Split (1)

train · 133k rows

text stringlengths 0 868k
Animals were euthanized with intravenous injection of sodium pentobarbital at a dose of 20 mg / kg body weight and then perfused with physiological saline through the common carotid arteries under deep anesthesia . All procedures were in accordance with the principles for animal experiments of iwate university and approved by the intramural committee for the care and use of animals . Animals were perfused with the bouin s solution without acetic acid via the common carotid arteries . After decapitation, the nasal parts were immersed in the same fixative for 2 days and then decalcified in 10% ethylenediaminetetraacetic acid for several months, routinely embedded in paraffin and cut transversally at 5 m . Some sections were stained with hematoxylin - eosin (h&e), periodic acid / schiff (pas), alcian blue (ph 1.0 and 2.5) or crossmon s trichrome for histological examinations . Lectin histochemistry: the other sections were processed for histochemistry with the avidin - biotin complex (abc) method using 21 types of biotinylated lectins (table 1table 1.binding specifities of lectins used in this studylectinsabbreviationconcentration (mg / ml)binding specificitywheat germ agglutininwga1.0 10glcnac, neuacsuccinylated - wheat germ agglutinins - wga1.0 10(glcnac) nlycopersicon esculentum lectinlel2.0 10(glcnac) 24solanum tuberosum lectinstl1.0 10(glcnac) 24datura stramonium lectindsl4.0 10(glcnac) 24bandeiraea simplicifolia lectin - iibsl - ii4.0 10glcnacdolichos biflorus agglutinindba1.0 10gal, galnacsoybean agglutininsba1.0 10gal, galnacbandeiraea simplicifolia lectin - ibsl - i4.0 10gal, galnacvicia villosa agglutininvva4.0 10gal, galnacsophora japonica agglutininsja2.0 10gal, galnacricinus communis agglutinin - irca-1202.0 10gal, galnacjacalin5.0 10gal, galnacpeanut agglutininpna4.0 10galerythrina cristagalli lectinecl2.0 10gal, galnaculex europaeus agglutinin - iuea - i2.0 10fucconcanavalin acona3.3 10man, glcpisum sativum agglutininpsa4.0 10man, glclens culinaris agglutininlca4.0 10man, glcphaseolus vulgaris agglutinin - epha - e5.0 10oligosaccharidephaseolus vulgaris agglutinin - lpha - l2.5 10oligosaccharidefuc, fucose; gal, galactose; galnac, n - acetylgalactosamine; glc, glucose; glcnac, n - acetylglucosamine; man, mannose; neuac, n - acetylneuraminic acid .) In the lectin screening kits i - iii (vector laboratories, burlingame, ca, u.s.a . ). After deparaffinization and rehydration, the sections were incubated with 0.3% h2o2 in methanol to eliminate endogenous peroxidase activity . The sections were rinsed in 0.01 m phosphate buffered saline (pbs, ph 7.4) and incubated with 1% bovine serum albumin to block nonspecific reactions . After rinsing, the sections were incubated with biotinylated lectins at 4c overnight and reacted with abc reagent (vector laboratories) at room temperature for 45 min . Thereafter, the sections were colorized with 0.05 m tris - hcl (ph 7.4) containing 0.006% h2o2 and 0.02% 33-diaminobenzidine tetrahydrochloride, dehydrated, cleared and mounted . Fuc, fucose; gal, galactose; galnac, n - acetylgalactosamine; glc, glucose; glcnac, n - acetylglucosamine; man, mannose; neuac, n - acetylneuraminic acid . Topographical and histological features of the olfactory mucosa: the olfactory mucosa occupied only a small region at the caudal roof of the nasal cavity, where it entirely covered the ethmoturbinates and the caudal parts of the dorsal and middle nasal conchae . The olfactory mucosa consisted of the olfactory epithelium and the underlying lamina propria (fig . (a) transverse section of the olfactory mucosa stained with periodic acid schiff (pas). Bar=100 m . Higher magnification of the olfactory epithelium stained with (b) pas and (c) alcian blue (ph 2.5). Higher magnification of the bowman s glandular acini stained with hematoxylin and eosin (d), alcian blue (ph 2.5) (e) or crossmon s trichrome (f). Arrowheads indicate bowman s glandular acinar cells . A, artery; bg, bowman s glands; nb, nerve bundle; obc, olfactory basal cells; orc, olfactory receptor cells; osc, olfactory supporting cells . Each type of cell had characteristics that have been already described for the cells of the olfactory epithelium in sheep [9, 13, 20, 22]. Briefly, nuclei of the olfactory basal, receptor and supporting cells were situated in the basal, middle and apical regions of the olfactory epithelium, respectively (fig . Their nuclei were pale with distinct nucleolus and were smaller than those of the receptor and supporting cells . The olfactory receptor cells were pear - shaped and extended their dendrites to the luminal surface and their axons toward the basal lamina . The olfactory supporting cells had dark, oval - shaped nuclei arranged in three or four of the layers in the upper region of the olfactory epithelium . Some melanin pigments were found both in the basal region of the olfactory epithelium and the underlying lamina propria, but they were not equally distributed along the olfactory epithelium (fig . (a) transverse section of the olfactory mucosa stained with periodic acid schiff (pas). Bar=100 higher magnification of the olfactory epithelium stained with (b) pas and (c) alcian blue (ph 2.5). Higher magnification of the bowman s glandular acini stained with hematoxylin and eosin (d), alcian blue (ph 2.5) (e) or crossmon s trichrome (f). Arrowheads indicate bowman s glandular acinar cells . A, artery; bg, bowman s glands; nb, nerve bundle; obc, olfactory basal cells; orc, olfactory receptor cells; osc, olfactory supporting cells . The secretory end - pieces of the bowman s glands were of the tubuloacinous type, and their ducts extended vertically through the olfactory epithelium to open into the free border of the olfactory epithelium . Acini of the bowman s glands consisted of pyramidal cells containing basally situated oval or round nuclei and surrounding a narrow lumen . Brownish granules were detected in the basal cytoplasm of the acinar cells as well as their duct cells (fig . 1e) stained the apical cytoplasm of the acinar cells, while crossmon s trichrome (fig . Lectin binding patterns in the olfactory mucosa: the receptor cells of the olfactory epithelium were labeled, with varying intensity, among 12 of the 21 lectins used in this study: wheat germ agglutinin (wga), succinylated - wheat germ agglutinin (s - wga), lycopersicon esculentum lectin (lel), solanum tuberosum lectin (stl), datura stramonium lectin (dsl), soybean agglutinin (sba), bandeiraea simplicifolia lectin - i (bsl - i), vicia villosa agglutinin (vva), ricinus communis agglutinin - i (rca-120), concanavalin a (con a), pisum sativum agglutinin (psa) and phaseolus vulgaris agglutinin - e (pha - e). Cell processes, cell membranes and perinuclear cytoplasm were intensely stained, but the nuclei were not stained (fig . 2a, 2afig . 2.olfactory mucosa reacted with six lectins: lel (a), (a), stl (b), (b), vva (c), (c), lca (d), (d), pna (e), (e) and pha - l (f) and (f). Bar=50 m in (a)(f) and 30 m in (a)(f)., 2b and 2b). Three lectins, s - wga, sba and psa, faintly stained the perinuclear cytoplasm of the receptor cells . Punctuated labeling of the receptor cells was made by vva and bsl - i (fig . 2c and 2c). The olfactory receptor cells were not labeled by nine of the lectins used: bandeiraea simplicifolia lectin - ii (bsl - ii), dolichos biflorus agglutinin (dba), sophora japonica agglutinin (sja), jacalin, peanut agglutinin (pna), erythrina cristagalli lectin (ecl), ulex europaeus agglutinin - i (uea - i), lens culinaris agglutinin (lca) and phaseolus vulgaris agglutinin - l (pha - l) (fig . Olfactory mucosa reacted with six lectins: lel (a), (a), stl (b), (b), vva (c), (c), lca (d), (d), pna (e), (e) and pha - l (f) and (f). Eight of the lectins used, wga, lel, stl, dsl, rca-120, con a, pha - e and pha - l, labeled both the olfactory supporting and basal cells with varying intensity . The localizations of staining reactions were similar to each other and were restricted to the cytoplasm of both the olfactory supporting and basal cells (fig . Vva labeled the cytoplasm of the basal cells (fig . 2c and 2c). The free border of the olfactory epithelium was stained by 13 lectins: wga, s - wga, lel, stl, dsl, sba, bsl - i, rca-120, pna, ecl, con a, pha - e and pha - l with varying intensity . Among the 21 lectins used, 13 lectins labeled bowman s glands with varying intensity: wga, s - wga, stl, dsl, bsl - i, vva, rca-120, jacalin, pna, ecl, con a, pha - e and pha - l . Seven lectins homogenously labeled the cytoplasm of bowman s gland cells: s - wga, stl, dsl, rca-120, jacalin, pna and ecl (fig . Bsl - i and vva had punctuated staining pattern, and the staining reactions were scattered within the cytoplasm of the glandular cells (fig . 2c). On the other hand, the staining patterns for wga, con a, pha - e and pha - l were similar to each other, where they intensely stained the basal part of the glandular cells (fig . The lectin binding patterns in the olfactory mucosa are summarized in table 2table 2.lectin binding patterns of the sheep olfactory mucosalectinfree borderreceptor cellssupporting cellsbasal cellsbowman s glandswga++++++s - wga++/+/lel++++++++stl+++++++dsl++++++/bsl - iidbasba++/bsl - i+/++vva+++sjarca-120++++++jacalin+/pna+/+ecl++/uea - icon a++++++psa+/lca-pha - e++++++pha - l++++++: negative staining, + /: faint staining, +: moderate staining, + +: intense staining ..: negative staining, + /: faint staining, +: moderate staining, + +: intense staining . Topographical and histological features of the respiratory mucosa: the respiratory mucosa was located mostly in the middle part of the nasal cavity of the sheep . It lined the lateral wall of the nasal cavity and nasal septum and covered the vomeronasal organ laterally . The respiratory mucosa was composed of respiratory epithelium and connective tissue lamina propria (fig . 3afig . (a) transverse section of the respiratory mucosa containing both the respiratory epithelium and the underlying lamina propria . Bars=20 m . A, muscular artery; g, goblet cell; ng, nasal glands; v, venous sinus . ). Each type of cell had properties that have been already described for the respiratory epithelial cells in sheep [20, 22]. The goblet cells consisted of an apical part containing mucopolysaccharide (mucin) granules and a basal part containing the nucleus . The goblet cells reacted positively with both pas and alcian blue ph 2.5 with varying intensity according to their mucin content (fig . 3b and 3c). The number of the goblet cells of the respiratory epithelium varied from one part to another in the nasal cavity . Their nuclei were darkly stained by hematoxylin and were smaller in size than those of the ciliated cells . Their cytoplasm was only faintly stained by eosin, and their nuclei were also paler than those of the basal and goblet cells . (a) transverse section of the respiratory mucosa containing both the respiratory epithelium and the underlying lamina propria . Bars=20 m . A, muscular artery; g, goblet cell; ng, nasal glands; v, venous sinus . Within the propria, numerous glands with their ducts were found . 4.histological features of the serous and mixed glands within the lamina propria of the respiratory mucosa . The mixed end - pieces comprised of both mucous, high cuboidal cells (flattened nuclei) together with a few number of peripherally located serous cells surrounding a relatively wide lumen (fig . 4b, 4d and 4e). On the other hand, the serous end - pieces consisted of pyramidal cells surrounding a narrow lumen . Their nuclei were rounded and located at the basal portion of the cell (fig . 4c, 4f and 4 g). Both glandular types reacted positively, but in a variable manner with pas and alcian blue ph 2.5 (fig . Mixed glands were stained with alcian blue ph 1.0, but the serous glands were not (fig . 4d and 4f). Histological features of the serous and mixed glands within the lamina propria of the respiratory mucosa . Lectin binding patterns in the respiratory mucosa: twelve out of the 21 lectins used in this study: wga, s - wga, lel, stl, bsl - ii, dba, sba, bsl - i, vva, rca-120, ecl and uea - i stained the goblet cells of the respiratory epithelium with varying intensity . The staining patterns were similar to each other, and the reactions were localized to the mucin granules in the apical cytoplasm . The intensity of staining was dependent on the amount of mucin granules in each goblet cell (fig . 5.respiratory mucosa reacted with 4 lectins: wga (a), (a) lel (b), (b), dba (c), (c) and pha - l (d), (d). D, glandular duct; g, goblet cell; m, mucous cell; s, serous cell . Bar=50 m in (a)(d) and 30 m in (a)(d)., 5b and 5b). Respiratory mucosa reacted with 4 lectins: wga (a), (a) lel (b), (b), dba (c), (c) and pha - l (d), (d). D, glandular duct; g, goblet cell; m, mucous cell; s, serous cell . Bar=50 staining patterns for dba, sba and vva in the respiratory epithelium were similar to each other . There were alternative intervals of stained and unstained regions in the basal and ciliated cells of the respiratory epithelium (fig . 5c and 5c). Eight lectins: dsl, dba, sba, vva, rca-120, uea - i, con a and pha - l, labeled the ciliated cells with varying intensity (fig . The staining patterns were similar to each other; these lectins labeled both their cell membranes and cytoplasm . The basal cells were stained by 11 lectins: lel, stl, dsl, dba, sba, bsl - i, vva, uea - i, con a, pha - e and pha - l with varying intensity . Cell membranes and cytoplasm of the basal cells were stained, but their nuclei were not stained (fig . The free border of the respiratory epithelium was labeled by 15 lectins: wga, s - wga, lel, stl, dsl, dba, sba, bsl - i, vva, rca-120, ecl, uea - i, con a, pha - e and pha - l with varying intensity . Four lectins out of the 21 lectins used: sja, jacalin, pna and lca were negative in neither epithelium . Several spindle - shaped cells of unknown origin with dark nuclei and scanty cytoplasm were detected within the respiratory epithelium mostly located close to the goblet cells (fig . These cells were labeled with varying intensity by 7 lectins: lel, dba, sba, bsl - i, vva, uea - i and pha - l . The staining reactions were similar to each other, including both their cytoplasm and nuclei (fig . 6b). Only uea - i distinguished their cytoplasm from nuclei by staining the cytoplasm intensely with the nuclei remaining unstained (fig . The lectin binding patterns in the respiratory epithelium are summarized in table 3table 3.lectin binding patterns of the sheep respiratory epitheliumlectinfree bordergoblet cellsbasal cellsciliated cellsunrecognized type of cellswga+++s - wga+++lel+++/+/++stl+++/dsl++++bsl - ii+dba++/++++++sba+++++++bsl - i+/+++vva+++++sjarca-120+++/+jacalinpnaecl++uea - i+/++++/++con a+++/psalcapha - e++/pha - l++++/+: negative staining, + /: faint staining, +: moderate staining, + +: intense staining . : remarkable staining (binding reaction is not equally distributed along the cell membrane)..: negative staining, + /: faint staining, +: moderate staining, + +: intense staining . : remarkable staining (binding reaction is not equally distributed along the cell membrane). In the lamina propria, the mucous cells were stained intensely by 9 among the 21 lectins used in this study: wga, s - wga, stl, dba, sba, vva, ecl, uea - i and pha - e (fig . 5a and 5c). The serous glands as well as the serous cells of the mixed glands were labeled by six lectins: lel, dsl, bsl - ii, con a, pha - e and pha - l with varying intensity (fig . 5b and 5d). The lectin binding patterns of the nasal glands are summarized in table 4table 4.lectin binding patterns of the glands in the lamina propria of the respiratory epitheliumlectinserous glandsmixed glandsserous cellsmucous cellswga++s - wga++lel++++stl+dsl++bsl - ii+/+/dba++sba+bsl - ivva++sjarca-120jacalinpnaecl++uea - i++con a++psalcapha - e+++pha - l++++: negative staining, + /: faint staining, +: moderate staining, + +: intense staining ..: negative staining, + /: faint staining, +: moderate staining, + +: intense staining . In the present study, we have revealed the details of the glycoconjugate localizations in sheep . Our histological and histochemical studies using h&e, pas and alcian blue had good agreement with previous reports by kavoi et al ., khamas and ghoshal and taher et al . . On the contrary, some of our findings using lectin histochemistry were inconsistent with the previous report in the olfactory epithelium by scocco et al . . Our study showed eight lectins labeled both the supporting and basal cells with varying intensity: wga, lel, stl, dsl, rca-120, con a, pha - e and pha - l . On the other hand, scocco et al . Labeled these cells using nine lectins and found that six lectins: wga, con a, lta, uea - i, sba and gsa - ib4 were positive in these cells . Only 2 lectins, wga and con a, were positive in both of our work and scocco s work . In the respiratory epithelium, the case was the same as in the olfactory epithelium . Our results and scocco s results showed only partial consistency; 5 of mutually examined lectins (con a, dba, sba, uea - i and rca) were positive by both studies, but one lectin (wga) was positive only in scocco s study . The discrepancies in the results between scocco et al . And our own study may at least be partially due to the differences in the fixatives employed (carnoy s fluid for 24 hr at room temperature and postfixed in 2% calcium acetate-4% paraformaldehyde solution 1:1 by scocco et al . ). But, it could also be attributed to the differences between the corriedale and lacaune sheep breeds . Twelve lectins stained both the free border of the olfactory epithelium and that of the respiratory epithelium: wga, s - wga, lel, stl, dsl, sba, bsl - i, rca-120, ecl, con a, pha - e and pha - l, indicating that the expression pattern of glycoconjugate was similar between the free border of these two epithelia . The lectin stainings in the free border may come partially from the glycoconjugates in the mucus covering the surface of the epithelium and partially from those expressed in the cell membrane of the cilia or the microvilli of the goblet, ciliated, receptor or supporting cells . The mucus at the surface of the olfactory mucosa constitutes the milieu in which perireceptor events associated with olfactory signal transduction occur . It is tempting to speculate, firstly, that the goblet cells and mucous nasal glands in the respiratory epithelium may contribute to the function of the olfactory epithelium in the perception of odorants in the olfactory receptor cells . The secretory products of the respiratory epithelium may distribute caudally on the free border of the olfactory epithelium by the movement of cilia and gravity and thus accelerating the movement of various odorants towards their targeted olfactory receptor cells, resulting in enhanced perception of odorants in the olfactory epithelium . Another possibility is that the secretory products of the bowman s glands may distribute cranially on the free border of the respiratory epithelium and thus help in discarding of dust particles and foreign organisms from the respiratory epithelium, accelerating the function of the goblet cells as a part of the nasal cavity immune system . The 2nd idea is that there are similarities in the carbohydrate expressions of the cell membranes of the two epithelia . Although it is possible that the secretion from bowman s and nasal glands affects the lectin - binding patterns on the free border, the patterns may be attributed to the sugar residues expressed on the olfactory knobs, cilia or microvilli of the free borders, since some of lectins binding to the free borders did not bind to the associated glands . For example, lel stained the free borders of both the olfactory and respiratory epithelia, but its staining intensity in the bowman s glands and goblet cells is faint . This may indicate that the sugar residues that were labeled by lel may originate from the cell processes and not secreted or expressed either in the bowman s glands or goblet cells . These cells were labeled by seven out of the 21 lectins used in this study . Exclusively, uea - i stained the cytoplasm of these cells, but not the nuclei . As far as we know, this is the first report detecting this type of cell in the respiratory epithelium of sheep . We speculate that the presence of these cells can be attributed to one of the different cell cycle phases of the goblet or ciliated cells, as immature differentiated cells.
Cd8 and cd4 t cell subsets were isolated from heparinized umbilical cord blood as described (10). In brief, mononuclear cells obtained by centrifugation on ficoll - metrizoate gradients were treated with l - leucine methyl ester to remove monocytes and nk cells; enriched t cells were isolated by treating cells forming rosette with srbcs by means of lympho - kwik t (one lambda, canogalark, ca). Cd8 t cells were positively selected with dynabeads m-450 cd8 (dynal, great neck, ny) and further depleted of cd4 cells with dynabeads m-450 cd4; cd4 t cells were obtained by treating enriched t cells with lympho - kwik t helper (one lambda). Neonatal t cell subsets were> 98% cd3 and <1% cd14, cd20, cd56, or cd16 positive, respectively; the cd8 subset was> 95% tcr-/ cd8-/,> 99% cd45ra / ro, and contained no detectable cd4 or cd29 positive cells . T cells were submitted to one or two cycles of activation and il-2 expansion as described (11). At each cycle, t cells were activated with anti - cd3 mab (ucht-1, 200 ng / ml; a gift from p. beverley, university college and middlesex school of medicine, london, uk) and irradiated cd32, b7.1 transfected l cells for 3 d, and cells were then washed twice and expanded in fresh medium supplemented with 50 iu / ml of il-2 for 4 d. t cells were then washed and either stored in liquid nitrogen, until use for hiv infection, or subjected to another cycle of activation / expansion . In some experiments, cd8 t cells (5 10 cells / ml) were stimulated with irradiated allogeneic dendritic cells (5 10 cells / ml) in the presence of il-2 (50 iu / ml). Dendritic cells were derived from adult blood monocytes cultured for 9 d with il-4, gm - csf, and tnf- exactly as described (12). One- or two - color flow cytometric analysis was performed on a facsort (becton dickinson, montreal, canada) according to standard procedures . The following fitc- or pe - labeled mabs or isotype - matched mouse ig were purchased from becton dickinson: anti cd8- (leu 2a), anti - cd4 (leu 3a), anti - cd3, anti - cd20, anti - cd14, anti - cd56, and anti - cd16 . Cd4 was also stained with okt4 (american type culture collection, rockville, md); mab to cd8-/ heterodimer (2st8) was given by e. reinherz (harvard medical school, boston, ma); the anti - cxcr4/fusin mab (12g5) has been described (13). Total cellular rna was extracted from resting or activated cord blood cd4 or cd8 t cells using rna ease total rna kit (qiagen, chasworth, ca) and pretreated with 10 u / ml rnase - free dnase (gibco brl, gaithersburg, md) before amplification . Synthesis of cdna and ensuing pcr amplification were performed using titan reverse transcriptase (rt)-pcr kit (boehringer mannheim, indianapolis, in) according to the supplier's instruction manual . Pcr products were separated on a 1% agarose gel and stained with ethidium bromide . Chinese hamster ovary cell rna served as negative control for cd4, cxcr4, and ccr5 genes; glyceraldehyde 3-phosphate dehydrogenase (gapdh) was amplified to confirm equal efficiency of amplification of each rna . No pcr product was detected in control amplification containing no added rna, taq, or rt dna polymerase . Primers for amplification were as follows: cxcr4: 5-agaattcaaccagcggttaccatggaggggatc, 5-agaattcgtcttttacatctgtgttagctggag; ccr5: 5-tcgatccggtggaacaagatggattatcaag, 5-tcggatccaagccatgtgcacaactctgactg; and cd4: 5-gcagtggcgagctgtggt, 5-gggtccccacacctcacagg . Either freshly activated or cryopreserved neonatal cd4 and cd8 cells were infected with hiv-1us-1 or hiv-1nl4 - 3 as previously described (14, 15). In brief, for each infection 5 10 cells were centrifuged, washed, and resuspended in 400 l of media containing 13 x 10 tissue culture and infectious dose (tcid)50 of hiv-1 . The cells were incubated at 37c for 2 h, washed three times to remove excess virus, and resuspended in 50% conditioned media at 10/ml . At t = 0, 2, 72, and 144 h after infection the cell pellets were lysed, amplified by pcr using hiv gag - specific primers, and the amplified sequences were detected by hybridization to a radiolabeled oligonucleotide specific for internal gag sequences . The hybridized products were separated by gel electrophoresis and exposed to a phosphorimager screen for 1 h. to ensure that the reactions were performed within the linear range of the assay, log increments hiv gag plasmid standards were amplified at the same time . To show that equivalent levels of input dna were present in each pcr reaction, human -globulin sequences were pcr amplified as described (15). After washes 12 10 cells were stained with optimized concentrations of cell surface marker antibodies for 1 h at 4c . The cells were washed twice with sterile pbs, ph 7.4, and fixed in 100 l of permeafix (ortho diagnostics, raritan, nj) for at least 1 h at room temperature . Cells were washed in sterile pbs, ph 7.4, pelleted by centrifugation, and then washed again in 2 standard saline citrate (ssc). After centrifugation, the cell pellet was resuspended in hybridization solution (2 ssc, 30% formamide, sonicated salmon sperm, yeast transfer rna) containing 500 ng of 5-carboxy - fluorescein double - end labeled, gag - pol specific oligonucleotide probes or gag - pol sense oligonucleotides as a negative control probe cocktail (16). The intracellular hybridization was performed at 42c for 1 h followed by successive washes in 2 ssc, 0.5% triton x-100, and 1 ssc, the cells were resuspended for analysis in pbs, ph 8.3, and analyzed on a flow cytometer (epic xl; coulter, miami, fl). Cd8 and cd4 t cell subsets were isolated from heparinized umbilical cord blood as described (10). In brief, mononuclear cells obtained by centrifugation on ficoll - metrizoate gradients were treated with l - leucine methyl ester to remove monocytes and nk cells; enriched t cells were isolated by treating cells forming rosette with srbcs by means of lympho - kwik t (one lambda, canogalark, ca). Cd8 t cells were positively selected with dynabeads m-450 cd8 (dynal, great neck, ny) and further depleted of cd4 cells with dynabeads m-450 cd4; cd4 t cells were obtained by treating enriched t cells with lympho - kwik t helper (one lambda). Neonatal t cell subsets were> 98% cd3 and <1% cd14, cd20, cd56, or cd16 positive, respectively; the cd8 subset was> 95% tcr-/ cd8-/,> 99% cd45ra / ro, and contained no detectable cd4 or cd29 positive cells . T cells were submitted to one or two cycles of activation and il-2 expansion as described (11). At each cycle, t cells were activated with anti - cd3 mab (ucht-1, 200 ng / ml; a gift from p. beverley, university college and middlesex school of medicine, london, uk) and irradiated cd32, b7.1 transfected l cells for 3 d, and cells were then washed twice and expanded in fresh medium supplemented with 50 iu / ml of il-2 for 4 d. t cells were then washed and either stored in liquid nitrogen, until use for hiv infection, or subjected to another cycle of activation / expansion . In some experiments, cd8 t cells (5 10 cells / ml) were stimulated with irradiated allogeneic dendritic cells (5 10 cells / ml) in the presence of il-2 (50 iu / ml). Dendritic cells were derived from adult blood monocytes cultured for 9 d with il-4, gm - csf, and tnf- exactly as described (12). One- or two - color flow cytometric analysis was performed on a facsort (becton dickinson, montreal, canada) according to standard procedures . The following fitc- or pe - labeled mabs or isotype - matched mouse ig were purchased from becton dickinson: anti cd8- (leu 2a), anti - cd4 (leu 3a), anti - cd3, anti - cd20, anti - cd14, anti - cd56, and anti - cd16 . Cd4 was also stained with okt4 (american type culture collection, rockville, md); mab to cd8-/ heterodimer (2st8) was given by e. reinherz (harvard medical school, boston, ma); the anti - cxcr4/fusin mab (12g5) has been described (13). Total cellular rna was extracted from resting or activated cord blood cd4 or cd8 t cells using rna ease total rna kit (qiagen, chasworth, ca) and pretreated with 10 u / ml rnase - free dnase (gibco brl, gaithersburg, md) before amplification . Synthesis of cdna and ensuing pcr amplification were performed using titan reverse transcriptase (rt)-pcr kit (boehringer mannheim, indianapolis, in) according to the supplier's instruction manual . Pcr products were separated on a 1% agarose gel and stained with ethidium bromide . Chinese hamster ovary cell rna served as negative control for cd4, cxcr4, and ccr5 genes; glyceraldehyde 3-phosphate dehydrogenase (gapdh) was amplified to confirm equal efficiency of amplification of each rna . No pcr product was detected in control amplification containing no added rna, taq, or rt dna polymerase . Primers for amplification were as follows: cxcr4: 5-agaattcaaccagcggttaccatggaggggatc, 5-agaattcgtcttttacatctgtgttagctggag; ccr5: 5-tcgatccggtggaacaagatggattatcaag, 5-tcggatccaagccatgtgcacaactctgactg; and cd4: 5-gcagtggcgagctgtggt, 5-gggtccccacacctcacagg . Either freshly activated or cryopreserved neonatal cd4 and cd8 cells were infected with hiv-1us-1 or hiv-1nl4 - 3 as previously described (14, 15). In brief, for each infection 5 10 cells were centrifuged, washed, and resuspended in 400 l of media containing 13 x 10 tissue culture and infectious dose (tcid)50 of hiv-1 . The cells were incubated at 37c for 2 h, washed three times to remove excess virus, and resuspended in 50% conditioned media at 10/ml . At t = 0, 2, 72, and 144 h after infection the cell pellets were lysed, amplified by pcr using hiv gag - specific primers, and the amplified sequences were detected by hybridization to a radiolabeled oligonucleotide specific for internal gag sequences . The hybridized products were separated by gel electrophoresis and exposed to a phosphorimager screen for 1 h. to ensure that the reactions were performed within the linear range of the assay, log increments hiv gag plasmid standards were amplified at the same time . To show that equivalent levels of input dna were present in each pcr reaction, human -globulin sequences were pcr amplified as described (15). After washes 12 10 cells were stained with optimized concentrations of cell surface marker antibodies for 1 h at 4c . The cells were washed twice with sterile pbs, ph 7.4, and fixed in 100 l of permeafix (ortho diagnostics, raritan, nj) for at least 1 h at room temperature . Cells were washed in sterile pbs, ph 7.4, pelleted by centrifugation, and then washed again in 2 standard saline citrate (ssc). After centrifugation, the cell pellet was resuspended in hybridization solution (2 ssc, 30% formamide, sonicated salmon sperm, yeast transfer rna) containing 500 ng of 5-carboxy - fluorescein double - end labeled, gag - pol specific oligonucleotide probes or gag - pol sense oligonucleotides as a negative control probe cocktail (16). The intracellular hybridization was performed at 42c for 1 h followed by successive washes in 2 ssc, 0.5% triton x-100, and 1 ssc, the cells were resuspended for analysis in pbs, ph 8.3, and analyzed on a flow cytometer (epic xl; coulter, miami, fl). Highly purified umbilical cord blood cd8 t cells (> 98% cd3,> 95% tcr-/, cd8-/, no detectable cd4 cells) and cd4 t cells (> 98% cd3 cd4, no detectable cd8 cells) were activated with anti - cd3 mab cross - linked on cd32 and b7.1 transfected l cells, expanded in il-2supplemented medium, and then infected with the macrophage - tropic hivus-1 or with the t cell tropic (t - tropic) hivnl4 - 3 virus; hiv replication was evaluated at days 3 and 6 after infection by quantitative pcr analysis of gag dna accumulation . Both cd8 and cd4 t cell subsets supported significant replication of the macrophage tropic (m - tropic), but not the t - tropic, strain of hiv (fig . 1), although the initial infection was slower in cd8 than in cd4 t cells, as judged from the day 3 values . That hiv infected cd8 t cells, and not contaminating cd4 cells was supported by 3 lines of evidence . First after infection with hivus-1 for 6 d, cd8 t cells were surface stained for cd8 expression and stained intracellularly for hiv gag and pol rna sequences . In addition, to confirm that a spreading infection was occurring in the neonatal cd8 t cells, samples were collected on both days 3 and 6 after infection and analyzed . At day 3, 3.4% of the cells were double positive for cd8 and hiv rna, and by day 6 the number grew to 12.3%, which is consistent with a productive infection (data not shown). Second, cd8 t cell cultures did not contain detectable cd4 single positive cells at day 6 after infection (data not shown). Third, cd4 ag and cd4 messenger rna (mrna) were undetectable in freshly prepared cd8 t cells, as assessed by flow cytometry and rt - pcr analysis respectively (fig . 3, a and b). Thus, activated neonatal cd8 t cells can be productively infected by primary m - tropic hiv isolates, responsible for disease transmission, but not by t - tropic hiv . The apparent resistance of neonatal cd4 and cd8 t cell subsets to t - tropic hiv could be related to the recent finding that anti - cd3/b7 activated naive cd4 t cells isolated from adult blood are also resistant to t - tropic hiv, as a result of postentry block in viral replication (1720). To be susceptible to hiv infection, a cell must express cd4, the primary hiv receptor, together with either ccr5 (the coreceptor for m - tropic strains), or cxcr-4/ fusin (the coreceptor for t - tropic strains) (for review see reference 21). According to this paradigm, indeed, we found that neonatal single positive cd8 t cells started to express low to moderate levels of cd4 within 24 h after anti - cd3/b7.1 activation (fig . 3 a); cd4 expression reached a plateau at 72 h (60 to> 90% double positive cells, n = 24) and remained stable for at least 2 wk (the duration of the present experiments). Flow cytometric analysis of anti - cd3/b7.1stimulated cd8 t cells stained with anti - cd4 revealed a unimodal histogram, suggesting that the ability to coexpress cd4 is a common property of most, if not the entire, neonatal cd8 t cell population (fig . Quantitatively, cd4 was expressed at significantly lower levels on activated cd8 t cells than on cd4 single positive t cells (fig . Rt - pcr analysis revealed that cd4 mrna was undetectable in freshly isolated cd8 t cells, but clearly induced after anti - cd3/ b7.1 stimulation, suggesting transcriptional activation of the cd4 gene (fig . 3 b). In experiments designed to determine the minimal requirements for cd4 expression on neonatal cd8 t cells, we found that: (a) tcr / cd3-mediated signals were sufficient to induce low levels of cd4, but that cd4 induction was markedly enhanced by cd28 costimulation (fig . 3 d), and (b) cellular proliferation was neither sufficient or necessary . Indeed, cd4 was not expressed on proliferating cd8 t cells stimulated with anti - cd2 together with anti - cd28 mabs and il-2, whereas it was induced on irradiated (nonproliferating) anti - cd3/ b7.1stimulated cells (data not shown). Finally and importantly, cd4 was coexpressed on neonatal t cells activated under more physiological conditions, i.e., by antigenic stimulation with allogeneic dendritic cells (fig . Thus, physiological activation of umbilical cord blood cd8 t cells is associated with the coexpression of low to moderate levels of cd4, most likely as a result of cd4 gene transcriptional activation . Moreover, effective costimulation is required for optimal induction of cd4 coexpression, presumably explaining why this phenomenon went unnoticed in earlier studies . Consistent with their susceptibility to infection with m - tropic hiv, activated neonatal t cells expressed ccr5 mrna (fig . As already mentioned, it is suggested that their resistance to t - tropic hiv infection results from a postentry block in viral replication (1720). The ability to coexpress cd4 is not a unique feature of neonatal cd8 t cells, and indeed a variable proportion (1040%, n = 5) of cd8 t cells isolated from adult blood expressed low levels of cd4 after anti - cd3/b7.1 activation (data not shown). Since neonatal cd8 t cells are immunologically naive whereas their adult counterparts contain both naive and memory cells, it will be of interest to examine cd4 expression and susceptibility to hiv infection in naive and memory cd8 t cell subsets . Preliminary results suggest that indeed, naive but not memory adult cd8 t cells may be induced to coexpress cd4 and become infectable by hiv . They challenge the paradigm that the cd4 gene is irreversibly silenced in extrathymic mature single positive cd8-/ tcr-/ t lymphocytes and raise the question of the role of cd4 in the biology of cd8 t cells . A small fraction (23%) of peripheral tcr-/ t cells are cd8 cd4 double positive (22). In the large majority of the cases, these cells are cd4 cd8 and express cd8 as a cd8-/ homodimer (23). In three cases however, the double positive t cells were shown to display the same phenotype as activated neonatal cd8 t cells, i.e., cd8-/ cd4, indicating that cells expressing this phenotype exist in vivo (24). Finally, infection of cd8 t cells by human herpesvirus 6 was previously shown to induce cd4 expression and confer susceptibility to hiv infection (25). From a clinical point of view, our finding may explain the recent reports that cd8 t cells of infected patients can harbor hiv-1 (26, 27). It is tempting to relate the hiv susceptibility of neonatal cd8 t cells to the rapid progression of the disease in a large proportion of infected neonates . Since viral replication is mainly controlled by cd8 t cells, it seems reasonable to assume that the infection of these cells may compromise the immune response to hiv . Productive infection of primary hiv - specific cd8 t cells may lead to an early disruption of the ag repertoire of hiv - specific cd8 t cells . Infected cd8 t cells may be deleted directly, after supporting high rates of viral replication, or indirectly by cytotoxic hiv - specific cd8 t cells . Early restriction of the antigen repertoire would facilitate the emergence of hiv variants expressing functionally important ags that were recognized by the deleted t cells (2830). Future studies aiming to verify in vivo some of these hypotheses and to confirm the differential susceptibility of naive versus memory cd8 t cells to hiv infection should further our understanding of the disease and have important implications for the development of hiv vaccines . Infection of neonatal cd4 and cd8 cells . Umbilical cord blood cd4 and cd8 t cells were activated with anti - cd3 and b7 - 1transfected cd32 l cells for 3 d, washed, expanded in il-2, and infected with either a ccr5-dependent virus, hivus1, or a cxcr4-dependent virus, hiv-1nl4 - 3 . The phosphorimage shows the accumulation of gag dna in cd4 and cd8 cultures at 0, 2, 72, and 144 h after infection . To ensure equivalent amounts of dna neonatal cd8 t cells were harvested 6 d after infection and stained with both anti - cd8 and labeled hiv dna probes . Left, facs analysis of cells infected with hivus1; right, a mock - infected control . Umbilical cord blood cd8 t cells were activated with anti - cd3 mab immobilized on b7.1 and cd32transfected l cells and expanded in il-2supplemented medium . (a) two - dimensional contour plot showing expression of cd4 and cd8 before t cell activation, after 24 and 72 h of primary activation, and at the end of a second cycle of activation / il-2 expansion (day 14). Similar results were obtained by staining with okt4 mab, recognizing another cd4 epitope than leu3a mab . More than 95% of resting or activated cd8 t cells were stained brightly with 2st8 mab (received from e. reinherz, harvard medical school, boston, ma) specific for the cd8-/ heterodimer . (b) expression of cd4, cxcr4, and ccr5 mrna in resting and activated (day 7) neonatal cd4 and cd8 t cells . Cells were stained with anti - cd4 mab at the end of the first cycle of activation / il-2 expansion (day 7). (d) cd4 expression on cd8 t cells activated with either plate - coated anti - cd3 (10 g / ml), immobilized anti - cd3 together with soluble anti - cd28 (clone 9.3, 500 ng / ml), anti - cd3 (200 ng / ml) immobilized on b7.1 cd32 l cells, or allogeneic dendritic cells together with il-2 (50 iu / ml). Cells were stained at day 7 with anti - cd4 and anti - cd8 mabs . Anti - cd3/b7.1activated cd8 t cells were stained with 12g5 mab at day 7.
Case history and pathological examination: the pig was brought into a slaughterhouse in japan . The pig had no clinical symptoms and an average physique at the ante mortem inspection in the meat inspection center . Pale, yellowish - red, discolored muscles with fat infiltration were found after carcass dressing in the rectus abdominis muscle and muscles of the femoral region . The rectus abdominis muscle was collected, fixed in 10% neutral - buffered formalin and embedded in paraffin for the pathological examinations . The paraffin sections were stained with hematoxylin and eosin (he), phosphotungstic acid hematoxylin (ptah), bodian - luxol fast blue (b - lfb) and periodic acid - schiff reaction (pas). In addition to the present case, the following 2 samples were used as controls for comparison: normal muscular tissue from a 4-week - old mixed - breed male pig, which was purchased from a pig farm in japan (shinasawa pig farming union, saitama, japan) and necrotic muscular tissue due to an infraction in a slaughtered pig of unknown sex . These 2 samples were fixed, embedded, sectioned, stained with he and subjected to the following immunofluorescence examinations . In addition, frozen normal muscular tissue was collected for confirming the cross - reactivity of an anti - dystrophin antibody . All research procedures involving animals were approved and were in accordance with the guidelines of the animal research committee of the national veterinary assay laboratory . Immunofluorescence staining on ffpe samples: the indirect immunofluorescence antibody technique was applied using an anti - dystrophin mouse monoclonal antibody (clone 1808; 1 in 100 dilution; abcam, cambridge, ma, u.s.a .) As the primary antibody . To unmask the epitope, tissue sections were boiled in 1 mm edta solution (ph 8.0) for 20 min . A fluorescence - labeled anti - mouse igg goat polyclonal antibody (1 in 500 dilution; life technologies corporation, carlsbad, ca, u.s.a .) Was used as the secondary antibody . Vectashield mounting medium with dapi (vector laboratories, burlingame, ca, u.s.a .) Was used for mount . Cross - reactivity of the primary antibody: the cross - reactivity of the primary antibody with porcine dystrophin was confirmed by western blotting using a lysate obtained from the normal muscle tissue and compared to the anti - dystrophin mouse monoclonal antibody with previously confirmed cross - reactivity (dys1; clone dy4/6d3; 1 in 250 dilution; leica biosystems newcastle, newcastle, u.k . ). Sex identification by polymerase chain reaction from ffpe sample: to determine the sex of the present pig, pcr analysis was performed in order to amplify the 163 base pairs of the dna fragment with the porcine sry gene dna primer pair (sense: 5-tgaacgctttcattgtgtggtc-3 and anti - sense: 5-gccagtagtctctgtgcctcct-3) designed by pomp et al . For sex identification of a raw embryo . Template dna was extracted from ffpe samples of the present case and the control samples of both sexes . The male control sample was prepared from the normal muscular tissue, and the female sample was prepared from the spleen of female pig, which was one of the previous case collections of our laboratory . In brief, these samples were cut into 50-m sections, collected in sample tubes, conjugated with 0.5 ml of dna isolator ps - rapid reagent (wako pure chemical industries, osaka, japan), boiled 10 min, transferred to a centrifuge tube with 0.2 m filter unit and centrifuged . Each template was mixed with a platinum pfx dna polymerase kit (life technologies corporation) according to the manufacturer s instructions . After incubation at 95c for 4.5 min, 40 cycles of 95c for 25 sec, 55c for 40 sec and 68c for 30 sec were performed . The amplicons were resolved by electrophoresis in a non - denaturing 2.0% agarose gel and then stained with ethidium bromide . Histological findings: the most characteristic histological alteration was fat infiltration; up to approximately 50% of the sectioned tissue was adipose tissue (fig . 1afig . 1.pig . Skeletal muscle (rectus abdominis), hematoxylin and eosin stain (he). Severe fat infiltration (a), vacuolar degeneration (b), hyalinized fiber and myophagy (c) and fiber splitting (d) are observed . The internal disposition of the nuclei is also seen in (b d). Bar scales: 200 m (a), 50 m (b), 50 m (c) and 100 m (d).). In a cross - section of muscle, the remaining muscular fibers varied in fiber diameters with mildly rounded shapes and the emergence of hypertrophic fibers, sometimes accompanied by vacuolar degeneration (fig . Slight endomysial fibrosis and intra - adipose tissue fibrosis were also observed . Pig . Skeletal muscle (rectus abdominis), hematoxylin and eosin stain (he). Severe fat infiltration (a), vacuolar degeneration (b), hyalinized fiber and myophagy (c) and fiber splitting (d) are observed . The internal disposition of the nuclei is also seen in (b d). Bar scales: 200 m (a), 50 m (b), 50 m (c) and 100 m (d). In the longitudinal sections, almost all of the remaining muscular fibers showed internal disposition of nuclei, and scattered segmental necrosis of myofibrils was observed as partial hyalinization, sometimes flocculated or accompanied with accumulated macrophages . The cross - striations of the fibers were focally obscure in he - stained sections, and those foci were ascertained to be z - disc streaming with ptah staining . Regenerated, small and pale basophilic fibers were not evident in cross - section and longitudinal section . Other fiber alterations, such as calcification, target fiber or sarcoplasmic masses, were not observed . Pas - positive materials were not found in the vacuoles of the degenerated muscular fibers . Immunofluorescence: the muscles of the present case showed focal and faint stainability of dystrophin at the sarcolemma in most areas (fig . 2.hematoxylin and eosin staining (he) and immunofluorescence staining for dystrophin: healthy pig (a, d), necrotic muscle (b, e) and the present pig (c, f). The healthy pig shows small fibers (a), because of its young age and clear stainability at the sarcolemma (d). The necrotic muscle, which consists of muscle fibers that are massively necrotized because of an infarct, shows strongly eosinophilic pale cytoplasm and declined muscle nucleus stainability in he (b), whereas dystrophin is stained at the sarcolemma (e). In the present pig, bar scales: 20 m (a) and 50 m (b f).). 2d) and necrotic muscular tissue showed intense and continuous stainability at the sarcolemma (fig . Hematoxylin and eosin staining (he) and immunofluorescence staining for dystrophin: healthy pig (a, d), necrotic muscle (b, e) and the present pig (c, f). The healthy pig shows small fibers (a), because of its young age and clear stainability at the sarcolemma (d). The necrotic muscle, which consists of muscle fibers that are massively necrotized because of an infarct, shows strongly eosinophilic pale cytoplasm and declined muscle nucleus stainability in he (b), whereas dystrophin is stained at the sarcolemma (e). In the present pig, bar scales: 20 m (a) and 50 m (b f). Cross - reactivity: to confirm the cross - reactivity of the primary antibody used in the present immunofluorescent examination, total muscular lysates from a healthy pig were examined by western blot analysis with the primary antibody . A closely spaced doublet band of 425 kda of porcine dystrophin was detected in porcine muscular homogenates below the 500-kda marker (fig . 3fig . Lane 2 is stained using the primary antibody (clone 1808) used in the present immunofluorescent examination . Closely spaced doublet bands of approximately 425 kda were visualized on both lanes below the 500-kda marker . Non - specific reactivity was not detected . ), which was similar to the findings of a previous report . Lane 2 is stained using the primary antibody (clone 1808) used in the present immunofluorescent examination . Closely spaced doublet bands of approximately 425 kda were visualized on both lanes below the 500-kda marker . Sex identification: the sry detection method by pcr was applicable to dna extract from ffpe samples . The electrophoretic analysis revealed a primer - specific band, which nearly corresponded to 160 bp, in the positive male control lane and the present case lane (fig . 4.agarose gel showing ethidium bromide - stained electrophoresis of pcr products of the sry gene fragment, which was amplified from dna isolated from paraffin - embedded tissue . Agarose gel showing ethidium bromide - stained electrophoresis of pcr products of the sry gene fragment, which was amplified from dna isolated from paraffin - embedded tissue . Histological features of the examined skeletal muscle were profound diffused fat infiltration into the skeletal muscle and heterogeneously scattered various types of degenerative and regenerative changes in the remaining muscles . The stainability of the dystrophin in the muscular tissue of the present case was revealed to be declined and patchy at the sarcolemma by immunofluorescent staining . Based on the results of the histological and immunofluorescent analyses, the present case was diagnosed with bmd - like myopathy associated with dystrophin abnormality in a pig . This is the first report of a natural case of myopathy associated with dystrophin abnormality in a pig . The results in this study implied an inherited factor as one of the causes of ms and the possible occurrence of the human bmd homolog in pigs . Furthermore, the immunostaining for dystrophin on the porcine ffpe tissue was evaluated and demonstrated in this study . An immunostaining for dystrophin is the most sensitive detection method for dystrophinopathy among the several types of detection methods, such as the detection of mutations in the dystrophin gene by pcr or sequence analysis and western blot analysis of dystrophin [15, 21]; however, an immunostaining for dystrophin is limitedly applicable on frozen sections with some exceptions of the immunostaining methods for dystrophin used in human . We suspected an association of dystrophin abnormality with the present myopathy, but we had not obtained frozen specimens . The present immunostaining revealed an intense and a continuous stainability at the sarcolemma in a normal control skeletal muscle and a necrotized skeletal muscle, and it detected the declined stainability, specifically in the skeletal muscle of the present case . The antibody used in the present immunostaining was also confirmed to react with porcine dystrophin without non - specific reactivity in the western blotting . The present immunostaining for dystrophin was revealed to be applicable on porcine ffpe tissue, and this may be useful for the detection and diagnosis of dystrophin abnormality - associated myopathy since frozen sections are not always available, especially in field cases . Considering the similar declination of dystrophin stainability in human bmd, these findings suggested that the present case was a homolog of human bmd, which is an x - linked muscular disorder in humans . On the other hand, the declination of dystrophin expression is reported in female carriers of dmd as a mosaic expression of dystrophin . The possibility that the present pig was a female carrier of dystrophinopathy could not be ruled out, because the sex of the case was not noted . For this reason, we attempted to identify the sex by sry gene amplification of ffpe tissue . The sry detection method by pcr, developed for raw materials, was applicable to dna extracts from ffpe tissue and showed that the present case was male . This result was consistent with the possibility that the present case was a human bmd homolog . Provided that a bmd homolog occurs in pigs, and the homolog results in abnormally fat - infiltrated muscle, namely ms, the detection and removal of a carrier sow is a feasible preventative measure that can be used to avoid the economic loss due to ms . The possible occurrence of a bmd homolog also suggested the possibility of bmd disorder model in a pig . In dystrophinopathy, experimental dmd models have been developed in mouse [4, 32] and dog . In particular, the experimental dog dmd model, originated from naturally occurring dmd in golden retriever dog [30, 31, 35], is valuable for the further study of dmd pathogenesis in humans, because its clinical features are similar to those of human dmd . In other animals, in contrast to dmd, there is no report of animal bmd cases, including dystrophin - declined myopathy or the establishment of an animal model of bmd . The cdna of porcine dystrophin is sequenced, and the deduced amino - acid sequence of porcine dystrophin shows a high degree of sequence similarity to human dystrophin with a 94% overall amino - acid identity . In addition, a pig is not only a meat - producing livestock but also a possible candidate animal model for biomedical research addressing regenerative medicine or preclinical investigations in pharmacology . Taking into account the high sequence similarity of porcine dystrophin to human dystrophin and the pig s aptitude as an animal model, the present bmd - like myopathy suggested a possibility of establishing a valuable disease model of human bmd using a pig . The muscular disorders characterized by abnormal fat infiltrate and discoloration in macroscopic findings may be routinely diagnosed as ms or so - called fatty muscular dystrophy without detailed histopathological examinations . Considering the fat infiltration is not a particular lesion in the skeletal muscle but is sequel after the muscular disorder, ms may consist of diverse collection of muscular disorders including the bmd - like myopathy . A lot of issues, such as the prevalence, genetic factors, pedigree and the systemic analysis of muscles, including heart, still remain unclear in our understanding of the bmd - like myopathy in a pig . Further studies on the bmd - like myopathy and ms with the present immunostaining method as one of the keys for examining muscular disorders are required in order to prevent economic loss and to ascertain the possibility of a bmd model using a pig.
Minimally invasive transforaminal lumbar interbody fusion (mis - tlif) is a popular and effective surgical technique for the treatment of degenerative lumbar disorders (dld), including spondylolisthesis, lumbar spinal canal stenosis associated with deformities, and discogenic pain identified by provocative discography [14]. Compared with the traditional open surgery, mis - tlif has multiple advantages, such as the decreased approach - related muscle damage, lesser blood loss, lower postoperative pain, shorter length of hospital stay, and minor postoperative narcotic usage allowing for early activity . Many previous studies have demonstrated that mis - tlif could achieve excellent clinical outcomes [69]. Although mis - tlif is widely performed with the treatment of dld, the choice for instrumentation with spinal fusion procedures remains controversial . In general, bilateral pedicle screw (bps) fixation for mis - tlif is preferred as a standard procedure due to its rigid fixation, great biomechanical stability and good clinical results . However, some studies have indicated that increased number of implants and excessive rigidity can lead to more adverse clinical effects, such as reducing fusion rate and adjacent segment degeneration . Recently, unilateral pedicle screw (ups) fixation has been recommended by an increasing number of surgeons [1316]. Ups fixation for the mis - tlif has multiple advantages in reduced soft tissue disruption of the contralateral side, shorter surgical time, and lower implant costs [1719], but relatively provides less rotational stability and stiffness based on many biomechanical studies . As far as we know, few previous clinical trials comparing ups versus bps fixation for open or mini - open tlif in multi - segment dld have been reported . Based on the previous studies which have shown similar clinical and fusion results of ups as those of bilateral fixation, we conducted this retrospective study to compare clinical outcomes in consecutive patients with multi - segment dld treated with ups or bps instrumented tlif . This study was approved by the committee of medical ethics and the institutional review boards of yuhuangding hospital . Informed consent was obtained from patients or their family members if the patient was unable to provide consent . A total of 84 consecutive patients who had undergone a multi - level mis tlif by the senior surgeon were enrolled . Patients treated with bps fixation for mis - tlif were compared with those with ups construct, based on age, sex, and body mass index (bmi). Indications for surgery were: 1) spinal stenosis, 2) lumbar disk herniation, and 3) spondylolisthesis . Only those subjects aged 18 to 70 years could be included . Patients enrolled in our study were excluded if they had the following: 1) active infection, 2) metabolic disease, 3) severe osteoporosis, 4) severe chronic disease, 5) symptomatic vascular disease, or 6) previous lumbar surgery . The merits and drawbacks of each procedure were thoroughly discussed with the patients and their family . All data, including patient demographics, examination results, and operative data, were obtained from hospital records . A c - arm image intensifier was used to determine the location of the interbody level . We used the local autograft and capstone cages (medtronic sofamor danek, memphis, tennessee) and pedicle screws (legacy; medtronic sofamor danek) in the surgery . Ups fixation placed at the time of mis - tlif applied in this study was previously described by lee et al ., and drainage was placed for 48 hours postoperatively and intravenously prophylactic antibiotics were given for 24 hours postoperatively . Patients in the unilateral group were mobilized early out of bed 24 hours postoperatively if no contraindications existed . All parameters, including blood loss, operative time, duration of hospital stay, complication rate, visual analog scale (vas), and oswestry disability index (odi) scores, were obtained and compared to evaluate efficacy between the 2 groups . All patients were asked to return for follow - up at 1 week and 3, 6, 12, and 24 months postoperatively . Preoperative and postoperative radiographs, including anteroposterior and lateral flexion - extension, were used to evaluate fusion status, screw failure, and other complications . The comparisons of continuous data presented as meanstandard deviation (sd) were analyzed with an independent - samples t test . A c - arm image intensifier was used to determine the location of the interbody level . We used the local autograft and capstone cages (medtronic sofamor danek, memphis, tennessee) and pedicle screws (legacy; medtronic sofamor danek) in the surgery . Ups fixation placed at the time of mis - tlif applied in this study was previously described by lee et al ., and drainage was placed for 48 hours postoperatively and intravenously prophylactic antibiotics were given for 24 hours postoperatively . Patients in the unilateral group were mobilized early out of bed 24 hours postoperatively if no contraindications existed . All parameters, including blood loss, operative time, duration of hospital stay, complication rate, visual analog scale (vas), and oswestry disability index (odi) scores, were obtained and compared to evaluate efficacy between the 2 groups . All patients were asked to return for follow - up at 1 week and 3, 6, 12, and 24 months postoperatively . Preoperative and postoperative radiographs, including anteroposterior and lateral flexion - extension, were used to evaluate fusion status, screw failure, and other complications . The comparisons of continuous data presented as meanstandard deviation (sd) were analyzed with an independent - samples t test . In this study, a total of 84 patients were followed up for an average of 26.2 months (range, 2336 months). Mean length of follow - up was 26.7 months for the ups group and 23.6 months for the bps group . In the ups group, 7 patients (16.7%) were diagnosed with spinal stenosis, 25 (59.5%) were diagnosed with lumbar disk herniation, and 10 patients (23.8%) were diagnosed with spondylolisthesis . In the bps group, 9 (21.4%) were diagnosed with spinal stenosis, 22 (52.4%) with lumbar disk herniation, and 11 (26.2%) with spondylolisthesis . No significant differences were found between the 2 groups in patient demographics (table 1). Mean length of hospital stay was 12.6 days in the ups group and 13.4 days in the bps group . No significant difference was found in hospital stay between the 2 groups . However, the ups group required a shorter operative time and had less blood loss than the bps group (p<0.01). Mean vas score was 1.81.2 in the ups group postoperatively and 2.21.4 in the bps group . Patients in the ups group postoperatively had an average odi score of 17.44.7 and patients in the bps group with16.67.5 . Both mean postoperative vas and odi improved significantly in each group, compared with preoperative vas and odi; however, no statistically significant differences were obtained between the 2 groups (table 2). With respect to fusion rate, 81.0% of patients in the ups group and 95.2% of patients in the bps group achieved successful fusion, which showed a significant difference (p=0.043). Neither group showed device - related complications, such as screw loosening or breakage, or fusion cage migration . With regard to general complications, there was no difference between the bps and the ups group (p>0.05). One patient in the ups group and 3 patients in the bps group developed superficial wound infections . Spinal fusion surgery is an effective method in the treatment of painful dld . With the development of advanced systems that can provide adequate access for decompression and instrumentation placement and reduce tissue disruption, the mis - tlif has become more popular in the treatment of dld . Recent biomechanical studies have suggested the equivalence between ups fixation and standard bps constructs [2426], and some clinical data have demonstrated acceptably reliable fusion rates in patients with ups fixation, which requires fewer pedicle screws . However, slucky et al . Reported that ups after mis - tlif led to less rotational stability and stiffness than bps fixation . Thus, the choice between bps or ups fixation after lumbar fusion for the treatment of dld remains controversial . The main aim of the pedicle screw is to stabilize the spine to promote fusion; therefore, the fusion rate is considered as the most important outcome . Deutsch et al ., in their studies in 2006, reported good outcomes of ups fixation after tlif with a greater than 20-point reduction in the oswestry disability index (odi) score, but they did not report the exact fusion rate and only evaluated the outcomes of short - term follow - up of less than 1 year . Both suk et al . And xue et al . Compared the efficacy of ups fixation vs. bps fixation after mis - tlif and reported lower fusion rates for the former; however, all patients in their studies received single - level fusion procedure . Some studies have shown that unilateral instrumentation might be not be suitable for multilevel fusion due to its inadequate fixation strength ., in their prospective randomized study, presented similar failed fusion rates of 2-level fusion in the ups group (3/16) and the bps group (2/11). They concluded that ups fixation in multi - level dld is similarly effective and safe . However, our study showed a different result that patients with ups had a lower fusion rate (81.0% vs. 95.2%) and that bps fixation was significantly safer . As many biomechanical studies have reported, the negative impact of the fusion in unilateral instrumentation might be due to less biomechanical stability . Moreover, we found less blood loss and a shorter operative time in patients with ups fixation after mis tlif, compared with bps fixation . These findings are consistent with the results of previous studies . With respect to functional scores, there were no differences between ups and bps fixation procedure in vas and odi . This finding is consistent with the results from many previous studies [3133], although the outcomes of patients in some of these studies were assessed using other assessment systems, including the japanese orthopaedic association (joa), mprolo, and 36-item short form healthy survey version 2 (sf-36v2) scores . Patients with ups fixation procedure had significantly had less blood loss and experienced shorter operation time as compared with those the bps fixation in our study . It is mainly due to dissection of soft tissue and insertion of pedicle screws only on 1 side for ups fixation, which takes less time and decreases blood loss . Hardware - related complications often cause serious adverse effects in fusion surgery . In our study, some patients had infections . One patient in the ups group and 3 patients in the bps group developed superficial wound infections . Similar to results in previous studies [1416,34,35], we also found there was no difference in terms of complication rate between the 2 procedures (ups vs. bps, 2.4% vs. 7.1%). Several meta - analyses also demonstrated that patients with ups procedure experienced similar complication rates as those with bps procedure . First of all, the relatively small sample size might limit the comparability and outcomes . Secondly, the follow - up durations in our study were not long enough to determine the results . Finally, the design of this study was not random, which could not adequately assess the outcomes of the 2 surgical methods . Further studies are required to compare the efficiency and safety of ups fixation in multi - level dld . In summary, the present study demonstrated that mis - tlif with ups fixation leads to similar clinical outcomes, compared with bps procedure for multi - level dld . Despite an association with decreased operative time and less blood loss, the ups technique had a lower fusion rate than the bps construct did . Due to the limitations of this study, multi - center studies with more patients and longer follow - up period
A function of any tumor cell that allows for propagation of diseased cells is the ability for that tumor cell to invade the surrounding tissue . One family of proteins involved in this pathological process is the plasminogen activator (pa) system [1, 2]. In addition to the role of the upa / upar complex in the degradation of the ecm, this complex plays a role in cell adhesion . Upar is able to engage cell surface integrins, allowing for attachment of cells expressing the upa / upar complex to other surrounding cells . Another key component is plasminogen activator inhibitor-1 (pai-1), the physiological inhibitor of upa activity [1, 2]. Pai-1 binds upa bound to the cell surface, forming a pai-1/upa / upar complex that is then recognized by the scavenger protein low - density lipoprotein receptor - related protein (lrp), which internalizes the tertiary complex [3, 4]. Paradoxically, elevated levels of pai-1 in breast cancer patients are associated with decreased patient survival . Peroxisome proliferator - activated receptor - gamma (ppar-) is a transcription factor that is considered the master regulator of adipogenesis [6, 7]. However, ppar- has been found in numerous cell lines, including endothelial cells [8, 9], normal and malignant prostate epithelium [10, 11], and normal and malignant breast epithelium . Ppar- is a ligand - activated nuclear transcription factor and the target of the thiazolidinedione (tzd) class of insulin sensitizing drugs [6, 13]. Drugs in this family bind ppar-, resulting in the activation of the ppar-/retinoid x receptor (rxr) heterodimer . Ppar- then binds the ppar response element (ppre) in the promoter of target genes, recruits coactivators, and then the gene is transcribed . In addition to tzd drugs, ppar- has been shown to be activated by the naturally occurring 15-deoxy--prostaglandin j2 (15d - pgj2). Although 15d - pgj2 is a potent agonist for ppar- in vitro, there is data suggesting 15d - pgj2 is not found at a high enough concentration to act as an in vivo ligand for ppar- . In addition to the tzd class of drugs and 15d - pgj2, ppar- has also been shown to be activated by a number of dietary fatty acids, specifically omega-3 (-3) and omega-6 (-6) fatty acids . A diet high in fat is associated with the development of a number of diseases, including cardiovascular disease, type 2 diabetes mellitus, and a variety of cancers . Dietary fat intake has been linked to prostate cancer risk, colon cancer [1719], and breast cancer . Thoennes, et al ., showed differential transcriptional activity by ppar- following treatment of mcf-7 cells with -3 and -6 fatty acids . Treatment with -3 fatty acids inhibited levels of ppar- activation, while -6 fatty acids increase ppar- activity over control . The goal of this study was to investigate the effect of ppar- ligands on breast cancer cell motility and the plasminogen activator system . The tzd ciglitazone decreased cell motility, independent of ppar-. Pai-1 levels were lower following ciglitazone treatment . The naturally occurring ppar ligand 15d - pgj2 also reduced wound - induced cell migration . Interestingly, treatment with the -6 fatty acid arachidonic acid (ara) increased cell motility, while the -3 fatty acid docosahexanoic acid (dha) had no significant effect . Our collective results suggest that the ppar- ligand ciglitazone decreases cell motility, in a ppar- independent manner, potentially though the down - regulation of pai-1; alternatively, the ppar- ligand ara promotes migration in a ppar- dependent manner that increases upa . F. miller, wayne state university, detroit, mich, usa) were cultured as previously described [22, 23]. All cell lines were cultured in dmem: f12 (gibco, invitrogen, carlsbad, calif, usa) containing 5% horse serum (hyclone, logan, ut), 1% psf (gibco, invitrogen, carlsbad, ca), 20 mg / ml egf (invitrogen, carlsbad, calif, usa), 50 ng / ml hydrocortisone, 100 ng / ml cholera toxin (calbiochem, san diego, calif, usa), and 10 mg / ml insulin (gibco, invitrogen, carlsbad, calif, usa). Cells were grown in a humidified atmosphere of 5% co2 at 37c as previously described . Cells were plated at 1.0 10 cells per well in a 12-well tissue culture treated plate as detailed previously [24, 25]. At confluence, cells were serum - starved overnight . Cells were then scratched with the tip of a sterile yellow pipet tip and serum - free media containing various concentration of 15d - pgj2 (calbiochem, san diego, calif, usa) or ciglitazone ranging to 10 m (cayman chemical, ann arbor, mich, usa) from ethanol stocks were added to each well . Migration was monitored at 0, 6, and 12-hours using a kodak mds290 camera . Wound closure was quantified by measuring distance as pixels between each leading edge of the wound (10 lines / wound) at each time point using the measuring tool in adobe photoshop, with a grid superimposed on image to guide measurements . Following serum starvation, cells were treated with ppar- ligands ranging to 10 m of ciglitazone, ara (ara - sodium salt, sigma, st . Louis, mo, usa), or dha (dha - sodium salt, sigma, st . Lower wells of chamber contained dmem: f12 plus 1 mg / ml fatty - acid - free bovine serum albumin (bsa, sigma, st . Louis, mo, usa) with or without 5 ng / ml egf (invitrogen, carlsbad, calif, usa). Cells (1 10) were plated in upper wells in dmem: f12 containing 1 mg / ml fatty - acid free bsa, above a collagen iv coated, 10 mm porated membrane . Cells were fixed and stained with diff - quick (dade - behring, newark, de). Cells that migrated to the undersurface of the membrane were examined microscopically at 200x magnification . Each condition was done in triplicate, with 4 fields counted per well . In experiments with gw9662, serum - starved cells were pretreated for 30 minutes with gw9662 (5 m) (calbiochem, san diego, calif, usa), then ciglitazone or fatty acid treatment was added to cells for 24-hours . Gw9662 is an irreversible ppar- antagonist and it was used at a concentration where it is selective for ppar- in cells [26, 27]. Cells were plated at 1.0 10 cells per well in a 96-well tissue culture plate . Confluent cells were serum - starved 24 hours, then mtt (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) reagent was added to cells and incubated at 37c for 3-hours . Absorbance was measured (abs = 595 nm) on a spectramax microplate reader (molecular devices, sunnyvale, calif, usa). Conditioned media from treated cells was collected and concentrated with centrifugal concentrators (amicon ultracel 30 kd, millipore, billerica, mass, usa). Protein concentration was determined using biorad protein dc assay (biorad, hercules, calif, usa). Proteins were separated by sds - page in 10% polyacrylamide and electrotransferred to pvdf membrane . Phosphate buffered saline/0.1% tween-20 (pbs / tween) buffer was used in all steps of immunoblot analysis . Nonspecific binding was blocked by 5% nonfat dry milk for 30 minutes at room temperature . Membrane was incubated at 4c overnight with primary antibody diluted 1: 1000 (unless otherwise noted) in 1% nonfat dry milk . Membrane was exposed for 1-hour at room temperature to horseradish peroxidase conjugated secondary antibody diluted 1: 5000 in 1% nonfat dry milk in pbs / tween . Membrane was exposed to luminal substrate for 1 minute, covered in plastic wrap then exposed to x - ray film . Primary antibodies were: rabbit antihuman pai-1 (1: 2000 dilution) (molecular innovations, novi, mi) and rabbit anti - human upa (no . 389, american diagnostica, stamford, conn, usa) as described previously . Mcf-10a and mcf-10ca1 cells (1 10) were plated in a 96-well plate . Following 24-hour serum starvation, cells were pretreated with ppar- antagonist gw9662 or vehicle control for 30 minutes at 37c . Cells were then treated with various concentrations (up to 10 m) of ciglitazone or arachidonic acid for 24 hours at 37c . After treatment, cells were washed with pbs and plasminogen was added to cells and incubated at room temperature . The supernatant was removed and added to another 96-well plate containing buffer amiloride to inhibit any residual upa activity . Chromogenic substrate is then added to the well and hydrolyzed by plasmin generated by plasminogen cleaved by upa on the cell surface . Rate of chromogenic substrate cleavage by plasmin was measured at 405 nm for 90 minutes . As previously reported, mcf-10a cells express less upa and upar but more pai-1 than mcf-1ca1 breast cancer cells . Both cell lines express ppar- and rxrs (data not included). Based on these findings, we performed a study with some ppar- ligands on upa / pai-1-mediated cell migration processes comparing near normal mcf-10a cells to oncogenic ras - transformed metastatic mcf-10ca1 cells . Ciglitazone decreased wound closure dose dependently (figure 1(a)), with 5 m ciglitazone reducing cell closure by 39% compared to no ciglitazone . 15d - pgj2 also decreased cell closure dose dependently, with 10 m 15d - pgj2 reduced cell closure by 50% compared to no 15d - pgj2 (figure 1(b)). These results show that ppar- ligands decrease wound closure of mcf-10a cells, and they further support the literature that ppar- activation inhibits migration of cancer cells in vitro . Ciglitazone decreased cell chemotaxis to egf in a dose - dependent manner (figure 2). To determine if these effects were mediated by ppar-, we pretreated the cells with the ppar- specific antagonist gw9662 . Interestingly, blocking ppar- activation with gw9662 (5 m) pretreatment did not reverse the effect of ciglitazone (5 m) in either cell line . Control experiments with 5 m gw9662 showed neither detrimental effect on cell viability nor changes in cell motility . The data suggest ciglitazone is working in a ppar- independent manner to reduce cell migration . Treatment of mcf-10a and mcf-10ca1 cells with 5 m ciglitazone partially reduced cell viability (abs 595 nm of cells with no and 5 m ciglitazone was 0.331 .014 and 0.292 .003 for mcf-10a cells and 0.304 .006 and 0.279 .002 for mcf-10ca1 cells, resp . ). There was a substantial loss of cell viability at 10 m ciglitazone for both cell lines; thus, all further experiments used 5 m ciglitazone . In additional control experiments, there was no loss of cell viability with the ppar- ligands 15d - pgj2 or ara when tested up to 10 m (data not included). These results imply that the effect of ciglitazone in mcf-10a and mcf-10ca1 cell motility is not due to a substantial reduction in cell viability . In both mcf-10a and mcf-10ca1 cell lines, ciglitazone treatment resulted in decreased pai-1 protein expression (figure 3). To determine if this decrease in pai-1 expression was mediated by ppar-, we pretreated with gw9662 prior to ciglitazone treatment . We did not see a reversal of ciglitazone - mediated reduction in pai-1 expression (figure 3) suggesting ciglitazone is affecting pai-1 levels independently of ppar-. In mcf-10a cells, ciglitazone treatment alone or in conjunction with gw9662 pretreatment increases upa activity on the cells surface (figure 4(a)). Ciglitazone treatment in mcf-10ca1 cells did not significantly alter upa activity although it seems gw9662 treatment in these cells results in more plasmin generation (figure 4(b)). With 10 m ara, we see a significant increase in cell motility compared to control cells (figure 5(a)). When we pretreated the mcf-10a cells with the ppar- antagonist gw9662, we see a reduction in cell motility (figure 5(a)). Ara treatment increases upa activity on the cell surface though gw9662 did not seem to fully reduce upa activity (figure 5(b)). Additionally, treatment with the -3 fatty acid dha, up to 10 m, had no effect on either cell motility or cell viability (data not shown). These results suggest ara is able to activate ppar-, resulting in increased cell motility and upa activity . Pai-1 and upa protein expression have been used as strong independent prognostic indicators for breast cancer [5, 2830]. In addition to cancer, pai-1 overexpression is linked to a variety of disease states . Morbidly obese individuals have elevated circulating pai-1 levels, likely due to an increase in pai-1 expression from adipose tissue . In rats with streptozocin - induced diabetes, pai-1 levels are increased 6080% over control . In humans, elevated pai-1 levels have been reported in patients with t2 dm and is related to cardiovascular dysfunction [33, 34]. While the literature on ppar- activation and pai-1 alterations is conflicting, it has been shown in a number of cell types and in vivo that ppar- does modulate pai-1 expression [3437]. We treated cells with ciglitazone, 15d - pgj2, and ara acid to investigate effects of ppar- activation on migration and pai-1 expression following treatment . Based on previous literature, we expected to see differential effects of ppar- activation, specifically with ara treatment . In vitro, treatment of tumor cells with tzds results in a number of antitumor effects . In prostate cancer cells, ppar- ligands reduced proliferation, induced terminal differentiation, and downregulated e - cadherin and c - myc expression . Pioglitazone, in combination with valproic acid, upregulates e - cadherin and reduced invasion and migration in prostate cancer cells . We found that treatment with either ciglitazone or 15d - pgj2 resulted in a significant decrease in wound closure of mcf-10a cells . Gw9662 is a specific ppar- antagonist, which binds ppar- and blocks ligand binding and subsequent activation of the receptor . Surprisingly, pretreatment with gw9662 did not reverse the effects of ciglitazone, which suggests that ciglitazone mediates this reduction in migration through a ppar--independent mechanism . Emery et al . Showed rosiglitazone and pioglitazone inhibited proliferation of pituitary tumors; however, ppar- antagonists did not reverse these effects, suggesting the antiproliferative effect was independent of ppar- activation . Another study found ciglitazone and 15d - pgj2 induced apoptosis in normal and malignant b cell, independent of ppar- . Finally, ciglitazone and 15d - pgj2 have been shown to activate p38 mapk signaling, which were reported to be independent of ppar- activation [43, 44]. These effects were reversed in cells pretreated with gw9662, suggesting ara is acting in a ppar--dependent manner . Since -3 and -6 fatty acids have been shown to have differential effects on ppar- activation, we also investigated if -3 fatty acids had an effect on cell migration in our system . We saw no change in migration in mcf-10a cells treated with dha, which agrees with past studies that -6, but not -3, fatty acids promote cell motility . Gw9662 pretreatment did not fully reverse ara - induced upa activity; one possibility for this is ara also signals through pi3k to upregulate upa expression . It is also possible ara is engaging ppar- intracellularly, resulting in increased cell migration, while independently initiating the pi3k signaling cascade and then upregulating upa activity . One limitation of our study was the exclusive use of gw9662 for its irreversible ppar- antagonist effect [26, 27]. Future studies with mcf-10a and mcf-10ca1 cells would benefit from either silencing ppar- expression or expressing a dominant negative ppar- to investigate any possible differences in cell motility or proliferation following treatment with ciglitazone or other ppar- agonists . Another limitation to our study was the absence of reporter studies for ppar- gene regulation . One clinical trial in phasetwo investigated the effect of pioglitazone in conjunction with a cox-2 inhibitor in glioma patients and saw moderate results in patients with high - grade glioma, suggesting pioglitazone treatment may be beneficial to a subset of patients . A phase - i trial of a non - tzd ppar- agonist ly29311 studied maximum tolerated dose in a combination regimen in patients with advanced solid tumors and determined there was no limiting toxicity and no disease progression . To date, these advances have not been realized with ppar- agonists in contrast to their preventative benefits in diabetic patients . This study shows ciglitazone treatment reduces both normal and malignant epithelial cell migration in vitro, independently of ppar- activation . Additionally, we found ciglitazone treatment reduces pai-1 protein levels, and this effect was not reversed by antagonism of ppar-. We hypothesize that the antimigratory effects of ciglitazone are mediated by the alteration of the pa system in these cells . We know pai-1 inhibits apoptosis, can promote cell motility, and plays a role in intracellular signaling [1, 2]. Given the role of pai-1 in these tumor processes, the in vivo data showing fda - approved tzds decrease pai-1 in diabetic patients, and our results and those of others, one could draw the conclusion that tzd therapies may eventually prove to be a valid adjuvant therapy for some breast cancer patients.
The altered postoperative physiology after pneumonectomy interventions can cause severe implications, especially in patients receiving adjuvant therapy for advanced lung cancer . A 60 year - old man with malignant pleural mesothelioma underwent a thoracotomy through double incision (5 and 7 intercostal spaces) for left pleuro - pneumonectomy and diaphragmatic resection after chemotherapy . The pre operative chest computed tomography scan showed a pattern of centrolobular emphysema . A thoracic epidural catheter was placed before anaesthesia induction and a mixture of ropivacaine 0.375% and fentanyl was used during the intervention and postoperative period . Parietal pleural dissection produced a significant blood loss and red blood cells and fresh frozen plasma transfused . The patient did not meet the extubation criteria and was transferred to the intensive care unit . On intensive care unit admission the patient was hypotensive (blood pressure= 90/60 mmhg) and treated with fluids . Chest x - ray was normal (figure 1) and the patient was extubated 40 minutes thereafter . This figure shows the first chest x - ray (immediately after the admission in the intensive care unit). An hypotensive episode (blood pressure 60/40 mmhg) and tachypnea (respiratory rate = 32 breaths per minute) were treated with fluids, dopamine (5 mcg / kg / min)and interruption of the epidural infusion . A chest x - ray with contrast administration trough nasogastric tube was performed . Respiratory arrest and asytolia the chest x - ray showed gastric and spleen herniation through a diaphragmatic breach (figure 2). This figure shows the diaphragmatic herniation (the chest xray was performed immediately before cardiorespiratory arrest). Dopamine infusion was interrupted during the operation, the patient was extubated in the intensive care unit six hours later discharged from the hospital on the 6th post operative day without further complications . The mortality rate after pneumonectomy is 6%, the major causes of death being pneumonia, pulmonary edema, pulmonary embolism, myocardial infarction, empyema and bronchopleural fistula . Gastric hernia is a rare postoperative complication usually diagnosed at the first postoperative chest xray . In our case the diagnosis was challenging because the hernia became evident only after intensive care unit admission and because the epidural analgesia confused the clinical scenario: this technique was considered the cause of persistent hypotension . The left pneumonectomy likely created a vacant space into which the stomach acutely herniated compressing the heart and creating a cardiac tamponade . In patients with hypotension after left pneumonectomy a high index of suspicion should be observed for diaphragmatic hernia during the whole postoperative period.
Pathogens on invading host cells express molecules that are broadly shared by all microbes and distinct from host . These include lipopolysaccharide, peptidoglycan, flagellin and microbial nucleic acids, and collectively are referred to as pathogen - associated molecular patterns (pamps) [13]. Pattern recognition receptors (prrs) of the host when recognizing pamps trigger a release of inflammatory cytokines and type i interferons (ifns) [4, 5]. Prrs are evolutionally conserved and have been investigated extensively . From the initial investigation of toll - like receptor (tlr) family to the recent discoveries of retinoic acid - inducible gene - i (rig - i)-like receptors (rlrs) [7, 8] and the nucleotide - binding domain and leucine - rich repeat containing gene family (nlrs, also known as nod - like receptors) [9, 10], all the evidence point to an important role in host defense . Tlrs are membrane bound receptors that sense pamps on the cell surface or in endosomes while rlrs and nlrs recognize microbial molecules in the host cytosol . The individual members of these prrs families are characterized by their ligand specificity, cellular localization and activation of unique downstream signaling pathways . Immunity against different microbial pathogen primarily depends on the recognition of the specific pamp of the pathogen by the corresponding prr . Double - stranded rna (dsrna), a virus replication intermediate and a signature of infection, is sensed by tlr3, two members of rlrs family, that is, the rna helicases rig - i and melanoma differentiation - associated gene 5 (mda-5), and the nlr pyrin domain (nlrp) 3 protein of nlr family . These trigger the release of inflammatory cytokines, that is, activating innate immunity which shapes adaptive immune response [11, 13, 14]. The primary cytokines involved in this response are type i ifns including ifn- and ifn- . In this review, the mechanism of innate and adaptive immunity induced by dsrna and the potential application of dsrna as a vaccine adjuvant against viral infection and anticancer immunotherapy is elaborated . Tlrs are type i integral membrane glycoproteins which have a trimodular structure composed of an extracellular domain, a single transmembrane domain and an intracellular toll / il-1 receptor (tir) domain [11, 16, 17]. The extracellular n - terminal domains of tlrs contain 1628 leucine - rich repeats (lrrs) [16, 18] in a horse - shoe structure . Each individual lrr is composed of 2030 amino acids with a conserved characteristic repetitive sequence pattern rich in leucines, the lxxlxlxxnxl motif and two or more repeats in tandem, form curved solenoid structures suitable for protein - protein interactions . The extracellular domain of human tlr3 comprises of 23 lrrs in a horse - shoe shaped structure . The convex face of the extracellular domain of tlr3 is glycosylation - free and contains many positively charged residues while the concave face is largely glycosylated and negatively charged [20, 21]. The dsrna binding site of tlr3 is located in two regions near the n - terminus and c - terminus . When dsrna interacts, two ectodomains of tlr3 are connected by dsrna in an when combined with tlr3, dsrna spans the whole m consisting of two horse - shoes of the ectodomains of tlr3 (figure 1a). This satisfies the minimum requirement of 4050 base pairs of dsrna allowing stable binding to tlr3 inducing signaling [16, 23, 24]. With the secondary structure, the transmembrane domain of tlr3 is a single -helix and the endodomain is composed of a five - stranded -sheet surrounded by five -helics that forms the tir domain . The b - b loop that connects -strand b with -helix b in the tir domain is considered the essential structure that directly interacts with the adaptor protein tir domain - containing adaptor inducing ifn- (trif). In addition to the b - b loop, three boxes of conserved residues that reside in tir domain are involved in tlr3 signaling [25, 27]. Tlr3 can be found both intracellularly and on the cell surface in human fibroblasts and epithelial cells . However, it is predominantly located in intracellular vesicles, for example, endosomes, in most cell types including dendritic cells and macrophages [28, 29]. Tlr3 is activated by extracellular dsrna that is released from dsrna viruses or is produced during single - stranded rna viruses' replication or comes from application of synthetic dsrna analogues . It is largely unknown how extracellular dsrna are delivered to the intracellular vesicles containing tlr3 . Studies have suggested that cd14 may play an important role in dsrna uptake [20, 30]. Once internalized into the endosome, dsrna binds to its adaptor protein tlr3 and activates several signaling pathways . Upon binding to dsrna, the b - b loop of the tlr3 tir domain combines with tir domain of trif activating several transcription factors, including nuclear factor-b (nf-b), interferon regulatory factor 3 (irf3), and activating protein 1 (ap-1). There are two pathways to activate nf-b mediated by receptor - interacting protein 1 (rip1) and tumor necrosis factor (tnf) receptor - associated factor 6 (traf6) (figure 1a). Traf6 is a ubiquitin ligase and plays a role in rip1 polyubiquitination [31, 32]. Polyubiquitinated rip1 is recognized by ubiquitin receptors, the transforming growth factor -activating kinase (tak) binding protein (tab) 2 and 3, which in turn activate tak1 . Ib kinase - related kinase (ikk) and ikk are phosphorylated by the activated tak1 . This leads to phosphorylation and degradation of ib, an inhibitor of nf-b, and eventually results in the translocation of nf-b to cell nucleus . Tak1 also activates the 2 other classes of kinase, jnk and p38 and these activate the family of ap-1 transcription factors . Trif activates the kinase complex traf family member - associated nf-b activator (tank)-binding kinase 1 (tbk1) and ikk through its adaptor protein, nf-b activating kinase (nak)-associated protein 1 (nap1), leading to the phosphorylation and nuclear translocaton of irf3 consequently inducing the expression of ifn- . In addition to nap1, traf3 is also part of the tbk1/ikk complex that is involved in the trif - mediated irf3 activation . Another signal from tlr3 is related to the phosphorylation of two specific tyrosine residues (tyr and tyr) in the tlr3 tir domain when tlr3 interacts with trif (figure 1a). Phosphorylated tyr recruits phosphatidylinositol 3-kinase (pi3k) which then activates kinase akt required for phosphorylation and activation of irf3 in nucleus . The phosphorylation of tyr and also tyr results in degradation of ib leading to nf-b release and this induces phosphorylation of nf-b which partially activates it . The unique signal pathway of trif is able to induce mammalian cell apoptosis (figure 1a). Trif interacts with fas - associated cell death domain (fadd) protein through rip1 which in turn activates procaspase-8 to initiate cell apoptosis [25, 39]. Rlrs are cytoplasmic viral rna sensors with three recognized members including rig - i, mda-5 and laboratory of genetics and physiology 2 (lgp2). In addition to the central helicase domain, rig - i and mda-5 have two caspase recruitment domains (cards) at its n - terminus which are responsible for downstream signaling cascade through the interaction with a card - containing adapter, mitochondrial antiviral signaling adapter (mavs, also known as ips-1, visa, or cardif) located in the outer mitochondrial membrane . Lgp2, lacking the n - terminal card, works as a negative regulator of rlrs signaling . Although only a single card physically interacts with mavs, both cards are essential for downstream signaling [42, 43]. The rig - i activation is self - inhibited by the c - terminal regulatory domain (rd), also referred as the c - terminal domain (ctd) or repressor domain, through intramolecular association between rd and both the card and the helicase domains [4244]. Rd is also responsible for the binding affinity to the dsrna and 5-triphosphated single - stranded rna (5ppp - ssrna) of viral rnas with a common core rna binding site specifically adapted to distinct and unique patterns [4447]. Mda-5 rd preferentially binds dsrna with blunt ends but does not associate with dsrna with either the 5 or 3 overhangs . The central helicase domain displays cooperative rna binding properties [43, 48, 49]. The rd of mda-5 does not exhibit self - inhibitory activity [42, 50]. Mda-5 is negatively regulated by dihydroxyacetone kinase (dak) and other possible regulators . Rig - i binds 5-triphosphate rna in single- or double - stranded forms [5254] or short dsrna of 3001000 bp without a 5-triphosphate while mda-5 recognizes long dsrna of more than 1000 bp in length and the synthetic dsrna analogue polyinosinic - polycytidylic acid [poly (i: c)] [5456]. Upon sensing rna, both rig - i and mda-5 are activated and initiate downstream signaling through the common pathway via adaptor protein mavs (figure 1b). Mavs consists of a card at the n - terminus, a proline - rich region (prr) in the middle and a transmembrane domain at the c - terminus attached to the outer surface of mitochondria . Activated rig - i and mda-5 associate mavs via a card - card interaction which leads to the dimerization of the mavs n - terminal card domains . Once activated, binding to traf3 occurs directly through the interaction between the traf domain of traf3 and the traf - interacting motif (tim) in the prr of mavs [5860]. Following the association of traf3 with mavs, the ring domain of traf3 forms a scaffold to assemble noncanonical ikks signal complex composed of tank, tbk1, ikk, nap1 and nf-b essential modulator (nemo). This complex then activates the signal - dependent phosphorylation of irf3 and irf7 to form a functional homodimer or heterodimer and translocates to the nucleus [61, 62]. Traf6 is essential in the activation of nf-b, jnk and p38 signaling while traf2 is involved in activation of p38 mapk which promotes il-12 and type i ifn production . Moreover, tnfr - associated death domain (tradd) is recruited to mavs following virus infection and interacts with traf3, tank, fadd and rip1 as well as activating both irf3 and nf-b signaling . Another protein - termed stimulator of interferon genes (sting, also known as mita or myps) expressed either on the outer micochondrial membrane or endoplasmic reticulum directly interacts with rig - i but not mda-5 . Sting has been reported to associate with major histocompatibility complex class ii (mhc ii) and mediates apoptotic signals via erk activation . It was recently reported that rig - i binds to an adaptor apoptosis - associated speck - like protein containing a caspase - activating and recruitment domain (asc) to trigger caspase-1-dependent inflammasome activation by a mechanism independent of mavs, card9 and nlrp3 . This suggests that rig - i is able to activate the inflammasome in response to certain rna viruses . Nlrs are intracellular prrs sensing pamps and danger signals or danger - associated molecular patterns (damps) released by injured cells . The nlr family has 23 members in humans and at least 34 members in mice . Nlrs are multidomain proteins with tripartite structure composed of an n - terminal effector region, a central nacht (neuronal apoptosis inhibitory protein, naip; class ii transactivator, ciita; plant het product involved in vegetative incompatibility, het - e; telomerase - associated protein 1, tp-1) domain (also known as nod domain), and a c - terminal region for pamps recognition . The c - terminal region is characterized by a series of lrrs and is implicated in ligand sensing and nlrs autoregulation but the precise mechanism is not clear . The nacht domain is a member of signal transduction atpases, part of the p - loop ntpase family and is related to self oligomerization and the formation of inflammasome . The n - terminal region contains several protein interaction modules, such as acidic domain, baculoviral inhibitory repeat (bir)-like domain, card and pyrin domain (pyd). Accordingly, nlrs are further divided into subfamilies as nlra, nlrb, nlrc and nlrp . An additional subfamily, nlrx, is characterized by the presence of an n - terminal domain with no strong homology to any known domains of other nlr subfamily member . Upon recognition of pamps, toxins, or danger signals by nlrs, a large protein complex termed the inflammasome composed of nlrs, asc and pro - caspase-1 is activated . This protein platform activates pro - caspase-1 into its active form of caspase-1 and this hydrolyzes pro - il-1 and pro - il-18 into their mature biologically active forms which are secreted extracellularly to play a role in immune response [14, 71]. Limited studies have suggested dsrna is an activator of nlrp3 inflammasome [7578] although this has been disputed . Nlrp3 senses pamps either from bacteria, such as lipopolysaccharide (lps), muramyl dipeptide (mdp), bacterial pore - forming toxin and bacterial dna and rna, or from viruses such as viral ssrna or dsrna, dsrna analogue poly (i: c). It also senses other compounds such as imidazoquinoline antiviral drugs r837 and r848, nonmicrobial signals encompassing uric acid crystals, calcium pyrophosphate dehydrate (cppd), asbestos, silica, extracellular atp, alum adjuvant and fibrillar amyloid- [14, 71, 72, 80]. It is believed that nlrp3 activation results in the interaction of nlrp3 pyd with asc pyd which in turn causes asc card to associate with pro - caspase-1 card assembling the nlrp3 inflammasome (figure 1c). Besides nlrp3, asc and pro - casepase-1, human nlrp3 inflammasome contains a card - containing protein, card inhibitor of nf-b - activating ligands (cardinal, also known as card8). Allen et al . (2009) utilized small heteroduplex rna (shrna) to knockdown the expressions of asc, nlrp3 and cardinal respectively in human thp-1 monocyte cell lines . The il-1 production triggered by lentivirus infection was significantly attenuated by the addition of shrna of asc or nlrp3 . It has been proposed that the activation of the nlrp3 inflammasome requires both microbial molecules and a second signal such as extracellular atp or pore - forming molecules . Alternatively, it has also been suggested that reactive oxygen species (ros) may be the common nlrp3 inflammasome activator since the most striking features associated with nalp3 activators like potassium efflux and the induction of frustrated phagocytosis all leads to ros production via nadph [71, 85, 86]. In particular, the activation of nlrp3 inflammasome triggered by virus infection or by poly (i: c) requires sensing viral rna or poly (i: c), lysosomal maturation, cathepsin b and ros generation . The assembly of nlrp3 inflammasome leads to the activation of pro - caspase-1 and consequently the maturation of pro - il-1 and pro - il-18 (figure 1c). Caspases belong to a conserved metazoan aspartate - specific cysteine proteases family with 11 members in human (caspases 1 to 10, and 14) and 10 members in murine species (caspases 1, 2, 3, 6, 7, 8, 9, 11, 12, and 14) [87, 88]. All caspases are synthesized as inactive zymogens containing a prodomain and are divided into two subfamilies: initiator caspases and effector caspases based on the length of their prodomains . Initiator caspases (caspases 1, 2, 4, 5, 8, 9, 10, 11, 12) are involved in the interaction with upstream adapter molecules and possess long prodomains that contain either the death effector domain or card . Effector caspases (caspases 3, 6, 7) that possess short prodomains are activated by upstream caspases and are able to cleave multiple cellular substrates involved in apoptosis . Caspase-1, along with caspases 4, 5, 11, and 12 are often referred to as proinflammatory caspases . Once incorporated into nlrp3 inflammasome, pro - caspase-1 is activated by proteolytic cleavage to remove the card prodomain . The active caspase-1 in turn cleaves the il-1, il-18, il-33 and il-1f7 precursors into their active forms and these active cytokines are secreted extracellularly and become immunoreactive (figure 1c). It was recently reported that influenza virus infection results in the activation of nlr inflammasomes in the lung . Although nlrp3 is required for inflammasome activation in certain cell types, adaptive immunity to influenza virus is asc and caspase-1 dependent rather than nlrp3 dependent, suggesting a central role of asc inflammasomes . The investigators concluded that influenza virus infection stimulates nlrp3-dependent and nlrp3 independent inflammasomes in a cell type - specific manner . Moreover, it has been suggested that some viral rna can activate inflammasome via interaction between rig - i and adaptor asc independent of nlrp3, mavs, and card . Dcs express a repertoire of prrs including tlrs (tlr3 is not expressed in plasmacytoid dcs), rig - i and mda-5 (absent in plasmacytoid dcs), as well as nlrs, and are able to recognize a range of pathogenic microbes [9294]. The interaction of pamps and prrs on dcs induces the maturation and activation of dcs via transcription, translation and secretion of inflammatory cytokines and chemokines through the signal pathways as described above . The activated dcs, characterized by enhanced antigen presentation capacity and referred to as antigen - presenting cells (apcs), migrate to draining lymph nodes and interact with t and/or b lymphocytes initiating the immunity process . Among the cytokines triggered and secreted, type i ifn plays a major role in the cross - priming of cd8 t - cells by promoting the expression of costimulatory molecules of dcs . The proliferation and differentiation of the lymphocytes are mediated by signals from the activated dcs which comprise of the co - presentation of mhc molecules and pathogen - derived peptides . Additionally, signals from costimulatory molecules including cd80 and cd86, as well as the instructional signals, for example, il-12p70 for th1, il-4 for th2, and il-6 and il-23 for th17 from the presenting dcs are also present . Dsrna receptors which include tlr3 and rig - i / mda-5 are expressed in myeloid dcs (mdcs) and primarily produce il-12 and ifn- when recognition of dsrna occurs . However, poly (i: c) with different molecular weights have differential effects on the maturation of dcs . Interestingly, co - culture of bone marrow - derived dcs with protein and poly (i: c) reduced the antigen uptake by dcs . However, the reduced uptake of antigen did not affect ctl priming by dcs suggesting that the reduction in uptake of soluble antigen in the presence of poly (i: c) is independent of tlr - mediated dc activation . Newly primed cd4 t - cells are programmed by various cytokines and other factors from dcs and other innate immune cells to differentiate into th1 or th2 or th17 effector cells or regulatory t - cells (treg). Th1 lymphocytes are produced by the nave cd4 t - cells (th0) interacting with il-12 from mdcs to stimulate the expression of signal transducer and activator of transcription (stat) 1 and subsequently that of t box expressed in t - cells (t - bet). Activated th1 cells produce cytokines like il-2 and ifn- that are cofactors in cd8 ctls activation and synergistically activate mdcs acting via a feedback loop . It is believed that dsrna is capable of inducing robust il-12p70 production which reduces the threshold of th1 response and herein promotes th1-biased adaptive immunity through tlr3 and jnk pathways [98, 100]. Tnf-, type i ifn and il-18 also play important roles in the induction of th1 response by dsrna . Type i ifn can activate mdcs directly by inducing phenotypic maturation which includes but is not restricted to upregulation of mhc class i, class ii, cd40, cd80, cd86 and higher expression of cd83 . Besides inducing mdcs maturation and activation, ifn-/ upregulates the expression of chemokine receptor ccr7 to sensitize mdcs to ccl19 and ccl21 which promote the migration of mdcs from peripheral tissues towards the t - cell area of lymphoid organs . Type i ifn is also necessary for the generation of a th1 cd4 adaptive t - cell response whereas il-12p40 and type ii ifn are not . Therefore, the activation of th1 cell response induced by dsrna is possibly mediated by its capacity of inducing robust type i ifn production . However, at low concentrations of dsrna (0.11 g / ml), human lymphocytes express prototypic th2 cytokine il-4 . Indeed, when coadministered with protein antigen, in addition to the induction of robust th1 biased immunity, dsrna is also capable of enhancing th2 antigen - specific immune response [104106]. When stimulated by dsrna along with specific antigen, activated dcs are able to induce antigen - specific cd8 cytotoxic t lymphocytes (ctls) activation through cross - presentation and cross - priming mechanism . During viral infection of mdcs, dsrna is produced during replication in the infected mdcs and the latter in turn activates mdcs through trif, mavs, nlrp3 inflammasome and possibly another undefined signal pathway(s) to become apcs . Apcs present endogenous antigens including those from intracellular viral origin with mhc class i molecules to nave cd8 lymphocytes along with costimulatory factors and instructional signals to activate the lymphocytes becoming mhc - i restricted ctls . However, in most cases, the virus does not invade mdcs directly but instead infects cells other than mdcs . In such cases, the extrinsic viral antigen and dsrna can be taken up into mdcs and these mdcs in turn present the antigen epitope with mhc - i molecules to cd8 lymphocytes inducing a ctl response . This mechanism is referred to as cross - priming and inducible by tlr3-trif signaling and mda-5-mavs signaling [107, 108]. Type i ifn produced through these signal pathways also enhances the cross - priming ability of mdcs possibly via augmenting their capacity to deliver costimulatory signals or directly stimulation of cd8 t - cells . The mechanism of mdcs uptake of the extrinsic antigens involves phagocytosis of particulate antigen, pinocytosis of soluble antigen and receptors mediating cross - presentation such as fc receptor, mannose receptor and dectin-1 . The ability of cell - associated poly (i: c) with antigen to induce robust cross - priming responses in nave mice is completely lost in the tlr3-deficient chimera mice . Immunized with protein along with alum and poly (i: c), the expansion of antigen - specific cd8 t - cell can be reduced in both mavs - deficient and trif - deficient mice and entirely abrogated in the bideficient mice . Type i ifn produced through trif or mavs signal pathway also enhances cross - priming by mdcs [102, 109]. A recent report suggested that cd8 t - cells can be activated by dsrna directly triggering tlr3 . Priming of ifn--producing cd8 t - cells by dying tumor cells failed in the absence of a functional il-1 receptor 1 and in nlpr3-deficient or caspase-1-deficient mice unless exogenous il-1 was present . Th17 cell is a proinflammatory lymphocyte belonging to th cell subset [113, 114]. This subset preferentially produces il-17, il-17f, il-22, and il-21, but not ifn- or il-4 . Nave t - cells are induced by transforming growth factor (tgf)- to differentiate into two reciprocal subsets, that is, th17 cells and treg cells under different polarizing signals . Il-6 is the polarizing signal of th17 which switches the transcriptional program initiated by tgf- to induce the development of th17 cells and blocks the development of treg cells [116118]. In fact, th17 cells can express such receptors if induced by tgf- acting through ror-t which is a unique transcription factor of th17 (the human counterpart of murine ror-t is ror - c). Ror-t is the key transcription factor that orchestrates the differentiation of th17 effector cell lineage by inducing transcription of the il-17 gene in nave helper t - cells and is also required for the development of il-17 producing cells in the presence of il-6 and tgf- . Il-6 is involved in upregulation of il-23r mrna expression, and il-6 and il-23 synergistically augment its protein expression . Therefore, il-23 acts on t - cells that are already committed to the th17 lineage rather than inducing th17 differentiation . Th17 cells are engaged in the neutrophil related inflammation against infections of fungi and certain extracellular bacteria . Most parenchymal cells express il-17 receptors that interact with il-17 that are expressed primarily from th17 cells to produce proinflammatory factors such as il-1, il-6, il-8, tumor necrosis factor (tnf) and matrix metalloproteinases [115, 123]. Th17 cells can also induce chemokine production which attracts numerous effector t - cells into inflammatory area promoting the inflammatory response . Thus, inappropriate regulation of th17 cells activities is associated with chronic inflammation and severe immunopathologic conditions such as autoimmunity . Trif signaling in mdcs might induce il-12 and il-23 production and play a role in th17 activation . However, the tlr3 pathway activated by dsrna induces activation of irf3 and irf7 which exclusively induce p35 and p28 but not p19 . These in turn would induce il-12 (p35 and p40) and il-27 (epstein - barr virus - induced gene 3 and p28) but not il-23 (p19 and p40). Stimulation of endosomal tlr3 by poly (i: c) can induce mdcs to produce both il-12p70 and il-27; the former promotes th1 cells to produce ifn- which can inhibit th17 cells generation and the latter inhibits th17 cells differentiation in a stat1-dependent manner . Trif - dependent type i ifn production along with its downstream signaling pathway negatively regulates th17 development and constrains th17-mediated autoimmune inflammation in mice . It has also been reported that poly (i: c) can induce synthesis of both il-17 and il-21 and drive the differentiation of nave th cells into an il-21 but not into an il-17-producing phenotype without affecting the levels of transcription factors t - bet, gata-3, or retinoic acid receptor - related orphan receptor c . Thymic stromal lymphopoietin (tslp) is a hemopoietic cytokine capable of conditioning mdcs and orientating the differentiation of nave t - cells towards a th2 profile . Mdcs activated by a combination of tslp and poly (i: c) are capable of priming nave cd4 t - cells to differentiate into th17-cytokine - producing cells with a central memory t - cell phenotype without changing the th2 polarization property of tslp . Innate immunity shapes adaptive immunity . Activated immune cells present specific antigen epitope associated with mhc - i / ii molecules along with costimulatory and instructional signals to nave t - cells to stimulate activation, differentiation and proliferation of immunoreactive t - cells . As a potent activator of both innate and adaptive immunity, dsrna simultaneously administered with a foreign antigen can act as an immunoadjuvant to induce specific adaptive immunity against the foreign antigen [91, 130]. Upon dsrna stimulation, type i ifn production by dcs is critical for the adjuvant property of poly (i: c). Type i ifn is considered to be the major player linking innate to adaptive immunity . Besides activating dcs in an autocrine or paracrine manner, type i ifn is capable of inducing an antigen - specific cd8 t - cell response, a cd4 th1 cell response and enhances the primary antibody response . (2009) demonstrated that proliferation and ifn- production of antigen - specific cd8 t - cells in the mice immunized by antigen gp33 (an h-2d restricted peptide derived from lymphocytic choriomeningitis virus glycoprotein 3341) with poly (i: c) adjuvant is abrogated when this regimen is administered in tlr3 mice . The mrna of tlr3 is undetectable in either cd8 effector or cd8 effector memory t - cells . Cd8 t - cell proliferation and the ability of inf- production are not affected by direct stimulation with poly (i: c) and specific tcr . Therefore, it appears that the adjuvant effect of poly (i: c) may be tlr3-dependent without any direct effect on cd8 t - cells . However, ngoi et al . (2008) experimenting on (c57bl/6) mice that were tlr3 and trif - deficient, with the poly (i: c) (invivogen) but using a different antigen, staphylococcal enterotoxin a, showed that cd8 t - cells expansion was not impaired, that is, a type i ifn production in response to poly (i: c) occurred . Splenocytes from nave wild - type mice can produce il-10 in a dose - dependent manner upon stimulation with poly (i: c) in the absence of antigen while il-10 production was impaired in tlr3 mice . Although these il-10 producing cells may be innate immune cells, the il-10 produced acts as a suppressive signal for adaptive immunity . Thus, the presence of tlr3 may suppress the development of adaptive immunity . Indeed, the activation of nk cells, involved in innate immunity, is inducible by poly (i: c) via both mavs- and trif - dependent pathways . Reported that in mavs - deficient or trif - deficient mice immunized with ova, alum and poly (i: c), the antigen - specific cd8 t - cell expansion was reduced in either mavs - deficient or trif - deficient mice and was entirely abrogated in the doubly deficient mice . Hence, the adjuvant effects of poly (i: c) requires a cooperative activation of tlr and cytoplasmic rna helicase pathways . Contamination of proteins used as antigens in these studies with other tlr ligands or the contamination of cd8 t - cells with other immune cells like innate cells might be a possible explanation of the discrepancy . With respect to human cd8 t - cells, tlr3 mrna expression has been detected in human effector and effector memory cells but not in nave and central memory t - cells . The addition of poly (i: c) significantly increased the quantity of ifn- released by effector and/or effector memory cd8 t - cells in response to pha in a dose - dependent manner . However, poly (i: c) by itself did not detectably induce ifn- release by any of the purified cd8 t - cell subsets . Furthermore, the addition of poly (i: c) had no effect on the cytolytic activity of ctl . Therefore, it is likely that the adjuvant effects and the corresponding mechanism of poly (i: c) are different in human and mouse cells . (2009) reported that mice vaccinated with h5n1 influenza vaccine with pika (a stabilized dsrna) as adjuvant experienced a maximum three - fold increase in antibody titer comparable to that produced by mice immunized by vaccine with complete freund's adjuvant . Vaccination significantly reduced the virus titer in the lung of mice challenged after immunization with the h5 vaccine and pika adjuvant . Without a specific vaccine, sole pika administration was also capable of reducing pulmonary viral titer in mice . This immunoprotective property of dsrna against influenza virus was further demonstrated by other studies using another synthetic dsrna analogue poly iclc comprising of poly (i: c) stabilized with l - lysine and carboxymethylcellulose [136, 137]. Pika was also able to induce activation and proliferation of b cells and nk cells . When hbsag was coadministered, an increase in hbsag - specific igg production was noted . Nonetheless, most studies suggested that poly (i: c) based dsrna analogues displayed th1 adjuvant property capable of activating antigen specific cd4 and cd8 t - cells when administrated as vaccine adjuvant [92, 105, 131, 132, 139, 140]. Another dsrna analogue, poly (i: c12u) (ampligen), was effective in inducing mdcs maturation and promoted th1 cytokine il-12 production while significantly decreased suppressive cytokine il-10 production compared to that induced by poly (i: c) in healthy donors . Intranasal administration of an ampligen adjuvanted h5n1 vaccine resulted in the secretion of vaccine - specific iga and igg in nasal mucosa and serum respectively and protected mice against homologous and heterologous viral challenge . Immunization of mice by hepatitis c virus nonstructural protein 3 and poly (i: c) emulsified with montanide isa 720 have demonstrated that the protein - based vaccine adjuvant, poly (i: c) was capable of eliciting th1-biased adaptive immunity although the protein - based vaccine alone favors th2-polarization . Additionally, the adjuvant potency of poly (i: c) emulsified with montanide isa 720 was much stronger than that of dispersed delivered poly (i: c) which suggests that protection of poly (i: c) from rapid degradation by ribonucleases was crucial for the adjuvant property of poly (i: c). Other groups have also suggested an th1 adjuvant role of poly (i: c) [92, 139]. More importantly, induction of cd4 th cells by poly (i: c) is required for memory in cd8 t lymphocytes . Therefore, it seems that the adjuvant property of distinct dsrna molecules may be different as suggested by avril et al . . Several synthetic dsrna analogues are commercially available such as poly (i: c), poly (i: c12u), poly iclc, poly (a: u) and pika . Poly (i: c) is a mismatched dsrna with one strand being a polymer of inosinic acid, the other a polymer of cytidylic acid . It was discovered in 1967 by hilleman's group who also discovered ifn induction by dsrna before the discovery of its molecular receptors of tlr3 and mda-5 [56, 146]. However, toxicity concerns prevent the clinical utility of poly (i: c) [147149]. Thus, most studies using poly (i: c) as an immunoprotective or vaccine adjuvant have been undertaken in animals . Attempts to design dsrna analogues that can induce ifn with less toxicity have resulted in poly (i: c13u) being modified to poly (i: c12u). Poly (i: c12u) differs from poly (i: c) in that every 13th cytosine of the dsrna, cytosine (c) is replaced by uracil (u). Uracil is unable to bond hydrogen to the hypoxanthine of the partner poly (i) strand and therefore results in a mismatched base which would be more readily degraded than the parent molecule . This poly (i: c) analogue has been applied in clinical trials for chronic fatigue syndrome and aids . It was generally well - tolerated via intravenous administration with insomnia and dry skin the most commonly reported adverse events . Poly iclc was introduced by levy et al . In 1975 and comprised of poly (i: c) with poly - l - lysine and carboxymethylcellulose . This complex is 510 times as resistant to hydrolysis by primate serum as the parent poly (i: c) and has a thermal denaturation temperature about 40c higher than that of poly (i: c). It was able to induce significant levels of serum ifn in monkey and chimpanzee under conditions in which poly (i: c) itself induced no ifn . In an early clinical trial in patients with malignancy, toxic reactions composed of fever, nausea, hypotension, thrombocytopenia and leukopenia, erythema, polyarthralgia with myalgia . Clinical information regarding pika is limited and the available data are only from animals [135, 138, 155]. (2009) reported that poly (i: c) and its analogues poly iclc and poly (i: c12u) are effective adjuvants for the induction of protein - specific cellular immune responses . Among the three molecular analogues, poly iclc was the most potent adjuvant in monkeys . Another study using hiv gag as antigen showed that both poly (i: c) and poly iclc were able to induce antigen - specific cd4 t - cell response without il-4 and il-17 secretion, confirming th1-polarized adjuvanticity . Gowen et al . Revealed that poly (i: c) treatment significantly protected tlr3 mice from the lethal punta toro virus infection despite deficiencies in cytokine induction while poly (i: c12u) was unable to protect tlr3 mice from lethal challenge . However, in wild - type mice, poly (i: c12u) treatment was able to promote ifn-, ifn-, and il-6 production and conferred protection from punta toro infection . These results suggested that both tlr3 and mda-5 are required for poly (i: c) to elicit immune responses but poly (i: c12u) requires only tlr3 . (2008). Distinct forms of poly (i: c) with different molecular weights or poly (i: c12u) are not equivalent in their biological behavior . Dcs and macrophages are major sensor cells to invading pathogen and transformed cells via germ - line encoded prrs . Upon sensing pathogens or tumor cells, activation involves these cells becoming apcs triggering innate immunity and thereby shaping adaptive immunity through cross - priming to eliminate the invading microbes and tumor cells . Cancer cells are malignantly transformed cells of the host and are capable of expressing antigens that are not expressed or in trace amount in healthy host and are referred to as tumor associated antigens (taas). Adaptive immunity is the major mechanism to eliminate cancer cells in the late stage of host defense responses by the generation of tumor - specific immunity . Various reports have demonstrated that the recruitment of tumor infiltrating lymphocytes, especially cd8 t - cells, is closely related to prognosis of the patients [159161]. However, the anticancer immunity of the tumor - bearing host is usually weak or anergic due to either the weak antigenicity of taas or because of suppressive immunity in the host . Thus, enhancing the immune response, in particular taa - specific ctl response and overcoming the immune suppression is crucial for anticancer immunity . Indeed, provenge (also known as sipuleucel - t or apc8015) (dendreon, seattle, wa), a new cancer vaccine for advanced prostate cancer, was recently approved by fda at april 29, 2010 . Provenge works by ex vivo stimulation of isolated autogenous dcs of the patient with a fusion protein of full - length human prostatic acid phosphatase (pap) and granulocyte - macrophage colony stimulating factor . The pap activated apcs are suspended in lactated ringer's solution, after removing the excessive antigen, and then infused into the patient resulting in innate and adaptive immunity against cancer cells . Agonists of tlrs with the capacity of priming and shaping adaptive immunity have aroused significant interest in the development of cancer immunotherapy, in particular imiquimod, unmethylated cytosine preceding guanosine motif oligodeoxynucleotides (cpg odns), and dsrna which act as agonistically with tlr7, tlr9, and tlr3, respectively . Activation of tlr3 by dsrna was capable of inducing either anticancer immune response or cancer cells apoptosis via tlr3 receptor expressed on a variety of cancer cells [168173]. Apoptosis of cancer cells presents the immune system with a new repertoire of taas in a tlr3 activation context that is favorable to the development of long - term anticancer immune responses . Poly (i: c12u) is capable of inducing phenotypic and functional maturation of dcs generated from peripheral blood monocytes of advanced ovarian cancer patients with sustained bioactive il-12p70 production . Dcs primed with tumor lysate and matured with poly (i: c12u) are capable of generating th1-biased specific anticancer responses in peripheral blood t - cells derived from cancer patients in the presence of ascites medium containing immunosuppressive cytokines . Using ovarian cancer ascites as an in vitro model, cd8 t - cells derived from ascites fluid primed with tumor antigen loaded dcs matured with poly (i: c12u), exhibited cytotoxic activity with the capacity of lysis of autologous tumor cells [140, 174]. Another synthetic poly (i: c) derivative, poly iclc, more effective as an type i ifn inducer in humans but also associated with more clinical side - effects, has been involved in a variety of clinical trials of malignancy treatment in the last 30 years [176180]. When poly iclc was used either in monotherapy or in combination therapy, it exhibited immunomodulatory effects and enhancement of il-2-induced nk lytic activity in cancer patients . However, sole poly iclc administration did not improve the survival of cancer patients [177, 179, 180]. Despite the unfavorable results of poly iclc in tumor therapy, auspicious results were noted when used as a cancer vaccine adjuvant in mice . When poly iclc was administered with tumor antigen - derived peptide epitopes as a cancer vaccine adjuvant in a murine brain tumor model this facilitates the infiltration of antigen - specific t - cells into the tumor site, promotes tumor homing of antigen - specific t - cells and improves the survival of tumor - bearing mice by inducing long term antitumor protection . A phase i / ii clinical trial using type i polarizing dcs loaded with peptides in combination with poly iclc in patients with recurrent malignant glioma is currently being conducted . Polyadenylic polyuridylic acid [poly (a: u)] is another type of synthetic dsrna analogue that has been used in combination with chemotherapy for locally advanced gastric cancer after curative surgery patients compared with chemotherapy alone despite of its inefficiency as a single adjuvant . A prolonged overall and recurrence - free survival was noted . Poly (a: u) is capable of inducing th1 cell generation and antibody production in mice when coadministered with protein . In vivo targeted delivery of tumor associated epitope to apcs in conjunction with poly (a: u) resulted in correction of the ineffective response to idiotypic epitopes, control of tumor growth, establishment of immune memory and protection against tumors bearing antigenic variants . The immunoadjuvant effects of poly (a: u) is believed to signal tlr3 and tlr7 . Tlr3 expresses not only on immune cells sensing dsrna and triggering immune response but also on tumor cells exhibiting other functions . It is well known that viral infection is closely related with carcinogenesis and approximately 20% of all cancers are associated with infectious agents such as human papillomavirus and hepatitis viruses . Prevention of viral infection is able to significantly reduce the occurrence rate of cancer [193195]. Inhibition of virus replication reduced the development of cancer dramatically even in chronically viral infected patients [194, 196]. In this scenario, it is suspected that dsrna, as intermediate of viral replication, is involved in the carcinogenesis . Long before the discovery of tlr3, researchers have found that dsrna, such as poly (a: u) treatment is capable of enhancing carcinogenesis in animals [197, 198]. Studies have suspected that activation of tlrs in cancer cells could promote tumor progression and chemoresistance by activation of nf-b to induce upregulation of antiapoptotic proteins and to inhibit proapoptotic proteins . Consistently, several groups have reported that tlr agonists stimulate the proliferation and suppressor function of treg cells and so attenuate the antitumor effects [199, 200]. However, most studies were conducted by activation of the tlrs other than tlr3 [190, 201, 202]. Recent reports suggested that tlr3 expression is much higher in metastatic cancer cells in comparison with primary cancer cells . In human hepatocellular carcinoma cells, tlr3 can be expressed both on cell surface and in cytosol and only activation of the cytoplasmic tlr3 can induce cancer apoptosis accompanied by the down - regulation of antiapoptotic protein . In situ stimulation of tlr3 and synergistic molecule cd40 can transform ovarian cancer - infiltrating dcs from immunosuppressive to immunostimulatory cells thus exhibiting therapeutic potential of tlr3 activation . Activation of tlr3 in nasopharyngeal carcinoma cells can inhibit cell migration by downregulation of chemokine receptor cxcr4 suggesting antimetastasis activity of endogenous human tlr3 expression in cancer cells . Thus, it seems that activation of endogenous human tlr3 expressed by cancerous cells may induce direct pro - apoptotic activity of the tumor cells . Additionally, mrna escaping from damaged tissue or contained within endocytosed cells could serve as an endogenous ligand for tlr3 . Double - stranded rna and its synthetic analogues, such as poly (i: c) and poly (a: u) have long been known to be potent type i ifn inducers and immunomodulators . However, the fact tlr3 recognized dsrna and activates nf-b signal pathway was only discovered in 2001 . Subsequently, other dsrna receptors, rig - i / mda-5 and nlrp3 have been uncovered [7, 75, 206]. It is unknown if there are any endogenous ligands that share these receptors with exogenous dsrna . Additionally, dsrna receptors especially tlr3 are found expressed ubiquitously in the body . It is reasonable that not all types of cells are involved in sensing viral infection and eliciting immune response . Thus, the role of these receptors in other type of cells deserves further exploration . Dsrna is able to induce both innate and adaptive immunity to eliminate the invading virus . However, the virus may evolve protective mechanism that enables it to destroy the dsrna - induced signaling thereby protecting itself by evasion from the immune response of the host [207, 208]. Recent report suggested that poly (i: c) binds to endo / lysosomal mda-5 and activates apoptotic caspases in melanoma cells to induce their self degradation by autophagy and apoptosis . The possibility that other dsrna receptors may be present in tumor cells deserves further investigation . Having such knowledge would be very helpful for development of therapeutic tumor vaccine with dsrna analogue adjuvant . It appears that there needs to be a balancing act between the possible carcinogenesis and the immune stimulating property of dsrna when dsrna analogues are considered as immunoadjuvants in tumor immunotherapy . Although dsrna have displayed favorable immunostimulatory and protective properties, many questions remain to be answered . Further investigations to uncover its roles in viral infection, carcinogenesis or anticancer actions deserve consideration.
A 19-year - old, single, unemployed, caucasian female (skin type iii) presented with multiple facial lesions . She had been suffering from multiple pigmented annular papules and plaques on her face for 7 years . She had been a normal, healthy, full - term baby and had normal physical milestones of development as a child . She appeared to be immunocompetent with no history of recurrent infections or any other skin lesions . Her parents and siblings (3 brothers and 2 sisters) were all normal and healthy . Her medical history was unremarkable with no other obvious complaints, and she was not overexposed to sunlight as she spent most of her time indoors . Upon examination, the central part of the face, i.e. The malar area and nose including the ala nasi, showed scattered annular papules and plaques of different sizes ranging from 0.3 to 2 cm . The lesions were asymptomatic and symmetrically distributed on both sides of the face (figs . 1, 2). The diagnosis was confirmed as dsap, with a classic and very illustrative pathological picture (figs . All physical modalities were excluded to avoid the possibility of side effects like scarring and disfigurement, as the lesions were located in the central part of the face and involved the skin overlying the nasal cartilage . We first prescribed a topical retinoic acid 0.1% cream that has keratolytic and antineoplastic effects, and it was assumed that this might rectify the faulty clonal epidermopoiesis . Six months later, the patient presented again and the picture was almost unchanged except for a few small new lesions in the malar area and on the nose . We decided to give her imiquimod 5% cream to be used once a day (3 times per week) for 24 weeks . Side effects like erythema, crustations and pruritus were experienced and were controlled by topical emollient cream; we avoided corticosteroids and calcineurin inhibitors because they can counter the effects of imiquimod . On completion of the therapy, central scarring and the scars across the nose improved in their color, thickness and texture, constituting an added benefit of imiquimod in this indication . Porokeratosis is inherited as an autosomal dominant trait; however, sporadic cases are also known to occur . Chernosky and freeman first described dsap in 1967 in a texas population . Dsap is the most common of the clinical variants and may account for almost half of all cases in the usa, while in singapore it is second to the mibelli type in frequency (18 and 56%, respectively). The incidence in females is double that of males, unlike the classic mibelli type . Dsap is characterized by multiple lesions that are superficial, relatively smaller than the mibelli type, slightly pigmented, annular, keratotic and with a central atrophic area . It mainly affects areas exposed to sunlight; however, paradoxically, the limbs are more affected than the face . Other regions such as the extensor surfaces of the extremities constitute the majority of reported cases, with cases of lesions appearing exclusively on the face being probably less frequent ., dsap does not appear to have more risk of malignant change than other types . It can sometimes coexist with other forms of porokeratosis (mibelli type, linear porokeratosis, porokeratosis palmaris et plantaris disseminata and punctate porokeratosis). There is good evidence that ultraviolet light can precipitate the development of new lesions or exacerbate pre - existing lesions . Our patient was minimally exposed to the sun and she spent most of her time indoors . The exact pathogenesis of porokeratosis is not clear; however, it has been assumed that a focal clonal expansion of abnormal cells gives rise to the shape of the coronoid lamella . The coexistence of different variants in one patient or in several members of an affected family indicates different phenotypic expressions of a common genetic entity which could possibly be explained by a simultaneous expression of closely linked genes . Genetic studies have mapped the loci responsible for dsap to chromosomes 12q, 15q and 18q . Several mutations have been identified in the ssh1 gene on chromosome 12, which encodes a phosphatase that plays a pivotal role in actin dynamics [10, 11]. In a genome - wide scanning and linkage analysis performed on six generations of a chinese family with dsap, two missense mutations in ssh1 and arpc3 were found, which are involved in the actin cytoskeleton pathway and interact with adherent junctions in the epidermal cells . This finding suggested that cytoskeleton disorganization in epidermal cells was likely associated with the pathogenesis of dsap . In a recent study on four chinese families, in 33% of the patients, three mutations were found in the mevalonate kinase (mvk) gene which plays a role in lipid metabolism . Psoriasis and phototherapy (uva, bb - uvb and nb - uvb) have been associated with porokeratosis . Dsap has also been associated with immune suppression, hiv infection, diabetes mellitus, liver cirrhosis, acute pancreatitis, crohn's disease, solid malignancy, the administration of immunomodulating drugs used to treat autoimmune diseases and following the transplantation of organs (particularly in kidney transplant patients) [14, 15]. Therapies such as cryotherapy, photodynamic therapy, erbium yag and co2 lasers or the application of topical 3% diclofenac gel or 5-fluorouracil cream are usually partially successful, but with inconsistent results . This therapy treated the plaques effectively, there were no more keratotic elevations or furrows, and even the central scars showed an improvement in color and texture . Biologically, imiquimod is also antineoplastic and is used to treat nonmelanoma skin cancers; this is a major added advantage because dsap may, in rare instances, be complicated by squamous cell carcinoma . Further studies are required to confirm whether imiquimod should have a place in the management of dsap . The mechanism of action of imiquimod in the treatment of dsap is not yet clear: it may suppress or switch off the abnormal mutant genes through its immunological effects on both adaptive and innate immunity . In conclusion, we presented a case of facial sporadic dsap, which was treated by application of imiquimod 5% cream in conjunction with regular sunscreens . Follow - up of this case is important to rule out the possibility of malignant transformation.
Phytoremediation technology using floating macrophytes (eichhornia crassipes) performed very well in remediation eutrophic water body since e. crassipes is capable of assimilating large amount of nutrients efficiently [13]. During 20102012, large - scale confined growth of e. crassipes was used to remove pollutants (mainly n and p) from dianchi lake as well as the rivers connecting to the lake . There are more than 31 rivers, which carried wastewater discharged from different types of sewage treatment plants (stps), agriculture, and domestic source, flowing into the lake . The macrophytes significantly improved water quality in both inflow rivers and dianchi lake . To evaluate the contributions of water hyacinth to the removal of nitrogen from the lake, both assimilation and stimulated denitrification by the macrophyte are important since n-15 tracing experiment in labs indicated that the values of n-15 at.% excess of n2-n production were significantly (p <0.05) higher with the growth of e. crassipes than that without [5, 6]. The presence of e. crassipes roots has positive effect on stimulating the activity, abundance, and diversity of denitrifiers . Previous studies also suggested that the root system of floating macrophyte could support the attachment of microorganism and enhance the growth and activity of bacteria for removing organic matter and nutrients . Environmental conditions are also critically important in mediating the activity, abundance, and diversity of bacteria [9, 10]. The abundance and diversity of denitrifiers on e. crassipes roots grown in the rivers receiving wastewater with different water properties may vary with the variation of environmental factors . The abundance of the functional genes and community compositions of denitrifiers can be affected by many factors, such as water temperature, ph, do, and nutrient concentrations . In the rivers with different sources of condensed pollutants and diverse physiochemical properties, the abundance and diversity of denitrifiers on the e. crassipes roots may be modified in various patterns . Hence, in the present study, we investigated the abundance and diversity of denitrifying bacteria on e. crassipes roots in 11 rivers with different pollution sources in the north side of dianchi lake . It put an emphasis on understanding the interactions between the changes of environmental factors and the abundance and diversity of denitrifying bacteria attached to e. crassipes roots . It was expected that the results would shed some insight on how environmental factors and cultivation of e. crassipes mediate denitrification process in different eutrophic rivers flowing into the dianchi lake . A total of 11 rivers around dianchi lake located from 249 to 250 latitude and 1026 to 1027 longitude were investigated (figure 1). As shown in figure 1, xinbaoxiang (xbx), daguan (dg), chuanfang (cf), and panlongjiang (plj) rivers receive effluents from sewage treatment plants (stps). Haihe (h), guangpugou (gpg), jinjia (jj), xibahe (xbh), and xinyunliang (xyl) rivers receive raw sewage from industrial, domestic, and agricultural sources . Xiaba (xb) and yaoan (ya) rivers represent the same sewage origin from the same upstream (not sampled due to water hyacinth not being grown) but different tributaries separated at water treatment wetland named wujia (not sampled due to water hyacinth not grown). Water temperature, ph, and dissolved oxygen (do) were measured in situ using portable meter (ysi proplus, usa). One - liter water samples were collected from each site with three replicates at 00.5 m of the water column of the eleven rivers using cylinder sampler in september 25, 2012 . Total nitrogen (tn), ammonium (nh4), nitrate (no3), nitrite (no2), and total soluble nitrogen (tsn) were analyzed using a seal autoanalyzer 3 (seal analytical co., hampshire, uk). Mixed root samples were collected randomly with three replicates at each sampling site using sterile scissors and forceps and then stored in an ice box and taken back to the laboratory . Fresh roots (2 g) of e. crassipes were transferred into 200 ml sterile water . Bacteria attached to e. crassipes roots were detached by vigorous shaking for 30 min (18.3 hz, thermomixer eppendorf) and filtered through a 0.45 m sterile filter . The resultant filtrates were filtered through 0.22 m millipore membrane filters using a vacuum air pump and the membranes stored at 80c for dna extraction . All the abovementioned membranes were cut into pieces with sterile scissors and used immediately for dna extraction, which was performed using an e.z.n.a . Water dna kit (omega bio - tek inc ., real - time quantitative pcr was performed to estimate the denitrifying bacteria abundance using the primers listed in table 1 . Real - time polymerase chain reaction (qpcr) was performed on abi 7500 real - time system (life technologies, usa). Amplification was performed in triplicate in a total volume of 20 l reaction mixtures by using sybr premix ex taqtm (tiirnaseh plus) qpcr kit as described by the suppliers (takara bio, dalian, china). For each assay, three different pcr conditions were performed separately for the same sample by varying annealing temperature at either 54c (nirs- cd3af / nirs - r3cd and nosz - f / nosz-1622r) or 58c (nirk - f1acu / nirk - r3cu). The qpcr amplification was performed as follows: initial denaturation at 95c for 2 min, followed by 35 cycles consisting of denaturation step at 95c for 5 s, varying annealing temperature for 30 s, and elongation at 72c for 30 s. the data were collected during the 72c for 30 s step . Data was analyzed using the abi 7500 software (version 2.0.6, life technologies, usa). The parameter ct (threshold cycle) was determined as the cycle number at which a statistically significant increase in the reporter fluorescence was detected . The standard curves for real - time pcr assays were developed as previously described . For denaturing gradient gel electrophoresis (dgge) analysis, the pcr was performed in reaction mixtures including 1 l of template dna, 5 l of 10 pcr buffer, 1 l of dntps (10 mm each), 1 l of each primer (20 m) (table 1), and 2 u of taq polymerase (takara bio, dalian, china) and adjusted to a final volume of 50 l with sterile deionized water . The reaction was performed in a bio - rad c1000 thermal cycler (bio - rad, usa) using different cycling conditions . The nirk gene (f1acu / r3cu - gc) pcr program was carried out with an initial denaturation at 94c for 3 min, followed by 32 cycles of 94c for 30 s, 58c for 30 s, and 72c for 45 s, followed by 72c for 10 min, and ended at 10c . The touchdown pcr amplification of nirs (cd3af / r3cd - gc) and nosz (nosz - f / nosz1622r - gc) was performed as follows: 94c for 2 min, followed by 10 cycles, 94c for 30 s, and 57c for 30 s in the initial cycle and at decreasing temperatures by 0.5c / cycle until a temperature of 52c was reached in the subsequent cycles . After the touchdown program, 30 cycles at 94c for 30 s, 53c for 30 s, and 72c for 1 min, followed by 72c for 10 min, and ended at 10c . The amplified products were pooled and resolved on dgge gels using a dcode system (bio - rad laboratories, hercules, usa). The purified pcr products (30 l) of nirs, nirk, and nosz containing approximately equal amounts of pcr amplicons were loaded onto the 1 mm - thich 6% (w / v) polyacrylamide (37.5: 1, acrylamide: bisacrylamide) gels with denaturing gradients of 5075% for 15 h (nirs), 5070% for 12 h (nirk), and 5070% for 15 h (nosz) (100% denaturant contains 7 mol / l urea and 40% (v / v) formamide). The gels were run in 1 tae (40 mm tris - acetate and 1 mm edta) at 100 v and 60c . Polaroid pictures of the dgge gels were scanned using an epson perfection v700 photo scanner (seiko epson corporation, nagano, japan). Dgge profiles were digitized after average background subtraction for the entire gel using quantity one software (version 4.5, bio - rad, usa) as previously described . Digitized information from the dgge banding profiles was used to calculate the diversity indices such as richness (s), which was determined from the number of bands in each lane, and shannon - wiener index (h), which was calculated from h = pi lnpi, where pi is the importance probability of the bands in a gel lane, calculated as pi = ni / n, where ni is the intensity of a band and data presented as mean values sd . One way analysis of variance (anova) followed by s - n - k - test was performed to check for quantitative differences between samples; p <0.005 was considered to be statistically significant . The relative intensity of a specific band was transformed according to the sum of intensities of all bands in a pattern . Redundancy analysis (rda) for community ordination was conducted using canoco (version 4.5, centre for biometry, wageningen, netherlands) for windows using relative band intensity data obtained from the quantity one analysis . Eight environmental parameters, including water temperature, ph, do, ammonia, nitrate, nitrite, total nitrogen, and total soluble nitrogen, were selected to perform rda - based variance inflation factor (vif) analysis with 499 unrestricted permutations to statistically evaluate the significance of the first canonical axis and of all canonical axes together . The corresponding environmental parameters (table 2) of the eleven rivers represented their own properties of different pollution sources . The water from stp sites was characterized by relatively high concentrations of nitrate (4.7912 mg l) and organic matter, which had contrary properties comparing to those rivers receiving raw sewage from industrial, domestic, and agricultural sources . The xb and ya rivers had similar characteristics to those rivers receiving water from stp but lower dissolved oxygen and higher ammonia nitrogen . The results showed that the abundance of nirk, nirs, and nosz gene copies per gram fresh root ranged from 4.13 10 to 6.11 10, 1.45 10 to 1.99 10, and 2.20 10 to 2.20 10, respectively (figure 2). The nirk and nirs abundance on the roots of e. crassipes in ya river and xb river were significantly higher than those in other rivers (p <0.05). The lowest abundance of nirk and nosz type denitrifiers were determined on the root sample from dg river . The nirk, nirs, and nosz copy abundance varied between sites indicated that different pollution source would influence the abundance of denitrifiers in rivers . The highest abundance ratio (125.34) of nosz/(nirk + nirs) occurred in jj river, followed by gpg (39.75), while the lowest ratio was in xyl river (1.43), and the ratios in other rivers were similar, ranging from 3.26 to 8.38 . However, the nirk / nirs ratio in all samples ranged from 1.70 to 6.60 . To explain the relationship between environmental factors and the abundance of nirk, nirs, and nosz, the gene copy numbers of three denitrifiers and eight parameters were explored by redundancy analysis (figure 3). The gray circle area implies a positive correlation and the white circle area implies a negative correlation . The larger the circle area, the greater the impact corresponding to the changes in environmental factors that would have influenced the denitrifiers . Denitrifier lines at the end in the gray circle had positive regression coefficients for that environmental variable with the corresponding t - value larger than 2.0 . The results showed that the temperature, ph, and nitrate circle areas were larger than other environmental factors, which indicated that temperature, ph, and nitrate circle greatly affected the nirs, nirk, and nosz abundance than other factors . The abundance of nirk and nirs was positively correlated with water temperature, nitrate, and nitrite concentrations and was negatively correlated with the other factors (ph, do, dtn, tn, and ammonium). The abundance of nosz was negatively correlated with water temperature and was positively correlated with the ph and do, while there were no significant correlations with other factors . Only one of the three replicates of dgge profiles was listed for each gene type to illustrate resolution . However, all the three replicates of the profiles were digitized and were used in statistics analysis . The shannon indices (h) calculated from dgge gels ranged from 2.23 to 2.90 for nirk, 2.08 to 2.69 for nirs, and 2.11 to 2.73 for nosz, which showed that high diversity of denitrifier (nirk, nirs, and nosz) genes on the root of e. crassipes (table 3). The significant differences among them were observed statistically (p <0.05). With respect to the richness and diversity of denitrifier communities in all sites, similar trends emerged with low richness and diversity of nirk and nirs genes in xbx and dg rivers, which mainly received effluent from stps . Next trends were in the h, jj, and xbh rivers with relatively higher richness and diversity of nirk and nirs genes, which were less impacted by the effluent from stps . The highest richness and diversity of nirk showed in the xb and ya rivers, which received wastewater after flowing through a wetland incubation on the water way . The richness and diversity of nosz, which was mainly impacted by temperature, gave a similar trend for all rivers due to the fact that temperature did not vary too much in all sites . To determine to what extent the eight environmental properties affected the three types of denitrifier community compositions, nirk, nirs, and nosz dgge fingerprints were evaluated by redundancy analysis (table 4). The first axis explained 26.9% of the nirk - type denitrifier diversity, and the second axis explained 21.8% of the diversity . For nirs - type denitrifier, the first two canonical axes explained 29.5% and 11.5% of the variation, respectively . For nosz - type denitrifier, 37.8% and 13.7% of the variation were explained by the first two canonical axes (table 4). Of the parameters, total n, do, ph, and water temperature appeared to be the relatively important environmental factors for denitrifiers (table 5). For nirk - type denitrifier, water temperature, do, and total n explained 46% variations of microbial communities, leaving 54% of the variation unexplained . Variation partitioning analysis showed that water temperature, do, and total n separately explained 19% (p = 0.020), 13% (p = 0.054), and 14% (p = 0.240) of the variation, respectively . For nirs - type denitrifier, water temperature (18%, p = 0.066), ph (10%, p = 0.304), and do (8%, p = 0.038) explained 36% variations of microbial communities, leaving 64% of the variation unexplained . Compared to nirs, the total n rather than do was relatively important for nosz - type denitrifier (table 5). The relationships of microbial patterns to environmental variables were summarized in rda ordination plots (figures 4(b), 5(b), and 6(b)). The rda charts (figure 4(b)) of nirk gene showed four rivers (plj, xyl, dg, and cf) grouped into one type, while other four rivers (xbh, xbx, h, and ya) clustered together . For nirs gene, plj, jj, and cf rivers were similar and grouped into one type, while other three rivers (xbh, xyl, and xbx) clustered together . Other rivers were not similar and did not belong to either group (figure 5(b)). According to the rda chart (figure 6(b)) of nosz gene, dg, h, gpg, and xbh rivers were located independently and did not cluster with any group . However, plj, xyl, jj, and cf rivers clustered into one group, while other three rivers (xb, xbx, and ya) clustered together . The activity of denitrifying microorganisms leads to significant net removal of dissolved nitrogen from the water, resulting in considerable improvement of water quality in aquatic ecosystem . Denitrifiers play an important role in buffering of the excessive load of nitrogen from upstream to downstream . In aquatic ecosystems, mats of macrophytes are important sites for microbial mediated biogeochemical processes, as accrual of biomass and increases in mat density reduce the degree of external factors to influence internal processes . The suspended root system of e. crassipes could provide a large surface area, approximately 2.5 to 8.0 mkg on a dry weight basis, for microbial attachment [5, 18]. Releasing of oxygen and dissolved organic carbon from roots of e. crassipes would support an appropriate microenvironment for nitrification and/or denitrification [19, 20]. Process of denitrification is driven by the denitrifying microorganisms under the influence of environmental conditions . Water properties in different rivers in the present study were shown altering the abundance and diversity of denitrifiers on e. crassipes roots . The abundance of nirk, nirs, and nosz denitrifiers on the root of macrophytes varied with the variation of environmental parameters in different rivers, which seemed depending on the nitrogen concentrations, water temperature, water turbulence, and pretreatment of wastewater using wetland . The abundance of nirk, nirs, and nosz denitrifiers on root samples from xbx, dg, cf, and plj rivers was relatively stable and low . These rivers were larger than other rivers around dianchi lake, which were important sites receiving effluent from the stps . The fast - flowing water and irregular discharge of effluent of these rivers may prevent development of the stable environment properties from microbial attachment and propagate . Contrarily, the abundance of denitrifiers genes on roots samples in xb and ya rivers (xiaba and yaoan rivers) was higher than that in other rivers . The xb river received both the wastewater from industrial and residential areas and the tidal water from dianchi lake, when water level increased in rainy seasons (may to october). The water merged at wujia wetland, and then part of it was pumped into ya river after 45 days of retention in wujia wetland . This implies that a combination of wetland and growth of water hyacinth may further promote denitrification processes in eutrophic water . The abundance of nirk gene was always greater than that of nirs gene on the roots of e. crassipes, suggesting that the fresh water of dianchi lake was more suitable for the growth of nirk - type denitrifying bacteria . The nirs gene of cytochrome cd1 type has also been found more often in anoxic locations, where do levels were consistently low . In contrast, nirk genes of copper containing type have been found where diurnal do swings are greater [24, 25]. This finding was of coincidence with that e. crassipes releases oxygen from roots, which facilitates the creation of aerobic microsites on the roots . Even though the nirk and nirs are functionally equivalent, denitrifying bacteria harboring either nitrite reductase seems to be likely not under the same community assembly rules . Philippot et al . Suggested that the existence of the two types of nitrite reductase (nir - gene) was due to differential niche preferences . This speculation was consistent with previously identified habitat preferences of nirs - gene and nirk - gene bearing organisms . Jones and hallin found that most nirk sequences were derived from soil but that most nirs sequences were prominently derived from marine and estuarine environment . Bacteria suspended in water and attached to the root of e. crassipes may originate from many different sources . Autochthonous bacterioplankton populations that developed in the water column were likely to be mixed with allochthonous populations from forest soils, urbanized land, farm fields, and wetlands as well as hyporheic sediments in the rivers . This mixed origination, impacted by varied environmental parameters, seemed to be the main cause of the discrepancy of denitrifiers found in the eleven rivers . This, however, did not necessarily indicate that nirk - type denitrifiers contributed more or less in denitrification than nirs - type ones; rather it may only imply that the root of e. crassipes could provide a broad support for different kinds of microorganisms . Dianchi lake together with surrounding rivers comprised a plateau water catchment to provide ecological services and fresh water supply for more than seven million people in the area . Its geochemical characteristics have made the water ph relatively high (7.568.03) and its geophysical characteristics have made the water temperature moderate with winter months (december to march next year) around 12c . Its heavy load of organic matters have made the do level relatively low (0.203.80 mg these environmental properties dominated the community assembly processes of the genetic makeup of the denitrifiers in the rivers . Nevertheless, specific environmental conditions in different rivers favored the variation in richness and diversity of different denitrifying genes . The dgge profiles for denitrification genes encoding nitrite and nitrous oxide reductase (nirk, nirs, and nosz) on the root of e. crassipes growing in 11 rivers around dianchi lake supported our hypothesis of profound differences in community composition, although a complex picture of denitrifier community similarity emerged depending on which functional denitrification gene was evaluated . The correlations of denitrifying microbial community compositions with abiotic environmental factors, using redundancy analysis (rda), confirmed that water temperature (temp), dissolved oxygen (do), and ph appeared to be the most important factors to alter the denitrifier community structures significantly by serving as essential conditions for the growth of microorganisms on the roots of e. crassipes (table 5). The results of this study indicated that the development of denitrifier communities on roots corresponded to different origins of rivers . The physiochemical characteristics of water from the river inlet varied with water origin and pollution sources [22, 23, 30], resulting in the variation in do, ph, pollutant species and concentrations, and organic carbons in rivers . These environmental factors, including do, carbon content, water temperature, and ph, influenced denitrification rates in rivers and as a consequence they might also affect the denitrifier community composition [32, 33]. . Found that the change of temperature resulted in gradually changed denitrification activity but also in abundance mutative of nitrate reducers and in different denitrifier community compositions . There are some indications that temperature and ph may directly or indirectly influence the abundance and communities composition of denitrifiers [35, 36]. The excess o2 resulted in reduced denitrifying bacterial growth and a smaller bacterial density versus nitrate reducing bacteria ration, which indicated that the development of the denitrifying bacteria was influenced by the do concentration . Many investigators had found that the ph, temperature, and do generally affect diversity and richness of denitrifier community [32, 38], and microbial community assembly was more dependent on local - scale environmental factors . On the other hand, different microorganisms may have their physiological constraints for growth and reproduction within narrow ph ranges, specific do, and nutrient availability, which affect the community structures directly [40, 41]. Activities of microorganisms could change the environmental properties that differed in the concentrations of enzymes and nutrients or do, the form and amount of dissolved carbon present, and ph hence to affect denitrifier community structure . Previous studies have found that growth of e. crassipes could regulate water at neutralize ph significantly, as a result of increase in the rate of denitrification in aquatic ecosystems . The variation in abundance of denitrifier communities on e. crassipes roots, grown in rivers flowing into dianchi lake, corresponded to different water properties of rivers . The ratio of nirk / nirs gene copies abundance was always greater than 1, indicating that the surface of e. crassipes roots was more suitable for the growth of nirk - type denitrifying bacteria . The temperature of water, nitrate concentration, and ph greatly affected the nirs, nirk, and nosz abundance than other factors . Meanwhile, the temperature of water, do, and ph appeared to be the most important factors to alter the community structures of denitrifiers on the roots of e. crassipes . As process of denitrification is driven by denitrifies under the influence of environmental conditions, a variation of denitrification capability in different rivers would be expected.
