text stringlengths 0 868k |
|---|
A 55-year - old male patient developed sudden loss of vision in the right eye following sirsasana with wall support (2 minutes) without supervision . The patient had suffered from pulmonary thromboembolism 5 years back and was receiving warfarin prophylaxis . Patient was practicing yoga since past 2 years for 45 minutes, 34 times / week . On examination, best - corrected visual acuity (bcva) was finger counting 1 m in the right and 20/20 in the left eye . Fundus examination showed disc edema, scattered superficial hemorrhages, and superficial whitening in macular area in the right eye [fig . 1], whereas the left eye fundus was unremarkable . 2] confirmed findings of ischemic crvo with cilioretinal artery occlusion (red free photos showed retinal whitening along the course of cilioretinal artery in the maculopapillary region and non - filling of the cilioretinal artery in the early phase of angiogram) all systemic investigations (hemoglobin, erythrocyte sedimentation rate, lipid profile, blood sugar, serum homocysteine levels) were normal, and international normalization ratio (inr) was 2.0 . Over 6 months follow - up, the patient developed neovascularization of the iris and received pan - retinal laser photocoagulation with no improvement in vision . Red - free photograph showing disc edema, scattered superficial hemorrhages and superficial whitening in the macular area in the right eye fundus fluorescein angiography photo: venous phase shows altered vascular caliber, blocked fluorescence at the disc due to hemorrhages, and macular ischemia this is an advanced pose and should be attempted after practicing forward and backward bends (asanas), under the supervision of a qualified yoga instructor . Sirsasana is known to cause elevation of iop, which reverts to normal after cessation of the same. [2] a sudden variation in iop has decompression effect on the eye, as after antiglaucoma surgery, causing decompression retinopathy . The practice of sirsasana is reported to increase the flow of blood to the brain, improving memory and other intellectual functions . Although, increased sympathetic vasomotor and sudomotor tone is known to occur after sirsasana, its effect on ocular hemodynamics has not been studied . Instructors suggest avoiding sirsasana in patients with hypertension, congestive heart failure, berry aneurysms, and those above 50 years of age . However, there is no existing study to support the above . Inr was established by the world health organization (who) and the international committee on thrombosis and hemostasis for reporting the results of blood coagulation (clotting) tests . A person taking warfarin might optimally maintain a prothrombin time of 2 - 3 inr . This international standardization permits the patient receiving warfarin to travel and still obtain comparable test results . It is known that patients receiving warfarin prophylaxis may not to be protected against a crvo, as in our patient (inr-2). Hence, both the above, in a case of pulmonary embolism, would have predisposed our patient to crvo . We conclude that predisposed subjects such as those having a previous thromboembolic phenomenon and age above 50 years (as in our patient) can be warned against doing sirsasana or head down postures in yoga . Because of the increased popularity of yoga, a long - term study to know its impact on ocular hemodynamics is needed. |
Adverse drug reactions (adrs) are important cause of morbidity, hospitalization, increased health expenditure and even death . A meta - analysis found serious adrs accounting for 6.7% of hospitalized admissions in usa . Adrs accounted for 0.7% of total admissions and 1.8% of total deaths in a south indian hospital . Studies have found the incidence of cadrs in developed countries as 13%, while the incidence in developing countries is supposed to be higher between 2 and 5%. [35] adr reporting leads to an increased general vigilance and may influence the recommendations for drug use through regulatory authorities . A prospective, observational study over a period of 6 months (january june, 2008) was conducted after the approval of the institutional ethics committee at a tertiary care teaching hospital located in north india . The study was conducted by the department of pharmacology with the help of dermatology department and used spontaneous reporting of adr for the collection of data . All patients presenting to the dermatology opd with cutaneous manifestations after drug consumption and those referred from other departments were included in the study . Causality assessment of the reported adr was done by establishing the drug use with elaborate elicitation of the history, temporal association with adr, response following stoppage and rechallenge . It was performed following stoppage of the drug for certain period of time depending upon the clinical status of the patient and considering the risk benefit ratio . Adrs were graded as definite, possible and probable according to who causality assessment scale . Cutaneous reactions due to drug abuse, errors in drug administration