The heat shock protein 70 (hsp70) is a molecular chaperone which plays an important function in protein homeostasis as well as in cell signaling and survival . Some of its functions include folding newly synthesized peptides, refolding misfolded proteins, assembling multiprotein complexes, and transporting proteins across cellular membranes . In addition to these housekeeping functions, hsp70 is an important regulator of malignant transformation, both through its role as a powerful antiapoptotic protein and as a cochaperone of heat shock protein 90 (hsp90). As a cochaperone of hsp90, hsp70 is thought to load client proteins onto the hsp90 machinery through the action of another cochaperone, heat shock organizing protein (hop). The hsp90 machinery is an important mechanism by which cancer cells regulate the function of several cancer - driving proteins, such as those involved in altered signaling, the cell cycle, and transcriptional regulation . Indeed, it is primarily for this reason that hsp90 has been actively pursued as an anticancer target . As an antiapoptotic molecule, hsp70 acts at multiple points in the apoptotic pathway to prevent cell death . Due to these functions, it is not surprising that hsp70 is frequently overexpressed in cancer, where the elevated expression is furthermore believed to be a cause of or to lead to resistance to chemotherapy and other treatments . These dual roles of hsp70 in cancer, i.e., cochaperone of hsp90 and antiapoptotic molecule, suggest that inhibition of hsp70 may offer a valuable anticancer strategy, as supported by hsp70 knockdown studies . Indeed, hsp70 is an important and highly sought after cancer target, and as such it is of no surprise that the discovery and development of hsp70 inhibitors is currently a hot topic . To identify druglike hsp70 inhibitors, we took a structure - based approach . In the first preceding paper in this issue, we described the development of inhibitors that target an allosteric pocket of hsp70 located in the n - terminal domain of the protein . This pocket, not evident in the available crystal structures of hsp70, has been recently identified by us through computational analyses . Thus, in the absence of an appropriate x - ray structure of human hsp70, we used this homology model to design ligands that could bind to the hsp70 allosteric pocket . Because the pocket also harbors a potentially reactive cysteine residue, the initially designed inhibitors, all built around the 2,5-thiodipyrimidine and 5-(phenylthio)pyrimidine scaffolds, also incorporated an acrylamide moiety suitably positioned to interact with this amino acid upon insertion into the binding site (figure 1). This body of work led to the identification of low micromolar inhibitors of hsp70 with a good cell permeability profile and potent and selective biological activity in several cancer cells through an hsp70-mediated mechanism of action . Our data indicated a good fit for these molecules inside the hsp70 pocket, suggesting that enthalpy played an important role in their interaction with the protein . Chemical structure of acrylamide - containing 2,5-thiodipyrimidine and 5-(phenylthio)pyrimidine scaffold hsp70 inhibitors that were designed to insert into the hsp70 allosteric pocket and form a covalent bond with cys267 upon binding . The yellow surface shows the geometry of the allosteric pocket as determined by sitemap (schrodinger llc, new york). In addition to being good leads, these compounds were also useful in demonstrating the therapeutic relevance of inhibiting the novel allosteric hsp70 pocket as a potential anticancer approach . Specifically, by inserting into the allosteric pocket, these inhibitors alter the oncogenic hsp70hsp90client complexes, resulting in degradation of hsp90hsp70onco - client proteins and inhibition of cell growth and induction of apoptosis . They do so without activating a feedback heat shock response, a mechanism believed to be responsible for limiting the anticancer activity of hsp90 inhibitors . The hsp90hsp70 machinery is also a known repressor of heat shock factor 1 (hsf-1). Inhibition of hsp90, but not depletion of the hsp90 cochaperones hsp70, hop, hip, p23, and cyp40, led to hsf-1 activation, possibly because while these cochaperones participate with hsp90 in the regulation of hsf-1, only hsp90 plays a nonredundant role in repressing its heat shock activation ability . Activation of hsf-1 has a protective effect on the cancer cell as it leads to the upregulation of antiapoptotic molecules . Thus, hsp70 allosteric inhibitors by differentiating between the regulatory activity of the hsp90hsp70 machinery on onco - clients and on hsf-1 may result in more robust apoptosis in cancer cells when compared to hsp90 inhibitors . Here we focus on the identification of inhibitors that act on hsp70 through reversible binding into the allosteric pocket . Although covalent inhibition may offer certain advantages (i.e., maintaining activity against mutations and the ability to inhibit the target in the presence of millimolar concentrations of atp within the cell) and can be desirable in some instances, it may come with some drawbacks . Because of the presence of a reactive moiety, covalent inhibitors have a greater potential for off - target effects, such as inherent reactivity toward nonspecific thiols such as glutathione . Therefore, we desired molecules that could also act in this pocket in a reversible manner . At this early point in hsp70 drug discovery, it is not clear which mode is best; therefore, we thought it wise to pursue both, and in this paper we show our initial efforts in the elaboration of a covalent inhibitor targeting the allosteric site into a reversible noncompetitive inhibitor of low micromolar potency . The design of reversible ligands for the allosteric hsp70 pocket took advantage of our knowledge on the geometry of the allosteric pocket and the structure activity relationship (sar) we have learned from previous studies in the irreversible ligand series (figure 2). Our tactic was to first take a localized approach in an attempt to phase out the covalent binding potential and to maximize noncovalent binding in this immediate region (modification on x4). Then we took a global molecular perspective to probe and to enhance interaction in other parts of the molecule (modification on x3, rings a and b, x5, and x6). Specifically, our modifications focused on replacing the acrylamide (x4) with a favorable noncovalent modifying functionality and on altering the nature of rings a and b (figure 2a, highlighted in blue). They then aimed to gain additional favorable enthalpy by filling out a hydrophobic pocket now only occupied by small x5,6 groups such as methoxy (figure 2a, highlighted in blue, and figure 2b, red circle). Favorable modifications, such as methylpiperazine at position x7, were left mostly unchanged (figure 2a). Design of the reversible hsp70 inhibitors and their proposed mode of interaction with the hsp70 pocket . (a) general strategy that indicates modifications that are explored here in the design of reversible inhibitors (highlighted in blue). (b) step - by - step process that highlights key modifications that led to 27c, a reversible hsp70 binder of activity rivaling that of the most potent irreversible inhibitor 1e . Thus, our overall design strategy entailed (1) determination of the extent of dependence of covalent modification for activity by replacing the acrylamide with groups that could provide favorable but noncovalent interaction with cysteine, (2) exploration of the sar to maximize noncovalent interactions within the pocket occupied by acrylamide, and (3) exploration of the sar in other parts of the molecule to maximize binding affinity . Modifying the acrylamide was based on several observations . As mentioned above, our modeling studies indicated that the region of hsp70 occupied by x4 also contained leu237, val238, arg264, asp234, and lys271 in addition to the reactive cys267 (figure 2a). While the ability to form a covalent bond with the cysteine added significantly to the potency of the irreversible inhibitors, modeling studies indicated that the alkene moiety of the acrylamide group was positioned to also form hydrophobic interactions with adjacent protein residues, including leu237 and val238, while its carbonyl was poised to form electrostatic interactions with arg264 (figure 2a). Therefore, we reasoned that suitable groups substituted at x4 would be capable of interacting with these residues in a wholly noncovalent manner . In our initial design of reversible ligands, we kept the amide functionality of x4 but modified the alkene with a variety of groups (r, figure 2a) incapable of interacting with cysteine covalently . These included alkyl groups of various sizes as well as aryl groups (r = methyl, ethyl, cyclopropyl, cyclobutyl, cyclohexyl, n - heptyl, allyl, phenyl, and furanyl) to probe the extent of modifications allowed by the pocket at this position . We also replaced the acrylamide with substituents that could potentially establish an ionic pair interaction with the s of cys267 (i.e., ionizable amines such as in 7f (r = aminomethyl) and 9 (r = 2-(dimethylamino)ethyl)) (tables 1 and 2). Inhibition of growth measured in kasumi-1 acute myeloid leukemia cells . Ring b is predicted to occupy the lower part of the binding site that also contains arg264 . Thus, the ligand s interaction with the pocket could potentially be stabilized by cation interactions between the aromatic ring of ring b and the guanidine group of arginine (figure 2a). Cation interactions play an important role in protein structure and molecular recognition and can contribute significantly to the binding energy of a ligand . Such interactions are more likely to occur between an electron - rich system (i.e., phenyl, ethylene, acetylene) and a neighboring cation and furthermore are generally favored with heterocycles that incorporate lone pair electrons into the aromatic system (i.e., indole, pyrrole) and become deactivated when the lone pair does not contribute to aromaticity (i.e., pyridine, pyrimidine). In the irreversible series, pyrimidine was favored for ring b; the two nitrogen atoms of the pyrimidine ring rendered the ring more electron deficient, thus activating the acrylamide s michael acceptor capability . In the reversible series, on the other hand, electron - rich b rings should be favored over electron - deficient ones because of their higher propensity toward cation interactions with arg264 (figure 2a). To test the hypothesis, we made compounds in which ring b was either phenyl (i.e., activating) or pyrimidine (i.e., deactivating) (tables 1 and 2). Ring a and its substituents x5 and x6 are placed midpocket . Our initial investigations have mainly explored small substituents at this position such as methoxy, ethoxy, and methyl . It is lined by amino acids that could provide hydrophobic (val59, tyr41, phe68, trp90) and electrostatic (arg261) interactions with the ligand (figure 2a). Therefore, we explored here the effects of larger substituents on ring a, especially those poised for interactions within the lipophilic pocket formed by tyr41, phe68, and trp90, such as derivatives in which x5 contains an aryl (red circle in figure 2b and table 3). We also disrupted the symmetry of these molecules around ring a by probing monosubstitution of the ring (x5 x6 = h, figure 2b). Ring b orients its x3 substituent toward several important pocket residues such as asp234 and glu268 (x3 is nh2 in 1a, figure 2a). Nh2 at this position is poised to form hydrogen bonds with their carboxylate groups, and we retained this functionality from the irreversible series in the design of new derivatives . The introduction of an nh2 at this position was synthetically challenging when ring b was phenyl, and for these, hydrogen was introduced at x3 . Thus, all compounds of this series contain either an nh2 or a h at position x3 . Our previous sar also showed that n - methylpiperazine was a preferred substituent on ring a at position x7, presumably because of a proper fit in the minor groove located at the exit of the binding site and because it could form a hydrogen bond interaction with the backbone carbonyl of his89 (figure 2a for 1a). As a result, the synthesis of all designed compounds evaluated in this study is shown in schemes 13 . Target compounds 3a d and 4a e were prepared by reaction of 2a d with the appropriate acid chloride (scheme 1). Similarly, target compounds 7a h were prepared by reaction of 6a, b with the appropriate acid chloride (scheme 1). Thioethers 6a and 6b were prepared by cui / neocuproine - catalyzed coupling of iodo derivative 5a or 5b, respectively, with 3-aminothiophenol (scheme 1). 9 was prepared by michael addition of dimethylamine to 8 with dbu (scheme 1). Bromopyridine 10 was reacted with n - methylpiperazine at 130 c for 16 h to give 11 in 88% yield . 12 was obtained in 95% yield following reaction of 11 with nis at rt . 12 was coupled to 4-amino-2-mercaptopyrimidine with cui / neocuproine to give thioether 13 in 60% yield . Acylation of 13 with propionyl chloride or cyclopropanecarbonyl chloride resulted in 14a or 14b, respectively . Coupling of 12 with 3-aminothiophenol resulted in 15, which was acylated with various acid chlorides to give target compounds 16a d . 17 was obtained from demethylation of 11 by refluxing in 48% hbr(aq) along with a catalytic amount of tetrabutylammonium bromide . Following pmb protection and reaction with nis, iodo derivative 19 was obtained, which was coupled with 3-aminothiophenol to give thioether 20 . Reaction of 20 with boc - glycine and subsequent deprotection with tfa resulted in 21 . First, 2,4-dichloropyrimidine (22) was reacted with benzyl alcohol under ptc conditions to result in a regioisomeric mixture of the desired 4-(benzyloxy)-2-chloropyrimidine (23a) along with 2-(benzyloxy)-4-chloropyrimidine in a ratio of 75:25, respectively . This mixture was used directly in the next step and reacted with n - methylpiperazine to give 24a, which was obtained pure following chromatography . After iodination with nis to yield 25a and further coupling with 3-aminobenzenethiol, 26a was obtained . 27a f was then obtained by reaction of the appropriate acid chloride with 26a . Phenyl - substituted analogue 27 g was obtained by a similar route used for compounds 27a f; however, the first step in the synthesis utilized a suzuki coupling to install a phenyl group selectively onto the 4-position of 22 to yield 23b (scheme 3). Our target - derived biological investigation was based on a specific battery of assays that we designed to probe hsp70-derived mechanisms in a cancer cell . These include biochemical and phenotypic assays that probe biological effects that stem from alteration of the hsp70hop these biological tests were paralleled by computational studies, and each derivative was docked into the allosteric pocket of hsp70 to understand the contribution of each chemical modification to the observed biological activity . Our first step toward the potential realization of reversible inhibitors involved removing the reactive acrylamide moiety . Rewardingly, elimination of the covalent mode of binding by isosteric replacement of the acrylamide to ethylamide diminished the biological activity by only 1 log (i.e., 1a vs 3a, 1b vs 4b, 1c vs 7a, and 1d vs 4c, tables 1 and 4) while retaining an hsp70-driven mechanism of action (table 1 and figure 3). Specifically, when cancer cells were incubated with select derivatives (i.e., 1a and 3a, acrylamide- and ethylamide - containing derivatives, respectively), we observed dissociation of hsp70hop complexes at concentrations at which we also noted degradation of the hsp70 onco - client protein kinase, her2 (figure 3). As previously mentioned, hop is a cochaperone that bridges hsp70 and hsp90 to form the megachaperone complex that regulates the stability of several onco - client proteins, such as her2 and raf-1 . When these complexes become disrupted, the client proteins (i.e., her2 and raf-1) become unstable and are cleared through the proteasome pathway . As mentioned above, the pocket occupied by the x4 substituent contains leu237, val238, and cys267, and the ethyl group of 3a would be well positioned to form hydrophobic interactions with these residues . Her2 and raf-1 steady - state levels, parp cleavage and inhibition of growth measured in skbr3 breast cancer cells . Binding to skbr3 cell extracts tested at the maximum concentration allowed by solubility . Skbr3 cells were treated for 24 h with vehicle or indicated concentrations of 1a or 3a . Dissociation: upon cell lysing, hsp70 complexes were isolated with an anti - hsp70 antibody (ip bb70) and analyzed by western blotting (wb). Her2 degradation: proteins in the lysate were analyzed by immonoblotting with an anti - her2 antibody . Gels were quantified by densitometry, values normalized to the control (vehicle only treated cells), and data graphed against the hsp70 inhibitor concentration . We wanted to explore the further potential of increasing potency by exploring this pocket with r groups of various sizes and to take advantage of potential hydrophobic interactions within the pocket . Substituting ethyl with methyl (i.e., 3c and 4a) diminished activity, while cyclopropyl at this position slightly increased activity (i.e., 4c vs 4e and 3a vs 7b, table 1, x1,2 = n). Substitution of ethyl with groups such as allyl or cyclobutyl (i.e., 7a vs 7 g and 7c) led to no significant change in activity, suggesting that such groups can be accommodated in this site, but that no additional favorable interactions were possible . Much larger hydrophobic substituents at this position abolished both activity (i.e., n - heptyl in 3d, steric clashes with asn235, leu237, val238, and val260) and solubility (i.e., cyclohexyl in 7d), which in the latter case precluded biological evaluation . We also found that flat, conformationally restricted aromatic groups were well tolerated at this position and in fact significantly improved activity . Specifically, the 2-furanyl derivative (i.e., 4d) was 23-fold more potent than the corresponding ethyl and cyclopropyl derivatives (i.e., 4c and 4e, respectively) and only 5-fold less potent than the corresponding acrylamide derivative (i.e., 1d) (table 1). Even more favored was a phenyl at this position (i.e., 7e), this compound being 810-fold more active than the corresponding ethyl derivative (i.e., 7a) (tables 1 and 4). Such an increase in potency for hydrophobic and -electron - containing r groups may be explained by enhanced hydrophobic interactions with leu237, val238, leu263, and phe241 or a potential s interaction between the sulfur of cys267 and the r group . Such favorable interactions between sulfur and aromatic systems were first suggested by morgan et al ., and a number of stable orientations are possible, including one where the sulfur is positioned 3.54.0 above the plane of the aromatic ring and another where the sulfur is positioned slightly above (2.5) and to the edge (4.56.0) of the aromatic ring . Both orientations have been found to occur with cysteine residues in proteins, and recently a s h/ interaction was proposed to rationalize the binding affinity of an flt3 kinase inhibitor . Our second approach toward enhancing activity within the pocket was to take advantage of the native cysteine residue and its potential to form ionic interactions through its side chain thiolate (s). We attempted to take advantage of such an interaction by incorporating an amine group at the same position as the -carbon of the michael acceptor acrylamide in 1a . An increase in potency was observed for r substituents that could potentially be positively ionized and form an ionic pair with s of cysteine (2-aminomethyl in 7f and 16d). Indeed, 2-aminomethyl appears to favorably position its amine, which is likely protonated at physiological ph, to interact with the sulfur of cysteine (i.e., 7f in table 1 and 16d in table 2). These derivatives have an activity that is comparable to that of the corresponding phenyl and/or furanyl compounds (7f vs 7e and 4d, table 1, and 16d vs 16c, table 2). Positioning the amine one carbon away, such as in 9 (r = 2-(dimethylamino)ethyl, table 1), resulted in activity comparable to that of 7f in the growth inhibition and caspase-3,7 activation assays . In this case, 9 has the potential to undergo bioconversion in cells via -elimination to the corresponding alkene, and therefore, in addition to possible interactions described above, it may also interact with cys267 covalently . Having determined these two potential strategies that replace the acrylamide with minimal loss of activity, i.e., a -electron- or positively ionizable functionality - containing r group, we went on to explore other sites on the molecule that would provide a gain in binding affinity . As mentioned in our design, changing ring b from pyrimidine to phenyl is expected to increase potency by enhancing the interaction of the ring with arg264 . Indeed, unlike in the irreversible inhibitor series, where pyrimidine was favored over phenyl because it increased the reactivity of acrylamide for cysteine, in the reversible inhibitor series, we found the opposite to be true (i.e., 7a vs 4b and 16b vs 14b, tables 1 and 2, and additional examples in table 1). Arg264 has its guanidinium group positioned atop ring b, thus favorably aligned for cation interactions to occur (figure 2a). Thus, an electron - rich aromatic ring, such as phenyl, may form a stronger stacking interaction than pyrimidine with this residue . In heterocycles, where the lone pair does not contribute to aromaticity, the electronegativity of the heteroatom weakens the cation binding ability . We next explored modifications to ring a. having ring a either pyrimidine or pyridine could increase the chemistry feasibility for exploring distinct x5 and x6 combinations on the molecules, and thus, we first explored the effect on activity by changing the nature of the ring . Rewardingly, a change from pyrimidine to pyridine led to no substantial change in activity (i.e., 7e vs 16c and 7f vs 16d, tables 1 and 2). On the other hand, disrupting the aromaticity of ring a completely abolished activity (21, table 2). 2-hydroxypyridines undergo tautomerism to give pyridones which can behave like amides and exist mainly as the amide tautomer in most solvents . The dramatic loss of activity observed upon replacing the methoxy group with a hydroxy group at x5 hinted at the importance of this position for binding energy and demonstrates that this group makes significant interactions that are essential for the potency of these compounds . Thus, having the ability to use both pyridine and pyrimidine as ring a increased our chemical versatility, and we next explored distinct x5,6 combinations . Results with the pyridine series (table 2) showed that disubstitution of x5 and x6 was not necessarily required as having a single methoxy group on the molecule performed as well as having two . This was also observed within the pyrimidine series, as 7h was of potency similar to that of its disubstituted analogue 7f (table 1). We therefore sought to explore this position further, especially by adding aryl substituents that, as indicated above, would be poised to fill the hydrophobic pocket currently occupied by methoxy (figure 2b, red circle). Substitution of x5 with benzyloxy led to a remarkable 1 log increase in potency (compare 27a to 7a). In fact, this derivative was almost as potent as the corresponding acrylamide - containing derivative (compare 27a to 1c). We further increased the activity of this compound once the methyl (r on x4; see figure 2a) was substituted with a phenyl or aminomethyl (27b and 27c, respectively, table 3), both favored x4 substituents (tables 1 and 2). With aminomethyl being favored at this position, we also probed whether adding hydrophobic bulk to this functionality could lead to a gain in affinity . As indicated above, leu237 and val238 are in the vicinity of cys267, and thus, there is potential for minor affinity gain by increasing hydrophobicity . Replacing the h in 27c with a methyl (27d) or isopropyl (27e) or switching the aminomethyl to 2-pyrrolidinyl (27f) resulted in a minor increase in activity or had no measurable effect on activity (table 3). Changing x5 from benzyloxy to the less flexible phenyl substituent directly attached to the pyrimidine a ring resulted in a significant 10-fold loss of activity (27 g, table 3). Furthermore, substituting the phenyl ring of 27c with the relatively more polar pyridine in 27h also decreased affinity 5-fold . These results are very much concordant with the proposed mode of binding for these ligands . Docking analysis showed that the benzyloxy group can be accommodated in the left - side hydrophobic subpocket (red circle, figure 2b) and form hydrophobic interactions with tyr41, phe68, and trp90 . For 27 g, the phenyl substituent is not able to orient properly in this cavity and, due to its inflexibility, rather orients toward asp69 and glu231, providing an explanation for its loss of activity . Similarly, replacing the phenyl in 27c with pyridine as in 27h increases the polarity and thus its ability to favorably interact with the hydrophobic residue environment . Altogether, and as seen in the irreversible series, our tests demonstrated a good correlation between the predicted binding mode (figure 2) and the observed biological activity (tables 14) of the designed ligands, further consolidating that the biological effect of these molecules in cancer cells is majorly hsp70 mediated . No effect was noted for these compounds on hsp90 at concentrations as high as 500 m (table 4). This ligand combines individual features that this study identifies as most favorable at each evaluated position; its x4 is glycine, ring b is phenyl, and x5 is benzyloxy (figure 2b). This analogue has an activity in cells comparable to that of the most active reported irreversible inhibitors of this class, namely, low micromolar activity in cancer cells (figure 4). We found that 27c interfered with the formation of functional hsp70hop hsp90 machinery as indicated by its ability to dose - dependently alter the megacomplex components and to destabilize an hsp70hsp90 machinery client, raf-1 (figure 4a). Hsp90 in concert with hsp70 maintains the transforming capacity of several oncoproteins, including her2, akt, raf-1, igf - ir, and hif-1 . When this chaperone complex becomes pharmacologically inhibited, these oncoproteins become destabilized and are degraded mainly by the proteasomal pathway . Indeed, we found that the steady - state levels and/or the activity of several oncoproteins involved in increased signaling through a pathogenic pathway were sensitive to hsp70 inhibition by 27c (figure 4b). These signaling oncoproteins include her2 and raf-1 in the her2-overexpressing skbr3 breast cancer cells, stat3 and raf-1 in the triple - negative breast cancer mda - mb-468 cells, stat3, raf-1, and akt in the miapaca2 pancreatic cancer cells, and mutant flt3 and stat5 in molm13 acute myeloid leukemia cells . 27c also resulted in induction of apoptosis in these cancer cells, as indicated by substantial parp cleavage (cparp; figure 4b). Allosteric ligands with a reversible mode of binding mimic the cellular phenotype observed with the irreversible hsp70 inhibitors . Addition of 27c to cancer cells dose - dependently alters the formation of the hsp70hop complex, a phenomenon associated with their destabilization and reduction in half - life (a). It is associated with degradation and/or inhibition of hsp90hsp70 oncoproteins and induction of apoptosis (b). Collectively, these data indicate that its mechanism of action is mediated by interaction with the hsp70 allosteric pocket in a fashion resembling the interaction of 1e . Next, we investigated whether binding of 27c to hsp70 interfered with its main biochemical activities, specifically refolding of a denatured client protein (figure 5). Activities are stimulated by hsp40 proteins and nucleotide exchange factors, such as hsp110 . Humans have several cytosolic hsp40 s, including hdj1, dja1, dja2, and dja4, and it has recently been reported that dja2 is most efficient in promoting the refolding of an hsp70 polypeptide substrate, firefly luciferase . In cells, the refolding of heat - denatured luciferase by endogenous as well as transfected hsp70 was inhibited by 27c . The nonspecific capacity of transfected hsp70 to maintain substrate solubility after heat shock was not greatly affected, indicating that 27c, in a manner we reported for 1e, targeted the specific substrate folding activity of hsp70 (figure 5). The cells were treated with cycloheximide and either vehicle or 27c at 10 m, incubated at 45 c for 1 h, and allowed to recover at 37 c for 2 h (left). Cells were lysed during and after refolding, and soluble ha - tagged luciferase and chaperones were detected in the lysates; exogenous transfected flag - tagged hsp70 is visible as a band above endogenous hsp70 (middle). Luciferase enzymatic activities in the lysates were measured at 2 h of refolding, unless otherwise indicated, and are represented as percentages of the initial activity before heat shock (right). 27c significantly inhibited endogenous hsp70 and transfected hsp70 in multiple experiments (n 3). We have shown that significant biological activity may be retained through reversible hsp70 inhibitors targeting an allosteric pocket located at the n - terminal domain . Because of the appropriate fit, and thus good enthalpy of binding of the irreversible inhibitors, simple modifications such as replacement of the covalent linkage with an ionic bridge (yellow, figure 2b) and filling of the hydrophobic pocket occupied by methoxy in 1e with a benzyloxy (red, figure 2b) have led to ligands of reversible mode of binding that not only mimic the phenotype observed with 1e, but do so with similar potency (figure 4). Our data show that the acrylamide group could be eliminated altogether by improving the enthalpy of the binding and indicate that significant binding energy can be attained through additional hydrophobic interactions of x5 substituents with the tyr41, phe68, and trp90 residues . This interaction weighs majorly toward the binding of these ligands to the allosteric pocket of hsp70 . Combined, the sar data from this and the accompanying paper validate the homology model and the proposed binding of these ligands to the allosteric pocket . First, the model has allowed for the rational design of a ligand that, when incubated with the thousands of proteins expressed in a cancer cell, affinity purified one, hsp70 . Second, the correctness of the binding mode analyses has allowed the rational design of specific ligands with a tractable sar . Some of these specific ligands as we show have a reversible mode of binding whose potency rivals that of the irreversible ligands, indicating that favorable enthalpy drives the binding of these compounds to hsp70 . Third, the concordance in the observed biochemical and phenotypic effects observed with these agents in cancer cells, such as exemplified for 27c, suggests that, in the tested concentration range, the biological activity of these agents is majorly and selectively channeled through an hsp70-binding mechanism . In addition to providing both a novel pharmacophore and medicinal chemistry for its assembly, we describe in our papers a testing battery for assessing hsp70-mediated mechanisms in cancer cells and for evaluating specific ligand action in cancer cells through hsp70 inhibition . Therefore, we provide a novel blueprint for a cancer - oriented development of hsp70-directed ligands . In conclusion, our findings propose the allosteric hsp70 inhibitors as important leads toward the development of novel targeted anticancer therapeutics . 27c serves as a molecule for further development that can potentially be elaborated into more potent molecules with in vivo efficacy . We are currently working to further optimize this class of compounds for potency and in vivo activity and will disclose our results in due course . All reagents were purchased from either aldrich or acros organics and used without purification . Nmr spectra were recorded on a bruker av - iii-500 or 600 mhz nmr spectrometer . Chemical shifts are reported in values in parts per million downfield from tms as the internal standard . H data are reported as follows: chemical shift, multiplicity (s = singlet, d = doublet, t = triplet, q = quartet, br = broad, m = multiplet), coupling constant (hz), integration . C chemical shifts are reported in values in parts per million downfield from tms as the internal standard . Low - resolution mass spectra were obtained on a waters acquity ultra performance lc instrument with electrospray ionization and an sq detector . Analytical hplc was performed on a waters autopurification system with pda, micromass zq, and elsd detectors . The purity of the title compounds used in pharmacology testing was verified by hplc ms using the following method: 1012 min gradient on a waters2525 binary gradient pump of increasing concentrations of acetonitrile in water (5% 95%) containing 0.1% formic acid with a flow rate of 1.2 ml / min and uv detection at = 220 and 254 nm on an xbridge c18 150 mm 4.6 mm, 5 m column . Analytical thin - layer chromatography was performed on 250 m silica gel f254 plates . Preparative thin - layer chromatography was performed on 1000 m silica gel f254 plates . The syntheses of 1a d and 8 are described elsewhere . To a solution of 2a (20 mg, 0.049 mmol) and et3n (49 mg, 0.49 mmol) in 1 ml of anhydrous dioxane was added propionyl chloride (45 mg, 0.49 mmol). The resulting mixture was stirred at rt for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (chcl3/meoh nh3 (7 n), 10:1) to afford 15 mg (66%) of 3a . H nmr (500 mhz, cdcl3): 8.17 (br s, 1h), 6.95 (s, 1h), 4.84 (br s, 2h), 4.35 (q, j = 7.5, 4h), 3.82 (m, 4h), 2.44 (m, 4h), 2.34 (s, 3h), 2.34 (q, j = 7.5 hz, 2h), 1.28 (t, j = 7.5 hz, 6h), 1.15 (t, j = 7.5 hz, 3h). C nmr (125 mhz, cdcl3): 173.3, 170.6, 170.5, 164.2, 160.0, 156.7, 87.7, 80.3, 62.4, 54.9, 46.3, 43.7, 30.6, 14.5, 9.1 . Hrms (m / z): [m + h] calcd for c20h31n8o3s, 463.2240; found, 463.2253 . To a solution of 2a (20 mg, 0.049 mmol) and et3n (49 mg, 0.49 mmol) in 1 ml of anhydrous dioxane was added cyclopropanecarbonyl chloride (62 mg, 0.49 mmol). The resulting mixture was stirred at rt for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (chcl3/meoh nh3 (7 n), 10:1) to afford 23 mg (62%) of 3b . H nmr (500 mhz, cdcl3): 8.48 (br s, 1h), 6.91 (s, 1h), 4.83 (br s, 2h), 4.35 (q, j = 7.1 hz, 4h), 3.82 (m, 4h), 2.44 (m, 4h), 2.34 (s, 3h), 1.52 (m, 1h), 1.27 (t, j = 7.1 hz, 6h), 1.03 (m, 2h), 0.84 (m, 2h). C nmr (125 mhz, cdcl3): 173.3, 170.6, 170.5, 164.2, 160.0, 156.7, 87.8, 80.4, 62.5, 54.9, 46.3, 43.7, 15.9, 14.5, 8.7 . Hrms (m / z): [m + h] calcd for c21h31n8o3s, 475.2240; found, 475.2237 . To a solution of 2b (20 mg, 0.049 mmol) and et3n (49 mg, 0.49 mmol) in 1 ml of anhydrous dioxane was added acetyl chloride (38 mg, 0.49 mmol). The resulting mixture was stirred at rt for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (chcl3/meoh nh3 (7 n), 10:1) to afford 21 mg (61%) of 3c . H nmr (500 mhz, cdcl3): 7.99 (br s, 1h), 6.94 (s, 1h), 4.81 (br s, 2h), 3.88 (m, 10h), 2.47 (m, 4h), 2.36 (s, 3h), 2.11 (s, 3h). C nmr (125 mhz, cdcl3): 171.1, 170.5, 169.3, 164.3, 160.1, 156.6, 87.8, 80.1, 54.9, 54.2, 46.2, 43.7, 24.8 . Hrms (m / z): [m + h] calcd for c17h25n8o3s, 421.1770; found, 421.1765 . To a solution of 2b (20 mg, 0.049 mmol) and et3n (49 mg, 0.49 mmol) in 1 ml of anhydrous dioxane was added octanoyl chloride (80 mg, 0.49 mmol). The resulting mixture was stirred at rt for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (chcl3/meoh nh3 (7 n), 10:1) to afford 17 mg (71%) of 3d . H nmr (500 mhz, cdcl3): 8.01 (br s, 1h), 6.97 (s, 1h), 4.86 (br s, 2h), 3.89 (s, 6h), 3.86 (m, 4h), 2.46 (m, 4h), 2.35 (s, 3h), 2.30 (t, j = 7.4 hz, 2h), 1.62 (m, 2h), 1.201.30 (m, 8h), 0.87 (t, j = 6.9 hz, 3h). C nmr (125 mhz, cdcl3): 172.7, 171.1, 170.4, 164.3, 160.0, 156.7, 87.9, 80.1, 54.9, 54.2, 46.3, 43.7, 37.7, 31.6, 29.1, 29.0, 25.2, 22.6, 14.1 . Hrms (m / z): [m + h] calcd for c23h37n8o3s, 505.2709; found, 505.2701 . To a solution of 2c (50 mg, 0.138 mmol) and et3n (139 mg, 1.38 mmol) in 2 ml of anhydrous dioxane was added acetyl chloride (108 mg, 1.38 mmol) dropwise . The resulting mixture was stirred at rt for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (chcl3/meoh nh3 (7 n), 10:1) to afford 56 mg (73%) of 4a . H nmr (500 mhz, cdcl3): 8.34 (d, j = 6.2 hz, 1h), 8.09 (s, 1h), 7.75 (d, j = 6.2 hz, 1h), 3.89 (br s, 10h), 2.50 (m, 4h), 2.38 (s, 3h), 2.18 (s, 3h). C nmr (125 mhz, cdcl3): 171.4, 171.1, 169.3, 160.1, 158.9, 157.0, 105.4, 79.4, 54.8, 54.2, 46.2, 43.6, 24.8 . Hrms (m / z): [m + h] calcd for c17h24n7o3s, 406.1661; found, 406.1661 . To a solution of 2c (50 mg, 0.138 mmol) and et3n (139 mg, 1.38 mmol) in 2 ml of anhydrous dioxane was added propionyl chloride (128 mg, 1.38 mmol) dropwise . The resulting mixture was stirred at rt for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (chcl3/meoh nh3 (7 n), 10:1) to afford 58 mg (81%) of 4b.h nmr (500 mhz, cdcl3): 8.33 (d, j = 5.6 hz, 1h), 8.05 (s, 1h), 7.77 (d, j = 5.6 hz, 1h), 3.96 (m, 4h), 3.89 (s, 6h), 2.59 (m, 4h), 2.42 (s, 3h), 2.41 (q, j = 7.6 hz, 2h), 1.20 (t, j = 7.6 hz, 3h). C nmr (125 mhz, cdcl3): 173.0, 171.2, 171.1, 160.1, 158.9, 157.0, 105.5, 77.0, 54.6, 54.3, 45.7, 43.1, 30.8, 9.0 . Hrms (m / z): [m + h] calcd for c18h26n7o3s, 420.1818; found, 420.1838 . To a solution of 2d (50 mg, 0.151 mmol) and et3n (152 mg, 1.51 mmol) in 2 ml of anhydrous dioxane was added propionyl chloride (140 mg, 1.51 mmol) dropwise . The resulting mixture was stirred at rt for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (chcl3/meoh nh3 (7 n), 10:1) to afford 59 mg (83%) of 4c . H nmr (500 mhz, cdcl3): 8.35 (d, j = 5.7 hz, 1h), 7.84 (s, 1h), 7.81 (d, j = 5.7 hz, 1h), 3.92 (s, 4h), 2.48 (m, 4h), 2.44 (s, 6h), 2.40 (q, j = 7.5 hz, 2h), 2.35 (s, 3h), 1.21 (t, j = 7.5 hz, 3h). C nmr (125 mhz, cdcl3): 173.0, 171.9, 170.7, 160.4, 159.1, 157.3, 108.7, 105.7, 55.0, 46.2, 43.5, 30.8, 23.9, 8.9 . Hrms (m / z): [m + h] calcd for c18h26n7os, 388.1920; found, 388.1921 . To a solution of 2d (50 mg, 0.151 mmol) and et3n (152 mg, 1.51 mmol) in 2 ml of anhydrous dioxane was added 2-furoyl chloride (197 mg, 1.51 mmol) dropwise . The resulting mixture was stirred at rt for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (chcl3/meoh nh3 (7 n), 10:1) to afford 56 mg (87%) of 4d . H nmr (600 mhz, cdcl3): 8.58 (br s, 1h), 8.40 (d, j = 5.6 hz, 1h), 7.94 (d, j = 5.6 hz, 1h), 7.567.58 (m, 1h), 7.31 (d, j = 3.5 hz, 1h), 6.60 (dd, j = 3.5, 1.7 hz, 1h), 3.903.97 (m, 4h), 2.49 (m, 4h), 2.46 (s, 6h), 2.36 (s, 3h). C nmr (150 mhz, cdcl3): 171.9, 170.9, 160.5, 159.1, 157.1, 156.3, 146.4, 145.4, 117.2, 113.0, 108.5, 106.0, 55.0, 46.3, 43.5, 23.9 . Hrms (m / z): [m + h] calcd for c20h24n7o2s, 426.1712; found, 426.1727 . To a solution of 2d (50 mg, 0.151 mmol) and et3n (152 mg, 1.51 mmol) in 2 ml of anhydrous dioxane was added cyclopropanecarbonyl chloride (158 mg, 1.51 mmol) dropwise . The resulting mixture was stirred at rt for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (chcl3/meoh nh3 (7 n), 10:1) to afford 48 mg (79%) of 4e . H nmr (500 mhz, cdcl3): 8.35 (d, j = 5.6 hz, 1h), 8.20 (s, 1h), 7.78 (d, j = 5.6 hz, 1h), 3.92 (m, 4h), 2.49 (m, 4h), 2.45 (s, 6h), 2.36 (s, 3h), 1.54 (m, 1h), 1.10 (m, 2h), 0.93 (m, 2h). C nmr (125 mhz, cdcl3): 173.1, 172.0, 170.6, 160.4, 159.0, 157.3, 108.8, 105.7, 55.0, 46.2, 43.5, 23.8, 16.0, 9.1 . Hrms (m / z): [m + h] calcd for c19h26n7os, 400.1920; found, 400.1913 . A mixture of 5a (0.200 g, 0.549 mmol), 3-aminothiophenol (70 l, 0.082 g, 0.659 mmol), neocuproine (0.023 g, 0.110 mmol), cui (0.021, 0.110 mmol), and k2co3 (0.152 g, 1.10 mmol) in dmf (7 ml) was heated at 120 c for 24 h. solvent was removed under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 200:1 to 40:1) to afford 0.133 g (67%) of 6a . H nmr (500 mhz, cdcl3): 6.97 (t, j = 8.0 hz, 1h), 6.466.51 (m, 1h), 6.366.40 (m, 2h), 3.884.03 (m, 10h), 3.58 (br s, 2h), 2.52 (m, 4h), 2.38 (s, 3h). C nmr (125 mhz, cdcl3): 171.8, 160.1, 146.9, 139.5, 129.6, 116.2, 112.2, 112.1, 81.1, 55.0, 54.6, 46.3, 43.8 . Hrms (m / z): [m + h] calcd for c17h24n5o2s, 362.1651; found, 362.1649 . To a solution of 6a (10 mg, 0.027 mmol) and et3n (50 l, 36 mg, 0.36 mmol) in 1 ml of ch2cl2 was added propionyl chloride (22 l, 24.4 mg, 0.27 mmol). The reaction was stirred at rt for 12 h and then quenched by adding cold meoh . Solvent was evaporated under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 20:1) to afford 7.3 mg (65%) of 7a . H nmr (500 mhz, cdcl3) 7.44 (d, j = 7.5 hz, 1h), 7.13 (m, 2h), 7.04 (s, 1h), 6.78 (d, j = 7.5 hz, 1h), 3.93 (m, 4h), 3.90 (s, 6h), 2.55 (m, 4h), 2.36 (s, 3h), 2.33 (q, j = 7.2 hz, 2h), 1.21 (t, j = 7.2 hz, 3h). Hrms (m / z): [m + h] calcd for c20h28n5o3s, 418.1913; found, 418.1910 . To a solution of 6a (10.9 mg, 0.0302 mmol) and et3n (21 l, 15.3 mg, 0.151 mmol) in ch2cl2 (1 ml) was added cyclopropanecarbonyl chloride (14 l, 15.8 mg, 0.1508 mmol), and the resulting solution was stirred at rt for 2 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 20:1) to afford 7.9 mg (61%) of 7b . H nmr (500 mhz, cdcl3): 7.49 (m, 1h), 7.29 (s, 1h), 7.13 (t, j = 7.8 hz, 1h), 6.97 (s, 1h), 6.78 (d, j = 7.6 hz, 1h), 3.883.95 (m, 10h), 2.48 (m, 4h), 2.36 (s, 3h), 1.051.13 (m, 1h), 0.740.96 (m, 4h). Hrms (m / z): [m + h] calcd for c21h28n5o3s, 430.1913; found, 430.1897 . 6a (10 mg, 0.028 mmol), et3n (19.5 l, 14.2 mg, 0.14 mmol), and cyclobutanecarbonyl chloride (9.6 l, 10.0 mg, 0.084 mmol) in ch2cl2 (1 ml) were stirred at rt for 2 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (etoac / meoh nh3 (7 n), 20:1) to afford 4.1 mg (33%) of 7c . H nmr (500 mhz, cdcl3): 7.50 (d, j = 7.8 hz, 1h), 7.14 (t, j = 7.9 hz, 1h), 7.00 (s, 1h), 6.94 (br s, 1h), 6.77 (d, j = 7.9 hz, 1h), 3.90 (br s, 10h), 3.07 (m, 1h), 2.50 (m, 14h), 2.142.42 (m, 7h), 1.822.02 (m, 2h). Hrms (m / z): [m + h] calcd for c22h30n5o3s, 444.2069; found, 444.2052 . 6a (10 mg, 0.028 mmol), et3n (19.5 l, 14.2 mg, 0.14 mmol), and cyclohexanecarbonyl chloride (11.4 l, 12.3 mg, 0.084 mmol) in ch2cl2 (1 ml) were stirred at rt for 3 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (etoac / meoh nh3 (7 n), 20:1) to afford 12 mg (91%) of 7d . H nmr (500 mhz, cdcl3): 7.50 (d, j = 7.9 hz, 1h), 7.18 (s, 1h), 7.13 (t, j = 7.9 hz, 1h), 7.02 (s, 1h), 6.76 (d, j = 7.7 hz, 1h), 3.90 (br s, 10h), 2.51 (m, 4h), 2.38 (s, 3h), 2.112.22 (m, 1h), 1.191.96 (m, 10h). 6a (10 mg, 0.028 mmol), et3n (19.5 l, 14.2 mg, 0.14 mmol), and benzoyl chloride (9.8 l, 11.8 mg, 0.084 mmol) in ch2cl2 (1 ml) were stirred at rt for 3 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (etoac / meoh nh3 (7 n), 20:1) to afford 8.6 mg (66%) of 7e . H nmr (500 mhz, cdcl3): 7.83 (d, j = 7.7 hz, 2h), 7.74 (br s, 1h), 7.59 (d, j = 7.8 hz, 1h), 7.54 (t, j = 6.4 hz, 1h), 7.47 (t, j = 7.8 hz, 2h), 7.20 (t, j = 8.0 hz, 1h), 7.13 (s, 1h), 6.86 (d, j = 7.9 hz, 1h), 3.873.93 (m, 10h), 2.50 (m, 4h), 2.37 (s, 3h). Hrms (m / z): [m + h] calcd for c24h28n5o3s, 466.1913; found, 466.1919 . To a solution of 6a (20 mg, 0.0552 mmol) in thf (1 ml) were added boc - glycine (9.7 mg, 0.0552 mmol) and dcc (12 mg, 0.058 mmol), and the resulting solution was stirred at rt for 5 h. the reaction mixture was concentrated under reduced pressure, and the residue was purified by preparatory tlc (etoac / meoh nh3 (7 n), 20:1) to afford a solid which was dissolved in 2 ml of ch2cl2/tfa (4:1). The resulting solution was stirred at rt for 1 h. the reaction mixture was concentrated under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 15:1) to afford 13.9 mg (60%) of 7f . H nmr (500 mhz, cdcl3/meoh - d4): 7.38 (d, j = 8.2 hz, 1h), 7.26 (s, 1h), 7.15 (t, j = 7.9 hz, 1h), 6.79 (d, j = 7.6 hz, 1h), 3.863.97 (m, 10h), 3.52 (s, 2h), 2.58 (m, 4h), 2.41 (s, 3h). Hrms (m / z): [m + h] calcd for c19h27n6o3s, 419.1865; found, 419.1862 . To a solution of 6a (10 mg, 0.027 mmol) and et3n (50 l, 36 mg, 0.36 mmol) in 1 ml of ch2cl2 was added 3-butenoyl chloride (28.2 mg, 0.27 mmol). The reaction was stirred at rt for 12 h and then quenched by adding cold meoh . Solvent was evaporated under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 20:1) to afford 8.3 mg (72%) of 7 g . H nmr (500 mhz, cdcl3): 7.35 (d, j = 8.1 hz, 1h), 7.29 (br s, 1h), 7.107.19 (m, 2h), 6.79 (d, j = 7.5 hz, 1h), 5.976.00 (m, 1h), 5.255.35 (m, 2h), 3.923.96 (m, 4h), 3.90 (s, 6h), 3.14 (d, j = 7.1 hz, 2h), 2.542.60 (m, 4h), 2.42 (s, 3h). Hrms (m / z): [m + h] calcd for c21h28n5o3s, 430.1913; found, 430.1911 . A mixture of 5b (0.200 g, 0.600 mmol) and k2co3 (0.166 g, 1.20 mmol) in dmf (6 ml) was evacuated and backfilled with argon three times . Copper(i) thiophene-2-carboxylate (0.034 g, 0.180 mmol) was added, and the resulting mixure was evacuated and backfilled with argon two times . 3-aminothiophenol (76 l, 0.090 g, 0.72 mmol) was added, and the reaction mixture was heated at 120 c for 24 h. solvent was removed under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 200:1 to 40:1) to afford 0.147 g (74%) of 6b . H nmr (500 mhz, cdcl3): 8.22 (s, 1h), 7.00 (t, j = 7.8 hz, 1h), 6.52 (d, j = 7.7 hz, 1h), 6.386.45 (m, 2h), 3.91 (s, 3h), 3.89 (m, 4h), 3.60 (br s, 2h), 2.49 (m, 4h), 2.36 (s, 3h). C nmr (125 mhz, cdcl3): 169.4, 164.9, 161.6, 146.9, 138.8, 129.6, 116.9, 112.9, 112.5, 99.2, 54.9, 53.9, 46.2, 43.8 . Hrms (esi) m / z [m + h] calcd for c16h22n5os, 332.1545; found, 332.1532 . To a solution of 6b (15.5 mg, 0.047 mmol) in thf (1 ml) were added boc - glycine (9.1 mg, 0.052 mmol) and dcc (10.7 mg, 0.052 mmol). After the resulting solution was stirred overnight at rt, thf was evaporated and 1 ml of ch2cl2/tfa (4:1) was added . The solution was stirred for 45 min and then concentrated to dryness under reduced pressure to give a residue which was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 15:1) to afford 13.4 mg (73%) of 7h . H nmr (500 mhz, cdcl3): 9.29 (br s, 1h), 8.23 (s, 1h), 7.457.50 (m, 1h), 7.307.34 (m, 1h), 7.17 (t, j = 8.0 hz, 1h), 6.816.87 (m, 1h), 3.91 (s, 3h), 3.863.90 (m, 4h), 3.45 (s, 2h), 2.462.52 (m, 4h), 2.35 (s, 3h). Ms (m / z): [m + h] 389.3 . To a solution of 8 (23 mg, 0.053 mmol) in ch3cn (1 ml) were added dimethylamine (2 m, thf; 53 l, 0.106 mmol) and dbu (4 mg, 0.026 mmol) at rt, and the resulting solution was stirred for 6 h. the reaction mixture was concentrated under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 10:1) to afford 13.5 mg (53%) of 9 . H nmr (600 mhz, cdcl3): 11.1 (br s, 1h), 6.91 (s, 1h), 4.79 (br s, 2h), 3.843.91 (m, 10h), 2.56 (t, j = 5.8 hz, 2h), 2.452.51 (m, 4h), 2.41 (t, j = 5.8 hz, 2h), 2.37 (s, 3h), 2.22 (s, 6h). C nmr (150 mhz, cdcl3): 171.9, 171.2, 170.2, 164.3, 160.0, 157.1, 88.4, 80.8, 54.9, 54.4, 54.1, 46.2, 44.1, 43.6, 33.6 . Hrms (m / z): [m + h] calcd for c20h32n9o3s, 478.2349; found, 478.2343 . To a solution of 2-bromo-6-methoxypyridine (10) (150 mg, 0.8 mmol) and 1-methylpiperazine (240 mg, 2.4 mmol) in 2 ml of dmf was added of k2co3 (220 mg, 1.6 mmol), and the resulting mixture was heated to 130 c for 16 h. solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (510% meoh in ch2cl2) to afford 145 mg (88%) of 11 . H nmr (500 mhz, cdcl3): 7.41 (t, j = 8.0 hz, 1h), 6.16 (d, j = 8.0 hz, 1h), 6.08 (d, j = 8.0 hz, 1h), 3.87 (s, 3h), 3.54 (m, 4h), 2.51 (m, 4h), 2.54 (s, 3h). C nmr (125 mhz, cdcl3): 163.1, 158.3, 140.1, 98.2, 98.1, 54.8, 52.9, 46.2, 45.1 . Ms (m / z): [m + h] 208.4 . To a solution of 11 (124 mg, 0.6 mmol) in 5 ml of acetonitrile was added n - iodosuccinimide (203 mg, 0.9 mmol), and the resulting mixture was stirred at rt for 2 h. the solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 1:0 to 85:15) to afford 190 mg (95%) of 12 . H nmr (500 mhz, cdcl3): 7.70 (d, j = 8.0 hz, 1h), 6.02 (d, j = 8.0 hz, 1h), 3.90 (s, 3h), 3.60 (m, 4h), 2.62 (m, 4h), 2.39 (s, 3h). C nmr (125 mhz, cdcl3): 177.7, 160.5, 157.8, 148.6, 100.7, 61.7, 54.2, 45.5, 44.5 . Ms (m / z): [m + h] 334.1 . A mixture of 12 (100 mg, 0.3 mmol), 4-aminopyrimidine-2-thiol (39 mg, 0.3 mmol), k2co3 (83 mg, 0.6 mmol), neocuproine (11 mg, 0.05 mmol), and cui (10 mg, 0.05 mmol) in dmf (3 ml) was heated to 130 c for 16 h. solvent was removed under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 1:0 to 85:15) to afford 60 mg (60%) of 13 . H nmr (500 mhz, cdcl3): 7.95 (d, j = 8.0 hz, 1h), 7.59 (d, j = 8.5 hz, 1h), 6.20 (d, j = 8.5 hz, 1h), 6.05 (d, j = 8.0 hz, 1h), 5.01 (s, 2h), 3.87 (s, 3h), 3.62 (m, 4h), 2.54 (m, 4h), 2.36 (s, 3h). C nmr (125 mhz, cdcl3): 171.9, 162.9, 162.5, 158.6, 156.2, 147.8, 101.1, 98.6, 97.6, 54.6, 53.6, 46.0, 44.6 . Ms (m / z): [m + h] 333.5 . To a solution of 13 (20 mg, 0.06 mmol) in 1.5 ml of ch2cl2 and et3n (100 l) was added propionyl chloride in ch2cl2 dropwise . Upon completion solvent was removed under reduced pressure, and the residue was purified by column chromatography (meoh nh3 (7 n), 210% in ch2cl2) to afford 18 mg (80%) of 14a . H nmr (500 mhz, cdcl3): 8.53 (br s, 1h), 8.34 (d, j = 8.0 hz, 1h), 7.79 (d, j = 8.0 hz, 1h), 7.58 (d, j = 8.0 hz, 1h), 6.21 (d, j = 8.0 hz, 1h), 3.86 (s, 3h), 3.63 (m, 4h), 2.52 (m, 4h), 2.41 (q, j = 7.2 hz, 2h), 2.36 (s, 3h), 1.08 (t, j = 7.2 hz, 3h). C nmr (125 mhz, cdcl3): 173.4, 172.2, 171.7, 162.9, 158.8, 157.3, 147.6, 105.6, 98.7, 96.7, 54.6, 53.7, 46.0, 44.6, 30.6, 8.96 . Hrms (m / z): [m + h] calcd for c18h25n6o2s, 389.1760; found, 389.1751 . To a solution of 13 (20 mg, 0.06 mmol) in 1.5 ml of ch2cl2 and et3n (100 l) was added cyclopropanecarbonyl chloride in ch2cl2 dropwise . Upon completion solvent was removed under reduced pressure, and the residue was purified by column chromatography (meoh nh3 (7 n), 210% in ch2cl2) to afford 21 mg (90%) of 14b . H nmr (500 mhz, cdcl3): 8.87 (br s, 1h), 8.31 (d, j = 8.0 hz, 1h), 7.75 (d, j = 8.0 hz, 1h), 7.57 (d, j = 8.0 hz, 1h), 6.20 (d, j = 8.0 hz, 1h), 3.87 (s, 3h), 3.62 (m, 4h), 2.52 (m, 4h), 2.36 (s, 3h), 1.61 (m, 1h), 1.08 (m, 2h), 0.88 (m, 2h). C nmr (125 mhz, cdcl3): 176.4, 173.5, 171.7, 162.9, 158.8, 157.2, 147.6, 105.7, 98.6, 96.7, 54.7, 53.6, 46.1, 44.6, 14.0, 7.7 . Hrms (m / z): [m + h] calcd for c19h25n6o2s, 401.1760; found, 401.1767 . A mixture of 12 (100 mg, 0.3 mmol), 3-aminothiophenol (37 mg, 0.3 mmol), k2co3 (83 mg, 0.6 mmol), neocuproine (33 mg, 0.15 mmol), and cui (29 mg, 0.15 mmol) in dmf (3 ml) was heated to 130 c for 16 h. solvent was removed under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 1:0 to 90:10) to afford 60 mg (60%) of 15 . Ms (m / z): [m + h] 331.2 . To a solution of 15 (20 mg, 0.06 mmol) and et3n (100 l) in 1.5 ml of ch2cl2 was added propionyl chloride in ch2cl2 dropwise . Upon completion solvent was removed under reduced pressure, and the residue was purified by column chromatography (meoh nh3 (7 n), 210% in ch2cl2) to afford 15 mg (70%) of 16a . H nmr (500 mhz, cdcl3): 7.55 (d, j = 8.0 hz, 1h), 7.45 (d, j = 8.0 hz, 1h), 7.22 (br s, 1h), 7.14 (t, j = 8.0 hz, 1h), 7.08 (s, 1h), 6.81 (d, j = 8.0 hz, 1h), 6.20 (d, j = 8.0 hz, 1h), 3.88 (s, 3h), 3.47 (m, 4h), 2.57 (m, 4h), 2.36 (s, 3h), 2.33 (q, j = 7.2 hz, 2h), 1.19 (t, j = 7.2 hz, 3h). Hrms (m / z): [m + h] calcd for c20h27n4o2s, 387.1855; found, 387.1855 . To a solution of 15 (20 mg, 0.06 mmol) and et3n (100 l) in 1.5 ml of ch2cl2 was added cyclopropanecarbonyl chloride in ch2cl2 dropwise . Upon completion solvent was removed under reduced pressure, and the residue was purified by column chromatography (meoh nh3 (7 n), 210% in ch2cl2) to afford 16 mg (70%) of 16b . H nmr (500 mhz, cdcl3) 7.61 (s, 1h), 7.31 (d, j = 8.0 hz, 1h), 7.20 (br s, 1h), 6.88 (m, 2h), 6.55 (m, 1h), 5.95 (d, j = 8.0 hz, 1h), 3.63 (s, 3h), 3.37 (m, 4h), 2.29 (m, 4h), 2.09 (s, 3h), 1.25 (m, 1h), 0.78 (m, 2h), 0.57 (m, 2h). C nmr (125 mhz, cdcl3) 176.4, 172.1, 162.7, 158.4, 147.5, 139.3, 138.7, 129.2, 122.2, 117.5, 116.8, 99.0, 54.6, 53.6, 46.1, 44.7, 13.9, 7.9 . Hrms (m / z): [m + h] calcd for c21h27n4o2s, 399.1855; found, 399.1853 . To a solution of 15 (20 mg, 0.06 mmol) and et3n (100 l) in 1.5 ml of ch2cl2 solvent was removed under reduced pressure, and the residue was purified by column chromatography (meoh nh3 (7 n), 210% in ch2cl2) to afford 20 mg (75%) of 16c . H nmr (500 mhz, cdcl3) 7.84 (s, 1h), 7.80 (d, j = 7.5 hz, 2h), 7.387.60 (m, 5h), 7.24 (m, 1h), 7.20 (t, j = 8.0 hz, 1h), 6.88 (d, j = 7.9 hz, 1h), 6.19 (d, j = 8.4 hz, 1h), 3.88 (s, 3h), 3.65 (m, 4h), 2.61 (m, 4h), 2.41 (s, 3h). C nmr (125 mhz, cdcl3) 165.7, 162.8, 158.4, 147.7, 139.7, 138.5, 135.0, 131.8, 128.7, 129.4, 127.0, 122.8, 118.0, 117.2, 99.4, 99.1, 54.4, 53.7, 45.7, 44.4 . Hrms (m / z): [m + h] calcd for c24h27n4o2s, 435.1855; found, 435.1849 . To a solution of 15 (20 mg, 0.06 mmol) in ch2cl2 (1 ml) were added boc - glycine (10.6 mg, 0.06 mmol), dmap (1.0 mg), et3n (10 l), and edci (11 mg, 0.06 mmol). The resulting solution was stirred at rt for 2 h. solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 1:0 to 85:15) to afford 26 mg (90%) of residue . To this ch2cl2, and the resulting solution was stirred at rt for 1 h. solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 1:0 to 85:15) to afford 16 mg (85%) of 16d . H nmr (500 mhz, cdcl3): 9.26 (br s, 1h), 7.55 (d, j = 8.0 hz, 1h), 7.47 (d, j = 8.0 hz, 1h), 7.28 (s,1h), 7.15 (t, j = 8.0 hz, 1h), 6.82 (d, j = 8.0, 1h), 6.21 (d, j = 8.0 hz, 1h), 3.89 (s, 3h), 3.62 (m, 4h), 3.42 (s, 2h), 2.54 (m, 4h), 2.36 (s, 3h). C nmr (125 mhz, cdcl3): 170.6, 162.7, 158.4, 147.5, 139.4, 138.0, 129.3, 122.5, 117.5, 116.5, 99.4, 98.9, 54.6, 53.6, 46.0, 45.1, 44.7 . Hrms (m / z): [m + h] calcd for c19h26n5o2s, 388.1807; found, 388.1808 . A mixture of 11 (8.0 g, 0.0386 mol) in 50 ml of 48% hbr(aq) and a catalytic amount of tetrabutylammonium bromide was refluxed overnight . The reaction mixture was concentrated under reduced pressure and purified by column chromatography to give 5.1 g (68%) of 17 . H nmr (500 mhz, cdcl3): 7.287.33 (m, 1h), 5.94 (d, j = 8.7 hz, 1h), 5.54 (d, j = 7.8 hz, 1h), 3.38 (m, 4h), 2.55 (m, 4h), 2.34 (s, 3h). C nmr (125 mhz, cdcl3): 165.2, 153.6, 142.6, 106.7, 90.6, 54.4, 47.3, 46.0 . Ms (m / z): [m + h] 194.0 . To a solution of 17 (1.2 g, 6.22 mmol) in dmf (40 ml) was added nah (0.596 g, 24.8 mmol) at rt, and the mixture was stirred for 10 min . Then (pmb)cl (1.06 g, 6.83 mmol) was added dropwise, and the mixture was stirred at rt for 1 h. the reaction mixture was concentrated under reduced pressure and purified by column chromatography to give 1.63 g (84%) of 18 . Ms (m / z): [m + h] 314.2 . To a solution of 18 (1.16 g, 3.7 mmol) in acetonitrile (50 ml) were added nis (1.66 g, 7.4 mmol) and tfa (1.42 ml, 18.5 mmol), and the solution was stirred for 1 h at rt . The reaction mixture was concentrated under reduced pressure and purified by column chromatography to give 1.22 g (75%) of 19 . A mixture of 19 (452 mg, 1.03 mmol), 3-aminothiophenol (137 mg, 1.10 mmol), k2co3 (552 mg, 4.0 mmol), neocuproine (45 mg, 0.2 mmol), and cui (39 mg, 0.2 mmol) in dmf (10 ml) was heated to 130 c for 16 h. solvent was removed under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 1:0 to 85:15) to afford 224 mg (50%) of 20 . Ms (m / z): [m + h] 437.2 . To a solution of 20 (220 mg, 0.5 mmol) in ch2cl2 (10 ml) were added boc - glycine (96 mg, 0.55 mmol), dmap (6.1 mg, 0.05 mmol), and edci (105 mg, 0.55 mmol). The resulting solution was stirred at rt for 2 h. solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 1:0 to 85:15) to afford a residue . To this was added 10 ml of 30% tfa / ch2cl2, and the resulting solution was stirred at rt for 2 h. solvent was evaporated under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7n), 1:0 to 85:15) to afford 153 mg (82%) of 21 . H nmr (500 mhz, cdcl3): 9.31 (br s, 1h), 7.62 (d, j = 8.4 hz, 1h), 7.44 (d, j = 8.0 hz, 1h), 7.31 (s, 1h), 7.19 (t, j = 8.0 hz, 1h), 6.93 (d, j = 7.8 hz, 1h), 5.58 (d, j = 8.4 hz, 1h), 3.34 (s, 2h), 3.33 (m, 4h), 2.29 (m, 4h), 2.22 (s, 3h). Hrms (m / z): [m + h] calcd for c18h24n5o2s, 374.1651; found, 374.1646 . To a solution of 2,4-dichloropyrimidine (22) (2.0 g, 0.0134 mmol) in toluene (20 ml) were added benzyl alcohol (1.53 ml, 1.59 g, 0.0147 mol), koh (0.82 g, 0.0147 mol), and 18-crown-6 (0.177 g, 0.00067 mol), and the resulting solution was stirred at rt for 1 h. the reaction mixture was diluted with etoac (400 ml), washed with water (3 50 ml), dried over mgso4, filtered, and concentrated to give a white solid that was chromatographed (hexane / ch2cl2, 1:1 to 3:7) to afford 2.09 g (71%) of a mixture of 23a with regioisomeric 2-(benzyloxy)-4-chloropyrimidine (relative ratio 75:25 by h nmr, respectively). Ms (m / z): [m + na] 243.1 . To a solution of 23a (2.09 g, 0.00947 mol; contains regioisomer) in dmf (34 ml) was added 1-methylpiperazine (3.15 ml, 2.85 g, 0.0284 mol), and the resulting solution was heated at 80 c for 1.75 h. solvent was removed under reduced pressure, and the residue was taken up into etoac (350 ml) and washed with brine (3 50 ml). The aqueous layer was extracted with etoac (2 50 ml), and the combined organic layers were dried over mgso4, filtered, and concentrated to give an oil that was purified by column chromatography (etoac / meoh nh3 (7 n), 1:0 to 25:1) to afford 1.88 g (70%) of 24a . H nmr (500 mhz, cdcl3): 8.06 (d, j = 5.6 hz, 1h), 7.41 (d, j = 7.0 hz, 2h), 7.35 (t, j = 7.0 hz, 2h), 7.32 (d, j = 7.0 hz, 1h), 6.03 (d, j = 5.6 hz, 1h), 5.35 (s, 2h), 3.83 (m, 4h), 2.45 (m, 4h), 2.33 (s, 3h). Ms (m / z): [m + h] 284.9 . To 24a (0.937 g, 0.0033 mol) in acetonitrile (16 ml) were added tfa (1.02 ml, 1.51 g, 0.0132 mol) and n - iodosuccinimide (0.965 g, 0.0043 mol), and the resulting solution was stirred at rt for 1 h. then 7 ml of 10% na2co3 (0.70 g, 0.066 mol) was added, and the resulting solution was stirred for 2 min . The reaction mixture was concentrated to dryness, and the residue was taken up into ch2cl2 (200 ml) and washed with 10% na2co3 (2 50 ml), 10% sodium thiosulfate (50 ml), and brine (50 ml). The organic layer was dried over mgso4, filtered, and concentrated to give an oil which was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 50:1) to yield 1.31 g (97%) of 25a . H nmr (500 mhz, cdcl3): 8.27 (s, 1h), 7.44 (d, j = 7.4 hz, 2h), 7.37 (t, j = 7.2 hz, 2h), 7.32 (d, j = 7.3 hz, 1h), 5.40 (s, 2h), 3.79 (m, 4h), 2.42 (m, 4h), 2.32 (s, 3h). Ms (m / z): [m + h] 411.0 . A mixture of 25a (0.985 g, 2.40 mmol), 3-aminobenzenethiol (255 l, 300.5 mg, 2.40 mmol), neocuproine (150 mg, 0.72 mmol), copper iodide (137 mg, 0.72 mmol), and potassium carbonate (0.663 g, 4.80 mmol) in dmf (25 ml) was stirred at 120 c for 18 h. solvent was removed under reduced pressure, and the residue was purified by column chromatography (ch2cl2/meoh nh3 (7 n), 50:1 to 20:1) to afford 0.75 g (77%) of 26a . H nmr (500 mhz, cdcl3): 8.24 (s, 1h), 7.167.30 (m, 5h), 6.99 (t, j = 7.3 hz, 1h), 6.56 (d, j = 7.6 hz, 1h), 6.386.46 (m, 2h), 5.38 (s, 2h), 3.84 (m, 4h), 3.56 (br s, 2h), 2.45 (br s, 4h), 2.33 (s, 3h). C nmr (125 mhz, cdcl3): 169.3, 164.5, 161.4, 158.1, 146.9, 138.5, 136.8, 129.6, 128.3, 127.7, 127.4, 117.6, 113.6, 112.6, 67.6, 54.8, 46.2, 43.9 . Ms (m / z): [m + h] 408.1 . To 26a (5.2 mg, 0.013 mmol) in ch2cl2 (0.2 ml) was added acetic anhydride (1.5 l, 1.6 mg, 0.0156 mmol), and the resulting solution was stirred at rt for 4 h. the solution was then concentrated to dryness under reduced pressure to give a residue which was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 20:1) to afford 4.5 mg (79%) of 27a . H nmr (500 mhz, cdcl3/meoh - d4): 8.24 (s, 1h), 7.54 (d, j = 7.7 hz, 1h), 7.227.27 (m, 3h), 7.137.20 (m, 3h), 7.09 (s, 1h), 6.87 (d, j = 7.7 hz, 1h), 5.36 (s, 2h), 3.85 (m, 4h), 2.49 (m, 4h), 2.35 (s, 3h), 2.10 (s, 3h). Ms (m / z): [m + h] 450.1 . 26a (14 mg, 0.034 mmol), et3n (24 l, 17.2 mg, 0.17 mmol), and benzoyl chloride (12 l, 14.3 mg, 0.102 mmol) in ch2cl2 (1 ml) were stirred at rt for 2 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 25:1) to afford 13.6 mg (78%) of 27b . H nmr (500 mhz, cdcl3/meoh - d4): 8.26 (s, 1h), 7.84 (d, j = 7.4 hz, 2h), 7.69 (dd, j = 1.4, 8.2 hz, 1h), 7.54 (t, j = 7.3 hz, 1h), 7.47 (t, j = 7.9 hz, 2h), 7.147.27 (m, 7h), 6.93 (dd, j = 0.9, 7.9 hz, 1h), 5.37 (s, 2h), 3.85 (m, 4h), 2.48 (m, 4h), 2.35 (s, 3h). C nmr (125 mhz, cdcl3/meoh - d4): 168.6, 166.3, 164.2, 161.3, 138.6, 138.3, 136.4, 134.8, 131.8, 129.3, 128.6, 128.3, 127.7, 127.5, 127.2, 123.4, 118.8, 117.9, 100.1, 67.8, 54.6, 45.9, 43.6 . Ms (m / z): [m + h] 512.1 . To 26a (30 mg, 0.0736 mmol) in thf (3 ml) were added boc - glycine (14.2 mg, 0.081 mmol) and dcc (16.7 mg, 0.081 mmol), and the resulting solution was stirred at rt overnight . The reaction mixture was concentrated under reduced pressure, the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 25:1) to afford an oil which was dissolved in 2.5 ml of ch2cl2/tfa (4:1), and the resulting solution was stirred at rt for 45 min . The reaction mixture was concentrated under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 15:1) to afford 24.6 mg (72%) of 27c . H nmr (500 mhz, cdcl3/meoh - d4): 8.24 (s, 1h), 7.50 (dd, j = 1.2, 8.1 hz, 1h), 7.31 (m, 1h), 7.227.27 (m, 3h), 7.137.20 (m, 3h), 6.86 (d, j = 7.9 hz, 1h), 5.37 (s, 2h), 3.85 (m, 4h), 3.39 (s, 2h), 2.49 (m, 4h), 2.35 (s, 3h). C nmr (125 mhz, cdcl3/meoh - d4): 171.4, 168.5, 164.1, 161.2, 138.2, 138.1, 136.4, 129.2, 128.2, 127.6, 127.2, 123.0, 118.2, 117.0, 67.7, 54.5, 45.8, 44.6, 43.5 . Ms (m / z): [m + h] 465.3 . To 26a (8.4 mg, 0.0206 mmol) in thf (0.5 ml) were added boc - l - alanine (5.6 mg, 0.0227 mmol) and dcc (4.7 mg, 0.0227 mmol), and the resulting solution was stirred at rt overnight . The reaction mixture was concentrated under reduced pressure, the residue was dissolved in 0.35 ml of ch2cl2/tfa (4:1), and the resulting solution was stirred at rt for 45 min . The reaction mixture was concentrated under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 15:1) to afford 4.1 mg (41%) of 27d . H nmr (500 mhz, cdcl3): 9.34 (s, 1h), 8.26 (s, 1h), 7.59 (d, j = 8.2 hz, 1h), 7.207.30 (m, 4h), 7.127.19 (m, 3h), 6.85 (m, 1h), 5.37 (s, 2h), 3.813.91 (m, 4h), 3.60 (q, j = 7.0 hz, 1h), 2.432.52 (m, 4h), 2.35 (s, 3h), 1.42 (d, j = 7.0 hz, 3h). Ms (m / z): [m + h] 479.4 . To 26a (6.6 mg, 0.0162 mmol) in thf (0.5 ml) were added boc - l - valine (4.1 mg, 0.0178 mmol) and dcc (3.7 mg, 0.0178 mmol), and the resulting solution was stirred at rt overnight . The reaction mixture was concentrated under reduced pressure, the residue was dissolved in 0.35 ml of ch2cl2/tfa (4:1), and the resulting solution was stirred at rt for 45 min . The reaction mixture was concentrated under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 15:1) to afford 4.4 mg (54%) of 27e . H nmr (500 mhz, cdcl3): 9.39 (s, 1h), 8.26 (s, 1h), 7.60 (d, j = 8.0 hz, 1h), 7.207.34 (m, 4h), 7.127.19 (m, 3h), 6.84 (d, j = 7.8 hz, 1h), 5.37 (s, 2h), 3.813.92 (m, 4h), 3.36 (m, 1h), 2.392.52 (m, 5h), 2.35 (s, 3h), 1.04 (d, j = 6.8 hz, 3h), 0.86 (d, j = 6.7 hz, 3h). Ms (m / z): [m + h] 507.2 . To 26a (8.6 mg, 0.0211 mmol) in thf (0.5 ml) were added boc - l - proline (5 mg, 0.0232 mmol) and dcc (5 mg, 0.0232 mmol), and the resulting solution was stirred at rt overnight . The reaction mixture was concentrated under reduced pressure, the residue was dissolved in 0.35 ml of ch2cl2/tfa (4:1), and the resulting solution was stirred at rt for 45 min . The reaction mixture was concentrated under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 15:1) to afford 6.0 mg (57%) of 27f . H nmr (500 mhz, cdcl3): 9.63 (s, 1h), 8.26 (s, 1h), 7.58 (dd, j = 1.2, 8.1 hz, 1h), 7.31 (t, j = 1.9 hz, 1h), 7.127.17 (m, 3h), 7.227.26 (m, 3h), 6.83 (d, j = 7.9 hz, 1h), 5.36 (s, 2h), 3.803.91 (m, 5h), 3.043.11 (m, 1h), 2.943.00 (m, 1h), 2.47 (m, 4h), 2.35 (s, 3h), 2.152.25 (m, 1h), 1.982.06 (m, 1h), 1.701.81 (m, 1h). Ms (m / z): [m + h] 505.2 . To a mixture of 22 (50 mg, 0.336 mmol), phenylboronic acid (41 mg, 0.336 mmol), sodium carbonate (110 mg in 0.5 ml of water), and dme (2.5 ml) were added palladium acetate (3.8 mg, 0.0168 mmol) and triphenylphosphine (8.8 mg, 0.0336 mmol). The reaction mixture was heated at 95 c for 20 h. solvent was removed under reduced pressure and the residue taken up into dichloromethane (20 ml), washed with water (3 5 ml), dried over mgso4, and concentrated to give a residue which was purified by preparatory tlc (hexane / etoac, 8:2) to yield 41 mg (64%) of 23b . H nmr (500 mhz, cdcl3): 8.63 (d, j = 5.2 hz, 1h), 8.068.11 (m, 2h), 7.64 (d, j = 5.3 hz, 1h), 7.477.57 (m, 3h). C nmr (125 mhz, cdcl3): 167.2, 161.9, 159.8, 135.1, 131.9, 129.1, 127.4, 115.2 . To a solution of 23b (38 mg, 0.201 mmol) in 0.5 ml of dmf was added 1-methylpiperazine (56 l, 50 mg, 0.31 mmol), and the resulting solution was heated at 90 c for 1.5 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 20:1) to yield 49 mg (95%) of 24b . H nmr (500 mhz, cdcl3): 8.36 (d, j = 5.2 hz, 1h), 8.018.09 (m, 2h), 7.437.50 (m, 3h), 6.92 (d, j = 5.2 hz, 1h), 3.96 (m, 4h), 2.50 (m, 4h), 2.34 (s, 3h). C nmr (125 mhz, cdcl3): 164.4, 162.1, 158.4, 137.8, 130.6, 128.8, 127.1, 105.8, 55.2, 46.4, 43.9 . Ms (m / z): [m + h] 255.1 . To 24b (49 mg, 0.193 mmol) in acetonitrile (1.4 ml) were added tfa (59 l, 88 mg, 0.772 mmol) and n - iodosuccinimide (43 mg, 0.193 mmol), and the resulting solution was stirred at rt for 1 h. solvent was evaporated, and the residue was taken up into dichloromethane (15 ml), washed with 10% na2co3 (2 5 ml) and water (5 ml), dried over mgso4, and concentrated to give a residue which was purified by preparatory tlc (ch2cl2/meoh, 10:1) to yield 67 mg (92%) of 25b . H nmr (500 mhz, cdcl3): 8.60 (s, 1h), 7.657.73 (m, 2h), 7.427.49 (m, 3h), 3.86 (m, 4h), 2.45 (m, 4h), 2.33 (s, 3h). C nmr (125 mhz, cdcl3): 167.5, 165.8, 160.9, 140.3, 129.7, 129.3, 128.1, 76.2, 55.0, 46.4, 43.9 . Ms (m / z): [m + h] 380.9 . A mixture of 25b (37.6 mg, 0.099 mmol), 3-aminobenzenethiol (12 l, 13.6 mg, 0.109 mmol), neocuproine (6.2 mg, 0.0297 mmol), copper iodide (5.7 mg, 0.0297 mmol), and potassium carbonate (42 mg, 0.198 mmol) in dmf (1.4 ml) was stirred at 110 c for 12 h. solvent was removed under reduced pressure, and the residue was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 10:1) to afford 10 mg (27%) of 26b . H nmr (500 mhz, cdcl3): 8.45 (s, 1h), 7.71 (d, j = 6.6 hz, 2h), 7.327.42 (m, 3h), 6.99 (t, j = 7.9 hz, 1h), 6.47 (d, j = 7.8 hz, 1h), 6.43 (dd, j = 2.0, 6.4 hz, 1h), 6.36 (d, j = 1.8 hz, 1h), 3.97 (m, 4h), 3.60 (br s, 2h), 2.52 (m, 4h), 2.37 (s, 3h). Ms (m / z): [m + h] 378.1 . To a solution of 26b (5 mg, 0.0133 mmol) in thf (0.5 ml) were added boc - glycine (2.3 mg, 0.0133 mmol) and dcc (3 mg, 0.0146 mmol). After the resulting solution was stirred for 2 h at rt, thf was evaporated, and 0.5 ml of ch2cl2/tfa (4:1) was added . The solution was stirred for 45 min and then concentrated to dryness under reduced pressure to give a residue which was purified by preparatory tlc (ch2cl2/meoh nh3 (7 n), 10:1) to afford 2 mg (35%) of 27 g . H nmr (500 mhz, cdcl3/meoh - d4): 8.45 (s, 1h), 7.69 (d, j = 8.2 hz, 2h), 7.357.45 (m, 4h), 7.31 (m, 1h), 7.17 (t, j = 8.0 hz, 1h), 6.76 (d, j = 7.8 hz, 1h), 3.96 (m, 4h), 3.36 (s, 2h), 2.56 (m, 4h), 2.38 (s, 3h). Ms (m / z): [m + h] 435.0 . Neal rosen (memorial sloan - kettering cancer center, mskcc) and kasumi-1 and molm-13 from dr . Cells were cultured routinely in dme / f12 (skbr3, mda - mb-468, mia - paca-2) or in rpmi (kasumi-1, moml-13) supplemented with 10% fetal bovine serum, 1% l - glutamine, 1% penicillin, and streptomycin . Cells were grown to 6070% confluence and treated with inhibitor or dmso vehicle for the indicated times . Protein lysates were prepared in 50 mm tris, ph 7.4, 150 mm nacl, and 1% np-40 lysis buffer . Protein concentrations were measured using the bca kit (pierce) according to the manufacturer s instructions . Page, transferred onto a nitrocellulose membrane, and incubated with the indicated primary antibodies: anti - her2 from rabbit (1:250, 28 - 0004, zymed), anti - raf-1 from rabbit (1:500, sc-133, santa cruz), anti - parp (p85 fragment) from rabbit (1:500, g7341, promega), anti--actin from mouse (1:2500, a1978, sigma - aldrich), anti - akt from rabbit (1:500, 9272, cell signaling), anti - p - stat3 (y705) from rabbit (1:500, 9145, cell signaling), anti - p - stat5 (y694) from rabbit (1:500, 9351, cell signaling), anti - flt3 form rabbit (1:500, sc-480, santa cruz), anti - hop from mouse (1:500, sra-1500, enzo), and anti - hsp / c70 from mouse (1:2000, smc-106b, stressmarq). Membranes were then incubated with a corresponding peroxidase - conjugated secondary antibody (1:3000 dilution). For the competition studies, fluorescence polarization (fp) assays briefly, fp measurements were performed on an analyst gt instrument (molecular devices, sunnyvale, ca). 3650) where both the excitation and the emission occurred from the top of the wells . A stock of 10 m gm - cy3b was prepared in dmso and diluted with felts buffer (20 mm hepes (k), ph 7.3, 50 mm kcl, 2 mm dtt, 5 mm mgcl2, 20 mm na2moo4, and 0.01% np40 with 0.1 mg / ml bgg). To each 96-well plate were added 6 nm fluorescent gm (gm - cy3b), 3 g of skbr3 lysate (total protein), and tested inhibitor (initial stock in dmso) in a final volume of 100 l of hfb buffer . Background wells (buffer only), tracer controls (free, fluorescent gm only), and bound gm controls (fluorescent gm in the presence of skbr3 lysate) were included on each assay plate . The assay plate was incubated on a shaker at 4 c for 24 h, and the fp values (mp) were measured . The fraction of tracer bound to hsp90 was correlated to the fp value and plotted against the values of competitor concentrations . The inhibitor concentration at which 50% of bound gm was displaced was obtained by fitting the data . All experimental data were analyzed using softmax pro 4.3.1 and plotted using prism 4.0 (graphpad software inc ., san diego, ca). This reagent offers a rapid objective measure of cell viability in cell culture, and it uses the indicator dye resazurin to measure the metabolic capacity of cells, an indicator of cell viability . Briefly, cells were plated on costar 96-well plates . For attached cells (such as skbr3), 8000 cells / well were used . For suspension cells (such as kasumi-1), 20000 cells / well were plated . Cells were allowed to incubate for 24 h at 37 c before drug treatment . Drugs were added in triplicate at the indicated concentrations, and the plate was incubated for 72 h. alamar blue (50 m) was added and the plate read 6 h later using the analyst gt (fluorescence intensity mode, excitation 530 nm, emission 580 nm, with a 560 nm dichroic mirror). The percentage cell growth inhibition was calculated by comparing fluorescence readings obtained from treated versus control cells, accounting for the initial cell population (time zero). Molm-13 cells (30000 cells / well) were plated in black 96-well plates (corning no . 3603) in 40 l of rpmi medium and left in an incubator (37 c, 5% co2) for up to 24 h. cells were treated for 16 h with compounds or dmso (control) at the desired concentrations in 50 l of medium . Following exposure of cells to hsp70 inhibitors, 50 l of buffer containing 10 mm hepes (ph 7.5), 2 mm edta, 0.1% chaps, and the caspase substrate z - devd - r110 at 25 m was added to each well . Plates were incubated until the signal stabilized, and then the fluorescence signal of each well was measured in an analyst gt microplate reader . The percentage increase in apoptotic cells was calculated by comparison of the fluorescence reading obtained from treated versus control cells . Skbr3 cells were treated with the indicated concentrations of the inhibitor for 24 h. samples were collected and lysed in 20 mm tris, ph 7.4, 25 mm nacl, 0.1% np-40 buffer with protease inhibitors added . Aliquots of 500 g of total protein adjusted to 100 l with the lysis buffer were prepared . Samples were incubated with 5 l of bb70 antibody (stressmarq) or normal igg (as a negative control) and 20 l of protein g agarose beads (upstate) at 4 c overnight . Samples were washed five times with the lysis buffer and applied to sds page followed by a standard western blotting procedure to detect levels of hop protein in the hsp / c70 complexes upon treatment . Hek293 cells were transfected with 2 g of luciferase plasmid and 8 g of hsp70 plasmid or control vector per 60 mm dish . Human hsp70, hsp70-c267s, and hsc70 were n - terminally flag - tagged, and luciferase was c - terminally ha - tagged in pcdna3.1 . Two days after transfection, cells were treated with cycloheximide (sigma) at 50 g / ml to inhibit protein synthesis, transferred to 45 c for 1 h, and then brought back to 37 c for up to 2 h of recovery . 27c cell samples, taken before heat shock and at 0, 1, and 2 h of recovery, were lysed on ice with pbs containing 1% triton x-100, and the insoluble material was removed by centrifugation at 20000 g . Total protein amounts in the supernatants were determined using the bca protein assay kit (pierce). Luciferase enzymatic activities in the supernatants were measured using the luciferase reporter assay kit (promega) and activity values normalized to total protein amounts . Cells were treated with cycloheximide (at a final concentration of 100 g / ml) with added vehicle (dmso) or 27c (20 m) for the indicated times . Cells were lysed as indicated above, and the resulting samples were analyzed by western blotting.
In ischemic stroke patients with> 70% stenosis of the internal carotid artery (ica) or middle cerebral artery (mca), the risk of recurrent stroke is high, and stent placement is considered to decrease the risk of further ischemic events . Cerebrovascular reserve (cvr), defined as the increase in cbf in response to a vasodilatory stimulus, is known to reflect the capacity of the brain to maintain adequate blood flow in the face of decreased perfusion due to arterial stenosis . Cvr has been identified as a predictor of ischemic stroke, but it is currently unclear whether the degree of stenosis or the cvr is a better predictor of ischemic stroke . Cvr can be measured by perfusion computed tomography (ct) with inhalation of co2 . The aim of this study was to measure cvr by perfusion ct with inhalation of co2, and to determine whether cvr is a better predictor of stroke than the degree of stenosis of the ica or mca . This study analyzed 37 patients who were treated at capital medical university affiliated beijing chaoyang hospital between march 2006 and july 2009 . The inclusion criteria were: age 2580 years; ica or mca stenosis or occlusion; cerebral angiography performed; and medical treatment only without stent placement, endarterectomy, or bypass surgery . Patients were excluded if they had evidence of infarction in the territory of a stenosed or occluded ica or mca . The patients were 27 men and 10 women with a mean age of 58.011.9 years (range 2576 years). All patients were initially treated for ipsilateral ischemic events, including transient ischemic attacks in 21 patients and minor completed ischemic strokes in 16 patients . All 37 patients underwent cerebral angiography, which showed ica occlusion in 7 patients, mca occlusion in 3 patients, and 3095% stenosis of the ica or mca in the remaining patients . Ct and fluid - attenuated inversion - recovery magnetic resonance imaging (mri) showed no evidence of infarction in the territories of the stenosed or occluded arteries . The study protocol was approved by our institute s committee on human research and written informed consent was obtained from every participant . Patients were divided into groups according to the degree of stenosis: 7099% stenosis or occlusion (stenosis 1) or 3069% stenosis (stenosis 2); and according to cvr: 10% cvr (cvr 1) or <10% cvr (cvr 2). Cerebrovascular reserve was measured using 16-detector row dynamic ct with inhalation of 5% co2 and 95% o2 (carbogen). Patients wore a face mask that was connected to a gas bag with a one - way valve, which was connected to a humidification bottle and then to a 2-l steel 10-kpa carbogen bottle . The gas flow varied from 4 to 10 l / min to ensure that the patient was able to breathe comfortably . The face mask and head of the patient were fixed to the scan bed to avoid movement of the head . Inhalation of carbogen started 20 min later, followed by a second dynamic ct scan . Two axial slices (thickness 10 mm) were selected: 1 through the basal ganglia and 1 through the corona radiata . Nonionic contrast agent (40 ml) was administered at a constant rate of 6 ml / s via an antecubital vein using a power injector . For each of the mca territory sections studied, an experienced neuroradiologist manually marked regions of interest on the cerebral blood flow (cbf) map over the parietal cortical gray matter of the expected territory of the mca bilaterally . Cvr was calculated according to the formula: all patients received medical treatment and were followed up at the outpatient clinic or by telephone . The clinical background characteristics were compared between groups using the independent samples t test or pearson s chi - square test . The rate of ischemic stroke was compared between groups using pearson s chi - square test . This study analyzed 37 patients who were treated at capital medical university affiliated beijing chaoyang hospital between march 2006 and july 2009 . The inclusion criteria were: age 2580 years; ica or mca stenosis or occlusion; cerebral angiography performed; and medical treatment only without stent placement, endarterectomy, or bypass surgery . Patients were excluded if they had evidence of infarction in the territory of a stenosed or occluded ica or mca . The patients were 27 men and 10 women with a mean age of 58.011.9 years (range 2576 years). All patients were initially treated for ipsilateral ischemic events, including transient ischemic attacks in 21 patients and minor completed ischemic strokes in 16 patients . All 37 patients underwent cerebral angiography, which showed ica occlusion in 7 patients, mca occlusion in 3 patients, and 3095% stenosis of the ica or mca in the remaining patients . Ct and fluid - attenuated inversion - recovery magnetic resonance imaging (mri) showed no evidence of infarction in the territories of the stenosed or occluded arteries . The study protocol was approved by our institute s committee on human research and written informed consent was obtained from every participant . Patients were divided into groups according to the degree of stenosis: 7099% stenosis or occlusion (stenosis 1) or 3069% stenosis (stenosis 2); and according to cvr: 10% cvr (cvr 1) or <10% cvr (cvr 2). Cerebrovascular reserve was measured using 16-detector row dynamic ct with inhalation of 5% co2 and 95% o2 (carbogen). Patients wore a face mask that was connected to a gas bag with a one - way valve, which was connected to a humidification bottle and then to a 2-l steel 10-kpa carbogen bottle . The gas flow varied from 4 to 10 l / min to ensure that the patient was able to breathe comfortably . The face mask and head of the patient were fixed to the scan bed to avoid movement of the head . Inhalation of carbogen started 20 min later, followed by a second dynamic ct scan . Two axial slices (thickness 10 mm) were selected: 1 through the basal ganglia and 1 through the corona radiata . Nonionic contrast agent (40 ml) was administered at a constant rate of 6 ml / s via an antecubital vein using a power injector . For each of the mca territory sections studied, an experienced neuroradiologist manually marked regions of interest on the cerebral blood flow (cbf) map over the parietal cortical gray matter of the expected territory of the mca bilaterally all patients received medical treatment and were followed up at the outpatient clinic or by telephone . The clinical background characteristics were compared between groups using the independent samples t test or pearson s chi - square test . The rate of ischemic stroke was compared between groups using pearson s chi - square test . Eighteen of the 37 patients had 70% stenosis (stenosis group 1) and 19 had <70% stenosis (stenosis group 2). Nineteen patients had 10% cvr (cvr group 1) and 18 had <10% cvr (cvr group 2) (table 1). Comparisons of the clinical background characteristics between groups using the independent samples t test or pearson s chi - square test did not show any significant differences between groups divided according to the degree of stenosis or the cvr (all p>0.05; table 1). During an average follow - up period of 56.9 months (range 2473 months), ischemic stroke occurred in 7 of the 37 patients . Ischemic stroke occurred in 0 of 19 patients in cvr group 1 (annual risk 0%), 7 of 18 patients in cvr group 2 (annual risk 7.7%), 3 of 18 patients in stenosis group 1 (annual risk 3.3%), and 4 of 19 patients in stenosis group 2 (annual risk 4.7%). Comparisons using pearson s chi - square test showed a significant difference in the rate of ischemic stroke between cvr group 1 and cvr group 2 [odds ratio (or) 1.700; 95% confidence interval 1.1422.530; p=0.003]. There was no significant difference in the rate of ischemic stroke between stenosis group 1 and stenosis group 2 (p=0.691; table 1). One was a 52-year - old male with <70% stenosis (ica 50% stenosis) and <10% cvr (-5%) who died of acute myocardial infarction after 69 months, and the other was a 69-year - old male with <70% stenosis (ica 40% stenosis and tandem mca stenosis 50%) and 10% cvr (20%) who died of heart failure after 24 months . Eighteen of the 37 patients had 70% stenosis (stenosis group 1) and 19 had <70% stenosis (stenosis group 2). Nineteen patients had 10% cvr (cvr group 1) and 18 had <10% cvr (cvr group 2) (table 1). Comparisons of the clinical background characteristics between groups using the independent samples t test or pearson s chi - square test did not show any significant differences between groups divided according to the degree of stenosis or the cvr (all p>0.05; table 1). During an average follow - up period of 56.9 months (range 2473 months), ischemic stroke occurred in 7 of the 37 patients . Ischemic stroke occurred in 0 of 19 patients in cvr group 1 (annual risk 0%), 7 of 18 patients in cvr group 2 (annual risk 7.7%), 3 of 18 patients in stenosis group 1 (annual risk 3.3%), and 4 of 19 patients in stenosis group 2 (annual risk 4.7%). Comparisons using pearson s chi - square test showed a significant difference in the rate of ischemic stroke between cvr group 1 and cvr group 2 [odds ratio (or) 1.700; 95% confidence interval 1.1422.530; p=0.003]. There was no significant difference in the rate of ischemic stroke between stenosis group 1 and stenosis group 2 (p=0.691; table 1). One was a 52-year - old male with <70% stenosis (ica 50% stenosis) and <10% cvr (-5%) who died of acute myocardial infarction after 69 months, and the other was a 69-year - old male with <70% stenosis (ica 40% stenosis and tandem mca stenosis 50%) and 10% cvr (20%) who died of heart failure after 24 months . Patients with 70% symptomatic stenosis of the ica or mca are considered to have a high risk of ischemic stroke [46], and are often treated by arterial stenting . However, it has been reported that not all patients with 70% stenosis have an increased risk of stroke . Scott et al . Reported that patients with 9099% stenosis have a relatively low risk of stroke . Domenico et al . Reported a similar phenomenon in patients with symptomatic ica stenosis of 9599% . It seems that the risk of stroke risk does not always increase as the degree of stenosis increases, but the reason for this is unknown . There is increasing evidence suggesting that cvr may be an independent predictor of stroke in symptomatic patients with large cerebral artery stenosis or occlusion [2,912], although some studies have reported conflicting results (table 2). A meta - analysis found that impairment of cvr was strongly associated with an increased risk of ischemic events in patients with carotid artery stenosis or occlusion (or 3.86). Another meta - analysis found that impairment of cvr was associated with an increased risk of stroke in asymptomatic patients (or 6.14). The results of this study show that impairment of cvr was associated with an increased risk of stroke (or 1.70), and that stenosis of 70% was not associated with a higher risk of stroke than stenosis of <70% . Research reported that 20% future strokes are not related to ica stenosis in patients with ica stenosis of 70% . Embolism formation is associated with vulnerable atherosclerotic plaque, which is not necessarily associated with the degree of stenosis . Detachment of the embolism may result in dilation of the arteriole, which affects cvr . In a stenosed artery, the degree of stenosis affects flow, but reduced flow may also result in formation of collateral circulation . The degree of stenosis is not necessarily well correlated with perfusion, such as in a patient with severe stenosis of the ica but abundant collateral circulation in the temporal lobe . When measuring cvr, there are 2 methods of inducing cerebral vasodilation: inhalation of co2 or injection of acetazolamide . The increase in cbf after inhalation of co2 may result from vasodilatation secondary to extracellular and intracellular acidification of vascular smooth muscle cells, or from neurogenic mechanisms via stimulation of the vasomotor center of the brain stem . Acetazolamide selectively inhibits carbonic anhydrase in erythrocytes, glial cells, capillary endothelium, and the choroid plexus; and induces extracellular acidosis of vascular smooth muscle cells, resulting in vasodilation . Although there may be differences in the mechanisms underlying these 2 methods, they are both widely used in clinical practice [2,914], and long - term cvr follow - up studies using these methods have reported similar results (table 2) [2,912]. Why did we choose 10% as a cut - off point to divide cvr groups? To the best of our knowledge, no prospective studies assessing cvr impairment and stroke risk have been performed with perfusion ct . A study using single - photon emission ct and acetazolamide to measure cvr, and adopting 11% as a cut - off point to divide cvr groups, reported a positive result; therefore, we tried 10% as a cut - off point to divide cvr groups and obtained satisfactory results . This study included 10 patients with ica or mca occlusion, of which 1 patient (cvr 5%) had a recurrent stroke . The other 9 patients (cvr 49%, 19%, 12%, 4%, 5%, 19%, 34%, 92%, and 11%) did not develop tia or recurrence of stroke during the follow - up period . One was a 52-year - old male with 50% ica stenosis and 5% cvr who died of acute myocardial infarction (ami) 69 months later . This man did not have heart disease or diabetes mellitus history, but did have hypertension, lipid metabolism disturbance, and smoking history, as well as ica - unstable atherosclerosis plaque (2.6-mm thick). The other patient was a 69-year - old male with ica 40% stenosis, tandem mca stenosis 50% and 20% cvr, who died of heart failure 24 month later . This man did not have heart disease or smoking history, but had hypertension, lipid metabolism disturbance, and diabetes mellitus history, as well as ica unstable atherosclerosis plaque (3.6-mm thick). Firstly, the cbf recorded in this study was 91.737.5 ml/100 g / min, which is higher than previously reported values . The cbf in the parietal cortex was previously reported be 72.08.5 ml/100 g / min in healthy individuals . This difference may be because the measured cbf is higher on perfusion ct than on positron emission tomography . Secondly, this was a single - center study with a small sample, and multiple large - sample studies are needed to confirm this result . Cerebrovascular reserve may be a more accurate predictor of stroke than degree of ica or mca stenosis . In clinical practice, when screening patients for stent placement to prevent future stroke, cvr should be considered because it may be more important than ica or mca stenosis degree.
Breast cancer (bc) is a prevalent cancer among women worldwide, and it has been estimated that there are 71 cases of bc per year for every 100 000 women in brazil . It is one of the most common causes of death among women, and epidemiological studies indicate that the age of onset is slowly, but steadily, becoming lower . This suggests that there may be changes in environmental factors that are affecting bc risk . The risk factors for bc include early age of menarche, delayed menopause, contraceptive use, hormonal replacement therapy, above - average body mass index, exposure to environmental pollutants, smoking, and alcohol use [13]. However, it is generally believed that the initiation of bc is a consequence of cumulative genetic damage, which leads to genetic alterations that result in the activation of proto - oncogenes and the inactivation of tumor suppressor genes . A large number of genetic variants that are associated with bc risk have been identified in genes involved in a wide variety of functions, including steroid hormone metabolism, detoxification of environmental carcinogens, dna damage repair, and tumor suppression . As observed in drug and chemical metabolism, there is considerable interindividual variability (i.e., polymorphisms) in the conjugation pathways of both estrogen and catechol estrogens . These person - to - person differences, which are attributed to polymorphisms in the genes encoding for the respective enzymes, may define subpopulations of women with higher lifetime exposure to hormone - dependent growth promotion or to cellular damage from particular estrogens and/or estrogen metabolites . Current evidence suggests that the metabolic by - products of estrogens in the body may act as initiators of cellular alterations . Estrogen metabolism products such as quinone - catecholestrogen can bind to dna and form dna adducts . The generation of free radicals by metabolic redox cycling between quinone and hydroquinone can damage dna by causing strand breaks, 8-hydroxylation of purines, and lipid hydroperoxide - mediated dna modifications . Although still controversial, a number of genes involved in biogenesis (cyp17), bioavailability (cyp1b1 and cyp1a1), and degradation (comt) of estrogen compounds contain polymorphisms that could affect susceptibility to bc . They are called low penetrance genes (or sometimes modifier genes) and are, in this instance, defined as genes in which subtle sequence variations or polymorphisms may be associated with a slightly to moderately increased relative risk for bc . The hypothesis of the present study is that polymorphic variants of the estrogen metabolizing genes cyp17, cyp1b1, cyp1a1, and comt may affect the spontaneous levels of chromosome damage in lymphocytes of bc patients and subsequently modulate bc risk . Therefore, the objective of the present work was to correlate the genotypes of polymorphic variants of the above - mentioned genes with the basal levels of chromosome damage in lymphocytes of untreated bc patients and healthy individuals . Micronucleus assay was employed to determine the extent of baseline chromosome damage in bc patients and controls, and pcr - rflp was used for genotype analysis . The bc patient group consisted of 62 untreated women diagnosed with in situ or invasive ductal breast carcinoma, ranging in age from 25 to 60 years old (mean age, 50.5 years old) and free of any pathology associated with the use of medication that is known to cause dna damage . The control group consisted of 62 women with ages ranging from 25 to 50 years (mean age, 46.7-years old). They were enrolled in the control group after a detailed investigation in order to ensure that they were free from any breast pathology . They came from the same geographical location, their dietary habits were not appreciably different, and they were not occupationally exposed to genotoxic chemicals . None of the subjects reported alcohol consumption, the use of genotoxic medicine, presence of known inherited genetic disorders or chronic diseases or exposure to ionizing or nonionizing radiation, even for diagnostic or therapeutic purposes, for at least one month prior to enrolling in the study . Patients and controls enrolled in the present study did not report family history of breast and/or ovarian cancer . This investigation was approved by the national ethics committee (conep: 1217/2004) and was performed in accordance with ethical standards . Informed consent of patients and controls was obtained before inclusion in the study and sample collection . Samples of venous blood (10 ml) were collected in heparinized and edta vacutainer tubes (becton dickinson, nj, usa) by venepuncture under sterile conditions . The samples were coded, immediately protected from direct light, and processed for genotyping and micronucleus assay . Genomic dna samples were obtained from blood lymphocytes using a wizard genomic dna purification kit (promega, madison, wi). Isolated dna was resuspended in tris - edta buffer (ph 8.0) and stored at 20c until use . The t1931c polymorphism of the cyp17 gene was determined by pcr - rflp with the following primers: sense, 5-caaggtgaagatcagggtag-3 and antisense, 5-gctagggtaagcagcaagag-3. The 145 bp product was digested overnight with 8 u of the restriction enzyme mspa1i . The t allele remained intact, but the c allele was digested into 75 and 70 bp fragments . The v432l polymorphism of the cyp1b1 gene was genotyped with the following primers: sense, 5-tcacttgcttttctctctcc-3 and antisense, 5-aatttcagcttgcctcttg-3. The 650 bp product was digested overnight with 8 u of the restriction enzyme acui . The genotypes of the t3205c polymorphism of the cyp1a1 gene were determined with the following primers: sense, 5-taggagtcttgtctcatgcct-3 and antisense, 5-cagtgaagaggtgtagccgct-3. The 340 bp pcr product was digested for 3 h with 5 u of the restriction enzyme mspi . The c allele was digested into 200 and 140 bp fragments, whereas the t allele remained intact . The genotypes of the v158 m polymorphism of the gene comt were determined with the following primers: sense, 5-tactgtggctactcagctgt-3 and antisense, 5-tgaagctggtgtgaacacct-3. The 114 bp pcr product was digested with 5 u of the restriction enzyme nlaiii . The met allele was digested into fragments of 96, 54, 39, and 27 bp, whereas the val allele was digested into fragments of 54 and 39 bp only . Lymphocyte cultures were prepared combining 0.5 ml of isolated lymphocytes in plasma with 5 ml of complete medium containing 78% of rpmi (sigma - aldrich co., usa), 20% inactivated fetal bovine serum (gibco - invitrogen, denmark), the antibiotics penicillin (5 g / ml, sigma - aldrich co., usa) and streptomycin (10 g / ml, sigma - aldrich co., usa), and 2% phytohemagglutinin (life technologies, grand island, ny, usa) to stimulate cell proliferation . Cultures were incubated at 37c . After 44 hours of incubation, cytochalasin b (sigma - aldrich co., usa) was added to the cultures to a final concentration of 4 g / ml, according to the method of fenech and morley . One thousand binucleated cells were analyzed per individual and the frequency of binucleated cells micronucleated (bcmn) was determined according to the criteria described by fenech . The mann - whitney statistical test was used to compare bcmn between patients and controls . The frequency of bcmn in different genotypes was analyzed with one - way anova and the statistical differences between groups for bc risk was calculated using fisher's exact test (two - tailed). Crude odds ratios (ors) were calculated and are given with 95% confidence intervals (cis). Table 1 compares and shows the homogeneity of bc patients and control groups according to their smoking habits, menopause status, hormone replacement therapy, and full - term pregnancy . Basal level of chromosome damage was measured by micronucleus (mn) assay in lymphocytes from 62 bc patients and 62 age - matched controls, as shown in figure 1 . Bc patients exhibited higher levels of chromosome damage than controls according to bcmn (p <.05). The genotype distributions for all cases were in agreement with those predicted by the hardy - weinberg equilibrium . An association between bc occurrence and the c allele of the t1931c polymorphism in the cyp17 gene was observed in the postmenopause group (or 4.3; 95% ci 1.313.7). Cyp1b1 v432l polymorphism had no association with bc occurrence in pre- and postmenopause women, however, in the premenopause women we observed increased risk to bc when the c allele of cyp1a1 gene (t3205c polymorphism) was present (or 10.5; 95% ci 2.641.7). Comt met allele was also associated with bc occurrence in premenopause women (or 3.2; 95% ci 1.18.6). The basal levels of chromosome damage in bc patients and controls among the different genotypes are presented in table 3 . Bcmn frequencies were higher in bc than in control group in all genotypes except for val / val of comt gene where differences between patients and controls were not significant (p = .07). We also evaluated the influence of different genotypes considering the levels of chromosome damage in patient and control groups individually (figure 2). Cyp17 t1931c and cyp1a1 t3205c polymorphisms had no influence in the frequency of bcmn in patients as well as in controls . However, in control group, cyp1b1 432l allele was related to increased frequencies of bcmn (p = .006). Differently, patients with v158 m polymorphism of comt gene presented higher frequencies of bcmn when compared to the wild - type counterparts (p = .04). Finally, we tested the risk to bc in the group of patients and controls that presented frequencies of bcmn higher than the mean (higher than 18.5 bcmn for patients and higher than 9.5 bcmn for controls) (table 4). Cyp17, cyp1b1, and cyp1a1 polymorphisms did not modify the occurrence of bc, however, comt v158 m polymorphism was more frequent in bc than in control group and resulted in significant or increasing (or 3.5; 95% ci 111.4). Dna damage can occur spontaneously or as consequence of exposure to chemical or physical genotoxins . There are modulators that can affect the levels of spontaneous dna damage, including dna repair genes, antioxidant defense genes, and estrogen - metabolizing gene polymorphisms that can lead to the accumulation of genotoxic estrogen subproducts . High serum estrogen levels are thought to be a major risk factor for bc . In vitro and in vivo animal and patient - based studies suggest that estrogens, their metabolic compounds, and the entire biochemical metabolic machinery may play a role in bc carcinogenesis . We can look forward into two different processes by which hormones are related to bc: (i) one involves the binding of estradiol to estrogen receptor (er) alpha with the stimulation of cell proliferation . Errors in dna occurring during replication result in fixed mutations when not well repaired; (ii) the other process results from the formation of genotoxic metabolites of estradiol, which can bind to dna, cause depurination, and also result in mutations . Herein, we focused on the second process . Therefore, in the present study, the relationship between the snps in four estrogen - metabolizing genes and basal levels of chromosome damage was examined using lymphocytes of untreated bc women and healthy controls once lymphocytes can circulate for years or even decades, accumulating mutations in their dna . Results presented here show that the basal levels of chromosome damage detected by mn assay and observed in the control group are in accordance with those previously reported in other control populations of similar age [15, 16]. It is well known that mn are formed by the condensation of acentric chromosomal fragments or by whole chromosomes lagging behind during cell division and that this is the only biomarker that allows the evaluation of both clastogenic and aneuploidogenic effects in a vast range of cells, as they are detected in interphase . As we did not observe any statistical difference between smoking and nonsmoking patients or controls (data not shown), we grouped these two subsets together for the analysis of the basal levels of chromosome damage in patients and controls . The investigation of basal levels of chromosome damage in peripheral lymphocytes of untreated cancer subjects has been previously reported . Baseline levels of dna damage were significantly higher in bladder cancer patients than in controls, and the frequency of mn in stimulated peripheral blood cells from an untreated leukemia population was significantly greater than that in the control group . Similar results were found by lou et al ., who simultaneously investigated both baseline and ionizing radiation - induced (ir) genetic damage in peripheral lymphocytes from 36 cancer patients using mn and comet assays . They found that both spontaneous and ir - induced genetic damages were higher in patients than in controls . In the present study, the primary objective was to investigate the relationship between the genotypes of polymorphisms in estrogen - metabolizing genes and the extent of endogenous chromosome damage . Although this is not an epidemiological study, the odds ratio for the different genotypes was also examined and displayed interesting findings . The results presented here show that there is a slight significant relationship between the cyp17 polymorphism, and bc risk is postmenopausal women, however, we found no correlation between spontaneous chromosome damage and the t1931c polymorphism of cyp17 gene, which encodes for cytochrome p450c17, a 17-hydroxylase that catalyzes the conversion of pregnenolone and progesterone to 17-oh - pregnenolone and 17-oh - progesterone, respectively . Cytochrome p450c17 also has a 17,20-lyase activity that converts hydroxylase products to dehydroepiandrosterone (dheas) and androstenedione, respectively, which can be further converted to estrogens and testosterone . It has been hypothesized that certain genotype variants in the cyp17 gene result in higher hormone levels, leading to an increased risk of bc . However, non - hispanic white women who were heterozygous or homozygous for the variant allele of cyp17 had lower estrone, total testosterone, free testosterone, and dheas concentrations compared to women homozygous for the wild - type allele . Chen and pei applied both traditional meta - analysis and bayesian approach to determine the overall effect of cyp17 t1931c polymorphism on risk of bc and detected that carriers of c allele were positively associated with risk of bc in postmenopausal women and were inversely related to bc in pre - menopausal women . The v432l polymorphism of the cyp1b1 gene is located within a catalytic heme - binding domain in exon 3 and has been analyzed in several independent studies that present controversial results . Chinese women with the leu / leu genotype at the l432v polymorphism had a higher risk of bc (or = 2.0, 95%; ci = 1.03.7). A positive association was also seen in turkish women but was limited to those with a high body mass index (or = 2.3, 95%; ci = 1.34.2). In contrast, results presented here showed no association between v432l polymorphism and bc occurrence in pre- or postmenopause women (or 2.5, 95% ci 0.87.5 and or 0.6, 95% ci 0.22.1, resp . ). A significant inverse association between the val allele and bc risk was previously observed in studies of african american or mixed populations . It is interesting to note that in the control group, carriers of the leu allele exhibited higher levels of dna damage compared to homozygous wild - type individuals while this was not observed in the patients group . We believe that this difference between patients and controls is mostly due to the increased spontaneous levels of chromosome damage in bc which makes it difficult to identify suitable differences in bcmn between polymorphic and wild - type individuals . It has been described that cyp1b1 catalyzes c4 hydroxylation of estradiol (4-hydroxyestradiol (4-ohe2)). This metabolite can undergo metabolic redox cycling to generate free radicals such as superoxide and chemically reactive estrogen semiquinone / quinone intermediates, which can form dna adducts [27, 28]. Anyway, these results suggest further investigation of this polymorphism combined with other low - penetrance gene polymorphisms such as dna repair in the modulation of spontaneous chromosome damage in healthy women . Cytochrome p450 1a1 (cyp1a1) is one of the most important phase i enzymes expressed in breast tissue . It catalyzes estrogen 2-hydroxylation, generating the 2-oh estrogen metabolite, which can form dna adducts [28, 29]. The 3205tc polymorphism in cyp1a1 is located in the 3 noncoding region and can affect the modulation of enzymatic activity and thereby the susceptibility risk to bc . The results presented here showed that the frequency of this polymorphism was higher in premenopause bc women than in controls and resulted in association to bc risk (or 10.5, 95% ci 2.641.7), however, it had no effect on the frequency of bcmn in patients or in control group . The rare ct and cc genotypes were detected in 14 patients and three controls, and it, therefore, resulted in an extensive confidence interval (ci). Similar results were observed by taioli et al . That demonstrated an association between this polymorphism and bc cancer risk in african american women (or = 9.7 95%, ci 2.047.9), and huang et al . Nevertheless, the association observed here must be interpreted with caution considering the number of individuals included in the present study and the fact that c allele is rare . The catechol - o - methyltransferase (comt) catalyzes the addition of a methyl group to reactive catechol estrogens, converting them into stable methyloxyestrogen conjugates . In patients group, carriers of met allele of the comt gene exhibited higher levels of chromosome damage relative to those homozygous for the wild - type allele . Besides, when the analysis considered the association of bc occurrence in individuals that exhibited levels of chromosome damage higher than the mean, met allele was strongly associated with bc occurrence . This was an interesting finding especially if we consider that biomarkers of susceptibility and risk contribute to the identification of high - risk subgroups of the population, independent of whether they are associated with previous exposure or they are involved in a defined pathway or mechanism . It is known that g to a polymorphism at codon 108 in the comt gene leads to a substitution of methionine to valine, resulting in decreased enzymatic activity and increased thermolability [34, 35]. As metabolites of catechol estrogens have the potential to induce oxidative dna damage and form dna adducts, the conversion of catechol estrogens into stable conjugates may be important in preventing bc . In a previous study of a taiwanese population, a strong association between the comt polymorphism and bc risk was observed (or = 3.5 95%, ci 1.1513.3). The correlation between genetic polymorphisms and specific phenotypes was evaluated by synowiec et al . . They correlated a polymorphism in a dna repair gene with oxidative dna damage in 41 bc patients and 48 controls . They demonstrated a strong association between bc occurrence and the c / c genotype of the rad51 - 135g / c polymorphism, the ser / ser genotype of the ogg1-ser326cys polymorphism and the lys / gln genotype of the xpd - lys751gln polymorphism . In contrast, the g / c genotype of the rad-135g / c polymorphism and the lys / lys genotype of the xpd - lys751gln polymorphism exhibited a protective effect against bc . In this study, the risk of bc was calculated in patients and controls that had higher levels of endogenous oxidative dna damage . We previously reported that brazilian untreated bc patients exhibited higher levels of chromosome damage than healthy controls and that xrcc3 polymorphism was weakly associated with the risk to bc in those individuals that presented higher levels of chromosome damage . It is well known that dna damage as detected in peripheral blood represents a surrogate for what would be observed in breast tissue . While the polymorphisms are obviously expressed in both breast tissue and lymphocytes, the level of expression of the genes and in particular, the level of substrate that in our present hypothesis is estradiol, may be and is likely very different within breast tissue and the lymphocytes, however, genome damage in lymphocytes may be correlated with cancer - initiating events in target tissues via a common genetic, dietary, or environmental factor . Therefore, the manifestation of effects of the polymorphisms on levels of the reactive quinones may be quite different in breast tissue and lymphocytes, making extrapolation of the findings being reported to implications for bc quite tenuous . As mentioned above, this is not an epidemiological study and although the limited number of participants, we consider that our results point that polymorphisms in the enzymes involved in the metabolism of estradiol / estrone to reactive quinones that cause dna damage may represent low penetrance risk factors susceptible of further detailed investigations . It is unknown whether the healthy controls and patients with bc had equal levels of dna damage before the appearance of clinical symptoms in the patients . It is also unclear whether mn enhancement is a consequence or causative agent of the disease process . However, the followup of those controls who are carriers of met allele of cyp1b1 gene that exhibited higher frequencies of bnmn than wild - type counterparts could help to further answer this question . In conclusion, according to the data presented here both the genetic background of genes involved estrogen metabolism and dna damage in healthy controls and patients can modulate bc risk reflected by higher chromosomal damage in lymphocytes.
In 1992, brugada syndrome (bs) was first described as a new clinical entity characterized by a typical electrocardiogram (ecg) pattern {right bundle branch block (rbbb) and persistent st - segment elevation in right precordial leads} and sudden cardiac death.1)2) after the first formal description in the medical literature, this clinical entity has been increasingly diagnosed.2 - 4) in patients with bs, sudden onset of ventricular tachycardia may develop; when this arrhythmia persists, it can degenerate into ventricular fibrillation, resulting in sudden cardiac death . Bs is known as a disease that is inherited via an autosomal dominant mode of transmission with varying penetration.2)5) although this syndrome is commonly known to manifest in adulthood, usually in the fifth decade, some pediatric cases have been reported, including one of a 2 day - old infant.6) to the best of our knowledge, there have been no reports on bs in korean children . A one - month - old male infant presented to the outpatient - department (opd) for systolic murmur . The patient visited opd regularly, and no remarkable symptoms were found . Because the vsd was of moderate size without significant hemodynamic compromise, when he was 4 months old, ecg revealed significant qrs widening in right precordial leads, with saddle back st elevation in the v3 lead (fig . The pattern of ecg changed progressively until 6 months of age, when definitive st elevation with t wave inversion of brugada type 1 pattern was observed (fig . 1c). At 24-hour holter monitoring, rare, premature ventricular contractions (<1%) however, ecg taken during the 2 mg / kg flecainide challenge test revealed a type 1 brugada pattern in both father and mother (fig . Deoxyribonucleic acid (dna) sequencing analysis of the cardiac sodium channel (scn5a) revealed a g to t base substitution at nucleotide position 4035 on exon 23 that led to replacement of tryptophan by cysteine at codon 1345 (c.4035g> t, p.w1345c, heterozygote) in domain iii of the sodium channel (fig . Study of the patient's father revealed no mutation, but the same novel mutation as that of the patient was found in a study of the mother (fig . This child with manifest brugada type ecg with scn5a mutation is asymptomatic at this point; thus, he is being closely monitored without treatment . A 12-year - old boy and his 10-year - old sister their father had died of sudden cardiac arrest after some alcohol intake at the age of 44 years . Cardiac arrest was suspected to be due to ventricular tachycardia associated with bs by the attending physician . The brother and sister had no medical history or symptoms, such as chest discomfort, syncope, or palpitation . On arrhythmia drug test with flecainide, the boy showed typical coved type st elevation in the precordial leads v1 to v3 (after 13 doses of flecainide 8 mg, 2.7 mg / kg) (fig . 4a), and the girl also revealed typical coved type st elevation in the precordial leads v1 to v3 (after 10 doses of flecainide 10 mg, 1.9 mg / kg) (fig . Programmed ventricular stimulation test showed no inducible ventricular tachycardia in either patient . Genetic study for scn5a implantable cardioverter - defibrillators (icds) are under consideration if symptoms or signs develop . A one - month - old male infant presented to the outpatient - department (opd) for systolic murmur . The patient visited opd regularly, and no remarkable symptoms were found . Because the vsd was of moderate size without significant hemodynamic compromise, when he was 4 months old, ecg revealed significant qrs widening in right precordial leads, with saddle back st elevation in the v3 lead (fig . The pattern of ecg changed progressively until 6 months of age, when definitive st elevation with t wave inversion of brugada type 1 pattern was observed (fig . 1c). At 24-hour holter monitoring, rare, premature ventricular contractions (<1%) however, ecg taken during the 2 mg / kg flecainide challenge test revealed a type 1 brugada pattern in both father and mother (fig . Deoxyribonucleic acid (dna) sequencing analysis of the cardiac sodium channel (scn5a) revealed a g to t base substitution at nucleotide position 4035 on exon 23 that led to replacement of tryptophan by cysteine at codon 1345 (c.4035g> t, p.w1345c, heterozygote) in domain iii of the sodium channel (fig . Study of the patient's father revealed no mutation, but the same novel mutation as that of the patient was found in a study of the mother (fig . This child with manifest brugada type ecg with scn5a mutation is asymptomatic at this point; thus, he is being closely monitored without treatment . A 12-year - old boy and his 10-year - old sister were referred to the pediatric cardiology opd for familial history of sudden death . Their father had died of sudden cardiac arrest after some alcohol intake at the age of 44 years . Cardiac arrest was suspected to be due to ventricular tachycardia associated with bs by the attending physician . The brother and sister had no medical history or symptoms, such as chest discomfort, syncope, or palpitation . On arrhythmia drug test with flecainide, the boy showed typical coved type st elevation in the precordial leads v1 to v3 (after 13 doses of flecainide 8 mg, 2.7 mg / kg) (fig . 4a), and the girl also revealed typical coved type st elevation in the precordial leads v1 to v3 (after 10 doses of flecainide 10 mg, 1.9 mg / kg) (fig . 4b). Programmed ventricular stimulation test showed no inducible ventricular tachycardia in either patient . Genetic study for scn5a implantable cardioverter - defibrillators (icds) are under consideration if symptoms or signs develop . Bs is a disease of adulthood, typically resulting in sudden death during the forties6)7); however, some cases have reported on childhood bs in patients as young as a few days old . Since it was first formally reported in 1992, numerous studies and reports on the clinical characteristics or the genetic and molecular aspects of the disease have appeared.2)8)9) now bs is regarded as responsible for 4% to 20% of all sudden death, and up to 20% of sudden death without structural heart disease.6)9) characteristic ecg patterns were identified soon after the first report: 1) type-1 ecg pattern was described in the initial report, where a coved st - segment elevation greater than or equal to 2 mm is followed by a negative t wave in more than 1 right precordial lead (v1-v3); 2) type-2 ecg pattern is characterized by an st - segment elevation, followed by a positive or biphasic t wave that together compose a saddle - back morphology; 3) type-3 ecg pattern is characterized by a right precordial st - segment elevation less than or equal to 1 mm with either a coved - type or a saddle - back morphology.2)10) although all of these 3 ecg patterns can be identified in patients with bs, only the type-1 ecg pattern now defines diagnosis of the syndrome.6)10) the proband of the first family in this report showed dramatic progression of the brugada type ecg pattern from simple rbbb to type 1 pattern during the first half of the boy's infancy (fig . 1). Because the patient in case 1 had vsd and septal aneurysm, the initial rbbb change on ecg could possibly be associated with the malformation itself . However, as demonstrated in fig . 1, ecg progression to typical coved type st segment elevation in v1-v3, which is the characteristic feature of bs, could have led to the diagnosis of bs . Bs can be diagnosed when a type-1 ecg pattern is observed in more than 1 right precordial lead (v1-v3), with or without a sodium channel blocker agent, and in concurrence with one of the following: documented ventricular fibrillation, polymorphic ventricular tachycardia, inducibility of ventricular arrhythmias with programmed electrical stimulation, family history of sudden death before the age of 45 years, presence of coved - type ecg in family members, syncope, and nocturnal agonal aspiration.2)6)10) although some sporadic cases of bs have been reported, it is now understood as an inherited disease, in which a familial occurrence was noted in approximately half of patients.2)4) the first description of a related mutation appeared in 1998 and identified the mutation in scn5a, the gene encoding the alpha subunit of the cardiac sodium channel.11)12) to date, 100 or more other mutations found in scn5a have been associated with this syndrome, and a second locus was found on chromosome 3p22 - 25 without identification of the causative gene.2)13) however, only 20 - 25% of bs shows mutations in scn5a . Our first proband with infantile manifestation had a novel mutation (c.4035g> t, p.w1345c, heterozygote) equal to that of the mother . However, the mother was asymptomatic, and brugada type ecg was uncovered only by flecainide injection . However, there may be another explanation for the spontaneous change of ecg in case 1 during infancy . This case may have another undefined predisposition because the father of the child showed equivocal type 1 brugada pattern st elevation by flecainide, despite having no documented scn5a mutation . As the scn5a mutation was not found in up to 70% of bs cases, we can speculate that the father of the patient may have an undefined or unknown mutation causing bs or a genetic polymorphism with predisposal to bs type st change under certain provocations . On the other hand, we still cannot exclude the possibility of a false positive result for the father on the flecainide provocation test, as the specificity of the provocation test has been reported to be 80% in adults, leaving a 20% false positive rate . However, it should be noted that racial differences could be reflected in the specificity of the provocation test . As a study targeting both adults and children in the korean population has not yet been reported, further study targeting the korean population may help to explain the discrepancy between results from genetic analysis and the provocation test . Current opinions do not support the role of genetic analysis in estimation of risk for bs5); however, it may be helpful in detection of asymptomatic carriers of the mutation, who may then be provided with clinical monitoring . Scn5a mutations resulted primarily in the production of either a non - conducting sodium channel or accelerated recovery of the sodium channel . The functional effect of the mutations in transmembrane domain iii, w1345c, has not yet been documented . Several factors have been known to trigger typical brugada - pattern ecg and polymorphic ventricular tachycardia in susceptible individuals . These factors include autonomic imbalance, electrolyte imbalance, fever, myocardial ischemia, and drugs, including antiarrhythmic agents, psychotropic drugs, alpha adrenergic agonists, potassium channel opening drugs, and first generation antihistamines.5)6) the only proven treatment option for bs is an icd.14) within the current guidelines, implantation of icd is indicated for patients with bs and aborted cardiac arrest who receive optimal long - term treatment and whose life expectancy in good general condition exceeds one year.5)15) in the first report of bs, 3 of the 8 patients were children1); however, little information on this syndrome during childhood has been available . It can manifest during childhood, and symptoms may appear during febrile episodes.16) symptomatic childhood patients, particularly those presenting with a spontaneous type-1 ecg, may be at a high risk for cardiac events during a relatively short period of follow - up.2) the first description of bs in children appeared in the literature in 2000.7)17) since that time, many cases of pediatric bs have been reported . In three japanese studies describing the prevalence and clinical course of childhood bs,7)18 - 20) typical ecg patterns of bs were found less frequently than in adult studies; however, this prevalence increased with age . The nature of bs is known to be dynamic, and this variability is more prominent in children.20) to the best of our knowledge, there have been no reports on bs in korean children . We reported on childhood bs in two families; one family had a novel scn5a mutation . Physicians should be aware of this potentially lethal disease, which may manifest even in infancy, resulting in sudden infant death syndrome.4)17)
Mineral trioxide aggregate (mta) was developed to be used in endodontic complications, as well as in apical surgery . Actually, it is also recommended to be used in pulp conservative treatments and in obturation of the apical portion of immature teeth . Mta induces a new apical cementum deposition when used in root canals . However, its handling is difficult for use in root canal obturations . Several calcium silicate - based sealers were developed to be used as a root canal filling material, such as endo - cpm - sealer (egeo, temperley, buenos aires, argentina), proroot endo sealer (dentsply maillefer, ballaigues, switzerland) and an experimental cement, mtas . Recently, a new formulation of mta - based cement (mta fillapex; angelus indstria de produtos odontolgicos s.a ., londrina, paran, brazil) was created to be used as a root canal sealer . The composition of mta fillapex after mixing is mta, salicilate resin, natural resin, bismuth and silica, according to the manufacturer . Mta fillapex has an antibacterial effect against e. faecalis before setting and adequate biocompatibility . Despite these biological properties, mta fillapex had the lowest push - out values to root dentine compared with ah plus and iroot sp sealers . But in another study, mta fillapex presented acceptable resistance to dislodgement, which was similar to ah plus . A possible reason for this different result can be attributed to the difficulty in handling due to excessive flowability . Excessive flowability can favor apical extrusion and injure the periapical tissue, mainly in teeth with a wide foraminal opening . A suggestion in order to decrease the flowability is the addition of calcium hydroxide into the sealer . On the other hand, the ideal endodontic sealer should be biocompatible and able to induce mineralized tissue formation . These properties are directly associated with the alkalization potential and calcium release of the materials . Calcium hydroxide provides an alkaline ph and calcium ion release, leading to biochemical effects that culminate in the acceleration of the repair process . The mta fillapex sealer (angelus) has an alkaline ph and promotes calcium release . However, the effects of the addition of calcium hydroxide into mta fillapex with the objective of reducing sealer flowability are unknown . The aim of this study was to evaluate the flowability, ph level and calcium ion release of mta fillapex, with the addition of 5% or 10% calcium hydroxide powder (in weight), compared to pure mta fillapex and ah plus . The sealers used in this study were: ah plus (dentsply detrey, konstanz, germany) and the mta fillapex (mtaf) (angelus indstria de produtos odontolgicos s.a ., londrina, paran, brazil). The mtaf was used pure or with the addition of 5% (mtaf5) or 10% (mtaf10) calcium hydroxide (labsynth, diadema, so paulo, brazil), in weight . For the ah plus, the base and catalyst pastes were used in equal parts, in the proportion of 1:1 (w / w). The root canal sealers were mixed according to conditions recommended by the manufacturer and the flowability test was performed according to the iso 6876:2001 requirements . Forty polyethylene tubes measuring 10 cm in length and 1.5 mm in internal diameter were filled with the sealers to be evaluated . For the ph level and calcium ion release evaluation, 10 samples were prepared from each material studied . Immediately after manipulating the materials, the tubes were filled and weighed to check the standardization of the amount of sealer in each tube (0.002 g) and placed in polypropylene flasks (injeplast, so paulo, so paulo, brazil) containing 10 ml of deionized water . The tubes were kept at 37c (fanem, so paulo, so paulo, brazil) during the entire study . After 24 h, 7 and 14 days, the water was assessed for ph levels and calcium release . Previous to the immersion of the specimens, the ph level and calcium ion concentration of the deionized water were verified, attesting a ph level of 6.8 and a total absence of calcium ions . The tubes containing the sealers were placed in new flasks with 10 ml of deionized water for further analyses in the different time periods . Measurements were performed with a ph meter q400as (quimis, diadema, so paulo, brazil) in constant temperature (25c). After 24 h of immersion, the tubes were carefully removed and placed into another flask with an equal amount of new deionized water . This procedure was repeated for a total of 336 h with the solution changed at 24 h, 7 and 14 days . The ph values were compared by the anova and tukey tests, at a 5% significance level . The calcium release was measured using an aa7000 atomic absorption spectrophotometer (shimadzu, nakaygio - ku, kyoto, japan), in accordance to the manufacturer's instructions . For the reading, 6 ml of the standard solutions or water samples were associated with 2 ml of lanthanum nitrate solution . For the white solution, 6 ml of deionized water was associated with the same amount of lanthanum nitrate solution . With the standard solutions, the white solutions and the prepared sample, the reading was carried out using an atomic absorption spectrophotometer . The calcium release was calculated by the equation of the line of the standard curve . The reading of the calcium release was taken in the same periods used for measuring the ph level . The calcium release values were compared by the anova and tukey tests, at a 5% significance level . The sealers used in this study were: ah plus (dentsply detrey, konstanz, germany) and the mta fillapex (mtaf) (angelus indstria de produtos odontolgicos s.a ., londrina, paran, brazil). The mtaf was used pure or with the addition of 5% (mtaf5) or 10% (mtaf10) calcium hydroxide (labsynth, diadema, so paulo, brazil), in weight . For the ah plus, the base and catalyst pastes were used in equal parts, in the proportion of 1:1 (w / w). The root canal sealers were mixed according to conditions recommended by the manufacturer and the flowability test was performed according to the iso 6876:2001 requirements . Forty polyethylene tubes measuring 10 cm in length and 1.5 mm in internal diameter were filled with the sealers to be evaluated . For the ph level and calcium ion release evaluation, 10 samples were prepared from each material studied . Immediately after manipulating the materials, the tubes were filled and weighed to check the standardization of the amount of sealer in each tube (0.002 g) and placed in polypropylene flasks (injeplast, so paulo, so paulo, brazil) containing 10 ml of deionized water . The tubes were kept at 37c (fanem, so paulo, so paulo, brazil) during the entire study . After 24 h, 7 and 14 days, the water was assessed for ph levels and calcium release . Previous to the immersion of the specimens, the ph level and calcium ion concentration of the deionized water were verified, attesting a ph level of 6.8 and a total absence of calcium ions . The tubes containing the sealers were placed in new flasks with 10 ml of deionized water for further analyses in the different time periods . Measurements were performed with a ph meter q400as (quimis, diadema, so paulo, brazil) in constant temperature (25c). After 24 h of immersion, the tubes were carefully removed and placed into another flask with an equal amount of new deionized water . This procedure was repeated for a total of 336 h with the solution changed at 24 h, 7 and 14 days . The ph values were compared by the anova and tukey tests, at a 5% significance level . The calcium release was measured using an aa7000 atomic absorption spectrophotometer (shimadzu, nakaygio - ku, kyoto, japan), in accordance to the manufacturer's instructions . For the reading, 6 ml of the standard solutions or water samples were associated with 2 ml of lanthanum nitrate solution . For the white solution, 6 ml of deionized water was associated with the same amount of lanthanum nitrate solution . With the standard solutions, the white solutions and the prepared sample, the calcium release was calculated by the equation of the line of the standard curve . The reading of the calcium release was taken in the same periods used for measuring the ph level . The calcium release values were compared by the anova and tukey tests, at a 5% significance level . The representative mean and standard deviation for flowability values from each sealer are presented in figure 1 (in mm). Mtaf showed higher flowability (29.4 mm) than the other sealers (p<0.05). The flowability of the mtaf5 was lower than the mtaf and ah plus (p>0.05); however, it was in accordance with the iso 6876:2001 requirements . Different letters indicate statistically significant differences (p<0.05) the mtaf10 showed the lowest flowability in relation to the other sealers (p<0.05) and this value was below the iso 6876:2001 requirements (p<0.05). The flowability means and standard deviations (in mm) for the mtaf, mtaf5, mtaf10 and ah plus were 29.40 (1.05), 20.75 (0.89), 16.80 (0.71) and 21.91 (0.36), respectively . The representative mean and standard deviation of ph values and calcium release from each sealer in different periods are presented in figures 2 and 3, respectively . For all periods, the ah plus showed the lowest ph value (p<0.05). At 24 h, the mtaf, mtaf5 and mtaf10 showed similar ph values (p>0.05). At 7 and 14 days, the mtaf5 and mtaf10 showed similar ph values (p<0.05) and higher ph level than the mtaf (p<0.05). Different letters indicate statistically significant differences (p<0.05) for all periods, the ah plus showed the lowest means of calcium release (p<0.05). On the other hand, the mtaf5 and mtaf10 showed similar calcium release (p>0.05) and lower calcium release than the mtaf . Calcium release (mg / l) from each sealer studied in the different experimental periods . Different letters indicate statistically significant differences (p<0.05) for all periods, the ah plus showed the lowest means of calcium release (p<0.05). On the other hand, the mtaf5 and mtaf10 showed similar calcium release (p>0.05) and lower calcium release than the mtaf . The addition of 5% calcium hydroxide to the mtaf provided a reduction of the flowability, in accordance with iso requirements . Its ph level was alkaline in all periods but the calcium release was lower than pure mta fillapex . Despite the addition of 10% calcium hydroxide to mta fillapex, it provided a reduction in flowability, and this mixture is in disagreement with the iso 6876:2001 requirements . The flowability test results revealed that the addition of calcium hydroxide provides a reduction in flowability of the mtaf . This can be explained by an increase in the powder / liquid ratio also promoted, in accordance with that observed in a previous study . Except for the mtaf10, all sealers were in accordance with the iso 6876:2001 requirements . It has been suggested that in order to stimulate mineralization, a material should have an alkaline ph level and calcium release . The methodologies used for the ph level and calcium release evaluations were similar to other studies . The mtaf5 and mtaf10 presented ph levels similar to the mtaf, but only in a 24 h period . After this time, the ph values were higher than any other sealer . For all periods, the mtaf showed a higher calcium release despite the fact that calcium hydroxide was added in the mtaf5 and mtaf10 . (2004) observed that the addition of 10% calcium hydroxide in some sealers causes variations in setting time . Therefore, the addition of calcium hydroxide in the mtaf could also have reduced the setting time of the sealer and consequently its solubility, consequently reducing the calcium release . In contrast with this result, the addition of calcium hydroxide did not alter the ah plus setting time . However, the compositions of these sealers are different . Ah plus sealer presented lower calcium release than the other sealers, although it contains tungstate calcium in its composition . These results are consistent with other studies also carried out with atomic absorption spectrophotometry . Through a comparative analysis of the compositions described by the manufacturers, it was observed that the mtaf and sealapex (sybronendo, orange, california, usa) contain several similar substances in their formulations . Thus, it is possible that many reactions and effects described in the sealapex also occur with the mtaf . (2007) report that a possible reason for the high calcium release provided by the sealapex is related with the presence of 24% calcium hydroxide . Since the sealer has a porous matrix with a low dimensional stability and high water absorption, the calcium is easily released . On the other hand, the addition of substances with calcium in the mta promotes a reduction of the setting time . Thus, the addition of calcium hydroxide in the mtaf could have interfered in the setting time and consequently in the calcium release . This could be a possible reason for the higher calcium release presented by mtaf when compared to the mtaf5 and mtaf10 . Its use as an endodontic sealer requires further adjustments, since its handling is very difficult . Mtaf is a new calcium silicate - based sealer whose flowability is in accordance with the iso 6876:2001 requirements; clinically, however, it is very high, which can favor the extrusion of the material to the apical tissues . The purpose of adding 5% calcium hydroxide (in weight) to the total weight of the sealer is to obtain an adequate alternative . Based on the methods and conditions employed in the present study, it is concluded that the addition of 5% calcium hydroxide (in weight) to the mtaf provides a reduction in the flowability of the sealer, in conditions required by the iso 6876:2001 specifications and favors a higher alkaline ph.
Flame photometry is one of the oldest direct potentiometric methods commonly used to measure the concentrations of sodium, potassium, and lithium in serum and urine samples . It is a routinely used reference method, working on emission photometric principle . Nevertheless, this method has drawbacks such as low throughput, requires manual operation, as well as time consuming procedure . The regular clinical need for the availability of these electrolytes with both patients presenting to emergency departments as well as with inpatients has paved way for the replacement of these techniques by newer ones . Ise are an important class of chemical sensors that has found widespread use today in a number of routine applications . A key driving force for their development was their implication in automated clinical analyzers for the high throughput determination of electrolytes in physiological samples . Over the last several years, numerous instruments have been introduced into the clinical market for testing various critical analyte; all of these systems claim to improve patient care by their simple, rapid, and fully automated user interface . Comparison of any new measurement technique with an established one is often needed to see whether they agree sufficiently for the new to replace the old . The aim of our study was to do an agreement analysis of two different laboratory methods used to measure electrolytes i.e., between the conventional flame photometer and the automated ion selective electrode method in serum and urine samples . We planned to measure the electrolyte concentrations (total sodium and ionized potassium) in serum and urine samples using both ral ion3 sp flame photometer and beckman coulter synchron cx9 pro electrolyte analyzer and performed an agreement analysis between the two measurements . This cross sectional study was done on routine biochemistry samples over a period of three months from september10 through december10, after receiving an approval from the institutional ethics committee . A total of 6492 samples were received for routine biochemistry analysis in our laboratory; from those, 630 blood samples were randomly processed for this study and 100 urine samples were also randomly selected for analysis . Trauma patients from all age groups and both genders with any severity of injury were included . Samples which we strongly- lipemic, strongly hyperbilirubinemic and hemolysed were excluded from the study . Also the routine samples which were <2 ml were not processed for the purpose of this study . From the routine biochemistry samples that were received at our laboratory, two ml of sample was taken in a plain gel tube (labtech disposables, ahemdabad, india) and centrifuged for five minutes at 10,000 rpm . The supernatant serum was collected from the blood samples for electrolyte measurement using both the analyzers . Whereas for the urine samples, concentrate was collected after similar centrifugation, and further, processed using both synchron cx9 (beckman coulter) biochemistry analyzer and ral ion sp3 flame photometer respectively; at the same time to obtain the electrolytes namely, sodium (na) and potassium (k) concentrations in the samples . The beckman coulter analyzer was used as per the manufacturer's instructions and proprietary synchron buffer and reagents were utilized for analysis . The ise electrolyte buffer and ise electrolyte reference maintain a constant ion activity on the electrodes . The flame provides energy to the elements leading to the excitement of their valence electrons . These unstable electrons emit energy as photons of a particular wavelength which is characteristic of that element . This intensity of light is directly proportional to the number of photons being emitted, which in turn is directly proportional to the number of atoms in the solution . Ral's ion3 flame photometer (tcnica para el laboratorio) was designed to measure na, k, li ion concentration in serum and na, k ion concentrations in urine . There is included an automated diluter that permits to prepare in an easy and precise way the samples and calibrations needed for the analysis of na, k ion . The solution to be analyzed is discharged through an atomizer in a fine mist into a chamber when it is drawn into a flame . An optical system produces light by the combustion of the elements in the vaporized solution conducted through appropriate filters to impinge upon a photoelectric cell which activates a galvanometer . Under proper operative conditions, the concentration of sodium or potassium in the solution can be estimated from the reading of the galvanometer . The instrument is equipped with an amplifier which permits the analysis of solutions with greatly varying concentrations of sodium and potassium . This instrument uses lithiumas an internal standard (std) reference in order to obtain a greater accuracy and enable a precise compensation of changes in the flame itself when used to determinate na and k in serum and urine samples . When measuring the lithiumtion concentration in serum, potassium is used as the internal std reference . Beckman coulter works on the principle, wherein, the ion selective electrodes (ise) measure the activity of ions in water which is directly proportional to their concentration . The instrument claims to have advantages such as improved operator safety, short turnaround time, unaffected by color or turbidity . An ise constitutes of a thin membrane across which only the selected ion can be transported from a higher to a lower concentration via selective binding with sites within the membrane creating a potential difference . The sample is diluted with a high ionic strength ise electrolyte buffer, minimizing the variation in the activity coefficients of the analyte to be measured . A potential is generated at the surface of ise when the diluted sample passes through the flow cell . The potassium and sodium concentrations of the sample can then be determined from these potentials using the nernst equation . Ise based biochemistry analyzers use various types of electrodes for estimation of different analyte, such as glass electrode, solid - state electrode, liquid - based electrode, or compound electrode . In the synchron cx9 biochemistry analyzer by beckman coulter, a glass electrode surface is used to estimate sodium concentration and the validamycin electrode surface is used to estimate potassium concentration . The short response time of synchron cx9 makes it an ideal instrument for high volume and rapid analysis in routine pathology; the instrument has a linear response of over four to six orders of magnitude, there is no consumption of analytes, non - contaminating . Precision of synchron cx9 biochemistry analyzer is rarely above 1%; limitations for this instrument are that, the electrodes can be corrupted by proteins or other organic solutes, they are fragile and have limited shelf life and respond to the activity of uncomplexed ion . Considering standard deviation of difference in na values by the two methods as 25, to estimate this difference with 20% precision and 95% confidence, 600 serum samples were required . The bias and variability of differences in the na and k values estimated by the two methods were analyzed according to bland and altman method . The difference (test minus standard method) between the two measurements was calculated and plotted against the mean of the two measurements . Stata 11.0 statistical software (stata corp, tx, usa) was used for data analysis . From the routine biochemistry samples that were received at our laboratory, two ml of sample was taken in a plain gel tube (labtech disposables, ahemdabad, india) and centrifuged for five minutes at 10,000 rpm . The supernatant serum was collected from the blood samples for electrolyte measurement using both the analyzers . Whereas for the urine samples, concentrate was collected after similar centrifugation, and further, processed using both synchron cx9 (beckman coulter) biochemistry analyzer and ral ion sp3 flame photometer respectively; at the same time to obtain the electrolytes namely, sodium (na) and potassium (k) concentrations in the samples . The beckman coulter analyzer was used as per the manufacturer's instructions and proprietary synchron buffer and reagents were utilized for analysis . The ise electrolyte buffer and ise electrolyte reference maintain a constant ion activity on the electrodes . The flame provides energy to the elements leading to the excitement of their valence electrons . These unstable electrons emit energy as photons of a particular wavelength which is characteristic of that element . This intensity of light is directly proportional to the number of photons being emitted, which in turn is directly proportional to the number of atoms in the solution . Ral's ion3 flame photometer (tcnica para el laboratorio) was designed to measure na, k, li ion concentration in serum and na, k ion concentrations in urine . There is included an automated diluter that permits to prepare in an easy and precise way the samples and calibrations needed for the analysis of na, k ion . The solution to be analyzed is discharged through an atomizer in a fine mist into a chamber when it is drawn into a flame . An optical system produces light by the combustion of the elements in the vaporized solution conducted through appropriate filters to impinge upon a photoelectric cell which activates a galvanometer . Under proper operative conditions, the concentration of sodium or potassium in the solution can be estimated from the reading of the galvanometer . The instrument is equipped with an amplifier which permits the analysis of solutions with greatly varying concentrations of sodium and potassium . This instrument uses lithiumas an internal standard (std) reference in order to obtain a greater accuracy and enable a precise compensation of changes in the flame itself when used to determinate na and k in serum and urine samples . When measuring the lithiumtion concentration in serum, potassium is used as the internal std reference . Beckman coulter works on the principle, wherein, the ion selective electrodes (ise) measure the activity of ions in water which is directly proportional to their concentration . The instrument claims to have advantages such as improved operator safety, short turnaround time, unaffected by color or turbidity . An ise constitutes of a thin membrane across which only the selected ion can be transported from a higher to a lower concentration via selective binding with sites within the membrane creating a potential difference . The sample is diluted with a high ionic strength ise electrolyte buffer, minimizing the variation in the activity coefficients of the analyte to be measured . A potential is generated at the surface of ise when the diluted sample passes through the flow cell . The potassium and sodium concentrations of the sample can then be determined from these potentials using the nernst equation . Ise based biochemistry analyzers use various types of electrodes for estimation of different analyte, such as glass electrode, solid - state electrode, liquid - based electrode, or compound electrode . In the synchron cx9 biochemistry analyzer by beckman coulter, a glass electrode surface is used to estimate sodium concentration and the validamycin electrode surface is used to estimate potassium concentration . The short response time of synchron cx9 makes it an ideal instrument for high volume and rapid analysis in routine pathology; the instrument has a linear response of over four to six orders of magnitude, there is no consumption of analytes, non - contaminating . Precision of synchron cx9 biochemistry analyzer is rarely above 1%; limitations for this instrument are that, the electrodes can be corrupted by proteins or other organic solutes, they are fragile and have limited shelf life and respond to the activity of uncomplexed ion . Considering standard deviation of difference in na values by the two methods as 25, to estimate this difference with 20% precision and 95% confidence, 600 serum samples were required . The bias and variability of differences in the na and k values estimated by the two methods were analyzed according to bland and altman method . The difference (test minus standard method) between the two measurements was calculated and plotted against the mean of the two measurements . Stata 11.0 statistical software (stata corp, tx, usa) was used for data analysis . A total of 630 blood samples and 100 urine samples were collected from patients with median age 35 years (5 - 87) with 75% (571) male and 25% females (129). Scatter plots were obtained on plotting the difference between the ion selective electrode method (test method) and flame photometer (standard method). Interference by endogenous and exogenous substances with assays for clinical analytes is a common problem in laboratory medicine . Thirty serum samples were excluded due to hemolysis and lipemia; hemolysis has a direct effect on several tests . The cellular components of erythrocytes may in fact raise the analyte concentration as a contaminant . However, methods are not affected by lipemia when the determination is made in the aqueous fraction, such as methods involving ion selective electrodes . To determine agreement between the ion selective method and flame photometer for serum samples, difference between the ion selective electrode method (test method) and flame photometer (standard method) for serum values were calculated (standard minus test). The means.d . Of na and k in serum and urine samples using both the methods the mean difference for na concentrations in serum was found to be -7.89, standard deviation was 17.28, and similarly for serum k concentrations the mean difference was -0.25, standard deviation was 0.75 . These values were plotted against the mean of the two measurements using bland and altman method . Mean na, k values using flame photometer and synchron cx9 biochemistry analyser the 95% limits of agreement for sodium values in serum were found to be from -42.2 to 26.6 [figure 1a]. The value of sodium as determined by both the methods (flame photometer and synchron cx9) lie between the upper and lower limit showing 95% limits of agreement . Similarly, 95% limits of agreement for potassium values in serum were found to be from -1.75 to 1.25 [figure 1b]. The value of serum potassium as determined by both flame photometer and synchron cx9 lie between the upper limit and lower limit showing 95% limits of agreement . There is only a 5% chance that the values may lay beyond the limits of agreement . (a) mean difference serum potassium (k) vs average serum potassium (k) values by flame photometer and synchron cx9 pro (bland and altman plot) 95% limits of agreement = mean difference 2 sd [1.23, -1.73] (b) mean difference serum sodium (na) vs average serum sodium (na) values by flame photometer and synchron cx9 pro (bland and altman plot) 95% limits of agreement = mean difference 2 sd [26, -41.73] the calculated mean of the differences between the two methods for sodium measurement in urine samples was -22.02 and standard deviation was 41.01 plotting the bland and altman plot the 95% limits of agreement for sodium measurement in urine samples were from -104 to 60 [figure 2a]. For urine potassium values, the calculated mean of the differences between the two methods was -5.27 and the calculated standard deviation was 38.91 . The value of urine potassium as determined by both flame photometer and synchron cx9 lie between the upper limit and lower limit showing 95% limits of agreement [figure 2b]. Since the two methods do not differ enough to cause problems in clinical interpretation, the use of synchron cx9 in place of flame photometer for electrolyte analysis in serum and urine is justified or use the two interchangeably (a) mean difference urine potassium (k) vs average urine potassium (k) values by flame photometer and synchron cx9 pro (bland and altman plot) 95% limits of agreement = mean difference 2 sd [77.48, -87.94] (b) mean difference urine sodium (na) vs average urine sodium (na) values by flame photometer and synchron cx9 pro (bland and altman plot) 95% limits of agreement = mean difference 2 sd [58.35, -102.41] the great clinical importance and common ordering of electrolyte studies in patients warrants the use of rapid, simple, and automated methods . Selective ion electrode is certainly a step towards simplicity and the automated synchron cx9 pro chemistry analyzer by beckman coulter is one such instrument . It was introduced in our laboratory to decrease the consumption of time engaged in the electrolyte analysis and to give rapid results in emergency cases . The data obtained in the present study was evaluated by applying bland and altman agreement analysis . The 95% limits of agreement estimated by mean difference 1.96 (standard deviation) of the differences provided an interval within which 95% of differences between measurements by the two methods were found to lie . With 95% of confidence interval, the values of both na and k determined by both the methods (flame photometer and synchron cx9) lie between the upper limit and lower limit showing 95%limits of agreement; there is a 5% chance where the values may lie beyond the limits of agreement . In 1983, a workshop on direct potentiometric measurements in blood was held in gaithersburg, md, under the co sponsorship of the national committee for clinical laboratory standards (nccls) and the national bureau of standards (nbs) [now national institute of standards and technology (nist)],to examine the factors that affect these measurements and to determine what decisions and data were necessary to establish standardization . Guidelines were established as regards to the methods of standardization of these equipments and are strongly supported by the area committee on clinical chemistry of nccls and its subcommittee on electrolytes . Similar studies have been done to compare and standardize the ion selective technique based instruments with the traditional flame photometric method . In a study by preusse et al, the two equipments, namely orion space - stat (ss-30) and the technicon stat / ion, were used to investigate quality control of na and k determinations in test sera (n=8) and in the plasma of 100 patients . The ion - selective electrode instruments, ss-30 and stat / ion, gave results very similar to those of flame photometry . The differences observed were small, within the clinical tolerance interval and without much clinical significance, thus the two methods are equivalent or comparable . Though some authors showed slight variations in the readings between the ion selective method and the flame photometric method, they strongly recommended this automated method for routine chemistry laboratory setting . Worth reappraised the working principle for the measurement of sodium and potassium by flame photometry and ion - selective electrode, and advocated all clinical chemistry laboratories having access to a direct - reading ion - selective electrode for sodium estimation . Spectrophotometer, coulometer, and ion - selective electrode (ise) technology in a correlation study, were assessed for their precision, actual time required for analysis, correlation, and the total cost per test . The study revealed that flame photometer would be suitable equipment for small scale hospitals, and that for medium and large scale hospitals, ion selective electrode technique would suffice . In a study by mikolaenko et al, the newly available beckman coulter lx20 (brea, ca) was analyzed with the standard reference methods . The results were obtained for linearity within- and between - day precision, correlation, interference, and serum vs plasma studies were satisfactory with most assays demonstrating within - day coefficients of variation <2% and between - day coefficients of variation <5% . The linearity for all assays were acceptable over the range tested and correlation results to be adequate . The major difference in serum vs hence, the authors concluded that the beckman coulter lx20 demonstrates good performance capabilities making it suitable for a medium- to high - volume laboratory . In a center like ours with a huge sample load, a fully automated, high throughput instrument is mandatory especially to meet the emergency need of the patients . Though similar studies have been done previously in other countries, this study was carried out to see how compatible beckman coulter synchron cx9 pro is in our hospital . This ise method based equipment has a high throughput and efficiency to provide rapid results of other biochemistry tests (sugar, liver function tests, renal function tests, lipid profile, magnesium, calcium, phosphorous, cardiac enzymes) besides the electrolyte measurement using the same sample in a single run in a shorter period of time even though the cost per test is higher than the flame photometric method . The correlation with the ise based automated electrolyte analyzers have also been shown previously by various authors in other automated analyzers for serum and plasma samples . In this study, urine samples were also used for the method comparison to see if similar results are observed . Good degree of agreement is seen on comparing the ion selective electrode method and the conventional flame photometer for measuring the electrolytes, namely sodium and potassium, for serum samples and also for the electrolytes measurement in urine samples . Ion selective electrode (synchron cx9 pro) equipment take a shorter analytic time, high throughput (larger volume of the test) compared to the semi automated flame photometric method . A good degree of agreement of results was seen on comparing the two methods, since they do not differ enough to cause problems in clinical interpretation; the use of synchron cx9 in place of flame photometer for electrolyte analysis in serum and urine is justified or use the two interchangeably.
Transplantation of embryonic renal or pancreatic primordia to replace the function of diseased organs offers theoretical advantages relative to transplantation of either pluripotent es cells or of fully differentiated (adult) organs (reviewed in [1, 2]). (1) unlike embryonic stem (es) cells, organ primordia differentiate along defined organ - committed lines . There is no requirement to steer differentiation and no risk of teratoma formation; (2) the growth potential of cells within embryonic organs is enhanced relative to those in terminally differentiated organs; (3) the cellular immune response to transplanted primordia obtained early during embryogenesis is attenuated relative to that directed against adult organs; (4) early organ primordia are avascular . The ability of cellular primordia to attract a host vasculature renders them less susceptible to humoral rejection than are adult organs with donor blood vessels transplanted across a discordant xenogeneic barrier; (5) organ primordia differentiate selectively . In the case of embryonic pancreas, exocrine pancreatic tissue does not differentiate following transplantation, obviating complications that can result from exocrine components such as the enzymatic autodigestion of host tissues . While the transplantation of human embryonic organs in human hosts has been contemplated [35], we [613] and others [4, 5, 1417] have focused on the use of embryonic organs from the pig, a physiologically suitable donor for human pancreas or kidney replacement [18, 19]. Pig renal primordia are preprogrammed to differentiate into a kidney after transplantation into the mesentery of hosts with reduced functional renal mass (unilateral nephrectomy). Differentiation without immune rejection occurs following allotransplantation of embryonic day 28 (e28) pig renal primordia into mesentery of nonimmune - suppressed adult pig hosts . However, engraftment and survival of embryonic pig kidney xenografts in immune - competent rodents require that hosts be immunosuppressed [5, 8, 9]. We transplanted e28 pig renal primordia (figures 1(a) and 1(b)) consisting of undifferentiated stroma (s), branched ureteric bud (ub), and primitive developing nephrons into the mesentery of lewis rats [8, 9] or c57bl/6j mice . From five to seven weeks after transplantation, no trace of the renal primordium could be found in hosts that received no immunosuppression . In contrast, figure 1 illustrates undifferentiated e28 pig renal primordia prior to transplantation (figures 1(a) and 1(b)) and differentiated primordia 6 - 7 weeks after transplantation into immune - suppressed rats (figures 1(c), 1(d), 1(e), and 1(f)). The developed pig renal primordium is slightly larger in volume (diameter and weight) than a normal rat kidney . Although not tested following transplantation of pig renal primordia into rats, the ultrastructurally normal kidneys that differentiate following allotransplantation of embryonic rat primordia are capable of filtering blood, and urine is excreted following anastomosis between transplant and host ureters . Such transplants support life in otherwise anephric hosts [20, 21]. Shown in figure 2 are glomeruli from rat kidneys and pig kidneys and glomeruli within pig renal primordia transplanted into rats 2 weeks previously and stained with antirat endothelial antigen 1 (reca-1) that is specific for rat endothelium, or anti - cd31 that is specific for pig endothelium . Dekel et al . Successfully transplanted renal primordia originating from pig embryos aged e20 - 21 to e27 - 28 beneath the renal capsule of immunodeficient mice . Most transplants from the e2025 donors fail to develop or evolve into growths containing few glomeruli and tubules, but other differentiated derivatives such as blood vessels, cartilage, and bone . In contrast, the transplants originating from e27 - 28 pig embryos all exhibited significant growth and full differentiation into mature glomeruli and tubule . Dekel et al . Found mouse cd31 expression in external vessels as well as developing glomeruli and small capillaries of pig renal primordium xenografts, consistent with a host origin for the vasculature of the developed renal primordium cellular transplants . Pig kidney tissue or e27 - 28 pig renal primordia beneath the renal capsule or onto the testicular fat of immunocompetent balb / c amice . Evaluation of adult or e27 - 28 embryonic tissues 2 weeks after implantation into non - ctla4-ig - treated hosts showed rejection of tissues . In ctla4-ig - treated hosts, in contrast, all adult kidney grafts had a disturbed morphology, necrotic tissue, and a high degree of lymphocyte infiltration . The authors interpreted these data as being consistent with an immune advantage of the developing precursor transplants over developed adult kidney transplants in fully immunocompetent hosts . Dekel and coworkers implanted metanephroi from e70 human embryos intraperitoneally into immunodeficient (scid) mice . Hybridization to cdna arrays of rna derived from normal human renal primordia at 8, 12, 16, or 20 weeks of gestation demonstrated a subset of 240 genes, the expressions of which changed substantially with time . Clustering analysis of global gene expression in transplants after transplantation revealed a temporal profile of gene expression similar to that observed in the normal human kidneys during development, consistent with recapitulation of a renal developmental program . Comparison of the expression profiles of developing metanephroi to a wilms' tumor specimen revealed no similarity consistent with no threat of malignant transformation after transplantation of human kidney precursors . We have shown that glucose tolerance can be normalized in streptozotocin- (stz-) diabetic (type 1) lew [7, 8, 12] rats or zdf (type 2) diabetic rats within 4 weeks following transplantation in mesentery of pig pancreatic primordia obtained very early during embryogenesis (on embryonic day 28 (e28)just after the organ differentiates and prior to the time dorsal and ventral anlagen fuse) without host immune suppression . Porcine insulin circulates after transplantation of e28 pig pancreatic primordia (embryonic pancreas), and levels increase after a glucose load . Cells expressing insulin and porcine proinsulin mrna with beta cell morphology engraft in host mesentery, mesenteric lymph nodes, liver, and pancreas after transplantation . Cells originating from e28 pig pancreatic primordia engraft similarly in nonimmune - suppressed stz - diabetic rhesus macaques . Figure 3 shows photomicrographs originating from a mesenteric lymph node of a transplanted rhesus macaque . Sections in figures 3(a), 3(c), and 3(e) are stained with an anti - insulin antibody . Sections in figures 3(b), 3(d), and 3(f) are incubated with control serum . Sections of medullary sinus are delineated by arrows (figures 3(a), 3(b), 3(c), and 3(d)). Individual cells with beta cell morphology that stain positive (red) are delineated by arrowheads (figure 3(e)). No positive - staining cells are found in sections treated with control serum (figures 3(b), 3(d), and 3(f). Cells with morphology similar to positive cells in figure 3(e) are delineated in figure 3(f) (arrowheads). No insulin - positive cells are present in mesenteric lymph nodes of nontransplanted rhesus macaques . As shown in figure 4, glucose tolerance can be nearly normalized in nonimmune - suppressed diabetic rhesus macaques following transplantation of e28 pig pancreatic primordia . Exogenous insulin requirements are reduced in transplanted macaques, and animals have been weaned off insulin for short periods of time, but not permanently . The most likely explanation for the difference between rats and macaques is that macaques weigh 20 times as much as rats . An stz - diabetic rat can be rendered normoglycemic lifelong with no exogenous insulin requirement by transplantation of 58 pig pancreatic primordia . Extrapolating, it would take 100160 primordia to render a diabetic rhesus macaque independent of exogenous insulin . This would require the sacrifice of about 712 pregnant sows and multiple surgeries with the attendant complications . In lieu of increasing the number of transplanted primordia in diabetic rhesus macaques, we embarked on a series of experiments to determine whether porcine islets, a more easily obtainable and possibly more robust source of insulin - producing cells, could be substituted in animals rendered tolerant to embryonic pig pancreas . Our first step was to determine using rats, whether engraftment of cells originating from e28 pig pancreatic primordia renders hosts tolerant to the same or similar cell component present in porcine islets from adult swine (adult islets). To this end, we implanted adult porcine islets beneath the renal capsule of rats that previously had been transplanted with e28 pig pancreatic primordia in mesentery . Figure 5 shows sections from a kidney from an stz - diabetic rat transplanted previously with embryonic pig pancreas in mesentery and subsequently with pig islets in one kidney . Sections are stained using anti - insulin antibodies (figures 5(a) and 5(c)) or control serum (figures 5(b) and 5(d)). As would be expected for kidney that filters, reabsorbs, and secretes insulin, proximal tubules (pts) in figure 5(a) are positive (red brown) relative to comparable structures in figure 5(b). Cells that stain for insulin (figure 5(a)), but not with control serum (figure 5(b)) are present in an expanded subcapsular space (figures 5(a) and 5(b); arrowheads). The cells that stain positive for insulin (red - brown stain) are polygonal with round nuclei and abundant cytoplasm (arrow), a beta cell morphology . Also shown in figure 5 are sections incubated with antisense (figure 5(e)) or sense (figure 5(f)) porcine proinsulin mrna probes . Hybridization occurs following incubation with the former (arrows), but not the latter . In contrast to the transplanted kidney, there is no expansion of the subcapsular space in the contralateral (nontransplanted) kidney and no cells are present with beta cell morphology . The subcapsular space of a kidney from a rat implanted with porcine islets four weeks previously with no prior transplantation of e28 pig pancreatic primordia is expanded relative to that of a nontransplanted kidney . However, there are no cells with beta cell morphology that stain for insulin . Define transplantation tolerance as immune unresponsiveness to the transplanted organ, but not to other antigens, in the absence of ongoing immunosuppression . Lew rats transplanted with e28 pig pancreatic primordia retain reactivity to other porcine xenoantigens (e28 pig renal primordia are rejected). Thus, our findings are consistent with induction of specific tolerance to a cell component (either beta cells or a stem cell component that differentiates into insulin - producing cells) of adult porcine islets implanted in lew rats by previous transplantation of e28 pig pancreatic primordia . Though not observed following xenotransplantation under all conditions [16, 17], host tolerance to early stage pancreatic progenitors has been reported twice previously . Described normalization of glucose after transplantation of e15, but not e18 embryonic chick pancreas into non - immune - suppressed stz - diabetic immune - competent rats . Abraham et al . Described successful xenoengraftment in multiple organs of human pancreatic islet - derived progenitor cells infused in nonimmunosuppressed immune - competent mice . It is possible that xenotransplantation of fetal pancreas is particularly suited to induction of tolerance . However, neither eloy et al ., nor abraham et al ., nor we [7, 8, 1012] define an immunological mechanism . Although the antigenicity of fetal tissues may be less than that of corresponding adult tissues, animal data suggest the reduction is not enough by itself to ensure permanent graft survival . Thus, the use of embryonic tissue (pancreas) per se cannot explain our findings . Host immune suppression is required for successful engraftment of embryonic pig pancreas in rodents or nonhuman primates carried out using methodology different from ours . Therefore, it is likely that one or more differential factors in the methodology we employ are critical for engraftment of embryonic pig pancreas without an immune suppression requirement . Such factors could include the developmental stage of embryos from which primordia are obtained, the number of pancreatic primordia transplanted, the manner in which embryonic pancreas organs are incubated in vitro prior to implantation, the diabetic status of the host, the transplantation site and methodology for securing the implants in place, and the stringency by which glucose levels in diabetic hosts are controlled after transplantation . We have proposed that transplantation of e28 pig pancreatic primordia in the mesentery and migration of cells to mesenteric lymph nodes and liver recapitulates events that occur during induction of oral tolerance [2628], the induction of which is dependent on antigen transport via afferent lymphatics into the draining mesenteric lymph nodes . In effect, we suggest that heterotopic introduction of embryonic pig pancreas in rat or primate mesentery co - opts the function of the gut - associated lymphoid tissues (galt), a complex redundant [2628] and phylogenetically ancient system [29, 30] of which embryonic pancreas is a part, that under normal conditions induces peripheral tolerance to ingested antigens in jawed vertebrates and their descendants . Have proposed a similar co - opting of oral tolerance to explain the muted immune response in vivo and by cells from mesenteric lymph nodes in vitro to a colon carcinoma of balb / c origin or a human cd80-transfected dba/2 mastocytoma injected into the subserosa of cecum in balb / c mice relative to tumors injected subcutaneously . Galt may have served similarly to prevent an immune response to insulin - producing cells scattered originally in the gut epithelium of primitive vertebrates [29, 30] and have been proposed to induce tolerance or immune suppression towards islet cell antigens during normal embryonic development . Dialysis as a therapy for end - stage kidney failure is life preserving but replaces only a small fraction of normal kidney function and has and considerable morbidity . Use of oral hypoglycemic agents and administration of insulin are cornerstones of treatment for diabetes mellitus . However, adequate control of circulating glucose levels cannot be attained by most patients, and attempts at maintaining euglycemia through intensive insulin therapy lead to hypoglycemia . In contrast, allotransplantation therapies (whole pancreas or islets of langerhans (islets)) can normalize glucose control [1, 2]. Given existing technology, a major limitation to the use of either whole pancreas or islet allotransplantation is the insufficient supply of human organs . Compounding this limitation for islet transplantation is the need to transplant large quantities of islets from multiple donors to achieve even short - term insulin sufficiency . Selection criteria at most us centers for pancreas transplantation dictate a conservative approach that excludes most type 2 diabetics, traditionally older and poorer surgical risks than type 1 patients . Newer, more targeted immunosuppressive regimens that do not require steroid or high - dose calcineurin inhibitors make islet transplantation a more attractive option . However, side effects of immune suppression that must be maintained so long as the graft functions remain a source of morbidity and even mortality . Thus, transplantation therapy for diabetes trades one set of morbidities (associated with diabetes and its medical treatment) for another (associated with immune suppression). In that pigs are plentiful and have renal function very similar to humans, and because porcine insulin works well in humans, the pig has been suggested as a kidney or pancreas organ donor for humans with chronic kidney disease or diabetes . While humoral rejection is ameliorated following transplantation into nonhuman primates of kidneys from pigs transgenic for the human complement activator, decay accelerating factor, or the use of kidneys or organs from transgenics that do not express alpha 1,3 galactosyltransferase, neither the immunosuppressive regimens used for pig to primate kidney transplantation nor the outcomes would be acceptable in humans . The severity of humoral rejection effectively precludes the use of pigs as whole pancreas organ donors for humans . However, because they are vascularized by the host after transplantation, islets like other cell transplants are not subject to humoral rejection . Recent experience with pig to primate islet or neonatal islet transplantation shows that sustained insulin independence can be achieved, but only through the use of immunosuppressive agents that are not approved for human use or that result in a high level of morbidity and mortality in diabetic primates [3739]. Thus, the need for host immune suppression is a barrier for pig - to - primate kidney or islet xenotransplantation . The use of individual cells including stem cells to regenerate or repair damaged kidney tissue or differentiate into insulin - producing cells (cell therapies) offers an alternative to whole organ replacement . Since cells are nonvascularized, these approaches can circumvent humoral rejection of xenogeneic tissue mediated by preformed antibodies directed against donor endothelial antigens . However, cell transplantation to replace the function of a structurally complex organs such as the kidney has limitations . In order for glomerular filtration, reabsorption, and secretion of fluid and electrolytes to take place in a manner that will sustain life, individual nephrons must be integrated in three dimensions with one another and with a collecting system, the origin of which is yet another separate structure, the ureteric bud . Concomitantly, vascularization must occur in a unique organ - specific manner from endothelial precursors that may originate from both inside and outside of the developing renal primordium . While it is conceivable that endocrine functions of the kidney, such as erythropoietin production, could be recapitulated by transplanting one particular type of renal cell and it is possible that replacement of one or another type of injured renal cell could enhance the function of damaged tubules, it is difficult to imagine how glomerular filtration and reabsorption in kidneys could be reconstituted de novo by infusion of individual cells . However, successful differentiation in vitro of functional beta cells remains an elusive goal . Xenotransplantation of embryonic pig renal or pancreatic primordia in lieu of mature pig organs or porcine islets couples the wide availability of whole pig organs with the immunological advantages inherent in transplanting cellular embryonic tissue, circumventing humoral rejection, and in the case of pancreas, obviating the need for host immune suppression . Furthermore, unlike es cells, renal and pancreatic primordia are programmed to differentiate into anatomically precise kidneys or beta cells in which glucose sensing and insulin release are functionally linked . Finally, prior transplantation of pig pancreatic primordia permits the engraftment of an insulin - producing cell component originating from porcine islets implanted subsequently . Xenotransplantation of embryonic pig kidney or pancreas, once employed safely and effectively in humans, will provide in essence an unlimited supply of donor organs . This will result in a paradigm shift in how the world thinks about organ replacement: (1) there will be no need to transport organs across long distances; (2) transplantation can be done electively at a convenient time; (3) transplantation can be offered to high - risk individuals and can be repeated as needed; (4) transplantation can be offered to patients currently not candidates including type 2 diabetics.
Hundreds of thousands of avoidable deaths are caused each year by parasitic infections, particularly the intestinal helminthes, and these infectious diseases affect the nutritional status of most children under the age of five . It has been estimated to affect about 3.5 billion people globally and caused morbidity in approximately 450 million people . Developing countries are the most affected, majority being school children because of their typical hand - mouth activity, uncontrolled fecal activity and their immature immune systems . The climatic conditions in this part of the world favor the development and survival of these parasites, the high prevalence in a region results to infection and diseases that are the immediate causes of malnutrition and death in young children . Records show that a global estimate of 162 million under - five years old children are documented to be stunted, 99 million underweight and 51 million wasted . A silent emergency already exists in nigeria, as the country has extremely poor nutritional indices: stunting 37%, underweight 29% and wasting 18% . Diarrhea is the second leading cause of death among children under five in nigeria after malaria . E. histolytica, g. lamblia, n. americanus, a. doudenale, hookworm, ascariasis and trichuriasis are the other common intestinal parasitic infections in benue state, nigeria . The incidence of the disease varies greatly with seasons and a child s age; the youngest children are most vulnerable, due to poor environmental sanitation and contamination of water . These parasitic infections have detrimental impact on host nutritional status in several ways, they can depress appetite and food intake, compete for micronutrients, or blood loss resulting in the loss of iron, diarrhea, vomiting, dehydration, weight loss and growth retardation, fever, school attendance, physical activity and cognitive performance of school age children. [8 - 11] thus, the objective of this study was to determine the prevalence of intestinal helminthic infections and assess the nutritional status of pre - school aged children in communities of gboko local government area of benue state in nigeria s middle belt region . The present research was a cross sectional study conducted from january - june 2016, among 418 school children under the age of five living in gboko . The area covers a land mass of 2,264 square kilometers with a population of 361,325 people according to 2006 nigeria census . On the geo - political map of nigeria, the area is located between latitude 630 and 810 north of the equator and longitudes 8 and 10 east of the greenwich meridian . The 17 council wards in gboko local government area (lga) were clustered into districts . A list of certified primary schools was obtained from benue state ministry of education, the schools in the randomly selected council ward (gboko - north, igorov, mbadim, ukpekper, mbankur) were further clustered into urban and rural primary schools . These schools were further clustered into private and public schools in both urban and rural areas . In all, 4 schools were selected from a council ward (a private & a public school in both rural and urban areas of each council ward), making a total of 20 schools . Entirely, 422 pupils both boys and girls ranging from ages of 2 - 5 years were randomly selected . The actual size of those that participated in the research were 418 with 208 children from rural areas and 210 children from urban areas . Before the commencement of the research, permission was obtained from the headmasters of all the schools including the pupil s parents / guardian . The study protocol was approved by the benue state ministry of health s ethical committee with the reference number med/156/vol.1/56 . Anthropometric measurements such as height and weight were taken by a set of trained investigators following the internationally accepted standard techniques . Height and weight measurements were recorded to the nearest 0.1 cm and 0.5 kg respectively . Weight - for - height (whz), which was used to identify wasting in children, was computed for all boys and girls of ages 2 - 5 years . Height - for - age (haz) and weight - for - age (waz) ratios were used to diagnose children with stunted and underweight growth (<-2sd) respectively . Stool samples were collected in labeled screw capped plastic containers for parasitological examination within one hour of collection . All stool samples were re - examined microscopically using the formal ether concentration technique which is considered to be the most - sensitive method for most intestinal helminthes . Anthropometry indices were computed using the calculator mode of anthropometry calculating software program epi info version 6 . Wasting, stunting and underweight were defined as z score values of less than -2sd (standard deviation). The significance of the differences in frequency distribution was tested by using chi - square analyses . The present research was a cross sectional study conducted from january - june 2016, among 418 school children under the age of five living in gboko . The area covers a land mass of 2,264 square kilometers with a population of 361,325 people according to 2006 nigeria census . On the geo - political map of nigeria, the area is located between latitude 630 and 810 north of the equator and longitudes 8 and 10 east of the greenwich meridian . The 17 council wards in gboko local government area (lga) were clustered into districts . A list of certified primary schools was obtained from benue state ministry of education, the schools in the randomly selected council ward (gboko - north, igorov, mbadim, ukpekper, mbankur) were further clustered into urban and rural primary schools . These schools were further clustered into private and public schools in both urban and rural areas . In all, 4 schools were selected from a council ward (a private & a public school in both rural and urban areas of each council ward), making a total of 20 schools . Entirely, 422 pupils both boys and girls ranging from ages of 2 - 5 years were randomly selected . The actual size of those that participated in the research were 418 with 208 children from rural areas and 210 children from urban areas . Before the commencement of the research, permission was obtained from the headmasters of all the schools including the pupil s parents / guardian . The study protocol was approved by the benue state ministry of health s ethical committee with the reference number med/156/vol.1/56 . Anthropometric measurements such as height and weight were taken by a set of trained investigators following the internationally accepted standard techniques . Height and weight measurements were recorded to the nearest 0.1 cm and 0.5 kg respectively . Weight - for - height (whz), which was used to identify wasting in children, was computed for all boys and girls of ages 2 - 5 years . Height - for - age (haz) and weight - for - age (waz) ratios were used to diagnose children with stunted and underweight growth (<-2sd) respectively . Stool samples were collected in labeled screw capped plastic containers for parasitological examination within one hour of collection . All stool samples were re - examined microscopically using the formal ether concentration technique which is considered to be the most - sensitive method for most intestinal helminthes . Anthropometry indices were computed using the calculator mode of anthropometry calculating software program epi info version 6 . Wasting, stunting and underweight were defined as z score values of less than -2sd (standard deviation). The significance of the differences in frequency distribution was tested by using chi - square analyses . The result presented below is the data for 418 pupils (208 rural and 210 urban) who returned stool sample and their anthropometric data were obtained . There were 103 males and 105 females for rural areas and 106 males and 104 females for urban areas . The subjects were grouped between 2 - 5 years with a mean age of 4.22 0.81 years . Prevalence of infection was significantly (p<0.05) higher among the rural pupils than among the urban pupils . Prevalence of e. histolytica was higher in both rural (51.0%) and urban areas (29.0%) than all other parasites encountered in the study areas (p<0.05). Other parasites found in both rural and urban areas were hookworm (46.2% and 24.8%); g. lamblia (11.5% and 8.6%); and t. trichiura (2.4% and 5.2%). The subjects co - infected with mixed species of parasites were (63.5% and 40.0%) in rural and urban pupils respectively (figure 1). Prevalence of intestinal parasites among children in rural and urban communities prevalence of intestinal parasites among children in rural and urban communities there were significant relationships between intestinal parasitic infection and school types as well as the community (table 2). The public school pupils were more infected with the parasites than the private school pupils (66.4% and 36.2%) and the pupils from the rural settings were more infected than those from the urban settings (63.5% and 39.5%). Prevalence of intestinal parasitic infection according to sex and school type in rural and urban communities p<0.05 statistically significant table 3 shows associations between the various risk factors and intestinal parasitic infections among the school pupils . Among all the potential risk factors explored, pupils from rural communities had the highest level of some risk factors that could easily result to infection . A total of 64.4% use well as their source of drinking water as against 29.0% in urban, 41.8% pupils in rural settings use pit latrine whereas only 14.3% in urban uses pit latrine, 38.0% pupil live in a house with sand as their type of floor as against 0.0% in urban areas and more importantly only 13.0% of the pupils in the rural area had been de - wormed in the 6 months preceding the study, 42.8% were not, while the remaining 44.2% had never been de - wormed . But in urban setting, 44.8% had been dewormed, 30.0% had not, and only 25.2% were never dewormed . The habit of washing hands after toilet use posed a problem in both rural and urban settings, 15.4% in rural settings still wash their hands while only 26.7% in urban settings do wash their hands after toilet use . Risk factors for intestinal parasitic infections the overall prevalence of nutritional indicators below -2sd is presented in table 4, the prevalance of stunting in rural and urban pupils were 43.8% and 32.9%; 64.4% and 39.0% rural and urban pupils were underweight while 30.3% and 24.3% were wasted . Only e. histolytica, hookworm and g. lamblia were significantly (p<0.05) associated with low height - for - age (stunting), weight - for - height (wasting) and weight - for - age (underweight). Generally intestinal parasitic infection are dangerous disease causing agents among school children ultimately resulting to malnutrition . The prevalence of intestinal parasitic infection in this study (63.5%) in rural and (40.0%) in urban is lower (80.9% rural and 51.4% urban) than what was found by opara et al in eastern nigeria, and also the 75.7% found by wosu et al in south eastern nigeria, but higher than the 30.6% as reported by adekunle et al, 45.5% that was reported by emeka, and the 52.0% reported by adefioye et al . These results evidently showed a high level of intestinal parasitic infection especially among the rural dwellers . Such prevalence has been attributed to ignorance, poverty, poor environmental and personal hygiene, shortages of clean potable water and indiscriminate defecation as most vegetable farmers use excreta as manure which is a veritable source of infection since children and their mothers often go to the farm to tender to the vegetables . Despite all these factors, the relatively high prevalence connotes continuous infection, re - infection and transmission of intestinal parasites . The commonest was the co - infection of e. histolytica, hookworm and g. lamblia . This present study recorded a high degree of malnutrition among the children investigated for intestinal parasitic infections . 64.4% of pupils in rural areas were found to be underweight whereas 39.0% in urban were underweight . This rate is similar to what was reported by goon et al, he reported 43% to be underweight in benue state and emeka who reported 57.9% . Higher rates of underweight were however reported by adekunle et al, in rural and semi - urban communities of osun state who reported 70.0% and 54.7% in the year 2015 . These findings agree with the publication of other researchers. [8, 10] the high rate (> = 30%) of stunting and underweight recorded in this study was due to high prevalence of e. histolytica, hookworm, g. lamblia and t. trichiura . It has been documented by crompton and neisheimthat growth and development during childhood could be diminished by ascariasis, trichiuriasis and hookworm infection . Intestinal parasitic infections can cause vomiting, diarrhea, anorexia, abdominal pain and nausea that may result in reduced food intake, thereby further reducing nutrient availability hence contributing to undernutrition therefore the government and other non - governmental organizations (ngos) involved in development should introduce adequate strategies to crisscross on personal and environmental hygiene, especially for the rural dwellers . There is also need for regular deworming of school - age children, especially those living in the rural communities . They should also design relevant policies or review existing ones in order to savage the situation because a greater proportion of the population still live in rural communities . The prevalence of intestinal helminthic infection in this study was high and was significantly associated with the nutritional status of the respondents . It was such that children with intestinal parasitic infections were more malnourished when compared with those with no infection . There is need for regular de - worming of preschool - age children, especially those living in the rural communities . Reducing the prevalence of parasitic infections in school children, compliance with ethical standards intestinal parasitic infections prominently detected in benue were e.histolytica, hookworm, g.lamblia, t.trichiura and the prevalence of infection was significantly higher in rural than urban areas.public school pupils were more infected with the parasites than the private school pupils.among all the potential risk factors explored, pupils from rural communities had the highest level of some risk factors that could easily result to infections.the rural children were significantly more malnourished than urban children . Only e.histolytica, hookworm, g.lamblia were significantly associated with stunting, underweight and wasting . Intestinal parasitic infections prominently detected in benue were e.histolytica, hookworm, g.lamblia, t.trichiura and the prevalence of infection was significantly higher in rural than urban areas . Public school pupils were more infected with the parasites than the private school pupils . Among all the potential risk factors explored, pupils from rural communities had the highest level of some risk factors that could easily result to infections . . Only e.histolytica, hookworm, g.lamblia were significantly associated with stunting, underweight and wasting.
Cerebral palsy (cp) is a non - progressive neurodevelopmental disorder that includes a wide spectrum of syndromes related to the early onset of posture and motor impairment1 . Dysfunctional postural control and movement patterns lead to limitations in participation in activities of daily living (adl)2 . According to jeong et al.3 cp is the most common infant brain injuries in south korea, representing 57.8% of brain injuries in the 09 years category . Management of children with cp requires various rehabilitative approaches that draw on the expertise of many specialists in different disciplines . Some of the current clinical therapeutic interventions include traditional physical and occupational therapy, neurodevelopmental treatment, the vojta method, and sensory integration to improve postural control, balance, and locomotion for improved participation in adl4 . Many children with cp not only exhibit neuromotor deficits but demonstrate difficulties with sensory processing and praxis5 . Sensory integration is a dynamic process that synthesizes, organizes and processes incoming sensory information from the body and the environment in order to create purposeful and goal - directed responses6 . Good sensory integration leads to the development of good body scheme, self - image, integration of primitive reflexes, balance, postural stability, ability to motor plan, coordination of two sides of the body, and eye - hand coordination7 . Among the sensory systems, although it may be important to apply sensory integration treatment techniques and sensory based activities for children with cerebral palsy, therapists maybe reluctant to do so as the evaluation of vestibular processing can prove to be difficult9 and vestibular activities may increase muscle tone in unwanted areas5 . The purpose of this case report is to present the effects of vestibular stimulation on a child with hypotonic cerebral palsy through the use of swings . This case was referred to this author via the child s occupational therapist who felt the child would benefit from this study . Inje university affiliated hospital ethics review board approved this case study and informed consent was obtained from the child s mother . The subject was a 19-month - old boy with a diagnosis of hypotonic cerebral palsy (cp) and oscillating nystagmus . He was born at 39 weeks of gestation via caesarian section and there were no complications reported at birth . However his mother reported him to be a fussy baby who cried often and appeared to be colicky . He started to demonstrate head control at about 8 months and ability to maintain the ring - sitting position for less than 30 seconds using his hands to prop himself up when put in a seated position; however he had not made any further progress in gross motor skills since . At 5 months of age, he started to receive therapy for developmental delays, including hospital based occupational therapy 2 times per week, physical therapy using the neurodevelopmental treatment (ndt) technique and the vojta method 2 times per week, and sensory stimulation once a week . He was reported to cry incessantly and was inconsolable in all of his therapy sessions from when he started therapies at 5 months to his initial assessment for this case study . Pre and post - intervention tests were completed by the researcher using the bayley scales of infant and toddler development ii . After the pre - intervention test and during the intervention phase all of the subject s other therapies were stopped to control the effect of vestibular stimulation without other interventions . The subject was provided with vestibular stimulation 3 times per week for 10 weeks in 1 hour sessions conducted by his mother as instructed by the researcher . Each session started with 30 minutes of swinging on an infant swing for all 10 weeks . The vestibular stimulation protocol using different swings is shown in table 1 table 1.vestibular stimulation protocol . The subject s mental raw score was 21 with a corresponding developmental age of 1 month, and his motor raw score was 40 with a corresponding developmental age of 6 months, pre - intervention . The subject s mental score increased to 46 with a corresponding developmental age of 4 months, and his motor score increased to 58 with a corresponding developmental age of 10 months (tables 2table 2.results of bayleyscalepre - testpost - testraw scorepercentile% raw scorepercentile% mental 2146motor4058behavior ratingorientation e111%3223%emotional r121%286%motor q151%251%additional i14total r score391%897%, 3table 3.results of bayley, developmental agepre - testpost - testmental developmental age1 month4 monthsmotor developmental age6 months10 months). The results show that the subject exhibited improved mental and motor skills of 3 and 4 months respectively which is a significant improvement at this age of development . The subject was able to ring - sit for less than 30 seconds at pre - test, and was not able to transition from supine or prone to sitting or from sit to pull to stand . However after 10 weeks of intervention he was able to walk with his hand held and independently for about 15 meters before losing balance, and he was able to transition from supine or prone to sit to pull to stand independently . As for mental skills, the subject showed no interest in toys or people and he cried throughout the entire therapy session at the beginning of this study; however once he was introduced to vestibular stimulation by swinging, he smiled, laughed and started to interact with both toys and people . Postural control is dependent on the integration of proprioception, vision and vestibular systems of which vestibular input is particularly important10 . Adequate motor performance and postural control is needed for an infant or a young child to independently perform and participate in play, activities of daily living and social interactions . Infants diagnosed with cerebral palsy demonstrate difficulties with postural control and locomotion and can miss opportunities to explore their environment11 . The subject in this case study was diagnosed with hypotonic cerebral palsy and demonstrated poor postural control, only being able to maintain a ring - sit position using his hands to prop himself up for 30 seconds . The subject was not able to explore his environment due to lack of mobility and he did not use his hands at the beginning of this research . One possible explanation for his incessant crying during all of his therapy sessions in the past year is that he had an inefficient vestibular system . Sensory integration of the vestibular system provides a gravitational security which helps with the emotional well - being5 however, due to the subject s poor integration of the vestibular system, he may have been fearful of being moved during all of his therapies which made him resistant and cry . When the subject was presented with intense vestibular inputs on different swings, he stopped crying very quickly and responded by holding his head and trunk more erect and eventually improved his postural control enough for him to walk . At the beginning of this study, the subject made no attempt to move his body and spent most of his waking hours lying in supine . When his mother put him in sitting position or moved him, he cried and was resistant to being moved . However by the end of this research the subject demonstrated improvements in movement in space and transitioning from supine or prone to sitting and from sitting to pull to stand independently . The vestibular system is thought to be a primary organizer of sensory information and contributes to physical and emotional security12 . This case study shows that improving the integration of the vestibular system through the use of swings resulted in the improvement of the subject s postural control, movement, exploration, and emotional well - being . The subject s mother reported feeling anxious and helpless as she did not know how to console or interact with her crying child . However once the subject had been introduced to vestibular inputs on different swings, he responded almost immediately by not crying, and started to laugh out aloud and babbling . Both the subject and his mother appeared much more relaxed with each other and able to interact with each other better as the subject decreased crying and started to explore his environment . The subject s mother reported that at the beginning of this study she could not take him anywhere to play as he cried the entire time when she took him to playgroups and playgrounds but from about the middle of the intervention of this study, he started to feel comfortable when taken to new environments . The level of subject s comfort, exploration, interaction, and play had improved significantly by the end of this study . This study has demonstrated that vestibular inputs through the use of swings has improved the subject s postural control, movement in space, emotional well - being, interaction with people and environment and participation in play . Therefore therapists may wish to consider providing vestibular inputs for children with hypotonic cerebral palsy in treatments to facilitate postural control and emotional well - being . Sensory based activities must be provided by a well trained and experienced therapist as children with cerebral palsy present neuromotor deficits as well as sensory issues . A limitation of this case study is that there was only one subject which makes it difficult to generalize the findings to a wider population . Therefore, further research with larger sample sizes are needed to determine the effectiveness of vestibular inputs through the use of swings on children with hypotonic cerebral palsy . Future studies should also look at the effectiveness of sensory integration and ndt in the treatment of children with cerebral palsy.
Laparoscopic surgery has enjoyed increasing success since its modest beginning in 1983 and has become the standard of care for cholecystectomy . Evaluation and application of new technologies has allowed for the rapid advancement of laparoscopic surgical techniques . What remains ill - defined is the application and safety of laparoscopic surgery to complex solid - organ procedures such as liver resection . The difficulties in approaching laparoscopic liver surgery require continued improvements in technology, such as video imaging, electrosurgical instruments, laparoscopic duplex ultrasound, and greater success with bloodless surgery . One possible application of advancements in laparoscopic liver surgery is the performance of partial nonanatomic hepatectomy . Using open surgical techniques, partial nonanatomic hepatectomy has gained acceptance as a procedure that may be used to treat patients with hepatocellular carcinoma, as well as other diagnoses . Nonanatomic liver resection is technically demanding due to hepatic anatomic variability and can be associated with considerable morbidity . This study evaluated a new technique for liver resection using the ligasure electrosurgical vessel - sealing device (valleylab - tyco healthcare, boulder, co). It does so by combining energy control with physical compression, including a brief cool down that produces a distinctive, translucent seal of partially denatured protein; thereby, fusing the collagen in the vessel walls and occluding the lumen entirely . These seals have bursting strengths comparable to those of ligatures and, unlike clips, resist dislodgment because they are intrinsic to the vessel wall structure . Thermal spread is minimal and the autologous seals formed by the ligasure device can withstand 3x systolic pressure . The ligasure device may be used for sealing vessels up to 7 mm in diameter . The effectiveness of this device for liver resection is not known, but we hypothesize that it has excellent potential for use in laparoscopic nonanatomic liver resection . This series is our initial experience with the ligasure device in the performance of laparoscopic nonanatomic resections of the liver using a sus scrofa pig model . The animal experiments were performed in accordance with the 1996 national research council guide for the care and use of laboratory animals and applicable federal regulations . Preoperatively, the animals were fasted 12 hours and medicated with hydromorphone (0.1 mg/ kg), acepromazine (0.1 mg / kg), and glycopyrrolate (0.01 mg / kg intramuscularly). Anesthesia was induced with tiletamine / zolazepam (telazol) (6 mg / kg intramuscularly). The animals were then intubated and given xylazine (2 mg / kg intravenously), and anesthesia was maintained using isoflurane (1.53%). Monitoring of the anesthetized animals was conducted using pulse oximetry for oxygen saturation, end - tidal carbon dioxide sensors, and cardiac sensors . The 9 domestic swine used in the experiments weighed 29 kg to 36 kg and were divided equally into 3 groups . In all of the experiments, 60% to 80% of the left lobe was removed . Before concluding each operation, all groups of animals (i, ii, and iii) were visually inspected for bleeding and biliary leakage at the site of resection . In laparoscopic cases, pneumoperitoneum was released for 10 minutes prior to the final visual inspection . In all cases, adequate hemostasis and biliary control postoperative analgesia for groups i and ii consisted of morphine epidural (2 mg) placed between vertebrae l6 and s1 in addition to a transdermal fentanyl patch (75 g) stapled to the animals' posterior neck . Postoperative analgesia for group iii consisted of buprenorphine (0.01 mg / kg q 12 hours) and a transdermal fentanyl patch (75 g) stapled to the animals' posterior neck . Surgical details of liver resections were as follows: the control animals underwent a nonanatomic left hepatic lobectomy through a scalpel incision in the abdominal midline by using the finger - fracture method . Blood vessels and bile ducts were clipped or suture ligated as appropriate and electrocautery (bovie) was used where indicated . The animals in group ii underwent a nonanatomic left hepatic lobectomy through a scalpel incision in the abdominal midline . The animals in group iii underwent a laparoscopic, non - anatomic, left hepatic lobectomy with the ligasure device for dividing the liver parenchyma and sealing and dividing all blood vessels and bile ducts . The pneumoperitoneum was insufflated by veress needle and maintained at a constant abdominal pressure of 12 mm hg . The laparoscopic atlas version of the ligasure was used to divide the parenchyma as well as any vessels or bile ducts in continuity without isolating them first . This was accomplished by opening the jaws of the device and then gently applying pressure to the parenchymal surface . The device was activated by depressing a foot pedal, and increasing pressure applied to the handle, slowly approximating (closing) the jaws . The rate of compression of the parenchyma was guided by the surgeon, who maintained a 1-mm blanched area of parenchyma around the jaws . When the jaws of the device were approximated, indicated by the handle locking, the device was recycled, the excised segment of the liver was placed in an endocatch bag, morselated, and removed through one of the port - site incisions . Animals from all groups (i, ii, and iii) were assessed for biliary leakage on postoperative day 2 by cholescintigraphy . Animals were anesthetized with telazol (6 mg / kg intramuscularly) to allow administration of the radiopharmaceutical, hepatolite (10 millicuries), given via a jelco 22 gauge needle in the animals' left lateral ear vein . One hour later, a hida scan was performed using the adac forte camera, allowing evaluation of hepatocellular function and patency of the hepatobiliary system by tracking the production and flow of radiolabeled bile from the liver through the bile ducts and into the intestine . Following the hida scan, all animals underwent a midline abdominal incision for gross inspection of the cut surface of the liver and the surrounding area for any evidence of hemorrhage or biliary leakage . Upon visual inspection, no apparent evidence was present of biliary leakage, resolving hematoma, or abscess formation . Samples of the cut surface were taken for histological examination, and the animals were euthanized with a barbiturate overdose (beuthanasia, 1 ml plus 1 ml/5 kg, intravenously). The control animals underwent a nonanatomic left hepatic lobectomy through a scalpel incision in the abdominal midline by using the finger - fracture method . Blood vessels and bile ducts were clipped or suture ligated as appropriate and electrocautery (bovie) was used where indicated . The animals in group ii underwent a nonanatomic left hepatic lobectomy through a scalpel incision in the abdominal midline . The animals in group iii underwent a laparoscopic, non - anatomic, left hepatic lobectomy with the ligasure device for dividing the liver parenchyma and sealing and dividing all blood vessels and bile ducts . The pneumoperitoneum was insufflated by veress needle and maintained at a constant abdominal pressure of 12 mm hg . The ligasure device was introduced through a 10-mm trocar . The laparoscopic atlas version of the ligasure was used to divide the parenchyma as well as any vessels or bile ducts in continuity without isolating them first . This was accomplished by opening the jaws of the device and then gently applying pressure to the parenchymal surface . The device was activated by depressing a foot pedal, and increasing pressure applied to the handle, slowly approximating (closing) the jaws . The rate of compression of the parenchyma was guided by the surgeon, who maintained a 1-mm blanched area of parenchyma around the jaws . When the jaws of the device were approximated, indicated by the handle locking, the device was recycled, the excised segment of the liver was placed in an endocatch bag, morselated, and removed through one of the port - site incisions . Animals from all groups (i, ii, and iii) were assessed for biliary leakage on postoperative day 2 by cholescintigraphy . Animals were anesthetized with telazol (6 mg / kg intramuscularly) to allow administration of the radiopharmaceutical, hepatolite (10 millicuries), given via a jelco 22 gauge needle in the animals' left lateral ear vein . One hour later, a hida scan was performed using the adac forte camera, allowing evaluation of hepatocellular function and patency of the hepatobiliary system by tracking the production and flow of radiolabeled bile from the liver through the bile ducts and into the intestine . Following the hida scan, all animals underwent a midline abdominal incision for gross inspection of the cut surface of the liver and the surrounding area for any evidence of hemorrhage or biliary leakage . Upon visual inspection, no apparent evidence was present of biliary leakage, resolving hematoma, or abscess formation . Samples of the cut surface were taken for histological examination, and the animals were euthanized with a barbiturate overdose (beuthanasia, 1 ml plus 1 ml/5 kg, intravenously). Intraoperative blood loss and operative times were significantly lower using the ligasure device and are shown in table 1 . Open resection animals (groups i and ii) were depressed postoperatively, had decreased appetite, and required analgesia . In contrast, laparoscopic animals (group iii) were alert, responsive, and feeding ad libitum 1 hour after recovery from anesthesia . Histological examination of excised liver and remaining liver at sacrifice showed secure sealing of all biliary and vascular structures in the ligasure groups . Not unexpectedly, thermal injury from standard electrocautery was 4 times greater than that observed in tissue examined where the ligasure device was used, as measured on histological specimens . One animal in group i had a bile leak detected on hida scan . However, this leak was not discernible upon subsequent visual inspection and was considered clinically insignificant . Additionally, postoperative bleeding was absent in all animals as confirmed by gross inspection on postoperative day 2 . Laparoscopic surgery provides benefits to the patients, such as shorter recovery time, less pain, and more cosmetically acceptable incisions . However, solid visceral organs such as the liver pose a significant challenge to the laparoscopic surgeon because they have a soft parenchyma richly interspersed with vasculature . Realization of the potential advantages of laparoscopic liver resection requires the technical ability to ensure hemostasis during division of the parenchyma . The effectiveness of laparoscopic instrumentation in maintaining a hemostatic, clear operative field has not been well documented to date . Due to this fact, the application of laparoscopic surgery to procedures on the liver has been delayed by the lack of appropriate instrumentation, and the testing of laparoscopic surgical techniques . Greater acceptance of laparoscopic liver resection requires careful evaluation of the safety and efficiency of available technology and techniques . To date, laparoscopic liver resection has been evaluated in several case studies demonstrating the expected benefits to patients: decreased postoperative pain, reduced trauma to the abdominal wall, smaller incisions, shorter hospital stay, and earlier ambulation and return to normal activities compared with conventional liver surgery . In this study, we evaluated the application of vesselsealing technology to liver resection in both open and laparoscopic approaches . Our findings demonstrate effective sealing of intrahepatic blood vessels and bile ducts without requiring isolation . Little to no blood loss occurred using the ligasure device as compared with that with the standard finger - fracture method of partial hepatectomy . Our specimens did not contain any veins greater than 7 mm, and we believe that other methods, such as endovascular staplers, would be required for larger portal or hepatic vein branches . A significant limitation of laparoscopic surgery, which has prevented application to liver resection, is the difficulty in controlling blood vessels . Laparoscopic suturing is difficult in the best circumstances; trying to control a bleeding hepatic vein using laparoscopic suturing would be a formidable undertaking . The ability of the ligasure device to effectively seal intraparenchymal blood vessels is a significant advancement that increases the feasibility of laparoscopic liver resection . The additional finding that bile ducts were effectively sealed further strengthens the applicability of the device to liver resection . The effectiveness of the ligasure in nonanatomic liver resection in this study emphasizes the importance of new surgical technology in extending the range of laparoscopic procedures available to the surgeon . There is no question that liver resection, especially nonanatomic, is a technically challenging operation . The application of laparoscopic techniques to these procedures should be considered only where full support for advanced laparoscopic procedures is available, and by surgical teams experienced in all aspects of liver surgery.
Osteoblastomas are rare, osteoid - forming tumors first described by lichtenstein and jaffe in 1956 . Twenty - six cases of osteoblastoma involving the temporal bone have been reported so far . Localized pain and swelling with occasional 7 and 8 cranial nerve compression are the main presenting clinical features . Raised intracranial pressure (icp) caused by mass effect has been reported in one case, and in another case, 6 nerve palsy caused by compression of the cavernous sinus has been described . The gold standard for the treatment of this type of lesions consists in the complete surgical resection, which unfortunately is not possible in every occasion . We report on the management of a small right temporal bone osteoblastoma causing compression of the right transverse - sigmoid sinus junction, which became clinically evident with isolated intracranial hypertension syndrome (ihs). A 7-year - old boy with a history of autism presented to a peripheral hospital complaining of headache and neck pain followed by visual disturbance . The ophthalmic examination documented a bilateral loss of visual acuity (2/10), fixed bilateral mydriasis and a grade iv bilateral papilledema . The noncontrast - enhanced computed tomography (ct) scan of the head was unremarkable . The patient was transferred to the pediatric ward of our hospital with a provisional diagnosis of pseudotumor cerebri . The patient underwent a magnetic resonance imaging (mri) scan of the brain with gadolinium which showed signs in keeping with longstanding raised icp, including bilateral kinking of the optic nerves within the orbit, enlargement of subarachnoid spaces, flattening of the posterior sclera, and the empty sella sign [figure 1b]. The same investigation documented a single, 16 mm, oval, t1 and t2 isointense, contrast - enhancing lesion arising in the right mastoid region, and narrowing the transverse - sigmoid sinus junction [figure 2b]. (a) coronal slice from the follow - up angio - magnetic resonance imaging showing the reconstitution of the physiological caliber of the right transverse - sigmoid sinus . Comparison between preoperative (b) and follow - up (c) axial magnetic resonance imaging images demonstrating the resolution of two important radiological signs of intracranial hypertension: the posterior flattening of the ocular globes and the papillary protrusion (a) angiographic sequence showing the mild right sinus dominance and the clear effect of the compression on the transverse - sigmoid junction . (b) angio - magnetic resonance imaging coronal slice showing the hyperintense solid lesion responsible for the hampering of the venous blood flow a cerebral angiography digital subtraction angiography documented the compression of the right transverse - sigmoid junction distal to the vein of labb, within a picture of mild right side dominance of the venous sinuses circulation in the posterior fossa [figure 2a]. A diagnosis of raised icp related to impaired cerebrospinal fluid (csf) absorption was supposed, considering the intracranial venous hypertension due to the lesion compressing the sinus . Intraoperatively, an osteolytic lesion was found on the asterion with a moderately bleeding core underneath, extending in the right mastoid . The lesion did not involve the dura and was indenting and stretching the right transverse sinus . We also considered the possibility to measure intraoperatively the hydrostatic pressure in the transverse sinus proximally to the lesion, but the potential risks related to a maneuver involving a puncture of the sinus outweighed the benefits . The histological examination was in keeping with a diagnosis of osteoblastoma [figure 3]. It shows the typical structure of the osteoblastoma consisting in anastomosing bone trabeculae embedded in a loose fibro - vascular stroma (h and e, 200) on the postoperative time, a right mastoiditis occurred, which was successfully treated . The postoperative course was characterized by a prompt resolution of a headache and a progressive improvement of the visual acuity over the following weeks . Indeed, a 4-week follow - up ophthalmic exam documented a visual acuity of 7/10 in the right eye and 4/10 in the left, associated with a complete resolution of the papilledema and some degree of residual left optic atrophy . A follow - up mri after 4 months showed the normalization of the diameter of the right transverse - sigmoid junction [figure 1a], and a significant regression of the signs of increased icp [figure 1c]. The morphological features of the venous sinuses in the general population are extremely variable: a symmetrical venous drainage in both transverse sinuses is reported in no more than 65% of cases and a prevalence of the right dominance account for 40%60% . Venous flow impairment through the transverse - sigmoid sinus has been often observed as a potential ihs - triggering mechanism, in particular, if associated with contralateral sinus hypoplasia . Several different conditions can account for venous sinus obstruction, including thrombosis and tumor compression . A recent retrospective study on a pediatric series 145 mr - venograms of patients diagnosed with idiopathic intracranial hypertension, was reviewed to assess the potential role of venous outflow impairment . Furthermore, obstruction of a dominant sinus was significantly associated with an increased opening pressure after lumbar puncture (median value 34 cm h2o and highest value 65 cm h2o). The presence of dominant - sided venous outflow obstruction was associated with pathological collateral venous circulation in 68% of patients . Nevertheless, maiuri et al . Recently observed that a nondominant sinus compression may lead to raised icp, whereas obstruction of a dominant sinus may remain without clinical consequences . Such findings, contrasting with the intuitive common sense, highlight the complexity of the venous sinuses as an anatomic - functional system, where an active role is also played by the development of an adequate collateral circulation . The temporal bone is the site where the transverse and sigmoid sinuses are located and so the development of an even small mass in this position may cause a compression of these vascular structures . The histopathological diagnosis in our case was in keeping with osteoblastoma, an osteoid - forming tumor that usually develops in the long bones or in the posterior vertebral arches . The rising from the temporal bone is extremely unusual, with only 26 cases described in the literature . The clinical presentation of temporal bone osteoblastomas is quite heterogeneous: the most common presenting symptoms are swelling and localized pain not relieved by salicylates; hearing loss, tinnitus and facial palsy occurred in 30% of cases . Only two other cases were reported with symptoms and signs similar to those found in our patient, but the mechanism responsible for that clinical condition was different . The first case presented with ihs due to the prevalent mass effect of a huge osteoblastoma (10 cm 6 cm 6 cm) located in the left temporal bone; the second case presented with headache and diplopia due to an osteoblastoma invading the apex of the cavernous sinus and causing 6 cranial nerve's palsy . In our case, we postulate that a decrease in csf reabsorption due to venous sinus obstruction was the underlying cause of the ihs . It should be noted that our patient suffered from learning disabilities, and this may have led to a diagnostic delay and the evidence of left optic atrophy suggests a longstanding raise in icp . Noncontrast - enhanced ct scan does not help the diagnosis as in our case, whereas the mri was essential to show the lesion and to document the characteristic signs of raised icp . A cerebral angiography was performed to assess the extent of sinus obstruction, as in our case the mri - angiogram proved to be of low accuracy to such purpose . The management of symptomatic patients with compression of a cerebral venous sinus entails restoring the normal venous drainage . Radiotherapy, which has been used in the past, has shown to be ineffective or even detrimental because it can promote malignant degeneration . Chemotherapy, on the other hand, does not have a role in the treatment of the primary singular benign bone tumor . We report the novel finding of ihs caused by a small temporal osteoblastoma obstructing the transverse - sigmoid junction in a pediatric patient . Complete resection of the lesion restored the venous drainage, leading to prompt clinical improvement . In the management of patients with a venous sinus compression, restoration of venous drainage
Common causes of haematochezia in adults are diverticular disease, vascular ectasia, colitis (ischaemic, inflammatory or infectious), colonic neoplasia and anorectal conditions (1). Haematochezia is not reported as a common mode of presentation among patients with cronkhite - canada syndrome (ccs) in which diarrhea and dysgeusia are the predominant initial presentations (2). Surgery in patients with ccs has been carried out for associated gastrointestinal tract malignancies, intestinal obstruction and severe protein loosing enteropathy (3). We present a case of persistent severe haematochezia in a patient with ccs, successfully managed with proctocolectomy . A 50-year - old sri lankan man presented with a 3-month history of diarrhoea, haematochezia and weight loss of 20 kg . One month prior to these symptoms he has noticed dark pigmentation of the skin and hair loss . Physical examination revealed a cachectic man with alopecia, generalized skin hyperpigmentation involving the palms and onychodystrophy of fingernails (fig 14). Diffuse skin hyperpigmentation involving the palms biochemical investigations revealed a haemoglobin value of 9g / dl and marked hypoalbuminaemia with serum albumin of 12g / l (normal- 36 - 44g / l). Upper gastrointestinal endoscopy and colonoscopy revealed multiple, sessile polyps of varying sizes distributed throughout the stomach, duodenum, colon and rectum without any polyps in the oesophagus . Video capsule endoscopy revealed numerous similar polyps throughout the small intestine (fig 4). Onychodystrophy of finger nails biopsy of colonic polyps revealed cystic dilatation of crypts with oedema of the lamina propria suggesting hamartomatous polyps . Thus, a diagnosis of cronkhite - canada syndrome was made, considering the characteristic ectodermal abnormalities on physical examination, endoscopic findings and histology . Haematochezia worsened despite medical treatment for 2 months and proctocolectomy with a permanent ileostomy was performed . Histology of the specimen revealed multiple polyps with a diverse spectrum of morphologic features including juvenile - type polyps, adenomatous polyps, serrated adenomas, hamartomatous polyps and mixed polyps . First described in 1955, cronkhite - canada syndrome (ccs) is a rare, nonhereditary polyposis syndrome with an uncertain aetiopathogenesis . Approximately about 400 cases have been reported in the literature with the majority being reported from japan . It is characterized by the presence of diffuse gastrointestinal polyposis (sparing the oesophagus) associated with characteristic ectodermal abnormalities such as alopecia, nail dystrophy and cutaneous hyperpigmentation (4,5). Associations with raised ana and igg4 levels, hypothyroidism and various autoimmune diseases such as systemic lupus erythematous, rheumatoid arthritis and scleroderma have been published in the literature (6). Most of these patients present with diarrhea and dysgeusia and the dermatological manifestations are known to appear later (2). The presentation in our patient is different because he had not developed dysgeusia, his cutaneous symptoms have preceded the onset of diarrhoea and haematochezia was one of his key presenting features ., different treatment modalities have been attempted with varying degrees of success (7). These include hyperalimentation, corticosteroids, h2-receptor antagonists, antibiotics, acid suppression, cromolyn sodium, anabolic steroids, surgery, and combinations of these therapies (7). Among the various complications this can be as high as 15% and both gastric and colorectal malignancies are known to occur in these patients (8,9). Some studies have shown overall mortality rates as high as 55% among their patients (2). To our knowledge, this is the first case of total proctocolectomy for refractory haematochezia in a patient with ccs . This also highlights the importance of considering cronkhite - canada syndrome as a rare possibility in a middle aged male presenting with haematochezia, specially if the patient is of asian origin and if there are any cutaneous abnormalities suggestive of this condition.
The agricultural industry in the southeast of the united states is an important contributor to the economy of the region . The industry relies on the manual labor of farmworkers who plant and harvest crops, work in packing houses, processing plants, and preparation facilities associated with farms . The majority of farmworkers in the southeastern united states are migrants from latin america, with some representation from other regions . A migrant farmworker is defined as an individual whose principal employment (at least 51%) is in agriculture on a seasonal basis and lives in temporary housing (us code, public health services act, migrant health). Currently, there are over 3 million migrant farmworkers in the united states . In 1964, the h-2a temporary agricultural program enables farmers who are unable to recruit sufficient domestic workers to bring foreign workers to usa to perform agricultural labor or services of a temporary or seasonal nature . Legal protections that apply to these h-2a workers are enforced through the wage and hour division of the united states department of labor . For example, in one county alone, riverside county, there are over 600 farms (riverside county is a pseudonym, for confidentiality reasons . ). Riverside county, an agriculture intensive region in southern georgia, has over 600 farms, of which just 3 are h-2a farms . Up until 10 years ago, there was just 1 h-2a grower in the state of georgia . The rights of farmworkers and responsibilities of farmers are delineated in the migrant and seasonal agricultural worker protection act (mspa), which apply to both h-2a workers as well as undocumented workers . The mspa requires housing inspection and compliance with federal and state safety and health standards, provides itemized statements of earnings and deductions, and ensures that vehicles for worker transportation meet federal and state safety standards and insurance requirements, and that each driver is properly licensed . The goal of these regulations is to protect all farmworkers from substandard and dangerous conditions . Farmworkers in georgia usually arrive via mexico, and they include not only mexicans (the majority), but central and south americans, as well as some persons from the caribbean . Farmworkers in southern georgia are typically undocumented, and farmers rely on smugglers, known as coyotes, to shuttle them back and forth from mexico to georgia . Farmworkers come to georgia looking for economic opportunities, but frequently undocumented workers' ability to be financially independent is untenable given the debts owed by farmworkers to a contractor . The contractor typically finances the farmworker's travels and living expenses, while expecting full reimbursement plus interest before the farmworker leaves his / her job . In 1996 the health centers consolidation act established a centralized funding source for migrant / seasonal farmworker health centers, as well as health centers for other vulnerable populations . Today there are 154 migrant farmworker health centers in 42 of the united states, which provide health care to over 807,000 farmworkers . Despite these health centers, access to health care the major threats to migrant farmworker health documented in the literature include occupational injuries, pesticide exposure, infectious disease, heat stroke, and dermatological conditions . The working and living conditions of migrant farmworkers generate unique health hazards, due to both occupational challenges as well as injury and illness that stem from the conditions imposed by the culture of migrant farmwork, including dependency and poverty . For example, food insecurity is prevalent among farmworkers in the state of georgia, with as many as 63% reporting inadequate food . Undocumented workers have an adjusted risk of food insecurity 3 times higher than h-2a workers . While significant research has been conducted on occupational hazards of farmwork, such as pesticide exposure, injuries, and dermal conditions, there has been little focus on the differential health risks encountered by farmworkers resulting from their marginalization . They also experience elevated rates of social and economic discrimination compared to the general immigrant population of the usa . Joseph hovey has written several articles on migrant farmworker health that highlight associations between high levels of depression and various risk factors, including family dysfunction, ineffective social support, hopelessness, and high acculturative stress . While there appears to be agreement among scholars that acculturation leads to stress and increased incidence of mental health dysfunction, one study found that the prevalence of psychiatric disorders among migrant farmworkers was lower than for mexican americans and the us population as a whole, but increased with further acculturation and primary residence in the united states . Although debates about migrant workers have emerged across the country, they are particularly volatile in the state of georgia . As of july 1st, 2011, georgia house bill 87, the illegal immigration reform and enforcement act of 2011, was enacted with the goal of deterring the undocumented from entering the state (house bill 87). The law requires that businesses and government agencies check the immigration status of new workers through a national system and impose fines of up to $250,000 and 15 years in prison on those who use false identification . An additional provision requires people applying for food assistance and public housing to provide specific forms of identification . The state's sixty - nine billion dollar a year agricultural industry is at stake with the passage of this new immigration law . The purpose of this paper is to inform public debate by presenting empirical data about the scope of health challenges facing migrant farmworkers . Nurses play an important role in the care of migrant farmworkers in usa, but many more nurses are needed to care for farmworkers . This paper utilizes narrative analysis of a case study to illustrate, through the relationship of the narrator to migrant farmworkers and the participant observations of the co - authors, how isolation from family and community, as well as invisibility within institutions, impact the health and well - being of migrant farmworkers . Acculturation theory is based on the assumption that immigrants succeed by adopting cultural practices of their host country and relinquishing those from their homes . Reference theories of migration and health have held explanatory power for permanent and not temporary migration . A 1997 review of acculturation theory, tracing its evolution and widespread critique, acknowledges the theory's absence of recognition for the diversity of modern day immigrant populations from the global south . Alba and nee discuss the weakness of acculturation theory in that a more differentiated and syncretic conception of culture is needed, and a recognition that american culture was and is more mixed, much more an amalgam of diverse influences, and that it continues to evolve . [16, page 834]. Nevertheless they define assimilation as the decline and ultimate disappearance of an ethnic / racial distinction with the social and cultural differences that express it . The idea that assimilation involves the disappearance of ethnic and racial distinction assumes recognition of individual subjectivity . Citizens are recognized members of the state, entitled to protection, rights, material support, and a degree of political loyalty . The binary category of citizen / noncitizen serves to perpetuate the invisibility of non - citizens . Thus, the effect of perpetuating migrant farmworkers in a stateless category, as the citizen's other [18, page 76] addresses its economic need in the contemporary global structure . Nevertheless, the political desire to create boundaries between foreigners and full citizens, especially with respect to limited resources, such that health care is uneasily juxtaposed to the economic need for the productive migrant labor that non - citizens provide . In addition to a legal obligation to ensure human rights within their borders, states have an economic interest in healthy workers who are physically and mentally able to work . Recognition (or its absence) recognition has its origin in the phenomenology of consciousness, in hegelian philosophy, which constitutes social reality as a relationship between subjects, in which each sees the other as an equal, but also separate . In order to become an individual subject, one must recognize, and be recognized by, another subject [20, page 10]. All social integration depends on reliable forms of mutual recognition which can be regarded as the engine of social change [20, page 245]. Since 1993, a partnership between health professional students and faculty members from several academic institutions in the state of georgia and a farmworker health clinic in south georgia has provided health care to migrant and seasonal farmworkers . This project, the farmworker family health program (fwfhp), brings students and faculty to the schools migrant children attend, as well as to the fields and barracks where farmworkers live and work to provide basic health care and screening services . This partnership has made it possible to develop a deeper understanding of the experience of migrant farmworkers in this setting, which led to the current study ., there is understandable fear among undocumented farmworkers that exposure may result in fines, incarceration, and deportation . Farmers may have incentive to keep farmworker barracks hidden and inaccessible, as their business could be penalized for employing undocumented workers . In 2010, the director of the farmworker health facility in the fwfhp and one of the co - authors attended a workshop together to develop a proposal for community - based participatory research with farmworkers, sponsored by the united states national institutes of health (nih). The farmworker health facility director, a middle aged caucasian woman whom we refer to with the pseudonym jackie, presented 5 critical health issues facing the migrant farmworker population (lack of prenatal care, alcoholism, domestic violence, poor dental care, and diabetes). The nih faculty quickly identified jackie to be a key informant, a source of enormous knowledge about the lives of farmworkers, because she has lived amongst and worked with farmworkers in the same site for more than twenty years . The same faculty encouraged the fwfhp partnership to tap into jackie's knowledge about the experience of migrant farmworkers in her setting . Such knowledge might usefully inform policy makers and others about this little understood population . As a result of the workshop, the authors (six of whom are faculty in the fwfhp) conducted in - depth interviews with jackie over three months in 2010, to elicit a deeper description of the lives of farmworkers related to the critical health issues she had identified . Additionally, all the authors have been participant observers (ranging from a few days to eighteen years) at the site, as nurses who provide health clinics, health education, and referral . Through years of advocacy and membership in the mexican community, she has personal and professional relationships with farmworkers and is clearly devoted to their well - being . Jackie was on the advisory council for the migrant health clinic for 8 years before she was offered the clinic director position . She is well - known and trusted within the migrant community in which she lives by both farmworkers, and farmers alike, and is an invaluable resource for migrant health . The data analyzed here consist of 5 in - depth, in - person interviews conducted with jackie over several weeks in the summer of 2010 . Interviews were conducted either at jackie's house or in her car, while driving around the area, visiting farm fields and packing areas, as well as farmworker housing . The project was submitted to the institutional review board (irb) of the main university partner; they ruled that the project didn't require irb review . Analysis of the transcripts of these interviews was done utilizing open coding and making memos, techniques possible with maxqda software . Memos were used to generate ideas and engage with the narratives . From these memos, codes were created, and ultimately several of the codes that were interrelated and most engaged with the themes developed in memos were selected for analysis . While farmworkers provide the manual labor required to produce the fruits and vegetables americans see every day in the supermarket, they are largely both figuratively and literally invisible . Driving along a rural route in southern georgia, a passerby cannot see the hundreds of men and women, stooped among the pepper plants, from the road . In the following passage from an interview conducted while driving through the fields, jackie explains there is one church that we [farmworker family migrant health project volunteers] go to for lunch and when we first started going there, the minister at that church told the group of nurses that the first time we went to lunch there that he didn't know there were migrant farm workers here, and see, they are oblivious to them . There is one church that we [farmworker family migrant health project volunteers] go to for lunch and when we first started going there, the minister at that church told the group of nurses that the first time we went to lunch there that he didn't know there were migrant farm workers here, and see, they are oblivious to them . They wouldn't know this was here . Throughout these interviews, jackie tells the story of fragmentation of the farmworker family . Migrant farmworker children are impacted by invisibility, from their entry into the united states to their interactions with state institutions . Children of undocumented workers may cross the border with their parents and traverse the desert or rivers, while mexicans with more social capital pay others to pass them off as their own children and travel with them . Crossing children is more dangerous when the children can talk, but do not understand why they are not allowed to talk . Once children arrive with their parents, they often fall through the cracks of the public school system if they are enrolled in school . While the parents do not need to show proof of legal residence to enroll their children in school, they must have a birth certificate, which the parents may not have brought, or may have lost, during the trip to the united states . According to jackie, if migrant farmworker parents are able to locate a daycare, there is a good chance that their child would not be able to enroll . Daycares would rather have children enrolled whose living situation is stable, so the daycare can have a guaranteed revenue stream . Additionally, there is often minimal bilingual staff.you know, i don't think it's that they [daycares] don't want [migrant] children necessarily, but they don't have the if it's a licensed daycare, they don't have the provisions in place and so you know they would be in violation [of rules about accomodations for non - english speakers] and they don't know how to do that sort of thing . (sic) you know, i don't think it's that they [daycares] don't want [migrant] children necessarily, but they don't have the if it's a licensed daycare, they don't have the provisions in place and so you know they would be in violation [of rules about accomodations for non - english speakers] and they don't know how to do that sort of thing . Jackie's narratives also chronicle the fundamental instability of farmworker employment, as crop yields are highly dependent on unpredictable environmental factors; hence, there may be a flood, a tornado, or a freeze that affects the crop yield and forces farmworkers to relocate . Farmworkers are at the mercy of the harvest for their livelihood, as they do not receive unemployment benefits . According to jackie, in the event of crop failure, h-2a farmworkers do not receive relocation money or disaster assistance from the federal government, while there is crop insurance for farmers . Additionally, h-2a farmworkers do not typically receive unemployment, so they must follow the crops to sustain their livelihood . Jackie describes below how timing is essential in the agricultural industry.during peak season [is] when they're picking squash, tomatoes, cucumbers, eggplant, those kinds of things . And they thought they're not quite ready to be picked, but tonight if the humidity is ideal, we better wake up in the morning and they be ready, they grow over night . Cucumber, zucchini, squash, can grow overnight, can be ready in the morning when you wake up . That's why you need a labor force when you are a big grower like this . The plastic is laid by machine, but there are people following pushing dirt up on it to keep it from blowing up . Talking of occupational health, when the stringing is going on, we have a lot of rotor cuff injuries because they're doing this all day long up and down these rows . During peak season [is] when they're picking squash, tomatoes, cucumbers, eggplant, those kinds of things . And they thought they're not quite ready to be picked, but tonight if the humidity is ideal, we better wake up in the morning and they be ready, they grow over night . Cucumber, zucchini, squash, can grow overnight, can be ready in the morning when you wake up . That's why you need a labor force when you are a big grower like this . The plastic is laid by machine, but there are people following pushing dirt up on it to keep it from blowing up . Talking of occupational health, when the stringing is going on, we have a lot of rotor cuff injuries because they're doing this all day long up and down these rows . Jackie describes that when they are sick, farmworkers do not have the traditional support network of family to care for them or make sure that they take care of chronic health conditions . Not only is farmworker livelihood intimately connected to the weather and the seasons, jackie explains that it is also inextricably connected to their health . The types of crops harvested determine the variety of pesticides used, which in turn may differentially impact their health . Certain repetitive movements elicit specific types of overuse injuries, such as rotator cuff injuries . While picking cucumbers, contact dermatitis is common among farmworkers . Cutting mustard greens with a butcher knife jackie was notified when a farmworker, very ill with syphilis, meningitis, and aids, was hospitalized and did not have anyone to care for him, or serve as his health care proxy as he was intubated and therefore unable to communicate . When he recovered, a girl claiming to be his sister - in - law picked him up from the hospital . It turned out that he had given a false name at the hospital, and he did not have a sister - in - law . This type of confusion and misrepresentation speaks to both the underlying fear of disclosing one's true identity, as well as a lack of real social support . Many farmworkers use false names and identification they do not exist legally . Jackie's narratives underscore the lack of access to health care among migrant farmworkers . As she recounted, a migrant farmworker was living in his car, and he appeared constantly intoxicated . People who lived in the surrounding area complained of his intoxicated behavior, and so jackie went to investigate . She found money to send him to a doctor, and it was discovered that he had a brain tumor that was exerting pressure on his brain, so as to make him appear intoxicated . The tumor was operable, and once it was removed, the man's mental status was completely restored . Late diagnosis of this brain tumor resulted from lack of access to care . Delayed diagnosis of treatable conditions leads to an increased burden on the health care system, as well as unnecessary suffering by individuals and families . Women are not screened for pregnancy upon entering the country, and there are no consequences if a woman becomes pregnant during her contract . In fact, farmworker women are protected, as are american women, from being laid off because of their pregnancy . This results in women working under very challenging conditions during pregnancy, and yet as long as they continue to do so, their hours cannot be limited by employers . In addition, under the conditions of the h-2a contract, the woman must work and be paid for at least 75% of the time, and so taking the time off to obtain prenatal care may be especially difficult . In the state of georgia, pregnant farmworker women, whether documented or authorized to work, do not qualify for publicly funded healthcare in the usa (medicaid). Emergency medicaid is available to cover the delivery of pregnant farmworker women; however, their only prenatal care option is to enroll in a state - funded program, babies born healthy . This program is commonly underfunded by the state legislature, leaving women without access to prenatal care during the last few months of the fiscal year when funds have been expended . While a farmworker's baby will be an american citizen when born in the united states, and thus entitled to state - sponsored programs, his / her mother is not entitled to any benefits under federal law . They would be required to pay out of pocket and also travel a long way to obtain an abortion . Jackie described a case where a 21-year - old woman had received no prenatal care . For the first 4 weeks after the child was delivered, she did not understand what was wrong with her baby and brought the newborn to the clinic . She came in and sat down in my office and she said, why is my baby's head so big? Does my baby have a brain? Jackie took the young mother and child to the pediatrician, who referred her to a specialist at children's medical in atlanta . Finding a specialist who would accept this child as a patient was challenging, as the child's medicaid coverage was still pending . While jackie discovered that this diagnosis had been made at birth, the young woman did not understand the meaning of the diagnosis or the choices she would have to make as a result . This young mother had come to georgia on an h-2a visa, but overstayed it, making her current status undocumented . She had to move out of the barracks once she gave birth, and was living in a trailer with several other people, sleeping on a mattress on the floor . In order to qualify, many undocumented women in southern georgia obtain false identification using a name that is not their own . This presents a problem at delivery, when the wrong name might go on the birth certificate of the child . If the woman wants to return to mexico with her child, unfortunately the only recourse is to obtain a dna test in order to change the child's name, which is very expensive . Just as the woman might have had to be smuggled across the border to work in the united states, she may have to smuggle her own child back across the border . In addition to the challenges of providing prenatal care to farmworker women, there is also the challenge of getting women to utilize prenatal care . They still have to pay for a portion of it that is significant in their overall income; at the riverbend clinic, it is $300 for prenatal care, charged at the first visit . Women have often seen their mothers and aunts go without prenatal care, and many wonder if it is a worthwhile expense . Access to health care includes not only physical access, but also whether health care is culturally and linguistically accessible to farmworkers . Another of jackie's stories illustrates the cultural divide between migrant farmworkers and the american social welfare program . A department of family and children's services (dfcs) worker made a home visit to a young guatemalan woman's home . The dfcs worker was getting very frustrated with the young mother and asked the woman what the baby had eaten that day . Jackie saw the pot of caldo, a traditional broth made from the meat of bones and fed to children, on the stove, and already knew the answer . She opened her cabinet and found that it was full to the brim with baby cereal, which she had never opened because she never understood what to do with it . The dfcs worker also insisted that the young woman obtains a crib for the safety of her child.well, when we came the next time, she very excitedly met us at the door and told me to tell her, and so she's telling us to come, come with her, come with her, so we're following her to the back of the trailer and we get back there and what again, it's about paradigms, what you and i would see as a closet, this young girl saw as her room and she was very excited because she had been able to recall how her mother had created cunas [cradle] by creating this sling - type thing that the baby slept in . Almost like a hammock and so to her, she had done exactly as she was taught . She had got a cuna, and the dfcs worker, before i could do anything, began ripping it out and just screaming at the top of her lungs about the baby being in a closet and the girl had absolutely no connotation of closet . Her home didn't have closets in guatemala, you know, just like 100 years ago our houses didn't have closets and so she was devastated . Well, when we came the next time, she very excitedly met us at the door and told me to tell her, and so she's telling us to come, come with her, come with her, so we're following her to the back of the trailer and we get back there and what again, it's about paradigms, what you and i would see as a closet, this young girl saw as her room and she was very excited because she had been able to recall how her mother had created cunas [cradle] by creating this sling - type thing that the baby slept in . Almost like a hammock and so to her, she had done exactly as she was taught . She had got a cuna, and the dfcs worker, before i could do anything, began ripping it out and just screaming at the top of her lungs about the baby being in a closet and the girl had absolutely no connotation of closet . Her home didn't have closets in guatemala, you know, just like 100 years ago our houses didn't have closets and so she was devastated . While the young mother was proud of herself for fulfilling the requirements of the dfas worker and providing for her child, her concept of the cuna, or cradle, did not align with the american crib envisioned by the dfcs worker . Rather than supporting this mother's attempts to be a loving and attentive parent, the dfcs worker, representing the role of the state, shamed this young woman and made her feel like she was a poor parent and provider for her child . Jackie recounted a story about a 15-year - old boy who tried to adjust to farmworker life and the painful isolation that often comes with solo migration . This boy was brought across the mexican border in order to work on a farm in florida, and a contractor brought him to south georgia from florida . One night, he had a panic attack so severe, he thought it was a heart attack, and he called 911 (emergency number) at the barracks where he lived, and an ambulance transported him to the hospital . Jackie was called by the department of family and children's services (dfcs) when the hospital realized that he did not have any relatives or guardians . She was asked to take him in, as dfcs had no foster families who would take him and nowhere else to bring him . She decided to take him, and found out that he was not free to go home to mexico until he paid all of the money back to the contractor who had paid the coyote that crossed him (smuggled him across the border). The boy was concerned that he or his family would be hurt if he did not pay back the money he owed before returning to mexico . Jackie used her connections to demand that one of the farm contractors pay the bus fare to return the boy to his home and promise not to hurt him or his family . This young man traveled alone, without family or friends, to georgia, leaving behind his support network . Once farmworkers arrive in southern georgia, rather than starting with a clean slate and earning money to send back to their families in mexico or support their families in the united states, many start with the burdens described in this case . While the living quarters are close, jackie notes a lack of human connection among the male farmworkers, whose primary socialization revolves around alcohol once the workday is over . Alcoholism is a part of daily life of farmworkers, and alcohol is available even when food is not readily available, as alcohol vendors come around the barracks in trucks . As most farmworkers do not have access to their own transportation, they are unable to reliably go out to purchase food or do laundry; however, alcohol is readily available to farmworkers and children of any age . Access to mental healthcare is a challenge for all americans, but it is particularly challenging for those who lack insurance, a language in common with most practitioners, and transportation and availability to access services . Unique mental health challenges arise from the circumstances of migrant farmworkers and the conditions under which they work and live . Typically, they live with other men in barracks, separated from their wives, children, and extended family . This lack of social support can create situations of extreme anxiety and depression for farmworkers, compounded by their isolation and poverty, and exacerbated by the challenges of identity that spans two cultures . Fear of violence and retribution causes unique stress on migrant farmworkers that may not be experienced by other immigrants . Farmworkers' lives are often tightly controlled by contractors, the middle men between the growers and the farmworkers, who determine when they are paid, how much, when they arrive and leave the workplace, the type of housing and transportation they have access to, along with other basic services . Contractors are associated with some of the most severe abuses in agriculture, as they control every aspect of daily life of the farmworker . Once farmworkers arrive in southern georgia, rather than starting with a clean slate and earning money to send back to their families in mexico or support their families in the united states, many begin with the burden of repayment of the debt of passage to the united states . Traditional latino gender norms intersect with the isolation of farmwork to make for a very lonely life for many of the male farmworkers in southern georgia . Jackie describes explaining to the family farmworker health project students that male farmworkers might present to the students with what seems like a minor injury, and they are looking for caring and emotional support that they do not often get in their daily lives, as many are separated from their mothers, wives, and children . In addition, traditional gender norms adversely impact women, who are often expected to prepare food for men in the adjacent barracks, while also working in the fields or packing sheds for 10 to 12 hours per day . Jackie commented that if a woman ends up in a domestic violence shelter, the goal of the shelter is to assist women in becoming self - sufficient, which requires employment . If the woman is undocumented, she cannot become employed, which creates a grave problem for undocumented women who are abused . Jackie also speculated that sometimes men would prefer that their female partners remain undocumented as a way of maintaining power over the household . While the majority of farmworkers in southern georgia are undocumented, women are even more likely to be undocumented than men, as they may have joined their spouses in georgia who are on h2a visas illegally . Women who migrate with their partners bear unique vulnerability to mental illness and violence due to the gendered power difference within the family . If the couple has differing legal status, this may prevent women who are abused from seeking help due to many barriers, including a language barrier, lack of autonomy, and fear of deportation . While there is a way of receiving temporary documentation if a woman is being abused (a u visa), as with all case studies, our ability to generalize the findings of this case study to other cases is limited . While the results of this case study identify critical themes of migrant farmworker health among a small, rural population of farmworkers in southern georgia, the salience of invisibility, isolation, and limited access to healthcare has been noted in several previous studies . Garcia and gondolf identified situational factors that increase problem drinking among mexican farmworkers as social isolation and peer influence . They concluded that programs and policies are necessary to support migratory families and offset social isolation as a means to address problem drinking . Hovey and magana, in several publications on mental health among mexican migrant farmworkers, acknowledge the impact of social isolation resulting from physical isolation as negatively impacting their mental health [8, 9]. He names geographical and social isolation as represented by stressors associated with being physically isolated . He also describes emotional isolation as characterized by the emotional inability to confide in others [9, page 114]. The possibility of selection bias exists in this case study the group of farmworkers represented may have unique characteristics that brought them to the united states, and also in contact with jackie . It is important that future studies be conducted that employ a variety of methodologies to strengthen the body of knowledge of migrant farmworker health, which in turn will inform interventions and policy decisions . As this case study shows, the health of migrant farmworkers in southern georgia is influenced by many factors . Moreover, the risks of agricultural work for latino migrant farmworkers go beyond the physical dangers of the job; both their physical and mental health are at increased risk . Multiple theories have been proposed to understand the health of migrant workers, with several focusing on the health of migrant farmworkers in particular . While certain aspects of these theories capture elements of the health concerns voiced in this case study, they all fail to capture the impact of isolation from family and community, as well as the invisibility of farmworkers before institutions . Years of participation and the narratives of the key informant in this study highlight the lived experience of migrant farmworkers in georgia . Their reality constitutes an important challenge to the dominant theory of acculturation on several levels of analysis . In order to adopt american beliefs and behaviors, farmworkers would need access to institutions utilized by americans, such as churches, health care facilities, the judicial system, and domestic violence shelters . Due to fears of deportation, lack of english skills, and transportation, farmworkers are unable to access these resources . The isolation experienced by farmworkers is exacerbated by their lack of access to health care . Despite significant disease burden and excess mortality rates from certain diseases and injuries, farmworkers utilize health care less frequently than others . Without sufficient access to health care, in fact, even for the h-2a legally documented farmworkers, there is no screening for infectious or chronic disease . While farmworkers certainly have skills that are necessary for a successful harvest like correctly picking a tomato plant so that it continues to flower their skills are not transferable . Paradoxically, acquiring skills limits the economic possibilities of farmworkers, as successfully integrated migrants fill niche positions within labor markets, whereas farmworkers' skills are tied to a unique market where self - sufficiency is difficult . Farmworkers are invisible before the law; they lack the protections afforded to workers in every other sector . While h-2a workers are entitled to some benefits, such as workers' compensation, at least 75% of farmworkers and up to 90% of children of farmworkers do not have health insurance . This paper has endeavored to illustrate why farmworkers remain trapped in a self - perpetuating liminal location and, thus, cannot advocate for themselves . Nurses and other health professionals are called to actively advocate for a more socially just policy towards working conditions and access to educational and healthcare institutions that could improve their physical and mental health . Much of the american discourse surrounding immigration policy addresses the strain immigrants put on our social systems, educational system, and health care system . Nurses can contribute their voices to the immigration discourse as well, so that policy makers can understand the reality of the farmworker's life . Farmworkers play an essential and irreplaceable role in american food production, and they deserve to be seen and heard . Nurses who care for farmworker populations are uniquely positioned to provide on - the - ground witness to the lived experience of migrant workers . Such accounts make visible the scope of the human condition within state borders; the intersubjectivity that nurses can relate to wider audiences, can in this way contribute to the engine of social change . This paper is a contribution by nurses to make visible the subjective experience of migrant farmworkers in the case of georgia.
Myd88 was first described in 1990 as a gene upregulated during il-6-induced myeloid differentiation, but its homology to the cytosolic domains of drosophila toll and mammalian il-1rs (whose homology had already been noted) was not appreciated for another 4 years . Eventually, myd88 was implicated in signaling downstream of il-1r and mammalian tlrs [57]. The c - terminal tir (toll il-1r) domain mediates the interaction with other tir domain - containing proteins (receptors or adaptors); the n - terminal death domain (dd) associates with the irak family members through homotypic dd interactions (figure 1). Consistent with these roles, overexpression of the dd of myd88 leads to spontaneous activation of nfb and c - jun n - terminal kinase (jnk), whereas the tir domain can act as a dominant negative . Although this domain does not appear to be involved in the direct interactions described above, it is necessary for irak4 activation . In fact, myd88s, a splice variant of myd88 lacking the int domain, is induced upon activation and acts as a dominant negative form of myd88 . Myd88 is composed of three main domains: a death domain (dd) (54 to 109), intermediate domain (int) (110 to 155), and toll - interleukin-1 receptor domain (tir) (159 to 296). Although the dd is annotated as 54 to 109, proper folding of the dd seems to require amino acids 110 to 117 . Point mutations inducing a loss (blue) or gain (red) of function are indicated by amino acid number . The site implicated in interferon regulatory factor 7 (irf-7) binding (1 to 59) and the domain lost in the splice variant myd88s (110 to 155) are indicated in black . Mice lacking myd88 were reported in 1998, and the initial analysis of these mice confirmed the importance of this adaptor downstream of the il-1r family . In the following year, myd88-deficient mice were shown to lack responsiveness to lipopolysaccharide (lps), the ligand for tlr4 . Although this muted response protected myd88-deficient mice from endotoxic shock, myd88-deficient cells retained some residual signaling when stimulated with lps, suggesting myd88-independent signaling mechanisms downstream of tlr4 . Ultimately, this observation led to the discovery of tir domain - containing adapter - inducing interferon - beta (trif) as an adaptor for tlr3 and 4 . Myd88-deficient mice have been used extensively as a model for tlr deficiency and are susceptible to a large variety of bacterial pathogens or parasites . Comparisons between myd88- and caspase-1/11-deficient mice have been used to control for lack of il-1r and il-18r signaling in myd88-deficient animals, but mice deficient for all tlr functions were recently described and may prove useful for evaluating the role of tlrs independently of receptors for il-1 family cytokines . Several inactivating mutations in myd88 have also been identified in humans with recurrent infections with pyogenic bacteria . These mutations, as well as some rare missense polymorphisms, are associated with reduced irak4 activation, leading to impaired responses through tlrs and il-1 family members . Myd88-deficient humans do not appear abnormally susceptible to many viral, fungal, or parasitic infections . Whether myd88 is somehow less central to human immunity is complicated by the vaccinations and antibiotic regimens received by these patients . As our understanding of innate immunity has grown, it has become clear that other myd88-independent signals can mediate innate and adaptive immune responses to many pathogens, especially viruses . The first structure of a tir domain was elucidated shortly after the first descriptions of the function of myd88 as a signaling adaptor . This first study solved the structure of the human tlr1 tir domain and demonstrated that tir domains can oligomerize, but with an affinity in the millimolar range . Of note, additional studies showed potentially significant differences in the structures of other tir domains, in particular the bb loop of the tir domain of myd88 . This structural difference results in the inability of the tir domain of myd88 to dimerize with itself, which may be critical to prevent ligand - independent activation . Because of the relative weakness of tir - tir interactions, it has been postulated that conformational changes upon tlr ligand recognition bring tir domains in close proximity . This change of avidity would allow for the initiation of myd88 signaling . In the case of tlr9, it has indeed been shown that the receptor occurs as a homodimer and that ligand binding brings the cytoplasmic tails containing the tir domains in close proximity . The structure of the extracellular domain of tlr3 has been determined in the absence and presence of ligand . Although the tir domain was not part of the crystallized protein, modeling shows that ligand binding by a tlr3 homodimer brings the tir domains in close proximity . Similarly, the structure of the extracellular domains of a tlr1/2 heterodimer formed in the presence of ligand suggests a close association between the tir domains of each tlr . The recently solved structure of the extracellular domain of tlr8 also supports this idea . Indeed, binding of a tlr8 homodimer to its ligand induces a conformational change in the extracellular domains, bringing the membrane - proximal regions together . This conformational change most likely promotes the association of the transmembrane domains and cytoplasmic tails that contain the tir domain, although those were not included in the structure . Together, all of the structures of tlr and their ligands solved so far support the model outlined above . Myd88 can associate directly with receptor tir domains, so it was unexpected when the tir - domain - containing adaptor protein (tirap [also named mal]), which contains its own tir domain and a lipid - binding motif, was shown to facilitate the association of myd88 and tlr4 . Initial studies showed that tirap was required for tlr4 and tlr2 signaling but was dispensable for tlr3, 7, or 9 signaling . Of note, the requirement for tirap does not appear absolute and can depend on ligand concentration as well as cell type . However, recent evidence suggests that tirap can also be involved in tlr9 signaling . Because the requirement for tirap during tlr9 signaling was evident only with particular ligands (viruses but not the more stable and commonly used phosphorothioate - linked cpg dna) and cell types (immortalized macrophages but not the more phagocytic bone marrow - derived macrophages), it is possible that tirap is necessary only when few tlrs are engaged, suggesting that a certain threshold of tir domains must be achieved to trigger downstream myd88 signaling . It is also possible that different types of ligands induce different degrees of conformational changes and tir clustering in tlr9 homodimers . In the case of tlr4, where the requirement for tirap is most evident, several non - exclusive hypotheses have been proposed to explain the role of tirap . Tirap appears to be necessary because of its membrane localization and can be bypassed by targeting myd88 directly to the membrane . On the other hand, there is evidence for a preferential interaction between tirap and myd88 tirs but not tlr4 and myd88 tirs . Clustering of tir domains is thought to provide a stable platform for myd88 binding and oligomerization . This oligomerization of myd88 was apparent in early overexpression studies, but the complex formed by myd88 dds and irak dd was crystallized only recently . This structure, termed the myddosome, is composed of a ring of six myd88 dds that serve as a seed for assembly of a ring of four irak4 dds and ultimately four irak2 dds in a helix . This helical assembly was observed in other dd - based oligomeric complexes, such as the piddosome and the death - inducing signaling complex (disc). All assemblies rely on three distinct types of interactions between dds, allowing sequential assembly of a large complex . Interestingly, the myddosome structure was obtained in the absence of most of the int domain (residues 1 to 117, the annotated int domain starts at residue 110), but a similar stoichiometry was observed in the presence of the full int domain (residues 1 to 157). However, because the structure was crystallized in the absence of tir domains, several questions remain unanswered . For example, it is unclear whether all myd88 molecules in the myddosome are bound to a tlr or il-1r through their tir domain or whether the clustering of two tir domains is enough to allow stable dd association that seeds binding of additional myd88 dds and assembly of a full myddosome . It will also be interesting to investigate whether myddosomes can connect multiple dimerized tlrs, as suggested by recent work on tumor necrosis factor (tnf)-induced dd complexes . In addition to showing myd88 functions induced by tir - containing receptors, a few studies have shown a role for myd88 downstream of receptors that do not contain tir domains, like interferon gamma receptor (ifnr) and tnf receptor superfamily member 13b (also named taci). In those cases, it is unclear whether the same molecular mechanisms are involved in myd88 signaling, as taci but not ifnr appears to signal through the usual partners used during tlr / il-1r signaling . On the other hand, although most of the myd88-dependent signaling is mediated by dd - dependent irak recruitment, myd88 can also directly bind to interferon regulatory factor 7 (irf-7) to promote type i ifn production . This association is mediated by the n - terminal portion of myd88 but is not dependent on a dd fold (as a myd88 60 - 296 can still interact with irf-7). It is interesting to note that a gain - of - function variant of myd88 (l256p) has been described in some classes of b - cell lymphomas . This mutant can spontaneously assemble and lead to persistent nfb and signal transducer and activator of transcription 3 (stat3) activation . The mutation lies within the tir domain of myd88, suggesting that myddosome assembly and signal initiation may be affected . At least two models could explain the oncogenic potential of this mutation: either the mutation promotes the direct binding of myd88 tir homodimers, allowing efficient self - assembly, or the mutation enhances the affinity of myd88 for tlr or il-1r tir domains . Importantly, this mutation was observed in the absence of well - characterized oncogenic events (for example, myc translocation), suggesting that this mutant of myd88 can act as an oncogenic driver . Of note, it is also possible that the overexpression of wildtype myd88 is sufficient to promote tumor growth in other cell types . In light of the oncogenic potential of myd88, it may be interesting to revisit its role during tumorigenesis (for example, by comparing myd88-deficient mice to tlr - deficient mice). Myd88 acts as a central hub in inflammatory responses and can induce signaling from several receptors, located either at the plasma membrane or in endosomes . Additionally, myd88 signaling can lead to the production of pro- or anti - inflammatory cytokines as well as type i ifns . Two tnf receptor - associated factors (trafs)traf3 and traf6can be activated by irak family members and lead to the production of type i ifn or pro - inflammatory cytokines, respectively . Although the myd88-irak4-irak2 axis of the pathway can theoretically interact with both traf3 and traf6 complexes, it is likely that only some receptors, adaptors, or signaling molecules are available at given subcellular locations or in specific cell types . Here, we will discuss some established examples as well as new research avenues in the interplay between the initiation and localization of myd88 signaling . Tlr4 is unique among tlrs because it can signal both through myd88 to induce pro - inflammatory cytokines via nfb and through trif to induce type i ifn through irf3 . Interestingly, it was found that those signaling events are spatially separated, with tirap / myd88 signaling occurring from the surface whereas signaling from trif - related adaptor molecule / trif (tram / trif) occurs from endosomes . In that specific case, receptor internalization induces a switch from myd88 to trif signaling because of a change of adaptors, from tirap to the other tir - containing adaptor tram . Because of the distinct lipid composition of the plasma membrane and endosomes, and of the affinity of tirap for the plasma membrane phospholipid phosphatidylinositol 4,5-bisphosphate (pip2), internalization limits tirap affinity and myd88 activation . Given the promiscuity of tirap binding to lipids, it is unclear whether the difference in affinities of tirap for pi(4,5)p2 and phosphatidylinositol (3,4,5)-trisphosphate (pip3) is sufficient to mediate the switch from tirap to tram or whether other mechanisms can act simultaneously to promote tram association . Aside from the case of tlr4, there is evidence that the site of ligand recognition influences the signaling outcome even for receptors that rely solely on myd88 . The existence of distinct signaling pathways under the control of a single receptor is evident in the case of tlr9, which recognizes cpg motifs and can trigger the production of pro - inflammatory cytokines or type i ifn . It has been appreciated for quite some time that different classes of cpg motifs (a or b) favor type i ifn or pro - inflammatory cytokine production, respectively . Analysis of plasmacytoid dendritic cells from adaptor protein 3 (ap-3)-deficient mice revealed that this adaptor complex is critical for type i ifn production but dispensable or detrimental for pro - inflammatory cytokine production . Similarly, a localization motif in the cytoplasmic tail of tlr9 is required for pro - inflammatory cytokine but not type i ifn production . Again, lipid composition of the signaling compartment appears to be critical for specificity, as fusion of traf3 (a critical signaling node downstream of irak kinases) to a pleckstrin homology (ph) domain that allows localization to phosphatidylinositol 3,5-bisphosphate (pip2)-containing vesicles can bypass the requirement for ap-3 . Although these bifurcation pathways have mostly been identified in the case of tlr9, they may occur during signaling through other receptors and may be underlying the ability of tlr2 to induce type i ifn during viral infection in inflammatory monocytes . In addition to the spatial regulation of adaptors (such as tirap) and signaling molecules (such as traf3), it is clear that tlrs themselves are spatially regulated . The chaperone unc93b is responsible for the trafficking of all endosomal tlrs, but some tlrs can also use their own localization motifs for trafficking (such as tlr7 and ap-4), providing a basis for differential trafficking of distinct receptors . Ligands themselves can also be trafficked through different cellular compartments depending on their nature, as is the case with dna in the form of immune complexes, for example . A key challenge for future years is to understand the interplay between the trafficking of receptors, adaptors, and ligands and how localization impacts signaling initiation and the interaction between myd88 and other specialized signaling components . Overall, since its discovery about 20 years ago, myd88 has emerged as a central and well - conserved node of innate immune responses through its role as a bridge between tir - containing receptors and dd - containing kinases . The characterization of the myddosome suggests a clear molecular mechanism for signal transduction upon the local clustering of tir domain - containing receptors . Myd88 signaling can lead to distinct outputs depending on the context, usually leading to pro - inflammatory cytokine or type i ifn production . Distinct pathways downstream of irak family members regulate these outputs, and the outcome of signaling can be influenced by the cell type and location of signal initiation . In the years ahead, a more dynamic view of myd88 interaction networks, from ligands to receptors to downstream signaling components, may provide us with additional insight into the regulation of diverse myd88 functions.
Balantidium coli (b. coli) is the only ciliated protozoan that is known to infect humans . Balantidiasis is a zoonotic disease occurring in humans via the feco - oral route from the normal host, the pig . However, it may be found in rare extraintestinal sites such as liver, lung, and genitourinary tract . B. coli can become an opportunistic parasite in immunosuppressed hosts living in urban environments, where pigs are not a factor in infection . In this case report, b. coli was incidentally found in the urine of a patient having chronic obstructive pulmonary disease (copd) who was on steroids for a long time . The patient had no history of diarrhea, other gastrointestinal (gi) symptoms, previous urinary tract infection, or urethral discharge . He was also taking bone broth / soup . As a routine work - up urine sample was received ., several oval - to - oblong ciliated parasites that were approximately 75 50 m in size were seen swimming rapidly across the slide [figure 1a]. Two to three pus cells per high power field and few candidal pseudohyphae and spores were also present . Cytosmears were prepared from the urine sediment to identify the morphology . Both hematoxylin and eosin (h&e) and giemsa staining were done . In h&e stained smears [figure 1b], cytoplasmic food vacuoles and macronucleoli were seen and faint impression of cilia was noted . In giemsa stained smears [figure 1c and d], the parasite was identified and the body was covered with short and delicate cilia that were all of uniform length . To exclude contamination, we examined two repeat urine samples that were collected under sterile condition . Based on the morphology and swimming pattern, a diagnosis of urinary balantidiasis was made . Oval - to - oblong ciliated trophozoites containing cytoplasmic food vacuoles (thin arrows). (b) (h&e, 40) trophozoites of b. coli in urine showing cytoplasmic food vacuoles and faint impression of cilia (thick arrow). (c and d) (giemsa, 40) trophozoite of b. coli in urine covered with short and delicate uniform length cilia (thin arrows) complete hemogram and biochemistry profiles were within normal limits . Serology for human immunodeficiency virus (hiv) and hepatitis b surface antigen (hbsag) were negative . His fecal samples and bronchoalveolar lavage fluid samples were negative for trophozoites / cysts of b. coli . The patient was very sick at the time of admission, later he was intubated and kept on ventilator . Malmsten was the first to recognize b. coli in two humans with dysentery in the year 1857 . The pig is the common reservoir of infection but the parasite is harmless to the host as the parasite thrives mainly on starchy food that is abundant in pig's intestine . The scarcity of starchy food in the human bowel explains the rarity of balantidial infection in man . Cyst is the infective stage, when ingested liberates trophozoites in the large intestine, which may remain in the bowel or may invade submucosal coat of the bowel . The trophozoites and cysts of b. coli are shed in feces and if the cysts, in particular, contaminate drinking water or food, the infection can be spread to other pigs or humans . The trophozoite measures 30 - 150 m in length and 25 - 120 m in width; the cyst, which may be spherical or slightly ovoid, measures 40 - 60 m in diameter . The mouth (oral apparatus) is located at the tapering anterior end, and the cytopyge (anus) is located at the rounded posterior end . Balantidium causes no serious disease of the gi tract; however, in conditions such as malnutrition, alcoholism, or a compromised immune system, it can lead to disease . In our case, the source of infection is not clear . The patient had no history of contact with pigs, but he had history of intake of bone broth . Third hypothetical possibility is the ascending infection from the urine pot that was washed with plain contaminated water . B. coli should be differentiated from trichomonas vaginalis (t. vaginalis), entamoeba histolytica (e. histolytica), ciliocytophthoria phenomenon . In urine it can be differentiated easily from b. coli by its morphology and motility . In stool, it moves on the slide surface by means of an anterior ectoplasmic pseudopod and is smaller (around 25 m) in diameter . In addition, mature cysts are smaller and quadrinucleate as compared to binucleate b. coli cysts . In case of samples taken from anatomic locales that are lined by ciliated columnar epithelium ciliocytophthoria are much smaller (average 12 10 m) anucleated cells with cilia along one edge . Many cases of b. coli infection in the stool sample have been reported worldwide . However, in urine there were only a few case reports available . We have found only two case reports of isolated urinary balantidiasis from india while the rest showed coinfection with t. vaginalis . Umesh reported a case of a 29-year - old woman with cystitis due to b. coli . Reported urinary balantidiasis in a 68-year - old farmer having diabetes and chronic kidney disease . To the best of our knowledge, this is the third case report of isolated urinary balantidiasis from india . Rapid spiraling motility and cytosmears stained with giemsa and h&e satins are very useful in morphological identification . Effective sanitation, use of clean water, and consumption of properly cooked food are probably the most effective ways to prevent balantidiasis in humans.
Standard strength and conditioning typically aims to improve slow speed strength, while plyometrics and agility training focus on power development (12). When velocity - based training (vbt) was introduced, it combined the strength and power phases to improve power development in the weight room with high - velocity movements using loads that compare to those used to improve strength (12). Research showed the positive effects of vbt and its effectiveness in improving overall power production (9). Since the introduction of vbt, coaches and athletes of many anaerobic - based sports have implemented vbt into their strength regiments as a way to maintain strength and increase power, while preventing muscular fatigue for the upcoming competition . Another popular style of strength training is eccentric training, as larger forces can be developed eccentrically (10). Wirth, et al . Reported that if an athlete can effectively use concentric and eccentric types of contractions, it is superior in building strength compared to a concentric contraction - based program (16). One particular study was able to show that after eleven weeks of eccentric training, explosiveness increased by 44% eccentrically and 77% concentrically (11). Also, many injuries occur during eccentric loading movements, and therefore training eccentrically may develop muscle that is more resistant to injury (3). Taken together, it is possible that a combined program, including both velocity and eccentric training (veb), may produce gains of both strength and power . Both vbt and eccentric training have been found to improve vertical jump (7, 13). Further, no matter the contraction type or load, power output is increased by training at maximal velocity (9). To combine the styles of eccentric training and vbt, the resistance should be at a moderate load, the eccentric contraction speed slow, and the concentric speed explosive . Moderate loads and low repetitions have been used in a study for vbt, along with sprint and jump training to enhance performance (7). To date, a study that has combined these two training programs in athletes could not be found . There, they reported positive results of increased 1rm in leg curl, leg press, and leg extension, supporting the combination of vbt and eccentric training . The purpose of this study was to determine whether eccentric training and vbt could be used together (veb) in a strength training program in track and field athletes to develop two critical characteristics of athletics: strength and power . We hypothesized that by training the two programs of eccentric contraction and vbt together in one program (veb), larger gains in both strength and power production would be made compared to a vbt program alone . Our null hypothesis was that there would be no differences in performance between the veb and vbt training groups . Twenty division iii men and women track and field athletes were randomly placed into one of two training groups: vbt or veb (table 1.0). Within each group (throwers, jumpers, sprinters), each participant was randomly assigned to either the veb or vbt training program . Both training groups completed their program on legend fitness training equipment (knoxville, tn). All athletes had completed a physical prior to participating in this study with the nwu athletic training staff indicating they were healthy and eligible for training and competition . All participants were informed of the risks involved and benefits associated with the study before they signed the informed consent form . The effectiveness of both veb and vbt were measured by testing projected 1rm squat, projected 1 rm bench press, vertical jump, and medicine ball put test . Resistance training programs for 20 track and field athletes were designed for a 12-week training period where the content of the programs was similar, only the method of execution of core lifts differed . Details about the content and periodization of the programs are given below, as well as detailed procedures for the exercise tests . A projected 1rm squat was performed by each individual to measure lower body strength . To perform the squat, each individual performed parallel to the floor squats until they reach a repetition between three and six . From there, they increased the weight and perform three to six repetitions until they could no longer reach parallel or could nt perform a single repetition . While the protocol is stated three to six repetitions, athletes were coached to perform three repetitions due to greater accuracy of conversion of one - rep max . A projected 1rm bench press was calculated to determine each participant s upper body strength . To perform the bench press, each individual was supine on a bench . Similar to squat, the subject unracked the barbell, lowered the bar to their chest until their arms formed a 90-degree angle or until the barbell touched their chest . The subject then extended their arms until the barbell was back in its starting position . They completed this motion between three to six times and then moved up in weight . While the protocol is stated three to six repetitions, athletes were coached to perform three repetitions due to greater accuracy of conversion of one - rep max . They completed the bench press when they could no longer return the barbell to its starting position with arms fully extended, or they could nt complete more than one repetition . Each subject completed the vertical jump test to determine their lower body power, and to begin, one subject stood under the vertec jump training system and with his or her dominant arm up, reached for the highest peg possible . Then, the subject was instructed to stand under the vertec, was allowed one rock step, and then jumped as high as possible off of both feet and push away more of the pegs on the vertec . Each subject completed a short warmup before it was their turn to jump to reduce the risk of injury . The subject was seated on a bench at an incline angle with a medicine ball, 8 pounds for females and 12 pounds for males . The medicine ball was placed in both hands, with elbows out to the sides of body . A chest toss for distance was performed, with the subject explosively extending their arms without having their back leave the seat of the bench . Resistance training programs for the track and field athletes consisted of core lifts, power lifts, and accessory exercises 34 times per week, rotating upper and lower body exercises to allow for adequate rest and recovery for 12 weeks . The first 6 of the weeks resistance training was performed 4 times / week, and the final 6 of the weeks of the program, resistance training was performed 3 times / week . During the resistance training, power lifts were performed first, followed by core lifts, and finally accessory exercises . Core lifts that were performed in both training programs include: squat, bench press, shoulder press, leg press, and incline bench press . Those in the veb group were coached to performing the lifts with a slow and controlled eccentric phase (approximately three seconds) and an explosive concentric phase, whereas the vbt group was coached to performed both the eccentric and concentric phases explosively . Power lifts and accessory lifts were also included in both programs, and the way in which they were performed did not differ between groups . Power lifts included: snatch, hang clean, power clean, and high pull . Approximately 46 accessory exercises, such as body weight lunges, pushups and pull - ups, were performed at the end of each resistance training session . Baseline measurements were completed over the course of a monday and tuesday, and the training programs began the following monday . Periodization for the 12-week program included three 3-week cycles, with one deload week after the first two cycles, and ending the programs with two weeks of tapering for peak . Details of the core and power lifts periodization include: cycle 1: 45 sets x 68 repetitions at 5060% of projected 1rm, cycle 2: 35 sets 46 repetitions at 6070% of projected 1rm, deload week: 3 x 45 at 70% of projected 1rm, cycle 3: 45 sets x 24 repetitions at 7080% of projected 1rm, final two weeks: 46 sets x 25 repetitions at 5565% of projected 1rm . The post - testing data was collected during the week following the end of the intervention . Changes in performance between training groups were compared using an independent t - test using microsoft excel . A value of p <0.05 was used to determine the significance of the results within the experiment . Twenty division iii men and women track and field athletes were randomly placed into one of two training groups: vbt or veb (table 1.0). Within each group (throwers, jumpers, sprinters), each participant was randomly assigned to either the veb or vbt training program . Both training groups completed their program on legend fitness training equipment (knoxville, tn). All athletes had completed a physical prior to participating in this study with the nwu athletic training staff indicating they were healthy and eligible for training and competition . All participants were informed of the risks involved and benefits associated with the study before they signed the informed consent form . The effectiveness of both veb and vbt were measured by testing projected 1rm squat, projected 1 rm bench press, vertical jump, and medicine ball put test . Resistance training programs for 20 track and field athletes were designed for a 12-week training period where the content of the programs was similar, only the method of execution of core lifts differed . Details about the content and periodization of the programs are given below, as well as detailed procedures for the exercise tests . A projected 1rm squat was performed by each individual to measure lower body strength . To perform the squat, each individual performed parallel to the floor squats until they reach a repetition between three and six . From there, they increased the weight and perform three to six repetitions until they could no longer reach parallel or could nt perform a single repetition . While the protocol is stated three to six repetitions, athletes were coached to perform three repetitions due to greater accuracy of conversion of one - rep max . A projected 1rm bench press was calculated to determine each participant s upper body strength . To perform the bench press, similar to squat, the subject unracked the barbell, lowered the bar to their chest until their arms formed a 90-degree angle or until the barbell touched their chest . The subject then extended their arms until the barbell was back in its starting position . They completed this motion between three to six times and then moved up in weight . While the protocol is stated three to six repetitions, athletes were coached to perform three repetitions due to greater accuracy of conversion of one - rep max . They completed the bench press when they could no longer return the barbell to its starting position with arms fully extended, or they could nt complete more than one repetition . Each subject completed the vertical jump test to determine their lower body power, and to begin, one subject stood under the vertec jump training system and with his or her dominant arm up, reached for the highest peg possible . Then, the subject was instructed to stand under the vertec, was allowed one rock step, and then jumped as high as possible off of both feet and push away more of the pegs on the vertec . Each subject completed a short warmup before it was their turn to jump to reduce the risk of injury . The subject was seated on a bench at an incline angle with a medicine ball, 8 pounds for females and 12 pounds for males . The medicine ball was placed in both hands, with elbows out to the sides of body . A chest toss for distance was performed, with the subject explosively extending their arms without having their back leave the seat of the bench . Resistance training programs for the track and field athletes consisted of core lifts, power lifts, and accessory exercises 34 times per week, rotating upper and lower body exercises to allow for adequate rest and recovery for 12 weeks . The first 6 of the weeks resistance training was performed 4 times / week, and the final 6 of the weeks of the program, resistance training was performed 3 times / week . During the resistance training, power lifts were performed first, followed by core lifts, and finally accessory exercises . Core lifts that were performed in both training programs include: squat, bench press, shoulder press, leg press, and incline bench press . Those in the veb group were coached to performing the lifts with a slow and controlled eccentric phase (approximately three seconds) and an explosive concentric phase, whereas the vbt group was coached to performed both the eccentric and concentric phases explosively . Power lifts and accessory lifts were also included in both programs, and the way in which they were performed did not differ between groups . Power lifts included: snatch, hang clean, power clean, and high pull . Approximately 46 accessory exercises, such as body weight lunges, pushups and pull - ups, were performed at the end of each resistance training session . Baseline measurements were completed over the course of a monday and tuesday, and the training programs began the following monday . Periodization for the 12-week program included three 3-week cycles, with one deload week after the first two cycles, and ending the programs with two weeks of tapering for peak . Details of the core and power lifts periodization include: cycle 1: 45 sets x 68 repetitions at 5060% of projected 1rm, cycle 2: 35 sets 46 repetitions at 6070% of projected 1rm, deload week: 3 x 45 at 70% of projected 1rm, cycle 3: 45 sets x 24 repetitions at 7080% of projected 1rm, final two weeks: 46 sets x 25 repetitions at 5565% of projected 1rm . The post - testing data was collected during the week following the end of the intervention . Within - group analysis was also done using a dependent t - test . A value of p <0.05 was used to determine the significance of the results within the experiment . Nineteen track and field athletes completed either the vbt or veb within the 12-week off - season (fall). When comparing the pre - to - post changes in performance, there were no significant differences between the vbt and veb training groups . However, there were significant differences from pre - to - post - intervention within each training group . Within the veb training group, there were significant increases in men s 1rm squat (166.55 35.74 to 177.73 34.80 kg; figure 2a), men s vertical jump (73.63 12.67 to 75.83 12.37 cm; figure 3a), and men s medicine ball put test (4.12 0.52 to 4.54 there were significant improvements in men s 1rm squat (154.55 9.46 to 176.71 15.89 kg; figure 2a), and women s 1rm squat (104.63 23.76 to 123.89 24.80 kg; figure 2b). All other group performances did not improve significantly, including no improvements in 1rm bench press in either training group . The main findings of this study suggest that vbt with or without eccentric focus will increase strength and power output, particularly seen in squat . A recent study by janovic, et al . Reported results and proposed that no matter the contraction type or load, the subject is able to increase power output by training with the intent to move the load at maximal velocity for the individual (9). In this study, power output and strength both increased, which is likely due to their interconnection to each other (14, 17). Strength and power are interrelated in the force development of power output, and be should trained as such to maximize potential in any given athletic event (4, 14, 15). Using a program such as vbt, as shown in this study, will develop the athlete s strength and ability to create force quickly . There were very few pre- to post - intervention performances that were negative numbers, demonstrating that on average, using any velocity - based training program can result in strength and power gains for the athlete . As seen in this study, vbt does increase both strength and power output, with or without eccentric focus, and this could be due to the fact that working at high velocities regardless of contraction type increases strength gains (1, 2, 6). Our study does contradict with a couple reports, showing that after eccentric training, explosiveness increased by 44% eccentrically and 77% concentrically (11). It is important to note that this study did not have vbt, but rather compared a high - velocity program without the heavy lifting concept to the eccentric training . Others have reported that eccentric contraction training results in improved jumping ability (5), which we only noted in the men s veb training group . Another study using moderate loads and low repetitions, which is a similar training strategy as velocity - based training, reported enhanced vertical jump and strength performance (7). Athletes began competitive training halfway through this study, and therefore, this could have influenced the performance in our study . It is possible that the athletes were fatigued or over - trained, which could have affected their performance . Unfortunately, there was much variety in the pool of athletes recruited for this study . Athletes were of different ages, had varying experience with resistance training, and competed in different types of events . Future studies involving a variety of athletes should be done to further investigate the effectiveness of a combination strength training program involving both eccentric and velocity components to determine if specific groups would benefit more from one type of training over another . As only performance measures were taken here, it is not known how lean mass changed within the athletes during the training program . It may be of interest for future studies to investigate changes in lean mass between the different types of programs to determine if hypertrophy or neuromuscular changes are involved in the performance improvements seen in vbt . While the findings of this study show that both the vbt and veb training programs were effective in improving strength and power, neither was superior . In examining the cost - benefit analysis of performing a veb program, it may not be worth the time and effort it takes to perform the eccentric motion . Athletes who participated in the veb program took much longer to finish their workout, but overall the gains were similar compared to the vbt group . Additionally, the moderate - to - low - intensity loads in vbt allows for less fatigue and quicker recovery, all - the - while - performance is still improving . Therefore, this type of training would be best implemented during the final weeks leading up to competition or a peak in training.
Methylammonium iodide (ch3nh3i) was prepared by dissolving methylamine (sigma - aldrich 534102) in absolute ethanol and reacting with hydroiodic acid (sigma - aldrich 210021) in an ice bath . Then, 12.4 ml of methylamine and 6 ml of hydroiodic acid were mixed with 50 ml of ethanol . The solvent was removed by rotary evaporation, and the obtained white powder was washed with anhydrous diethyl ether . Ch3nh3i and pbcl2 (sigma - aldrich 268690) were dissolved at a final concentration of 40 wt% in anhydrous n, n - dimethylformamide (dmf) (the molar ratio between ch3nh3i and pbcl2 was 3:1). Mapbi3 films were grown onto clear white glass substrates (proscitech) previously cleaned sequentially in ethanol, acetone, 2-propanol, and finally treated oxygen plasma for 300 s. ch3nh3pbi3 precursor solution (100 l) was deposited (substrate area 2 cm 2 cm) by spin - coating at 5000 rpm . After 6 s, while the spinning process took place, 200 l of anhydrous chlorobenzene was dropped onto the center of the substrate, as previously reported . The resulting films were then annealed at 100 c for 3 h, until a pure ch3nh3pbi3 layer was obtained . Optical characterization . Total transmittance (t) and total reflectance (r) spectra of the ch3nh3pbi3 films were measured using an integrating sphere attached to a uv vis spectrophotometer (shimadzu uv-2101 pc). The spectral dependence of the absorptance (a) of the ch3nh3pbi3 films was determined by making use of the formula a = 1 r t. ple measurements were performed in a commercial fluorometer (fluorolog 3 from horiba). The samples were excited with a spot of 1 1 cm with a wavelength variable between 450 and 850 nm (fwhm = 5 nm), and detection was carried out at an angle of = 22.5 at the maximum of pl (= 775 nm). Pl measurements were carried out by optically pumping the samples with a tunable picosecond laser source (fianium sc400) delivering low power (sub - mw), 900 ps long pulses with a 1 khz repetition rate . The pump beam was focused down to a 100 m spot with an achromatic lens (f = 10 cm), which also collected the emission . Spectra were collected at 0.5 s intervals with a fiber - coupled spectrometer (usb2000 from ocean optics).
Fecal contamination can degrade the water quality in estuaries, beaches, lakes, and rivers to such an extent that these environments may become impaired for recreational, agricultural, and industrial uses . A major concern for resource managers is to determine the source of fecal pollution in order to apply appropriate corrective measures . In recent years, several molecular pcr - dependent approaches have been developed and used for detecting diagnostic sequences of the 16s rrna gene of human fecal indicator bacteria as a marker for human fecal pollution . Many researchers use the amplicons from bifidobacteria and bacteroidales as molecular markers for indicating the presence of human fecal pollution [14]. While some studies have used the molecular detection of bifidobacterium adolescentis to indicate the presence of human fecal pollution in environmental samples [1, 2, 4, 5], other researchers have relied on the detection of human - associated bacteroides (hubac) as a marker of human fecal pollution [68]. Currently, there are conflicting reports on which fecal bacterial group provides the most reliable marker for the presence of human fecal pollution in the environment . In addition, the lack of uniform methods of dna extraction from environmental samples has added to the inconsistencies among reports on detection of human fecal pollution in the environment . Dna extraction from samples is a critical initial step in pcr detection of bacteria in environmental samples . There are numerous commercially available dna extraction kits that are used for recovering bacterial dna directly from feces, soil, and water samples [7, 9, 10]. Although the use of dna extraction kits in research laboratories has become routine, the amount and quality of dna recovered depend on the skill of the researcher and on the choice of the dna extraction protocol . With the use of such kits, it is usually faster to recover dna from fecal, sediment, and soil samples than from water samples . This is because the bacteria in a water sample are often concentrated using centrifugation or by membrane filtration prior to beginning the dna extraction [1, 11, 12]. Typically, membrane filters of pore sizes of 0.2 m or 0.45 m are used for concentrating bacteria from water samples prior to dna extraction [1, 2, 10]. There is limited information available in the scientific literature on which pore size of filters is the most effective in maximizing pcr detection of target bacteria from water samples . Bifidobacteria are strictly anaerobic, gram - positive rods that make up a significant portion of the intestinal microflora of humans and animals [1315]. Certain species, such as b. adolescentis, have been shown to be associated with human feces and have been used as an indicator of human fecal pollution [10, 12, 16]. Recent culture - dependent surveys also suggest the prevalence of bifidobacter species other than b. adolescentis in feces of commonly reared animals . However, there are reports indicating that b. adolescentis can be detected in nonhuman fecal samples [2, 17, 18]. There are three common pcr methods that are often used to detect b. adolescentis in environmental samples . Developed and successfully used 16s rrna gene primers biado-1 and biado-2 to detect b. adolescentis directly from human fecal samples . Bonjoch et al . Demonstrated that b. adolescentis could be detected in human sewage samples using a nested pcr reaction that first amplifies a 1.35 kb 16s rrna gene fragment of the bifidobacterium genus with the primer pair lm26 and lm3 followed by a second pcr with the primer pair bi ado-1 and biado-2 . Later, an optimized nested pcr similar to the bonjoch method was developed, and it detected b. adolescentis in areas near human sources of fecal pollution in estuarine and freshwater environments [10, 11, 19]. The king method, uses primers lm26 and 785r in the first pcr to produce a 756-bp product which is used as the template in the second pcr with the bi ado - primers . Previous reports have indicated positive correlations between the detection of b. adolescentis in marine and freshwater environments and fecal bacteria numbers [1, 3, 5, 11, 19]. However, the study by lamendella et al ., using the one - step pcr protocol of matsuki et al ., was unable to detect b. adolescentis in some sewage and human fecal samples, suggesting further variability in the detection of fecal pollution from human sources using b. adolescentis as a marker . These inconsistencies among methods for the detection of human fecal pollution in environmental samples have caused concern within the scientific community and resource managers . Currently, there is no information available on the comparison of pcr detection of b. adolescentis using the methods of matsuki et al ., bonjoch et al ., and king et al ., and of hubacs in environmental samples . One aim of this paper was to determine the influence of membrane filters on the yield of dna recovered from water samples and on subsequent pcr detection of fecal bacteria . Another aim of this paper was to evaluate these three common pcr approaches for detecting b. adolescentis and a single - step pcr approach for detecting hubac as indicators of human fecal pollution in environmental samples . Sewage samples from the city of milledgeville municipal sewage treatment plant were serially diluted in 0.9% sterile saline solution to 10, and triplicate 100 ml samples were filtered through a sterile mixed cellulose 0.22-m - pore (type gs, millipore, billerica, ma) or a 0.45-m - pore (gn-6-pall corporation, ann arbor, mi) membrane filter . Animal fecal samples from pig, chicken, cow, rabbit, and horse were collected from local farms in central georgia . Freshwater grab samples (100 ml) were collected from lacey mill road, little river and big indian creek in the oconee watershed of middle georgia and returned to the laboratory within two hours for processing . Marine water samples were obtained from eight sites close to public beaches in puerto rico, stored on ice, returned to the laboratory, and filtered through 0.22-m - pore nitrocellulose membrane filter (type gs, millipore, billerica, ma). The filters from puerto rico were frozen and shipped on dry ice by overnight courier to milledgeville, ga . Filters were processed with the mobio ultraclean soil dna kit (carlsbad, ca) using a modification of the alternative protocol given by the manufacturer [5, 10]. This involved separating the bead solution from the beads and placing it in a 15-ml centrifuge tube containing the filter . Solutions s1 and irs were placed in the tube and vortexed vigorously for 15 minutes . The solution was removed from the centrifuge tube and placed in the bead tube . From this point on, the manufacturer's protocol was followed . Dna was extracted from animal fecal samples following the procedure of the mobio ultraclean fecal dna kit . Extracted dna was quantified, using a nanodrop nd-1000 spectrophotometer (wilmington, de), and visually inspected under uv light for integrity on a 1.5% agarose gel stained with ethidium bromide . The dna extracted from water and sewage samples was tested for the presence of pcr inhibitors by using salmon testes dna from oncerhynchus keta (sigma, st . Louis, mo) as an exogenous internal control and known amounts of b. adolescentis genomic dna atcc number 15703d . The salmon testes dna was diluted in sterile distilled and deionized water to create a standard curve ranging from 0.0068 ng to 68.4 ng of dna . Quantitative pcr contained 1 l water or sewage sample, and 6.84 ng salmon testes dna as templates in a single 25 l qpcr, and primers specific to the rrna transcriber region 2 of o. keta . Samples with mean ct values within 3 standard deviations of the 6.84 ng dna containing control standard were considered uninhibited as in king et al . . In addition, samples were also amended with two different amounts of b. adolescentis dna (0.5 and 5 ng) per qpcr reaction using the qpcr conditions stated below (section 2.4) to evaluate possible discrepancies among filters and if effects of impurities on different concentrations of target were present . The changes in ct values between amended and unamended samples were compared to evaluate if shifts in ct values were proportional to concentration of amended b. adolescentis dna as an indication of the presence of impurities in the dna extracts . Quantitative pcrs were prepared in 200 l optical tubes with the following components and then adjusted to a final volume of 25 l: 12.5 l stratagene (la jolla, ca) fullvelocity sybr green qpcr master mix, a 2 concentrated mixture of archaeal dna polymerase, dntps (gauc), stabilizers, neutralizing hot start monoclonal antibodies, a thermostable accessory protein, 1.5 mm mgcl2; 0.1 m of each primer, and 10 ng template dna . The reactions were monitored in a mj / miniopticon real time pcr detection system (biorad, hercules, ca), under the following conditions: 95c for 8 minutes; 40 cycles of 95c for 20 s, annealing temp (table 1) for 45 s, followed by melting curve analysis at 4595c every 1c for 10 s. cycle threshold (ct) was determined automatically on the miniopticon following manual adjustment of the threshold fluorescence . B. adolescentis dna ranging from 0.005 ng to 5 ng was used for the standard curve . All standards were run in duplicate, and all samples and controls were run in triplicate . A no - template control, containing all the pcr reagents without dna, was run with each reaction . Prior to the pcr detection of bifidobacteria, dna samples were subjected to pcr using eubacterial primers 8f and 785r to establish that the dna recovered was suitable for pcr amplification . Three pcr protocols were followed to detect b. adolescentis in environmental samples using b. adolescentis genomic dna atcc number 15703d as a positive control . Primer sequence and annealing temperatures for each pcr method are listed in table 1 . Another method used to detect b. adolescentis was the nested pcr approach as described by bonjoch et al . Which was used to generate a genus - specific amplicon of 1.35 kb using primers lm26 and lm3 in the first reaction followed by using primers biado-1 and biado-2 in a second pcr to produce the 279-bp marker of b. adolescentis (table 1). The final pcr protocol used was the nested pcr procedure of king et al . . The first step consisted of an amplification using the primers, im26f and 785r, as the template for a second pcr mixture and amplified using b. adolescentis species - specific primers biado1-biado2 (table 1) added to a 50-l reaction mixture . Pcr was performed under the following conditions: initial denaturing at 94c for 5 minutes; 45 cycles of 94c for 30 s, 48c for 20 s, 55c for 20 s, and 72c for 1 minute; final elongation at 72c for 5 minutes and carried out with a techne tc-312 thermal cycler (cambridge, uk). Products from all pcrs were analyzed by electrophoresis in a 2% agarose gel stained with ethidium bromide and viewed in a gel documentation system to detect the presence of the appropriate bands as shown in figure 1 . Human - associated hubacs were detected using the primers hubac566f and hubac692r (table 1). Each pcr reaction had a 50-l volume containing 0.3 mm dntp, 3 mm mgcl2, 1 u taq dna polymerase, and 1 pcr reaction buffer . The samples were run on a techne tc-312 thermal cycler under the following conditions: initial denaturing at 94c for 5 minutes; 30 cycles of 94c for 30 s, 60c for 30 s, and 72c for 30 s; final elongation at 72c for 5 minutes . Water samples collected from marine and freshwater sites were assayed for the presence of b. adolescentis and bacteriodales . Fecal enterococci were enumerated using the enterolert system, whereas numbers of total e. coli were determined using the colilert system (idexx laboratories, westbrook, me). 100 ml of undiluted water samples and samples diluted (1010) with sterile distilled water were placed in sterile, 100-ml polystyrene bottles and mixed with manufacturer - supplied growth medium until dissolved . The contents of each bottle were poured into a sterile quanti - tray panel containing 97 wells and is heat sealed . Quanti - tray panels for fecal enterococci enumeration were incubated at 41 0.5c; those for total coliforms and e. coli were incubated at 35 0.5c . The presence of fecal enterococci and e. coli in wells was determined by detection of fluorescence with uv light at 365 nm . A manufacturer - supplied table was used to convert the number of positive wells to most probable number (mpn) values . There were no significant differences between the total dna recovered from 100 ml of sewage samples that have been diluted from 10 to 10 and filtered through 0.22- and 0.45-m - pore membrane filters (table 2). The evaluation of pcr inhibition in the dna extracts amended with salmon testes dna suggests negligible effects of background impurities since samples filtered through different pore sizes had similar ct prior to dna addition (average ct = 24; data not shown). Furthermore, the ct was proportional to the spiked b. adolescentis dna (p .95, snk multiple comparison test). In summary, both 0.22-m and 0.45-m - pore membrane filters spiked with 5.0 ng of b. adolescentis dna had similar changes in ct values (8.94 and 9.16, resp .) While the additiion of 0.5 ng of b. adolescentis dna elicited an increase of ct values of 5.90 and 5.51 . Qpcr estimates of the amount of b. adolescentis dna recovered from sewage using 0.22-m - pore membrane filters were in average higher than those from 0.45-m - pore membrane filters, especially considering dilutions of up to 10 (table 2). The molecular methods for detecting human fecal bacteria in environmental samples were initially evaluated and compared using municipal sewage dna and animal fecal dna samples . Detection of b. adolescentis as a marker of human fecal bacteria in sewage samples with a single pcr showed positive bands in only 2 out of 3 raw sewage samples and was ineffective with diluted sewage samples (table 3). To increase the sensitivity of detecting b. adolescentis in fecal samples, bonjoch et al . Developed a nested pcr assay for b. adolescentis overall, this nested pcr detection method was more successful at detecting b. adolescentis in diluted sewage samples and detected b. adolescentis in over half of the sewage samples, but b. adolescentis was detected in 3 out of 8 pig fecal samples . Using the nested pcr method developed by king et al ., b. adolescentis was detected in 100% of the sewage samples but not in the animal fecal samples tested, suggesting good specificity for detection of human - derived fecal pollution . It was observed with the nested pcr approaches that in the first pcr the putative marker of bifidobacteria was not always visible in samples that were positive for b. adolescentis after the second round of pcr . Hubacs were detected in 5 out of 24 sewage samples analyzed, in most of the pig fecal dna samples, and cow and horse samples . None of the dna from sewage samples recovered from 0.45-m - pore membrane filters showed positive bands for hubac, and the detection of hubac decreased in sewage samples with increasing dilution (table 3). Idexx fecal bacteria enumeration indicated levels of enterococci and e. coli ranging from undetectable to hundreds of thousands cfu (table 4). Molecular detection of b. adolescentis in dna samples recovered from marine and freshwater environments indicated that b. adolescentis was detected in 5 of the marine sites and in 3 freshwater sites using the method of king et al . All of these 8 sites had elevated levels of at least one of the fecal - indicator bacteria, based on established water - quality standards for full body contact (usepa, 2004). However, the king method did not detect the presence of b. adolescentis at the patillas station in puerto rico characterized by elevated numbers of both fecal indicator bacterial groups . Using the method of matsuki et al ., b. adolescentis was not detected in any of the environmental samples while the method of bonjoch et al . Detected b. adolescentis only in one freshwater site at lacey mill road (table 4). The hubac marker was detected in three samples from the marine environment that had elevated levels of fecal - indicator bacteria and in one of the freshwater samples from lacey mill road site 2 . It is well established that the concentrations and quality of dna recovered from water samples influence any subsequent pcr analysis of that dna for the detection of specific bacteria [10, 19]. Currently, in microbial source tracking of fecal pollution, numerous methods are used for the recovery of fecal bacterial dna from water samples . Often the water samples are filtered through membrane filters of pore sizes ranging from 0.2 to 0.45 m for concentrating the bacteria prior to dna extraction [1, 2, 10]. Differences between the concentration of total sewage dna recovered from 0.22-m - pore nitrocellulose membrane filter (type gs) and that from 0.45-m - pore membrane filter (gn-6) were mostly not significant until reaching dilutions> 10 (table 2). It is not clear why the yield of dna at higher dilutions was lower using smaller pore size filters, however variability is ruled out as it was minimal for this set of observations . The similarity among different sample dilutions points to saturation of the adsorbing matrix of the kit used . That is, the dna retention capacity of cartridges used from the kits was surpassed by most of the dilutions used . Even though there were no major differences in the concentration of dna recovered from most of the filters, it is possible that the presence of pcr inhibitors in the dna extracts could have differentially inhibited pcr or qpcr assays . The lack of qpcr inhibition in dna extracted from environmental samples using 0.22-m or 0.45-m filters and the mobio kit has been reported in previous studies [5, 19]. However, collecting bacteria on a 0.22-m - pore mixed cellulose membrane filter increased the amount of b. adolescentis dna detected in diluted sewage samples compared to the detection of these bacteria in sewage samples filtered through a 0.45-m - pore membrane filter . In our case, it seems that b. adolescentis could pass through 0.45-m pores as our analysis shows an order of magnitude higher in detection by using 0.22-m pore size filters than by 0.45 m ones (table 2). These results agree with previous observations that suggested using 0.22-m - pore membrane filter (type gs) instead of 0.45-m - pore membrane filter (gn-6) for dna extraction from environmental samples . Pcr detection of host - specific fecal - bacteria has become very useful in tracking the source of fecal pollution in environmental samples . However, common fecal - indicator bacteria, e. coli and enterococci, were not used in this study because there are no known strains of these bacteria that are limited to a specific host [8, 19]. Comparison of three pcr methods for the detection of the fecal bacteria b. adolescentis indicated that direct detection of b. adolescentis by a single - step pcr was only effective for detecting the bacteria in raw sewage samples concentrated on a 0.22-m filters . Other reports have indicated that the detection of b. adolescentis in environmental samples required multiplex pcr [1012]. In contrast, the nested pcr detection methods for b. adolescentis [10, 12] readily detected b. adolescentis in raw and diluted sewage samples (table 3). The method of king was the most reliable of the three methods for detecting b. adolescentis in sewage samples . The higher sensivity of the king compared to the bonjoch method for detecting b. adolescentis in parallel dna extracts was attributed to the amplicon in the first pcr being smaller (777 bp) than the amplicon generated by the bonjoch (1350 bp) pcr assay (figure 1). The hubac pcr assay performed well with undiluted sewage samples but was prone to cross - reaction with animal fecal samples [7, 17]. However, the lack of specificity and sensitivity of the hubac assay must have been derived from our modification of the original method that was designed for a qpcr assay with a fluorescent probe for one, which is more economical and simpler to execute based on nonquantitative pcr [1, 7]. In contrast, the second round of amplification based on king did not detect b. adolescentis in any of the nonhuman sources of fecal contamination . This points out the high specificity of the king assay to b. adolescentis and indicates that there is a higher cross - reactivity of the other methods tested . However, previous studies have indicated that b. adolescentis was detected in some animal fecal samples, particularly in pigs . It is important that the source - tracking approaches should complement sampling with knowledge of activities within the watershed that may impact conclusions . Analysis of marine and freshwater samples from puerto rico and georgia with known concentrations of the fecal indicator bacteria, e. coil and enterococcus sp ., indicated that the pcr method of king and the modified layton method for hubac were in agreement in detecting human fecal pollution in most sites with elevated levels of e. coli and enterococcus sp . In west luquillo beach, there were high levels of fecal bacteria but only the method of king indicated the presence of human fecal pollution . In contrast, the bonjoch assay detected b. adolescentis in only one site at lacey mill road . The location and close proximity of some of these samples such as patillas, costa azul creek, and tubo - drna to human activity supports the finding of human fecal bacteria in those samples . Molecular source tracking methods are very useful for identifying the source of fecal pollution in environmental samples, however, attention should be placed on choosing the most appropriate pcr procedure and molecular marker in order to avoid misleading results . The reliable detection of b. adolescentis in environmental samples by conventional pcr (nonquantitative pcr) as an indicator of human fecal pollution requires multiplexing . The general good agreement of bacteriodales and b. adolescentis detection from field samples suggests that both methods are suitable for detection of fecal contamination in the environments examined . More work is needed to underpin the use of fecal indicators as a sole proof of human sources of fecal contamination . As evidenced previously, the incidence of b. adolescentis detection is higher for a limited number of common animal sources, including human, helping pinpoint sources of fecal contamination . The discrepancies observed in this paper compared to other papers on the detection of b. adolescentis as a putative marker of human fecal pollution were attributed to differences in the methods of dna extraction from environmental samples and differences in the pcr protocol used (e.g., primer sets and nested pcr). Combining traditional methods for enumerating fecal indicator bacteria and multiple - host markers from different bacterial groups should increase the reliability of results . It is strongly recommended that 0.2-m - pore filters be used when qpcr approaches are conducted.
Vascular lesions of the small intestine and colon are common causes of acute or chronic gastrointestinal hemorrhage, and arteriovenous malformations (avms) are an important vascular cause of obscure and intermittent gastrointestinal bleeding (1). Histologically, avms are persistent communications between thick - walled arteries and veins without intervening capillaries and are divided into true or congenital and acquired forms according to their locations and age at their presentations . Although the endoscopic appearances of avms occurring in gastrointestinal tracts are not distinctive, some reported cases were observed as flat or mildly elevated hemorrhagic spots or erosions, while others have been appeared as polypoid masses . Avms are usually small, single, and are located mainly in the rectum and descending colon in case of congenital or true avms, unlike acquired avms which are located mainly within the right colon . Avms are relatively uncommon in the small bowel, and it is extremely rare that they present as a circumferential, transmural, and dilated vascular structure encasing only the terminal ileum and mimicking intestinal varicosis . We report a rare case in which a transmural avm mimicking intestinal varicosis and encasing the terminal ileum circumferentially . A 30-yr - old man was transferred to our hospital for the investigation and management of intermittent hematochezia for a 5-yr duration . On admission, he was not being prescribed a nonsteroidal anti - inflammatory drug, nor was suffering from portal hypertension or liver disease . There was no history of a peptic ulcer, and examinations of skin, oral, and anal mucosa revealed no abnormal findings . Subsequent colonoscopy revealed a circumferential erythematous, nodular, and elevated lesion with hematocystic spots in the terminal ileum resembling varicosis (fig . 1). Computed tomography (ct) scans with 3-dimensional angiographic reconstruction showed a vascular tuft located around the terminal ileum (fig . 2). To exclude other synchronous intraluminal sources of bleeding in the small bowel we performed enteroclysis, which revealed a segmental, nodular, and uneven elevated lesion with a length of 10 cm in the terminal ileum (fig . The patient was treated by ileocecectomy, which encompassed the nodular and dilated vascular structure in the terminal ileum that resembled a varicosis lesion on gross inspection (fig . 4). Surgical biopsy specimens revealed dilated vascular channels with a thickened wall involving the entire bowel wall and secondary arterialization of veins consistent with an avm (fig . 5). His postoperative course was uneventful, and the patient has been followed - up without a further episode of hemorrhage . Despite dramatic improvements in diagnostic and therapeutic modalities, it is not always possible to determine the appropriate diagnosis and treatment for vascular lesions, such as, vascular ectasia, hemangiomas, dieulafoy lesions, and avms . In particular in the case of avms, no distinctive endoscopic or radiologic appearance has been elucidated because of their rarity, terminologic inconsistencies, and the diverse natures of their endoscopic morphologies . The presented case describes an unusual avm that involved the full thickness of the terminal ileum, mimicking intestinal varicosis on endoscopic and gross inspection . Endoscopic finding of our case which demonstrates dilated and tortuously distended vascular tufts with red markings is a typical feature of intestinal varicosis (2, 3). The majority of avms reported are focal, flat, or mildly elevated with erythematous spots or erosions, and a minority of avms have polypoid or pedunculated masses (4 - 6). A medline search revealed that only a small proportion of avms mimic intestinal varicosis with transmural involvement of the small and/or large bowel, and no endoscopic pictures were provided (7 - 9). We found only one case of an avm with complete endoscopic pictures and gross pictures of dilated, tortuous, vascular tufts similar to our case . It involved the entire colon without displaying a vascular texture by angiography (10). Although avms can occur in jejunum (11), the most common sites of involvement of true congenital avms are the rectum or sigmoid colon . Many reports have suggested that they are most common in the cecum and ascending colon, but the terminologic confusion concerning the differentiation of angiodysplasia and acquired avms, which mainly develop in right colon, from congenital avms may have influenced the results . True avms are developmental and mainly occur in the rectum or sigmoid colon of patients younger than 50 yr, and correspond to type 2 lesions according to moore's classification (12). Acquired avms or angiodysplasia correspond to type 1 according to this classification and occur in patients older than 50 yr . Avms in younger patients tend to occur at atypical sites such as in the small bowel, but no segmental form of avm has been previously reported to involve only the terminal ileum in a cylindrical manner . The usefulness of ct for the detection of sources of gastrointestinal bleeding has been recently described in the context of imaging modality developments (13). In the present case, we performed ct with a 3-dimensional angiographic reconstruction instead of conventional mesenteric arterial angiography because we did not consider invasive radiological therapeutic intervention as a potential elective hemostatic modality, and because we required an evaluation of the relation between the vascular architecture and the bowel wall . Ultimately, surgical resection offers the best chance of curative treatment in such situations . In conclusion, we experienced a rare case of a segmental transmural avm involving the terminal ileum and mimicking intestinal varicosis, which presented as a case of recurrent lower gastrointestinal hemorrhage, and which was successfully treated by surgical resection.
Cryptorchidism, defined as the absence of at least one testis in the scrotum, is a frequent condition in the pediatric population . It affects up to 9% of full - term newborns and up to 1.5% of 1-year - old boys . The most common location for an undescended testicle is just outside the external ring (suprascrotal), followed by the inguinal canal followed by the abdomen . Cryptorchidism occurs more commonly among patients with congenital disorders of testosterone secretion or action, secondary hypogonadism, testosterone biosynthetic defects, or insensitivity syndromes, abdominal wall defects, neural tube defects, cerebral palsy, and various genetic syndromes (e.g., trisomy 18, trisomy 13, noonan syndrome, prader - willi syndrome, and laurence - moon - biedl syndrome). Rathke cleft cysts (rccs) are benign, epithelium - lined sellar and suprasellar cysts believed to originate from remnants of the rathke pouch lying between the pars anterior and the pars intermedia of the pituitary gland . They are usually asymptomatic and are discovered incidentally, when radiographic or necropsy findings are reviewed . Symptomatic rccs are uncommon, but cysts can enlarge and cause symptoms secondary to compression of the pituitary gland, pituitary stalk, optic chiasm, or hypothalamus . Atypical presentations for rcc include abscess formation within the cyst, aseptic meningitis or entirely suprasellar rcc . Distinction among these remains a difficult preoperative problem, because the symptoms, signs, and biochemical and radiographic features of these lesions can mimic each other . Here, we report a rare case of entirely suprasellar rathke's cleft cyst (rcc) in a 4.5-year old child causing hypopituitarism, who presented to us with bilateral cryptorchidism . Although till date, a few cases of symptomatic rccs have been reported in world literature, the condition continues to remain largely unknown to practicing clinicians . The current report intends to draw attention towards hypopituitarism as one of the etiology of cryptorchidism . To the best of our knowledge, this is the first case of entirely suprasellar rcc presenting in a child with cryptorchidism to be reported from world literature . A 4.5-year - old boy presented to the pediatric surgery department with bilateral undescended testes for which surgery was planned . Upon evaluation for short stature at the department of endocrinology, he was found to be born to nonconsanguineous parents, at full term by normal vaginal delivery; there was no history of prolonged labor or birth asphyxia and his birth weight was 2.5 kg . Mother noticed bilateral undescended testes at the time of delivery, but was reassured by the doctor that testes would descend subsequently . There was no history of seizures or prolonged jaundice in the neonatal period, but his motor and mental milestones were delayed . He remained shorter than his peers and his sister who is 2 years younger is taller than him . There was no history of chronic systemic disease, hypothyroidism, or features suggestive of raised intracranial pressure . On examination, his height is 84 cm (<3 percentile), upper to lower segment ratio is 0.9 [figure 1], standard deviation score was 4, weight was 13 kg, and head circumference was 51 cm . He had frontal bossing, doll - like facies, central obesity, micropenis with stretched penile length of 2 cm, and both gonads were palpable in suprascrotal area with a poorly developed empty scrotal sac . Investigations revealed a hemoglobin of 13.6 g% (11 - 15), total lymphocyte count of 5,600/mm (4 - 11,000), erythrocyte sedimentation rate of 15 (5 - 20), random blood sugar of 94 mg% (90 - 130), creatinine 0.8 mg / dl (0.6 - 1.5), free thyroxine (t4)-0.9 ng / ml (0.93 - 1.7), thyroid stimulating hormone (tsh)-7.27 miu / ml (0.3 - 5.5), bone age-1 year, basal cortisol-13.76 g / dl (8 - 20), follicle stimulating hormone (fsh)-0.63 miu / dl (1.5 - 10.2), luteinizing hormone (lh)-0.1 miu / dl (1.9 - 12), testosterone basal 0.025 ng / ml (3 - 6.5), stimulated testosterone with human chorionic gonadotropin (hcg) was 0.68 ng / ml (suggestive of normally functioning testes), and insulin - like growth factor 1 (igf-1) was undetectable . Radiological evaluation revealed bilateral suprascrotal testes in ultrasound abdomen, a 3.8 3.6 cm suprasellar cystic lesion with compressed pituitary gland in magnetic resonance imaging (mri) brain [figures 2 and 3], which was hypointense on t1 and hyperintense on t2 images suggestive of cystic craniopharyngioma or rathke's cyst . Child did not cooperate for an accurate visual field examination, but grossly he had some degree of visual impairment in left eye . Urine output and fluid input both were approximately 1 l. magnetic resonance imaging (mri) sagittal section is showing suprasellar rathke's cleft cyst (rcc) with normal compressed pituitary mri coronal section is showing suprasellar rcc child was subsequently treated with levothyroxine replacement in view of secondary hypothyroidism . After 4 weeks (with the normalization of t4 levels), he underwent right frontotemporal orbitozygomatic craniotomy, marsupialization of suprasellar cyst along with biopsy . Biopsy revealed a single - cell layered, cuboidal epithelium, suggesting a rathke's cleft cyst . So the final diagnosis was rathke's cleft cyst with hypopituitarism . At 6 and 12 weeks after surgery, child was reevaluated for pituitary function, which revealed persistent secondary hypothyroidism and low igf-1 levels suggestive of growth hormone deficiency . Levothyroxine was reinstituted followed by initiation of growth hormone replacement along with 5 week hcg therapy (intramuscular (i m) 1,000 iu twice a week). Rccs are usually located in an intrasellar or combined intra- and suprasellar location, between the pars anterior and the pars intermedia of the pituitary gland; they are assumed to be benign remnants of the craniopharyngeal duct, which is part of rathke's pouch . The pars tuberalis of the pituitary gland which lies above the diaphragma sellae, is also derived from rathke's pouch, and is the site of origin of entirely suprasellar rccs . Majority of the rcc are asymptomatic . If the normal involution of rathke's pouch fails to occur, the resulting rcc may increase in size by accumulation of cyst fluid and compress the surrounding structures with ensuing headache, visual problems, and hypopituitarism . Entirely suprasellar symptomatic rccs with normal sella turcica are exceptionally rare and very few case reports are available in world literature . Further, rcc presenting at such a young age with hypopituitarism has not been reported till date . Testicular descent occurs in two phases, comprising of transabdominal and inguinoscrotal descent, which occur approximately during the first and last thirds of gestation, respectively . Key anatomical events to release the testis from its urogenital ridge location and to guide the free gonad into the scrotum are the degeneration of the craniosuspensory ligament and a thickening of the gubernaculum . Androgens play a role in both these processes, particularly with respect to enabling the testis to traverse the inguinal canal in the final phase of descent . The thickening of the gubernaculum, a process crucial for anchoring the testis to the inguinal region is controlled by insulin - like 3 peptide (insl3) and its g protein coupled receptor (great). In turn, this insl3 is controlled by hcg and lh . Even though surgical management is the cornerstone of treatment for cryptorchidism, medical treatment can be effective in the above mentioned endocrine disorders and it is prudent to give a trial before resorting to orchiopexy . Available agents are gonadotropin releasing hormone (gnrh) or hcg injections that produce a significant rise in local testosterone levels; thereby facilitating testicular descent . Commonly used agent is hcg and there are many protocols for the use of hcg . One such protocol is the administration of 1,000 - 2,500 iu two times per week intramuscularly for 4 - 5 weeks . Whatever protocol is used, the likelihood of success is greatest in the most distal true undescended testicles . Complete success was defined as full descent of the testicle into the scrotum and needs assessment between 8 weeks and 6 months after the completion of treatment . These studies have reported temporary virilizing side effects, including increased penile length, erections, and testicular enlargement associated with hormonal treatment . Rcc causing a pressure effect on pituitary with subsequent inhibitory effect on the release of fsh, lh, growth hormone (gh), and tsh led to the hypogonadism (perhaps, the rcc was causing this pressure effect from the intrauterine period itself and hence resulted in cryptorchidism) along with hyposomatotropism and hypothyroidism . We also propose that because of its chronic compressive effect with consequent ischemic and pressure necrosis, all cell lineages were affected irreversibly as evidenced by no recovery of pituitary function in the post - surgical reevaluation . After hcg therapy, gonads descended into the scrotum and the patient is on long - term follow - up with replacement of levothyroxine and growth hormone . In conclusion, rccs are usually intrasellar or combined intra- and suprasellar, can rarely occur in an entirely suprasellar location with intact diaphragm and intact sella turcica, but a presentation as in our case, with features of hypopituitarism at such a young age, is distinctly uncommon . In the evaluation of cryptorchidism one should explore the possibility of central causes in the etiology, as this may respond to medical therapy, thereby obviating the need for unnecessary surgical intervention.
Eligibility requirements included body mass index> 18.5 kg / m (mean 24.8sd 4.5 kg / m), age 1850 years (267.5), no current use of antioxidant dietary supplements or a willingness to refrain from their use three weeks prior to and during the study, and self - reported smoking of 3 cigarettes / day (11.05.1) for 1 year (8.06.3). Smoking status was confirmed by a saliva sample analyzed for cotinine by salimetrics, llc, state college, pa (189.3121.0 ng / ml). (21), was 50.528.2 m, which was between the 59.1 m detected in passive smokers and the 40.3 m detected in persons smoking 15 cigarettes per day (22). Half of the participants consumed gj in the first experimental session and placebo in the second; the other half followed the opposite order . Most participants three sessions were on the same day of the week over the course of three consecutive weeks . Each session consisted of two visits to the laboratory a lunch visit and a diet recall visit the following day . The treatments were 10 ml / kg body weight of a placebo beverage or 100% concord gj containing 2,100 mg / l total phenolics as gallic acid equivalents (beverages and data supplied by welch foods, inc . The placebo was formulated to match concord gj for energy, fructose and glucose content, acidity, taste, color and aroma . Participants were instructed to eat a similar breakfast on each treatment day (which participants reported during the following day's diet recall) and not to consume any food or energy - containing beverage within three hours of arrival at the laboratory . Participants were also instructed not to consume any additional gj or red wine for the entire day . For the lunch visit, participants arrived at the laboratory between 12:00 and 13:00 hours on weekdays and completed a profile of mood states questionnaire (poms) (multi - health systems inc ., north tonawanda, ny) and an affect grid (ag) (23). Next, participants completed the first of four word fragment completion (wfc) tasks (see description below), followed by an appetite assessment . Appetite ratings were provided on a personal digital assistant (pda) programmed to record marks made by participants on visual analog scales . Next, participants had up to 30 minutes to consume a lunch of as much kraft easy mac (kraft foods inc ., northfield, il) as desired, one 99 g hunt's snack pack butterscotch pudding cup (conagra foods inc ., omaha, ne), and the treatment beverage . After lunch, participants provided appetite ratings and completed a second poms and ag . Then, they performed a second wfc task . Immediately afterward, another ag was completed, followed by a third wfc task and another ag . Finally, a fourth and final wfc task was completed, followed by a third set of appetite ratings, the final poms and the final ag . During all wfc tasks, participants wore noise - reducing headphones to reduce auditory distractions (maxell noise cancellation headphone, maxell corporation of america, fair lawn, nj). After leaving the laboratory, participants provided hourly appetite ratings on the pdas and continued recording their food intake for the remainder of the day . The following day, participants returned their pda to the laboratory and participated in a computer - aided 24-hour diet recall interview with nutrition data system for research software (nds - r, 2005 and ndsr, 2006 nutrition coordinating center, university of minnesota, minneapolis, mn). Due to the nature of a within - subject study design and the desire not to arouse participants out of the post - lunch dip by administering a novel test of mental function, changes in mental ability were assessed in a covert manner on a repetitive task using a modified test of implicit memory . This test involved a wfc task where participants were shown a fragment (e.g. _ ha_ad _) and were asked to fill in the missing spaces to make a word (e.g. Charade). For assessing implicit memory, this task usually involves prior presentation of the unfragmented words in a long list (24). Later, fragments of those words are presented along with fragments of new words, and participants are asked to complete the fragments (24). The increased likelihood of participants completing the fragments with previously studied words is considered priming (25). In the present study, due to its monotonous nature, this task was not only unlikely to arouse participants out of the post - lunch dip, but may have augmented its development . Fragments were considered incomplete if there was no response, if the response was spelled incorrectly or if the response was not a primed word . Six of the fragments in the first task were repeated in the final task to serve as the test of implicit memory, and only the proportion of these words completed correctly is reported . Thirty - six words were used as priming words, divided into six sets of six words that were counter - balanced among the thirty - six participants and three sessions in order to avoid confounding by word set . As there were not enough fragments in the source used (26), some additional distraction fragments were introduced by the researchers . An affective post - lunch dip state was expected to be induced and maintained after 30 minutes of performing the wfc tasks based on a previous study attempting to induce the post - lunch dip through a letter cancellation task (27). The final fragment completion task was performed by participants approximately 4767 minutes after finishing lunch, so they were within the expected post - lunch dip time both by the previous study and by indications that the post - lunch dip occurs one hour after beginning lunch (28). Further, because debate exists regarding whether the post - lunch dip is related to consuming lunch or circadian rhythms, the study was designed to administer the final fragment completion task between approximately 13:30 and 14:45 hours, depending on when participants arrived and how quickly they consumed lunch . Thus, the timing of this study was designed so that participants completed the fourth fragment completion task both at the appropriate time of day and period of time after consuming lunch for the post - lunch dip to occur . Further, seeking effects between 45 and 65 minutes after consuming the juice coincides with other research documenting acute effects of grape polyphenol consumption . These acute effects include improved flow mediated dilatation from dealcoholized red wine as compared to regular red wine in coronary artery disease patients (29) and increased serum total antioxidant capacity (30). Finally, as several participants requested, but were denied, a cigarette smoking break upon completion of lunch, participants may have experienced further deficits due to forced smoking abstinence during this timeframe . Thus, participants were tested with the final wfc task just as the gj polyphenols were expected to begin inducing physiological effects, and the post - lunch dip, smoking abstinence and tedium of a repetitive task were likely to impair their ability / motivation . Participants were compensated financially for participation, and the study protocol was approved by the purdue university institutional review board using signed informed consent . Upper and lower outliers were removed if they were greater or lower than the value of the third or first quartile plus one and one - half times the interquartile range, respectively (31). The proportion correct on wfc tasks (by - person and by - word) and the post - lunch dip affective state were analyzed for a main effect of time and a time - by - juice interaction using repeated measures analysis of variance . Food intake and appetite ratings were analyzed for differences between treatments using the wilcoxon signed ranks test . Upper and lower outliers were removed if they were greater or lower than the value of the third or first quartile plus one and one - half times the interquartile range, respectively (31). The proportion correct on wfc tasks (by - person and by - word) and the post - lunch dip affective state were analyzed for a main effect of time and a time - by - juice interaction using repeated measures analysis of variance . Food intake and appetite ratings were analyzed for differences between treatments using the wilcoxon signed ranks test . Thirty - three participants provided saliva samples, and one individual had a cotinine concentration below the 713 ng / ml cutoff recommended for identifying smokers (32) so was not included in further analyses . The by - person and by - word analyses, the proportion correct for word fragments before lunch was unexpectedly and significantly higher in the gj treatment: f(1, 27) = 7.01, p=0.01 and f(1, 35) = 4.84, p=0.04, respectively (table 1). There was no time - by - juice interaction or main effect of time . Mean (standard deviation) for repeated word fragment completion (wfc), hunger, fullness and energy intake * significantly higher than placebo (p<0.05). For the ag (table 2), there were no time - by - juice interactions, but there was a significant overall effect of time for both pleasure - displeasure, f(3.6, 115.0) = 2.89, p=0.03, and arousal - sleepiness, f(3.0, 97.9) = 12.52, p<0.01 . For pleasure - displeasure, the final two post - lunch measurements were significantly lower than baseline . For arousal - sleepiness, affect grid ratings, mean (standard error) time effects * significantly different from baseline measurement (p<0.05). For the poms questionnaire (table 3), there were no time - by - juice interactions . However, time had an overall significant effect for confusion - bewilderment, f(1.9, 59.0) = 4.14, p=0.02; fatigue - inertia, f(1.4, 41.2) = 15.37, p<0.01; total mood disturbance (tmd), f(1.7, 50.6) = 10.03, p<0.01; and vigor - activity, f(2.0, 66.0) = 34.78, p<0.01 . For confusion - bewilderment, fatigue - inertia and tmd, the second rating was not different from baseline, but the third rating was significantly higher than baseline . For vigor - activity, profile of mood state (poms), ratings mean (standard error) time effects * significantly different from baseline measurement (p<0.05). For the appetite ratings, during the free - living period after lunch, at least 50% of participants provided entries hourly from 15:00 to 21:00 hours . The data from those seven time points, along with the two in - laboratory entries provided after lunch, were used to determine mean, peak and nadir ratings . There were no significant differences in hunger, fullness or energy intake (table 1). For the cognitive component, this study mirrored a recommendation from research on cocoa beverages to test participants in a state of fatigue . This augments identification of treatment effects (12) as it allows for measurement of revival of function or protection from a performance decline (1). This study did so through use of the post - lunch dip, which is the deterioration in mental function that often occurs after consuming the mid - day meal (33). All measures of mood were significantly modified over time in the direction expected to indicate the presence of a post - lunch dip by the time of the final mood assessment . However, the lack of time - by - juice interactions indicates beverage type had no effect on subjective feelings of the post - lunch dip . To further enhance measurement sensitivity, participants with likely increased risk for oxidative stress this was accomplished by recruiting individuals who smoked at least three cigarettes daily for at least one year (34). This sub - group may be more likely to benefit from antioxidant treatment and have been used previously in research on grape products as a model of oxidative stress (35). Smokers also tend to have low antioxidant vitamin intake (36). As wfc performance was not significantly changed over time for either treatment, it appears gj does not affect implicit memory and/or that performance on individual words is too stable to be affected . Also, wfc rates before lunch were consistently higher in the gj treatment, which may have predisposed the results toward non - significance or favoring the placebo as there was less freedom to improve over time in the gj treatment . This study failed to detect effects of acute gj consumption by smokers on measures of appetite / food intake, mood and implicit memory . Future research should explore the effects of a chronic dosing regimen on a wider variety of cognitive tasks, physiological measures and possibly a larger and different subset of participants (e.g. Nonsmokers). 5 p50 at00477 from the national center for complimentary and alternative medicine (ncaam) and the office of dietary supplements and a hatch grant from the usda #ind 084055h.
Potential incriminators are growth hormone, thyroid hormone, and gonadal hormone deficiency . Growth hormone deficiency has been associated with endothelial dysfunction [as evidenced by higher levels of plasminogen activator inhibitor - i levels (pro - coagulant), loss of circulating cd34 + cells], increased total cholesterol, low - density lipoprotein (ldl) cholesterol, increased body fat (truncal and waist hip ratio), decreased lean body mass and increased risk of hypertension . Both central hypothyroidism and hypogonadism has also been associated with increased (serum total and ldl cholesterol, homocysteine, (c - reactive protein) crp) and impaired endothelial - dependent vasodilatation and insulin resistance . Haffner et al . Showed that the incidence of fatal and nonfatal myocardial infarction to be 3.5/100 person - years in nondiabetics as compared with 20.2/100 person - years in patients with t2 dm . A 62-year - old male patient coming from the interiors of maharashtra (kolhapur), india, a nonsmoker, nonethanolic, on the background history of diabetes mellitus since the past 10 years, presented with sudden onset severe headache, right sided ptosis, for which he got admitted in a local hospital . Imaging of the brain showed pituitary macroadenoma . Within a few hours of admission he developed features suggestive of acute left ventricular failure secondary to acute coronary syndrome (non - st - elevation myocardial infarction associated with elevated serum troponin t, regional wall abnormalities of mid and basal septum and apical and lateral wall of left ventricle on 2d - echocardiography . He discharged himself and was referred to our endocrine team by the cardiologist . On examination his observations read as follows: blood pressure 120/80 mmhg in right arm without any postural fall, pulse 84/bpm, elevated jugular venous pressure . Baseline biochemical tests were normal except for an elevated creatine phosphokinase - mb 115 (4 - 36 iu / l) and troponin - t 21 mcg / l (00.1). Follicular stimulating hormone (fsh) 0.79 m iu / ml (0.95 - 11.95), luteinizing hormone (lh) 0.43 miu / ml (0.57 - 12.07), total testosterone 0.88 ng / ml (1.56 - 5.63), prolactin 1.14 ng / ml (3.46 - 19.4), t3 53.49 pg / ml (58 - 159), t4 6.74 ng / ml (4.87 - 11.72), thyrotropin stimulating hormone (tsh) 0.08 miu / ml (0.2 - 6), adrenocorticotropic hormone 68 pg / ml (10 - 100), cortisol 17.4 mcg / dl (3.729.4) [tests done while on hydrocortisone treatment], insulin like growth factor- 1 (igf)-1 55.5 ng / ml (75 - 212), with a serum sodium of 139 meq / l . 2d echo showed a reduced ejection fraction of 35% with septal and left ventricular apical and lateral regional wall abnormalities . Dexa densitometry revealed severe osteoporosis at the level of both hip (t - score magnetic resonance imaging (mri) pituitary [figure 1a and b] showed a sellar mass (2.2 1.3 cm in size) causing compression of optic chiasma . (a) mri showing a sellar mass (2.2 1.3 cm in size) causing compression of optic chiasma, (b) mri showing sellar mass compressing optic chiasma and invading cavernous sinus a coronary angiogram showed totally occluded right coronary artery proximally, 90% proximal stenosis of left anterior descending artery with heavy calcification and obtuse marginal 1 and 2 showing> 85% stenosis . A coronary artery bypass surgery was planned, which was undertaken successfully under appropriate steroid and thyroid hormone cover . After 4 weeks, he had complete resolution of his right sided 3 cranial nerve palsy . Pituitary apoplexy refers to a clinical syndrome characterized by sudden onset headache, vomiting, visual impairment, and decreased consciousness caused by hemorrhage and/or infarction of the pituitary gland, which usually occurs in patients with preexisting pituitary adenomas and prolactinomas evolving over a period of hours or days . Patients with hypopituitarism are subject to a significant increase in all cause mortality (standardized mortality ratio being 2.06 for males and 2.8 for female) and mortality from vascular disease (standardized mortality ratio 1.4 for males and 1.7 for females). On the background of diabetes mellitus this cardiovascular mortality is amplified . The case described brings to light the need for an appropriate cardiovascular evaluation in patients with hypopituitarism especially if they have a background history of t2 dm . Current practice in patients presenting with hypopituitarism is to provide appropriate hormonal replacement and follow - up is focused only on the pituitary gland . There may be an argument for aggressive cardiac evaluation and treatment in patients with t2 dm associated with hypopituitarism . This is the first case of pituitary apoplexy presenting as myocardial infarction to be reported from india.
Accurate attribution of co2 variability is required to constrain coupled models combined influence of drought and fire exceed ecosystem responses to temperature temporal and spatial smoothing of co2 observations masks variability from fire observed variations in the growth rate of atmospheric carbon dioxide, co2, provide insight about the processes that govern land and ocean sinks for anthropogenic co2 . Interannual variability in atmospheric co2 is tightly linked with volcanic eruptions [farquhar and roderick, 2003; frlicher et al ., 2013] and climate modes, including el nio southern oscillation (enso) [bacastow, 1976; jones et al ., 2001; zeng et al ., 2005; schwalm et al ., evidence from carbon isotopes suggests that these co2 variations originate mostly from terrestrial ecosystems, rather than ocean carbon exchange [francey et al ., 1995; battle et al ., 2000; rayner et al ., 2008; alden et al ., 2010]. Recent work has improved our understanding of the underlying processes regulating variability in carbon fluxes within terrestrial ecosystems . Many studies have noted a positive correlation between land temperature anomalies and the atmospheric co2 growth rate [keeling et al ., 1995; braswell, 1997; rafelski et al ., 2009], especially during the warm el nio phase of enso [wang et al . Tropical ecosystem responses to warmer temperature tend to release co2 to the atmosphere as a consequence of several physiological processes that operate in concert . Specifically, gross primary production (gpp) in tropical forests generally decreases in response to lower carboxylation efficiency and other stresses [berry and bjorkman, 1980; doughty and goulden, 2008]. Autotrophic respiration responses also likely contribute to carbon losses as a consequence of greater leaf, stem, and root maintenance costs . In parallel, microbial responses to higher temperature cause decomposition to accelerate [atkin, 2003; davidson and janssens, 2006; mahecha et al ., 2010], increasing emissions from litter and soil organic matter . These plant and microbial responses to temperature are widely represented in terrestrial ecosystem models, albeit with varying temperature dependencies [todd - brown et al . We hereafter refer to the combined set of these canopy - scale processes (and their temperature dependencies) as the direct temperature response of net ecosystem exchange (nee); alone, this response is sufficient to generate a strong positive relationship between interannual temperature variations and tropical co2 fluxes in models [wang et al ., climate modes also modify hydrology, complicating explanations of atmospheric co2 variability that rely solely on nee responses to temperature . Shifts in atmospheric circulation from pacific or atlantic sea surface temperature anomalies modify rainfall in tropical and subtropical terrestrial ecosystems [ropelewski and halpert, 1987; nobre and shukla, 1996]. In certain wet tropical forests, seasonal or interannual drought reduces soil respiration considerably, whereas gpp may be less affected as a consequence of increased light availability and the ability of deeply rooted trees to withstand desiccation of surface soil layers [saleska et al ., 2003; bonal et al ., due to a paucity of data, it remains unclear how tropical drought responses vary along moisture gradients or with vegetation type; however, top - down constraints from atmospheric co2 suggest that in the amazon, basin - wide net carbon uptake is reduced in drought years [gatti et al ., indicate that, overall, drought - induced reductions in gpp exceed those for ecosystem respiration, and therefore, net carbon uptake is reduced [schwalm et al ., in addition to the temperature and drought stress impacts on nee described above, fires also contribute to atmospheric co2 variability on interannual time scales . Fire emissions are usually confined to the dry season in tropical forests and are regulated both by climate and human drivers [van der werf et al ., 2010;, drought conditions often increase burning in woodlands but reduce fuel availability and emissions in drier grasslands [randerson et al ., 2005]. Fires also contribute to interannual variability in atmospheric methane (ch4) [bousquet et al ., 2006] and are a dominant driver of interannual variability in carbon monoxide (co) [langenfelds et al ., 2002; van der werf et al ., 2004]. When ch4 and co observations are combined with measurements of emission ratios from smoke plumes [andreae and merlet, 2001; akagi et al ., 2011], they provide evidence for a significant contribution from fires to variability in atmospheric co2 [langenfelds et al ., 2002; van der werf et al ., 2004; gatti et al ., 2014]. Partitioning the observed variability in atmospheric co2 to temperature, drought, and fire drivers remains an important research challenge because the correct balance of mechanisms is needed to simulate the global carbon cycle accurately in earth system models (esms). . Found that the temperature sensitivity of tropical nee was the dominant mechanism explaining co2 interannual variability, with considerably weaker controls from precipitation - induced changes in nee and even smaller contributions from fires . Similarly, cox et al . Found that heterotrophic respiration responses in c4mip models were the primary drivers of model - to - model differences in the sensitivity of tropical nee to temperature, with no explicit estimate of fire emissions considered in model comparisons with observations . In both studies, the co2 record used in the analysis was a globally averaged time series that was further temporally smoothed during estimation of the growth rate, either by using a 12 month running mean [wang et al ., 2013] or by differencing the annual means from two consecutive years [cox et al ., an important motivation was the observation that many of the climate extremes over the last several decades have been confined to specific regions [reichstein et al ., 2013], and thus, biospheric responses to these events likely leave an asymmetric (and unique) imprint on the meridional distribution of co2 . In addition, emission anomalies from fires are phase locked to the dry season in tropical forests and are closely associated with regional hotspots of land use change, further enabling separation of this tracer from nee responses to temperature and drought stress . In section 2, we describe our method to simulate interannual variability in atmospheric co2 from simple basis fluxes derived from gridded climate data . These basis fluxes were propagated through an atmospheric transport model [suntharalingam et al ., 2004; nassar et al ., 2010], enabling direct comparison of simulated co2 against meridional and temporal patterns in monthly atmospheric observations . In section 3, we present the relative contribution of individual drivers and combinations thereof to the observed interannual variability of co2 during 19972011 determined from optimal estimation . In section 4, we discuss how the interplay among these drivers provides both improved estimates of the climate sensitivity of nee and directions for reducing carbon cycle uncertainties in esms . We analyzed co2 interannual variability for the 15 year period from 1997 through 2011 using monthly mean noaa global cooperative air sampling network observations [dlugokencky et al ., 2013] at marine boundary layer (mbl) sites with greater than 70% data coverage for the time period of interest (figures 1a1f and table 1). We chose this period based on the availability of fire emissions data [van der werf et al ., 2010] to compare with temperature and drought effects . Co2 interannual variability was calculated by (1) detrending the observed time series at each site with a third - order polynomial, (2) computing a mean annual cycle from the detrended time series, (3) removing the mean annual cycle from the original time series, and (4) fitting a third - order polynomial to the time series obtained from step (3) [keppel - aleks et al ., our results were largely insensitive to the method of calculating the monthly mean co2 or to detrending methodology (data not shown). We averaged the co2 time series into six bands encompassing the tropics, midlatitude, and high latitude in each hemisphere for comparison with simulated co2 response functions (figures 1g1l). Although the resulting time series for co2 variability share similarities, each band is influenced by a different mix of local and remote fluxes modified by atmospheric transport . (a f) original monthly mean time series and (g l) the interannual component of atmospheric co2 variations from marine boundary layer (mbl) sites in the noaa esrl global cooperative air sampling network . Marine boundary layer (mbl) sites in noaa's global cooperative air sampling network we simulated monthly mean co2 patterns arising from prescribed fluxes using the geos - chem atmospheric transport model, version 9.1.2 [suntharalingam et al ., 2004; nassar et al ., the model was driven by 3- to 6-hourly modern era retrospective - analysis for research and applications reanalysis meteorology [rienecker et al ., 2011] at 4 (latitude) by 5 (longitude) horizontal resolution with 47 vertical layers . We sampled monthly mean model output at the grid cells containing the mbl sites, and we detrended and binned simulated co2 identically to the observations . We used spatially resolved monthly climate time series to construct a series of nee sensitivity basis fluxes without closely tying our results to the parameterizations of any specific ecosystem model (figure 2). These fluxes were uniform across an entire month . To represent the influence of temperature stress on nee, we used land air temperature anomalies at 5 by 5 resolution from the climatic research unit (cru) at the hadley centre [jones et al ., we modeled the interannually varying component of the nee flux due to temperature variations (neet) as follows: 1where the temperature anomaly at each grid cell from its monthly long - term mean () is scaled by the annually integrated net primary production (npp), following the assumption that the magnitude of monthly nee anomalies at a particular location should be proportional to gross ecosystem fluxes at the same location . In equation (1), t represents time (year and month), while m represents month of the year for the long - term temperature climatology, x represents latitude, and y represents longitude . For the gridded annual mean npp fluxes we used a climatological estimate derived from the carnegie - ames - stanford approach (casa) biogeochemical model at a 1 by 1 resolution [randerson et al ., 1997]. Given the high degree of spatial correlation of annual npp from models derived from satellite estimates of the fraction of absorbed photosynthetically active radiation and that we only used npp to scale the spatial pattern of time - evolving nee anomalies, the results we present have only a marginal sensitivity to specific parameterizations within the biogeochemical model . We included an exponential term (q10 = 2) that reduced the impact of temperature anomalies at colder temperatures . The normalization constant t was determined such that the standard deviation in annually integrated neet was 1 pg c yr globally over 15 years . This model assumes that nee variations on interannual time scales can be represented as a linear perturbation of temperature anomalies, with the magnitude of the response proportional to the gross ecosystem fluxes in a given region . Although ecosystems may exhibit nonlinear or threshold responses to temperature or drought stress [berry and bjorkman, 1980; reichstein et al ., 2013], we caution that discriminating and fitting such nonlinear responses within the 15 year duration of our study period would lead to a loss in the robustness of our results given the required increase in the number of fitting parameters and degrees of freedom . Analysis of nonlinear climate impacts on terrestrial ecosystem fluxes may better be suited for future analysis when longer global time series of fire emissions and ecosystem fluxes permit the use of more sophisticated statistical models . Similarly, we developed a family of basis fluxes to represent the impact of drought stress (d) on nee (need) using three drivers that reflect moisture stress on different time scales . We used precipitation from the global precipitation climatology project (gpcp) [adler et al .,, 1996]: palmer drought severity index (pdsi) [dai et al ., 2004], which reflects the cumulative departure from local moisture balance, and potential evaporation (pe), which reflects the evaporative demand given a sufficient soil water source . We used a similar framework to estimate the perturbation to nee (need) from drought stress (d) for each of these proxies: 2 as in equation (1), d was a normalization constant such that each gridded need time series had a global standard deviation of 1 pg c yr from 1997 to 2011 . For this convention, co2 fluxes were positive to the atmosphere when precipitation had a positive deviation relative to climatology and when pdsi was in a positive phase (indicating water abundance). For fires, we used emissions from the global fire emissions database (gfed3) [van der werf et al ., 2010], which combines satellite observations of active fire counts, burned area, and vegetation productivity with the casa biogeochemical model to calculate fire emissions . We also prescribed a mostly independent set of fire emissions scaled according to the along - track scanning radiometer (atsr) distribution of active fires [arino and melinotte, 1998]. Because atsr is a polar - orbiting satellite and therefore oversamples fires at high latitudes relative to midlatitude and tropical fires, we scaled the atsr fire counts in 10 latitude bins by the fraction of gfed emissions occurring within each bin, thus imposing gfed's latitudinal emissions distribution while preserving distinct patterns of variability between the two basis flux sets . Simulated co2 response functions from global and regional fluxes were compared against observed interannual variability either individually or in linear combination . We determined scale factors,, for each driver included in the model by minimizing the cost function: 3 in equation (3), co2 (,t) is the observed interannual variability in each latitude band, . The matrix m(,t) contains the individual co2 response functions simulated by geos - chem from driver fluxes with 1 pg c yr standard deviation . The vector contains the optimal scale factors that modulate the standard deviation of the fluxes in each model case . We did not expect that our simple flux models would account for all variability across each latitude band . In the northern hemisphere, for instance, observations were characterized by greater temporal variability that likely owes to contributions from fossil fuel fluxes and other processes that were not resolved in our modeling framework . We therefore simultaneously fit parameters () to represent the unresolved variability in each latitude band . Their optimal values reflect the balance between the sum - squared residual and penalty terms of the cost function that resulted in each latitude band contributing equally to the overall sum - squared residual . Our optimizations were conducted without prior constraints on the fluxes . To account for correlations among successive months, we determined the effective number of co2 observations in each latitude band assuming an autoregressive (ar1) model and inflated the posterior error covariance matrix by the ratio of actual to effective sample size . We tested the sensitivity of the results to different cost function formulations by weighting the six latitude bands by area fraction and by assuming a t distribution for errors . In each case, the optimized values remained within the reported error bars, demonstrating the robustness of the optimization results presented in section 3 . We assessed the quality of our regression models for each latitude band using both the familiar pearson's r coefficient (which indicates the degree of correspondence between model and data) and the rms amplitude factor . The amplitude factor, a, was calculated as a ratio of the standard deviation in the simulated co2 time series (adjusted by the appropriate values) to the standard deviation in the observed co2 time series (equation (4)) and therefore provides information about the magnitude of variability explained by each flux model . 4 we used the f test to compare the relative performance of different regression models; for this test, the number of data was adjusted by the effective sampling rate calculated from the ar1 model . 1996] to test whether synthetic co2 data generated from our optimized regression models reproduced the observed correlations among temperature, drought, and fire . This provides a quality metric that focuses specifically on the ability to faithfully attribute signal to each driver, rather than just reflecting the overall goodness of fit as given by the r coefficient . This model comparison was carried out by fitting synthetic data using single - driver, single - region regression models and by comparing the resulting values to those determined from fits to the observations themselves . We analyzed co2 interannual variability for the 15 year period from 1997 through 2011 using monthly mean noaa global cooperative air sampling network observations [dlugokencky et al ., 2013] at marine boundary layer (mbl) sites with greater than 70% data coverage for the time period of interest (figures 1a1f and table 1). We chose this period based on the availability of fire emissions data [van der werf et al ., 2010] to compare with temperature and drought effects . Co2 interannual variability was calculated by (1) detrending the observed time series at each site with a third - order polynomial, (2) computing a mean annual cycle from the detrended time series, (3) removing the mean annual cycle from the original time series, and (4) fitting a third - order polynomial to the time series obtained from step (3) [keppel - aleks et al ., our results were largely insensitive to the method of calculating the monthly mean co2 or to detrending methodology (data not shown). We averaged the co2 time series into six bands encompassing the tropics, midlatitude, and high latitude in each hemisphere for comparison with simulated co2 response functions (figures 1g1l). Although the resulting time series for co2 variability share similarities, each band is influenced by a different mix of local and remote fluxes modified by atmospheric transport . (a f) original monthly mean time series and (g l) the interannual component of atmospheric co2 variations from marine boundary layer (mbl) sites in the noaa esrl global cooperative air sampling network . We simulated monthly mean co2 patterns arising from prescribed fluxes using the geos - chem atmospheric transport model, version 9.1.2 [suntharalingam et al ., 2004; nassar et al ., the model was driven by 3- to 6-hourly modern era retrospective - analysis for research and applications reanalysis meteorology [rienecker et al ., 2011] at 4 (latitude) by 5 (longitude) horizontal resolution with 47 vertical layers . We sampled monthly mean model output at the grid cells containing the mbl sites, and we detrended and binned simulated co2 identically to the observations . We used spatially resolved monthly climate time series to construct a series of nee sensitivity basis fluxes without closely tying our results to the parameterizations of any specific ecosystem model (figure 2). To represent the influence of temperature stress on nee, we used land air temperature anomalies at 5 by 5 resolution from the climatic research unit (cru) at the hadley centre [jones et al ., 2012]. We modeled the interannually varying component of the nee flux due to temperature variations (neet) as follows: 1where the temperature anomaly at each grid cell from its monthly long - term mean () is scaled by the annually integrated net primary production (npp), following the assumption that the magnitude of monthly nee anomalies at a particular location should be proportional to gross ecosystem fluxes at the same location . In equation (1), t represents time (year and month), while m represents month of the year for the long - term temperature climatology, x represents latitude, and y represents longitude . For the gridded annual mean npp fluxes we used a climatological estimate derived from the carnegie - ames - stanford approach (casa) biogeochemical model at a 1 by 1 resolution [randerson et al ., 1997]. Given the high degree of spatial correlation of annual npp from models derived from satellite estimates of the fraction of absorbed photosynthetically active radiation and that we only used npp to scale the spatial pattern of time - evolving nee anomalies, the results we present have only a marginal sensitivity to specific parameterizations within the biogeochemical model . We included an exponential term (q10 = 2) that reduced the impact of temperature anomalies at colder temperatures . The normalization constant t was determined such that the standard deviation in annually integrated neet was 1 pg c yr globally over 15 years . This model assumes that nee variations on interannual time scales can be represented as a linear perturbation of temperature anomalies, with the magnitude of the response proportional to the gross ecosystem fluxes in a given region . Although ecosystems may exhibit nonlinear or threshold responses to temperature or drought stress [berry and bjorkman, 1980; reichstein et al ., 2013], we caution that discriminating and fitting such nonlinear responses within the 15 year duration of our study period would lead to a loss in the robustness of our results given the required increase in the number of fitting parameters and degrees of freedom . Analysis of nonlinear climate impacts on terrestrial ecosystem fluxes may better be suited for future analysis when longer global time series of fire emissions and ecosystem fluxes permit the use of more sophisticated statistical models . Similarly, we developed a family of basis fluxes to represent the impact of drought stress (d) on nee (need) using three drivers that reflect moisture stress on different time scales . We used precipitation from the global precipitation climatology project (gpcp) [adler et al ., 2003], which reflects the short - term water inputs to the ecosystem ., 1996]: palmer drought severity index (pdsi) [dai et al ., 2004], which reflects the cumulative departure from local moisture balance, and potential evaporation (pe), which reflects the evaporative demand given a sufficient soil water source . We used a similar framework to estimate the perturbation to nee (need) from drought stress (d) for each of these proxies: 2 as in equation (1), d was a normalization constant such that each gridded need time series had a global standard deviation of 1 pg c yr from 1997 to 2011 . For this convention, co2 fluxes were positive to the atmosphere when precipitation had a positive deviation relative to climatology and when pdsi was in a positive phase (indicating water abundance). For fires, we used emissions from the global fire emissions database (gfed3) [van der werf et al ., 2010], which combines satellite observations of active fire counts, burned area, and vegetation productivity with the casa biogeochemical model to calculate fire emissions . We also prescribed a mostly independent set of fire emissions scaled according to the along - track scanning radiometer (atsr) distribution of active fires [arino and melinotte, 1998]. Because atsr is a polar - orbiting satellite and therefore oversamples fires at high latitudes relative to midlatitude and tropical fires, we scaled the atsr fire counts in 10 latitude bins by the fraction of gfed emissions occurring within each bin, thus imposing gfed's latitudinal emissions distribution while preserving distinct patterns of variability between the two basis flux sets . Simulated co2 response functions from global and regional fluxes were compared against observed interannual variability either individually or in linear combination . We determined scale factors,, for each driver included in the model by minimizing the cost function: 3 in equation (3), co2 (,t) is the observed interannual variability in each latitude band, . The matrix m(,t) contains the individual co2 response functions simulated by geos - chem from driver fluxes with 1 pg c yr standard deviation . The vector contains the optimal scale factors that modulate the standard deviation of the fluxes in each model case . We did not expect that our simple flux models would account for all variability across each latitude band . In the northern hemisphere, for instance, observations were characterized by greater temporal variability that likely owes to contributions from fossil fuel fluxes and other processes that were not resolved in our modeling framework . We therefore simultaneously fit parameters () to represent the unresolved variability in each latitude band . Their optimal values reflect the balance between the sum - squared residual and penalty terms of the cost function that resulted in each latitude band contributing equally to the overall sum - squared residual . Our optimizations were conducted without prior constraints on the fluxes . To account for correlations among successive months, we determined the effective number of co2 observations in each latitude band assuming an autoregressive (ar1) model and inflated the posterior error covariance matrix by the ratio of actual to effective sample size . We tested the sensitivity of the results to different cost function formulations by weighting the six latitude bands by area fraction and by assuming a t distribution for errors . In each case, the optimized values remained within the reported error bars, demonstrating the robustness of the optimization results presented in section 3 . We assessed the quality of our regression models for each latitude band using both the familiar pearson's r coefficient (which indicates the degree of correspondence between model and data) and the rms amplitude factor . The amplitude factor, a, was calculated as a ratio of the standard deviation in the simulated co2 time series (adjusted by the appropriate values) to the standard deviation in the observed co2 time series (equation (4)) and therefore provides information about the magnitude of variability explained by each flux model . 4 we used the f test to compare the relative performance of different regression models; for this test, the number of data was adjusted by the effective sampling rate calculated from the ar1 model . We also used posterior predictive model checking [gelman et al ., 1996] to test whether synthetic co2 data generated from our optimized regression models reproduced the observed correlations among temperature, drought, and fire . This provides a quality metric that focuses specifically on the ability to faithfully attribute signal to each driver, rather than just reflecting the overall goodness of fit as given by the r coefficient . This model comparison was carried out by fitting synthetic data using single - driver, single - region regression models and by comparing the resulting values to those determined from fits to the observations themselves . Co2 fluxes from temperature, drought, and fire emissions captured many of the large - scale features in observed atmospheric co2 variability from 1997 to 2011 (figure 3). Ocean fluxes [doney et al ., 2009] (figure 3b) were relatively small across all latitudes and consistent with earlier work [bousquet et al ., 2000; nevison et al ., 2008; rayner et al ., we optimized scale factors () for each of the terrestrial co2 response functions using single - factor regression models (table 2). Since the co2 response functions were simulated from flux fields normalized to 1 pg c yr standard deviation, the values of can be interpreted as the standard deviation of the optimized carbon fluxes (in units of pg c yr) owing to individual climate drivers over the 15 year period . (a) observed variability determined from mbl sites (figure 1 and table 1). (b) co2 response functions derived from the sum of fossil fuel and ocean fluxes . Co2 response functions derived from the drought sensitivity of nee determined from (d) precipitation, (e) palmer drought severity index (pdsi), and (f) potential evaporation (pe). The co2 patterns arising from drought stress metrics were scaled by 1, since the simulated patterns were negatively correlated with the observations . Co2 response functions from fire emissions from (g) the global fire emissions database version 3 (gfed3) and (h) scaled along track scanning radiometer (atsr) fire counts . X axis tick marks and year labels correspond to the beginning of each calendar year . The contribution of terrestrial ecosystem fluxes to interannual variability in atmospheric co2 from single - variable global flux modelsa the pearson's r coefficient and the amplitude factor (a), calculated as the ratio of the simulated co2 standard deviation to the observed co2 standard deviation, was optimized for each model to minimize the cost function across all six latitude bands . The temperature - driven nee model was positively correlated with the observed co2 patterns and explained the largest amount of variance across different latitude bands with an average r of 0.46 . After optimization, the temperature - driven nee fluxes had a standard deviation of 0.80 0.07 pg c yr and the adjusted atmospheric co2 response function had a standard deviation that was 61% relative to that of the observations (table 2). The co2 response function from nee responding to the palmer drought severity index (pdsi) had the second most explanatory power with a mean r of 0.42 and an adjusted standard deviation (hereafter termed the amplitude factor) that was 55% . The co2 patterns arising from pdsi and precipitation were negatively correlated with the observations, indicating that drought stress increased co2 growth and decreased terrestrial carbon storage on interannual time scales . The two fire emissions time series, gfed3 and atsr, were the third most important class of models, with mean r values of 0.36 and 0.34, respectively, and each with an amplitude factor of 51% of the observations . The optimized gfed3 flux standard deviation of 0.40 0.05 pg c yr was 25% higher than the standard deviation of the original gfed3 emissions time series (0.32 pg c yr) but within expected uncertainties [van der werf et al ., although the precipitation and potential evaporation (pe) co2 patterns were qualitatively similar to pdsi (figures 3d3f), the mean r was only 0.34 for precipitation and 0.20 for pe, in part due to a likely time delay in nee responses to precipitation anomalies [zeng et al ., 2013]. To isolate the contribution of tropical fluxes to atmospheric co2 variability, we ran an additional geos - chem simulation for each of the drivers described above, considering only fluxes between 23n and 23s . The co2 variability explained by tropical nee fluxes had similar pearson's r coefficients as the global models even in the extratropics (table 3), confirming earlier work showing that tropical ecosystem responses to climate influence co2 variability globally [bousquet et al ., 2000; rayner et al ., 2008]. A key mechanism explaining this result is the coupling of large net ecosystem carbon flux anomalies to tropical deep convection that efficiently transports these fluxes poleward in the upper troposphere [plumb and mahlman, 1987]. With the exception of fire emissions, regression models derived from extratropical northern hemisphere fluxes had considerably lower performance metrics than their tropical or global counterparts (table 4), while extratropical southern hemisphere fluxes had almost no impact on co2 variability globally (figure 4). Northern hemisphere fires explained a much larger fraction of the co2 variability at northern middle and high latitudes than tropical or global fires, consistent with past studies documenting considerable interannual variability in boreal forest fires [kasischke et al ., 2005] and the proximity of northern surface stations to these sources . The contribution of terrestrial ecosystem fluxes to interannual variability in atmospheric co2 from single - variable tropical flux models, similar to table 2 the contribution of terrestrial ecosystem fluxes to interannual variability in atmospheric co2 from single - variable northern hemisphere flux models, similar to table 2 goodness - of - fit metrics for models of increasing complexity . (top) the pearson's r coefficient (an indication of correlation between observed and simulated co2 variability) and (bottom) the relative amplitude factor (equation (4)) as the goodness - of - fit metric . The value of each metric is shown for (a and b) global fluxes, (c and d) tropical fluxes, (e and f) northern hemisphere fluxes, (g and h) southern hemisphere fluxes, and (i and j) linear combinations of both tropical and northern hemisphere fluxes . For each panel, t represents an nee model driven solely by temperature, d an nee model driven solely by pdsi, and f a model driven solely by gfed fire emissions . The relative amplitude is the standard deviation of the simulated co2 from the model divided by the standard deviation of observed co2 and is an indication of the magnitude of variability contributed by each flux model . For this analysis, we used pdsi - driven nee and gfed3 fire emissions since these single - factor regressions performed better than other models within the same class (table 2), and we focused on fluxes originating in the tropics and northern hemisphere . In general, these models were able to explain more of the co2 variability in the southern hemisphere than in the northern hemisphere, in part due to greater high frequency variability in northern hemisphere observations (figures 1 and 4). Given significant correlations among various drivers (e.g., figure 3), the scale factors () for the multidriver regression models had reduced magnitudes compared to the corresponding single - driver regressions since the signal amplitude was spread across multiple drivers (table 5). Optimal coefficients () from each component in multidriver regression modelsa the best case model includes six driver variables: temperature, pdsi, and gfed3 contributions in both the tropics and nh . For a best - case model estimate, we optimized coefficients for temperature, drought, and fires from the northern hemisphere and tropics simultaneously . This model, comprised of six basis functions, explained 39 to 57% of the observed variability in the northern hemisphere and 52 to 79% of the variability in the southern hemisphere (figure 5). The combined contributions from fires and nee responses to drought stress accounted for 6070% of the model variability in each latitude belt (figure 6a). The direct temperature response of nee contributed between 3037% of model variability in the northern hemisphere and 3940% in the southern hemisphere . Thus, although direct control of nee by temperature was the single largest driver of observed variability in atmospheric co2 (except north of 23n), the contribution from temperature was smaller than the sum of drought and fire components, contrasting with results reported by [wang et al ., 2013]. We tested an alternative version of the best - case model, substituting precipitation for pdsi as the climate proxy for drought stress, and regression results indicated a further reduction in the contribution from tropical temperature to co2 variability (figure 6b). Contributions of tropical (tr) and northern hemisphere (nh) temperature, drought stress (pdsi), and fire emissions (gfed3) to atmospheric co2 interannual variability by latitude . The pearson's r coefficient for each latitude band is given in the upper right hand corner . The best - case model (mod) is shown with a grey line and the observations (obs) with a black line . The black lines denoting the observations were not identical to the time series shown in figure 1 because a refinement to the third - order detrending polynomial was fit based on the residual between the observations and the optimized model . (a) relative contributions to the simulated variability in atmospheric co2 in different latitude bands (x axis) from nee responses to temperature and drought stress (pdsi), and fire emissions (gfed3) originating from the tropics and northern hemisphere . The amplitude factor (a), calculated as the ratio of the standard deviation of the simulated co2 relative to the standard deviation of the observations, is shown for each latitudinal band . (b) using gpcp precipitation rather than pdsi as a drought stress metric further diminishes the contribution of tropical temperature to interannual variability in atmospheric co2 . Simultaneously accounting for temperature, drought, and fire in the best - case model improved both goodness - of - fit metrics compared to models that assumed only a single driver (figures 5 and 6, and table 2). Accounting for correlations among successive monthly observations, the calculated f statistic justified the additional degrees of freedom in the best - case model relative to the tropical temperature - only model (p <0.01). Moreover, synthetic data generated from the best - case model, as opposed to those from the tropical temperature - only model, were more consistent with the atmospheric observations (figure 7). One rationale that has been given for using the present - day temperature sensitivity of the co2 growth rate as a constraint on future model projections is that the apparent temperature sensitivity implicitly captures the covarying sensitivity to drought and fire; if that were the case, synthetic co2 generated from a tropical temperature - only regression model should yield the same sensitivity to drought and fire as atmospheric observations . However, when the synthetic temperature data were fit serially using single - driver, single - region regression models, the values were significantly different from those determined from atmospheric observations, ruling out the possibility that a tropical temperature - only model is sufficient to describe the observations . Scale factors for single drivers when fit to observations versus when fit to synthetic data derived from tropical temperature - only and best - case regression models . We generated 1000 realizations of synthetic co2 using parameter values drawn from the uncertainty distributions of the tropical temperature - only and the best - case regression models, and fit single - driver temperature, drought, and fire response functions to the synthetic data . The individual values fit to the synthetic data derived from the best - case model (circles) were consistent with those fit to the observations, while the northern hemisphere values and tropical fire value fit to the temperature - only synthetic data deviated significantly (triangles), ruling out the possibility that the tropical temperature - only model was consistent with the observations (p <10). Fires had a greater impact in the northern hemisphere (3342%) than in the southern hemisphere (3032%), where fire emissions from boreal forests were large relative to other surface fluxes . In the northern hemisphere, the standard deviation of the fire flux in the best - case model increased to 0.13 0.04 pg c yr from the gfed3 baseline of 0.10 pg c yr . In contrast, the standard deviation of the optimized tropical fire emissions was significantly lower than the standard deviation within the tropics from gfed3 (0.17 0.04 pg c yr versus 0.30 pg c yr). The ability to isolate the contributions from temperature, drought, and fire in the meridional distribution of co2 was lost when these data were aggregated to a global, area - weighted co2 time series . For the best - case model described above, the tropical fire contribution decreased by 60% when fit against a globally averaged co2 timeseries rather than against the meridional structure of co2 (table 6). In contrast, the optimal flux magnitude for northern hemisphere fire emissions increased several fold (table 6)an unrealistic increase given available constraints from ch4 and co. when we averaged the global mean co2 data to annual time steps, the tropical fire emissions component was further reduced . These exercises demonstrated that aggregating co2 data over larger spatial scales and longer time scales may mask contributions from fire emissions observed at higher resolutions . Optimal scale factors () and globally averaged amplitude factors (a) for tropical or northern hemisphere gfed fire emissions based on spatial and temporal averaging of monthly atmospheric co2 data estimates of the temperature or drought sensitivity of nee at large temporal and spatial scales are required for ecosystem model evaluation . Specifically, atmospheric co2 responses to regionally coherent climate anomalies provide an opportunity to quantify biome - level responses that integrate across regional variations in species composition, moisture availability, and other important drivers of ecosystem processes that are difficult to represent in global models . This information is complementary to canopy - scale responses derived from eddy covariance observations [e.g., schwalm et al ., we determined the large - scale sensitivity of nee to temperature and drought stress by regressing the land area - weighted monthly nee fluxes derived from our optimized models against the land area - weighted average of monthly temperature or pdsi anomalies (figure 8). Accounting for fire emissions considerably reduced the sensitivity of nee to temperature and drought stress inferred from the atmospheric co2 observations (table 7). We found that the temperature sensitivity of tropical nee was 3.9 0.4 pg c yr k when no other climate drivers or fire fluxes were taken into consideration . When we applied the value from a model that included global fire emissions, the temperature sensitivity of tropical nee decreased by 25% to 2.9 0.4 pg c yr k. the sensitivity of tropical nee to temperature was further reduced to 2.6 0.7 pg c yr k when we considered all scale factors from the best - case model (figure 9). The nee sensitivity to tropical drought stress pg c yr per unit of pdsi when no other drivers were considered to 0.8 0.1 pg c yr per unit of pdsi when we accounted for global fire emissions (table 7). Land - weighted temperature, precipitation, and pdsi anomalies for the tropics and northern hemisphere . Sensitivity of nee to temperature and drought stress (normalized to a 1 unit increase in the palmer drought severity index) when nee responses were considered alone or in conjunction with fire emissionsa an f test was used to compare model pairs with and without fire . The best - case model (blue) represents the sum of fluxes from temperature - driven nee, pdsi - driven nee, and fire - driven nee in the tropics and northern hemisphere . The tropical temperature case (green) only includes temperature - driven fluxes in the tropics . Our results suggest that the correlation between tropical temperature and the co2 growth rate is caused by an assortment of covarying processes, including nee responses to temperature and drought stress as well as fire emissions in tropical and boreal forest ecosystems . We found that the combined influence of the response of nee to drought and fire emissions accounted for more of the variability than direct temperature responses of nee when these drivers were considered simultaneously . These findings have several implications for studies that use contemporary co2 variability to constrain esms . First, fire, temperature, and drought responses within esms need to be separately and explicitly considered during model evaluation . Cox et al . Developed a novel approach for constraining the long - term sensitivity of tropical carbon stocks to warming () in esms using contemporary atmospheric co2 and temperature observations . The authors showed that a relationship existed across different models between and the interannual co2 growth rate sensitivity to temperature . In a second step, cox et al . Used observations from the past several decades to show that many models overestimated the observed co2 growth rate sensitivity to temperature and thus had values that were likely excessive . Since many of the models in the ensemble did not have explicit representation of fire processes, removing fire contributions from the observed co2 growth rate may enable a more direct comparison with simulated nee responses to tropical temperature . Our results suggest that after removing fire contributions, the component of the observed co2 growth rate variability attributable to tropical nee would be reduced by approximately 25% (e.g., table 7), bringing a different set of models into closer agreement with the observed range . Although a more rigorous evaluation is needed, this preliminary estimate strengthens conclusions by cox et al . That earlier models may have had unrealistically large (negative) values of at least for the nonfire component of the tropical net ecosystem carbon balance . It is important to recognize that while esm agreement with present - day co2 variability and its multiple drivers is necessary to have confidence in climate predictions, it is not sufficient because, on longer time scales, climate changes would be expected to modify processes that are likely of second - order importance to the interannual variations we analyze here, including plant competition and tree mortality . Second, estimates of the fire contribution to co2 variability change significantly with temporal and spatial averaging . The standard deviation of optimized tropical fire emissions decreased by 6070% when co2 variability was averaged globally and by up to 80% when variability was determined from annual, rather than monthly, co2 time series . This result underscores the need to consider the full spatial and temporal distribution of atmospheric co2 and to use a consistent transport - modeling framework to infer the sensitivities to temperature and drought stress in both models and observations . The extension of column co2 time series from gosat and forthcoming observations from nasa's orbiting carbon observatory (oco-2, launched in 2014) may enable future refinements in the partitioning among temperature, drought, and fire contributions to co2 variability . Fire management is one possible lever for reducing co2 emissions as the climate warms . In the tropics, where fires are often linked with forest and peatland clearing, different management practices may lead to greater long - term carbon storage . Optimizing long - term development strategies [nepstad et al ., 1999] or more effective use of fire forecasting tools [chen et al ., accurate attribution of interannual variability of co2 to fire and nee responses to drought and temperature also may improve our understanding of drivers of long - term changes in this variability [wang et al ., 2014] and reveal opportunities for decoupling carbon fluxes from drought stress as climate changes . Analysis of the climate drivers of co2 variability at seasonal, interannual, and decadal time scales may ultimately provide a path toward improved climate predictability in esms . We stress that capturing variability at these time scales does not ensure accurate climate predictions at longer time scales, but only improves our confidence that important mechanisms are adequately represented . The linkages among temperature, drought, and fire contributions in this study underscore their similar responses to climate variability and the importance of balanced investments in field and modeling research programs that improve our understanding of all of these interactions and their representation in esms.
A 62-year - old woman presented to the emergency department of central hospital bad berka with nausea and an episode of acute chest pain . She had been previously diagnosed with a myxofibrosarcoma of the left forearm (april 2013), which had been treated surgically . At that time, the maximal diameter of her ascending aorta was 47 mm, and anti - hypertensive therapy with a calcium - channel blocker was initiated . A contrast - enhanced computed tomography (ct) scan upon admission to the emergency unit showed an eccentric hypodense thickening of the ascending aorta and aortic arch . The maximal thickness of the intramural hematoma (imh) was 25 mm in the convexity of the ascending aorta and 10 mm in the aortic arch . Moreover, no pleural effusion and only a small pericardial effusion were detected (fig . Despite the presence of an intramural hematoma, the patient s clinical symptoms did not recur, and she remained stable without progression of the pericardial effusion on echocardiographic follow - up . The imh was interpreted as a stable and non - emergency finding, and the patient was treated medically . Due to an episode of recurrent chest pain, the patient was referred to our cardiac surgical unit the next morning . As a part of a preoperative work - up in preparation for urgent surgery, another follow - up ct scan was conducted . The rationale behind this decision was to determine whether the status of the imh had changed and to determine whether an intimal tear could be detected . To our surprise, significant regression of the aortic imh was found, with only minor residual thickening in the aortic arch and virtually no detectable hematoma in the ascending aorta (fig . Transesophageal echocardiography was then performed, demonstrating a complete disappearance of the imh (fig . Moderate aortic valve regurgitation was detected, showing no obvious changes in comparison with previous echocardiographic findings . Although the patient remained asymptomatic, the recurrence of aortic imh was diagnosed 72 hours after the second ct scan . We were surprised to find a recurrence of aortic imh, especially since it predominantly involved the ascending aorta, with a maximal imh thickness of 12 mm (fig . Due to the recurrence of type a imh, in combination with the presence of aortic valve regurgitation and the increasing degree of pericardial effusion, the decision was made to undertake urgent surgery . Intraoperatively, an unanticipated intimal tear was identified in the noncoronary sinus at the level of the sinotubular junction (fig . Regurgitation and moderate root dilatation (an aortic root diameter of 45 mm), root replacement (bentall technique) using a bioprosthesis was conducted, as well as a partial aortic arch replacement . The patient s postoperative course was uneventful and she patient the unusual dynamics of this aortic imh are demonstrated in the frontal reconstructions of consecutive ct scans (fig . Aortic imh has often been diagnosed as a variant of aortic dissection using modern imaging techniques . It may present with the clinical symptoms of aortic dissection, and may occasionally precede overt aortic dissection or rupture . The clinical course of imh has been reported to vary, ranging from progression to an overt aortic dissection to complete disappearance over the course of follow - up . The serial changes of imh during follow - up have yet to be established, whereas its disappearance has been linked to a good long - term prognosis . We report herein a patient in whom two episodes of aortic imh (stanford a, debakey i) occurred within four days, influencing the surgical treatment strategy . Aortic imh is a variant of overt dissection and may account for up to one of three to four cases of acute aortic syndrome . Imh may completely resolve during follow - up, or it may progress to a classic aortic dissection . In the largest case series, reported by song et al ., the vast majority of the type a imh patients (84%) were classified as being hemodynamically stable and hence were treated medically, resulting in a mortality rate of only 7.1%, whereas the international registry of aortic dissection reported a mortality rate of medically treated type a imh of as high as 33% . Similarly to our patient, ohmi et al . Reported a case in which an imh exhibited rapid regression, affecting the descending aorta during the initial presentation and involving the ascending aorta one year later . On both occasions, the imh regressed rapidly just hours after it was diagnosed . No aortic surgery was conducted due to the rapid and complete resolution of the imh . The phenomenon of the regression and/or disappearance of an imh is intriguing, and may explain to some extent the ongoing controversy with regard to its optimal treatment . Nishigami et al . Claimed that the disappearance of an imh suggests a good long - term prognosis . Although no significant changes were observed during the course of follow - up among their patients with an imh that disappeared, they did not present guidelines regarding whether such cases of regressed imhs should be frequently checked for malign changes . Therefore, the results from this single study should be interpreted with caution and cannot be generalized to the entire spectrum of regressed imhs . Progressive groups might be suboptimal, as it may only represent different stages of ongoing aortic disease . The clinical course of imh is very similar to that of a possible overt aortic dissection, mainly because an imh diagnosed using imaging techniques may precede an overt aortic dissection . Although the resorption of an imh may occur without specific treatment, a substantial number of medically treated patients may suffer sudden cardiac death during the course of follow - up . Therefore, no consensus has emerged regarding the most appropriate surveillance strategy in asymptomatic patients with a known history of the regression of an aortic type a imh . Nevertheless, as previously reported, new - onset pericardial and pleural effusion have been reported to be more common in imh patients than in patients with an overt aortic dissection . Due to the fact that our patient presented with these two indirect signs of imh - related complications and an initial imh thickness of 25 mm, a rather aggressive treatment strategy was chosen in order to prevent the possibility of impending sudden death . The definite decision to perform surgical treatment in the present patient was made due to the recurrence of an imh on the third ct scan, which demonstrated the malignant character of this case of acute aortic syndrome . Despite aortic imaging by means of serial ct scans and transesophageal echocardiography, the intimal tear and overt aortic dissection furthermore, it remains uncertain whether the intimal tear remained undetected or developed secondarily during the course of the imh . Nevertheless, the majority of patients undergoing surgical treatment for acute type a imh may present intraoperatively with an intimal tear . The lack of a visible tear on the ct scan may contribute to the delay of surgical treatment . This possibility means that the appropriateness of aortic imaging as currently implemented should be questioned, and further raises the issue of whether other markers would lead to more accurate decision - making in the treatment of acute aortic syndrome.
Tinnitus can be caused by head and neck injuries (chan and reade, 1994), chemotherapy (bokemeyer et al ., 1998), ototoxic drugs such as salicylate (stypulkowski, 1990) but, most frequently, tinnitus is caused by intense sound exposure (passchier - vermeer and passchier, 2000). The various causes of tinnitus generate a diverse range of tinnitus percepts (eggermont and roberts, 2004). Some patients with chronic tinnitus are constantly aware of the phantom perception, but cope very effectively with this disturbance . For some patients, however, tinnitus is more than just a minor annoyance these patients report that tinnitus causes extreme feelings of desperation and in some cases results in suicidal thoughts (dobie, 2003). Despite the increasing numbers of tinnitus sufferers due to increasing risks from occupational and recreational sources as well as the increased awareness of the disease a basic understanding of the neural basis of tinnitus is lacking . Mechanistically, tinnitus had been considered for many years as a peripheral disorder; a disorder of the external ear . This view has changed as sectioning of the eighth cranial nerve was an ineffective surgical treatment of tinnitus (house and brackmann, 1981; barrs and brackmann, 1984) and collateral sectioning of the auditory nerve with tumor removal surgery even caused tinnitus in some patients (berliner et al ., 1992; baguley et al ., 2006). These results indicate that it is the auditory central nervous system and not the periphery that maintains the percept of tinnitus . Recently developed animal models of noise - induced tinnitus have provided a unique opportunity for determining the neural mechanisms underlying the induction and the expression mechanisms of tinnitus (eggermont and roberts, 2004). These studies have uncovered many forms of aberrant plasticity that result in marked changes in the cellular and molecular properties of the auditory system of animals with tinnitus compared to healthy animals . An emerging hypothesis for the cellular mechanisms underlying tinnitus involves reduced activity of the auditory nerve as a result of the noise - exposure or other injury (liberman and kiang, 1978; mulheran, 1999; muller et al . This hyperactivity is thought to arise from a central down regulation of inhibition to compensate for reduced peripheral afferent drive (suneja et al ., 1998a, b; wang et al ., 2009; middleton et al ., an alternative hypothesis suggests the up - regulation of excitatory inputs as a contributor to tinnitus - related hyperactivity (dehmel et al ., 2012). Tinnitus - related hyperexcitability has been observed in several auditory centers throughout the ascending auditory pathway . (jastreboff and sasaki, 1986; chen and jastreboff, 1995; ochi and eggermont, 1997; eggermont and komiya, 2000; kaltenbach and afman, 2000; kaltenbach et al ., 2000; brozoski et al ., 2002 while the establishment of hyperactivity neural activity as a correlate of tinnitus has advanced the understanding of the mechanistic basis for tinnitus, the features of neural activity that specifically underlie the perception of tinnitus remain elusive . Thalamocortical dysrhythmia emerge as a plastic maladaptation to peripheral injury (llinas et al ., 2005). These rhythms may act to promote coherent high - frequency (gamma) oscillations and thus generate the conscious perception of tinnitus . Imaging studies in humans have sought to pinpoint the neural correlates of tinnitus, however, they do not allow for the dissection of the cellular mechanisms underlying tinnitus . On the other hand, imaging studies in animal models of tinnitus offer a reduced, better - controlled experimental environment that will facilitate the discovery of the underlying physiological remodeling that leads to tinnitus . Here we will review and compare studies that have employed different imaging modalities to examine the neural correlates of tinnitus in animal models and in humans . We will also discuss how imaging in animal models may help address specific hypotheses about the persistent basis of tinnitus in the central nervous system . Further experimental and conceptual linking between human studies and studies in animal models of tinnitus will facilitate the discovery of the etiology and the cure of tinnitus . Traditional methods of recording electrophysiological brain activity present significant problems that prohibit their usage in human studies . The most important issue being that extracellular electrode recordings require craniotomies, which are untenable for non - critical patients . Imaging techniques offer an alternative means of accessing physiological parameters in a non - invasive manner . In particular, positron emission tomography (pet) and functional magnetic resonance imaging (fmri) are now commonly used to study the physiological basis of tinnitus in human sufferers . Neural imaging involves monitoring changes in the level of cerebral blood flow or glucose metabolism in areas of the central nervous system . Subjects in pet studies are injected with radioactive tracer isotopes attached to a biologically active compound . These compounds are introduced to the bloodstream and, depending on the biological compound tethered to the isotope, can be used for detecting changes in blood flow, oxygen metabolism or glucose metabolism as a result of brain activity (fox et al ., fmri can be used to image the oxygenation state of cerebral blood, and thus provides an indirect measure of neural activity . Hemoglobin in the oxygenated state is more susceptible to the brief magnetic pulses produced by fmri scanners, thus enabling this technique to specifically measure the contrast of blood oxygenation level dependence (bold) (ogawa et al ., however, since the bold signal also arises from non - neural sources, baseline neural activity cannot be inferred using fmri . Instead, relative changes in the bold signal must be used as a secondary indicator of changes in neural activity . Both imaging methods described, pet and fmri, have limitations compared to traditional recording techniques: (1) they indicate blood flow or metabolic state and thus are only indirectly linked to neural activity, (2) their temporal resolution is slower than recording techniques that directly measure neural activity (i.e., electrical recordings, voltage, or calcium - sensitive dyes), and (3) their spatial resolution is limited to the scale of millimeters . This last point is the factor that most limits the usage of these techniques in animal studies of tinnitus . In particular, it becomes difficult to resolve signals from auditory brainstem nuclei in rodent models of tinnitus since their volume is typically smaller than a cubic millimeter . Other non - invasive recording techniques, such as electroencephalograms (eegs) and magentoencephalograms (megs), provide alternates to pet and fmri imaging . The electric fields measured by eegs are the result of extracellular currents that are oriented perpendicular to the cortical surface from synchronously firing neurons (nunez and srinivasan, 1981). Megs likely arise from the synaptic currents that are generated by apical dendrites across synchronously activated neurons (hillebrand and barnes, 2002). The skull and scalp attenuate eegs, but are transparent to magnetic fields, thus megs offer better spatial resolution than eegs . The spatial resolution of megs is only limited by the number of neurons that must be synchronously active to generate sufficiently strong signals for detection . Traditional methods of recording electrophysiological brain activity present significant problems that prohibit their usage in human studies . The most important issue being that extracellular electrode recordings require craniotomies, which are untenable for non - critical patients . Imaging techniques offer an alternative means of accessing physiological parameters in a non - invasive manner . In particular, positron emission tomography (pet) and functional magnetic resonance imaging (fmri) are now commonly used to study the physiological basis of tinnitus in human sufferers . Neural imaging involves monitoring changes in the level of cerebral blood flow or glucose metabolism in areas of the central nervous system . Subjects in pet studies are injected with radioactive tracer isotopes attached to a biologically active compound . These compounds are introduced to the bloodstream and, depending on the biological compound tethered to the isotope, can be used for detecting changes in blood flow, oxygen metabolism or glucose metabolism as a result of brain activity (fox et al ., 1986). Fmri can be used to image the oxygenation state of cerebral blood, and thus provides an indirect measure of neural activity . Hemoglobin in the oxygenated state is more susceptible to the brief magnetic pulses produced by fmri scanners, thus enabling this technique to specifically measure the contrast of blood oxygenation level dependence (bold) (ogawa et al ., however, since the bold signal also arises from non - neural sources, baseline neural activity cannot be inferred using fmri . Instead, relative changes in the bold signal must be used as a secondary indicator of changes in neural activity . Both imaging methods described, pet and fmri, have limitations compared to traditional recording techniques: (1) they indicate blood flow or metabolic state and thus are only indirectly linked to neural activity, (2) their temporal resolution is slower than recording techniques that directly measure neural activity (i.e., electrical recordings, voltage, or calcium - sensitive dyes), and (3) their spatial resolution is limited to the scale of millimeters . This last point is the factor that most limits the usage of these techniques in animal studies of tinnitus . In particular, it becomes difficult to resolve signals from auditory brainstem nuclei in rodent models of tinnitus since their volume is typically smaller than a cubic millimeter . Other non - invasive recording techniques, such as electroencephalograms (eegs) and magentoencephalograms (megs), provide alternates to pet and fmri imaging . The electric fields measured by eegs are the result of extracellular currents that are oriented perpendicular to the cortical surface from synchronously firing neurons (nunez and srinivasan, 1981). Megs likely arise from the synaptic currents that are generated by apical dendrites across synchronously activated neurons (hillebrand and barnes, 2002). The skull and scalp attenuate eegs, but are transparent to magnetic fields, thus megs offer better spatial resolution than eegs . The spatial resolution of megs is only limited by the number of neurons that must be synchronously active to generate sufficiently strong signals for detection . In this section, we will briefly review several imaging studies that show patterns of activation that are consistent with physiological studies of animal models and some results that point to the involvement of non - auditory brain centers in tinnitus . Pet imaging has revealed increased regional cerebral blood flow (rcbf) in the contralateral auditory cortex of patients with tinnitus in one ear (lockwood et al ., 2002). Some patients have the ability to modulate the experience of perceived tinnitus with orofacial manipulations (lockwood et al ., 1998). In the cases where manipulations decreased tinnitus perception, there was a significant reduction of rcbf in the auditory cortex and also in the contralateral hippocampus . This further supports the hypothesis that the basis of tinnitus is centrally located and that internal perceptions can be modulated by the top - down influence of voluntary orofacial movements . Measuring changes in hemodynamics in tinnitus patients with fmri has revealed increased activation of inferior colliculus (ic) to sound stimuli compared to control subjects (figure 1) (melcher et al ., 2009). This study is consistent with animal studies showing increased activation of ic in different animal models of tinnitus (bauer et al ., 2008) another fmri study shows that auditory cortex hyperexcitability correlates with tinnitus while hyperexcitability of subcortical brainstem regions is more directly linked with the occurrence of hyperacusis, or diminished sound level tolerance (gu et al ., 2010). An fmri imaging study reveals larger sound - evoked activation of the inferior colliculus in patients with tinnitus (left) compared to control subjects (right). The color scale indicates the significance of the difference of activation between on and off stimulus periods . One recent discovery emerging from human imaging studies is the involvement of the limbic system in tinnitus . Tinnitus - related functional and structural changes are observed in the hippocampus and in the amygdala, (lockwood et al ., 1998; de ridder et al ., 2006; landgrebe et al ., more recently, strong correlation was shown between structural and functional changes in the auditory system and limbic system in tinnitus patients (leaver et al ., 2011). Specifically, fmri revealed hyperactivity in the nucleus accumbens (nac) and primary auditory cortex when tinnitus patients were presented acoustic stimuli matched to their perceived tinnitus frequency (figure 2a). No functional changes were observed in the prefrontal cortex, however, structural changes were uncovered using voxel - based morphometry (vbm) on high resolution structural mri . The ventromedial prefrontal cortex (vmpfc) of tinnitus patients had increased gray matter and decreased white matter concentrations . The degree of structural changes in vmpfc was significantly correlated with functional changes in nac and auditory cortex (figure 2b). Because the limbic system is involved in modulating and maintaining emotional state it has previously been hypothesized to play a role in the neural basis of tinnitus (rauschecker et al ., 2010). However, it remains unclear whether the limbic dysfunction is involved in the establishment of tinnitus or whether it is a secondary consequence of the emotional distress tinnitus caused by tinnitus . Furthermore, the recent finding of correlated structural and functional changes in the limbic and auditory systems suggest a widespread alteration in the limbic corticostriatal pathway, which is thought to assess stimulus relevance and filter out undesirable stimuli (leaver et al ., 2011). The compromise of the limbic system may play a role in gating the persistent representation of phantom stimuli in the auditory cortex . Stimuli matched for perceived tinnitus frequency evoked significantly higher activity, as measured by fmri, in (a) the nucleus accumbens (nac) and (b) medial hershel's gyrus (mhg), the presumed site of primary auditory cortex . It is not clear whether the perception of tinnitus is linked to stimulus - induced activity or properties of spontaneous neural activity alone, however, there is evidence that auditory stimulus related changes in the cortical bold signal are specifically correlated with the presence of tinnitus (gu et al ., 2010). While the intrinsic, synaptic and circuit mechanisms underlying tinnitus - related hyperactivity or tinnitus - related enhanced evoked activity are not well understood (tzounopoulos, 2008), it is likely that similar mechanisms may mediate both spontaneous and stimulus - evoked changes . Meg recordings from tinnitus sufferers have also contributed important insights into the neurobiology of tinnitus . Meg recordings from human sufferers of tinnitus demonstrated a redistribution of the tonotopic axis in a1 in human tinnitus patients (muhlnickel et al ., 1998). Meg signals for the presumed tinnitus frequency occupied more cortical space at the expense of other frequencies . Animal models of noise - induced tinnitus corroborate these findings as they demonstrate tonotopic reorganization (norena and eggermont, 2005, 2006). This reorganization can be prevented by enriched acoustic environments (norena and eggermont, 2005, 2006) and even reversed by pairing vagus nerve stimulation with pure tone stimulation (engineer et al ., 2011). Despite the evidence that tonotopic reorganization can result from noise - induced tinnitus, human fmri studies suggest that tonotopic reorganization may not be necessary for the conscious perception of tinnitus (langers et al . The interpretation that tinnitus does not require tonotopic reorganization is further supported by the possibility that increased meg signals may also reflect changes in neural synchrony . An alternative hypothesis for the neural basis of tinnitus proposes that reduced thalamic input due to sound - exposure driven deafferentation leads to thalamocortical dysrhythmia (llinas et al ., 1999). Meg recordings of spontaneous neural activity from tinnitus patient's exhibit pronounced cortical activity peaks in the theta range (48 hz; figure 3). Rhythms in this range were reduced when the patients were presented masking auditory stimuli (llinas et al ., 2005). Tinnitus patients also exhibit meg activity that has broad - spectrum gamma rhythms with elevated power compared to megs from control subjects . Cortical gamma rhythms are hypothesized to bind together activity of neural populations to form the substrate of conscious perception (fries et al ., 2007). A potential causal link between aberrant theta rhythms and aberrant gamma rhythms has been suggested by in vitro experiments (llinas et al ., 2005). It was shown that 40 hz (gamma) stimulation of cortical tissue evokes focal responses while stimulation with 4 hz (theta) evoked more widespread responses . Furthermore, mixing of theta and gamma - evoked responses promotes the spread of gamma oscillatory activity into neighboring cortical regions . This so - called edge effect provides an attractive mechanistic explanation for the basis of certain forms of tinnitus where patients exhibit abnormally high theta rhythms in meg signals . (a) megs of spontaneous neural activity from tinnitus patients show a distinct peak in the theta range (red) that is suppressed when a masking sound is presented (blue). (b) the relative power of these two conditions reveals a strong coherent theta rhythm under spontaneous conditions . Gamma oscillations have been linked with behaviorally relevant perceptual tasks . In humans and monkeys, the latency of detection of visual stimulus changes is reduced when gamma power in visual cortex is increased (womelsdorf et al ., 2006; hoogenboom et al ., correlated activity between different brain regions that is associated with perception can arise through rhythmic gamma activity (womelsdorf et al ., 2007). Thus, noise - induced intracortical gamma - mediated signaling, arising from thalamocortical dysrhythmia, could contribute to the perception of tinnitus . Tinnitus generation via increases of gamma - band activity at the edge frequency may not be relevant for all forms of tinnitus . The edge effect that we described above may arise from the functional lesion of a very small range of frequencies; such a lesion may lead to increased gamma activity and to subsequent tinnitus perception at the predicted edge area . However, functional damage of a broader range of cochlear frequencies is expected to lead to a more global cortical reorganization, thus leading to tinnitus that involves perception of broader spectrum of frequencies . The underlying cellular and molecular causes of aberrant thalamocortical dysrhythmia are unclear, but the relevance of this model is supported by a clinical study showing that a group of patients with therapy - resistant tinnitus exhibited theta frequency bursting of neurons in the medial thalamus (jeanmonod et al ., 1996). This type of bursting pattern is associated with the de - inactivation of low - threshold calcium currents (llinas and jahnsen, 1982). Surgical removal of the medial thalamus has suggested a reduced perception of phantom noises associated with tinnitus (jeanmonod et al ., 1996). Despite the appeal of the dysrhythmia hypothesis the mechanism underlying the initiation of pathological bursting in the thalamus electrophysiological studies in animal models of tinnitus have contributed significantly to the understanding of the neural basis of tinnitus . These studies have uncovered physiological signatures of tinnitus in different processing centers of the auditory system . In the dorsal cochlear nucleus (dcn) elevated firing rates are observed after exposure to intense sound (kaltenbach et al ., 1998; brozoski et al ., 2002 in the ic increased firing rates are observed after application of large doses of salicylate (jastreboff and sasaki, 1986; chen and jastreboff, 1995). Salicylate also results in long lasting increases in firing rates of neurons in cat auditory cortex (zhang et al ., 2011). Noise trauma results in hyperactivity at the auditory cortex (eggermont and komiya, 2000; seki and eggermont, 2003). The trauma induces increases in both spontaneous firing rates and in peak neuronal cross - correlations (norena and eggermont, 2003, 2006). How the neural correlates of tinnitus observed in animal studies relate to the neural correlates of tinnitus revealed by imaging brain activity in human sufferers is not entirely clear . Recent studies that involve imaging techniques applied to animal models of tinnitus have begun to provide these missing connections . One notable study employed the use of micro positron emission tomography (pet) to image baseline spontaneous activity in rat auditory nuclei (paul et al ., 2009). Rats were injected with a radioactive fluorescent tracer fluorine-18 fluoro-2-deoxyglucose (fdg) and serial reconstructions of relative metabolic activity were made from measurements using a pet scanner . This study showed that metabolic activity signals were higher in ic and auditory cortex, but not significantly increased in the thalamus of rats with salycilate - induced tinnitus . An important aspect of this study is the reproducibility of response magnitudes in successive imaging sessions of control subjects . This allows for the measurement of an absolute baseline signal enabling the assessment of both spontaneous and evoked responses . Altogether, this paper in agreement with electrophysiological studies demonstrates that in vivo imaging techniques reveal hyperactivity as a neural correlate of tinnitus . Plastic maladaptive changes in inhibitory neurotransmission in different auditory nuclei are thought to play a role in establishing the neural basis of tinnitus . Gabaergic and glycinergic release are altered in auditory brainstem nuclei after cochlear ablation (suneja et al ., 1998b; wang et al ., 2009); gabaergic activity is altered in the ic in a salicylate model of tinnitus (bauer et al ., 2000). Importantly, pharmaceutical treatments that enhance the action of gabaergic systems restore the physiological function of the auditory system in animals with behavioral evidence of tinnitus (bauer and brozoski, 2001; brozoski et al ., 2007). A recent imaging study revealed the role of different excitatory and inhibitory neurotransmitter systems in mediating the observed tinnitus - related hyperactivity . In this study a novel imaging paradigm has been applied; flavoprotein autofluorescence (fa) imaging (middleton et al ., flavoproteins are mitochondrial proteins that become oxidized and reduced in the electron transport chain of cellular metabolism (shibuki et al ., 2003; reinert et al ., 2007). In the oxidized state, flavoproteins absorb blue light (480 nm) and emit green light (540 nm). Using fa imaging in dcn slices, electrical stimulation of the molecular cell layer of the dcn (figure 4a) reveals that the spread of the fa signal is proximal to the stimulation site in control mice (figure 4b1). Similar stimulation in mice with behavioral evidence of tinnitus revealed fa signals that extend over a much broader region of the dcn (figure 4b2). Analysis of the center (stimulation site) and surround regions of the dcn slice show that the surround / center ratio is significantly larger in the dcn from tinnitus mice (figure 4c). To determine which neurotransmitter system mediates the increased fa signal in tinnitus mice, the impact of a series of neurotransmitter receptor antagonists on fa signals was assessed (figures 4d, e). Application of sr-95531 (gabaergic inhibition antagonist) caused a larger increase in the surround signal of control slices in tinnitus slices (figure 4e). Successive application of blockers of excitation caused similar reductions in the relative fa response in control and tinnitus dcn slices . These results indicate that gabaergic inhibition plays a role in maintaining focal responses in normally functioning dcn . Moreover these results indicate that decreased gabaergic inhibition leads to hyperactive dcn circuits in mice with behavioral evidence of tinnitus . The impairment of gabaergic inhibition provides a mechanism for the neural basis of tinnitus - related hyperexcitability in the dcn in addition to the known role of impaired glycinergic inhibition after cochlear injury (suneja et al ., these studies demonstrate the applicability of imaging techniques that are analogous to human imaging studies to study the underlying mechanisms of tinnitus neural correlates . Flavoprotein autofluorescent (fa) imaging reveals gabaergic related hyperactivity in the dorsal cochlear nucleus (dcn) of mice with behavioral evidence of tinnitus . Electrical stimulation of the dcn brain slices (a) leads to a spatially concise excitatory response in control animals (b1) and a spatially extended response in tinnitus animals (b2). The center region is defined as the area at the stimulation electrode while the surround regions flank the center on either side along the fusiform cell layer . The size of surround responses relative to the stimulation center response is significantly larger in tinnitus brain slices (c). Pharmacological blockade of inhibitory and excitatory neurotransmitters has similar effects on the center signal of control and tinnitus mice (d) while the gabaergic antagonist sr causes a larger relative increase in the surround of control brain slices (e). The growing prevalence of tinnitus has made it imperative to better understand the mechanistic development of the neurological basis of tinnitus . However, the connection between the underlying physiology in animal models and the functional imaging patterns in human studies remains unclear . The methods directly related to cellular metabolism, and thus indirectly related to neural activity (pet and fmri) are somewhat limited in their ability to measure single cell activity and specific microcircuit activation . Metabolic signals may be used to develop models describing the dynamics of neural populations and how they change with tinnitus - related plasticity . However, any such model would be under constrained as there are multiple cell - types contributing to the metabolic signal, and many different combinations of subpopulation activity could lead to the same observable signal . In order to understand how cellular and circuit based plasticity underlies altered bold responses in tinnitus patients one must be able to assess cellular and circuit properties underlying the bold response . A better understanding of the mechanistic link between circuit - based plasticity and the altered bold responses in tinnitus patients may be furthered through combined imaging and physiological studies in animal models of tinnitus . One technique that may allow for this powerful combination involves the use c - fos / green fluorescent protein (gfp) constructs to identify subsets of neurons that have been activated by sensory stimulation (barth et al ., 2004). C - fos is an early immediate gene whose expression is dependent on neural activity (gall et al ., 1998). When used in animal models, it is an ideal marker of neural populations that have been recently active in in vivo contexts . In a previous immunohistochemical study, levels of c - fos were visualized several hours after animals were exposed to loud narrowband noise or given salycilate injections (mahlke and wallhausser - franke, 2004). In this study, a previous study showed differences in c - fos activation in the dcn: c - fos expression was increased with noise exposure but not salycilate injections (wallhausser - franke et al ., 2003). In order to understand the circuit - based mechanisms underlying the bold signal or other in vivo imaging signals, imaging experiments could be performed on c - fos / egfp mice that have been given tinnitus - inducing manipulations . These mice could be taken immediately after imaging sessions so that brain slices may be prepared for in vitro recording experiments . What this technique will potentially reveal is the identities of the neurons that previously contributed to increased metabolic signals from in vivo imaging experiments . These fluorescent neurons may then be targeted for the characterization of changes in intrinsic physiological characteristics allowing for an increased understanding of the cellular and network basis for altered functional imaging signals in sufferers of tinnitus . One interesting finding from imaging studies in tinnitus sufferers is the involvement of the limbic system in the neural basis of tinnitus (lockwood et al ., 1998; mahlke and wallhausser - franke, 2004; leaver et al ., 2011). These studies revealed hyperactivity in the hippocampus (lockwood et al ., 1998), amygdala (mahlke and wallhausser - franke, 2004) and prefrontal cortex (leaver et al ., 2011). These findings point to the need for increased focus on the cellular and circuit properties of neurons in affected limbic areas in animal models of tinnitus . The role of the structural changes in prefrontal cortex and/or other limbic structures could be assessed by stimulating these regions while performing concurrent imaging or electrophysiological recordings of auditory cortical regions in intact animal models of tinnitus . Human meg studies support the idea that a low frequency thalamocortical dysrhythmia may form the neurological substrate for long lasting tinnitus in the cortex . This theory hinges on the assumption that thalamic relay neurons are excessively hyperpolarized as a result of partial de - afferentation . The aberrant opening of these channels at the frequency areas where de - afferentation occurs would promote increased cortical gamma band activity in nearby frequency bands: abnormal silence in one area promotes sound generation in a neighboring area (edge effect, llinas et al ., 2005). This is an attractive model for explaining tonal tinnitus . In vitro imaging and electrophysiological studies, especially in t - type channel knockout mice will be essential in proving or disproving this hypothesized tinnitus generation mechanism . While frequency - specific deafferentation at the level of the thalamus would account for burst promoting activation of t - type calcium channels, much evidence from animal studies points to hyperactivity in subthalamic auditory centers (eggermont and roberts, 2004). We propose an alternative hypothesis that involves the reciprocally connected excitatory - inhibitory loop between thalamus and the thalamic reticular nucleus (trn). Sensory nuclei in the thalamus send excitatory collaterals to neurons in trn, which in turn project inhibitory connections back to the thalamus (crabtree, 1999). If subthalamic hyperactivity acts to strengthen the feedforward excitatory pathway (mgn trn) during early stages of tinnitus, the feedback inhibitory pathway (trn mgn) may be upregulated to maintain physiological levels of corticothalamic activity . If subthalamic hyperactivity subsides during later stages of tinnitus, the residual inhibition from trn may persist thus providing a physiological mechanism for hyperpolarization - activated theta bursting in thalamus . Longitudinal animal imaging studies are necessary to test this hypothesis to verify whether there are time - dependent changes in hyperexcitability of subthalamic auditory nuclei . Additionally, joint recordings of neurons from mgn and trn would help support or refute this hypothesis . Anatomical studies have demonstrated top - down connections from layers 5 and 6 of auditory cortex to the ic, the olivary complex and the cochlear nucleus (doucet et al ., 2003). Activation of top - down pathways in a specific frequency region of auditory cortex modulates the response properties and the number of brainstem neurons preferentially responding to similar frequencies (yan and ehret, 2002; yan et al ., 2005; luo et al ., 2008). Therefore, noised - induced modification of top - down modulatory inputs could also play a role in the induction of tinnitus . This hypothesis could be addressed by ablating corticofugal neurons (bajo et al ., 2010) or electrically stimulating them in rodent models of tinnitus while measuring the resulting changes in brainstem neuron receptive field properties . Another alternative theory, consistent with the discovery of limbic involvement is that nac activity, which is elevated in tinnitus patients (leaver et al ., 2011), drives the trn via serotonergic synapses (o'donnell et al ., 1997), and would thus indirectly increase the inhibition to mgn . The resulting increased inhibitory drive that trn provides to auditory thalamus would provide the necessary hyperpolarization to activate t - type calcium currents and consequently promote aberrant thalamocortical rhythms as described above . Ultimately, we believe that imaging studies, both in tinnitus sufferers and in animal models of tinnitus, are invaluable for their ability to connect non - invasively measured neural correlates and compare those to similarly measured quantities in animal models . Together with behavioral diagnostic techniques and in vitro intrinsic and network characterization of neurons that contributed to increased metabolic activity in vivo, imaging studies will increase the understanding of induction and maintenance of tinnitus and aid in the development of therapeutic strategies to improve hearing deficits for human sufferers of tinnitus . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Colorectal cancer is the third leading cause of cancer death among men and women in the us . In 2009, an estimated 146,970 cases were diagnosed and an estimated 49,920 deaths occurred.1 current colon cancer prevention guidelines from the american cancer society are for average - risk men and women over 50 years of age to receive a flexible sigmoidoscopy every 5 years, a colonoscopy every 10 years, a double - contrast barium enema every 5 years, or a computed tomography colonography every 5 years to identify the presence of precancerous adenomatous polyps and detect colon cancer.2 despite these recommendations, screening colonoscopies remain uncommon . An estimate by the behavioral risk factor surveillance system in 2001 estimated that only 47.3% of adults above the age of 50 years had ever undergone a lower endoscopy.3 since screening colonoscopies are recommended for a large segment of the american population, the efficient use of resources is essential.4,5 colonoscopies are rarely performed without sedation.6 typically, sedative medications are administered to ensure patient comfort and to decrease awareness during the procedure . The overall cost of providing sedation for the colonoscopy increases if an anesthesia provider is present . The value of having sedation for screening colonoscopies administered by anesthesia providers (anesthesiologists and/or certified registered nurse anesthetists [crnas]) has been debated . Gastroenterologists frequently prefer propofol over other sedatives (such as opioids and benzodiazepines) due to propofol s quick onset and quick offset . The beneficial effect of propofol on throughput is an important consideration for gastroenterologists.7,8 however, due to the us food and drug administration s (fda) restrictions for propofol use exclusively among providers who have been trained in the administration of general anesthesia and not involved in the conduct of the surgical / diagnostic procedure, many gastroenterologists will not use propofol without the presence of a licensed anesthesia provider.9 patients satisfaction appears equivocal, when choosing between sedation with propofol versus sedation with an opioid and benzodiazepine combination.10 however, researchers have stated that the presence of an anesthesia provider improves the quality of sedation and is cost - effective, allowing for a more complete and carefully conducted colonoscopy with improved health outcomes.11 recent studies have challenged these assertions . In a retrospective population - based study of 165,527 procedures in 100,359 medicare beneficiaries, including 35,128 (21.2%) who received anesthesia services, cooper et al demonstrated that anesthesia services were associated with an increased risk of aspiration (0.14%) compared to non - anesthesia services (0.10%) (p=0.02).12 the increased risk of aspiration was the main factor accounting for the overall increase in complications (perforation and splenic injury) in patients undergoing colonoscopy with anesthesia services (0.22%) compared to without anesthesia services (0.16%) (p=0.0001). Mortality following a screening colonoscopy is a rare event.12 the overall 30-day mortality is 0.29% and was similar in the anesthesia (0.32%) and non - anesthesia (0.28%) groups (p=0.29). The overall 1-year mortality was 2.68% and was also similar in the anesthesia (2.82%) and non - anesthesia (2.64%) groups (p=0.06). Although the absolute risk of 30-day and 1-year mortality was low, the frequency of major cardiac or neurologic morbidity is unknown . This study evaluates the impact of anesthesia services on major morbidity associated with myocardial infarction (mi) or stroke within 7 days following a screening colonoscopy . In addition, the efficacy, completion rate, incidence of a repeat colonoscopy within 6 months, and incidence of hospital admission within 7 days following a screening colonoscopy were also studied . We hypothesize that the presence of an anesthesia provider during colonoscopy would result in a more complete exam and an associated increased incidence of cancer detection . Additionally, we hypothesize that sedation administered by an anesthesia provider would be associated with fewer serious complications during and after a screening colonoscopy, due to better sedation management skills . Diagnostic outcomes and adverse events associated with the presence or absence of an anesthesia provider in a large population undergoing screening colonoscopies are evaluated . In addition, adherence to the 2004 joint national guidelines published by the american college of gastroenterology (acg), american gastroenterological association (aga), and american society of gastrointestinal endoscopy (asge) on the use of anesthesia providers during screening colonoscopies is studied . After institutional review board approval, a cross - sectional and retrospective cohort analysis was conducted, using medical and pharmaceutical claims data for a representative population insured through commercial (hmo or ppo) or medicare advantage plans administered by humana, inc . Three electronic databases were merged . The member file database contained demographic information for each member per encounter (age, sex, type of insurance, and geographical region). The medical file database stored up to nine recorded international classification of diseases ninth revision (icd-9) codes per encounter, the primary code / reason for the encounter, the current procedural terminology (cpt) codes, the cpt modifiers, and the g codes for procedures . The pharmacy file contained all generic product identifier (gpi) numbers of pharmacy - dispensed medications per claim . Between the identification period of july 1, 2005 and june 30, 2007, patients 50 years of age and older with at least one medical claim containing 45,355, 45,378, or 45,380 cpt codes for colonoscopy and at least one g0121 or g0105 code were identified . To increase the likelihood of capturing only screening colonoscopies, patients with prior history (by icd-9 code) of colorectal cancer, ulcerative colitis, or crohn s disease involving the colon during the 12-month baseline period were excluded . The index date was defined as the date of the first medical claim for screening colonoscopy . Patients were eligible for the study if they had 18 months of continuous insurance enrollment, defined as at least 12 months of baseline coverage prior to the index date and at least 6 months of follow - up coverage . Baseline characteristics for all patients include the demographics (sex, age, race / ethnicity, and type of health insurance plan), the deyo charlson modified comorbidity index, and the revised cardiac risk index (rcri). The american society of anesthesiologists (asa) physical status classification was noted whenever it was coded . The deyo charlson modified index is an extensively studied and validated comorbidity index, which has been adapted for use with icd-9 databases and includes 17 diseases that have been selected and weighted on the basis of the strength of their association with mortality.13 all patients were defined as either average - risk or high - risk, based upon their baseline characteristics of the rcri score calculated using baseline period claims data.5 a subset of patients was also risk stratified by asa status if the physical status cpt modifier was submitted either with the claim for screening colonoscopy or in the year prior to the index date . In the latter case, average - risk patients were defined as those with an rcri class score of i or ii, which means not having any risk factors or one risk factor of ischemic heart disease, history of congestive heart failure, history of cerebrovascular disease, insulin therapy for diabetes, or renal insufficiency . Patients with the risk factor of insulin therapy for diabetes must have had claims with an icd-9 code for diabetes and a gpi code for insulin . High - risk patients were defined as those with an rcri class score of iii or iv, which means two or more of the rcri risk factors . The presence of an anesthesia provider was identified by the 00810 cpt code (anesthesia for lower intestinal endoscopic procedures, endoscope introduced distal to duodenum) submitted with the screening colonoscopy claim . If no claims for anesthesia services were associated with the submitted screening colonoscopy claim, then no anesthesia provider was presumed to be present . Six months of follow - up claims were evaluated to identify whether the diagnosis of new colon cancer was made within 6 months of the colonoscopy; whether the colonoscopy was completed on the index date; whether repeating the colonoscopy was necessary; whether new primary icd-9 diagnosis codes for mi and stroke were added within 7 days of the procedure; and whether hospital admission was required within 7 days . Each patient was followed for a 6-week period after the colonoscopy (latest follow - up was december 31, 2007). Adherence to acg / aga / asge guidelines, which support the administration of sedation by non - anesthesia providers to average - risk patients receiving a screening colonoscopy, was measured.14 descriptive statistics were produced for each set of the study measures . Mean and reported standard deviation for continuous variables, and frequency counts and percentage for categorical variables, were reported . Mcnemar s test was used to determine the statistical significance of differences in categorical measures, including comparison of the ratings based on rcri score and asa status . The study cohorts for evaluating the impact of an anesthesia provider were obtained by matching patients who had an anesthesia provider on the index date with those without an anesthesia provider, using the propensity score method on a 1:1 basis.15 the parsons algorithm selected matched pairs and the final cohorts, using the five digits match.16 logistic regression using the generalized estimating equations (gee) method was used to incorporate the matched pairs design and compare the effects of having an anesthesia provider present on the efficacy of colonoscopy in identifying colon cancer; the completion of the colonoscopy on the index date (as defined by coding that the examination was completed distal to the splenic flexure); the requirement for a repeat colonoscopy within 6 months; the development of an mi (a new primary icd-9 code for the hospital encounter) within 7 days of colonoscopy; the incidence of stroke (a new primary icd-9 code for the hospital encounter) within 7 days of colonoscopy; and the incidence of a hospital admission within 7 days of the screening colonoscopy in both groups . Between the identification period of july 1, 2005 and june 30, 2007, patients 50 years of age and older with at least one medical claim containing 45,355, 45,378, or 45,380 cpt codes for colonoscopy and at least one g0121 or g0105 code were identified . To increase the likelihood of capturing only screening colonoscopies, patients with prior history (by icd-9 code) of colorectal cancer, ulcerative colitis, or crohn s disease involving the colon during the 12-month baseline period were excluded . The index date was defined as the date of the first medical claim for screening colonoscopy . Patients were eligible for the study if they had 18 months of continuous insurance enrollment, defined as at least 12 months of baseline coverage prior to the index date and at least 6 months of follow - up coverage . Baseline characteristics for all patients include the demographics (sex, age, race / ethnicity, and type of health insurance plan), the deyo charlson modified comorbidity index, and the revised cardiac risk index (rcri). The american society of anesthesiologists (asa) physical status classification was noted whenever it was coded . The deyo charlson modified index is an extensively studied and validated comorbidity index, which has been adapted for use with icd-9 databases and includes 17 diseases that have been selected and weighted on the basis of the strength of their association with mortality.13 all patients were defined as either average - risk or high - risk, based upon their baseline characteristics of the rcri score calculated using baseline period claims data.5 a subset of patients was also risk stratified by asa status if the physical status cpt modifier was submitted either with the claim for screening colonoscopy or in the year prior to the index date . In the latter case, the most recent asa status was used . Average - risk patients were defined as those with an rcri class score of i or ii, which means not having any risk factors or one risk factor of ischemic heart disease, history of congestive heart failure, history of cerebrovascular disease, insulin therapy for diabetes, or renal insufficiency . Patients with the risk factor of insulin therapy for diabetes must have had claims with an icd-9 code for diabetes and a gpi code for insulin . High - risk patients were defined as those with an rcri class score of iii or iv, which means two or more of the rcri risk factors . The presence of an anesthesia provider was identified by the 00810 cpt code (anesthesia for lower intestinal endoscopic procedures, endoscope introduced distal to duodenum) submitted with the screening colonoscopy claim . If no claims for anesthesia services were associated with the submitted screening colonoscopy claim, then no anesthesia provider was presumed to be present . Six months of follow - up claims were evaluated to identify whether the diagnosis of new colon cancer was made within 6 months of the colonoscopy; whether the colonoscopy was completed on the index date; whether repeating the colonoscopy was necessary; whether new primary icd-9 diagnosis codes for mi and stroke were added within 7 days of the procedure; and whether hospital admission was required within 7 days . Each patient was followed for a 6-week period after the colonoscopy (latest follow - up was december 31, 2007). Adherence to acg / aga / asge guidelines, which support the administration of sedation by non - anesthesia providers to average - risk patients receiving a screening colonoscopy, was measured.14 descriptive statistics were produced for each set of the study measures . Mean and reported standard deviation for continuous variables, and frequency counts and percentage for categorical variables, were reported . Mcnemar s test was used to determine the statistical significance of differences in categorical measures, including comparison of the ratings based on rcri score and asa status . The study cohorts for evaluating the impact of an anesthesia provider were obtained by matching patients who had an anesthesia provider on the index date with those without an anesthesia provider, using the propensity score method on a 1:1 basis.15 the parsons algorithm selected matched pairs and the final cohorts, using the five digits match.16 logistic regression using the generalized estimating equations (gee) method was used to incorporate the matched pairs design and compare the effects of having an anesthesia provider present on the efficacy of colonoscopy in identifying colon cancer; the completion of the colonoscopy on the index date (as defined by coding that the examination was completed distal to the splenic flexure); the requirement for a repeat colonoscopy within 6 months; the development of an mi (a new primary icd-9 code for the hospital encounter) within 7 days of colonoscopy; the incidence of stroke (a new primary icd-9 code for the hospital encounter) within 7 days of colonoscopy; and the incidence of a hospital admission within 7 days of the screening colonoscopy in both groups . Table 1 reports the demographics and the frequency of comorbid conditions among the patients who received screening colonoscopies . Only 6.52% of subjects had an asa score submitted, of which the most commonly reported score was a physician status 3 . The majority of patients had 0 or 1 rcri factors (73% and 19%, respectively). High - risk patients were significantly more prevalent among the group having an anesthesia provider present during the colonoscopy (9.3% vs 7.5%, p<0.0001). Through propensity scoring using the charlson comorbidity index and rcri score, 14,006 colonoscopy patients were matched (7,003 patients in the group without an anesthesia provider and 7,003 with an anesthesia provider). Mis (0.07%), strokes (0.06%), and hospital admissions (0.76%) within 7 days of the procedure were rare in both groups . A significant difference in the number of these events between the groups did not exist . The incidence of incomplete colonoscopies was not significantly different between those procedures performed with or without an anesthesia provider (1.39% and 1.14%, respectively). However, the incidence of repeat colonoscopies were significantly increased following a colonoscopy without an anesthesia provider as compared to with an anesthesia provider (2.40% vs 1.78%, p<0.02). A nonsignificant trend toward a greater likelihood of a cancer diagnosis was present if an anesthesia provider was involved (2.03% vs 1.7%, p=0.13) (tables 3 and 4). Nine point three one percent of the 16,243 patients who had an anesthesia provider qualified as high - risk by rcri criteria . The demographics of those with an anesthesia provider versus those without an anesthesia provider are shown on table 5 . Table 1 reports the demographics and the frequency of comorbid conditions among the patients who received screening colonoscopies . Only 6.52% of subjects had an asa score submitted, of which the most commonly reported score was a physician status 3 . The majority of patients had 0 or 1 rcri factors (73% and 19%, respectively). High - risk patients were significantly more prevalent among the group having an anesthesia provider present during the colonoscopy (9.3% vs 7.5%, p<0.0001). Through propensity scoring using the charlson comorbidity index and rcri score, 14,006 colonoscopy patients were matched (7,003 patients in the group without an anesthesia provider and 7,003 with an anesthesia provider). Mis (0.07%), strokes (0.06%), and hospital admissions (0.76%) within 7 days of the procedure were rare in both groups . A significant difference in the number of these events between the groups did not exist . The incidence of incomplete colonoscopies was not significantly different between those procedures performed with or without an anesthesia provider (1.39% and 1.14%, respectively). However, the incidence of repeat colonoscopies were significantly increased following a colonoscopy without an anesthesia provider as compared to with an anesthesia provider (2.40% vs 1.78%, p<0.02). A nonsignificant trend toward a greater likelihood of a cancer diagnosis was present if an anesthesia provider was involved (2.03% vs 1.7%, p=0.13) (tables 3 and 4). Nine point three one percent of the 16,243 patients who had an anesthesia provider qualified as high - risk by rcri criteria . The demographics of those with an anesthesia provider versus those without an anesthesia provider are shown on table 5 . This retrospective observational study of a large health benefits claims database evaluated the impact of the presence or absence of an anesthesia provider on major morbidity for a large population of average- and high - risk patients undergoing screening colonoscopies . Anesthesia providers were present 25.48% of the time, which is consistent with previously published us and canadian rates of 27.8% and 19.1%, respectively.6,17 our study demonstrates that, in a population of predominantly average - risk patients, the presence of an anesthesia provider during a colonoscopy has no impact on the incidence of mi or stroke . However, a statistically significant decrease in the rate of repeated colonoscopies (0.7%) was associated with the presence of an anesthesia provider . Although further study with sufficient power is needed to confirm the finding of a nonsignificant trend toward increased cancer detection, the decrease in repeat colonoscopies may be consistent with the nonsignificant trend toward greater cancer detection when an anesthesia provider is present . If a gastroenterologist were more inclined to avoid repeating a colonoscopy or aborting a procedure when an anesthesia provider manages the commonly occurring complications of hypoxemia (55.6%), bradycardia (5.6%), and hypotension (8.9%), they may identify more lesions and be more confident that a sufficiently thorough exam was performed.18 guidelines prepared jointly by the acg, aga, and asge, addressing the issue of sedation during routine lower endoscopic procedures, do not support the administration of moderate sedation by specially trained anesthesia providers to average - risk patients . However, for high - risk patients, the guidelines suggest that the administration of sedation by an anesthesiologist or other anesthesia provider might be considered.17 conflicting results regarding outcomes and adverse events exist.19 the asa has equivocated on whether the immediate availability of a provider with postgraduate training in anesthesiology increases the likelihood of a satisfactory outcome or decreases the associated risks associated with moderate sedation (more commonly performed on average - risk patients). For deep sedation or when procedures are performed on high - risk patients, the asa agrees that the immediate availability of an anesthesiologist increases the likelihood of satisfactory sedation and decreases the likelihood of adverse outcomes.20 however, recent data suggests that the use of propofol by anesthesiologists has been associated with an increased risk of aspiration pneumonia among medicare patients undergoing outpatient colonoscopy.12 agostoni et al found that pulmonary aspiration is the most common significant complication of a colonoscopy.21 additional evidence attributes the risk of respiratory complications and infections following endoscopies and colonoscopies to the depth of sedation achieved during the procedure.22 national guidelines regarding the use of anesthesia providers are not commonly followed in clinical practice . Currently, an endoscopist s decision to include an anesthesia provider has largely been dependent upon their level of comfort managing the administration of sedation and their desire to best meet the needs of their patients . The implementation of any guideline requires an understanding of existing trends in clinical practice and a commitment at the national, regional, and local levels to adapt evidence - based recommendations to available resources . In the absence of any outcome study our study contains a number of limitations related to its retrospective nature and use of insurance claims data . The presence of anesthesia provider does not differentiate between the presence of an anesthesiologist (or the subset of board - certified anesthesiologists) or a crna . Perhaps measuring outcomes however, no method existed to determine if the sedation was administered by another physician or registered nurse . Medications represent a potential confounding variable, as they differ in their safety and pharmacologic profiles . As an example, anesthesia providers are more likely to utilize medications such as propofol, which has more profound pharmacodynamic effects than other sedatives . Data on the type of anesthesia administered (general anesthesia, deep sedation, or moderate sedation) was not available . However, given the extremely low incidence of complications, the likely that further stratification of providers, depth of anesthesia, or type of sedative medications administered would change our conclusions is low . Finally, polyp yield from the colonoscopy procedure and histology and staging for cases of colon cancer identified were not available in the dataset, which might have caused a missed benefit of having an anesthesia provider present, if effectiveness of the screening examination was considered using that data . There were a very small number of cardiovascular events from which to draw conclusions about the choice of professionals providing sedation . Evaluating the effectiveness of the therapies and the usefulness of anesthesia providers for routine screenings, treatments, or symptom management is a national imperative of medical research . This study helps formulate updated policies related to endoscopic sedation and advances the understanding of health care expenditures about the outcomes related to sedation during colonoscopy . Through additional carefully conducted research and thoughtful analysis, physicians and guideline - setting organizations will be able to make recommendations on the optimal use of health resources, for the benefit of individual patients and the health of our society . The presence of an anesthesia provider during a screening colonoscopy did not affect the incidence of completed colonoscopies or the incidence of significant morbidity . A nonstatistically significant trend toward increased cancer detection was found, when an anesthesia provider was present . Adherence to 2004 published guidelines by several societies representing gastroenterologists regarding the use of anesthesia providers was poor . Abbreviations: cpt, current procedural terminology; gpi, generic product identifier; icd-9, international classification of diseases ninth revision; inj, injected.