and in patients with incomplete history were not included in the final analysis . Patients were specifically asked about the intake of any alternative medicine as they do have high potential to cause cadrs . All reactions were classified into dermatologically distinct morphological patterns by a senior dermatologist on duty and recorded by a pharmacologist in a prefixed proforma for the study . All the patients were given adequate treatment (soothing lotions, local / oral antibiotics or steroids) depending upon the severity of cadr . Of the total 91 cases reported during the study, 47 (51.7%) were females and 44 (48.3%) were males . The maximum number of cases was seen in the age group 2130 years (25.27%) followed by the age group 3140 years (23.07%) [figure 1]. Relation of frequency of cadrs with age the drugs most commonly responsible for cadrs were antimicrobials (48.30%), followed by nonsteroidal anti - inflammatory drugs (nsaids) (21.90%) and anti - epileptics (13.20%) [figure 2]. Other drugs presenting with cadrs included ramipril (n = 1, 1.09%), enalapril (n = 1, 1.09%), amlodipine (n = 1, 1.09%), steroids (n = 2, 2.19%), lithium (n = 2, 2.19%), oral contraceptives (n = 1, 1.09%), folic acid (n = 1, 1.09%), benzoylperoxide (n = 1, 1.09%), and chlorpromazine (n = 1, 1.09%). Fixed drug combinations causing cutaneous manifestations included tetracycline and ibuprofen (n = 1, 1.09%), diclofenac and allopurinol (n = 1, 1.09%), rifampicin and isoniazid (n = 1, 1.09%), and dapsone and clofazimine (n = 1, 1.09%). One fatal cadr, toxic epidermal necrolysis (ten), was seen with ciprofloxacin which was prescribed for a case of suspected enteric fever . Drug groups causing cadrs maculopapular rash was the most common cadr (n = 39, 42.85%), followed by fixed drug eruption (fde) (n = 19, 20.87%), urticaria (n = 11, 12.08%) and photosensitivity (n = 4, 4.39%). Bullous eruption, erythema multiforme, lichenoid eruption, and ten were seen in 1 (1.09%) patient each . Other cadrs accounted for 14 (15.38%) cases [tables 1 and 2]. Incidence of different cadrs incidence of different cadrs with commonly used drugs the lag period between starting the drug and appearance of cutaneous reactions varied between 2 and 14 days in maximum number of cases (n = 73, 80.2%), within 2 days in 2 (2.19%) and between 15 and 30 days in 16 (17.58%) cases . Of all the 91 cases, 3.29% were classified as definite (n = 3), 76.98% as probable (n = 70) and 19.78% as possible (n = 18). Outcome of cadr showed 65 (71.42%) patients cured, 25 (27.47%) improved and 1 (1.11%) expired . . A wide spectrum of cutaneous manifestations ranging from maculopapular rashes to ten can be produced by different classes of drugs . Reactions include pruritis, maculopapular and morbilliform rashes, erythema multiforme, exfoliative dermatitis and others . Most drug - induced skin eruptions can be described as erythematous, morbilliform or maculopapular in nature . In the present study, this number may not represent the true prevalence of cadrs during this period as patients with incomplete history and doubtful diagnosis were not included . Moreover, the exclusion of many minor cutaneous reactions which do not require hospitalization and underreporting by patients might have contributed to the decreased prevalence of cadrs in this study . Mild predominance of cadrs was seen in females as compared to males in concordance with other studies . This difference may be attributed to the fact that the females may be more conscious of any cutaneous reactions and report it, while males tend to ignore or not notice minor cutaneous reactions . Similar results have been obtained in other studies where antimicrobials were responsible for 38.6% of cadrs, while some have reported incidence of antimicrobials as a causative factor for cadrs as 56.9% and 55.88% . In a study of hospitalized patients, antimicrobials as the causative factor for cadrs cotrimoxazole continues to be the drug commonly implicated in cadrs, with 23.07% of the cases in the study . Predominance of sulfonamides as causative agents for cadrs has been reported from a multicentric analysis from italy and a 6-year study from chandigarh, india . There was one fatal cadr in the form of ten due to ciprofloxacin in the present study . A higher incidence of fatal cadrs ten and steven johnson syndrome (sjs) as 11.4% was found in the study by sharma et al . The incidence of ten and sjs was reported to be 0.2% and 1.82%, respectively, by the italian study . The study by sharma et al . Reported nsaids as a cause for cadrs in 18% of the patients . Of the various cutaneous manifestations of drug reactions, maculopapular rash was seen most commonly in 42.8% of the patients, followed by fde in 20.8% and urticaria in 12.08% of the patients in the present study . Maximum incidence of maculopapular rash was seen in cases of antimicrobial use, followed by nsaid use . Anticonvulsants as the most common cause of maculopapular rash were reported by sharma et al . The present study also documented the most common cadr following antiepileptic use as maculopapular rash . Fde