Obesity is a major risk factor for onset of upper body breast cancer - related lymphedema (bcrl) [13], which is a persistent adverse outcome of cancer treatment that affects the physical health and quality of life of up to 35% of the 2.9 million breast cancer survivors in the us [4, 5]. Bcrl is an inflammatory condition that arises when removal of lymph nodes during cancer treatment causes lymphatic fluid to build up in the arms, breast, and torso . Because of arm swelling and altered lymphatic function, upper body bcrl may affect a breast cancer survivor's ability to complete activities of daily living and maintain employment and may lead to psychosocial distress or secondary comorbidities [811]. In addition to elevated bmi, other known risk factors of bcrl onset include older age, greater number of lymph nodes removed via axillary lymph node dissection, adjuvant radiation therapy [1, 12], and low physical activity . Many of these risk factors are differentially distributed by race, which may explain race differences in bcrl onset . While observational studies have suggested that black breast cancer survivors are nearly 2.2 times more likely to develop incident bcrl than white breast cancer survivors [1317] and are also more likely to face greater upper arm disability, there has been less exploration of differences in bcrl severity by race . Volume differences between arms, or interlimb difference, are a commonly used objective measure of bcrl severity [19, 20] and are relevant to understanding the impact of the condition . Greater arm volume has been associated with limitations in activity, overall declines in physical functioning, and greater levels of depression . Increasing physical activity and weight loss have been the focus of interventions designed to prevent, stabilize, or reduce bcrl severity [1, 5, 22]. Race is a social construct [23, 24] and racial differences in bcrl severity may represent a litany of embodied social factors . In the case of black americans, race may be an indicator of differences in types of treatment received and healthcare access that could translate to differences in bcrl severity or access to lymphedema management resources, such as compression garments or lymphedema therapy sessions . For example, black breast cancer survivors, on average, have higher bmis than white breast cancer survivors [26, 27] and are less likely to meet physical activity guidelines, both of which could contribute to race - based disparities in bcrl outcomes . Black women are more likely than white women to undergo axillary lymph node dissection, which is associated with greater morbidity than the less invasive sentinel lymph node biopsy [3033]. While this may be explained in part by the higher likelihood of being diagnosed with more aggressive tumors, there is evidence that even when adjusting for stage and grade of tumors, black women are more likely to undergo axillary lymph node dissection [34, 35], putting black women at greater risk of bcrl . Identifying a profile for risk of greater bcrl severity is recognized as a great need in research [2, 5, 15, 36], and the social risk factors for increased severity can inform both risk profiles and interventions designed to reduce arm volume [1317]. Social risk factors for increased severity might include indicators of socioeconomic position, such as education or income, which may be linked to access to knowledge of bcrl; access to healthcare resources for bcrl management, such as formal prescription for bcrl treatment; or inflammation - related factors like psychosocial stress due to work obligations or household composition . This cross - sectional observational study uses baseline data from an in - progress clinical trial to explore racial differences in bcrl severity as measured by interlimb volume differences in arm swelling, while accounting for other social, physical, and treatment - related bcrl risk factors, among black and white breast cancer survivors . The study population is drawn from 351 women enrolled in the ongoing women in steady exercise research (wiser) survivor trial conducted within the university of pennsylvania's transdisciplinary research on energetics and cancer (trec) center . The wiser survivor trial was approved by the university of pennsylvania institutional review board and all participants provided informed consent . Wiser survivor is a one - year randomized controlled weight loss and exercise intervention trial in sedentary overweight breast cancer survivors with breast cancer - related lymphedema (bcrl; see study nct01515124 at clinicaltrials.gov for details). Participants were recruited from southeastern pa and nj zip codes, first through letters sent to patients diagnosed with breast cancer from 1999 to 2014 listed in each state's cancer registry or regional hospital - based cancer registry records and then through community events for breast cancer survivors . Eligibility requirements included (1) having stable (no cellulitis or flare - ups within the past 3 months) breast cancer - related lymphedema according to a standardized clinical evaluation by a certified lymphedema therapist and interlimb arm volume difference of> 5% based on the us national cancer institute's common terminology criteria for adverse events (ctcae) v3.0; (2) being currently cancer - free at least 6 months after treatment for breast cancer; (3) being overweight or obese (25 bmi 50); and (4) being able to walk unaided for at least 6 minutes . Exclusion criteria included (1) medical conditions or medications that would prohibit participation in an exercise program; (2) plans for additional (e.g., curative or reconstructive) surgery during the study period; (3) self - report of weight - lifting within the past year; (4) current engagement in 3 or more times weekly aerobic activity of moderate intensity; (5) plans to move away from the area over the next year; (6) current use of weight loss medication (otc or prescription); (7) self - report of alcohol or substance abuse within the past 12 months, including at - risk drinking (current consumption of more than 14 alcoholic drinks per week); (8) unstable weight, assessed as weight loss> 10 lb in the past 3 months; and (9) a history of bariatric surgery . While women of all racial / ethnic groups were allowed in the study, 17 participants who did not self - report as black or white (~5% of participants) were excluded from this analysis of racial variation between the two groups . Thirty - six women with bilateral bcrl were also excluded from analysis, plus one woman with a bmi that was borderline for meeting study eligibility . Interlimb arm volume difference was measured by perometry, operationalized as the difference between the left and right arms . The optoelectronic perometer (juzo usa, cuyahoga falls, oh) is a reliable and valid tool to assess interlimb dimension and volume [3840]. The perometer uses infrared lasers to calculate the total limb length and circumference of each arm based on cross - sectional imaging of the upper limbs and yields girth and volume, as well as the percent difference between affected (side of breast cancer surgery) and unaffected arm limbs . Only assessments taken before randomization were used in this analysis, at which time each participant recorded self - reported arm dominance . To ensure that bcrl self - care practices did not interfere with accurate arm volume measurements, participants were instructed to remove lymphedema compression garments, tape, or bandages at least 1 hour prior to perometry measurement . Larger differences in interlimb volume are significantly positively correlated with greater arm symptom burden and pain . The dominant left or right arm may be favored for use in day - to - day activities so the dominant arm may be larger by volume prior to the development of bcrl or may influence measurement and diagnostic precision of arm volume measurement . Measures of interlimb volume suggest a 3.3% difference in dominant versus nondominant arms in healthy normative populations . Thus, this analysis reduced the volume of the dominant 3.3% before interlimb difference was calculated to account for arm dominance . The demographic, physical, and clinical data were collected via self - report survey at study entry and included race, age, education level (nonoverlapping categories), employment status, total number of persons living in the household, presence of dependent children at home, years since breast cancer diagnosis, type of breast cancer treatment(s), and history of bcrl treatment . Education level cut - offs were based on previous examinations of education, self - rated health, and obesity, which use four categories (less than high school diploma, high school graduate, some college, and college graduate). However, due to sample size, the categories of less than high school and high school graduate were combined, resulting in a 3-category education variable . Bmi was determined by objectively measured height and weight using a scale mounted stadiometer and digital scale . Types of breast cancer treatment (chemotherapy, radiation, and hormonal therapies), number of lymph nodes removed, breast cancer stage at diagnosis, and years since breast cancer diagnosis were confirmed by pathology report, when available . If pathology reports were unavailable, the pennsylvania state cancer registry was used to ascertain clinical characteristics . Lymph node removal was later classified as sentinel lymph node biopsy for <5 nodes removed or axillary lymph node dissection or 5 nodes removed . Adherence to lymphedema treatment was assessed by self - report [45, 46] and was coded as yes if the participant indicated being prescribed and also using one or more of the following treatments at least 25% of the time during the past 3 months: self - care techniques, therapist care, compression garments, bandaging, elevation, skin care, taping, medications, or any other lymphedema treatment in the past 3 months . This variable was coded as no if the participant had not been prescribed any of the aforementioned forms of care in the past 3 months or used them less than 25% of the time in the past 3 months . Over 98% of participants reported having health insurance so insurance status was not included in the analysis, due to lack of variation in this covariate . Data analyses for this cross - sectional observational study were conducted using r version 3.2.2 (r core team (2015). Missing data on cancer stage of diagnosis and bilateral bcrl were imputed via iterative regression . Multivariable linear regression models were constructed with an outcome of percent change in continuous interlimb volume difference, as a measure of bcrl severity . Table 1 shows descriptive statistics for the 296 women in the final analytic sample, of whom 102 were black (34.5%) and 194 were white (65.5%). Study participants had an average interlimb volume difference of 6.86% (sd = 14.1), corresponding to grade 1 breast cancer - related lymphedema (bcrl) according to nci common terminology criteria for adverse events (ctcae) v3.0 . The average participant had a body mass index (bmi) of 34, was 60 years old, was the recipient of a college degree or more (47%), was not retired (68%), worked an average of 26 hours per week outside of the home (regardless of retirement status), had 3 people living in the household, and had no dependent children in the home (60.5%). Participants received cancer treatment an average of 8 years from time of study entry, with nearly 70% diagnosed at stage ii or earlier . The majority had axillary lymph node dissection (5 lymph nodes removed; 72%), adjuvant radiation (82%), chemotherapy (83%), hormone therapy (57%), and no breast reconstruction (60%). Just under half (46%) had used some form of bcrl treatment at least 25% of the time in the 3 months leading up to their bcrl measurement . There was no significant difference in black - white racial distribution across educational categories in this study (p = 0.37); however, black women had significantly higher bmi than white women (35.0 versus 33.3; p = 0.01). In table 2 multivariable linear regression controlling for demographic, clinical, and treatment factors, neither race (0.26, p = 0.89) nor bmi (0.22, p = 0.10) was associated with interlimb volume difference . Completing some time in college was associated with a 4.9% smaller interlimb volume difference (4.86, p = 0.03) though being a college graduate was not significantly different compared to completing high school or less (p = 0.28). Each year that passed since completing cancer treatment was associated with a 0.55% higher interlimb difference (p <0.001), and receipt of axillary lymph node dissection was associated with an increased 4.75% interlimb difference when compared to sentinel lymph node biopsy (p = 0.01). Receipt of or adherence to lymphedema care treatment (4.10, p = 0.01) was significantly associated with greater interlimb difference . Models (not presented) including a covariate for arm dominance did not change results . This analysis of breast cancer - related lymphedema (bcrl) in overweight black and white women found no differences in interlimb arm volume by race or bmi but found large differences by education, suggesting a greater role for resource than race for bcrl severity . Interlimb volume difference is a measure of bcrl severity used by previous researchers and as part of clinical criteria [19, 20]. Having achieved more than a high school education was associated with a nearly 5 percentage point reduction in bcrl severity as measured by interlimb volume, which represented a stronger influence on bcrl severity than any other physical, clinical, or social risk factor . The lack of difference in interlimb arm volume by race may mirror findings from a growing number of studies showing that the effects of race on bcrl onset are adjusted away in multivariable analysis and that the observed differences by race may be explained by other social and physical factors, including bmi . While weight gain after cancer treatment has been shown to be a predictor of bcrl onset and increases in arm swelling are associated with bmi 25 compared to those with bmi <25, higher bmi was not associated with additional interlimb volume differences in this sample of weight - stable women with bmi 25 . Large weight fluctuations after cancer surgery may increase risk of lymphedema onset, but all of the women in the sample had bcrl at the outset and were weight stable at the time of enrollment . For those already classified as overweight or obese, actual bmi may not further exacerbate interlimb volume differences after triggering initial onset . Previous explorations of bcrl development have focused on the same clinical and physical risk factors that predispose certain populations to greater bcrl onset, such as node dissection type and bmi, but have neglected social factors . The present study's results support that physical factors are still valid, as the use of axillary lymph node dissection [1, 36] was significantly associated with an increased interlimb volume difference, and that social factors should have greater consideration . The present analysis is among the first to suggest an influential role for low educational attainment as an important risk factor for increased bcrl severity, and in this case, educational attainment had a stronger association than years since treatment and adherence to bcrl care . Findings of differences by education and not race could not be attributed to the differential distribution of education by race . Few studies have included any extensive social factors, leaving a gap in studies to which we might compare our results . One study of bcrl symptoms adjusting for race and other social factors, which did not show any effect of educational attainment, focused on the presence of bcrl, but not severity . This may suggest that the factors related to onset may be different than those associated with severity and progression . A separate study in hong kong on interlimb arm volume differences did include a range of social factors related to socioeconomic position, including education and type of job . While that study similarly found no associations between work status and bcrl severity, it also did not find that education played a role . This difference in findings might be ascribed to variations in the economic and social returns of educational attainment in hong kong compared with the us . In this paper's findings, the lack of significant difference in interlimb volume when comparing college graduates to only high school degrees may further highlight the variability in economic and social returns at each level of education . In the united states, educational attainment is considered to be a proxy measure for the larger construct of socioeconomic position, with low attainment being highly correlated with low income, high poverty risk, and reduced access to healthcare resources . Potential mediators of bcrl progression among less educated participants remain speculative but candidates include (1) higher levels of hand use due to manual labor job, (2) inflammatory response induced by socioeconomic stressors, (3) greater use of axillary lymph node dissection for low socioeconomic position patients, and (4) low access to resources for bcrl management . However, the first three mechanisms were not supported by our data or previous study data . Hand use has had mixed results and work status did not support differences in interlimb differences . While there were no direct measures of socioeconomic stressors via income or poverty, related household composition measures of number in household and dependent children were not associated with interlimb difference . Receipt of axillary lymph node dissection was also not significantly different by education level . Given our data, the most plausible explanation is that lower educational attainment may be linked to greater interlimb differences through worse access to health resources to manage bcrl . Low - resource women may not have what they need to navigate worsening bcrl, especially in light of other competing demands that they face in day - to - day life . Still, in line with other studies with similar populations, adherence to bcrl care did not eliminate the interlimb volume disparity [45, 46]. This may suggest that adherence to or usage of bcrl care may not be sufficient to overcome disparities in severity . In other words, underlying social determinants must be addressed in order to reduce disparities in bcrl severity . Poor access to healthcare resources may mean that low - education women are more likely to deal with healthcare providers who are uninformed about bcrl . Thus, they may not receive proper health education to prevent arm swelling from becoming more severe . Proposed educational interventions have been focused on educating patients about bcrl specifically but have not modeled patient overall educational attainment [46, 5557]. The present results suggest that focusing on adherence to bcrl care and education about bcrl may not be enough to mitigate the risk of greater severity . While there is no evidence that increasing educational attainment itself can reduce the likelihood of bcrl progression or severity, interventions designed to reduce bcrl arm swelling should specially focus on meeting the needs of low - education patients . Contrary to some studies that have shown that bcrl can dissipate on its own in the first 1824 months after treatment [2, 58], our analysis aligns with studies suggesting that bcrl may get progressively more severe over time [59, 60]. This may support the notion that bcrl is a slowly progressing chronic illness that may worsen with time without active treatment . Adherence to bcrl treatment was associated with higher interlimb volume differences, which may be because women with the most severe bcrl are most likely to be prescribed a treatment regimen and be more likely to adhere to it . Given the potential of increased interlimb volume over time, behavioral interventions could be employed to address progression of arm swelling . Behavioral interventions to reduce arm swelling have focused on the use of physical activity and weight loss to stabilize or lower bcrl severity [1, 5, 22]. Black breast cancer survivors [1317], who are at risk for higher levels of obesity [26, 27] and are unlikely to meet recommended physical activity guidelines but who still need to effectively manage bcrl, may benefit from these interventions . Black women in the general population tend to lose less weight than women from other races during behavioral interventions, and culturally tailoring interventions improves outcomes only modestly [61, 62]. Unfortunately, thus far, studies on culturally tailored interventions have lacked large sample sizes, long - term follow - up, attention controls, theory - driven behavioral change strategies, or objective measures of physical activity . Nor have these prior studies addressed resource disparities . These interventions may continue to struggle to be successful if they continue to be only tailored culturally and do not account for resource differences among study participants . Since less educated black women are more prone to have distinct barriers to physical activity, there needs to be a reevaluation of how to best tailor physical activity and weight loss interventions focused on reducing arm volume due to bcrl . To effectively address bcrl disparities from onset through progression, interventions addressing bcrl onset could be tailored by race, given previous findings about race differences in onset, while interventions addressing arm volume changes after onset could be tailored by resource level, given findings from the present analysis . Tailoring interventions by resource is a novel approach that may be supported by the results of the present analysis . While this study boasts a large community - based sample with broad coverage across a metropolitan area, results may not be generalizable, due to the use of a sample of participants who were healthy enough to enroll in a clinical trial . The study sample may be healthier or better - resourced than the overall population of cancer survivors . Nearly half of the study sample had a college education, compared to 29.2% of women over 35 in the us (us census 2014 estimates), meaning that these women may be more resourced than their peers and that work and household indicators may not represent stressors for the relatively high - resource women who comprised the study population . Since it is not a population - based sample, determining whether or not differences in bcrl severity exist by race or other social factors in the general population is not possible; however, no existing population - based datasets of the general population include information on bcrl severity, making this study the best available sample to assess these relationships . Although perometry is a reliable tool for assessing upper body interlimb volume differences, the use of perometry for measuring interlimb knee and hand volume suggests it may overestimate volume by 2.2 to 7.5% when compared with water volume measurements; however, bias estimates for upper limbs have not been established and this study did not intend to compare differences to water volume - based measures . That said, the average 6.9% interlimb volume difference in this sample exceeds the ctcae criteria of a 5% interlimb difference indicating bcrl . Differences in interlimb volume may be attributable to morphological differences unrelated to bcrl, which is why this study used both perometry measurements and the examination by the certified lymphedema therapist to confirm that differences in interlimb volume were attributable to bcrl severity . This dataset was limited to a few proxy measures of socioeconomic position and resource level and did not have data on income or direct measures of psychosocial stress . Education is an imperfect proxy of resource level or socioeconomic position, which may explain the nonmonotonic relationship between education and bcrl severity that has been observed in other analyses of education, obesity, and health outcomes for population - based adult samples . Nevertheless, educational attainment is preferable to other measures of socioeconomic position because it can be determined for all individuals (since not everyone has an occupation or income), and most educational attainment is normally completed by the early adult years, thus avoiding the potential for causation inherent in using income . Future exploration should include direct measures of social status, socioeconomic position, and psychosocial stress . This study was designed to explore differences by race in interlimb arm volume differences among breast cancer survivors with breast cancer - related lymphedema (bcrl), accounting for social and physical risk factors for bcrl . In this sample of overweight women, neither race nor bmi was associated with greater interlimb volume, but the social factor of education level had the strongest relationship with interlimb differences . These results suggest a greater role of resource than race for bcrl severity and point to a possible approach to reduce disparities in the burden of bcrl . This may stand in contrast to interventions focused on bcrl onset, which may still warrant specific focus on black women . Future studies should further examine the roles of education level and socioeconomic differences with expanded and more precise measures of education and socioeconomic position.
Tumefactive fibroinflammatory lesions (tfls) constitute a rare idiopathic fibrosclerosing disorder . Clinically, tfls mimic a malignant process due to their aggressive clinical behavior and locally destructive nature; however, histologically they are a benign lesion . Depending on the site of occurrence, organ of origin, or predominant pathological features, tfls have variably been termed plasma cell granulomas, xanthogranulomas, or multiple synonyms are due to the rarity of these lesions and a lack of definite clinical criteria for classification . The most common sites of involvement include the head and neck region, especially the sinonasal region and the neck region . Rarely the extremities may be affected . We introduce a case of this rare lesion presenting as a cheek mass with a view to contributing to the existing literature . A 29-year - old woman was admitted with a history of a rapidly increasing swelling on the cheek of 1 month s duration . The patient initially felt a dull aching pain in the right upper back tooth region, which initially responded partially to a course of antibiotics and anti - inflammatory drugs . After 2 days, she noticed swelling inside the mouth, which increased and grew large enough to appear on the cheek . The pain became throbbing and unbearable over the next few days, compelling her to seek medical attention in emergency services . A 32 cm firm, nodular, tender, noncompressible, nonfluctuant, and nonpulsatile swelling was noted on the right cheek . It extended superiorly to the infraorbital margin, medially to the alae of the nose, and laterally to 2 cm anterior to the pre - auricular region with an indistinct inferior margin . Intra - oral examination revealed a firm and nodular swelling present on the right buccal vestibule extending from the 1st premolar to the 2nd molar region anteroposteriorly . Radiography of the paranasal sinuses was reported as hazy along with resorption of the bony walls (figure 2a), hinting at the possibility of right maxillary sinusitis . Ultrasonography of the right cheek swelling revealed an irregular hypoechoic collection, 2.20.5 cm in size, seen in the muscle plain at the site of complaint, abutting the bone in the right cheek along with a hypoechoic lymph node, 2.31.1 cm in size . On contrast - enhanced computed tomography, an ill - defined and minimally enhancing soft - tissue mass, 3.43.12.4 cm in size, was seen involving the right infratemporal fossa and maxillary sinus with associated destruction of its lateral wall without any evidence of calcification / hemorrhage . Anterolaterally, the mass was causing destruction of the anterior root of the zygoma with extension into the premaxillary soft tissues . Superiorly, there was destruction of the floor of the orbit with an infratemporal extension, medially causing blockage of the osteomeatal complex and inferiorly destroying the maxillary bone (figures 2b, c, and d). The possibility of infective etiology of a fungal origin, without ruling out malignancy, was suggested . A) x - ray shows hazy paranasal sinuses with resorption of the bony walls . B), c), and d) contrast - enhanced computed tomography face shows the mass on the right side . Biopsy from the mucosal aspect of the cheek was received with a clinical differential diagnosis of an infective lesion (of probably a fungal etiology), fibroma, and schwannoma . Histopathology of the biopsy revealed fibroadipose and fibrocollagenous tissue, showing dense chronic inflammation along with the formation of lymphoid follicles . Fungal stains were negative, and there was no evidence of granuloma or malignancy . Although the swelling did not increase in size, a significant reduction in the swelling was not achieved and the patient continued to complain of severe pain . Within a week, repeat biopsy, labeled soft tissue right buccal mucosa and right upper posterior teeth region, was submitted with special requisition again to rule out fungal infection . Microscopically, it revealed stratified squamous mucosa, submucosa, and deeper fibromuscular soft tissue enclosing the lobules of the minor salivary glands along with acute on chronic nonspecific inflammation . Intraoperative frozen section showed the destruction of the skeletal muscle, dense collagenization, and mild inflammation along with proliferating plump spindle cells . Multiple biopsies, labelled mass infratemporal space, anterior border of the masseter muscle including the lesion, anterior wall of the right maxillary antrum, and other soft tissues from the zygomatic arch, were received . All the biopsies revealed almost similar histopathological features and consisted of necrotic antral mucosa, proliferating fibrous tissue, and bands of hyalinized collagen with dense chronic lymphoplasmacytic infiltrates with formation of lymphoid follicles and giant cells extending into the subcutaneous fat and septa along with varying stages of granulation tissue (figure 3). No cellular atypia or mitosis, typical or atypical, was seen even on extensive screening . Based on the clinical and radiological findings (short history, large persistent swelling with evidence of bone destruction), special stains including pas, gms, and zn stain (fungus, mycobacterium) were negative . Various differentials of reactive and neoplastic processes, which give similar appearances including nodular fasciitis, proliferative fasciitis inflammatory myofibroblastic tumors (imts), fibromatoses, pseudolymphomas, kaposi sarcomas, fibrosarcomas, and lymphomas were kept . Further extensive screening and immunohistochemical (ihc) stains with a review of literature were employed for a conclusive diagnosis . On ihc, spindle cells were positive for vimentin, sma, with focal positivity for desmin and negative for cytokeratin, s-100, and alk . The lymphoid follicles revealed polyclonal positivity, showing the coexpression of cd3, cd5, and cd20 in different subpopulations of the same follicles (figure 3). Based on these ihc findings, the possibilities of the various differentials kept were excluded . A diagnosis of nodular fasciitis, proliferating fasciitis, and fibromatosis was ruled out due to dense inflammation, lack of a storiform pattern, and cellularity . Lymphoma was ruled out due to the polyclonal nature of the lymphoid cells on ihc . Complete imaging workup, including thoracic and abdominal imaging, was done to rule out other manifestations of idiopathic fibrosing conditions . A 29-year - old woman was admitted with a history of a rapidly increasing swelling on the cheek of 1 month s duration . The patient initially felt a dull aching pain in the right upper back tooth region, which initially responded partially to a course of antibiotics and anti - inflammatory drugs . After 2 days, she noticed swelling inside the mouth, which increased and grew large enough to appear on the cheek . The pain became throbbing and unbearable over the next few days, compelling her to seek medical attention in emergency services . A 32 cm firm, nodular, tender, noncompressible, nonfluctuant, and nonpulsatile swelling was noted on the right cheek . It extended superiorly to the infraorbital margin, medially to the alae of the nose, and laterally to 2 cm anterior to the pre - auricular region with an indistinct inferior margin . Intra - oral examination revealed a firm and nodular swelling present on the right buccal vestibule extending from the 1st premolar to the 2nd molar region anteroposteriorly . Radiography of the paranasal sinuses was reported as hazy along with resorption of the bony walls (figure 2a), hinting at the possibility of right maxillary sinusitis . Ultrasonography of the right cheek swelling revealed an irregular hypoechoic collection, 2.20.5 cm in size, seen in the muscle plain at the site of complaint, abutting the bone in the right cheek along with a hypoechoic lymph node, 2.31.1 cm in size . On contrast - enhanced computed tomography, an ill - defined and minimally enhancing soft - tissue mass, 3.43.12.4 cm in size, was seen involving the right infratemporal fossa and maxillary sinus with associated destruction of its lateral wall without any evidence of calcification / hemorrhage . Anterolaterally, the mass was causing destruction of the anterior root of the zygoma with extension into the premaxillary soft tissues . Superiorly, there was destruction of the floor of the orbit with an infratemporal extension, medially causing blockage of the osteomeatal complex and inferiorly destroying the maxillary bone (figures 2b, c, and d). The possibility of infective etiology of a fungal origin, without ruling out malignancy, was suggested . A) x - ray shows hazy paranasal sinuses with resorption of the bony walls . B), c), and d) contrast - enhanced computed tomography face shows the mass on the right side . Biopsy from the mucosal aspect of the cheek was received with a clinical differential diagnosis of an infective lesion (of probably a fungal etiology), fibroma, and schwannoma . Histopathology of the biopsy revealed fibroadipose and fibrocollagenous tissue, showing dense chronic inflammation along with the formation of lymphoid follicles . Fungal stains were negative, and there was no evidence of granuloma or malignancy . Although the swelling did not increase in size, a significant reduction in the swelling was not achieved and the patient continued to complain of severe pain . Within a week, repeat biopsy, labeled soft tissue right buccal mucosa and right upper posterior teeth region, was submitted with special requisition again to rule out fungal infection . Microscopically, it revealed stratified squamous mucosa, submucosa, and deeper fibromuscular soft tissue enclosing the lobules of the minor salivary glands along with acute on chronic nonspecific inflammation . Intraoperative frozen section showed the destruction of the skeletal muscle, dense collagenization, and mild inflammation along with proliferating plump spindle cells . Soft tissues sent for direct immunofluorescence were negative for immune deposits . Multiple biopsies, labelled mass infratemporal space, anterior border of the masseter muscle including the lesion, anterior wall of the right maxillary antrum, and other soft tissues from the zygomatic arch, were received . All the biopsies revealed almost similar histopathological features and consisted of necrotic antral mucosa, proliferating fibrous tissue, and bands of hyalinized collagen with dense chronic lymphoplasmacytic infiltrates with formation of lymphoid follicles and giant cells extending into the subcutaneous fat and septa along with varying stages of granulation tissue (figure 3). No cellular atypia or mitosis, typical or atypical, was seen even on extensive screening . Based on the clinical and radiological findings (short history, large persistent swelling with evidence of bone destruction), special stains including pas, gms, and zn stain (fungus, mycobacterium) were negative . Various differentials of reactive and neoplastic processes, which give similar appearances including nodular fasciitis, proliferative fasciitis inflammatory myofibroblastic tumors (imts), fibromatoses, pseudolymphomas, kaposi sarcomas, fibrosarcomas, and lymphomas were kept . Further extensive screening and immunohistochemical (ihc) stains with a review of literature were employed for a conclusive diagnosis . On ihc, spindle cells were positive for vimentin, sma, with focal positivity for desmin and negative for cytokeratin, s-100, and alk . The lymphoid follicles revealed polyclonal positivity, showing the coexpression of cd3, cd5, and cd20 in different subpopulations of the same follicles (figure 3). Based on these ihc findings, the possibilities of the various differentials kept were excluded . A diagnosis of nodular fasciitis, proliferating fasciitis, and fibromatosis was ruled out due to dense inflammation, lack of a storiform pattern, and cellularity . Lymphoma was ruled out due to the polyclonal nature of the lymphoid cells on ihc . Complete imaging workup, including thoracic and abdominal imaging, was done to rule out other manifestations of idiopathic fibrosing conditions . The term tfl was first introduced by wold and weil and in 1983 to describe lesions of the head and neck that clinically simulate a malignant process in that they are locally invasive but histologically composed of mature sclerosing fibrous lesions interspersed with normal - appearing fibroblasts and lymphocytes . Coexisting fibrosclerotic processes have been seen in 20% of cases including retroperitoneal fibrosis, sclerosing cholangitis, sclerosing mediastinal fibrosis, and orbital pseudotumors . In medical literature, tfls have been described under inflammatory pseudotumors . To date, approximately only 35 cases have been reported in the literature . A wide age group is involved ranging from 10 to 74 years with a slight male predominance . The possible mechanism considered is an exaggerated immunological host tissue response to unidentified infectious agents, adjacent necrotic tissues, foreign bodies, or neoplasms or an autoimmune reaction to a previous viral infection . Smoking and chronic irritation by cocaine abuse have also been suggested as triggering factors for tfls . It is, however, on histopathological examination that the diagnosis becomes clear and malignancy is ruled out . Grossly, these lesions are firm and tannish - to - gray white and vary from being circumscribed to locally invasive . The histopathological features are of a benign lesion consisting of an admixture of fibrous tissue, collagen, and inflammatory cells associated with a giant cell reaction . Tfls can invade the adjacent soft tissues, muscles, and neurovascular structures and can erode the underlying bone with the involvement of the meninges and the brain . Hence, any mass - forming lesion with any of these features should raise suspicion of malignancy . Our patient also presented with similar clinical, radiological, and histological findings . Even on extensive sampling, tfl - like lesions should be differentiated from more commonly encountered lesions of the head and neck like fibromatoses, nodular fasciitis, malignant fibrous histiocytomas, and fibrosarcomas . Nodular fasciitis, seen in the head and neck, is a pseudosarcomatous self - limiting process which shows a prominent whorled or feathery cellular pattern lacking inflammatory infiltrates . Although tfls are infiltrative, they lack the cellularity, cellular atypia, and mitotic activity seen in malignant fibrous histiocytomas and fibrosarcomas . A differential diagnosis of tfls also includes imts, which have been categorized under inflammatory pseudotumors . Imts mainly occur in the lung, but they also have been seen in the head and neck area . Additionally, 50% of imts are alk positive . However, in our patient, this entity was ruled out because alk was negative . The treatment options include surgery, steroids, and radiation therapy either alone or in combination . Some studies have shown steroids to be a better first - line treatment option, which may be followed by surgery and/or radiotherapy . Surgery is successful in surgically accessible sites, while radiation therapy is reserved for patients who do not respond to steroids or when the tumor extent limits surgical excision . Our patient was put on steroids, followed by surgical excision, but she reported back after 6 months with similar complaints . Hence, these patients should be kept on regular follow - up and be assessed bearing in mind that tfls may involve multiple body sites . We introduced a rare case of tfl presenting as a cheek mass, which was biopsied for suspicion of malignancy because of its aggressive clinical presentation . Reaching such lesions should be kept a possibility while dealing with clinically aggressive, invasive lesions, especially in the head and neck region, and treated appropriately.
Cigarette smoking is one of the preventable causes of deaths and diseases, responsible for a tenth of adult mortality rate around the world . It is predicted that by 2030, smoking will be the cause of 70% of annual mortality rate globally in developing countries . The prevalence of smoking among male teens of 1315 years of age has been 17% in eastern mediterranean in the period of 20052010 . According to who data, the latest statistics on iran indicate that the daily consumption of tobacco has been 20.4% among males . Scientific findings show that smoking is harmful not only for smokers, but also for individuals around smokers indirectly . It is believed that the transition period from adolescence to early adulthood brings significant changes in behavior and psychology of the individuals . Taking decisions on a healthy lifestyle is the basis for personality building of the individual . Given, the many studies have shown that it is a strong predicting factor of smoking in adulthood . Initiation of cigarette smoking in younger ages will be accompanied with difficulties to quit smoking in adult life . Several investigations indicate that the prevalence of cigarette smoking in both boys and girls is increasing . In other words, the age of initiation of cigarette smoking mohtasham amiri and who report showed that the average age to initiate cigarette smoking was at 13 years . Other studies indicated that the prevalence of cigarette smoking among adolescents was related to a smoker among family members, friends, the lack of knowledge about consequences of cigarette smoking, socioeconomic status of the parents, and school conditions . Therefore, researchers in industrial countries have emphasized upon prevention of smoking in young people, and programs have been designed and implemented to achieve this objective . These programs aimed to improve students knowledge, change in their attitudes, and behavior with a level of success . Thus, any program aimed for training resistance skills against drug abuse, and cigarette smoking should be implemented with an emphasis upon theories of behavioral change and based on effective educational programs . Extended parallel process model (eppm) provides a major theoretical framework of change in behavior . Because adolescents can be predisposed to engage in high - risk behaviors therefore, this is an attempt to apply the eppm for designing effective programs to reduce high - risk behaviors such as cigarette smoking [figure 1]. The extended parallel process model . Adapted from witte (1994) according to the eppm, if people believe that they are highly exposed for suffering diseases or health risks, they will be more motivated to confront with risks and diseases, and then the assessment begins for the efficacy of recommended strategies, and the outcome of efficacy of recommended strategies is assessed to counter risks . In fact, fear of threat will cause people to counter with health risks by adopting strategies . Consequently, it is possible the change of attitude, intention, and behavior will increase . Wong and capella believed that motivation of health - risk message regarding cigarette smoking according to eppm has been effective in nonsmoking programs among individuals . In such a moment, special measures (response efficacy of the message) to overcome the threats come to minds of the individuals . A person who has received a message should believe that he or she could act according to recommended process (high self - efficacy). Thus, this study was designed to determine the effect of educational programs based on parallel process model for prevention of cigarette smoking among middle school students in shiraz city . It is expected that this study provides the appropriate solution to prevent cigarette smoking among adolescents and enhances their health promotion and community by providing useful results . This study was interventional quasi - experimental research that was carried out among male students of middle schools in shiraz in the period 20092010 . Through simple random sampling, two schools were selected . Finally, from each school, four classes were randomly selected . According to the sample size formula, we randomly selected 120 students for the experimental group and 120 students for the control group . Approximately, 10% of participants were excluded from the study because of the absence of educational sessions as well as unwillingness to continue in the study . Then, a questionnaire according to eppm was modified based on witte's eppm scale for cigarette smoking and its consequences . The questionnaire were designed with 19 items about demographic and background information such as age, having father who had experiences with smoking (yes / no), having friends who smoked (yes / no), insistence to smoke by friends (yes / no), age of the first - time smoking (10 years; 11 years; 12 years; and 13 years), most important reason for smoking (urgent need, to alleviate pain, having smoker friends, adventurism, and feeling happy), and also eppm variables were designed to measure perceived susceptibility with six items (e.g. I may smoke like some of the young people in the future), perceived severity with six items (e.g. I believe that smoking causes lung cancer), perceived response efficacy with five items (e.g. I protect myself against smoking with using the resistance skills), and perceived self - efficacy with six items (e.g. I believe that i cannot resist pressure from my friends). Preventive behavior with six items (yes / no); in the last 2 months, when you exposed to smoke, have you attempted to get away from it? (yes / no); in the last 2 months, have you ever tried that your family acquired more information about consequences of cigarette smoking, and ways to prevent it? (yes / no); in the last 2 months, do you have to talk about the consequences of cigarette smoking, and ways to prevent it for smoker? (family, peers and friends, others); when your friends and peers offer you a cigarette, what is your answer? (i smoke cigarette, i m not saying against them offer and immediately leave there, and i stay with them, but i m not smoking). To increase self - efficacy for ability to say no and ability to resist peer pressure to cigarette smoking was used the role - playing method . Each item of constructs of eppm was measured by likert scale having five descriptors of strongly agrees to strongly disagree . To measure the reliability and validity of the questionnaire, a pilot study was conducted on 35 students . Estimated reliability coefficients for each eppm variables were as follows: perceived susceptibility (= 0.75), perceived severity (= 0.65), perceived response efficacy (= 0.70), and perceived self - efficacy in applying skills of resistance against smoking (= 0.77), indicating internal consistency . To measure the validity, after pretest and determination of a critical point as to which stages of threat control process (risk control or fear control), the required content was developed for the target group . An educational program was implemented as the following: in a school chosen as the experimental group, three types of posters with contents of cigarette, its risks on physical health, and skills to resist (say no to cigarette smoking) were placed . Then, five lectures and discussion sessions were held within displaying a video clip that each lasted 40 min . The educational sessions topics are as follows: first session: having a discussion about definition and physiology of addiction, second session: to debate about knowledge of smoking, and discussion about influencing factors on initiation of smoking, third session: identifying and understanding about the complications and consequences of cigarette smoking, and benefits of quitting smoking, fourth session: ability to detection of high - risk situations and problem - solving skills . Fifth session: ability to say no and ability to resist peer pressure to cigarette smoking . The video clip included physical, psychological, and social effects and consequences of cigarette smoking . In the end of each session, a question was asked as scenario and home assignment aimed at active learning and better preparation by students in the next session . If any student who did not do homework, questions were asked them . A handbook entitled guide to prevention of smoking in adolescents was developed and distributed among the participants . Furthermore, in the research, to enhance the effect of active learning and educational intervention, the peer education method was applied through choosing the most popular student and teacher in each class by direct voting by students . Due to time constraints and being close to the program of examinations in the target group, 2 months after the intervention the data were analyzed with spss 16 using, mcnamara, independent t - test, and paired t - test with 0.05 significance level . As shown in table 1, more than one - third of students experienced an initial cigarette smoking at 13 years old (43.8%). Further, less than one - third of participants in the experimental group and more than one - quarter in the control group reported that their father smoked (30.8% and 26.7% respectively). The results showed that less than one - fifth of students stated that their friends experienced cigarette smoking (9.2%). In addition, less than one - fifth of participants reported that their friends insisted that they smoke (5%). Less than one - third of students reported curiosity as their most important reason for cigarette smoking (31.2%). Frequency and relative frequency distribution of demographic and background variables of participants in the control and experimental groups table 2 shows that there was no significant difference in background and demographic variables between the experimental and control groups . To compare the means of scores for eppm constructs and preventive behavior components, independent and paired t - tests were carried out on the experimental and control groups before and after the educational intervention . Table 2 displays that before the educational program, there was no significant difference between the experimental and control groups in scores of eppm constructs and preventive behavior, except for the scores of perceived self - efficacy (p = 0.048). The result indicated that there was a significant difference between the mean of scores of perceived susceptibility, perceived severity, perceived response efficacy, perceived self - efficacy, and preventive behavior on cigarette smoking before and after educational intervention in the experimental group (p <0.001); whereas, there was no significant difference between the same variables before and after the educational intervention in the control group (p> 0.05). Comparison of mean of scores for extended parallel process model constructs and preventive behavior, before and after intervention in the experimental and control groups the results of this study showed that educational interventions based on the eppm can increase preventive behaviors of cigarette smoking among students . The extended nature of problems arising from smoking and drug consumption and failure of approaches taken to prevent and to treat are two strong motivating factors to develop and apply new preventive approaches . In this study, after the educational intervention, the mean score of perceived susceptibility declined significantly in the experimental group . This result is consistent with similar findings of other studies, so that witte maintained that if people do not feel at - risk for a threat (low perceived susceptibility), or do not feel the threat to be significant (low perceived severity), they simply will ignore information about the threat . Hong concluded that when individuals knew more information about ways of coping with a health threat, their perceived susceptibility toward the threat reduced . Indicated that message themes about cigarette smoking increased health - risk severity perceptions but were undermined by low perceived vulnerability . Although students believed the serious complications and consequences of smoking, on the other hand, perceived severity scores were high; but these students did not perceive that they were at high risk for cigarette smoking . Some studies have reported that people tend to believe they are less likely to experience negative events and more likely to experience positive events than other people . This phenomenon has been named optimistic bias . Adolescents may engage in more risk - related behaviors, such as the consumption of alcohol and drugs, cigarette smoking, or unprotected sexual intercourse for two major reasons . First, adolescents may have feelings of invulnerability to harm, thus promoting risky behavior . Second, adolescents sometimes do not perceive their actions as unsafe and engage in risky behaviors out of ignorance of the consequences . Both a sense of invulnerability and low perceived susceptibility to danger are instances of optimistic bias . In both instances, individuals perceive that they are less likely than others to be afflicted with poor health outcomes, such as cigarette smoking . Perhaps because of low perceived susceptibility, high percentage of participants experienced an initial cigarette smoking at 13 years old . And mohtasham amiri revealed that the average age of initial cigarette smoking was 13 years . Lack of perceived susceptibility to smoking among these participants may be due to a lack of knowledge about the role and the effect of peer pressure . This result suggests that health educators may need to emphasize perceived susceptibility in cigarette smoking prevention programs . The increased perceived severity in the experimental group demonstrated the effectiveness of messages with the content of fear appeals . Revealed that education programs have a significant effect on increasing the perceived severity after interventions . In addition, rahnavard et al . Indicated the effect of health education on increasing the perceived severity score after educational intervention . For the first time, rogers provided a definition of perceived threat and efficiency as important variables in his studies . In eppm, the perceived threat consisted of two components; the perceived susceptibility and perceived severity from the threat . Sharifi - rad et al . Also revealed that the mean score of the perceived threat has significantly increased after educational intervention . Further, cho and witte and hong concluded that perceived threat on health behavior should be somewhat high so that individuals feel at risk and perceive the seriousness of the threat . The increased perceived response efficacy score in the experimental group in our study probably reflects the effect of messages and educational programs according to resistance skills or rejecting persistence of friends and peer groups, and problem - solving skills . Peer pressure and invitation for cigarette smoking and other drugs by friends have been one of the most risk factors for the experience of smoking . Cigarette smoking among friends and members of the family, especially the parents of smoking, can be a major factor in the tendency toward smoking in adolescents . Lorenzo - blanco et al ., schuck et al ., and rafiee et al . Indicated that having smoker peers or parents had been the most important motivating factors to smoke among adolescents . Fujimoto et al . And zadeh et al . Showed that friends were an important factor in the initiation of smoking . Offering and insistence on smoking by friends may be stimulus factor to start cigarette smoking in adolescents . Showed the most common situations where male students smoked, when they were accompanied by their friends . Individuals are influenced by peer pressure on early teens; therefore, educational programs for resistance skills, especially say no to insistence on smoking, by friends played an important role in prevention of cigarette smoking and drug abuse . Several studies have emphasized on confronting peer pressures in prevention of drug abuse and smoking . Several studies indicated that according to eppm, individuals evaluated the efficacy of the recommended response so that they determine the easy, feasible, and effective recommended response . When individuals believe that messages are useful and also they are able to actually use them, the perceived response efficacy would increase consequently . The findings of moscato et al . Indicated that perceived response efficacy and perceived threat were significantly correlated to drinking alcohol . Other studies reported that perceived response efficacy and their effect on change in behavior increased after educational interventions . There was a significant difference for perceived self - efficacy with using resistance skills against cigarette smoking between the experimental and control group before educational intervention . It seems that this difference would be accounted for by the very nature of youth in protecting or adventuresome behaviors . However, after implementing interventions, the self - efficacy score of the experimental group displayed a significant increase compared to that of the control group . In this respect, reported that the mean scores of perceived self - efficacy were significantly high after the interventional programs . These findings indicated that training life skills (resistance against peer pressures and problem solving skills) with emphasis upon perceived self - efficacy would provide a giant leap forward in prevention and control of smoking among adolescents and adults . The improvement of preventive behavior of smoking in the experimental group after education was indicative of the effect of eppm components in prevention of smoking . On the basis of these results, it is necessary to emphasize perceived susceptibility, perceived response efficacy, and self - efficacy in smoking resistance programs . Thus, eppm could help improve the efficiency of fear appeal messages for prevention of cigarette smoking . First, adolescents who have not entered school for any reason were not considered for this study . Educational programs based on eppm increased the perceived threat and perceived efficacy for the preventive behavior of smoking . Thus, increasing the perceived threat causes an increase in susceptibility and severity of threat in adolescents . On the other hand, educating skills to resist peer pressure based on the perceived response efficacy of messages and strategies can be effective in the prevention of smoking . Therefore, planning for school - based interventions should be developed with emphasis on the eppm variables, and programs for prevention of smoking should be started in younger adolescents.
The idiom of knowledge being power is applicable in a vast number of fields, yet rarely more so than in the context of academia, where the discussion of existing knowledge and the development and refinement of ideas forms the basis of academic work . The equally well - known concept of a publish or perish culture in academic life stems directly from the perception that progress can only be made by contributing to, sharing and competing with the knowledge of peers . Within the context of limited access to information and barriers to publishing, this reality adds another level to existing north - south inequalities; the ability of researchers from resource - poor countries to fully participate in global academia is limited by the availability of information, expertise, equipment and financial resources . Less than 2% of publications between 1992 and 2001 referenced within the science citation index and the social sciences citation index originated in low - income countries, and only one - fifth of these were from sub - saharan africa (1). Capitalising on academia's need to publish, publishers have a seemingly endless supply of authors and, to an extent, readers . However, the academic publishing industry faces increasing risks from reduced library spending, demands to digitalise content and dissent from authors, libraries and academics regarding increasing subscription costs, which has led to falling revenue in recent years (2, 3). This has coincided with a demand for open - access journals, with subscription fees increasingly being replaced by alternative financing mechanisms, commonly an author - pays model (2, 48). Under the author - pays model, journal production fees are typically met by the author's employer or research funder and rarely by the individual researcher themselves; however, in resource - poor settings this can mean that individual research funds may be cut to compensate for publication charges (9). Nevertheless, journals based on the author - pays model typically offer fee waiver or subsidy schemes in cases of financial hardship or for authors from developing countries . Perceptible efforts have been made to address the challenges faced by academics in less - developed regions by european and american multinational publishing firms that dominate global academic publishing . Most notably in the field of health, progress in improving access to information in low - income countries, facilitated by growing internet access, has improved the flow of global health information . Additional efforts have been made to improve access to literature through philanthropic initiatives offering developing countries free or greatly subsidised access to large collections of otherwise subscription - only literature (10). Meanwhile, the international network for the availability of scientific publications (inasp) operates the program for the enhancement of research information (peri), which strengthens research capacities in developing countries by reinforcing local efforts to produce, disseminate and gain access to scholarly information and knowledge (11). Other initiatives include hinari, authoraid, africa journals online, fame, bireme & scielo, each of which is contributing to the growing movement towards greater access to information and support for local journal publishing in resource - poor settings (10, 1216). Together, these initiatives have, at least in part, been responsible for a rapid growth in the number of article downloads over recent years, illustrating growing awareness and uptake of such programmes (17). Nevertheless, the flow remains unbalanced transfer of health information from south to north, and perhaps more importantly from south to south, is still grossly limited (18, 19). Northern - generated information has been criticised for failing to fully reflect the information and market needs of a southern readership, and open - access schemes intended to improve global information provision may perpetuate dependency of developing - nation researchers on foreign aid and charitable subsidies . Instead of promoting and publicising indigenous research, the content of much literature, open access or otherwise, can be of limited relevance to developing countries and there exists an imbalance of research in favour of northern - produced or northern - led research (20). Whilst there is much literature on the potential technical fixes that might narrow the information gap, very few attempts have been made to ask health researchers working in resource - poor settings for their views and experiences of such challenges . One attempt, conducted by the lancet in 2000, surveyed international editorial advisors (comprising senior academics with obvious insights into academic publishing) and describes some of the challenges faced by researchers, concluding that information flow, research, publication capacities and indeed health are intimately linked (21). By surveying end - users in 2005 from settings where access to literature and to publication is potentially limited, the present authors gathered the views and experiences of those at the early stages of their academic careers (masters- and phd - level researchers in public health) in order to capture some of the experiences of a new generation of computer literate and internet - savvy practitioners and researchers . Taking advantage of international links within the ume international school of public health, sweden, in 2005 study participants were recruited using arbitrary convenience sampling methods . Inclusion criteria were residence in a resource - poor setting and participation in health - related research activities . Given the geographically dispersed nature of the sample and in order to maximise response, a mixed - methods approach (drop - and - collect self - completion surveys; email self - completion surveys; face - to - face structured interviews) was used to gather information on participants views and experiences of access and contribution to medical literature (22). The use of interviews as well as self - completion questionnaires provided an opportunity for the researchers to develop a first - hand understanding of context as well as a chance to probe further in open - ended responses . Detailed descriptions of the methods and study populations are described in detail elsewhere (23) (attached as a separate file to this paper - see supplementary files under reading tools online). Completed questionnaires and interview schedules were analysed using simple frequency analysis and qualitative thematic analysis, and attempts were made to make some general inferences in total, 49 individuals from asia, africa and south america were contacted and asked about their views and experiences (39 using self - completion questionnaires and 10 for interview). Follow - up contact and reminder letters were sent to non - respondents, after which a total of 23 individuals responded (46.9%; 16 males and 7 females): 15 from africa (ethiopia, kenya, malawi, tanzania and uganda); 7 from asia (bangladesh, indonesia and vietnam); and 1 from latin america (nicaragua). Some gender bias was indicated in the response rate, with approximately 80% response from males compared to 25% response from females . Respondents from all settings described more frequent use of periodicals than reference text books, reflecting a widespread appreciation of the more timely content on specialised subjects that journals offer (24, 25). This desire for up - to - date content was also illustrated in respondents preference for online journals over print . Seventy percent of respondents described online journal access as their preferred method, citing reasons such as more easily searchable content, remote access and the ability to save and print relevant articles . Importantly, however, almost one - third of respondents all from africa described a preference for printed, hard - copy periodicals . More than half of the respondents (n=12, 52%) expressed dissatisfaction with their access to print and online journals, directly relating this to inadequate university and research budgets . According to one respondent, providing access to relevant journals was simply not a priority for their employer . Most recent headings could be up to five years out of date and, given the desperate need for any information, there was a tendency for any material to be displayed, including promotional pamphlets in a variety of languages . Almost all respondents (n=22, 96%) stated that they were expected to publish their own research papers in peer - reviewed journals as part of their work, yet more than half (n=12, 52%) had yet to submit any work . Of the individuals who had submitted work to a scientific or medical journal, more than one - fifth had their submissions rejected . When asked about their motivation for selecting a particular journal when submitting a manuscript, the most common reason given was the journal's reputation, although the opportunity to reach an international audience was also cited . More than half of the individuals who had published or submitted articles stated that they had problems writing the articles in english and were required to edit and re - submit their work having reviewed language errors, often at an additional cost as external language editing was sometimes required . Additional barriers highlighted were: perceptions that their work was not deemed relevant for an international journal; inability to compete with many submissions within the same field; lack of experience in preparing manuscripts; unreasonably high expectations from editors and reviewers; lack of a professional reputation within the academic community; and insufficient access to existing information on the research subject . Thirteen respondents (56%) were opposed to the author - pays model of publishing . Seventeen respondents (78%) stated that they would be unwilling or unable to pay a fee to publish their work, although 4 of these individuals stated that they would be willing to publish in an author - pays journal if their employer or funder paid the fees . Respondents from all settings described more frequent use of periodicals than reference text books, reflecting a widespread appreciation of the more timely content on specialised subjects that journals offer (24, 25). This desire for up - to - date content was also illustrated in respondents preference for online journals over print . Seventy percent of respondents described online journal access as their preferred method, citing reasons such as more easily searchable content, remote access and the ability to save and print relevant articles . Importantly, however, almost one - third of respondents all from africa described a preference for printed, hard - copy periodicals . More than half of the respondents (n=12, 52%) expressed dissatisfaction with their access to print and online journals, directly relating this to inadequate university and research budgets . According to one respondent, providing access to relevant journals was simply not a priority for their employer . Most recent headings could be up to five years out of date and, given the desperate need for any information, there was a tendency for any material to be displayed, including promotional pamphlets in a variety of languages . Almost all respondents (n=22, 96%) stated that they were expected to publish their own research papers in peer - reviewed journals as part of their work, yet more than half (n=12, 52%) had yet to submit any work . Of the individuals who had submitted work to a scientific or medical journal, more than one - fifth had their submissions rejected . When asked about their motivation for selecting a particular journal when submitting a manuscript, the most common reason given was the journal's reputation, although the opportunity to reach an international audience was also cited . More than half of the individuals who had published or submitted articles stated that they had problems writing the articles in english and were required to edit and re - submit their work having reviewed language errors, often at an additional cost as external language editing was sometimes required . Additional barriers highlighted were: perceptions that their work was not deemed relevant for an international journal; inability to compete with many submissions within the same field; lack of experience in preparing manuscripts; unreasonably high expectations from editors and reviewers; lack of a professional reputation within the academic community; and insufficient access to existing information on the research subject . Thirteen respondents (56%) were opposed to the author - pays model of publishing . Seventeen respondents (78%) stated that they would be unwilling or unable to pay a fee to publish their work, although 4 of these individuals stated that they would be willing to publish in an author - pays journal if their employer or funder paid the fees . This small series of case studies reflects recognition among study respondents of their need to use and contribute to global knowledge in order to advance professionally . However, according to individuals surveyed, opportunities for information exchange is hindered by a persistent lack of access to up - to - date information and the skill set needed for publication . The focus on researchers at the early stages of their academic careers is a particular strength of this study . Although no claims of representativity can be made based on the methods employed in this study, expressed views were relatively consistent between respondents, both within and between settings . This implies that personal experiences did not differ greatly between settings, and results may be of relevance to wider populations of health researchers in resource - poor contexts . The almost unanimous preference for printed over online articles among respondents from africa compared to those from other settings is striking . This difference perhaps reflects the weaker penetration and capacity of information technology systems in africa compared to asia and latin america, as well as the ease with which researchers from different settings use computers and internet searches . This preference merits further investigation and, if found to be representative of wider views in africa, warrants serious consideration by publishers should they decide to migrate to online - only platforms . Several respondents described the unavailability of up - to - date literature as a primary challenge . Institutional libraries in the poorest parts of the world often rely on donations of printed periodicals rather than direct subscription, resulting in second - hand, out - dated titles, irrelevant publications and inappropriate foreign language materials, and this appeared to be the case in the current study . Therefore longstanding concerns that donor programmes intended to improve access to resources in low - income countries may actually supply irrelevant materials do not seem to be resolved (18, 21, 26, 27). The impact of new open - access initiatives on this issue will be an important outcome measure of their overall effectiveness . Contrary to the findings from south asia in horton's study (21), whereby it was implied that publication might be perceived as a low priority for career progress, in the current study the reported ambition to publish reflects respondents recognition of publication as a high priority for personal and professional development . Whether this is an artefact caused by sampling a population associated with an academic institution where publication is highly prioritised (ume university), or a reflection of wider professional development ambitions in resource - poor settings, is unknown the fact that the majority of respondents cited international journals as a target for their work further suggests an acute awareness and desire to participate in global health debates . Targeting such journals is likely to enhance real or perceived pressures to publish work in english . Whilst this will undoubtedly increase the accessibility of one's work, it also presents further barriers that must be overcome by researchers for whom english is a foreign language . As reported by several of the study respondents, the necessary skills and training to write and submit suitable academic publications in english is lacking . Current open - access and aid - based initiatives are invaluable and have undoubtedly improved access to information . However, based on views expressed by study respondents, the author - pays model of open access appears to fall short of successfully overcoming unidirectional information flow . The fact that more than three - quarters of respondents stated that they would be unwilling or unable to pay author fees suggests that contributions from southern academics could remain limited . This resistance to the author - pays model is similar to findings from a study of published academics from more developed regions (28). Further investigation into the knowledge and attitudes of academics from resource - poor settings in relation to open - access and author - pays models is important in order to see whether reluctance or inability to pay to publish is based on a matter of principle, a lack of awareness of fee - waiver schemes or a poor understanding of open - access concepts . Whatever the cause, however, there is a danger that this unwillingness or inability to pay to publish may perpetuate the imbalance of a north to south information flow, in that academics in resource - poor countries are still not contributing to academic literature and are most likely to only access those journals that are open access rather than a broad and therefore balanced simultaneously addressing biases in information flow whilst building capacity for research and publication are key to international development in general and to health in particular (21). Building upon this series of case studies, there is a need for more in - depth, systematic research into the issues of access to publication, conducted on larger samples . Nevertheless, a powerful message from the preliminary findings presented here is a need for more direct editorial support, coupled with efforts to improve access to academic literature, in order to open up bidirectional information flow . More innovative thinking around the entire publication process is therefore needed . Along the lines of authoraid and inasp (11, 13), models offering author mentoring schemes (scientific as well as editorial) combined with low publication fees and open access platforms whilst maintaining scientific rigour are likely to play a significant role in addressing the gross inequality between north and south . Publisher - led market research into the needs and desires of end - users and contributors from resource - poor settings may guide current developments in academic publishing in the right direction . Given that they are unlikely to be lucrative business ventures (at the outset at least), the new commercial pressures may be quite different from those that contributed to the evolution of northern - led academic publishing . Whether this results in more equitable distribution and production of academic literature will be interesting to see . Meanwhile, as new information highways are opened, experienced editors and authors from all settings have vital roles to play in supporting them and creating international solidarity . All must assume responsibility for directing the flow of global health information in both directions and this should be seen as a vital part of effective scientific communication, enabling effective global public health action.
Vitamin d deficiency is a common and serious problem worldwide, and this problem has an unusually high prevalence in sunny countries, such as those in the middle east (1, 2). Vitamin d is a steroid hormone that helps facilitate the metabolism of minerals, especially calcium, and it is essential for strong bones . This vitamin possesses receptors in most organs of the body, including the pancreas, stomach, genitals, brain, and skin (35). Severe vitamin d deficiency can result in several disorders, including the mineralization of bones, rickets in children and adults, along with osteoporosis and pathologic fractures in adults (68). In addition to being obtained through skin synthesis, vitamin d can be absorbed through sunlight, which has the major role in supplying the required vitamin d. thus, if this mechanism provides sufficient vitamin d, the need to acquire it through one s diet would be alleviated . Different factors affect the skin s synthesis of vitamin d due to exposure to sunlight, such as the distance from the earth to the sun in different seasons, air pollution, the climate in the area, exposure to sunlight, and the type of clothing (911). The results of various studies have shown that about one billion people worldwide have severe or medium vitamin d deficiency (7, 1214). With a half - life of two to three weeks, total serum 25(oh) vitamin d levels thus, measuring the levels of 25-(oh) vitamin d could assist in diagnosing vitamin d deficiencies (1517). In a study conducted in yazd, severe vitamin d deficiency was reported in 53.7% of the participants, with 23.2% and 14.6% having medium and mild deficiencies, respectively (18). In another study conducted in tehran in 2004, the prevalence of severe, medium, and mild vitamin d deficiency was reported as 9.5, 57.6 and 14.2% respectively (19). Another study of vitamin d deficiency was conducted in the urban populations of tehran, tabriz, bushehr, shiraz, and mashhad among three age groups, i.e., people younger than 50, people in the age range of 50 to 60, and people older than 60 . The results of the study indicated that, in the three age groups, medium to severe vitamin d deficiencies existed in 47.2, 45.7, and 44.2% of the males, respectively, and in 54.2, 41.2, and 37.5% of the females, respectively . According to the results of this study, the highest prevalence of medium to severe vitamin d deficiency was in males in tehran, and the lowest prevalence was in females and males in mashhad and bushehr (20). Previous studies in iran have shown significant vitamin d deficiencies in different groups . However, with regard to the high prevalence of vitamin d deficiency in iran, it is essential to recognize the factors that affect this deficiency and to identify suitable strategies to overcome this problem . To that end, this study was conducted to investigate vitamin d levels and their relationship with the lipid profiles of patients who were referred to clinical laboratories in different districts of mashhad . The results of this study could provide useful information for planning and conducting additional studies vitamin d deficiency in iran . This retrospective cross - sectional study was conducted in 2015, and it included 1,110 patients who were referred to 10 laboratories in mashhad for diagnoses, i.e., two laboratories in jihad daneshgahi and eight others in different districts . Laboratories were chosen that were dispersed throughout the city, such that a laboratory was selected in each of the 10 districts of mashhad . The sample size consisted of all patients who were referred to laboratories for vitamin d and other tests for blood biochemical factors . By obtaining an introduction letter from payame noor university of mashhad (punm), the authors were referred to the laboratories to implement the plan . To collect the data, the required coordination was arranged by the treatment deputy of mashhad university of medical sciences and the head of jihad daneshgahi . Then, the lab officials were asked to present details of the patients (except their names) and the results of their tests . Specialists in laboratory sciences interpreted the results of the laboratory tests, and the authors assessed and analyzed the results of their interpretations . In this study, serum vitamin d levels of the patients were classified in four categories, i.e., vitamin d deficiency, insufficient amount of vitamin d, sufficient amount of vitamin d, and toxic amount of vitamin d (19 and 21), as defined below: vitamin d level <20 ng / ml: vitamin d deficiency vitamin d level = 2030 ng / ml: insufficient amount of vitamin d vitamin d level = 30100 ng / ml: sufficient amount of vitamin d vitamin d level> 100 ng / ml: toxic amount of vitamin d the raw data were entered into spss 13 software (spss inc . Chicago, illinois, usa), and they were analyzed using the spearman rank correlation, anova, and t - test . The deputy of education of the university issued an introduction letter that allowed the researchers to enter the study area . In this study, it was not necessary to mention patients names, and their details were extracted and used generally . This retrospective cross - sectional study was conducted in 2015, and it included 1,110 patients who were referred to 10 laboratories in mashhad for diagnoses, i.e., two laboratories in jihad daneshgahi and eight others in different districts . Laboratories were chosen that were dispersed throughout the city, such that a laboratory was selected in each of the 10 districts of mashhad . The sample size consisted of all patients who were referred to laboratories for vitamin d and other tests for blood biochemical factors . By obtaining an introduction letter from payame noor university of mashhad (punm), the authors were referred to the laboratories to implement the plan . To collect the data, the required coordination was arranged by the treatment deputy of mashhad university of medical sciences and the head of jihad daneshgahi . Then, the lab officials were asked to present details of the patients (except their names) and the results of their tests . Specialists in laboratory sciences interpreted the results of the laboratory tests, and the authors assessed and analyzed the results of their interpretations . In this study, serum vitamin d levels of the patients were classified in four categories, i.e., vitamin d deficiency, insufficient amount of vitamin d, sufficient amount of vitamin d, and toxic amount of vitamin d (19 and 21), as defined below: vitamin d level <20 ng / ml: vitamin d deficiency vitamin d level = 2030 ng / ml: insufficient amount of vitamin d vitamin d level = 30100 ng / ml: sufficient amount of vitamin d vitamin d level> 100 ng / ml: toxic amount of vitamin d the raw data were entered into spss 13 software (spss inc . Chicago, illinois, usa), and they were analyzed using the spearman rank correlation, anova, and t - test . The research ethics committee of mashhad university of medical sciences approved this study . The deputy of education of the university issued an introduction letter that allowed the researchers to enter the study area . In this study, it was not necessary to mention patients names, and their details were extracted and used generally . We investigated the test results of 1,110 patients who were referred to diagnosis laboratories in mashhad in 2015 . The patients in the study were divided into four categories based on their ages, i.e., 1) younger than 20 (5.9%); 2) between 20 and 39 (28.8%); 3) between 40 and 59 (45.5%); and 60 and over (19.7%). The results showed that 68.8% were vitamin d deficient, 14.6% had unsuitable levels of vitamin d, 0.5% had toxic levels of vitamin d, and only 16.7% had suitable vitamin d levels . For the 1,110 patients in the study, table 1 shows their mean serum levels of vitamin d, cholesterol, triglycerides, calcium, high - density lipoproteins (hdl), and low - density lipoprotein (ldl) by gender . The data in table 1 indicate that serum cholesterol and vitamin d levels were higher than normal in females . Ldl (bad cholesterol) levels in females exceeded the recommended limit as well . The t - test showed a significant relationship between gender and hdl, ldl, total cholesterol (tc), triglyceride (tg) and vitamin d in the patients (p <0.05). No significant relationship was observed between calcium level and gender (p> 0.05) (table 1). The relationships between vitamin d and lipid profile by gender are shown in table 2 . The results showed that, in females, there was a significant relationship between vitamin d and cholesterol, triglycerides, hdl, and calcium, but there was no significant relationship between vitamin d and ldl . In addition, the results showed that there was no significant relationship between vitamin d and the calcium and lipid profiles (p> 0.05). The results showed that the age ranges of the patients in the study were 290 for males and 485 for females . The spearman test was used to investigate the relationship between age and biochemical factors in the patients in the study, and the results showed a positive and significant relationship between age, vitamin d, and calcium (table 3). The anova test showed that there was a significant mean difference between age and the biochemical factors (p <0.05), except for calcium . In addition, the tukey follow - up test showed that the difference between the means of the serum lipid profiles and age was significant (p <0.05). The results of this study showed a high prevalence of vitamin d deficiency in the population that was studied . In all areas in the study, both genders had considerable vitamin d deficiencies, with about two - thirds of the population that was studied having vitamin d deficiencies and males showing a higher prevalence than females . Unfortunately, the amount of vitamin d absorbed in the body through nutritional sources is not sufficient . Foods enriched with vitamin d are limited, and they cannot supply the amounts of vitamin d required for children or adults . This issue could be the major cause of the epidemic prevalence of vitamin d deficiency even in european and american nations (21). In fact, the major source of the human body s supply of vitamin d is the vitamin d that is produced when the human body is exposed to the ultraviolet rays of the sun (16, 21). The results of various studies have shown that there is a higher prevalence of vitamin d deficiency in middle east countries than in european and american countries (1, 7, 10, 13). It appears that regional customs concerning clothing are major factors that affect the prevalence of vitamin d deficiency in middle east and islamic countries, especially among women . Therefore, in nations in which women s clothing covers most parts of their bodies, such as saudi arabia, united arab emirates, jordan, turkey, and lebanon, the prevalence of vitamin d deficiency is greater (7, 12, 18). The results of this study were in good agreement with the results of saeidnia s and shakiba s studies (12, 18) in that all three studies showed a high prevalence of vitamin d deficiency in the patients that were studied . However, the results of this study did not confirm that the type of clothing had a significant effect on vitamin d deficiency, because this deficiency was found to be significantly greater in males than in females . In a study conducted in 2008 in tehran, shiraz, tabriz, mashhad, and bushehr, a high prevalence of vitamin d deficiency was reported even in coastal areas and at low longitudes, where sun exposure is stronger and more direct . In this study, the major causes of the high prevalence of vitamin d deficiency was reported to be the lack of exposure to sunlight in spite of sufficient radiation in these areas (because of people s lifestyles), high pigmentation of the skin, and low nutritional intake of vitamin d and calcium (2). In this study, a significant relationship was shown between vitamin d and amounts of serum lipids (hdl, cholesterol, and triglycerides) and calcium . This finding could represent the effectiveness of vitamin d with serum lipid profile in the body . Low calcium intake increases the catabolism of vitamin d. in previous studies, no apparent differences were identified between daily calcium intake and normal and low vitamin d levels (19). In this study, no significant decrease was observed in serum vitamin d levels with increasing age, as has been reported in other studies (2325). There was a significant and direct relationship between age and vitamin d levels along with serum calcium and age of the patients, i.e., when the vitamin d levels were increased or decreased, the calcium levels were increased or decreased as well . Various studies of different age groups have produced different results of vitamin d deficiency, especially in elderly patients (26, 27). The prevalence of vitamin d deficiency is high in mashhad, and the prevalence is greater in men than in women . There was a direct and significant relationship between vitamin d and lipid profiles . A positive and significant relationship was observed between the decrease of vitamin d and the decrease of serum calcium, which may reflect the lack of dairy products consumed by the patients because of low economic status, poor nutrition, and lifestyle (avoiding exposure to sunlight). It appears that vitamin d deficiency is a common health issue in mashhad that requires basic planning, especially to enrich food products with vitamin d and to increase peoples awareness about this vitamin and the ways to increase its serum levels, especially in adults.
Coltheart, langdon, and mckay (2007) extended a two - factor explanation of capgras' delusion to somatoparaphrenic delusions and from there to paranoid delusions in schizophrenia . The authors argued that abnormal experiences or data give rise to delusional hypotheses which are not rejected because of damage to a belief evaluation system located in the right frontal cortex . 's attempt to bring all delusions under a single theory represents an important advance on theories of psychosis that neglect somatoparaphrenic symptoms and/or focus on cognitive bias to underwrite the transition from abnormal experiences to delusions (see, for example, broome et al ., 2005). Metcalf, langdon, and coltheart (2007) and turner and coltheart (2010) then applied the two - factor theory to inform the relationship between confabulation and delusion . Essentially, the authors argued, first, that mnemonic factors in confabulation and experiential factors in delusions operate at the same first - factor level, and second, that confabulations and delusions share common evaluative and monitoring second - factor processes . The validity of these claims rests on crucial assumptions about the first - factor aetiology of confabulation and the original justification for relying on second - factor defective belief evaluation in a theory of delusions . The starting point for this paper is the observation that theories that rely on abnormal experience and defective belief evaluation and/or cognitive bias have difficulty explaining how complex delusional hypotheses are generated . It will be proposed that the solution can be found by reflecting on the aetiology of somatopsychotic symptoms and also on the work of johnson (1988, 1991; johnson, o'connor, & cantor, 1997; johnson & raye, 2000), and involves replacing the defective belief evaluation and/or cognitive bias factor with confabulation . It will be argued that the resultant two - factor theory clarifies, first, the aetiological role of autonoetic agnosia (frith & done, 1989; keefe, 1998), and, second, the relationship between confabulation and delusion . The latter will be achieved through a discussion of the aetiology of confabulation which allows defective evaluation to be reintroduced in its proper, more restricted context . It will then be suggested that the new theory provides a natural explanation of why individuals with schizophrenia confabulate, and can inform the understanding the relationship between confabulation and thought disorder (lorente - rovira, pomerol - clotet, mccarthy, berrios, & mckenna, 2007; nathaniel - james & frith, 1996) in a way that gives an early indication of how the gap between research on delusions and research on language impairments in schizophrenia might be bridged . The existence of pseudohallucinations or subjective sensory experiences which are the consequence of functional psychiatric disorders and which are interpreted in a non - morbid way by the patient (hare, 1973, p. 474), coupled with the observation that delusions can arise from thematically related abnormal experiences, suggest that theories that explain delusional content primarily in terms of abnormal experience are likely to be correct that this should be the first factor in a two - factor explanation of psychotic symptoms . Strictly speaking, the nature of the first factor will need qualifying when somatopsychotic symptoms and autonoetic agnosia are discussed later in the paper . The contentious part of empiricist theories, as campbell (2001) refers to them, is the account they give of how abnormal experiences are converted into delusions . In an important paper, 2007) argue that there are two requirements on an adequate explanation of this transition: (1) to explain how (often complex) delusional content arises from a mere experience which has become known as the abductive inference problem (bayne & pacherie, 2004; coltheart, menzies, & sutton, 2010); and (2) to explain why delusional content, once generated, is not simply rejected as false . The most parsimonious approach is to address (1) and (2) simultaneously by suggesting that delusions are abnormal experiences that are somehow endorsed as accurate representations of reality (bayne & pacherie, 2004, p. 3). The difficulty with subsuming all delusions under this theory, however, is that it is prima facie unlikely that the content of complex delusions (even nonclassical capgras' delusions such as cutting's patient who thought her common - law husband was the son of adam and eve [1997, p. 141]) is exclusively experiential . Most empiricist theories acknowledge this, and argue that delusional content arises, in part, out of an attempt to explain abnormal experiences . (2005), for example, arguing that data - gathering and attribution biases result in the delusional interpretation of abnormal experiences . However, we will not discuss this proposal in detail since not only do not all psychotic individuals exhibit cognitive bias (kemp, chua, mckenna, & david, 1997), but delusions can be it is perhaps worth adding, that the analogous but more familiar role that cognitive bias plays in two - factor explanations of somatisation disorder (turner, 2006, pp . 2930) suggests that a two - factor theory which relies on it will in any case struggle to account for complex delusional abductive inferences . (2007) share the view that delusional content results from an attempt to explain abnormal experiences, but the authors continue to rely on abnormal experience to do most of the content generating work . According to coltheart et al . (2010), for example, the delusional hypothesis provides a much more convincing explanation of the highly unusual data [i.e., abnormal experience] than the nondelusional hypothesis; and this fact swamps the general implausibility of the delusional belief (p. 278). If this approach is extended to complex delusions, it suggests that david's (1990, p. 804) patient's delusional hypothesis that he had an actual power station, complete with labourers, machinery, and cooling towers inside him is exhibiting a perfectly rational response to very abnormal data (coltheart, menzies, & sutton, 2010, p. 281). Furthermore, by not employing a second content generating mechanism, which could contribute to the explanation of why delusional hypotheses are not rejected, coltheart et al . (2007) have no way of avoiding the introduction of a second aetiological factor the sole theoretical purpose of which is to fulfil this role . With this in mind, postulate that there is a region of the right frontal cortex which, when damaged, prevents the correct evaluation of delusional hypotheses . (2010) articulate defective belief evaluation as irrationally ignor[ing] or discount[ing] the evidence on the basis of its incompatibility with the hypothesis to which they have become committed; so the delusional belief persists (p. 281). Now, we have already suggested that there are difficulties relying on cognitive bias to generate content, and the same considerations are likely to apply if the process is reintroduced to explain defective belief evaluation . On the other hand, if defective belief evaluation is understood as a neuropsychological deficit, as coltheart et al . (2007) imply, then this, as we will see in the next section, is difficult to reconcile with a point made by the philosopher gareth evans that when a subject wants to make absolutely sure that his judgment is correct, he gazes again at the world (thereby producing or reproducing, an informational state in himself) (1982, p. 227, emphasis in original). We will return to defective belief evaluation when discussing the relationship between delusions and confabulations, but the natural solution to the problems caused by complex delusional hypotheses is to construct a theory that relies on a content generating mechanism which can both make a substantial contribution to content and simultaneously explain why delusional hypotheses are not rejected . . 's (2007) extension of their theory of capgras' syndrome to somatoparaphrenic delusions . (2007) consider the development of a delusion of nonownership of a paralysed limb in an individual with a left hemiplegia following a right - sided brain insult . The authors then ask, what could have happened to the hemiplegic individual for this delusion to arise? The answer, they suggest, is that the abnormal experience of paralysis requires an explanation and the delusion of nonownership of the limb provides this . Then argue that because many hemiplegic individuals do not develop delusions, a second aetiological factor is required and, in view of the typically intact left hemisphere, this must have something to do with the right hemisphere . We will refer to this as assumption 2 . In terms of assumption 1, it is difficult to understand why not being able to move a paralysed limb would lead an individual to hypothesise that their limb belonged to someone else . Why, especially in the absence of significantly disturbed thinking, is the paralysed individual's first thought not i am paralysed? This concern is compounded by reports of cases that involve recognition of paralysis but not of ownership . Cutting (1997, p. 273), for example, mentions von anygal and frick's (1941) patient who claimed his paralysed side was his paralysed brother . (2010, p. 283) later recognise that such cases represent an objection to their theory, but it is the reversal of the direction of causation between limb ownership and paralysis at the point of theory construction which gives rise to the difficulties . The most likely explanation for such cases is that the failure to recognise one's paralysis, i.e., anosognosia, is a manifestation of difficulties with bodily representation or, as devinsky and d' esposito (2004, p. 77) refer to it, which in their most severe form amount to hemisomatagnosia, which involves a failure to recognise the limb(s) as one's own . As in von anygal and frick's (1941) paralysed brother case, this does not preclude implicit awareness of the existence of a paralysis, and it is well recognised individuals use personification and other metaphors such as a piece of rusty machinery or dead wood indicating knowledge that something is amiss (weinstein, 1991, p. 242). However, it is the underlying absence of experience, what bisiach and germiniani (1991) refer to as a representational lacuna (p. 31), and what we might refer to as the experiential abnormality rather than an abnormal experience of paralysis, that is the natural basis of delusions of nonownership . Hemisomatagnosia interferes with the capacity to form a correct judgement and, in doing so, makes the introduction of a separate process of defective belief evaluation, at least in the sense intended in coltheart et al . In other words, a delusion is not something that results from an experiential abnormality which is then incorrectly evaluated . It results (in part) from an experiential abnormality which itself involves an interference with the capacity to form correct judgements . 's second - factor process of defective evaluation and this is where we see the importance of evans's (1982) point . When a subject wants to make absolutely sure that his judgement is correct (i.e., evaluate it), he gazes not at his experiential abnormality, but rather through it, and this will only reproduce the original information state in himself . The difficulty, however, is that we still require an explanation of how complex somatopsychotic delusions, such as those about we need to postulate a further cognitive process which creates, as weinstein puts it, a this process is recognised to be confabulation, and, unlike defective belief evaluation and cognitive bias, it is a familiar consequence of brain damage that has clear content - generating capabilities . Furthermore, and turning to coltheart et al . 's (2007) assumption 2, although confabulation is likely to arise out of an attempt to make sense of the experiential abnormalities originating in the damaged right hemisphere, the evidence from split brain or corpus callosotomy patients supports the hypothesis that it requires left hemispheric interpretative activity in the presence of disrupted interhemispheric relations (phelps & gazzaniga, 1992). In other words, the generation of psychotic symptoms is likely to require the constructive activity of an intact left hemisphere as much as the lack of activity associated with a damaged right hemisphere . By identifying the difficulties with coltheart et al . 's (2007) account of somatopsychotic symptoms, we have arrived at a two - factor theory that relies on confabulation and a broader experiential factor, which includes agnosia, i.e., an experiential abnormality rather than an abnormal experience . The latter distinction may appear semantic, but empiricism's overly narrow construal of the experiential factor at the theory construction stage obscured the theoretical availability of confabulation, notwithstanding that it is phenomenologically related to the experiential deficits that the theory maintains underlie delusions, and can perform the content generating work explaining the complex somatopsychotic delusional hypotheses in a way that obviates the need to rely on coltheart et al . . 's (2007) proposal that it recognises the pivotal theoretical importance of somatopsychotic symptoms to formulating a general theory of delusions . However, the neglect of somatopsychotic symptoms by earlier empiricist theories (bayne & pacherie, 2004) drives an aetiological wedge through the reduplicative delusions (i.e., capgras' and somatopsychotic) and removes the means to explain even complex versions of the very capgras' delusions that empiricist theories were originally formulated to address . There are a number of reasons why empiricist theories have failed to appreciate the relevance of confabulation to the aetiology of delusions . Maher's (1974/1988) original emphasis on experientially generated content exerts a continuing influence, as does the continuing tendency to attribute confabulation to memory dysfunction . We will examine the relationship between confabulation and memory dysfunction later, but it is important to notice that even if one focuses on this, it has long been recognised that there are two cognitive processes that generate false memories; as kopelman (1987) put it, two types of confabulation . Bonhoeffer (1904) originally recognised the difference between provoked confabulation, involving minor distortions in recall, and spontaneous confabulation, involving an alternative autobiographical or semantic narrative, which may or may not accompany genuine lacunae in the provoked confabulation is essentially a form of cognitive bias on which empiricist theories rely to act as their second factor, either in isolation or as part of the mechanism that leads to defective belief evaluation . However, recalling weinstein's (1991) description of the cognitive deficit in somatopsychosis, it is spontaneous confabulation that has the theoretical potential to explain complex content . This realisation can be attributed to johnson who, in a series of papers, developed a reality monitoring theory of confabulation and then extended this to explain delusions . According to johnson, confabulations are false statements that are not made to deceive (1991, p. 187) and which occur when people confuse the origin of information, misattributing something that was reflectively generated to perception (p. 180). By reflectively generated, johnson means produced by the imagination and this indicates that confabulations are essentially imaginations mistaken for memories . Johnson refers to these errors as reality monitoring failures and suggests that they are more likely to occur when imaginations are rich in perceptual information and/or poor in cognitive operations information, as these make it more difficult to identify the source of information . However, johnson's difficulty is that reality - monitoring failure does not explain how often - complex imaginations arise in the first place . Johnson et al . (1997) solve this problem by hypothesising that confabulators have a propensity towards detailed imaginations (p. 203) and conclude that confabulation is due to an interaction between detailed imagination, defective source monitoring, and problems with the systematic retrieval of memories . We will argue later that confabulation does not require memory dysfunction and that the propensity to detailed imaginations and source monitoring problems form the basis of an adequate two - factor theory of confabulation . In the remainder of this section we will concentrate on johnson's extension of her work on confabulation to explain delusions . One way of understanding johnson's strategy is to view her as, first, separating off the mistaking of ongoing imaginations for perceptions in order to explain hallucinations, and, second, arguing that delusions arise when specific imaginations are subject to reality monitoring failures . The difficulty is that most delusional content cannot be understood in terms of mistaking imaginations for memories and this suggests that reality - monitoring failures may account for only a subset of delusions, i.e., delusional memories . Interestingly, kopelman (2009) recently emphasised the similarity between confabulation and delusional memories, whilst concluding that subsuming confabulation and delusion under a single theory has limited explanatory utility . In fact, many imaginations seem to be accepted as they are imagined for the first time and this suggests that the reliance on detailed imaginations will have to be supplemented with an account of how ongoing imaginations can be mistaken for beliefs . Now, whilst johnson herself does not articulate the issues this way, her (1988) treatment of hallucinations as reality testing failures (p. 35) contains crucial insights which can be generalised to produce the two - factor theory of delusions, which is consistent with the two - factor theory of somatopsychotic symptoms developed earlier . In considering how hallucinations arise, johnson's first argument is that imaginations are so similar to perceptions that an individual could easily become confused . However, since imaginations have insufficient perceptual information and too much cognitive operation information to be misclassified, johnson recognises that this will not explain hallucinations . In order to address the perceptual information requirement, johnson invokes abnormal experience through a discussion of horowitz's suggestion that hallucinations may be elaborated from elementary sensations in the retinal ganglionic and postretinal neural network and/or from anatomic bodies within the eyeball unfortunately, even when abnormal experience relieves the imagination of responsibility for some content generation, it takes a considerable amount of imaginative work to interpret muscae volitantes as rats, or the visual consequences of a partially detached retina as the blood of christ (johnson, 1988, pp . Johnson's solution, which we can infer from the remark that loss of control makes a self - generated event seem like a perceptual event (p. 53), is to hypothesise that imaginations have little cognitive operations information attached to them . If a confabulation is reasonably detailed and does not have strong cognitive - operations information associated with generating it, then it would be judged (p. 57). If we now generalise this interpretation of johnson's (1988) proposals to delusions, we find that a combination of abnormal experience and detailed imaginations, which have reduced cognitive operations information attached to them, explains how content arises and is not rejected . This proposal has the advantages of, first, embodying the main insight of empiricism by acknowledging the importance of abnormal experience, and, second, avoiding the need to introduce coltheart et al . 's (2007) notion of defective evaluation, by ensuring that the two delusional hypothesis - generating factors contribute to the defective source monitoring, which explains why these hypotheses are not rejected: (1) experiential abnormalities, by furnishing thoughts with the perceptual information, and (2) confabulation, by reducing cognitive operations information attached to psychotic content . It is worth emphasising the fundamental difference between johnson's (1988) notion of defective monitoring, which focuses on the process, which gives rise to information, and coltheart et al . 's (2007) notion of defective evaluation, which focuses on the content of information . Originally intended by defective evaluation, and in fact has more in common with the defective monitoring of actions which will be discussed in the next section . However, since johnson's defective monitoring contributes to the explanation of how individuals make false statements without being aware that they are false, it is partly responsible for delivering what coltheart et al . Were trying to achieve by introducing defective evaluation, albeit without having to elevate this to the status of a factor in a theory of delusions . Returning to the thread of the discussion, johnson and raye (2000) argue that perceptual information plays a significant role in heuristic (or nondeliberative) source monitoring and that cognitive operations information is important to systematic (or deliberative) source monitoring, which they suggest may require interhemispheric cooperation (p. 62). We will argue later that the defective monitoring that constitutes the second factor in a theory of confabulation is due to imaginations lacking cognitive operations information, and then relate this to problems with interhemispheric communication . However, for now the important point is that by reflecting on johnson's (1988) work, we arrived at a two - factor theory of visual hallucinations which is consistent with our two - factor theory of somatopsychotic symptoms and, in virtue of relying on a propensity to detailed imaginations, is capable of being seamlessly extended to explain even complex allopsychotic delusional hypotheses . Autonoetic agnosia forms the basis of an entirely separate theory of psychosis (frith, 1992; frith & done, 1989; keefe, 1998; lari, barr, & keefe, 2004), a clarification of which will offer an opportunity to further underline the need for both confabulation and for a broader construal of the experiential factor than empiricist theories of delusions strictly allow . The approach is based on the idea that when, in ordinary circumstances, a motor instruction is sent, a corollary message or reafference copy of this signal is also sent to an internal monitoring system . The purpose of the reafference copy is to allow for an internal prediction of what will occur and, by comparing this prediction with perceived outcome, behaviour can be adjusted to meet the changing demands of complex tasks . The system is a monitoring system that allows identification of self - generated stimuli (cahill & frith, 1996, p. 284), and, according to cahill and frith's (1996) version of the theory, psychotic symptoms occur when an individual executes an action without a reafference copy of the motor instruction being available for internal monitoring, with the consequence that the individual is unable to recognise that the action was caused by himself . This approach to the monitoring of action is clearly well suited to explaining certain auditory hallucinations (failure to monitor the initiation of inner speech and thought) and passivity experiences such as delusions of control (failure to monitor intentions to act) (p. 285). However, there are two sets of symptoms that are resistant . The first includes symptoms the content of which cannot be traced to the failure to identify a normal internal event . Cahill and frith (1996) acknowledge these cases when they indicate that it is not clear the account can explain visual hallucinations . However, they do not mention equally problematic cases in which the content is in some sense externally generated, such as in psychotic illusions . The second set of symptoms that cannot be fully explained by autonoetic agnosia are complex delusions . Indeed, even complex auditory hallucinations and passivity phenomena are problematic, in that it is one thing to believe that one's thought is a voice, but quite another to attribute it to evil spirits (to use one of cahill and frith's own case examples). The only way of salvaging an aetiological contribution for autonoetic agnosia is for cahill and frith (1996) to acknowledge the point made by johnson and raye (2000, p. 62) that more complex delusions are likely to involve additional factors, and to add confabulation to his theory . The modified version of the theory will then explain complex delusions and complex forms of symptoms which autonoetic agnosia was originally directed at . However, notice that visual hallucinations remain recalcitrant, since these (as johnson and frith have effectively concluded from opposite directions) require the additional postulation of abnormal experience (johnson & raye, 2000; cahill & frith, 1996). This suggests that we will have to allow that abnormal experience in visual hallucinations plays an equivalent aetiological role to that played by autonoetic agnosia in auditory hallucinations and passivity phenomena . It is interesting that empiricist theories have effectively recognised this, although their attempts to bring auditory hallucinations and passivity phenomena under their own theory causes them to construe autonoetic agnosia as abnormal experience . Coltheart and davies suggest that a cognitive abnormality, either in the generation of the efference copy and feedback information, might give rise to abnormal experiences of action [which if accepted] as veridical would be a step on the way to the delusion of alien control (2000, p. 37). This approach has an advantage over frith's theory because it brings out that autonoetic agnosia is really just an experiential abnormality, thereby facilitating its assimilation into a two - factor theory . The difficulty, however, is that the implicit removal of the agnosia from autonoetic agnosia is a further example of the experiential abnormality being construed too narrowly at the theory construction stage . The neglect of confabulation is less obvious in this situation because it results from a distancing of autonoetic agnosia from the agnosias underlying the somatoparaphrenic delusions that empiricist theories prior to coltheart et al . This is perhaps why bayne and pacherie (2005, p. 176, note 7) detect frith's difficulties with complex delusions, whilst not perceiving that their own version of empiricism is susceptible to the same criticism . The result, in any case, is that we have again arrived at our original two - factor theory, only now, assisted by frith's contribution, the theory has been further refined by an understanding that the experiential abnormality underlying a further subset of psychotic symptoms, i.e., auditory hallucinations and passivity phenomena, is autonoetic agnosia . Johnson and raye (2000) argue that the distinction between the delusion and confabulation is governed by whether or not a particular false claim is made in the presence of brain damage or psychopathology and that an aetiology - based distinction between delusions and confabulations [is] questionable (p. 37). However, because johnson's work antedated the contributions that imposed the current structure on the debate about the aetiology of delusions (bayne & pacherie, 2004; campbell, 2001; currie, 2000; langdon & coltheart, 2000), a two - factor theory that included confabulation was not clearly articulated . On the other hand, theorists who have taken maher's proposals as a starting point have emphasised the experiential basis of monosymptomatic delusional content to an extent that the relevance of confabulation did not, at least until recently, come into view . (2007) and turner and coltheart (2010) constitute an important an attempt to progress beyond these obstacles by relating confabulation to a two - factor theory of delusions . However, before we try to show that these authors' reliance on a common second factor failure to reject unsubstantiated thought (turner & coltheart, 2010, p. 357) inherits the original difficulties caused by focusing on evaluation at the expense of content generation, we need to lessen the resistance to the current proposals, by clarifying the relationship between confabulation and memory disorder . This is particularly important, because whilst turner and coltheart (2010) focus primarily on a common second factor shared by confabulations and delusions, and could, strictly speaking, remain neutral on the first - factor process that gives rise to confabulations, the current proposals rely on a component of confabulation (detailed imaginations) to produce delusional content and as such confabulation cannot be due to memory dysfunction . Hirstein (2005) refers to studies of patients with frontal lobe lesions (shimamura, janowsky, & squire, 1990) and post anterior communicating aneurysm surgery (vikki, 1985) who have memory impairment but do not confabulate; and second, studies of korsakoff's syndrome where memory impairment persists whilst confabulation improves (stuss, alexander, lieberman, & levine, 1978). The more difficult question is whether memory impairment is necessary for confabulation . Turner, cipolotti, yousry, and shallice (2008) concluded that it does seem to be, although since some of their confabulating patients scored in the normal range on memory tests, and they could find no single measure of memory on which all of their sample were impaired, their findings do not exclude the possibility that memory impairment and confabulation involve damage to two different closely associated neural systems (stuss et al ., 1978). If one then considers that confabulation also occurs in hemisomatagnosia, corpus callosotomy, and schizophrenia in the absence of memory impairment (on schizophrenia see lorente - rovira et al ., 2007; nathaniel - james & frith, 1996), it appears likely that memory impairment is not necessary for confabulation . This does not exclude the possibility of coexisting memory dysfunction, and indeed cognitive impairment more generally, exacerbating confabulation (dalla barba, 1993), and it is perhaps worth noting the situation in which amnesia is associated with metamemory difficulties (i.e., a representational lacuna in the domain of memory). There is no reason why a representational lacuna relating to the memory could not function like a representational lacuna relating to the body and give rise to an experiential abnormality that would influence confabulatory content . In such cases, the resultant mnemonic confabulation would be what the theory proposed in the paper regards as a delusion, thereby giving substance to kopelman's point about the relationship between confabulations and delusional memories . However, this is a special case that does not lend any more support than does hemisomatagnosia for a paralysed limb to the claim that confabulation in general is due to memory dysfunction . The absence of a primary aetiological role for memory dysfunction must be accommodated by any attempt to relate confabulations and delusions and this brings us back to metcalf et al . 's (2007) extension of their two - factor theory of delusions to confabulations . Essentially, metcalf et al . Suggest that the first factor in confabulation is operating at the same level as the first factor in delusion, although in the former it is mnemonic and in the latter perceptual or affective . This is somewhat difficult to reconcile with turner and coltheart's (2010) comment that a confabulation by a patient that he had met a woman who had a bee's head did not involve distortion of true memory; instead it appeared to involve imagination furthermore, if, as this example suggests, memory dysfunction is not essential to confabulation, metcalf et al . Have identified a first factor that does not have a role in a theory of confabulations with a first factor that most authors agree does have a role in a theory of delusions . The importance of turner and coltheart's (2010) comments about the role of the imagination in the bee's head confabulation now becomes apparent in that we require another first factor in a theory of confabulation and, according to the current proposals, it is this factor that contributes to content generation in both confabulations and delusions . 's account of the aetiology of somatopsychotic symptoms and argue that since these involve confabulation, the first factor in confabulation must be experiential, as this places empiricism on the horns of a dilemma: either deny that somatopsychotic and allopsychotic symptoms should be subsumed under the same theory of delusions, or accept that delusions, at least in complex cases, are not primarily experiential . The experiential basis of delusional content is closely associated with the claim that delusions are beliefs and together these represent the central tenets of the empiricism that coltheart et al . 's original approximation of somatopsychotic and allospsychotic symptoms was intended to protect . The possibility of filling the first factor gap left by the absence of memory dysfunction by extending the first factor experiential abnormality is almost equally unattractive to the current proposals as this would involve completely absorbing the concept of confabulation into the concept of delusion . The problem with this is that corpus callosotomy patients have neither memory nor experiential deficits in the sense required by the two - factor theory of delusions developed here, and yet they confabulate . So, providing we want to allow that this is essentially the same phenomenon as that which generates delusional content, which seems intuitively plausible, we must look to interhemispheric communication for the first factor in a theory of confabulation . What corpus callosotomy cases indicate is that when the left hemisphere is deprived of information from the right hemisphere it generates interpretations and it is these that constitute confabulatory content . However, for this to occur, it may only be necessary that a portion of the corpus callosum or crucial adjacent structures are damaged . This could occur with a circumscribed lesion in the inferior medial prefrontal system (turner et al ., 2008), which would be consistent with evidence of dissociation between frontal executive dysfunction (the traditional alternative aetiology to memory dysfunction) and confabulation, even in schizophrenia (lorente - rovira et al ., 2007). Let us suggest, then, that such a lesion is the cause of the first factor in a theory of confabulation, johnson's propensity to detailed imaginations, which when combined with the defective monitoring to be discussed in the next section, constitutes the second factor in the proposed theory of delusions . This suggestion is consistent with evidence of damage to the corpus callosum in schizophrenia (downhill et al ., 2000), but must be reconciled with delusions where there are first - factor experiential abnormalities due to a posterior lesion . Here one can envisage two possible routes to the propensity to detailed imaginations: first, through coexisting damage by a second lesion in the inferior medical prefrontal region, or, second, because the posterior lesion causing the experiential abnormalities is sufficiently extensive that it involves relevant structures . (see feinberg, venneri, simone, fan, & northoff, 2010, for evidence that somatoparaphrenic patients have greater orbitofrontal damage than hemisomatagnosic patients .) Irrespective of which of these pertains, they entail that the first factor in delusions is not the first factor in confabulation per se, a proposal that firms up the distinction between hemisomatagnosic claims due to right - sided representational problems, and complex delusional content, such as in von anygal and frick's (1941) paralysed brother case, due to inferior medial prefrontal damage . We are now in a position to address the more complex problems associated with turner and coltheart's (2010) claim that confabulation and delusion share a common second factor . With this in mind, we have seen that empiricist theories in general share a common reliance on experience to generate delusional content and that they were originally formulated to explain monosymptomatic delusions, specifically capgras' delusion, and it was suggested that this approach has difficulties explaining even complex capgras' delusions . However, it was only when coltheart et al . (2007) generalised their account to somatopsychotic symptoms (without attempting to address complex delusions) that the precise nature of the difficulties became apparent . In order to bring out these difficulties, we need to revisit the key elements of coltheart's et al . 's (2007) arguments: suppose we construct a general theory meant to apply to the explanation of all kinds of monothematic of delusion: to somatoparaphrenia, for example what distinguishes left - hemiplegic people with somatoparaphrenia from these left - hemiplegic non deluded others . Whatever this is, it is something to do with the right hemisphere because the left hemisphere is typically intact the function of this [damaged] region of the right hemisphere is, therefore, belief evaluation . Suppose we construct a general theory meant to apply to the explanation of all kinds of monothematic of delusion: to somatoparaphrenia, for example what distinguishes left - hemiplegic people with somatoparaphrenia from these left - hemiplegic non deluded others . Whatever this is, it is something to do with the right hemisphere because the left hemisphere is typically intact the function of this [damaged] region of the right hemisphere is, therefore, belief evaluation . Is that by not recognising the need to accommodate complex delusional contents, and then not building confabulations into a theory of delusions, coltheart et al . Had no alternative but to direct evaluation at the first factor in their theory of delusions . In other words, evaluation is directed at the representational problems that underlie psychotic symptoms, but which, according to the current proposals, are not susceptible to evaluation because experiential abnormalities themselves interfere with the ability to form correct judgements . Instead, it is the interpretations generated by the left hemisphere (which, as mentioned earlier, corpus callosotomy patients show us can be intact in confabulation) that provide the natural target for defective evaluation . Thus, when turner and coltheart (2010) apply coltheart et al . 's (2007) theory of delusions to confabulations and postulate a common set of evaluative and monitoring processes (the second factor) (p. 357), this involves an inter - level identification between a factor that we have suggested has no role in a theory of delusions, i.e., defective belief evaluation, and a factor which johnson holds has a central role in the aetiology of confabulation, i.e., defective monitoring . As a result the question of whether a theory of delusions can do without defective belief evaluation, which we have argued it can and should, is conflated with that of whether a theory of confabulation (and, by proxy, of delusions) can do without defective monitoring . We have already acknowledged that it cannot when discussing johnson's reliance on cognitive operations information to explain why detailed imaginations are not rejected or, perhaps more accurately, correctly categorised (johnson & raye, 2000). We will return to cognitive operation information shortly, but having concluded that experiential abnormalities interfere with the ability to make correct judgements in a way that obviates the need for defective evaluation of first - factor content in delusions, could we not simply redeploy coltheart et al . 's (2007) defective evaluation against detailed imaginations? After all, it would seem that an individual's failure to detect that his unsubstantiated hemisomatagnosic claims are false must at least in part be due to the right - sided representational lacuna itself . Hirstein (2005) has this possibility in mind, when he writes: first, a false claim will be generated because the area responsible for that knowledge domain is damaged and some other much less competent area has generated the answer . Then the answer cannot be properly checked because the only area that can do this is damaged . (p. 147) first, a false claim will be generated because the area responsible for that knowledge domain is damaged and some other much less competent area has generated the answer . Then the answer cannot be properly checked because the only area that can do this is damaged . 's (2007) claim that the defective evaluation of evidence for an unsubstantiated claim plays a role in the failure to reject unsubstantiated delusional content . However, if we understand this as a higher level right - sided process defectively evaluating the content arising from a lower level right - sided process, then we will conflate hemisomatagnosic claims with complex delusional contents . Alternatively, if we understand the claim in terms of a higher level right - sided process defectively evaluating left hemispheric detailed imaginations, then since these would not arise without the presence of the first factor, there is no conceptual space for nondefective evaluation . In other words, the interference with the capacity to form correct judgements involves an interference with the capacity to evaluate the judgements thus formed, even if they are delivered by the left hemisphere . The delusion that one's paralysed side is one's brother surely cannot in any meaningful sense be attributed to a failure to evaluate a false claim . In other words, it seems counterintuitive to claim that an individual is able to check, as it were, whether their arm is their brother or indeed, whether they have a power station inside them . Defective monitoring, however, is an important notion and this brings us back to the second factor in confabulation, and to johnson and raye's (2000) discussion of cognitive operations information and its relationship to interhemispheric relations . Now, we have previously attributed detailed imaginations to problems with the right to left transfer of information due to damage in the inferior medial prefrontal region . However, interhemispheric traffic is not one way, and this opens up the possibility that problems with the left to right transfer are responsible for detailed imaginations not having cognitive operations information attached to them . Turner and coltheart (2010) articulate defective evaluation / monitoring as not tagging for doubt, but the introduction of the notion of a tag when viewed in light of the following comment suggests a move away from coltheart et al . 's (2007) original construal of defective belief evaluation: in the absence of a tag, fragments of ideas, or ideas purely derived from the imagination, would acquire the same status as fully formed beliefs (p. 359). This formulation is consistent with the theory developed in this paper, providing that we understand tag in terms of cognitive operations information, and therefore defective monitoring as not tagging for source . This avoids both the intuitive and theoretical difficulties associated with the notion of evaluating the content of detailed imaginations whilst successfully accounting for why they are not correctly categorised . Note also that the existence of pseudologia fantastica is evidence of conceptual room for the nondefective monitoring which is not possible if the process is directed at first - factor contents . In conclusion, then, the second factor in a theory of confabulations (and the second part of the second factor in a theory of delusions) is defective source monitoring, caused by the very same damage in the inferior medial prefrontal system that causes the first factor . Finally, it is worth adding that currie (2000) proposes a theory of delusions according to which detailed imaginations are not correctly categorised because of defective source monitoring explicated in terms of a frithian autonoetic agnosia for the imagination . (currie & ravenscroft, 2002, p. 11), currie's theory of delusions approximates to a theory of confabulation . In the course of examining currie's proposals, bayne and pacherie (2005) have noticed that it may be more plausible to describe delusional patients as suffering from an impairment in the control of rather than the monitoring of imagination this paper has tried to show that, in fact, an adequate theory of confabulation will include impairments in the control and not just the monitoring of the imagination, and that an adequate theory of delusions will include this and underlying experiential abnormalities . According to the current proposals, two separate aetiological processes come together to give rise to psychotic symptoms . If this is correct, then evidence of these processes coming apart and operating independently of one another would provide significant support for the theory . With this in mind, the presence of experiential abnormalities in schizophrenia is a relatively uncontroversial matter with cutting (1997), for example, referring to gross and huber's case of a female with schizophrenia who reported that the left side of her husband's face suddenly seemed so sad and serious as if he were split into two parts (p. 109). It is difficult to conceive of a reason for doubting that such symptoms tell us something important about the aetiology of psychotic symptoms . However, it is the relationship between confabulation and schizophrenia, which has only recently started to attract empirical attention (nathaniel - james & frith, 1996), that is more interesting . It has long been recognised that patients with schizophrenia confabulate and, although these will naturally present as provoked in experimental settings, the historical literature contains unequivocal accounts of spontaneous confabulation . Lorente - rival et al . (2007) refer to kraepelin's account of extraordinary stories (p. 1) and fish (1974) points out that some schizophrenics confabulate, producing detailed descriptions of fantastic events which have never happened (p. 63). The current proposals provide both a natural way of understanding the presence of confabulation in schizophrenia and a potential explanation of aspects of the phenomenology, such as the fact that delusions tend [sic] to be fixed, compared with the shifting and changing nature of many confabulations (kopelman, 1999, p. 202). In other words, perhaps psychotic individuals have a general tendency to confabulate and coexisting experiential abnormalities anchor a subset of confabulations to produce (two - factor) delusions . The more complicated question is whether the current proposal can advance the understanding of empirical correlates of confabulation is schizophrenia, and in particular nathaniel - james and frith's (1996) and lorente - rovira et al the difficulty is, how do we understand this relationship and both authors question whether clinicians and researchers could be describing the same phenomenon in different ways . (2007) perceive to this possibility is that the speech of neurological patients with confabulation is understandable it is only the factual content which strikes the listener as odd the authors go on to make the point that if it is accepted that confabulation in schizophrenia is different from the neurological form of the symptoms, then some phenomenological overlap with thought disorder might become a more viable option (2007) point out that empirical findings on confabulation in schizophrenia, namely the reorganising and restructuring of ideas in a story and the use of approximate and new words, resemble the manifestations of thought disorder . After referring to one of chaika's (1974) patients who said his mother's name was bill and that st . Valentine's day was the start of the official breeding season for birds, lorente - rovira et al . Conclude that while episodic confabulation, as seen in neurological disorders, and thought disorder, are not the same thing, conceptualising some aspects of thought disorder as semantic confabulation may be an idea with some heuristic value (2007) do not, however, consider the possible role of confabulation in the aetiology of delusions and this both reintroduces the distinction between two types of confabulation (albeit in a different form to that proposed by bonhoeffer, 1904, and kopelman 1987) and drives an aetiological wedge between somatopsychotic and allopsychotic delusions . What is required is an interpretation of association between confabulation and thought disorder in schizophrenia that is informed by its proposed role in the aetiology of delusions, and there are two possibilities: first, confabulation and thought disorder are coexisting processes that have a joint impact on the use of language; second, confabulation and thought disorder are different manifestations of the same process . The first interpretation is an extension of arguments about the nonessential relationship between memory / frontal executive dysfunction and confabulation . If confabulations are part of delusions, then the correlation between confabulation and thought disorder could be due to an underlying correlation between delusions and thought disorder . This interpretation would need to accommodate the phenomenological overlap between thought disorder and confabulation, but this could be explained by former being superimposed on the latter . Accordingly, nathaniel - james and firth (1996) suggest that thought disorder may be a contributor to the severity of confabulation rather than its presence (p. 397). One potential difficulty is that the current theory predicts a correlation between confabulation and delusions, and nathaniel - james and frith did not find this . The second interpretation (favoured by lorente - rovira et al ., 2007, but more difficult to reconcile with neuroanatomical considerations) is that confabulation and thought disorder are on a semantic syntactic continuum between unsubstantiated claims and incoherent speech . The theory developed in this paper offers a way of reconciling this interpretation with campbell's (2001) underexplored insight that the really key question about the deluded subject is how the use that she makes of the terms in which she frames her delusion relates to her knowledge of the meaning of those terms (p. 95). Empiricist theories, on the other hand, are more or less committed to the preservation of meaning in delusions (bayne & pacherie, 2004, p. 2). The question is whether, given the requirement to explain both complex delusions and thought disorder in light of the association between confabulation and thought disorder, they can afford to be . This paper has argued that theories that rely on defective belief evaluation and/or cognitive bias cannot explain complex delusions, and that replacing these with confabulation solves this problem in a way that brings somatopsychotic and allopsychotic symptoms under one theory of delusions . The development of this theory yielded a two - factor theory of confabulation consisting of the propensity to detailed imagination and defective source monitoring . It was suggested that the two factors that lead to confabulation are due to reciprocal problems with interhemispheric communication consequent upon damage in inferior medial prefrontal region and that, as with delusions, memory and frontal executive dysfunction are not of primary aetiological relevance . It was argued that the relationship between confabulation and language impairments may also be nonessential, but that confabulation may be on a continuum with thought disorder and, if this were the case, the inclusion of confabulation in a theory of delusions provides a possible starting point for relating research on delusions to research on language impairments in schizophrenia.
Ectopic thyroid is a developmental defect of thyroid gland that leads to presence of thyroid tissue at sites other than its normal cervical location . It is frequently found along the course of the thyroglossal duct but can also be found at remote distant sites . It is very rare to have two ectopic foci of thyroid tissue, and only a very few cases of dual ectopia have been reported in the world literature . In 70% of cases of ectopic thyroid, it is extremely rare to have dual ectopic thyroid with a normally located pretracheal thyroid gland . A seventeen - year - old female presented with history of a swelling at the base of the tongue first noticed about eight months ago . The swelling gradually increased in size causing dysphagia . There was no history of pain, ulceration, or bleeding from the swelling or any symptoms of airway obstruction . Local examination revealed a pink 2.5 2.5 centimeter swelling covered with intact mucosa and visible vessels over it at the base of the tongue (figures 1 and 2). Thyroid function test suggested primary hypothyroidism with tsh 31.6 miu / l (0.44.0), t4 50.5 nmol / l (57.9161), and t3 1.82 nmol / l (1.252.74). Ultrasonography of the neck showed normally located thyroid gland but both lobes were hypoplastic (figure 3). Fnac from the swelling was done which showed thyroid follicular cells in loosely cohesive sheets, microfollicular as well as macrofollicular arrangements (figure 4(a), 4(b), 4(c), and 4(d), 400x, mgg). A thyroid scan with technetium-99 m showed two foci of intense uptake, one at the base of the tongue and another in the submental region consistent with dual ectopic thyroid (figures 5 and 6). She has since been put on 100 microgram of levothyroxine daily and is on regular followup . Ectopic thyroid was first described by hickman in 1869 in a newborn who was suffocated 16 hours after birth because of a lingual thyroid causing upper airway obstruction . Lingual thyroid is the most common ectopic thyroid accounting for 90% of all cases with a prevalence between 1: 100000 and 1: 300000 and a clinical incidence between 1: 4000 and 1: 10000 . Other sites of ectopic thyroid are suprahyoid and infrahyoid, lateral aberrant thyroid, substernal goiters, struma ovarii, and struma cordis . Ectopic thyroid has also been found in larynx, trachea, oesophagus, pericardium, diaphragm, and branchial cysts . Rare cases of ectopic thyroid are described in parathyroid, cervical lymph nodes, submandibular gland, duodenal mesentery, adrenals, and carotid bifurcation . Ectopic thyroid occurs more commonly in females and are usually seen during adolescence and pregnancy when the demand for thyroid hormone increases . Upto 70% of patients with lingual thyroid have hypothyroidism, and 10% suffer from cretinism . The thyroid gland is not found in its usual location in 70% of patients with ectopic thyroid . Presence of two ectopic foci of thyroid tissue simultaneously is rare, and very few such cases of dual thyroid ectopia have been reported in the world literature . In an extensive review of the literature, sood et al . Found that the mean age of these patients was 15 years, more common in females with an f: m ratio of 1.25: 1 . The symptoms varied from asymptomatic to anterior neck swelling with or without altered thyroid status . In almost all of these patients, one site of ectopy was at lingual or sublingual region . Familial dual ectopic thyroids with perihyoid ectopic thyroid and lingual thyroid have also been described . Lingual thyroid can cause foreign body sensation in tongue, dysphagia, dysphonia, or sensation of choking . Large blood vessels present on the surface of lingual thyroid predispose it for ulceration . All diseases capable of affecting the normal thyroid can affect the ectopic thyroid like adenoma, hyperplasia, inflammation, and malignancy . The rate of malignant transformation in ectopic thyroid is no greater than in normally placed thyroid . Carcinoma of the lingual thyroid is a rare clinical entity with an estimated incidence of 1% . Carcinoma of lingual thyroid presents in the same manner as a symptomatic patient with a lingual thyroid . Therefore, for exact pathological diagnosis a biopsy should always be taken . In our case lingual thyroid usually has a poorly defined capsule that leads to intermingling of glandular tissue with muscle elements raising the suspicion of malignancy . The most important diagnostic modality for ectopic thyroid is a thyroid scan with technetium-99 m, but ultrasonography, ct scan, and mri may help in defining the extension and location of the ectopic thyroid gland . Asymptomatic and euthyroid patients do not require any treatment, but they should be followed up and looked after for any complications . Patients with raised tsh with swelling should be put on replacement therapy with thyroid hormone which can produce a slow reduction of the mass . When medical treatment fails or there are obstructive symptoms or haemorrhage or suspicion of malignancy, then surgery should be considered . As malignant transformation has been described, some authors consider complete excision of ectopic thyroid as an appropriate treatment in all cases.
Peripheral nerve injury may result in mechanical allodynia, a condition of extreme cutaneous sensitivity to normally innocuous mechanical stimuli . Unilateral ligation of l5 and l6 spinal nerves produces some signs that seem representative of neuropathic pain (1). Signs of mechanical allodynia were most evident in the nerve ligation model among several experimental animal models (2). The spinal pharmacology at spinal nerve ligation - induced allodynia has been shown to be distinct from that associated with acute nociceptive input . Adenosine is an endogenous purine compound functioning as an extracellular signaling molecule in the central and peripheral nervous systems (3). Adenosine is released locally at tissue sites in response to trauma, ischemia and interactions with specific receptors . There are many experimental data showing the role of adenosine in the modulation of nociceptive transmission at the spinal level (4, 5). Four types of adenosine receptors have been identified and cloned as a1, a2a, a2b, and a3 (3, 6). It is known that the antiallodynic effects are mediated through the activation of spinal a1 adenosine receptors and motor dysfunction effects are mediated through a2 adenosine receptors at the spinal level (7). Gabapentin is a 3-alkylated analogue of gamma - amino butyric acid, which modulates 2calcium - channel subunits, a mechanism thought to be important in neuropathic pain (8). Gabapentin analgesia is unaffected by opioid antagonism, and repeated administration of gabapentin does not lead to analgesic tolerance (9). Preclinical studies suggest that additive interactions may occur between gabapentin and morphine (10, 11) and that opioid tolerance can be prevented by the use of gabapentin (12). The combination of mechanistically distinct analgesic agents may result in additivity or synergism and may improve efficacy at lower doses, with fewer side effects than with the use of one agent alone . There is no study on the antiallodynic interaction of intrathecal gabapentin and a1 adenosine receptor agonist in the spinal nerve ligation rat model . Therefore, in the present study, we have investigated the intrathecal interaction of gabapentin and a1 adenosine receptor agonist, r - pia (n-[2-phenylisopropyl]-adenosine r-[-]isomer) on mechanical allodynia in nerve - ligated neuropathic pain rats . The effect of a1 adenosine receptor antagonist (dpcpx; 1,3-dipropyl-8-cyclopentylxanthine) against the antiallodynic effect produced by combination of each drug was also examined . This study was performed under a protocol approved by the animal use and care committee at asan institute for life science . The experiments were conducted in male sprague - dawley rats (weight 160 - 180 g), which were housed individually in a temperature - controlled vivarium and allowed to acclimate for 3 days in a 12/12-hr, light / dark cycle . For creating the neuropathic rat model, a surgical procedure was performed (1). Under enflurane anesthesia, the left l5 and l6 spinal nerves were gently isolated and ligated tightly with 6 - 0 black silk distal to the dorsal root ganglion and proximal to the formation of the sciatic nerve . If the rats showed a withdrawal threshold of <4.0 g by postoperative day 7, these rats were defined as demonstrating mechanical allodynia . For spinal drug administration intrathecal polyethylene catheter (pe-10, becton dickinson and company, sparks, md, u.s.a .) Was passed caudally from the cistern magna to the spinal cord level of lumbar enlargement . Proper location was confirmed by a temporary motor block of both hindlimbs after injection of 2% lidocaine 10 l . Only animals with no evidence of neurologic deficit after the operation were studied . Mechanical allodynia develops within 1 week after nerve ligation surgery and it lasts for 6 - 8 weeks . The animals were 8 - 10 weeks of age at the time of drug testing . For intrathecal administration, the drugs were given by using a microinjection syringe over a 60-sec interval in a volume of 10 l, followed by a 10 l flush . For the determination of the time to peak effect and the dose (ed50) estimated to produce 50% maximal possible effect (% mpe) for each drug, gabapentin (sigma, st . Louis, mo, u.s.a .) And r - pia (sigma) were administered intrathecally . The doses of 3, 10, 30, 100, and 300 g (n=9 per subgroup) were injected for gabapentin, and 0.03, 0.1, 0.3, 1, 3, and 10 g (n=9 per subgroup) were injected for r - pia, respectively . Fractions of ed50s (1/2, 1/4, 1/8, and 1/16; n=9 per subgroup) were administered intrathecally in an equal dose ratio to establish the ed50 of the drug combination . When the drug combinations were given, the intrathecal injections were concurrent because the times of the peak effect of intrathecal gabapentin and r - pia coincided . Thereafter, the interaction between these two drugs was assessed isobolographically . For the evaluation of an antagonistic effect in each pretreatment group, dpcpx (sigma) 10 g (n=9) was administered intrathecally 15 min before injections of the combination of the two . For the control group, normal the maximal reversal from the peak effect of the combination group for antagonist was assessed and compared with peak% mpe . There was at least a 7-day interval between drug injections of successive experiments to minimize any possibility of tolerance development and to eliminate the residual effects of a drug . All behavioral tests were conducted at fixed times (10:00 am-1:00 pm) in a quiet room by the same person who was kept unapprised of both the injected solution and the dose used . To undertake these measurements of a mechanical threshold, after 20 min, mechanical threshold was measured by applying a series of 8 calibrated von frey filaments (0.40, 0.70, 1.20, 2.00, 3.63, 5.50, 8.50, and 15.1 g; stoelting co., wood dale, il, u.s.a .) To the midplantar surface of the hindpaw ipsilateral to the nerve injury until a positive sign for pain behavior was elicited . Was considered as positive responses, in which case the next filament tested was the next lower force . In the absence of such response, the next filament tested was the next greater force . In the absence of a response at 15 g of pressure, the animals were assigned to this cutoff value . The mechanical stimulus producing a 50% likelihood of withdrawal measurements were taken before and 15, 30, 45, 60, 90, 120, and 180 min after an intrathecal dose of the drug(s). Baseline threshold value for each animal at each drug trial was determined by checking responses to von frey filaments on the same day just before drug injection . Locomotor function changes in the neuropathic rats were evaluated by rotarod testing (acceler rota - rod for rats 7750; ugo basile, comerio - varese, italy). Neuropathic rats were acclimated to revolving drums and habituated to handling to ameliorate stress during testing . Before the actual day of drug testing, rats were given three training trials on revolving drums having an axis diameter of 6.0 cm and a corrugated surface for 2 days . Rats were placed on the drum rotating at lowest speed of 4 rpm and the speed was increased as the rate of 0.12 rpm / sec, maximally to 40 rpm . Rats able to remain on the revolving drum for a minimum of 120 sec were selected for drug testing . Rotarod performance time was measured at 20, 60, 90, 120, and 180 min after intrathecal injection . Each test was performed three times at 5-min intervals, and the mean values were compared . We graded the placing and stepping function of the hind paw as follows: 0, normal brisk placing and stepping reflex response (normal weight bearing); 1) sluggish response to dragging the dorsum of hind paw at the edge of table (weakness of the hind paws and poorly coordinated movement of the hind limbs during ambulation); and 2) no reflex (significant flaccidity and loss of weight bearing in the hindquarters). Withdrawal threshold data from von frey hair testing were obtained as the actual threshold in grams and were converted to% mpe using the formula:% mpe for antiallodynia=([postdrug threshold - baseline threshold]/[15 g - baseline threshold]) 100, where postdrug threshold means the largest threshold observed after intrathecal injection . The cutoff value was defined as a stimulus intensity of 15 g for the mechanical threshold (i.e.,% mpe=100). The peak drug effect was used to calculate a% mpe, and these data were used to plot a% mpe versus log dose curve . The ed50 values, slopes, and 95% confidence intervals were calculated using dose - response data . Variances and its 95% confidence intervals for the theoretical ed50 may also be calculated from the variances of each component administered alone (16). To determine whether the drug interaction is additive or synergistic, an isobologram was constructed by plotting the ed50 value for gabapentin on the x axis and the ed50 values for r - pia on the y axis . Individual ed50 values for each agonist were resolved from the combination dose required to cause 50% mpe and were plotted on the isobologram as the experimental combination dose . The theoretical additive dose of combination was calculated . Experimental values were compared with theoretical additive values as defined by the theoretical additive line . The theoretical additive point lies on a line connecting the ed50 values of the individual drugs, and experimental values that lie below and to the left of this additive line were considered to be synergistic . The difference between the theoretical additive ed50 value and the experimental ed50 value was compared using a student's t - test . The least antagonistic effect for each pretreatment group was compared with the peak agonistic effect of the combination group using the unpaired t - test . A p value <0.05 was considered to be statistically significant . After spinal nerve ligation, most rats displayed normal general behavior and weight gain . After catheter implantation in the animals with nerve ligation, the thresholds for evoking hindpaw withdrawal were in the range of 1 - 4 g for all rats . Intrathecal gabapentin, r - pia, and their combination resulted in a dose - dependent antiallodynic effect (fig . Although not being closely paralleled, the slope of the combination group was shifted to the left side in larger doses compared with gabapentin (3 - 300 g) and r - pia (10 g), respectively (fig . The ed50 values and slopes (95% confidence intervals) were as follows: 10.4 (5.3 - 20.4) g and 39.5 (26.4 - 52.6) for gabapentin, 0.2 (0.1 - 0.3) g and 35.2 (25.6 - 44.7) for r - pia, and 1.8 g (1.4 - 2.2) and 70.7 (50.2 - 91.3) for their combination, respectively . The time - effect courses of these two agonist groups and their combination groups were similar in general (fig . The maximal effects occurred within 15 - 30 min and then gradually decreased up to the previous baseline level over time for all doses of each group . A somewhat longer antiallodynic time course was observed in some rats after the injections of gabapentin 100 or 300 g and r - pia 1, 3 or 10 g . Intrathecal normal saline produced only a slight increase in withdrawal response, which means that vehicles do not have an effect on the action of each drug and their combination . A synergistic effect was found in the gabapentin plus r - pia combination group (fig . The experimentally determined gabapentin plus r - pia combination ed50 (sem) was 1.7 (0.2) g for gabapentin and 0.03 (0.006) g for r - pia . The theoretical additive ed50 was calculated to be 5.2 (1.1) g for gabapentin and 0.1 (0.02) g for r - pia . The experimental value of the gabapentin plus r - pia combination group was significantly smaller than the calculated theoretical additive value (p<0.05). The standard errors of these two points on the isobologram show that they do not overlap, which supports a significant synergistic interaction . Pretreatment with dpcpx remarkably attenuated the maximal antiallodynic effect produced by the intrathecal gabapentin plus r - pia combination after 15 min (p<0.05) (fig . 4). In the dpcpx pretreatment group, the antiallodynic effect of both drug combination dpcpx alone produced only a slight increase in% mpe (data not shown) and this suggests that dpcpx does not have an effect on antiallodynia . Some rats showed mild - to - moderate motor weakness or sedation with the largest dose of each drug, but no severe motor weakness or sedation was observed in any rats . The incidence and magnitude of side effects were not considerably increased in the combination group . Moderate motor weakness was observed in 2 rats (1 in the gabapentin 300 g group and 1 in the r - pia 10 g group). The occurrence of mild - to - moderate motor weakness returned to the baseline level within 3 hr . We observed no significant change in rotarod performance time at gabapentin (3 - 100 g), r - pia (0.03 - 10 g), and gabapentin plus r - pia combination . However, at a dose of gabapentin 300 g, the locomotor function was significantly decreased from 20 to 60 min after drug administration (fig . We found that intrathecal gabapentin, r - pia and their combination produced a dose - dependent increase of withdrawal threshold for a spinally - mediated mechanical allodynia . In addition, we observed that gabapentin enhanced the effect of r - pia synergistically when coadministered intrathecally . It has already been reported that the allodynic response to mechanical stimuli could be attenuated by intrathecal administration of r - pia in a dose - dependent manner, but there were no significant motor weakness (17, 18). It is confirmed that such an antiallodynic effect is mediated by the spinal adenosine a1 receptor subtype with administration of the selective antagonist (17). Several animal neuropathic pain models induced by sciatic chronic constriction injury and intrathecal strychnine suggest an antiallodynic effect mediated by the spinal adenosine a1 receptor (17 - 19). We also observed a similar result in this spinal nerve ligation model after administration of intrathecal r - pia . Previous studies demonstrated that both a1 and a2 receptor subtypes are concentrated in a very small area of the dorsal horn and are only localized diffusely throughout the ventral horn (20). It is reported that there was no evidence for up - regulation in spinal a1 receptors after spinal nerve ligation and that spinal cord adenosine was decreased after spinal nerve ligation (21). Gabapentin is an anticonvulsant that was synthesized as a structural analog to gamma - aminobutyric acid (22). Intrathecal or systemic administration of gabapentin diminishes hyperalgesia in tissue injury pain models without affecting acute noxious stimuli threshold (23, 24). Furthermore, the antinociceptive effect of gabapentin is more powerful after intrathecal rather than systemic administration (25). These findings suggest that gabapentin may alter the facilitated state and the major site of action of gabapentin may be the spinal cord . Although the mechanisms of action of gabapentin are not clear, the relations to specific receptors (22, 23) or substances (26), l - amino acid transporter (27), or voltagedependent calcium channel (28) has been proposed as the site of action of gabapentin . It has been reported that gaba - pentin decreases glutamate concentrations and inhibits the release of glutamate and glutamatergic synaptic transmission presynaptically (29). Glutamate acts on the nmda and non - nmda receptor and shows the excitatory effect (30). Further, the ampa - evoked neuronal response is inhibited by gabapentin (31). In our experiments, we suggested that the antiallodynic effect found in the combination group was mediated by the independent receptor systems at the spinal level and there was an attenuation in dose for each drug, and we thought it was a synergistic interaction . Although we cannot know the exact mechanism, there are two possible explanations for synergistic effect . The slope was increased in the combination group and was shifted to the left in large doses, which may explain a synergistic interaction . It is anticipated that the frequency of motor weakness and sedation could be also enhanced with increase in the antiallodynic component . In our experiments, there were no siginificant changes in motor function and sedation by rotarod test, so it is hard to suggest the functional receptor interaction . However, the fact that the receptors for the sensory component are mainly located in the dorsal horn of spinal cord and that there may be an interaction of the a1 receptor with the gabapentin receptor shows the possibility of a functional receptor interaction . In animal behavioral tests, severe sedation after drug administration could decrease response to stimulations and mask the antiallodynic effect . The effect on motor performance is particularly crucial in studies of spinal a1 receptor agonists because of the possible action of a large dose of r - pia in the motor neuron area of the spinal cord (7). Therefore, we measured rotarod performance test to examine drug - induced adverse effects, such as sedation or locomotor dysfunction . Experimental rats that adjusted to the rotarod did not show significant reduction in rotarod performance test after gabapentin and r - pia were coadministered . Thus, we suggest that the antiallodynic effect produced by gabapentin and r - pia was not affected by drug - induced sedation mainly because the amounts of doses of each drug were quite small . The difference in action site and receptor number and function changes after nerve injury may affect the results (32). With respect to reduced side effect and synergistic effect, a combination therapy administering a smaller dose of each drug and a target - specific treatment using r - pia and gabapentin may be beneficial to the management of allodynia . We performed an antagonistic study with pretreatment of dpcpx in the combination subgroup to investigate the reversal effect, and maximal antiallodynic effect was reversed . These findings may suggest that spinal gabapentin is independently necessary for the optimal function of r - pia in producing a synergistic effect . In our experiment, we chose only the a1 antagonist dpcpx because the a1 receptor subtype was most effective in the reversal of mechanical allodynia in the nerve ligation injury model (7). Unfortunately, we could not find exact gabapentin antagonist, so we could not perform the antagonistic study of gabapentin . However, with the present experiments we cannot rule out that other mechanisms could participate in this interaction . In conclusion, gabapentin and r - pia produced a dose - dependent antiallodynia without severe side effects and intrathecal gabapentin produced a synergistic interaction with r - pia in a rat model of nerve ligation injury . Thus, these results suggest that activation of adenosine a1 receptors are required for the synergistic interaction between gabapentin and r - pia in reducing mechanical allodynia.
The roles of inflammation, vascular dysfunction and oxidative stress in the pathophysiology of different stroke subtypes are not well understood . Overall, acute ischaemic stroke is associated with inflammation, which seems to predominantly reflect the severity of the lesion . However other data do not support the hypothesis that markers of the acute phase response simply reflect stroke severity . For example, interleukin-6 has been found to be higher in subjects with small vessel, compared to large vessel, ischaemic stroke . In addition, there is accumulating evidence that inflammation and endothelial activation are relevant to the pathogenesis of small volume and silent brain lesions [57]. Small studies show that oxidised ldl is higher in large, compared with small, vessel stroke, suggesting that the degree of oxidative stress may simply reflect infarct size . Cortical infarction is associated with more severe oxidative stress than non - cortical infarction, but this relationship may be confounded by stroke severity . Thus it remains uncertain whether there are important differences in the degree of oxidative stress associated with different subtypes of ischaemic stroke . We hypothesized that inflammation, vascular function and oxidative stress would be independently associated with stroke sub - type and aetiology among subjects with acute ischaemic stroke . Thus, this study sought to determine if systemic markers of vascular function, inflammation and oxidative stress are influenced by the clinical syndromes and aetiologic subtype of acute ischaemic stroke . Participants with acute ischaemic stroke were recruited from acute stroke wards and tia clinics within 10 days of onset of acute ischaemic stroke or tia at two teaching hospitals in perth, western australia between may 2005 and november 2008 . Clinical records were reviewed subsequent to the patient s discharge to confirm a final clinical diagnosis of an acute cerebral ischaemic event, classify the clinical syndrome using the oxfordshire community stroke project classification, and assign an aetioloogic subtype using the trial of org 10172 in acute stroke treatment (toast) classification . Patients with blood glucose level> 13 mmol / l or an acute co - morbid illness were excluded . At enrolment, neurologic impairment, handicap and cognitive function were assessed using the national institutes of health stroke scale (nihss), modified rankin scale (mrs) [1516], and mini mental status examination (mmse). Laboratory data were collected to assess astroglial injury (s100b concentration), inflammation (high sensitivity c - reactive protein (hs - crp) and fibrinogen), endothelial activation (e - selectin), endothelial cell damage (von willebrand factor (vwf)), and oxidative stress (f2-isoprostanes). With the exception of f2-isoprostanes, all assays were performed by the pathwest laboratory medicine units at royal perth and sir charles gairdner hospitals, using routine collection and analysis procedures . For analysis of f2-isoprostanes, 5 ml of whole venous blood was collected into cold edta tubes containing reduced glutathione and centrifuged as soon as possible at 1000 g for 10 min at 4c . The plasma was protected from oxidation by the addition of butylated hydroxytoluene at a final concentration of 20 g / ml plasma and stored at 80c until analysis by gas chromatography / mass spectrometry . Blood pressure was assessed using validated oscillometric ambulatory blood pressure monitors (oscar 2, suntech medical, morrisville nc usa) worn by participants for 24 hours after enrolment . Data were analysed using spss (version 15, spss inc, chicago, usa). Analysis of variance (anova) was used to compare means, and chi squares to compare proportions of categorical variables . If overall significant differences in means of continuous variables were confirmed, pairwise comparisons were performed using tukey s adjustment for multiple comparisons . Correlations between markers of stroke severity, inflammation, endothelial function and oxidative stress were then examined . Significant correlations were further examined with partial correlations to determine if the association was independent of blood pressure . General linear models were then used to determine if significant partial correlations were independent of stroke aetiologic and clinical subtype (by entering toast and ocsp classifications as fixed factors, s100b or nihss as a covariate, and hs - crp, fibrinogen, e - selectin, vwf or f2-isoprostanes as the dependent variable) in general linear models . The research was approved by the royal perth and sir charles gairdner hospital ethics committees . Able participants provided written informed consent . If there was uncertainty regarding the person s ability to provide informed consent, agreement to trial participation was also sought from the person s next of kin . Participants with acute ischaemic stroke were recruited from acute stroke wards and tia clinics within 10 days of onset of acute ischaemic stroke or tia at two teaching hospitals in perth, western australia between may 2005 and november 2008 . Clinical records were reviewed subsequent to the patient s discharge to confirm a final clinical diagnosis of an acute cerebral ischaemic event, classify the clinical syndrome using the oxfordshire community stroke project classification, and assign an aetioloogic subtype using the trial of org 10172 in acute stroke treatment (toast) classification . Patients with blood glucose level> 13 mmol / l or an acute co - morbid illness were excluded . At enrolment, neurologic impairment, handicap and cognitive function were assessed using the national institutes of health stroke scale (nihss), modified rankin scale (mrs) [1516], and mini mental status examination (mmse). Laboratory data were collected to assess astroglial injury (s100b concentration), inflammation (high sensitivity c - reactive protein (hs - crp) and fibrinogen), endothelial activation (e - selectin), endothelial cell damage (von willebrand factor (vwf)), and oxidative stress (f2-isoprostanes). With the exception of f2-isoprostanes, all assays were performed by the pathwest laboratory medicine units at royal perth and sir charles gairdner hospitals, using routine collection and analysis procedures . For analysis of f2-isoprostanes, 5 ml of whole venous blood was collected into cold edta tubes containing reduced glutathione and centrifuged as soon as possible at 1000 g for 10 min at 4c . The plasma was protected from oxidation by the addition of butylated hydroxytoluene at a final concentration of 20 g / ml plasma and stored at 80c until analysis by gas chromatography / mass spectrometry . Blood pressure was assessed using validated oscillometric ambulatory blood pressure monitors (oscar 2, suntech medical, morrisville nc usa) worn by participants for 24 hours after enrolment . Data were analysed using spss (version 15, spss inc, chicago, usa). Analysis of variance (anova) was used to compare means, and chi squares to compare proportions of categorical variables . If overall significant differences in means of continuous variables were confirmed, pairwise comparisons were performed using tukey s adjustment for multiple comparisons . Correlations between markers of stroke severity, inflammation, endothelial function and oxidative stress were then examined . Significant correlations were further examined with partial correlations to determine if the association was independent of blood pressure . General linear models were then used to determine if significant partial correlations were independent of stroke aetiologic and clinical subtype (by entering toast and ocsp classifications as fixed factors, s100b or nihss as a covariate, and hs - crp, fibrinogen, e - selectin, vwf or f2-isoprostanes as the dependent variable) in general linear models . The research was approved by the royal perth and sir charles gairdner hospital ethics committees . If there was uncertainty regarding the person s ability to provide informed consent, agreement to trial participation was also sought from the person s next of kin . 129 patients with acute ischaemic stroke were recruited to the study, a mean of 63 hours (sd 36 hours, minimum 6 hours, and maximum 192 hours) after the onset of symptoms . Most participants had ischaemic stroke of cardioembolic (33%) or unknown (31%) aetiology . The mean nihss score was 7, indicating moderate neurologic impairment . However substantial proportions (46%) of participants had severe handicap (mrs 45) at the time of assessment . Participants with severe (total anterior circulation) clinical syndromes tended to be older although the difference between groups was not statistically significant . Systolic blood pressure was lower in participants with a partial anterior circulation (129.327.2 mmhg) compared to those with lacunar clinical syndromes (142.033.7 mmhg; p=0.01). Total anterior circulation syndrome strokes were associated with the greatest neurologic impairment, handicap and astroglial injury . Hs - crp concentrations were higher in total (22.024.1 mg / l) than partial (15.332.4 mg / l) anterior circulation and lacunar (4.94.3 f2-isoprostanes tended to be higher in subjects with total anterior and lacunar syndromes, although these differences were not significant only two people had stroke of an other aetiology . Data for the remaining aetiologic subtypes of acute ischaemic stroke are shown in table 3 . Systolic blood pressure was higher in subjects with small vessel (143.538.4 mmhg) compared to cardioembolic (131.231.5 mmhg) stroke . Astroglial injury (s100b concentration) was greater in large artery (0.40.5 ug / l) and cardioembolic (0.60.9 ug / l), compared to small vessel 0.10.0 ug / l stroke (p<0.01). Hs - crp concentration tended to be higher in large vessel and cardioembolic stroke, and there was also a trend to higher f2-isoproastane concentrations in subjects with small vessel stroke, although these differences were not statistically significant . Hs - crp concentration correlated moderately with nihss score (r=0.45, p<0.01) and s100b concentration (r=0.48, p<0.01). (table 4) von - willebrand factor activity also correlated fairly with s100b concentration (r=0.26, p=0.01). Fibrinogen appeared to correlate weakly with nihss (r=0.19) and s100b (r=0.20), but both relationships were of borderline statistical significance (p=0.052 and 0.047 respectively) and the correlations were no longer significant after controlling for blood pressure . There was no correlation between markers of stroke severity and markers of oxidative stress or endothelial activation . Aetiologic and clinical subtypes were not independently associated with markers of inflammation or endothelial damage when included in general linear models also including markers of stroke severity (table 5). 129 patients with acute ischaemic stroke were recruited to the study, a mean of 63 hours (sd 36 hours, minimum 6 hours, and maximum 192 hours) after the onset of symptoms . Most participants had ischaemic stroke of cardioembolic (33%) or unknown (31%) aetiology . The mean nihss score was 7, indicating moderate neurologic impairment . However substantial proportions (46%) of participants had severe handicap (mrs 45) at the time of assessment . Participants with severe (total anterior circulation) clinical syndromes tended to be older although the difference between groups was not statistically significant . Systolic blood pressure was lower in participants with a partial anterior circulation (129.327.2 mmhg) compared to those with lacunar clinical syndromes (142.033.7 mmhg; p=0.01). Total anterior circulation syndrome strokes were associated with the greatest neurologic impairment, handicap and astroglial injury . Hs - crp concentrations were higher in total (22.024.1 mg / l) than partial (15.332.4 mg / l) anterior circulation and lacunar (4.94.3 mg / l) syndromes (p=0.01). F2-isoprostanes tended to be higher in subjects with total anterior and lacunar syndromes, although these differences were not significant only two people had stroke of an other aetiology . Data for the remaining aetiologic subtypes of acute ischaemic stroke are shown in table 3 . Systolic blood pressure was higher in subjects with small vessel (143.538.4 mmhg) compared to cardioembolic (131.231.5 mmhg) stroke . Astroglial injury (s100b concentration) was greater in large artery (0.40.5 ug / l) and cardioembolic (0.60.9 ug / l), compared to small vessel 0.10.0 ug / l stroke (p<0.01). Hs - crp concentration tended to be higher in large vessel and cardioembolic stroke, and there was also a trend to higher f2-isoproastane concentrations in subjects with small vessel stroke, although these differences were not statistically significant . Hs - crp concentration correlated moderately with nihss score (r=0.45, p<0.01) and s100b concentration (r=0.48, p<0.01). (table 4) von - willebrand factor activity also correlated fairly with s100b concentration (r=0.26, p=0.01). Fibrinogen appeared to correlate weakly with nihss (r=0.19) and s100b (r=0.20), but both relationships were of borderline statistical significance (p=0.052 and 0.047 respectively) and the correlations were no longer significant after controlling for blood pressure . There was no correlation between markers of stroke severity and markers of oxidative stress or endothelial activation . Aetiologic and clinical subtypes were not independently associated with markers of inflammation or endothelial damage when included in general linear models also including markers of stroke severity (table 5). These data suggest that stroke aetiology and clinical syndrome may not be important independent determinants of the degree of systemic inflammation, oxidative stress and endothelial function in acute ischaemic stroke . The apparent finding that inflammation does vary according to stroke clinical subtype appears to be confounded by stroke severity, given that the aetiologic and clinical subtypes were not associated with the degree of systemic inflammation after control for stroke severity . In addition to stroke severity, systolic blood pressure varies in patients with stroke of different aetiologic and clinical subtypes . Measured blood pressure in the setting of acute stroke reflects pre - morbid blood pressure, but is also influenced by haemodynamic changes related to the acute stroke event . Other systemic factors (such as co - morbidity, risk factors, and use of medications) may explain inter - individual variation in the systemic acute inflammatory response, and the degree of oxidative stress and vascular dysfunction, associated with acute ischaemic stroke . This hypothesis is supported by evidence showing that the presence of diabetes is associated with greater oxidative stress in participants with acute ischaemic stroke . We considered vascular risk factors, age, blood pressure and stroke severity (measured both clinically and biochemically) in addition to markers of the key variables of interest (stroke subtype, inflammation, vascular function and oxidative stress). Stroke is a complex clinical syndrome and clinically severe syndromes are sometime caused by small strategically placed lesions . This was adequately accounted for by controlling for both the degree of neurologic impairment (nihss score) and a marker of brain (atroglial) injury (s100b). However, because stroke severity is also associated with stroke sub - type it could be argued that such models over correct for stroke severity . The other major limitations of our study are the cross sectional design, and failure to collect detailed information regarding pre - morbid or acute medical therapy and interventions . Baseline (i.e. Pre - ictus) systemic inflammation, oxidative stress and vascular dysfunction among participants were also unable to be measured . These could also be important factors, given the evidence that pre - morbid measures of inflammation are associated with stroke risk . The markers we have chosen are not entirely specific (for example fibrinogen is not only a marker of inflammation) and vary over time . Furthermore, there is potential for selection bias as the participants were drawn from hospital populations, and non - consecutive sample of patients were screened (as our centres recruit to multiple trials simultaneously). Thus the study population may not be representative . The study size may have precluded adequate power to detect small independent associations, and future larger studies are required . These factors prevent any causal inferences being made, and limit the conclusions which can be reached . Our results differ from those in other studies which have supported the hypothesis that there are important differences in inflammation, oxidative stress or vascular function among different stroke subtypes . Differences in interval from onset of symptoms to collection of data may thus contribute to apparent differences between studies given that the concentrations of biochemical markers may change over time . However other data found significant elevations in f2-isoprostanes only in samples collected in the very early phase (median 6 hours) after ictus . Inclusion of people with stroke of cardioembolic and uncertain aetiology in our study, and the resulting requirement to use anova (rather than independent samples t - tests), may also contribute to the apparent differences in results between studies . These data suggest that stroke aetiology and clinical syndrome may not be important independent determinants of the degree of systemic inflammation, oxidative stress or endothelial function in acute ischaemic stroke . Other factors, including stroke severity, pre - morbid inflammation and co - morbidity may explain variations among groups of participants with different subtypes of acute ischaemic stroke.
Apoptosis of retinal ganglion cells (rgc) underlies glaucomatous neuropathy, which results in pathologic changes of the nerve fibre layer . A number of pathomechanisms triggering this type of programmed cell death are recognized: hypoxia, increase of intraocular pressure, decrease of bdnf (brain - derived neurotrophic factor) concentration in cells, and local increase of glutamate concentration . The final effect of these processes is the loss of rgc population, with its initial number being 1.21.4 million cells . The degeneration of rgc is accompanied by the atrophy of their axons that create the nerve fibre layer in the retina . In its incipiency, fibres become less parallel and form a less organized structure which, in imaging examination, results in polarization of the light passing through the layer . In subsequent stages the whole layer decreases in thickness, which is also visible in imaging examination as sectorial defects or spilled layers of retinal nerve fibres . The basis of early diagnosis of glaucoma is the earliest detection of pathologic (morphologic) changes before other changes (ie, functional damage of visual field, initially as relative and later as absolute defects) appear in the cascade of glaucomatous neuropathy . Recent reports of elements common between the pathomechanism of the damage of ganglion cells (which form the fibres of the optic nerve in glaucoma) and multiple sclerosis have appeared in the literature . Due to this, it seems advisable to test the methods of measuring parameters of nerve fibre layer as a means of diagnosis and monitoring of multiple sclerosis, especially when it is accompanied by retrobulbar optic neuritis . Such tests are currently carried out by the research team of our clinic . In recent years 2 types of devices were introduced to the early diagnosis of pathologic changes of nerve fibre layer: scanning laser polarimeter (gdx) and optical coherence tomographs (oct). The older method, already common in the diagnosis of glaucoma, is the laser scanning polarimetry gdx . During the examination, light emitting from a laser diode and polarized in 2 perpendicular surfaces because of the idiosyncratic, tubular structure of the nerve fibre layer, each of these beams passes through this layer at a slightly different velocity the more accordant the configuration of layers is with the direction of wave propagation, the faster this wave passes through . After the light is reflected off pigment epithelium, it returns to the detector, again passing through nerve fibre layer and the whole process repeats . Mutual delay of the 2 components of the polarized light registered by the device is converted to the thickness of nerve fibre layer in micrometers (called polarimetric micrometers because this parameter also describes the level of arrangement of layers, before the change of thickness of the whole layer appears). The examination is performed in the ellipsoidal belt around the optic disc . In the state - of - the - art gdx devices these issues stem from the fact that other structures of the eye, possessing the feature of birefringence (cornea, sclera), can also generate changes in the velocity at which laser beams pass through and which appear as artefacts in the examination . Optical coherence tomography is a method of laser scanning imaging, initially introduced for displaying the longitudinal section of retina in different condition, and usually concerning macula . The currently used version of the tomograph, where measurements are based on time - domain (td - oct), is being gradually replaced by a newer one based on spectral domain (soct). In the analysis of the laser wave reflected off the retina to a detector, a system of rotating mirrors providing interference for the wave under examination and the reference wave (td - oct) was replaced by a static spectrometer (soct), which analyses the entire light spectrum reflected, absorbed and scattered by each layer of the retina in a different manner . Images of longitudinal sections of consecutive layers are in very high resolution, up to 45 micrometers . In recent years many oct devices were fitted with an additional glaucoma module, enabling a possibility of measuring the retinal nerve fibre layer . The device, after distinguishing the nerve fibre layer, measures its thickness in the entire measurement window and, similarly to gdx examination, in the ellipse around the optic nerve . The major problem with this type of examination of nerve fibre layer is artefacts, as this layer lies superficially, near the vitreoretinal junction, and different types of unevenness (vessels, adhesion, tractions, condensation of vitreous, epiretinal membranes) can generate errors . Such errors can be a result of an erroneous determination of the nerve fibre layer s external boundary, which may be a result of, for example, lowered clarity of optical media . It is still disputed which of the above - mentioned devices reflects the actual image of the nerve fibre layer more faithfully and which will detect the earliest morphological changes specific for glaucoma [58], ocular hypertension, preperimetric glaucoma or other diseases accompanied by the neuropathy of optic nerve such as multiple sclerosis . The purpose of our study was to compare different types of optical coherence tomographs with scanning laser polarimeter in terms of measurements of the retinal nerve fibre layer thickness in patients with advanced primary open - angle glaucoma . The second aim was to study in this group the correlation of classifying parameter of the gdx vcc device (in accordance with internal normative databases) the nfi (nerve fibre index), which allocates the results to groups the study enrolled patients of the clinic of ophthalmology at the medical centre of postgraduate education with advanced primary open - angle glaucoma, diagnosed and confirmed by additional examinations (static computer perimetry, stereoscopic ophthalmoscopy of optic nerve, gonioscopy), previously treated conservatively . A total of 10 patients were enrolled (9 women and 1 man), aged 1870 years of age, in which 19 eyes with advanced glaucomatous neuropathy were examined . As an indicator of the advancement of glaucoma, we considered specific morphological changes of the optic disc, with the cup measured by the c / d 0.7 ratio and the existence of absolute, specific for glaucoma visual field defects of nasal step type, and quadrant defect connected or not with the blind spot, with mean deviation of perimetry md> 6 db . The condition for enrolling patients in the study was obtaining permission to perform examination and the existence of clear media, allowing an accurate oct examination and gdx vcc polarimetry resulting in high - quality scans, and a lack of surgical operations and laser surgeries related to the organs of sight in patients medical histories . In all patients enrolled for the study, full ophthalmological examination was performed, consisting of visual acuity examination, measurement of intraocular pressure, biomicroscopic examination of the anterior segment and funduscopy by volk lens . In all patients octopus 101 perimetry was also performed, threshold strategy g2 in the area of 30 degrees, to confirm defects specific for advanced primary open - angle glaucoma . In the next stage, gdx scanning laser polarimetry of the retinal nerve fibre layer was performed with a vcc (variable corneal compensation) version of the device, allowing an individual compensation of birefringence of the cornea, which (without applying such optical compensation) can generate artefacts affecting the quality of the examination s results . Within a month, measurement of the retinal nerve fibre layer thickness was performed in all patients, with 3 different optical coherence tomographs with the use of the glaucoma diagnostic module . The optical coherence tomographs used in the study were: oct stratus (zeiss) a time - domain tomograph (td - oct), oct copernicus (optopol), and 3d oct 1000) topcon, both spectral domain tomographs (soct). Statistical analysis included the results of measurements of retinal nerve fibre layer thickness in the upper and lower sectors (defects in these regions are most characteristic for glaucoma); total, mean thickness of nerve fibre layer in the entire examined area; and the nfi (nerve fibre index), which describes the probability of glaucoma on the basis of collective analysis of all parameters of examination . The nfi can range from 0 to 100 . In the classification determining the probability of glaucoma, the following division is applied: 025 = normal results, 2650 = suspicious results, and 51100 = abnormal results . The parameters of the retinal nerve fibre layer thickness are highly correlated between the gdx and oct stratus and 3d oct-1000, especially in terms of nerve fibre layer mean thickness, nerve fibre layer thickness in the upper sector, and correlation of nfi (gdx) with mean nerve fibre layer thickness in oct examinations (table 1). A good correlation occurs in statistical classification that allocates the examined sectors of the nerve fibre layer to abnormal groups between the gdx device and the results of measurements of retinal nerve fibre layer thickness in oct stratus and 3d oct-1000 . Absolute measured values of the retinal nerve fibre layer thickness (in m) differ significantly (almost 2-fold) between gdx and all oct devices (table 2). Parameters of the retinal nerve fibre layer thickness, both mean and for each individual sector, which were performed with oct stratus and 3d oct 1000, correlated highly with analogical measurements performed with gdx . These 2 tomographs were the best in distinguishing both the inner (vitreoretinal) as well as the outer boundary of the retinal nerve fibre layer . In the case of oct copernicus, more artefacts appeared and this could have been the reason for a lower correlation of these parameters . As for the nfi index, considered as the most important one in the case of gdx examination, it correlated well (which means negatively) with the thickness of nerve fibre layer measured with oct devices, which also allocated patients to the suspicious or abnormal group . This is why patients who were enrolled in this study had a perimetrically confirmed advanced glaucoma, to avoid uncertainty as to whether a person actually has neuropathy . The most interesting aspect of the obtained results is the discovery of a significant difference in the mean thickness of the nerve fibre layer, expressed in m, between gdx and oct devices, ranging up to twice the value obtained from gdx . Our results remain in accordance with the few similar reports of other authors; however, there were no similar comparisons performed in a group with such advanced primary open - angle glaucoma . Our results can be indirectly compared to studies examining the nerve fibre layer thickness in a group of healthy persons with the devices used by us . Report that the gdx vcc in vivo examination of the nerve fibre layer thickness in healthy people revealed the following results of the nerve fibre layer thickness: mean 56.87 m; upper sector 67.35 m . On the other hand, studies by knight et al . With soct and td - oct devices show that the nerve fibre layer thicknesses were, respectively, mean 92.0 m for soct and 99.4 m for td - oct . Thus, in a group of healthy people, the 2-fold difference in mean thickness of nerve fibre layer in oct and gdx is also demonstrated . What seems interesting is how the above - mentioned studies, as well as our results, relate to the study by cohen et al ., which examined the actual nerve fibre layer thickness with a microscopic method in a retina isolated post - mortem from persons previously healthy . Results of the nerve fibre layer thickness obtained by this team mean 60.3 m; upper sector 75.3 m, lower sector 69.4 m; nasal sector 48.1, temple sector 49.2 are very similar to gdx vcc examination in healthy persons . This suggests that polarimetric examination can more precisely reflect the actual nerve fibre layer thickness in the peripapillary region . Both analyzed methods of examining retinal nerve fibre layer show significant disparity in establishing its absolute thickness (in micrometers); however, mean values of measurements remain in good correlation between the devices . When the internal classification of these devices, consistent with the normative database assigned to the software, is taken into consideration, then both oct and gdx vcc devices are efficient tools in the diagnosis of glaucoma . This is because each one of them matches the acquired data of nerve fibre layer thickness with a comparative database specifically made for that particular device . Glaucoma neuropathy at the microstructural level is not only a change in nerve fibre layer thickness, but also a disorder of the organized tubular structure of its nerve fibres, resulting in earlier stages of the disease in a disorder of the polarization phenomenon itself . This is where the advantage of the laser polarimeter, gdx, can be noticed . Firstly, the measurement method is based on determining the changes of the polarization of perpendicularly set laser beams . Secondly, as shown by comparative results from literature, values of nerve fibre layer thickness obtained in polarimetry correspond with actual anatomical values measured morphometrically during histological examination, which favor measurements performed with a polarimeter . Further research is needed to establish which of these devices provides measurements closer to the actual thickness of the retinal nerve fibres . It is possible that the optimal approach would be to combine both devices into one . However, a polarimetric sensitive oct is not yet commercially unavailable, but is currently undergoing clinical trials.
Pregnancy has a profound physiological impact on the thyroid gland and thyroid function . During pregnancy, the thyroid gland increases in size by 10% in iodine sufficient countries and to a greater extent in iodine deficiency countries . Production of thyroid hormones and iodine requirement both increases by approximately 50% during pregnancy as part of physiology . In addition, pregnancy is a stressful condition for the thyroid gland resulting in hypothyroidism in women with limited thyroid reserve or iodine deficiency . Data from recently published studies have underscored the association between miscarriage and preterm delivery in women with normal thyroid function who test positive for thyroid peroxidase (tpo) antibodies . Prenatal and postnatal adverse effects including attention deficit and hyperactivity syndrome have been reported in children born to hypothyroid mothers . During the first trimester, approximately 1 in 10 pregnant women develop antibodies to tpo or thyroglobulin and hypothyroidism develops in roughly 16% of these women . There are a few reports of prevalence of hypothyroidism during pregnancy from india with prevalence rates ranging from 4.8% to 11% . Therefore, this study was carried out in a larger cohort of pregnant women during the first trimester from a government hospital setting catering to majority of women from lower socioeconomic status . This was a cross - sectional multicenter study conducted at allahabad, bengaluru, rohtak, chennai, kolkata, hyderabad, nasik, pune, new delhi, srinagar, and vizag to assess the incidence of hypothyroidism in pregnant women . Complete blood count (hemogram), total cholesterol, triglycerides, serum creatinine, and blood urea nitrogen were evaluated for all subjects . Estimation of thyroid stimulating hormone (tsh), free t4, and anti - tpo antibodies was carried out using roch modular kit using eclia technology . The intra - assay precision of tsh and free t4 was 3 and 2, whereas interassay precision was 7.2 and 4.8, respectively . The mean age of the study population was 25.5 5.6 years with a mean gestational age of 19.3 15.9 weeks . Demographic characteristics of the study population (n=2955) keeping upper normal limit of tsh <4.5, we found in our study population 13.13% of pregnant women to be hypothyroid (n = 388). Anti - tpo antibodies were positive in 20.74% of all pregnant women (n = 613), whereas 40% (n = 155) of hypothyroid pregnant women were positive for anti - tpo antibodies . A total of 36.07% (n = 816) of pregnant women were found to be hypothyroid when we used trimester - specific tsh reference ranges as suggested by the american thyroid association (ata) [table 2]. Thyroid profile of pregnant women the prevalence of hypothyroidism was 15.1%, 12.06%, and 14.36% in the first, second, and third trimester, respectively, whereas anti - tpo antibody positivity was seen in 18.07%, 19.45%, and 22.91% in each trimester [table 2]. Miu / l for the second and third trimester as suggested by ata, we found 44.3%, 32.0%, and 34% women were found to have hypothyroidism in the first, second, and third trimester, respectively [table 2]. When we analyzed prevalence of hypothyroidism in individual states / cities, srinagar (kashmir), reported unusually high prevalence of hypothyroidism of (39%) and the lowest prevalence was reported from bengaluru (karnataka) (7.8%) [table 3]. This study was aimed to evaluate thyroid function during different trimesters of pregnancy in a large cohort across india . The major findings are that 13.3% women attending secondary and tertiary public hospitals have hypothyroidism majority being subclinical . The prevalence of hypothyroidism has been reported from different countries very recently . On analysis, results of this study are consistent with recently published data from india and other countries . Previous studies conducted in delhi reported a 14.3% prevalence of hypothyroidism during the first trimester . There are at least two small - scale published studies from the south, one from chennai, and another from hyderabad . Rao et al . Included 163 nonpregnant women with recurrent pregnancy loss in a gestational age up to 12 weeks (2006) in hyderabad . Similarly, in a community - based large - scale study involving over 500,000 pregnant women from the usa showed a 15.5% prevalence of hypothyroidism . Hypothyroidism was found in 7 (4.12%) women with recurrent pregnancy loss and one in the control group . The study demonstrates that hypothyroidism has a statistically significant relationship with recurrent pregnancy loss in the first trimester . Another study examined 500 pregnant women attending two government obstetrics and gynecology hospitals in chennai for a period of 5 months in 2007 for thyroid function . Subclinical hypothyroidism was detected in 2.8%, among them, tpo antibodies positivity was seen in 57.1%, whereas euthyroid women had significantly lower positivity (7%). In another study, sahu et al . Have done thyroid function during the second trimester in high - risk pregnant women and reported that prevalence of thyroid disorders, especially overt and subclinical hypothyroidism was 6.47% . Further, in this study, significant adverse effects on maternal and fetal outcomes were observed emphasizing the importance of routine antenatal thyroid screening . Therefore, findings of our study are consistent with other previously reported data from india and this study also shows a rising trend of hypothyroidism among the indian pregnant women . The impact of thyroid dysfunction on pregnancy outcomes appears to manifest with a tsh threshold of> 2.5 miu / l in the first trimester rather than with a tsh range based on percentiles cutoff derived from apparently normal pregnant women . Ata recommends> 2.5 and> 3.0 iu / ml as cutoff range for diagnosis of hypothyroidism during the first and later part of pregnancy, respectively . However, we have taken 4.5 iu / ml as cutoff for diagnosis of hypothyroidism in different trimesters . In addition, marwaha et al . Have reported that normal range of thyroid hormones in the indian pregnant women are higher as compared to international cutoffs . The large burden of subclinical hypothyroidism in pregnancy may prove to be a major public health burden in india, once it becomes clear that adverse outcomes can be corrected with screening and early replacement of levothyroxine . Children born to hypothyroid mothers have a poor intellectual function during the later part of their life . Therefore, majority of the developed countries have the national neonatal screening program in place and routinely screen all newborn for hypothyroidism . The question whether to screen all pregnant women for hypothyroidism ata in its recently published guidelines has stated against the universal screening of pregnant women for hypothyroidism . Some of these studies have shown an adverse effect on fetal and maternal health outcomes . However, these studies are too small, and it is advisable that a large - scale study is done in this regard from india . The strong point of this study is that we have included the largest number of subjects in this study from different parts of india . Further, the study population belongs to different socioeconomic strata and therefore, represents probably the pregnant population of india . This study also demonstrates a secular trend in prevalence of hypothyroidism in india, when data from other previous studies was analyzed . However, there are few limitations of this study . We have not carried out clinical and radiological thyroid examination including ultrasound, and apart from autoimmunity, we have not evaluated other causes of hypothyroidism in these women . This study concludes that there is a high prevalence of hypothyroidism in pregnancy (13.13%). Further studies are required to evaluate impact of thyroid disorders during pregnancy in the indian population to decide whether universal screening is needed for indian pregnant women.
She had previously been diagnosed with infiltrating ductal carcinoma in her right breast and had known metastases to the liver and bone . She had undergone a palliative right mastectomy and chemotherapy . When she first complained of horizontal diplopia, headache, and nausea, brain magnetic resonance imaging (mri) and cerebrospinal fluid analysis revealed no abnormal findings . Her visual acuity was 20/20 in both eyes, and no abnormal findings were detected on slit lamp examination . The alternate prism cover test revealed 10 prism diopters of esotropia in the primary position . On two months later, both eyes were fixed in the midline on attempted right gaze . In contrast, left gaze was preserved in both eyes and vertical eye movements were normal (fig . Follow - up brain mri revealed an enhancing round nodular mass at the right facial colliculus of the lower pons, suggesting involvement of either the right abducens nucleus or the paramedian pontine reticular formation (pprf) along with the facial nucleus or nerve tract (fig . The findings in our patient suggested impairment of the right abducens nucleus, which contains both motoneurons that control right eye abduction and internuclear neurons that control left eye adduction . Involvement of the right pprf could also be inferred given a complete loss of right saccade movements of the right eye . Moreover, the accompanying ipsilateral facial palsy supported the possibility of damage to the right facial nucleus or nerve tract in the vicinity of the abducens nucleus . On mri, a small tumor was found exactly at the facial colliculus of the lower pons (fig . The preservation of adduction of the right eye on left gaze implied that the median longitudinal fasciculus (mlf) was intact . Pathologic confirmation could not be obtained because we did not think the benefit of biopsy outweighed the risk of pontine injury . However, based on the mri findings and the slow progression of the neurologic deficits, a pontine tumor was favored . Other potential diagnoses, including pontine hemorrhage, infarction, aneurysm, or demyelination, were excluded . The absence of hypertension and diabetes mellitus as well as an age younger than 55 years also supported the diagnosis . However, the patient's history of liver and bone metastases along with a previous report indicating that brain metastasis was detectable in up to 30% of patients with breast cancer strongly supported the possibility of a metastatic lesion . In addition, metastatic brain tumors have been reported to be at least four times as common as primary brain tumors, and breast cancer is known to be the second most common cause of brain metastasis . Yen et al . Reported that the incidence of brainstem involvement in patients with breast cancer metastasis to the brain was as high as 12.4%, higher than that in patients with any other type of cancer . Reported that 28% of cases of brain metastasis in breast cancer showed a single metastatic lesion, supporting the idea that a single brain lesion does not necessarily suggest a primary tumor . Moreover, brainstem gliomas, the most common primary tumor of the brainstem, are usually slow - growing and progressive over several years; the rapid growth in only three months also supported the diagnosis of metastatic cancer . Neoplasm is known to be one of the causes of abducens nerve palsy and internuclear ophthalmoplegia . However, to the best of our knowledge, this is the first report of unilateral conjugate gaze palsy due to a pontine metastatic mass . While gaze palsy caused by herpes zoster infection or pontine hemorrhage has been reported, this is the first report of unilateral horizontal gaze palsy due to metastasis to the abducens nucleus . In conclusion, a localized metastasis to the abducens nucleus that spares the mlf can cause gaze palsy in a patient with breast cancer.
An 18-year - old man presented with a soft tissue mass of five months' duration in the right forearm . Physical examination revealed a round, tender mass . On magnetic resonance scan of the right forearm, t1-weighted imaging revealed a circumscribed mass with intermediate signal intensity . The obtained slides were stained with hematoxylin and eosin and papanicolaou methods . On microscopic examination, the smear revealed clusters, sheets, and isolated cells in the background of myxoid materials (fig . The nuclei were uniformly round to ovoid, with finely distributed chromatin and a small nucleolus . Some cells had eccentrically - located nuclei and lesser amount of basophilic cytoplasm, resulting in a plasmacytoid appearance . Neither mitosis nor necrosis was found . On immunohistochemical staining for cytologic slides, the tumor cells were occasionally positive for cytokeratin (ae1/ae3) and s100 protein . The excised tumor measured 3.01.81.5 cm . The tumor was well - demarcated, yellow solid, soft, and myxoid (fig . The tumor cells were present in solid sheets or reticular pattern without ductal component or necrosis . The tumor cells showed immunostaining for cytokeratin (ae1/ae3), epithelial membrane antigen (ema), s100 protein, and glial fibrillary acidic protein (gfap) (fig . Soft tissue myoepithelioma is a rare tumor composed of neoplastic cells with features of myoepithelial differentiation . The tumor presents as a painless or painful mass in the dermis, subcutis, or deep soft tissue.3,4 while most myoepitheliomas are of salivary gland origin, they have been reported in the soft tissue, retroperitoneum,3 lung,5 and testis.6 the histogenesis of myoepithelial tumors arising in soft tissue is unknown . It likely reflects a different pattern of gene expression during oncogenesis rather than origin of a specific cell lineage.7 hallor et al.8 reported that a minimally deleted region of 3.55 mb at chromosome band 19p13 was identified in soft tissue myoepitheliomas . In the present case, the tumor consisted of epithelioid, spindle, and plasmacytoid cells forming solid sheets or reticular pattern in myxoid and fibrous stroma . The tumor cells revealed positive reaction for cytokeratin (ae1/ae3), ema, s100 protein, and gfap . The cytomorphologic and immunohistochemical features of the present case are similar to those of myoepitheliomas arising in the salivary gland.9 - 12 soft tissue myoepitheliomas, mixed tumors, and parachordomas are on the spectrum of tumor showing myoepithelial differentiation.1 characteristically, mixed tumor has more pronounced ductal differentiation, while parachordoma shows prominent cytoplasmic vacuolation . In the present case, ultrastructurally, myoepitheliomas show intermediate filaments, desmosomes, and basal lamina.13 intermediate filaments, desmosomes, and basal lamina were present in this case . Soft tissue myoepitheliomas may be mistaken as other type of soft tissue tumors due to their cytomorphologically heterogeneous features . The differential diagnosis of soft tissue myoepithelioma includes mixed tumor, parachrodoma, schwannoma, smooth muscle tumor, ossifying fibromyxoid tumor (ofmt), myxoid liposarcoma, extraskeletal myxoid chondrosarcoma (emc), and metastatic carcinoma . Immunohistochemically, parachordomas are positive for cytokeratin and s100 protein.14 schwannoma has wavy, point - ended nuclei in collagenous or myxoid background and nuclear palisading.15 smooth muscle tumor has cigar - shaped, blunt - ended nuclei and eosinophilic fibrillary cytoplasm.16 conversely, the cells of soft tissue myoepithlioma have more tapered nuclei . Immunoreactivity for smooth muscle actin, desmin, and h - caldesmon supports a diagnosis of smooth muscle tumor . Ofmt shows round and ovoid cells in myxoid matrix.17 ofmt is immunoreactive for s100 protein in approximately 70% of cases but negative for cytokeratin and gfap . Myxoid liposarcoma shows lipoblasts and delicate, arborizing, thin - walled blood vessels in myxoid background.18 emc is characterized by spindle, stellate, or round cells in a myxoid or chondromyxoid matrix and shows variable immunoreactivity for s100 protein, neuron - specific enolase, and synaptophysin.19,20 generally, metastatic carcinomas show epithelial tumor cells with hyperchromatic nuclei, prominent nucleoli, and a high nuclear to cytoplasmic ratio . It can be excluded by the absence of immunoreactivity for s100 protein and myogenic markers . Immunohistochemical expression for epithelial markers (cytokeratin and/or ema), s100 protein or gfap is useful for confirmation of myoepithelial differentiation.3,7 although most cases of myoepithelial neoplasms of soft tissue are benign, approximate 20% have a risk for local recurrence.3 the histopathologic criteria for malignancy in soft tissue myoepithelial neoplasms are moderate to severe cytologic atypia, increase of nuclear to cytoplasmic ratio, nuclear pleomorphism, and readily identifiable nucleoli.2,3 no cytologic features of malignancy were present in this case of myoepithelioma . Recognition of the cytomorphologic features of soft tissue myoepithelioma is necessary for the correct cytological diagnosis . Soft tissue myoepithelioma should be included in the differential diagnosis of soft tissue epithelioid and spindle cell neoplasms.
Hepatocellular carcinoma (hcc) is one of the most common malignancies in the world (700, 000 deaths / year) and its incidence is increasing . Therapeutic options available include liver transplantation, surgical resection and local ablative therapies, but the prognosis of hcc remains poor due to high tumor recurrence rates . Thus, new strategies are needed and immunotherapy based on stimulation of the antitumor immune response is a promising approach . . Secreted afp, synthesized in the yolk sac, the fetal liver, and the gastrointestinal tract, is the main serum protein during the fetal development . However, afp is reexpressed in 50 to 80% of hcc, whereas its expression is low or absent in normal adult liver . Several vaccination strategies based on afp as a taa have been investigated for hcc immunotherapy . Briefly, afp can be presented as an antigen by human and murine dc and persisting t cd8 memory clones present in the human and the murine repertories can recognize some peptide epitopes derived from afp [58]. In murine models, murine afp can function as a tumor rejection antigen in melanoma models and afp - specific vaccination can significantly impair the growth of an autochthonous hepatocellular carcinoma . In the two conducted clinical trials, afp - specific ctl have been detected in blood after afp peptides administration but, however, it has not been correlated to an objective clinical response [7, 8]. This could be due to the fact that onco - fetal antigens, including afp, are self - tolerated molecules and that the tumor immune evasion mechanisms have to be successfully controlled to trigger an efficient antitumor response . Vaccination with altered forms of the antigen or with the xenogeneic protein is a possible strategy to overcome the tolerance to antigens [1113]. It has been successfully used to raise immune response against various antigens [15, 16]. Compared to immunotherapy strategies with monoclonal antibodies or with immunodominant peptides, vaccination with mva encoding a tumor antigen presents the advantage of raising an immune response against the whole antigen . In the context of a mva vaccination, the primary induction of the ctl response depends mostly on cross - presentation suggesting that the expression of a full - length antigen localized subcellularly should be considered during the mva vector design . In the present study, we compare the immune response elicited by the vaccination with a recombinant mva vector encoding the afp antigen either in its native secreted form or in modified membrane - associated or intracellular forms . Primary chicken embryo fibroblasts (cef) were used for homologous recombination and amplification of recombinant vectors . Cef were prepared from chicken embryos obtained from fertilized eggs (lohmann, france) previously incubated 11 days at 37c in a humid atmosphere . Embryos were dissected and treated with a triple select solution (invitrogen) (w / v). Cef cells were maintained in eagle - based medium supplemented with 5% fetal bovine serum . The mva shuttle plasmid contains a multiple - cloning site under the control of the ph5r early - late vaccinia virus promoter surrounded by the flanking sequences of the deletion iii of the mva allowing homologous recombination and a selection gene, the e. coli xanthine - guanine phosphoribosyl - transferase gene (gpt gene) under the control of the p11k7.5 promoter . Full - length cdna encoding the secreted form of murine afp (s - mafp) was obtained by pcr (primers f5-ggccgcgctagccgccaccatgaagtggatcacacccgcttc-3; r5-gcagtcagggcccctgcactcagtaatacataaacgcccaaagcatcacgagttttg-3) and digestion with nhei and noti enzymes (new england biolabs) on pcineomafp . The intracellular afp sequence (i - mafp) was obtained by deleting the exporting signal (nucleotides 1 to 54) by pcr (primers f5-ggccgcgctagccgccaccatgaaagcattgcacgaaaatgagtt-3; r5-gagccacatccagggccagcttc-3) and enzyme digestion . The transmembrane afp (t - mafp) sequence was obtained by successive pcr and fusion between the s - mafp sequence and a rabies transmembrane domain, kindly provided by dr . The resulting sequences, verified by sequencing, are described in figure 1(a) and were cloned into the corresponding sites of the mva shuttle plasmid . Briefly, cef cells were infected with a mva without any inserted transgene (mva - null) and then transfected with the different shuttle plasmids by cacl2 precipitation . Homologous recombination occurred and recombinant mva viruses are isolated by multiple steps of mycophenolic acid selection . Final recombinant mva viruses were controlled by pcr, amplified in cef, and virus stocks were titrated on cef by plaque assay . Cef cells were infected with each mva vector at a multiplicity of infection (moi) of 0.2 and incubated for 48 h. cell lysate proteins were run on a 10% sds - page gel under reducing conditions and transferred onto a nitrocellulose membrane . The membrane was incubated with a polyclonal goat anti - afp (c-19) antibody (santa cruz) at a 1: 1000 dilution or with a rabbit anti - rabies transmembrane domain at a 1: 2000 dilution . The membrane was then washed and incubated with a secondary antibody coupled with horseradish peroxidase (ge healthcare). C3h / hen (c3h) male mice (8 weeks) were purchased from janvier laboratory (france) and were bred in the nantes ifr 26 animal facility . All experiments procedures involving animals were conducted according to the guidelines of the french agriculture ministry and were approved by the local ethical committee . Mice were immunized three times subcutaneously (s.c .) Into the flank with 5 10 pfu of mva vectors at 7-day intervals . Mice subjected to regulatory t cells depletion were injected intraperitoneally (i.p .) 1 day prior the vaccination course with 400 g of anti - cd25 antibody (pc61) purchased from bioxcell (new hampshire, usa). Cd8 t cells were isolated from spleen cells with mouse cd8a (ly-2) microbeads and ms columns (miltenyi biotec). Specific t - cell response was monitored on cd8 t cells with ifn elispot kit (diaclone), according to the manufacturer's protocol . Cells, plated at a concentration of 5 10 cells per well, were stimulated with 20 m of a mafp - specific cd8 restricted peptide (nefgiastl) described earlier, with medium alone or with mva - null at moi 10 for 24 h. ifn-secreting cells were counted on an aid elispot reader 9 (autoimmun diagnostika). Results are presented as the number of ifn-secreting cells per million of cd8 t cells after subtraction of nonspecific signal obtained with medium alone . Blood samples were collected on days 0, 7, 14, and 21 during the vaccination course . Plasma was separated by centrifugation from blood collected . A fusion protein consisting of the native murine afp and a v5 tag afp open reading frame was inserted in frame with a sequence encoding the v5 epitope in the pcdna3.1/v5-his vector (invitrogen). 293 cells were transfected with the resulting plasmid with lipofectamine (invitrogen) and the afp - v5 fusion protein was secreted in the culture supernatant . 96-well plates were coated overnight at 4c with a goat anti - v5 tag antibody (abcam, uk) at 1 g / ml diluted in bicarbonate coating buffer . Following blocking with pbs - tween - milk (5%) (ptm), plates were incubated overnight at 4c with 100 l of supernatant containing the afp - v5 fusion protein . Wells were then washed three times in ptm and incubated overnight at 4c with primary mouse sera diluted serially in ptm . Wells were then washed three times in ptm and incubated with a goat anti - mouse igg hrp secondary antibody (dako) for 2 h at room temperature . Following washings in ptm, wells were incubated with an abts substrate (roche diagnostics, germany). Statistical analyses were performed using the non - parametric kruskal - wallis or mann - whitney tests and graphpad prism software . A p value <0.05 was considered to be statistically significant . The sequences corresponding to the secreted (s mafp), intracellular (i mafp), and transmembrane (t mafp) forms of the murine afp protein were introduced in the deletion iii of the mva genome under the control of the early - late promoter ph5r . The recombinants mva produced are presented in figure 1(a). Specific signals corresponding to the intracellular and to the secreted mafp proteins in cellular extracts isolated from cep cells infected either by mva - i mafp (figure 1(b), lane 1) or by mva - s mafp (figure 1(b), lane 2) were detecting using a polyclonal antibody directed against the c - terminal part of the afp protein . The respective sizes of these two proteins are in line with the expected size of the native mafp protein and with the molecular modifications achieved . As the antibody previously used was directed against the c - terminal part of the protein where the fusion was made, the expression of the transmembrane form was confirmed by western blot using an antibody directed against the transmembrane rabies domain . A specific protein band was detected at a higher size compared to the native protein in agreement to the fusion with the supplementary domain (figure 1(c), lane 1). Mice (n = 4) were vaccinated with the different recombinants mva by three subcutaneous injections one week apart (figure 2(b)). One week after the last immunization, the specific cd8 t - cell response was measured in an interferon gamma elispot assay, with the h-2 afp peptide nefgiastl, as described previously . As shown in figure 2(b) and as expected, no specific response was detected in mice vaccinated with the parental vector mva - null . Surprisingly, no significant increase in the number of spots was observed in mice vaccinated either with mva - s mafp or with mva - i mafp . In contrast, mva - t mafp - vaccinated mice displayed a significantly higher number of ifn--producing cells compared to mice vaccinated with the other mva vectors . Thus, in the context of afp vaccination by an mva vector, the transmembrane form elicits a higher cd8 t - cell immune response in c3h / hen - vaccinated mice . Populations of regulatory t cells could impair the immune response against a self - antigen such as afp . To address this possibility, groups of mice were vaccinated with the mva - t mafp vector, with or without an injection of 400 g of pc61 anti - cd25 monoclonal antibody the day before the first vaccination (figure 3(a)). At sacrifice, cd4 cd25 t - cell depletion was verified by facs analysis (data not shown) and the cd8 t - cell response was compared in splenocytes prepared from the two groups by ifng elispot assay . A single injection of anti - cd25 antibody did not enhance significantly the afp - specific cd8 t - cell immune response (figure 3(b)). In contrast, the t reg depletion has an impact on the immune response against the vector (figure 3(c)). In fact, the antibody injection resulted in a significantly higher number of ifn--producing cd8 t cells after mva restimulation confirming that the depletion did occur . To monitor the afp - specific humoral response elicited by the vaccinations with the mva recombinant vectors, mice (n = 3) were vaccinated either with the mva afp viruses or with the mva - null, by three injections one week apart and sacrificed one week after . The serological response was assessed by elisa as described in the material and methods section . The presence at sacrifice of circulating antibodies directed against the afp protein was analyzed in mice vaccinated with the four different mvas (figure 4(b)). No afp - specific antibody could be detected in the sera of mice vaccinated with mva - null, or mva - s mafp or mva - i mafp, even at the minimal dilution (1: 50). In contrast, vaccination with mva - t mafp elicited a significantly stronger specific antibody response . The time course of afp - specific antibody titer was assessed during the vaccination protocol (figure 4(c)). Repeated immunizations (at day 0, day 7, and day 14) with mva - t mafp led to the production of afp - specific antibodies which was maximal by day 14 and remained stable at day 21 . Tolerance to tumor - associated antigen is profound, therefore strenuous immune modulation is required to overcome it and achieve meaningful response . In this paper, we assessed the ability of mva to induce an immune response against the self - antigen -fetoprotein (afp), and we compared the immunogenicity of different forms of this antigen after vaccination in nave mice . Three vaccines were generated to encode recombinant afp that was either secreted or membrane - bound or cytosolic . Comparable strategies targeting antigen to specific subcellular compartments have been shown to efficiently modulate the specific immune response elicited . The correct expression of the recombinant afp forms by the mva vectors was first confirmed . The vaccination protocol consisted in three subcutaneous injections one week apart and one week later, both the cellular - specific cd8 t - cell response and the humoral response were monitored . Expression of a cytosolic form of afp failed to raise a strong immune response as what has been shown for a soluble cytosolic fragment of the her-2 protein which is promptly degraded by the proteasome . Vaccination with the transmembrane form of afp induced a stronger cd8 t - cell response compared to the ones obtained with the mva encoding the secreted and the intracellular forms of afp . Since the number of specific spots was limited, we evaluated the effect of a t reg depletion on the immune response obtained and we concluded that the afp - specific cd8 response was not modulated by the cd25 t cell population during a mva - t mafp vaccination protocol . Finally, the vaccination with the transmembrane form of the antigen leads to the production of antibodies directed against afp . Previously, vaccination with an mva encoding a modified membrane - associated form of the epithelial tumor antigen h23, aberrantly expressed in breast cancer, has been shown to allow the production of elevated levels of specific antibodies in vaccinated animals [23, 24]. The difficulty to raise a significant immune response against afp compared to other taa could be due to the fact that this self - antigen is produced by the liver, which is known to constitute a specific tolerogenic environment . In conclusion, we demonstrate that the secreted and the intracellular afp antigens expressed from mva are less effective immunogens than their transmembrane counterpart . Vaccination with a membrane - bound form of a self - antigen, combined with other strategies, involving stimulation with cytokines (il2, il12, gm - csf) [26, 27] could represent a promising strategy to enhance immunogenicity in the context of mva vaccination.
This retrospective cohort study included pediatric and adult patients admitted to the university of iowa hospitals and clinics (iowa city, ia, usa) or to the university of maryland medical center (baltimore, maryland, usa) during 20032009 . First, we used codes from the international classification of diseases, ninth revision, clinical modification (icd-9-cm), to identify patients with influenza - like illness (ili) (5). This criterion was part of an initial study investigating influenza - like illness and s. aureus pneumonia (j.s . Patients were included in the study if they had respiratory cultures (sputum, bronchial specimen, or tracheal aspirate) that grew s. aureus and were tested for influenza before or during their admissions . If a patient was admitted> 1 time, only the admission with the first s. aureus positive respiratory culture was included . The primary outcome of interest, 30-day in - hospital mortality, was defined as death occurring in the hospital within 30 days of the first culture that grew s. aureus . The adapted charlson comorbidity index served as an aggregate score for co - occurring conditions (6). The year of each patient s first positive s. aureus culture was dichotomized: 20032007 and 20082009 . We conducted bivariable analyses using either the test or the fisher exact test for categorical variables and the student t - test or wilcoxon rank - sum test for continuous variables . We used logistic regression to identify associations between potential predictor variables and 30-day mortality rates . Variables associated with death (p<0.25) in the bivariable regression analysis were examined for fit within the multivariable model and were retained if statistically significant (p<0.05). The year of each patient s first positive s. aureus culture was forced into the model . We analyzed data using sas software version 9.3 (sas institute, cary, nc, usa). A total of 195 patients had> 1 respiratory culture that grew s. aureus and were also tested for influenza . Sputum samples (115, 59%) and bronchial washes (50, 26%) were the most common respiratory specimens . Respiratory or blood samples of 109 (56%) patients grew methicillin - resistant s. aureus (mrsa). Most patients (166, 85%) were admitted to the university of maryland medical center; 116 (59%) were male, and median age was 42 (interquartile range 559) years . Of the 195 patients, 32 (16%) had positive influenza test results . Patients who had a positive influenza test were more likely to receive quinolones (odds ratio [or] 3.30, 95% ci 1.517.21) than were patients whose influenza tests were negative (table 1). Patients who had a positive influenza test were significantly more likely to have the positive s. aureus respiratory culture collected <2 days after hospital admission than were the patients whose influenza tests were negative (or 3.27, 95% ci 1.397.70). Of the 32 influenza - positive patients, 9 (28%) died; of the 163 influenza - negative patients, 18 (11%) died (or 3.15, 95% ci 1.277.86; p = 0.021) (table 2). Of the 9 influenza - positive patients who died, 5 had mrsa . Among the 27 patients who died, those with a positive influenza test were more likely to have diabetes than those who had a negative influenza test (33% vs. 0%; p = 0.029). The multivariable logistic regression model found that, after statistically adjusting for year and time from admission to collection of s. aureus culture samples, patients whose influenza tests were positive had> 4-fold increased odds of death compared with patients whose influenza tests were negative (or 4.31, 95% ci 1.5711.83; p<0.005) (table 2). * defined as death occurring in the hospital within 30 d of the first respiratory culture that grew s. aureus . Other investigators reported poor outcomes among patients who were co - infected with influenza viruses and s. aureus (3,4,7). Kallen et al . Found a statistically significant increased risk for death among patients who had positive influenza test results and community - acquired s. aureus pneumonia, compared with patients who had negative influenza test results and community - acquired s. aureus pneumonia (7). Study included patients who had either mrsa or methicillin susceptible s. aureus pneumonia (7) but evaluated only 47 patients . The sample size for our study was much larger than previously performed studies, and we were able to examine mortality rates among patients who had a respiratory culture that grew either mrsa or methicillin - susceptible s. aureus . Additionally, co - infection with influenza and s. aureus has been examined in animal models to identify mechanisms that cause poor outcomes (812). Severity of illness related to co - infection has been associated with a dysfunctional cell repair system and an altered immunologic response such as suppression of macrophage function, inhibition in phagocytic bacterial clearance, and cell damage to the airway system (812). Investigators have hypothesized that influenza damages epithelial cells in the respiratory system, providing opportunity for enhanced bacterial attachment (8,11). Once bacteria invade, cell destruction and fluid cause dysfunction of the airway system (8,11). First, the investigation might have excluded patients who were tested for influenza at other facilities or who did not have laboratory - confirmed influenza . Second, we could not determine whether the respiratory cultures that grew s. aureus represented infections or colonization . However, the information we describe remains clinically relevant because often clinicians do not know whether patients with positive s. aureus cultures are infected or colonized . Diagnosing s. aureus pneumonia is challenging, and acquiring a lower respiratory culture such as a bronchial specimen or tracheal aspirate can be invasive and difficult to collect . Therefore, if s. aureus pneumonia is suspected (e.g., symptoms and positive sputum culture), patients may be treated without a confirmed positive lower respiratory culture . Third, our dataset did not include information about variables such as influenza vaccination status, mechanical ventilation, co - infection with organisms other than influenza and s. aureus, and whether the pneumonia was necrotizing . Patients with a negative influenza test may be misclassified since we were unable to determine the time interval between the onset of ili symptoms and the collection of the influenza sample . Last, influenza - like illness icd-9-cm codes were used to identify the cohort because the patients initially were included in a study of influenza - like illness and s. aureus pneumonia (j.s . Therefore, patients may have been missed if they had a respiratory infection with s. aureus and the condition or symptoms were not captured through an icd-9-cm code . In conclusion, among patients whose respiratory cultures grew s. aureus, patients with influenza were significantly more likely to die than were patients whose influenza tests were negative . Interventions that increase influenza vaccination rates among patients at high risk for s. aureus respiratory infections may prevent both co - infection and death.
Adenosine is released into the extracellular space when the oxygen supply is decreased or energy consumption is increased [1, 2]. In particular, significant levels of adenosine are found in the extracellular fluid of solid tumors, suggesting a role for adenosine in tumor growth . Adenosine is an endogenous nucleoside that modulates many physiological processes through its interaction with at least four membrane receptors: a1, a2a, a2b, and a3 [4, 5]. The a2 receptors are divided into two subtypes: high - affinity a2 receptors in rat striatum and low - affinity a2 receptors throughout the brain . These high- and low - affinity receptor subtypes were later designated as a2a and a2b, respectively . It was thought that the a2b receptor plays a small role in vivo because of its relatively low affinity for adenosine . Recently, spychala discovered that activation of adenosine receptors may be involved in tumor progression . In a previous study, we collected 64 samples of hepatocellular carcinoma from clinical patients and found that a2b receptors were highly expressed in tumor tissue and expressed in peritumoral tissues to a lesser extent by real - time pcr, western blot, and immunohistochemical staining . These results indicate that the a2b receptor may contribute to hepatic tumor progression and may represent a good therapeutic target . In recent years, rna interference (rnai) has been widely used to study gene expression regulation in mammalian cells and therapeutic intervention for various diseases including cancer . In this study our vector is based on the psilencer 3.1-h1 neo (hind iii / bamh i) vector (ambion) which contains the human h1 promoter and neomycin resistance gene to enable antibiotic selection in mammalian cells . Three pairs of complementary oligonucleotides (shrna1, shrna2, and shrna3) were synthesized, targeting adenosine a2b receptor cdna (genbank: nm_000676cds 3331331) at nucleotides 591610, 856875, and 909928, respectively . The oligonucleotides encoding the human adenosine a2b receptor shrna targeting the adenosine a2b receptor were as follows (http://www.ambion.com/techlib/resources/rnai/index.html). Shrna 1 5-gatcccgtgctggtgatctacattaattcaagagattaatgtagatcaccagcattttttggaaa-35-agcttttccaaaaaatgctggtgatctacattaatctcttgaattaatgtagatcaccagcacgg-3 5-gatcccgtgctggtgatctacattaattcaagagattaatgtagatcaccagcattttttggaaa-35-agcttttccaaaaaatgctggtgatctacattaatctcttgaattaatgtagatcaccagcacgg-3 5-gatcccgtgctggtgatctacattaattcaagagattaatgtagatcaccagcattttttggaaa-3 5-agcttttccaaaaaatgctggtgatctacattaatctcttgaattaatgtagatcaccagcacgg-3 shrna 2 5-gatcccgtcccattgtctatgcttacttcaagagagtaagcatagacaatggga ttttttggaaa-35-agcttttccaaaaaatcccattgtctatgcttactctcttgaagtaagcatagacaatgggacgg-3 5-gatcccgtcccattgtctatgcttacttcaagagagtaagcatagacaatggga ttttttggaaa-35-agcttttccaaaaaatcccattgtctatgcttactctcttgaagtaagcatagacaatgggacgg-3 5-gatcccgtcccattgtctatgcttacttcaagagagtaagcatagacaatggga ttttttggaaa-3 5-agcttttccaaaaaatcccattgtctatgcttactctcttgaagtaagcatagacaatgggacgg-3 shrna 3 5-gatcccgttatctccaggtatcttctttcaagagaagaagatacctggagataattttttggaaa-35-agcttttccaaaaaattatctccaggtatcttcttctcttgaaagaagatacctggagataacgg-3 5-gatcccgttatctccaggtatcttctttcaagagaagaagatacctggagataattttttggaaa-35-agcttttccaaaaaattatctccaggtatcttcttctcttgaaagaagatacctggagataacgg-3 5-gatcccgttatctccaggtatcttctttcaagagaagaagatacctggagataattttttggaaa-3 5-agcttttccaaaaaattatctccaggtatcttcttctcttgaaagaagatacctggagataacgg-3 all oligonucleotides were synthesized by sbs genetech, ltd . The synthesized shrna cassette was annealed and cloned into the psilencer3.1-h1 neo vector according to the manufacturer's instructions . A blast search with the target sequences was performed to ensure that only the adenosine a2b receptor gene was targeted . A scrambled control plasmid (psilencer-3.1-y) encoding a shrna contained a sequence not present in the mouse, human, or rat genome databases . Shrna 5-gatccagttcaacgaccagtagtcttcaagagagactactggtcgttgaactttttttggaaa-3 and 5-agcttttccaaaaaaagttcaacgaccagtagtctctcttgaagactactggtcgttgaactg-3. 5-gatccagttcaacgaccagtagtcttcaagagagactactggtcgttgaactttttttggaaa-3 and 5-agcttttccaaaaaaagttcaacgaccagtagtctctcttgaagactactggtcgttgaactg-3. 5-gatccagttcaacgaccagtagtcttcaagagagactactggtcgttgaactttttttggaaa-3 and 5-agcttttccaaaaaaagttcaacgaccagtagtctctcttgaagactactggtcgttgaactg-3. Hepg2 cells were cultured in dulbecco's modified eagle's medium (dmem, gibco), supplemented with 10% heat - inactivated fbs in a humidified incubator with 5% co2 at 37c . Cells were transfected with lipofectamine 2000 (invitrogen) according to the manufacturer's instructions with 8 g psilencer 3.1-h1 neo - mix (shrna1, shrna2, and shrna3) and psilencer-3.1-y . One day after transfection, cells were screened in medium containing g418 (0.4 mg / ml) and resistant clones were maintained in medium containing 0.4 mg / ml g418 . Stably transfected cells were plated in 60-mm dishes (1.5 10 per dish). The treated cells were trypsinized and then centrifuged for 2 minutes at 12,000 rpm at 4c . Cell pellets were washed with pbs, collected, and lysed with trizol reagent (gibco). Total rna was isolated by phenol / chloroform extraction, isopropanol precipitation, and 75% ethyl alcohol wash and dissolved in depc water . The reverse transcription reaction was set up according to promega's reverse transcription system protocol using primers for the a2b receptor (forward primer: 5-tccatcttcagccttctggc-3; reverse primer: 5-aaaggcaaggacccagagga-3) and -actin (forward primer: 5-gccctgaggcactcttcca-3; reverse primer: 5-gaaggtagtttcgtggatgcca-3). Each pcr reaction was performed using an optimized number of cycles (25 cycles) of 94c for 1 minute, 56c for 30 seconds, and 72c for 40 seconds, with a final extension of 72c for 7 minutes . The pcr reactions were visualized on a 1.2% agarose gel containing 5 g / ml of ethidium bromide . Intensity of the dna bands was analyzed by glyko bandscan analysis software, using -actin as an internal standard . Cell monolayers in six - well culture plates were washed twice with ice - cold pbs and lysed with 150 l of ripa lysis buffer (0.05 m tris - hcl (ph 7.4), 0.15 m nacl, 0.25% deoxycholic acid, 1% np-40, and 1 mm edta) containing protease inhibitors (1 mm pmsf, 1 g / ml aprotinin, and 1 g / ml leupeptin). Protein concentration was measured (bca protein assay, pierce), and samples were resolved by reducing sds - page, transferred to nitrocellulose, and incubated in blocking buffer (25 mm tris - hcl, ph 8.0, 125 mm nacl, 0.05% tween 20, and 5% bsa). Membranes were incubated with an antibody to the adenosine a2b receptor (chemicon international, diluted 1: 200) at 4c overnight . The membranes were washed in blocking solution and incubated with an hrp - conjugated secondary antibody for 1 hour at room temperature . Blots were exposed to x - ray film for the appropriate time period . A total of 2 10 cells / well were suspended in complete medium containing 0.3% agarose (gibco) and seeded in triplicate in six - well plates onto a bottom layer of complete medium containing 0.6% agarose . A total of 50,000 cells were used for fluorescence - activated cell sorter analysis (facs). Briefly, the cells were harvested, washed twice with pbs buffer, and then incubated at room temperature for 45 minutes . After two pbs washes, the cells were resuspended in pbs and filtered through spectra mesh filters (spectrum). Data were analyzed by cellquest software (becton - dickinson) and the modfit / lt software . At total of 20,000 events hepg2 cells were passed into 96-well plates (1,000 cells / well) 24 hours after transfection . Viability and proliferation of cells were measured using mtt assays from the second until the seventh day after passage . For each group, experiments were carried out a total of three times, and the difference in average od (490 nm) between treated groups was compared using the unpaired, two - tailed t - test . Results were expressed as mean standard error (se). Values with p <0.05 were considered significant . Four pairs of primers were cloned into psilencer3.1-h1 neo (hind iii / bamh i) vector to construct four interfering vectors: psilencer3.1-h1 neo-1, psilencer3.1-h1 neo-2, psilencer3.1-h1 neo-3, and psilencer3.1-h1 neo - y . Plasmids were verified by sequencing (figure 1). To verify the silencing effect of the three sirna vectors, we transfected the three vector psilencer3.1-h1 neo-1, 2, 3 (mixed) and psilencer3.1-h1 neo - y (as control) into the hepg2 cell line . Rt- pcr showed that transfection of mixed vector could decrease the a2b receptor mrna about 66% 5%, while psilencer3.1-h1 neo - y had no effect (figure 2). Western blot analysis of a2b receptor was comparable to the rt - pcr results (figure 3). Cells transiently transfected with psilencer3.1-h1 neo-1, 2, 3 decreased levels of adenosine a2b receptor (about 70% 8%). Cells transfected with psilencer3.1-h1 neo - y had no effect on a2b receptor protein levels . After seven days in culture, we compared the proliferation rate of the three groups of cells . The cells transfected with psilencer3.1-neo - mix showed a significant decrease in the proliferation rate after five days in culture . However, cells transfected with psilencer3.1-neo - y and untransfected cells had similar proliferation rates (figure 4(a)). To determine anchorage - independent growth rates, control - transfected cells showed an average colony forming efficacy of 108 10.7%, compared to untransfected hepg2 cells (= 100%). In contrast, stably transfected cells showed a decreased colony forming ability of 60.33 9.6% compared with hepg2 cells (p <0.05) (figure 4 (b)). To explore the mechanism of growth suppression in a2br - silencing cells, the number of cells in go / g1 phase was 89.56, 62.01, and 56.19% for the psilencer3.1-neo - mix, psilencer3.1-neo - y, and untransfected cells, respectively (figure 5 and table 1). Liver cancer is the fifth most important cancer worldwide in terms of morbidity but the third in terms of mortality . In addition, its mortality has increased in recent years, with 548,600 cases in the year 2000 . Little is known about the mechanisms of hepatocarcinogenesis which seem to differ according to the risk factors involved . Many genes are associated with liver cancer.the p53 protein is involved in cell cycle control, senescence, dna repair, genomic stability, and apoptosis, and different mutations of p53 are involved in hepatocellular carcinoma formation . The prb protein is phosphorylated during the g1 phase of the cell cycle by members of the cyclin - dependent kinase (cdk) the mutation of other genes, including -catenin, smad2, smad4, p16 ink4a, and cyclin d1, may also be implicated in liver cancer . Significant advances have been made in the understanding of the molecular pharmacology and physiological relevance of adenosine receptors, but little is known about a2b receptors . A2b receptors have been implicated in mast cell activation and asthma, vasodilation, regulation of cell growth, intestinal function, and modulation of neurosecretion . In a previous study, we found that a2b receptors were highly expressed in hepatocellular carcinoma tissue, indicating that expression of the a2b receptor may contribute to tumor progression and may be a good therapeutic target for liver cancer . Rna interference (rnai) is a natural silencing process first described in caenorhabditis elegans and drosophila melanogaster by which double - stranded rna initiates and directs the degradation of homologous mrna . Specific inhibition of cellular mrna by rnai can be triggered in mammalian cells by the introduction of synthetic 21- to 23-nucleotide double - stranded small interfering rna (sirna) [26, 27] or alternatively by the transcription of sirna from a dna construct driven by the rna polymerase cassette . Rnai technology has been widely used as an extremely powerful strategy for reverse functional genomics [29, 30] and as an effective method for gene silencing - based therapeutics [31, 32]. Rnai - mediated inhibition of virus infection or replication has been reported for numerous viruses, including several important human pathogens such as hiv-1, hepatitis c virus, and dengue virus [3335]., we constructed three rnai vectors which target the a2b receptor gene to investigate if silencing can convert the tumor phenotype . As shown by rt - pcr and western blot, transfected cells showed specific silencing of the a2b receptor gene without interrupting other molecular interactions . A stably transfected hepg2 cell line which silences the expression of a2b receptors mtt and soft agar assays show that the proliferation rate of the stably transfected cells was significantly decreased compared with control - transfected or untransfected hepg2 cells . Fcm experiments revealed that 89.56 3.15% of stably transfected cells were in the g1 phase . Taken together, these results show that rnai silencing of the a2b receptor gene alters the phenotype of hepg2 cells, and this method might lead to development of novel therapies for the human hepatocellular carcinoma.
They can self - renew and differentiate into several cell lineages, including osteogenesis, adipogenesis and - chondrogenesis.1,2 as a result of these capabilities, mscs play an important role in continuous preservation and repair most tissue types . Generally, it was accepted that the quantity and quality of mscs decrease with aging, which is associated with the progressive failure of function of tissues and organs.3 furthermore, mscs become uncommonly found in bone marrow (- 0.001%). One of the main goals is still to optimize mscs recovery and in vivo expansions so as to fulfill a great deal of functional cells in reasonable times.4 apparently, the various methods for msc isolation can lead to enrichment of different subsets of mscs with different biological properties . Different methods can be customized to gain mscs from the bm: plastic dish adhesion and negative (cd 45, gly - a) or positive selection (cd133, stro-1, and cd49-a).5,6,7,8,9 however, the adherence of mscs to tissue culture plastic surfaces had remained the most traditional and customary of the various msc isolation methods, and the non - adherent cell populations are generally discarded during the first media change . A little study have shown that non - adherent bm cells can lead to colony - forming unit - fibroblasts (cfu - f) in vitro10,11,12,13 and formed bone14 after in vivo transplantation . Various study have exhibited that fibroblast - like cells can be derived from peripheral blood and mobilized from bm by cytokines,15,16 hypoxia17 and acute skin damage.18 the observation imply the existence of non - adherent bm cell populations in bm and these cells maybe circulation when the useful time . Knowledge about the characteristics of non - adherent cell populations opens exciting perspectives in basic research on bone tissue formation and repair . Relatively few articles have been published on this issue, and the results obtained by several authors have suggested that, in non - adherent bone marrow stromal cell populations that may become adherent in vitro, begin to proliferate, and differentiate into several tissue lineages, as well as enhance bone formation in vivo.19 recently, it was showed that the extracellular matrix (ecm) prepared from bone marrow progenitor cells advanced the proliferation of mscs, facilitated master the portion of mscs, and enhanced their capacity for stem cell - based therapy.20 this led us to investigate whether culture of mscs on a quantification of ecm could improve their number and possession . The purpose of current study was to identify characteristic of low - adherent bmmscs obtained by quantification of extracellular matrix and know the response of low - adherent mscs on titanium (ti) surfaces . C3h male mice aged 3 month, weighing 22 g were used in this study and fed a diet of standard commercial mouse chow . All of the animals were handled according to the " recommendations for handling of laboratory animals for biomedical research " complied by the committee on the safety and ethical handling regulations for laboratory animal experiments in the college of dentistry at seoul national university (approval number: snu-120007 - 2). Bm isolation procedure based on the previous studies was utilized.21 femur and tibia were carefully cleaned off soft tissue and bm were harvested by flushing with buffer consisting of phosphate buffered saline (pbs) containing 2% fetal bovine serum (fbs)(equitech - bio inc, kerrville, tx, usa), antibiotics . The bm cells were filtered through a 70 mm nylon mesh filter (falcon, franklin lakes, nj, usa). The collected bm cells were treated with ammonium - chloride - potassium (ack)(lonza, walkersville, md, usa) lysing buffer at rt and centrifuged . The suspension was poured off, and the mononuclear cells were re - suspended with complete alpha - modified eagle's medium (-mem) (life technologies, grand island, ny, usa) supplemented with 15% fbs (life technologies, grand island, ny, usa), glutamine (2 mm), 2-mercaptoethanol (55 m), penicillin / streptomycin (life technologies, grand island, ny, usa) and l - ascorbic acid (100 m)(wako pure, tokyo, japan) and cultured for 14 days at 5% co2 for 37 until the first medium exchange . Constitution of ecm coated dishes was performed as previously described.20 bmmscs were cultured on a dish and, after 1, 4, 7, 10 days of culturing, non - adherent cells were discarded, respectively . The ecm coated dishes was washed with pbs and stored in a humidified atmosphere at 37 with 5% co2 . Non - adherent cells were reseeded on an ecm coated dish to acquire low - adherent bmmscs according to the following steps . For the first media change, the removed media containing cells was centrifuged and cells were replated in an 7 days culturing of adherent bmmscs derived ecm coated dishes and then cultured in a humidified atmosphere at 37 with 5% co2 for 14 days . After the 14 days in culture, the reattached cells were termed low - adherent bmmscs and two additional passages were performed to obtain a sufficient quantity of cells, which were used to conduct the following experiments (fig . The adherent bmmscs and low - adherent bmmscs proliferation was tested using the bromodeoxyuridine (brdu) method following the manufacturer's instructions . Adherent bmmscs and low - adherent bmmscs were seeded on chamber slides (nalge nunc international, rochester, ny, usa) and maintained in the medium . After one day, brdu labeling reagent (invitrogen, frederick, md, usa) were added in the cultures . After 24 hours, the cells were stained with a brdu staining kit (invitrogen, frederick, md, usa). Nine representative active images were used to calculate the number for brdu - stained nuclei, using a microscope . The image was analyzed for determining the brdu - positive staining percentage by manual counting . After 14 days, the cells were stained with 1% toluidine blue solution in 2% paraformaldehyde (pfa). Adherent bmmscs and low - adherent bmmscs were cultured under osteogenesis, and adipogenesis conditions in order to determine their capability to produce bone, adipose cell lineages . After induction, the cells were stained with alizarin red s staining and oil red o staining to detect bone and adipose lineages, respectively . Medium for osteogenic induction: -mem supplemented with 20% fbs (becton dickinson, franklin lakes, nj, usa) l - glutamine (2 mm), 2-mercaptoethanol (55 m)(life technologies, grand island, ny, usa), dexamethasone (10 nm)(sigma, st . Louis, mo, usa), l - ascorbic acid (100 m)(wako pure chemical, richmond, va, usa), -glycerophophate (2 mm) and penicillin & streptomycin (life technologies, grand island, ny, usa). Medium for adipogenic induction: -mem supplemented with 15% fbs (becton dickinson, franklin lakes, nj, usa) l - glutamine (2 mm), 2-mercaptoethanol (55 m), penicillin / streptomycin (life technologies, grand island, ny, usa), l - ascorbic acid (100 m)(wako pure, tokyo, japan), isobutyl - methylxanthine (0.5 mm) (sigma, st . 5 10 cells were washed with fluorescence - activated cell sorting (facs) buffer, incubated with 3% rat serum on ice for 30 min, and immunolabeled with 1 g of r - phycoerythrin (pe)-conjugated monoclonal antibody against mouse cd14, cd34, cd44, cd105, cd117, sca-1, oct-4, and cd29 on ice for 30 min . For immunolabeling with oct-4, the cells were fixed and permeabilized with fixation / permeabilization working solution according to the manufacturer's instructions . The cells were then incubated with oct-4 (santa cruz biotechnology, santa cruz, ca, usa) on ice for 30 min and fluorescent secondary antibody on ice for 30 min . Analyses were executed by facs calibur (becton - dickinson, san joes, ca, usa). Total rna was extracted with trizol reagent (life technologies, carlsbad, ca, usa) from untreated and differentiated adherent bmmscs and low - adherent bmmscs . For rt - pcr, cdna was synthesized with superscript iii first - strand kit (life technologies, carlsbad, ca, usa) using random hexamers, according to the instructions of the manufacturer . The reflection production were resolved by electrophoresis on a 1.5% agarose gel and viewed with sybr green i (life technologies, carlsbad, ca, usa). Both kinds of cultured cells were seeded onto 10 mg of hydroxyapatite / tricalcium phosphate (ha / tcp) powder (zimmer, freiburg, germany) and incubated at 37 with 5% co2 for 2 hours and subcutaneously transplanted into immunocompromised mice . After 8 weeks, the transplants were harvested, fixed, decalcified and paraffin embedded . The paraffin sections were stained with hematoxylin and eosin (h&e) staining . In order to measure cell proliferation of adherent and low - adherent bmmscs on machined and anodized ti disc, an ez - cytox cell viability assay kit (daeil lab service co., seoul, korea) ti disc were made from pure titanium grade iv (warentec co., seoul, korea) with the dimensions of 25 mm diameter and 1 mm thickness . An anodic oxidation ti disc was performed at 300 v in an aqueous electrolytic solution of 0.15 m calcium acetate monohydrate (ca(ch3coo)2.h2o) and 0.02 m calcium glycerophosphate (cac3h7o6p) and machined surface disc with no treatment.22,23 all samples were decontaminated with ethylene oxide gas . Both adherent and low - adherent bmmscs were seeded on machined and anodized ti discs . The optical densities (ods) were assessed using a spectrophotometer at 405 nm, after 1, 4, and 7 days of culturing . Test of normality and equality of variances were applied, and no violations of those basic assumptions were observed . Our study investigated the capability of adherence cells for forming fibroblastic cells on a quantification of ecm coated dishes . Adherent bmmscs were cultured on a dish and, after 1, 4, 7, 10 days, non - adherent cells were discarded by washing with pbs . In the present study, the isolated bm cells were adhered for 48 hours to plastic dishes, and then non - adherent bm cells were transferred and maintained on ecm coated dishes . After the 14 days, we obtained fibroblastic colonies with all of the adherence cells (fig . 2a, fig . However, the number of cfu - f cells was significantly higher when non - adherent cells were cultured on ecm coated dishes, which was made by 7 days of culturing adherent bmmscs (p<.05)(fig . The colony numbers were significantly increased in the 7 days culturing of adherent bmmscs derived ecm coated dishes (fig . The ecm coated dishes which made by 7 days were used for further experiment . To characterize the properties of low - adherent bmmscs, we assessed the proliferation of low - adherent bmmscs by brdu incorporation . Our studies showed there was no different increased in brdu uptake rate between adherent bmmscs (fig . 6b) in terms of their formation of mineralized nodules under the osteogenesis inductive cultures (fig . 6e)(p>.05), which was associated with expression of the runt - related transcription factor (runx2)(fig . 7 g) (p>.05), which was associated with the expression of lipoprotein lipase (lpl)(fig . Both the adherent bmmscs and low - adherent bmmscs positively expressed cd29, cd44, and oct-4 (fig 8a). We observed no differences in the percentage expression of any of the markers used for flow cytometry analysis (p>.05)(fig ., newly formed bone tissues were seen in ha / tcp loaded with either adherent (fig . 9b). There was no significant difference bone formation ability between adherent and low - adherent bmmscs in vivo (p>.05)(fig . The results of the (3-(4, 5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2h - tetrazolium) (mts) assay are shown (fig . Sem image of adherent and low - adherent bmmscs showed spindle - like morphology on ti discs (fig . There was higher cell proliferation appearance in adherent bmmscs and low - adherent bmmscs seeded on anodized ti discs than adherent and low - adherent bmmscs seeded on machined ti discs by time (p<.05)(fig . Bmmscs are usually obtained from bm stromal cells and appeared adherence and colony - forming unit fibroblastic on plastic culture dishes, followed by subsequent proliferation.24 the cfu - f assay has been thought to be an effective method to investigate the selection of bmmscs . It was well known that mscs lose their capability to proliferation as well as their differentiation potentiality upon long time culturing on plastic culture dish.25 in our study, we showed non - adherent cells cultured on ecm coated dishes made by adherent bmmscs exhibited higher cfu - f number than freshly isolated bm cells cultured on plastic dishes . We confirmed in this study that a method of acquisition of low - adherent bmmscs using ecm coated dishes were effective in increasing cell numbers and shortening the cell culture time and maintaining stemness of the stem cells . We also showed in this study that extracellular matrix coated dish made by 7 days culturing of adherent bmmscs was appropriate for obtaining mscs . A possible explanation for this mechanism was that 7 days culturing of adherent bmmscs derived ecm may provide proper composition of the growth factors or cytokines to non - adherent cells . It has been reported that mscs cultured on this ecm showed notable promotion of proliferation and retention of stem cell properties when comparing with cultured on uncoated plastic dish.26 from the point of clinical use, it is important step to obtain sufficient quantity of stem cells in primary cell culture stage . This study revealed a simple method to increase the number of acquired mesenchymal stem cells . Previously study reported that the non - adherent cell suspensions of bm contained non - hematogenous cells which expressed osteoblastic markers.11,27,28 the non - adherent suspension cells contained more osteogenesis progenitors than adherent cells.29 the suspension cells from bm cultures were able to cause adherent stromal cells . It is possible that adherent potential cells existed in the non - adherent suspension cells and they could conduct osteogenic potential to clinical use . Up to date, there was no attempt to confirm the osteogenic ability of these non - adherent cells . In our study, we termed the non - adherent cells adhered to the ecm coated dish as low - adherent bmmscs, because there was no consensus agreement of terming bmmscs . This study was intended to report the characteristic of low - adherent mscs acquired from non - adherent suspension cells which cultured on the ecm coated dishes . Our results showed that the non - adherent cells exhibited adherent morphology, multi - lineage potentiality, and also express mscs surface molecular markers in vitro . In addition, this study confirmed that low - adherent mscs promoted bone formation in vivo . After 8 weeks of subcutaneous transplantation of mscs in immunocompromised mice, many blood vessels were seen in mscs loaded ha / tcp, indicating that adherent bmmscs and low - adherent bmmscs might enhance vascularization to induce new formation of bone tissue, which was found in both cell types, suggesting that low - adherent bmmscs have osteogenic potential in vivo as do adherent bmmscs . Our in vivo results may provide important progress in achieving critical clinical applications of using low - adherent bmmscs . Thus, transplantation of autologous adherent bmmcss or low - adherent bmmscs obtained from adult bm may be able to reconstitute both the hematopoietic cells and their associate osteogenesis environment . Additionally, our results confirmed that low - adherent bmmscs and adherent bmmscs cultured on the anodized ti discs showed higher cell proliferation rates than the machined ti discs along with time . It seems that mscs has affinity to the anodized ti surface instead of the smooth surface as might have been expected . In conclusion, 7 days culturing of adherent bmmscs derived ecm was an appropriate microenvironment of obtaining non - adherent bone marrow cells . Low - adherent bmmscs acquired by 7 days culturing of adherent bmmscs derived ecm coated dishes can adhere, proliferate and differentiate into specialized cell lineages and have function in bone formation . It should be further proved that low - adherent bmmscs may have important clinical therapeutic implication, therefore could be used effectively as adherent bmmscs.
Anorexia nervosa (an) is an eating disorder characterized by severe voluntary restriction of food with resultant major weight loss affecting up to 1% of women in western societies . Patients with an typically have primary or secondary amenorrhea likely due to suppression of the reproductive axis by means of inadequate energy stores . Another consequence of the decreased caloric intake in an patients is a consistently reported decrease in resting energy expenditure (ree). Ree, also known as resting metabolic rate, represents the amount of calories required in a 24-hour period by the body during a nonactive period . Metabolic rate is mainly a function of the activity of lean body mass also known as fat - free mass (ffm). Although a reduced ree theoretically facilitates weight gain during refeeding, ree has also been consistently found to increase with nutritional rehabilitation, thereby potentially rendering weight gain more difficult for patients . Several small studies have proposed explanations for this phenomenon, including that the increase in ree is a reflection of lean body mass growth, a reversal of the initial adaptation to malnutrition, or a defense of low body weight . Most puzzling is that others have found the increase in ree to be disproportionately greater than weight gain and deemed this clear evidence of a strong cellular waste phenomenon or an energy drain of unknown source accounting for the use of extra calories . One possible hypothesis is that reversal of the metabolic consequences of caloric restriction necessitates activation of systems requiring energy . Recently, bone has been recognized as a highly metabolically active tissue requiring energy such that new bone formation is appropriately suppressed with inadequate nutrition . Indeed, reduction in bone mass to the degree of osteopenia and osteoporosis has been observed in over 90% of adolescents with an who have been amenorrheic for more than 6 months . Despite consideration of various therapies, weight restoration, which occurs prior to return of menses, significant increases of bmd have been noted prior to return of menses with an increase in suppressed bone formation and a fall in bone resorption . Osteocalcin and n - telopeptide (ntx), established biochemical markers of bone formation and resorption, respectively, have been shown to appropriately increase and decrease, respectively, with weight recovery accompanied with a 3 - 4% increase in bmd in as little as 4 months . In this longitudinal study in which we examine women with an before and after weight normalization and compare them with healthy female control subjects, we propose that a substantial amount of the unexplained increase in ree during refeeding of an patients is channeled towards bmd recovery such that significant bone rebuilding is required before energy stores become available for restoration of gonadal function . We studied 37 patients aged 23.4 4.8 (range 1836 years) with an and 16 healthy control women aged 25.1 4.7 (range 1835 years). Patients were receiving inpatient treatment on the eating disorders research unit at the new york state psychiatric institute, columbia university medical center (nyspi, cumc). All met criteria for an from the 4th edition of the diagnostic and statistical manual of mental disorders . Subjects were recruited, screened, and subjected to exclusion criteria as previously described . The 16 healthy control women were recruited from the new york city area and the columbia university campus by public advertisements . All were healthy, eumenorrheic, and matched with patients by age and percentage of ideal body weight (ibw) as previously described . None of the control women had a history of an eating disorder or psychiatric or medical illness . Potential control subjects receiving hormonal or other medications known to affect reproductive function or bone metabolism were excluded . The study protocol was approved by the irb of the nyspi, cumc, and st . Spine, pelvis, leg, and total bmds were determined using dual energy x - ray absorptiometry (dexa) from a dpx scanner (lunar corp ., the reports from the dpx - l scanner (ge systems, madison, wi) were analyzed with the use of version 3.6 software and were used to determine regional bmd of the hip and spine, total body bone mineral content, and total percentage of body fat . The cvs for bmd measurements ranged from 0.5% to 1.0% . When measured by dxa, percentage of body fat is independent of bmd because this value is measured directly by recognized standard means in fat depots at sites where bone is not present . Ffm is calculated by the following: fat mass = weight fat% and ffm = weight fat mass . The chamber was equipped with a high - precision gas (oxygen and carbon dioxide) exchange measurement system . Ree was measured early in the morning, with subjects in a fasted state for 1215 h before the experiment . Subjects remained in the chamber for 1 h, and ree calculations were based on the average of 3 10-minute readings after 30 minutes had elapsed . Serum osteocalcin was measured using a human immunoradiometric assay (immunotopics international, san clemente, ca) with a sensitivity of 0.5 ng / ml and an interassay cv of 5.56.7% . Urine ntx was measured with the use of an enzyme - linked immunoassay (ostex international inc, seattle, wa) with a detection limit of 20 nmol bone collagen equivalent and an interassay cv of 4.1% . Assays for estradiol, fsh, lh, prl, testosterone, dheas, t3 and t4 (both total and free), tsh, and cortisol were performed as previously described . Igf-1 was assessed by ria after alcohol extraction with an intra - assay coefficient of variation of 2.43.0% (nichols institute diagnostics, san juan capistrano, ca). Leptin and total ghrelin levels were measured using commercial elisa kits (diagnostic systems, webster, tx). The intra - assay coefficient of variation was 3.6%, and the interassay coefficient of variation was 4.9% . For ghrelin, the intra - assay coefficient of variation was 4.9%, and the interassay coefficient of variation was 5.5%, based on five assays . Blood and urine samples from patients were obtained at the initiation of hospitalization and at maintenance of weight gain to 90% ibw for 2 weeks except for one patient who reached 79% ibw . Venous samples from controls and menstruating subjects were obtained during the follicular phase of the menstrual cycle (days 310) as determined by a take - home ovulation test kit to confirm ovulatory cycles . Treatment for patients with an followed a predominantly behavioral approach at the nyspi aimed at normalizing weight and eating . Target weight was a minimum of 90% ibw based on 1959 metropolitan life actuarial tables . All but one patient reached a minimum of 90% ibw; that patient remained amenorrheic at 79% ibw . Median number of days of admission was 66 . On admission, patients were fed a standard hospital diet of 1800 kcal (55% of energy from carbohydrates, 15% of energy from protein, and 30% of energy from fat), given as 3 meals / d and a snack . Patients were observed to eat 100% of the food prescribed and for 1 h afterwards . If patients did not gain weight, calories were increased in 400-kcal increments in food or liquid nutritional supplement (ensure plus; abbott laboratories, abbott park, il). After a 1 - 2 wk medical stabilization period, patients began the active weight - gain treatment phase that continued until patients reached 90% ibw with weight gain rates as previously described . Formal exercise was not allowed during hospitalization although no effort was made to control for previous exercise load . Next, a 46 wk period of weight maintenance ensued during which patients gained independence and transitioned to outpatient care . Data was analyzed using multiple t - tests, and the probability level was adjusted using the bonferroni correction to compare patients at baseline and after weight gain, those with amenorrhea, those who regained menses, and controls . Multiple comparisons were made with use of the bonferroni method, available in spss software (version 12; spss inc, chicago, il). Initially, patients were analyzed as one group with the use of independent t - tests; later, menstrual status was taken into account . For comparisons with controls, repeated - measures analyses were performed for lh, fsh, estradiol, testosterone, dheas, serum osteocalcin, urine ntx, and leptin after a log transformation that resulted in a sd <20% value for each parameter . Correlations between ree and change in bmd and between ree and ffmi were tested using the pearson linear correlation . When the an patients were refed to 90% ibw, significant increases were observed in bmi, ree, ffmi, osteocalcin, spine and pelvis bmds, lh, fsh, estradiol, leptin, total t3, and igf-1 while cortisol and ghrelin decreased . As the metabolic rate is a function of metabolically active tissues, all of them contained in the ffm, we controlled for differences in ffm between patients with anorexia and controls by using ree / ffm and ree / ffmi . At 90% ibw, significant correlations were observed between ree and changes in spine (r = 0.48, p <0.02) and leg (r = 0.43, p <0.05) bmds as shown in figures 1 and 2, respectively . At 90% ibw, both bmi and weight correlated with change in leg bmd, and total t3 correlated with change in spine bmd (p <0.05). The ree correlations with spine and leg bmds were even more significant after controlling for weight gain, an important predictor of bmd (r = 0.65, p <0.005) and (r = 0.56, p <0.02), respectively . No significant correlations were found between ree and ffmi at baseline or at 90% ibw or between ree and the hormonal parameters including leptin, ghrelin, and igf-1 . Comparison of the patients with an at 90% ibw to controls showed significantly lower bmi, spine, pelvis, leg, and total bmds, lh, fsh, estradiol, and free t4 and higher urine ntx and igf-1 . In contrast to the patients with an, controls exhibited high correlation between ree and ffmi (r = 0.71, p <0.01). As a further analysis, patients were divided into two groups according to menstrual status at the time of treatment after 90% ibw testing: those who remained amenorrheic and those who regained menses . Of note, there was no difference in baseline weight (41.1 kg versus 42.3 kg, amenorrheic versus regained menses). After weight rehabilitation, no differences were observed between the groups in weight, bmi, or ree, but the amenorrheic group had higher urine ntx (p <0.02) and lower estradiol (p <0.006) than those who regained menses . Osteocalcin was also highest in this group, but not significantly so . Compared to controls, the amenorrheic group at 90% ibw had lower bmi (p <0.03), estradiol (p <0.001), spine (p <0.001), pelvis (p <0.0005), leg (p <0.008), and total (p <0.001) bmds and higher igf-1 (p <0.05). Significant correlation between ree and change in spine bmd (r = 0.59, p <0.02) was exhibited in the group who remained amenorrheic without correlation between ree and change in leg bmd (p <0.09). Controlling for weight gain was limited by the number of patients in the group . No difference in bmi, estradiol, igf-1, or bmds was exhibited in the group who regained menses compared with controls, indicating near recovery of bone mass and gonadal function . Interestingly, no significant correlation between ree and changes in bmd was found in this group . The etiology of the increase in ree with refeeding in an patients has been the subject of much debate . This is the first report showing significant correlations between ree and changes in bmd with nutritional rehabilitation . This correlation is apparent in only women who have not yet regained menses, suggesting a physiologic event with bone as a possible metabolic sink or energy drain . Previous studies have not attempted to correlate ree and ffmi in an patients although ree was disproportionately elevated compared to increases in lean body mass . This is the first study to show no correlation between ree and height - normalized ffm indices in an patients despite high correlation in the normal population . The absence of correlation found in our study along with the disproportionate ree elevations previously reported suggest that the increase in ree with refeeding is not accounted for by lean body mass but by another physiologic system undergoing marked energy utilization . During refeeding, the significant correlations between ree and changes in bmd along with the elevated osteocalcin and the increase in igf-1 to induce bone collagen formation suggest bone recovery from the osteopenic or osteoporotic state as a source of the increased ree . The observed correlation of ree with change in bmd in amenorrheic subjects with low bmds and the lack of correlation in the group with resumed menses and near - normal bmds suggest that the latter group no longer needs to channel the energy towards bone . Indeed, whereas the group who remained amenorrheic continued to exhibit elevated urine ntx, the group who regained menses demonstrated normalization of urine ntx, indicating a return to the normal state of bone resorption . The recent discovery of bone remodeling as a physiologic phenomenon requiring a large amount of energy but serving an evolutionary advantage further supports the notion of bone as a metabolic sink, for the utilization of ree for bone recovery would serve a survival purpose . Indeed, the endocrine manifestations of an typically result from mechanisms designed to preserve energy . Many studies relate osteopenia and osteoporosis in an to nutrition, but observations linking resumption of menses to bone recovery [1921] may be explained by the notion that only after substantial bone recovery occurs are sufficient energy stores available for gonadal recovery . The etiology of bone loss in an is multifactorial, and nutritional factors, particularly igf-1, have been recognized to likely have an important role . The dramatic increases in ree seen with nutritional rehabilitation and weight gain appear to be related to bone recovery . Indeed, a comprehensive study in an following bone indices showed the powerful anabolic effect of nutritional rehabilitation on bone . However, in this study, the authors state that menstrual resumption was required to suppress bone resorption and allow maximal appropriate bone recovery . Yet a quantitative effect of regained menses on bone mass remains unclear . In our study, the group who regained menses had near - normal bmds and no correlation between ree and changes in bmd, suggesting that the majority of bone recovery had already occurred such that resumption of menses would not lead to further significant change . Instead of favorably predicting bmd recovery, menstrual return may indicate adequate replacement of energy stores . One potential regulator linking disordered eating, amenorrhea, and bone is leptin, a fat cell hormone disproportionately lowered by fasting . Leptin thresholds have been associated with increased gonadotropins and leptin administration with resumption of ovulation in hypothalamic amenorrheic women . Recently, leptin receptors were also discovered in bone, thereby providing a possible mechanism for interaction between nutritional and metabolic bone axes and resumption of menses . Our data are consistent with other studies examining the bone and hormonal changes that occur with refeeding in an [2, 9]. In this present study, however, we searched for and found significant correlations between ree and changes in bmd during nutritional rehabilitation . The main limitation was the size of the study population, for a larger sample would allow for control of various variables while examining correlations and would facilitate detection of differences between those who remained amenorrheic versus those who regained menses . Of note, it would have been interesting to follow the bone markers of the amenorrheics at 90% ibw to see if continuation of adequate nutritional intake would reverse bone loss and amenorrhea, two of the many important complications of an . In conclusion, we explore here an alternate hypothesis of the increase in ree during refeeding of an patients to relate the increased energy expenditure to bone formation such that only after substantial bmd recovery are sufficient energy stores available for gonadal recovery . Bone recovery from osteopenic and osteoporotic states may take priority because of its survival advantage, a notion consistent with the reproductive then bone loss that occurs in an . Further research is necessary to identify why one group of an patients recovers bone mass and menses while undergoing the same nutritional rehabilitation as another group yet to recover either . Nonetheless, our hypothesis that bone recovery utilizes a vast amount of energy offers the exciting possibility that prolonged nutritional rehabilitation may lead to recovery from osteopenia and osteoporosis and resumption of menses in the women who remain amenorrheic with low bmd . M. p. warren: consultant / advisory board: pfizer, quatrx, yoplait; grants / research support: ferrring, pfizer; speaker's bureau: amgen, upsher smith, warner chilcott.
Interhemispheric connections are essential components of the complex neural network in eutherian animals [1, 2]. Among such connections, the corpus callosum (cc) is the most prominent commissural connection, composed of callosal axons, in the brain . In humans, the corpus callosum consists of about 200 million axons, making it the most prominent fiber tract within the central nervous system [3, 4]. Many studies have clarified the molecular mechanism involved in the development of the cc in humans using mouse experiments . Callosal neurons are mostly found in layers ii / iii and layer v of the cerebral cortex in rodents . Recently, molecules related to the identities of the general or subtypes of cortical neurons have been disclosed . Alcamo et al . Reported that satb2, a dna - binding protein, has a key role in the specification of callosal neurons and the formation of corticocortical connections . Developmentally, callosal axons from layer v first start to project to the contralateral targets, and callosal axons from the upper layers follow the preexisting axons . After the callosal axons start to elongate, they are guided by many cues within their pathfinding route . Although the importance of such cues in the development of callosal axons has been known for over 30 years, it still remained unclear until recently how these cues help callosal axons encountering them to project precisely to their targets . Recent studies have, however, revealed the detailed mechanisms in the regulation of axon guidance by these structures . Midline structures, which consist of glia and neurons, express or secrete short- or long - range guidance molecules . In the contralateral cortex, where the callosal axons terminate, interactions with postsynaptic neurons play important roles, in an activity - dependent manner, in ensuring proper projections [1012]. In this paper, we first focus on how the callosal axons are guided by the cues that they encounter, namely, the (1) midline structures and (2) neighboring axons, from the time that they start to grow until they reach their targets in the contralateral cortex . Then, we describe the activity - dependent development of the interhemispheric connections . The midline structures mainly consist of glial populations, but also contain neuronal populations . The role of the midline glial structures in the formation of the cc in the mouse brain, these glial structures have been shown to already exist on embryonic day (e) 15.0 and can guide the growth of callosal axons [8, 14, 15]. The midline glial structures mainly consist of four structures: the glial wedge (gw), the indusium griseum (ig), the midline zipper (mz), and the glial sling (gs) [8, 16] (figure 1). The mz is thought to be required for the fusion of the two hemispheres, which facilitates the passage of axons across the midline [9, 17]. The other structures are responsible for promoting the crossing of at least the callosal axons [1823]. These structures help the callosal axons find their correct path by secreting or expressing guidance molecules . Interestingly, shu and richards have illustrated that correct orientation as well as the presence of the gw is required for callosal axons to turn toward the midline; in one experiment, when the gw was replaced with 180 rotation (medial to lateral), the axons turned away from the midline . Studies have gradually uncovered the molecules secreted by the midline structures for callosal axon guidance . The axon guidance cues for callosal neurons secreted by the midline structures have been classified into two types: long range (figures 2(a)2(c)) and short range (figure 2(d)). The long - range guidance molecules are secreted by the midline glial populations, forming a concentration gradient and helping callosal axons pass through the cc with attractive (figure 2(a)) and repulsive signals (figures 2(b) and 2(c)). Slits [15, 24, 25], wnts, netrins [27, 28], draxin, and semaphorins are some of the reported long - range guidance molecules . Have suggested a novel role of slits in regulating the positioning and maturation of the midline glial populations, presumably independent of the activity of its receptor, robo1, in addition to its role as a repulsive axon guidance cue . Wnt5a not only promotes axon outgrowth as a long - range guidance molecule, but also serves as a short - range repulsive axon guidance cue [32, 33]. In addition to the midline structures, other cell populations have also recently been shown to play roles in the formation of the cc . Gabaergic and glutamatergic neurons that transiently exist within the cc have been shown to be able to attract callosal axons . The meninges have also been reported to be involved in the development of the cc . Bmp7 secreted by the meninges has been shown to inhibit the outgrowth of callosal axons, potentially preventing early formation of the cc . The short - range molecules guide axons through transmembrane or membrane - associated proteins (figure 2(d)). Eph receptors are divided into two subclasses, a and b, according to the sequence homology and binding affinity for their ligands, ephrins a and b, respectively [36, 37]. Although the ephrin / eph system signals through eph tyrosine kinase receptors, ephrins can also transduce reverse signals into the cell in which they are expressed . The ephb receptors and ephrin b ligands have been well studied and shown to play important roles in callosal axon pathfinding [39, 40]. Importantly, the complementary expression of multiple ephrin b ligands and ephb receptors in the callosal axons and midline structures has led to the hypothesis that interactions occur between the eph receptors in callosal axons and ephrins in the midline structures or vice versa, although it is also possible that the interactions occur between callosal axonal fibers . The expression of ephrin b ligands in the callosal axons is suggestive of the involvement of reverse signaling, and bush and soriano showed that ephrin - b1 reverse signaling is critical for callosal axon pathfinding, which requires the binding of the psd-95/dlg / zo-1 (pdz) domain - containing proteins for the transduction of this reverse signal . Pioneer neurons represent one of the most important players in callosal axon guidance by other preexisting axons during cc development . On e15.5 in mice, the axons of the pioneer neurons, which originate from the cingulate cortex, cross the midline and enter the contralateral cortex (figure 3(a)) [42, 43]. It has been shown that cc genesis is triggered by these pioneer axons [39, 4245]; pioneer axons are the first to form the path for the commissural neurons through interactions with several cues, including the midline structures, and on e17.0, the most early follower axons from layer v follow those of these pioneer neurons [42, 43, 46] (figure 3(a)). An accepted view is that the follower axons utilize their direct interactions with the pioneer axons to find their correct path of growth, although the molecular mechanism of such interaction remains unclear . Interestingly, piper et al . Described the molecular mechanisms driving the guidance of the cortical pioneers during development . They demonstrated that neuropilin 1 expressed on the cingulate pioneers plays a crucial role in the crossing of the midline by the pioneer while many studies have revealed the indispensable roles of the interactions between the callosal axons and the midline structures, it is still unclear whether axon - axon interactions play important roles in callosal axon pathfinding . Although increasing evidence has revealed the importance of these interactions in other systems, such as the retinal, spinal and olfactory systems [4750], the involvement of such axon - axon interactions in cc development remains to be explored in detail . Have recently reported repulsive interactions between callosal axons originating from the medial and lateral cerebral cortices (figure 3(b)). Based on a previous study by the same group, they focused on epha3, which is preferentially expressed in the callosal axons from the lateral cerebral cortex, and found that knockdown of epha3 in the lateral cortical axons resulted in their disorganized segregation in the cc and disrupted axon pathfinding . They have suggested that epha3 mediates, at least in part, the repulsive interactions between the medial and lateral cortical axons . So far, several studies using knockout and transgenic mice have identified molecules involved in the development of the cc . However, as knockout and transgenic mice show influences of all developmental stages, analyses of these mutant mice are not necessarily sufficient for describing the primary causes of the abnormal phenotypes . Recent studies using in utero electroporation and various culture experiments, including the stripe assay [37, 54, 55], have enabled reasonably easy analysis of each specific stage of cc development . Further experiments focusing on each step of development will be essential to understand the entire process of formation of the cc . To eventually establish interhemispheric connections through the cc, reshaping of the axons is also crucial . The callosal connections are initially exuberant and brushed up by the selective death of neurons and withdrawal and degeneration of axonal collaterals . Since callosal axons start to establish synapses with specific postsynaptic neurons after entering the contralateral hemisphere [39, 57], the involvement of synaptic activity - dependent mechanisms (as well as nonsynaptic activities) in this process of reshaping of the axons has been shown by many studies [57, 58]. In the visual system, for example, the stimuli from the eyes contribute to the formation of the precise patterns of callosal axonal connections [59, 60]. Importantly, although the callosal axons are generally believed to have a simple mirror projection across the cc in the contralateral hemisphere, there are also heterotopic callosal projections . In addition, the tangential distribution of the callosal axon projections is not even in the adult cortex . For example, the callosal connections are highly focused at the level of the primary areas . While these might possibly be established during the later development of the callosal axon projections (i.e., refinement and elimination), establishment of such uneven projections in the early phase of development cannot also be ruled out . Recently, synaptic and non - synaptic activities have also been reported to be involved in the regulation of different aspects of development of the callosal projections besides reshaping of the axons . Blockade of the spontaneous electrical activity of the callosal neurons resulted in abnormal projections in the somatosensory cortex and visual cortex . Interestingly, blockade of the spontaneous electrical activity of projection neurons such as the motor and olfactory neurons also influenced a variety of guidance and adhesion molecules that are critical for their development [6163], suggesting that spontaneous electrical activity of the axons may also have some role in axon guidance . As described above, a number of different control mechanisms are involved in the development of the interhemispheric connections, and disruption of any of these mechanisms may cause malformations of the cc . Some examples are knockout mice lacking some of the molecules involved in the formation of the midline glial structures [1923], gabaergic neurons [34, 64, 65] or pioneer neurons, or the axon guidance mechanism . Phenotypes of such knockout mice are quite varied and range from hypoplasia or partial dysgenesis of the cc to complete dysgenesis and formation of probst's bundles [40, 67], which are also observed in partial dysgenesis . A comparison between mice and humans revealed many similarities in the development of the cc between the mouse brain and human brain . Not only are the midline glial structures conserved in humans, but also the expression profiles of the molecules known to be involved in the formation of the cc are similar between human and mouse brains [9, 69, 70]. In humans, several psychiatric, neurologic, and metabolic disorders have been shown to be associated with congenital agenesis of the cc or the surgical procedure, callosotomy [5, 71, 72]. Among the famous of these reports is the story of the patient with callosotomy who could not verbally describe the stimulation presented to his freshly disconnected right hemisphere . In subjects with complete dysgenesis of the corpus callosum, paul et al . Described that despite having normal iq, individuals with complete dysgenesis of the cc show impaired social intelligence, analyzing their responses to pictures from the thematic apperception test . Moreover, many studies have reported that major mental disorders, such as autism, attention deficit hyperactivity disorder (adhd), and schizophrenia, may be related to the morphology of the cc [7476]. However, the precise nature of these associations remains unclear . How could malformations of the cc have any relation to these disorders? Do the genes associated with these disorders play a role in normal cc development? Future studies on the development of the cc may help elucidate the precise nature of these associations . By integrating information between the right / left hemispheres, interhemispheric connections enable us to accomplish higher brain functions . Development of interhemispheric connections such as the cc is guided by molecules in the axonal environment, under the regulation of a number of different control mechanisms . It would be of great interest to conduct detailed investigation of the mechanisms underlying cc development, especially in view of their relevance in the pathogenesis of human disorders.
A case control study was performed using the dutch pharmo record linkage system (rls) database (www.pharmo.nl). The database contains pharmacy dispensing data (including dispensed drug, type of prescriber, dispensing date, amount dispensed, and written dosage instructions) of about 1 million dutch residents, linked to a nationwide hospital discharge register . Diagnoses are coded according to the international classification of diseases, 9th revision (icd-9). Patients are included irrespective of health insurance or socioeconomic status and represent about 7% of the general population . The pharmo rls database has a high level of completeness, as shown in several independent validation studies . Cases were defined as patients who had sustained their first hip fracture during the 10-year study period (1 january 1991 to 31 december 2002, at least 18 years of age). Up to four controls were selected for each case, matched by year of birth, gender, and geographic location . Control patients were registered in the database and had no record for a hip fracture hospitalization ., we restricted the study population to subjects who were at least 50 years of age at the index date . History of primary ka before index date was determined using icd-9 surgical procedure code 81.54 . Time since onset (recency) of the ka was determined by calculating the time between the index date and the earliest hospital admission for the ka . We created a proxy for unilateral / bilateral ka by stratifying ka patients into (1) subjects with one primary ka record before the index date and (2) those with multiple primary ka records before the index date . In a sensitivity analysis, we stratified patients who had undergone a ka to the region of the body in which oa was recorded . We used icd-9 codes 715.6 (oa of lower leg) as well as 715.0715.5 and 715.7715.9 (oa of other or unspecified regions) to identify a history of oa . In addition, time since onset of oa was calculated similarly to that of time since ka . Odds ratios (ors) for fracture risk were estimated using conditional logistic regression (sas version 9.1.3, phreg procedure; sas institute, cary, nc). The following risk factors were considered as potential confounders: use of benzodiazepines in the 3 months before the index date; use of bronchodilators, inhaled corticosteroids, oral corticosteroids [12, 13], statins, antipsychotics, lithium, antidepressants, beta - blockers, opioids (tramadol and stronger), antiepileptics, thiazide diuretics, renin angiotensin aldosterone system inhibitors, acid suppressants, two or more dispensings of a nonsteroidal anti - inflammatory drug (nsaid), disease - modifying antirheumatic drugs, organic nitrates, antidiabetic drugs, bisphosphonates, hormone - replacement therapy, calcium / vitamin d supplements, digoxin, and other antiarrhythmics within the 6 months before the index date . In addition, a diagnosis of anemia, mental disorders, impaired renal functioning, skin or subcutaneous disease, any serious injury within the year before the index date, or a history of malignant neoplasm, endocrine disorder, cardiovascular disease, obstructive airways disease, inflammatory bowel disease, musculoskeletal diseases (excluding oa), and connective tissue diseases or rheumatoid arthritis ever before index date were considered as potential confounders . Parameters were included in the final regression model if they independently changed the beta coefficient for arthroplasty with> 5% in the logistic regression model . In a sensitivity analysis, we included use of bisphosphonates and hormone - replacement therapy within 6 months before index date in the final regression model, regardless of the change in beta coefficient for arthroplasty caused by these treatments . The longitudinal relationship between the risk of hip fracture and time since ka was visualized using a smoothing spline regression plot (sas version 9.1.3, gplot procedure). A case control study was performed using the dutch pharmo record linkage system (rls) database (www.pharmo.nl). The database contains pharmacy dispensing data (including dispensed drug, type of prescriber, dispensing date, amount dispensed, and written dosage instructions) of about 1 million dutch residents, linked to a nationwide hospital discharge register . Diagnoses are coded according to the international classification of diseases, 9th revision (icd-9). Patients are included irrespective of health insurance or socioeconomic status and represent about 7% of the general population . The pharmo rls database has a high level of completeness, as shown in several independent validation studies . Cases were defined as patients who had sustained their first hip fracture during the 10-year study period (1 january 1991 to 31 december 2002, at least 18 years of age). Up to four controls were selected for each case, matched by year of birth, gender, and geographic location . Control patients were registered in the database and had no record for a hip fracture hospitalization ., we restricted the study population to subjects who were at least 50 years of age at the index date . History of primary ka before index date was determined using icd-9 surgical procedure code 81.54 . Time since onset (recency) of the ka was determined by calculating the time between the index date and the earliest hospital admission for the ka . We created a proxy for unilateral / bilateral ka by stratifying ka patients into (1) subjects with one primary ka record before the index date and (2) those with multiple primary ka records before the index date . In a sensitivity analysis, we stratified patients who had undergone a ka to the region of the body in which oa was recorded . We used icd-9 codes 715.6 (oa of lower leg) as well as 715.0715.5 and 715.7715.9 (oa of other or unspecified regions) to identify a history of oa . In addition, time since onset of oa was calculated similarly to that of time since ka . Odds ratios (ors) for fracture risk were estimated using conditional logistic regression (sas version 9.1.3, phreg procedure; sas institute, cary, nc). The following risk factors were considered as potential confounders: use of benzodiazepines in the 3 months before the index date; use of bronchodilators, inhaled corticosteroids, oral corticosteroids [12, 13], statins, antipsychotics, lithium, antidepressants, beta - blockers, opioids (tramadol and stronger), antiepileptics, thiazide diuretics, renin angiotensin aldosterone system inhibitors, acid suppressants, two or more dispensings of a nonsteroidal anti - inflammatory drug (nsaid), disease - modifying antirheumatic drugs, organic nitrates, antidiabetic drugs, bisphosphonates, hormone - replacement therapy, calcium / vitamin d supplements, digoxin, and other antiarrhythmics within the 6 months before the index date . In addition, a diagnosis of anemia, mental disorders, impaired renal functioning, skin or subcutaneous disease, any serious injury within the year before the index date, or a history of malignant neoplasm, endocrine disorder, cardiovascular disease, obstructive airways disease, inflammatory bowel disease, musculoskeletal diseases (excluding oa), and connective tissue diseases or rheumatoid arthritis ever before index date were considered as potential confounders . Parameters were included in the final regression model if they independently changed the beta coefficient for arthroplasty with> 5% in the logistic regression model . In a sensitivity analysis, we included use of bisphosphonates and hormone - replacement therapy within 6 months before index date in the final regression model, regardless of the change in beta coefficient for arthroplasty caused by these treatments . The longitudinal relationship between the risk of hip fracture and time since ka was visualized using a smoothing spline regression plot (sas version 9.1.3, gplot procedure). Table 1 shows baseline characteristics of the fracture cases and controls . As expected (due to matching), cases and controls had a similar age and gender distribution . Fracture cases had recently used more medication that has been associated with fracture, such as oral glucocorticoids and strong opioid analgesic . Compared to controls, they had more often a history of comorbid conditions.table 1characteristics of hip fracture cases and controlscharacteristiccases (%) controls (%) (n = 6,763)(n = 26,341)gender female4,929 (72.9)19,138 (72.7)age (years) 18701,641 (24.3)6,554 (24.9) 71802,144 (31.7)8,496 (32.3)> 802,978 (44.0)11,291 (42.9)use 6 months prior to index date oral glucocorticoids366 (5.4)918 (3.5) paracetamol882 (13.0)2,247 (8.5)> 1 nsaid929 (13.7)2,584 (9.8) opioids253 (3.7)455 (1.7) dmards115 (1.7)202 (0.8) antipsychotics412 (6.1)921 (3.5) calcium / vitamin d supplements362 (5.4)894 (3.4)hospitalization ever prior to index date osteoarthritis220 (3.3)773 (2.9) rheumatoid arthritis245 (3.6)731 (2.8) musculoskeletal / connective tissue disease (excluding osteoarthritis)469 (6.9)1,328 (5.0) endocrine disorders199 (2.9)381 (1.4) obstructive airway disease266 (3.9)643 (2.4)nsaid nonsteroidal anti - inflammatory drug, dmard disease - modifying antirheumatic drug characteristics of hip fracture cases and controls nsaid nonsteroidal anti - inflammatory drug, dmard disease - modifying antirheumatic drug table 2 shows the relationship between time since ka and the risk of hip fracture . In the adjusted analysis, we found a 54% increased risk of hip fracture among patients with ka (adjusted [adj .] Or = 1.54, 95% confidence interval [ci] 1.161.99). In the sensitivity analysis, use of bisphosphonates and hormone - replacement therapy within 6 months before index date did not substantially change the increased risk (adj . Or = 1.54, 95% ci 1.192.00). Similarly, the increased risk was not changed when looking at subjects aged 50 years only (93.2% of the study population; adj . Or = 1.55, 95% ci 1.192.01). There was a suggestion that the increased risk of hip fracture was greatest in the first few years after the first ka (fig . 1), no substantial differences were found with regard to the proxy for unilateral (adj . Or = 1.40, 95% ci 1.011.95) and bilateral (adj . Or = 1.81, 95% ci 1.202.74) ka (p = 0.34). Furthermore, timing of increased hip fracture risk following the most recent ka was comparable between the two groups (data not shown).table 2risk of hip fracture with knee arthroplastycases (%) controls (%) crude or (95% ci)adj . Or (95% ci)(n = 6,763)(n = 26,341)never knee arthroplasty6,674 (98.7)26,133 (99.2)1.00 referent1.00 referentever knee arthroplasty89 (1.3)208 (0.8)1.69 (1.322.18)1.54 (1.192.00)<2 years before index28 (0.4)69 (0.3)1.60 (1.032.49)1.43 (0.892.29)25 years before index40 (0.6)79 (0.3)2.01 (1.372.96)1.96 (1.312.92)>5 years before index21 (0.3)60 (0.2)1.37 (0.832.26)1.08 (0.631.85)by number of primary ka records before index one ka record53 (0.8)135 (0.5)1.54 (1.112.12)1.40 (1.011.95) multiple ka records36 (0.5)73 (0.3)1.98 (1.332.96)1.81 (1.202.74)or odds ratio, adj adjusted, ci confidence interval statistically significant differences compared to referentadjusted for use of benzodiazepines within 3 months prior, use of bronchodilators, antipsychotics, antidepressants, opioids, antiepileptics, disease - modifying antirheumatic drugs, calcium / vitamin d supplements, a history of anemia, skin or subcutaneous disease, or serious injuries 1 year prior, malignant neoplasms, endocrine disorders, cardiovascular disease, obstructive airway disease, inflammatory bowel disease, musculoskeletal / connective tissue disease (excluding osteoarthritis), or rheumatoid arthritis ever before index datefig . 1smoothed spline visualization of the relationship between time since first ka and adjusted risk of hip fracture . As shown in table 2 risk of hip fracture with knee arthroplasty or odds ratio, adj adjusted, ci confidence interval * statistically significant differences compared to referent adjusted for use of benzodiazepines within 3 months prior, use of bronchodilators, antipsychotics, antidepressants, opioids, antiepileptics, disease - modifying antirheumatic drugs, calcium / vitamin d supplements, a history of anemia, skin or subcutaneous disease, or serious injuries 1 year prior, malignant neoplasms, endocrine disorders, cardiovascular disease, obstructive airway disease, inflammatory bowel disease, musculoskeletal / connective tissue disease (excluding osteoarthritis), or rheumatoid arthritis ever before index date smoothed spline visualization of the relationship between time since first ka and adjusted risk of hip fracture . Adjusted for confounders as shown in table 2 table 3 shows that the increase in risk of hip fracture in patients with ka was highest in patients aged 1870 years (adj . Or = 2.76, 95% ci 1.166.59). The increase in hip fracture risk rapidly decreased toward baseline levels with increasing age (fig . (95% ci 1.152.57), while the risk was no longer elevated in patients who were older than 80 years (adj . Or = 1.16, 95% ci 0.771.75). The increase in risk of hip fracture tended to be higher in females (adj . Or = 1.62, 95% ci 1.222.15) compared to males (adj . Or = 0.82, 95% ci 0.332.03), although this difference did not reach statistical significance.table 3risk of hip fracture with knee arthroplasty stratified by gender, age and medication usecases (%) controls (%) crude or (95% ci)adj . Or (95% ci)(n = 6,763)(n = 26,341)never knee arthroplasty6,674 (98.7)26,133 (99.2)1.00 referent1.00 referentever knee arthroplasty89 (1.3)208 (0.8)1.69 (1.322.18)1.54 (1.192.00)by gender males7 (0.1)24 (0.1)1.17 (0.502.74)0.82 (0.332.03) females82 (1.2)184 (0.7)1.76 (1.352.29)1.62 (1.222.15)by age (years) 187013 (0.2)13 (0.0)4.18 (1.909.19)2.76 (1.166.59) 718043 (0.6)95 (0.4)1.82 (1.262.63)1.72 (1.152.57) > 8033 (0.5)100 (0.4)1.27 (0.851.89)1.16 (0.771.75)by use of pain relievers 6 months before yes43 (0.6)75 (0.3)2.25 (1.553.28)1.93 (1.282.91) no46 (0.7)133 (0.5)1.37 (0.971.92)1.33 (0.931.89)by use of oral corticosteroids 6 months before yes6 (0.1)12 (0.0)1.94 (0.735.18)1.41 (0.474.21) no83 (1.2)196 (0.7)1.68 (1.292.17)1.56 (1.182.05)by use of calcium / vitamin d supplements 6 months before yes7 (0.1)18 (0.1)1.77 (0.734.30)1.40 (0.553.58) no82 (1.2)190 (0.7)1.64 (1.252.15)1.56 (1.182.06)or odds ratio, adj adjusted, ci confidence intervalstatistically significant differencesadjusted confounders as shown in table 2 compared to referent, except for the stratified covariate of interestopioids (tramadol or stronger), paracetamol, or more than one nsaid prescriptionfig . 2smoothed spline visualization of the association between first ka and adjusted risk of hip fracture, by age at the index date . Dashed lines represent 95% confidence interval bands . Adjusted for confounders as shown in table 2 risk of hip fracture with knee arthroplasty stratified by gender, age and medication use or odds ratio, adj adjusted, ci confidence interval statistically significant differences adjusted confounders as shown in table 2 compared to referent, except for the stratified covariate of interest opioids (tramadol or stronger), paracetamol, or more than one nsaid prescription smoothed spline visualization of the association between first ka and adjusted risk of hip fracture, by age at the index date . As shown in table 2 ka patients who were dispensed pain relievers (opioids [tramadol or stronger], paracetamol, or more than one nsaid prescription) 6 months before the index date did not have a significantly higher risk of hip fracture (adj . Or = 1.93, 95% ci 1.282.91) compared to patients without a history of pain reliever use (adj . Or = 1.33, 95% ci 0.931.89) 6 months before (p = 0.17) (table 3). Similarly, patients who had used oral corticosteroids in the 6 months before (adj . Or = 1.41, 95% ci 0.474.21) were at the same risk of hip fracture compared to patients without use of oral corticosteroids in the same period (adj . Or = 1.56, 95% ci 1.182.05). Table 4 shows that the association between ka and hip fracture did not substantially change when kas were restricted to patients with a history of oa . The proportion of lower leg oa in patients who had undergone ka was 85% . Ka patients with lower leg oa had the same risk of hip fracture (adj . Or = 1.45, 95% ci 1.081.95) compared to ka patients without correction of lower leg oa (adj . Or = 1.54, 95% ci 1.192.00).table 4risk of hip fracture with knee arthroplasty among osteoarthritis of lower legcases (%) controls (%) crude or (95% ci)adj . Or (95% ci)(n = 6,763)(n = 26,341)never knee arthroplasty6,674 (98.7)26,133 (99.2)1.00 referent1.00 referentever knee arthroplasty89 (1.3)208 (0.8)1.69 (1.322.18)1.54 (1.192.00)by osteoarthritis at any site never before index12 (0.2)21 (0.1)2.23 (1.104.55)1.84 (0.883.85) ever before index77 (1.1)187 (0.7)1.63 (1.242.13)1.48 (1.111.97)by site of osteoarthritis lower leg73 (1.1)179 (0.7)1.61 (1.222.12)1.45 (1.081.95) <2 years before24 (0.4)61 (0.2)1.56 (0.972.50)1.39 (0.832.32) 25 years before32 (0.5)64 (0.2)1.98 (1.293.03)2.00 (1.293.11) > 5 years before17 (0.3)54 (0.2)1.24 (0.722.15)0.93 (0.511.69) other regions4 (0.1)8 (0.0)2.00 (0.606.64)2.17 (0.617.66)or odds ratio, adj adjusted, ci confidence interval * statistically significant differences compared to referentadjusted for confounders as shown in table 2 risk of hip fracture with knee arthroplasty among osteoarthritis of lower leg or odds ratio, adj adjusted, ci confidence interval * statistically significant differences compared to referent adjusted for confounders as shown in table 2 this study showed a 1.5-fold increased hip fracture risk in patients who had undergone a ka . The risk of hip fracture was greatest in young patients (1870 years). With increasing age, we found a rapid decrease in strength of association, which was no longer elevated in patients aged 81 years and above . The association tended to be greater during the first few years after surgery, but it did not reach statistical significance . Recent use of pain relievers or glucocorticoids did not alter the overall risk of hip fracture . This is the second study that has evaluated risk of hip fracture in patients with a history of ka and is in line with the first study, which showed a 58% increased risk of hip fracture in british patients within the first year after their ka . Studies that investigated the association between oa (the main indication for ka) and risk of hip fracture have yielded conflicting findings . Some authors suggested a decreased fracture rate among patients with oa [57], possibly due to higher bmd levels . Although data are controversial, patients with oa may have increased osteoblastic activity at the oa site, resulting into higher bmd levels and therefore lower fracture rates . On the other hand, others reported an increased hip fracture risk, which is in line with our study results . Found an increased risk of both vertebral (2.0-fold) and nonvertebral (1.5-fold) fractures in patients with knee oa . Similarly, arden et al . Demonstrated that patients with knee pain or a clinician diagnosis of knee oa have an increased risk of hip and nonvertebral fractures . This is probably explained by an increased severity of falls since they could not detect an increased number of falls . It should be noted, however, that data collection on falls is often incomplete . This could explain the results of a different study that found an increased occurrence of falls among patients with lower limb oa . Furthermore, looking at differences in fracture types, arden et al . And vestergaard et al . Found a substantially higher increase in risk of hip fracture compared to other fractures (such as distal forearm fractures). This may suggest an important role for the nature of falls in patients with knee oa, as explained by arden et al . A us case control study has shown that hip fractures tend to result from falling sideways or straight down (low walking speed), whereas forearm fractures may be more likely to be the result of falling backward . Overall, our findings support the studies that found an increased hip fracture risk, indicating that the increased number and severity of falls may attenuate any potentially beneficial effects of higher bmd levels on fracture risk in these patients . Given this proposed mechanism, we would have expected hip fracture rates to decrease after the ka procedure as the surgery relieves pain and partially restores the biomechanical properties of the knee . One study reported fewer falls within 1 year after the ka, while a recent danish study could not detect any decreases in hip fracture rates during that period . In line with the danish study and the british study mentioned earlier, we found no obvious decrease in hip fracture risk shortly after the surgery . A possible explanation for our findings is that patients become rapidly more active after their ka, due to effective knee pain relief . This could also explain our observed effect modification by age: the youngest patients were at highest hip fracture risk . Compared with elderly patients, these patients may be more likely to increase their physical activity quickly after surgery . In addition, residual knee pain and stiffness in the first months after surgery may be present in some ka patients and could further explain our observed increased hip fracture risk . Strengths of our study include its population - based setting and that it had a reasonable sample size and longitudinal data collection [10, 1214]. Linkage with the dutch national hospitalization registry assured routinely collected ka surgeries and hip fractures . Limitations include the lack of data on physical activity, which could be an alternative explanation for our observed association between ka and hip fracture . Physical activity is significantly increased in ka patients within 9 months postoperatively, while a rapid increase could potentially initiate falls . In addition, we did not have data on body mass index (bmi), which could have underestimated our observed association between ka and hip fracture . An increased bmi is a well - known risk factor for knee oa, while it is inversely associated with risk of hip fracture . Nevertheless, our findings are similar to the bmi adjusted results from the general practice research database (gprd) study . Similar to the british study, we could not differentiate between the sides of ka or the sides of hip fracture . This information could be helpful in understanding the mechanism of the observed increased risk of hip fracture following ka . Local bone loss may be induced on the side of the replaced knee, possibly resulting in an increased fracture risk of the hip on the same side . The only feasible way to investigate this is to link a dedicated joint registry to a hospital / general practitioner database, which has been planned for the uk national joint registry and the gprd . Furthermore, we did not have data on bmd or falling, which could have been useful for the assessment of causality and the underlying mechanism . Frail, unexposed subject bias may have occurred if ka patients had lower mortality rates compared to subjects who had not undergone ka (due to clinical assessment of operative risk). This was probably not the case: within our control subjects (those without a hip fracture), proportions of cardiovascular hospitalizations were not lower in ka patients (6.7%) compared to patients without a history of ka (4.9%). Unfortunately, we did not have data on other fracture types (such as distal forearm fractures). As our data source only keeps track of hospitalizations, fractures other than those of the hip would suffer from underrecording . Although oa diagnosis and ka surgery have not been validated in this data source, we expect high completeness for ka registration . Our hospitalization source was primarily designed to keep track of economic parameters (e.g., health - care cost). Given the high cost of ka surgery, we would expect adequate recording of this procedure . In conclusion, we showed that ka was associated with a 54% increased risk of hip fracture, which was not influenced by recent use of pain relievers or corticosteroids . The increase in risk was highest among younger patients (<71 years), which may reflect a rapid increase in physical activity immediately after surgery . Risk assessment of hip fracture could therefore be considered in patients who are about to undergo a ka.
Animal and treatment: one week after the artificial insemination, second parity landrace yorkshire crossbred sows were randomly divided into two groups . Sows in control group (n = 6) were fed with standard diet (table 1table 1.composition and nutrient content of the experimental dietcontrolbetaineingredient, g / kgcorn370370wheat300300bran8080soybean meal170170lignocelluloses3030cahpo42020soybean oil88premix2020betaine03digestible energy, mj / kg13.113.1calculated compositioncrude protein,% 1515crude fiber,% 4.54.5calcium,% 0.840.84phosphorous,% 0.650.65 the premix contains (per kg): vitamin a: 240,000 iu; vitamin d3: 60,000 iu; vitamin e: 720 iu; vitamin k3: 30 mg; vitamin b1: 30 mg; vitamin b2: 120 mg; vitamin b6: 60 mg; vitamin b12: 360 mg; niacin: 600 mg; pantothenic acid: 300 mg; folic acid: 6 mg; manganese sulphate: 1.0 g; zinc oxide: 2.5 g; iron sulphate: 4.0 g; copper sulphate: 4.0 g; sodium selenite: 6 mg; calcium: 150 g; phosphorus: 15 g; sodium chloride: 40 g.), and those in betaine group (n = 6) were fed with diet supplemented with 3 g / kg betaine hydrochloride of 98% purity (skystone feed co., ltd ., all animals were treated in the same way of insemination and reared under the same housing condition . The hippocami of male offspring (one per litter) were sampled at delivery, immediately frozen in liquid nitrogen and stored at 80c . * the premix contains (per kg): vitamin a: 240,000 iu; vitamin d3: 60,000 iu; vitamin e: 720 iu; vitamin k3: 30 mg; vitamin b1: 30 mg; vitamin b2: 120 mg; vitamin b6: 60 mg; vitamin b12: 360 mg; niacin: 600 mg; pantothenic acid: 300 mg; folic acid: 6 mg; manganese sulphate: 1.0 g; zinc oxide: 2.5 g; iron sulphate: 4.0 g; copper sulphate: 4.0 g; sodium selenite: 6 mg; calcium: 150 g; phosphorus: 15 g; sodium chloride: 40 g. operating procedures for animal breeding and husbandry were in accordance with technical regulations for commercial pig production for intensive pig farms (gb / t 17824.2 - 2008). The experimental protocol was approved by the animal ethics committee of nanjing agricultural university, with the project number 2012cb124703 . The slaughter and sampling procedures complied with the guidelines on ethical treatment of experimental animals (2006) no . 398 after pretreated with rnase - free dnase, 2 g of total rna was reverse - transcribed to cdna in obedience to the protocol provided in the random hexamer primers kit (promega, madison, wi, u.s.a . ). Two l of diluted cdna (1:25, vol / vol) was used for real - time pcr which was performed with a mx3000p real - time pcr system (stratagene, santa clara, ca, u.s.a . ). All the primers, synthesized by generay biotech, for determining gr total mrna and its variants and internal control (-actin) are listed in table 2table 2.primers for real - time pcr amplification of gr mrna and its variants, segments of gr promotertarget geneproduct lengthprimer sequencereference(bp)(f: forward, r: reverse)gr108f: 5-ccaaactctgccttgtgtgttc-3ay779185r: 5- tgtgctgtccttccactgct-3gr 1 - 4161f: 5-cacacagcacaacctttc-3r: 5-aaccttcacaggagttcc-3gr 1 - 5207f: 5-gcgtgcaacttccttcaa-3r: 5-cttggagtctggctgaga-3gr 1 - 6189f: 5-gagtgggccgcccagacgat-3r: 5-ccccccctcaggcttttat-3gr 1 - 7185f: 5-gcgaagagaaactagagaaa-3r: 5-aaccttcacaggagttcc-3gr 1 - 8144f: 5-tgcccagcgtcgccaaca-3r: 5-ccgcccctcaggcttttat-3gr 1 - 9,10177f: 5-cctgctttcacacgctaa-3r: 5-atcacatgggctctctcc-3gr 1 - 11163f: 5-ctggtggaagtgggcgtgtc-3r: 5-ttcctcccctcaggcttttat-3-actin201f: 5-cccacggaatcgagaaagag-3af057040r: 5-ttgacggaagggcacca-3gr segment1f: 5-cggcgaaggtctaggtacg-3r: 5- gaaggctgccccgtgt-3gr segment2f: 5- tctttgaaccccgcactt-3r: 5- ctcccagcgacaaaccag-3negative controlf: 5- ctgggcatcagaacctgt-3(actb promoter)r: 5- gagcaatcccctgaagaa-3. Data analysis conformed to the method of 2 . The abundance of gr variants mrna was presented as the percentage of total gr mrna in control group . Protein samples, after being measured concentrations with a pierce bca protein assay kit (no . 23225, thermo, rockford, il, u.s.a . ), were denatured in waterbath for 5 min at 100c and seperated in a 7.5% or 10% sds - page . After protein transfer, nitrocellulose membranes (biotrace, pall co., ann arbor, mi, u.s.a .) Were blocked with 4% bsa and incubated respectively with anti - gr (sc-1004, santa cruz biotechnology, dallas, tx, u.s.a ., 1:500) and anti - actb (ap0060, bioworld, atlanta, ga, u.s.a ., 1:10,000) antibodies overnight at 4c . Bands were visualized by enhanced chemiluminescence with the lumiglo substrate (super signal west pico trial kit, pierce, rockford, il, u.s.a .) And captured by versadoc 4000mp system (bio - rad, hercules, ca, u.s.a .) To calculate the value of band density using quantity one software (bio - rad) automatically . Methylated dna immunoprecipitation analysis: hippocampal genomic dna was sonicated into fragements approximately 500 bp in size . Two g of sonicated dna were denatured and incubated with the antibody against 5-methyl cytosine (ab10805, abcam, cambridge, ma, u.s.a .) To immunoprecipitate the methylated dna fragments . Then, protein g agarose beads were used to capture the dna - antibody complex which was washed and treated with proteinase k to release the precipitated dna . The medip dna was then extracted, purified and used to amplify the fragment of gr promoter by real - time pcr, following the procedure described previously . The promoter region of actb gene containing no cpg sites was amplified to serve as a negative control in medip analysis . Data were normalized against the negative control and presented as the fold change relative to the average value of the control group . Prediction and determination of mirnas: the potential mirnas targeting the 3 utr of gr mrna were predicted with the probability of interaction by target accessibility (pita) algorithm based on the online database of pig micrornas (http://www.mirbase.org/), using microrna prediction tool (http://genie.weizmann.ac.il/pubs/mir07/mir07_prediction.html). Two g of total rna from each piglet were polyadenylated by poly(a) polymerase (pap) at 37c for 1 hr using a poly(a) tailing kit (am1350; ambion, rockford, il, u.s.a . ), according to the manufacturer s instructions . After phenol / chloroform extraction and ethanol precipitation, treated rna was then dissolved and reverse - transcribed using poly(t) adapter and m - mlv (promega). Real - time pcr was performed in an mx3000p (stratagene) with sybr_premix ex taqtm ii (takara, otsu, japan) using a mirna - specific forward primer and a universal reverse primer complementary to part of the poly (t) adapter sequence . The sequences for all the primers and the poly (t) adapter are listed in table 3table 3.primers for real - time pcr amplification of mirnasprimerprimer sequencemir-18b5-taaggtgcatctagtgcagttag-3mir-22 - 3p5-aagctgccagttgaagaactgt-3mir-22 - 5p5-agttcttcagtggcaagcttta-3mir-30a-3p5-ctttcagtcggatgtttgcagc-3mir-30a-5p5-tgtaaacatcctcgactggaag-3mir-130b5-cagtgcaatgatgaaagggcat-3mir-1385-agctggtgttgtgaatcaggc-3mir-181a5-aacattcaacgctgtcggtgagtt-3mir-1835-tatggcactggtagaattcactg-3mir-181d5-cccaccgagggatgaatgtcac-3mir-181c5-aacattcaacctgtcggtgagt-3universal reverse primer 5-tagagtgagtgtagcgagca-3u65-ggcaaggatgacacgcaaat-3poly (t) adapter 5-tagagtgagtgtagcgagcacagaattaatacg actcactataggttttttttttttttttvn-3. The abundance of mirnas was presented as the fold change relative to the average value of the control group . Functional validation of mir-130b and mir-181d: dual luciferase activity assay was used to verify the function of mir-130b and mir-181d targeting gr 3utr in vitro, as previously described . Briefly, fragments of mir-130b and mir-181d precursor and the scramble control (sc) sequences (table 4table 4.nucleotides sequences used in functional validation of mirnasnamesequences (f, forward; r, reverse)mir-130b precursorf:5-gatccccttggcataacgtagcagcacataatggtttgtgggttttgaaaaggtgcaggccatattgtgctgcctcaaaaatacaaggttttttggaaa-3r:5-agcttttccaaaaaagcctgactgatgccctttcatcattgcactgcttcccagtggcccacagtagtgcaacagggaaagagtgtcaggcaggcg-3mir-181d precursorf:5-tgctgcccaccgagggatgaatgtcacgttttggccactgactgacgtgacatttccctcggtggg-3r:5-cctgcccaccgagggaaatgtcacgtcagtcagtggccaaaacgtgacattcatccctcggtgggc-3mir - scf:5-gatccgacttacagccagttcctagtatagtgaagcagcagatggtatactaggaactggctgtaagctttttttggaaa-3r:5-agcttttccaaaaaaagcttacagccagttcctagtataccatctgctgcttcactatactaggaactggctgtaagtcg-3gr 3utr primerf:5-tctagactttcgttggtgtat-3r:5- tctagagcaaacccattggg-3) were subcloned to construct plasmids named psilence - mir-130b, psilence - mir-181d and psilence - mir - sc, respectively (fig . 3afig . 1.rt-pcr demonstrated that hippocampal expression of gr exon 1 - 4 and 1 - 9,10 mrna was higher in betaine - treated group, associated with the higher total gr mrna . Meanwhile, western blotting analysis showed that total gr protein content was not changed so much . Values are means, with their standard errors, and * indicates significant difference between groups at p<0.05, * * means at p<0.01.fig . 2.cpg sites are underlined in detectable segment1 (4861 ~ 4722) and segment2 (1650 ~ 1515) from translation start codon (atg), which were marked as block in gr exon 1 structure diagram (blank arrow). Medip results are presented in column figure, showing dna methylation status of cpgs in segment2 was increased . Values are means, with their standard errors, and * indicates significant difference between groups at p<0.05.fig . (c) statistic results of the data from dual luciferase activity assay system . * * indicate significant difference between groups at p<0.05 and p<0.01, respectively . ). Gr 3 utr sequence was amplified by pcr using the specific primers (table 4), and the product was then subcloned to pgl3-control using xbai (invitrogen, rockford, il, u.s.a .) To construct the pgl3-gr - utr plasmid (fig . Hela cells were transfected with the plasmids with an electroporation device, and prl - tk was used to normalize the transformation efficiency . After 24 hr incubation at 5% co2 and 37c, firefly and renilla luciferase activities were measured, and the targeting efficacy of mirnas in post - transcriptional repression of reporter protein was presented as the fold change relative to the average value of the psilence - mir - sc . Rt - pcr demonstrated that hippocampal expression of gr exon 1 - 4 and 1 - 9,10 mrna was higher in betaine - treated group, associated with the higher total gr mrna . Meanwhile, western blotting analysis showed that total gr protein content was not changed so much . Values are means, with their standard errors, and * indicates significant difference between groups at p<0.05, * * means at p<0.01 . Cpg sites are underlined in detectable segment1 (4861 ~ 4722) and segment2 (1650 ~ 1515) from translation start codon (atg), which were marked as block in gr exon 1 structure diagram (blank arrow). Predicted transcription factor binding sites among segment2 were framed . Medip results are presented in column figure, showing dna methylation status of cpgs in segment2 was increased . Values are means, with their standard errors, and * indicates significant difference between groups at p<0.05 . (b) plasmid structure containing gr 3utr sequences . Cloning region is indicated in dot line with gr 3utr sequences (1,384 bp). (c) statistic results of the data from dual luciferase activity assay system . Statistical analysis: all data were expressed as means sem and analyzed with one - way anova for independent samples with statistical packages for the social sciences (spss) 11.0 for windows . Expression of total gr mrna and the alternative exon 1 mrna variants, as well as the total protein content of gr: as shown in fig . 1, the hippocampal expression of total gr mrna was significantly higher (p<0.01) in offspring piglets born to betaine - treated sows . Seven alternative gr exon 1 mrna variants were detected in the hippocampus of newborn piglets . But, only gr 1 - 4 (p<0.05) and gr 1 - 9,10 (p<0.01) mrna variants were significantly upregulated in betaine group . Nevertheless, no significant alteration was observed in total gr protein content as revealed by western - blot analysis (fig . 1). Methylation level of gr promoter sequences: two segments of gr promoter, 4861 ~ 4722 and 1650 ~ 1515 from translation start codon (atg), were analyzed using medip assay . The sequences of these two segments and the position relative to gr exon 1 variants are shown in fig . 2 . Data from medip analysis indicated that the methylation level of segment 1 (4861 ~ 4722) was not significantly changed, but segment 2 (1650 ~ 1515) was hypermethylated (p<0.05) in betaine group (fig . The transcription factor prediction analysis with patch (http://www.gene-regulation.com/cgi-bin/pub/programs/patch/bin/patch.cgi) showed many potential transcription factor binding sites within this segment (fig . 2). Expression of mirnas targeting gr: the abundance of mir-181a (p<0.05), mir-181d (p<0.01) and mir-130b (p<0.05) was significantly higher in the hippocampus of betaine - treated piglets compared to control counterparts (table 5table 5.expression of mirnas targeting porcine gr 3utrpredicted mirnascontrol (n = 5)betaine (n = 5)p - valuemir-130b1.00 0.091.35 0.090.03 mir-1381.00 0.061.10 0.060.26 mir-18b1.00 0.091.09 0.100.50 mir-181a1.00 0.061.22 0.060.04 mir-181c1.00 0.081.07 0.090.61 mir-181d1.00 0.413.08 0.140.00 mir-1831.00 0.131.29 0.140.16 mir-22 - 3p1.00 0.061.07 0.090.51 mir-22 - 5p1.00 0.101.10 0.110.54 mir-30a-3p1.00 0.091.04 0.050.71 mir-30a-5p1.00 no significant difference was detected for the expression of mir-18b, 22 - 3p/5p, 30a-3p/5p, 138, 183 or 181c between control and betaine - treated groups . Functional validation of mir-130b and mir-181d: the schematic maps of the ssc - mir-130b and ssc - mir-181d over - expression plasmids, as well as the luciferase reporter plasmid containing 1384 bp of pig gr 3 utr, are shown in fig . 3a and 3b, respectively . Overexpression of mir-130b (p<0.05) or mir-181d (p<0.01) was able to significantly reduce the luciferase activity of hela cells transfected with the pig gr 3utr reporter plasmid, as compared with the scramble control (fig . It is well - documented that gr expression can be modulated by maternal nutritional interventions, such as protein restriction in rats [4, 21] and undernutrition in sheep, as well as dietary supplementation of methyl donors in rats and in humans . Moreover, infusion of l - methionine diminished hippocampal gr expression in the adult rat offspring of high licking / grooming and arched - back nursing (lg - abn) mothers . Similarly, maternal dietary supplementation with methyl donor mixture inhibited hippocampal gr expression in three - month - old tame rats . In the present study, however, maternal betaine supplementation increased total gr mrna expression in the hippocampus of newborn piglets . The diverse responses of hippocampal gr expression to maternal methyl donor supplementation may attribute to multiple factors, such as the type and the dose of the substances, the timing and the duration of supplementation, the species, genotype and the age of the animals investigated . Moreover, the distribution patterns of gr exon 1 mrna variants differ significantly between species . In pigs, gr mrna variants, 1 - 4, 1 - 6 and 1 - 9,10, are abundantly expressed and tightly regulated in the hippocampus [29, 31], while in rats, gr 1 - 7 appears to be the most important mrna variant of functional significance in hippocampus . Therefore, it is presumed that the transcriptional regulation of gr expression in hippocampus is complex and species - specific . In our experiment, significant change of hippocampal gr expression in mrna level was observed with maternal betaine treatment, but not in protein level . Probably, potential participant of transcript regulation, such as dna methylation and mirnas, was also induced by maternal betaine to maintain gr protein homeostasis in the hippocampi of these piglets . The effects of maternal methyl donors on the regulation of gr transcription often involve changes of the methylation status in gr promoter regions . Higher choline intake led to hypermethylation of 5 untranslated exon 1f (homologue of exon 1 - 7 in rats) of gr promoter in human placenta, while methionine treatment reversed the hypomethylation of the exon 1 - 7 gr promoter in the hippocampus of adult rat offspring of high lg - abn mothers, as revealed with sodium bisulfite sequencing technique . Nevertheless, it was also reported that feeding methyl - supplemented diet or methyl donor deficiency diet to pregnant dams did not alter the methylation level of gr exon 1 - 7 promoter in the hippocampus of rat offspring . These results suggest that the maternal or prenatal supplementation of methyl donors has minor, if any, effects on methylation status of gr exon 1 - 7 promoter in the hippocampus of rat offspring . In the present study, only two segments in the region of porcine gr promoter were investigated, and the segment (1650 ~ 1515) was found to be hypermethylated in the hippocampus of maternal betaine - treated piglets . The other regions cannot be amplified due to extremely high enrichment of cpgs . Certainly, more detailed and higher resolution analysis of methylation pattern across the whole region of gr promoter is required, by using more powerful techniques, to elucidate the role of cpg methylation in the transcription regulation of different gr mrna variants . It is well known that dna hypermethylation in gene promoter is functioned for suppression of mrna expression when positive transcript factors cannot bind to the corresponding sequences . Otherwise, binding loss of negative transcript factor would contributed to promoting mrna expression, as we previously reported that hypermethylation of differentially methylated regions in igf2 gene promoter was associated with high expression of igf2 mrna . Here, we found that the segment (1650 ~ 1515) of gr gene promoter was hypermethylated, which might co - work with negative transcript factors to improve gr mrna expression . The segment (1650 ~ 1515) is located upstream of the translation start codon (atg) in exon 2, which contains multiple transcription factor binding sites (fig . 2), predicted to be involved in the transcriptional regulation of gr expression . Therefore, feeding betaine - supplemented diet to pregnant sows modulated hippocampal gr transcription in neonatal offspring piglets through, at least partly, alterations of methylation status in gr promoter . Gr expression is also regulated at the post - transcriptional level . In this study, the increased abundance of total gr, as well as its 1 - 4, and 1 - 9,10 mrna variants, did not lead to significant change in the level of gr protein in the hippocampus of betaine - treated piglets . We presumed that there might be mirna - mediated post - transcriptional regulation involved . Methyl donor deficiency (mdd) in utero caused growth retardation of rat fetus at embryonic day 20 associated with upregulated expression of the stat3 regulator mir-124 . We reported previously that feeding betaine - supplemented diet to pregnant sows significantly altered hepatic expression of mir-497 and mir-181 in neonatal offspring piglets . In this study, hippocampal expression of mir-130b, mir-181a and mir-181d was significantly up - regulated in neonatal piglets of betaine group . Overexpression of mir-130b was reported to decrease the expression of endogenous gr protein and the activity of the luciferase reporter containing the 3utr of human gr mrna in gc - sensitive mm.1s cells . In the present study, the suppressive function of ssc - mir-130b and ssc - mir-181d on gr expression was validated in hela cells transfected with a luciferase reporter plasmid containing pig gr 3utr sequence . Mir-181d was previously reported to target methyl - guanine - methyl - transferase gene in human and was implicated to be a potential target for glioma therapy . Furthermore, mir-181d was found to be one of the stress - responsive mirnas which may target a number of stress and metabolic signaling pathways in thymocytes . However, direct evidences to support the suppressive effect of mir-181d on gr expression are lacking . To our knowledge, here, we provide the first evidence that ssc - mir-181d is able to target porcine gr 3utr and suppress the luciferase reporter activity in hela cells . In conclusion, we demonstrate, for the first time, that maternal betaine supplementation during gestation enhances the expression of total gr mrna, as well as its exon 1 - 4 and 1 - 9,10 mrna variants, in the hippocampus of neonatal piglets, without affecting the total cellular gr protein content . Alterations of cpg methylation in the proximal region of gr promoter and modified expression of mirnas targeting 3utr of porcine gr mrna appear to be involved in the regulation of hippocampal gr expression . Long - term follow - up studies are required to evaluate the possible consequences of maternal betaine supplementation regarding the health and performance of pigs in later life.
We report an arboviral outbreak that occurred in gabon, central africa, from march through july 2007, which showed the unexpected extent of the spread of ae . We also describe its association with atypical epidemiologic characteristics such as the co - circulation of chikv and denv-2 and the frequency of human co - infections . The outbreak centered on the capital of gabon; peaked from april through may 2007, in the heat of the long wet season; and subsequently moved north, where the virus sequentially reached several small towns along the route to northern gabon and cameroon (figure 1). Patients with suspected cases exhibited a dengue - like syndrome, including fever, arthralgia, and asthenia . Conjunctival hemorrhage, maculopapular rash, headache, and vomiting were also observed in the most severe cases . Distribution of the outbreak and location of the 7 towns where suspected cases have been laboratory confirmed by using quantitative reverse transcription chikungunya cases are represented by red circles, dengue cases by blue circles, and cases negative for the viruses by green circles . Testing methods are described in the footnote to the table . During the course of the outbreak, 773 early blood samples (i.e., obtained during the first week after the onset of the disease) were collected from febrile patients who visited identified medical health centers in libreville and other towns in gabon (table). Samples were tested for the presence of various arboviral rna genomes by using the taqman quantitative reverse transcription pcr (qrt - pcr) technology and specific primers and probes (protocols available upon request to the corresponding author). Among these 773 patients, 275 and 54 were positive for chikv and denv, respectively, during may and july 2007 (table), with 8 cases of co - infections . Using a dengue serotype - specific qrt - pcr assay, we showed that all denv patients were positive for serotype 2 (denv-2). In all 7 towns investigated on the route from libreville to cameroon (530 km), both chikv and denv-2 human cases were reported, except in cocobeach where only laboratory denv-2 confirmed cases were observed (figure 1). * chikv, chikungunya virus; denv-2, dengue-2 virus; +, positive . Rna was extracted from 50 l of plasma by using the abi prism 6100 nucleic acid prepstation according to the manufacturer s recommended procedures (applied biosystems, foster city, ca, usa). Fifty - microliter aliquots of extracted rna were then used in 100-l high capacity cdna synthesis reactions according to the manufacturer s instructions (applied biosystems). Finally, 10 l of each cdna reaction was then used as template for 50-l quantitative pcrs that contained 200 nmol / l of probe and 900 nmol / l of each primer . The quantitative pcrs were then thermo - cycled in a 7500 real - time pcr system (applied biosystems) according to manufacturer s recommended procedures . The probe used for the chikv, denv, and denv-2 assays were fam - labeled with tamra quencher (applied biosystems). To investigate this atypical scenario further, we analyzed 4,807 mosquitoes belonging to various species of aedes (2,504 ae . Sp . ), anopheles (78 an . Gambiae) and mansonia (120 m. africana, 123 m. uniformis) in 15 different locations in libreville where chikv or denv-2 laboratory confirmed human cases were detected . Pools of 20 mosquitoes (constituted according to species and place of collection) were homogenized by using genogrinder 2000 (ops diagnostics, bridgewater, nj, usa) technology, and then tested for chikv and denv-2 by qrt - pcr . Albopictus were positive for chikv and denv-2, respectively, while no group containing other mosquito species was positive, indicating that ae . These data provide evidence for the presence of chikv and denv in gabon and for their transmission to humans by ae . These epidemiologic results also confirm our previous observation that chikv strains isolated during the gabon outbreak in 2007 belong to the central african lineage and harbor the a226v mutation as a result of adaptation to ae . More surprisingly, our results show that the spread of this mosquito in an area previously occupied predominantly by ae . One denv-2 strain (designated as libreville 2007), isolated from 1 febrile patient by using e6 vero cells was further characterized by full - length genome sequencing (10,695 nt). Phylogenetic analysis showed that the denv-2 gabon 2007 strain belongs to the cosmopolitan, rather than the sylvatic, genotype (figure 2). This cosmopolitan genotype includes mainly asian but also related strains isolated in india, australia, mexico, the indian ocean, and africa (uganda, somalia, and burkina faso), presumably the result of travel to these remote locations by viremic patients or the transportation of commercial goods by ship . Phylogenetic relationships among dengue-2 virus (denv-2) isolates based on full - length sequences (10,695 nt). A total of 85 denv-2 genomes were compared with the human isolate obtained during the gabon outbreak . A neighbor - joining tree was constructed by using mega version 3.2 (www.megasoftware.net) with the kimura 2-parameter corrections of multiple substitutions . Branches are scaled according the number of substitutions per site, and the branch leading to the thailand 94 strain was shortened for convenience . Taken together, these findings document chikv and denv-2 co - circulation that resulted in large simultaneous outbreaks in regions where ae . Notably, we identified 8 patients with blood samples that tested positive for the presence of both chikv and denv-2 genomes, indicating co - infection of these patients by both viruses . However, while unlikely, genetic exchanges between the 2 viruses, either by recombination or complementation, are not definitively excluded . Clinical examination of these patients (all adults, 5 women and 3 men) did not identify specific or severe symptoms, although given the limited number of cases and clinical and biologic investigations, this observation should be interpreted with caution . Although the denv cases were few, 8 of 48 (17%) denv-2 positive patients from towns affected by the 2 outbreaks tested positive for chikv (table). Extrapolation of this result suggests that the total number of denv-2 patients who are superinfected with chikv is likely to be high, which suggests that denv-2 infection is not the antagonist for a secondary chikv infection . In contrast, only 3% of chikv+ patients were also denv-2 +; however, the starting period of time of infection or the sequence of infection by the 2 viruses cannot be assessed . Although concurrent infections of dengue and chikungunya have been reported (14), such denv-2 and chikv co - infections have never been previously associated with transmission by ae . Our study therefore provides a disconcerting example of the unexpected epidemiologic patterns that may be associated with the dispersal of both vectors (ae . Albopictus and ae . Albopictus mosquitoes are now present in several temperate countries of the northern hemisphere where, given the opportunity, they could cause future arboviral epidemics . Albopictus in northern italy (5) provides a potential warning of what might occur much more frequently in the future in europe and even in north america . Introduction of denv or chikv in these regions are likely to generate indigenous transmission by ae . Albopictus.
Plasma cell neoplasms are characterized by the neoplastic proliferation of a single clone of plasma cells, typically producing a monoclonal immunoglobulin . Plasma cell neoplasms can present as a single lesion (solitary plasmacytoma) or as multiple lesions (multiple myeloma). Solitary plasmacytomas most frequently occur in the bone (plasmacytoma of bone), but can also be found outside the bone in soft tissues (extramedullary plasmacytoma).1 approximately 5% of all cases of plasma cell disorders are solitary plasmacytomas of the bone.2 however, the involvement of the pancreas is rare . We report a case of an extramedullary plasmacytoma of the pancreas diagnosed using ultrasonography - guided fine needle aspiration (eus - fna) with a review of the literature . A 58-year - old woman was transferred to our hospital for further evaluation of pelvic pain that was aggravated by walking and began approximately 2 months before admission . The initial laboratory tests showed a hemoglobin level of 10.6 g / dl, and blood urea nitrogen was 12.0 mg / dl . The level of total protein level was 9.7 g / dl and the albumin level was 3.3 g / dl . Skeletal surveys detected a small osteolytic lesion without a sclerotic rim in the left parietal bone and a large bone destructive osteolytic lesion in the right inferior pelvic bone (fig . Further evaluation showed a serum free light chain lambda level of 3,475.3 mg / l and a 2-microglobulin level of 4.6 mg / l . Contrast - enhanced abdominal computed tomography (ct) revealed a suspicious ill - defined marginated mass in the body of the pancreas (fig . 2). To further characterize the lesion, magnetic resonance imaging (mri) of the pancreas was performed . T2-weighted mri indicated that the pancreatic proximal body contained a mass of subtle high signal intensity (fig . Linear eus (eu - me1 ultrasound system; olympus, tokyo, japan) (gf - uct 240; olympus) revealed a 1.21.0-cm sized, hypoechoic, heterogeneous, well - defined round mass in the pancreatic body (fig . 4a); fna was performed via a transgastric approach and five passages were made with a 22-gauge needle (echotip ultra, echo-22; cook endoscopy, winston - salem, nc, usa) (fig . The cytopatholgy results showed a small cell neoplasm and the immunohistochemical profile was compatible with plasmacytoma (fig . The patient began combination therapy consisting of bortezomib, mephalan, and prednisolone with local radiation therapy for the right pelvic bone lesion . Multiple myeloma is a disease characterized by malignant proliferation of plasma cells typically involving medullary bones . Extramedullary plasmacytomas represent 3% to 4% of all plasma cell neoplasms and have a male predominance, with a three to five times higher incidence in men than in women; they usually occur in the sixth and seventh decades of life . Approximately 80% to 90% of tumors develop in the head and neck area, although gastrointestinal involvement has been reported in 10% of cases . Pancreatic involvement of myeloma is relatively rare, with an incidence rate of 2.3% based on autopsy studies . However, previous studies failed to describe the type of disease entity, and did not distinguish between multiple myeloma, myelomatosis, solitary bone myeloma, or extramedullary plasmacytoma.3 - 6 the radiological differentiation of extramedullary plasmacytoma of the pancreas from other pancreatic tumors such as poorly differentiated pancreatic neoplasm, lymphoma, and metastasis is difficult . Most cases of plasma cell infiltration of the pancreas are microscopic, and well - formed masses are unusual . The latter may present as a focal mass or a diffuse enlargement of the pancreas; typically, the patient presents with jaundice and abdominal pain related to the obstruction of the biliary tree because pancreatic plasmacytoma is often located in the head of the pancreas . In the present case, the mass was detected incidentally because it was located in the body of the pancreas . On ultrasound, pancreatic plasmacytoma appears as a multilobulated heterogenous or a homogenous hypoechoic mass . The ct features have been described as a focal multilobulated solid hypodense mass with homogeneous intravenous contrast enhancement or diffuse enlargement of the pancreas . Mri features include pancreatic enlargement with a lobulated contour, lower signal intensity than that of the liver on t1-weighted images, and diffusely increased signal intensity on t2-weighted pulse sequences with heterogeneous enhancement.7,8 in our case, imaging findings were compatible with those of previous western reports . The diagnosis of an extramedullary plasmacytoma is based on evidence of a monoclonal plasma cell tumor outside the bone marrow . In the present case eus - fna has an excellent safety profile regarding the risk of pancreatitis, bleeding, and perforation . Major complications have been reported in 2.5% of 355 patients who underwent eus - fna for a solid pancreatic mass.9 potential complications include acute pancreatitis, infection, and sedation - related complications; no deaths have been reported.10 seeding of the needle track with tumor cells is rare . Previous studies reported that the risk of seeding of pancreatic adenocarcinoma via eus - fna is 2.2%, which is low compared with that (16.3%) of ct or transabdominal ultrasonography - guided percutaneous biopsy.11,12 moreover, seeding of a pancreatic extramedullary plasmacytoma during eus - fna is yet to be reported . In conclusion, we safely performed eus - fna in a patient with pancreatic plasmacytoma, and were able to provide an accurate visualization and histopathologic diagnosis . Although there are approximately three case reports describing pancreatic involvement of multiple myeloma diagnosed by eus - fna in the english language literature,7,13,14 to the best of our knowledge, this is the first time it is reported in korea.
The commingling of pigs and people at agricultural fairs represents a potentially important and inadequately evaluated interface in the evolution and transmission of zoonotic influenza a viruses . This interface may be a critical point for the movement of influenza a viruses and/or genes between human and swine populations . Recent cases of influenza a (h3n2) variant virus (h3n2v) infection in humans have been epidemiologically associated with exposures to swine at agricultural fairs in north america . Since 2009, we have conducted a prospective influenza a virus surveillance study among pigs exhibited at county fairs in ohio . In july 2012, as part of routine sampling, h3n2pm viruses (h3n2 influenza a viruses containing the matrix (m) gene from the influenza a (h1n1) pdm09 virus) were recovered from pigs at a county fair associated with concurrent cases of human h3n2v infections among its participants . Here we report that next generation sequencing of the complete h3n2pm virus genomes, isolated from pigs at the fair, exhibited> 99% similarity at the nucleotide level to h3n2v isolates concurrently recovered from the human cases . As part of our ongoing surveillance project, nasal swabs were collected from 34 randomly selected pigs (out of a total of 348 pigs) exhibited at an ohio county fair on the last day of the fair, 28 july 2012, approximately 7 days after the pigs arrived at the fair . Visual examination of all pigs in the barns immediately prior to sample collection did not reveal any pigs with overt clinical signs consistent with influenza - like illness (ili) although swine exhibitors reported pigs at the fair had a variety of maladies (diarrhea, vomiting and fever) 35 days prior to the sampling day, which resulted in the early dismissal of a few pigs from the fair . Swabs were placed singly into vials containing viral transport media and stored at 80 c until they were tested . Real - time reverse transcriptase polymerase chain reaction (rrt - pcr) was used to screen the original samples for the presence of influenza a virus, to determine hemagglutinin (ha) and neuraminidase subtypes, and to characterize the m gene lineage . Representative influenza a virus isolates were sent to the united states department of agriculture national veterinary services laboratories for confirmational testing and complete genome sequencing using integrated semiconductor sequencing (ion torrent). All eight segments of two isolates were amplified using gene - specific and universal primers for each segment . The cdna was purified and cdna libraries were prepared for the ion torrent using the ionxpress plus fragment library kit (life technologies corp ., grand island, ny, usa) with ion xpress barcode adapters (life technologies corp . ). Prepared libraries were quantitated by qpcr using the ion library quantitation kit (life technologies corp . ). Quantitated libraries were diluted and pooled for library amplification using the ion one touch and es systems (life technologies corp . ). Following enrichment, dna was loaded onto an ion 314 chip (life technologies corp .) And sequenced using the ion pgm 200 sequencing kit (life technologies corp . ). Reference based assemblies were performed using h3n2pm reference sequences generated at national veterinary services laboratories (full open reading frames). The number of bases used for reference - based assembly was equal to the open reading frame length, i.e. 2280 bp for the pb2 gene, 1701 bp for the ha gene, etc . The output of the assemblies generated a full - length contiguous sequence for each gene segment spanning the complete open reading frame . Full - length sequences from the two swine - origin influenza a virus isolates reported here, a / swine / ohio/12tosu268/2012(h3n2) and a / swine / ohio/12tosu293/2012(h3n2), have been deposited in genbank (accession numbers jx534958jx534973). On 27 july 2012, the ohio department of health was notified by a county health department of two individuals who presented with ili to local medical facilities and had significant direct swine contact over a number of days at their local county fair . Specimens were submitted for preliminary testing to the ohio department of health laboratory and then forwarded to the centers for disease control and prevention for final confirmation ., an additional 20 cases of human illness associated with this county fair were confirmed to be caused by h3n2v . Sequences from the influenza a virus isolates recovered from the swine were compared to the human - origin influenza a h3n2v virus sequences (partial and full length) of a / ohio/13/2012(h3n2), a / ohio/14/2012(h3n2), a / ohio/15/2012(h3n2), a / ohio/16/2012(h3n2) and/or a / ohio/20/2012(h3n2) recovered from people with ili following exposure to swine at the fair (global initiative on sharing all influenza data and the influenza research database). All segments were analyzed separately, and their evolutionary history was inferred using the maximum parsimony or maximum likelihood methods . A bootstrap consensus tree inferred from 500 replicates is taken to represent the evolutionary history of the taxa analyzed . The matrix protein tree was obtained using the close - neighbor - interchange algorithm with search level 1 in which the initial trees were obtained with the random addition of sequences (10 replicates). The trees are drawn to scale, with branch lengths calculated using the average pathway method and are in the units of the number of changes over the whole sequence . Influenza a (h3n2) viruses containing the m gene from the influenza a (h1n1) pdm09 virus (h3n2pm) were detected in 31 of the 34 swine nasal swabs using rrt - pcr and h3n2pm viral isolates were recovered from 29 of the 31 rrt - pcr - positive samples . Analysis of the ha gene placed the concurrently recovered h3n2v and h3n2pm isolates tightly within the contemporary cluster iv h3 viruses circulating in the us swine herd (figure 1). The clustering of all ha genes of the human- and swine - origin viruses from this fair suggests common source dissemination . Furthermore, the phylogenetic structure of the ha gene suggests that h3 from the new variant viruses are evolving away from the classical cluster iv h3 . Neuraminidase (figure 2), the polymerase complex (figure 3), nucleoprotein (figure 4) and non - structural (figure 5) genes all show a similar trend with near 99% nucleotide similarity between the swine - origin h3n2pm and human - origin h3n2v viruses (table 1). The m genes of both the h3n2pm and the analyzed h3n2v influenza a viruses clustered into a single clade with h1n1pdm segments from 2009 and 2012 and were separated from m genes from older, as well as more recent classical h3n2 viruses (figure 6). For some segments, isolates from pigs and people from illinois (2011) and nebraska clustered with the h3n2v genes . This study presents clear molecular evidence that pigs and humans were concurrently infected with the same strain of influenza a virus at an ohio county fair in july 2012 . The most recent ancestors of all the genetic segments of the h3n2v / h3n2pm viruses can be found in various triple reassortant h3n2, h1n2 and h1n1 influenza a viruses which have been detected in pigs in north america . The cocirculation of the genetic elements found in the h3n2v / h3n2pm viruses makes reassortment events occurring in swine the most likely path of emergence . Although similar influenza a h3n2pm viruses have been previously reported in pigs and in commercial swine herds, they had not been reported in exhibition pigs temporally and spatially linked to human cases of h3n2v until july 2012 . Twelve pigs at the laporte county fair in northwestern indiana tested positive for h3n2pm in early july 2012, but to date, there has been no documented comparison of genomic sequences of the viruses recovered from people and pigs . The temporal and spatial proximity of the human cases and swine reported here, the frequency of virus isolation from the pigs, and the> 99% sequence identity of the swine- and human - origin viruses originating from this fair clearly demonstrates inter- and intra - species transmission of h3n2pm / h3n2v viruses (figures 16). However, the route by which the virus was introduced into the swine and human populations at the fair has not been resolved . Pigs are unique in their ability to serve as hosts of avian-, swine- and human - origin influenza a viruses and thus have been identified as a source of novel reassortant strains with zoonotic potential . The remarkable nucleotide sequence similarity between the swine - origin and human - origin h3n2 viruses reported here provides evidence that there are few or no adaptive genetic changes needed for the virus to replicate in either host . None of the nucleotide differences between the h3n2pm and h3n2v isolates resulted in a change in the predicted amino acid sequence, although the ambiguous base call at position 221 in the m genes of the h3n2pm isolates makes it unable to predict the resulting amino acid in that position (table 1). Historically, as an influenza a virus emerges in a new host, there is commonly a series of genotypic changes that occur as the virus adapts to grow and transmit more efficiently in the new host . The lack of difference between the genotypes of these isolates suggests that there are virtually no innate species barriers preventing bidirectional interspecies transmission of h3n2pm / h3n2v viruses between humans and pigs . Furthermore, this close phylogenetic relationship between the swine and human viruses is consistent with a recent interspecies transmission . Fortunately, the symptoms exhibited among most human cases of h3n2v in 2012 have been relatively mild and sustained human - to - human transmission of these viruses has not been observed . However, with the growing number of documented human cases during recent months, the continuing evolution h3n2v is a concern . Agricultural fairs are unique settings where pigs and people from multiple sources and immunological status are concentrated at one location, creating an interface where new or existing influenza a viruses and/or genes can move within or between human and swine populations . The repeated swine swine and human swine interactions occurring at agricultural fairs are distinctly different from those occurring in commercial swine production settings . This statement is supported by the increasing number of human h3n2v cases in the united states in late summer 2012 and previously documented influenza a virus transmission from humans - to - swine and swine - to - humans at agricultural fairs . Appropriate steps to prevent and/or reduce intra- and inter - species transmission of influenza a viruses at fairs should be undertaken to protect animal and human health while considering short- and long - term implications for the cultural value of livestock exhibitions . Potential strategies to mitigate the transmission of influenza a viruses between pigs and people are available from several sources including the ohio state university's animal influenza ecology and epidemiology research program website (http://vet.osu.edu/preventive-medicine/aieerp), centers for disease control and prevention and united states department of agriculture information publications.
Hypertrophic cardiomyopathy (hcm) presents with a wide range of phenotypes . Apart from perturbed contractility previous studies have described an increased rv wall thickness as well as an increased rv muscle mass in a substantial proportion of patients with hcm [25]. Echocardiographic tissue doppler studies also found an impairment of rv function in patients with hcm [6, 7]. Cardiovascular magnetic resonance imaging (cmr) is an image modality that combines the advantages of an excellent spatial resolution with the ability to visualise both ventricles using freely selectable image planes and has therefore emerged as gold standard for the rv volume and function measurements [810]. However, rv volumetry is time - consuming and requires dedicated post - processing software . In routine clinical practice, echocardiography is used to get semi - quantitative information about rv function measuring tricuspid annular systolic excursion (tapse). Several recent studies [1114] using a modified tapse adapted from echocardiography have shown good correlation with cmr - derived rv function in a number of clinical conditions . The existing data on cmr - determined tapse measure the maximum apical excursion of the lateral tricuspid annular plane in the four - chamber view with reference to a point in the apex of the right ventricle . Whereas to determine tapse with echocardiography, the m - mode curser is oriented from outside the right ventricle to the junction of the tricuspid valve plane with the rv free wall using the apical four - chamber view . Therefore, in our opinion a cmr approach to measure tapse with a reference point outside the right ventricle would be more comparable with echocardiography . Moreover, patients with hcm have a hypercontractile right ventricle and a significantly greater apical torsion at end systole compared with other clinical conditions . Thus, use of a reference point in the rv apex might distort the longitudinal tapse measurement since the rv apex might leave the central axis plane . Furthermore; no information is so far available for determination of tapse in patients with hcm . Thus, the aim of our study was to evaluate the accuracy of semi - quantitative methods to assess rv function using tapse with a reference point within the ventricle (tapsein) or with one outside the ventricle (tapseout) and rv fractional shortening (rvfs) derived from cmr images in comparison to rv volumetry in patients with hcm . Furthermore, we performed a subgroup analysis in patients with hypertrophic obstructive cardiomyopathy (hocm), as well as in patients with hypertrophic non - obstructive cardiomyopathy (hncm) to test these measurement approaches . A total of 105 consecutive patients with hcm referred for cmr were enrolled at our department between february 2003 and august 2012 . Patients with a pressure gradient> 30 mmhg at rest or after provocation with either valsalva manoeuvre and/or after application of nitroglycerine were classified as hocm . Twenty age - and sex - matched healthy subjects served as controls and satisfied the following criteria: normal physical examination, normal blood pressure (systolic <130 mmhg and diastolic <85 mmhg), normal ecg findings, no history of chest pain or dyspnoea, no diabetes, no hyperlipidaemia and normal 2d echocardiography and doppler examination . Exclusion criteria for healthy controls were the presence of signs or symptoms of cardiac diseases, hypertension, diabetes, smoking, or participation in competitive sports . All patients and volunteers gave informed consent and the study was approved by the local ethics committee . All studies were performed using a 1.5 tesla whole body imaging system (magnetom avanto and sonata, siemens healthcare sector, erlangen, germany) using a four - element (sonata) or a six - element (avanto), phased - array body coil . Cine images were acquired using a balanced segmented steady state free precession (truefisp) sequence in three long - axis views (two-, three-, and four - chamber view) and in multiple short - axis views, covering the entire left ventricle from base to apex . Typical image parameters were: te = 1.2 ms, tr = 3.2 ms, temporal resolution 35 ms, in - plane spatial resolution 1.4 1.8 mm2, slice thickness 8 mm, interslice gap 2 mm . Cmr data were analysed using commercially available software (argus, siemens healthcare). For rv volumetry the short - axis cine loops were reviewed and the end - diastolic and end - systolic frames were identified for each short - axis section position . The first frame of each cine image showing the largest rv cavity area was defined as end - diastole . The phase of end - systole was defined as the frame showing the smallest cavity area . The most basal section was the area of the rv outflow tract below the level of visible pulmonary valve tissue . At the inflow portion of the rv, only the area of the blood pool surrounded by trabeculated ventricular identification of the tricuspid valve annulus was facilitated by the simultaneous display of a cross - referenced four - chamber cine image . Endocardial contours were outlined manually at the boundary between the blood pool and the compact myocardium on each end - diastolic and end - systolic short - axis view cmr image . The workstation calculated end - systolic and end - diastolic rv volumes using a modification of the simpson rule . The rv stroke volume was calculated by subtracting the end - systolic volume (esv) from the end - diastolic volume (edv). The rv ejection fraction (rvef) was calculated by dividing the stroke volume by the edv . On the four - chamber view, the distance between the cutting edge of the tricuspid annulus with the rv free wall and the rv apex or a reference point outside the rv apex were measured in end - diastole (end - diastolic length (edl)in or edlout) and end - systole (end systolic length (esl)in or eslout). The point outside the rv apex was chosen in extension to the rv apex and had to stay unchanged at end - diastole and end - systole . In order to ensure that the reference point outside the rv apex stayed unchanged during end - systole, we left the curser at the point of the chosen reference point while scrolling from end - diastole to end - systole . 1a, b) was defined as the difference between edlin and esl, tapseout (fig . The rvfs was calculated as follows: rvfs (%) = [(edlin eslin)/edl in] 100 .fig . 1schematic figure of tapsein (panel a and b) and tapseout (panel c and d) measurement using a four - chamber cine image . Two separate reference lines are drawn in diastole (right ventricular end - diastolic length [rvedl]) and systole (right ventricular end - systolic length [rvesl]) from the basal lateral tricuspid annulus to a reference point in the right ventricular apex: tapsein (panel a and b) or a reference point outside the right ventricle: tapseout (panel c and d) abbreviations: tapse tricuspid annular systolic excursion schematic figure of tapsein (panel a and b) and tapseout (panel c and d) measurement using a four - chamber cine image . Two separate reference lines are drawn in diastole (right ventricular end - diastolic length [rvedl]) and systole (right ventricular end - systolic length [rvesl]) from the basal lateral tricuspid annulus to a reference point in the right ventricular apex: tapsein (panel a and b) or a reference point outside the right ventricle: tapseout (panel c and d) abbreviations: tapse tricuspid annular systolic excursion to determine interobserver and intraobserver reliability, tapsein and tapseout were measured in the first 20 hcm patients twice by the first observer and once by a second observer . A period of at least 1 week passed between the two measurements made by the first observer . Pearson s correlation coefficients (r) were calculated for the relation between tapsein, tapseout, rvfs and rvef . Additionally, pearson s r was transformed to z using the following formula: z = 0.5[ln(1 + r)-ln(1-r)], where ln is the natural logarithm . Fisher s z was then used for computing 95% confidence intervals (ci) on the difference between correlations . Lower limit of the 95%ci = z-1.96, upper limit of the 95%ci = z + 1.96, = 1/(n-3), whereas r is the correlation coefficient and n = number of observations . Agreement between the measurement of tapsein and tapseout was assessed using the bland - altman method of analysis, providing the mean difference between the measurements (d = bias), the standard deviation (sd) of the differences and the limits of agreement (d 1.96sd, where sd = standard deviation of the differences). A one one - sample t - test against zero for the statistical significance of the observed differences in intraobserver and interobserver variability was performed . The ability of tapsein, tapseout, and rvfs to predict an rvef <45% was calculated using receiver - operating characteristic (roc) analysis . . Analyses were performed with statistical package for social sciences (spss for windows 14.0, chicago, il, usa). A total of 105 consecutive patients with hcm referred for cmr were enrolled at our department between february 2003 and august 2012 . Patients with a pressure gradient> 30 mmhg at rest or after provocation with either valsalva manoeuvre and/or after application of nitroglycerine were classified as hocm . Twenty age - and sex - matched healthy subjects served as controls and satisfied the following criteria: normal physical examination, normal blood pressure (systolic <130 mmhg and diastolic <85 mmhg), normal ecg findings, no history of chest pain or dyspnoea, no diabetes, no hyperlipidaemia and normal 2d echocardiography and doppler examination . Exclusion criteria for healthy controls were the presence of signs or symptoms of cardiac diseases, hypertension, diabetes, smoking, or participation in competitive sports . All patients and volunteers gave informed consent and the study was approved by the local ethics committee . All studies were performed using a 1.5 tesla whole body imaging system (magnetom avanto and sonata, siemens healthcare sector, erlangen, germany) using a four - element (sonata) or a six - element (avanto), phased - array body coil . Cine images were acquired using a balanced segmented steady state free precession (truefisp) sequence in three long - axis views (two-, three-, and four - chamber view) and in multiple short - axis views, covering the entire left ventricle from base to apex . Typical image parameters were: te = 1.2 ms, tr = 3.2 ms, temporal resolution 35 ms, in - plane spatial resolution 1.4 1.8 mm2, slice thickness 8 mm, interslice gap 2 mm . Cmr data were analysed using commercially available software (argus, siemens healthcare). For rv volumetry the short - axis cine loops were reviewed and the end - diastolic and end - systolic frames were identified for each short - axis section position . The first frame of each cine image showing the largest rv cavity area was defined as end - diastole . The phase of end - systole was defined as the frame showing the smallest cavity area . The most basal section was the area of the rv outflow tract below the level of visible pulmonary valve tissue . At the inflow portion of the rv, only the area of the blood pool surrounded by trabeculated ventricular identification of the tricuspid valve annulus was facilitated by the simultaneous display of a cross - referenced four - chamber cine image . Endocardial contours were outlined manually at the boundary between the blood pool and the compact myocardium on each end - diastolic and end - systolic short - axis view cmr image . Trabeculations and papillary muscles were included as part of the rv volume . The workstation calculated end - systolic and end - diastolic rv volumes using a modification of the simpson rule . The rv stroke volume was calculated by subtracting the end - systolic volume (esv) from the end - diastolic volume (edv). The rv ejection fraction (rvef) was calculated by dividing the stroke volume by the edv . On the four - chamber view, the distance between the cutting edge of the tricuspid annulus with the rv free wall and the rv apex or a reference point outside the rv apex were measured in end - diastole (end - diastolic length (edl)in or edlout) and end - systole (end systolic length (esl)in or eslout). The point outside the rv apex was chosen in extension to the rv apex and had to stay unchanged at end - diastole and end - systole . In order to ensure that the reference point outside the rv apex stayed unchanged during end - systole, we left the curser at the point of the chosen reference point while scrolling from end - diastole to end - systole . 1a, b) was defined as the difference between edlin and esl, tapseout (fig . The rvfs was calculated as follows: rvfs (%) = [(edlin eslin)/edl in] 100 .fig . 1schematic figure of tapsein (panel a and b) and tapseout (panel c and d) measurement using a four - chamber cine image . Two separate reference lines are drawn in diastole (right ventricular end - diastolic length [rvedl]) and systole (right ventricular end - systolic length [rvesl]) from the basal lateral tricuspid annulus to a reference point in the right ventricular apex: tapsein (panel a and b) or a reference point outside the right ventricle: tapseout (panel c and d) abbreviations: tapse tricuspid annular systolic excursion schematic figure of tapsein (panel a and b) and tapseout (panel c and d) measurement using a four - chamber cine image . Two separate reference lines are drawn in diastole (right ventricular end - diastolic length [rvedl]) and systole (right ventricular end - systolic length [rvesl]) from the basal lateral tricuspid annulus to a reference point in the right ventricular apex: tapsein (panel a and b) or a reference point outside the right ventricle: tapseout (panel c and d) abbreviations: tapse tricuspid annular systolic excursion to determine interobserver and intraobserver reliability, tapsein and tapseout were measured in the first 20 hcm patients twice by the first observer and once by a second observer . A period of at least 1 week passed between the two measurements made by the first observer . Pearson s correlation coefficients (r) were calculated for the relation between tapsein, tapseout, rvfs and rvef . Additionally, pearson s r was transformed to z using the following formula: z = 0.5[ln(1 + r)-ln(1-r)], where ln is the natural logarithm . Fisher s z was then used for computing 95% confidence intervals (ci) on the difference between correlations . Lower limit of the 95%ci = z-1.96, upper limit of the 95%ci = z + 1.96, = 1/(n-3), whereas r is the correlation coefficient and n = number of observations . Agreement between the measurement of tapsein and tapseout was assessed using the bland - altman method of analysis, providing the mean difference between the measurements (d = bias), the standard deviation (sd) of the differences and the limits of agreement (d 1.96sd, where sd = standard deviation of the differences). A one one - sample t - test against zero for the statistical significance of the observed differences in intraobserver and interobserver variability was performed . The ability of tapsein, tapseout, and rvfs to predict an rvef <45% was calculated using receiver - operating characteristic (roc) analysis . . Analyses were performed with statistical package for social sciences (spss for windows 14.0, chicago, il, usa). Baseline patients and rv cmr characteristics are displayed in table 1 . In the whole cohort of patients with hcm, the mean rvef was normal with a mean of 63 10% . Only 6 (5.7%) patients presented with an impaired rvef <45%; 4 (3.8%) of them had an impaired rvef <40% . Right ventricular end - systolic volume index (rv - esvi) was higher and rvef was lower in patients with hncm compared with those with hocm . In the whole cohort of patients with hcm (n = 105), rvef determined by cmr revealed a weak correlation with tapsein (r = 0.31, 95% ci 0.130.51, p = 0.001) and rvfs (r = 0.35, 95% ci 0.170.56, p = 0.0002) but a moderate correlation with tapseout (r = 0.57, 95% ci 0.460.84, p <0.0001). Comparison of tapsein and tapseout showed a weak correlation (r = 0.35, p = 0.0002).table 1patient characteristics and right ventricular cmr parameterhealthy controls n = 20hcm n = 105 p - valuecontrols vs hcmhocm n = 40hncm n = 65 p - valuehocm vs hncmage (years)53 1356 150.458 1354 160.2male gender (n,%)12 (60)63 (60)0,9925 (63)38 (58)0.9height (m)1.72 0.81.73 0.90.71.74 0.91.72 0.90.1weight (kg)78 1883 170.386 1481 180.1lvot gradient40 (38)40 (100) at rest20 (19)20 (50) after provocation20 (19)20 (50)rv - ef (%) 58 463 100.0566 961 110.01tapsein (cm)2.0 0.32.5 0.90.012.7 0.82.4 1.00.1tapseout (cm)1.9 0.21.8 0.50.11.8 0.51.8 0.50.8rvfs (%) 24 332 100.000234 1031 100.1rv - edvi (ml / m)68 1069 220.966 1770 240.3rv - esvi (ml / m)28 627 120.423 928 130.04rv - svi (ml / m)40 642 120.644 1041 130.2 abbreviations: edvi end - diastolic volume index, ef ejection fraction, esvi end - systolic volume index, fs fractional shortening, hcm hypertrophic cardiomyopathy, hncm hypertrophic non - obstructive cardiomyopathy, hocm hypertrophic obstructive cardiomyopathy, lvot left ventricular outflow tract, rv right ventricular, tapse in tricuspid annular plane systolic excursion with a reference point within the right ventricle, tapse out tricuspid annular plane systolic excursion with a reference point outside the right ventricle patient characteristics and right ventricular cmr parameter abbreviations: edvi end - diastolic volume index, ef ejection fraction, esvi end - systolic volume index, fs fractional shortening, hcm hypertrophic cardiomyopathy, hncm hypertrophic non - obstructive cardiomyopathy, hocm hypertrophic obstructive cardiomyopathy, lvot left ventricular outflow tract, rv right ventricular, tapse in tricuspid annular plane systolic excursion with a reference point within the right ventricle, tapse out tricuspid annular plane systolic excursion with a reference point outside the right ventricle in the subgroup analysis of patients with hocm (n = 40), rvef showed a significant but weak correlation with tapseout (r = 0.36, 95% ci 0.140.62, p = 0.02) and no correlation with tapsein (r = 0.05, 95% ci 0.190.29, p = 0.7) and rvfs (r = 0.20, 95% ci 0.040.44, p = 0.2). In patients with hncm (n = 65), there was a moderate correlation between rvef and tapseout (r = 0.57, 95% ci 0.490.81 p <0.0001) but a weak correlation with tapsein (r = 0.39, 95% ci 0.250.57, p = 0.001) and rvfs (r = 0.38, 95% ci 0.240.56, p = 0.002). In healthy controls, there was a good correlation between rvef and both tapsein (r = 0.69, 95% ci 0.611.09, p = 0.001) and rvfs (r = 0.55, 95% ci 0.380.86, p = 0.01). Furthermore there was a strong correlation between rvef and tapseout (r = 0.80, 95% ci 0.861.34, p <0.0001). The limits of interobserver as well as intraobserver agreement for tapseout measurements were narrower than those for the tapsein measurements (table 2, fig . 2). Additionally, the coefficients of repeatability were lower for the tapseout measurements, indicating better reproducibility (table 2).table 2interobserver and intraobserver reproducibility of tapse and tapse in 20 patients with hypertrophic cardiomyopathytapseout tapsein mean sdlimits of agreementcoefficient of repeatabilitymean sdlimits of agreementcoefficient of repeatability p - valueinterobserver variability0.01 0.120.24 to + 0.220.230.19 0.380.56 to + 0.940.770.001intraobserver variability0.05 0.130.31 to + 0.260.260.02 0.250.48 to + 0.510.50.04 abbreviations: sd standard deviation, tapse tricuspid annular systolic excursionfig . 2bland - altman plots depict interobserver and intraobserver agreement regarding tapseout (a, c) and tapsein (b, d). On each plot, the solid line represents mean value of the differences between measurements between two observers (a, b) or between two observations (c, d). The mean value of the two measurements is plotted along the x - axis and the difference between two observer or observations is plotted along the y axis abbreviations: sd standard deviation, tapse tricuspid annular systolic excursion interobserver and intraobserver reproducibility of tapse and tapse in 20 patients with hypertrophic cardiomyopathy abbreviations: sd standard deviation, tapse tricuspid annular systolic excursion bland - altman plots depict interobserver and intraobserver agreement regarding tapseout (a, c) and tapsein (b, d). On each plot, the solid line represents mean value of the differences between measurements between two observers (a, b) or between two observations (c, d). The mean value of the two measurements is plotted along the x - axis and the difference between two observer or observations is plotted along the y axis abbreviations: sd standard deviation, tapse tricuspid annular systolic excursion figure 3 shows the roc curve analysis of tapseout, tapsein and rvfs in the whole cohort of patients with hcm . The ability to predict an rvef <45% was best for tapseout (auc = 0.83, p = 0.01). P = 0.03) and rvfs (auc 0.74, p = 0.05) were inferior . With a cut - off value tapseout of 1.5 cm, the sensitivity and specificity to detect an rvef 45%was 67% and 82%, respectively.fig . 3receiver - operating characteristic curve of tapseout (solid line), tapsein (dotted line) and rvfs (dashed line) to indicate right ventricular ejection fraction of less than 45% . Abbreviations: sd standard deviation receiver - operating characteristic curve of tapseout (solid line), tapsein (dotted line) and rvfs (dashed line) to indicate right ventricular ejection fraction of less than 45% . Area under the curve was 0.83 for tapseout,0.77 for tapsein and 0.74 for rvfs . Our study demonstrates that cmr - derived tapse measurements using a reference point in the rv apex (tapsein) are not suitable in patients with hcm . Cmr tapse measurements with a reference point outside the right ventricle (tapseout) showed a good correlation with the standard rv volumetric approach in patients with hncm, but only a weak correlation in patients with hocm . Comparison of tapsein and tapseout showed a weak correlation in the whole population . In patients with hcm, rv wall thickening is common and it is well known that the hypertrophic process in hcm is diffuse [25]. Therefore, detection of rv dysfunction might also be important in these patients . A study by mckenna et al . In patients with hcm reported not only a significant association between rv involvement and severity of symptoms but they also found an increased incidence of ventricular tachycardia and supraventricular arrhythmias in patients with hcm and concomitant rv involvement . Moreover, patients with hcm and rv hypertrophy were assumed to present more often with atrial fibrillation . Even in the absence of atrial fibrillation, an increased risk of pulmonary embolism due to rv aneurysm formation associated with a poorer prognosis has been shown . Echocardiographically assessed tapse represents a quick semi - quantitative approach to assess information about the rv function [2224]. Using echocardiography, the two - dimensional m - mode curser is positioned on the lateral tricuspid annulus near the free rv wall in the apical four - chamber view and aligned as close as possible to the apex of the heart . Recent studies using cmr introduced a modified tapse approach with a reference point in the rv apex (tapsein). This approach showed a good correlation with quantitative assessment of rv function in patients with heart failure due to ischaemic heart disease [12, 14, 25], pulmonary artery hypertension [12, 13], brugada syndrome, dilated cardiomyopathy and valvular or congenital heart disease . However, in patients with surgically repaired tetralogy of fallot cmr - derived tapse measurement with a reference point in the rv apex was not a reliable measure of rvef . The authors hypothesised that the poor correlation between tapse and rvef assessed by cmr in repaired tetralogy of fallot patients may be due to the increased function in the apical rv slices and an altered contraction pattern in these patients . The two approaches to determine tapse using either echocardiography or cmr - derived tapse with a reference point in the rv apex (tapsein) are different . Thus, the longitudinal tapse measurement may be falsified by the movement of the rv apex out of the central plane . Therefore, we introduced a new cmr method to determine tapse with a reference point chosen outside the rv which is unaffected by the contraction and the torsion of the apex and is more comparable with the echocardiographic measurements . In this context our results showed that in patients with hcm, tapse measurements with a fixed reference point outside the rv (tapseout) correlated best with the standard rv volumetric approach and seem to reflect more accurately the tricuspid annular systolic excursion than the measurements with the reference point within the right ventricular apex (tapsein). There was a good correlation between rvef and tapseout and a weak correlation with tapsein and rvfs . Furthermore, in patients with hocm, rvef showed a significant but weak correlation with tapseout and no significant correlation with tapsein and rvfs . One could assume that in patients with hcm and especially in patients with hocm who have a predominantly hypercontractile right ventricle and a significantly greater apical torsion at end - systole, the impact of the apical torsion on tapse measurements is not negligible . Our healthy subjects also showed a good correlation to the three - dimensional volumetric approach using tapsein . However, even in our healthy population, cmr - derived tapseout measurements revealed a better correlation to rvef than the tapsein or rvfs indicating that inclusion of the rv apex as a reference point may also affect tapse measurements in healthy volunteers . Furthermore, nijveldt et al . Validated tapse and rvfs as a screening tool to identify patients with rv dysfunction in several clinical conditions . For routine rv screening tapse and rvfs seemed to be easy and reliable methods to identify these patients but they were not sufficient to detect subtle changes in rv function . Comparable with these findings, our results also showed a good performance of all semi - quantitative methods, best for tapseout, to detect rv dysfunction . However, they were also not suitable for the detection of small changes in rv function . To the best of our knowledge the present study is the first to compare cmr - derived tapse measurements using either a reference point inside or outside the rv apex . To date, no data were available on which method to use to achieve the most reliable and reproducible results for rv longitudinal function analysis using cmr . The clinical value of a specific analysis method is determined not only on the basis of its accuracy but also on its reproducibility . There are two main reasons for this finding: a) the above - described pronounced apical torsion of the right ventricle in patients with hcm and b) the fact that the right ventricle is also hypertrophied in patients with hcm which makes it more difficult to identify the rv apex, particularly in end - systole . Furthermore, we investigated for the first time whether a semi - quantitative approach using tapse or rvfs derived by cmr is suitable to describe rv function in patients with hcm . In terms of acquisition, images required for the gold standard volumetric 3d approach and for the semi - quantitative 2d analysis are actually both part of the routine cmr imaging protocol . The 3d approach requires outlining the endocardial border of the right ventricle on each slice of the short - axis stack which takes up to 10 min, depending on the experience of the observer, whereas the 2d approach only requires to determine in end - diastole and end - systole the distance between the cutting edge of the tricuspid annulus with the rv free wall and a reference point outside the right ventricle which can be done in 1 min . Thus, it is advantageous to have a quick 2d screening tool to identify patients with rv dysfunction and to select patients in whom a more detailed analysis would be beneficial . Furthermore, 2d tapse or rvfs measurements can easily be assessed by less experienced readers whereas 3d rv volumetry requires more experience . In our cohort of patients with hcm thus, the suggested tapse cut - off values to discriminate between patients with normal and reduced rvef should be tested in further larger hcm populations . In terms of acquisition, images required for the gold standard volumetric 3d approach and for the semi - quantitative 2d analysis are actually both part of the routine cmr imaging protocol . The 3d approach requires outlining the endocardial border of the right ventricle on each slice of the short - axis stack which takes up to 10 min, depending on the experience of the observer, whereas the 2d approach only requires to determine in end - diastole and end - systole the distance between the cutting edge of the tricuspid annulus with the rv free wall and a reference point outside the right ventricle which can be done in 1 min . Thus, it is advantageous to have a quick 2d screening tool to identify patients with rv dysfunction and to select patients in whom a more detailed analysis would be beneficial . Furthermore, 2d tapse or rvfs measurements can easily be assessed by less experienced readers whereas 3d rv volumetry requires more experience . In our cohort of patients with hcm, there was only a small number of patients with reduced rvef . Thus, the suggested tapse cut - off values to discriminate between patients with normal and reduced rvef should be tested in further larger hcm populations . Cmr - derived tapse measurements using a reference point in the rv apex (tapsein) are not suitable in patients with hcm . Cmr tapse measurements with a reference point outside the rv (tapseout) showed a good correlation with the 3d volumetric determined rvef in patients with hncm but only a weak correlation in patients with hocm . However, the detection of subtle changes in rv function requires the more time - consuming standard 3d quantitative approach.
Type 1 diabetes (t1d) is an autoimmune disease characterized by t cell - mediated destruction of the pancreatic islet beta cells . Multiple genetic loci contribute to t1d susceptibility in humans, with the most responsible locus being the major histocompatibility complex (mhc). The ability of certain class ii mhc genes to influence disease risk has long been appreciated [2, 3]. Multiple studies have also revealed an association with certain class i mhc alleles, including the common hla - a02:01 [413]. These findings are not surprising, given that cd4 and cd8 t cell responses to a variety of beta cell antigens, including insulin, are observed in t1d patients . After the mhc, the locus that confers the strongest susceptibility to t1d in humans is the variable number of tandem repeats (vntr) regulatory region of the insulin gene [1, 15]. Vntr alleles with the smallest number of repeats, designated as class i, predispose to t1d [16, 17], while the longer class iii alleles have a dominant protective effect [15, 18]. Class iii vntr alleles are associated with thymic insulin rna levels that are increased two- to threefold compared to class i alleles, leading to the hypothesis that impaired negative selection of insulin - specific t cells in individuals with class i vntr alleles explains their predisposition to t1d [19, 20]. While findings from a single human study are consistent with this idea, the development of a mouse model for t1d that incorporates the reduced, but not abolished, thymic insulin expression observed in patients would allow for more rigorous future testing of this hypothesis . The nod mouse is the primary rodent model used for studying t1d . Unlike humans, while both genes are expressed in beta cells, ins2 expression predominates in the thymus [2427], with little to no [2527] detectable thymic ins1 expression . Ins2-deficient (ins2) nod mice develop diabetes at an accelerated rate [2830], as do hla - a02:01-transgenic ins2 nod mice, and both ins2-deficient strains have increased insulin - specific islet - infiltrating cd8 t cells compared to their wild - type (wt) counterparts . While these ins2 mouse strains highlight the importance of thymic insulin expression, they do not accurately represent a human patient, where thymic insulin expression is diminished but still present [19, 20]. Here we have developed an hla - a02:01-transgenic nod - based t1d model that is heterozygous (het) for the ins2 allele, resulting in thymic insulin expression that is decreased but not eliminated . The mice develop accelerated disease compared to ins2 mice, and this is true regardless of gender . Immune cell populations are not grossly altered, and the mice exhibit typical signs of islet autoimmunity, including cd8 t cell responses to beta cell peptides also targeted in hla - a02:01-positive t1d patients . This model should find utility as a tool to uncover the mechanisms underlying the association between class i vntr alleles and t1d in humans . It should also aid in preclinical studies to evaluate insulin - targeted immunotherapies for the disease . Nod.2m.hhd mice transgenically express a single - chain chimeric hla - a02:01 molecule in which human 2-microglobulin (2 m) is covalently linked to the 1 and 2 domains of hla - a02:01 . The 3, transmembrane, and cytoplasmic portions of the molecule are derived from h-2d . Mouse class i mhc molecules are not expressed in these mice due to the murine 2 m deficiency . The resulting progeny were bred as appropriate to obtain ins2 and ins2 nod.2m.hhd mice for our studies . Female 2 m mice breed poorly in our hands and so were rarely used for this purpose . Similarly, nod and nod.ins2 mice were intercrossed and the resulting progeny bred as appropriate to obtain ins2 and ins2 nod mice . The hhd transgene and the wt and ko 2 m and ins2 alleles were identified by pcr using the following primer pairs: hhd, 5-cttcatcgcagtgggctac-3 and 5-cggtgagtctgtgagtggg-3; 2 m, 5-gaaacccctcaaattcaagtatactca-3 and 5-gacggtcttgggctcggccatact-3; 2 m, 5-gaaacccctcaaattcaagtatactca-3 and 5-tcgaattcgccaatgacaagacgct-3; ins2, 5-ggcagagaggaggtgctttg-3 and 5-agaaaaccaccagggtagttagc-3; ins2, 5-ggcagagaggaggtgctttg-3 and 5-attgaccgtaatgggatagg-3. All animal experiments were approved by the institutional animal care and use committee of albert einstein college of medicine . Female ins2 and ins2 nod.2m.hhd mice (four each) were sacrificed and thymus was harvested . Total thymic rna was isolated using the rneasy midi kit (qiagen, valencia, ca) and treated with dnase i (qiagen) to eliminate dna contamination . 1.52.3 g of rna was reverse - transcribed to cdna using random hexadeoxynucleotides and oligo dt primers (invitrogen). Equal amounts of cdna were mixed with sybr green pcr master mix (qiagen) and each ins2 primer (5-cttcttctacacacccatgtcc-3 and 5-tctacaatgccacgcttctg-3) or primers for the u6 normalization control (5-ctcgcttcggcagcacatatacta-3 and 5-acgaatttgcgtgtcatccttgcg-3) and brought to a final volume of 25 l . Real - time quantitative rt - pcr was performed in triplicate using an iq5 optical system (bio - rad, hercules, ca). Amplification was carried out as follows: a single denaturing step at 95c for 10 min followed by 40 cycles of 95c for 15 sec, 59c for 30 sec, and 72c for 30 sec, followed by a final extension step of 72c for 3 min . Results were analyzed using the relative expression software tool (rest) [32, 33]. Glucosuria was monitored weekly using diastix reagent strips (bayer, elkhart, in). Mice were considered diabetic after two consecutive positive tests, and the date of the first positive test was recorded as the time of onset of disease . Cells were stained with anti - b220, anti - cd11c, anti - cd4, and anti - cd8 (all from bd biosciences, san jose, ca). In some samples, cells were stained with anti - cd25 (bd biosciences), fixed and permeabilized with fixation / permeabilization buffer (ebioscience, san diego, ca), and stained with anti - foxp3 (ebioscience). To assess insulitis in female nod.2m.hhd and nod.2m.hhd.ins2 mice at 4 and 8 weeks of age, pancreata were fixed in bouin's solution, embedded in paraffin, and sectioned at nonoverlapping levels . Sections were stained with aldehyde fuchsine to readily visualize granulated beta cells and counterstained with hematoxylin and eosin for detection of leukocytes . Islets were scored as previously described: 0, no insulitis; 1, local insulitis without infiltration of islet itself; 2, less than 25% infiltration; 3, 2575% infiltration; or 4, greater than 75% infiltration . An insulitis index was calculated by adding the scores of all islets and dividing by four times the number of islets scored . Islets were isolated from female nod.2m.hhd.ins2 mice at 8 weeks of age by collagenase p perfusion of the common bile duct as previously described . Islets were handpicked using a micromanipulator and a dissecting microscope and up to 50 islets were transferred per well to 24-well plates in 500 l r-10 medium (rpmi 1640 (invitrogen, carlsbad, ca) containing 10% fbs, 1 mm sodium pyruvate, 28 m -mercaptoethanol, 1x nonessential amino acids (invitrogen)) with 50 u / ml recombinant human il-2 (peprotech, rocky hill, nj). Cells were cultured for 7 days at 37c in 5% co2, at which point the majority of the cells are expected to be cd8 t cells . Human hla - a02:01-positive t2 cells, deficient for the transporter associated with antigen processing, were cultured at 26c overnight prior to use . Elispot plates (millipore maha s4510, billerica, ma) were coated with anti - mouse ifn antibody (bd biosciences) and blocked with 1% bovine serum albumin (sigma - aldrich, st . T2 cells were plated at 2 10 cells / well and pulsed with 10 m of the indicated peptides for 1 hour at 26c . Cultured islet - infiltrating t cells from nod.2m.hhd.ins2 mice were added at 2 10 cells / well in 50 l r-10 . Wells were then washed with 0.05% tween 20/pbs and biotinylated anti - mouse ifn detection antibody (bd biosciences) was added for 2 hours at 37c . After washing, streptavidin - alkaline phosphatase (zymed laboratories, carlsbad, ca) was added and incubated for 1 hour at 37c . Wells were washed and spots were developed using 5-bromo-4-chloro-3-indolyl - phosphate / nitro - blue tetrazolium substrate (sigma - aldrich). Spots were counted using an automated elispot reader system (autoimmun diagnostika, strassberg, germany). Responses are reported as a stimulation index, which is defined as spot number in response to the test peptide divided by spot number in response to an irrelevant hiv - derived hla - a02:01-binding peptide (slyntvatl). The cutoff for positivity is a stimulation index greater than 2 and a test peptide spot number greater than 5 per 1 10 t cells . A previous study had demonstrated that ins2 mice of mixed, but primarily c57bl/6, background experience a reduction in thymic insulin expression of approximately 40% . To develop a mouse model of t1d having reduced thymic insulin quantity, and also expressing the human class i mhc molecule hla - a02:01, we generated nod.2m.hhd.ins2 mice . Using quantitative rt - pcr, we similarly found a reduction in thymic insulin expression of 35% in female ins2 compared to ins2 mice (n = 4 mice of each genotype). Both female (figure 1(a)) and male nod.2m.hhd.ins2 mice (figure 1(b)) demonstrated accelerated diabetes development compared to their ins2 counterparts . Female nod.2m.hhd.ins2 mice developed diabetes as early as 9 weeks of age and all were diabetic by 27 weeks (figure 1(a)). The first onset of diabetes in ins2 female mice was at 11 weeks, and only 47% developed diabetes by 30 weeks . As also seen in standard nod males [39, 40], diabetes development was slowed and overall incidence was reduced in nod.2m.hhd males (figure 1(b)) compared to females . However, ins2 males exhibited an earlier onset of disease compared to ins2 males (10 weeks versus 17 weeks), and a larger percentage (56% versus 24%) had developed diabetes by 30 weeks of age (figure 1(b)). Thus, both genders of nod.2m.hhd.ins2 mice faithfully model the circumstance in humans where reduced thymic insulin expression is predisposing to t1d [16, 17]. Note that this is not what we observed in the case of nod.ins2 mice, where both female (figure 2(a)) and male ins2 mice (figure 2(b)) exhibit a diabetes profile that is statistically indistinguishable from that of nod mice . To verify that the accelerated diabetes development observed in nod.2m.hhd.ins2 mice could not be attributed to a gross alteration in immune cell populations, we examined the splenocyte composition of 8-week - old female nondiabetic nod.2m.hhd and nod.2m.hhd.ins2 mice (figure 3(a)). It was previously shown that nod.2m.hhd mice have a reduced cd8 t cell population and elevated b and cd4 t cells compared to standard nod mice . This was also true for nod.2m.hhd.ins2 mice, and no differences were observed in any of the cell types analyzed as a percentage of total cells . To investigate whether a reduction in regulatory t cells (treg) might contribute to disease pathogenesis in the ins2 mice, nod.2m.hhd and nod.2m.hhd.ins2 splenocytes were monitored for expression of the characteristic treg cell phenotype, cd4cd25foxp3 . No difference was observed in treg cells as a percentage of cd4 t cells (figure 3(b)). These results indicate that the accelerated diabetes development seen in nod.2m.hhd.ins2 mice is the result of neither an altered immune cell composition nor reduced treg cells, at least at the level investigated here, that is, without regard to antigenic specificity . In mixed background mice carrying zero, one, or two copies of the ins2 gene, furthermore, ins2 mice perform identically to their ins2 counterparts in intraperitoneal glucose tolerance tests . Thus, we hypothesized that the diabetes observed in nod.2m.hhd.ins2 mice was of an autoimmune nature, as is the case for the nod.2m.hhd parent strain, and not a deficiency in pancreatic insulin production due to the presence of only one functional copy of the ins2 gene . To verify this, histological sections of pancreata from female mice at 4 and 8 weeks of age were examined . All mice studied exhibited some degree of insulitis, which progressed significantly with age (figure 3(c)), and islets showing a wide range of immune cell infiltration and beta cell destruction were observed (figure 3(c)). We previously identified several hla - a02:01-restricted beta cell epitopes, derived from the autoantigens insulin and islet - specific glucose-6-phosphatase catalytic subunit - related protein (igrp) that are recognized by islet - infiltrating t cells from nod.2m.hhd mice [31, 42]. To further confirm the autoimmune nature of the diabetes observed in nod.2m.hhd.ins2 mice, islets from 8-week - old females were cultured for 7 days and t cell reactivity to the previously identified beta cell epitopes was monitored by ifn elispot . All mice harbored autoreactive t cells specific for at least two epitopes (figure 3(d)), further confirming the autoimmune nature of their disease . A subset of these epitopes (ins b514, igrp 228236, and igrp 265273) have previously been shown to be recognized by cd8 t cells in hla - a02:01-positive t1d patients [4346], supporting the clinical relevance of the model . Insulin is an important autoantigen recognized by t cells in both human t1d and the nod mouse model of the disease . Reduced thymic insulin expression is associated with susceptibility to t1d in patients [16, 17, 19, 20], suggesting that impaired negative selection of t cells specific for insulin is responsible for this predisposition . Here we have developed and characterized nod.2m.hhd.ins2 mice as a model of t1d that incorporates reduced thymic insulin . We find that, as in patients, disease is accelerated (figure 1), and we suggest these mice as a new diabetes model that can be used to better understand this phenomenon . The nod.2m.hhd.ins2 mice present advantages over other disease models that have been described for this purpose . For example, thymic insulin expression is abolished in nod.ins2 and nod.2m.hhd.ins2 mice, and both exhibit accelerated t1d [2830] and increased insulin - specific islet - infiltrating cd8 t cells when compared to their ins2 counterparts . While these findings suggest the importance of thymic insulin expression, ins2 models do not accurately represent patients, where thymic insulin expression is reduced, but not eliminated [19, 20]. As for nod.ins2 mice, in our hands two earlier studies of nod.ins2 mice also showed no effect on disease in males [29, 30], and only one of the two showed acceleration in females . In contrast, both male and female nod.2m.hhd.ins2 mice show enhanced disease (figure 1). Indeed, the female and male incidence curves are nearly overlapping until 15 weeks of age (cf . These studies should include the quantification of insulin - specific effector t cells and treg and analysis of their phenotype and function . The recently described ability to isolate insulin - specific cd4 t cells from nod mouse strains using enrichment with peptide / mhc tetramer reagents will facilitate this work . In nod mice, establishment of immunological tolerance to insulin can lead to prevention of t1d [4951] and remission of established disease . Because of these findings, there is great interest in immunological interventions for human t1d that seek to manipulate the t cell response to insulin . The nod.2m.hhd.ins2 mouse strain should be considered as an additional preclinical model to be used to evaluate such therapies, as it incorporates aspects of the human disease that are not represented in standard nod mice, including reduced thymic insulin expression . In humans, vntr alleles associated with diminished thymic insulin have been shown to alter the frequency and avidity of insulin - specific t cells, both of which could reasonably influence the outcome of therapies designed to manipulate the immune response to insulin . Given that human insulin - specific cd8 t cells have been shown to have cytotoxic activity against islets, an additional advantage of the nod.2m.hhd.ins2 mouse model is the expression of the t1d - predisposing human class i mhc allele hla - a02:01 [4, 6, 8, 12], which we have shown as supporting the development of t cells specific for hla - a02:01-restricted insulin epitopes in these mice (figure 3(d)). In terms of insulin - specific cd4 t cells, the class ii mhc allele expressed in the nod.2m.hhd.ins2 mice is i - a, which is structurally similar to the human t1d - predisposing hla - dq8 [55, 56]. Indeed, i - a and hla - dq8 are capable of presenting similar peptides [5759]. The nod.2m.hhd.ins2 mouse therefore has a variety of potential uses as a humanized model of t1d, including cd8 and cd4 t cell epitope identification, analysis of the relationship between thymic insulin expression and tolerance, and the evaluation of antigen - specific immunotherapies, particularly those targeting the immune response to insulin . Nod.2m.hhd.ins2 mice represent a model for t1d that incorporates the reduced, but not abolished, thymic insulin expression observed in patients . This model should find utility in investigations to probe the mechanisms underlying the association between reduced thymic insulin expression and t1d in humans . It will also be an important tool for t cell epitope discovery and for the preclinical evaluation of insulin - targeted immunotherapies for the disease.
Stroke is the second leading cause of death worldwide, and the leading cause of neurological disability in adults in developed countries.1 2 recognised risk factors include high blood pressure, heart disease, diabetes, obesity, smoking, alcohol and physical inactivity, but further environmental factors are likely to be relevant to stroke risk . Exposure to psychosocial stress has been identified by several recently conducted studies as a possible stroke risk.35 psychosocial stress, particularly with chronic exposure, is a feasible risk for stroke through its influence on the hypothalamic pituitary adrenal (hpa) axis and sympathetic nervous system, which can result in inflammation and altered metabolic and cardiac autonomic control.6 moreover, stress may be related to lifestyle factors relevant to stroke risk, such as cigarette smoking, physical inactivity and alcohol intake.7 to date, the association between psychosocial stress and stroke has been investigated incompletely.8 recent case - control studies investigating this may have been limited by potential reporting bias, and exclusion of subjects who experienced fatal stroke, as the measure of exposure to stress was collected after onset of stroke.4 9 10 while some prospective studies have been performed,3 5 limited duration of follow - up has not allowed examination of chronic exposure, which may be of particular relevance . Stress susceptibility or stress resilience is an important determinant of the consequences of exposure to stress.11 12 a poorly controlled stress response (potentially signalled by low stress resilience) results in a prolonged physiological response to stressful exposures, thus increasing the possible longer - term adverse consequences of psychosocial stress . Stress resilience may be a useful and underused measure for investigating the consequences of chronic stress in relation to stroke risk . Here, we examine the association of stress resilience in adolescence with subsequent stroke risk in middle age within a general population - based cohort of male swedish residents . Stress resilience was measured during the assessment for military conscription over 10 years prior to stroke and, therefore, not subject to differential reporting bias . A secondary aim was to examine whether other risk factors might mediate associations of stress resilience with stroke risk . At the end of follow - up the subjects were still relatively young, under age 60 years, so the study is of stroke risk during working age rather than the later ages when stroke is more common . The study cohort consists of male swedish residents born between 1952 and 1956, who were eligible for military conscription and included in the swedish military conscription register.13 at this time, conscription and the associated examinations were mandatory for all male citizens of the appropriate age (18 and 19 years, with a small number at later ages). During the years covered by this study, only men with significant disability or a severe chronic disease were exempted from conscription (approximately 23% annually).14 the assessments included extensive and highly standardised physical and psychological examinations by physicians and psychologists . Stroke risk was assessed from 1987 (when the swedish national inpatient register15 attained full coverage) to 2010 . From among a total of 284 198 men identified, we excluded 2564 subjects with unreliable data such as errors in the personal identification number or uncertain vital status . Those with implausible values for height (less than 144 cm), weight (above 178 kg), body mass index, bmi, (below 15), systolic blood pressure (below 50 or above 230 mm hg) and diastolic blood pressure (below 30 or above 135 mm hg), were also excluded from the analysis; in total 225 men.16 after excluding individuals who emigrated, died, or had a diagnosis of stroke before study entry in 1987, the sample comprised 271 767 men . Men with missing data for stress resilience, potential confounding factors (year of birth, geographic region, systolic and diastolic blood pressure, bmi, cognitive function, physical working capacity, parental socioeconomic index and household crowding) were also excluded (37 196 men; including 722 men with a stroke diagnosis at some time). The sample available for the main analysis comprised 237 879 men, 84% of the potential target population . The men underwent a psychological examination to assess their potential ability to cope with war - time stress,17 based on the ability to control and channel nervousness, tolerance of stress and disposition to anxiety.18 during this assessment, the potential conscripts met a psychologist for a semistructured interview which covered areas relevant to general everyday life; including psychosocial dimensions, such as social maturity, leisure interests, psychological motivation, and emotional stability.18 this interview was used to produce a stress resilience score from 1 to 9 which we grouped into low (13), medium (46) and high (79). Details of the test are available in swedish,19 and it has been used in published research.16 17 to ensure consistent evaluation, a central authority supervised the instruction and training of participating psychologists, supported by a written manual . Height and weight were used to calculate bmi, which was categorised using the who criteria . Systolic and diastolic blood pressure was measured after rest in recumbent men using a sphygmomanometer . Physical working capacity was assessed using the cycle ergonometric test . After a normal resting electrocardiogram, 5 min of submaximal exercise was performed at different work rates depending on body mass, directly followed by a maximal test with gradually increasing load until volitional exhaustion, or an estimate was derived from a nomogram for men who did not complete the full duration . The cognitive test was a written assessment and comprised four domains: linguistic understanding, spatial recognition, general knowledge and ability to follow mechanical instructions: the results were transformed into a single score with a value ranging from 1 to 9 . From the medical assessment at conscription, we identified diagnoses, and we used the international classification of diseases eighth revision, icd-8, icd-8 codes 393458 to indicate diagnosis of any cardiovascular disease at the time of conscription . Using the swedish national inpatient register15 exlude and the cause of death register,20 we identified the dates of first fatal and non - fatal stroke diagnoses during the period 19692010 . The codes used for stroke were 430434 and 436 in icd-8, 430, 431, 433, 434 and 436 in icd-9; and i60, i61, i63, i64 in icd 10 . For ischaemic stroke, they were 432434 in icd-8, 433, 434 in icd-9, and i63 in icd-10; for intracerebral haemorrhagic stroke 431 in icd-8, 431 and 432 in icd-9, and i61 in icd-10 . The government organisation, statistics sweden, provided socioeconomic and demographic data including information on vital status and emigration from the total population register.21 childhood social and material circumstances were estimated using data from the 1960 census . The head of household's occupation was classified as manual, agricultural, farm owners / mangers, office workers, business owners / mangers, and others . Household crowding was divided into two categories to indicate a ratio of less than two persons per room, or more or equal to two persons per room . Cox regression was used to examine the association of stress resilience in adolescence with subsequent stroke risk between ages 31 and 58 years . The follow - up period began on 1 january 1987 and ended at first stroke, death, emigration or 1 january 2010, whichever occurred first . Subjects with a diagnosis of stroke before 1987 were excluded (n=218). Non - fatal and fatal stroke were examined together and separately . In the analyses of aetiological subtypes (ischaemic and intracerebral haemorrhagic stroke), first event by each subtype was used . Associations were examined using an unadjusted (model 1) and three further adjusted models . In model 2, adjustment was for demographic and socioeconomic factors for the family of origin: birth year, geographical region, parents socioeconomic index, and household crowding . Model 3 was additionally adjusted for characteristics in adolescence: cognitive function (continuous), systolic and diastolic blood pressure (continuous), and cardiovascular disease at conscription . In model 4 lifestyle factors in adolescence (here represented by physical fitness and body mass) were also added to the model: bmi (in 4 categories) and physical working capacity score (continuous). The proportional hazards assumption for stress resilience in relation to stroke was tested graphically, as well as using a test based on schoenfeld residuals, and no evidence was found that it was violated . As this was assessed using age as the underlying time scale, it indicates that the association between stress resilience and stroke was constant and did not diminish with increasing age . The study cohort consists of male swedish residents born between 1952 and 1956, who were eligible for military conscription and included in the swedish military conscription register.13 at this time, conscription and the associated examinations were mandatory for all male citizens of the appropriate age (18 and 19 years, with a small number at later ages). During the years covered by this study, only men with significant disability or a severe chronic disease were exempted from conscription (approximately 23% annually).14 the assessments included extensive and highly standardised physical and psychological examinations by physicians and psychologists . Stroke risk was assessed from 1987 (when the swedish national inpatient register15 attained full coverage) to 2010 . From among a total of 284 198 men identified, we excluded 2564 subjects with unreliable data such as errors in the personal identification number or uncertain vital status . Those with implausible values for height (less than 144 cm), weight (above 178 kg), body mass index, bmi, (below 15), systolic blood pressure (below 50 or above 230 mm hg) and diastolic blood pressure (below 30 or above 135 mm hg), were also excluded from the analysis; in total 225 men.16 after excluding individuals who emigrated, died, or had a diagnosis of stroke before study entry in 1987, the sample comprised 271 767 men . Men with missing data for stress resilience, potential confounding factors (year of birth, geographic region, systolic and diastolic blood pressure, bmi, cognitive function, physical working capacity, parental socioeconomic index and household crowding) were also excluded (37 196 men; including 722 men with a stroke diagnosis at some time). The sample available for the main analysis comprised 237 879 men, 84% of the potential target population . The men underwent a psychological examination to assess their potential ability to cope with war - time stress,17 based on the ability to control and channel nervousness, tolerance of stress and disposition to anxiety.18 during this assessment, the potential conscripts met a psychologist for a semistructured interview which covered areas relevant to general everyday life; including psychosocial dimensions, such as social maturity, leisure interests, psychological motivation, and emotional stability.18 this interview was used to produce a stress resilience score from 1 to 9 which we grouped into low (13), medium (46) and high (79). Details of the test are available in swedish,19 and it has been used in published research.16 17 to ensure consistent evaluation, a central authority supervised the instruction and training of participating psychologists, supported by a written manual . Height and weight were used to calculate bmi, which was categorised using the who criteria . Systolic and diastolic blood pressure was measured after rest in recumbent men using a sphygmomanometer . Physical working capacity was assessed using the cycle ergonometric test . After a normal resting electrocardiogram, 5 min of submaximal exercise was performed at different work rates depending on body mass, directly followed by a maximal test with gradually increasing load until volitional exhaustion, or an estimate was derived from a nomogram for men who did not complete the full duration . The cognitive test was a written assessment and comprised four domains: linguistic understanding, spatial recognition, general knowledge and ability to follow mechanical instructions: the results were transformed into a single score with a value ranging from 1 to 9 . From the medical assessment at conscription, we identified diagnoses, and we used the international classification of diseases eighth revision, icd-8, icd-8 codes 393458 to indicate diagnosis of any cardiovascular disease at the time of conscription . Using the swedish national inpatient register15 exlude and the cause of death register,20 we identified the dates of first fatal and non - fatal stroke diagnoses during the period 19692010 . The codes used for stroke were 430434 and 436 in icd-8, 430, 431, 433, 434 and 436 in icd-9; and i60, i61, i63, i64 in icd 10 . For ischaemic stroke, they were 432434 in icd-8, 433, 434 in icd-9, and i63 in icd-10; for intracerebral haemorrhagic stroke 431 in icd-8, 431 and 432 in icd-9, and i61 in icd-10 . The government organisation, statistics sweden, provided socioeconomic and demographic data including information on vital status and emigration from the total population register.21 childhood social and material circumstances were estimated using data from the 1960 census . The head of household's occupation was classified as manual, agricultural, farm owners / mangers, office workers, business owners / mangers, and others . Household crowding was divided into two categories to indicate a ratio of less than two persons per room, or more or equal to two persons per room . The men underwent a psychological examination to assess their potential ability to cope with war - time stress,17 based on the ability to control and channel nervousness, tolerance of stress and disposition to anxiety.18 during this assessment, the potential conscripts met a psychologist for a semistructured interview which covered areas relevant to general everyday life; including psychosocial dimensions, such as social maturity, leisure interests, psychological motivation, and emotional stability.18 this interview was used to produce a stress resilience score from 1 to 9 which we grouped into low (13), medium (46) and high (79). Details of the test are available in swedish,19 and it has been used in published research.16 17 to ensure consistent evaluation, a central authority supervised the instruction and training of participating psychologists, supported by a written manual . Height and weight were used to calculate bmi, which was categorised using the who criteria . Systolic and diastolic blood pressure was measured after rest in recumbent men using a sphygmomanometer . Physical working capacity was assessed using the cycle ergonometric test . After a normal resting electrocardiogram, 5 min of submaximal exercise was performed at different work rates depending on body mass, directly followed by a maximal test with gradually increasing load until volitional exhaustion, or an estimate was derived from a nomogram for men who did not complete the full duration . The cognitive test was a written assessment and comprised four domains: linguistic understanding, spatial recognition, general knowledge and ability to follow mechanical instructions: the results were transformed into a single score with a value ranging from 1 to 9 . From the medical assessment at conscription, we identified diagnoses, and we used the international classification of diseases eighth revision, icd-8, icd-8 codes 393458 to indicate diagnosis of any cardiovascular disease at the time of conscription . Using the swedish national inpatient register15 exlude and the cause of death register,20 we identified the dates of first fatal and non - fatal stroke diagnoses during the period 19692010 . The codes used for stroke were 430434 and 436 in icd-8, 430, 431, 433, 434 and 436 in icd-9; and i60, i61, i63, i64 in icd 10 . For ischaemic stroke, they were 432434 in icd-8, 433, 434 in icd-9, and i63 in icd-10; for intracerebral haemorrhagic stroke 431 in icd-8, 431 and 432 in icd-9, and i61 in icd-10 . The government organisation, statistics sweden, provided socioeconomic and demographic data including information on vital status and emigration from the total population register.21 childhood social and material circumstances were estimated using data from the 1960 census . The head of household's occupation was classified as manual, agricultural, farm owners / mangers, office workers, business owners / mangers, and others . Household crowding was divided into two categories to indicate a ratio of less than two persons per room, or more or equal to two persons per room . Cox regression was used to examine the association of stress resilience in adolescence with subsequent stroke risk between ages 31 and 58 years . The follow - up period began on 1 january 1987 and ended at first stroke, death, emigration or 1 january 2010, whichever occurred first . Subjects with a diagnosis of stroke before 1987 were excluded (n=218). Non - fatal and fatal stroke were examined together and separately . In the analyses of aetiological subtypes (ischaemic and intracerebral haemorrhagic stroke), first event by each subtype was used . Associations were examined using an unadjusted (model 1) and three further adjusted models . In model 2, adjustment was for demographic and socioeconomic factors for the family of origin: birth year, geographical region, parents socioeconomic index, and household crowding . Model 3 was additionally adjusted for characteristics in adolescence: cognitive function (continuous), systolic and diastolic blood pressure (continuous), and cardiovascular disease at conscription . In model 4 lifestyle factors in adolescence (here represented by physical fitness and body mass) were also added to the model: bmi (in 4 categories) and physical working capacity score (continuous). The proportional hazards assumption for stress resilience in relation to stroke was tested graphically, as well as using a test based on schoenfeld residuals, and no evidence was found that it was violated . As this was assessed using age as the underlying time scale, it indicates that the association between stress resilience and stroke was constant and did not diminish with increasing age . All analyses are based on the 237 879 conscripts with complete information for the required variables, after exclusion of individuals who emigrated, died, or had a diagnosis of stroke before the beginning of follow - up in 1987 . During the follow - up period of 19872010, 3411 men (1.4%) received an inpatient diagnosis of stroke (or stroke was recorded as the underlying cause of death). The stroke incidence rate was 64 per 100 000 person - years in our study population, compared with 101 per 100 000 person - years in the excluded subset with missing data on covariates . Men with low resilience tended to have lower physical capacity, lower cognitive function scores, higher blood pressure, were underweight, overweight or obese, more often had a diagnosis of cardiovascular disease at conscription, and had parents with a lower socioeconomic index and experienced greater household crowding in childhood . Population (n=237 879) characteristics by stress resilience levels cvd, cardiovascular disease; sei, socioeconomic index . The associations with stroke for stress resilience and the other measures are reported in table 2 . The lowest stress resilience group (21.8% with scores 13) compared with the highest (23.7% with score 79) was associated with increased risk of all stroke types . The intermediate category of stress resilience lay between the low and high groups, indicating a graded association . When adjusted for the demographic and socioeconomic factors in childhood, the association attenuated slightly but remained statistically significant . Additional adjustment for health and development characteristics in adolescence further adjustment for physical fitness indicated by bmi and physical capacity had the most notable impact on the hrs, but despite the reduction in magnitude, statistical significance remained . Blood pressure was modelled as continuous variables to ensure the most effective adjustment: the magnitude of the associations appears small as the hrs are for each unit change per mm hg, but statistical significance for associations with stroke remained after adjustment for all other measures . / material background factors (birth year, region, parental sei and household crowding). Model 3 . Adjusted for 2 + characteristics in adolescence (cognitive function, diastolic and systolic blood pressure and cvd diagnosis at conscription). Model 4 . Adjusted for 2 + 3 + physical fitness in adolescence (physical working capacity and bmi). Table 3 presents the outcomes for the stroke subgroups, fatal (n=308), ischaemic (n=2060) and intracerebral haemorrhagic (n=676) stroke . All showed a significant association with stress resilience, with higher magnitude associations for fatal than non - fatal stroke; and for haemorrhagic than ischaemic stroke . In adjusted models, a similar pattern as for all stroke appeared, but the association of stress resilience and ischaemic stroke was more notably attenuated by adjustment for bmi and physical capacity . Stress resilience and stroke subdivided by stroke characteristics model 2 . Adjusted for socio / material background factors (birth year, region, parents sei, household crowding). Model 3 . Adjusted for 2 + characteristics in adolescence (cognition, systolic and diastolic blood pressure, cvd diagnosis at conscription). Model 4 . Adjusted for 2 + 3+physical fitness in adolescence (physical working capacity and bmi). Low stress resilience in adolescence was associated with a higher risk of stroke in men of working age between 31 years and 58 years, a relatively young age group to experience stroke . This association was independent of childhood socioeconomic circumstances, as well as health and developmental characteristics in adolescence . The association was attenuated more notably (but not eliminated) by adjustment for bmi and physical working capacity as indicators of physical fitness in adolescence, likely to signal future lifestyle characteristics . Our results from a general population - based cohort of men are consistent with recent studies suggesting a role for psychosocial stress in influencing stroke risk.35 9 10 similarly, poorer adaptation to social adversity possibly signalling lower stress resilience has also been linked with an increased risk of stroke.22 stress resilience in adolescence does not measure exposure to stress but does indicate susceptibility, such that the adversities of daily life may have a greater impact and conspire to produce a more chronic pattern stress arousal over adult life . Another study has found associations with stress independent of lifestyle factors.4 this difference with our findings may be due to methodological variations, as we have a measure of resilience rather than stress exposure, it was collected prospectively, many years before stroke, and we adjusted for some characteristics in adolescence that may themselves be consequences of low stress resilience, as discussed below . We hypothesise that low resilience to psychosocial stress could indicate exposure to psychosocial stress in earlier life, resulting in poorer control of the stress response that can continue across the life course . Animal studies have demonstrated that early life stress can alter hpa axis function in a way that can persist over the life course, producing persistent low resilience to stress.23 24 stress resilience may also be a characteristic of personality type, and thus, a persistent trait . For example, low resilience may reflect something like type a behaviour which, although controversial, has previously been related to increased cardiovascular risk.25 it has been demonstrated that adverse socioeconomic conditions in childhood increase stroke risk26; so we adjusted for such factors, with little impact on the association of stress resilience with stroke . Markers of early life exposure to stress have been linked with poorer cognitive development27 and higher blood pressure.28 thus, cognitive function and blood pressure may represent consequences of earlier stressful exposures and poorer stress resilience, and adjusting for these factors may have produced conservative estimates of association; arguably an over - adjustment . Markers of stressful exposures in early life are also linked with unhealthy weight gain,29 which may influence physical exercise or be a consequence of low exercise levels.30 thus, even in adolescence, bmi and fitness could, in part, be a consequence of lower stress resilience and earlier stressful exposures . We believe the results suggest that a significant proportion of the association of stress and stress resilience with stroke risk is due to lifestyle risk factors . This is consistent with recent findings from a british cohort study with older participants, where the association of psychological distress with cvd risk was largely explained by behavioural / lifestyle processes.31 our findings suggest such processes have a long natural history, beginning in childhood or adolescence . Our results were consistent among the different stroke subtypes (fatal, non - fatal, ischaemic and intracerebral haemorrhagic stroke) although there may be pathological heterogeneity . Previous studies investigating the association between psychosocial stress and stroke subtypes are few, but the results are mostly consistent with our findings suggesting a more notable association for fatal than for non - fatal stroke, and for haemorrhagic than ischaemic stroke . The stronger association with haemorrhagic than ischaemic stroke could also be a consequence of a greater aetiological heterogeneity in ischaemic stroke . Physical working capacity and bmi in adolescence most notably attenuated that association of stress resilience with ischaemic stroke, suggesting more significant mediation through lifestyle factors . As this is a study of stress resilience measured in adolescence, it is possible that stressful exposures in adult life might represent a higher risk of stroke, particularly chronic exposures among the less stress resilient . Overweight, obesity and poorer physical capacity in adolescence are likely to signal an accumulation of behavioural / lifestyle health risks that continue through adulthood.32 33 other lifestyle risks in the years between conscription and stroke, such as smoking, alcohol and diet, are also likely to be relevant mediating factors . Further mediating factors might include type 2 diabetes, a stroke risk which tends to have its onset in adulthood some years after the time of conscription, which has also been linked with psychosocial stress.34 35 as behaviours and diagnoses occurring between conscription and stroke are intermediate in the causal pathway, we have not included them in the model . Unfortunately, we have no data on smoking, diet or alcohol consumption, which could have added further to our understanding of lifestyle risks . Thus, major mediation between poor stress resilience and stroke risk may be through lifestyle factors and fitness, suggesting interventions for psychosocial stress and behaviour might be most effective in lowering stoke risk among younger men . The use of prospectively recorded data from several linked registers, and the long - term follow - up subsequent to the measure of susceptibility, increases the validity and reliability of the study, as well as avoiding bias due to reverse causation or poor recall . The study population is largely representative of the male general population as only a small proportion of swedish men were exempted from enlistment examinations . Extensive physical and psychological examinations were conducted in adolescence, so the information was objectively measured and were able to adjust for a variety of powerful stroke risk factors including, bmi and physical capacity which are objective physiological measures . The duration between conscription examination and start of follow - up means it is unlikely that prodromal characteristics of an impending stroke were driving the stress resilience measure, and it was possible to identify pre - existing cardiovascular diagnoses and adjust for blood pressure . The potential limitations of the study include the inclusion of only men, as women also suffer from stroke . This was necessary as the measure of stress susceptibility was collected during military conscription, which at the time was almost exclusively available to men . As stress resilience was only measured once, we cannot be definitive about stability of this characteristic over time and how this may interact with stressful exposures . In these data, the association of stress resilience with stroke risk did not vary by age, indicating that this measure of stress resilience is a relatively stable characteristic over time, at least in terms of stroke risk . There is a possibility of misclassification of the stress resilience measure if potential conscripts attempted to obtain exemption from military service through false answers, if they exist, would most likely dilute the resilience measure and result in less precise estimates . The temporal relationship of stress resilience and physical fitness in adolescence cannot be established, but we hypothesise that poor stress resilience has an adverse influence on physical fitness . As stressful exposures were not examined, it is possible that the magnitude of associations with stress resilience is conservative . A proportion of the cardiovascular diagnoses at conscription when the men in our cohort were 1819 years old may not be directly relevant to stroke risk . We included this information in the models to ensure that poorer stress resilience was not a function of pre - existing cardiovascular disease, where a proportion of these diseases may increase subsequent stroke risk . Most stroke onset occurs at a higher age than in our study, so early stroke may be somewhat atypical and the aetiology may differ from stroke at older ages.36 however, stroke incidence in younger adults (younger than 55 years of age) is increasing.37 stroke at young (working) age is a particular concern, as a reduction of working capacity increases the personal, social as well as economic burden of the disease . This is of public health significance, as stroke at early ages has the potential for greater lifetime burden of disability, and because some risks may be modifiable . The proportion of stroke diagnoses in the analytic sample is lower than among those who were not included . This is for two reasons, and the first is that men who had a stroke at an early age, close in time to the conscription examination, were excluded deliberately to avoid associations due to reverse causation . Some men in poor health, with very low levels of physical fitness, or low cognitive function at the time of the conscription examination, were identified as unsuitable for military service by the assessors and may not have completed all the examinations (including for stress resilience). As these men excluded due to missing values on the assessments may have the greatest risk of stroke, we may have underestimated the proportion at risk and conceivably produced a conservative estimate of stroke risk . The validity of some diagnoses recorded in the swedish national inpatient register can be questionable, but the reliability of stroke diagnoses is satisfactory.38 39 the use of prospectively recorded data from several linked registers, and the long - term follow - up subsequent to the measure of susceptibility, increases the validity and reliability of the study, as well as avoiding bias due to reverse causation or poor recall . The study population is largely representative of the male general population as only a small proportion of swedish men were exempted from enlistment examinations . Extensive physical and psychological examinations were conducted in adolescence, so the information was objectively measured and were able to adjust for a variety of powerful stroke risk factors including, bmi and physical capacity which are objective physiological measures . The duration between conscription examination and start of follow - up means it is unlikely that prodromal characteristics of an impending stroke were driving the stress resilience measure, and it was possible to identify pre - existing cardiovascular diagnoses and adjust for blood pressure . The potential limitations of the study include the inclusion of only men, as women also suffer from stroke . This was necessary as the measure of stress susceptibility was collected during military conscription, which at the time was almost exclusively available to men . As stress resilience was only measured once, we cannot be definitive about stability of this characteristic over time and how this may interact with stressful exposures . In these data, the association of stress resilience with stroke risk did not vary by age, indicating that this measure of stress resilience is a relatively stable characteristic over time, at least in terms of stroke risk . There is a possibility of misclassification of the stress resilience measure if potential conscripts attempted to obtain exemption from military service through false answers, if they exist, would most likely dilute the resilience measure and result in less precise estimates . The temporal relationship of stress resilience and physical fitness in adolescence cannot be established, but we hypothesise that poor stress resilience has an adverse influence on physical fitness . As stressful exposures were not examined, it is possible that the magnitude of associations with stress resilience is conservative . A proportion of the cardiovascular diagnoses at conscription when the men in our cohort were 1819 years old may not be directly relevant to stroke risk . We included this information in the models to ensure that poorer stress resilience was not a function of pre - existing cardiovascular disease, where a proportion of these diseases may increase subsequent stroke risk . Most stroke onset occurs at a higher age than in our study, so early stroke may be somewhat atypical and the aetiology may differ from stroke at older ages.36 however, stroke incidence in younger adults (younger than 55 years of age) is increasing.37 stroke at young (working) age is a particular concern, as a reduction of working capacity increases the personal, social as well as economic burden of the disease . This is of public health significance, as stroke at early ages has the potential for greater lifetime burden of disability, and because some risks may be modifiable . The proportion of stroke diagnoses in the analytic sample is lower than among those who were not included . This is for two reasons, and the first is that men who had a stroke at an early age, close in time to the conscription examination, were excluded deliberately to avoid associations due to reverse causation . Some men in poor health, with very low levels of physical fitness, or low cognitive function at the time of the conscription examination, were identified as unsuitable for military service by the assessors and may not have completed all the examinations (including for stress resilience). As these men excluded due to missing values on the assessments may have the greatest risk of stroke, we may have underestimated the proportion at risk and conceivably produced a conservative estimate of stroke risk . The validity of some diagnoses recorded in the swedish national inpatient register can be questionable, but the reliability of stroke diagnoses is satisfactory.38 39 the association with stress resilience suggests that stress may be implicated in the aetiology of stroke, which is, in part, explained by poorer physical fitness among the less stress resilient . We hypothesise that the most effective interventions to prevent stroke would focus on behaviour and lifestyle factors, as well as psychosocial stress.
In the previous issue of critical care, chen and colleagues investigate whether hydrocortisone influences the neurological outcome and mortality in a rat model of traumatic brain injury (tbi)-induced critical illness - related corticosteroid insufficiency (circi). Up to 30 to 80% of tbi patients circi has been studied in sepsis but received much less attention after tbi, despite the fact that its incidence seems high . The authors postulated that early recognition of circi after tbi and treatment with corticosteroids may improve neurological outcome . This may prove important since bombardier and colleagues have shown that 51.3% of patients met the criteria for major depressive disorders during the first year after tbi . In the present study, chen and colleagues nicely demonstrate in a rat model of tbi that treating circi with hydrocortisone improves neurological recovery by blocking neuronal apoptosis, and reducing damage of the tight junction . Interestingly, the authors also show that a synthetic glucocorticoid (methylprednisolone) did not alter neurological outcomes or mortality . Hyponatremia is frequent after tbi, and recent evidence showed that mild hypernatremia could decrease the intracranial pressure, improving the cerebral perfusion pressure . Second, after initial tbi, the exaggerated inflammatory response may cause circi by altering the function of the hypothalamic pituitary adrenal axis . Tumour necrosis factor and interleukin (il)-6 are increased in tbi or septic shock associated with circi . In particular, hoen and colleagues have shown that blood il-6 was significantly higher in severe trauma patients with circi as compared with patients without circi . It is well known that hydrocortisone decreases the production of these inflammatory cytokines, but recent evidence permits a reappraisal of the properties of hydrocortisone regarding the inflammatory response . In septic patients, hydrocortisone decreased the blood level of the anti - inflammatory cytokines (il-10) and increased the blood levels of il-12 (cytokine - enhancing immune response against bacterial infection) without inducing immunosuppression . These data suggest that hydrocortisone is able to restore a balanced inflammatory response rather than inducing immunosuppression . Third, corticosteroids are believed to be potent inducers of apoptosis mainly by a shutdown of the inflammatory response through inhibition of the nf-b pathway, which promotes survival of cells generally . These data were provided mainly with a high dose of synthetic glucocorticoids in patients with cancer or solid organ transplantation, but few data were published with hydrocortisone . Chen and colleagues show that hydrocortisone prevents neuronal apoptosis even if the exact mechanism for this novel property of the drug remains largely unknown . The authors also demonstrate that hydrocortisone but not methylprednisolone improves neurological outcomes and prevents mortality in tbi rats . However, the benefit of corticosteroids in tbi patients remains controversial . In the crash study, a high dose of methylprednisolone worsened mortality as compared with placebo, and it was also speculated that hydrocortisone might increase the rate of secondary infections . In a recent cochrane systematic review, a stress dose of hydrocortisone (200 to 300 mg / day) did not increase the rate of infection as compared with placebo in septic shock patients . In the hypolyte study involving severe trauma patients, including 65% tbi patients, the results obtained with hydrocortisone were spectacular in circi patients, whereas in the a priori planned subgroup analysis the treatment was particularly efficient in the tbi patients . Answering the question of whether we should use hydrocortisone in tbi patients remains a subject of hard debate . Detecting circi to select patients eligible for hydrocortisone treatment shows promise . The results of a large randomized multicenter study (corti - tc) will provide valuable data on the effects of hydrocortisone in severe tbi patients . Circi: critical illness - related corticosteroid insufficiency; il: interleukin; tbi: traumatic brain injury.
Tracer is a 2-week pgy2 block where the resident rounds with the inpatient teaching ward team as the quality officer and follows two to four patients after hospital discharge . The tracer meets the patient on rounds and later returns to discuss the patient's experience and readiness for discharge . At the time of discharge the resident then meets the patient and nurse within the hour of arrival at the facility or the following day in the home . Using standardized tools, the resident assesses the transition and reflects on process (appendices a and b) (17, 18). Current gaps in resident knowledge are targeted including medication reconciliation, handover of hospital course, and anticipatory advice . The tracer reports their findings to the inpatient team and the pac - performance improvement (pi) team . Reporting back to the team has improved the awareness for those not on the rotation, including attendings . Reports to the pac - pi team have led to changes including condensing the discharge report; clarifying medications started, stopped, and changed during admission; and improving access to discharge documents for all visiting nurses . The tracer rotation requires a physician rotation director who orients the resident, leads the pac - pi team in weekly interprofessional meetings, and assesses the performance of the tracer resident . We use semistructured interviews at the end of each year to assess our baystate learner - manager - teacher program redesign . In spring 2010, pgy3s, who had completed tracer the previous year, were asked to comment about what they had learned being a tracer . End of training teachers / pgy3s were asked the following questions about tracer: when you were a manager / pgy2, what did you learn about being a tracer resident? And did you do anything different in your third year as the result of tracer? These interviews explore the resident experience of tracer 1 year after completing the rotation . The intent is to learn about the tracer program's sustained effect on learning and practice . Sixteen i m residents completed training in 2010: nine male and seven female; seven us medical graduates and nine international medical graduates . Two trainees had unanticipated schedule changes . Using transcripts, the authors, all of whom are also coordinators of the rotation, reviewed and coded each, using a grounded theory approach to develop themes . The authors performed initial coding and several rounds of transcript review and recoding for the following report . Tracer is a 2-week pgy2 block where the resident rounds with the inpatient teaching ward team as the quality officer and follows two to four patients after hospital discharge . The tracer meets the patient on rounds and later returns to discuss the patient's experience and readiness for discharge . At the time of discharge the resident then meets the patient and nurse within the hour of arrival at the facility or the following day in the home . Using standardized tools, the resident assesses the transition and reflects on process (appendices a and b) (17, 18). Current gaps in resident knowledge are targeted including medication reconciliation, handover of hospital course, and anticipatory advice . The tracer reports their findings to the inpatient team and the pac - performance improvement (pi) team . Reporting back to the team has improved the awareness for those not on the rotation, including attendings . Reports to the pac - pi team have led to changes including condensing the discharge report; clarifying medications started, stopped, and changed during admission; and improving access to discharge documents for all visiting nurses . The tracer rotation requires a physician rotation director who orients the resident, leads the pac - pi team in weekly interprofessional meetings, and assesses the performance of the tracer resident . We use semistructured interviews at the end of each year to assess our baystate learner - manager - teacher program redesign . In spring 2010, pgy3s, who had completed tracer the previous year, were asked to comment about what they had learned being a tracer . End of training teachers / pgy3s were asked the following questions about tracer: when you were a manager / pgy2, what did you learn about being a tracer resident? And did you do anything different in your third year as the result of tracer? These interviews explore the resident experience of tracer 1 year after completing the rotation . The intent is to learn about the tracer program's sustained effect on learning and practice . Sixteen i m residents completed training in 2010: nine male and seven female; seven us medical graduates and nine international medical graduates . All of whom are also coordinators of the rotation, reviewed and coded each, using a grounded theory approach to develop themes . The authors performed initial coding and several rounds of transcript review and recoding for the following report . Sixteen i m residents completed training in 2010: nine male and seven female; seven us medical graduates and nine international medical graduates . Using transcripts, the authors, all of whom are also coordinators of the rotation, reviewed and coded each, using a grounded theory approach to develop themes . The authors performed initial coding and several rounds of transcript review and recoding for the following report . Five themes emerged from review and coding of 14 interviews: seeing things from the other side, the ah ha moment of fragmented care, team collaboration, patient understanding, and passing the learning on . Overall, tracer residents describe the transition of care from the patient perspective rather than the traditional physician perspective (table 1). Five themes of the transition of care rotation (tracer) residents become aware of how the transition looks from the other side, both the facility and the home . For a facility transfer, the tracer resident appreciates that the nurse has poor access to the hospital team and is gathering information from the written documents only . Tracer residents identify with this admission process; they see the similarity to the hospital admission process . They learn that the medication list on transfer is used immediately to call in admission orders to the on - call physician and, thus, needs to be accurate . They realize the importance of the discharge summary to the receiving team as opposed to its equal relevance to the hospital team for future care . Residents experience directly the impact of the transition on the other side (the accepting nurse side) of a facility transfer . The tracer resident comes to have a new appreciation for the transition to home . The residents learn that patients have little understanding of the basic elements of the hospitalization such as the primary hospital diagnosis, the changes in medications, and the follow - up plan . Patients are also unprepared for the recovery period challenges as they are still recovering from illness; how and when to get their new medications, tracking medication changes, and mobility issues . Residents have new awareness of the challenges in the transition to home as they see the experience from the other side (the patient's side) of the handoff . Residents describe an epiphany, the moment when they realize that the transition is fragmented for patients and their families . Tracer allows the resident to slow down and become an observer of the process of care and reflect . They identify patient education, handoff communication (written and verbal), and team collaboration as keys to a successful discharge . Both written and verbal, for both patients and the health care team, is a hallmark lesson learned in this ah ha moment . They come to see the unique roles and responsibilities of the hospital nurse at discharge, the nurse in the accepting facility, and the nurse in the home . The hospital nurse is responsible for educating the patient on the primary discharge diagnosis and medication changes as well as preparing the patient for the next level of care . The facility nurse relays orders to the accepting physician and assesses the patients appropriateness for this level of care . And finally, the home nurse possesses skills for advocacy, education, and coordination of care . Overall, the tracer resident learns the various scopes of practice of the nurse in different settings and describes being more prepared to collaborate in the future . Residents also realize that different pac settings (home vs. facility) require different transition strategies . For the transition to home, a patient is required to manage independently, including their activities of daily living, medication, and follow - up plans . Thus, the home discharge is a handoff to the patient with a home nurse as an advocate, whereas the facility transfer is a handoff to the health care team with patient involvement . The tracer residents gain a deeper understanding of their role in collaborating around discharge as they have more knowledge of the nursing scope of practice and different needs of the patient in the two settings (table 1). The patients do not understand basic elements of the bedside conversation, for example, their diagnosis, medication changes, and what to expect . The residents see three parts to the problem: too much medical terminology, the hospital physician not appropriately checking or understanding or using teach - back, and an overwhelmed, sick patient . Trainees see that communicating at the level of the patient and checking for understanding are key elements of the transition (table 1). The pgy3 carry the lessons learned from tracer into their physician practice as pgy3 teachers on the wards . The pgy1/medical students bring out the importance of the tracer learning experience as the pgy3 reinforces the value of a good transition of care . As teachers, they internalize the value of the tracer experience and see the importance of teaching this knowledge to their colleagues (table 1). Residents become aware of how the transition looks from the other side, both the facility and the home . For a facility transfer, the tracer resident appreciates that the nurse has poor access to the hospital team and is gathering information from the written documents only . Tracer residents identify with this admission process; they see the similarity to the hospital admission process . They learn that the medication list on transfer is used immediately to call in admission orders to the on - call physician and, thus, needs to be accurate . They realize the importance of the discharge summary to the receiving team as opposed to its equal relevance to the hospital team for future care . Residents experience directly the impact of the transition on the other side (the accepting nurse side) of a facility transfer . The residents learn that patients have little understanding of the basic elements of the hospitalization such as the primary hospital diagnosis, the changes in medications, and the follow - up plan . Patients are also unprepared for the recovery period challenges as they are still recovering from illness; how and when to get their new medications, tracking medication changes, and mobility issues . Residents have new awareness of the challenges in the transition to home as they see the experience from the other side (the patient's side) of the handoff . Residents describe an epiphany, the moment when they realize that the transition is fragmented for patients and their families . Tracer allows the resident to slow down and become an observer of the process of care and reflect . They identify patient education, handoff communication (written and verbal), and team collaboration as keys to a successful discharge . Both written and verbal, for both patients and the health care team, is a hallmark lesson learned in this ah ha moment . Residents learn the importance of team collaboration . They come to see the unique roles and responsibilities of the hospital nurse at discharge, the nurse in the accepting facility, and the nurse in the home . The hospital nurse is responsible for educating the patient on the primary discharge diagnosis and medication changes as well as preparing the patient for the next level of care . The facility nurse relays orders to the accepting physician and assesses the patients appropriateness for this level of care . And finally, the home nurse possesses skills for advocacy, education, and coordination of care . Overall, the tracer resident learns the various scopes of practice of the nurse in different settings and describes being more prepared to collaborate in the future . Residents also realize that different pac settings (home vs. facility) require different transition strategies . For the transition to home, a patient is required to manage independently, including their activities of daily living, medication, and follow - up plans . Thus, the home discharge is a handoff to the patient with a home nurse as an advocate, whereas the facility transfer is a handoff to the health care team with patient involvement . The tracer residents gain a deeper understanding of their role in collaborating around discharge as they have more knowledge of the nursing scope of practice and different needs of the patient in the two settings (table 1). The patients do not understand basic elements of the bedside conversation, for example, their diagnosis, medication changes, and what to expect . The residents see three parts to the problem: too much medical terminology, the hospital physician not appropriately checking or understanding or using teach - back, and an overwhelmed, sick patient . Trainees see that communicating at the level of the patient and checking for understanding are key elements of the transition (table 1). The pgy3 carry the lessons learned from tracer into their physician practice as pgy3 teachers on the wards . The pgy1/medical students bring out the importance of the tracer learning experience as the pgy3 reinforces the value of a good transition of care . As teachers, they internalize the value of the tracer experience and see the importance of teaching this knowledge to their colleagues (table 1). Tracer residents are transformed by workplace learning as they can take a step back to observe and reflect on the transition . Physician workplace learning is traditionally embedded only in the clinical wards or the ambulatory setting (19). This, however, omits learning about handoffs, performance improvement, and pac teams . The tracer resident follows the patient experience through the continuum of care with systems improvement as the focus of workplace learning . For example, the tracer resident may describe an error in medication reconciliation and report emphatically, one small error can lead to significant harm. Through the short reflections from each visit and the long reflective essay added to the curriculum in 2012, we are able to triangulate the data . Although the message of accurate medication reconciliation is taught in other venues including orientation, didactics, chart stimulated recall, and direct observation; it is the tracer experience that seems to have the greatest impact on transition of care learning . Tracer residents have the time and intellectual space to step back and reflect in the workplace, focusing on competencies in systems based practice (sbp), practice based learning (pbli), professionalism (prof), and interpersonal and communication skills (ics), specifically subcompetencies sbp 14, pbli 1 and 2, prof 1 and 3, and ics13 . Although we have considered moving tracer into the pgy1 curriculum, the pgy1 learner puts greater value into learning competencies in medical knowledge and patient care . We have added case - based learning to our didactics and we have implemented a pgy1 transition of care curriculum for orientation, direct observation, and chart stimulated recall . For tracer, our next steps are to explore the tracer model for other professions and for interprofessional education (ipe). The care transitions education project, a robert wood johnson funded demonstration project of the massachusetts senior care foundation, has applied the tracer curriculum to nursing students and found similar themes (20). How do we train physician, nurse, and pharmacist together for the transition? Other next steps for investigation include assessing the clinical outcomes of a tracer experience during and after the rotation . Residents describe the tracer experience as an epiphany, an ah ha moment, with a sustained effect 1 year after they have completed the rotation . They identify with the patient's experience and the health care team in the continuum of care . Accurate written and verbal communication is a hallmark lesson learned in this ah ha moment of acknowledging the ramifications of fragmented care . They note the importance of open bidirectional communication with the health care team and the importance of owning the handover to insure patient safety . They are able to differentiate the needs of the patient who can go home versus those who require skilled nursing . Tracer, in the middle of the training years, gives residents a moment to breathe and open their eyes to the patient's experience of care in transition and develop physician competencies not easily assessed in traditional rotation.
The general public is exposed to multiple sources of information on medicine, either through traditional mass media (e.g., television, journals, and radio) or through the internet (e.g., blogs, twitter, facebook, and the many features of web 2.0). The media's potential to reach large audiences gives it an important role in providing health - related information, shaping public health - related beliefs, and influencing health behaviors . However, medical information published in newspapers can often be based on scant evidence because of a lack of specialized knowledge of medical journalists, criticisms of medical information in newspapers, and a lack of available time to secure strong evidence prior to copy deadlines . In addition, information from newspapers, which should be understood by the general population, is sometimes an exaggeration or overstatement . Erectile dysfunction is defined as a consistent or recurrent inability of a man to obtain and/or maintain a penile erection sufficient for sexual activity . A duration of symptoms of at least 3 months is considered acceptable to establish a diagnosis of erectile dysfunction, except in some instances of trauma or surgery . Erectile dysfunction affected about 150 million men worldwide in 2000, and this number is expected to double by 2025 as a result of improved life expectancy and the age - related nature of erectile dysfunction . This disorder is also associated with lower overall life satisfaction scores, mental health quality of life (qol) scores, and vitality qol scores . Many patients look for information on erectile dysfunction from various media outlets, and commercials on treatment for erectile dysfunction have been developed . Recently, sugita and miyakawa reported that the size of the japanese market for counterfeit phosphodiesterase-5 inhibitors was estimated to be about 2.5 times larger than that for genuine phosphodiesterase-5 inhibitors . The aim of the present study was to evaluate the accuracy of news information on erectile dysfunction from 10 nationwide newspapers . Our present study will add to the growing body of research documenting the nature and influence of news information on erectile dysfunction in korea . Articles on erectile dysfunction from 10 nationwide daily newspapers in korea from january 2011 through december 2011 were evaluated in this study . The newspapers included were the kyunghyang shinmun, the kukminilbo, the dong - a ilbo, the munhwa ilbo, the seoul shinmun, the segye ilbo, the hankyoreh, the hankok ilbo, the chosun ilbo, and the korea joongang daily . Newspaper articles or columns that reported results of clinical or experimental studies were included; however, articles that discussed disease occurrence, accidents, crime, policies, social phenomena related to medicine, questionnaire surveys, educational information, esoteric medical information from unreliable sources, and advertisements were excluded . News articles that summarized scientific congresses or journal articles that did not include direct quotations were also excluded . Because a public set of data was used that did not include personal data, the present study was exempted from institutional review board review . The websites of both the chosun ilbo and korea joongang daily (http://www.chosun.com and http://joongang.joinsmsn.com) newspapers were used to search for relevant articles, whereas the website of the korean press foundation (http://www.kinds.or.kr) was used to search for articles from the other newspapers identified above ., we identified 20 articles in a pilot test to confirm the evaluation process for interpretation . All newspaper articles were separately extracted by two researchers (y.s.h . And j.y.l . ). Differences in the results of the extraction and interpretation were discussed, and agreement was sought from a senior physician specializing in andrology (k.s.c . ). The articles were first categorized into articles with accurate statements and articles with inaccurate or misleading statements . On the basis of a previous study, articles with inaccurate or misleading statements were subclassified into four groups: 1) using inappropriate surrogate outcomes as clinical endpoints, 2) extrapolating nonhuman results to humans, 3) exaggerating the significance of results, and 4) using incorrect words . Surrogate outcomes are defined as physiological or anatomical results; however, clinical endpoints are defined as patient - related or functional outcomes, such as symptomatic improvement, recovery of normal activity, and survival . Traditionally, surrogate outcomes have been interpreted as clinical endpoints, although the two should not be considered equivalent . For instance, an article on post - prostatectomy - induced erectile dysfunction that could be cured by mesenchymal stem cells demonstrated a typical example of confusing surrogate outcomes with end outcomes . Results from animal experimental research or the use of cell lines may be inappropriately interpreted as equivalent to human data . Although experimental, physiological, and animal studies are valuable and useful, they do not directly influence clinical decisions . Finally, the use of incorrect words suggests that subjective and apocryphal terminologies may have been used . Data extraction, sharing, and cooperation with our researchers were performed by using google drive (http://drive.google.com) and google docs (google inc ., mountain view, ca, usa). A pearson chi - squared test and fisher exact test were used to compare distributions of categorical values, and statistical analyses were performed by using r (r ver . 2.15.3, r foundation for statistical computing, vienna, austria; http://www.r-project.org). Articles on erectile dysfunction from 10 nationwide daily newspapers in korea from january 2011 through december 2011 were evaluated in this study . The newspapers included were the kyunghyang shinmun, the kukminilbo, the dong - a ilbo, the munhwa ilbo, the seoul shinmun, the segye ilbo, the hankyoreh, the hankok ilbo, the chosun ilbo, and the korea joongang daily . Newspaper articles or columns that reported results of clinical or experimental studies were included; however, articles that discussed disease occurrence, accidents, crime, policies, social phenomena related to medicine, questionnaire surveys, educational information, esoteric medical information from unreliable sources, and advertisements were excluded . News articles that summarized scientific congresses or journal articles that did not include direct quotations were also excluded . Because a public set of data was used that did not include personal data, the present study was exempted from institutional review board review . The websites of both the chosun ilbo and korea joongang daily (http://www.chosun.com and http://joongang.joinsmsn.com) newspapers were used to search for relevant articles, whereas the website of the korean press foundation (http://www.kinds.or.kr) was used to search for articles from the other newspapers identified above . Searching was not performed by using the real newspaper . However, the korean press foundation supplied the nearest article in the printed version ., we identified 20 articles in a pilot test to confirm the evaluation process for interpretation . All newspaper articles were separately extracted by two researchers (y.s.h . And j.y.l . ). Differences in the results of the extraction and interpretation were discussed, and agreement was sought from a senior physician specializing in andrology (k.s.c . ). The articles were first categorized into articles with accurate statements and articles with inaccurate or misleading statements . On the basis of a previous study, articles with inaccurate or misleading statements were subclassified into four groups: 1) using inappropriate surrogate outcomes as clinical endpoints, 2) extrapolating nonhuman results to humans, 3) exaggerating the significance of results, and 4) using incorrect words . Surrogate outcomes are defined as physiological or anatomical results; however, clinical endpoints are defined as patient - related or functional outcomes, such as symptomatic improvement, recovery of normal activity, and survival . Traditionally, surrogate outcomes have been interpreted as clinical endpoints, although the two should not be considered equivalent . For instance, an article on post - prostatectomy - induced erectile dysfunction that could be cured by mesenchymal stem cells demonstrated a typical example of confusing surrogate outcomes with end outcomes . Results from animal experimental research or the use of cell lines may be inappropriately interpreted as equivalent to human data . Although experimental, physiological, and animal studies are valuable and useful, they do not directly influence clinical decisions . Finally, the use of incorrect words suggests that subjective and apocryphal terminologies may have been used . Data extraction, sharing, and cooperation with our researchers were performed by using google drive (http://drive.google.com) and google docs (google inc ., mountain view, ca, usa). A pearson chi - squared test and fisher exact test were used to compare distributions of categorical values, and statistical analyses were performed by using r (r ver . 2.15.3, r foundation for statistical computing, vienna, austria; http://www.r-project.org). After website searches, a total of 188 news articles on erectile dysfunction from 10 newspapers in 2011 were reviewed . 1); excluded articles were those discussing disease occurrence (16), accidents (11), crime and policy (7), social phenomena related to medicine (5), questionnaire surveys (4), educational information (4), esoteric medical information from unreliable sources (63), and advertisements (57). In addition, 21 articles that summarized scientific congresses or journal articles were also excluded . Our exclusion criteria were based on the concept that simple reporting of an article without discussion of the outcomes of the research was not new health information . Of the 47 articles that met our inclusion criteria, 27 (57.4%) contained inaccurate or misleading statements on the basis of an evidence - based medicine evaluation . These included using inappropriate surrogate outcomes as clinical endpoints (three cases, 6.4%), extrapolating nonhuman results to humans (two cases, 4.3%), exaggerating the significance of results (eight cases, 17.0%), and using incorrect words (14 cases, 29.8%; fig . The rate of error was higher in information from korean sources than in information from international sources (22 cases vs. 5 cases). However, there were no significant differences between korean and foreign sources in any category (table 1). There were also no differences between articles written by general journalists and those written by medical journalists or specialists (13 cases by general journalists vs. 14 cases by medical journalists). After website searches, a total of 188 news articles on erectile dysfunction from 10 newspapers in 2011 were reviewed . 1); excluded articles were those discussing disease occurrence (16), accidents (11), crime and policy (7), social phenomena related to medicine (5), questionnaire surveys (4), educational information (4), esoteric medical information from unreliable sources (63), and advertisements (57). In addition, 21 articles that summarized scientific congresses or journal articles were also excluded . Our exclusion criteria were based on the concept that simple reporting of an article without discussion of the outcomes of the research was not new health information . Of the 47 articles that met our inclusion criteria, 27 (57.4%) contained inaccurate or misleading statements on the basis of an evidence - based medicine evaluation . These included using inappropriate surrogate outcomes as clinical endpoints (three cases, 6.4%), extrapolating nonhuman results to humans (two cases, 4.3%), exaggerating the significance of results (eight cases, 17.0%), and using incorrect words (14 cases, 29.8%; fig . The rate of error was higher in information from korean sources than in information from international sources (22 cases vs. 5 cases). However, there were no significant differences between korean and foreign sources in any category (table 1). There were also no differences between articles written by general journalists and those written by medical journalists or specialists (13 cases by general journalists vs. 14 cases by medical journalists). Good health is a prime global concern, and various factors including economic development play a significant role in shaping and defining a population's perception of health . In particular, men's health, including erectile dysfunction and andropause, are important matters in developing and developed countries . In asia, the men's attitudes to life events and sexuality (males) study, which studies the prevalence and treatment of erectile dysfunction in china, japan, korea, malaysia, and taiwan, reported that 6.4% of 10,934 men between 20 and 75 years of age self - reported erectile dysfunction, and 83.5% found suitable treatments in the media . Tannenbaum, in a survey on men's health of 2,325 canadians between 55 and 97 years of age, reported that 35.7% of men surveyed, especially those of a younger age, showed an interest in erectile dysfunction . In an epidemiological study on erectile dysfunction in korean men, the rate of self - reported erectile dysfunction was 13.4% in 1,570 men aged 40 - 75 years, and the percentage of men scoring fewer than 17 points on the international index of erectile function scale was 32.4%, demonstrating a high prevalence of erectile dysfunction among korean men . Thus, the prevalence of erectile dysfunction is high, particularly in developed countries like korea . It might be difficult for men with erectile dysfunction who are keen to receive treatment to find a urologist, schedule an interview, and finally receive medical treatment . Reported on the numbers of prescriptions written for phosphodiesterase-5 inhibitors from each department within three medical institutions in korea . In their study, the mean rate of prescriptions for phosphodiesterase-5 inhibitors was approximately 46.4% from the urology departments, compared with 33.0% from endocrinology, 5.1% from neurology, 4.4% from cardiology, and 3.9% from family medicine, which indirectly suggests that the medical diagnosis and treatment of erectile dysfunction was relatively low in the urology departments of the three hospitals . Mass media such as newspapers and television broadcasts are alternative sources of medical and health information . With the recent introduction of medical journalists, many medical news articles have appeared in newspapers and television broadcasts and are subsequently redistributed via the internet . Unfortunately, as shown in our present study, the accuracy of these medicine - related articles can be unreliable . Hwang et al . Performed an evidence - based medical evaluation of health information from the television news . In that study, over an 8-month period, there were 85 such reports on the evening news, and 34 of them (40.0%) were found to be inaccurate or misleading . In particular, using inappropriate surrogate outcomes as clinical endpoints was the most frequent error . This could be attributed to the misinterpretation of results owing to inappropriate study designs, or medical researchers assuming that anatomical or physiological endpoints in their studies could be translated directly to represent clinical outcomes in patients, and the ignorance of news reporters on the medical issues they were reporting . The reason for this might be that the researchers published exaggerated results, and the news media chose to focus on this misinformation of popular interest . The frequency of errors was higher in articles from korean sources than in articles from foreign sources . News articles from the foreign presses were re - reported by the korean media mainly because they were easily accessible to the journalists . On the contrary, domestic sources were often more interested in publicizing study researchers and their associated hospitals, often exaggerating claims although the level of korean media has been increasing, it may report biased content not based on exact evidence . Because an increasing number of medical commentaries initially reported on television news and newspapers are now available online in media such as twitter, facebook, and youtube, the accuracy of primary sources (i.e., television news and newspapers) has become more crucial . Presently, the korean urological association and the korean society for sexual medicine and andrology do not use twitter or facebook aggressively, so as to reduce " retweeting " or " liking " misleading information and comments made by the television news or newspapers . To curtail these errors, evidence - based medical methodology must be agreed upon and practiced by all medical journalists and the news media . Doctors must first embrace evidence - based medicine during the course of their training and clinical work and publish their research findings in relevant peer - reviewed journals before making their results public . Additionally, medical journalists should spend more time studying and digesting medical - related information and receive training in evidence - based medicine . Last but not least, both the korean urological association and the korean society for sexual medicine and andrology should constantly monitor misleading medical articles and request revisions whenever necessary . It is only through these measures that the general public can be spared the negative effects of medical misinformation . Approximately 57% of all articles on erectile dysfunction from 10 nationwide daily newspapers were found to be inaccurate on the basis of an evidence - based medicine evaluation . To this effect, urologists, the korean urological association, and the korean society for sexual medicine and andrology play a paramount role in identifying articles containing inaccurate information . In addition, medical journalists should be trained to write articles based on evidence rather than sensation.
Major depressive disorder (mdd) constitutes the second leading cause of disability worldwide and is associated with a substantial socio - economic burden (licinio and wong, 2011; vos et al ., 2012; the sequelae of mdd comprise several emotional as well as cognitive symptoms, which are considered to merely reflect a bias towards negatively - valenced information processing leading to adverse emotional responsiveness, attention, and dysfunctional executive function (nolen - hoeksema, 1991; beck, 2008; disner et al ., 2011; elliott et al ., imaging studies have provided compelling evidence of altered emotion networks in mdd encompassing the amygdala and the anterior cingulate cortex (drevets et al ., 1997; pezawas et al ., 2005; price and drevets, 2012), highlighting the superior role of the cortical midline structures in the pathogenesis of mdd and antidepressant treatment response (liotti et al ., 2002; lozano et al ., 2008; kupfer et al ., 2012). Recently, more attention has been paid to cognitive control mechanisms in patients with concurrent major depressive episodes (mdes) (harvey et al ., 2005; rose et al ., 2006; matsuo et al ., 2007; walsh et al ., 2007; fitzgerald et al ., 2008; schlosser et al ., 2014) demonstrating increasingly converging evidence of less default mode network (dmn) suppression during performance of attention - demanding tasks (sheline et al ., 2009; disner et al ., 2011;, 2012; rodriguez - cano et al ., 2014). While the dmn (gusnard et al ., 2001; raichle et al ., 2001) is physiologically activated at rest and deactivated during goal - directed cognition, insufficient dmn suppression has been repeatedly associated with goal - irrelevant functions such as self - referential thought, introspective processing or rumination (mason et al . Complementary evidence of dysfunctional dmn activation in mdd has also been detected at rest (greicius et al ., 2007; sheline et al ., 2010; zhang et al ., 2011;, 2013; li et al ., 2013; sambataro et al ., 2013; while an abundance of imaging research on cognitive control or functioning was conducted in patients with concurrent major depressive episodes (mdes), studies dedicated to remitted mdd (rmdd) are relatively sparse and inconclusive (walsh et al ., 2007; okada et al ., 2009; schoning et al ., 2009;, 2012a, 2012b; nixon et al ., 2012; li et al ., 2013;, 2013; jacobs et al ., 2014; young et al ., 2014). Nonetheless, rmdd is of significant clinical interest since it often represents a euthymic state with increased relapse risk (bhagwagar and cowen, 2008; kendler and gardner, 2010) and, together with information on the number of previous mdes, guides clinical recommendations for antidepressant maintenance treatment (apa, 2013). Apart from providing complementary evidence to disease concepts of symptomatic mdd, the study of rmdd raises the possibility to elucidate the neurobiological and psychological mechanisms underlying maintenance of remission as well as determinants of relapse (marchetti et al ., 2012). While the majority of above - mentioned rmdd studies focused on possible alterations in task - positive networks, the involvement of task - negative dmn regions gains increasing attention (jacobs et al ., 2014; specifically, the extent of dmn suppression, which has been shown to be crucial for goal - directed cognition and to be dysfunctional in symptomatic mdd (disner et al ., 2011; hamilton et al ., 2011; anticevic et al ., 2012; nejad et al ., 2013; leech and sharp, 2014), has yet to be thoroughly studied in this specific patient group (marchetti et al ., 2012). Additionally, several limitations present in previously published rmdd studies such as concomitant antidepressant treatment (walsh et al ., 2007; schoning et al ., 2009; nixon et al ., 2012; li et al ., 2013), moderate sample size (okada et al ., 2009; norbury et al ., 2013), or incomplete remission (walsh et al ., 2007; schoning et al ., hence, we conducted a cross - sectional functional magnetic resonance imaging (fmri) study in a large sample of adult fully remitted and drug - free mdd patients as well as adult healthy controls (hc) without any previous psychiatric life - time diagnosis . Additionally, we investigated possible behavioral and neural differences with respect to age of mdd onset, because adolescent - onset mdd contrasts clinically with its adult - onset counterpart with regard to chronicity, severity, vulnerability, and stress - sensitivity (harrington et al ., 1990;, 1999; aalto - setala et al ., 2002; gilman et al ., 2009; pajer et al ., 2012; schosser et al ., 2012; ramirez et al ., the main goal of this study was to assess both task - positive (cole et al ., 2014) and task - negative (anticevic et al ., 2012) differences of neural networks that are engaged or suppressed during working - memory (wm) performance . Based on recent findings demonstrating a relationship between reduced dmn suppression and increased rumination in symptomatic mdd (hamilton et al ., 2011), we hypothesized to observe similar deficits in full remission, a condition, where maladaptive self - referential processing has been associated with onset of depressive symptoms (nolen - hoeksema, 1991; michl et al ., 2013). Moreover, we expected that adolescent - onset rmdd patients would be more severely affected than those with adult - onset given the more deleterious course of adolescent - onset mdd . Study volunteers recruited by online advertisements, announcements on bulletin boards or word of mouth were invited to the outpatient clinic of the department of psychiatry and psychotherapy, medical university of vienna (muv), vienna, austria, to participate in this cross - sectional fmri study . Study procedures were approved by the ethics committee (ec) of the muv (ec number: 11/2008) according to the declaration of helsinki (wma, 2013). All participants, who were adult and fully capable to give written informed consent, were considered and financially compensated for their expenditure of time . After a comprehensive clinical assessment comprising previous history, neurological and medical examinations involving electrocardiography, blood pressure measurement and routine laboratory testing diagnoses were evaluated according to the german version of the structured clinical interview for dsm - iv axis i disorders (scid - i) (wittchen et al ., 1997). Depressive symptoms were assessed by the 21-item version of the hamilton rating scale for depression (ham - d) (hamilton, 1960). Only healthy participants without any previous or concurrent axis i disorder were enrolled in this study, whereas previous single or multiple mdes without any other present or previous axis i disorders were mandatory for inclusion of rmdd patients . In order to exclude cases with questionable clinical significance, only patients reporting previous antidepressant treatment (antidepressant medication, psychotherapy, or both) were included . Only rmdd patients who remitted and discontinued any antidepressant treatment at least three months prior to study enrollment were considered . Based on recent recommendations for considering remission and normal levels of functionality (romera et al ., 2011) a total ham - d score 5 was required for all subjects . A complete list of further inclusion- and exclusion criteria is available in the supplemental information . Consecutively, 78 adult rmdd patients were enrolled in this study . With respect to age of onset, adolescent - onset was defined as 19 years and adult - onset as> 19 years (pajer et al ., 2012). 42 adult hc chosen from a larger sample were automatically age- and gender - matched for both adult rmdd subgroups comprising 42 adolescent- and 36 adult - onset patients using an optimal full matching procedure (hansen and olsen klopfer, 2006). Prior to scanning, subjects received a standardized instruction and computerized training for the classical digit variant of the n - back task (callicott et al ., 1999) with two complexity conditions . The n - back task was designed to engage subjects to constantly update their mental set while minimizing interference from incoming stimuli (digits 14). Briefly, subjects had to follow a simple visual instruction ahead of each task block that indicated if they had to recall any number seen two presentations before (two - back; 2b) or if they had to identify the digit currently seen (zero - back; 0b). This wm paradigm consisted of four 2b blocks and four 0b blocks in total, each lasting for 30 s. fourteen digits were pseudo - randomly presented for 1000 ms and followed by a 1000 ms inter - stimulus - interval at the corners of a trapeze - shaped array within each block . Visual stimuli were displayed using standard software (presentation 10.3, http://www.neurobs.com/) and presented via a back - projection screen by a beamer placed outside the scanner room . Performance data represented as percentage (accuracy) as well as latencies (given in milliseconds) of correct responses were recorded via response buttons of an mri - compatible response box fixed on the right thigh . Subjects replied with their right hand, using the middle finger for digit 1, the ring finger for digit 2, the index finger for digit 3 and the little finger for digit 4 . Demographic and psychometric differences between subgroups (adolescent- and adult - onset rmdd patients, hc) were investigated utilizing a one - way analysis of variance (anova) or a chi - squared contingency table test . (wst) (schmidt and metzler, 1992), an operationalization of verbal intelligence, was assessed to confirm comparable education levels between the investigated subgroups . Additionally, response style questionnaire (rsq) (nolen - hoeksema, 1991) data were available for a subsample of 39 participants (adolescent - onset rmdd patients: n = 14, adult - onset rmdd patients: n = 9, hc: n = 16), and were utilized to study the relationship between the personality trait rumination and imaging results within a post - hoc regression analysis . Clinical differences between the rmdd subgroups were tested by a two - sample t - test or a two - sample wilcoxon test, where appropriate . In accordance with previous studies employing the n - back task (rose et al ., 2006; schoning et al ., 2009), wm performance represented by accuracy and reaction time (rt) was recorded after stimulus onset for each complexity condition and examined by a repeated - measures anova using one within - subject factor (wm load: two levels) and one between - subject factor (group: three levels). Behavioral analyses including scanner motion parameters were also examined by an anova . Including age and gender in an additional analysis of co - variance (ancova) did not alternate these results . All analyses were performed in r (version 3.1.1, http://cran-r-project.org/). The significance threshold was set at p <0.05, two tailed . Briefly, fmri data processing was carried out using afni (http://afni.nimh.nih.gov/afni/) implemented into an r framework (http://cran.r-project.org/) (boubela et al ., 2012). Second - level activation analysis was conducted utilizing a mixed - effects meta - analysis approach (3dmema), which takes advantage of both beta - coefficients and t - values thereby accounting for between - subject variability and also the precision estimates of individual subject analyses (chen et al ., 2012). Functional connectivity (fc) analysis was performed for two 4 mm spherical seeds representing maximal task - negative and -positive group differences (anterior - medial prefrontal cortex, ampfc: 5, 46, 12; dorsolateral pfc, dlpfc: 25, 26, 38). Fisher z - transformed correlation maps were used as dependent variable within a general linear model for between group comparisons using age and gender as covariates of no interest . Second - level results have been corrected for multiple comparisons in a whole - brain analysis of regions activated by the task for activation, and within a whole - brain mask for fc analysis using family - wise error (fwe) rates . Proportional variance estimation (s) for regression analysis of behavioral imaging correlates was based on the package demographic, clinical as well as behavioral data of all subjects are displayed in table 1 . No significant group differences were detected with respect to age (f(2, 117) = 1.35, p = 0.11), gender ((5) = 3.9, p = 0.56), years of education (f(2, 117) = 0.88, p = 0.42), and the wst (f(2, 116) = 0.85, p = 0.43). Ham - d scores differed significantly between the subgroups (f(2, 117) = 6.45, p = 0.002) given the large sample size . It is noteworthy, that all subjects were below a conservative ham - d cut - off 5, considered to indicate clinical relevance (romera et al ., 2011). As expected, there was a significant effect of wm load (2b minus 0b) for both accuracy (f(1, 117) = 216.87, p <0.001) and rt (f(1, 117) = 34.14, p <0.001). No significant main effects were observed for both accuracy (f(2, 117) = 2.00, p = 0.14) and rt (f(2, 117) = 0.52, p = 0.59) between all three investigated groups . No significant interaction effects for group and wm load were detected for either accuracy (f(2, 117) = 2.41, p = 0.094) or rt (f(2, 117) = 1.22, p = 0.298). Also here, although all subjects showed adequate cognitive performance (0b accuracy> 80%), a separate condition analysis revealed subtle but significant subgroup differences for 0b rt (f(2, 117) = 3.37, p = 0.038) given the large sample size . With respect to scanner motion, we observed rather low maximum translation parameters (mean 0.46 mm, sd = 0.28 mm) with strongest movement of 1.32 mm . Furthermore, we did not observe any significant difference of maximal displacement between all three groups (f(2, 117) = 1.86, p = 0.16). Adolescent - onset rmdd patients exhibited more previous mdes (p = 0.001), a higher cumulative number of months of mdes (p = 0.009), a longer duration of illness (t(76) = 4.83, p <0.0001), a longer duration of remission (p = 0.036), and a longer time - span since termination of psychotherapy (p = 0.006) than adult - onset rmdd patients . No significant differences were found for ham - d scores (t(76) = 0.96, p = 0.34), cumulative number of months of antidepressant medication (p = 0.37), cumulative number of psychotherapy units (p = 0.62), and duration of the last mde in months (p = 0.99) between the rmdd subgroups . To test if the employed paradigm recruited both, the task - positive wm network (wmn) as well as the task - negative dmn, in our study, we performed a within - group comparison for wm load (2b minus 0b). In all three groups, significantly increased activation was detected in the dlpfc, the ventrolateral pfc (vlpfc) as well as the inferior parietal lobe (table 2, fig . Concurrently, significant load - dependent deactivation was found in the ampfc, posterior cingulate cortex (pcc), as well as in the adjacent frontal-, temporal-, and parahippocampal gyrus (table 2, fig . S1). While the overall peak of activation was clearly found in the dlpfc, maximal deactivation was located in the ampfc in all three groups (table 2, fig ., rmdd patients showed a significantly diminished deactivation of dmn regions with punctum maximum in the ampfc, while no significant group differences were found in typical wm areas (fig . Significant effects were even more pronounced, when comparing hc to adolescent - onset rmdd patients, where the latter exhibited significantly reduced dmn deactivation, which was most prominent in the ampfc, the pcc, and the temporal lobe (fig . Interestingly, adolescent - onset rmdd patients differed similarly from adult - onset rmdd patients, though not reaching significance (fig . 1c, fig . In contrast, activation patterns of adult - onset rmdd patients did not significantly differ from hc (fig . 1c, fig . S2c; table 3). To investigate the degree of coupling between the dmn and the wmn, we calculated fc for regions with maximal task - negative (ampfc) and -positive (dlpfc) group differences . Analogous to activation results, fc analyses revealed significant differences between adolescent - onset rmdd patients and hc . Compared to hc, adolescent - onset rmdd patients exhibited significantly reduced coupling of the ampfc with most brain regions (fig . Inversely, the dlpfc as seed region mirrored this result demonstrating increased fc with the ampfc and decreased fc between the dlpfc and the remaining brain regions (fig . In contrast, adult - onset rmdd patients exhibited a qualitatively similar, but less - pronounced coupling pattern for both seed regions, which did not significantly differ from hc or adolescent - onset rmdd patients (fig ., we performed a post hoc linear regression analysis of accuracy and neural activation on a regional as well as brain systems level while controlling for age and gender . We correlated the strongest group difference for deactivation (ampfc) and fc (ampfc was used as seed region), and observed a significant negative relationship between 2b accuracy and ampfc - dlpfc coupling (s = 8.1%; t(116) = 3.22, p = 0.0016, fig . In addition, we found a trend - wise significant positive correlation of 0b accuracy with ampfc - medial frontal gyrus (mfg) coupling (s = 2.9%; t(116) = 1.93, p = 0.0557) as well as a negative correlation with the ampfc activation (s = 2.3%; t(116) = 1.7, p = 0.0896). A post - hoc regression analysis of rsq data and imaging results indicated that reduced dmn deactivation is significantly associated with an increased ruminative response style (s = 14.3%, t(35) = 2.39, p = 0.023; fig . . Moreover, rumination differed significantly between subgroups (f(2, 35) = 6.26, p = 0.0047) with maximal rumination values in adolescent - onset rmdd patients and lowest in hc, while adult - onset rmdd patients showed intermediate scores (fig . Similar to previous analyses, age and gender were modeled as covariates of no interest . The main goal of the present study was to investigate putative functional alterations of neural networks that are engaged or suppressed during wm performance in a large sample of adult drug - free rmdd patients and hc . Briefly, in comparison to hc, rmdd patients showed a significantly diminished deactivation of dmn nodes, which are known to be suppressed during externally directed wm performance (anticevic et al ., 2012). Moreover, the present study revealed that such reduced suppression of the dmn was significant only in adolescent - onset rmdd patients, putatively reflecting the more chronic course of early - onset mdd from a neurobiological perspective . On a brain systems level, adolescent - onset rmdd patients showed increased ampfc - dlpfc coupling, while all other connections within the wmn and dmn regions showed an inverse directionality . This tight coupling might underlie decreased reciprocal inhibition between the anterior parts of these antagonistic networks . Moreover, the fact that the strongest dmn disinhibition was detected in the ampfc underlines the superior role of this cortical midline structure in the dynamic interplay between several large - scale neural circuitries, encompassing the fronto - parietal central executive network, cingulo - opercular salience network (sn), and the medial prefrontal - medial parietal dmn, which has been shown to be dysfunctional in depression (lemogne et al ., 2012; li et al ., 2013; liston et al ., 2014) and other major neuropsychiatric disorders (meyer - lindenberg and tost, 2012; chen et al ., 2013; 2014). In detail, the present findings are in line with the idea that a dysfunctional ampfc interferes with bottom - up processes during wm - related computations in mdd patients . As a consequence, top - down control mechanisms are likely initiated to down - regulate the dmn system, but fail to completely suppress its activity (disner et al ., 2011; the key finding of this study is the reduced dmn suppression in mdd patients existing even after full recovery, which mirrors findings in symptomatic- (rose et al ., 2006;, 2009; sheline et al ., 2010; disner et al ., 2011; zhang et al ., 2011;, 2012; davey et al ., 2012a; zhu et al ., 2012; connolly et al ., 2013; guo et al ., 2013; li et al ., 2013; sambataro et al ., 2013; dutta et al ., 2014; rodriguez - cano et al ., 2014) and euthymic- (walsh et al ., 2007; schoning et al ., 2009; smoski et al ., 2013) this reduction of dmn suppression, which is accompanied by increased ruminative response style in our study, might therefore be interpreted as increased self - referential processing as well as insufficient inhibition of conflicting computations in line with previous literature (mason et al . It is noteworthy that rumination has been found to be mediated by midline cortical structures of the dmn (northoff et al ., 2006;, 2011; northoff et al ., 2011; nejad et al ., 2013) and to predict mdd onset, severity (liotti et al ., 2002; northoff et al ., 2011), and duration (nolen - hoeksema, 1991; michl et al ., 2013) hence, we are tempted to speculate that the dysfunctional dmn suppression present in non - symptomatic mdd patients could also render the biological signature of increased relapse likelihood . This assumption is further supported by significantly pronounced dmn suppression deficits in adolescent - onset rmdd patients, who are prone to a more severe and chronic course compared to mdd patients with later onset, as repeatedly suggested in previous studies (harrington et al ., 1990; klein et al ., 1999; weissman et al ., 1999; aalto - setala et al ., 2002; zisook et al ., 2007; kendler et al ., 2009; pajer et al ., 2012; schosser et al ., 2012; ramirez et al ., our data are further underlined by a recently published imaging study of remitted depressed young adults demonstrating that hyperconnectivities of the dmn and the sn with cognitive control networks are related to rumination and sustained attention (jacobs et al ., 2014). Similar neural alterations of the medial prefrontal cortex (mpfc) have been observed in another recent study in rmdd patients reporting an association between dysfunctional deactivation of the dorsomedial pfc and impaired autobiographical memory (young et al ., 2014). Our results resembling the critical role of the mpfc in neural alterations being found in symptomatic - as well as euthymic mdd patients (young et al ., 2014; jacobs et al ., 2014) hint at the possibility that neural dysfunction may persist even after full recovery of mdd . The mpfc is known to represent a critical neural hub that is involved in self - referential processing such as autobiographical memory, rumination, and cognitive control . It is noteworthy that one important function of the mpfc is to integrate contextual information of autobiographical memory in order to imagine the future (schacter and addis, 2007; euston et al ., 2012). The context - dependent autobiographical memory has been shown to be negatively - biased and less specific in symptomatic- and to some degree also in remitted mdd patients (euston et al ., 2012; laxton et al ., 2013; young et al ., 2014), and is therefore thought to reflect a specific cognitive style, which might predict antidepressant treatment response and depression relapse (nolen - hoeksema, 1991; liotti et al ., 2002; northoff et al ., 2011; michl et al ., 2013; andrews - hanna et al ., 2014). Together with the known stress - sensitivity of the mpfc, conditions of uncontrollable stress paralleled by an exacerbation of helplessness and rumination could therefore be responsible for depression relapse (nolen - hoeksema, 1991; amat et al ., 2005). While there is little doubt today that functioning of dmn - related brain regions is affected in mdd and other psychiatric disorders, the role of the dmn and the regional specialization of anterior and posterior parts of the human medial cortex has been increasingly investigated in the context of various mental processes (amodio and frith, 2006; beckmann et al ., 2009;, 2014; leech and sharp, 2014). Accordingly, neural alterations linked to symptoms like rumination as demonstrated for the mpfc and the dmn clearly show that underlying neural signatures are not limited to dsm - defined boundaries . Hence, such neural changes observed in symptomatic as well as euthymic mdd are thought to reflect disease - related changes of neural systems that might be of diagnostic value in future neurobiology - based diagnostic systems (nestler and hyman, 2010; insel, 2012; kapur et al ., 2012). In contrast to the marked neural activation differences between rmdd patients and hc, the main effects on wm performance were statistically indistinguishable between the groups, which is in line with the majority of previous reports (walsh et al . However, the non - isomorphism between brain function and behavior present in this study could further be related to the chosen maximal wm - load of the behavioral paradigm (2b), which might change, when wm - load increases (e.g. 3b, 4b) or stress - related environmental distractors, requiring a more rigorous control of the dmn, are involved . Our post hoc analysis of the relation between behavioral and imaging data revealed a significant negative correlation between ampfc - dlpfc coupling and 2b accuracy . This finding indicates that less accuracy is accompanied by dmn - wmn hyperconnectivity, which might reflect the increased relapse risk of rmdd patients (jacobs et al ., 2014). While our results as well as limited evidence available from recent studies (jacobs et al ., 2014; young et al ., 2014) hint at the importance of dmn - wmn interplay with respect to depression relapse prediction, future longitudinal studies are clearly needed in order to validate the assumption that a dysfunctional dmn is causally related to increased relapse likelihood in mdd patients . Despite the intriguing neural alterations observed in this large study of fully - recovered drug - free rmdd patients, some limitations may apply . To address the biological heterogeneity of mdd, we decided to sub - group our patient sample according to disease onset, which was driven by encouraging reports on distinct biological signatures of adolescent mdd patients (pajer et al ., 2012), well - known clinical differences between adolescent- and adult - onset mdd patients (zisook et al ., 2007), and the ease and precision of assessment . While competing sub - classifications such as typical / atypical depression, single / multiple episode mdd as well as others (harald and gordon, 2012; lamers et al ., 2012; sung et al ., 2013; thase, 2013; rodgers et al ., 2014; wakefield and schmitz, 2014) exist, their biological significance is still under debate and has not fully been addressed yet (insel, 2012; casey et al ., 2013). Thus, we are confident that our choice to subgroup patients according to disease onset is appropriate for this study type . Notably, the present cross - sectional study targets exclusively the remitted phase of mdd, and therefore does not allow a direct comparison to symptomatic mdd . Hence, all inferences being made with respect to symptomatic mdd are purely literature - based . However, we are confident that our conclusions are not too far - fetched given the multitude of imaging literature on symptomatic mdd . Summarizing, this study demonstrates that dmn alterations persist even after full recovery of mdes . Observed neural activation patterns were related to rumination, which is a well - established indicator of mdd severity (hamilton et al ., 2011). Brain systems level analyses mirrored the aberrant dmn suppression in rmdd patients and underlined the specific role of the ampfc as mediator of these effects (lemogne et al ., 2012; chen et al ., 2013; li et al . In contrast to adult - onset rmdd patients, adolescent - onset rmdd patients exhibited significant local as well as systems level findings, which might reflect the more detrimental clinical course of this diagnostic subgroup . In conclusion, this study demonstrating reduced dmn suppression in rmdd patients encourages the investigation of dmn suppression measures as putative relapse predictor in future clinical trials, which might eventually lead to important implications for antidepressant maintenance treatment . This work was partly funded by the special research project sfb-35 (project number f3514-b11) and the program clinical research (project number kli148-b00) of the austrian science fund (fwf), and the oesterreichische nationalbank, anniversary fund (project number 13903). Lucie bartova, bernhard m. meyer, kersten diers, ulrich rabl, and lukas pezawas designed research . Lucie bartova, bernhard m. meyer, kersten diers, ulrich rabl, christian scharinger, ana popovic, klaudius kalcher, roland n. boubela, gerald pail, dominik mandorfer, christian windischberger, and ewald moser performed research . Bernhard m. meyer, kersten diers, ulrich rabl, klaudius kalcher, roland n. boubela, and lukas pezawas analyzed data . Lucie bartova, bernhard m. meyer, kersten diers, ulrich rabl, ana popovic, julia huemer, siegfried kasper, nicole praschak - rieder, harald h. sitte, ewald moser, burkhard brocke, and lukas pezawas wrote the paper . Lucie bartova, bernhard m. meyer, kersten diers, ulrich rabl, christian scharinger, ana popovic, klaudius kalcher, roland n. boubela, julia huemer, dominik mandorfer, christian windischberger, nicole praschak - rieder, burkhard brocke and lukas pezawas report no conflicts of interest . Harald h. sitte has received honoraria for lectures and consulting from astra zeneca, lundbeck, nycomed, ratiopharm, roche, sanofi - aventis, serumwerk bernburg, torrex - chiesi pharma . Gerald pail has worked as a consultant for astrazeneca, bristol - myers squibb, glaxosmithkline, lundbeck, msd and servier and he has served on speakers' bureaus for astrazeneca, bristol - myers squibb, lundbeck, nycomed and servier . He has been employed by lundbeck from 2005 to 2007 and has received educational grants by lundbeck and servier . Siegfried kasper has received grant / research support from bristol myers - squibb, eli lilly, glaxosmithkline, lundbeck, organon, sepracor and servier; he has served as a consultant or on advisory boards for astrazeneca, bristol - myers squibb, eli lilly, glaxosmithkline, janssen, lundbeck, merck sharp and dome (msd), novartis, organon, pfizer, schwabe, sepracor, and servier; and he has served on speakers' bureaus for angelini, astrazeneca, bristol myers - squibb, eli lilly, janssen, lundbeck, neuraxpharm, pfizer, pierre fabre, schwabe, sepracor, and servier . Ewald moser has received an unrestricted research grant by siemens healthcare, which is unrelated to the present work.
A 36-year - old man with repeatedly paroxysmal headache was admitted to our hospital . The patient suffered a severe head trauma in a car accident 21 days prior to the accident . He was admitted to hospital with periorbital soft tissue swelling, ct scanning revealed a skull fracture in sss area . Before he was transferred to our hospital, computerized tomographic angiography (cta) revealed vascular malformation and venous congestion of the sss, which was considered to be secondary to the trauma . Left internal carotid artery angiogram revealed a davf supplied by the anterior falx artery (figure 1a). Left lateral (figure 1b), anteroposterior (figure 1c) and right lateral (figure 1d) view of left external carotid artery (eca) angiogram showed the sss davf with bilateral cortical venous reflux . Endovascular treatment for a patient with posttraumatic dural arteriovenous fistula (davf) of the superior sagittal sinus (sss). A) left internal carotid artery angiogram before embolization showing the davf supplied by the anterior falx artery; b, c and d) lateral (b&d) and anteroposterior (c) view of left external carotid artery (eca) angiogram before embolization showing the davf of sss with bilateral cortical venous reflux; e) unsubtracted image showing the scepter balloon catheter navigated close to the fistulous point for onyx injection (arrow head indicating the balloon markers, arrow indicating the distal tip); f) unsubtracted image showing the onyx cast extending to the proximal draining vein after embolization; g) post - embolization angiogram of the left common carotid artery showing complete disappearance of the fistula . H) post - embolization angiogram of the right eca showing complete disappearance of the fistula . (415 mm, microvention, tustin, california, usa) was placed at the most distal segment of the left middle meningeal artery (mma) and contrast medium was injected into the balloon . Unsubtracted image showed the scepter balloon catheter navigated close to the fistulous point for onyx injection (figure 1e). In order to occlude any residual fistula, onyx-18 (ev3, irvine, california, usa) was then injected through the dual lumen balloon catheter positioned in one branch of the mma . Unsubtracted image showed the onyx cast extending to the proximal draining vein after embolization (figure 1f). With the balloon inflated, a total of 1.2 ml of onyx-18 was delivered with thorough penetration into the malformation slowly, after which, angiogram of both the left common carotid artery and the right external carotid artery (eca) showed complete disappearance of the fistula (figures 1g - h). The balloon was deflated by syringe suction without difficulty . At the end of the procedure, the catheter was removed under constant aspiration without any noticeable adherence to the onyx cast . Discussion dural arteriovenous fistula account for 10%15% of intracranial arteriovenous malformations.6 davfs in sss are extremely rare . A small percentage of patients have a history of previous trauma, they have been well reported.7 the common characteristic of davfs happened when a patient suffered skull fraction, or other trauma, not long after a head injury with progressive symptoms such as, exophthalmos, swelling of the eyelids, bruit, and so forth . This scenario most likely accounts for the findings in our patient, and we believe that his davfs probably were secondary to the head injury rather than a congenital anomaly . So far, the first - line treatment for davfs is embolization by using transarterial, transvenous, or occasionally, combined approaches.1 - 8 this approach proved to be effective comparable with davf obliteration in preventing neurologic morbidity with lower levels of procedural risk . The use of onyx has been increasingly reported for the treatment of davfs.2 - 10 using reflux as a plug, operator creates a forward flow of onyx, which is called the plug and push technique . The dual lumen balloon microcatheter served a dual purpose: the onyx-18 injection was allowed through the dual lumen balloon catheter and a mechanical barrier was provided to prevent the onyx reflux at the same time . This technique is an option during extracranial embolic embolization in a few select cases . In this case, a patient with a post - traumatic davf of the sss was effectively treated . It is appropriate to select a dual lumen balloon microcatheter for complex dural arteriovenous fistulas . Using a dual lumen balloon microcatheter helps prevent onyx reflux and improves its penetration during onyx embolization of davfs . Thus, this is a feasible and effective alternative approach for the management of post - traumatic davfs.
Hepatoblastoma is a primary malignant liver tumor that originates from embryonic and fetal liver cells . It constitutes 30%-45% of all primary liver tumors and 50%-60% of all malignant tumors that occur during childhood.1, 2 hepatoblastoma is often associated with a congenital anomaly, particularly with familial adenomatous polyposis coli . It is primarily a tumor of young children, and more than 90% of tumors usually present before five years old, but rarely presents in older children or adults.4, 5 males are affected twice as often as females . However with increasing age, the gender difference equalizes . This is a relatively rapid growing tumor . The serum alfa - fetoprotein (afp) levels are markedly elevated in approximately 90% of the patients . An 18-year - old man referred due to right upper quadrant (ruq) pain since two months prior to admission in this hospital . The ruq pain, which was constant has had radiation to his back, and gradually was worsened . He had complaints of low back pain, that aggravated by movement since one month prior to admission . The patient had anorexia with a 15 kg weight loss during these two months with no history of fever, chills, vomiting, diarrhea, change in bowel habits or tarry stools . The liver was enlarged with firm two nodular consistency, and spleen was palpable by ballottement maneuver . Laboratory results were as follows: hemoglobin (9.1 g / dl), platelets (257000/mm), homocysteine: 20.5 mol / l (normal 5 - 15), anti - cardiolipinigm 2.9 mpl (normal <15), anti - phospholipid igg: 1.8 (normal <10), protein c: 127% (normal 70 - 130), protein s: 51% (normal 65 - 140), lupus anticoagulant: negative, alanine aminotransferase: 113 iu / l, aspartate aminotransferase: 495 iu / l, alkaline phosphatase: 1253 iu / l, total bilirubin: 12.6 mg / dl, direct bilirubin: 12 mg / dl and ldh: 789 u / l, serum hbs ag was positive and hbv dna serum level was 247 iu / ml . Total protein, albumin, and coagulation indexes were within normal ranges . Paracentesis of ascitic fluid showed clear color with high serum ascites albumin gradient, without findings of peritonitis . Ultrasonography of abdomen showed a coarse liver parenchyma, without mass or space occupying lesion . Endoscopy was notable for the presence of f1 esophageal varices, and fundal varices (without active bleeding or stigmata of recent hemorrhage), and a kissing type duodenal ulcer disease . Color doppler ultrasonography of abdomen showed splenic and portal vein thrombosis, but the hepatic artery and inferior vena cava were normal . The initial serum alpha - fetoprotein level was 300 ng / ml (normal 0 - 8.5) that after ten days increased to 112000 ng / ml . Triphasic ct scan of the liver shows a large heterogeneous caudate lobe, with small right and left liver lobes . There was thrombosis in the main portal vein with extension to the intra - hepatic branches, and splenic vein . Liver biopsy (figs . 3 and 4) contained normal as well as neoplastic tissues . In the non - neoplastic tissues the tumor component was composed of small and large nests of small hepatocyte - like cells . The individual cells were round to polygonal shaped with amphophilic to somewhat eosinophilic cytoplasm and round to oval hyperchromatic nuclei with occasional nucleoli . There were also scattered and large aggregates of polygonal cells with abundant fat accumulation in the cytoplasm (fig . 3). Immunohistochemistry (ihc) was positive for hepar1 (focal), vimentin, ck, afp, pcea and afp (diffuse), and alfa-1 anti - trypsin . Ihc was negative for cd34, synaptophysin, nse, ttf-1, desmin, chromogranin, placental alkaline phosphatase, cd99, cd10, albumin, and s100 . According to the histopathology features and ihc profile, h&e stain of liver mass shows some fat vesicles with no evidence of cirrhosis . Hepatoblastoma is the most common primary liver tumor of childhood and adolescence, but is rarely found in adults, this tumor presents more commonly before the age of three years, predominantly in males.7- 9 however with increasing age the gender difference disappears and the incidence becomes equal among genders ., hepatoblastoma can be presented with rapidly enlarging upper abdominal mass, weight loss, and or failure to thrive; in adults symptoms of abdominal pain, fever, malaise and the presence of an abdominal mass are more frequent . Hepatocellular carcinoma is the most common primary liver tumor seen in adults and is closely related to cirrhosis and chronic liver disease, particularly in patients with chronic hepatitis b virus infection . Diagnosis of hepatocellular carcinoma should be considered in patients with cirrhosis who deteriorate clinically or has a liver mass in radiological workups . In any patient with cirrhosis and newly developed signs of decompensation such as ascites, hepatic encephalopathy, variceal bleeding or fever of unknown origin, the presence of hepatocellular carcinoma should be investigated . Our patient presented with ascites, esophageal varices and a large firm liver and positive hepatitis b virus antigen, so the initial clinical impression was hbv induced liver cirrhosis with hepatocellular carcinoma, but normal platelet count, and albumin was not in favor of advanced portal hypertension . Hepatocellular carcinoma is the first diagnosis in any patient with clinical findings of cirrhosis, liver mass and elevated serum afp . Hcc have been reported in hbv infected non - cirrhotic young patients below age 20 but is a rare finding . In a report by sezaki et al . Only four out of 187 patients with hcc were young with ages; 10, 22, 23, and 26 years . They suggested predisposition to hcc due to integration of hbv genome into host genome during intrauterine life . Although development of portal vein thrombosis in a patient with cirrhosis can be explained, however the presence of both cirrhosis and hepatocellular carcinoma in a young adult with isolated hbv infection is very unusual . In young patients with liver mass (es), without evidence of cirrhosis and an elevated afp, hepatoblastoma should be considered . The impression of caudate lobe hypertrophy in the radiologic reports can cause confusion in such cases for differentiation between cirrhosis plus hepatocellular carcinoma versus a large slowly growing hepatoblastoma arising from caudate lobe within non cirrhotic liver . Any pathology that causes caudate lobe enlargement can induce pressure effect on the portal venous system . This process can induce right and left lobe liver atrophy and portal vein thrombosis also . Pathologic diagnosis of adult hepatoblastoma is difficult in that hepatic teratoma; carcinosarcoma, malignant mesenchymal tumor, and hepatocellular with sarcomatous changes and hepatoblastomatous lesions should also be considered and be differentiated by appropriate immunohistochemistry evaluation . Treatment of choice is complete surgical resection, and without surgery the survival is poor . However improvements in survival have occurred with standardized chemotherapy that reduces the tumor size, enabling complete tumor excision . This process can be performed in patients who present with unresectable or metastatic disease . Chemotherapy reduces bleeding from the tumor and surrounding normal parenchyma and vascular structures, therefore facilitating resection of lesion . Chemotherapy has been proven effective as both an adjuvant and neoadjuvant treatment for tumor shrinkage, followed by surgical removal of the mass . Hepatoblastoma is sensitive to chemotherapeutic drugs such as doxorubicin, cisplatin, vincristine, 5-fu, and cyclophosphamide . This presentation of hepatoblastoma in a young patient with positive hepatitis b virus infection and portal hypertension (ascites, esophageal varices, and splenomegaly) is unusual . However the normal platelet count and serum albumin in the patient is not in favor of advanced cirrhosis as the cause of portal hypertension . The histologic evaluation of non - tumoral segments of liver can help us for differentiation of cirrhosis with hcc or a non - hcc liver tumor arising in a non - cirrhotic liver . Calcification within the mass, which is in favor of hepatoblastoma, was not shown in abdominal triphasic ct scan; and only the liver biopsy results were positive for hepatoblastoma.
Physician - patient communication is well recognized as an important component of good quality health care . Although much academic attention has been given to physician - patient communication and its improvement in the western world, research on this topic has only recently begun in the arabian gulf countries . There is a growing interest in this part of the world in physician - patient communication, particularly in regards to the breaking of bad news to a patient and family and communicating with patients with diabetes . The modest literature available suggests that physicians in the arabian gulf countries may benefit from some guidance on how best to communicate in a challenging culturally complex clinical environment . We are aware of only two such published communication skills training programs in this region . A 1-day workshop in saudi arabia for physicians, interns, and students received favorable reviews . Educators in oman published a 3-day curriculum for communication skills training, but no results were given . Salem and salem broadly generalized some of the beliefs and expectations about the delivery of bad news as illustrations of the differences between eastern and western cultures . They categorized these differences as health - care decisions; patient's perspective of bad news; the family's involvement in decision making for a patient's illness . Further, they assert that in muslim cultures, there is concern that a patient's knowledge of his illness will have a psychological impact leading to low self - esteem, in contrast to western belief that patients have the right to be given the news whatever it is to make better decisions about their care . Finally, the illness experience is seen as a family event in arabic and muslim cultures, rather than a personal event as viewed in the west . It should be noted that these are broad generalizations that may not apply to all muslim countries . Nevertheless, the multicultural makeup of some arabian gulf countries, although enriching, creates challenges in health - care communication . Several factors led to the development and implementation of the training course being reported here . Hamad medical corporation (hmc) in doha, qatar, has been accredited by both the accreditation council for graduate medical education - international and the joint commission international, leading to increased accountability for the quality of care, education, and patient safety . A previous study in qatar found that the perceived quality of communication between doctor and patient was related to patient satisfaction . In addition, published research demonstrates that people with different cultural backgrounds outside the mainstream of society generally have less access to health care and worse health - care outcomes . It has also been shown that poor communication is the root cause of malpractice claims . Since march 2014, practicing hmc physician specialists applying for promotion to consultant positions (attending faculty) the title specialist as used in our hospital typically refers to physicians who have completed a residency program followed by board certification, but who do not practice as completely independent consultants or attending physicians . The course prepares these physicians to assume important educational roles as faculty, and improve their delivery of healthcare . The restructuring of physicians' appointments at hmc as part of the recognition into an academic health system led to many such promotions . The objective of this paper is to describe the implementation of and participants' satisfaction with a large - scale communication skills training program for specialists in qatar . In addition, we posed the following research questions: what percentage of course participants had previously participated in communication skills training?did previous participation in a communication skills training had any impact on the satisfaction with the current course? What percentage of course participants had previously participated in communication skills training? Did previous participation in a communication skills training had any impact on the satisfaction with the current course? Participants were predominantly specialist physicians at hmc, a nonprofit public health - care system which provides health - care services throughout qatar . Hmc manages eight public hospitals and other health - care services and employs more than 23,000 people . Physicians are of many different nationalities, speak different languages, and had often attended medical school and/or had residency training outside of qatar . At the time we began the program, there were approximately 1150 physicians who were specialists . We partnered with the communication skills training and research laboratory at memorial sloan - kettering cancer center (mskcc, new york, usa) to run a communication skills training program culturally tailored for our institution . The program developed at mskcc, the comskil model, describes a theory - based, hierarchical structure of health - care communication skills . While these are very useful for early learners such as medical students, they appeared too basic for more advanced learners . For the teaching of practicing physicians, we felt it necessary to have a model that was flexible for many types of medical consultations and allowed for a more learner - centered approach, based on the learners' strengths . In addition, the skills - based comskil model allowed for discipline and cultural adjustments . The program comprised seven modules to be given on two consecutive days: breaking bad news, shared decision - making, responding to patient anger, working with interpreters, discussing prognosis, discussing end of life goals of care, and conducting a family meeting . The methods of teaching followed international best practice and mirrored the approach taken at mskcc . Each module began with a didactic presentation that reviewed relevant studies and explained suggested techniques and skills for that particular module, including demonstration trigger videos for a large group discussion . Four of the seven modules included facilitator - led small group role - play sessions with trained standardized patients (sps). Role - play facilitators were healthcare physicians or other providers who had previously completed the course and had been identified as having an interest in becoming facilitators . Those who participated in this study attended a training course . To keep their appointment, facilitators were required to participate twice during each academic year and attend one refresher course . Sps are nurses who volunteered to participate in the program and completed a training course in january 2015 . Although we kept the core of the mskcc comskil curriculum, in terms of educational approach and the skills - based curriculum, changes were made in the modules to meet local and cultural needs . The names and patient backgrounds in the role - play scenarios were changed to be more consistent with those seen in our country . Locally used metaphors and terminology were employed . Studies from regional and culturally similar countries and information about hospital policies to the didactic sessions for topics such as breaking bad news and end of life discussion were added . We have also developed new local videos for some modules that show our own doctors meeting with simulated patients . We significantly changed the focus of two of the modules, to be better tailored culturally to our population . The module on conducting a family meeting was changed to place emphasis on how to respond to the historically cultural practice of families asking doctors to withhold the disclosure of life - threatening disease to patients and place strong emphasis on the role of the family from the arab and islamic perspectives . The module on working with interpreters was also changed to focus on working with untrained interpreters, as there is no department of trained interpreters . Finally, a variety of role - play scenarios were developed to meet different needs of the various disciplines: pediatrics, obstetrics and gynecology (obgyn), medicine, critical care, surgery, and cancer . Because each small group was interdisciplinary, the facilitators had to guide the selection of a role - play that was available, or developed a new one within the group . A 17-item online survey with qualtrics survey software was sent to the physicians after the training . Three reminders were sent in a period of 10 days following the initial survey e - mail . Evaluation items included an overall 5-point scale rating of satisfaction (very dissatisfied - very satisfied); rating of how much the components of the training (e.g., presentation, role - play) helped improve communication skills using a 4-point scale rating of the usefulness of the individual modules again on a 4-point scale . There were also open - ended questions on the strengths and weaknesses of the workshop . In addition, physicians were asked if they had ever participated in a communication skills training workshop that included role - play . Question was specifically asked about role - play as an indicator of experiential learning, which is widely accepted as the most critical part of communication skills training . Data were transferred from qualtrics software (provo, ut, usa) into spss version 22 (armonk, ny, usa: ibm corp) for analysis; frequencies and percentages were calculated, and statistical significance was tested using chi - square test . To examine the role of previous experience on the ratings, dichotomous variables were created for satisfaction (very satisfied and satisfied vs. other), helpfulness of components (none / little vs. some / a lot), and usefulness of individual modules (completely useless / useless vs. useful / very useful). Because the number of participants who gave low ratings was small, a second set of dichotomous variables was created to split the highest ratings (very satisfied, a lot, and very useful) from the rest . It was attended by 410 physicians, 326 of whom completed the course evaluation yielding an 80% response rate . These physicians came from 26 departments, and the number of participants per course ranged from 21 to 39 (average = 27.33). Overall, participants were satisfied with the 2-day course, with 39.2% of the doctors responding very satisfied and 48.8% of doctors responding satisfied . As shown in table 1, all modules received a high rating for usefulness . The module of breaking bad news received the highest combined ratings of useful and very useful . Participants found the small group role - play the most helpful component of the course for improving their communication skills, with 20% reporting some and 77% marking physicians' ratings of usefulness of modules for their communication with patients physicians' ratings of helpfulness of components of communication skills workshop for improving communication skills the most frequent response to the open - ended question on what was found the most useful was role - play, (27%). However, the majority (57%) of respondents answered this question by referring to a module topic, and breaking bad news was the most frequently quoted . Answers to the question on the improvement of the workshop were diverse, with suggestions on timing, length of course, logistics, role - play scenarios, videos, and having it more tailored to specific disciplines . Participants most frequently suggested the following topics for future workshops: communication with other health - care staff, medical errors, adverse events, and requesting consent, as well as topics on specific specialties (e.g., communicating with parents of a young child). One - third (33.3%) of the physicians reported that they had previous experience of communication skills workshops that included role - play . There were no differences between those with previous experience and those without, on any of the dichotomous ratings of satisfaction, helpfulness of course components, and usefulness of the modules . Improving health - care communication is an important undertaking, particularly in arab and muslim countries of the arabian gulf region, where multi - cultural influences are at play . Overall, the doctors who participated in our training program reported that they were very satisfied and gave high ratings for the elements and modules of the course . They reported that the experience of role - play was the most useful for improving their own communication skills and that the module on breaking the bad news was the most helpful . Participants in a course implemented in saudi arabia also reported that role - play was a major strength of the workshop . Approaches to education such as role - play work in non - western countries, our results, as well as those from the saudi arabian study, indicate that experiential role - play could have cross - cultural effectiveness . Communication skills training has not historically been part of medical education in this region, and some other regions where our doctors were trained . This is supported by the fact that two - thirds of the doctors who attended our course had never been on an experiential communication skills training course, though it is possible that they had participated in lectures or discussions related to communication in healthcare . It is interesting that previous experience with communication skills training was not associated with satisfaction with the course or evaluations of it . It may be that previous training was so varied in content, format, and had taken place so long ago that it did not impact the evaluations of this course in any systematic way . Our experience may serve as a model for utilizing external expertise to initially implement a communication skills training program and subsequently build the capacity to sustain the program using only local resources . However, there are challenges to such a model . Transferring a western health - care communication curriculum into a multicultural muslim arab culture is not the easiest thing to do . For instance, the cultural practice in some cases is to disclose the diagnosis of cancer or any life - threatening disease for that matter to the family but not to the patient . Despite the hospital policy on patients' rights to information, the reality is that information is rather disclosed to families and withheld from patients . The module on breaking the bad news that does not take this into account is thus not culturally - sensitive . The rapid demographic changes in qatar, as well as the numerous languages, in excess of 40, spoken by the patient population, are barriers to such a program . Consequently, we adapted the module to suit working with untrained interpreters . To make the program more applicable in qatar, we initially adjusted the role - play scenarios to the local culture by changing the names and background characteristics of the patients . However, the didactic presentations cited western studies and the physicians and patients acting in the exemplary videos were primarily caucasian . In addition, the initial program was focused on cancer only, but since our groups were multidisciplinary we have eventually modified the presentations and created some videos of our own . However, more improvements are required . Creating videos with a local flavor seems to be a particularly important part of tailoring the curriculum to fit our cultural milieu . Building and retaining a core of dedicated and skilled instructors and facilitators also takes time . This has been the objective of our train - the - trainer courses, monthly e - newsletters, and refresher courses we will continue to put resources into keeping our teaching faculty skilled and enthusiastic as participants, as the program is only good as long as there is continued engagement in teaching and interest as facilitators . Teaching new consultants as well as keeping a strong cadre of skilled instructors may also contribute positively to counteracting the hidden curriculum, the implicit learning that happens outside the classroom, usually through the transmission of cultural norms and role modeling . As trainees interact with the faculty who have participated in the workshop, it is our hope that they will increasingly become aware of models of good communication skills and patient - centered care . Another consideration when organizing such large scale communication skills training programs is whether to teach the course using a multidisciplinary approach, as we have done, or focus on specific disciplines such as obgyn or cancer ., it may be more feasible to have participants from different departments come on the same day so that patient care is not unduly affected . In addition, participants seemed to genuinely appreciate meeting and learning from each other, although physicians reported that they would like to have more discipline - specific videos and role plays . Limitations of this study include the lack of evidence of skills transfer to real encounters with patients . With diverse group of trainees from several hospitals, such since the survey did not sought any demographic information, it is impossible to look for associations with gender, years of experience, etc . A further limitation is our inability to triangulate our data with precourse evaluation data, which was not collected . Our future work includes continuing to fine - tune the implementation and curriculum of our program . We also would like to expand our module topics to include some of the challenging scenarios that the participants mentioned in their course evaluations . These include consent, discussion of adverse events, and communication with other health - care providers . Finding a feasible and effective way to measure the impact of the course on actual practice is also a priority . The result of the evaluation of this program conducted over a 2-year period shows that the communication skills training course was well accepted and was effective in helping our physicians learn new communication skills . As this program progresses, we hope to make a substantial and sustainable difference in the quality of care through improved communication skills . Educators in non - western countries may find that initially using western - developed communication skills training programs with some cultural modifications may be feasible and acceptable . Role - play, in particular, seems to be an acceptable valuable teaching strategy.
Non - hodgkin s lymphoma (nhl) accounts for approximately 3%4% of all cancers worldwide.1 nhl is a growing problem, with the global prevalence projected to rise to more than 0.4 million in 2016, and estimates suggest that approximately half of new nhl cases will result in death.2 follicular lymphoma (fl) is the second most common type of nhl and accounts for 10%20% of all lymphomas.3 the most ubiquitous indolent lymphoma, fl is typically diagnosed in individuals 5560 years of age and is slightly more prevalent in females.3 fl is characterized by painless swelling in several lymph node sites, with bone marrow involvement in approximately 70% of cases.4 approximately 19% of patients present with b symptoms, such as fever, weight loss, or night sweats, at the time of diagnosis.3,4 fl predominantly originates from b lymphocytes . Cd20 is a b - cell - specific antigen expressed on both malignant b cells, including fl and healthy cells, and is involved in the proliferation and differentiation of normal b cells.5 as such, targeting cd20 is an optimal therapeutic strategy and plays a central role in the treatment of fl . Rituximab (rituxan; genentech, south san francisco, ca, usa / mabthera; roche, basel, switzerland) is a chimeric anti - cd20 monoclonal antibody that binds specifically to cd20.6,7 in addition to its role in the treatment of diffuse large b - cell lymphoma (dlbcl) in the first - line or relapsed / refractory settings, rituximab is also approved for use in fl as a single agent or in combination with first - line chemotherapy.6,7 given the importance of rituximab across the spectrum of fl treatment and the evolving therapeutic landscape with the emergence of novel agents, the role of rituximab in the future management of fl is described . The role of rituximab biosimilars in the future of fl treatment and how the introduction of biosimilars can help to relieve this lack of access are also discussed . The national comprehensive cancer network (nccn)8 (table 1) and the european society for medical oncology (esmo) guidelines9 (figure 1) outline the recommended treatment regimens for patients with fl in the us and europe, respectively . Owing to its established long - term efficacy, rituximab is an important component of fl treatment.10 treatment options for patients with limited - stage disease (stage i / ii) include radiation,1113 watch - and - wait approach,14 or rituximab alone or in combination with chemotherapy (eg, bendamustine plus rituximab [br]; rituximab plus cyclophosphamide, doxorubicin, vincristine, and prednisone [r - chop]; or rituximab plus cyclophosphamide, vincristine, and prednisone [r - cvp]).15 despite the paucity of randomized clinical trials, radiation therapy is the preferred treatment for patients with non - bulky stage i fl . Patients with grade 3b fl or those undergoing histologic transformation are best treated with chemoimmunotherapy regimens, such as r - chop . Patients with stage ii fl are appropriate candidates for treatment with either rituximab alone or in combination with chemotherapy, depending on their clinical presentation . In general, the treatment approach for patients with stage ii fl includes watch - and - wait, single - agent rituximab vs rituximab plus chemotherapy, or radiation for those with contiguous nodal involvement . Patients with bulky disease or those with an adverse prognosis presenting with b symptoms and/or clinically significant tumor load are candidates for treatment with rituximab plus chemotherapy.8,9 treatment options for patients with advanced - stage (stage iii / iv) fl are similar to those for stage ii fl . For asymptomatic patients with non - bulky disease, the watch- and - wait approach with treatment upon disease progression may be appropriate.16 results from a study by ardeshna et al conducted in asymptomatic patients with advanced - stage low - tumor - burden fl showed that 88% of patients on maintenance treatment with rituximab did not require treatment at 3 years compared with 46% in the watch - and - wait group (p<0.0001).15 the rituximab induction arm was affected by early closure because of poor accrual . Moreover, there were 18 serious adverse events, possibly as a consequence of treatment with rituximab . However, this study highlights that rituximab monotherapy is a possible option for patients with asymptomatic, low - tumor - burden fl, particularly for those who may not tolerate chemotherapy or for those with slowly progressive disease.8 patients with advanced - stage fl that is progressive, symptomatic, and/or has associated cytopenias are candidates for chemoimmunotherapy . Recent evidence suggests that br is effective as a first - line regimen in patients with advanced disease . In a randomized phase iii study, treatment with br resulted in non - inferior clinical response compared with standard rituximab chemotherapy (r - chop or r - cvp), with an acceptable toxicity profile.17 in a prospective, randomized, open - label study in patients with previously untreated indolent lymphoma, first - line therapy with br resulted in greater progression - free survival and fewer toxic effects compared with r - chop.18 patients who respond to induction treatment with r - cvp or r - chop are potential candidates for maintenance therapy with rituximab . Primary rituximab and maintenance (prima) was a randomized open - label study to investigate the effect of 2 years of rituximab maintenance therapy (375 mg / m every 8 weeks) after first - line treatment with rituximab plus chemotherapy.19 at a median follow - up of 3 years, progression - free survival was significantly improved in the rituximab maintenance group (75%) compared with the observation group (58%) (p<0.0001). Furthermore, a significantly greater proportion of patients achieved a complete response with rituximab maintenance therapy than those in the observation group (72% vs 52%, respectively; p=0.0001). However, there was no difference in the overall survival between the 2 groups in this study.19 further investigation is needed to understand the long - term toxicities of rituximab maintenance therapy and to identify the patients most likely to benefit from this treatment regimen . A recent study by kahl et al20 failed to demonstrate a significant clinical benefit from continuing rituximab maintenance treatment in patients with advanced - stage, low - tumor - burden fl after induction with the single - agent rituximab . Although rituximab maintenance therapy should be considered after rituximab plus chemotherapy, it is not recommended after rituximab monotherapy (table 1; figure 1). Furthermore, rituximab maintenance therapy after induction with rituximab monotherapy is of less clinical benefit in patients with low - tumor - burden fl, compared with rituximab re - treatment.20 rituximab is also effective in the re - treatment setting and is used in combination with chemotherapy regimens for the treatment of relapsed / refractory fl . Common chemotherapy regimens include first - line (br, r - chop, and r - cvp) and second - line (fludarabine, cyclophosphamide plus mitoxantrone or fludarabine monotherapy) regimens (table 1). In patients with early relapse (12 years), a non - cross - resistant regimen is preferable (eg, bendamustine before or after chop). If patients subsequently experience remission for 6 months, the addition of rituximab should be considered (table 1).8 following the clinical success of rituximab in the treatment of fl, novel agents are emerging and currently under development . Ibrutinib, an oral, selective, and covalent bruton s tyrosine kinase inhibitor, has been approved by the us food and drug administration (fda) for the treatment of patients with mantle cell lymphoma who have received at least 1 prior therapy,21 chronic lymphocytic leukemia (cll)/small lymphocytic lymphoma, and waldenstrm s macroglobulinemia.22 ibrutinib has also been approved by the european medicines agency (ema) for the treatment of patients with relapsed / refractory mantle cell lymphoma, in the first - line, refractory, and relapsed / refractory settings of cll, for those with waldenstrm s macroglobulinemia who have received at least 1 prior therapy, and in the first - line setting for patients unsuitable for chemoimmunotherapy . Ibrutinib is currently under investigation for use in combination with rituximab (clinicaltrials.gov, nct01980654) and as monotherapy for relapsed / refractory fl (clinicaltrials.gov, nct01849263). Idelalisib, an oral phosphoinositide 3-kinase - delta inhibitor, has been approved by the fda for the treatment of patients with relapsed / refractory cll and relapsed / refractory fl.24 a phase i / ii study to evaluate the efficacy and safety of idelalisib in patients with previously treated low - grade fl is ongoing (clinicaltrials.gov, nct01306643). A phase ii study is planned to explore the efficacy and safety of idelalisib in combination with rituximab in patients with previously untreated fl and small lymphocytic lymphoma (clinicaltrials.gov, nct02258529). Obinutuzumab is a humanized immunoglobulin g1 monoclonal antibody, with a novel glycoengineered fc region . In combination with chemotherapy obinutuzumab is approved for use in combination with bendamustine followed by obinutuzumab monotherapy for the treatment of patients with fl who relapsed after, or are refractory to, a rituximab - containing regimen.25 approval was based on an open - label, randomized, phase iii trial in patients with indolent nhl refractory to rituximab.26 in another study, obinutuzumab demonstrated clinical efficacy and an acceptable safety profile in the relapsed / refractory fl setting.27 in a phase iii study, obinutuzumab - based induction and maintenance therapy resulted in small improvements in progressionfree survival in treatment - nave patients with fl; however, a higher incidence of grades 35 adverse events was observed compared with rituximab.28 a phase i study in patients with nhl or cll showed that induction and maintenance therapy with obinutuzumab offered clinical benefits, with a favorable safety profile.29 similarly, obinutuzumab showed encouraging results in patients with relapsed / refractory nhl.30 lenalidomide, an immunomodulatory agent, has been approved by the fda for the treatment of patients with multiple myeloma, myelodysplastic syndromes, and relapsed / refractory mantle cell lymphoma.31 in a phase ii trial, lenalidomide in combination with rituximab was effective and well tolerated as initial treatment for patients with advanced indolent nhl.32 in light of these promising results, a phase iii study to evaluate the efficacy and safety of rituximab in combination with lenalidomide compared with r - chop, r - cvp, or br in patients with previously untreated fl is ongoing (clinicaltrials.gov, nct01476787). Despite an array of novel agents emerging and in clinical development, it is likely that rituximab will remain at the forefront of fl treatment.33 however, patents for many biologics have expired or will lose exclusivity over the coming years (figure 2). Importantly, the composition - of - matter patent covering rituximab in europe (mabthera) expired in 2013, and its counterpart in the us (rituxan) will expire in 2018 . Moreover, rituximab is not widely available to physicians and patients in several countries, including the us, mexico, turkey, russia, and brazil . In a recent survey of 450 oncologists and hematologists, 31% considered rituximab an easily accessible option in brazil . Similarly, 25% and 19% reported challenges in getting access to rituximab in mexico and russia, respectively . Issues related to insurance coverage, treatment guidelines, and patient comorbidities were the most common barriers to access or use of rituximab . Indeed, these barriers have the potential to compromise clinical outcomes and patient care across the spectrum of fl treatment, potentially resulting in a change or delay in treatment with rituximab, largely the result of payment issues or patient response . However, baer et al found physicians who participated in the survey would increase use of rituximab if a more affordable version were available, without compromising efficacy, safety, or patient care.34 another concern in the biologics arena is that these agents are likely to be susceptible to drug shortages as a consequence of sparse active ingredients, coupled with obstacles in manufacture and supply . In addition, suboptimal compliance with current good manufacturing practice, changes in clinical standards, a greater demand for rituximab, and manufacturing delays are the most common factors that contribute to drug shortages.35 the supply of chemotherapeutics, such as 5-fluorouracil, liposomal doxorubicin, and fludarabine, as well as rituximab, may be adversely affected by looming drug shortages, with potentially pernicious outcomes for patients.36 drug shortages can lead to delays in treatment, use of alternative, potentially less effective treatment, increased case management for health care professionals, and poor availability of more effective, well - tolerated combination therapies.35 the loss of exclusivity and limited access to rituximab has led to the development of well - characterized, safe, and effective biosimilars to rituximab . Biosimilars are defined as biologic products that are highly similar to the reference biologic product, notwithstanding minor differences in clinically inactive components.37 the availability of biosimilars may mitigate the impact of the limited access to rituximab . Biosimilars provide a greater spectrum of treatment choices and may offer efficiencies to the health care system . In addition, biosimilars increase access to biologics and foster greater use of biologic therapies, which may facilitate improved overall health outcomes at a time when a shortage of biologics may become a barrier to the treatment of patients with fl . Biosimilars have the potential to increase access to therapies by offering more affordable treatment options . Savings with biosimilars could facilitate the reallocation of expenditure to optimize treatment of patients with fl, resulting in patients receiving treatment earlier in therapy, with more patients able to access medicines such as rituximab.37 biosimilars are large, structurally complex molecules developed to be similar to and treat the same condition(s), using the same treatment regimens as an existing licensed or approved (originator or reference) biologic . Development of biosimilars involves a stepwise approach of physicochemical and biological evaluation, along with a series of comparative nonclinical and clinical studies . Several factors influence the extent of clinical data required for the approval of biosimilars, including the similarity to the originator biologic and strength of preclinical data as well as the molecular complexity . The ultimate aim of biosimilar development is to demonstrate that there are no clinically meaningful differences based on the totality of evidence encompassing all available analytical, nonclinical, and clinical data . The totality of evidence approach is specifically tailored for biosimilars and applies a different paradigm than the regulation of originator biologics, for which the aim is to establish de novo efficacy and safety . Furthermore, the biosimilar developer is not required to demonstrate efficacy to the reference biologic in each indication, as the extrapolation of clinical data across indications is permitted, and any differences may be considered in the totality of evidence, given appropriate scientific justification.38 the approval of biosimilars is a highly regulated and comprehensive process (table 2). The ema and the us fda have published extensive guidance documents with their respective definitions of biosimilars, and the requirement of a series of detailed analytical and similarity assessments, nonclinical in vivo evaluation, and safety and efficacy studies, all in comparison with the reference biologic.38,39 the biosimilars approval pathway was established in the european union (eu), with 8 biosimilars (under 20 different trade names) authorized by the ema over the past decade.40 the first biosimilar in the us (filgrastim - sndz [zarxio]), a biosimilar version of neupogen, was granted approval in 2015 under the us biologics price competition and innovation act of 2009.41,42 although complex, the regulatory approval process for biosimilars in europe,39 the us,38 and elsewhere43 has been tailored and is often shorter than that required for originator biologics . A biosimilar version of rituximab (truxima) has recently been granted approval for the treatment of nhl, cll, and rheumatoid arthritis (ra) in south korea.44 several potential rituximab biosimilars are currently in development, each in comparison with the originator (reference) rituximab (table 3). A study in patients with newly diagnosed advanced fl showed pharmacokinetic similarity between a potential biosimilar to rituximab, ct - p10, and rituximab (each administered with cvp), with similar b - cell kinetics and immunogenicity.45 in another study, ct - p10 and rituximab showed equivalent pharmacokinetics, and comparable efficacy, pharmacodynamics, immunogenicity, and safety in patients with ra.46 a clinical study in patients with previously untreated fl showed therapeutic equivalence in overall response rate between another proposed biosimilar to rituximab, gp-2013, and rituximab sourced from the eu . In this trial, similarity was demonstrated for efficacy, pharmacokinetic, and pharmacodynamic parameters, with similar safety findings.47 in addition, the efficacy and safety of another potential biosimilar, bi-695500, in patients with low - tumor - burden lymphoma is under clinical investigation (clinicaltrials.gov, nct01950273). Abp 798, a potential biosimilar to rituximab, is in clinical development in patients with cd20-positive b - cell nhl (clinicaltrials.gov, nct02747043). Another potential biosimilar to rituximab, mabioncd20, is in development in patients with cd20-positive dlbcl (clinicaltrials.gov, nct02617485). In nonclinical studies, pf-05280586, a proposed bio - similar to rituximab, showed the same primary amino acid sequence and similar physicochemical and in vitro functional properties as the licensed originator biologic.48 a study in patients with active ra demonstrated pharmacokinetic similarity of pf-05280586 to rituximab sourced from the eu (rituximab - eu) and the us (rituximab - us) and that of rituximab - eu to rituximab - us.49 in this trial, all 3 treatments were generally well tolerated, and the incidence of treatment - related adverse events was low . These encouraging findings support the ongoing development of pf-05280586 as a potential biosimilar to rituximab . A trial is ongoing to compare the efficacy, safety, pharmacokinetics, and immunogenicity of pf-05280586 to rituximab in patients with low - tumor - burden fl (clinicaltrials.gov, nct02213263). Debate continues over the optimal treatment strategy for untreated fl: the watch- and - wait approach vs therapeutic intervention . However, for patients who are candidates for systemic therapy, an anti - cd20 monoclonal antibody alone or in combination with chemotherapy remains at the forefront of the therapeutic landscape . It is well recognized that rituximab will remain as the cornerstone of therapy in the treatment of patients with fl . The loss of exclusivity of composition - of - matter patents of biologics in recent and coming years, and the lack of access to rituximab in some countries are of particular concern for patients and physicians . Thus, it is relevant, appropriate, and necessary to develop a biosimilar to rituximab with the potential to generate cost savings and efficiencies for health care systems and to increase access to patients worldwide, which can help augment resources for other important aspects of health care . It will be crucial to engage clinicians on the importance of biosimilars, and moreover, to increase understanding of data that underpin the development of biosimilars and how these data may translate into clinical practice . At present, the availability of safe and effective rituximab biosimilars is eagerly anticipated, potentially offering a greater range of therapeutic options and improved clinical benefits to patients with fl.
Cancers in many tissues are heterogeneous, and the efficacy of therapeutic interventions depends on the specific subtype of the malignancy . Hence, early and accurate identification of the cancer subtype is critical in designing an effective personalized therapy . Current methods for assessment rely on microscopic examinations of the malignant tissue for previously established histopathological abnormalities . Unfortunately, such features may not be apparent during early stages of the disease and moreover, differentiating between abnormalities in distinct cancer subtypes can be challenging . Recent advances in high - throughput genomics offer an exciting new alternative for early and reliable cancer prognosis . Mutations that underlie a malignancy modify the levels of many genes within a cell; the goal of gene expression profiling is to define a signature for each cancer subtype through statistically significant up-/downregulation of a panel of genes . The national institutes for health, through the cancer genome atlas (tcga) [1, 2], will aid this effort by establishing large sets of genomic data on human cancers in at least 20 tissues [38]. The premise behind tcga is that statistically significant changes in gene expression levels due to malignant mutations can be placed in a few groups associated with subtypes, and that unsupervised (or semisupervised) clustering algorithms can be used to uncover these partitions . This is illustrated through a schematic malignancy that can be partitioned using the expression levels of two genes . In this schematic, each patient sample is represented by a point on a plane, see figure 1 . The basic observation is that, while the patient samples are distributed over a broad range, there are pockets of high concentration, which can be identified using traditional clustering methods . The members of the pocket define the core samples of a cancer subtype . However, the presence of significant levels of noise in genomic data makes the partitioning a nontrivial task . The variability is due to both the subject dependence of the expression levels and to imperfections in microarray technology . Unfortunately, costs associated with microarray experiments prohibit the use of a large set of replicates to reduce the effective error rates . One focus of tgca has been glioblastoma multiforme (gbm), the most common and aggressive form of brain cancer [9, 10]. Tcga provides the expression levels of 11861 genes in 200 gbm and 2 normal brain samples [1, 2]. Reference identifies 1740 genes with consistent expression across affymetrix huex, affymetrix u133a (affymetrix, santa clara, ca, usa), and agilent 244k common genomic hybridization arrays (agilent technologies, santa clara, usa), to be used for the subgrouping . They search for common partitions under sampling of genes and patients . The resulting consensus clustering yields four robust clusters whose class boundaries are statistically significant . 173 core representatives of the four groups were identified, and an 840-gene signature was determined on the basis of lowest cross - validation and prediction error . This genomic partitioning of the 173 core samples was found to be consistent with the grouping into the four known subtypes classical, mesenchymal, proneural, and neural of glioblastoma . In this work, we introduce a new algorithm for gene expression profiling, which is illustrated through an application to gbm . This approach avoids several difficulties associated with clustering algorithms commonly adopted to partition large sets of genomic data . It provides robust partitions of patients and identifies a compact set of genes used to distinguish the clusters . In particular, for gbm, the clusters of patients are sharply defined leading us to establish the quintessential genetic profile for the subtypes . Further, the newly identified set of genes will allow tumors of new patients to be subtyped quickly after diagnosis, which perhaps could lead to a more personalized and successful treatment regimen . Most of these genes have not been previously implicated in brain cancer or cancer in general; they may be unidentified members of the cancer network . Unfortunately, significant structural variation in tumor samples renders it impossible to determine subtype by histological methods . Thus, we are unable to have independent corroboration of our results and are left to compare our calculation with the clustering analysis of the tgca data . Our algorithm requires the panel of genes used for clustering to be predetermined . Due to stochasticity the choice of an excessively large set of genes is likely to be counter productive as well, at least in part due to contamination from the many genes that are irrelevant for the comparison . A large gene set will cause a another well - known difficulty, namely, that of partitioning a (relatively) small number of objects in a high dimensional space . Thus, it is important to preselect a sufficient yet compact set of genes for clustering . This issue is resolved using a statistical invariant and persistent homology [1315], one of the most exciting recent developments in topology . This yields the appropriate number of clusters and provides information on the genetic proximity of the subtypes . Additionally, refinements to the panel of genes used in the partitioning are possible through repeated application of the method . There is no natural genomic distance between two samples, although the correlation distance (defined below) is used in most studies . Hence, it is desirable to use a topological approach (such as persistent homology that is adapted here) for partitioning, rather than one which relies on computation of metrics such as eigenvalues . This is likely the reason why hierarchical clustering typically provides a more robust partitioning than spectral clustering [1720] or those based on principal components analysis . Empirical cumulative distribution functions, which quantify the proximity of a given clustering to a perfect grouping (where the membership of each object is unambiguous) is one of the more successful approaches to address the problem in genomic data . Next, we wish to introduce a prediction model to assign the cancer subtype . To this end, we randomly select 20 (test samples) of the 202 patient samples which are only to be used for validation . (the algorithm is robust in the sense that the patient subgroups obtained from the algorithm do not depend on the number of genes selected for the panel .) One partition contains 60 samples, 27 of which labeled classical by tcga and 28 of which labeled mesenchymal . Its partitions contain 18 (17 classical) and 14 (all mesenchymal) patient samples . Thus, our method identifies the three primary clusters of gbm . In our calculation, the neural group was not found to be a single, coherent cluster . Interestingly, core nodes of the biological network underlying gbm such as tp53, pten, rb1, nf1, pik3r1, and pik3ca [1, 22] are not in this list . Finally we use the 59-gene set to assign the cancer subtypes in the 20 test samples, comparing the conclusions with those of the clustering calculation http://tcga-data.nci.nih.gov/docs/publications/gbm_exp/ . The assessment of the subtype of each test sample is made using the mean of its correlation distance from the corresponding core patient samples . Five of these were not assigned a group by either our calculation or that of tcga . Four samples, which were labeled neural, were not provided an assignment by our algorithm . A gene can only be useful in differentiating between subtypes of cancer if its expression levels in the subtypes lie on statistically distinct distributions [1, 23]. A necessary (but not sufficient) condition is the bimodality of the corresponding distribution for all patient samples . (note that, at this stage, we do not know the mean values, variances, or the membership of the putative subgroups . Hence standard statistical tools such as discriminant analysis [24, 25] cannot be used to decide if and how patient samples are to be partitioned .) We propose the use of the nondimensionalized standard deviation(1)=var (x)[\|x[x]\|], to select such genes . Here [x] represents the expectation value of a random variable x and var (x) = [x] [x] its variance . The definition is inspired by kurtosis, which is a scale - invariant measure of the width of a distribution . Unfortunately, it is difficult to estimate the fourth moment reliably from 182 noisy points (gene expression levels). Is larger for distributions with broad tails: for gaussian and biexponential distributions its values are /2 and 2, respectively . Its value for a finite - range characteristic function (which has no tails) is 2/3 . Variation of as a function of the distance between two gaussian distributions is shown in figure 2(a), demonstrating that bimodality of a distribution can be inferred from the value of . The gene expression profiles for the 202 patient samples are given at http://tcga - data.nci.nih.gov / docs / publications / gbm_exp/. The table unifiedscaled.txt contains mean expression levels (from three replicates) for 11861 genes of each patient sample . Figure 2(b) shows the values of for the 11861 genes in increasing order . (for each gene, we have discarded the extreme outliers, which are more than 8 standard deviations away from the mean .) A very small fraction of genes have abnormally small values of, which we associate with multimodal distributions . The eight smallest values of are found for genes eif1ay, rps4y1, ddx3y, uty, usp9y, jarid1d, zfy, and nlgn4y . The homology analysis (see below) shows that these eight genes and cyorf15b belong to one group, that is, the correlation distance between these genes is small . However, each gene in this group belongs in the y - chromosome, and hence the associated partitioning is that between male and female subjects ., we select n = 60 that have the smallest values of . The final partitioning of patients is independent of n for choices between 50 and 120, and persistent homology fails to find appropriate partitions when n is outside this range . Not all of the 60 genes selected using may be useful for subdividing patient samples . Our second refinement is to search for groups of genes whose expression levels change coherently between patient samples . This coherence can, for example, result from the genes' membership in a subnetwork . For this task, we represent a gene gn by its expression levels xn in all m = 182 patient samples; the 60 genes form a point cloud . As is traditional in clustering algorithms, the proximity d(xn, xm) between two points xn and xm is chosen to be the correlation distance: (2)d(xn, xm)1c(xn, xm)=1[xnxm][x][xm]var [xn]var [xm], where c(xn, xm) is the pearson correlation function . We have now converted the search for critical genes to clustering a point cloud . This task could be implemented through algorithms such as hierarchical clustering [16, 29], spectral clustering [20, 30], or community structures . Spectral approaches are highly sensitive to the precise genes chosen for the analysis and to cutoff values, and hierarchical clustering does not provide an unambiguous estimate for the number of partitions . Consider a point cloud and a set of connections between a subset of pairs of points . A k - simplex is a set of (k + 1) points, each pair of whose vertices is connected . For example, a 1 simplex is a line along with its two vertices, a 2 simplex is a triangle along with its edges and vertices, and a 3 simplex is a tetrahedran along with its faces, edges, and vertices . The face of a k simplex is a subset which is a simplex of lower order . For example, the vertices, edges, and triangular sides of a tetrahedran are its faces . A k simplicial complex is an object formed by gluing together faces of a set of simplices each of whose dimension is less than or equal to k; the intersection of any two such simplices is required to be a face of both . For example, an object formed by gluing a set of triangles on their edges or vertices, with perhaps some lines and isolated points, is a 2-simplicial complex . The question is addressed by constructing a simplicial complex and searching for its disjoint components . First, for a prespecified cutoff radius rc, connect points xm and xn if and only if d(xn, xm) <rc . The object so formed is a simplicial complex . For sufficiently small rc when rc is sufficiently large, all pairs of points are connected, and the simplicial complex is a single component . Simplicial complexes can be characterized using topological invariants (i.e., features that do not change under smooth distortions of space). One of these invariants is the number of disjoint components, which is referred to as the zeroth betti number (betti0). The first betti number, betti1, is the number of connected components with a two - dimensional hole . The second betti number (betti2) is the number of surfaces enclosing a three - dimensional region . The first three betti numbers for the crust of a bagel are 1, 2, and 1 . Betti numbers can provide a more comprehensive invariant characterization of the point cloud than possible through clustering . (persistent homology has been used successfully to search for recurrent genomic instability in breast cancer [31, 32].) A partition will be robust if the components (of the point cloud) are far apart from each other; consequently, the number of components will remain unchanged for a broad range in rc . A generalization of this statement forms the novel proposal in [13, 14], which associates robust characteristics of the point cloud with persistent topological invariants . Our computations are implemented using the package jplex (available at http://comptop.stanford.edu/programs/jplex/index.html). We note first that if r1 <r2, the simpicial complex at cutoff r1 is contained in that at r2 . The primary construction used in jplex is the rips stream, which computes the simplices at cutoff radii rc in a prespecified range, and assigns a filtration time for each simplex, when it first appears . Barcodes, such as those shown in figure 3, show how the number of components evolves as rc is increased . The abscissa is the cutoff radius and each horizontal line represents a component that maintains its identity as rc increases . It should be noted that the membership of a component may increase with rc . In figure 3(a), we only show components that contain a minimum of nmin points . This constraint is imposed by constructing a new rips stream which contains the original simplices; the filtration time associated with each simplex in the new stream is defined to be the maximum of the original filtration time and the time when the component reaches nmin elements . The top panel of figure 3 shows the results of the analysis for the 60 genes with nmin = 5 . The membership of the groups is maximized at rc 0.56, just prior to their combining into a single component . (the persistence width of the component that begins after rc = 0.56 decreases as the number n of genes used for the analysis increases .) Genes in each component are found using the jplex routine verticesineachcomponent . At rc = 0.56, the components contain 17 and 20 genes, respectively . However, we find that identical partitioning of the patient samples can be achieved with a smaller number of genes . For the analysis here, we select the first ng = 15 genes to join each component . This choice is made in order to include a sufficiently inclusive, yet not too large a set of genes for the analysis . The two gene sets are (3)c1={ugt8,mbp, c11orf9,mog, klk6,rp1135n6.1,rab33a, dcx, gpr17,cxorf1,lrrtm4,tmsl8,sn, ap91,atp10b, luzp2},c2={meox2,pipox, fgfr3,dlc1,pla2g5, egfr, grik1,erbb2,ptrf, postn, baiap3, pdlim4,kcnf1,eya4,spag4}. Genes in c1 lie on chromosomes 1, 2, 3, 4, 5, 6, 7, 8, 10, 13, 17, 20, and 21 . Genes meox2, egfr, dcl1, efgr, ptrf, and eya4 have the gene ontology (go) classification nucleus . Genes meox2, dcl1, erbb2, ptrf, eya4, spag4 have the classification cytoplasm, and fgfr3, grik1, kcnf1 have the classifications membrane and integral to membrane . Genes in c2 belong to chromosomes 1, 2, 4, 5, 6, 9, 11, 15, and the x - chromosome . C11orf9 and klk6 have the gene ontology classification nucleus, while dcx, klk6, and tmsl8 have the classification cytoplasm, and ugt8, c11orf9, mog, gpr17, lrrtm4, and atp10b have the classification membrane . The 182 patient samples are partitioned using the expression levels of the 30 genes in c1 and c2. Each sample is represented by the expression levels y of these 30 genes . As before, the distance between two points (patient samples) ym and yn in is defined as the correlation distance . The barcode for the analysis, where we retain only groups of size 10 or larger, is shown in figure 3(b). Two groups are seen to persist over a significant range in the cutoff radius rc . Since the components grow with rc, we choose rc 0.34, in order to maximize their membership . They contains 84 and 76 patient samples, and the heat map [3335] is shown in figure 4(a). The patient samples in each group are arranged in the order they appear in the component as rc is increased . The fold inductions for genes in the left - most samples in each group are significantly closer than those joining the component later . We propose to only include the most coherent patient samples in the core group associated with each category, see figure 1 . With this trimming the new heat map, figure 4(b), provides a significantly sharper partitioning than those computed through many previous approaches [1, 2, 11, 12, 36, 37], although the membership in each group is smaller . The first group of 60 contains 27 patient samples that have been assigned the classical subtype and 28 samples that have been assigned the mesenchymal subtype of gbm by the clustering analysis of tcga . 37 of the 44 patient samples in the second group have been assigned to the proneural subtype by tcga . The rest of the samples in this group are unassigned with the exception of one sample labeled neural and one labeled mesenchymal . One of our goals is to search for a panel of genes to differentiate between the subtypes of gbm . Thus far, we have used the genes in c1 and c2 to find two subgroups of the 182 patient sample, and (using the heat map) select the most tightly correlated members in each subgroup . However, when only the 60 and 44 core samples are considered, an alternative gene set may provide a sharper separation of the patient samples . We thus repeat the computations of the last three subsections, using only the 104 patient samples in the two core groups . The new gene groups are (4)c1={ugt8,rp1135n6.1,dcx, rab33a, gpr17, erbb3,sox10,pak7,il1rapl1,dnm3, snap91,atp1a3,rundc3a, dusp26,ephb1},c2={elovl2,arsj, flj21963,pipox, nr2e1, znf217,pla2g5,meox2,ephb4,dcl1, postn, lama2,egfr, kcnf1,eya4}. Genes in c1 and c2 are spread among several chromosomes . Genes rp11 - 35n6.1, ugt8, gpr17, il1rapl1, snap91, and ephb1 of c1 have the go classifications membrane and/or integral to membrane, while dcx, rab33a, and dnm3 have the classification intracellular . Genes nr2e1, znf217, meox2, egfr, and eya4 of c2 have the go classification nucleus and arsj, pipox, pla2g5, postn, lama2, egfr, and kcnf1 have the classification extracellular region . The heat map, shown in figure 4(b), clearly indicates that genes in c1 and c2 provide a significantly better separation of the core members in the two groups . We conducted the corresponding analysis for the validation data set combined from four public cohorts (see http://tcga-data.nci.nih.gov/docs/publications/gbm_exp/) using genes in c1 and c2 . We again find a clear difference in fold changes of the genes between the two partitions . In addition, the fractional sizes of the partitions are similar to those of figure 4(b). (the assignments of the cancer subtype of validation samples are not given at the tcga site .) The next step is to partition patient samples in group a, which we found to contain exclusively classical and mesenchymal samples . The computations described above are repeated, however, only using 60 patient samples assigned to the partition . The gene groups for the partition are (5)c1(cm)={ascl1,mpped2,cspg5,bcan, dscam, dpf1,znf606,znp30,znf419,sgta, znf8,dgkb, egfr, phc1,blm},c2(cm)={tnfaip8,slc25a24,olfml2b, sft2d2, kynu, dkk1,rras, gusb, heph, enpp4, ndn, spag4,mtap, klhl9,col11a1}. Genes in c1 lie in chromosomes 1, 3, 7, 11, 12, 15, 19, and 21 . Dpf1, sgta, and the four zinc fingers belong to chromosome 19 (19q13) and have the go classification intracellular . They along with ascl1, blm, and phc1 have the go classification nucleus . Genes in c2 belong to chromosomes 1, 2, 5, 6, 7, 10, 15, 19, and the x - chromosome . Tnfaip8, slc25a24, kynu, spag4, and mtap have the classification cytoplasm . The first group of patient samples contains 18 members, 17 of which have been assigned to the classical subtype in . The second group contains 14 samples, all of which have been assigned the mesenchymal subtype in . The heat map for the bisection of the classical / mesenchymal group is given in figure 5 . The complete list of core patient samples is given in supplementary materials (see supplementary materials available online at doi:10.5402/2012/381023). A similar bisection of patient group b, which contains the proneural samples, was not possible . Fold inductions of genes belonging to c1, c2, c1, and c2 can be used to predict the membership of a new sample in the three core groups . The choice is based on the mean correlation distance between the patient sample and members of each core group . The first step is to determine if the new sample belongs to the classical / mesenchymal or proneural core groups . The determination is made using genes belonging to c1 and c2 and computing the mean correlation distance between the new sample and those in each partition . However, we must first determine the radius (for the correlation distance) within which the membership for each group is assigned . For every patient sample in the classical / mesenchymal core group, we compute its mean correlation distance from the remaining members of the group . The largest of these values is defined to be the radius of the classical / mesenchymal subgroup of patient samples . This choice guarantees that all core patient samples in the group are assigned correctly, and that those outside the core group are not assigned to it . The computed cutoffs for the classical / mesenchymal and proneural core groups are rcm = 0.70 and rp = 0.42, respectively . A new patient sample whose mean correlation distance from members of the classical / mesenchymal core group is smaller than rcm is assigned to that group, and any sample closer than rp to the proneural subgroup is assigned to it . Next, we use genes in c1 and c2 to assign the membership of any patient sample in the classical / mesenchymal core group . The corresponding cutoff radii are rc = 0.63 and rm = 0.30 . Table 1 shows the mean correlation distances between the test samples and the core groups . The last column of the table gives the assignment of the gbm subtype given by tcga (see http://tcga-data.nci.nih.gov/docs/publications/gbm_exp/). Five of the test samples did not belong in the core subgroups identified in, and our calculation agrees . Of the remaining 15 patient samples, 5 do not belong to any of our three core groups . (in fact, 4 of these have been assigned to the neural subgroup .) Robust prognostics for many subtypes of cancer are yet to be discovered [23, 32]. High - throughput genomics offers a possible approach for early and reliable cancer prognosis [8, 38]. Clustering algorithms require the definition of a genomic distance between patient samples . Since there is no natural measure, topological approaches to partitioning are likely to prove more robust . Second, although techniques have been proposed to identify the optimal number of partitions of a set of objects, its value can be sensitive to the choice of the gene panel used for profiling . It was used to partition the 202 gbm patient samples whose genetic profiles are given at the publicly accessible tcga site . We identified a set of genes most useful for the partitioning and to determine core groups of samples for each subtype of gbm . We argued that a necessary condition for the inclusion of a gene was that its fold inductions lie on a distribution with a (relatively) small value of the nondimensionalized standard deviation, indicating a bimodal distribution . We then used persistent homology to streamline the set further by only retaining genes that belong in groups; genes within a group exhibit highly correlated variations of expression levels between patient samples . Many of them do not play a pivotal role in gene regulatory networks associated with gbm [14, 22, 23, 39] and may be downstream nodes . It would be interesting to determine if they can be implicated directly in the histopathological criteria used to define the malignancies . Next, we use the differential expression of genes in c1 and c2 to bisect the patient samples . The two partitions contain 84 and 76 patient samples . Using the heat map for guidance, we selected 60 and 44 samples from the two partitions as its core members . Once the core patient samples in each group are known, it is possible to determine the most suitable gene set to differentiate between the partitions . The new gene groups c1 and c2 provide a significantly sharper heat map . We find that the first core group contains patient samples of the classical and mesenchymal subtypes, while the second contains proneural samples . (1) patient subgroups derived from the analysis depend only weakly on the number of genes used for the persistent homology step (n = 60 for the results reported here). For the gbm data, barcodes (figure 3(a)) for a range of choices for n between 50 and 120 are similar, with the component appearing at rc 0.6 lasting for a smaller range in cutoff as n increases . Values of n <50 do not give uniform results, and those larger than 120 cannot be justified from figure 2(b). (2) the patient groups are very weakly dependent on the number of genes ng chosen for the panels c1 and c2 (ng = 15 for each set). We could choose ng as small as 10 or use all genes in the sets c1 and c2 for the analysis with similar results . A unique aspect of our approach is that each subgroup can now be further bisected, albeit using different gene sets . Specifically, the classical / mesenchymal group was subdivided using sets c1 and c2, each containing 15 genes . It is known that that classical patient samples exhibit a high level of expression of egfr [1, 9]. Consistent with this, we find that egfr is over expressed in the classical / mesenchymal partition in figure 4 and in the classical group in figure 5 . The proneural subtype of gbm is associated with high alterations in tp53, pdgfra, and idh1 . It is possible that, although there are large alterations in the levels of these genes, the mean values in the ensemble (of proneural samples) do not change significantly . The high levels of mutations of nf1 of mesenchymal samples are not reflected in the gene sets as well . Our analysis suggests that patient samples in this group lie, not on a single partition, but on several small partitions . We used the panel of 59 genes in c1, c2, c1, and c2 to introduce a prediction model for the subtypes of gbm . The test involved the computation of the mean correlation distance between a new sample and members of each core group . Fifteen out of the 20 test sample predictions agreed with the results from the clustering calculation . Four of the remaining samples were categorized as neural by the clustering method but were unassigned by ours since the neural group was not found to be a single cluster . Of the genes in c1, c2, c1, c2, only egfr has been previously implicated in gbm . However, other gene groups may have functions related to cancer (the functional annotations can be found in genecards, the human gene compendium, weizmann institute of science). One example is a group related to intercellular scaffolding: dcx translates to a microtubule - associated protein, dnm3 is involved in producing microtubule bundles, postn plays a role in extracellular matrix mineralization, rras regulates the actin cytoskeleton, and coll11a1 may play a role in fibrillogenesis . Another group is known to be expressed in brain function: rab33a is a member of the ras oncogene superfamily, gpr17 may mediate in brain damage, and nr2e1 may be required for brain development . A third group of genes is associated with differentiation, development, and the cell cycle: they include edhb4, ascl1 involved in early stages of development, mpped2, which plays a role in the development of the nervous system, cspg4, which functions as a growth and differentiation factor, bcan involved in terminal differentiation, meox2, which plays a regulatory role in muscle cells, and ndn, which is a growth suppressor involved in cell cycle arrest . The zinc fingers zfp30, znf419, znf8, and znf606 are involved in transcriptional regulation . We have introduced a novel algorithm for genomic subtyping of cancer samples . Unlike prior clustering techniques, we predetermine a compact set of genes to be used in the analysis through the nondimensionalized standard deviation and persistent homology . Importantly, the gene set selected for the analysis depends on the group of patient samples to be analyzed . Hence, if needed, partitions obtained from the first step can be further bisected . Our approach not only provides a robust partitioning of patient samples, but can also be used to identify a panel of genes to be used as a biomarker . The gene panels have been used to introduce a prediction model to determine if a new patient sample belongs to the core subgroups associated with classical, mesenchymal, and proneural subtypes of gbm.
Senile plaques and neurofibrillary tangles are the two main histopathological characteristics of alzheimer's disease . They were described for the first time by alois alzheimer in 1907, who discovered both structures in the autopsy of a brain from a patient who had exhibited severe cognitive impairment and memory loss . Although these hallmarks of the disease were established as long as a hundred years ago, the illness was not fully recognized as such due to the social dismissal of dementia as a normal part of the human ageing process . From the late 1970s onwards however, extensive neurobiological research has been in progress to understand the disease and to develop therapeutic approaches . Today it is widely accepted that the basis for ad is biological and that senile plaques and neurofibrillary tangles are responsible for the inception of the disorder and also that especially the number of nfts is proportionally related to the severity of the accompanying symptoms, such as memory loss, confusion, and cognitive failure . Plaques and tangles can be found post mortem mainly in the hippocampus and cerebral cortex but also in other areas of the brain important for cognitive functioning . Early and late onset ad as well as familial and sporadic ad are distinguished based on the time in life of the patient when symptoms first occur and the involvement of gene mutations or chromosomal aberrations that can be related to the disease, respectively . Nevertheless, in all cases the development of histopathological and behavioral symptoms is similar to indistinguishable . Several genetic factors have been described in relation with early and late onset familial ad, though their involvement is not per se essential for development of the disorder, given that only about 1% of all cases of alzheimer's are familial . However, studying how these genetic influences may be able to induce the symptoms characteristic for ad could be a step towards understanding the mechanisms of the disease and lead scientists towards future clinical therapeutic approaches . The most studied is the apoe e4 allele of the gene coding for apolipoprotein e. though the underlying mechanism is still unknown, proof exists that this allele causes a shift in age of onset towards a younger age . In early onset familial ad, mutations have been described in three genes involved in senile plaque formation, namely app, psen1, and psen2 which encode the proteins amyloid precursor protein, presenilin-1, and presenilin-2, respectively . The presenilins are integral membrane proteins that form part of the -secretase complex that, after -secretase cleavage of the amyloid precursor protein, generates the amyloid (a) fragment . Mutations in psen1 and psen2 are believed to possibly contribute to an increase in a, especially the more neurotoxic form comprised of 42 amino acids, a 42 . Mutated forms of human app have been expressed in a variety of transgenic animal models to further the understanding of plaque formation . Other contributing factors to the pathogenesis of ad are being addressed in various studies, and today lifestyle choices, adequate nutrition, psychological well being, and intellectual stimulation are proven to exert important influence on susceptibility to ad and other forms of dementia [5, 6]. The understanding and distribution of this information may not provide a cure but help to prevent the development or lower the severity of ad symptoms in many cases . Senile plaques are formed via the aggregation of amyloid outside neuronal cells . While a is a naturally occurring 4 kda polypeptide in the brain, it becomes neurotoxic in excess quantities or when it fails to be degraded so that polymerization occurs . Plaques are formed mostly from a derived from amyloid precursor protein (app) which is an integral membrane protein type i of unknown function which occurs in different isoforms . The most common isoform which is expressed exclusively in neurons is app695, comprised of 695 amino acids . App contains various domains: a single transmembrane domain, an extramembranous n - terminal domain, and a cytoplasmic region at its c - terminus as well as a signal sequence . The neurotoxic effects of app are believed to be mediated by proteolytic processing of app which gives rise to a . -secretase (bace1, cleaving enzyme of the -site of app) liberates the amino terminal fragment of a while the subsequent cleavage by -secretase of the resulting c - terminal fragment determines the overall length of the amyloid peptide, giving rise to a 40, and the less common but more neurotoxic form a 42 . -secretase cleavage of app does not contribute to plaque formation due to the fact that this cleavage takes place inside the a region of app . A is believed to be one of the principal factors which causes neurodegeneration in alzheimer's disease by forming oligomeric aggregates leading to accumulation of these structures in the brain . A 42 is considered to be more prone to aggregation and probably acts as a catalyst for the aggregation of a 40 . Neurofibrillary tangles (nft) are the second histopathological hallmark found in brains affected by ad . These intraneuronal lesions consist principally of aberrant filaments, the principal proportion (95%) being paired helical filaments (phfs), and the rest being straight filaments (sfs). Phfs are bundles made up of twisted filaments, which like sfs, are composed of aberrantly hyperphosphorylated tau protein [9, 10]. The diameter range of phfs is 820 nm and they exhibit periodic repeats of 80 nm along their length while straight filaments do not show this periodicity and have a diameter of 15 nm . Phfs are also the components of the neuropil threads, which appear independently of plaques and tangles and may be observed in an array of dystrophic neurites . Not all neuronal cell types appear to develop neurofibrillary tangles . In the cerebral cortex, all cells containing nfts are pyramidal neurons, while in the subcortical nuclei the most affected cells are the ones with extremely long axons, consistent with the observation of thin long neurites being especially vulnerable to ad - related cytoskeletal changes . Nfts also appear independently from the presence of senile plaques in other neurodegenerative disorders such as pick's disease, progressive supranuclear palsy, frontotemporal dementia and parkinsonism linked to chromosome 17, meningioangiomatosis, or subacute sclerosing panencephalitis . Under normal physiological conditions however, tau is a phosphoprotein that plays an important role in a variety of processes . Besides its crucial role in tubulin assembly and microtubule stabilization [17, 18], it is also important for the outgrowth of neurites from the cell body . Recently, tau has also been observed to be involved in the migration of new neurons . The authors detected phosphorylated tau protein in newly generated neurons in two well - known regions of adult neurogenesis, the subventricular zone associated with the lateral ventricles and the subgranular zone of the hippocampus . In these zones, phosphorylated tau was colocalized with doublecortin, a cytoskeletal protein that serves as a marker for neuronal migration, while tau knockout mice showed similar numbers of doublecortin - expressing cells but also a significant decrease in migration of these cells . The obtained results suggest a function for tau in the migration of newborn neurons in adult neurogenesis . The modification of the tau protein by phosphorylation can alter the way it interacts with microtubules, as is the case with ad . There, hyperphosphorylation induces tau to dissociate from the microtubules which depolymerize while the concentration of soluble tau in the cells increases . This effect contributes to the assembly of filaments and the creation of phfs from the soluble pool of tau . As neurofibrillary tangles are composed mainly of phfs and their number in the brain has been described to be proportional to the severity of symptoms of dementia, phosphorylation of tau appears to play a major role in the pathogenesis of ad . Given these observations, it would be of great interest to determine the enzymes that phosphorylate tau in the brain . One of them has been identified as the kinase gsk-3 . As an example, in a drosophila melanogaster model, tau phosphorylation via its gsk-3 homologue shaggy has been described to facilitate its aggregation to filamentous structures . For an extensive explanation of tau and its role under physiological and pathological conditions, see the review published by our group . An alternative interpretation of the role of phosphorylated tau protein has been promoted by the group of mark a. smith . These authors question the concept that phospho - tau is inherently toxic because of its presence in neurofibrillary tangles and must therefore be a direct mediator of the disease . Instead, tau aggregation could be a response to the disease, and actually play the role of a protective shield against neurotoxic agents rather than leading to neurodegeneration . In support of this model castellani and coworkers point out that nfts, (a) are found in viable neuronal cells even in late stages of ad, (b) exist in the neuronal cytoplasm for decades, (c) can be observed, sometimes at high concentrations, in the brains of elderly persons who showed no signs of dementia throughout their lifetime, and (d) are present in neurons which contain normal amounts of structurally intact microtubules . Several animal models of ad have been created in order to emulate specific features of the disease, such as its histopathological, biochemical, and behavioral characteristics . These models were designed to probe the pathological and biochemical changes that take place in affected organisms throughout the progression of the disorder and to test for possible therapeutic measures to be applied in the future in human patients . The usefulness of an animal model depends on its capability of faithfully replicating the physiological processes that take part in the progress of the disease in human patients so that it leads to a better comprehension of the pathogenesis and finally allows developing an efficient therapeutic approach . Since no other natural species spontaneously produce all of the histopathological, cognitive, and behavioral symptoms that characterize alzheimer's, there was a need for the development of transgenic animal models or of dietary manipulation of test animals which would allow reproduction of the hallmarks of ad . From a practical viewpoint, it is of great importance to choose animals with a short lifespan and fast rates of ageing in order to be able to observe, in a reasonable time window, processes which take from 50 to 80 years in humans to appear and develop . Each animal model has its limitations and advantages, as to date, none are able to express the whole set of characteristics needed to resemble full - blown ad pathology (table 1). The contribution of each model to the understanding of this devastating disease, however, is immeasurable and has permitted the scientific community to establish an extensive base of knowledge on ad and the mechanics of the disorder . In the following, we will present the different animal models which have been established so far, discuss their characteristics, advantages, and pitfalls as well as take a look at the latest developments in this field of research . Different invertebrate models have been created for studying alzheimer's disease, the most commonly used organism being the fruit fly drosophila melanogaster . Besides being easy to breed, manipulate, and genetically modify, d. melanogaster presents the advantage of having an extremely short development time spanning only 12 days from a fertilized egg to an adult fly, so the generation of large numbers of offspring is very easy . In one model, although overexpression of either tau form led to the premature death of the flies, symptoms of progressive neurodegeneration were more pronounced in the strain carrying the mutant gene . Intriguingly, the symptoms of neurodegeneration were not accompanied by the formation of neurofibrillary tangles . However, when flies which expressed wild type tau were induced to also overexpress the drosophila gsk-3 homologue shaggy, neurofibrillary lesions could be observed . These findings indicate that higher levels of tau phosphorylation cause its aggregation into filaments and thus indicate an important role for gsk-3 in contributing to the formation of neurofibrillary tangles in ad . Drosophila was also used to investigate the neurotoxicity of human wild type and mutant tau in the early stages of embryonic development . These experiments revealed that in spite of the pan - neuronal expression of tau in these transgenic lines, different anatomical patterns of toxicity in the cns of these flies could be observed depending on whether the expressed isoform was wild type or mutant . While human wt tau was observed to be hyperphosphorylated at specific sites and caused severe abnormalities in the development of the mushroom body (mb) of the animals, the ftdp17 mutant isoform led to significantly less severe aberrations in mb development . The data from these experiments in d. melanogaster suggest that not only high levels of phosphorylation are required to mediate tau toxicity but also that modification has to take place at specific phosphorylation sites, and that tau toxicity is cell type - dependent . Another study points in the same direction, coming to the conclusion that specific phosphorylations at various sites modulate tau toxicity in a synergistic manner . Modeling of a plaque formation in d. melanogaster has been another objective of animal studies . The transgenic expression of human wt or mutant app led to neuronal death in the brain already at the larval stage of development . The severity of the symptoms was proportional to the concentration of a and the c - terminal fragment of app . Clues exist that the different forms of a as soluble, oligomeric, and insoluble plaque deposits exhibit different toxicities towards cells . This fly model together with the recently generated specific antibodies against the different types of a-aggregates [29, 30] could be used to address this question . D. melanogaster has also been successfully employed in the study of the influence of oxidative stress on the pathology of alzheimer's disease . Lowering the antioxidant defenses of animals which expressed r406 mutant human tau increased tau toxicity while the antioxidant -tocopherol (vitamin e) was able to alleviate the effects of tau toxicity . Another application of the fruit fly with direct clinical relevance is that of a model organism for first round drug screening in ad . Given its extremely short development period, being an organism which is cheap and easy to manipulate even in large numbers and the low ethical restrictions when working with flies, d. melanogaster presents an overall advantageous choice . In a very recent study, a drosophila model was described using the fly's notal bristles as a tool for assessing tau - induced toxicity . The authors propose the use of this model for the screening of possible drugs for use in ad therapy . While the fruit fly presents a number of advantages as a suitable animal model for ad, there are also certain pitfalls . One major restriction when trying to extrapolate experimental data gained with d. melanogaster is its significantly different brain structure from humans, as it does not possess a hippocampus for example . Due to its small size the drosophila brain is also difficult to analyse using stains for identification of distinct regional expression of histopathological markers . Last, memory impairment and cognitive deficits in such a phylogenetically distant organism are difficult to extrapolate to compare with human conditions . To widen the understanding of the cellular mechanisms involved in ad and to aid in the search for pharmacological compounds that could be in the benefit of therapeutic interventions for tauopathies, two of the most widely used animal models at the time are the roundworm caenorhabditis elegans and the zebrafish (danio rerio). The advances that these models provided have been summarized in recent literature reviews [33, 34] for c. elegans and [35, 36] for d. rerio, respectively . C. elegans is a small organism with a short life span that allows for high throughput manipulation and drug screening applications, while the zebrafish, another well - suited organism for studying neurodegeneration, presents the advantage of being completely transparent in its larval development state, allowing continuous in vivo observation of processes taking place in its exposed nervous system . Paquet and coworkers generated a fluorescently labeled tau transgenic zebrafish model . Using this animal, the authors were able for the first time to trace directly neurodegenerative processes taking place in the fluorescently stained larvae and to visualize the resulting neuronal cell death via time lapse microscopy in vivo . In addition, they employed this novel model as a tool for drug screening of gsk-3 inhibitors and have validated one promising compound termed ar-534 . Choosing a neuroanatomy which more closely resembles the human brain, several mouse models of ad and other tauopathies earlier models fell into two main groups, according to the ad hallmark lesion (amyloid plaques or neurofibrillary tangles) mimicked in each model, but more recent approaches have generated models exhibiting both features simultaneously . Several transgenic mouse lines have been generated which express one of the mutant forms of app . Most of these transgenic lines exhibited senile plaques as a depositions and also the characteristic behavioral deficits reminiscent of ad in animal models . The first of the transgenic animals expressed the human mutant v717f app form driven by the platelet - derived growth factor (pdgf) mini promoter . A plaque formation was observed in the test animals as well as memory impairment, especially related to spatial learning . When compared to wild type mice, the transgenic animals showed a significantly more severe decline in memory as assessed by a modification of the morris water maze experiment . Another model expressed a different mutant app form, the app (swedish) double mutation inserted into a hamster prion protein (prp) cosmid vector . -amyloid concentrations increased fivefold in a 40 and 14-fold in a 42, and the deposits could be stained with congo red especially in the cortical and limbic regions of the brain . In a third model that overexpressed app sevenfold, amyloid plaques appeared as soon as at six months of age in the tested mice . In contrast to the other two cited studies, these mice showed significant neuronal cell death besides the plaque deposits, specifically of pyramidal neurons in the ca1 region of the hippocampus, with the plaques seemingly affecting cell integrity in the adjacent neurons . Several experiments in transgenic mice have shown that amyloid plaque formation can promote tau pathology [40, 41]. When crossing human app transgenic mice with tau expressing strains, or administering a 42 intracerebrally, tau phosphorylation was enhanced and nft depositions increased in concentration . Interestingly however, when happ mice were crossed with tau knockout animals, no memory or learning deficits could be detected in spite of the massive deposition of plaques in these mice . These findings underscore the importance of the presence of tau protein for the induction of the disease as in this animal model amyloid - mediated toxicity was nullified by the absence of tau . The level of neurotoxicity exerted by a also depends on its length as was revealed in a transgenic mouse study carried out by mcgowan and coworkers, as transgenic mice which express only a 40 did not develop any senile plaques while a 42-expressing animals did . A different mechanism of proteolytic modification of the amyloid precursor protein is the cleavage at aspartate residue 664 (d664) by caspases . Previous studies suggested that this cleavage, alternative to the described catalytic mechanisms involving secretases, could play a key role in the pathogenesis of ad [44, 45]. To address this question, harris and coworkers used two transgenic mouse lines carrying the app gene with (b254) and without (j20) the caspase - specific cleavage site and studied the possible implication of the resulting products, the c31 and jcasp fragments, in ad . Although these products had been described before to cause cell death in vitro, in these in vivo experiments, histological and behavioral assessment of the test animals did not reveal significant differences between the b254 and j20 mice . The authors came to the conclusion that caspase cleavage of app does not play a critical role in the generation of ad - related abnormalities in these transgenic mice, and that therefore the d664 cleavage site of app would not be a suitable target for the development of therapeutic interventions . Recently, the differential toxicity of soluble a oligomers and fibrillary a plaques has been discussed . In a study with mice, animals which overexpressed the arctic mutation were compared to mice overexpressing wildtype a . While the mutant a (ae22 g) led to the marked formation of amyloid plaques, it also lowered the concentration of a specific nonfibrillar a-assembly (a56). Remarkably, both strains showed similar behavioral and neuronal deterioration when normalized for a56 levels, while the number of plaques was very different . The authors of the study concluded that a*56 concentrations are a more suitable marker for ad - related functional deficits than the amount of a deposited in the form of plaques . Therapeutic approaches that lead to the breakdown of fibrillary a but possibly increase the levels of soluble oligomers could therefore be counterproductive . In view of these data, therapeutic interventions which block the production of a monomers and soluble oligomers these enzymes however are involved in other physiological processes as well, and it may therefore be detrimental to indiscriminately reduce their activity . Recent strategies avoid this problem, as in the case of some nonsteroidal anti - inflammatory drugs (nsaids) which do not alter secretase activity but alter its cleavage site specificity resulting in the generation of the less toxic 38 residue a instead of the highly amyloidogenic a42 . The introduction of immunotherapeutic treatments could also lead to the specific elimination of a oligomers and might prevent their formation . Positive effects of this approach have been described in a transgenic mouse model and were also assessed in humans in a small cohort of ad patients . Transgenic mice carrying cdnas which encode either the largest or the smallest human tau isoform have been generated . Later, mouse models which express the mutant isoform of tau found in ftdp-17 patients were also developed, as well as mice that model the disease via the overexpression of certain kinases which play a key role in the hyperphosphorylation of tau in ad and related disorders . The first transgenic mouse which expressed the longest tau isoform under control of the human thy-1 promoter showed tau phosphorylation at sites which are usually found to be modified in phfs and presented localization of human tau in neuronal soma, axons, and dendrites . These mice exhibit modest expression of human tau protein (approximately 10% of total tau in the animals) and did not exhibit neurofibrillary tangles . However, the histopathology observed in these animals reflects an early stage of ad prior to the formation of neurofibrillary tangles, in which hyperphosphorylated forms of tau are localized in the soma and dendrites of neuronal cells . In another mouse model in which the shortest human tau isoform was overexpressed under the murine hmg coa reductase promoter, transgenic tau could be detected in the somatodendritic compartment, although again no nft formation was observed . Subsequent transgenic mouse models were designed using stronger promoters, resulting in increased expression of human tau in these animals until eventually brain tau aggregates could be detected, although the formation of nfts still remained elusive [54, 55]. These models showed not only ad - like symptoms in brain cells but also exhibited spheroidal tau aggregates in the spinal cord resulting in motor symptoms in the animals characteristic more of amyotrophy . While transgenic mice with excessive overexpression of human tau are not viable, lines that overexpress tau less than tenfold have been generated and tau inclusions have been observed in cortical, brain stem, and spinal cord neurons, accompanied by other symptoms such as axon degeneration, decrease of microtubules, and motor deficits . Staining of the inclusions with the ad pathology - specific dyes congo red and thioflavin s revealed increasing insolubility of the aggregates over time and nft - like inclusions could be detected in old animals (18 to 20 months). Other models with the tau gene under the control of the prp promoter led to the expression of high levels in certain types of neurons and glial cells . Here, fibrillary structures could be detected in glial cells (oligodendrocytes) as well as neurons . In a mouse model expressing three isoforms of human tau simultaneously, structures were observed which were similar to the astrocytic plaques that characteristically appear in the gray matter in cases of corticobasal degeneration (cbd), although neuronal cells were not equally affected, as they did not show any fibrillary lesions . While to this day no mutations have been found in the tau - encoding mapt gene in ad patients, molecular analysis of another tauopathy, frontotemporal dementia with parkinsonism linked to chromosome 17 (ftdp-17), has revealed characteristic mutations in this gene . Some of them like the p301l or the r406w mutations have been observed to lower tau's potential to promote microtubule stability . In mouse models expressing a human tau isoform containing the p301l mutation, reviewed in, it was found that this mutation reduces the affinity of tau for microtubules . In one study, the mice showed nfts in the brain as well as in the spinal cord alongside with a substantial reduction in the number of motor neurons . Furthermore, the animals developed severe behavioral deficits which emulate neurological symptoms of the disease in humans . In another study also employing mice overexpressing human tau with the p301l mutation, short tau filaments were isolated from the brains of the test animals . Interestingly, one study revealed that when the expression of mutant p301l tau was suppressed after a period of overexpression, the behavioral symptoms in these mice could be reversed, while the insoluble nfts were not removed but continued to accumulate . This result hints at the possibility that soluble tau rather than its fibrillary deposits is the cause of neuronal cell death in alzheimer's disease . A triple transgenic mouse model expressing the mutant transgenes ps1 (m146v), app, and p301l tau was generated by the group of laferla to examine the interactions between beta - amyloid, neuronal dysfunction and neurofibrillary tangles . These 3xtg - ad mice developed both of the classical hallmarks of alzheimer's in human patients, senile plaques and neurofibrillary tangles, and furthermore, synaptic plasticity and neuronal long - term potentiation were impaired in these animals in a manner which could be related to a formation . In 2002 this mutation is responsible in humans for an early onset of the pathological signs of ftdp-17 . In this model, numerous phfs consisting of tau filaments could be detected in the brains and spinal cords of the animals . Another observation was that motor neurons were the cell type where the highest concentrations of tau could be detected . Consistent with the findings in human patients where the p301s mutation is related with an earlier onset of ftdp-17 as compared to the p301l mutation, neuronal cell death was highly elevated (49%) in mice which overexpressed human p301s tau . Colocalization of hyperphosphorylated tau deposits and map kinases hinted at the possible implication of these enzymes in tau modification . In another study which compared the development of neurodegenerative signs in p301s mutant transgenic and wild type mice, neurofibrillary lesions could be detected in the transgenic animals at the age of 9 to 12 months, accompanied by the massive loss of hippocampal and cortical neurons . Interestingly, synapse loss in the hippocampus and deficits in synaptic function could be observed long before the formation of nfts, at about three months of age . Given that early microglial activation was also observed and that tau pathology could to some extent be reverted by administration of the immunosuppressive drug fk506, the authors of the study established a link between neuroinflammation and the early stages in the development of tauopathies . The implication of an improperly controlled cell cycle in neurodegenerative diseases has also been described in the literature . In degenerating neurons elevated concentrations of proteins associated with the cell cycle such as cyclins, cyclin - dependent kinases, and the products of proto - oncogenes such as c - myc, can often be detected . Two studies investigate the effects of cell cycle reentry mediated by transduction with c - myc, using an in vitro cell culture model as well as a transgenic mouse model . Induced cell cycle reentry led to the death of neurons, gliosis, and cognitive impairment in the mouse model, thus indicating that this loss of control in mature, postmitotic neurons may contribute to the pathogenesis of diseases like alzheimer's . Interestingly, forced cell cycle re - entry led to the phosphorylation of tau and to the formation of tangle - like structures in the in vitro model, providing further evidence for a possible causal connection between the cell cycle and ad . As insulin has been described to be involved in the metabolism of both a and tau, the researcher studied the possible effect of artificially induced diabetes mellitus (dm) on the brain cells of pr5 transgenic mice which expressed the p301l human mutant tau and produced neurofibrillary tangles . After drug induced - insulin depletion, tau phosphorylation increased in both wild type controls and transgenic mice, though remarkably only the transgenic animals produced massive deposits of nonsoluble hyperphosphorylated tau protein . The authors came to the conclusion that dm is capable of triggering an earlier onset of a preexisting tau pathology in susceptible animals and that diabetes might cause an abnormal phosphorylation of tau via the elevation of glucose levels . Given the high rates of comorbidity of ad and dm in the human population, this line of research deserves further investigation as it might unveil new insights on the pathogenesis of ad . In a complex yet very elegant survey, a genome wide search strategy employing lentivectors led to the identification of a retroposed gene in mouse . This rps23r1 gene normally encodes for the ribosomal protein s23 but in the retroposed form is transcribed in the reversed sense, expressing a functional protein which is localized integrated in cell membranes of the cerebral cortex and hippocampus . Intriguingly, overexpression of rps23r1 reduced levels of a, gsk-3 activity, and tau phosphorylation . The proposed mechanism of this effect consists of an initial interaction with adenylate cyclases upregulating cellular camp levels, which in turn activates protein kinase a (pka). This activation results in the inhibition of gsk-3, a kinase that is involved in tau phosphorylation and a generation . Given that these aberrant phosphorylations of tau play a key role in the development of alzheimer's disease, another important strategic approach is to identify the phosphorylation sites that are connected to the formation of aggregates and to identify the responsible enzymes and pathways for these tau modifying reactions, namely, the kinases and phosphatases . The first generation of transgenic mice expressing gsk-3, a kinase involved in many physiological pathways, was generated using both ubiquitous or cns - specific promoters . In all cases however, though slight increases in the phosphorylation levels of tau could be observed, no overexpression of the enzyme took place . This is probably due to the narrow window of concentrations in which gsk-3 can be expressed in cells, below and above which the lack or excess of gsk-3 activity proves lethal . Considering the narrow concentration range of gsk-3 that permits cell viability, a model was created with gsk-3 gene expression adjustable by means of a conditional tetracycline regulated system under the control of the cam kinase ii -promoter . The advantage of animal models employing the tetracycline regulation system lies in the possibility to carry out reversible studies . In this mouse model, gsk-3 overexpression the overexpression of the kinase led to hyperphosphorylation of tau as detected by specific antibodies and showed how tau phosphorylation lowers its affinity for microtubule binding . Behavioral deficits related to alzheimer's disease however, could be observed in this animal model by applying the morris water maze test . In spite of these findings, the correlated deposition of insoluble tau neurofibrillary tangles could not be observed . The shutdown of gsk-3 overexpression in turn leads to normal gsk-3 activity, normal phospho - tau levels, diminished neuronal death, and the suppression of the cognitive deficits . These findings further support the potential of gsk-3 inhibitors in the treatment of ad . To further study the involvement of gsk-3, transgenic mice that overexpress gsk-3 were crossed with ftdp-17 mutant tau mice . This ad animal model, termed gsk-3/vlw, shows tau hyperphosphorylation in ca1 hippocampal neurons, the region where the expression patterns of both transgenes overlap . Tau filaments with a phf - like structure were found in gsk-3/vlw mice but not in single transgenic mice expressing either gsk-3 or ftdp-17 tau alone . Phf - like filament formation in gsk-3/vlw mice was accompanied by thioflavin - s staining, indicating the presence of senile plaques . All these data suggest that there is a synergistic contribution of both types of tau modification, hyperphosphorylation and missense mutations, to induce aberrant tau aggregation . The same animal model has been utilized to study the possible effects of lithium, a gsk-3 inhibitor used for treating affective disorders with well - documented effects in humans . Two questions were addressed: first, whether chronic lithium treatment is able to prevent the formation of aberrant tau aggregates (formed by overexpression of ftdp-17 tau and gsk-3); and second, whether lithium can revert already formed tau aggregates and nfts to achieve their clearance in aged animals . The results indicated that lithium is capable of preventing the development of tau pathology when administered early in disease progression . On the other hand, if lithium administration is initiated at late stages, tau hyperphosphorylation is reduced but tau aggregation cannot be reversed . The data supports studies describing novel gsk-3 inhibitors as new pharmacological treatments of this kind of neurodegenerative disorders, as reviewed byavilaand hernndez . A second transgenic animal expressing a constitutively active form of the kinase, gsk-3(s9a), has been cross - bred with transgenic mice that overexpress the longest human tau isoform . The number of axonal enlargements present and the motor impairment typical for these tau transgenic animals were reduced in the double transgenic mice . Thus, taking into account all these data it seems that gsk-3 could have different functions in different neurons and in different regions of the brain, while the hippocampal dentate gyrus seems to be more susceptible to degeneration in transgenic mice overexpressing gsk-3 . A recent publication examines the possible role of gsk-3 in tau phosphorylation in the dentate gyrus . Previously generated transgenic mice which overexpress gsk-3 in the dentate gyrus were crossed with a tau knockout strain in order to verify if gsk-3 mediated phosphorylation of tau is the cause of neurodegeneration in the dentate gyrus . When compared to tau - expressing control animals, the authors observed that the signs of neurodegenerative damage were significantly attenuated in the absence of tau . Therefore, hyperphosphorylation of tau is proposed to be a causal factor of the histopathological lesions found in the animals . Very recently, the role of caspases in ad was reevaluated in a study by calignon and coworkers . Using the transgenic tg4510 mouse strain, the researchers observed that tangle free cells which showed caspase activation formed nfts within 24 hours . Furthermore, administration of wild type tau into wild type animals led to caspase activation and eventually to tangle formation . The data from this study suggest that caspase activation of tau could be a direct cause of tangle formation, and as has been pointed out in various recent articles, that the ad typical neurofibrillary deposits are the final histological outcome of a neurodegenerative process, rather than the cause of it . While research models in animals allow studies in the whole organism within a reasonable time, there also exists a need for the possibility to investigate disease - related processes in human cells . Therefore, recently cell culture - based approaches are being developed, relying on the derivation and propagation of neuronal cells from different types of human tissue . One widely employed model for neuronal cells in culture is the human neuroblastoma line shsy5y, which was used to elucidate the role of leptin in alzheimer's disease . Leptin has recently been proposed as another factor related to the susceptibility of contracting ad . It is an endocrine hormone with implications in food intake regulation as well as processes of learning and memory, for example, in long - term potentiation (ltp). Epidemiological data from human populations suggest a significantly lower risk of developing ad for people with higher leptin blood levels . The mechanism of action is probably the same as one described for the physiologically closely related peptide insulin . Experiments with differentiated shsy5y human neuroblastoma cells indicate that both compounds are capable of reducing the level of tau phosphorylation via inactivation of gsk3- . Another study revealed a possible protective effect of leptin on neuronal cells against -amyloid toxicity . In as shsy5y cell culture model as well as in a transgenic mouse model, leptin leptin reduces the activity of -secretase, one of the enzymes that cleaves app, which could probably be the underlying mechanism of the a reducing effect of leptin . Recently, the applicability of cell culture models has been vastly improved by the possibility of deriving patient - specific cell lines that can be propagated in vitro . Patient - specific fibroblasts for example, can be reprogrammed to induced pluripotent stem (ips) cells and then differentiated into neuronal cell types similar to those found in the hippocampus or cerebral cortex . This allows the generation of cell models that reproduce certain disease - specific features in vitro, without ethical concerns and which are easily accessible for analysis and manipulation . The groundbreaking work in ips generation was conducted by the group of yamanaka, who succeeded in creating pluripotent stem cells first by transducing mouse embryonic fibroblasts with a set of four genes encoding the factors oct3/4, sox2, c - myc, and klf4 . When grown under culture conditions for embryonic stem (es) cells, these ips cells showed the morphological traits, growth potential, and immunomarkers of es cells . Later, the authors were able to generate ips cells from adult human dermal fibroblasts using the same four factors . Today, several cell lines specific for various neurodegenerative diseases have been generated with the objective of creating human in vitro models . Examples are amyotrophic lateral sclerosis (als), parkinson disease (pd), and huntington disease (hd), reviewed in . In the case of als, dimos and coworkers were able to derive ips cells from fibroblasts of an 82-year - old patient suffering from the disease and subsequently differentiate these ips cells into motor neurons, the cell type affected by als . To date, the generation of alzheimer's specific ips cells has not been published, but their generation and differentiation to neuronal types involved in disease progression hopefully will be accomplished soon, offering a novel tool to study the pathological processes, such as tau phosphorylation and tangle formation, which so far have not been completely recapitulated in animal models . Another strategy is the use of fetal human neural stem cells (hnsc) to create cell models by differentiation of these cells to neuronal types of interest . We have established a method for the differentiation of hnsc to postmitotic neurons which express the neuronal markers tau and iii - tubulin . These neurons were derived from human fetal forebrain tissue and are viable in cell culture for weeks . This model permits the study of effects of candidate therapeutic drugs on tau expression or phosphorylation state . Furthermore, these cells can be transduced with viral vectors to overexpress ad - related genes, such as those encoding tau or gsk-3 allowing the study of the consequent alterations, including the formation of tangles and plaques . Additionally, the effect of tau - overexpression on neural stem cells (in their undifferentiated state) is an interesting topic, as brains affected by ad show high levels of tau phosphorylation in regions, such as the hippocampus, where neural stem cells reside and are involved in adult neurogenesis . As research in neural stem cells and neurodifferentiation continues to make technological leaps, further contributions to alzheimer research can be expected soon by means of creation of human cell models that imitate specific aspects of the disease . In summary, a variety of animal models have been generated which reproduce either the a or tau histopathological hallmark lesions of ad as well as transgenic animals which exhibit both features simultaneously . Some of these models reproduce the lesions as well as the related behavioral impairments, while suggesting that both plaques and tangles may have synergistic effects in driving the disorder rather than developing independently from each other . This observation is strengthened by the notion that the transgenic mouse models most successfully reproducing ad - like pathology are the ones which combine overexpression of tau and app, like the 3xtg - ad mice . The animal models shed light on mechanisms of progression of tauopathies and their application as drug screening systems pave the way for the development of future treatments of dementia . Due to the additional need for human models combined with the impossibility of conducting basic research in humans in vivo, the use of ips cells and neural stem cell cultures derived from human fetal and adult tissue is being established as an alternative and complementary route . While this approach does not hold the advantages of conserving the integrity of the biological system under study, they do allow the study of molecular interaction and biochemical pathways in an all - human system, a point of high relevance due to the human specificity of many aspects of ad.
The unique architecture of axons poses a significant demand on the cell body, as most newly synthesized proteins, organelles, and mrnas originate in the soma and require long - distance delivery into axons . Axonal dysfunction and impaired axonal transport are frequently described as among the earliest and possibly causative changes in age - related neurodegenerative diseases (adalbert and coleman, 2013; millecamps and julien, 2013). As axonal transport declines during normal aging however, little is known about the nature of this decline in individual axons, specifically regarding timing, affected cargoes, similarities between peripheral nerves and the central nervous system (cns), and the potential to reverse these changes . Most studies either analyze the bulk transport of several cargoes in all axons of a nerve (brunetti et al ., 1987; cross et al ., 2008; frolkis et al ., 1997; geinisman et al ., 1977; mcquarrie et al ., 1989; stromska and ochs, 1982) or investigate a specific cargo in all axons (castel et al ., 1994; fernandez and hodges - savola, 1994; goemaere - vanneste et al ., 1988; li et al ., 2003; mcmartin and o'conner, 1979; tashiro and komiya, 1994) without giving insight into individual axons . It is, for example, important to clarify whether a global reduction in axonal transport reflects reduced transport in individual axons or simply axon loss . Conventional tracking of radiolabeled cargoes or newer approaches using tetanus neurotoxin (millecamps and julien, 2013) do not easily allow this distinction . Video - enhanced imaging provides information on transport rates in individual axons (viancour and kreiter, 1993) but does not easily distinguish between different cargoes . Mitochondrial transport declines in individual peripheral nerve axons between 8 and 24 months of age (gilley et al ., 2012), but how much this is representative of other cargoes and other regions of the nervous system, especially in the cns, remains unknown . In addition, little is known about when during adulthood these changes occur, or whether they can be reversed . Live - imaging studies of axonal transport in nervous system tissue have largely focused on mitochondria (gilley et al ., 2012; mar et al ., 2014; marinkovic et al ., 2012; misgeld et al ., 2007) but whether this is fully representative of other cargoes is unclear . One cargo that appears to be of particular importance is nicotinamide mononucleotide adenylyltransferase 2 (nmnat2), as we propose that a reduced supply of this critical axon - survival factor could place axons at increased risk of degeneration (conforti et al ., 2014). We previously described the use of nmnat2-venus mice to visualize axonal transport of fluorescently tagged nmnat2 (milde et al ., 2013a). Here, we use live imaging of peripheral nerve and cns explants to study age - associated changes in the fast axonal transport of nmnat2 and mitochondria . The data reveal 2 separate periods of declining axonal transport in some parts of the nervous system, 1 period as the growth phase plateaus and the other in old age . Intriguingly, we show that neurons in aged mice are still capable of supporting higher rates of fast axonal transport, suggesting the existence of signals that can reverse the age - related decline in axonal transport . All animal work was approved by the babraham institute animal welfare and experimentation committee and carried out in accordance with the animals (scientific procedures) act, 1986, under project licenses 80/2254 and 70/7620 . The generation, breeding, genotyping, and initial characterization of nmnat2-venus mice expressing nmnat2-yfp(venus) under the neuron - specific thy1.2 promoter was described previously (milde et al ., 2013a). Mitos mice (thy1.2-mitocfp - s) (misgeld et al ., 2007) were kindly provided by prof . Animals were used for transport imaging (see 2.3 below) at indicated ages (see results). We observed no significant difference between transport parameters in male and female animals of the same age for any of the measures used, so data from both sexes was combined for all analyses . All animals were heterozygous for the relevant transgene and c57bl/6jbabr mice (babraham institute) were used for breeding . Animals were kept on a 12:12 hours light: dark cycle at a constant temperature of 19 c in a pathogen - free environment with up to 5 animals per cage . Mice were humanely killed by cervical dislocation followed by exsanguination . For analysis of pns axonal transport, sciatic nerves were dissected rapidly and immersed immediately into pre - warmed (37 c), pre - oxygenated neurobasal - a medium (gibco). For analysis of cns axonal transport, mice were subsequently decapitated and the head immersed in pre - warmed, pre - oxygenated neurobasal - a medium . Optic nerves and the fimbria of the hippocampus were then dissected out and transferred into pre - warmed oxygenated neurobasal - a medium . Optic nerves were removed by transection behind the eye globe and at the rostral limit of the optic chiasm . To remove the fimbria of hippocampus, first the cortex and striatum were dissected out on both sides of the brain, followed by the hippocampus . The fimbria and body of fornix were cleaned of any attached gray matter before imaging . Imaging of axonal transport in tissue explants was performed on an olympus cell imaging system (ix81 microscope, hamamatsu orca er camera, 100 1.45 na apochromat objective). During imaging, tissues were maintained in oxygenated neurobasal - a medium at 37 c in an environment chamber (solent scientific). Images were captured using fixed light intensity and camera exposure time settings at a rate of 2 frames per second for 1.5 to 3 minutes . Five to 10 individual movies (often containing multiple axons) were captured for each tissue explant . To ensure reproducibility between experimental days, 3-month - old animals were imaged on all experimental days along with animals of other ages . Individual axons were straightened (except where indicated) using the straighten plugin in imagej software version 1.44 (rasband, w.s ., imagej, u. s. national institutes of health, bethesda, md; http://imagej.nih.gov/ij/, 19972012). Axonal transport parameters were determined for individual axons using the differencetracker set of imagej plugins (andrews et al ., 2010). The principal output of these plugins is the number of moving particles identified in each frame of the image, normalized to axon length (presented as particle count per second per 100 m axon length) and the average and maximum velocities of the detected moving particles (shown in m / s). It is important to note that the plugin does not track a particle once it has become stationary and thus does not take into account pauses in movement or reversals of direction . These are instead represented as new tracks in the output (see andrews et al ., 2010). Details of analysis parameters are listed in table 2 . On average, 14, 12, and 17 axons were analyzed for each sciatic nerve, optic nerve and fimbria explant, respectively . For nerve crush and regeneration experiments, mitos (n = 4, male) and nmnat2-venus (n = 4, female) animals at 23 months of age were anaesthetized with isoflurane and the distal part of the sciatic nerve was exposed and crushed above knee level by applying firm pressure using fine forceps (dumont #5) for 20 seconds . Four weeks after surgery, recovery of motor function was assessed based on gait, grasp and posture, all of which showed good functionality . Eight weeks after surgery, animals were killed by cervical dislocation, and both tibial nerves were dissected and processed for live imaging as described above . Both tibial nerves were removed into warm, oxygenated neurobasal a medium immediately after the animal had been killed . The order of imaging of control and crushed nerves was alternated between animals to control for the amount of time that nerves were kept in medium before imaging . After live imaging, nerves were processed for semi - thin sectioning (500-nm section thickness), staining, and imaging as described previously (adalbert et al ., 2005; milde et al ., 2013a), to confirm the extent of axon regeneration and to assess the morphology of the regenerated nerve . Statistical analyses were performed using graphpad prism 6 (graphpad software inc) and spss statistics 20 (ibm). Where indicated, age groups were combined to increase statistical power . The critical axon survival factor nmnat2 (gilley and coleman, 2010; gilley et al ., 2013) associates with a golgi - derived axonal transport vesicle population through palmitoylation of a double - cysteine motif in its central isoform - specific targeting and interaction domain (lau et al ., 2010; milde et al ., 2013b) and undergoes fast axonal transport (gilley and coleman, 2010; milde et al ., 2013a). To study the transport parameters of nmnat2 vesicles in aging animals, we used nmnat2-venus mice (milde et al ., 2013a). We assayed axonal transport using fluorescence live imaging of acute tissue explants combined with semi - automated image analysis using the imagej differencetracker plugins with settings shown in table 2 (see methods). Importantly, however, stationary or pausing particles are excluded from the analysis and not quantified (see methods for details). For a thorough characterization of the time course of age - associated changes, we studied 6 groups of animals at ages ranging from 1.5 to 24 months . To investigate age - associated changes of nmnat2 vesicles in peripheral axons, we imaged and quantified the axonal transport of nmnat2-venus particles in sciatic nerve axons (fig 1a). Average (total displacement of a particle / time tracked) and maximal (farthest displacement of each tracked particle between 2 frames) particle velocities in both anterograde and retrograde directions remained stable from 1.5 and 18 months, but then reduced significantly in animals at 24 months of age (fig 1b and c). Surprisingly, the number of particles observed moving anterogradely and retrogradely showed a significant drop even in young animals between the ages of 3 and 6 months . This was followed by a relatively stable plateau that was maintained at least up to 18 months . From 18 to 24 months, another significant reduction in the number of anterogradely moving particles was observed, along with a similar, but statistically nonsignificant trend in the retrograde direction (fig 1d and e). To test whether these changes could have been caused by changes in expression level of the transgene over the lifetime of the animals, which might impair tracking of particles, we quantified the average fluorescence intensity of labeled axons from animals of different ages . As shown in table 3, there were no consistent trends or differences in fluorescence intensity that would explain the observed changes in the number of moving particles . The significant drop in transport rates of nmnat2-venus particles observed from 3 to 6 months of age prompted us to ask whether this was a general effect on multiple fast axonal transport cargoes, or perhaps a more specific effect on nmnat2 vesicles . To start addressing this question, we imaged mitochondrial transport in sciatic nerves of mitos mice expressing mitochondrially targeted cfp under the same thy1.2 promoter (fig 2a). We previously reported a fall in axonal transport in these mice between 8 and 24 months (gilley et al ., 2012), but earlier ages have not been studied . Here, we observed a significant drop in the number of anterogradely and retrogradely transported mitochondria from 3 to 6 months of age, with no further change until at least 12 months (fig 2b and c). Over the same time course, no significant changes in transport velocities, changes in the average fluorescence intensity of labeled axons are unlikely to account for these differences (table 3). These findings parallel the results for nmnat2-venus above and suggest a general reduction in fast axonal transport rates in peripheral nerves between 3 and 6 months of age, followed by a more stable plateau during adult life . Combined with our findings in older mitos mice (gilley et al ., 2012), these results suggest 2 major periods of reduction in the fast axonal transport of several cargoes, 1 occurring in young animals between 3 and 6 months of age, and the other during old age after 18 months . Most of the existing studies that have reported fluorescence live imaging of axonal transport have, presumably at least in part because of technical difficulties, focused on the peripheral nervous system . However, many age - associated neurodegenerative conditions affect the cns (adalbert and coleman, 2013; millecamps and julien, 2013), highlighting the need to understand how aging affects the function of cns neurons, including their axonal transport . Thus, we aimed to use nmnat2-venus mice to investigate age - associated changes in cns axonal transport . In addition to technical advantages (easy accessibility, rapid dissection), degeneration of retinal ganglion cells and their axons, which constitute the optic nerve, contributes critically to pathology in glaucoma (beirowski et al . Bidirectional fast axonal transport of nmnat2-venus particles was readily and reproducibly detectable in optic nerve explants . Individual axons were identified in time - lapse recordings and straightened, and quantification of axonal transport was performed in the same way as for sciatic nerve axons, above (fig 3a). However, the dissection and imaging procedures used here mean that anterograde and retrograde transport were not analyzed separately and, instead, only overall transport rates were measured . Interestingly, we observed an overall similar profile of transport changes from 1.5 to 24 months of age as for sciatic nerve axons . However, the reduction in the number of moving particles at a young age occurred earlier, from 1.5 to 3 months, with a stable plateau from 3 to 18 months and a further significant drop at 24 months of age (fig 3b). Average and maximal transport velocities were more variable overall than for sciatic nerve, but no consistent trends or significant changes were observed (fig 3c). Although the average fluorescence intensity of labeled axons in the optic nerve varied somewhat with age (table 3), there is no decline relative to young mice and no consistent relationship between increases or decreases in label intensity and the number of moving particles detected . Thus, simple changes in expression level are unlikely to account for the observed differences . Instead, these results indicate that, as for sciatic nerve axons above, 2 phases of reductions in axonal transport rates in young and old animals are separated by a stable plateau in adults . To extend our observations to an additional cns region this white matter bundle consists of a large number of parallel axons that can be dissected free from surrounding tissue while maintaining a considerable length of intact axon . Although some optimization of dissection technique and duration was required (fig 4a h and methods), we reproducibly observed a large number of bidirectionally mobile particles undergoing fast axonal transport along the axon tracts in the left and right side fimbria . It is important to note that the bidirectional orientation of axons in this area prevents separate analysis of anterograde and retrograde axonal transport (fig 4i). As in optic and sciatic nerves, axonal transport of nmnat2-venus in the fimbria we observed a significant drop in the number of nmnat2-venus particles undergoing axonal transport from 1.5 to 3 and from 3 to 6 months of age, followed by a stable plateau (fig 4j). Intriguingly, there was no evidence of a second period of decreasing axonal transport rates up to 24 months of age . Instead, the plateau observed in adult animals from 6 months onward appeared to be stable until at least 24 months . Over the complete time course of our analysis, no significant changes in average or maximal transport velocities these findings hint at possible tissue - specific effects of old age on axonal transport rates of nmnat2-venus particles . As for the other tissues investigated, changes in the average fluorescence intensity of labeled axons are unlikely to account for the observed differences in transport (table 3). We also attempted to measure mitochondrial transport in optic nerve and fimbria explants from mitos mice in the same way as for nmnat2-venus . However, a reliable quantification of mitochondrial transport in these tissues was not achieved, as we frequently observed little or no movement with mitochondria that had adopted a rounded - up morphology (data not shown). This could be linked to the known sensitivity of mitochondrial trafficking to calcium influx (wang and schwarz, 2009) and suggests that, for analysis of cns axonal transport in explanted tissue, nmnat2-venus mice could be a more robust model than mitos . Given the above results showing a significant decline in nmnat2-venus transport from 18 to 24 months of age in several parts of the nervous system, together with previous results indicating a similar decline in mitochondrial transport (gilley et al ., 2012), the possibility of reversing this decline could be useful both to study its consequences and for application in age - related disorders . To test whether aged neurons in an old systemic environment can, in principle, support a higher rate of transport given the right signals, we reasoned that a regenerative response could be a way to provide these signals . For this, we performed a crush injury in 1 of the tibial nerves in 23-month - old nmnat2-venus or mitos mice . Peripheral nerve regeneration has been previously been shown to still occur in aged mice, albeit at slower speeds than in young mice (tanaka and webster, 1991; tanaka et al ., 1992), and in younger animals it is known to transiently enhance axonal transport (mar et al ., 2014; in agreement with this, we found that functional recovery was well advanced 4 weeks after injury, as judged based on posture, gait, and grasp . In order to focus the study on longer - term effects of nerve repair rather than any residual, longitudinal axon growth, we allowed animals to survive for several more weeks to study rates of axonal transport in the regenerated nerves at or approaching 8 weeks after the original injury . Semi - thin sections of tibial nerves from the injured leg revealed large numbers of intact myelinated axons, confirming that successful regeneration had taken place, with myelin sheaths and axon calibers still slightly thinner than in uninjured contralateral nerves as expected (fig 5a). Interestingly, these regenerated axons also showed myelin irregularities similar to those observed in the uninjured control axons, suggesting that newly regenerated and remyelinated axons very quickly acquire these structural abnormalities in old animals . Measuring the rates of axonal transport in these axons, we observed a consistent, statistically significant increase in the number of anterogradely moving particles in the regenerated axons in mitos (fig 5b) and nmnat2-venus mice (fig 5d) compared to axons in the contralateral uninjured nerve . The regenerated nerves supported a level of anterograde axonal transport not dissimilar to those in much younger mice (figs 1 and 2). Retrograde transport was not significantly increased in either mitos (fig 5c) or nmnat2-venus mice (fig 5e), although we did observe a statistically nonsignificant trend for increased retrograde transport in regenerated mitos axons (fig 5c). Average or maximum transport velocities were not altered in regenerated axons relative to uninjured control axons (data not shown). These findings suggest that neurons in 24- to 25-month - old mice are still capable of supporting significantly higher levels of axonal transport, indicating that the age - related decline in transport rates described above is at least partially reversible . Interestingly, the structural abnormalities and myelin invaginations we observed in the regenerated axons of mitos and nmnat2-venus mice (fig 5a), suggest that an improvement in the structural appearance of the regenerated axons is not required for this response . Here we report evidence to suggest that 2 independently transported cargoes mitochondria and the axon survival factor nmnat2show a similar pattern of declining axonal transport during aging . An early drop between 1.5 and 6 months of age is followed by a stable plateau during adult life and a significant, tissue - specific reduction in transport rates after 18 months . Importantly, we find that such age - associated changes could be reversible, and that old neurons are still able to support higher rates of transport, similar to those observed in younger animals . There are few existing studies of transport rates of a specific cargo in individual axons of aging animals, but we previously observed a significant decline in the rate of mitochondrial transport in mitos mice from 8 to 24 months of age (gilley et al ., 2012). Although this study starts to shed light on the behavior of an individual organelle, the repertoire of cargoes studied needs to be extended for several reasons . First, mitochondria are most likely not representative for the majority of axonal transport cargoes . Vesicle - mediated and mitochondrial transport use different (albeit partially overlapping) sets of transport motors and adaptors (hirokawa and noda, 2008; hirokawa et al ., 2009), and we have shown that nmnat2 and mitochondria are transported independently of one another in primary culture and in vivo (milde et al ., 2013a, 2013b). This means that impairments in the transport of 1 of these cargoes do not necessarily affect the other . Second, any alteration in the balance between mitochondrial fusion and fission in the axon could affect the perceived rates of mitochondrial axonal transport, especially because smaller mitochondria appear to move more frequently than larger ones (misgeld et al ., 2007). However, such processes would not necessarily affect vesicular axonal transport in the same way . Third, even the energy sources driving vesicular and mitochondrial transport appear to differ from each other, and might thus be affected differently during aging (zala et al ., 2013). Thus, it is difficult to extrapolate findings from mitochondrial to vesicular transport or vice versa, and a range of cargoes need to be studied quantitatively to gain a more complete picture of the change in axonal transport during aging . In addition, many studies on age - associated changes in axonal transport analyze only 2 time - points (young and old, or adult and old). This means that the time course of the decline in axonal transport was not well characterized, and the question largely remains as to whether transport decreases slowly throughout adult life, or whether there are periods of sudden change . Using transgenic animals for live imaging of axonal transport in mice aged 1.5 to 24 months, we observed a pronounced early drop in the rate of nmnat2-venus as well as mitochondrial axonal transport in sciatic nerves . In addition, a similar reduction was observed for nmnat2-venus particles in optic nerves and the fimbria of the hippocampus . Although the precise timing of this change is tissue dependent, it appears to be complete by 6 months of age in all tissues investigated . These findings are consistent with previous studies in which bulk radiolabeling revealed a reduction in the rate of slow axonal transport between 1 and 6 months of age in peripheral and cns axons in rats (mcquarrie et al ., 1989) and from 2 to 7 months of age in rat sciatic nerves (tashiro and komiya, 1994), but the present study reveals how this operates at the level of specific cargoes in individual axons . These early changes could reflect the final stages of growth and development in 1.5- and 3-month - old mice . Even though they are usually considered young adults, mice at this age are still in the late phase of body growth (somerville et al ., 2004). This means that their peripheral axons are still extending, resulting in a higher demand for energy and cell body - derived structural materials that need to be supplied by axonal transport . At 6 months of age, peripheral axons have reached their final length, and axonal transport has settled to a plateau that is maintained until at least 18 months of age . However, given that skull and brain size do not change significantly after about 1 month of age (aggarwal et al . 2010), it is difficult to explain the observed drop in axonal transport rates in the optic nerve and fimbria simply through longitudinal axon growth . Other potential late developmental changes that could account for the observed reduction in transport from 1.5 to 3 or 6 months of age include hormonal changes, a decrease in general locomotor and exploratory activity (elias et al ., 1975; rogers et al ., 2001), or late - phase myelination (agrawal et al ., 2009). The finding that, depending on the precise cargo and tissue, fast axonal transport does not settle down to its adult plateau until 3 to 6 months of age also has important implications for the choice of young control mice in aging studies more generally . Thus, a comparison of axonal transport rates between 3- and 24-month - old mice would not only detect the old - age drop but also include the much earlier reduction in young adulthood . Our study also demonstrates the importance of the analysis of multiple time - points, as the precise pattern of age - associated changes cannot be deduced from 2 or 3 individual age groups . Here, we find an early reduction in transport rates of mitochondria in peripheral nerve axons from 3 to 6 months, followed by a stable plateau until at least 12 months of age . Together with results from a previous study in which mitochondrial transport declined significantly from 8 to 24 months of age (gilley et al ., 2012), these results suggest an overall profile for age - associated changes in mitochondrial transport in peripheral axons that is similar to what we found for nmnat2-venus, with a significant drop in transport rates between 12 and 24 months . Thus, even though the precise timing of the old - age associated drop in mitochondrial transport has not been as precisely defined as for nmnat2, our findings suggest that these 2 cargoes behave in a broadly similar way, indicating that at least some of the underlying mechanisms could be shared as well . Interestingly, the reduction in axonal transport of nmnat2-venus in 24-month - old animals observed in sciatic and optic nerves was not detectable in fimbria . The fact that the earlier drop between 1.5 and 6 months was readily observed in the fimbria suggests that our method was sensitive enough to detect potential changes . Thus, our data support the conclusion that axonal transport rates in some regions of the aging central nervous system might not change significantly until at least 24 months of age . For the optic nerve, previous results indicate a reduction in the extent of dendritic and axonal arborization of mouse retinal ganglion cell axons from 3 to 24 months of age (samuel et al ., 2011). However, in the absence of a more detailed time course of the loss of terminal arborization, it is not possible to draw conclusions about any potential causative relationships between the reduction in the rate of nmnat2-venus axonal transport and the loss of axonal arbor area . It is, however, interesting to speculate that the extent of an axon s terminal arbor could be 1 of the factors driving age - associated changes . If and when axonal arborization declines with age, axonal transport could fall simply to reflect the reduction in the amount of material needed to support a smaller distal arbor, rather than (or perhaps in addition to) a reduced capacity of the axon to support higher levels of axonal transport . With this in mind, the regeneration experiment may have increased the demand for materials to be delivered to the distal axon to support longitudinal and radial growth, with the axon responding accordingly, rather than necessarily reversing a decline in capacity . Overall, our results support the conclusion that, at least in peripheral and optic nerves, axonal transport of the axon survival factor nmnat2 in mice declines substantially at old age, following a previous period of decline at a young adult stage and a relatively stable plateau during adulthood . Given the extensive evidence of impaired axonal transport at early stages in models of neurodegenerative disease (adalbert and coleman, 2013; chevalier - larsen and holzbaur, 2006; de vos et al ., 2008), it will be important to extend the study of age - associated changes in axonal transport rates to human aging and age - associated neurodegenerative disease . Albeit technically challenging, this information is vital, given the longer lifespans and more diverse genetic and environmental factors affecting human aging . One method that has been used to study axonal transport rates in humans is the measurement of kinetic biomarkers in cerebrospinal fluid (csf), which revealed significant impairments in transport rates in parkinson's disease patients compared to control subjects (fanara et al ., 2012), thus further substantiating findings from animal models that suggest impaired transport rates in neurodegenerative disease . Although no age - associated changes were observed in the control subjects in that study, it is possible that the age span used (3660 years) corresponds to the adult plateau observed in our study, and more extensive investigations using this or similar methods on a broader range of ages are needed to elucidate the time - course of axonal transport changes both in healthy aging humans and in the presence of neurodegenerative disease . It is, for example, interesting to speculate that any disruption of axonal delivery caused by age - associated neurodegenerative disease could synergize with age - associated changes and deplete nmnat2 levels below its threshold, contributing to axon degeneration in age - associated neurodegeneration . Importantly, our results also suggest that old neurons in an old systemic environment still have the capacity to sustain higher rates of axonal transport and that appropriate signals can trigger this increase . It will be interesting to determine whether other signals in addition to injury and regeneration can lead to higher rates of axonal transport in old axons . These could include demyelination and remyelination, or the activation of autophagy to promote the clearance of existing axonal structures and the need to deliver new materials into axons . Identifying the signaling pathways, both locally within the axon and within corresponding cell bodies that drive the increase in transport capacity, could highlight more targeted means to trigger these changes and to investigate their effects on axon survival during normal aging and in age - associated neurodegenerative disease.
Resuscitation from hypotensive circulatory shock is often more complex than just giving intravascular fluids . Even in fluid - responsive hypotensive patients, vital organ perfusion may remain compromised despite fluid infusion if the mean arterial pressure (map) does not also increase with increasing cardiac output (co). Garca and colleagues suggested an approach that would predict whether the hypotensive patient would increase their map in response to intravascular fluid loading . There is a tight correlation between positive - pressure ventilation - induced changes in arterial pulse pressure (pp), called pulse pressure variation (ppv), and fluid responsiveness . Ppv is calculated as the ratio of difference between maximum and minimum pp to their mean as assessed over about 5 breaths or 20 seconds . Not surprisingly, subsequent studies showed that similarly calculated stroke volume variation (svv), when measured independently, also predicted volume responsiveness . Importantly, pp is created by stroke volume (sv) into the central arterial compartment as quantified by a transfer function . If arterial elastance (ea) and compliance remain constant, then aortic pp will vary directly with sv . If the bedside physician wants to know whether their hypotensive patient will increase their map in response to fluid loading, then they need to know two things . First, is the patient volume responsive? If the patient is not responsive, then volume loading will not increase co. second, the physician needs to know the patient's vasomotor tone . If the patient has marked vasodilation, as commonly occurs in septic shock, then map may not increase in response to fluid loading even if co does . To know whether a fluid - responsive patient is also pressure responsive the reciprocal of compliance is ea, which defines the pp / sv relation . Increasing vasomotor tone increases both map and pp relative to co and sv . If one knew both ppv and svv, their ratio would define a dynamic ea (eadyn). Theoretically, map and pp should co - vary with changes in co if the heart rate remains constant . We previously predicted that ppv / svv> 0.8 would define pressure - responsive subjects if co increased . Relative to this construct, garca and colleagues examined the ability of the ppv / svv ratio, deferred to as eadyn, to predict changes in map in 25 hypotensive patients with preserved volume responsiveness (defined as map <65 mmhg or systolic blood pressure <90 mmhg and svv> 10%). Using a standard 500 ml colloid fluid bolus, the authors defined map responders as those with a> 15% increase in map . They found that a baseline eadyn value> 0.89 predicted> 15% map increase after fluid administration with a sensitivity of 94% (95% confidence interval = 69.8 to 99.8%) and a specificity of 100% (95% confidence interval = 66.4 to 100%). Their clinically derived eadyn threshold of> 0.89 is remarkable similar to our> 0.8 value based on vascular modeling . Importantly, as long as the ppv and svv values are great enough to define a slope, this relationship will remain constant and predictive even during spontaneous ventilation and with cardiac arrhythmias because eadyn is independent of volume responsiveness . Since all of the commercially available arterial pressure - derived co monitoring devices report ppv and svv, this added eadyn parameter to define those patients needing vasopressors earlier in their management should have a significant impact on resuscitation efficacy . Before embracing this approach and these findings totally, caution needs to be used in its routine bedside application . Eadyn is a measure of arterial stiffness, which is itself partially determined by vasomotor tone . Ea increases with age, with the expression of atherosclerosis and with aortic cross - clamping during aortic vascular procedures . For all these conditions, however, if sv increases then pp will also increase . Regrettably, map may not increase as much as pp because diastolic pressure may remain constant . Furthermore, pp can be independently increased by increasing left ventricular ejection velocity . To the extent that inotropic agents are being used, one may presume an increase in map not realized by increasing co even if eadyn> 0.89 . The above study, how - ever, used an arterial pulse contour estimating method to derive co and svv, and herein rests a potential problem . Much attention has focused on using arterial pulse contour analysis devices at the bedside to measure co and svv from the arterial pulse . Unfortunately, most indwelling arterial catheters sample a more peripheral arterial pressure signal, whose waveform may be altered in unexpected ways as the arterial tone, pulse wave velocity and left ventricular contractility vary . Although this variability in co estimates can be readily improved by calibration, it will not improve the accuracy of the ppv / svv relation (that is, eadyn). The eadyn accuracy is intrinsic to the assumptions used by each device to estimate svv . This is because ppv can be measured directly and is accurate when compared with ppv measured manually . All arterial pressure - sensing devices that estimate co do so by assuming a constant ea . How, then, is it possible for an algorithm that uses arterial pressure to calculate co to show differing changes in pp relative to sv over time? The three major commercially available monitoring devices, however, do not share the same shoe size - the variance amongst these devices to estimate changing co is significant . The flotracdevice estimates svv from the standard deviation of the individual arterial pressure values over single beats averaged over 20 seconds . Assuming the sv variance has a normal distribution, this assumption is valid for calculating svv . Importantly, svv as a time - series function may not be normally distributed during atrial fibrillation and with vigorous spontaneous inspiratory efforts . How much error such non - normal distribution would introduce into the svv calculation is not known, but on theoretical modeling the degree of non - normal distribution would need to be great for it to affect svv by the standard deviation method . The picco uses a proprietary algorithm based on the ventriculo - arterial coupling transfer function to calculate co. this co estimate is averaged over 20 to 30 seconds and is quite accurate . However, since the picco no longer reports individual sv values on a beat - to - beat basis, it is unclear how it derives svv . The lidco uses a simple power transfer function to estimate sv on a beat - to - beat basis and calculates co from the mean sv values . To the extent that this power transfer function is accurate over time, the svv estimates should also be accurate . Since this device does not use the pulse contour, the lidco remains accurate with dampened arterial pressure signals . Accordingly, although each device reports ppv and svv values, the cross - correlation amongst devices based on their different algorithms is poor . Validation of eadyn thus needs to be done independently both for each device and for different types of patients before this new bedside parameter is used for clinical decision - making . Co: cardiac output; ea: arterial elastance; eadyn: dynamic arterial elastance; map: mean arterial pressure; pp: pulse pressure; ppv: pulse pressure variation; sv: stroke volume; svv: stroke volume variation.
Developments in healthcare are immense . The possibilities to treat patients with severe illnesses are growing as is the body of medical knowledge, pharmaceutical treatments and advanced technologies . The size and complexity of healthcare the 19th century hospitals knew only two different health care professions: medicine and nursing . Nowadays more than 600 different health care professionals work in hospitals, including a variety of therapists, technicians, economists, social workers and even clowns . The impact of the increasing possibilities of healthcare, social developments and developments in the health professions have created many roles, leading to new professions . The scope of healthcare being too broad for one profession to have an overall view, there is a need for extensive specialization not only in medicine and nursing, but also for therapists and technicians . And with the realization of vertical function differentiation the need for collaboration increases . Collaboration is essential to cover all the healthcare needs of patients and to ensure alignment of care and unambiguous information to patients . In order to achieve that coordination and responsibilities have to be clear and this means that professionals should be aware of the contribution to the healthcare process of all the different professionals involved it is hard to obtain a good overview of the work of different groups of professionals . Moreover collaboration has been shown to be complicated and working in a team is by no means easy . Traditionally healthcare workers belong to their own professional groups, each with its own culture and its own standards and values . Multiprofessional education (mpe) or multidisciplinary training (mdt) seems a logical step to stimulate teamwork . The potential benefits are the fostering of team spirit, mutual understanding and respect, and improved communication . Communication problems are one of the main causes of errors in healthcare . But despite incentives from the government to stimulate mpe, successful implementation remains difficult to achieve . Influenced by the national patient safety programmes, mdt, and crew resource management in particular, is gaining in popularity, although so far it seems to be restricted to acute care settings . The world health organization (who) defines mpe as the process by which a group of students (or workers) in health related fields and with different educational backgrounds are learning together during certain periods of their education . Interaction is considered important to achieve collaboration in promoting health, preventing and curing disease, rehabilitation and other health - related services . The chance of students socializing unilaterally in their specific domain of health care is becoming smaller . The last decade has seen the introduction of mpe programmes, aimed at introducing students to the skills and expertise of other professions during their training in order to foster a more cooperative and collaborative approach to healthcare . The term multiprofessional is used to denote cooperation of health professionals from three or more different health professions . Mdt is used in education and training in different professional disciplines which have a subject in common, which they all approach from their own professional perspective . The aim is to stimulate collaboration, including communication, situational awareness, problem solving, decision making and teamwork . The mdt approach is characterized by each discipline within the team working towards its own discipline - related goals . Team members work within the boundaries of their professional practice: progress is formally discussed at team meetings, and effective communication is considered vital . Collaboration is a dynamic interprofessional process in which two or more health professional make a commitment to interact authentically and constructively to solve problems and to learn from each other in order to accomplish identified goals, purposes or outcomes . Successful collaborative practices are those in which patients easily move back and forth between providers and situation dictates . Collaboration is widely regarded as useful and desirable . Nevertheless, it is hard to attain . Team members see themselves as representatives of their own discipline rather than as members of a collaborative team . There is rivalry between professional groups, such as different medical specialties, particularly when resources are limited . Who is the lead clinician and who gets the credit? . The paternalistic approach of cure - oriented health professionals versus the approach of public health and social advocates are examples . The traditional power relations between professions in health care professions and occupations cannot be understood simply in terms of the current balance of social relations . Account should also be taken of structures and practices that have their roots in past patterns of social relations . The image of nursing has its roots in the victorian age, the period of florence nightingale . Nurses were expected to lovingly and humbly devote themselves to the health and well - being of others, without any thoughts of professional autonomy . In hospitals nurses today physicians were exclusively male and nurses were female . Medicine has often been seen as a leading example of how an occupation can raise itself . The contemporary position of medicine as a profession is still one of the most powerful ones of all occupations . Although nursing has experienced a radical transformation due to higher levels of education, emancipation, independent practice and new roles like that of nurse practitioner, some nurses still have a low self image . And low self image has a damaging influence on the image of the profession . Despite the existence of many successful nurse physician collaborative practices, tradition and stereotypes often have a powerful impact on successful collaboration in groups . Social identity theory is a diffuse but interrelated group of social psychological theories concerned with when and why individuals identify with, and behave as part of, social groups, adopting shared attitudes to outsiders . It is also concerned with what difference it makes when encounters between individuals are perceived as encounters between group members . Social identity theory is thus concerned with both the psychological and sociological aspects of group behaviour . In sociology, a group is usually defined as a collection of humans who share certain characteristics, interact with one another, accept expectations and obligations as group members and share a common identity . People derive their social identity from the group to which they belong . Who am i and who am i in relation to others? People aspire to a positive social identity, which is based on a favourable result of comparisons between the group to which one belongs and other related groups . . An individual can try to become a member of another social group with a higher status . In that case, the status of the original group does not change . Groups can try to change their status as well . A group can seek competition with another group by showing the irrationality of the differences between them . Collaboration and the formation of a new team can be favourable for professionals with a low image, but unfavourable for professionals of high status . The latter will stay with their group and be reluctant to accept new members from a different background . Confusion about the scope of practice of other disciplines can be one of the consequences . There are, however, numerous incentives for nurses, physicians and other health professionals to collaborate . Several studies have demonstrated improved patient outcomes (lower mortality rates, reduced length of stay) with collaborative practice . Failure to communicate and to collaborate affects patients and clinicians job satisfaction . In addition failure to collaborate may contribute to inefficiencies in the delivery of health care . But despite the obvious advantages of collaboration, social identity seems to be an insurmountable barrier to successful collaboration . In the netherlands there are a few examples of mpe, although they do not fully meet the who definition . At the university medical center in groningen, students in dental medicine and students in oral hygiene collaborate throughout their education, especially during skills training . The educational concept that is used in this example of mpe is patient oriented and problem based learning . Another example has been realized at the university of applied sciences of arnhem and nijmegen . Students of eight different healthcare programmes are offered the same study programme in communication and collaboration skills . An example of mdt is multidisciplinary team training (crew resource management) which is provided at the university medical center groningen . Some disciplines describe patient problems as problems in functioning, while other disciplines describe them as diseases or self - care problems . An inherent contradiction is that interprofessional education, if done well, implies problem - based learning and other innovative approaches, and these are expensive . Teachers are not motivated to invest in mpe, because they have other priorities and they are not optimistic about the effects . Most teachers have a background in healthcare and know how difficult the practice of health care can be ., sessions often have to be cancelled due to the absence of some team members who have unexpected obligations in patient care . Another problem of mpe is that students appear to be not really interested in the information for other disciplines . They have a low regard for interprofessional activities, which they consider diversions from their real professional preparation . Medical students attend nursing courses in their first year, as part of the development of their professional attitude . During the course some professionals want to protect their knowledge and are unwilling to share it with other disciplines . As a result they are not prepared to accept students from other disciplines . Problems with social identity are not only a barrier to collaboration; they are equally a barrier to improvement of collaboration through mpe and mdt . Collaboration and mpe and mdt are also hindered by the fact that they are optional . Despite evidence that collaboration leads to better patient outcomes and mpe leads to better collaboration, mpe is still not obligatory,,,, . Although collaboration is crucial in today s complex healthcare system, it is very difficult to achieve . Professionals are afraid to lose their status when they collaborate with professionals of lower status . Mpe and mdt can stimulate collaboration, but are hampered by the same problems of social identity . This purpose is quality of care and tangible patient outcomes, such as lower mortality rates . Not the professional group but the team should become the social group from which professionals derive their status . Every contribution to further this goal is welcome . Roodbol, phd, is head wenckebach institute, university medical center groningen, the netherlands; lecturer of nursing hanze university of applied science groningen, the netherlands.
Th17 differentiation conditions are often used to simulate a chronic inflammatory situation in vitro with the aim to unravel the underlying mechanism of related autoimmune diseases like multiple sclerosis, rheumatoid arthritis, or psoriasis (reviewed in). Therefore, the analysis of the orchestration of t helper (th) cell subtypes generated under these conditions is essential not only for understanding the process of disease development but also for the establishment of therapeutic approaches . By now, il-17a, ifn-, il-9, and il-22 producing t cells have been described to be generated under th17 polarizing conditions [2, 3]. Nevertheless, the percentage of il-17a or il-9 cells generated under th17 polarizing conditions is very low ranging from 2 to 20% [3, 4] and the nature of other cd4 t cell subsets coming up under these conditions has not been further elucidated . An important role in inflammation is attributed to il-8 (cxcl8), a pleiotropic chemokine with a high neutrophil - attracting capacity (reviewed in). However, as il-8 is not a typical t helper cytokine, it has not been investigated intensively in t cell differentiation assays . In models of autoimmune diseases such as experimental autoimmune encephalomyelitis (eae) it became evident that the aryl hydrocarbon receptor (ahr) plays an important role in regulation of the immune response [6, 7]. Ahr activation by its ligand 2,3,7,8-tetrachlorodibenzo - p - dioxin (tcdd) induced functional treg, whereas ahr activation by 6-formylindolo[3,2-b]carbazole (ficz) boosted th17 cell differentiation and increased the severity of eae in mice . In humans tcdd and ficz have been shown to enhance il-22 while simultaneously decreasing il-17a production by cd4 t cells [8, 9]. However, the effect of ahr ligands on cd4 t cells producing il-8 and il-9 known to also be involved in inflammation has not been analyzed yet . In addition, the effect of the ahr ligand benzo[a]pyrene (b[a]p), a component of cigarette smoke, on cd4 t cells is still unknown . Furthermore, the involvement of mir-326, which is positively correlated with il-17a expression of human cd4 t cells, is not yet elucidated in ahr - mediated immune regulation and may offer new aspects in this process . Thus, in the present study we aimed to investigate changes at cellular, protein, as well as mrna and microrna level in cd4 t cells challenged with ahr ligands (tcdd, ficz, and b[a]p) under th17 polarizing conditions (tgf-, il-1, and il-23). We observed that th17 polarizing conditions and ahr ligands not only affect il-17a production but mainly influence the generation of il-8 and il-9 producing cd4 t cells . In addition, we show here that the ahr ligand ficz influences the expression of mir-326 in a time - dependent manner, which might lead to an altered il-17a production in human cd4 t cells . Buffy coats were obtained from healthy human donors (institute of transfusion medicine, university of leipzig, germany) with fully informed written consent, conducted in accordance with the declaration of helsinki and approved by the ethics committee of the university of leipzig (272 - 12 - 13082012). Peripheral blood mononuclear cells (pbmc) were purified by ficoll density gradient centrifugation (ficoll paque plus, ge healthcare europe gmbh, freiburg, germany) and cd4 t helper cells (purity> 96%) were isolated by negative selection using cd4 t cell isolation kit ii (miltenyi biotec, bergisch gladbach, germany). Cd4 t cells were cultured in imdm + glutamax supplemented with 10% knockout serum replacement (both invitrogen, life technologies, carlsbad, ca, usa) and 5 10 m -mercaptoethanol (merck, darmstadt, germany) at 37c in 5% co2 humidified air . The cells were stimulated with plate bound anti - cd3 (1.5 g / ml; ucht1) and soluble anti - cd28 antibodies (1 g / ml; cd28.2; both bd bioscience, heidelberg, germany) and for th17 polarizing conditions recombinant human proteins (tgf-1 (0.5 ng / ml), il-23 (10 ng / ml, both r&d systems, minneapolis, mn, usa); il-1 (10 ng / ml, ebioscience, frankfurt, germany)) were added . Cd4 t cells were cultured in the presence or absence of the ahr - ligands 6-formylindolo[3,2-b]carbazole (ficz, 100 nm, enzo life sciences, lrrach, germany), 2,3,7,8-tetrachlorodibenzo - p - dioxin (tcdd, 5 nm, lgc standards gmbh, wesel, germany), or benzo-[a]-pyrene (b[a]p, 100 nm, sigma aldrich, st . Supernatants were harvested every day in a 5-day culture period and stored at 80c for further cytokine measurement . Cultured cells were harvested at indicated time points for extracellular and intracellular staining and flow cytometry as well as for protein and total rna isolation . For intracellular cytokine staining cultured cells were restimulated with pma (50 ng / ml, sigma aldrich) and ionomycin (1 g / ml, invitrogen, life technologies) in the presence of monensin (2.5 mm, sigma aldrich) for 5 h. to measure the cell viability (> 80%) the cells were stained with annexin - v fitc and 7-aad according to the manufacturer's protocol (bd bioscience). The cells were fixed with 4% paraformaldehyde and permeabilized with 0.1% saponin - containing buffer before washing and staining in different combinations with anti - cd4 (beckman coulter, krefeld, germany), anti - il-17a, anti - il-22, anti - il-9, anti - il-8, anti - ahr, anti - rort (ebioscience), and anti - ifn- (bd bioscience). Data were acquired on facscantoii (bd bioscience) and were analyzed with flowjo software (tree star inc ., culture supernatants were analyzed for il-17a, il-9, il-8, and ifn- by flow cytometry using bd cba human soluble flex set system (bd bioscience) according to the manufacturer's instructions and as described previously . In brief, cytokine specific antibody coated beads were incubated for 1 hour with 25 l of supernatants or standard solution . Analysis of data and quantification of cytokines was performed using the fcap array software (bd bioscience) on the basis of corresponding standard curves . Il-22 concentrations were measured by elisa using the human il-22 elisa ready - set - go!-kit (ebioscience) according to the manufacturer's instructions . Total protein of cultured cells was isolated with peqgold trifast (peqlab, erlangen, germany) according to the manufacturer's protocol . Protein concentrations were measured using dc protein assay according to the manufacturer's instructions (bio - rad laboratories munich, germany). Proteins (510 g) were separated under denaturing conditions on 412% nupage bis - tris gradient gels (invitrogen, life technologies) and transferred onto nitrocellulose membranes (bio - rad laboratories). After blocking with ecl prime blocking reagent (ge healthcare europe gmbh), proteins were detected using anti - ahr (ab 2770, rtp1, abcam, cambridge, uk) and anti--actin (a2228, ac-74, sigma - aldrich) as well as horseradish peroxidase - conjugated secondary anti - mouse igg - specific antibody (bio - rad laboratories). Bands corresponding to the proteins of interest were visualized with ecl select western blotting detection kit (ge healthcare europe gmbh) and fluorchem 8900 imager (alpha innotec, kasendorf, germany) and quantified with imagej (nih, bethesda, md, usa; rsbweb.nih.gov). Total rna was isolated with peqgold trifast and transcribed into cdna with improm - ii - reverse transcriptase according the manufacturer's instructions (promega, mannheim, germany). The biomark hd system with 96.96 dynamic array integrated fluidic circuit (ifc; fluidigm, san francisco, ca, usa) was used for real - time pcr . Primers were predesigned by universal probelibrary assay design center (roche applied science, mannheim, germany) and purchased from biotez (berlin buch gmbh, berlin, germany). The preamplification pcr was performed on the lightcycler 480 system (roche diagnostics gmbh, mannheim, germany). Thermal cycling and detection of the reaction products were performed with the biomark hd system (fluidigm). The data was analyzed with the biomark gene expression data analysis software and the ct - method . The data is presented as relative expression to the mean of -d - glucoronidase (gusb), peptidylprolyl - isomerase - a (ppia), and phosphoglycerate - kinase1 (pgk1) reference gene expression and to the expression at day 0 . For microrna (mirna) expression 100 ng total rna was reverse - transcribed into cdna using the mircury lna universal rt kit according to the manufacturer's instructions (exiqon a / s, vedbaek, denmark). The mirna expression was detected by real - time pcr using the mircury lna universal rt microrna pcr lna pcr primer set hsa - mir-326 and the reference gene pcr primer set snord44 (hsa) (exiqon a / s). All results are presented as relative expression to snord44 reference gene expression and the mirna expression at day 0 . Statistical significance was calculated with unpaired student's t - test (statistica for windows version 10, [statsoft inc . (europe), hamburg, germany]) after log - transformation or with mann - whitney - u test of the original data . For th17 polarizing conditions the cytokines tgf-, il-1, and il-23 were added to anti - cd3/anti - cd28 stimulated human cd4 t cells . After five days of culture cytokine protein expression cd4 t cells activated by anti - cd3 and anti - cd28 without additional cytokines were used as control . Compared to the control the th17 polarizing conditions induced, besides il-17a (from 2.73% 0.5 to 7.71% 0.49) and il-9 producing cd4 t cells (from 0.54% 0.89 to 5.67% 1.17), a high number of il-8 producing cd4 t cells (from 10.13% 1.72 to 20.32% 2.43) (figures 1(a) and 1(b)). In contrast to this, the amount of il-22 producing cells was reduced in th17 polarized cells (from 1.95% 0.26 to 0.49% 0.1). The amount of ifn- producing t cells was not affected by th17 polarizing conditions . With reference to the large amount of il-8 t cells generated under th17 polarizing conditions (approx . 20% of all cd4 t cells), a high proportion of these cells produced il-8 only . As it was observed in cultures with single cytokine application the complete th17 polarizing conditions were necessary for the enhancement of il-8 expression in cd4 t cells (figure 2). The measurement of the cytokine concentration in the cell culture supernatant confirmed these results regarding il-17a, il-9, and il-8 induction under th17 polarizing conditions (figure 3). Also the secretion of il-22 was reduced compared to control after five days of culture . It is noteworthy that il-8 was produced in higher amounts at early time points (approximately 10 pg / ml) compared to il-17a or il-9 that were hardly detectable until day three (figure 3, table 2). Ifn- secretion was induced by th17 polarizing cytokines until day 4, but no differences between control and th17 polarizing conditions were detectable after five days of culture . The mrna expression of these cytokines as well as of il-21 and il-23r, known to be involved in th17 polarization, was also regulated by these culture conditions (figure 4(a)). Furthermore, the mrna expression of transcription factors, known to be important for th17 cell function, for example, rorc and stat3 (reviewed in), was upregulated 10- and 2-fold, respectively (figures 4(b) and 4(c)). The aryl hydrocarbon receptor (ahr) has made its entry into immunology research as a mediator between environment and immune system (reviewed in). We aimed to determine the expression of the ahr in human t helper cells and focused on the influence of different ahr ligands (ficz, tcdd and b[a]p) on the cytokine expression under th17 polarizing conditions . We showed that the ahr mrna expression was 3-fold upregulated under th17 polarizing conditions compared to control (figure 5(a)). In western blot analysis the ahr protein was hardly detectable until day five of t cell culture and at this time point th17 polarized cells showed a higher ahr protein expression compared to control (figure 5(b)). Furthermore, the expression of ahr target genes (cyp1a1, cyp1b1, and tiparp) was induced after stimulation with the ahr ligands ficz, tcdd, and b[a]p (figure 5(d)). To investigate the impact of the ahr ligands on the cytokine expression of human cd4 t cells, intracellular as well as the ahr ligands ficz, tcdd, and b[a]p caused a significant change in the number of cytokine producing cd4 t cells stimulated with anti - cd3/anti - cd28 and th17 polarizing conditions (figure 6(a)). Both ficz and tcdd significantly decreased the amount of il-17a t cells by approximately 50%, whereas tcdd also halved the amount of il-9 t cells . Tcdd and b[a]p doubled the proportion of il-22 t cells . Regarding the secreted cytokines, ficz and tcdd significantly increased the concentration of il-8 and il-22 at day five of culture compared to control (figure 6(b)). The concentration of il-9, strongly induced by th17 polarizing conditions, was decreased by 50% in ficz and tcdd treated cell cultures (figure 6(b)). The expression of the th1 cytokine ifn- was not affected by the ahr ligands (figure 6(b) and table 2). The modification of cytokine secretion occurred in an ahr ligand dependent manner: ficz and tcdd showed similar results, whereas the addition of b[a]p had no effect . At the protein level, the ahr ligands tcdd and ficz changed the pattern of the analyzed cytokines under th17 polarizing conditions . The il-9 mrna expression was significantly decreased by ficz, tcdd, and b[a]p under th17 polarizing conditions (figure 6(c)). These results at least partly confirm the altered cytokine production measured by intracellular staining (figure 6(a)) and in cell culture supernatant (figure 6(b)). Furthermore rorc is a th17 specific transcription factor that is essential for il-17a expression (reviewed in). However, a change in il-17a mrna expression was not visible at that time point (figure 6(c)). In trend also il-8 mrna expression was upregulated by ficz and tcdd compared to control . The expression of the transcription factor stat3 was not affected by ahr ligands (data not shown). The reduction of il-17a expression by ficz and tcdd was observed only on protein but not on mrna level . To conclude, we aimed to investigate whether factors like mirnas play a role in this finding . The expression of the th17 associated microrna mir-326 was determined by real - time pcr after 1, 3, and 5 days of culture . Unexpectedly, th17 polarizing conditions did not have any effect on the mir-326 expression at these time points (figure 7(a)). Regarding the ahr ligands, ficz significantly downregulated mir-326 expression under th17 polarizing conditions at day three of culture (figure 7(b)). Thus, likewise to the protein and mrna expression in human cd4 t cells the expression of the th17 cell related microrna mir-326 was influenced in an ahr ligand dependent manner . The discovery of th17 cells has been followed by the realization that t helper cells can produce various other cytokines alone or in combination in patterns not fitting the preconceived definition of th1/th2 or th17 subsets . These findings had led to the description of additional t helper cell lineages, including th22 and th9 . In our study th17 polarizing conditions promoted, besides the known il-17a, ifn- and il-9 producing t helper cells, a distinct cd4 t cell population that produces il-8 (cxcl8). This cell population mainly expressed il-8 and coexpressed il-17a, il-9, and ifn- only to a small extent (figure 1(a)). With measuring the cytokine concentrations in cell culture supernatants it was obvious that il-8 was strongly induced by th17 polarizing conditions at the beginning of the t cell culture, whereas the production of cytokines known to be enhanced by th17 polarizing conditions like il-17a and il-9 was not detectable until day three . These findings indicate that the used th17 polarizing conditions first activate an il-8 producing t helper cell population . Il-8 is not a typical t helper cell cytokine and by now only two publications have reported il-8 production in these cells [15, 16]. Schaerli and colleagues reported that approximately 2.5% of cd4 t cells in normal peripheral blood also produce il-8 . They could show that in neutrophils treated with conditioned medium from il-8 t cells, apoptosis was reduced by 40% . In lesional skin, il-8 t helper cells consistently expressed the chemokine receptor ccr6 suggesting that il-8 producing t cells facilitate skin inflammation by orchestrating neutrophilic infiltration and ensuring neutrophil survival . Recently, pelletier and colleagues demonstrated that some th17 t cell clones also produce il-8, indicating that the chemotactic effect of th17 cell supernatants on neutrophils can be mainly attributed to il-8 . In our study the single il-8 producing as well as the double il-8/il-17a cd4 t cell population increased significantly after culturing with th17 polarizing conditions . However, the proportion of il-8/il-17a producing cells was very low (1.83% 0.78) compared to il-8/il-17a (19.12% 5.07) cd4 t cells . Thus, the question arises whether il-8 producing t cells generated under th17 polarizing conditions represent a new effector t cell population or whether it is only a bystander population . Although the presence of low frequencies of il-8 producing cd4 t cells in the peripheral blood of healthy individuals has been reported years ago a further characterization and chase of these cells has been neglected the following years . The main reason for not paying attention to this cell population and that they remained undiscovered when performing th17 polarization may lie in the fact that most th17 experiments are conducted in mice where il-8 producing t cells do not exist . Besides il-17a producing cells also a high proportion of il-9 producing cells were generated under th17 polarizing conditions . Il-9 t cells act proinflammatory and are involved in immune mediated diseases ranging from autoimmunity to asthma (reviewed in). Il-17a and il-9 producing cells have already been placed into central focus of immune therapeutic strategies by the usage of blocking antibodies against the core cytokines of these cells [18, 19]. Certainly, the usage of single antibody treatments does not satisfactorily downregulate inflammatory immune responses . Considering our results that under th17 polarizing conditions, besides il-17a and il-9 cells, also a substantial proportion of il-8 producing t cells was generated, it is necessary to also include this cytokine into a therapeutic approach . As a potent modulator of t cell differentiation the aryl hydrocarbon receptor (ahr) has made its entry into immunology (reviewed in [14, 20]). Ficz and tcdd curtailed il-17a, il-9, and il-8 producing t cells, whereas the number of il-22 producers was enhanced at day five . Cytokine levels in cell culture supernatants stimulated with these ligands partially mirrored the results on cellular level (figures 6(a) and 6(b)). The finding that the differentiation of il-17a and il-22 t cells is influenced by ahr ligands is in line with previously published data . Ramirez and colleagues demonstrated that tcdd and ficz reduced il-17a and enhanced il-22 production by cd4 t cells under th17 differentiation conditions . Il-22 plays a pivotal role in regulating host defense and inflammation (reviewed in) and thereby upregulation of il-22 production was seen in several human diseases like psoriasis [22, 23], atopic dermatitis, and crohn's disease . Therefore, ahr activation by environmental and endogenous derived ligands may play a role in the induction and process of several inflammatory diseases . New in our findings is that under these conditions also the production of il-8 and il-9 is regulated by tcdd and ficz . We found that both ahr ligands reduced the concentration of il-9, which is strongly induced by th17 polarizing conditions, but enhanced the production of il-8 in the supernatant . Thus, ficz and tcdd seem to reverse the effects induced by th17 polarizing conditions except il-8 . Other research groups investigated the impact of ahr ligands on the il-8 expression in human epidermal keratinocytes (hek) [26, 27]. Bap was shown to induce il-8 production in hek cells, whereas ficz alone was not able to trigger il-8 production in these cells . However, in this publication ficz synergizes the effect of resveratrol enhancing il-8 production in hek cells . Differences to our data might be explained by the different cell types used as well as by different experimental settings . In our approach cells were not starved and il-8 measurements were performed at day 5 (compared to 24 hours) and different ficz concentrations (100 nm versus 1 m) were used . Furthermore, in contrast to keratinocytes our cd4 t cells were cultured under activation conditions . The th17 polarizing conditions and the ahr ligands modulated the expression of a variety of cytokines, known to be regulated by different transcription factors and signaling pathways . Recently, also the ahr pathway was found to be associated with the expression profile of immune relevant micrornas . Therefore, we aimed to investigate if the expression of mir-326 is modulated by th17 polarizing conditions and ahr ligands . Mir-326 plays a role in multiple sclerosis models, influencing the il-17a expression [11, 29]. However, our data reveal that changes at microrna level were independent of differentiation conditions . In our study, the addition of the ahr ligand ficz significantly downregulated mir-326 expression in cd4 t cells . Therefore, the inhibitory effect of ficz on the il-17a expression might be elicited due to modulation of mir-326 expression . It has been reported that a large fraction of protein - coding genes are under microrna control and that the amount and the time of microrna expression are crucial for cell homeostasis or disease development . In contrast to ficz, tcdd and b[a]p showed no effect on the mir-326 expression contrary to the fact that ahr ligands activate the receptor in a similar manner, they cause different effects on the t cell's cytokine, mrna, and mirna expression . Possibly, one explanation is the specific binding affinity of the different ligands to the ahr . The tryptophan derivative ficz shows an almost ten times higher affinity to the ahr than the prototype ligand tcdd, whereas the affinity of the polycyclic aromatic hydrocarbon b[a]p to the ahr is significantly lower compared to ficz and tcdd (reviewed in). Another distinguishing feature could be the specific metabolism of the ligands . In this regard, ficz is degraded very fast after ahr binding, whereas tcdd is hardly metabolized and rather accumulates in the body with a half - life of approximately three years leading to a chronic activation of the ahr . Nevertheless, ficz and tcdd show a different affinity and metabolism; both ahr ligands modulate the cytokine expression of human t helper cells in a similar way . Like ficz, the ahr ligand b[a]p is also degraded rapidly in an ahr dependent manner . In this study, b[a]p showed only modest effects on the cytokine expression of human t helper cells . Furthermore, the induction of the ahr target genes cyp1a1 and cyp1b1 was lower in b[a]p treated t cells compared to ficz and tcdd, which indicates a generally weaker ahr activation by b[a]p in human t cells . Therefore, it can be assumed that the impact of the ahr ligands on the cytokine expression of human t helper cells might be dependent on the ligand affinity as well as the strength and duration of ahr activation . In summary, our data reveal that under th17 polarizing conditions an il-8/il-17a / il-9/il-22 t helper cell subtype is generated . The proportion of il-8 producing cd4 t cells was higher than that of other t cell subtypes suggesting a major physiological role of these cells especially under th17 polarizing conditions . Thus, it will be of great interest to further examine this t cell subtype . Both, il-8 and il-9 production were affected by the ahr ligands ficz and tcdd which encourages the opinion of an existing physiological role of the ahr on the human immune system . Moreover, we could show that mir-326 expression was moderately affected by the ahr ligand ficz . This result shows that besides the classical ahr signalling pathway also the modulation of mirna expression is potentially involved in the ahr molecular network in human cd4 t cells.
Cutaneous leishmaniasis (cl) is known as an endemic disease in iran and according to who, annually reports, nearly 20000 new cases occur per year in this country . Moreover, some researchers believe that it may be underestimating, and the actual rate is more than this (1, 2). Leishmania major and l. tropica are the main cause of zoonotic cl (zcl) and anthroponotic cl (acl) in iran, respectively (3). Cl is reported in 17 out of 31 provinces of iran and sistan and baluchestan is one of the important endemic foci of acl and zcl . In recent years, 3 cutaneous leishmainasis foci chabahar, konarak, and mirjaveh were identified in sistan and baluchistan province and cl cases reported progressively from these areas (4). Moreover, an outbreak of cl happened in mirjaveh city for the first time in 1996 and this province is considered as a third focus of zcl (5). Differentiation of species is critical, because preventing and controlling methods, clinical course, prognosis and choice of treatment are different from species . Because of the morphological similarities, microscopic examinations are not capable to differentiate the species . This method requires an abundant number of parasites, is not cost effecting and is time - consuming (6). Considering wide clinical spectrum of cl, conventional diagnostic methods such as morphological and parasitical methods are not appropriate methods anymore . In recent years application of high tech molecular methods, such as pcr- rflp, rapd - pcr, nested - pcr and real time pcr are increasing sharply because of their high specificity and sensitivity in detection and identification (7, 8). Its, gp63, miniexon, kinetoplastic dna and hsps are the available genetic targets for molecular diagnosis of leishmania species (9). Hsps constitute a large family of proteins that are often categorized based on their molecular weight: hsp10, hsp40, hsp60, hsp70, hsp90, etc . Genes are sensitive enough for differentiation of leishmania species . Because of the encoding for a major antigen, allow probing of the genetic variability of molecules and lower rate of genetic variation hsp70 genes are more priority than others (11). For future multigenic pcr - oriented approaches as well as studies involving direct populations, sistan and baluchestan is one of the endemic areas for cl but the species of leishmania were identified . Therefore, the aim of present study was to detect the parasite species using the pcr - rflp method . The province of sitan and baluchestan, is one of the 31 provinces of iran, located in southeastern iran, bordering pakistan and afghanistan with geographical coordinates between 29.4924n 60.8669e (fig . This province is characterized by long, hot and dry summers and short winters, whereas in coastal region, near the oman sea, the weather is warm with a high percentage of humidity . Districts and geographical outlines are depicted in this experimental study, samples were collected from the individuals clinically suspected to cl and referred to konarak and chabahar health centers . A questioner was completed to record the essential information such as demographic information, sites of ulcer on the body and travel history . After obtaining a complete clinical history, the study was conducted in the laboratory of zahedan university of medical sciences in the sistan and baluchestan province, southeastern iran in 2015 . Skin suspected lesions were cleaned with 70% ethanol and the samples by injecting 0.2 ml of sterile saline into the dermis of the inside border of skin wounds with 1 ml of sterile insulin syringe were collected . Afterward suction, the serosity was moved to the sterile 1ml tube enclosing the 0.5 ml of ethanol 70% . Direct smears for standard microscopically examination was prepared by aspiration of fluid from under the ulcer . After air - drying, slides were fixed with absolute methanol, stained with giemsa 10%, and observed via optical microscopy (magnification 1000) for the existence of amastigote forms of the parasite . Dna was extracted from geimsa stained slides as declared by the manufacturer using the high pure pcr template purification (takapouzist, iran dynabio blood / tissue genomic dna extraction kit). To detect and identification of the leishmania species isolates, we used the hsp70 region, using the primers 70-ir - d (5- ccaaggtcgaggaggtcgac ta- 3) and 70-ir - m (5- acgggtaggg ggaggaaaga -3) (12). Amplification was done in 30 ml containing 3 ml of pcr buffer (roche, mannheim, germany), 2.5 mm mgcl2 (25 mm; roche), 1 ml dntp (10 mm; roche), 15 pmol of each primer, 10 ng of genomic dna and 0.5 units of taq polymerase (genet bio, korea). Amplification was done with 35 cycles, each of 30 s at 94 c, 30-s at 49 c, and 1 min at 72 c in a thermocycler (biometra, goettingen, germany). Then 5 ml of each pcr reaction was run on a 1% agarose gel and stained with ethidium bromide . The pcr product including the amplified hsp70 were digested with haeiii (bsur1) (fermentas, life sciences, germany) as commended by the producer . Digestion products were separated using 3% agarose gels in tae buffer and visualized after staining by gel red . Using software of clcdna in the insilico analysis and using fasta format genes downloaded from genbank and with bsur1 enzymes, the number of regions in different species was identified . In hsp70 genes in the l. major using bsur1enzymes and three sections and four sizes 70, 178, 183 and 323 bp were provided . Besides, l. tropica hsp70 gene was examined and two sections and three pieces with sizes 182, 243, 321bp were delivered . Pcr products of hsp70 from five isolates, 2 samples from l. tropica and three samples from l. major were purified from the agarose gel, by pcr purification kit (bioneer, korea), and sequenced from both directions (applied biosystems, dna analyzers sequencing, bioneer, korea, sanger method), using the same primers used in pcr . Multiple alignments were performed with data related to leishmania spp . From iran and other countries deposited in genbank using bioedit sequence alignment editor vr . Bootstrap analyses (using 1,000 replicates) were carried out to define the robustness of the finding . The province of sitan and baluchestan, is one of the 31 provinces of iran, located in southeastern iran, bordering pakistan and afghanistan with geographical coordinates between 29.4924n 60.8669e (fig . This province is characterized by long, hot and dry summers and short winters, whereas in coastal region, near the oman sea, the weather is warm with a high percentage of humidity . In this experimental study, samples were collected from the individuals clinically suspected to cl and referred to konarak and chabahar health centers . A questioner was completed to record the essential information such as demographic information, sites of ulcer on the body and travel history . After obtaining a complete clinical history, the study was conducted in the laboratory of zahedan university of medical sciences in the sistan and baluchestan province, southeastern iran in 2015 . Skin suspected lesions were cleaned with 70% ethanol and the samples by injecting 0.2 ml of sterile saline into the dermis of the inside border of skin wounds with 1 ml of sterile insulin syringe were collected . Afterward suction, the serosity was moved to the sterile 1ml tube enclosing the 0.5 ml of ethanol 70% . Direct smears for standard microscopically examination was prepared by aspiration of fluid from under the ulcer . After air - drying, slides were fixed with absolute methanol, stained with giemsa 10%, and observed via optical microscopy (magnification 1000) for the existence of amastigote forms of the parasite . Dna was extracted from geimsa stained slides as declared by the manufacturer using the high pure pcr template purification (takapouzist, iran dynabio blood / tissue genomic dna extraction kit). To detect and identification of the leishmania species isolates, we used the hsp70 region, using the primers 70-ir - d (5- ccaaggtcgaggaggtcgac ta- 3) and 70-ir - m (5- acgggtaggg ggaggaaaga -3) (12). Amplification was done in 30 ml containing 3 ml of pcr buffer (roche, mannheim, germany), 2.5 mm mgcl2 (25 mm; roche), 1 ml dntp (10 mm; roche), 15 pmol of each primer, 10 ng of genomic dna and 0.5 units of taq polymerase (genet bio, korea). Amplification was done with 35 cycles, each of 30 s at 94 c, 30-s at 49 c, and 1 min at 72 c in a thermocycler (biometra, goettingen, germany). Then 5 ml of each pcr reaction was run on a 1% agarose gel and stained with ethidium bromide . The pcr product including the amplified hsp70 were digested with haeiii (bsur1) (fermentas, life sciences, germany) as commended by the producer . Digestion products were separated using 3% agarose gels in tae buffer and visualized after staining by gel red . Using software of clcdna in the insilico analysis and using fasta format genes downloaded from genbank and with bsur1 enzymes, the number of regions in different species was identified . In hsp70 genes in the l. major using bsur1enzymes and three sections and four sizes 70, 178, 183 and 323 bp were provided . Besides, l. tropica hsp70 gene was examined and two sections and three pieces with sizes 182, 243, 321bp were delivered . Pcr products of hsp70 from five isolates, 2 samples from l. tropica and three samples from l. major were purified from the agarose gel, by pcr purification kit (bioneer, korea), and sequenced from both directions (applied biosystems, dna analyzers sequencing, bioneer, korea, sanger method), using the same primers used in pcr . Multiple alignments were performed with data related to leishmania spp . From iran and other countries deposited in genbank using bioedit sequence alignment editor vr . Bootstrap analyses (using 1,000 replicates) were carried out to define the robustness of the finding . Suspected cl patients samples were microscopically surveyed at first . Out of 130 suspected patients, 59 (45.3%) were positive by the microscopic examination . Twenty - four (37.5%) patients were from konarak city and 40 (62.5%) were from chabahar city (fig . The results of rflp - pcr method indicated that 53 (82.8%) of samples patterns were identical to that of l. tropica and 11 (17.1%) to that of l. major (fig . Multiple lesions were seen in zcl forms due to l. major and most ulcers were in hands and feet . Distribution of leishmania species using pcr - rflp based on patients infected study area in konarak and chabahar during 20142015 hsp70-pcr and restriction fragment length polymorphism (rflp) patterns obtained from patient s samples.lane 1 hsp70-pcr banding patterns (750bp)lane 2, 4 l.major (72bp, 178bp, 183bp, 320bp)lane 3 100-bp size marker (fermentas)lane 1 100-bp size marker (fermentas)lane 2, 4 l.tropica (182bp, 240bp, 320bp)lane 5 hsp70-pcr banding patterns (750bp) lane 1 hsp70-pcr banding patterns (750bp) lane 2, 4 l.major (72bp, 178bp, 183bp, 320bp) lane 3 100-bp size marker (fermentas) lane 1 100-bp size marker (fermentas) lane 2, 4 l.tropica (182bp, 240bp, 320bp) lane 5 hsp70-pcr banding patterns (750bp) phylogenetic relationship of hsp70 sequences of isolates of l.tropica and l.major from iran using neighbor - joining method . Leishmaniasis is an important parasitic disease that is life threating for human in endemic areas (13). Cutaneous leishmaniasis is the most prevalent dermatological disease worldwide and considered as one of the challenging health problem in involved countries (14). Afghanistan, iran, syria, saudi arabia, algeria, brazil and peru are containing more than 90% of cl new cases, which occur annually (15). Iran is one of the endemic areas for cl so that in more than half of the population are at risk (16) and 2040/100,000 cases are annually reported (17, 18). Acl (dry or urban) and zcl (wet or rural) are two common forms of cutaneous leishmaniasis in iran (19). Because of the different strategies of prevention and control, identification of the species is crucial (20). Cl has been emerged in recent years in konark and chabahar, sistan and baluchestan areas in southeast of iran . These border regions have geographically important because of the business, tourism industry and exchanging visitors from neighboring countries . Cl is an emerging disease in these areas, the main cause specie was not distinguished up to now, and medical doctors have relied on the clinical manifestations whereas the clinical symptoms are variable and may be confused with other etiological causes (20). Molecular - based techniques are valuable for identification of the species of leishmania (21). Pcr has been used widely for detection of infection, and identification of leishmania species in cl, visceral leishmaniasis and other forms of the disease (2224). Phylogenetic studies in leishmania needs more focusing on molecular markers; for this purpose (its) 1 and 2, cytochrome oxidase ii gene, glycoprotein 63 gene, cysteine protease b genes, cytochrome b gene, heat shock protein genes and suchlike have been used for analyzing phylogenetic issues in leishmania . Heat shock proteins (hsps) are likely to play important roles in the differentiation of the promastigotes in sandflies from to amastigotes in mammalian hosts (2628). Hsps, which seem to be implicated in the adaptation and survival of the cell to heat and other stress conditions (29). Among hsps, hsp70 is the most highly conserved in sequence and function in all organisms (30). Fraga et al . Introduced an important and novel technique for identification of leishmania species with sequencing of hsp70 regions (31). They are the best - conserved sequences along the evolutionary tree of life (32). The hsp70 gene is being widely used as a target for pcr - rflp assays for leishmania species differentiation because of its lower rate of genetic diversity than other markers for instance gp63 or rdna its genes (9, 33). In several provinces of iran cl is reported and to identification of the leishmaniasis species in several studies different laboratory methods have been performed (34, 35). In mashhad province, using its - pcr and pcrrflp, the dominant causative agent of cl was l. tropica (3638). In shush city in khuzestan and in shiraz province by nested pcr, the dominant species was l. major (35, 39). In several studies, the molecular methods were used to identify leishmania species in the patients, vectors and reservoirs . In brazil recognition of leishmania parasites showed pcr - rflp profiling of the hsp70 gene as a valuable tool for recognizing leishmania species related with human leishmaniasis (33). In japan, leishmania species was identified in the sand flies using pcr (40). In spain, detection of leishmania parasite in biopsies from 100 dogs using pcr was shown that in 63% of the dogs, leishmania dna could be detected by pcr in at least in one of the tissues studied (41). In france, leishmania species was identified in the mouse tissues using real - time pcr (42). For identification of leishmania species isolates from konark and chabahar, sistan and baluchestan province, we used hsp-70 as an ideal object for classification of different leishmania species through the pcr - rflp method . This method has been applied and showed to be valuable for diagnosis and identification of leishmania (9, 12, 31, 33, 4346). In the current study, from 130 suspected cl patients infected, 59 (45.3%) were positive by the microscopic examination while using hsp70-pcr 64(49.2%) samples were positive . In a study, from 155 suspected cl patients, 69 (44.5%) cases were positive by microscopic examination and 86 (55.4%) were positive by its - pcr (47). According to similar study conducted on samples from different parts of iran, l. major is the most important causative agent of cl in khuzestan, ilam, kermanshah and semnan, however (48). Our study showed similar results; in tehran, north khurasan, esfahan, kerman, fars and razavi khurasan both l. tropica and l. major were identified (48). Additionally, there is not any report of l. aethiopica, l. mexicana complex and l. braziliensis complex in human (4850). Nevertheless in this area of study to identify the species of leishmania parasite limited molecular approaches was carried out and there is not correct map for this issue so this study was conducted as a pilot . Furthermore, sistan and baluchestan is one of the important foci of acl and also zcl and unlike to other study in these area, acl is the dominant cause of cl . Free trading area, immigrants from pakistan and afghanistan country, kerman and yazd provinces (foci of acl); are some reasons that l. tropica is the dominant species . Additionally, dogs as a reservoir hosts phlebotomus sergenti as a most prevalent sand fly in these areas are helping l. tropica to be a dominant species . Meanwhile l. tropica (the dominant species .) Is an anthroponotic parasite, therefore in order to control the disease, it is suggested to focus on chemotherapy of patients and for l. major should have to pay more attention on immigrants from rural areas and visitors from neighboring countries (pakistan and afghanistan) and rodents eradication.
The incidence of primary cardiac tumors is low, at 0.001% to 0.03% [1 - 3]. The advent of variable cardiac imaging modalities, including echocardiography and multidetector computed tomography (ct), has led to the identification of an increasing number of cases of asymptomatic cardiac tumors . Cardiac papillary fibroelastoma (cpf) is a rare and benign cardiac tumor that can arise anywhere in the heart, but usually involves cardiac valves . Moreover, the incidence of cpf in the left ventricle is lower than that in other parts of the heart . Here we report a case of left ventricular cpf detected by echocardiography and successfully surgically resected . A 65-year - old woman was referred to our cardiology department for evaluation of a cardiac mass of the left ventricle . Prior to the referral, she was admitted to another hospital with a complaint of chest pain of 3 days' duration . Coronary angiography and echocardiography coronary angiography showed no significant coronary disease, but a mass was found by echocardiography . She had been treated for hypertension and a stroke she suffered 5 years prior . On physical examination, her blood pressure was 110/70 mmhg, and her pulse rate was 62 beats / min . Transthoracic echocardiography revealed a 1.8 1.7 cm highly mobile round mass attached by a stalk on the apical inferior wall of the left ventricle with an echolucent area (fig . Ct of the chest showed a 1.9 1.6 cm round and pedunculated mass with soft tissue density on the apical inferior wall of the left ventricle (fig . On opening the left atrium, there was a mass attached deep to the inferior wall of the left ventricle . The resected tumor was 1.8 1.5 cm and had the appearance of a sea anemone (fig . Histology showed that the lesion had a papillary configuration with an avascular connective tissue core (fig . Among primary cardiac neoplasms, benign tumors account for 63% and malignant tumors for 37% . The mean age at diagnosis of cpf is approximately 60 years, although it has been reported in teenagers and children . Cpf affects both sexes, but males predominate in most series . In the study of a series at the mayo clinic from 1957 to 2001, of 110 primary cardiac tumors that were surgically removed a recent study reported that cpf represented 5% of primary cardiac tumors in 21 patients . In a report of 110 cpf cases, about 90% of cpfs appeared on cardiac valves, and the remainder originated from nearly all portions of the non - valvular endocardium, including the left ventricular septum, the left ventricular mural endocardium, the right ventricular outflow tract, the right atrium, the atrial septum, the papillary muscle, the chordate tendinea, the eustachian valve, and the chiari network . They have a gelatinous membrane on the surface and a stalk with multiple papillary projections . Microscopically, cpfs are composed of a central stalk with radiating villus - like projections . The papillae are avascular structures, containing a core of dense collagen fibers admixed with varying amounts of reticulin and elastin fibers . The microscopic structure of a cpf closely resembles that of chordea tendineae, which prompted some to propose a hamartomatous - like pathogenesis . A cpf is a collection of avascular fronds of dense connective tissue lined by endothelium . However, it is deemed to be a reactive process rather than a true neoplasm . It is suggested that cpf may be associated with lambl's excrescence and shear stress, and congenital factors may be involved in its development; however, the cause remains unclear . With improved echocardiographic resolution due to higher transducers and new imaging modalities, cpf was considered to be an incidental autopsy finding and to have no clinical significance in the past . The clinical presentation of a cardiac tumor is determined by its location, size, and mobility . In particular, left - sided, larger sized (1 cm) and highly mobile tumors have a higher incidence of embolization . Cpfs have a predilection for the left side of the heart . In a review of the literature regarding complications in 79 cases of cpf, 61 lesions occurred on the left side of the heart, whereas only 18 were right - sided . Cpfs are generally slow growing tumors, but may serve as nidi, allowing formation of large superimposed thrombi over a short period of time . Symptoms include cerebral infarction and transient cerebral ischemic attack associated with soft and fragile fibroelastoma in 44% of patients, angina pectoris in 18%, myocardial infarction in 10%, cardiac failure in 9%, and sudden death in 8% . Symptomatic cpf should be resected surgically; however, there are no guidelines for the treatment of asymptomatic cpf . Large, left - sided mobile tumors should be excised to prevent sudden death and emboli . Small, non - mobile tumors may be followed with serial echocardiography and removed if they increase in size or become mobile or symptomatic . Various methods have been proposed for complete excision of left - sided cpfs to avoid a left ventriculotomy due to further complications . For tumors deep within the left ventricular cavity close to the apex, the use of a cardioscope passing through the aortic or mitral valve is recommended to avoid damage to the valvular apparatus . In our case, we used a surgical approach through the left atrium and mildly pushed up the left ventricular apical inferior wall for easy resection of the mass . Recently, a case in which a cpf deep in the left ventricle was resected under the guidance of a gastrointestinal fiberscope was reported . In this report, we present a case of cpf attached to the left ventricular apical inferior wall, which was successfully removed surgically.
This cross - sectional case - control study was performed in the following 3 belarusian medical hospitals: republic clinical hospital of medical rehabilitation (minsk, belarus), 1st minsk city clinical hospital (minsk, belarus), and 10th minsk city clinical hospital (minsk, belarus). From 2007 to 2011, a total of 200 consecutive t1d patients were evaluated . The diagnosis of t1d was based on the american diabetes association criteria (6). Inclusion criteria were as follows: age between 20 and 55 years, duration of disease 2 years, and eugonadal status . The exclusion criteria were as follows: 1) the presence of severe chronic kidney disease, 2) the presence or history of diseases and syndromes associated with low bmd (i.e., noncompensated hypothyroidism, hyperthyroidism, hyperparathyroidism, intestinal malabsorption, inflammatory bowel disease, or history of malignancy), 3) intake of drugs that can influence bone metabolism, 4) the pregnancy and lactation periods, and 5) the presence of acute infectious disease . Ultimately, 82 t1d patients were enrolled . In the same period, 82 healthy subjects were recruited as controls among 932 subjects referred to our outpatient clinic by health providers of general medicine for the suspicion of hypothyroidism or hashimoto thyroiditis . The control subjects were enrolled in the study if they had normal thyroid function and negative autoimmunity and if they fulfilled the inclusion criteria (age 2055 years, eugonadal status) without any exclusion criteria (the presence of diabetes mellitus; the presence or history of diseases and syndromes associated with low bmd, such as hyperparathyroidism, intestinal malabsorption, inflammatory bowel disease, or history of malignancy; intake of drugs that can influence bone metabolism; the pregnancy and lactation periods; and the presence of acute infectious disease). All subjects gave their witnessed, informed consent before entering the study, which was approved by local ethical committees and conducted in accordance with helsinki declaration ii . In all patients and controls, height and weight were measured and bmi was calculated . In all subjects, bmd was assessed with dxa (prodigy lunar; general electric medical systems) and expressed as sd units (z - values) in relation to an age - matched reference population at both lumbar spine (z - ls) and femoral neck (z - fn). Bmd was adjusted for weight and classified as normal, osteopenic, or osteoporotic on the basis of z - ls or z - fn bmd (7). We decided to use both z - score and t - score because the sample was composed of premenopausal women and men younger than 50 years . Indeed, as stated by the international society of clinical densitometry (7), t - score and z - score are equal for young people aged between 20 and 50 years . In addition, the t - score yields important clinical information regarding the presence or absence of osteoporosis, whereas the use of z - score normalizes for age . Only 1 subject among both patients and controls was older than 50 years (a 54-year - old premenopausal woman), and we decided not to eliminate her from the study . Data from lumbar spine scans were used only if at 3 vertebrae were visualized without interfering artifacts . The coefficient of variation bmd measurements at lumbar spine and femoral neck was <1.5% . X - ray loading in one projection was 0.04 msv . In both t1d patients and controls, the presence of morphometric vfx was assessed with dxa with the software vertebral fracture assessment (vfa) from t4 to l4 vertebrae . This software is a program within the prodigy lunar system, including a lateral projection of the spine . The manufacturer refers to this lateral projection as dual - energy vertebral assessment, dva . Each vertebra was considered as intact (grade 0) or as having approximately mild (2025% compression), moderate (2540% compression), or severe (> 40% compression) deformity (grades 1, 2, and 3, respectively).the dxa and vfa reviewers were blinded to the presence of diabetes . In all patients with evidence of a vfx on vfa, conventional spinal radiographs in lateral (t4l4) and anteroposterior projection (l1l4) were obtained . In all cases, diabetic neuropathy evaluation was based on symptoms, quantitative sensory testing (temperature, vibration, and pressure perception) and quantitative motor testing (patellar and ankle reflexes). Diabetic nephropathy was assessed by measuring microalbumin in 24-h urine samples (normal values <30 mg / day) twice (at enrolment and after 36 months) to determine persistent microalbuminuria . Microalbuminuria and macroalbuminuria were diagnosed on the basis of albumin excretion rate between 30 and 300 mg / day or> 300 mg / day, respectively (9). For each patient, the diabetes complication score was calculated on the basis of the presence of 0, 1, 2, or 3 complications among neuropathy, retinopathy, and nephropathy (score of 0, 1, 2, or 3, respectively). Venous blood samples were taken from all t1d patients in the morning before the insulin injection after a 10-h fast, centrifuged, and stored at 70c until analysis . Glycosylated hemoglobin (hba1c, normal value 4.06.0%) and serum creatinine were measured by high - performance liquid chromatography with autoanalyzer d10 (bio - rad) and with analyzer hitachi 911 (roche diagnostics, germany), respectively . Creatinine clearance (clcr) was calculated with the formula of cockcroft - gault: clcr (ml / min) = [140 age (years) weight (kg)/72 11.3 serum creatinine (mmol / l)] for males and clcr (ml / min) = 0.85 [140 age (years) weight (kg)/72 11.3 serum creatinine (mmol / l)] for females (9). Because all t1d patients had completed complex education aimed at diabetes management in everyday life, all were motivated to complete standardized physical activity 30 min / day 5 days / week (a brisk walk, jogging, swimming, bicycling outside and indoors, dancing, playing tennis), as recommended by the american diabetes association (6). During the personal visit, the patients were asked how much time in a day and how many days in a week they spent on physical activity as previously described . The average values of physical activity in a week and in a day (expressed as hours / day) were then calculated . Statistical analysis was performed with the spss version 18.0 statistical package (ibm corporation, armonk, ny). The comparison of continuous variables between patients and controls was performed with the student t test or mann - whitney u test as appropriate . General linear modeling was performed to compare the continuous variables between patients and controls after adjusting for age . The associations between variables were tested by either pearson or spearman correlation, as appropriate . Multivariate logistic or linear regression analysis assessed the association between the presence of morphometric vfx (categorical dependent variable) and the following independent variables: age, sex, bmi, lumbar spine bmd, score of diabetes complications (expressed as a continuous variable), and physical activity . Statistical analysis was performed with the spss version 18.0 statistical package (ibm corporation, armonk, ny). The comparison of continuous variables between patients and controls was performed with the student t test or mann - whitney u test as appropriate . General linear modeling was performed to compare the continuous variables between patients and controls after adjusting for age . The associations between variables were tested by either pearson or spearman correlation, as appropriate . Multivariate logistic or linear regression analysis assessed the association between the presence of morphometric vfx (categorical dependent variable) and the following independent variables: age, sex, bmi, lumbar spine bmd, score of diabetes complications (expressed as a continuous variable), and physical activity . Age, anthropometric parameters (height, weight, and bmi), sex distribution, and renal function were comparable between patients and controls . Patients with t1d had significantly lower z - ls and z - fn and higher prevalence of low bmd (z - score less than 1.0). N = 20) had at least 1 vfx . Among these, 14 patients had only mild vfx, whereas the remaining 4 and 2 patients had moderate or severe vfx, respectively; the difference from controls was statistically significant for mild vfx but not for moderate or severe vfx (table 1). Even after excluding patients with mild fractures, these differences were substantially confirmed (t1d vs. controls, subjects with vfx 8.5 vs. 1.2%, p = 0.064, respectively). Clinical characteristics of patients with t1d and control subjects when analyzing male and female subjects separately, the results were the same as for the whole t1d group both for t1d males (t1d males vs. controls, z - ls 1.0 1.1 vs. 0.4 0.67, p <0.001, and z - fn 1.0 1.1 vs. 0.35 0.6, p <0.001; subjects with vfx 23.1 vs. 4.5%, p = 0.078, respectively) and t1d females (t1d female patients vs. controls, z - ls 0.34 1.3 vs. 0.32 1.1, p = 0.003, and z - fn 0.45 1.2 vs. 0.27 1.0, p = 0.01; subjects with vfx 25 vs. 6.7%, p = 0.009, respectively). Comparing t1d patients with and without vfx, no differences were found in age, bmi, sex distribution, diabetes duration, age at t1d manifestation, hba1c, renal function, and physical activity (table 2). T1d patients with vfx tended, however, to have a lower bmd at both lumbar spine and femoral neck and higher prevalences of neuropathy and retinopathy and higher complication score relative to patients without vfx . The same trend toward lower bmd at both sites was seen also in controls with vfx relative to those without . Comparing t1d patients with and without vfx divided by sex clinical characteristics of patients with and without t1d with and without vfx clinical characteristics of males and females with t1d with vfx and without vfx analyzing diabetic patients together with controls, we found that the presence of mild, moderate, or severe vfx was associated with the presence of t1d but not with spine bmd after adjusting for age, sex, and bmi (table 4). Separately analyzing t1d patients, we found that the presence of mild, moderate, or severe vfx tended to be associated with low spine bmd after adjusting for age, sex, bmi, complication score, and physical activity (table 4). Odds ratios for the presence of vfx after adjustment for lumbar spine bmd and other risk factors in the whole sample of t1d patients and controls, the presence of vfx of only moderate or severe grade was significantly associated with bmd at the lumbar spine (odds ratio 2.78 [95% ci, 1.097.14]; p = 0.033), but not with t1d (2.20 [0.2024.40]; p = 0.51) after adjusting for age (1.06 [0.961.17]; p = 0.28), male sex (2.50 [0.4813.16]; p = 0.28), and bmi (1.04 [0.841.29]; p = 0.69). This association was lost when only t1d patients were considered (bmi 1.00 [0.512.00]; p = 0.98; age 1.07 [0.921.26]; p = 0.37; female sex 2.16 [0.7364.02]; p = 0.66; z - ls 4.17 [0.4835.70]; p = 0.20; complication score 1.43 [0.248.46]; p = 0.69; physical activity 1.01 [0.991.04]; p = 0.27). Age, anthropometric parameters (height, weight, and bmi), sex distribution, and renal function were comparable between patients and controls . Patients with t1d had significantly lower z - ls and z - fn and higher prevalence of low bmd (z - score less than 1.0). N = 20) had at least 1 vfx . Among these, 14 patients had only mild vfx, whereas the remaining 4 and 2 patients had moderate or severe vfx, respectively; the difference from controls was statistically significant for mild vfx but not for moderate or severe vfx (table 1). Even after excluding patients with mild fractures, these differences were substantially confirmed (t1d vs. controls, subjects with vfx 8.5 vs. 1.2%, p = 0.064, respectively). Clinical characteristics of patients with t1d and control subjects when analyzing male and female subjects separately, the results were the same as for the whole t1d group both for t1d males (t1d males vs. controls, z - ls 1.0 1.1 vs. 0.4 0.67, p <0.001, and z - fn 1.0 1.1 vs. 0.35 0.6, p <0.001; subjects with vfx 23.1 vs. 4.5%, p = 0.078, respectively) and t1d females (t1d female patients vs. controls, z - ls 0.34 1.3 vs. 0.32 1.1, p = 0.003, and z - fn 0.45 1.2 vs. 0.27 1.0, p = 0.01; subjects with vfx 25 vs. 6.7%, p = 0.009, respectively). Comparing t1d patients with and without vfx, no differences were found in age, bmi, sex distribution, diabetes duration, age at t1d manifestation, hba1c, renal function, and physical activity (table 2). T1d patients with vfx tended, however, to have a lower bmd at both lumbar spine and femoral neck and higher prevalences of neuropathy and retinopathy and higher complication score relative to patients without vfx . The same trend toward lower bmd at both sites was seen also in controls with vfx relative to those without . Comparing t1d patients with and without vfx divided by sex clinical characteristics of patients with and without t1d with and without vfx clinical characteristics of males and females with t1d with vfx and without vfx analyzing diabetic patients together with controls, we found that the presence of mild, moderate, or severe vfx was associated with the presence of t1d but not with spine bmd after adjusting for age, sex, and bmi (table 4). Separately analyzing t1d patients, we found that the presence of mild, moderate, or severe vfx tended to be associated with low spine bmd after adjusting for age, sex, bmi, complication score, and physical activity (table 4). Odds ratios for the presence of vfx after adjustment for lumbar spine bmd and other risk factors in the whole sample of t1d patients and controls, the presence of vfx of only moderate or severe grade was significantly associated with bmd at the lumbar spine (odds ratio 2.78 [95% ci, 1.097.14]; p = 0.033), but not with t1d (2.20 [0.2024.40]; p = 0.51) after adjusting for age (1.06 [0.961.17]; p = 0.28), male sex (2.50 [0.4813.16]; p = 0.28), and bmi (1.04 [0.841.29]; p = 0.69). This association was lost when only t1d patients were considered (bmi 1.00 [0.512.00]; p = 0.98; age 1.07 [0.921.26]; p = 0.37; female sex 2.16 [0.7364.02]; p = 0.66; z - ls 4.17 [0.4835.70]; p = 0.20; complication score 1.43 [0.248.46]; p = 0.69; physical activity 1.01 [0.991.04]; p = 0.27). To our knowledge, this is the first study evaluating the prevalence of morphometric vfx in patients with t1d . We found that bmd is decreased and the prevalence of morphometric vfx is increased in t1d patients . It is well known that t1d patients frequently show low bone mass, the pathogenesis of which is still not clear (2,3). In this study, we confirmed that adults with t1d have significantly lower bmd and higher prevalence of low bmd (z - score bmd less than 1.0) both at the lumbar spine and at the femoral neck relative to controls, as already suggested by previous studies (1,4). In addition to low bone mass, t1d has been suggested to be characterized by elevated risk of clinical fractures (1,2,10); this also is consistent with our results, because in this study about 25% of t1d patients had vfx . On the other side, it has been recently suggested that fractures in t1d might be not entirely explained by reduced bmd (1), as happens in several forms of secondary osteoporosis (11). This is in keeping with the results of the logistic regression analysis (table 4), which confirms the association of t1d with the presence of vfx regardless of bmd . When limiting the analysis to the moderate or severe fractures, bmd but not t1d was found to be associated with vfx . These apparently discordant findings may have arisen because the reduction of bmd remains crucial and overcomes the role of t1d when only more severe vfx is considered . It is not possible, however, to exclude the possibility that the number of patients with moderate or severe vfx (n = 5) was insufficient to evaluate the effect of t1d reliably in this subset of patients . Notwithstanding these limits, these finding are of clinical importance, because the prevalence of vfx predicts future fractures regardless of bmd (5) and because the recognition of vfx by imaging of the spine may change the patient diagnostic classification, estimation of fracture risk, and threshold for pharmacological intervention . In our sample, no potential risk factors for vfx other than bmd (among age, sex, bmi, physical activity, and complications) were found to be significantly associated with the presence of vfx in the logistic regression analysis (table 4). Because t1d patients with vfx tended to have higher complication score and higher prevalence of diabetes complications, in particular retinopathy and neuropathy, the presence of chronic diabetes complications might be an adjunctive tool in addition to bmd in evaluating risk factors for fractures in t1d . The statistical significance for complication score was not reached, possibly because of the large sd and the relatively small number of patients with vfx . The link between the presence of the chronic complications and the presence of osteoporosis in t1d is debated (1218). Recently, the presence of the chronic diabetes complications has been shown to be associated with low bmd in t1d (4). 10) showed that the complications of diabetes other than diabetic kidney disease add little to the overall risk of fracture . Some data suggest that the nonenzymatic glycosylation of type 1 collagen, with subsequent formation of advanced glycation end products, has a negative impact on mechanical properties of cancellous and cortical bone . The alteration of the organic matrix in bone by advanced glycation end products could be relevant to increased bone fragility with aging and in such disease as diabetes (19,20). This is a suitable explanation for poor bone quality in t1d . In this study, the lack of association between bmd and vfx in t1d patients may suggest the loss of bone quality as a cause of the increased vfx prevalence in t1d patients . First, we measured hba1c only at enrollment . Because hba1c levels are representative of the metabolic status of the last 3 months, we could not exclude the possibility that the metabolic status of an individual subject was different during the previous years and therefore not reliably mirrored by the current hba1c levels . This technique uses a lower radiation level than standard radiography; however, it also provides lower image resolution (21). It has a good sensitivity (8793%) and specificity (9395%) for detecting moderate and severe vfx, but its performance for diagnosing mild vfx in the presence of scoliosis or osteoarthritis has been questioned (21). In our sample, however, no subjects had severe osteoarthritis, and an anteroposterior view of the spine by vfa was obtained to identify the patients with scoliosis . Moreover, in all patients with evidence of a vfx at vfa, the conventional spinal radiographs confirmed the vfa results, and even after excluding patients with mild fractures, the results were substantially confirmed . Finally, another limitation of this study is related to its cross - sectional design, which does not allow assessment of causality but only of association between variables . In conclusion, this study confirms that bmd is reduced in t1d . Moreover, it shows that the prevalence of morphometric vfx is increased in t1d and not associated only with the reduction of bmd.
A 53-year - old asian woman with a history of lupus erythematosus was initially treated with hydroxychloroquine (plaquenil, unknown dose) for 5 years . Approximately 3 years ago, the patient's medication was changed to chloroquine (400 mg daily). Within a few years of taking chloroquine, she noticed a circular shadow in her central vision, which she described as an arch surrounding her central vision . At first, she only noticed a superiorly oriented half - moon shadow that lasted for a few seconds during reading . The shadow was seen while both eyes were open and disappeared after a few seconds . Because of these symptoms and the presence of bull's eye maculopathy on fundus examination, chloroquine was discontinued and the patient's medication was changed to dapsone (unknown dose). The best - corrected visual acuity (corrected with current spectacles) of the highly myopic patient during her most recent examination was 20 / 25 in both eyes, with no evidence of an afferent pupillary defect . Slit - lamp examination indicated that the anterior segment was unremarkable and goldmann applanation intraocular pressure was normal (16 mmhg) in both eyes . However, a significant central defect was noted on humphrey visual field (hvf) examination (humphrey visual field analyzer 10 - 2; humphrey instruments, san leandro, ca, usa) in both eyes . Dilated fundoscopy revealed tilting of the optic nerves in both eyes, consistent with myopia, and a ring - shaped area of rpe depigmentation in the parafoveal area of the left eye (fig . Fundus autofluorescence (faf) imaging revealed a hypofluorescent lesion in the foveal and perifoveal areas correspond with the bull's eye retinopathy . In the left eye, a prominent hypofluorescent lesion was also noticed on faf imaging, reflecting marked atrophy of the rpe layer (fig . Cross - sectional retinal scans, obtained with sd - oct (spectralis hra+oct; heidelberg engineering, heidelberg, germany) showed obvious thinning of the macula and disruptions in the outer retina . More specifically, loss of the photoreceptor inner / outer segment (is / os) junction corresponded to the location of the maculopathy as identified on fundus photography, faf, and hvf 10 - 2 . The outer retinal layer had a moth - eaten appearance at the is / os junction, but the thickness and appearance of the inner retina were within normal limits . Additionally, a downward displacement of the overlying retina was seen in perifoveal areas and corresponded to the hypofluorescent lesion in faf images . Unlike the anatomically disrupted areas, which corresponded to the bull's eye lesion, the central fovea had normal thickness and structure on sd - oct in both eyes (fig . The ao system used in the current study utilized a dual liquid crystal on silicon spatial light modulators (lcos - slms; x10468 - 02, hamamatsu photonics, morimoto, japan) first introduced by hirose et al . . Although deformable mirrors have been widely used, their performance is limited with respect to compensating large amounts of aberration of human eyes . Meanwhile, although lcos - slm is able to compensate large amounts of aberration by the phase wrapping method utilizing a continuity of the wavefront of a laser beam, it is only capable of compensating a particular polarization component . This system is very efficient at following changes in aberration of a subject according to change in imaging location, but is not suitable for obtaining high contrast images because the power of the lights used for simultaneous imaging and measurement / compensation of time is limited for safety . In this study, we overcame these problems by adopting dual lcos - slm to compensate the two orthogonal polarization components and sequential processing of slo imaging and measurement / compensation of aberrations . Ao - slo images were obtained and cone density was measured 0.5, 1.0, and 1.5 mm from the center of the fovea in each of the 4 major directions (superior, inferior, nasal, and temporal). A montage was then created and verified by checking the correspondence between the ao - slo and wide - field images . Cone density was calculated using photoreceptor analysis software (canon, tokyo, japan). To obtain an accurate cone density, the axial length, anterior chamber depth, and keratometry values were all considered when counting cone cells, which were represented in images as bright spots 2 to 5 m in size . We manually selected areas of interest, and excluded retinal vessels and artifacts that obscured the underlying cone mosaic . Ao - slo images showed patch cone mosaic lesions, indicating abnormal regions of missing or lost cones . In addition, the observed cones were asymmetrical in shape and size and varied in brightness (fig . Cone densities in the right eye were 14,927, 10,377, and 11,853 cones / mm at 0.5, 1.0, and 1.5 mm from the center of the fovea, respectively . The corresponding cone densities in the left eye were 16,692, 12,564, and 13,100 cones / mm, respectively . The cone density at 1.5 mm from the center of the fovea was closer to normal than the other distances; however, the photoreceptors located 1.5 mm from the foveal center exhibited asymmetrical shapes and sizes, and varied in brightness in ao - slo images . Additionally, sd - oct images showed an abnormal is / os cytoarchitecture 1.5 mm from the foveal center . When we matched the disrupted areas on the ao - slo images with the visual field test, the areas with abnormal cone mosaic patterns and low cone density corresponded with the location of visual field defects on hvf (fig . Ocular side effects associated with chloroquine can be primarily divided into keratopathy, ciliary body changes, and retinopathy . Bull's eye maculopathy, a type of retinopathy, is associated with the use of antimalarial agents and is relatively rare . However, bull's eye maculopathy is the most serious of the ocular adverse effects and is of serious pathologic concern, as the associated visual changes can be severe and there is little chance of visual recovery . In addition, visual loss associated with bull's eye maculopathy can progress even after the drug treatment is terminated . Patients with retinopathy usually present with central visual loss, visual field defect, color vision deficiency, photoaversion, night blindness, and entopic phenomenon . Easterbrook reported that patients with minimal paracentral scotomas do not complain of symptoms and have normal color vision . In these patients, however, in nearly 70% of patients with ocular symptoms, abnormal color vision, and fundus changes, retinopathy progresses even after termination of drug use . Together, these studies illustrate the importance of early detection, ideally before the onset of visual symptoms . Fluorescein angiography (fa) can reveal the bull's eye pattern of granular hyperfluorescence, but is not useful for the diagnosis of early retinopathy . In full - field electroretinography (erg), there may be a deepening of the a - wave or an amplitude reduction in the scotopic b - wave . However, in most cases, erg findings are normal with minimal macular damage and decrease only after diffuse retinal damage has occurred . It was also reported that sd - oct images are able to show the perifoveal interruption of the photoreceptor is / os junction in eyes with chloroquine retinopathy . However, despite this new information, there is currently no established criteria for diagnosing chloroquine retinal toxicity prior to the development of irreversible visual loss . Studies performed in mice have shown that photoreceptors are the primary targets affected by chloroquine maculopathy, and that further degeneration occurs despite cessation of medication . Additionally, rosenthal et al . Showed that use of chloroquine in rhesus monkeys causes significant changes in both the inner and outer retinal layers . Exposure to ultraviolet radiation causes chloroquine to fluoresce, and based on this property, clinical studies have shown that a widespread, severe reduction of rod and cone processes occur in the outer nuclear and plexiform layers . Still, because of aberrations of ocular optics, none of the currently available imaging methods are capable of observing cells with disrupted photoreceptors in living human eyes . Recently, ao technology has been developed that allows for individual cones to be clearly visualized in vivo by compensating for aberrations in ocular optics [6 - 8]. Using ao - slo technology, several studies have shown that successful visualization of photoreceptor microstructure is possible in both normal eyes and eyes with various retinal diseases . Consistent with previous ao studies, our ao - slo images from normal eyes showed a regular cone mosaic pattern, in which the cone density decreased with increasing distance from the center of the fovea . In the patient with bull's eye maculopathy, we observed a disrupted cone mosaic pattern with individual cones having irregular shapes and sizes . Additionally, compared with normal patients, patients with bull's eye maculopathy can exhibit irregular cone brightness as well as dark and patchy lesions where cones are either missing or lost . In the present study, along with the disrupted cone mosaic pattern, measured cone densities were diminished in all areas . To better interpret the findings in our study, comparative data was obtained from both previous studies and historical controls . In normal eyes the average cone densities 0.5 and 1.0 mm away from the foveal center are approximately 30,000 and 15,000 cones / mm, respectively . These values were in agreement with histological studies reporting cone densities of 37,000, 16,000, and 14,000 cones / mm at 0.5, 1.0, and 1.5 mm away from the foveal center, respectively . Stepien et al . Previously reported an ao image of bull's eye maculopathy associated with antimalarial agent use . Although similar abnormal images of cones have been obtained using their ao system, they were not as high quality as the images obtained in the present study . Specifically, we were able to achieve improved image quality and contrast because our ao - slo utilized a dual liquid crystal on lcos - slms to correct for wavefront aberrations, while the system used by stepien et al . Moreover, creating a montage of ao - slo images made it possible to compare each ao - slo image to visual field test results . Using this technique, we were able to demonstrate that areas with visual defects could be matched with cone pattern and density abnormalities . Because ao - slo can image the retina with such high resolution, it is more sensitive to photoreceptor abnormalities than sd - oct . In our study, sd - oct images revealed equal disruption of the outer retinal layer at 1.0 and 1.5 mm away from the fovea . However, ao - slo images revealed a higher level of cone pattern disruption and a lower cone density at 1.0 mm away from the fovea, compared with 1.5 mm away from the fovea . There were several limitations of the present study that should be mentioned . Because the central foveal structure was conserved, our patient had a visual acuity of 20 / 25 . However, we could not obtain images of the central fovea for reasons described in previous studies [6 - 8]. Unfortunately, the inability to obtain these images made it impossible to compare cellular images of the fovea with those obtained from the bull's eye lesion . Another limitation of our study was that the ao - slo system could not acquire images from the central fovea or the peripheral retina . Therefore, we only investigated cone properties at 0.5, 1.0, and 1.5 mm away from the center of the fovea . Because of this limitation, we were unable to compare preserved areas adjacent to the bull's eye lesion, which may possibly have contained cones in the preclinical stage of the disease . As described above, the visual acuity of the patient was 20 / 25, and we hypothesized that the reason for the relatively mild visual decrease was because the structure of the central fovea remained relatively preserved . However, we could not confirm this possibility because the center of the fovea could not be precisely imaged by ao - slo . Similarly, because the ao - slo cannot obtain images from the peripheral retina, it was not possible to compare the disrupted macula to the relatively preserved peripheral retina . Depending on the specific disease, patients may be treated with either a chronic maintenance or acute high - level dose of chloroquine . A daily dose of chloroquine> 3 mg / kg and a treatment duration of> 5 years therefore, patients who are taking chloroquine or hydroxychloroquine should have regular ophthalmic examinations to detect retinal changes as early as possible in order to minimize retinal toxicity . In the present study, we showed that ao - slo can image cellular structures of the retina in living eyes in order to detect preclinical stages of chloroquine associated retinal damage that may not be apparent on standard clinical tests (e.g., fundus photography, fa, hvf, and electrophysiological testing). Importantly, the ability to identify photoreceptor disruptions in the preclinical stages of toxicity should allow for chloroquine withdrawal during the reversible stages of maculopathy . Despite the limitations of our ao system, our results suggest that ao - slo should provide a non - invasive, quantitative, high - resolution modality for imaging chloroquine retinopathy patients . Likewise, the abilities of ao - slo have the potential to provide a new approach for the diagnosis and monitoring of chloroquine toxicity.
B55 is a regulatory b subunit of the phosphatase complex pp2a (sontag, 2001). Pp2a participates in an immense number of pathways, and this explains the lethal phenotype associated with knockout of the catalytic c subunit in mice (gtz et al ., 1998). Few b - subunit knockout mice have been generated, and none has shown lethality; instead, these mice have tissue - specific pathological features (louis et al ., 2011,, the regulatory b subunits only contribute to pathways ascribed to their specific substrates so that they act uniquely under different pathological contexts (sablina et al ., 2010). We recently found that pp2a / b55 promotes the growth of colorectal cancer by dephosphorylating phd2 and modifying its enzymatic properties (di conza et al ., 2017). Phd2 (or egln1) is a member of the hypoxia - inducible factor (hif)-prolyl hydroxylase domain proteins (phds) family (epstein et al ., 2001). These enzymes are crucial for hif activation and the cellular response to hypoxia (chan et al ., 2005). Indeed, under normoxia, phds utilize oxygen and alpha - ketoglutarate (-kg) to carry out a hydroxylation reaction on specific hif prolines that lead to ubiquitination and proteasomal degradation (keith et al ., 2011). In addition to oxygen and cosubstrates, the mtor pathway, when dephosphorylated by pp2a / b55, phd2 shows impaired enzymatic activity, allowing full activation of hif1 in hypoxia (di conza et al ., 2017). Here, we investigate the molecular interaction between phd2 and b55 in response to glucose starvation in the context of breast cancer cells . The main function of phd2 is the hydroxylation at specific proline residues within the alpha subunit of hifs . Based on our previous findings showing the interaction and negative regulation of phd2 by b55/pp2a (di conza et al ., 2017), we wondered whether phd2 was able to degrade b55 in a feed - forward loop . We found that co - overexpression of phd2 and b55 in hek293 t cells resulted in reduced b55 protein levels (figure 1a) that was linked to its increased ubiquitination (figure 1b) and proteasomal degradation (figure 1c). The control of b55 protein levels was specific for phd2 only, because either phd1 or phd3 was not able to induce b55 proteasomal degradation (figure s1a). Mirroring the overexpression data, phd2 knockdown increased the half - life of b55 as assessed by translation blockade with cycloheximide (figures 1d and s1b). Inhibition of phd2 enzymatic activity by iox2 or dimethyloxaloylglycine (dmog) impaired both b55 ubiquitination and degradation (figures 1e and 1f). Moreover, physiological inhibition of phd2 by exposure to hypoxia was able to induce b55 accumulation as well (figures s1c and s1d). Overall, these data indicate that phd2 hydroxylase function is required for targeting b55 to the proteasome . Mass spectrometry analysis of b55 isolated from hek293 t cells, upon co - expression of phd2, revealed three hydroxylation sites in p159, p236, and p319 of b55 that we singularly mutated into an alanine . Of the three b55 point mutants, only b55 exhibited increased resistance to phd2-mediated degradation (figure 1 g). To confirm that this residue is hydroxylated by phd2, we performed an in vitro hydroxylation assay where recombinant phd2 was incubated with increasing doses of a b55 peptide and the km was determined by using a michaelis - menten curve or a lineweaver - burk (l - b) plot (figure 1h). The same assay was then performed by using a b55 peptide spanning from amino acid 311 to 329, therefore containing p319, or b55 p - oh (where p319 is synthetically hydroxylated) and hif1 (556575) peptides as negative and positive controls, respectively . This assay confirmed that phd2 was able to directly hydroxylate b55 in p319, although with a lower efficiency than for hif1 (figure 1i). However, when we tested the ubiquitination levels of this mutant, we could not detect any difference (figure s1e). Because proline 319 lies in the region of b55 that allows its binding to the scaffold subunit of the pp2a complex (li and virshup, 2002), we hypothesized that the hydroxylation of this residue is important to detach b55 from the complex, therefore making it more available for degradation . When measuring the binding of b55 and b55 to the scaffold a and the catalytic c subunits of the pp2a complex, we found that b55 had higher affinity for the complex than b55 (figure 1j). Moreover, recombinant phd2 was able to reduce the binding of b55 (but not of b55) to the a subunit of pp2a complex (figure 1k). Altogether, these data suggest that b55 hydroxylation is important to disassemble the pp2a complex, rendering b55 available for degradation . To analyze the degradation of endogenous b55, we silenced phd2 in three breast cancer cell lines, mda - mb231, mcf7, and skbr3 . In all cell lines, we observed an increase of b55 protein levels upon silencing of phd2 (figure 2a) that was not linked to an augmentation in the mrna levels (figures 2b and 2c). Contrariwise, overexpression of phd2 could reduce endogenous b55 protein levels (figure s1f). Because a previous report has shown that b55 plays an important role in response to nutrient deprivation (reid et al ., 2013), in order to investigate the biological readout of our findings, we cultured breast cancer cells in glucose - deprived medium at several time points . We observed that b55 was progressively degraded (figures 2d and 2e) and that, in the same conditions, silencing of phd2 was able to rescue the degradation of b55 (figures 2f and 2 g). Based on the observation that glucose starvation did not affect the overall levels of phd2 accordingly, lack of glucose, by slowing down the tricarboxylic acid (tca) cycle, would lead to a change in the amount of -kg, a co - substrate needed for phd2 activity, as well as fumarate and succinate, two metabolites that inhibit phd2 and derive from the oxidation of -kg in the tca cycle (isaacs et al . To test this hypothesis, we measured by mass spectrometry the levels of -kg, succinate, and fumarate upon glucose starvation . At all the time points tested, in both mda - mb231 and mcf7 cells, the levels of fumarate rapidly declined, whereas succinate was not affected (figures 2h and 2i). As a consequence, the -kg - to - fumarate ratio gradually and significantly increased, possibly playing in favor of phd2 function (figures 2j and 2k). To further explain why fumarate dropped more rapidly than -kg under glucose starvation, we analyzed the levels of malate (that generates from fumarate in the tca cycle) and we measured the amount of -kg deriving from glutamine . In both cell lines, malate levels were tremendously reduced to a similar extent as observed for fumarate (figures 2h and 2i). This, together with the fact that succinate levels were unaltered, suggests a block of succinate dehydrogenase (sdh) activity upon glucose starvation (andreev et al ., 2015). At least in mcf7, the amount of -kg coming from glutamine was increasing under glucose deprivation versus fed conditions, as evidenced by u - c - glutamine fractional labeling (figure s2a). Reductive carboxylation (rc), a pathway that utilizes glutamine - derived -kg to generate citrate and eventually acetyl - coa (metallo et al ., 2011), was slightly but significantly decreased under glucose starvation as proven by a drop of the m + 1 acetyl - coa isotopologue in the presence of 5-c - glutamine (figure s2b). Levels of glutamine - derived -kg were close to the detection limit in mda - mb231 cells (not shown). Overall, our data indicate that, in the absence of glucose, at least in breast cancer cells, a block of sdh activity, per se or together with increased glutamine anaplerosis, results in a high -kg - to - fumarate ratio . We transfected fed and glucose - deprived mcf7 cells with a luciferase construct fused to the oxygen degradation domain of hif1 (oddd - luc). When active, phd2 leads to the degradation of this oddd - luc, resulting in overall reduction of luciferase signal . During glucose starvation, the activity of both endogenous and overexpressed phd2 was strongly increased (figure 2l), and addition of fumarate to the medium was able to rescue this induction (figure s2c), thus supporting that increased phd2 activation in glucose starvation leads to b55 degradation . We then wondered whether the degradation of b55 was necessary for the activation of survival / apoptotic pathways in response to nutrient deprivation (sun et al ., 2015). Cell - cycle analysis showed that deprivation of glucose induced a high percentage of cell death in both mda - mb231 and mcf7 cell lines (figure 3a). However, cells silenced for phd2 showed 30% of reduction in cell death (figures 3a3c), whereas the cell - cycle phases were unchanged (figures s2d and s2e). Furthermore, this protection against cell death was b55 dependent because combined knockdown of b55 and phd2 was able to restore apoptosis in cells silenced for phd2 only (figures 3d, 3e, s2f, and s2 g). Similarly to phd2 silencing, overexpression of b55 or b55 was able to induce protection against cell death as well (figure 3f). Complementing these data, physiological expression of b55 in mcf7 silenced for phd2 was able to reduce glucose starvation - induced cell death, whereas un - degradable b55 was ineffective (figure 3 g). These data demonstrate that phd2-mediated b55 degradation is responsible, at least in part, for cell apoptosis induced by glucose deprivation . Unlike mda - mb231 and mcf7, skbr3 cells were partially resistant to starvation - induced cell death . When skbr3 cells were cultured in glucose - deprived medium, the protein levels of b55 were unchanged and silencing of phd2 did not significantly affect cell death (figures 3h and 3i). Depletion of b55 rendered these cells responsive to glucose deprivation and ultimately able to activate the apoptotic pathway (figure 3j). In a focus - forming assay, glucose starvation partly decreased the number of colonies formed by control skbr3 cells, but combined b55 silencing resulted in a further and stronger reduction (figures 4a and 4b), confirming the relevance of b55 degradation in response to glucose starvation . In order to test whether the molecular interaction between phd2 and b55 had relevance in an in vivo context, we injected subcutaneously mda - mb231 cells stably silenced for ctrl (shctrl) or phd2 (shphd2) in nude mice . When the tumors reached 50100 mm, we treated the mice with glycolysis inhibitor 2-dg (2-deoxy - glucose) (in order to mimic glucose starvation) or a vehicle control . In the presence of phd2 (shctrl), treatment with 2-dg blocks tumor growth with strong efficiency . However, when phd2 is silenced (shphd2), the tumors showed complete resistance to the treatment (figures 4c and 4d). Consistent with our in vitro findings, the levels of b55 were reduced in 2-dg - treated tumors, whereas this degradation was rescued in tumors lacking phd2 (figure 4e). Histological analysis of tumor sections revealed a strong increase of tunel positivity in 2-dg - treated cells that was completely canceled by silencing of phd2, confirming the relevance of its activity in the response to glucose starvation (figure 4f). Altogether, these data prove that phd2-mediated b55 degradation allows breast cancer cell death in response to chronic glucose deprivation . In this study, we uncover two molecular players in response to nutrient restriction: the phosphatase b55/pp2a and the prolyl - hydroxylase phd2 . The pathways involved in the response to nutrient deprivation have been widely investigated . In the absence of nutrients, the stress sensor ampk is activated, leading to the inhibition of mtor and the induction of a metabolic response able to initiate adaptation to nutrient restriction in order to allow the cell to survive in this harsh situation (laplante and sabatini, 2012). Although all of the kinases of this pathway have been studied for decades (brown et al ., 1994), the relevance of phosphatases in this matter has only recently received more attention (reid et al ., 2013, wong et al ., 2015). Upon nutrient starvation, pp2a activity is liberated as a consequence of mtor repression, and this event leads to a pp2a - mediated block of c - myc that thus causes inhibition of proliferation (cianfanelli et al ., 2015, moreover, the inactivation of mtor and the simultaneous activation of pp2a / b55 are necessary to switch on the autophagic pathway in a very early response to amino acid deprivation (wong et al ., 2015). In this study, we have further investigated the link between pp2a / b55 and nutrient shortage, unravelling how a late response to glucose restriction is accomplished by degradation of pp2a / b55. Induced prevention of its degradation (by silencing of phd2) or impaired control of its levels, cause a resistance to cell death . It is thus possible that pp2a / b55 participates in a first - wave reaction in response to nutrient stress by controlling the phosphorylation cascade responsible for the growth arrest / survival of the cells . However, prolonged cell stress leads to the activation of apoptosis, signaled by a reduction in b55 levels that is mediated by phd2 . The role of pp2a in response to nutrient restriction has been highlighted by several studies (cianfanelli et al ., 2015, wong et al ., 2015), and what is mostly emerging from all of them is the tight and reverse relationship between pp2a and mtor signaling under starved conditions . Similarly, we have shown that hypoxic blockade of mtor (via the upregulation of redd1) releases pp2a / b55 activity, allowing dephosphorylation of phd2 and full hif1 stabilization (di conza et al ., 2017). In the current report, we demonstrate that, in a feed - forward loop, phd2 is able to harness its own inhibitor pp2a / b55 by inducing its hydroxylation, ubiquitination, and degradation through the proteasome . These data indicate that b55 is a substrate of the oxygen - sensing enzyme phd2 . However, different from what occurs for hif1, the b55 hydroxylation is not a signal for ubiquitin ligase, but it rather facilitates the detachment of b55 from the main complex pp2a . Indeed, it has been demonstrated that the domain where the proline 319 lies, is involved in the binding with the scaffold a subunit (li and virshup, 2002). Therefore, the hydroxylation in proline 319 by inhibiting this binding favors b55 ubiquitination and degradation . Several reports have highlighted the pro - tumoral activity of b55 (gilan et al ., 2015, hein et al ., 2016, reid et al ., the role of phd2 in cancer is more controversial, having shown even opposite effects in different tumor contexts (chan et al ., 2009, if, on one hand, we show that oxygen shortage enables b55 accumulation, on the other hand, we speculate that in breast cancer cells glucose deprivation reduces the production of fumarate mainly because of a block of sdh (andreev et al ., 2015), tilting the balance toward an excess of -kg at the expense of the phd2 inhibitor fumarate, overall resulting in enhanced phd2 activity and increased b55 degradation . In parallel,, unpublished data) that further boosts phd2 function and therefore b55 degradation (di conza et al ., 2017). Yet, it remains to be defined how glucose starvation causes this sdh block in this specific cell context . Altogether, this study shows that phd2 takes part in the network of nutrient - sensing proteins by regulating pp2a in breast cancer cells . Hek293 t, mcf7, mda - mb231, and skbr3 cell lines were cultured in dmem (gibco) supplemented with 10% heat - inactivated fetal bovine serum (fbs) (gibco), 2 mm glutamine (life technologies), and 100 units / ml penicillin/100 g / ml streptomycin (life technologies). Cells were maintained in a humidified incubator at 37c and 5% co2 . For glucose starvation experiments, dmem glucose - free (life technologies) has been supplemented with heat - inactivated fbs previously dialyzed with slide a lyzer cassette (thermo scientific). Transfections were performed with lipofectamine 2000 transfection reagent or lipofectamine rnaimax (life technologies), according to the manufacturer s instructions . Polar metabolites were extracted using a methanol - water extraction (fendt et al ., 2013). Following extraction, the extract was centrifuged for 10 min at 4c at 20,000 g, and the supernatant was transferred to ms vials . Measurements by gas chromatography (gc) or liquid chromatography (lc) were performed as described in supplemental experimental procedures . An in vitro decarboxylation assay was performed as previously published (zheng et al ., 2014) to assess the hydroxylation of a specific peptide by recombinant phd2 . The sequences of the peptides used are as follows: b55 peptide, wdlnmenrpvetyqvheyl; b55 p - oh peptide, wdlnmenrp#vetyqvheyl (#denotes hydroxylation); hif1 (556575), dldlemlapyipmdddfqlr . Mda - mb231 cells were harvested and single - cell suspensions of 10 10 cells in 100 l of pbs and matrigel solution (1:1) were injected subcutaneously into the flank of cd1 mice . Tumor volumes were measured three times a week with a caliper and calculated using the formula: v = [d d]/6, where d is the minor tumor axis and d is the major tumor axis . Statistical significance was calculated by two - tailed unpaired t test with p <0.05 considered statistically significant . G.d.c . Performed experimental design, experiments, acquisition of data, analysis and interpretation of data and wrote the manuscript.
An ever - increasing number of prostatectomies are being performed using the da vinci robotic system [14]. Multiple reports over the past five years have described the advantages that are characteristically seen with robotic surgery, including decreased blood loss, shorter hospital stay, and a shorter convalescence with a faster return to daily activities and work [510]. More recently, functional results with regard to potency and continence after robotic prostatectomy have also been reported and have demonstrated results that are equal to the open approach [1116]. In addition to issues regarding expedited recovery and potential advantages with regard to urinary control and sparing of potency, the primary goal of cancer control still remains the primary goal of the operation . For robotic prostatectomy to be considered an alternative to the open approach, cancer control must be equivalent or better [1720]. Because robotic prostatectomy is a relatively new technique, long - term follow - up data regarding cancer control is not available . An early marker for oncologic efficacy after radical prostatectomy is the positive surgical margin rate . Cancer at the inked margin suggests incomplete resection and may be associated with a worse prognosis . Although, this point can be debated, a growing body of investigators agree that a positive margin may adversely affect cancer control [1727]. Several recent studies have suggested that leaders in robotic prostatectomy have decreased their own positive margin rates by switching from open to robotic radical prostatectomy [5, 2831]. Theoretically, this improvement is largely attributed to enhanced visualization of the deep pelvis and precision of dissection afforded by the instrumentation . To date, it has not been determined if this phenomenon is transferable to non - fellowship trained urologists in private practice . Herein, we describe the positive margin rates of two non - fellowship trained private practice urologists who converted from open radical retropubic prostatectomy to robot - assisted laparoscopic radical prostatectomy . Our study was a retrospective outcome analysis of radical prostatectomies performed by two non - fellowship - trained private - practice urologists . Both surgeons (j.r.v . And f.w.t .) Their method of choice until september 2004 for removal of the prostate for clinically localized prostate cancer was open radical retropubic prostatectomy . In september 2004 operative and pathologic data was collected via retrospective chart review for the last 50 open radical prostatectomies performed by surgeons 1 and 2 and compared to similar data collected for the first 50 robotic prostatectomies . Table 1characteristics of both surgeons last 50 open retropubic and first 50 robotic prostatectomiescharacteristicopen casesrobotic cases p valuenumber of cases (both surgeons)100100 age64.962.60.03pre - operative psa (ng / ml)8.517.330.3gleason score (median)660.4mean prostate weight51.042.30.01ebl (mean) (cc)7101700.001low - risk profile 62590.8intermediate - risk profile 27310.8high - risk profile 9100.8 low - risk profile = psa <10, gleason score 6, clinical stage t1c or t2a intermediate - risk profile = psa 1020, gleason score 7, stage t2b high - risk profile = psa> 10, gleason score 8, stage t2c characteristics of both surgeons last 50 open retropubic and first 50 robotic prostatectomies low - risk profile = psa <10, gleason score 6, clinical stage t1c or t2a intermediate - risk profile = psa 1020, gleason score 7, stage t2b high - risk profile = psa> 10, gleason score 8, stage t2c the indications for robotic and open prostatectomy were identical . Patients with clinically localized prostate cancer were offered all standard treatment modalities including watchful waiting, hormonal ablation therapy, radical prostatectomy, and radiotherapy (brachytherapy and external beam). Previous abdominal surgery, including preperitoneal hernia repair with mesh, was not considered to be a contraindication for robotic prostatectomy . [32, 33], while the robotic approach was performed as described by ahlering et al . [5, 28] a positive surgical margin was defined as the presence of tumor at the inked margin of the specimen . The same pathologic teams evaluated the specimens and were aware of the switch from the open to robotic technique . No specimen required a re - read and none of the specimens were changed from their first final read . In addition, there was no change in the method of sectioning or reporting methods during the study period . All data as outlined in tables 1 and 2 were collected retrospectively from patient charts . All comparisons were made using the paired t test, with p <0.05 considered statistically significant . Table 2positive surgical margin status by stage for both surgeons performed by the open retropubic and robotic approachopenroboticsurgeon 1mean gg6.66.8mean pre - op psa8.18.3mean prostate weight49.440.4pt2 (all) + margins15 of 41 (36.6%)2 of 35 (5.7%)t3a + margins5 of 7 (71.4%)5 of 11 (45%)t3b + margins0 of 0 (0%)3 of 4 (75%)t4 + margins2 of 2 (100%)0 of 0 (0%)total positive margins22 of 50 (44%)10 of 50 (20%)surgeon 2mean gg6.46.4mean pre - op psa8.96.4mean prostate weight52.644.2pt2 (all) + margins8 of 38 (27.5%)3 of 42 (7%)t3a + margins1 of 3 (33.3%)2 of 3 (67%)t3b + margins4 of 9 (44.4%)4 of 5 (80%)t4 + marginsnanatotal positive margins13 of 50 (26%)9 of 50 (18%) positive surgical margin status by stage for both surgeons performed by the open retropubic and robotic approach our study was a retrospective outcome analysis of radical prostatectomies performed by two non - fellowship - trained private - practice urologists . Both surgeons (j.r.v . And f.w.t .) Their method of choice until september 2004 for removal of the prostate for clinically localized prostate cancer was open radical retropubic prostatectomy . In september 2004 operative and pathologic data was collected via retrospective chart review for the last 50 open radical prostatectomies performed by surgeons 1 and 2 and compared to similar data collected for the first 50 robotic prostatectomies . Table 1characteristics of both surgeons last 50 open retropubic and first 50 robotic prostatectomiescharacteristicopen casesrobotic cases p valuenumber of cases (both surgeons)100100 age64.962.60.03pre - operative psa (ng / ml)8.517.330.3gleason score (median)660.4mean prostate weight51.042.30.01ebl (mean) (cc)7101700.001low - risk profile 62590.8intermediate - risk profile 27310.8high - risk profile 9100.8 low - risk profile = psa <10, gleason score 6, clinical stage t1c or t2a intermediate - risk profile = psa 1020, gleason score 7, stage t2b high - risk profile = psa> 10, gleason score 8, stage t2c characteristics of both surgeons last 50 open retropubic and first 50 robotic prostatectomies low - risk profile = psa <10, gleason score 6, clinical stage t1c or t2a intermediate - risk profile = psa 1020, gleason score 7, stage t2b high - risk profile = psa> 10, gleason score 8, stage t2c the indications for robotic and open prostatectomy were identical . Patients with clinically localized prostate cancer were offered all standard treatment modalities including watchful waiting, hormonal ablation therapy, radical prostatectomy, and radiotherapy (brachytherapy and external beam). Previous abdominal surgery, including preperitoneal hernia repair with mesh, was not considered to be a contraindication for robotic prostatectomy . [32, 33], while the robotic approach was performed as described by ahlering et al . A positive surgical margin was defined as the presence of tumor at the inked margin of the specimen . The same pathologic teams evaluated the specimens and were aware of the switch from the open to robotic technique . No specimen required a re - read and none of the specimens were changed from their first final read . In addition, there was no change in the method of sectioning or reporting methods during the study period . All data as outlined in tables 1 and 2 were collected retrospectively from patient charts . All comparisons were made using the paired t test, with p <0.05 considered statistically significant . Table 2positive surgical margin status by stage for both surgeons performed by the open retropubic and robotic approachopenroboticsurgeon 1mean gg6.66.8mean pre - op psa8.18.3mean prostate weight49.440.4pt2 (all) + margins15 of 41 (36.6%)2 of 35 (5.7%)t3a + margins5 of 7 (71.4%)5 of 11 (45%)t3b + margins0 of 0 (0%)3 of 4 (75%)t4 + margins2 of 2 (100%)0 of 0 (0%)total positive margins22 of 50 (44%)10 of 50 (20%)surgeon 2mean gg6.46.4mean pre - op psa8.96.4mean prostate weight52.644.2pt2 (all) + margins8 of 38 (27.5%)3 of 42 (7%)t3a + margins1 of 3 (33.3%)2 of 3 (67%)t3b + margins4 of 9 (44.4%)4 of 5 (80%)t4 + marginsnanatotal positive margins13 of 50 (26%)9 of 50 (18%) positive surgical margin status by stage for both surgeons performed by the open retropubic and robotic approach the transition to robotic prostatectomy in our private - practice setting occurred on september 1, 2004 . None of the robotic prostatectomies for either surgeon required conversion to open surgery . Since there was a transition point for a change in the surgical technique we do not feel that there is a selection bias between both groups as they represent all newcomers to our practice . To ensure that the open surgery and robotic surgery groups were clinically comparable, the pre - operative clinical parameters were attained and are presented in table 1 . There were no significant differences between the groups with regard to age, pre - operative psa or gleason score . In addition, when stratified by risk profile there was no significant difference between the number of low-, intermediate-, and high - risk patients in each cohort (table 1). Table 2 compares the positive surgical margin rates in both groups of patients for both surgeons . The overall positive margin rate and pt2 positive margin rate for surgeon 1 dropped from 44 to 20% and from 37 to 5.7%, respectively, after changing from open to robotic prostatectomy . For surgeon 2, the overall positive margin rate decreased from 26 to 18% and the pt2 positive margin rate decreased from 27.5 to 7% after converting . A review of the locations for the positive margins in table 3, demonstrates that the majority of positive margins for both surgeons in the open approach was at the apex, while for the robotic approach they were primarily at the bladder neck for one surgeon and posterolateral for the other . Table 3location of the majority of positive margins of both surgeons by both approachessurgeonopenroboticsurgeon 1apexbladder necksurgeon 2apexposterolateral location of the majority of positive margins of both surgeons by both approaches several studies have demonstrated that a positive surgical margin in a radical prostatectomy specimen is an independent predictor of disease recurrence, and the need to receive adjuvant therapy [17, 19, 21, 2426, 34]. Therefore, prevention of positive surgical margins is a critical endpoint of radical prostatectomy . In a study performed by eastham, it was demonstrated that the surgeon is an independent risk factor for positive surgical margins even after adjusting for various patient and disease characteristics . It was also found that surgeons with higher - volume practices have lower positive surgical margin rates . Theoretically, the lower positive margin rates amongst high - volume surgeons is the result of technique refinement . The data has varied with regard to the impact of surgical technique on surgical margin status . A recent review of the open radical prostatectomy literature shows the incidence of positive surgical margins to ranges from 10 to 48% . The positive margin rates for laparoscopic and robotic prostatectomy are relatively comparable and range between 5.7 and 29% [3538]. Several recent reports regarding surgical margin status in conjunction with the known advantages of robotic prostatectomy have demonstrated that expert open prostatectomists exhibit an improvement in their personal positive surgical margin rates after switching to the robotic approach [5, 7, 2830, 39]. Has shown with the use of the da vinci robot, surgeons can potentially benefit from the advantages of minimally invasive surgery and also be able to markedly reduce the risk of iatrogenic positive margins in patients with pt2 prostate cancer . This phenomenon has been replicated at several centers of excellence, but it is not known if this phenomenon applies to the private - practice urologist and, if so, what may be the key factors governing the robotic benefit . We believe that that the superior positive margin rates obtained after converting to the robotic - assisted approach can be explained by two main factors . The most critical factor was that the individual surgeons made a concerted effort to retrain in how to perform the procedure by observing and emulating experts . Second, the magnified three - dimensional (3-d) view of the pelvis, the precision movements afforded by the articulating robotic instrumentation and the bloodless field secondary to the pneumoperitoneum fostered a more precise dissection of the prostate . In combination, these two factors seemed to make a marked difference with regard to the ability of these two surgeons to obtain surgical margins . Of critical importance to the successful improvement of margins was the seamlessness of the transition from open to robotic - assisted procedures . The most critical factor was that the individual surgeons made a concerted effort to retrain in how to perform the procedure by observing and emulating experts . After attending a three - day training course at university of california, irvine, consisting of observation and cadaver training in the laboratory, the two surgeons returned to their institutions and made a 100% conversion from open to robotic prostatectomy . Surgeon 1 had his first four cases proctored by an expert in robotic prostatectomy that acted as the bedside assistant for the cases . Thereafter surgeon 1 was assisted by another robotic - trained but nonexpert attending urologist or a robotic - trained chief urology resident . Surgeon 2 also had 4 cases proctored by an expert robotic surgeon who acted as a bedside assistant but also had some additional training during the first 20 cases, during which an expert robotic surgeon acted as the bedside assistant while giving real - time feedback and input . Traditionally, the proctor for the first few robotic prostatectomies does not scrub in as an assistant; they give verbal instruction and advice . We feel that having a hands - on expert proctor as the assistant made a major difference with regard to achieving proficiency more quickly . In addition to aforementioned factors, the well - described advantages of the da vinci robotic system (magnified 3-d view of the pelvis, the precision movements afforded by the articulating robotic instrumentation) as well as the bloodless field secondary to the pneumoperitoneum fostered a more precise dissection of the prostate . Secondly, a dedicated surgical staff was in place, including nurses and technologists all of whom underwent thorough training to familiarize them with the robot . And finally, the bedside surgical assistants were all comfortable with the robot, familiar with the surgery, and had themselves spent time at the console . With chief and senior residents at our institution logging roughly 50 robotic prostatectomies, and averaging 15 as primary surgeon, the bedside assistants were clearly quite facile with the entire procedure and greatly aided in making the transition as smooth as possible . All of these factors allowing this ease of transition were made possible by absolute dedication to the robotic platform . As was previously noted, since the decision to adopt the robot was made, only two case has been performed in the open manner . The wholehearted adoption allowed for rapid assimilation of the knowledge and skills, which are evidenced by the ability of these two surgeons to obtain negative surgical margins . The open and robotic - assisted groups were similar with regard to preoperative characteristics and the transition from 100% open to 100% robotic prostatectomies was made abruptly in september of 2004 with no mixing of techniques . Therefore, we do not believe that the stated results can be explained by selection bias . It might be argued that the perceived improvement in positive margin rates was attributable to the high number of positive margins in the open group . Although, the positive margin rates were high in the open group for both surgeons (36.6 and 27.5%), they are still within the reported range noted in a current study . Since most urologists do not routinely keep track of their margin data, we believe that these high rates may be reflective of many others . We feel strongly that the process of retraining and taking advantage of the robotic technology may help urologists improve their results markedly . Finally, upon reviewing the locations for the positive margins, we learned that the majority of positive margins for both surgeons in the open approach was at the apex, indicating a likely problem with visualization of the deep pelvis, while during the robotic approach they were primarily at the bladder neck for one surgeon and posterolateral for the other . Since making this realization both surgeons have made concerted efforts to further refine their technique of dissection in these areas . Although not routinely performed during the study period, a video review of the cases with positive margins would have been helpful in this regard . Changing from open to robotic - assisted radical prostatectomy may improve the ability of urologists to obtain negative surgical margins . This phenomenon does seem to apply to non - fellowship - trained urologists in private practice provided they undergo formal robotic training, and can be realized within the first 50 cases performed . Finally, it is only through the maintenance of a surgical database that stark realizations such as the results outlined in this paper can be realized.
Anterior procedures are increasingly recognized as advantageous for multilevel cervical decompression in a compromised anterior spinal cord, having the ability for anterior release, durable reconstruction of physiological alignment and instrumented fusion through a less complicated approach compared to the posterior approach surgery . With anterior procedures, decompression of the neurologic structures can be accomplished by means of segmental disectomy or corpectomy . However, in many cases, multilevel anterior disectomy or corpectomy and reconstruction is required . In such cases, the fusion and complication rates at the anterior cervical spine have been shown to have a direct correlation with the mechanical stability of fixation . There are numerous reports of failure of instrumentation, especially in the weakened osteoporotic, neoplastic or infectious spine . In such cases, such surgeries are known to have more complications . To avoid the additional posterior surgery in such cases, without compromising the biomechanical stability of the cervical anterior screw - plate constructs, some authors introduced the concept of anterior transpedicular screw fixation and fusion . Successful placement of anterior transpedicular screws in the cervical spine requires accurate identification of the screw axis depending on a sufficient three - dimensional understanding of the anatomical morphology of the pedicle . As a result of the anatomical features of the cervical pedicle and its intimately close relationship to critical neural and vascular structures, navigation of this structure poses serious risks and unfortunately little data exists on the anatomical morphologic character for cervical anterior transpedicular screw fixation . The aim of the present study, was to investigate anatomical morphologic trends with respect to linear and angular parameters associated with anterior transpedicular screw fixation in the cervical spine . Morphological parameters for cervical anterior transpedicular screw fixation were measured using a helical computed tomography (ct) scan and reconstruction at the radiology imaging department of our university hospital . Informed consent was taken from all subjects and the institute ethics committee approved the study protocol . There were 18 males and 18 females, ranging in age from 22 years to 75 years (43.80 8.02). Subjects with evidence of infectious, neoplastic, traumatic or congenital spine anomalies and significant degenerative changes were excluded from the study . Cervical ct scans were performed with a general electric light speed helical ct scanner (siemens, germany). Sagittal, oblique sagittal and coronal bony window reconstruction images of the cervical pedicles from c3 to c7 were obtained using 0.75 mm thickness slices . The following left pedicle parameters were determined as diagrammatically shown in figure 1, using the measuring tools of the centricity web imaging software . (a) maximal pedicle axial length (the distance between a and b point), pedicle transverse angle (, angle formed between pedicle axis and mid - sagittal line, distance transverse insertion point (the distance between point a and c) and outer pedicle width (distance medial border of transverse foramen and medial border of pedicle). (b) out pedicle height (distance upper to lower pedicle surface in the sagittal plane), distance of the insertion point to the upper end plate (distance between point a and e) and pedicle sagittal transverse angle (, angle formed between plane of anterior vertebral body wall at mid - sagittal line and pedicle axis) angle formed between transverse pedicle axis and mid - sagittal line . Angle formed between plane of anterior vertebral body wall at mid - sagittal line and pedicle axis, distance between the distance of the insertion point to the upper end plate (diup) in the sagittal plane . Distance between the transverse intersection point and mid - sagittal line at the anterior vertebral body wall . (outer pedicle width [opw], a distance medial border of transverse foramen to the medial border of pedicle). Distance upper to lower pedicle surface in the sagittal plane, maximal pedicle axis length (mpal), distance from the posterior cortex of the lateral mass to the anterior wall of the vertebral body along the pedicle axis . Descriptive statistics including mean values, standard deviations and ranges were used to summarize data . The independent t test was performed to analyze the difference of the parameters for cervical anterior transpedicular screws fixation between females and males p <0.05 was considered statistically significant . Angle formed between plane of anterior vertebral body wall at mid - sagittal line and pedicle axis, distance between the distance of the insertion point to the upper end plate (diup) in the sagittal plane . Distance between the transverse intersection point and mid - sagittal line at the anterior vertebral body wall . (outer pedicle width [opw], a distance medial border of transverse foramen to the medial border of pedicle). Distance upper to lower pedicle surface in the sagittal plane, maximal pedicle axis length (mpal), distance from the posterior cortex of the lateral mass to the anterior wall of the vertebral body along the pedicle axis . Descriptive statistics including mean values, standard deviations and ranges were used to summarize data . The independent t test was performed to analyze the difference of the parameters for cervical anterior transpedicular screws fixation between females and males p <0.05 was considered statistically significant . The mean and standard deviations of linear and angular parameters were calculated at each level . There were 36 opw (25 in females and 11 in males), less than 4.0 mm and only four oph in females less than 4.0 mm . The overall average oph ranged from 5.8 0.9 mm to 7.3 1.4 mm in c3 - 7 . The largest oph was found at c7 in both males (7.6 1.7 mm) and females (7.1 1.6 mm). The smallest average of oph was found at c5 in females and males (5.4 0.7 mm and 6.3 0.9 mm). The average oph was significantly greater in males than in females at c3 - 6, but there was no difference at c7 [figure 2a]. (a) average of out pedicle height was greater significantly in males than in females at c3 - 6 (p<0.05), but there was no difference at c7 (p>0.05); (b) the average of outer pedicle width was greater significantly in males than in females at all levels p<0.05 the overall average opw ranged from 4.3 1.0 to 6.0 1.3 mm in c3 - 7 . The smallest mean pw was found at c3 in both males (4.7 1.2 mm) and females (3.9 0.5 mm); the largest mean opw was at c7 in both males (5.8 1.5 mm) and females (5.5 0.5 mm). The average of opw was significantly greater in males than in females at all levels [figure 2b]. The overall mean diup in c3 - 7 ranged from 4.0 0.8 to 4.4 1.2 mm . The maximal mean value of diup was found at c7 and c3 in females (4.6 0.8 mm) and males (4.8 1.4 mm). The minimal mean value was observed at c6 and c4 in females (3.9 0.8 mm) and males (3.8 1.0 mm). The average of diup was significantly greater in males than in females in c3, 4, 6, 7 levels, but there was no significant difference between females and males at c5 [figure 3a]. (a) average of distance of the insertion point to the upper end plate was significantly greater in males than in females in c3, 4, 6, 7 levels, but it was no significant difference between females and males at c5 . (b) the average of maximal pedicle axis length was greater in males than in females at all levels, and this difference were statistically significant at all levels (p <0.05) the overall average mpal ranged from 31.8 2.0 mm to 33.3 2.4 mm . The maximum mean mpal in females and males was found at c6 (3 2.4 1.8 mm) and c7 (34.7 2.5 mm). The minimum mean value of mpal was found at c4 in females (30.7 1.4 mm) and c3 in males (32.5 2.4 mm). The average mpal was greater in males than in females at all levels and the difference was statistically significant at all levels (p <0.05) [figure 3b]. The overall mean dip in c3 - 7 ranged from 3.1 0.8 mm to 4.5 1.1 mm . The largest mean value of dip was found at c5 in females (4.3 1.3 mm) and c4 in males (4.9 1.1 mm). The smallest value was at c 7 in both females (2.8 1.9 mm) and males (2.8 1.9 mm). The average of dip was greater in males than in females at c3 (p <0.05), but there was no statistically significant difference between females and males at c4 - 7 levels [figure 4a]. (a) average of distance transverse insertion point was greater in males than in females at c3 (p<0.05), but there was no significant difference between females and males at c4 - 7 levels (p>0.05); (b) the average of pedicle transverse angle was significantly greater in males than in females at c3, but there were no statistically difference between females and males at c4 - 7 levels the overall mean pta ranged from 44.4 3.1 to 47.1 4.1. the smallest mean pta was found at c6 in both males (44.9 3.8) and females (43.9 4.8). The largest mean pta was observed at c3 in males (47.6 2.1) and at c5 in females (47.8 4.0). The average pta was significantly greater in males than in females at c3, but there was no statistical difference between females and males at c4 - 7 levels [figure 4b]. The overall mean psta ranged from 99.2 6.7 to 105.4 6.0. the smallest mean psta was found at c7 in both males (99.1 5.8) and females (99.3 7.6). The maximal mean value of psta was recorded at c6 in males (109.1 5.4) and at c4 in females (104.8 6.2). The mean value of psta showed no statistically significant differences at c3 - 4 and c7 level between genders, and was significantly greater in males than females at c5 - 6 [figure 5]. The mean value of pedicle sagittal transverse angle was no statistically significant differences at c3 - 4 and c7 level between gender and there was significant greater in males than n females at c5 - 6 the overall average oph ranged from 5.8 0.9 mm to 7.3 1.4 mm in c3 - 7 . The largest oph was found at c7 in both males (7.6 1.7 mm) and females (7.1 1.6 mm). The smallest average of oph was found at c5 in females and males (5.4 0.7 mm and 6.3 0.9 mm). The average oph was significantly greater in males than in females at c3 - 6, but there was no difference at c7 [figure 2a]. (a) average of out pedicle height was greater significantly in males than in females at c3 - 6 (p<0.05), but there was no difference at c7 (p>0.05); (b) the average of outer pedicle width was greater significantly in males than in females at all levels p<0.05 the overall average opw ranged from 4.3 1.0 to 6.0 1.3 mm in c3 - 7 . The smallest mean pw was found at c3 in both males (4.7 1.2 mm) and females (3.9 0.5 mm); the largest mean opw was at c7 in both males (5.8 1.5 mm) and females (5.5 0.5 mm). The average of opw was significantly greater in males than in females at all levels [figure 2b]. The overall mean diup in c3 - 7 ranged from 4.0 0.8 to 4.4 1.2 mm . The maximal mean value of diup was found at c7 and c3 in females (4.6 0.8 mm) and males (4.8 1.4 mm). The minimal mean value was observed at c6 and c4 in females (3.9 0.8 mm) and males (3.8 1.0 mm). The average of diup was significantly greater in males than in females in c3, 4, 6, 7 levels, but there was no significant difference between females and males at c5 [figure 3a]. (a) average of distance of the insertion point to the upper end plate was significantly greater in males than in females in c3, 4, 6, 7 levels, but it was no significant difference between females and males at c5 . (b) the average of maximal pedicle axis length was greater in males than in females at all levels, and this difference were statistically significant at all levels (p <0.05) the overall average mpal ranged from 31.8 2.0 mm to 33.3 2.4 mm . The maximum mean mpal in females and males was found at c6 (3 2.4 1.8 mm) and c7 (34.7 2.5 mm). The minimum mean value of mpal was found at c4 in females (30.7 1.4 mm) and c3 in males (32.5 2.4 mm). The average mpal was greater in males than in females at all levels and the difference was statistically significant at all levels (p <0.05) [figure 3b]. The overall mean dip in c3 - 7 ranged from 3.1 0.8 mm to 4.5 1.1 mm . The largest mean value of dip was found at c5 in females (4.3 1.3 mm) and c4 in males (4.9 1.1 mm). The smallest value was at c 7 in both females (2.8 1.9 mm) and males (2.8 1.9 mm). The average of dip was greater in males than in females at c3 (p <0.05), but there was no statistically significant difference between females and males at c4 - 7 levels [figure 4a]. (a) average of distance transverse insertion point was greater in males than in females at c3 (p<0.05), but there was no significant difference between females and males at c4 - 7 levels (p>0.05); (b) the average of pedicle transverse angle was significantly greater in males than in females at c3, but there were no statistically difference between females and males at c4 - 7 levels the overall mean pta ranged from 44.4 3.1 to 47.1 4.1. the smallest mean pta was found at c6 in both males (44.9 3.8) and females (43.9 4.8). The largest mean pta was observed at c3 in males (47.6 2.1) and at c5 in females (47.8 4.0). The average pta was significantly greater in males than in females at c3, but there was no statistical difference between females and males at c4 - 7 levels [figure 4b]. The overall mean psta ranged from 99.2 6.7 to 105.4 6.0. the smallest mean psta was found at c7 in both males (99.1 5.8) and females (99.3 7.6). The maximal mean value of psta was recorded at c6 in males (109.1 5.4) and at c4 in females (104.8 6.2). The mean value of psta showed no statistically significant differences at c3 - 4 and c7 level between genders, and was significantly greater in males than females at c5 - 6 [figure 5]. The mean value of pedicle sagittal transverse angle was no statistically significant differences at c3 - 4 and c7 level between gender and there was significant greater in males than n females at c5 - 6 transpedicular screw fixation provides greater strength to pull - out than does lateral mass screw fixation or screw fixation into the vertebral body . However, due to the close proximity of the spinal cord, nerve roots and vertebral arteries, transpedicular cervical screw fixation has been considered inherently more risky than cervical vertebral body fixation and is supposed to be technically more demanding . Transpedicular fixation of the cervical spine is not widely performed because of its complex morphological structures . There are numerous reports of screw penetrating the pedicle due to the variation of cervical pedicle morphology . It is, therefore very important to sufficiently understand the three dimensional pedicle morphology for pedicle screw fixation . Recently, several studies have been aimed at describing the anatomical morphologic characteristics of the cervical pedicle for posterior transpedicular screw fixation . Koller et al . Had reported that the morphologic character for cervical anterior transpedicular screw fixation was not different between left and right sides . We had previously investigated the morphologic characters and clinical results for cervical anterior transpedicular screw fixation at c2 . Most right handed surgeons believed that the right side incision is more convenient and pedicle screws can only be implanted in the left pedicle . To measure the pedicle morphologic parameters, the helical ct scan is more accurate than artificial measure (means manual measure in vitro). In vivo measurements of the cervical pedicle using ct images are believed to provide more accurate linear and angular pedicular dimensions than similar measurements obtained manually in cadavers . In the present study, we used helical ct scan and reconstruction imaging to evaluate the in vivo cervical pedicle parameters . The measurements have been performed independently by three radiologists and the averages were analyzed . In this study, the orientation of pedicles was described as pta and psta and the insertion point was identified by the dip and diup . The overall mean dip and diup ranged from 3.1 0.8 mm to 4.5 1.1 mm and 4.0 0.8 to 4.4 1.2 mm, respectively . The overall mean pta and psta ranged from 40.6 3.1 to 47.1 4.1 and 99.2 6.7 to 105.4 5.0 in this study . As cervical posterior pedicle screw fixation, the opw and oph for anterior transpedicular fixation need to be larger than 4 mm to accept the smallest screw available today which has a diameter of 3.5 mm . In the present study, the overall average opw and oph were ranged from 4.3 1.0 mm to 6.0 1.3 mm and 5.8 0.9 mm to 7.3 1.4 mm in c3 - 7 . There were 36 opw (25 in females and 11 in males) was less than 4.0 mm, and only four oph in females were less than 4.0 mm . Furthermore, we found that the average of oph and opw were greater in males than in females at all levels (p <0.05). The data suggests that when compared with the male population, a smaller percentage of female cervical pedicles will be able to accommodate the smallest cervical pedicle screw available today . Diup should be sufficiently larger to accept the pedicle screws available today . However, there was no data of diup in present literature for the placement of anterior transpedicular screws in the cervical spine . We a hypothesized that the diup>2.0 mm is feasibile for placement of anterior transpedicular screws in the cervical spine . In our study, diup ranged from 4.0 0.8 mm to 4.4 1.2 mm, and only four diup were less than 2.0 mm (observed in females). Our data suggested that it was possible in most patients to do a cervical anterior transpedicular fixation . In our study, the mpal was larger than those reported in others studies, which investigated mpal for cervical posterior transpedicular fixation . The mpal was lower in females than that in males at all levels and the difference was statistically significant (p <0.05). Our data indicated that the anterior transpedicular screw fixation in the cervical spine, results in more strength and can provide longer pathway than in cervical posterior transpedicular fixation . Thus longer pedicle screws can be used in males than in females for anterior transpedicular screw fixation in the cervical spine . To conclude the results suggest that the placement of cervical anterior transpedicular screws should be individualized for each patient . The preoperative helical ct scans and reconstructions for patients who would undergo cervical anterior transpedicular fixation should be thoroughly analyzed with attention to the pedicle size and its angulation.
Tear fluid drains through the lacrimal punctum into the lacrimal canaliculi; it then flows through the lacrimal sac and the nasolacrimal duct before being absorbed by the nasal mucosa . When this pathway becomes blocked, the resulting condition is known as nasolacrimal duct obstruction, which may be either congenital or acquired . Over the last 15 years, our clinic has experienced 64 cases of nasolacrimal duct obstruction, all of which were successfully treated with lacrimal passage irrigation . In this procedure, 0.4% xylocaine ophthalmic solution is injected using a 1-ml syringe tube and a lacrimal passage irrigation needle, with the tip of the needle being inserted into the inferior lacrimal punctum pointing toward the nose and facing slightly downward . To facilitate irrigation, the patient is asked to snort in order to create negative pressure in the nasal cavity . Once the patient has registered the bitter taste of the xylocaine, irrigation should be performed repeatedly with physiological saline . In these 64 cases, we performed at least 10 irrigations for each patient, and for some, we performed 50 or more . Of the 64 cases, recurrence only occurred in the 1 case that we present here . In this patient, the blockage resulted from rice grains ingested over a period of many years, forming an obstructive mass . The patient, a 39-year - old male who works as a surgeon and is the lead author of this report, experienced abnormal lacrimation of the left eye while at work . However, the condition recurred 5 times during the following 2 years despite repeated irrigation on each occasion . During the sixth treatment, after approximately 20 irrigations had been completed, an object was suddenly ejected into the rear of the patient's nasal cavity . On histological examination, this object was found to be an agglomeration of rice grains (fig . 1, fig . 2) and was believed to have penetrated the nasolacrimal duct over a long period via reflux through hasner's valve . This mass then became molded into a rectangular, cone - shaped plug, matching the shape of the nasolacrimal duct . Since this successful treatment, there has been no further recurrence . Approximately 1 month after completing treatment, the author underwent detailed examination of the paranasal sinuses by an otolaryngologist using fiberscopy . Although it was not possible to view up to hasner's valve, no other abnormalities were noted within the range visible by fiberscopy . To the best of our knowledge, there have been no other reported cases of nasolacrimal duct obstruction caused by the retention of foodstuffs . The patient had a habit of talking while eating, and we concluded that a rice grain had at some point penetrated the orifice of the nasolacrimal duct from the nasal cavity side via reflux through hasner's valve . This led to incomplete valve closure and allowed the subsequent entry of a succession of rice grains, coalescing into a single mass and causing the blockage . In this case, the nasolacrimal duct appears to have been nearly completely obstructed by a lump of rice . During initial treatment, neither anesthetics nor physiological saline solution could pass through the duct, instead pouring out of the inferior punctum . In the latter phase of treatment, as the lump of rice started to slowly drop down into the paranasal sinus, water was gradually able to pass through the site despite meeting some resistance . When the lump of rice emerged from the paranasal sinus, this resistance to passing physiological saline solution disappeared and the patient suddenly felt physiological saline solution flow into the paranasal sinus . Backflow caused the rice grain to initially enter the nasolacrimal duct, after which deposits built up over a number of years to cause an obstruction . We then started to treat this with flushing, which could not have caused the backflow considering the chronology, because there is no possibility that backflow occurred as a result of flushing . Nasolacrimal duct obstruction is typically attributed to the accumulation of ocular discharge within the lacrimal passages; however, such cases may be more common, although they may go unrecognized . In the treatment of nasolacrimal duct obstruction, a bougie is normally inserted immediately after an irrigation test . Because this blind insertion can be dangerous however, we believe that successful treatment is possible using only repeated irrigation with physiological saline . This approach is safe and simple, allows flushing of the entire lacrimal passage, and is effective in preventing recurrences . To perform this procedure, the physician should wait for the water to completely pass through during the irrigation test . Then, instead of immediately inserting a bougie, irrigation should be patiently repeated numerous times . Therefore, the irrigation should be considered not only as a test but also as a form of washout therapy . The patient reported here first presented with persistent lacrimation . Only after repeated unsuccessful treatments was it determined to be due to obstruction by impacted foodstuffs . We have never observed any other cases in which a lump of foodstuff was retained in the nasolacrimal duct and caused an obstruction, as in the present patient . In other cases, the discharge contained in tears adhered to the lumen of the nasolacrimal duct and caused either narrowing or a state close to obstruction . Therefore, such cases could be treated using flushing performed repeatedly to gradually wash out the discharge . This is not a frequent cause of nasolacrimal obstruction, but it should perhaps be considered as a possible factor in similar cases of refractory nasolacrimal disorders.
Intelligent drug carriers have attracted much attention in biomedical applications due to their size, core - shell structure, decoration with targeting ligands, and stimuli - responsive properties . Recently, ph and/or temperature - sensitive micro / nano - particles have been intensively investigated for controlled drug delivery systems. [37] among the various temperature - sensitive polymers, poly(n - isopropylacrylamide) [poly(nipaam)] is the most often employed material as a core or shell in the forms of particle and gel. [810] generally, poly(nipaam) exhibits a hairy structure below the lower critical solution temperature (lcst) and undergoes hydrophobic aggregation above the lcst due to a change in hydrogen bonding between water and amide groups of poly(nipaam). Therefore, particles consisting of poly(nipaam) show a unique conformational behavior with respect to environmental temperature, eventually allowing for the thermosensitive drug release . Pluronic surfactants, poly(ethylene oxide)-poly(propylene oxide)-poly(ethylene oxide) (peo - ppo - peo), are known triblock copolymers with biocompatible properties . To extend their application, a few researchers had synthesized functional copolymers based on pluronic surfactants by polymerizing hydrophilic or hydrophobic segments at the ends of the peo blocks . Polymerized hydrophobic segments at the ends of a pluronic surfactant to improve the hydrophobic property for the better encapsulation of liphophilic drugs . Synthesized pentablock terpolymers based on poly(nipaam) and a pluronic surfactant by atomic transfer radical polymerization and characterized their micelle formation at different temperatures . However, the fabrication of microparticles using a poly(nipaam)-pluronic surfactant and their application for controlled drug delivery have not been reported . In this study, thermosensitive poly(nipaam)-pluronic surfactants with different lengths of poly(nipaam) were synthesized by activating two hydroxyl groups at the ends of pluronic f68 using redox initiator[1416] and subsequently adding a nipaam monomer . Poly(d, l - lactide - co - glycolide) (plga) microparticles were produced by the typical oil - in - water emulsification method using poly(nipaam)-pluronic surfactants in an aqueous continuous phase . The rationale for our approach is as follows: at room temperature (below the lcst), plga microparticles prepared using poly(nipaam)-pluronic surfactants exhibit appropriate colloidal stability due to the hairy structure of poly(nipaam) at the surface of the microparticles . When the plga microparticles are injected into the human body, the poly(nipaam) block shrinks and forms a hydrophobic layer at the surface of the microparticles, eventually resulting in the sustained release of the drug . The ultimate goal of this work is to evaluate the feasibility of the poly(nipaam)-pluronic copolymer as a surfactant and demonstrate its application for a controlled drug delivery . N - isopropylacrylamide (nipaam), ceric ammonium nitrate (can), nitric acid, nile - red (nr), ethyl acetate, and poly(d, l - lactide - co - glycolide) (plga, 75:25, mw 66,000107,000) were purchased from sigma - aldrich (usa). Distilled water (di) from a milli - q water purification system (direct - q 3; millipore, bedford, md, usa) with a resistance of 18 mcm was used . Poly(nipaam)-pluronic surfactants with different lengths of poly(nipaam) were synthesized by the polymerization of nipaam at the ends of the hydroxyl group of pluronic f68 using can as a redox initiator . Di water (150 g) was poured into a double - jacket reactor equipped with a mechanical stirrer, nitrogen inlet apparatus, and a reflux condenser . Pluronic f68 (3 g) was poured into the reactor with stirring at 200 rpm at 65c . The solution of can (0.1 g) and nipaam (0.1, 0.2, and 0.25 g) in 5 ml of nitric acid (0.2 mol / l) was added and then polymerization progressed for 4 h under a nitrogen atmosphere . The resultant was sufficiently cleaned using a dialysis membrane (mwco 60008000; membrane filtration products, inc ., tx, usa) and then dried at 25c for 12 h in a vacuum oven . The prepared poly(nipaam)-pluronic surfactants were characterized by ft - ir (tensor27, bruker, the netherlands) and gel filtration chromatography, gpc, (waters breeze system; waters co., usa). The gpc column was a series of styragel columns (hr5, hr4, hr1, and hr5e) and thf was used as an eluent at a flow rate of 1 ml / min and 1 10 pa pressure . Polystyrene samples (sigma - aldrich) with different molecular weights were used for the standard in gpc analysis . To measure the critical micellar concentration (cmc), aqueous solutions with different concentrations of the poly(nipaam)-pluronic surfactant (0.01, 0.025, 0.05, 0.1, 0.25, and 0.5 wt.%) were prepared and the surface tensions of the samples were measured using a semiautomatic tension meter (surface tensiomat 21, fisher scientific, usa). From the plot of surface tension versus concentration, the cmc value could be obtained as the intersect point of two regressed lines . Plga microparticles were prepared using an oil - in - water emulsion and solvent evaporation method at room temperature . In brief, an oil phase containing plga (0.2 g) and nr (1 mg) in ethyl acetate (10 g) was poured into an aqueous phase (50 g) containing a poly(nipaam)-pluronic surfactant (0.5 g) and subsequently emulsified for 7 min with a high - speed homogenizer at 10,000 rpm (omni international, waterbury, ct, usa), followed by stirring for 6 h for solvent evaporation . After placing the samples in the water bath at the different temperatures at 15c and 37c for 1 h, the average size of the microparticles was determined by the dynamic light scattering method (dls, zetaplus; brookhaven inst . After fabricating the plga microparticles containing nile red, the encapsulation efficiency was measured by the centrifugation of the dispersion containing the plga microspheres and then analyzing the amount of nile red in the aqueous continuous phase using a uv spectrophotometer (uv-1601, shimadzu, japan) at 460 nm . In all the cases, the cumulative release of the dye was calculated on the base of the total encapsulated amount of the dye . For the release profile, 20 ml of a microparticle suspension (4 mg / ml) was sealed in a dialysis tube (mwco 6000 - 8000), and then placed in 100 ml of the pbs medium (ph 7.4) with gentle shaking at 37c . At predetermined time intervals, 4 ml of the solution was collected from the released media and replaced with fresh pbs . The released nile red was analyzed by a uv / vis spectrophotometer at different time points . N - isopropylacrylamide (nipaam), ceric ammonium nitrate (can), nitric acid, nile - red (nr), ethyl acetate, and poly(d, l - lactide - co - glycolide) (plga, 75:25, mw 66,000107,000) were purchased from sigma - aldrich (usa). Distilled water (di) from a milli - q water purification system (direct - q 3; millipore, bedford, md, usa) with a resistance of 18 mcm was used . Poly(nipaam)-pluronic surfactants with different lengths of poly(nipaam) were synthesized by the polymerization of nipaam at the ends of the hydroxyl group of pluronic f68 using can as a redox initiator . Di water (150 g) was poured into a double - jacket reactor equipped with a mechanical stirrer, nitrogen inlet apparatus, and a reflux condenser . Pluronic f68 (3 g) was poured into the reactor with stirring at 200 rpm at 65c . The solution of can (0.1 g) and nipaam (0.1, 0.2, and 0.25 g) in 5 ml of nitric acid (0.2 mol / l) was added and then polymerization progressed for 4 h under a nitrogen atmosphere . The resultant was sufficiently cleaned using a dialysis membrane (mwco 60008000; membrane filtration products, inc ., tx, usa) and then dried at 25c for 12 h in a vacuum oven . The prepared poly(nipaam)-pluronic surfactants were characterized by ft - ir (tensor27, bruker, the netherlands) and gel filtration chromatography, gpc, (waters breeze system; waters co., usa). The gpc column was a series of styragel columns (hr5, hr4, hr1, and hr5e) and thf was used as an eluent at a flow rate of 1 ml / min and 1 10 pa pressure . Polystyrene samples (sigma - aldrich) with different molecular weights were used for the standard in gpc analysis . To measure the critical micellar concentration (cmc), aqueous solutions with different concentrations of the poly(nipaam)-pluronic surfactant (0.01, 0.025, 0.05, 0.1, 0.25, and 0.5 wt.%) were prepared and the surface tensions of the samples were measured using a semiautomatic tension meter (surface tensiomat 21, fisher scientific, usa). From the plot of surface tension versus concentration, the cmc value could be obtained as the intersect point of two regressed lines . Plga microparticles were prepared using an oil - in - water emulsion and solvent evaporation method at room temperature . In brief, an oil phase containing plga (0.2 g) and nr (1 mg) in ethyl acetate (10 g) was poured into an aqueous phase (50 g) containing a poly(nipaam)-pluronic surfactant (0.5 g) and subsequently emulsified for 7 min with a high - speed homogenizer at 10,000 rpm (omni international, waterbury, ct, usa), followed by stirring for 6 h for solvent evaporation . After placing the samples in the water bath at the different temperatures at 15c and 37c for 1 h, the average size of the microparticles was determined by the dynamic light scattering method (dls, zetaplus; brookhaven inst . After fabricating the plga microparticles containing nile red, the encapsulation efficiency was measured by the centrifugation of the dispersion containing the plga microspheres and then analyzing the amount of nile red in the aqueous continuous phase using a uv spectrophotometer (uv-1601, shimadzu, japan) at 460 nm . In all the cases, the cumulative release of the dye was calculated on the base of the total encapsulated amount of the dye . For the release profile, 20 ml of a microparticle suspension (4 mg / ml) was sealed in a dialysis tube (mwco 6000 - 8000), and then placed in 100 ml of the pbs medium (ph 7.4) with gentle shaking at 37c . At predetermined time intervals, 4 ml of the solution was collected from the released media and replaced with fresh pbs . The released nile red was analyzed by a uv / vis spectrophotometer at different time points . Figure 1a is a schematic diagram showing the synthesis of a poly(nipaam)-pluronic surfactant, where pluronic f68 was used as a macroinitiator . Hydroxyl groups at the ends of pluronic f68 were radicalized by can and reacted with a nipaam monomer, followed by the propagation of the monomers . There could be little possibility for two or more pluronic f68 molecules to be synthesized together serving nippam as a linker, because the reaction was conducted in a quite diluted solution and the resulting poly(nipaam)-pluronic surfactants exhibited fairy uniform molecular weights . Ft - ir analysis showed that a broad peak at around 3400 nm corresponding to the hydroxyl group in the pluronic f68 disappeared after the polymerization, indicating the synthesis of the poly(nipaam)-pluronic surfactant [figure 1b]. The poly(nipaam)-pluronic surfactants with different lengths of poly(nipaam) were synthesized by varying the amounts of the nipaam monomer (0.1, 0.2, and 0.25 g) with other conditions kept same (namely, np-1, np-2, and np-3) table 1 shows the properties of the resultant surfactants, obtained from gpc analysis . An increase in the amount of nipaam monomer led to an increase in the molecular weight of the resulting surfactant, suggesting an increase in the unit number of poly(nipaam) because the molecular weight of pluronic f68 was not changed through polymerization . Although nuclear magnetic resonance (nmr) or elementary analysis is needed to exactly determine the unit number of poly(nipaam) in the surfactants, a simple calculation using data (mn) from gpc could provide the approximate unit number of poly(nipaam), where the results showed that the np1, np2, and np3 had 16, 23, and 46 units of nipaam, respectively . Moreover, the cmcs of the surfactants were evaluated using a surface tension meter . As shown in figure 2, the poly(nipaam)-pluronic surfactants with a longer length of poly(nippam) exhibited a higher cmc value at room temperature, which is due to the increased hydrophilicity and steric hindrance of the poly(nipaam) block . (a) a schematic diagram of the synthesis of a poly(nipaam)-pluronic surfactant and (b) ft - ir spectra of pluronic f68 and poly(nipaam)-pluronic surfactants properties of poly(nipaam)-pluronic surfactants cmcs of the pluronic f68 and poly(nipaam)-pluronic surfactants with different lengths of poly(nipaam) at room temperature to evaluate the effect of the length of poly(nipaam) on the average particle size and release profile from microparticles, four different kinds of plga microparticles were prepared by a typical emulsification and solvent evaporation method using pluronic f68 and three kinds of poly(nipaam)-pluronic surfactants with different lengths of poly(nipaam) in an aqueous phase . The encapsulation efficiency of nile red was found to be around 88.2 3.4% in all the samples without any influence of the length of poly(nipaam) block . Figure 3 shows the variation in the average size of the plga microparticles, which was measured by dls at 15c and 37c . There was no difference in the average size of the microparticles prepared using pluronic f68 at different temperatures . In contrast, there was a clear tendency that the microparticles prepared using poly(nipaam)-pluronic surfactants exhibited the smaller average particle size at 37c than that at 15c . It is mainly due to the fact that the poly(nipaam) block stretches into the aqueous phase at 15c, whereas ppo and poly(nipaam) blocks were insoluble in an aqueous solution at 37c, resulting in the formation of a dense shell layer of ppo and poly(nipaam) at the surface of the microparticles . The dependence of the average particle size on environmental temperature can be a direct evidence of the thermosensitive property of the poly(nipaam) block in the surfactants . Variation in the average size of the plga microparticles at 15c and 37c (measured by dls) pluronic surfactants and poly(nipaam) exhibit reversible thermosensitive properties in their aqueous solutions which were attributed to the formation of hydrogen bonds with respect to temperature . The lcsts of pluronic surfactants (e.g., f68 and f127) are known to be highly dependent on their concentrations and chemical compositions . In contrast, the lcst of poly(nipaam) is around 3234c regardless of its concentration . In our approach, despite the difficulty in the determination of the concentration of the poly(nipaam)-pluronic surfactants at the surface of the microparticles, it can be accepted that the poly(nipaam)-pluronic surfactants exhibit two lcsts less than 37c in an aqueous solution, still depending on the concentration at the surface of the microspheres . Nile red was chosen as a model dye to evaluate the release behavior of the microparticles due to its easiness of encapsulation into the organic plga phase . Figure 4 shows the release profiles of nile red (model dye) for the plga microparticles at 37c, where the plga microparticles prepared using pluronic f68 were used as a control . Nile red was found to be released from the plga microparticles prepared using poly(nipaam)-pluronic surfactants in a sustained manner compared to the control, which is due to the formation of a dense layer of poly(nipaam). Moreover, the plga microparticles prepared using the poly(nipaam)-pluronic surfactant with a longer length of poly(nipaam) exhibited a more sustained pattern of dye release, which is due to the formation of the thicker layer of poly(nipaam) at the surface of the microparticles . This result confirmed that the use of a poly(nipaam)-pluronic surfactant can reduce the initial burst release of a drug . Release profiles of nile red from the plga microparticles prepared using pluronic f68 and poly(nipaam)-pluronic surfactants with different lengths of poly(nipaam) at 37c we have successfully synthesized poly(nipaam)-pluronic surfactants by polymerizing nipaam from the ends of hydroxyl groups of pluronic f68 using can and also demonstrated the reduction in the initial burst release of the drug from the plga microparticles prepared using the poly(nipaam)-pluronic surfactants . We believe that the poly(nipaam)-pluronic surfactants with a thermosensitive property can be easily utilized for other drug delivery systems.
We developed a stent - like electrode that consisted of four parts: an introductory sheath, a stent, a tube through which a guide wire is passed, and an adaptor (fig . The sheath was made from 8-f teflon tubes, and the tube through which the guide wire is passed was made from 3-f polyethylene tubes, with a tapered dilator attached to the tip of the guide wire tube . The stent itself was knitted from a single thread of 0.22-mm nitinol wire in a tubular configuration and with an interlocking, diamond - shaped pattern . One end of the stent was collapsed and fixed with a polyethylene tube, using nitinol wire . The free end of the this wire, connected to the stent, was used as a connector, and insulated with a 3-f polyethylene tube (figs . 1, 2). In order to gauge the extent of rfa, we measured the depth of ablation in cow liver . Using the stent - like electrode and an rf generator (rf2000, radiotherapeutics corporation, calif ., radiofrequency energy was applied to excised cow liver through the parenchymal tract at 3-min - intervals (3, 6, 9, 12, and 15 mins) and in 20-watt increments (10, 30, 50, 70, and 90 watts) (fig . Impedance, power output, and elapsed time were recorded at 15-sec - intervals until full system impedance was realized . After the completion of rfa, the liver was sectioned serially across the ablation zone, either perpendicular to the electrode or parallel to the needle track, and the maximal transverse diameter of each lesion was measured . Correlation between the thickness of the thermal lesion and (a) elapsed time to full system impedance, and (b) power applied was determined using cox regression analysis (spss for windows, version 10.01; chicago, ill . On the basis of a protocol approved by the animal research committee at chosun university, 14 male white new zealand rabbits, weighing between 2.0 and 3.2 kg, were anesthetized via intramuscular injection using a mixture of rompun (bayer, seoul, korea) and ketamin (yuhan, seoul, korea), both at a concentration of 1 mg per kg of body weight . After the thighs and abdomen of each rabbit were shaved, the animals were placed in the supine position within a fixation device, and two 35-cm ground pads (each with conductive gel applied to their surface) were placed bilaterally on each thigh . Under fluoroscopic guidance, the anterior wall of the stomach was sutured to the abdominal wall in a purse - string fashion using blue nylon 3.0 (ailee, pusan, korea). Next, the stomach was punctured at the center of the purse string suture using an 18-gauge peripheral catheter (angiocath, becton dickinson, seoul, korea) and a guide - wire was advanced through the sheath of the catheter until it reached the duodenum . The stent - like electrode was advanced over the guide - wire as far as the distal duodenum . Three different levels of rf energy were applied to three different sites of the duodenum in a retrograde sequence, moving from distal to proximal positions (fig . 4), and during each application, impedance (in ohms) was documented every 15 sec . Energy was applied under six sets of conditions: 10 watts for 1 min, 10 watts for 2 mins, 20 watts for 1 min, 20 watts for 2 mins, 30 watts for 1 min, and 30 watts for 2 mins . Higher levels of rf energy (40, 50, and 60 watts for 1 and 2 mins) were applied to additional rabbits . Six rabbits were sacrificed immediately after the application of rf energy and the gross and microscopic pathological findings were correlated with the twelve different power and time settings used . Eight rabbits were monitored for 4 weeks following the procedure, during which time they were pathologically examined . We developed a stent - like electrode that consisted of four parts: an introductory sheath, a stent, a tube through which a guide wire is passed, and an adaptor (fig . The sheath was made from 8-f teflon tubes, and the tube through which the guide wire is passed was made from 3-f polyethylene tubes, with a tapered dilator attached to the tip of the guide wire tube . The stent itself was knitted from a single thread of 0.22-mm nitinol wire in a tubular configuration and with an interlocking, diamond - shaped pattern . One end of the stent was collapsed and fixed with a polyethylene tube, using nitinol wire . The free end of the this wire, connected to the stent, was used as a connector, and insulated with a 3-f polyethylene tube (figs . 1, 2). In order to gauge the extent of rfa, we measured the depth of ablation in cow liver . Using the stent - like electrode and an rf generator (rf2000, radiotherapeutics corporation, calif ., radiofrequency energy was applied to excised cow liver through the parenchymal tract at 3-min - intervals (3, 6, 9, 12, and 15 mins) and in 20-watt increments (10, 30, 50, 70, and 90 watts) (fig . 3). During the procedure, impedance, power output, and elapsed time were recorded at 15-sec - intervals until full system impedance was realized . After the completion of rfa, the liver was sectioned serially across the ablation zone, either perpendicular to the electrode or parallel to the needle track, and the maximal transverse diameter of each lesion was measured . Correlation between the thickness of the thermal lesion and (a) elapsed time to full system impedance, and (b) power applied was determined using cox regression analysis (spss for windows, version 10.01; chicago, ill . On the basis of a protocol approved by the animal research committee at chosun university, 14 male white new zealand rabbits, weighing between 2.0 and 3.2 kg, were anesthetized via intramuscular injection using a mixture of rompun (bayer, seoul, korea) and ketamin (yuhan, seoul, korea), both at a concentration of 1 mg per kg of body weight . After the thighs and abdomen of each rabbit were shaved, the animals were placed in the supine position within a fixation device, and two 35-cm ground pads (each with conductive gel applied to their surface) were placed bilaterally on each thigh . Under fluoroscopic guidance, the anterior wall of the stomach was sutured to the abdominal wall in a purse - string fashion using blue nylon 3.0 (ailee, pusan, korea). Next, the stomach was punctured at the center of the purse string suture using an 18-gauge peripheral catheter (angiocath, becton dickinson, seoul, korea) and a guide - wire was advanced through the sheath of the catheter until it reached the duodenum . The stent - like electrode was advanced over the guide - wire as far as the distal duodenum . Three different levels of rf energy were applied to three different sites of the duodenum in a retrograde sequence, moving from distal to proximal positions (fig . 4), and during each application, impedance (in ohms) was documented every 15 sec . Energy was applied under six sets of conditions: 10 watts for 1 min, 10 watts for 2 mins, 20 watts for 1 min, 20 watts for 2 mins, 30 watts for 1 min, and 30 watts for 2 mins . Higher levels of rf energy (40, 50, and 60 watts for 1 and 2 mins) were applied to additional rabbits . Six rabbits were sacrificed immediately after the application of rf energy and the gross and microscopic pathological findings were correlated with the twelve different power and time settings used . Eight rabbits were monitored for 4 weeks following the procedure, during which time they were pathologically examined . A total of 40 ablations were performed in the excised livers, showing that the dimensions of the thermal lesions increased both with elapsed time and increased rf energy levels . Cox regression analysis demonstrated that the thickness of the resultant lesion showed linear correlation with both elapsed time (fig . The regression equation used was as follows: diameter of the thermal lesion= -11.436 + 1.57 elapsedtime+0.315watts (p value <.001; r2, 82%). Rf ablation using the stent - like electrode was technically successful in all 14 rabbits . During ablation of the duodenum, impedance of between 60 and 120 impedance increased rapidly (within 75 to 90 sec) and both animals died within one day of the procedure . One rabbit to which we applied rfa at power levels of 10, 20, and 30 watts for 2 min died 7 days after the procedure . Three animals (two in the 1-min group and one in the 2-min group) were sacrificed at the end of the 2nd week after ablation, and two more (both in the 1-min group) at the end of the 4th week (table 1). During the rf procedure, three sites were perforated and the duodenum was seen to adhere to adjacent organs such as the liver, abdominal wall, and colon (fig . The acute changes apparent in the rabbits' small intestine following rf ablation included color change, cytoplasmic denaturation, fibrin deposition and hemorrhage, among which hemorrhage of the mucosal layer was the earliest finding . Sequential histologic findings correlated well with the six different power and elapsed time parameters used in this part of the study (table 2). Animals subjected to one minute of rf ablation manifested no histologic change either 2 or 4 weeks after the procedure, irrespective of the power applied . A total of 40 ablations were performed in the excised livers, showing that the dimensions of the thermal lesions increased both with elapsed time and increased rf energy levels . Cox regression analysis demonstrated that the thickness of the resultant lesion showed linear correlation with both elapsed time (fig . The regression equation used was as follows: diameter of the thermal lesion= -11.436 + 1.57 elapsedtime+0.315watts (p value <.001; r2, 82%). Rf ablation using the stent - like electrode was technically successful in all 14 rabbits . During ablation of the duodenum, impedance of between 60 and 120 ohms was maintained . During the 4-week follow - up period, three of eight rabbits in the 2-min group died . In two rabbits, impedance increased rapidly (within 75 to 90 sec) and both animals died within one day of the procedure . One rabbit to which we applied rfa at power levels of 10, 20, and 30 watts for 2 min died 7 days after the procedure . Three animals (two in the 1-min group and one in the 2-min group) were sacrificed at the end of the 2nd week after ablation, and two more (both in the 1-min group) at the end of the 4th week (table 1). During the rf procedure, three sites were perforated and the duodenum was seen to adhere to adjacent organs such as the liver, abdominal wall, and colon (fig . The acute changes apparent in the rabbits' small intestine following rf ablation included color change, cytoplasmic denaturation, fibrin deposition and hemorrhage, among which hemorrhage of the mucosal layer was the earliest finding . Sequential histologic findings correlated well with the six different power and elapsed time parameters used in this part of the study (table 2). Animals subjected to one minute of rf ablation manifested no histologic change either 2 or 4 weeks after the procedure, irrespective of the power applied . Radiofrequency ablation systems are comprised of three components: a radiofrequency generator, an active electrode, and dispersive electrodes . Rf energy (alternating current) is introduced into tissue via the active electrode, and as it moves from there to the dispersive electrode (i.e. The electrosurgical return pad), and back again, ions within the tissue oscillate as they attempt to follow this change in direction . This movement results in frictional heating of the tissue, and as its rises above 60, cells begin to die . Rf thermal ablation using high - frequency electrical current is now an accepted procedure for the control of certain tumors . For both sexes, carcinoma of the gastrointestinal tract was the leading cause of cancer death in the united states in the year 2000, with a 5-year relative survival rate of only 5% . In about 58% of patients with esophageal cancer and 40% of those with gastric cancer, curative resection is not feasible and palliative anastomotic surgery is the usual option . In patients with inoperable cholangiocarcinoma, several authors have reported that intracavitary radiation therapy can be an effective local treatment and has a positive effect on patient survival (13 - 15). Using currently available rf ablation technology, zones of necrosis of up to 5 cm in diameter can be created in a single application, and tumors of larger diameter can be addressed with multiple applications of rf energy from different deployment sites (16 - 19). There are several possible differences between radiofrequency ablation of a gastrointestinal tract lesion and other solid organs such as the liver . First, we found it impossible to apply maximal power for an extended period, so estimation of the ablation depth required was essential prior to rfa . The gastrointestinal tract is adjacent to the common bile duct and other structures, and to avoid possible injury, care thus needs to be taken if the tract undergoes rfa for the maximum possible time and at maximal power . Secondly, if the center of the target lesion contains a fluid- or air - filled space, the dimensions of the resultant thermal lesion may be affected due to heat conduction and convection within that tissue . In our study, two rabbits in the 2-min group experienced a rapid increase in the level of impedance during rf ablation and both died the next day . We surmise that the duodenum of these animals was seriously injured by rf ablation, indicating that bowel circumstances could affect the procedure . Thirdly, it is very hard to monitor ablation while it is on - going, and the plan for rfa must thus be decided in advance, according to the size of the target lesion, after determining this by means of ct, mri, or ultrasound, for example . Although the regression equation for depth of a thermal lesion due to elapsed time and applied power derived from the ex - vivo study had a high correlation value, correlation was low when the equation was used in our in - vivo study . Prior to its use in a clinical situation, the equation should be refined to a higher probability through additional ex - vivo studies . Two factors present in our ex - vivo study may affect the extent of a thermal lesion: tissue composition and the lack of perfusion . The first of these is the principal factor that can alter the extent of coagulation following rf ablation . Since heat is conducted through different tissues at various rates, the power settings for rf ablation vary according to the tissue involved . In addition, heat transfer through excised cow liver is undoubtedly different from that through the bowel tissue of a living rabbit . Equally as important to the development of a thermal lesion is the degree of perfusion within tissue . The movement of blood or other fluids through tissue has been reported to reduce heat generation during thermal ablation, a phenomenon labeled the heat - sink effect (20). In this way, ablation near major blood vessels can require either longer periods of time or higher levels of power, or both, if the resultant lesions are to encompass the areas of tissue to the desired degree . Since perfusion - mediated tissue cooling reduces the extent of coagulation necrosis produced by thermal ablation, tissue that is not perfused (such as excised cow liver) will exhibit larger zones of ablation than are normally seen in perfused tissue . As a result, the correlation noted in the ex - vivo study is less clinically useful than in an in - vivo or tumor study; however, it certainly provides the basis for developing a clinical model for use in perfused tissue . The stent - like electrode developed for this work has some advantages over currently configured needle electrodes used in soft tissue coagulation, providing easy control of the extent of the thermal lesion induced . Its shape, furthermore, permits its use in any tubular structure, including the esophagus, gastric outlet, bile duct, and vessels . More importantly, in this study the stent - like electrode did not directly perforate the gastrointestinal tract, and because it has no sharp end or point, perforation during future applications is unlikely . In addition, when applied to the duodenum, it was easily expanded and retracted within the tissue . Because the bowel changes its shape and location during rfa with this electrode, real - time ultrasonographic guidance could well be useful . The changes noted in the duodenum following rf ablation in this study correspond closely with these reported in other studies involving soft tissues (1, 10, 17). The resultant thermal lesions were comprised mainly of coagulation necrosis and fibrosis, and any changes in the mucosal layer had healed completely within two weeks . However, long application times and/or high power applications resulted in submucosal and serosal injuries that lead to peritonitis or ulcer formation and eventual bowel perforation . We believe that rfa procedures that combine lower power with shorter elapsed time will, in future, be the preferred manner of using rfa to address gastrointestinal malignancies, including biliary caner . While the results of this experimental study are encouraging, determination of a more accurate algorithm for applying radiofrequency energy to tissue within the gastrointestinal tract will require further investigation and long - term follow - up in animals . In addition, the effect of bowel circumstances on rf ablation should be investigated before its application in cases involving unresectable gastrointestinal lesions.
Thereby, reconstruction of the last common ancestor (lca) to all mollusks, the so - called hypothetical ancestral mollusk, has been hampered by difficulties in recovering fossils of unambiguous molluscan stem species and by the lack of a general agreement concerning the relationships of the various molluscan class - level taxa to each other . As a consequence, morphology - based analyses have suggested either one or the other of the sclerite - bearing but shell - less aplacophoran clades (neomeniomorpha or chaetodermomorpha, respectively) as the earliest molluscan offshoot [8, 9], a monophyletic aplacophora as sister group to all remaining mollusks (the testaria), or a polyplacophoran - aplacophoran assemblage (aculifera) as sister to all other mollusks with a primarily univalved shell (conchifera) [11, 12]. This controversy may soon be settled, however, since two phylogenomic studies have independently confirmed the latter concept, whereby both recovered a monophyletic aplacophora as sister group to polyplacophora (chitons) within aculifera [4, 5]. In the light of this phylogenetic framework, the recent description of a cylindrical (i.e., worm - shaped) sclerite- and shell - bearing paleozoic mollusk and the results of integrative molecular - paleontological studies [13, 14] have been considered as evidence for the presence of seven or eight shell plates in the lca of crown - group aculiferans . If correct, this implies that the body plan of recent aplacophorans is the result of secondary simplification and thus a derived condition [6, 14]. Despite additional descriptions of fossils that exhibit a mixture of polyplacophoran- and aplacophoran - like features [15, 16] this may be due to the overall paucity of well - preserved paleozoic fossils that undoubtedly can be assigned to the aculiferan lineage, the uncertainty as to whether or not some early (cambrian or precambrian) fossils [17, 18] indeed represent crown- or stem - group mollusks, and the fact that solid morphological and developmental evidence from recent aplacophoran representatives is still largely lacking . The few reports of individual aplacophoran larvae and postlarvae have shown that these animals may bear six or seven rows of papillae, sclerites, or sclerite - secreting cells [1921], but these studies found no further support by gross morphological developmental studies of two neomeniomorph representatives [22, 23]. The muscular architecture of mollusks is intimately associated with the existence, number, and arrangement of shells in the respective taxa . In polyplacophorans, the myoanatomy is highly complex [7, 25] (figures 1a and 1c) and several components, such as a laterally positioned enrolling muscle and a dorsal rectus system that spans the longitudinal axis of the animal, have been widely considered as defining morphological features (autapomorphies) of this taxon . In stark contrast to the sophisticated polyplacophoran myoanatomy, aplacophoran representatives have a much simpler muscular organization that, together with the body wall musculature, mainly comprises serially repeated dorsoventral muscles (figures 1b and 1d). Accordingly, a scenario that suggests a shell plate - bearing aculiferan lca with polyplacophoran - like musculature implies drastic secondary simplification of the muscular body plan of aplacophoran mollusks . Since ontogenetic data may provide important insights into the evolutionary history of a given taxon [26, 27], we investigated the development of a model neomeniomorph aplacophoran, wirenia argentea, from hatching of the larvae until after metamorphosis . In comparing myogenesis in wirenia with that of a polyplacophoran (leptochiton asellus), we found striking similarities in the muscular organization of both species (see table 1 for a summary of major larval and adult muscle systems known for the various molluscan lineages), including the presence of a rectus muscle (figures 2a2d), so far only known from polyplacophorans, and a laterally positioned enrolling muscle (figures 2a2h). Both systems are retained in adult polyplacophorans but are lost during wirenia postlarval development (note that some neomeniomorphs do exhibit distinct enrolling muscles as adults [28, 29]). Although homology between the polyplacophoran and neomeniomorph enrolling muscles has been questioned, their similar position in the respective animals and, in particular, their identical mode of ontogenetic formation as independent muscle system (and not as a thickened derivative of the body wall musculature, as proposed earlier for the aplacophoran taxa) argue strongly for their common evolutionary origin and thus for the presence of such a system in the lca of both clades . Aside from these muscles both systems are only transiently present in advanced larvae, and neither has a counterpart in either the polyplacophoran or the neomeniomorph adult body plan . As with the rectus and the enrolling muscles, the identical positions of the ventrolateral and the ventromedian muscles in wirenia and leptochiton larvae, together with their identical positions relative to other muscles, clearly suggest that these respective muscles are homologous between the two species (see for a recent overview on homology theory and assessment). Earlier, we had already found the ventrolateral system in larvae of another polyplacophoran, mopalia muscosa, but had overlooked the ventromedian muscle . Reinvestigation of the original 3d data set, however, unambiguously revealed such a muscle also in mopalia (data not shown; available on request). Accordingly, it appears highly likely that the ventrolateral and the ventromedian muscles together with the enrolling and the rectus muscle were all part of the muscular toolkit of the lca of polyplacophorans and neomeniomorphs, and that the simple myoanatomy of adult wirenia is a derived, secondary condition . Formation of the eight sets of dorsoventral muscles in polyplacophorans passes through a transitory stage of multiple individual myocytes that appear synchronously (figure 2e) and give rise to the first seven paired shell muscle units (while the eighth set forms considerably later, together with the most posterior shell plate). In wirenia, seven pairs of dorsoventral muscles develop simultaneously (figures 3a3e) and differentiate further in later stages (figure 2f). A gradual numerical increase of the dorsoventral muscle sets was observed only after metamorphosis (figure 3f). Accordingly, both neomeniomorphs and polyplacophorans exhibit a transient stage of seven - fold seriality in the arrangement of these muscles . Despite the different ontogenetic pathways that lead to this seven - fold seriality (fusion of multiple myocytes in polyplacophorans versus simultaneous formation in wirenia), this seven - fold seriality appears to be a reoccurring pattern, at least in aculiferan mollusks (unfortunately, the ontogenetic sequence of the formation of the eight pairs of dorsoventral muscles in monoplacophora is still unknown). This is well in line with the description of the seven - shelled fossil kulindroplax, as well as with the serially arranged sclerites or papillae of some recent aplacophorans [1921], and lends further support for an aculiferan lca with a seven - fold seriality of epidermal hardparts and the associated musculature . This implies that the eighth set of dorsoventral muscles of recent polyplacophorans is a derived condition . The late formation of the most posterior shell plate and associated musculature in polyplacophorans [7, 31] may well be considered as ontogenetic testimony of such a scenario . The rudimentary data on myogenesis (and development in general) of the second aplacophoran taxon, the chaetodermomorpha, does not allow for definite conclusions concerning the presence of neomeniomorph- and/or polyplacophoran - like features such as the rectus or the ventromedian muscles in the lca of this taxon . However, the ring musculature in the body wall of both aplacophoran clades, which is also rudimentarily present in the apical region of polyplacophoran larvae (figure 2), may constitute an aculiferan apomorphy uniting polyplacophora, neomeniomorpha, and chaetodermomorpha (table 1). This, together with the cylindrical shape of the aplacophorans and the polyplacophoran larva as well as the fossil kulindroplax, argues for a worm - like body shape of the lca of aculifera, rendering the dorsoventrally flattened appearance of recent polyplacophorans a derived condition . The paired lateral longitudinal muscle in the larva of the chaetodermomorph chaetoderma may correspond to either the enrolling or the ventrolateral muscle of larval polyplacophorans and neomeniomorphs (table 1), which would further support the inclusion of chaetodermomorpha within aculifera . The fact that kulindroplax shares morphological features not only with polyplacophorans but also with recent chaetodermomorphs, including the absence of a pedal pit and the position of the gills, likewise supports such a scenario . Whether or not a monophyletic aculifera will stand the test of future phylogenetic analyses or whether chaetodermomorpha, despite these shared morphological characters, will be proven to have different affinities remains to be seen . The transient expression of typical polyplacophoran - like muscles in the wirenia larva, however, strongly suggests that at least neomeniomorph aplacophorans stem from an ancestor with polyplacophoran - like features that most likely also included seven shell plates.
Rectal polypectomy causes thinning (or even perforation) of the rectal wall in addition to thermic injury at the polypectomy site . We present a rare case of spontaneous rectal perforation after uncomplicated nerve sparing endoscopic extraperitoneal radical prostatectomy in a patient with a previous history of rectal polypectomy at the perforation site . This conservative therapy for such rectal perforations is indicated if the patient's general condition remains stable without any signs of infection . Adequate time interval should be given to allow healing and avoid adding further thermal wall damage which may obscure healing leading to complications like fistula . Conservative therapy for small missed rectal perforations constitutes an attractive, feasible and non invasive treatment entity . Following this principle coloscopy is a routine examination for men over 50 years in germany . From the surgical point of view the other one is the perforation of the gut which is a severe and possibly lethal complication with a reported incidence of 0.1% to 0.9% [1 - 4]. Most rectal injuries during nerve sparing endoscopic extraperitoneal radical prostatectomy (nseerpe) occur while transecting rectourethralis muscle cutting further into rectal wall . We present a rare case of spontaneous rectal perforation after uncomplicated nseerpe in a patient with a previous history of rectal polypectomy at the perforation site, which was successfully treated conservatively . In november 2005, an otherwise healthy 71-year - old man with localised prostate cancer underwent nseerpe in our hospital . He gave history of polypectomy 10 cm from anus 4 weeks before, otherwise no clinical or laboratory abnormalities . Coloscopy revealed bleeding from intraluminal wall laceration over a haematoma in polypectomy site (figure 1a) which was sealed with fibrin glue . Ct revealed pelvic haematoma without detectable connections between rectum, bladder or abdomen (figure 1b). Ct at 16day showed established free connection between rectum and haematoma with some air without abdominal connections (figure 2a, b). Later, there was complete resorption of haematoma and healing of fistula as shown by abdominal ct (figure 2c) and coloscopy at 3month . Psa is still undetectable . (a) rectoscopy view showing bleeding from wand haematoma without any fistula (2postoperative day). (b) ct examination showing pelvic haematoma without any signs of rectal perforation (3postoperative day). (a. and b) coronal and sagittal abdominal ct sections showing free connection between rectum and prostate bed with haematoma, contrast material and some air (16postoperative day). In this case rectal perforation could be either due to laceration because of previous polypectomy or missed iatrogenic perforation . Owing to the intimate anatomical relation to prostate, it is our believe that this rectal wall thinning (or perforations) together with thermic injury at site of polypectomy should be given enough time to heal with adequate scare, otherwise it well predispose to laceration followed by perforation / necrosis in this site during or after operative manipulations . However care should be taken to exclude merely secondary haemorrhage due to clot dissolution in these cases which may manifest itself days to weeks after coloscopy (0.3 - 6.1%). Although practiced in the beginning of open retropubic prostatectomy, most laparoscopic groups, including ours, leave the urethra intact during most of the dissection . Instead, the plane between the seminal vesicles, prostate, and rectum is developed, progressing from the base of the prostate as close as possible to the apex . Most of these injuries are visually identified intraoperatively and commonly repaired in a 2-layer suture with or without interposition of omentum / fat between the rectum and the vesicourethral anastomosis [5 - 7]. In case of missed perforations, signs and symptoms will be related to the size and site of the perforation, adequacy of bowel preparation, amount of peritoneal soilage, underlying bowel pathology (e.g. Thin walled colon from colitis or ischemia may result in a larger perforation than a healthy colon) and finally, overall clinical condition of the patient . Radiology often establishes the diagnosis however a localized perforation may demonstrate lack of pneumo peritoneum and necessitates other diagnostic procedures . Management remains a controversial issue in that it can be effectively done by operative and nonoperative measures . Generally, nonsurgical management is indicated if the patient's general condition remains stable, the pneumoperitoneum does not increase in size, there are no signs of peritonitis and if the patient's condition improves in response to conservative treatment . Surgery is most definitely indicated in the presence of a large perforation, in the setting of generalized peritonitis or ongoing sepsis, the presence of concomitant pathology, unremitting colitis or perforation proximal to an obstructing distal lesion . Finally, in the patient who deteriorates with conservative management . However, the best treatment for rectal injury during nseerpe remains prevention . Although the primary reason is certainly anatomical since the plane of dissection is close to the rectum, another reason could be weakness of the rectal wall e.g. Following polypectomy . In our opinion the later case needs 2 months in order to heal adequately and withstand operative manipulations . Also to avoid adding further thermal wall damage to this site which may later obscure healing leading to more serious complications like fistula . According to this principle we have not faced this complication in following similar cases . Nevertheless, the use of an intrarectal device / air should be emphasized in difficult cases due to surgeon inexperience, inflamed prostate, large volume gland, narrow and/or deep pelvis or previous rectal operations . These simple manoeuvres help in identifying the site of perforation and/or lacerations, if exist . About 2 months interval should be given to allow adequate healing before the operation and avoid adding further thermal wall damage which may obscure healing leading to complications like fistula . Conservative therapy for these small missed rectal perforations constitutes a feasible and non invasive treatment entity . However in the presence of a large perforation, generalized peritonitis, ongoing sepsis or if the patient condition deteriorates surgery is indicated . Intra - operative use of an intrarectal device / air should be emphasized in difficult cases . The authors disclose any commercial association that might pose a conflict in connection with the submitted article.
Four bat guano samples were collected from known roost sites on the remote offshore island of whenua hou (codfish island) (4647s, 16738e), which is situated at the southern coast of new zealand . It has special conservation status for the protection of endangered species, and public access is not permitted (9). Bat guano was held at 4c during transport (<48 h), resuspended in 2 ml phosphate - buffered saline, and subjected to centrifugation at 6,000 g for 5 min . Rna was extracted from 400 l of supernatant by using the iprep purelink virus kit (life technologies, carlsbad, ca, usa) and eluted into 50 l reverse transcription pcr molecular - grade water (ambion, austin, tx, usa). Metagenomic sequencing was then conducted for 1 of the samples by using an illumina miseq instrument (new zealand genomics ltd ., massey genome service, massey university, palmerston north, new zealand) after a series of steps involving dnase i treatment, reverse transcription, multiple displacement amplification (qiagen, valencia, ca, usa), and illumina truseq library preparation (new zealand genomics, ltd . ). A total of 10,749,878 paired - end sequence reads of 250 bp were generated and assembled into contigs by using velvet 1.2.07 (10). Assembled contigs were searched for viral sequence by comparison to the nonredundant nucleotide database in genbank (downloaded march 2013) by using the nucleotide basic local alignment search tool (national center for biotechnology information, bethesda, md, usa). Forty - six contigs showed similarity to known genus alphacoronavirus sequences (table). (raw sequence data are available on request from the authors .) * blastn, nucleotide basic local alignment search tool (http://blast.ncbi.nlm.nih.gov/blast.cgi?program=blastn&page_type=blastsearch&link_loc=blasthome). Virus sequence from the genus alphacoronavirus was confirmed in all 4 original guano samples by using a specific reverse transcription pcr based on the metagenomic data specific for 582 bp of the rna - dependent rna polymerase (rdrp) gene (genbank accession nos . The rdrp sequence was identical in all 4 guano samples, and the closest relative was bat coronavirus hku8 (genbank accession no . Phylogenetic analysis was performed for rdrp (figure 1) and for the spike protein, as derived from metagenomic data (genbank accession no . We propose that these data support identification of a new alphacoronavirus, which has been designated as mystacina bat cov / new zealand/2013 . Phylogenetic tree showing genetic relatedness of rna - dependent rna polymerase amino acid sequences for mystacina sp . Bat coronavirus (cov)/new zealand/2013 (shown in boldface) with those of known coronaviruses . Evolutionary history was inferred for 183 informative amino acid sites by using the maximum - likelihood method based on the whilan and goldman model with gamma distribution in mega 5.05 software (www.megasoftware.net). Bootstrap values are calculated from 1,000 trees (only bootstrap values> 50% are shown). Tgev, transmissible gastroenteritis cov; prcv, porcine respiratory cov; sars, severe acute respiratory syndrome . Bat coronavirus (cov)/new zealand/2013 (shown in boldface) with those of known coronaviruses . Evolutionary history was inferred for 492 informative amino acid sites by using the maximum - likelihood method based on the whilan and goldman + f model with gamma distribution and invariant sites in mega 5.05 software (www.megasoftware.net). Bootstrap values are calculated from 1,000 trees (only bootstrap values> 50% are shown). Tgev, transmissible gastroenteritis cov; prcv, porcine respiratory cov; sars, severe acute respiratory syndrome . The discovery of unknown coronaviruses provides information for a model of coronavirus evolution (11) and contributes to understanding the process of disease emergence, as in detection of middle east respiratory syndrome coronavirus (12). The alphacoronavirus identified in this study from m. tuberculata bat guano is unique in respect to the extreme geographic and evolutionary isolation of the host bat species, which along with c. tuberculatus bats, has been separated from all other mammalian species for 1 million years . The current estimate for a common ancestor for all coronaviruses is 8,100 bce (13). To be consistent with this estimate, mystacina bat coronavirus would need to have been introduced to bats on whenua hou within the past 800 years since humans first arrived on this island (given that the island had no other mammals before this time) (11) or is extant to modern alphacoronavirus phylogenetic radiation (genesis and expansion). Apart from humans, only 2 other terrestrial mammals have ever inhabited whenua hou: the brushtail possum (trichosurus vulpecula) and the polynesian rat (rattus exulans), both of which were eliminated from the island in the late 1980s (11); neither mammal has been reported as a host of alphacoronaviruses . Members of the genus alphacoronavirus infect only mammals . Thus, an avian origin for this virus is unlikely . An alternative theory of an ancient origin for all coronaviruses has recently been proposed that involves an alternative evolutionary molecular clock analysis, which places the most recent common ancestor many millions of years ago (14). The discovery of mystacina bat cov / new zealand/2013 virus could lend support to such a theory; despite potentially millions of years of isolation, it has diverged relatively little from other extant alphacoronaviruses, as shown by the close relationship of the rdrp and spike protein genes to those of other extant alphacoronaviruses (figures 1, 2). An expanded survey for mystacina bat coronavirus in mammals in new zealand and subsequent characterization of viral genomes would provide further insights into the origin of coronaviruses . Only a small number of conservation staff handle these bats, these staff use standard personal protective equipment and work practice . Staff are also offered prophylactic rabies vaccination as a precautionary measure, even though new zealand is free from rabies . The genus alphacoronavirus includes several human and animal pathogens, but on the basis of phylogenetic data in this study, it is not possible to estimate the risk posed by mystacina bat coronavirus to human or animal health . This country is free from many human and animal diseases, such as rabies and foot - and - mouth disease, and infections with human arboviruses because of recent colonization by humans and strict biosecurity border controls (15). Thus, indigenous wildlife in new zealand has generally been viewed as an almost sterile and unique biosphere . Given detection of this coronavirus, more thorough characterization of the ecology of viruses and other microorganisms in native wildlife should be considered to fulfill conservation needs and further safeguard human and domestic animal health against cross - species transmission.
The tilting provokes blood pooling in the splanchnic and the lower extremity circulation which triggers the neural and humoral compensatory mechanisms aiming to maintain stable blood pressure and cerebral perfusion . Then the diagnostic utility of the tilt test has been expanded for diagnosis of orthostatic hypotension, autonomic failure, postural tachycardia syndrome, and other forms of orthostatic intolerance . Common orthostatic symptoms are usually defined by heart rate and blood pressure responses to tilting . The orthostatic cerebral blood flow is less studied; even many orthostatic symptoms are due to orthostatic cerebral hypoperfusion . Therefore, the purpose of this study was to analyze the cerebral blood flow and cardiovascular patterns in common orthostatic syndromes . The study was approved by the institutional review board of the university of massachusetts medical school as a minimal risk study . This retrospective, single - center study included patients with history of autonomic function testing at the university of massachusetts medical school, autonomic laboratory, between years 2007 and 2014 . The first group constitutes orthostatic intolerance symptoms which include dizziness, lightheadedness, unexplained falls, chronic fatigue, heaviness, chest pain, and shortness of breath . The second group includes patients with history of unexplained loss of consciousness that were referred for evaluation of suspected syncope . Only the tilt test results are reported here . After a resting supine period of at least 10 minutes duration, subjects were tilted at 70 degrees for 10 minutes or longer if patients can tolerate . During the whole testing, heart rate, blood pressure, respiratory movement, and cerebral blood flow velocity (cbfv) were monitored . Arterial blood pressure was measured in the upper arm intermittently using an automated noninvasive oscillometric device dinamap procare monitor 100 (ge, fairfield, ct), as well as continuously by infrared finger plethysmography (finapress medical systems, amsterdam, netherlands). Nasal thermistor and end tidal co2 (capstar-100, cwe, inc ., ardmore, pa) were used for monitoring respiratory parameters . Cbfv was monitored using transcranial doppler (multidop t, dwl, singen, germany) with a 2 mhz probe . Cbfv was obtained from the left middle cerebral artery with the doppler probe attached to a three - dimensional positioner which kept the probe at a constant depth and angle of insonation . . Normally heart rate increases at least 10 beats per minute (bpm) but less than 30 bmp during the tilt (table 1) [3, 6]. The normal response is a drop of systolic blood pressure <20 mmhg and diastolic blood pressure <10 mmhg on upright posture . Since the baseline cbfv is gender and age dependent, the orthostatic criteria are given in relative values where the supine baseline is 100% . The threshold for normal drop of the mean cbfv is 90% (1st minute), 89% (5th minute), and 85% (10th minute) of the supine baseline (= 100%) which immediately precedes the tilt . Pots is defined by the presence of orthostatic symptoms associated with an increment of heart rate by 30 bpm held for more than 30 seconds when changing position from supine to upright in the absence of orthostatic hypotension . The timing of heart rate increment is either not mentioned or defined within 5 minutes or within 10 minutes or longer of the upright posture . Early description of pots also required the absolute heart rate 120 bpm or more, while the heart rate below 120 during the tilt test was termed as mild orthostatic intolerance . To avoid overlap with the definition of the inappropriate sinus tachycardia (see below), an additional criterion for the pots is average heart rate <100 bpm during supine baseline before the tilting . The cbfv may be abnormally decreased during tilting due to hyperventilation induced hypocapnia during the tilt . Historically, oh is defined as a drop 20 mmhg in systolic blood pressure or 10 mmhg in diastolic blood pressure within three minutes of standing or head - up tilt . This definition does not take into account the baseline value; therefore a modified definition was that using a relative drop of 80% and 85% in systolic and mean blood pressure, respectively, where supine baseline is 100% . Ohtn is a common syndrome with a prevalence of 1.1% and occurs in 16.3% of older hypertensive patients . Ohtn is defined as a postural increase of systolic blood pressure by at least 20 mmhg or an increase in systolic blood pressure during the tilt to 120% and above where supine baseline is equal to 100% . The latter definition was used in this study since it accounts for a supine baseline . Neurally mediated, also called reflex, neurocardiogenic, or vasovagal, syncope is a syncope triggered by a neural reflex resulting in systemic hypotension, reduced cardiac output, peripheral vasodilatation, and/or bradycardia . Based on the heart rate responses, syncope can be divided into three forms: cardioinhibitory, vasodepressor, and mixed which is the most common . In general, the vasodepressor syncope is due to a predominant loss of upright vasoconstrictor tone . Bradycardia or asystole predominates in cardioinhibitory syncope and both mechanisms (vasodilatation and cardioinhibition) are present in mixed syncope . Cbfv has characteristic pattern during syncope consistent with cerebral vasodilation as indicted by increased systolic and decreased diastolic cbfv and thus increased pulsatility index defined as systolic cbfv the vasis (vasovagal syncope international study) classification of syncope has been expanded using the cbfv and blood pressure criteria (table 1). In psychogenic syncope, also termed psychogenic pseudosyncope, consciousness is only apparently lost and global cerebral hypoperfusion is absent . In this study, the psychogenic syncope was defined as an apparent loss of consciousness without changes in cbfv indicative of syncope . Pst can be frequently encountered during the tilt test and may be due to underlying anxiety disorder . Paroxysmal pst in this study was defined as intermittent (duration <2 minutes) tachycardia (heart rate> 100 bpm) associated with heart rate increment 30 bpm . Ist is associated with persistent or recurrent elevated heart rate (> 100 bmp) at rest including supine and excessive or inappropriate heart rate increment in upright position [7, 18]. In this study the inappropriate heart rate increment was defined as 30 bpm during the tilt . Ochos is a recently described syndrome associated with reduced orthostatic cerebral blood flow velocity (cbfv) without oh, bradycardia, and excessive tachycardia . The normal supine cbfv is age and gender dependent and pcaf is defined as cbfv less than the lower limit of the normal range where the normal limit is 72.090.38 age cm / s and 82.20.45 age cm / s for men and women, respectively, using the multidop t device (table 1). Since this pattern (e.g., low cbfv and normal or high bp) may indicate cerebral vasoconstriction, cerebral vascular resistance defined by mean blood pressure / mean cbfv has been calculated as well . It is a policy at our autonomic laboratory to acquire blood pressure by both methods, for example, oscillometric and plethysmographic, and if the sustained difference is more than 10%, then finger device should be repositioned . In the case the difference persists, blood pressure from plethysmographic device should be recalibrated using the oscillometric device . The syndromes described above were detected automatically by an algorithm written in matlab programming language (mathworks, natick, ma). The software used in this study is an extension of the quantitative scale for grading of cardiovascular autonomic reflex tests and small fibers from skin biopsies (qasat), also written in matlab . Qasat is an objective and validated instrument for grading of tilt responses which defines normal and abnormal responses in heart rate, blood pressure, and cbfv during the tilt test . The clinical variables associated with orthostatic syndromes were compared with normal responses using wilcoxon rank test since most of the data had nonnormal distribution . Nine clinical syndromes were compared with the normal response to the tilt, for example, oh, ochos, ohtn, pots, ist, pst, syncope, psychogenic syncope, and pcaf, and therefore the initial significance 0.05 was adjusted by bonferroni correction to 0.005 (0.05/10 comparisons). All statistical analyses were performed using jmp 12.0 (cary, nc) statistical software . All patients had unrevealing standardized evaluation including medical history, neurological examination, basic metabolic panel, 12-lead ecg, imaging studies (ct or mri of the brain), and eeg if patients were referred for evaluation of syncope . 669 patients were referred for evaluation of orthostatic symptoms including dizziness and 75 patients were referred for evaluation of unexplained loss of consciousness with a suspected diagnosis of syncope . However, from these subjects, only 7 subjects had normal entire autonomic testing (e.g., qasat total score = 0). Remaining subjects had at least one abnormality in parasympathetic (evaluated by deep breathing test) or sudomotor (evaluated by qsart) functions . From 669 patients evaluated for orthostatic intolerance (not syncope), the tilt test was normal in 77 patients . From 75 patients referred for evaluation of syncope, the tilt test showed normal response in 25 subjects, neutrally mediated syncope in 33 patients, and abnormal results but nonsyncope pattern in remaining patients (table 2). Additional 23 patients that had syncope during the tilt test were referred for nonsyncope evaluation . Table 2 shows details of orthostatic symptoms in each syndrome including the frequency of reproduction of previous symptoms that prompted autonomic testing and the frequency of a new diagnosis obtained from the tilt test . The symptoms were commonly reproduced in the pst (100%), pots (99%), ochos (98%), ist (86%), and uncompensated oh (85%). Most common new diagnosis was obtained from the tilt test, which means the diagnosis was not mentioned in the chart or was not mentioned in the reason for the referral of the testing, which was ochos (n = 97), pcaf (n = 67), and pots (n = 67). Figure 1 shows head - to - head comparisons of normal response, oh and ochos . Figure 2 compares the profile of common tachycardia syndromes including pots, ist, and pst . Figure 3 shows three main types of syncope, for example, cardiovagal, vasodepressor, and mixed . Pure syncope pattern with otherwise normal responses on the tilt test was detected in 32 patients . Syncope was combined with other syndromes including pots (12 patients), ohtn (1 patient), ist (3 patients), pst (3 patient), and pcaf (1 patient). Characteristic patterns of syncope are seen in figure 3 with details in figures 811 and 17 . All three types of syncope share common pattern in cbfv which is consistent with cerebral vasodilation (figures 3 and 811). Oh can be progressive (figures 1, 4, and 7), transient (figure 5), associated with stable orthostatic cbfv, for example, compensated (figures 4 and 5), or reduced orthostatic cbfv, for example, uncompensated (figures 6 and 7). Mean blood pressure was reduced in both oh groups while the cbfv tilt drop score was abnormal in the oh - uncompensated group during the tilt (table 2). Ochos (figures 1, 12, and 20) showed primary reduction in orthostatic cbfv with normal orthostatic heart rate responses and without orthostatic hypotension . In ohtn (figure 13) orthostatic blood pressure was elevated while orthostatic cbfv was stable . Characteristic features of tachycardia syndromes (pots, ist, and pst) are shown in figures 2, 1518, and 23 and table 2 . Both pots and pst patients were younger than subjects with the normal tilt test and had elevated heart rate during the tilt . Ist subjects were younger than subjects with the normal tilt response and had elevated heart rate in supine position and during the tilt . Vasomotor oscillations (figure 19), spurious fluctuations of blood pressure (figure 20), and sustained drift in blood pressure (figure 21) obtained from finger plethysmographic device can be recognized by simultaneous recording of the arm blood pressure and cbfv . Eight patients had pseudosyncope (figures 22 - 23) with stable orthostatic cbfv . From these patients, tilt test showed normal responses in 4 subjects, pots in 2 subjects, and oh - compensated and mixed syncope in 1 subject . Patients with pcaf had reduced cbfv in the supine position, had elevated cerebral vascular resistance in supine position and during the tilt, and had abnormal drop of cbfv score during the tilt (table 2). Table 3 summarizes the main diagnostic features of common patterns encountered during the tilt test . Characteristic pattern associated with a particular orthostatic syndrome can be grouped into abnormalities predominantly affecting heart rate (pst, ist, and pots), blood pressure (syncope, oh, and ohtn), and cerebral blood flow (ochos, pcaf). Psychogenic pseudosyncope is associated with stable cbfv without any particular heart rate or blood pressure pattern . This study also showed that criteria for several orthostatic syndromes had to be modified to allow unambiguous pattern classifications . Orthostatic symptoms, except of syncope, are nonspecific and in general poorly correlating with orthostatic blood pressure or heart rate . This study showed that orthostatic drop in cbfv is more sensitive and specific marker of prediction of orthostatic symptoms than orthostatic blood pressure changes . Criteria for orthostatic syndromes are heterogeneous; some criteria are exclusively physiological (e.g., oh which can be symptomatic or asymptomatic) while the others require also the presence of symptoms, for example, pots . Nevertheless, the information obtained from the tilt test should not be used in isolation but always on clinical ground . Primarily, it is the timing of tachycardia that distinguishes each syndrome . Using the nonmodified criteria, majority of patients with ist and pst the ambiguities in determination of tachycardia syndromes were solved by modifying the diagnostic criteria as mentioned in the section 2 . Cbfv is characteristically reduced in pots, normal in ist, and normal or transiently elevated in pst . Loss of consciousness usually occurs if systolic blood pressure declines to 60 mmhg that is accompanied by cerebral vasodilation . In this study, the diastolic cbfv was close or equal to zero, the mean cbfv was less than 30 cm / sec, and pulsatility index increased which is consistent with cerebral vasodilation . It is advantageous to use cbfv in differentiation of pseudosyncope or spurious decline in finger blood pressure; in both conditions cbfv remains stable . Pcaf is defined as low supine cbfv without supine hypotension or other hemodynamic abnormalities that can explain low cbfv . Patients with pcaf have increased cerebral vascular resistance that may be due to cerebral autoregulatory failure . Cbfv is also reduced during the tilt in spite of stable orthostatic blood pressure, further pointing to altered cerebral autoregulation . This hypothesis is supported by a previous study that showed significant negative correlation between cbfv and severity of white matter abnormalities in the mri which is a marker of small vessel disease . Clinical significance of pcaf is unclear but pcaf may be a cause of cerebral dysfunction due to chronic cerebral hypoperfusion . Original definition of ohtn included only an increase of blood pressure during the tilt while heart rate and cbfv responses to tilting were not considered . These limitations can cause diagnostic overlap with pots since occasional rise in blood pressure during tilting can be observed in the hyperadrenergic form of pots . Consider an example in figure 12, where the excessive rise in blood pressure is associated with drop in cbfv during the tilt test . This patient has diagnosis of ochos, but using the original ohtn criteria he also qualifies for diagnosis of ohtn . The above mentioned shortcomings were overcome by including the heart rate and cbfv responses in the ohtn definition (table 1). Typically, the tilt test uses heart rate and blood pressure responses in classification of results . The usefulness of an additional cbfv monitoring during the tilt test can be demonstrated by comparing the yield of the tilt test with and without cbfv monitoring . Without cbfv and when using heart rate and blood pressure monitoring only, then all ochos subjects (13% or 97 subjects) will be labeled as having normal tilt test . Since they have orthostatic symptoms (100% of ochos patients were symptomatic in this study) they may be misdiagnosed as having psychogenic, vestibular, or an unclassified disorder . Furthermore 67 (9%) patients with diagnosis of pcaf would also be missed without using cbfv . Cbfv also helps to differentiate pst, ist, and pots and spurious blood pressure oscillations . No specific changes in hemodynamic parameters except of stable cbfv have been found in this study . This is in contrast with a recent study which observed elevated heart rate and blood pressure before and during the loss of consciousness . In this study no particular heart rate and blood pressure pattern the characteristic drop in cbfv associated with a vasodilatation pattern seen in syncope is missing in pseudosyncope . Nevertheless, the clinical significance of adjusted criteria needs to be validated in future studies . Table 3 summarizes common patterns associated with the tilt test and emphasizes the main features that enable differentiating each pattern . Tilt test can be used as an add - on in diagnosis of orthostatic syndromes . However diagnostic criteria for several syndromes had to be made more explicit to allow unambiguous pattern classification . To be able to classify all patterns,
The myotomy alleviates dysphagia symptoms by releasing the distal esophageal muscular layers, thereby limiting lower esophageal sphincter contraction . However, myotomy alone has been shown to increase gastroesophageal reflux disease (gerd); hence, it is now common practice to include an antireflux procedure . These patients have some degree of esophageal body dysmotility, and a 360 wrap can make esophageal emptying more difficult . Thus, although nissen fundoplication is effective at controlling postoperative acid reflux, it is less favorable because of a high dysphagia recurrence rate . A partial fundoplication has the benefits of less dissection, decreased operative time, and improvement in dysphagia symptoms, while showing improvement in reflux rates comparable with 360 fundoplication . Both dor and toupet fundoplications provide antireflux benefits with less risk for recurrent dysphagia in postmyotomy patients . Our initial practice consisted of lhc in conjunction with routine toupet fundoplication for patients with achalasia . Toupet fundoplication is advocated on the basis of better reduction of reflux and better outcomes because the 270 posterior fundoplication aids in keeping myotomy edges apart . However, we have since transitioned to performing dor fundoplication because it covers the exposed esophageal mucosa, and less extensive dissection is required, leaving the stomach attachments in place . Additionally, dor fundoplication may be more amenable to a single - site surgical technique . The risk for pseudodiverticulum of the esophagus after myotomy is a concern raised primarily after the thoracoscopic approach; however, this phenomenon has been described in other laparoscopic and endoscopic procedures and could be a risk in the toupet procedure secondary to an uncovered myotomy . Given the current controversy regarding best surgical practice for the treatment of achalasia, the objective of our study was to compare the reflux - related and regurgitation - related quality - of - life outcomes between patients undergoing myotomy with toupet fundoplication and those undergoing myotomy with dor fundoplication . In addition, we investigated overall patient satisfaction after lhc in the treatment of achalasia . The study group consisted of 135 consecutive patients who underwent lhc with fundoplication between 1998 and 2010 by 1 surgeon at a single institution . Before january 2010, toupet fundoplication was performed for all patients unless there was suspicion of mucosal violation after myotomy . The study design and patient questionnaire were approved by the institutional review board of the penn state hershey medical center . The gastroesophageal reflux disease health - related quality of life scale (gerd - hrql) was used to assess the severity of reflux . The gerd - hrql is a disease - specific, 10-question, 6-point likert - type scale identifying symptoms such as heartburn and bloating . The scale ranges from 0 to 50, with higher scores correlating with worse symptoms . Additionally, the subjects were asked to rate how often they experienced symptoms of gerd or dysphagia . Briefly, symptoms of gerd were rated as follows: 0 = none, 1 = once or twice a month, 2 = once or twice a week, 3 = once a day, and 4 = once a day and continuous . Symptoms of dysphagia were rated as follows: 0 = no symptoms, 1 = dysphagia once or twice a month to bread or meat, 2 = dysphagia once or twice a week to thick food, 3 = dysphagia to thick liquids daily, and 4 = inability to swallow oral secretions . For the purposes of our study, patients were deemed to have resolution of their dysphagia symptoms if they reported a score of 0 or 1 . Parametric data are presented as mean sd, and nonparametric data are presented as median (interquartile range). Symptom scores after myotomy were analyzed using fisher's exact test, chi - square statistics, and wilcoxon's rank - sum test . Intraoperative endoscopy was used to ensure adequacy of the myotomy and to rule out mucosal perforation with a leak test . Toupet fundoplication was undertaken by passing the fundus posteriorly through the dissected retroesophageal space and anchoring it to the myotomy site and the right and left crura with serial sutures . For dor fundoplication, the fundus was brought anteriorly and sutured to the left crus and myotomy site . A second suture was used to affix the fundus to the left side of the myotomy without including the crus . This was repeated in the same fashion on the right side to complete the fundoplication . We do not routinely fully expose the retroesophageal crura or divide the short gastric vessels . The study group consisted of 135 consecutive patients who underwent lhc with fundoplication between 1998 and 2010 by 1 surgeon at a single institution . Before january 2010, toupet fundoplication was performed for all patients unless there was suspicion of mucosal violation after myotomy . The study design and patient questionnaire were approved by the institutional review board of the penn state hershey medical center . The gastroesophageal reflux disease health - related quality of life scale (gerd - hrql) was used to assess the severity of reflux . The gerd - hrql is a disease - specific, 10-question, 6-point likert - type scale identifying symptoms such as heartburn and bloating . The scale ranges from 0 to 50, with higher scores correlating with worse symptoms . Additionally, the subjects were asked to rate how often they experienced symptoms of gerd or dysphagia . Briefly, symptoms of gerd were rated as follows: 0 = none, 1 = once or twice a month, 2 = once or twice a week, 3 = once a day, and 4 = once a day and continuous . Symptoms of dysphagia were rated as follows: 0 = no symptoms, 1 = dysphagia once or twice a month to bread or meat, 2 = dysphagia once or twice a week to thick food, 3 = dysphagia to thick liquids daily, and 4 = inability to swallow oral secretions . For the purposes of our study, patients were deemed to have resolution of their dysphagia symptoms if they reported a score of 0 or 1 . Parametric data are presented as mean sd, and nonparametric data are presented as median (interquartile range). Symptom scores after myotomy were analyzed using fisher's exact test, chi - square statistics, and wilcoxon's rank - sum test . Intraoperative endoscopy was used to ensure adequacy of the myotomy and to rule out mucosal perforation with a leak test . Toupet fundoplication was undertaken by passing the fundus posteriorly through the dissected retroesophageal space and anchoring it to the myotomy site and the right and left crura with serial sutures . For dor fundoplication, the fundus was brought anteriorly and sutured to the left crus and myotomy site . A second suture was used to affix the fundus to the left side of the myotomy without including the crus . This was repeated in the same fashion on the right side to complete the fundoplication . We do not routinely fully expose the retroesophageal crura or divide the short gastric vessels . Fifteen of the 20 eligible patients (75%) with dor fundoplication responded, whereas 48 of the 115 patients (42%) with toupet fundoplication participated . The mean age of patients was 57 17 years, with 33 men and 30 women . Both treatment groups were similar in age, gender, and number and type of preoperative interventions . Median operative time was shorter in the dor group than the toupet group (100 [92131] vs 129.5 [115162] min, p <.01) (table 1). The median follow - up time was 60 (3684) months for the toupet group and 19 (1422) months for the dor group (p <.001). Patient characteristics of dor and toupet groups data are expressed as mean sd, as numbers, or as median (interquartile range). Using gerd - hrql, no difference in the severity of postoperative gerd symptoms was seen between the toupet fundoplication and dor fundoplication groups . There was no difference in patient satisfaction in current postoperative condition between the 2 groups (88% toupet vs 93% dor, p = .60). Health - related quality of life scale . 0 = no symptoms; 1 = symptoms noticeable but not bothersome; 2 = symptoms noticeable and bothersome but not every day; 3 = symptoms bothersome every day; 4 = symptoms affect daily activities; 5 = symptoms are incapacitating, unable to do daily activities . Statistically significant (p <.05). However, 25% of toupet patients and 20% of dor patients reported having symptoms at least once or twice a week . There was no difference between dor and toupet fundoplication with respect to the incidence of postoperative gerd symptoms (p = .49). Assessment of postoperative frequency of gerd symptoms there was no difference between the groups (= 0.25). Gerd, gastroesophageal reflux disease . 0 = none; 1 = once or twice a month; 2 = once or twice a week; 3 = once a day; 4 = once a day and continuous . Eighty percent of patients undergoing surgery for achalasia reported complete resolution of dysphagia symptoms as measured by patient questionnaire . Eighty - seven percent of patients undergoing dor fundoplication and 78% of patients undergoing toupet fundoplication had complete resolution of their dysphagia symptoms . There was no difference between the dor and toupet groups (p = .73). Assessment of postoperative dysphagia symptoms there was no difference between the groups (= 0.73). Gerd, gastroesophageal reflux disease . 0 = no symptoms; 1 = dysphagia once or twice a month to bread or meat; 2 = dysphagia once or twice a week to thick food; 3 = dysphagia to thick liquids daily; 4 = inability to swallow oral secretions . The high incidence of postoperative reflux has led most surgeons to perform an antireflux procedure in addition to the myotomy . Although a 360 nissen fundoplication has been shown to be effective, it may be associated with a high incidence of long - term postoperative dysphagia . Thus, partial fundoplication has been advocated . In a review by abir et al, dysphagia resolution was achieved in 83% to 90% of patients undergoing lhc with toupet fundoplication and 77% to 91% of patients undergoing lhc with dor fundoplication . Furthermore, a recent randomized control trial by rawlings et al demonstrated reduction in symptoms postoperatively in 90.9% in the dor group and 93.1% in the toupet group at 6-month to 12-month follow - up . Patients undergoing toupet and dor fundoplications reported 81% and 87% resolution of dysphagia, respectively . There was no significant difference in gerd incidence or severity in patients undergoing toupet or dor fundoplication . The overall incidence of gerd was low, with a majority of patients reporting a score of 0 or 1 on the gerd assessment scale . However, 25% of toupet patients and 20% of dor patients reported having symptoms of gerd at least once a week or more . The overall severity of gerd symptoms was low in both groups, with> 75% of patients scoring 1 for all the questions on the gerd - hrql scale . We did not perform physiologic testing, but rawlings et al found abnormal acid reflux in 21.1% and 41.7% of the toupet and dor groups . Although this result was not statistically significant, patients with abnormal ph test results reported significantly greater heartburn frequency and severity . The goal of our study was to investigate outcomes in our lhc patients to assess the difference between the toupet and dor groups . Toupet fundoplication has been a popular antireflux procedure in achalasia patients . Along with gerd control, proponents of toupet fundoplication believe it keeps the myotomy edges apart, thereby reducing recurrence of achalasia . Several prospective studies have evaluated the outcomes between posterior fundoplication and anterior fundoplication . In a study by hagedorn et al, no differences in esophageal symptoms were found, but toupet fundoplication was associated with significantly lower rates of abnormal acid exposure . Engstrom et al showed that patients with dor fundoplication had higher incidences of heartburn and regurgitation symptoms requiring a greater use of acid - reducing medications . Rawlings et al found comparable degrees of alleviation of symptoms with both procedures and no statistically significant difference in pathologic acid reflux . However, as with nissen fundoplication, toupet fundoplication requires dissection posterior to the gastroesophageal junction, which increases operative time and potentially alters the posterior soft tissue attachments to the esophagus, possibly increasing postoperative gerd and dysphagia . Dor partial anterior fundoplication allows preservation of the posterior gastroesophageal junction as well as the potential advantage of protection of the exposed mucosa at the myotomy site . Finally, dor fundoplication has been successfully performed using a single - site technique . The longer follow - up for the toupet group compared with the dor group is consistent with our change in procedure of choice . It is known that a certain percentage of patients will have recurrence of symptoms requiring additional treatment . Early recurrence is due to stenosis of the myotomy, best treated by repeat myotomy or dilations . Late recurrence is considered irreversible progression of the disease with development of mega - esophagus . This type is traditionally treated with esophagectomy, but some groups are advocating repeat myotomy, even in this setting, as a safe treatment . In our analysis, we did not attempt to differentiate between symptoms of early stenosis and late recurrence . It is likely that several of our patients will fit into these categories, and it is a subject of future research . Nonetheless, detailed quality - of - life data were available for 63 patients, or 47% of our study population . Finally, our results are consistent with those found in previous studies and contribute to the existing body of evidence for dor and toupet fundoplication in conjunction with laparoscopic heller myotomy . Patients undergoing dor or toupet fundoplication experienced no significant difference in dysphagia or gerd incidence or severity in the short term . This suggests that both are acceptable antireflux procedures when used as adjuncts to lhc in the treatment of achalasia.
Significant breakthroughs in basic research on the pathophysiology of dementing disorders and new innovative models of dementia care hold the promise of reducing the future burden of dementia.1 however, the majority of dementia research is conducted in specialized research centers among patients who represent less than 1% of the patient population with dementia, with ethnic minority groups being largely underrepresented.26 furthermore, the translation of innovative research discoveries into clinical practice typically takes an average of 17 years and the current research infrastructure fails to shorten this translational cycle.7 the national institutes of health s (nih) roadmap and the institute of medicine (iom) recognized the large gap in translating research innovations from discovery to delivery and recommended re - engineering of the clinical research enterprise.810 the iom and the nih roadmap recommended the use of complex adaptive system perspectives and information technology to build a localized and cohesive collaboration among the various members of the community, health care systems, and research organizations.810 in response to the iom and the nih recommendations, the regenstrief institute, inc, the indiana university center for aging research (iucar), and the indiana alzheimer disease center have been building a network of health care providers, clinical researchers, and community advocates dedicated to enhancing the quality of life and care of individuals with dementia and the life and care of their informal caregivers . The network is called the indianapolis discovery network for dementia (idnd).11 the idnd has created an environment that supports exchanges of information and ideas among its diverse and autonomous individuals, allowing the network to accomplish its three - fold mission of facilitating the development of rapid, innovative health care solutions that meet local research, clinical, and community needs; promoting a culture of discovery, cooperation, and teamwork among its diverse members; and disseminating novel and effective dementia care knowledge within the various health care systems in indianapolis . This article describes the theoretical framework, process, tools, and early successes of the idnd network, which we believe could help facilitate the building of similar dementia networks in other regions of the usa . Complex adaptive system theory was selected to guide the structuring and development of a social network focused on reducing the societal burden of dementia by connecting local research activities with local dementia care delivery systems.1119 a complex adaptive system is an open, dynamic, and flexible network that is considered complex due to its composition of numerous interconnected, semiautonomous, competing, and collaborating members.1316 this complex network is capable of learning from its prior experiences and is flexible to change the connecting pattern of its members to better fit its environment and accomplish its various missions and tasks.1318 furthermore, complex adaptive systems are characterized by emergent behaviors as opposed to predetermined behaviors and self - organized controls instead of hierarchical controls.1318 health care delivery organizations, universities, and internet - based social networks are considered examples of complex adaptive systems.6,1119 to organize, facilitate, and sustain effective interactions among the network s autonomous members, we applied the nine emerging and connected organizational and leadership principles of complex adaptive system theory:20 view the social network as a complex adaptive system . The members of such a social network are semiautonomous, interdependent, competitive, and collaborative individuals who interact in a nonlinear way leading to the emergence of unpredictable behaviors . Work on building an acceptable and flexible vision for the network with minimum specifications rather than having a detailed and rigid operational manual . Direct and guide the network dynamics and interactions by balancing data and intuition, planning and acting, safety and risk . Encourage and promote a balance of information exchange, connection channels, diversity, power differential, and tension among network members instead of controlling information exchange, forcing agreement, and dealing separately with contentious groups . Avoid systematically working down all the layers of the hierarchy in sequence and seeking comfort . Uncover and encourage unpredictability and tension rather than shying away from them . Go for multiple actions at the fringes . Let direction arise rather than micro - planning every step and searching for the highest level of linearity . Listen to the informal relationships, gossip, rumors, and hallway conversations that contribute significantly to individuals perceptions about their surrounding environment and their subsequent actions . Allow complex subnetworks to emerge out of the links among simple networks that work well and are capable of operating independently . Build a community of members who collaborate, create, learn, and compete simultaneously . Building on these principles, we chose to incorporate reflective adaptive process (rap) as a practical method focused on using complex adaptive system principles to introduce acceptable and effective change.12,14,17 rap facilitates the development of strategies, not prescribed protocols, and change built on explicit opportunities for learning, reflection, and adaptation . The five guiding principles of rap are: vision, mission, and shared values are fundamental in guiding ongoing change processes in a complex adaptive system . Creating time and space for learning and reflection is necessary for a complex adaptive system to adapt to and plan for change . Improvement teams should include a variety of the system s agents with different perspectives of the system and its environment . System change requires supportive leadership that is actively involved in the change process, ensuring full participation from all members and protecting time for feedback and reflection17 (see table 1). The idnd development process began with the formation of a cross - functional operational team consisting of the network director and coordinator and representatives from both academic and nonacademic memory care practices . Our operational team used iterative cycles to identify priority improvement opportunities, discuss potential solutions, pilot several changes, and reflect on the impact of changes . The idnd network director and coordinator explored existing relationships with local professionals to identify potential members who shared the goals of the network and practiced within the indianapolis metropolitan area . Membership was open to those in various disciplines, such as physicians, nurses, psychologists, social workers, health care administrators, pharmacists, and public health officers, including representatives of the major health care systems in the metropolitan area: wishard health services, indiana university health, st vincent health and hospital, the community health network, and saint francis health care . In addition, the alzheimer s association of greater indiana and the indianapolis minority health coalition participate as representatives of local advocacy organizations . Representatives from other local pharmaceutical companies or for - profit organizations who shared an interest in the goals and objectives of the network were not excluded from membership . The idnd consultancy round, which is part of the bimonthly meeting, offers structured time and space for the generation and sharing of innovative ideas, potential solutions, and member - to - member shared perspectives and support . This group - based problem - solving process is a modified version of a peer - to - peer advisory activity that was developed by the john a hartford foundation to support interaction between the foundation s interdisciplinary grantees and scholars.21 the idnd consultancy round part of the bimonthly meeting is limited to 60 minutes, and has the following six specifications: prior to each meeting, an idnd member selects a clinical, educational, or research challenge for which he / she would like to seek feedback on from other members . The presenter has up to 15 minutes to present his / her selected challenge using a typical oral presentation with or without the use of slideshow software or other media . Meeting attendants have up to 5 minutes to ask clarifying questions related to the presented challenge . Approximately 2 minutes is allotted to each idnd member who would like to provide solutions or feedback to the presenter; each idnd member is encouraged to provide a solution and no idnd member can criticize or respond to any of the feedback or solutions presented by other idnd members . The presenter will have up to 5 minutes to summarize the feedback received; he / she cannot respond to suggestions from the idnd members . Following the feedback summary, the group will have an open discussion regarding the themes generated from the consultancy round . The idnd coordinator records all of the solutions and shares them with the presenter and other idnd members upon request . In each idnd meeting, there is a 30-minute period before and 30-minute period after the consultancy round that are designed to enhance social interaction and networking among members . During this time, the network director introduces new members and briefly celebrates idnd members recent accomplishments . For the idnd, the director also serves as the meeting facilitator, responsible for monitoring the process of the idnd consultancy round, gathering information generated during the meetings, and encouraging participation and self - reflection . This includes the active solicitation of feedback from all members at minimum, feedback from a recognized leader who can speak on behalf of their own profession or specialty . This can be a challenge for larger networks and requires a leader who is not only well respected and sensitive to the needs of all group members but also who can create a comfortable environment . The role of the facilitator is not specifically allocated to the network director, so can be held by another member supported by the network s idnd governing body and members . Complex adaptive system theory was selected to guide the structuring and development of a social network focused on reducing the societal burden of dementia by connecting local research activities with local dementia care delivery systems.1119 a complex adaptive system is an open, dynamic, and flexible network that is considered complex due to its composition of numerous interconnected, semiautonomous, competing, and collaborating members.1316 this complex network is capable of learning from its prior experiences and is flexible to change the connecting pattern of its members to better fit its environment and accomplish its various missions and tasks.1318 furthermore, complex adaptive systems are characterized by emergent behaviors as opposed to predetermined behaviors and self - organized controls instead of hierarchical controls.1318 health care delivery organizations, universities, and internet - based social networks are considered examples of complex adaptive systems.6,1119 to organize, facilitate, and sustain effective interactions among the network s autonomous members, we applied the nine emerging and connected organizational and leadership principles of complex adaptive system theory:20 view the social network as a complex adaptive system . The members of such a social network are semiautonomous, interdependent, competitive, and collaborative individuals who interact in a nonlinear way leading to the emergence of unpredictable behaviors . Work on building an acceptable and flexible vision for the network with minimum specifications rather than having a detailed and rigid operational manual . Direct and guide the network dynamics and interactions by balancing data and intuition, planning and acting, safety and risk . Encourage and promote a balance of information exchange, connection channels, diversity, power differential, and tension among network members instead of controlling information exchange, forcing agreement, and dealing separately with contentious groups . Avoid systematically working down all the layers of the hierarchy in sequence and seeking comfort . Uncover and encourage unpredictability and tension rather than shying away from them . Go for multiple actions at the fringes . Let direction arise rather than micro - planning every step and searching for the highest level of linearity . Listen to the informal relationships, gossip, rumors, and hallway conversations that contribute significantly to individuals perceptions about their surrounding environment and their subsequent actions . Allow complex subnetworks to emerge out of the links among simple networks that work well and are capable of operating independently . Build a community of members who collaborate, create, learn, and compete simultaneously . Building on these principles, we chose to incorporate reflective adaptive process (rap) as a practical method focused on using complex adaptive system principles to introduce acceptable and effective change.12,14,17 rap facilitates the development of strategies, not prescribed protocols, and change built on explicit opportunities for learning, reflection, and adaptation . The five guiding principles of rap are: vision, mission, and shared values are fundamental in guiding ongoing change processes in a complex adaptive system . Creating time and space for learning and reflection is necessary for a complex adaptive system to adapt to and plan for change . Improvement teams should include a variety of the system s agents with different perspectives of the system and its environment . System change requires supportive leadership that is actively involved in the change process, ensuring full participation from all members and protecting time for feedback and reflection17 (see table 1). The idnd development process began with the formation of a cross - functional operational team consisting of the network director and coordinator and representatives from both academic and nonacademic memory care practices . Our operational team used iterative cycles to identify priority improvement opportunities, discuss potential solutions, pilot several changes, and reflect on the impact of changes . The idnd network director and coordinator explored existing relationships with local professionals to identify potential members who shared the goals of the network and practiced within the indianapolis metropolitan area . Membership was open to those in various disciplines, such as physicians, nurses, psychologists, social workers, health care administrators, pharmacists, and public health officers, including representatives of the major health care systems in the metropolitan area: wishard health services, indiana university health, st vincent health and hospital, the community health network, and saint francis health care . In addition, the alzheimer s association of greater indiana and the indianapolis minority health coalition participate as representatives of local advocacy organizations . Representatives from other local pharmaceutical companies or for - profit organizations who shared an interest in the goals and objectives of the network were not excluded from membership . The idnd consultancy round, which is part of the bimonthly meeting, offers structured time and space for the generation and sharing of innovative ideas, potential solutions, and member - to - member shared perspectives and support . This group - based problem - solving process is a modified version of a peer - to - peer advisory activity that was developed by the john a hartford foundation to support interaction between the foundation s interdisciplinary grantees and scholars.21 the idnd consultancy round part of the bimonthly meeting is limited to 60 minutes, and has the following six specifications: prior to each meeting, an idnd member selects a clinical, educational, or research challenge for which he / she would like to seek feedback on from other members . The presenter has up to 15 minutes to present his / her selected challenge using a typical oral presentation with or without the use of slideshow software or other media . Meeting attendants have up to 5 minutes to ask clarifying questions related to the presented challenge . Approximately 2 minutes is allotted to each idnd member who would like to provide solutions or feedback to the presenter; each idnd member is encouraged to provide a solution and no idnd member can criticize or respond to any of the feedback or solutions presented by other idnd members . The presenter will have up to 5 minutes to summarize the feedback received; he / she cannot respond to suggestions from the idnd members . Following the feedback summary, the group will have an open discussion regarding the themes generated from the consultancy round . The idnd coordinator records all of the solutions and shares them with the presenter and other idnd members upon request . In each idnd meeting, there is a 30-minute period before and 30-minute period after the consultancy round that are designed to enhance social interaction and networking among members . During this time, the network director introduces new members and briefly celebrates idnd members recent accomplishments . For the idnd, the director also serves as the meeting facilitator, responsible for monitoring the process of the idnd consultancy round, gathering information generated during the meetings, and encouraging participation and self - reflection . This includes the active solicitation of feedback from all members at minimum, feedback from a recognized leader who can speak on behalf of their own profession or specialty . This can be a challenge for larger networks and requires a leader who is not only well respected and sensitive to the needs of all group members but also who can create a comfortable environment . The role of the facilitator is not specifically allocated to the network director, so can be held by another member supported by the network s idnd governing body and members . Today, the idnd includes more than 250 members representing 20 disciplines and more than 30 local organizations (see table 2). Since its inception in february 2006, the idnd has conducted over 30 consultancy rounds, presented by 20 different members, that have covered educational, research, and clinical problems . It incorporates both leadership and front - line representation from the disciplines of clinical medicine, economics, research, biostatistics, information technology, and marketing . The idnd has members from eight memory care practices representing five of the different indiana health care systems . The model of dementia care within each memory care practice varies, with some clinics having a dedicated dementia care nurse specialist while others have both a nurse and a social worker with expertise in dementia care (see figure 1). Two of these memory care practices have successfully translated the collaborative dementia care model into self - sustained clinical services.22 the idnd has also facilitated the recruitment and execution of more than ten research projects that have been awarded more than usd$24 million dollars in funding and have recruited more than 2500 participants (see table 3). Furthermore, idnd - supported projects and educational opportunities have resulted in the development of multiple clinical tools, including the healthy aging brain center (habc) monitor, enhanced care for hospitalized older adults with memory problem (e - champ) delirium protocols, recognizing and assessing the progression of cognitive impairment and dementia in primary care (rapid - pc) assessment cards, and the anticholinergic cognitive burden (acb) scale available for professionals online through the idnd website s resource center . The first and last of these the habc monitor and the acb scale are two of the most successful products of the idnd s collaborative efforts . These and the enhanced electronic medical record for aging brain care (emr - abc) are discussed following . In hypertension care, the blood pressure cuff is a tool used for screening, diagnosis, and monitoring . Concept, the habc monitor was developed to function similarly in dementia care: one instrument capable of achieving all three processes . The development of the habc monitor was based on data collection from our previous studies5,22 and its face validity tested using the feedback of an interdisciplinary team of 22 representatives from three disciplines clinical care, clinical research, and psychometrics who were involved in dementia care and research . There are two versions of the monitor, the habc caregiver and habc self - report, both of which are actively used in several of our local affiliated memory care practices . The literature strongly supports the increased risk of acute cognitive impairment and possibly chronic cognitive impairment in older adults using anticholinergic medications . While physicians are aware of the side effects of drugs within the anticholinergic category, many may not recognize the anticholinergic properties of drugs new to the market or those with unrecognized anticholinergic properties . To assist with the recognition of these medications, our interdisciplinary team developed the acb scale as a practical tool that identifies the severity of anticholinergic effects from both prescription and over - the - counter medications on cognition . One of the largest and longest - term development projects of the idnd has been the construction of the emr - abc, a web - based medical record system that meets the needs of dementia research and care . As a first step in building the emr - abc, the idnd consulted with the leadership of iucar and the regenstrief institute, inc, and organized two meetings with all idnd clinical providers in an effort to understand the providers perspectives about potential barriers to emr - abc . The meetings with the clinical providers identified the following critical elements necessary to build an efficient and successful emr - abc: clinicians and researchers need to identify potential patients with dementia using criteria that represent a community standard . Clinicians and researchers need to reach consensus on the data elements relevant to both dementia care and research that should be collected, stored, and tracked . The emr - abc must store and safeguard data in a consistent format using accepted standards . The emr - abc must be able to transmit dementia - related data in a standardized format . The emr - abc must incorporate tools that are feasible and familiar to all personnel involved in collecting the data . The idnd has successfully completed a pilot test of its emr - abc in one health care system and has received additional funding to upgrade the current program and continue further testing on a larger scale to assure its: capability in capturing reliable data related to dementia care and outcomes; ability in managing, summarizing, and presenting captured data to various eligible researchers and clinicians; and ability in facilitating dementia research activities by identifying potential subjects for various studies and tracking their health outcomes . Over the past 12 months, the idnd website has been redesigned to improve its user interface, offer more resources, and create an additional environment for networking among members . The website serves as an open - source repository for network members and the public, providing an array of information including past dinner presentations, links to external resources for both the patient and the caregiver, idnd products such as the habc monitor and the acb scale, calendar of events for both idnd and community and clinic collaborators, and interesting articles and journal publications related to dementia research and care . The website also offers its members the opportunity to list information on the website about the clinics, facilities, and organizations they represent . Although the idnd consists primarily of local members, the website allows wider access to the idnd . Additionally, idnd s continued expansion and the growing needs of dementia research prompted the development of two core groups within idnd: the idnd governing body and the patient advisory board . Both groups were established to assist the operational body which includes the network director, associate director, and the assistant network director in the decision - making processes of the network . The idnd governing body consists of 15 members divided into three subgroups: memory care practice (six positions); long - term care (one position); and elected (eight positions), which is comprised of experts in information technology, law, finance, education, and public relations . The governing body also contains five subcommittees: education, clinical practice and implementation guidelines, research and implementation, governance, and finance and accountability . Each subcommittee is directed by a chair and vice chair elected by the governing body members . Members of the first governing body were selected and voted for by the core members of idnd, who were instrumental in its early development . To facilitate its function, the operational body also created guidelines for the governing body, which includes position and term definitions, voting protocols, its role in assisting the network in maintaining the network s values and meeting its mission and goals . The governing body meets quarterly throughout the year and is directed by two people, a nominated chair and vice chair . The patient advisory board was developed to add a unique perspective to the consultancy round as well as to respond to new requests by federal funders for the addition of patient / caregiver input on the design and implementation of new dementia research that may influence patients and caregivers health outcomes . The idnd patient advisory board comprises eight patients and their caregivers . As active members, they are asked to attend the regular idnd consultancy dinners . As the idnd continues to expand, one step in its growth is to help idnd s member memory practices form a pbrn . Pbrns offer advantages to both research and quality improvement initiatives, having the ability to move scientific advances into daily practice quickly and to incorporate practice - relevant topics into the research agenda.7 most recently, the us department of health and humans services agency for healthcare research and quality recognized the idnd as an affiliate primary care pbrn . The idnd has also facilitated the recruitment and execution of more than ten research projects that have been awarded more than usd$24 million dollars in funding and have recruited more than 2500 participants (see table 3). Furthermore, idnd - supported projects and educational opportunities have resulted in the development of multiple clinical tools, including the healthy aging brain center (habc) monitor, enhanced care for hospitalized older adults with memory problem (e - champ) delirium protocols, recognizing and assessing the progression of cognitive impairment and dementia in primary care (rapid - pc) assessment cards, and the anticholinergic cognitive burden (acb) scale available for professionals online through the idnd website s resource center . The first and last of these the habc monitor and the acb scale are two of the most successful products of the idnd s collaborative efforts . These and the enhanced electronic medical record for aging brain care (emr - abc) are discussed following . In hypertension care, the blood pressure cuff is a tool used for screening, diagnosis, and monitoring . Concept, the habc monitor was developed to function similarly in dementia care: one instrument capable of achieving all three processes . The development of the habc monitor was based on data collection from our previous studies5,22 and its face validity tested using the feedback of an interdisciplinary team of 22 representatives from three disciplines clinical care, clinical research, and psychometrics who were involved in dementia care and research . There are two versions of the monitor, the habc caregiver and habc self - report, both of which are actively used in several of our local affiliated memory care practices . The literature strongly supports the increased risk of acute cognitive impairment and possibly chronic cognitive impairment in older adults using anticholinergic medications . While physicians are aware of the side effects of drugs within the anticholinergic category, many may not recognize the anticholinergic properties of drugs new to the market or those with unrecognized anticholinergic properties . To assist with the recognition of these medications, our interdisciplinary team developed the acb scale as a practical tool that identifies the severity of anticholinergic effects from both prescription and over - the - counter medications on cognition . One of the largest and longest - term development projects of the idnd has been the construction of the emr - abc, a web - based medical record system that meets the needs of dementia research and care . As a first step in building the emr - abc, the idnd consulted with the leadership of iucar and the regenstrief institute, inc, and organized two meetings with all idnd clinical providers in an effort to understand the providers perspectives about potential barriers to emr - abc . The meetings with the clinical providers identified the following critical elements necessary to build an efficient and successful emr - abc: clinicians and researchers need to identify potential patients with dementia using criteria that represent a community standard . Clinicians and researchers need to reach consensus on the data elements relevant to both dementia care and research that should be collected, stored, and tracked . The emr - abc must store and safeguard data in a consistent format using accepted standards . The emr - abc must be able to transmit dementia - related data in a standardized format . The emr - abc must incorporate tools that are feasible and familiar to all personnel involved in collecting the data . The idnd has successfully completed a pilot test of its emr - abc in one health care system and has received additional funding to upgrade the current program and continue further testing on a larger scale to assure its: capability in capturing reliable data related to dementia care and outcomes; ability in managing, summarizing, and presenting captured data to various eligible researchers and clinicians; and ability in facilitating dementia research activities by identifying potential subjects for various studies and tracking their health outcomes . In hypertension care, the blood pressure cuff is a tool used for screening, diagnosis, and monitoring . Based on the blood pressure cuff concept, the habc monitor was developed to function similarly in dementia care: one instrument capable of achieving all three processes . The development of the habc monitor was based on data collection from our previous studies5,22 and its face validity tested using the feedback of an interdisciplinary team of 22 representatives from three disciplines clinical care, clinical research, and psychometrics who were involved in dementia care and research . There are two versions of the monitor, the habc caregiver and habc self - report, both of which are actively used in several of our local affiliated memory care practices . The literature strongly supports the increased risk of acute cognitive impairment and possibly chronic cognitive impairment in older adults using anticholinergic medications . While physicians are aware of the side effects of drugs within the anticholinergic category, many may not recognize the anticholinergic properties of drugs new to the market or those with unrecognized anticholinergic properties . To assist with the recognition of these medications, our interdisciplinary team developed the acb scale as a practical tool that identifies the severity of anticholinergic effects from both prescription and over - the - counter medications on cognition . One of the largest and longest - term development projects of the idnd has been the construction of the emr - abc, a web - based medical record system that meets the needs of dementia research and care . As a first step in building the emr - abc, the idnd consulted with the leadership of iucar and the regenstrief institute, inc, and organized two meetings with all idnd clinical providers in an effort to understand the providers perspectives about potential barriers to emr - abc . The meetings with the clinical providers identified the following critical elements necessary to build an efficient and successful emr - abc: clinicians and researchers need to identify potential patients with dementia using criteria that represent a community standard . Clinicians and researchers need to reach consensus on the data elements relevant to both dementia care and research that should be collected, stored, and tracked . The emr - abc must store and safeguard data in a consistent format using accepted standards . The emr - abc must be able to transmit dementia - related data in a standardized format . The emr - abc must incorporate tools that are feasible and familiar to all personnel involved in collecting the data . The idnd has successfully completed a pilot test of its emr - abc in one health care system and has received additional funding to upgrade the current program and continue further testing on a larger scale to assure its: capability in capturing reliable data related to dementia care and outcomes; ability in managing, summarizing, and presenting captured data to various eligible researchers and clinicians; and ability in facilitating dementia research activities by identifying potential subjects for various studies and tracking their health outcomes . Over the past 12 months, the idnd website has been redesigned to improve its user interface, offer more resources, and create an additional environment for networking among members . The website serves as an open - source repository for network members and the public, providing an array of information including past dinner presentations, links to external resources for both the patient and the caregiver, idnd products such as the habc monitor and the acb scale, calendar of events for both idnd and community and clinic collaborators, and interesting articles and journal publications related to dementia research and care . The website also offers its members the opportunity to list information on the website about the clinics, facilities, and organizations they represent . Although the idnd consists primarily of local members, the website allows wider access to the idnd . Additionally, idnd s continued expansion and the growing needs of dementia research prompted the development of two core groups within idnd: the idnd governing body and the patient advisory board . Both groups were established to assist the operational body which includes the network director, associate director, and the assistant network director in the decision - making processes of the network . The idnd governing body consists of 15 members divided into three subgroups: memory care practice (six positions); long - term care (one position); and elected (eight positions), which is comprised of experts in information technology, law, finance, education, and public relations . The governing body also contains five subcommittees: education, clinical practice and implementation guidelines, research and implementation, governance, and finance and accountability . Each subcommittee is directed by a chair and vice chair elected by the governing body members . Members of the first governing body were selected and voted for by the core members of idnd, who were instrumental in its early development . To facilitate its function, the operational body also created guidelines for the governing body, which includes position and term definitions, voting protocols, its role in assisting the network in maintaining the network s values and meeting its mission and goals . The governing body meets quarterly throughout the year and is directed by two people, a nominated chair and vice chair . The patient advisory board was developed to add a unique perspective to the consultancy round as well as to respond to new requests by federal funders for the addition of patient / caregiver input on the design and implementation of new dementia research that may influence patients and caregivers health outcomes . The idnd patient advisory board comprises eight patients and their caregivers . As active members, as the idnd continues to expand, one step in its growth is to help idnd s member memory practices form a pbrn . Pbrns offer advantages to both research and quality improvement initiatives, having the ability to move scientific advances into daily practice quickly and to incorporate practice - relevant topics into the research agenda.7 most recently, the us department of health and humans services agency for healthcare research and quality recognized the idnd as an affiliate primary care pbrn . Within the last 6 years, the idnd has been a competitive force in the development and delivery of new and innovative dementia care research . In turn, research founded and supported by the idnd has yielded multiple journal publications and invitations to present work at seminars and conferences throughout the nation . Despite early successes, the idnd has not been paralyzed by its early achievements but has preserved its momentum and is continuing to evolve to meet the changing needs of the community it serves . As the idnd moves forward in creating and achieving new goals, it has much to learn about the history and successes of other community- and practice - based research networks . Although the infrastructures of contract research organizations and pbrns vary widely, they do share some common elements . Both have a mission statement, a director, support staff, communication processes, and a community advisory board.23,24 as the membership and diversity of the idnd have continued to grow, the network has been successful in its rigorous adherence to its original mission and goals while maintaining complexity . As with other community research networks, however, the research supported by the idnd has been conceptualized, executed, and led largely by the idnd network director; collaborative efforts among the idnd group members have been limited to recruitment and dissemination . This is not due to a lack of support from the idnd leadership in encouraging idnd members to explore their own research interests; rather, it is perhaps due to lack of guidance . Within the last year, the network responded to this by establishing a governing body and patient advisory board to assist members at any point along the research timeline (ie, grant proposal, study design, recruitment, data collection and analysis, and implementation). As already outlined, the idnd governing body and patient advisory board were developed to guide the idnd members in their research development and implementation . Unlike other research networks with elaborate leadership panels and established bylaws, the governing body and advisory board have limited decision - making power . Guidelines were developed but only to document the developmental process of the governing body and patient advisory board and to define the roles of each for the network members . It is at the discretion of the investigator and research study team to respond to advice given . Although not a requirement among all community networks, patient representation within the idnd ensures patient input in the decision - making process and project development . Unlike other patient advisory boards, which are restricted to patients only or patients with specific forms of dementia or disease, the idnd s definition of patient includes the informal caregiver, allowing the idnd to develop research that addresses the needs of both . Although the functions of the governing body and patient advisory board for idnd continue to be defined, even in their juvenile state, both groups have already made significant contributions to the idnd . For most networks, funding is a constant obstacle, which can limit the degree of size, outreach, and direction of network growth.25 the idnd is sponsored by the regenstrief institute, inc, and iucar, which support the bimonthly meetings and the administrative infrastructure of the network . Any research grants, educational programs, or quality improvement projects generated by a member of the network are routed via the member - affiliated organizations . The network has functioned as a facilitator or catalyst for grant generation and clinical or educational program development . Other research networks, such as the alzheimer s association of indianapolis, have sponsors and additional financial partners, which allows for flexibility, increased involvement, and a larger societal impact . Although the idnd has the interest and representation of the major health care systems in the indianapolis area, exploration of additional funding is necessary to translate the idnd into a national model for the building of regional and national dementia networks . Communication tools vary among networks and include email listservs, newsletters, websites, and face - to - face meetings.23 for the idnd, information exchange has been unidirectional, primarily through email, newsletters, and the idnd website . With the exception of the regular dinner meetings, most idnd members do not have other opportunities to communicate with the idnd administration and other network members . The use of message boards and e - newsletters has been instrumental for other research networks in increasing information exchange among their members, gaining the interest of new parties, and expansion of research . Although the idnd has had many successes within its first years of operation, further development is needed in the financial and communication facets of the network as well as increased research proposition and involvement from other members to ensure longevity and lifelong societal impact . Improvements in these areas will result in opportunities for regional and national recognition and the translation of the idnd model into the building of other dementia discovery networks . These regional networks would be the ideal testing ground for new ideas and technologies for primary, secondary, and tertiary dementia prevention, creating more opportunity for collaborative research projects, quality improvement, and global impact.
Falls occur more often in women than in men, and the rate of falls in people older than 65 years is greater than 33%1 . Falls are affected by many causes; for example, culture, sex, social services regarding health, physical activities, healthy intake, drug intake, behavior that increases dangerous causes, attitudes, fear of falls, treatment after falls, and personal factors, like race, social environment, and economic strength, are factors affecting personal life and are taken as having a negative effect on quality of life2 . However, these fall factors can be good prevention factors that decrease danger of falls in the elderly3,4,5 . Loss of muscle strength in the weak elderly occurs more on the upper part of the body than the lower part; special knee supporting muscle strength shows a decrease, so that the body sways even when standing with two feet supported on a bearing surface6 . In addition, gait is also affected, so that decrease in step length, stride length, gait speed, and toe off and double support time increase . Therefore, elderly persons should increase muscle and maintain balance, and prevent falls through experimental factors like exercise7 . Research on fall prevention exercise for the elderly has been proposed, which includes balancing exercise while standing on a hard and soft surface8, resistive exercise that increases muscle strengthening exercise using a thera - band9, endurance exercise riding on a stationary exercise bike10, and maintenance of a maintain static body posture that can improve flexibility, like yoga11 and tai chi chuan, which is effective for balance and motor sensation12 . However, all these studies suggest different methods, and there is no typical method . The otago exercise program is composed of muscle strengthening, balance training, and walking, which suggests a specific training method13; in an experiment using this training program, males and females aged older than 70 were randomly divided into an experimental group and control group; the results showed an increase in balance, muscle strength, and falls percentage, and the danger rate of falls was decreased14 . On the other hand, recent rehabilitation research has introduced a new rehabilitation training method using various forms of tasks that fit the patient s personal purpose and is performed using virtual reality and augmented reality; the results showed significant functional improvement15, 16 . Augmented reality provides reality and additional information using external projection equipment17 combined with an imagine target, which turn increases the reality effects, which increases feedback, making flexible imagined changes become reality and vice versa18 . Therefore, the treatment environment when using augmented reality increases task complication gradually and also helps in increasing the effects of the education19 . Thus, this study was conducted in order to investigate the effect of application of augmented reality - based otago exercise on the elderly for fall prevention and to provide basal information . Bmi, body mass index a total of 21 elderly women who voluntarily agreed to active participation were included in this study . The selection criteria were sufficient cognitive ability to participate, as indicated by a mini - mental state examination score of 24 or higher . The exclusion criteria were 1) disabilities in visual, auditory sensation, and vestibular organs; 2) defects in extremities; and 3) fracture in the past year . All of the subjects received an explanation of this study and agreed to participate . A total of 21 elderly women were selected and divided into an augmented reality - based otago exercise group, which included 10 subjects, and an otago exercise group, which included 11 subjects; exercise was performed for 12 weeks . General characteristics of the augmented reality - based otago exercise group and otago exercise group are shown in table 1 . This study was conducted in order to provide an augmented reality environment for training of elderly women, provide the graphic and vision - based web - camera recognition handling technique, provide the vision and auditory expression technique for emotional feedback, build up vision and auditory models and a recognition information database, and provide a handling technique for situational perception and its reactions as a way of improving balance, gait, and physical factors in falls; in particular, real - time motion recognition was performed using a preserved modeled movement for measurement of speed of the movement and its accuracy . The first week of research started with a moderate intensity exercise program that subjects could perform five times . Subjects stood in front of a computer with a web camera, which had an svga resolution (800 600) head - mounted display (i - visor fx601, dae - yang e&c co, korea, 2008) and followed the movement displayed . The computer sensed the movement of the subjects and sent the information to the head - mounted display in order to repeat the task and move to the next level, which increased the speed . The muscle strengthening exercises include knee extension exercise for front knee strengthening, knee flexion for back knee strengthening, hip joint abduction for side hip strengthening, plantar flexion for calf raises of the ankle, and dorsiflexion for toe raises of the ankle; the balance training includes backward walking, walking and turning around, heel to toe walking, one leg stand, heel walking, toe walk, heel to toe walking backward, sit to stand, and stair walking . Muscle training and balance training are performed for a period of 40 minutes each, three times per week, according to the level of the subjects, and after the exercise, there was a 10-minute cooling down period13 . The bbs is a valid and reliable instrument for measuring both the static and dynamic aspects of balance in elderly people with stroke20 . Bbs scores range from 0 to 56 points, and the higher the score, the better the balance . Gait function was measured using a gaitrite system (gaitrite, cir systems inc ., the gaitrite system was used to measure spatiotemporal parameters, including gait velocity, cadence, step length, and stride length . Subjects were asked to walk at a comfortable speed, without the use of an assistive device, along a 10 m hallway21 . Fall efficacy was measured using the short falls efficacy scale - international (fes - i) version, which is a tool for measuring confidence regarding prevention of falls . Kempen et al.22 selected seven items for the short fes - i out of the 16 items of the fes - i . The spss statistical package, version 18.0, was used in performance of all statistical analyses . The paired t - test was used to determine changes between before and after the balance test, gait function, and falls efficacy test . The independent t - test p<0.001 differences in balance, gait, and falls efficacy after training are shown in table 2 . The bbs score showed a significant increase, from a score of 47.605.36 before to a score of 53.702.50 (p=0.000) after in the augmented reality - based otago exercise group; a significant difference, from a score of 48.914.53 to a score of 52.452.91, was observed in the otago exercise group (p=0.001). Gait parameters in the augmented reality - based otago exercise group showed significantly increased gait velocity (from 79.8313.22 cm / s to 99.1811.56 cm / s, p=0.001), cadence (from 100.799.92 steps / min to 116.738.81 steps / min, p=0.000), left side stride length (from 93.8810.18 cm to 100.259.91 cm, p=0.041), right side step length (from 46.784.67 cm to 50.555.13 cm, p=0.011), and right side stride length (from 93.6410.48 cm to 100.3910.07 cm, p=0.019). The otago exercise group showed significantly increased gait velocity (from 90.2212.22 cm / s to 103.7612.83 cm / s, p=.001), cadence (from 107.928.69 steps / min to 118.557.67 steps / min, p=0.022), left side step length (from 51.125.68 cm to 53.436.84 cm, p=0.023), and right side stride length (from 100.6412.79 cm to 105.0514.02 cm, p=0.028). The falls efficacy score for the augmented reality - based otago exercise group showed a significant difference, from a score of 14.504.58 to a score of 11.803.71 (p=0.019); however, the otago exercise group showed no significant difference (from a score of 12.366.23 before to a score of 11.184.53 after). This study examined the effect of augmented reality - based otago exercise on balance, gait functions, and falls efficacy of elderly women . As one grows older, anatomically, physiological aging and degeneration of proprioception and the vestibular system occurs . In addition, muscle mass decreases and postural sway increases, so the reaction time of the motor nerve becomes slower until changes ultimately occur in balance control, which increases the frequency of falls24 . Liu - ambrose et al.14 randomly divided 74 elderly people older than 70 years of age into an experimental group, which included 36 subjects, and a control group, which included 38 subjects . Otago exercise was performed in the experimental group for six months; for static balance, postural sway showed a decrease, from 360.3 mm to 305 mm, and dynamic balance, which was tested using the timed up and go test, decreased from 14.2 s to 13.6 s. in addition, campbell et al.25 divided 233 elderly women into an experimental group, which included 116 subjects, and a control group, which included 117 subjects . Otago exercise was performed for six months; the 4-test balance score showed a significant difference, from 0.42 to 0.01 (p<0.05). In this study, the bbs score for the augmented reality- based otago exercise group showed a significant increase, from 47.60 to 53.70 (p=0.000); a significant increase, from 48.91 to 52.45 (p=0.001), was observed in the otago exercise group, corresponding to findings of previous research . This means that otago exercise might affect improvement in the ankle strategy and hip strategy . In the ankle strategy, the body can move as a single entity about the ankle when the foot muscle is activated on the ground26; otago exercise was helpful in walking, standing erect, control of the body when it moves in a small range of area, and regaining balance when moving unconsciously . The hip strategy is used when the body moves faster as the velocity increases along with the distance26; otago exercise helped walking posture with regard to movement correction and muscle activation pattern and the helped with balance control with regard to the base of support . Finally, we assume that augmented reality is a medium for helping the ankle and hip strategy by allowing individuals to visually compare the modeled motion and self motion . An independent gait makes life productive, and is the most efficient method of moving from one place to another27 . As the elderly age, aerobic capacity, joint flexibility, muscle strength, and bone mass decrease, so that gait velocity and cadence decrease, step length and stride length decrease, double leg support time increases, and heel off and arm swing decrease, resulting in an unstable gait pattern28 . Binns29 divided women older than 80 years into an experimental group, which included 19 subjects, and an control group, which included 18 subjects; otago exercise was performed in the experimental group for six months; gait velocity increased from 0.80 m / s to 1.10 m / s . In this study, the augmented reality - based otago exercise group showed a significant increase, from 0.79.8 m / s to 0.99.2 m / s (p=0.001), which corresponded with results of previous research . We assume that this is affected by backward walk, walking and turning around, heel to toe walking, and stair walking in the otago exercise program . The subjects worked on speed, distance, direction, rhythm and muscle tone, and strength while walking . In addition, through stair walking, the subjects practiced with a fixed foot support, acceleration, balance control, extension and contraction of the lower limb, and ankle dorsiflexion to move the center of gravity to control the afferent, efferent, and contraction of the lower limb muscles . As a result, coordination and weight shifting were learned through movement of the lower limbs, and this improvement resulted in an increase in step length of the right lower limb and stride length of both lower limbs, thereby improving gait velocity and cadence . Self - efficacy is the self - belief or capability to create a plan and implement it . This efficacy also affects elderly, and decreases as people grow older, and it can be a hazardous factor for falls5; in addition, fear, which is the most significant complication of falls, should be regarded as an important matter30 . Campbell et al.31 divided 233 women older than 80 years of age randomly into an experimental group, which included 116 subjects, and a control group, which included 117 subjects; otago exercise was performed in the experimental group for six months; fall efficacy showed a significant difference, from 93.3 to 91.9 (p=0.009). Two years later, campbell et al.31 traced 41 subjects in the experimental group, and 61 subjects in the control group and found that the falls efficacy changed from 91.0 to 89.4, which was statistically significant (p=0.03). In this research, the falls efficacy in the augmented reality - based otago exercise group showed a significant difference (p=0.019), from 14.50 to 11.80, which corresponded with the previous research . This was the result of repeated training with the augmented reality program and the head - mounted display, which isolated the subjects from the external environment in order to increase concentration . Thornton et al.32 have shown that virtual reality participants had greater improvements in quantitative measures and made more comments expressing enjoyment and improved confidence . An augmented reality environment can provide users with direct visual feedback to control their movement and watch their own movement at the same time33 . It implies that otago exercise based on augmented reality can draw a user s interest and influence the falls efficacy . In addition, the improved gait of subjects in the augmented reality - based otago exercise group resulted in increased mobility, which helped in performance of activities of daily living and social activities and was also related to positive physical activity . In this study, we assume that the augmented reality program represented repeated feedback, and the otago training represented a goal of the subjects, which they could achieve by succeeding at each level, and that self - pride increased . The increase in self - pride was related to self - efficacy, which leads to an increase in falls efficacy . Therefore, repetitive training using the augmented reality - based otago exercise for fall prevention leads to a decrease in the fear of falls in elderly women and even changes their behaviors . This research showed that augmented reality - based otago exercise is effective for improving balance, gait, and falls efficacy of elderly women and that application of augmented reality - based otago exercise is meaningful . We expect that this augmented reality - based otago exercise will be used in elderly care centers as a physical therapy for effective training for balance, gait, and falls efficacy, and it could be used as a database for rehabilitation . We also hope that augmented reality - based rehabilitation research will be conducted continuously.
It is well documented that regular physical activity (pa) has many health benefits [1, 2] and that there is a dose - response association between pa and all - cause mortality [3, 4]. However, the pa of the majority of adults does not reach recommended levels, although there seem to be relatively stable or slightly increasing levels of leisure - time pa . Only 20% of norwegian adults meet the recommended daily requirement for 30 min of moderate - intensity activity . Declining levels of work - related activity, transportation activity, and activity at home the effectiveness of interventions that promote and increase pa has been studied, and there is strong evidence that public health efforts can successfully increase pa [8, 9]. The most cost - effective interventions, such as sign to prompt stair use, reached a high number of people using low - intensity (and low - cost) methods . However, the benefit was limited since these interventions were insufficient on their own to significantly increase the proportion of individuals who satisfied pa recommendations . The least cost - effective interventions were high - intensity individually adapted behavior change and social support programs . These programs had the largest effect sizes (largest increase in met hours per person per day) but had a higher cost since they required more face to face counseling or interaction compared to more cost - effective interventions . Many of these individually adapted behavior change programs have much in common in terms of exercise progression, diet, and motivation . If a program similar to those with a large effect size could be scaled up to reach a large number of people, it would be a cost - effective intervention for increasing pa . An increasing interest in health, fitness, and exercise features in newspapers and magazines has made collaboration with media possible . Health and exercise researchers can design interventions that may help to increase pa and public health behavior, and newspapers can cover the stories of the intervention participants . If the intervention could motivate the newspapers' readers to be more physically active, and these articles attract new readers, this is a win - win situation . We found no published evaluations of collaborations between newspapers and scientists with the aim of increasing pa among readers . Thus, we started the project from couch potato to half marathon runner in 14 weeks, which was a collaboration between a quality norwegian regional newspaper and the university of stavanger . The participants were enrolled in an intensive lifestyle intervention program for untrained adults, and their goals were to become physically fit and run a half marathon (21.1 km) after 14 weeks of training . The newspaper aimed to reach a new group of readers by publishing the experiences of the participants in this intervention study and to inspire readers to change their lifestyles and become more physically active . The main purpose of this study was to measure the response from readers regarding reports of untrained adults who participated in an individually designed lifestyle intervention program . We also wanted to gain experience of this intervention method and to explore its possibilities to increase participation in lifestyle intervention programs . The nature of exploratory research is to gain experience that will be helpful in expressing relevant hypothesis for more definite investigation . The main challenge of the study was to intercept readers' response to the newspaper articles during the intervention period, since this was unknown . The newspaper wanted to collaborate with the university of stavanger to design an exercise program and train three sedentary adults . The newspaper's readers were asked to participate in the 14 weeks long intervention study . The inclusion criteria were that participants had a body mass index between 25 and 35, had to be capable of running a distance of 3,000 m in around 20 min, should not have any kind of knee or hips problems, and could not be engaged in regular endurance training . A total of 169 adults (60% women) aged 1774 asked to be included in the project . In addition, a physiotherapist and a nutritional expert provided advice on alternative training and nutrition . The participants were informed that they would become the focus of public interest because they would receive newspaper coverage every week during the project period . The participants provided written informed consent that all the data related to their training and testing could be published in the newspaper and used in a scientific publication . The daily circulation of the newspaper was 63,000 copies, with an estimated readership of around 180,000 (three readers per copy). Before intervention, the newspaper aimed to publish 2 - 3 articles per week about the project . Total amount of published articles ended at 48, distributed equally throughout a period of 15 weeks and published both in the newspaper and on the project's website . Twenty - two articles focused on the testing, training, and progression of the three participants . Seven articles focused on exercise training principles, three articles on nutrition, and four articles on pa and health . Five of the articles focused on a mix of two or more of the mentioned topics . Every friday, the training program for the coming week was published in the newspaper and on the newspaper's website . The number of hits on the project's website was registered throughout the project period . The maximal oxygen uptake (vo2max) of the participants was measured at the start and after 13 weeks of training using a vmax 29 oxygen analyzer (sensormedics, yorba linda, ca, usa). A treadmill (elg 2; woodway gmbh, weil am rhein, germany) the three participants completed a 3,050 m running test around a lake at baseline and after 13 weeks of training . The 14-week training program was based on elite runners training principles, which consisted of a weekly mixture of two intensive interval sessions at 90% of hrmax and two continuous running sessions at moderate and low intensity . During the first three training weeks, the effective running time for the interval sessions was 15 - 16 min, that is, 8 times 2-minute jog at a heart rate of about 90% of hrmax with 1 min walk recovery . After five weeks, the effective running period during the interval sessions was increased to 2024 min . The continuous sessions started with one running session of 20 min and the other session as a combination of 40 min of walking and running . After week 5, the longest continuous running sessions were increased by 10 min each week until the participants could complete 100 min of continuous running . The lead journalist on the project also received an average of 15 questions or comments each week from readers by e - mail . The newspaper invited readers to engage in six different internet debates about training, pa, nutrition, and other health issues . Between 20 and 35 questions from the readers, readers were invited to join an open and supervised interval training session with the three project participants . First, the participants in the three open interval training sessions established a weekly running group . One year after the end of the project, 3060 participants aged 1573 (70% women) still met twice each week for an interval running session . A total of 90 different individuals participated in one or more of these training sessions . This newspaper followed three untrained adults whose goal was to complete a 41 km cross - country skiing competition, the hovden tour, after 11 weeks of training . Over 390 readers asked to participate in this project . Two double - page articles were published in the newspaper's sport pages each week during the project period . On three occasions, seventy individuals participated in the first running session, but the number of participants was limited to 60 in two subsequent technical skiing sessions . The cross - country competition, the hovden tour, was arranged for the first time in the project year . Three lakes race, which was the half marathon race the three participants competed in, was organized for the sixth time during the project year (2011). The number of runners who finished the race gradually increased from 150 in the first year (2006) to 460 in 2009 . In the year prior to the project year (2010), the number of runners who completed the race was 450 . In the project year, the number of competitors who completed the race was 937 . In the two previous years, there was also a relay class in the race . The number of teams increased from 11 in 2010 to 28 in the project year . Throughout 13 weeks of training, all participants experienced a significant increase in their vo2max, a reduction in their bmi, and an improvement in the running test (table 1). After seven weeks, they competed in a 10 km road race, and they achieved the following running times: 1:05:14 hour: min: s (female 1 or f1), 1:01:44 (female 2 or f2), and 1:02:07 (male 1 or m1). All participants completed the half marathon race after 14 weeks of training, and they achieved the following times: 2:24:54 (f1), 2:20:18 (f2), and 2:15:30 (m1). In their respective age groups, the participants finished 160 of 172 (f1), 34 of 40 (f2), and 160 of 170 (m1). The main findings of the study were that the press cover of the three former inactive participants, who achieved their goal of completing the half marathon race based on a 14-week - long lifestyle intervention program, resulted in 25,000 weekly unique hits at the project's website . The readers e - mailed questions, participated at internet debates and open training sessions, and established a weekly training group . An important criterion for success was that the three participants achieved their goals during the lifestyle intervention period . The participants told their stories through the newspaper, and the impact of the project was dependent on their achievements . Thus, great efforts were made to optimize their physical training programs and to increase the consciousness of participants about healthy lifestyle habits . The male participant stated that this project was one of the best things that could have happened to him . He reduced his body weight by 10 kg and normalized his total cholesterol level and blood pressure . He continued to train four times each week after the project and aimed to participate in future endurance runs . One of the female participants (f1) was one of two coaches who established the running group after the project . She now runs 2 - 3 weekly running sessions and cycles 20 km to and from her job twice each week . It has a positive effect on my spirit and my level of energy, and i have enrolled for my next half marathon race . The second female runner (f2) had problems with her hips for several weeks throughout the project period . During this period, she began supervised strength training and replaced two of the running sessions with steep walking sessions on a treadmill (10% gradient). The length and intensity of these sessions were the same as those in the recommended running sessions . I have reduced my body weight by 10 kilograms as a result of changing my way of living, and my goal is to run another half marathon race in the near future . The story about her use of alternative training during the injury period was published in the newspaper, and it may have been helpful for others struggling with similar injury problems . Approximately 60% of the 90 participants in the running group, which was established after the open training sessions, had previously been regularly physically active for more than six months . However, none of them had participated in systematic interval endurance training, and they experienced an improvement in their training quality in the running group . Twelve percent of the participants in the running group had previously not been regularly physically active, and they stated that they saw this open training invitation as a good opportunity to start exercising . To keep the running group motivated and to increase the number of participants, one of the two voluntary coaches sent a weekly e - mail to all 90 participants containing information about the next week's training program and encouraging them to bring a friend . A study by reed showed that e - mail intervention campaigns can be successful in increasing the level of pa among women, so this initiative seemed entirely reasonable . The running group received valuable publicity in newspaper reports, and this publicity was important for recruitment . This training group has recently started a walking group since some of the new participants found running too hard and uncomfortable . A norwegian study found that 76% of physically inactive subjects, that is, those who had not engaged in regular physical activity at least once every 14 days, wanted to engage in regular pa . The majority of this group reported that they required more initiatives or greater motivation to change their pa habits . The response to the present project was much greater than expected, and it showed that this type of intervention can provide the necessary motivation to increase pa . The newspaper gave the project high priority with front - page covers and double - page articles . The project received intensive coverage because of high interest among readers prior to the project . A reader survey of 1,000 newspaper readers was conducted a short time before the project commenced and showed that 60% (around 100,000) of the readers were interested in articles about pa, training, nutrition, and lifestyle . It is reasonable to consider that the newspaper's high level of project coverage increased interest among readers . Another important factor that affected involvement in the project was that the project period was sufficiently short to be attractive to readers but long enough to make the participants fit . A systematic review by foster et al . Indicated that professional advice and guidance with continued support can encourage people to become more physically active in the short to medium term . Therefore, an improvement of the project would have been to provide more follow - up reports, for example, different exercise programs that focus on the maintenance of physical fitness articles, to maintain the interest and support of readers . The idea of training people for a better life and publishing this in the media is not new . This approach has been used in many reality shows and other health programs on television and in health magazines . The publication of personal success stories also occurs on a large scale in commercial advertising . The same principle was applied in the present study, and the large numbers of readers who followed the project showed that the subject was of great interest . However, it is of great importance that readers were inspired to make lifestyle changes themselves and that they actually took steps to begin exercising . We do not know how many of the new competitors in the local half marathon race (the three lakes race) were inspired to copy the three project participants . However, it is not unlikely that some of the increase in race participants could relate to the project from couch potato to half marathon runner in 14 weeks . The transtheoretical model, which is also known as the stages of change model, could be useful for describing the pa level of readers affected by this project . Stage one would include the inactive readers who had not considered becoming more active, whereas inactive readers who wanted to be more active were included at stage two . Stage three included those who wanted to become physically active within one month, and many of these would already be engaged in some form of pa . Stage - four individuals had been regularly physically active for less than six months, whereas those who had been regularly physically active for more than six months were at stage five . We did not determine the characteristics of new participants in the three lakes race . However, the three project participants finished near the bottom of the results list . So, despite the doubling of participants from the previous year, it is reasonable to consider that the new race participants were more physically fit than our project participants; that is, they were likely to be defined to stage four or five in the transtheoretical model . Based on the level of participation in the running group, it seems that this group may have been the attraction for people who were occasionally physically active but who wanted more structure in their physical training, which is typical for people at stages three and four . However, the walking group, which was recently established, seems to recruit people from stage two . The newspaper articles could have been important for raising awareness about pa and health, which is essential for people at stages one and two in the transtheoretical model . Thus, it seems reasonable to assume that this type of intervention strategy engaged people at stages two to five, although the main effects were on people at stages three and four . The cost of the intervention program for the three participants was around us$6,250, which is high for only three people . However, the project had an estimated 100,000 readers and 25,000 unique weekly hits on the website . We also found that the number of participants in the half marathon race increased by around 500, while 90 people joined the weekly running sessions . Thus, the price per participant was low after taking these figures into consideration, regardless of whether the cost was split among 90, 500, or 25,000 participants . An important factor for this kind of intervention is the collaboration with the press . A public health department would probably have been incapable of conducting such a successful program on its own . It would have been very expensive to pay for advertising containing 48 articles, most of which were double - paged and several front - page stories . Second, the level of interest may also have been lower if the project had been published as an advertisement in a newspaper . Several other regional newspapers also took an interest in the project, and one month after the end of our project the leading regional newspaper in kristiansand, the fifth - largest city in norway, started a similar project . Compared with the present study, twice as many readers asked to be included in the project . However, the lead journalist on the project said that they had reached a new segment of readers, and the large number of hits on the project's web page confirmed that this type of reportage was of great interest . Women comprised over 50% of those who wanted to participate in the skiing project and those who joined the three public training sessions . Traditionally, less than 30% of the competitors in public norwegian cross - country skiing competitions are women . The overrepresentation of women in the half marathon running project and the cross - country skiing project might suggest that this type of lifestyle intervention program appeals more to women . According to hagberg and lindholm, the main criteria for judging the success of a lifestyle intervention program are exercise efficacy, population penetration (capacity to recruit participants), and adherence to pa . First, we established a well - designed training program with personal trainers, a nutritional expert, and a physiotherapist . We measured the physical fitness of the participants and detected significant improvements after the training period, while the participants reported highly positive experiences with this intensive and individually adapted intervention program . Second, the project received a lot of coverage in the newspaper, which ensured widespread publicity and increased the likelihood of recruiting participants . Third, only three of the 169 highly motivated applicants were included in the study, but the adherence to the program was 100% . First, there was no control group for measuring the response of the readers to the project . We could have conducted a survey of 1,000 readers and included questions on the possible effects of the study . Second, our estimate of 100,000 readers was based on a reader survey prior to the project and not during the project . However, the survey was carried out only two months before the start of the project . Third, we did not interview the new participants in the half marathon race to determine any possible link with the present project . We therefore do not know how many of the new participants were inspired to start as a result of the newspapers project coverage . A limitation or challenge with this type of intervention is that the general advice provided in a newspaper is not suitable for all readers . It is not possible to provide individually tailored training programs, so the wrong type of activity and training duration / intensity could result in injuries . There is high media interest in publishing health - related reportage, and this opportunity to motivate healthy lifestyles should be explored more intensively . The study presents a new approach to increase participation in a high - cost lifestyle intervention program . From an international perspective, this project has high potential for promoting public health via increased participation in pa . For example, the newspaper usa today publishes 1.8 million copies each day, so the paper has around 5.4 million readers if we assume three readers per copy . If this paper launched a similar project and received the same level of interest as the current study, almost three million readers might follow this lifestyle intervention program . Thus, there is great potential for recruiting participants to physical activity interventions by working with a newspaper or other large - scale media organizations . A challenge is to ensure that major editorial desks are made aware of this opportunity to acquire new readers or viewers, and hopefully the present study can facilitate this type of collaboration.
The study population was composed of youth at the time of entry into a weight management program who enrolled in the determinants of change in childhood obesity (decco) study, a prospective, observational study examining determinants of health indicators at baseline and during weight management in an established weight management program . All subjects aged 517, with no untreated endocrine disorder, were eligible for study participation . Participants in the decco study had four study visits baseline (enrollment in weight management program), 6 months, 1 year, and 2 years (1 year after completion of monthly program)whereas this analysis considers only the baseline data in a cross - sectional manner . Written informed consent was provided by the legal guardian and the child provided signed assent . The study was approved by the institutional review board at the hamilton health sciences corporation (hamilton, on, canada). The baseline study visit occurred in the morning, after an 8- to 12-h fast (allowing water), and comprised an evaluation of cardiometabolic risk factors (including an ogtt), anthropometric evaluation, and completion of questionnaires as described below . Bmi (kg / m) and bmi z score were calculated based on centers for disease control and prevention normative data, using nutstat, a component of the epi info program (15). Waist circumference (wc) was measured half - way between the iliac crest and lower rib (16) using a nonstretching tape with attached spring balance pulled to a tension of 250 g. wc z scores were calculated based on age- and sex - specific canadian normative data (17,18). Blood pressure (bp) was measured three times on the right arm, using an oscillometric method (omron healthcare, inc ., lake forest, il) with appropriate - sized cuff after the children had been sitting at rest for 10 min (19). Age, sex, and height cutoffs for defining hypertension were based on the 95th centile using u.s . Normative data as recommended (19). Parents reported the family history of premature coronary heart disease (defined as events in first- or second - degree male relatives <55 years old and/or female relatives <65 years old), t2 dm, and obesity . Children aged 8 years completed a confidential questionnaire identifying their cigarette smoking history and self - assessed pubertal stage (20,21). Boys and girls aged <8 years were assumed to be prepubertal, based on normative data for pubertal onset . An ogtt was conducted as follows: a baseline venous blood sample was taken and the patient consumed 1.75 g / kg glucose solution up to a maximum of 75 g orally . Prediabetes was defined as ifg, igt, or ifg + igt using ada criteria (ifg: fasting glucose level 5.6 baseline laboratory analyses were conducted in the laboratory of hamilton health sciences and included plasma glucose, total cholesterol (tc), hdl cholesterol (hdl - c), and triglyceride (tg); ldl cholesterol (ldl - c) was calculated using the equation of friedewald (22). Glucose was measured using an enzymatic reference method with hexokinase, and cholesterol levels were measured with an enzymatic colorimetric method on a roche integra analyzer . Mmol / l and/or hdl - c <1.03 mmol / l and/or ldl - c> 3.3 mmol / l, according to current recommendations (23). Study participants with dysglycemia were compared with those without dysglycemia using an unpaired t test for continuous variables and test for discrete variables . Laboratory variables (tc, hdl - c, ldl - c, tg, glucose, hemoglobin a1c (hba1c) alanine aminotransferase [alt], and aspartate aminotransferase [ast]) were log transformed to improve normality and are presented in table 1 as geometric means and 95% cis . All other continuous variables are presented as mean sd and discrete variables as n (%). The ada currently recommends criteria for screening for t2 dm in children (table 2). The sensitivity and specificity of these criteria for identifying dysglycemia (t2 dm, ifg, and igt) and isolated igt in our population were calculated . To examine the association of risk variables with dysglycemia, logistic regression analysis was used and odds ratios (ors) were calculated . The sensitivity and specificity of other risk strategies were also evaluated including 1) current canadian diabetes association (cda) guidelines (24), 2) a risk score developed by reinehr et al . The cda recommends screening all subjects in puberty or aged 10 years who have two of the following: bmi> 95th centile, high - risk ethnic group or family history of t2 dm, signs or symptoms of insulin resistance, and/or use of antipsychotic medications . (4) developed a simple risk score that includes parental history of t2 dm (2 points), pubertal onset (1 point), and extreme obesity defined as bmi z score> 2.58 (1 point) and recommended screening children or youth with 2 points . (3) recommended doing an ogtt to identify igt in children or youth if the fpg exceeded 4.8 mmol / l . As we were primarily interested in reducing the number of ogtts performed, while detecting patients with isolated igt, several models for the prediction of isolated igt were developed from least invasive to most complex . Variables that were significant in univariate analysis were included (age, sex, family history of t2 dm, systolic bp [sbp], bmi z score, wc, hba1c, fpg, elevated alt, tc - to - hdl ratio, and tg). Model 1 included data available with history and clinical exam only; model 2 included data from history, clinical exam, and nonfasting blood work (hba1c); model 3 included data from history, clinical exam, hba1c and fasting glucose; and model 4 added in the influence of fasting tg . To evaluate the predictive properties of current ada and cda screening criteria and each model to identify igt, we performed receiver operating characteristic (roc) analysis on the entire population with complete data . To estimate the discriminative value of the predictive models, we calculated the roc area under the curve (auc) for the outcome igt . The auc for the ada and cda screening criteria and each of the models was compared using a test . Although the models were developed using continuous variables, we sought to establish a user - friendly screening test using thresholds for each variable and to examine these in a logistic model . The applied thresholds considered were previously recommended, including bmi z score 2.58 (4) and hba1c 5.7%, or were obtained using optimal discrimination on the roc curve (tg> 1.17 mmol / l). The baseline study visit occurred in the morning, after an 8- to 12-h fast (allowing water), and comprised an evaluation of cardiometabolic risk factors (including an ogtt), anthropometric evaluation, and completion of questionnaires as described below . Bmi (kg / m) and bmi z score were calculated based on centers for disease control and prevention normative data, using nutstat, a component of the epi info program (15). Waist circumference (wc) was measured half - way between the iliac crest and lower rib (16) using a nonstretching tape with attached spring balance pulled to a tension of 250 g. wc z scores were calculated based on age- and sex - specific canadian normative data (17,18). Blood pressure (bp) was measured three times on the right arm, using an oscillometric method (omron healthcare, inc ., lake forest, il) with appropriate - sized cuff after the children had been sitting at rest for 10 min (19). Age, sex, and height cutoffs for defining hypertension were based on the 95th centile using u.s . Parents reported the family history of premature coronary heart disease (defined as events in first- or second - degree male relatives <55 years old and/or female relatives <65 years old), t2 dm, and obesity . Children aged 8 years completed a confidential questionnaire identifying their cigarette smoking history and self - assessed pubertal stage (20,21). Boys and girls aged <8 years were assumed to be prepubertal, based on normative data for pubertal onset . An ogtt was conducted as follows: a baseline venous blood sample was taken and the patient consumed 1.75 g / kg glucose solution up to a maximum of 75 g orally . Prediabetes was defined as ifg, igt, or ifg + igt using ada criteria (ifg: fasting glucose level 5.6 mmol / l; igt: 2-h glucose level 7.8 baseline laboratory analyses were conducted in the laboratory of hamilton health sciences and included plasma glucose, total cholesterol (tc), hdl cholesterol (hdl - c), and triglyceride (tg); ldl cholesterol (ldl - c) was calculated using the equation of friedewald (22). Glucose was measured using an enzymatic reference method with hexokinase, and cholesterol levels were measured with an enzymatic colorimetric method on a roche integra analyzer . Dyslipidemia was defined as fasting tg> 1.7 mmol / l and/or hdl - c <1.03 mmol / l and/or ldl - c> 3.3 mmol / l, according to current recommendations (23). Study participants with dysglycemia were compared with those without dysglycemia using an unpaired t test for continuous variables and test for discrete variables . Laboratory variables (tc, hdl - c, ldl - c, tg, glucose, hemoglobin a1c (hba1c) alanine aminotransferase [alt], and aspartate aminotransferase [ast]) were log transformed to improve normality and are presented in table 1 as geometric means and 95% cis . All other continuous variables are presented as mean sd and discrete variables as n (%). The ada currently recommends criteria for screening for t2 dm in children (table 2). The sensitivity and specificity of these criteria for identifying dysglycemia (t2 dm, ifg, and igt) and isolated igt in our population were calculated . To examine the association of risk variables with dysglycemia, the sensitivity and specificity of other risk strategies were also evaluated including 1) current canadian diabetes association (cda) guidelines (24), 2) a risk score developed by reinehr et al . (4), and 3) fasting glucose> 4.8 mmol / l (3). The cda screening criteria are similar to the ada criteria but somewhat less stringent . The cda recommends screening all subjects in puberty or aged 10 years who have two of the following: bmi> 95th centile, high - risk ethnic group or family history of t2 dm, signs or symptoms of insulin resistance, and/or use of antipsychotic medications . (4) developed a simple risk score that includes parental history of t2 dm (2 points), pubertal onset (1 point), and extreme obesity defined as bmi z score> 2.58 (1 point) and recommended screening children or youth with 2 points . (3) recommended doing an ogtt to identify igt in children or youth if the fpg exceeded 4.8 mmol / l . As we were primarily interested in reducing the number of ogtts performed, while detecting patients with isolated igt, several models for the prediction of isolated igt were developed from least invasive to most complex . Variables that were significant in univariate analysis were included (age, sex, family history of t2 dm, systolic bp [sbp], bmi z score, wc, hba1c, fpg, elevated alt, tc - to - hdl ratio, and tg). Model 1 included data available with history and clinical exam only; model 2 included data from history, clinical exam, and nonfasting blood work (hba1c); model 3 included data from history, clinical exam, hba1c and fasting glucose; and model 4 added in the influence of fasting tg . To evaluate the predictive properties of current ada and cda screening criteria and each model to identify igt, we performed receiver operating characteristic (roc) analysis on the entire population with complete data . To estimate the discriminative value of the predictive models, we calculated the roc area under the curve (auc) for the outcome igt . The auc for the ada and cda screening criteria and each of the models was compared using a test . Although the models were developed using continuous variables, we sought to establish a user - friendly screening test using thresholds for each variable and to examine these in a logistic model . The applied thresholds considered were previously recommended, including bmi z score 2.58 (4) and hba1c 5.7%, or were obtained using optimal discrimination on the roc curve (tg> 1.17 mmol / l). The descriptive characteristics and risk variables of the cohort (n = 259) and of those with and without dysglycemia (prediabetes or t2 dm) are presented in table 1 . Although the mean age was 11.8 years, participants ranged in age from 5 to 17 years . Of the participants, 1 (0.39%) had undiagnosed t2 dm based on a 2-h glucose> 11.1 mmol / l . Prediabetes was present in 20.5% of the cohort, and 4.2% had ifg, 13.9% isolated igt, and 2.3% ifg + igt . Thus, of the 53 participants with prediabetes identified using an ogtt, 36 (68.0%) had isolated igt and would not have been identified if only fasting glucose had been measured . We identified no difference in the prevalence of prediabetes in those <10 vs. 10 years (17.8 vs. 22.0%; p = 0.45). Baseline characteristics of the study cohort the participants with dysglycemia (prediabetes or t2 dm) did not differ in age, self - reported pubertal stage, ethnicity, bmi z score, wc z score, or percent body fat from those without dysglycemia (table 1). A family history of t2 dm was relatively common in the children in this cohort (50.2%), and the prevalence was not different in those with and without dysglycemia . Diagnosed t2 dm in at least one parent was less common (16.2%) but also did not differ between groups . Children with dysglycemia had higher sbp and diastolic bp (dbp), fasting tg, hba1c, and alt . The prevalence of elevated alt was also higher in the dysglycemia group (13.0 vs. 4.9%; p = 0.03), but no differences in the prevalence of dyslipidemia (p = 0.07) or hypertension (p = 0.14) were noted . The prevalence of hba1c above the recommended threshold of 5.7% was not different in those with dysglycemia (p = 0.10). The strongest predictor of dysglycemia in univariate analysis was hba1c (or per 1-sd increment 3.4 [95% ci 1.249.35]; p = 0.02). Other cardiovascular risk factors that predicted dysglycemia included serum tg (1.87 [1.332.63]; p = 0.0003) and sbp (1.04 [1.011.07]; p = 0.01). The ada recommends screening children aged 10 years (or pubertal children) who are overweight or obese and have two associated risk factors as described in table 2 . Current screening criteria had a sensitivity of 38.9% (95% ci 25.951.9) and a specificity of 69.8% (63.576.0) to detect dysglycemia . In a similar manner, the sensitivity to detect isolated igt was 41.7% (25.657.8) with specificity of 69.5% (63.575.6). Thus, in applying the current ada screening criteria, less than half of those children with isolated igt were identified . As noted in table 3, reinehr score and fpg> 4.8 mol / l also had low sensitivity and comparable specificity to the ada criteria . The cda criteria had higher sensitivity to identify a child with igt (81.8 vs. 43.2% using ada) but lower specificity (37.7 vs. 70.2%). Ada - recommended criteria for screening children and youth for t2 dm sensitivity and specificity of current screening guidelines, published scores, and simple tg model for detecting isolated igt as described in research design and methods, we proceeded to develop the models based on increasing complexity . We compared the models using the auc of the roc curves (table 4). Adding hba1c or elevated alt values to data obtained from the clinical history and physical exam did not improve the prediction of igt, but adding fasting blood work was beneficial . Adding fasting glucose alone demonstrated no increased predictive power, but adding fasting tgs did . Similar conclusions were reached if the anthropometric variable included was bmi z score or wc z score . Roc analysis of models for prediction of isolated igt using ada criteria using thresholds for each variable in model 4, the potential predictors age> 10 (p = 0.49), pubertal (p = 0.52), parental t2 dm (p = 0.15), hba1c> 5.7% (p = 0.43), fasting blood glucose (p = 0.85), sbp> 95th centile (p = 0.82), and bmi z score> 2.58 were not significant and were not included in the final logistical model . Remaining in the model was tg> 1.17 mmol / l (or 4.3; p <0.0001). This variable alone had clinical usefulness (table 3), and auc that exceeded the ada and cda screening criteria was somewhat lower than continuous models 4a and 4b (table 4). Current ada screening criteria had low discriminatory capacity for identifying dysglycemia in our cohort of overweight children presenting to a weight management program . Using a specific multilevel approach to applying screening criteria, we have identified a screening algorithm requiring history and physical examination only, with comparable discriminatory capacity (auc in roc analysis) to ada recommendations but requiring less information (age, sex, parent history of t2 dm, sbp, and bmi z score). The addition of a nonfasting blood test to measure hba1c did not improve the predictive properties, but adding a fasting tg improved the discriminatory capacity . In fact, a fasting tg> 1.17 mmol / l had better discriminatory capacity and clinical usefulness than current ada criteria in identifying isolated igt . Dysglycemia was common (20.8%) and igt was identified in 16.2% of the participants, comparable to the findings of several american studies (2,25). Silent t2 dm was relatively rare in this population (1 of 259) but was identified on a 2-h blood glucose alone . As with previous studies, the prevalence of ifg was low, and 68% of children with elevated 2-h glucose levels had fasting glucose <5.6 mmol / l (ada cutpoint for ifg). Among our population of obese children and adolescents, important risk predictors for sbp, parental t2 dm, and higher tc - to - hdl ratio were also predictive variables . Important variables without evident influence include age, pubertal stage, sex, body size (bmi), and wc, suggesting that among obese youth, these variables have little predictive potential for dysglycemia . Current ada screening criteria had low sensitivity and only moderate specificity to identify isolated igt . Using roc analysis, we identified a model using history, physical examination, and fasting laboratory data (glucose and tg) with better discrimination of igt than current ada and cda screening criteria . This may enable reasonable identification of children with prediabetes while avoiding excessive use of ogtts . Hba1c thresholds recently have been recommended for identifying adults at high risk for t2 dm and for diagnosis of t2 dm in adults (26). This approach also has been recommended recently for adolescents, although the clinical usefulness in this age - group has since been challenged (27,28). Using national health and nutrition examination survey data, hba1c thresholds of 5.7 and 6.0% had poorer performance in identifying prediabetes in adolescents compared with adults . We found no added predictive benefit of including hba1c with data from history and physical examination in identifying igt . However, adding the fasting tg level improved the auc . When applying thresholds to develop a simple clinically applicable version of model 4, only fasting tg> 1.17 mmol / l remained in the model, and this alone had sensitivity of 70% and specificity of 64% to identify igt . Furthermore, the auc exceeded that of current ada and cda screening methods . Despite being one of very few studies to critically examine the usefulness of current screening recommendations to identify prediabetes in obese youth, our study does have some limitations . Even though no influence of pubertal stage was identified on prevalence of prediabetes, it is noteworthy that puberty was not assessed by a physician but was self - reported by the study participants using a validated methodology . Although we identified no difference in prevalence of prediabetes in those aged <10 compared with those 10 years, only 73 participants aged <10 were included . Thus, further observation of the prevalence of prediabetes and evaluation of appropriate screening criteria in this age group should occur . Our classification of the glycemic status of the study participants was based on a single ogtt, and given published concerns on the reliability of this measure, we may have misclassified some of the participants . However, our methodology is consistent with that used in most studies examining the risk of progression to t2 dm and comparable studies identifying the prevalence of prediabetes in youth . Finally, our evaluation was within a select population: all children and youth were overweight, 93% were obese, and all were referred for weight management . Balancing the costs and the consequences of more invasive testing with the potential health advantages of screening depends on how important one considers the identification of a disorder . Although in adults we have interventions that prevent the progression of prediabetes to t2 dm, thus arguing for high importance of identification of prediabetes, questions remain on the natural history of prediabetes in youth . 8 of 33 (24%) youth with igt at baseline progressed to t2 dm during a 2-year period (1), comparable to annual progression rates of 510% reported in adults (6). Should future research support the importance of intervening in children and youth with igt, screening criteria with high sensitivity would be required . Although screening obese children and youth with a fasting tg provides moderate sensitivity and specificity and is better than currently recommended approaches, 30% of obese children with igt will not be identified using this screening criteria, suggesting that an ogtt be done in all obese children and youth.
Disruption of androgen biosynthesis and actions by environmental endocrine disrupting compounds (edcs), of synthetic or natural origin chemicals (table 1), inhibiting critical cellular processes controlling steroidogenesis in leydig cells (e.g., transport and delivery of cholesterol into mitochondria, steroidogenic enzyme expression or activity) and androgen binding to the androgens receptor (ar) may lead to incomplete masculinization and malformations in the male reproductive tract of both humans and animals . Androgen deficiency during prenatal development is thought to disturb differentiation of the wolffian duct, a process crucial to the proper development of male internal reproductive organs . An increase in a number of human male reproductive developmental disorders such as cryptorchidism, hypospadias, testicular cancer, as well as decreased quality of semen all have all been proposed to be due to the action of edcs . It has been hypothesized that edcs play a role in the etiology of these abnormalities, collectively termed testicular dysgenesis syndrome (tds). Reliable data on the prevalence of tds are scarse but> 5% of the danish male population was reported to suffer from undescended testes, hypospadia, or testicular cancer . Moreover, the recent finding of an age - independent decrease in testosterone and sex hormone - binding globulin (shbg) levels in us and danish populations over the past 20 years indicate an environmental influence such as a growing negative effect of edcs on androgen production by leydig cells . In addition, recent findings have demonstrated the association between exposures to edcs and the development of obesity, a factor that may cause increased estrogenic effects on the humans and attenuate leydig cell function and fertility . The aim of this paper is to give an overview of the published literature on the effects of edcs on leydig cell function and steroidogenesis with particular focus on male reproduction and fertility . Two distinct generations of leydig cells have been identified: fetal leydig cells (flcs) and adult leydig cells . Despite their differences in morphological and biochemical properties, fetal and adult leydig cells share the same principal function to produce androgens . During the prenatal period, the (flcs) are the primary source of androgens . These cells then secrete testosterone and other androgens, which regulate not only the masculinization of internal and external male genitalia, but also neuroendocrine functions . Flcs start to appear in the mesenchyme of the developing prenatal testis at e12.5 in mice, e14.5 in rats, and 7 - 8 weeks of gestation in human ., flc numbers increase from 2.5 10 per testis at e17 to about 1 10 cells per testis at e21 . Flcs seem to arise from multiple sources including the coelomic epithelium, gonadal ridge mesenchyme, and migrating mesonephric cells [7, 8]. Endothelial cells migrating from the mesonephros contribute to precursors of the peritubular myoid and vascular cell lineages [9, 10] and may also serve as the origin of fetal leydig cells . There is also opinion that flcs due to their expression of neuronal proteins may have origin from neural crest cells . Moreover, it has been suggested that the flcs may have first evolved from slight modifications of fetal adrenal cells . This hypothesis is supported by the finding that adrenal cortex and gonads are both derived from the common adrenal - gonadal primordium before they separate into separate organs . Flcs possess a well - developed steroidogenic machinery expressing the key steroidogenic enzymes, such as steroidogenic acute regulatory (star) protein, cytochrome p450scc, 3-hydroxysteroid dehydrogenase - isomerase (3hsd), cytochrome p450c17, and 5-reductase (5-r) required for androgen synthesis . Testosterone secreted by flcs is required for masculinization and proper development of male reproductive organs . This steroid produced by flcs is converted to 5-dihydrotestosterone (dht) by the enzyme 5-r . Dht is a more potent androgen than testosterone and controls proper development of male external genitalia (e.g., the penis and scrotum) and the release of the testis from its urogenital ridge location . Experiments on animals have shown that disruption of flcs development results in feminization of external genitalia due to lack of androgens required for their masculinization . Moreover, flcs also produce insulin - like factor 3 (insl3), a protein that plays a critical role in the regulation of the early phase of testicular descent . Thus, flc dysfunction may lead to incomplete masculinization and various malformations in the male reproductive tract of humans and animals (e.g., cryptorchidism and hypospadia). Adult leydig cells originate postnatally and produce testosterone required for the pubertal development of external genitalia and onset of spermatogenesis, the important endocrine functions apparent at the onset of puberty . Adult leydig cells are not derived from preexisting fetal leydig cells, but most likely from undifferentiated peritubular - like stem cells, which express both stem and peritubular cell markers . The leydig stem cells proliferate neonatally and transform to progenitor cells by day 14 postpartum in rodents . They have spindle shape and classify as leydig cells because they express luteinizing hormone (lh) receptor and low levels of steroidogenic enzymes (e.g., 3-hydroxysteroid dehydrogenase (3-hsd), cytochrome p45017-hydroxylase / c17 - 20 lyase (p450c17), 17-hydroxysteroid dehydrogenase (17-hsd)) and produce low but detectable levels of androgens [16, 17]. This type of leydig cell exists for only a brief interval, postnatal days 1428 in rats . During that time immature leydig cells function during day 28 to 56 and express high levels of steroidogenic enzymes involved in the biosynthesis and metabolism of testosterone (e.g., 5-reductase and 3-hsd), and therefore secrete more 5-reduced androgens than testosterone . Adult leydig cells have low numbers of lipid drops, higher number of lh receptors, and the major androgen produced by the cells is testosterone due to enhanced expression of 17-ksr and suppression in the activities of 5-reductase and 3-hsd . Steroidogenesis in leydig cells is regulated mainly by lh, a glycoprotein produced by the anterior pituitary . Binding of lh to its 7-transmembrane g - protein coupled receptor stimulates adenylate cyclase activity, resulting in increased cyclic adenosine monophosphate (camp) formation . Camp stimulates the camp - dependent protein kinase (pka), which phosphorylates serine and threonine residues on specific protein substrates . Camp activates steroidogenesis by temporally distinct manners; acutely (minutes) or chronically (hours). The delivery of cholesterol molecules into the inner mitochondrial membrane is generally accepted to be the rate - determining step in steroidogenesis . The cholesterol transport mechanism is a complex process, involving an interaction between the steroidogenic acute regulatory (star) protein and the peripheral - type benzodiazepine receptor (pbr) [23, 24]. Star expression is upregulated by trophic hormones, and after synthesis as a 37-kda precursor protein, it needs to be processed to a 30-kda mature protein to become functionally active . Pbr has high affinity to bind cholesterol from cytosolic donors and transfers it from the outer into the inner mitochondrial membrane . Star and pbr are suggested to work coordinately in the process of transporting cholesterol into mitochondria, where star is functioning as an initiator of cholesterol transport and pbr as a gate for cholesterol entry into mitochondria . This reaction is one of the rate - limiting in steroidogenesis and catalysed by the cytochrome p450 enzyme cyp11a1 and specific electron transferring proteins, localized at the inner mitochondrial membrane . Pregnenolone then leaves the mitochondria to the smooth endoplasmic reticulum, where it is converted by 3-hsd to progesterone . This steroid is then metabolised by p450c17 to androstenedione, which is converted to testosterone by 17-hsd . The pesticides procymidone, linuron, vinclozolin, p, p-ddt and its derivatives, are all antagonists of ar and inhibit androgen - dependent tissue growth in vivo . None of these pesticides or their metabolites appears to display significant affinity for the estrogen receptor or to inhibit 5-reductase activity in vitro . Procymidone (n-(3,5-dichlorophenyl)-1,2-dimethyl - cyclopropane-1,2-dicarboximide) is widely used as a fungicide for the control of plant diseases . High mg quantities of procymidone were found in unhusked rice (1.42.3 mg / kg), tomatoes (about 5 mg / kg), grapes, and wine (us environmental protection agency annual report, 1994) suggesting that an intake of significant quantities of this compound in the human is possible . Long - term administration of procymidone is suggested to inhibit the negative feedback exerted by androgens on the hypothalamus and/or the pituitary, thereby causing hypergonadotropism in rats . The lesser ability of testosterone to bind ar in this situation suppresses the inhibitory feedback of testosterone on lh production by preventing the hypothalamus and anterior pituitary from recognizing the presence of testosterone . This results in hypersecretion of lh with concomitant elevation of serum testosterone (figure 1). Long - term hypergonadotropism and hyperstimulation of leydig cells induced by procymidone give rise to leydig cell tumors in male rats . Recent findings from our own laboratory reveal that dietary administration of procymidone to rats for three months not only enhances serum levels of lh and testosterone, but that the leydig cells isolated from these animals display an enhanced capacity for producing testosterone in response to stimulation by hcg or (bu)2camp, as well as elevated levels of star, p450scc, and p450c17 . Linuron (3-(3,4-dichlorophenyl)-1-methoxy-1-methylurea) is marketed as a selective urea - based herbicide for pre- and/or postemergence control of weeds in crops and potatoes . This compound binds to both rat prostatic and human ar (har) and inhibits dht - induced gene expression in vitro . The anti - androgenic effect of linuron is observed clearly upon administration during gestation [32, 33] or in a hershberger assay . Administration of linuron (200 mg / kg daily) to sexually immature and mature rats for 2 weeks results in decreased weights of accessory sex organs and increased serum estradiol and lh levels, without altering the serum concentration of testosterone . In contrast, prenatal exposure to linuron (75 mg / kg / day) during gestational days 1418 in rats has recently been shown to decrease testosterone production by fetal leydig cells . This latter study suggests that linuron disrupts the development of androgen - dependent tissues primarily by acting as an ar antagonist and by inhibiting testosterone synthesis by the fetal testis . This suggestion agrees well with the evidence that in utero exposure to potent pharmaceutical antagonist of ar, flutamide decreases the expression levels of sf-1, insl3, and 3hsd in the developing fetal rat testis, suggesting impaired differentiation of the fetal leydig cells . Vinclozolin is a dicarboximide fungicide that has two active metabolites, m1 and m2, which both have anti - androgenic properties . These metabolites compete for androgen binding to ar and inhibit dht - induced transcriptional activation by blocking ar binding to androgen response elements in dna . Oral administration of vinclozolin delayed pubertal maturation, decreased sex accessory gland growth and increased serum levels of lh, testosterone and 5-androstane, 3,17-diol . Studies in vivo have also revealed that vinclozolin - treated male offspring displayed female - like anogenital distance (agd) at birth, retained nipples, undescended testes, and small sex accessory glands . However, experiments in vitro revealed that vinclozolin did not affect basal and hcg - stimulated testosterone production by rat leydig cells in primary culture . Furthermore, the most sensitive period of rat fetal development to anti - androgenic effects of vinclozolin was found to be gestational days 16 - 17 . P, p-dde, a metabolite of the environmentally persistent pesticide ddt, acts as an antagonist of ar both in vivo and in vitro . When p, p-dde (100 mg / kg daily) was administered to rats during fetal development on days 1418 of gestation, the agd was reduced and hypospadia, retention of nipples, and weight reduction of androgen - dependent tissues occurred . Moreover, long - term administration of p, p-dde to rat pups from the time of weaning until approximately 50 days of age did not significantly alter the weights of accessory sex organs or serum hormone levels, but resulted in pronounced reduction of the weights of androgen - dependent tissues in the hershberger assay . As with rats, administration of p, p-ddt or p, p-dde to rabbits during gestation resulted in reproductive abnormalities, including cryptorchidism, in the male offspring . It has also been suggested that p, p-dde causes abnormalities in the reproductive development of wildlife . For instance, high concentrations of p, p-dde, together with enhanced susceptibility of the developing reproductive system to this environmental anti - androgen due to a loss of genetic diversity, has been suggested to contribute to the high incidence of cryptorchidism in the florida panther . Phthalates are widely used as plasticizers in the production of plastics, as well as solvents in inks, and are present, among other places, in children's plastics toys, food packaging, and certain cosmetics . Although diethylhexyl phthalate (dehp) and monoethylhexyl phthalate (mehp) disturb reproductive development in an anti - androgenic fashion, neither of these compounds binds to ar . However, it is now established that these phthalates inhibit leydig cell steroidogenesis at different ages of fetal development . For example, prenatal exposure of rats to dehp attenuates serum levels of both lh and testosterone in male offspring at 21 and 35 days of postnatal age . In contrast, treatment with dehp for two weeks postnatally (beginning at 21 or 35 days of age) results in a significant decrease in the activity of 17hsd and reduces testosterone production by leydig cells by 50% . On the other hand, treatment of adult rats with dehp does not influence their leydig cell steroidogenesis . From these findings it has been concluded that the effects of dehp on leydig cell steroidogenesis are dependent on the stage of development at the time of exposure and may involve modulation of the activities of steroidogenic enzymes and/or serum levels of lh . It has recently been demonstrated that chronic exposures to low environmentally relevant dehp levels increased plasma levels of lh, testosterone, and 17-estradiol . These metabolic events coincided with high proliferative activity of leydig cells, likely to be induced by the high levels of lh . Moreover, this study pointed out that dehp might be indirectly estrogenic because it increased 17-estradiol plasma levels, presumably due to induction of aromatase activity in leydig cells by lh . We have recently demonstrated that mehp inhibits androgen production activated by human chorionic gonadotropin (hcg) in primary cultures of leydig cells . This process was associated with decreased expression of steroidogenic acute regulatory (star) protein and reduced transport of cholesterol into mitochondria but no detectable adverse effect on steroidogenic enzymes was observed . Moreover, upon exposure to mehp alone, 5-reductase activity was decreased in immature, but not in adult leydig cells, indicating higher susceptibility to adverse effects of mehp in young animals . In line with the above observations and possibly contributing to undermasculinization of male fetuses, prenatal exposure of rats to di(n - butyl)phthalate (dbp) during days 1221 of gestation gives rise to leydig cell hyperplasia and adenomas, as well as agenesis of the epididymis . Despite the increased numbers of leydig cells present after such exposure, testicular levels of testosterone are reduced at 18 and 21 days of gestation age . It has been suggested that the proliferation of leydig cells observed in rat fetuses exposed to dbp may be a compensatory mechanism designed to increase testicular steroidogenesis in response to levels of testosterone that are insufficient to promote normal differentiation of the male reproductive tract . In addition to reducing testicular levels of testosterone, inhibition of fetal leydig cell steroidogenesis by phthalates causes numerous malformations of androgen - dependent tissues in male rats, including a decrease of agd, hypospadia, epididymal agenesis, and testicular atrophy . In addition to suppression of androgen production by fetal leydig cells, fetal exposure to phthalates has been shown to reduce insl3 expression and to inhibit the transabdominal descent of the testis, most likely due to an altered maturation of the fetal leydig cells . It should be noted that there are very large species differences in the response to phthalate exposure . Mice and marmoset monkeys are almost insensitive to phthalates, while rats are very sensitive . This is supported by the observation that administration of high doses of mbp to pregnant marmosets found no evidence for masculinization disorders, suggesting normal functioning of fetal leydig cells . This finding is consistent with the absence of effect of mbp on steroidogenesis in vitro by fetal human testis explants . Similarly, administration of high doses of dbp or mehp to pregnant mice did not reduce testicular testosterone levels or affect the expression of the steroidogenic enzyme genes, as seen in the rat . Polychlorinated dibenzo - p - dioxins such as 2,3,7,8-tetrachlorodibenzo - p - dioxin (tcdd) are released into the environment as a by - product of the manufacture of chlorinated hydrocarbons and during other industrial processes, and are recognized as potent developmental and reproductive toxins . Upon binding of tcdd to an aryl hydrocarbon receptor (ahr), the receptor complex translocates into the nucleus, where ahr heterodimerizes with the aryl hydrocarbon receptor nuclear translocator (arnt), binds to dioxin - responsive enhancer elements and regulates the transcription of target genes . It has been shown that the mechanisms of tcdd - induced disorders in the reproductive system of mammals are multiple and could involve (i) altered steroidogenesis [54, 55], (ii) reduced expression of sex steroid and lh receptors [56, 57], and (iii) induction of cytochrome p450 1 (cyp1) family enzymes resulting in inactivation of steroid hormones . It is likely that the adverse effects following a tcdd exposure are result of a combination of the mechanisms described . It has been recently demonstrated that prenatal treatment of pregnant rats with low (0.3 g / kg) dose of tcdd significantly reduced intratesticular testosterone of fetal males, while high (1 g / kg) dose attenuated lh production by the pituitary of exposed male fetuses . One possible explanation for tcdd - induced decrease in testicular steroidogenesis could be the reduction in leydig cell number . In adult male rats exposed to tcdd, the size and the number of leydig cells has been decreased . Interestingly, pharmacological treatment of tcdd - exposed rats with human chorionic gonadotropin (hcg) preserves leydig cell morphology and function . Tcdd treatment is also associated with inhibition of the mobilization of cholesterol and of the activities of cytochromes p450scc and p450c17 in leydig cells [62, 63]. Many if not all of these alterations in steroidogenesis might be explained by the recent finding that tcdd inhibits the formation of camp by cultured leydig cells . The inhibitory effect of estrogens on male reproductive function appears, at least in part, to be mediated by suppression of lh release by the pituitary . A direct effect of estrogen on leydig cell steroidogenesis has also been demonstrated . In vivo experiments have shown that exogenously administered estradiol can inhibit steroidogenesis via suppression p450c17 activity in leydig cells . These findings were supported by experiments in vitro, showing that estradiol may interact directly with p450c17 as a noncompetitive inhibitor, by binding to the enzyme and inhibiting its activity . Estrogen receptor (er) is expressed by leydig cells and er null mice were shown to have lower sperm counts and elevated serum testosterone levels . Moreover, the expression of several steroidogenic enzymes and factors such as p450c17, 17-hsd, and star was higher in er deleted mice than in wild - type mice, suggesting that er-signalling can suppress androgen production in leydig cells . Since exogenous compounds of anthropogenic or natural origin with estrogenic functions are widely distributed in food, air, and water, it is suggested that such environmental factors may negatively influence reproductive functions in humans . They are structurally similar to 17-estradiol and have therefore the ability to cause estrogenic or / and antiestrogenic effects . Chemically, the phytoestrogens can be divided into four main classes: flavonoids (e.g., genistein, daidzein, naringenin, and kaempferol), coumestans (coumestrol), lignans (matairesinol and secoisolariciresinol), and stilbene (resveratrol). The main sources of phytoestrogens are fruits, vegetables, and legumes . It is important to note that humans can intake of high mg quantities of flavonoids (e.g., genistein, daidzein) via food consumption . Low m levels of genistein are found in serum of the japanese population and in infants who consume large amounts of food products derived from soy beans . Moreover, resveratrol is now popular drug widely used for prophylactic of cardiovascular diseases and its consumption may reach several grams per day . The isoflavones genistein and daidzein are widely distributed in human and animal diet and were found to have a structural similarity to 17-estradiol (e2). The highest amount of flavonoids has been found in soybeans and soy food (1,2 - 3,3 mg isoflavones / g dry weight) as well as in other types of beans and legumes . The presence of genistein and daidzein in soy - based infant formula at high-m concentrations and the fact that blood concentrations of the isoflavones are 1000 times higher than endogenous e2 indicate a possibility for interaction with leydig cell function and development of the reproductive system in male infants . Several studies have reported on an influence by isoflavones on testicular morphology and leydig cell development . Similarly, marmoset fed with soy formula milk developed large testes and morphological studies demonstrated an increased number of leydig and sertoli cells when compared with controls . However, lower concentrations of serum testosterone associated with an increased number of leydig cells have been observed in neonatal marmosets fed with soy milk formula when compared with animals fed with cow milk formula . We have demonstrated recently that long - term dietary administration of genistein to rats suppressed the steroidogenic response of leydig cells to hcg and (bu)2camp by downregulating the expression of p450scc, suggesting that genistein and/or its metabolites have direct effects on leydig cell function . The exact cellular and molecular mechanism behind these effects of genistein remains to be defined, but may involve activation of the estrogen receptor by the phytoestrogen . This suggestion agrees well with the evidence that high estrogen exposure reduces expression of sf-1, star, and cyp17 and attenuates fetal leydig cell steroidogenesis in rodents [79, 80]. It has also been reported that long - term dietary administration of genistein reduces serum levels of testosterone and androstenedione without affecting the expression of star in rats . Furthermore, this compound also suppresses both basal and lh - stimulated androgen production by rooster leydig cells in vitro . However, treatment of ma-10 cells with genistein and resveratrol was shown to suppress star gene expression whereas quercetin enhanced star promoter activity and expression, resulting in increased progesterone synthesis by the same cells . Moreover, we have recently demonstrated that resveratrol and certain analogs structure dependently attenuated steroidogenesis in leydig cells through suppression of the expression of star and cytochrome p450c17 . These in vitro effects are similar to those observed in infant rats after exposure to potent ers agonist diethylstilbestrol (des), where significant suppression of testicular star expression associated with decline in plasma testosterone level was demonstrated, suggesting a role for ers in the regulation of star gene expression and functioning . Another synthetic compound with estrogenic activity, which is widely used in industry is bisphenol a (bpa). The chemical structure of bpa is quite similar to that of a very potent estrogenic compound des but it is a much weaker estrogen, approximately 1000- to 2000-fold less potent than estradiol . It was demonstrated that exposure to environmentally relevant bpa levels has adverse effects on testicular function by decreasing pituitary lh secretion and reducing leydig cell steroidogenesis . Bpa was found to act directly in leydig cells because it decreased testosterone production after treatment of leydig cells in vitro . Analysis of steroidogenic enzyme gene expression by rt - pcr indicated that bpa caused specific inhibition of the p450c17 enzyme, which is known to be inhibited by estradiol . Although bpa suppresses testosterone production via decreased lh secretion, there is also evidence that bpa interferes with lh receptor - ligand binding and uncoupling of lh from the lh receptor potentially contributes to diminished lh stimulation of steroidogenesis . However, bpa was recently demonstrated to increase aromatase expression but reduced testosterone synthesis in rat leydig r2c cell line in vitro . Thus, phytoestrogens and bpa may negatively influence leydig cell function resulting in androgen insufficiency . This may contribute to undermasculinization of the male urogenital tract resulting in malformations such as hypospadia, cryptorchidism, and poor development of external genitalia in the male . Edcs of natural or anthropogenic origin may cause deleterious effects on male reproduction and fertility . The mechanisms of their adverse actions may be diverse but one important end point is reduced capacity of leydig cells to produce androgens . Dysfunction of fetal leydig cells induced by edcs may cause incomplete masculinization and development of various malformations in the male reproductive tract of humans and animals . Attenuation of adult leydig cell development and function may manifest by suppressed spermatogenesis and libido . The impaired leydig cell function is displayed by a decrease in testosterone production as a consequence of reduced expression of several important steroidogenic factors, including star, cyp17a1, cyp11a1, and 3-hsd . All these factors being important components of the steroidogenic machinery may serve as susceptible targets of edc actions . However, our knowledge on the intracellular signalling cascades triggered by edcs is still limited . Little is also known about the mechanisms that determine the selectivity of different edcs for disruption of particular target molecules involved in steroidogenesis . Increasing evidence indicate that multiple mechanisms are causing endocrine disruption including (1) direct effects on the expression of genes of steroidogenic factors, (2) suppression of upstream signalling pathways controlling phosphorylation and activation of target proteins involved in transport of cholesterol into mitochondria of steroidogenic cells, and (3) direct interference with ar function blocking androgen action . A scheme describing potential sites of action of edcs attenuating androgen action is presented in figure 2 . The action of edcs on leydig cell function and the reproductive potential is a complex process that depends on the exposure route, dose, the developmental stage of the exposed target organism, and many other factors . Together, these factors determine the potential risk for adverse consequences with long - lasting effects on male reproductive function.
This disease is one of the most common reasons for hospitalization of children under the age of six months . The disease is characterized by frequency of occurrence with prevalence in the winter season november - march . To diagnose severe forms of bronchiolitis as a clinical syndrome in daily practice, knowledge of epidemiological data, the patient s age, clinical examination and insight into the risk factors for the disease s development are often sufficient factors . Bronchiolitis is an acute inflammatory disease of the small bronchial tubes, most often caused by viral infection . The most frequent cause of the disease in about 4/5 of the total number of diseased is the respiratory syncytial virus (rsv). In the us and the uk, 1 - 3% of the infected infants are hospitalized each winter because of this respiratory infection . Bronchiolitis with severe clinical features is usually seen in younger infants . Out of the total number of children hospitalized with bronchiolitis, 2 - 5% is in need for mechanical ventilation and those are usually children with rsv bronchiolitis . This is more frequent in premature born infants and those with pre - existing chronic pulmonary diseases . According to the same studies, the mortality is less for 1% for the infants without existing risk factors while it is to a certain degree higher (3 - 10%) for the infants with chronic pulmonary diseases and with congenital cardiac anomalies . According to the data disaggregation based on patients gender, the number of boys hospitalized with bronchiolitis is higher than the number of girls . This disease can also occur in older children, even up to two years of age, but in this case the clinical features are less severe . It is believed that rsv infection affects 70 - 80% of infants and practically all children until the second year of age . Incubation of the rsv lasts four days and a child is contagious five to twelve days after onset of the illness (1). After the first infection, the immunity is not permanent, consequently, the reinfections are common but with more subtle illness symptoms . If the disease occurs in the spring or summer, the cause is the human metapneumovirus . Usually, the epidemic occurs during the winter months with shorter and longer periods of absence in between . The virus is almost always transmitted from a collective into the family by an older child, and given its high contagiousness and transferability by sharing of items and goods, it affects young children . The virus remains alive for around 30 hours on objects and for about an hour on hands what is sufficient time for an easy transmission amongst family members(1). In the temperate climate zone the rsv epidemics occur every winter and last four to five months . Over the remaining months, the epidemics usually has a peak in january and february . At the time of the epidemic, the number of infants hospitalized because of bronchiolitis varies depending on the number of the rsv infected individuals in the community . In the tropical zone, the epidemical pattern is less clear (2). With regards to the virus prevalence in differently populated communities, it has been seen that in urban areas around half of vulnerable infants are exposed to the infection during each epidemic season . The rsv antibodies which have a protective effect with the full term infants healthy term infants are transplacentally transmitted, which explains the decreased rates of infected infants, especially those with more severe clinical features, in the first four to six weeks of life . To diagnose in daily practice the severe forms of bronchiolitis as a clinical syndrome, knowledge of epidemiological data, the patient s age, clinical examination and insight into the risk factors for the disease s development are often sufficient elements . As for the prognoses, in most of the cases the disease more recently, the studies have shown that the rates of hospitalizations of children with risk factors and sever clinical features have decreased most probably thanks to the introduced palivizumab immunoprophylaxes . Since it is spread through droplets and contacts, it is important to conduct rapid diagnostic and to undertake adequate preventive measures aimed at preventing occurrence and spread of the rsv nosocomial infections (3). The history of the disease in 155 infant patients, who were clinically treated because of bronchiolitis in the period from february 2013 to february 2014 in the department of pediatric pulmonary clinic in sarajevo was retrospectively analyzed . The research involved 155 children from 1 to 12 months old who were hospitalized with the clinic features of bronchiolitis in the department of pediatric pulmonary clinic in sarajevo in the period from 01.02.2013 to 01.02.2014 . The infants with repeated infections of lower respiratory tubes were not included in the research . Out of the total number of children hospitalized with bronchiolitis (155), 91 (58.7%) were boys and 64 (41.3%) where girls . The study conducted in 2007 in the pediatric clinic in sarajevo also stated the higher percentage of hospitalized male infants (4). In relation to age distribution of bronchiolitis incidence the first group is composed of children 1 - 3 months old, the second group were children 3 - 6 months old and the third group was composed of children 6 - 12 months old . In the first group there were 74 children (47.7%), in the second group 54 (34.8%) and in the third group 27 (17.4%) as presented in the graph 1 . Thus, the most widely affected children were under the age of three months . According to the study conducted in the sarajevo clinic in 2007, the greatest number of patients was in the group of children 3 - 6 months old, which was consistent with current research . The study registered a larger number of patients shifting to lower age groups, and although the clinical features are milder, none of the children were ventilated or situations with latent consequences . The rsv infection has been proven in less than 1/3 of cases . In the comprehensive 10-year study in the usa (1997 - 2006), which included survey of the rsv infection in children up to 5 years of age, 26 of 1000 were children up to 1 year old amongst which the most represented age group were children up to 3 months of age (48 of 1000) and the least represented were children older than 12 months, 1.8 of 1000 (5). The age distribution of infant bronchiolitis looking at the seasonal distribution of bronchiolitis in a one year period, the greatest registered number of diseased was in the winter time . The number of diseased has been growing from november 15/155 (9.7%), during december 23/155 (14.8%) and reaches its peak occurrence in january 29/155 (18.7%) and in february 24/155 (15.5%). After february, it is gradually decreasing, in march 16/155 (10.3%), april 6/155 (3.9%), graph 2 . The one - year retrospective study conducted at the pediatric clinic in sarajevo in 2007 also alleges the highest number of diseased in the winter months (5). Seasonal distribution of rsv and non - rsv bronchiolitis follows different rates in different months, depending on climate and epidemiological seasonal conditions in the world (6). According to the study, the greatest number of diseased has been registered in the period january - february what corresponds to the quotes of the mentioned literature . As risk factors, artificial food, prematurity, birth weight, congenital hearth anomalies, broncho - pulmonary dysplasia, and asphyxia monthly distribution of bronchiolitis in one - year period having researched the influence of the risk factors on the bronchiolitis incidence, when compared with previous years, in the us different results relating to the risk factor of prematurity were reached . In the observed group (155) the risk factor of artificial food was dominantly present with 53.5% (83/155). According to milanovi v. breast feeding and breast milk play an important protective role (7). According to scottish intercollegiate guidelines network, if the breast feeding lasted less than two months there is a greater possibility of hospitalization of the children affected by bronchiolitis (8). In the conclusion of the study conducted on 384 children, ukalovi and associates claimed that breast fed children get sick from bronchiolitis less often than others (9). According to the study, amongst the children hospitalized with bronchiolitis the number of those on artificial food was dominant, which is in accordance with the quoted literature . The prematurity as a risk factor is represented in the percentage of 16.1 (25/155). According to this risk factor, the patients have been divided into three age groups: above 36 weeks of gestation, 32 - 35 weeks of gestation and 28 - 31 weeks of gestation . In the first group there were 83.9% (130/155) of children, in the second group 10.3% (16/155) of children and in the third group 5.8% (9/155) of children as presented in the graph 2 . We can see that when compared with the number of diseased under the influence of the prematurity risk factor, the greater number of diseased is amongst the healthy term children, what is perhaps the consequence of other viral ethology . The fewest number of diseased was registered in the group of children born with 28 - 31 weeks of gestation . However, on contrary to this data, the study conducted at the sarajevo pediatric clinic in sarajevo in 2007 stated that there was greater rate of hospitalized children with the prematurity risk factor and with the shortest gestation period . Thus reduced number of patients in premature infants in our study may be explained by the introduction of the regular rsv prophylaxis as of 2007 . The findings are presented in the graph 3 . The frequency of risk factors for infant bronchiolitis in one - year period . Gestational age in infant bronchiolitis gender disaggregation of patients in age groups distribution of tested patients on age according to the artificial nutrition as risk factor the congenital heart anomaly was represented with 14.2% (22/155). A higher percent of illness caused by this risk factor when compared with the previous study in sarajevo pediatric clinic may be explained with the usual more frequent respiratory infections in children with hearth anomalies and with the fact that larger number of children was observed in this case . Broncho - pulmonary dysplasia (bpd) was represented with 1.9% (3/155) and asphyxia with 2.6% (4/155). Small share of bpd as a risk factor causing severe bronchiolitis may be explained by the protocol use of the rsv chemoprophylaxis . The tested sample of 83 patients on artificial nutrition was divided into three groups:1 - 3 months, 3 - 6 months, 6 - 12 months . The age group 1 - 3 months had 30 while the age group 6 - 12 months had 20 patients . According bulkow lr et all . The breast feeding is associated with reduced risk for hospitalization in children younger than 6 months . (10) using the hi - squared test, we compared gender - related differences in groups and no significant statistical deviations were found in any of controlled age groups . The highest number of affected patients in our climate zone occurs in the winter months (january and february).all the patients had a favorable outcome of treatment; there were neither fatal outcomes nor patients who required mechanical ventilation.risk factors such as prematurity, low birth weight, usm and bpd as well as rsv etiology are less present in the examined period compared to the period before the introduction of rsv chemoprophylaxis at the sarajevo pediatric clinic.this study confirms the well - known importance of breast feeding in the prevention of early respiratory infections and the importance of rsv chemoprophylaxis.these epidemiological findings contribute to timely diagnosis and adequate treatment of non rsv and rsv bronchiolitis . The highest number of affected patients in our climate zone occurs in the winter months (january and february). All the patients had a favorable outcome of treatment; there were neither fatal outcomes nor patients who required mechanical ventilation . Risk factors such as prematurity, low birth weight, usm and bpd as well as rsv etiology are less present in the examined period compared to the period before the introduction of rsv chemoprophylaxis at the sarajevo pediatric clinic . This study confirms the well - known importance of breast feeding in the prevention of early respiratory infections and the importance of rsv chemoprophylaxis . These epidemiological findings contribute to timely diagnosis and adequate treatment of non rsv and rsv bronchiolitis.
Modern insulin analogues are a convenient new approach or tool to glycaemic control, associated with low number of hypoglycaemia and favourable weight change . A1chieve, a multinational, 24-week, non - interventional study, assessed the safety and effectiveness of insulin analogues in people with t2 dm (n = 66,726) in routine clinical care . Please refer to editorial titled: the a1chieve study: mapping the ibn battuta trail .. the patient characteristics for the entire cohort divided as insulin - nave and insulin users is shown in the table 1 . The majority of patients (81.1%) started on or were switched to biphasic insulin aspart . Other groups were insulin detemir (n = 22), insulin aspart (n = 6), basal insulin plus insulin aspart (n = 2) and other insulin combinations (n = 4). Overall demographic data after 24 weeks of treatment, overall hypoglycaemia decreased for both insulin user (from 30.1 events / patient - year to 13.8 events / patient - year) and insulin nave (from 24.9 events / patient - year to 12.7 events / patient - year) groups . The hypoglycaemia incidence in insulin naive group at 24 weeks was lower than that observed in insulin users at baseline . Also a decrease in body weight was observed for both the groups at 24 weeks [tables 2 and 3]. All parameters of glycaemic control improved from baseline to study end in the total cohort [table 4]. Overall efficacy data of the total cohort, 146 patients started on biphasic insulin aspart ogld, of which 95 (65.1%) were insulin nave and 51 (34.9%) were insulin users . After 24 weeks of treatment, hypoglycaemic events or episodes increased for both the groups (insulin nave: from 26.4 events / patient - year to 14.7 events / patient - year and insulin users: from 29.6 events / patient - year to 14.1 events / patient - year). Quality of life improved at the end of the study [tables 5 and 6]. Biphasic insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to biphasic insulin aspart for both insulin nave and insulin user groups [table 7]. Biphasic insulin aspartoral glucose - lowering drug efficacy data of the total cohort, 2 patients started on or were switched to basal + insulin aspart and both of them were insulin users . Of the total cohort, 22 patients started on insulin detemir ogld, of which 17 (77.3%) were insulin nave and 5 (22.7%) were insulin users . After 24 weeks of starting or switching to insulin detemir, hypoglycaemic events decreased for both insulin nave (from 0.4 events / patient - year to 0.6 events / patient - year) and insulin user (from 2.9 events / patient - year to 1.9 events / patient - year) group . Quality of life improved at the end of 24 weeks [tables 8 and 9]. Insulin detemiroral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin detemir oglds for insulin - nave group [table 10]. Insulin detemiroral glucose - lowering drug efficacy data of the total cohort, 6 patients started on insulin aspart ogld of which 1 (16.7%) was insulin nave and 5 (83.3%) were insulin users . After 24 weeks of treatment, hypoglycaemic events reduced from 13.0 events / patient - year to 0.0 events / patient - year for insulin user group [tables 11 and 12]. Of the total cohort, 146 patients started on biphasic insulin aspart ogld, of which 95 (65.1%) were insulin nave and 51 (34.9%) were insulin users . After 24 weeks of treatment, hypoglycaemic events or episodes increased for both the groups (insulin nave: from 26.4 events / patient - year to 14.7 events / patient - year and insulin users: from 29.6 events / patient - year to 14.1 events / patient - year). Quality of life improved at the end of the study [tables 5 and 6]. Biphasic insulin aspartoral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to biphasic insulin aspart for both insulin nave and insulin user groups [table 7]. Of the total cohort, 2 patients started on or were switched to basal + insulin aspart and both of them were insulin users . Of the total cohort, 22 patients started on insulin detemir ogld, of which 17 (77.3%) were insulin nave and 5 (22.7%) were insulin users . After 24 weeks of starting or switching to insulin detemir, hypoglycaemic events decreased for both insulin nave (from 0.4 events / patient - year to 0.6 events / patient - year) and insulin user (from 2.9 events / patient - year to 1.9 events / patient - year) group . Quality of life improved at the end of 24 weeks [tables 8 and 9]. Insulin detemiroral glucose - lowering drug safety data all parameters of glycaemic control improved from baseline to study end in those who started on or were switched to insulin detemir oglds for insulin - nave group [table 10]. Of the total cohort, 6 patients started on insulin aspart ogld of which 1 (16.7%) was insulin nave and 5 (83.3%) were insulin users . After 24 weeks of treatment, hypoglycaemic events reduced from 13.0 events / patient - year to 0.0 events / patient - year for insulin user group [tables 11 and 12]. Our study reports improved glycaemic control following 24 weeks of treatment with any of the insulin analogues (biphasic insulin aspart; insulin detemir; insulin aspart) with or without ogld . Bodyweight decreased and quality of life improved after 24 weeks in the total cohort . Though the findings are limited by number of patients, still the trend indicates that insulin analogues can be considered effective and possess a safe profile for treating type 2 diabetes in oriental morocco.
Road traffic injuries are a major component of the global burden of disease and disability and, in most countries, are the major cause of death during the first few decades of life.1 in the middle east, in countries with high income levels, motor vehicle deaths are higher than in many other world regions where income levels are much lower . During the last decade, qatar, a member of the gulf cooperation council, has exhibited rapid economic development and recently gained prominence by winning the bid for hosting the 2022 fifa (fdration internationale de football association) world cup . Qatar, a small country with a total land area of about 11 600 km, shares a common border with saudi arabia and is situated on a peninsula jutting into the persian gulf . The population, now estimated to be 1.61.8 million, has increased rapidly, as have the number of motor vehicles and licensed drivers . The estimated length of the road system is about 1600 km, and about half of the roads are divided highways . To alleviate traffic congestion in doha, the capital city traffic death rates in qatar increased steadily, reaching a level of 23 per 100 000 in 2005 . In comparison, in western europe and north america, motor vehicle death rates ranged from about 5 to 10 per 100 000.1 in qatar, until 2007, nearly two - thirds of all trauma - related deaths were caused by vehicular crashes and three - fourths of the victims were less than 50 years of age.2 beginning in early 2007, much more stringent traffic control measures were implemented an increase in fines for traffic violations, greater attention to seat belt use and an increase in the number of speed control cameras from 14 to 84 (a sixfold increase). Reports of the effectiveness of speed enforcement detection devices from westernised countries (europe, north america and australia) have shown some beneficial impact on reducing road traffic injury and death rates,3 but there are limited data on the use of photo enforcement cameras in other countries of the middle east . The aim of this study was to examine time trends in motor vehicle injuries in qatar between 2000 and 2010, with particular emphasis on the impact of photo enforcement cameras . For this report, we relied upon yearly data collected and stored by the qatar supreme council of health during the years 2000 to 2010 . These data are the basis of comprehensive health reports published annually by the health information section of the supreme council of health . Additional information about traffic control measures was obtained from the traffic department of the ministry of interior . We considered any death within a 30-day period after a motor vehicle injury as being caused by that injury . Included in this category are drivers, passengers and occupants of trucks and buses, as well as pedestrians and bicyclists injured by motor vehicles . In addition to motor - vehicle - associated deaths, we also recorded non - fatal injuries classified as severe (requiring hospitalisation) or mild (not requiring hospitalisation). The traffic department supplied information on the yearly number of tickets issued for traffic violations . By dividing the number of yearly tickets by the total population however, these cannot be considered true rates because many individuals had received more than one ticket . Tickets issued as a result of activity collected by the photo enforcement system were only for speeding or for driving through red lights and not for other traffic violations . We used means, standard deviations and student t test to compare the frequency of motor vehicle injuries and tickets issued for traffic violations before and after speed cameras were installed in 2007 . During the study period, the overall population of qatar increased from 614 000 to 1.7 million; about 75% of the population were <40 years of age . There were a total of 27 722 motor vehicle injuries, including 1991 deaths (table 1). Tickets issued for traffic violations increased dramatically during the study period, from about 52 000 in 2000 to over a million in 2010 . Traffic injury data: qatar 20002010 changes in injury rates differed by degree of severity . Mild injury rates exhibited inconsistent changes until 2007, when there was a sudden and sustained increase . Severe, that is, non - fatal injuries requiring hospitalisation decreased steadily throughout the period . In contrast, fatal injuries showed a steady increase until speed camera installation in 2007, when there was a sharp drop . During the period 2000 to 2006, the mean (sd) vehicular injury death rate per 100 000 was 19.94.1; from 2007 to 2010, the mean (sd) vehicular death rates were significantly lower: 14.71.5 (p=0.043) (figure 1). The decline in fatal injury rates from 2007 to 2010 was restricted to persons <40 years of age; there was no significant change in fatal injury rates for older persons (figure 2). Circles indicate injuries not requiring hospitalisation, triangles denote injuries requiring hospitalisation and squares indicate injuries resulting in death . Yearly vehicular death rates per 100 000 in qatar during the period 20012010 stratified by age . Filled bars indicate rates in persons <40 years, while open bars denote rates in persons 40 years . After the installation of photo enforcement cameras in early 2007, there was a marked increase in the number of tickets issued: prior to camera installation, the mean (sd) number of tickets issued per 100 population was 13.97.1 compared to 52.47.7 after camera installation (p0.001). The increase in tickets for traffic violations corresponded with the decreased death rate from traffic injuries (figure 3). Vehicular death rates in qatar plotted against number of tickets issued per 100 persons in two time periods: before and after 2007 . Mild injury rates exhibited inconsistent changes until 2007, when there was a sudden and sustained increase . Severe, that is, non - fatal injuries requiring hospitalisation decreased steadily throughout the period . In contrast, fatal injuries showed a steady increase until speed camera installation in 2007, when there was a sharp drop . During the period 2000 to 2006, the mean (sd) vehicular injury death rate per 100 000 was 19.94.1; from 2007 to 2010, the mean (sd) vehicular death rates were significantly lower: 14.71.5 (p=0.043) (figure 1). The decline in fatal injury rates from 2007 to 2010 was restricted to persons <40 years of age; there was no significant change in fatal injury rates for older persons (figure 2). Circles indicate injuries not requiring hospitalisation, triangles denote injuries requiring hospitalisation and squares indicate injuries resulting in death . Yearly vehicular death rates per 100 000 in qatar during the period 20012010 stratified by age . Filled bars indicate rates in persons <40 years, while open bars denote rates in persons 40 years . After the installation of photo enforcement cameras in early 2007, there was a marked increase in the number of tickets issued: prior to camera installation, the mean (sd) number of tickets issued per 100 population was 13.97.1 compared to 52.47.7 after camera installation (p0.001). The increase in tickets for traffic violations corresponded with the decreased death rate from traffic injuries (figure 3). Vehicular death rates in qatar plotted against number of tickets issued per 100 persons in two time periods: before and after 2007 . This study of traffic injuries in a small middle eastern country was conducted during a period of rapid population growth leading to an approximately threefold increase in the number of registered vehicles and a much higher increase in the number of licensed drivers a possible explanation for the increase in the number of mild, non - fatal injuries . During the study period, the traffic department of the ministry of interior authorised an increase in the number of cameras from 14 to 84, with nearly all the increase taking place in 2007 . As a result, tickets issued increased dramatically and were associated with a significant decrease in the motor vehicle injury death rate . With respect to the role of traffic tickets, we observed what appears to be a threshold effect: below 40 per 100, an increase in the number of tickets had no impact on death rate . However, above this level, there was a profound drop in traffic deaths, which has persisted over a 4-year period (figure 3). A major weakness of the study is that we cannot be sure how much of the reduction in death rates was caused by the new camera surveillance system . Although the sixfold increase in the number of installed cameras was associated with a highly significant increase in the number of traffic tickets issued, it is possible that other factors such as an increase in the amount of fines, increased use of seat belts by motor vehicle occupants, more effective triage and transportation or improved patient care may have contributed to the lowered death rates . Another weakness of this study is that although traffic deaths and serious injuries declined during the study period, the incidence of mild injuries not requiring hospitalisation increased . We believe that this could be related to improved notification of mild injuries or to the rapid population growth resulting in increased traffic density . Another explanation is that speed cameras decreased speeding enough to reduce the death rate, without affecting less severe injuries . Opinions about the effectiveness of speed control cameras are conflicting.36 most reports resemble our study, which used a before / after design . In qatar, photo cameras appear to have had the greatest impact on fatal injuries rather than on severe or mild injuries, and decreases in motor vehicle deaths were more noticeable in younger persons, who constitute three - fourths of the population . In 2008, of persons with serious injuries, about 20% were native qataris, which is approximately equal to the proportion of qataris in the population . Therefore, we believe that both the native and the non - native groups have about the same risk of motor vehicle injury . This is reassuring because many of the non - qatari inhabitants come from countries where driving regulations differ from qatar's . How do current death rates in qatar compare to other regions? In 2009, many western countries such as spain, ireland, austria, france, germany, uk, sweden, norway and australia had road traffic death rates ranging from 5 to 10 per 100 000, lower than the 2009 rate of 14 per 100 000 for qatar . This suggests that appropriate well - enforced laws have the potential for further reducing traffic death rates . This could be important in qatar, where road traffic injuries have been considered an epidemic7 and more than 25% of drivers have been involved in a road traffic crash.8 throughout the world, road traffic injuries are a major cause of morbidity and mortality . Speed cameras have been proven to be effective in controlling traffic crashes, but they have not been evaluated in the middle east . In qatar, a country with recent rapid population and economic growth, road traffic deaths increased steadily during the first several years of the 21st century . After installation of speed control cameras in 2007, there was a significant drop in motor vehicle deaths . When combined with additional traffic control measures, speed control cameras in non - western countries can help reduce the burden of road traffic injuries.
The lack of hepatic g6pase was obtained by a specific deletion of g6pc exon 3 in the liver using a cre - lox strategy in mice, which was recently described by mutel et al . Male adult (68 weeks old) b6.g6pc.sa and c57bl/6j mice (charles rivers laboratories) were injected intraperitoneally once daily with 100 l of tamoxifen (10 mg / ml) on 5 consecutive days, to obtain l - g6pc and l - g6pc (wt) mice, respectively (14). Mice were housed in the animal house of lyon 1 university, in controlled temperature (22c) conditions, with a 12-h light12-h - dark cycle . The specific hepatic deletion of g6pc exon 3 in the l - g6pc mice was always verified by pcr on purified liver genomic dna after euthanasia, as described by mutel et al . All procedures were performed in accordance with the guidelines established by the european convention for the protection of laboratory animals . Insulin, glucagon, and corticosterone concentrations were determined with mouse elisa kits from chrystal chem, biovendor, and neogen, respectively . Catecholamines and amino acids levels were determined by high - performance liquid chromatography (centre hospitalier universitaire, lyon). -hydroxybutyrate was measured using optium ketone test strips with optium xceed sensors (abbott diabetes care, u.k . ). Blood glucose was determined with an accu - chek go glucometer (roche diagnostics) during fasting experiments . Hepatic glycogen determinations were carried out as described by keppler and decker (15). A catheter was inserted into the right jugular vein under anesthesia, and mice were allowed to recover for 46 days . After 6 h or 24 h of fasting, mice were infused with a bolus (92.5 kbq) of [3-h] glucose . We then administered [3-h] glucose at a rate of 6.3 kbq / min ., we checked that a steady state of plasma [3-h] glucose - specific activity reached from 30 min of infusion (data not shown). Plasma glucose concentration did not vary during the infusion time . At a steady state of glycemia and [3-h] glucose - specific activity (between 60 to 90 min), egp was calculated as ra using the simplified equation of steele, by dividing the [3-h] glucose infusion rate by the [3-h] glucose - specific activity (16). L - alanine and l - glutamine tolerance tests were performed after 6 h or 24 h of fasting . Mice were injected intraperitoneally with l - alanine or l - glutamine (2 g / kg bw). Blood glucose levels were determined from the tail vein at 0, 15, 30, 45, 60, and 120 min after injection . For glucagon challenge, wt mice were injected intraperitoneally with 0.9% nacl or glucagon (glucagen, novo nordisk) at a dose of 200 ng / g of weight . Kidneys and intestine were rapidly removed and fixed in formaldehyde for chromatin immunoprecipitation (chip) experiments, as described previously (17). For gcgr antagonist experiments, l - g6pc mice were dosed by gavage with 50 mg / kg of gcgr antagonist l168,049 (glucagon receptor antagonist ii, calbiochem) in 5% peg-400/5% tween-80/90% h2o or vehicle, as described previously (18). The liver and kidneys were rapidly removed, with tongs chilled previously in liquid n2, and frozen . G6pase and pepck - c activities were assayed at maximal velocity, as described previously (19). Immunoblotting was carried out using purified anti - rat g6pc (20), anti - pepck (santa cruz biotechnology), and antiglutaminase (kindly provided by dr . Reverse transcription and real - time pcr were performed using sequence - specific primers (supplementary table 1), with ribosomal protein ml19 transcript (rpl19) as a reference . Chromatin obtained was then sheared with the enzymatic shearing kit (active motif), yielding chromatin fragments of 500200 bp in size . Each immunoprecipitation was performed with about 10 g of chromatin using the chip - it express kit (active motif). Chromatin complexes were immunoprecipitated for 1618 h at 4c while rotating with either phospho - creb (ps133) antibody (epitomics), glucocorticoid receptor antibody (sc-1004; santa cruz biotechnology), or gfp antibody (santa cruz) as a negative control . After dna purification, quantitative pcr amplification was performed using primers specific for the camp or glucocorticoid response units of pck1 and g6pc promoters (supplementary table 1). The lack of hepatic g6pase was obtained by a specific deletion of g6pc exon 3 in the liver using a cre - lox strategy in mice, which was recently described by mutel et al . Male adult (68 weeks old) b6.g6pc.sa and c57bl/6j mice (charles rivers laboratories) were injected intraperitoneally once daily with 100 l of tamoxifen (10 mg / ml) on 5 consecutive days, to obtain l - g6pc and l - g6pc (wt) mice, respectively (14). Mice were housed in the animal house of lyon 1 university, in controlled temperature (22c) conditions, with a 12-h light12-h - dark cycle . The specific hepatic deletion of g6pc exon 3 in the l - g6pc mice was always verified by pcr on purified liver genomic dna after euthanasia, as described by mutel et al . All procedures were performed in accordance with the guidelines established by the european convention for the protection of laboratory animals . Insulin, glucagon, and corticosterone concentrations were determined with mouse elisa kits from chrystal chem, biovendor, and neogen, respectively . Catecholamines and amino acids levels were determined by high - performance liquid chromatography (centre hospitalier universitaire, lyon). -hydroxybutyrate was measured using optium ketone test strips with optium xceed sensors (abbott diabetes care, u.k . ). Blood glucose was determined with an accu - chek go glucometer (roche diagnostics) during fasting experiments . Hepatic glycogen determinations were carried out as described by keppler and decker (15). A catheter was inserted into the right jugular vein under anesthesia, and mice were allowed to recover for 46 days . After 6 h or 24 h of fasting, mice were infused with a bolus (92.5 kbq) of [3-h] glucose . We then administered [3-h] glucose at a rate of 6.3 kbq / min ., we checked that a steady state of plasma [3-h] glucose - specific activity reached from 30 min of infusion (data not shown). Plasma glucose concentration did not vary during the infusion time . At a steady state of glycemia and [3-h] glucose - specific activity (between 60 to 90 min), egp was calculated as ra using the simplified equation of steele, by dividing the [3-h] glucose infusion rate by the [3-h] glucose - specific activity (16). L - alanine and l - glutamine tolerance tests were performed after 6 h or 24 h of fasting . Mice were injected intraperitoneally with l - alanine or l - glutamine (2 g / kg bw). Blood glucose levels were determined from the tail vein at 0, 15, 30, 45, 60, and 120 min after injection . For glucagon challenge, wt mice were injected intraperitoneally with 0.9% nacl or glucagon (glucagen, novo nordisk) at a dose of 200 ng / g of weight . Kidneys and intestine were rapidly removed and fixed in formaldehyde for chromatin immunoprecipitation (chip) experiments, as described previously (17). For gcgr antagonist experiments, l - g6pc mice were dosed by gavage with 50 mg / kg of gcgr antagonist l168,049 (glucagon receptor antagonist ii, calbiochem) in 5% peg-400/5% tween-80/90% h2o or vehicle, as described previously (18). Immediately after gavage, mice were fasted and killed 6 h later . The liver and kidneys were rapidly removed, with tongs chilled previously in liquid n2, and frozen . G6pase and pepck - c activities were assayed at maximal velocity, as described previously (19). Immunoblotting was carried out using purified anti - rat g6pc (20), anti - pepck (santa cruz biotechnology), and antiglutaminase (kindly provided by dr . Reverse transcription and real - time pcr were performed using sequence - specific primers (supplementary table 1), with ribosomal protein ml19 transcript (rpl19) as a reference . Chromatin obtained was then sheared with the enzymatic shearing kit (active motif), yielding chromatin fragments of 500200 bp in size . Each immunoprecipitation was performed with about 10 g of chromatin using the chip - it express kit (active motif). Chromatin complexes were immunoprecipitated for 1618 h at 4c while rotating with either phospho - creb (ps133) antibody (epitomics), glucocorticoid receptor antibody (sc-1004; santa cruz biotechnology), or gfp antibody (santa cruz) as a negative control . After dna purification, quantitative pcr amplification was performed using primers specific for the camp or glucocorticoid response units of pck1 and g6pc promoters (supplementary table 1). G6pase activity was disrupted specifically in the liver by temporal and tissue - specific deletion of the g6pc gene based on a cre - lox strategy (14). In brief, transgenic b6.g6pc mice were crossed with transgenic b6.sa mice (21) to generate b6.g6pc.sa mice, expressing inducible cre specifically in the liver . The treatment of adult b6.g6pc.sa mice with tamoxifen induced the excision of g6pc exon 3, specifically in the liver (14), leading to a complete lack of hepatic g6pase activity (fig . This finding is consistent with these mice being unable to mobilize their glycogen stocks during fasting (fig . 1c), leading to a hepatomegaly (table 1). In wt mice, indeed, glycogen stock was about 40% of the fed level at 6 h of fasting and was completely exhausted after 12 h of fasting (0.6 mg / g of liver, n = 4). Although mice with the total knock - out of g6pc die after weaning, these l - g6pc mice are viable . Moreover, all l - g6pc mice survived prolonged fasting (45 h), although hepatic g6pase activity was still undetectable throughout the fasting period (fig . Because hepatic glucose production is thought to be critical for glucose homeostasis during fasting periods, plasma glucose concentration and egp were determined in l - g6pc and wt mice during prolonged fasting . L - g6pc mice displayed the same blood glucose level as control mice in the fed state (fig . Consistent with the role of hepatic glycogenolysis as an important pathway of glucose production in the early postabsorptive state, egp levels were found to be lower in 6 h fasted l - g6pc animals than in control animals (fig . This was correlated with a lower blood glucose in 6 h fasted l - g6pc mice (fig . G6pase activities (a) and glycogen content (b) were assayed in the liver of l - g6pc (black bar) and wt (white bar) mice in the fed state (0 h) or in fasted states (6 h, 24 h, and 40 h; n = 5 to 6 mice per group). C: blood glucose concentrations were determined afterward for 0, 6, 16, 24, 30, 40, and 45 h fasting in l - g6pc and wt mice . D: egp was determined in conscious l - g6pc (black bar) and wt (white bar) mice fasted for 6 h or 24 h (n = 6 mice per group). Data were obtained 5 weeks after gene deletion and are expressed as means sem ., significantly different with respect to the value in fed state in each group (p <0.01). And, significantly different with respect to the value at 6 h of fasting in each group (p <0.05 and p <0.01, respectively). Body and liver weights and plasmatic parameters of 6 h fasted l - g6pc mice values are expressed as means sem . Data were determined 5 weeks after gene invalidation from l - g6pc and wt l - g6pc mice upon 6 h of fasting . Values significantly different from wt (* p <0.05 and * * p <0.01) are indicated (mann - whitney test). Concomitant with this drop in blood glucose observed at 6 h fasting, ketogenesis was rapidly induced in l - g6pc animals . At 6 h fasting, the amounts of ketone bodies (-hydroxybutyrate) in l - g6pc mice were fivefold greater compared with the control mice that were able to produce high levels of glucose by inducing glycogenolysis (supplementary fig these results were accounted for by fast induction of the mitochondrial 3-hydroxy-3-methylglutaryl - coa synthase (hmgcs2) expression in 6 h fasted l - g6pc mice (supplementary fig . It is important to recall here that ketone bodies provide an alternative form of cellular energy fuel in postabsorptive situations characterized by low glucose availability . This is true notably for the brain, which may derive up to 70% of its energy from ketone bodies (6), and for the kidney and intestine, the two alternative gluconeogenic organs, which derive 50% of their energy from ketone bodies in postabsorptive state (22,23). It therefore seems unlikely that l - g6pc mice lacked energy fuels for these essential organs . It is noteworthy that differences in egp between l - g6pc and control animals were no longer observed after longer fasting periods, and that l - g6pc mice controlled blood glucose effectively during long fasting periods (fig . We even observed a significant increase in blood glucose between 6 h and 16 h fasting, such that the blood glucose concentration of l - g6pc mice eventually reached that of control mice after 30 h fasting (fig . By contrast, blood glucose concentration decreased steadily during fasting in control mice, eventually reaching a plateau at 100 mg / dl after 24 h of fasting (fig . It was hypothesized that l - g6pc mice maintained their glycemia through rapid induction of extrahepatic gluconeogenesis, compensating for lack of glucose production by the liver . It is noteworthy that blood glucose was the same in l - g6pc and control mice in the fed state, although glucose injection was necessary in the total g6pc knockout mice to maintain blood glucose (24). To explain this difference, we assessed the expression of gluconeogenic genes in the kidneys and intestine of fed animals . Renal g6pc mrna levels of fed l - g6pc mice were about 1.7-fold higher than those in control mice (fig . Finally, specific g6pase activity in the kidney was 40% higher in l - g6pc than in control mice (fig . 2c). On the contrary, no modification of g6pc and pepck - c expression was observed in the intestine of l - g6pc compared with control mice (fig . Only g6pase was upregulated in the kidneys of l - g6pc mice in the fed state, reflecting constitutive induction of the gluconeogenic pathway in the kidneys of l - g6pc compared with wt mice . Expression of main gluconeogenic enzymes in the kidneys (a c) and the intestine (d f) of fed l - g6pc mice . A and d: level of g6pc and b and e: western blot and quantification analysis for g6pc and pepck - c proteins . C and f: specific g6pase and pepck - c activity of homozygous l - g6pc (black bar) and wt (white bar) mice . Data were obtained 5 weeks after gene deletion in fed mice (n = 6 mice per group) and are expressed as the mean sem . Values significantly different from wt (* p <0.05, * * p <0.01) are indicated . After 6 h fasting, the expression of the genes encoding major regulatory enzymes of extrahepatic gluconeogenesis [g6pase, pepck - c, and glutaminase] was dramatically induced in both the kidneys and intestine of l - g6pc mice . In the kidneys, amounts of g6pc mrna and protein were about twice those in the control (fig . 3a and b), and specific g6pase activity was 36% higher than in control mice (fig . Renal pepck - c expression was increased concomitantly, resulting in a threefold increase of pck1 mrna and protein and specific pepck - c activity more than twice that of l - g6pc mice (fig . There was also an induction of glutaminase in the kidneys of l - g6pc mice (fig . A similar pattern of induction of gluconeogenic gene expression was observed for the three enzymes in the intestine of l - g6pc mice (fig . Thus, the expression of gluconeogenic genes was rapidly induced in both the kidneys and intestine of l - g6pc mice in postabsorptive state . Expression of main gluconeogenic enzymes in the kidneys (a c) and the intestine (d f) of 6 h fasted l - g6pc mice . A and d: level of g6pc and pck1 mrna expressed as a ratio relative to rpl19 mrna level . B and e: western blot analysis and quantification for g6pc, pepck - c, and glutaminase proteins . C and d: specific g6pase and pepck - c activity of homozygous l - g6pc (black bar) and wt (white bar) mice . (n = 6 mice per group), and are expressed as means sem . Values significantly different from wt (* p <0.05, * * p <0.01) are indicated . These results strongly suggested that the l - g6pc mouse rapidly upregulated gluconeogenesis in the kidneys and intestine once food glucose was lacking . It is noteworthy that there is clear - cut organ substrate selectivity for the liver, kidney, and intestine gluconeogenesis (9). Whereas gluconeogenesis from glutamine only takes place in the kidneys and intestine, gluconeogenesis from alanine and lactate is the key pathway in the liver (4,9,25). To substantiate the view that postabsorptive or fasting l - g6pc mice were able to regulate plasma glucose from extrahepatic gluconeogenesis in the absence of hepatic gluconeogenesis, we performed tolerance tests from alanine (exclusive hepatic substrate) and glutamine (exclusive extrahepatic substrate). After 6 h of fasting, there was a marked increase in plasma glucose upon glutamine injection in l - g6pc mice, whereas only a marginal increase was observed in wt mice (fig . 4a). On the contrary, l - g6pc mice were unable to increase their plasma glucose in response to alanine injection (fig . Surprisingly, there was no increase in plasma glucose in wt mice injected with alanine; this might be a result of the preponderant role of hepatic glycogenolysis in egp and the nonactivation of gluconeogenesis at 6 h fasting in normal mice (see fig . Wt mice dramatically increased plasma glucose in response to alanine injection after 24 h of fasting, a time where glycogen stores were exhausted and liver gluconeogenesis was enhanced (fig . L - g6pc mice were still unable to convert the injection of alanine in increased plasma glucose (fig . 4c). Also in line with the absence of liver gluconeogenesis in l - g6pc mice, plasma alanine and lactate concentrations were 5060% higher than in wt mice (table 1). On the other hand, the plasma concentration of glutamine was slightly lower in l - g6pc mice than in wt mice, which was consistent with an increased utilization of glutamine (table 1). Taken together, these data strongly suggested that l - g6pc mice regulated plasma glucose from extrahepatic gluconeogenesis exclusively . After 6 h (a and b) or 24 h (c) of fasting, l - g6pc (black circles) and wt (open squares) mice were injected with glutamine (a) or alanine (b and c). Blood glucose levels were measured every 15 min for 2 h. data were obtained 5 weeks after tamoxifen treatment . Percent values relative to time 0 were expressed as means sem (n = 6 mice / group). Values significantly different from wt (* p <0.01); significantly different with respect to the value before alanine or glutamine injection (p <0.01). We then investigated the mechanisms underlying expression changes of gluconeogenic genes in both the kidneys and intestine in the absence of g6pc in the liver . First, we analyzed the hormonal status of l - g6pc mice in both fed and 6 h fasting states . In mammals, sophisticated hormonal control by insulin, glucagon, glucocorticoids, and cathecholamines maintains blood glucose within narrow limits, orchestrating the uptake and production of glucose . In both the fed state and after 6 h fasting, glucagon levels were higher in l - g6pc mice than in control mice (fig ., l - g6pc mice exhibited a lower insulin level than that of control mice after 6 h fasting (fig . 5b). This resulted in a twofold (fed state) to threefold (6 h fasted state) increase in the glucagon - to - insulin ratio in l - g6pc mice in comparison with that of the control mice (fig . Moreover, corticosterone levels were markedly increased in l - g6pc mice compared with the control mice after 6 h fasting (table 1), but not in the fed state (63.0 10.8 ng / ml in l - g6pc mice vs. 65.0 14.0 ng / ml in wt mice). However, the epinephrine and norepinephrine plasma concentrations were similar in both l - g6pc and control mice (table 1). This is in agreement with the observation that a hypoglycemic state around 60 mg / dl is mild and does not represent a stressed condition from the metabolic viewpoint, especially in the light of the concomitant increased availability of ketone bodies (see above). Glucagon regulates gluconeogenic gene expression in the kidneys and intestine of l - g6pc mice . Plasma glucagon (a), plasma insulin (b), and glucagon - to - insulin ratio (c) of fed or 6 h fasted l - g6pc (black bars) and control (white bars) mice are shown . D: rt - pcr analysis of the expression of glucagon receptor in the liver, kidney, and intestine of control mice fasted for 6 h. e - g: p - creb binding to the g6pc or pck1 promoter was analyzed by chip assay from kidneys or intestine of fed mice (e) or 6 h fasted mice (f and g). H: level of pck1 mrna expressed as a ratio relative to rpl19 mrna level in the liver of l - g6pc mice treated or not with gcgr antagonist l-168,049 (black bars) and wt mice (white bars) fasted for 6 h. i and j: level of g6pc mrna expressed as a ratio relative to rpl19 mrna level in the kidneys (i) and intestine (j) of l - g6pc mice treated or not with gcgr antagonist l-168,049 (black bars) and wt mice (white bars) fasted for 6 h. data were obtained 5 weeks after gene deletion (n = 6 mice per group) and are expressed as means sem . Values significantly different from wt (* p <0.05, * * p <0.01) and untreated l - g6pc mice ($p <0.05, $$p <0.01) are indicated ., significantly different fed state (p <0.01). In the light of these findings, glucagon could be a major candidate responsible for the induced expression of gluconeogenic genes in the kidneys and intestine of l - g6pc mice . Glucagon receptors (gcgr) are known to be present in the liver, but gcgr are also expressed in the kidneys, notably in the proximal tubules and, to a lesser extent, in the intestine (2628). We confirmed these data in l - g6pc mice where gcgr mrna was substantially expressed in the kidneys (10 times less than in the liver, however) and more weakly in the intestine (about 500 times less than in the liver) of both control and l - g6pc mice (fig . 5d). To date, the specific role of gcgr in these organs is still unexplained . However, two previous articles suggested a possible role of glucagon in the kidney cortex and intestine: 1) glucagon stimulated camp production in a kidney cortical cell line (29) and 2) glucagon infusion caused a net release of glucose into portal blood in dog (30). The gcgr is coupled to gs proteins, stimulating adenylate cyclase and increasing intracellular camp levels (26). This activates protein kinase a (pka), which phosphorylates camp - response element binding protein (creb). The phosphorylated form of creb (p - creb) induces the transcription of g6pc in the kidneys and intestine, via binding to the gene promoter (17). We then examined whether p - creb could bind to the g6pc and pck1 promoters by performing a chip assay . On the fed state, p - creb was bound to the g6pc promoter in the kidneys of the fed l - g6pc mice, but not to that of the wt mice (fig . P - creb was bound neither to the g6pc promoter nor to the pck1 promoter in the intestine of fed l - g6pc or wt mice (not shown). After 6 h fasting, p - creb was bound to the renal g6pc promoter, but still not to the pck1 promoter of l - g6pc mice (fig . It is noteworthy that in the intestine of 6 h fasted l - g6pc mice, p - creb was bound to both g6pc and pck1 promoters (fig . Unequivocally that the binding of p - creb on g6pc promoter in the intestine and kidney of l - g6pc mice was dependent on the increase of plasmatic glucagon, we administered orally a glucagon receptor antagonist to l - g6pc mice (l-168,049, 50 mg / kg body) (18). L-168,049 inhibits the fixation of glucagon on gcgr and glucagon - stimulated camp synthesis in cho cells expressing human gcgr (31). In the liver of l - g6pc mice, pck1 mrna expression was decreased by half 6 h after the administration of gcgr antagonist (fig . 5h), demonstrating the efficiency of the suppression of glucagon signaling . In agreement with the role of glucagon in the induction of extrahepatic gluconeogenesis, the administration of the antagonist prevented the increase of the g6pc expression in both the kidneys and intestine of 6 h these results strongly suggested that the increase of glucagon levels could account for the induction of g6pc expression in the kidneys and intestine of l - g6pc mice . An intriguing observation, however, is that the g6pc gene was induced in the kidneys but not in the intestine in fed l - g6pc mice (figs . 2 and 5). This might be dependent on differential sensitivity to glucagon in both organs, possibly related to the higher expression level of gcgr in the kidneys (see above). Although this reasoning may appear speculative, this phenomenon might to some extent be related to the fact that the kidney rapidly become predominant in participating in egp during fasting (8), whereas the participation of the intestine is weaker and is induced later in the same situation (5). In agreement with this rationale, the binding of p - creb to the renal g6pc promoter occurred from 6 h of fasting in wt mice (fig . 5f). To increment our findings and confirm that the extrahepatic glucagon effects observed herein were not an adaptation specific to l - g6pc mice but could also take place in wt, we carried out a glucagon challenge in fed wt mice . After 30 min of glucagon administration, the plasma glucagon rose to the level of 6 h fasted l - g6pc mice (figs . Consistent with the results obtained in l - g6pc mice, p - creb was firmly bound to the g6pc promoter in both tissues (fig . Moreover, in response to glucagon injection, p - creb bound to the pck1 promoter only in the intestine (fig . 6b), as already noted in l - g6pc mice (fig . 5). In conclusion, these results show definitively for the first time that g6pc gene expression is regulated by glucagon not only in the liver, but also in the kidneys and intestine, under physiological conditions . Moreover, glucagon can also regulate pck1 in the intestine, but not in the kidneys . It must be noted that the increased concentration of corticosterone might also play a role in the induction of extrahepatic gluconeogenesis . Glucocorticoids activate gluconeogenesis via the binding of glucocorticoid receptors (grs) to glucocorticoid response element on both g6pc and pck1 promoters . These regulations have been essentially documented in the liver up to now (for review see). Using chip experiments, we showed that grs were bound to g6pc and pck1 promoters in both the kidney and intestine of 6 h fasted l - g6pc and wt mice (supplementary fig . The recruitment of grs to pck1 promoter was markedly increased in both the kidney (about threefold compared with wt) and intestine (sixfold compared with wt) of l - g6pc mice (supplementary fig . 2a and b). There was also a robust recruitment of grs to the g6pc promoter in the intestine of l - g6pc mice compared with wt mice (about eightfold compared with wt; supplementary fig . These data suggested that glucocorticoids concurred in the induction of g6pc and pck1 gene expression in the kidney and intestine of l - g6pc mice . This does not exclude that they could act in synergy with p - creb to stimulate both g6pc and pck1 gene transcription in the kidney and intestine, as it was observed previously in the liver (33,34). A: plasma glucagon of wt mice injected with saline solution (white bar) or glucagon (black bar). B: p - creb binding to g6pc or pck1 promoter was analyzed by chip assay from the kidneys and intestine, 30 min after the injection of saline solution or glucagon in wt mice . In view of these results, another mechanism should be involved in the induction of pepck - c expression in the kidneys of 6 h fasted l - g6pc mice . Despite a high glucagon - to - insulin ratio the transcription of pck1 gene is known to be controlled by metabolic acidosis in the kidneys, whereas it does not respond to changes in ph in the liver (35,36). It is noteworthy that the plasmatic levels of free fatty acids, ketone bodies, and lactate were higher in l - g6pc mice than in control mice, after 6 h fasting (table 1, supplementary fig . Consistently, urinary ph of 6 h fasted l - g6pc mice was more acidic compared with that of 6 h fasted control mice (fig . Both l - g6pc and wt mice presented the same neutral urinary ph, ranging from 6.5 to 7.0 . To test whether acidosis is the mechanism by which the pck1 gene was induced in l - g6pc mice, we counteracted acidosis by the addition of 0.28 m nahco3 in the drinking water of l - g6pc mice for 3 days (37). The urinary ph of 6 h fasted l - g6pc mice increased after treatment with nahco3 and was not different from that of control mice (fig . This led to a specific normalization of pck1 expression at the mrna and protein levels in the kidneys, but not in the intestine, of 6 h fasted l - g6pc mice treated with nahco3 (fig . G). On the contrary, g6pase expression was not affected in the kidneys and in the intestine after nahco3 treatment (fig . G), confirming that g6pc expression is not regulated by acidosis (35). These data also strongly suggested that pck1 expression is not regulated by acidosis in the intestine . A: follow - up of urinary ph of l - g6pc mice (black bars), l - g6pc mice treated with 0.28 mol / l nahco3 in drinking water (gray bars), and wt (l - g6pc mice, white bars) on the fed or postabsorptive state . B and c: expression levels of mrna encoding g6pc or pck1 gene in the kidneys (b) or in the intestine (c) of 6 h fasted mice . D g: western blot quantification and enzyme activity assays of g6pase and pepck determined in the kidneys (d and f) or in the intestine of 6 h fasted mice (e and g). Data were obtained 5 weeks after gene deletion and are expressed as mean sem . Values significantly different from wt (* p <0.05; * * p <0.01), from the fed state ($$p <0.01), and from l - g6pc without nahco3 treatment (p <0.01). The liver has always been considered the major source of egp until now . In contradiction with this dogma, we here report that, after a transient drop in plasma glucose as a result of incapacity to mobilize glycogen stores, the absence of hepatic glucose production has no major effect on the control of fasting plasma glucose . Instead, the early induction of gluconeogenesis in the kidneys and intestine occurs, permitting sustentation of egp and blood glucose right from the start of fasting periods . This perfectly matches what has been observed during the anhepatic phase of liver transplantation in humans (38,39). Our data also emphasize that an essential function of the liver is the rapid tuning of blood glucose during nutritional transitions, via the handling of glycogen stores . However, the first major finding of this study is that the liver is not an irreplaceable source of endogenous glucose in the absence of food glucose . Similarly, glucagon, which is well known to stimulate hepatic glucose release via activation of glycogenolysis and gluconeogenic gene expression, has up to now been considered as only targeting the liver . In opposition to this other dogma, the second major finding here is that glucagon also plays a key role in the transcriptional regulation of renal and intestinal gluconeogenic genes . This may account for the basal induction of renal g6pc in the absence of hepatic glucose production and for the rapid induction of intestinal g6pc and pck1 once food is lacking . Either fasting or type 2 diabetes is characterized by increased glucagon secretion in humans, which is believed to exert a key role in the augmented egp of diabetes (40). In these two situations, moreover, the renal glucose production could play a crucial role in the counterregulation of insulin - induced hypoglycemia in humans, a situation of increased glucagon and cortisol secretions (41,42). At least, the important role of the kidney evidenced here might also explain why patients with renal failure are prone to hypoglycemia (44). In conclusion, our study provides a definitive quantitative estimate of the capacity of extrahepatic gluconeogenesis to sustain fasting egp, regardless of the contribution of the liver . It also extends the regulatory role of glucagon to the control of gluconeogenesis in the kidneys and intestine . This leads us to conclude that the current dogma relating to the relative role of the liver vis - - vis extrahepatic gluconeogenic organs in glucose homeostasis should be reconsidered . G6pase activity was disrupted specifically in the liver by temporal and tissue - specific deletion of the g6pc gene based on a cre - lox strategy (14). In brief, transgenic b6.g6pc mice were crossed with transgenic b6.sa mice (21) to generate b6.g6pc.sa mice, expressing inducible cre specifically in the liver . The treatment of adult b6.g6pc.sa mice with tamoxifen induced the excision of g6pc exon 3, specifically in the liver (14), leading to a complete lack of hepatic g6pase activity (fig . This finding is consistent with these mice being unable to mobilize their glycogen stocks during fasting (fig . 1c), leading to a hepatomegaly (table 1). In wt mice, indeed, glycogen stock was about 40% of the fed level at 6 h of fasting and was completely exhausted after 12 h of fasting (0.6 mg / g of liver, n = 4). Although mice with the total knock - out of g6pc die after weaning, these l - g6pc mice are viable . Moreover, all l - g6pc mice survived prolonged fasting (45 h), although hepatic g6pase activity was still undetectable throughout the fasting period (fig . Because hepatic glucose production is thought to be critical for glucose homeostasis during fasting periods, plasma glucose concentration and egp were determined in l - g6pc and wt mice during prolonged fasting . L - g6pc mice displayed the same blood glucose level as control mice in the fed state (fig . Consistent with the role of hepatic glycogenolysis as an important pathway of glucose production in the early postabsorptive state, egp levels were found to be lower in 6 h fasted l - g6pc animals than in control animals (fig . This was correlated with a lower blood glucose in 6 h fasted l - g6pc mice (fig . G6pase activities (a) and glycogen content (b) were assayed in the liver of l - g6pc (black bar) and wt (white bar) mice in the fed state (0 h) or in fasted states (6 h, 24 h, and 40 h; n = 5 to 6 mice per group). C: blood glucose concentrations were determined afterward for 0, 6, 16, 24, 30, 40, and 45 h fasting in l - g6pc and wt mice . D: egp was determined in conscious l - g6pc (black bar) and wt (white bar) mice fasted for 6 h or 24 h (n = 6 mice per group). Data were obtained 5 weeks after gene deletion and are expressed as means sem ., significantly different with respect to the value in fed state in each group (p <0.01). And, significantly different with respect to the value at 6 h of fasting in each group (p <0.05 and p <0.01, respectively). Body and liver weights and plasmatic parameters of 6 h fasted l - g6pc mice values are expressed as means sem . Data were determined 5 weeks after gene invalidation from l - g6pc and wt l - g6pc mice upon 6 h of fasting . Values significantly different from wt (* p <0.05 and * * p <0.01) are indicated (mann - whitney test). Concomitant with this drop in blood glucose observed at 6 h fasting, ketogenesis was rapidly induced in l - g6pc animals . At 6 h fasting, the amounts of ketone bodies (-hydroxybutyrate) in l - g6pc mice were fivefold greater compared with the control mice that were able to produce high levels of glucose by inducing glycogenolysis (supplementary fig these results were accounted for by fast induction of the mitochondrial 3-hydroxy-3-methylglutaryl - coa synthase (hmgcs2) expression in 6 h fasted l - g6pc mice (supplementary fig . It is important to recall here that ketone bodies provide an alternative form of cellular energy fuel in postabsorptive situations characterized by low glucose availability . This is true notably for the brain, which may derive up to 70% of its energy from ketone bodies (6), and for the kidney and intestine, the two alternative gluconeogenic organs, which derive 50% of their energy from ketone bodies in postabsorptive state (22,23). It therefore seems unlikely that l - g6pc mice lacked energy fuels for these essential organs . It is noteworthy that differences in egp between l - g6pc and control animals were no longer observed after longer fasting periods, and that l - g6pc mice controlled blood glucose effectively during long fasting periods (fig . We even observed a significant increase in blood glucose between 6 h and 16 h fasting, such that the blood glucose concentration of l - g6pc mice eventually reached that of control mice after 30 h fasting (fig . By contrast, blood glucose concentration decreased steadily during fasting in control mice, eventually reaching a plateau at 100 mg / dl after 24 h of fasting (fig . It was hypothesized that l - g6pc mice maintained their glycemia through rapid induction of extrahepatic gluconeogenesis, compensating for lack of glucose production by the liver . It is noteworthy that blood glucose was the same in l - g6pc and control mice in the fed state, although glucose injection was necessary in the total g6pc knockout mice to maintain blood glucose (24). To explain this difference, we assessed the expression of gluconeogenic genes in the kidneys and intestine of fed animals . Renal g6pc mrna levels of fed l - g6pc mice were about 1.7-fold higher than those in control mice (fig . Finally, specific g6pase activity in the kidney was 40% higher in l - g6pc than in control mice (fig . 2c). On the contrary, renal pck1 expression and pepck activity were not modified (fig . No modification of g6pc and pepck - c expression was observed in the intestine of l - g6pc compared with control mice (fig . Thus, only g6pase was upregulated in the kidneys of l - g6pc mice in the fed state, reflecting constitutive induction of the gluconeogenic pathway in the kidneys of l - g6pc compared with wt mice . Expression of main gluconeogenic enzymes in the kidneys (a c) and the intestine (d f) of fed l - g6pc mice . A and d: level of g6pc and pck1 b and e: western blot and quantification analysis for g6pc and pepck - c proteins . C and f: specific g6pase and pepck - c activity of homozygous l - g6pc (black bar) and wt (white bar) mice . Data were obtained 5 weeks after gene deletion in fed mice (n = 6 mice per group) and are expressed as the mean sem . Values significantly different from wt (* p <0.05, * * p <0.01) are indicated . After 6 h fasting, the expression of the genes encoding major regulatory enzymes of extrahepatic gluconeogenesis [g6pase, pepck - c, and glutaminase] was dramatically induced in both the kidneys and intestine of l - g6pc mice . In the kidneys, amounts of g6pc mrna and protein were about twice those in the control (fig . 3a and b), and specific g6pase activity was 36% higher than in control mice (fig . Renal pepck - c expression was increased concomitantly, resulting in a threefold increase of pck1 mrna and protein and specific pepck - c activity more than twice that of l - g6pc mice (fig . C). There was also an induction of glutaminase in the kidneys of l - g6pc mice (fig . A similar pattern of induction of gluconeogenic gene expression was observed for the three enzymes in the intestine of l - g6pc mice (fig . Thus, the expression of gluconeogenic genes was rapidly induced in both the kidneys and intestine of l - g6pc mice in postabsorptive state . Expression of main gluconeogenic enzymes in the kidneys (a c) and the intestine (d f) of 6 h fasted l - g6pc mice . A and d: level of g6pc and pck1 mrna expressed as a ratio relative to rpl19 mrna level . B and e: western blot analysis and quantification for g6pc, pepck - c, and glutaminase proteins . C and d: specific g6pase and pepck - c activity of homozygous l - g6pc (black bar) and wt (white bar) mice . (n = 6 mice per group), and are expressed as means sem . Values significantly different from wt (* p <0.05, * * p <0.01) are indicated . These results strongly suggested that the l - g6pc mouse rapidly upregulated gluconeogenesis in the kidneys and intestine once food glucose was lacking . It is noteworthy that there is clear - cut organ substrate selectivity for the liver, kidney, and intestine gluconeogenesis (9). Whereas gluconeogenesis from glutamine only takes place in the kidneys and intestine, gluconeogenesis from alanine and lactate is the key pathway in the liver (4,9,25). To substantiate the view that postabsorptive or fasting l - g6pc mice were able to regulate plasma glucose from extrahepatic gluconeogenesis in the absence of hepatic gluconeogenesis, we performed tolerance tests from alanine (exclusive hepatic substrate) and glutamine (exclusive extrahepatic substrate). After 6 h of fasting, there was a marked increase in plasma glucose upon glutamine injection in l - g6pc mice, whereas only a marginal increase was observed in wt mice (fig . L - g6pc mice were unable to increase their plasma glucose in response to alanine injection (fig . Surprisingly, there was no increase in plasma glucose in wt mice injected with alanine; this might be a result of the preponderant role of hepatic glycogenolysis in egp and the nonactivation of gluconeogenesis at 6 h fasting in normal mice (see fig . Wt mice dramatically increased plasma glucose in response to alanine injection after 24 h of fasting, a time where glycogen stores were exhausted and liver gluconeogenesis was enhanced (fig . 4c). On the contrary, l - g6pc mice were still unable to convert the injection of alanine in increased plasma glucose (fig . 4c). Also in line with the absence of liver gluconeogenesis in l - g6pc mice, plasma alanine and lactate concentrations were 5060% higher than in wt mice (table 1). On the other hand, the plasma concentration of glutamine was slightly lower in l - g6pc mice than in wt mice, which was consistent with an increased utilization of glutamine (table 1). Taken together, these data strongly suggested that l - g6pc mice regulated plasma glucose from extrahepatic gluconeogenesis exclusively . After 6 h (a and b) or 24 h (c) of fasting, l - g6pc (black circles) and wt (open squares) mice were injected with glutamine (a) or alanine (b and c). Blood glucose levels were measured every 15 min for 2 h. data were obtained 5 weeks after tamoxifen treatment . Percent values relative to time 0 were expressed as means sem (n = 6 mice / group). Values significantly different from wt (* p <0.01); significantly different with respect to the value before alanine or glutamine injection (p <0.01). We then investigated the mechanisms underlying expression changes of gluconeogenic genes in both the kidneys and intestine in the absence of g6pc in the liver . First, we analyzed the hormonal status of l - g6pc mice in both fed and 6 h fasting states . In mammals, sophisticated hormonal control by insulin, glucagon, glucocorticoids, and cathecholamines maintains blood glucose within narrow limits, orchestrating the uptake and production of glucose . In both the fed state and after 6 h fasting, glucagon levels were higher in l - g6pc mice than in control mice (fig ., l - g6pc mice exhibited a lower insulin level than that of control mice after 6 h fasting (fig . This resulted in a twofold (fed state) to threefold (6 h fasted state) increase in the glucagon - to - insulin ratio in l - g6pc mice in comparison with that of the control mice (fig . Moreover, corticosterone levels were markedly increased in l - g6pc mice compared with the control mice after 6 h fasting (table 1), but not in the fed state (63.0 10.8 ng / ml in l - g6pc mice vs. 65.0 14.0 ng / ml in wt mice). However, the epinephrine and norepinephrine plasma concentrations were similar in both l - g6pc and control mice (table 1). This is in agreement with the observation that a hypoglycemic state around 60 mg / dl is mild and does not represent a stressed condition from the metabolic viewpoint, especially in the light of the concomitant increased availability of ketone bodies (see above). Glucagon regulates gluconeogenic gene expression in the kidneys and intestine of l - g6pc mice . Plasma glucagon (a), plasma insulin (b), and glucagon - to - insulin ratio (c) of fed or 6 h fasted l - g6pc (black bars) and control (white bars) mice are shown . D: rt - pcr analysis of the expression of glucagon receptor in the liver, kidney, and intestine of control mice fasted for 6 h. e - g: p - creb binding to the g6pc or pck1 promoter was analyzed by chip assay from kidneys or intestine of fed mice (e) or 6 h fasted mice (f and g). H: level of pck1 mrna expressed as a ratio relative to rpl19 mrna level in the liver of l - g6pc mice treated or not with gcgr antagonist l-168,049 (black bars) and wt mice (white bars) fasted for 6 h. i and j: level of g6pc mrna expressed as a ratio relative to rpl19 mrna level in the kidneys (i) and intestine (j) of l - g6pc mice treated or not with gcgr antagonist l-168,049 (black bars) and wt mice (white bars) fasted for 6 h. data were obtained 5 weeks after gene deletion (n = 6 mice per group) and are expressed as means sem . Values significantly different from wt (* p <0.05, * * p <0.01) and untreated l - g6pc mice ($p <0.05, $$p <0.01) are indicated ., significantly different fed state (p <0.01). In the light of these findings, glucagon could be a major candidate responsible for the induced expression of gluconeogenic genes in the kidneys and intestine of l - g6pc mice . Glucagon receptors (gcgr) are known to be present in the liver, but gcgr are also expressed in the kidneys, notably in the proximal tubules and, to a lesser extent, in the intestine (2628). We confirmed these data in l - g6pc mice where gcgr mrna was substantially expressed in the kidneys (10 times less than in the liver, however) and more weakly in the intestine (about 500 times less than in the liver) of both control and l - g6pc mice (fig . 5d). To date, the specific role of gcgr in these organs is still unexplained . However, two previous articles suggested a possible role of glucagon in the kidney cortex and intestine: 1) glucagon stimulated camp production in a kidney cortical cell line (29) and 2) glucagon infusion caused a net release of glucose into portal blood in dog (30). The gcgr is coupled to gs proteins, stimulating adenylate cyclase and increasing intracellular camp levels (26). This activates protein kinase a (pka), which phosphorylates camp - response element binding protein (creb). The phosphorylated form of creb (p - creb) induces the transcription of g6pc in the kidneys and intestine, via binding to the gene promoter (17). We then examined whether p - creb could bind to the g6pc and pck1 promoters by performing a chip assay . On the fed state, p - creb was bound to the g6pc promoter in the kidneys of the fed l - g6pc mice, but not to that of the wt mice (fig . P - creb was bound neither to the g6pc promoter nor to the pck1 promoter in the intestine of fed l - g6pc or wt mice (not shown). After 6 h fasting, p - creb was bound to the renal g6pc promoter, but still not to the pck1 promoter of l - g6pc mice (fig . It is noteworthy that in the intestine of 6 h fasted l - g6pc mice, p - creb was bound to both g6pc and pck1 promoters (fig . Unequivocally that the binding of p - creb on g6pc promoter in the intestine and kidney of l - g6pc mice was dependent on the increase of plasmatic glucagon, we administered orally a glucagon receptor antagonist to l - g6pc mice (l-168,049, 50 mg / kg body) (18). L-168,049 inhibits the fixation of glucagon on gcgr and glucagon - stimulated camp synthesis in cho cells expressing human gcgr (31). In the liver of l - g6pc mice, pck1 mrna expression was decreased by half 6 h after the administration of gcgr antagonist (fig . 5h), demonstrating the efficiency of the suppression of glucagon signaling . In agreement with the role of glucagon in the induction of extrahepatic gluconeogenesis, the administration of the antagonist prevented the increase of the g6pc expression in both the kidneys and intestine of 6 h these results strongly suggested that the increase of glucagon levels could account for the induction of g6pc expression in the kidneys and intestine of l - g6pc mice . An intriguing observation, however, is that the g6pc gene was induced in the kidneys but not in the intestine in fed l - g6pc mice (figs . 2 and 5). This might be dependent on differential sensitivity to glucagon in both organs, possibly related to the higher expression level of gcgr in the kidneys (see above). Although this reasoning may appear speculative, this phenomenon might to some extent be related to the fact that the kidney rapidly become predominant in participating in egp during fasting (8), whereas the participation of the intestine is weaker and is induced later in the same situation (5). In agreement with this rationale, the binding of p - creb to the renal g6pc promoter occurred from 6 h of fasting in wt mice (fig . 5f). To increment our findings and confirm that the extrahepatic glucagon effects observed herein were not an adaptation specific to l - g6pc mice but could also take place in wt, we carried out a glucagon challenge in fed wt mice . After 30 min of glucagon administration, the plasma glucagon rose to the level of 6 h fasted l - g6pc mice (figs . Consistent with the results obtained in l - g6pc mice, p - creb was firmly bound to the g6pc promoter in both tissues (fig . Moreover, in response to glucagon injection, p - creb bound to the pck1 promoter only in the intestine (fig . 6b), as already noted in l - g6pc mice (fig . 5). In conclusion, these results show definitively for the first time that g6pc gene expression is regulated by glucagon not only in the liver, but also in the kidneys and intestine, under physiological conditions . Moreover, glucagon can also regulate pck1 in the intestine, but not in the kidneys . It must be noted that the increased concentration of corticosterone might also play a role in the induction of extrahepatic gluconeogenesis . Glucocorticoids activate gluconeogenesis via the binding of glucocorticoid receptors (grs) to glucocorticoid response element on both g6pc and pck1 promoters . These regulations have been essentially documented in the liver up to now (for review see). Using chip experiments, we showed that grs were bound to g6pc and pck1 promoters in both the kidney and intestine of 6 h fasted l - g6pc and wt mice (supplementary fig . The recruitment of grs to pck1 promoter was markedly increased in both the kidney (about threefold compared with wt) and intestine (sixfold compared with wt) of l - g6pc mice (supplementary fig . There was also a robust recruitment of grs to the g6pc promoter in the intestine of l - g6pc mice compared with wt mice (about eightfold compared with wt; supplementary fig . These data suggested that glucocorticoids concurred in the induction of g6pc and pck1 gene expression in the kidney and intestine of l - g6pc mice . This does not exclude that they could act in synergy with p - creb to stimulate both g6pc and pck1 gene transcription in the kidney and intestine, as it was observed previously in the liver (33,34). A: plasma glucagon of wt mice injected with saline solution (white bar) or glucagon (black bar). B: p - creb binding to g6pc or pck1 promoter was analyzed by chip assay from the kidneys and intestine, 30 min after the injection of saline solution or glucagon in wt mice . In view of these results, another mechanism should be involved in the induction of pepck - c expression in the kidneys of 6 h fasted l - g6pc mice . Despite a high glucagon - to - insulin ratio the transcription of pck1 gene is known to be controlled by metabolic acidosis in the kidneys, whereas it does not respond to changes in ph in the liver (35,36). It is noteworthy that the plasmatic levels of free fatty acids, ketone bodies, and lactate were higher in l - g6pc mice than in control mice, after 6 h fasting (table 1, supplementary fig . Consistently, urinary ph of 6 h fasted l - g6pc mice was more acidic compared with that of 6 h fasted control mice (fig . Both l - g6pc and wt mice presented the same neutral urinary ph, ranging from 6.5 to 7.0 . To test whether acidosis is the mechanism by which the pck1 gene was induced in l - g6pc mice, we counteracted acidosis by the addition of 0.28 m nahco3 in the drinking water of l - g6pc mice for 3 days (37). The urinary ph of 6 h fasted l - g6pc mice increased after treatment with nahco3 and was not different from that of control mice (fig . This led to a specific normalization of pck1 expression at the mrna and protein levels in the kidneys, but not in the intestine, of 6 h fasted l - g6pc mice treated with nahco3 (fig . G6pase expression was not affected in the kidneys and in the intestine after nahco3 treatment (fig . G), confirming that g6pc expression is not regulated by acidosis (35). These data also strongly suggested that pck1 expression is not regulated by acidosis in the intestine . A: follow - up of urinary ph of l - g6pc mice (black bars), l - g6pc mice treated with 0.28 mol / l nahco3 in drinking water (gray bars), and wt (l - g6pc mice, white bars) on the fed or postabsorptive state . B and c: expression levels of mrna encoding g6pc or pck1 gene in the kidneys (b) or in the intestine (c) of 6 h fasted mice . G: western blot quantification and enzyme activity assays of g6pase and pepck determined in the kidneys (d and f) or in the intestine of 6 h fasted mice (e and g). Data were obtained 5 weeks after gene deletion and are expressed as mean sem . Values significantly different from wt (* p <0.05; * * p <0.01), from the fed state ($$p <0.01), and from l - g6pc without nahco3 treatment (p <0.01). The liver has always been considered the major source of egp until now . In contradiction with this dogma, we here report that, after a transient drop in plasma glucose as a result of incapacity to mobilize glycogen stores, the absence of hepatic glucose production has no major effect on the control of fasting plasma glucose . Instead, the early induction of gluconeogenesis in the kidneys and intestine occurs, permitting sustentation of egp and blood glucose right from the start of fasting periods . This perfectly matches what has been observed during the anhepatic phase of liver transplantation in humans (38,39). Our data also emphasize that an essential function of the liver is the rapid tuning of blood glucose during nutritional transitions, via the handling of glycogen stores . However, the first major finding of this study is that the liver is not an irreplaceable source of endogenous glucose in the absence of food glucose . Similarly, glucagon, which is well known to stimulate hepatic glucose release via activation of glycogenolysis and gluconeogenic gene expression, has up to now been considered as only targeting the liver . In opposition to this other dogma, the second major finding here is that glucagon also plays a key role in the transcriptional regulation of renal and intestinal gluconeogenic genes . This may account for the basal induction of renal g6pc in the absence of hepatic glucose production and for the rapid induction of intestinal g6pc and pck1 once food is lacking . Either fasting or type 2 diabetes is characterized by increased glucagon secretion in humans, which is believed to exert a key role in the augmented egp of diabetes (40). In these two situations,, the renal glucose production could play a crucial role in the counterregulation of insulin - induced hypoglycemia in humans, a situation of increased glucagon and cortisol secretions (41,42). At least, the important role of the kidney evidenced here might also explain why patients with renal failure are prone to hypoglycemia (44). In conclusion, our study provides a definitive quantitative estimate of the capacity of extrahepatic gluconeogenesis to sustain fasting egp, regardless of the contribution of the liver . It also extends the regulatory role of glucagon to the control of gluconeogenesis in the kidneys and intestine . This leads us to conclude that the current dogma relating to the relative role of the liver vis - - vis extrahepatic gluconeogenic organs in glucose homeostasis should be reconsidered.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.