was most commonly due to cotrimoxazole use and similar results have been reported in other studies . Only one case of fde was seen due to tetracycline use, in a patient who had used fixed drug combination of tetracycline and ibuprofen . Cutaneous manifestations of adrs have been remarkably similar for most drugs and have been seen to be consistently associated with them . In conclusion, they increase the burden of work and can be fatal at times adding to the common person's negative perception of allopathy . With the number of drugs being marketed increasing every year, it is of paramount importance to have an in - depth understanding of their possible adverse reactions and this is possible only when the physician is trained adequately and is actively looking for any adrs . A robust mechanism for reporting of adrs is required while the clinician is to be always on the lookout for adrs . So, anticipating, preventing, recognizing and responding to adrs should be the prime concern of the clinicians so as to minimize the incidence of adrs. |
Developmental changes and regressive changes of the tooth have been related to chronological age in adult and subadult populations . The underlying concept of the study was that pulpal reduction caused by apposition of secondary dentin and occlusal tooth wear are used as morphometric parameters in estimating age . The timing of the secondary dentin formation is fit by a curved line rather than a straight line with underlying chronological differences . Hence, there is a need for research to provide sufficient data for age estimation . The aim was thus to estimate the accuracy of age evaluation by the analysis of measurements of dental pulp and effects of occlusal wear using digital intraoral periapical radiographs in a subset of the indian population . Kvaal et al . In 1995 reported a method that allows age estimation based on the morphological measurements of two - dimensional radiographic features of individual teeth . The measurements include comparisons of pulp length and tooth length (x1), pulp length and root length (x2), pulp and root widths at three defined levels (x3) and tooth length and root length (x4). Our study of age estimation was based on the concept as given by kvaal et al ., although a few changes in the study design were made to assess whether the accuracy of age estimation can be influenced . 50 patients, ages 15 - 57 years old and each with known chronological age, were randomly selected irrespective of their religion or gender [table 1]. Each patient's chronological age was noted after verifying his / her respective identity proof . Age and gender distribution of the study sample six teeth were selected for each patient: one maxillary central incisor, one maxillary lateral incisor, one maxillary second premolar, one mandibular central incisor, one mandibular lateral incisor, and one mandibular second premolar . The examined teeth had to be in normal functional occlusion and free from any manifestations of traumatic results . Furthermore, teeth with fillings, crowns, and carious lesions were excluded from evaluation . Teeth with pathologies in the apical bone, and rotated or endodontically treated teeth were also excluded . High - quality digital intraoral periapical radiographs with respect to contrast and angulation were made at an exposure of 10 ma and 70 kvp using the satelec x - mind intraoral x - ray machine (acteon company, italy) and the kodak rvg 5000 digital radiography system (eastman kodak company, rochester, ny). Paralleling technique was used, employing the rinn xcp - ds positioning device (dentsply international inc . All radiographs were obtained in dicom format and analyzed using kodak dental imaging software windows v6.0.1 software, (eastman kodak company, rochester, ny) which gave a digital quantification of measurements between any two reference points with a resolution of 14 lp / mm . The following measurements were then made from the radiographs using the kodak rvg 5000 digital radiography system on all six teeth from each patient: [figure 1] diagram showing measurements: tooth length (t); pulp length (p); root length (r); root and pulp width at the cementoenamel junction (cej) (w1); root and pulp width midway between cej and apex (w2); root and pulp width at apex (w3) the maximum tooth length from the occlusal surface to the apex of the tooth (t)the pulp length from the highest pulp horn to the radiographic apex (p)the root length on the mesial surface from the cementoenamel junction (cej) to the root apex (r),the root and pulp width at three levels the levels being at the cej (w1), at the midroot level (w2), and the apex of the root (w3); then a mean width was derived . The maximum tooth length from the occlusal surface to the apex of the tooth (t) the pulp length from the highest pulp horn to the radiographic apex (p) the root length on the mesial surface from the cementoenamel junction (cej) to the root apex (r), the root and pulp width at three levels the levels being at the cej (w1), at the midroot level (w2), and the apex of the root (w3); then a mean width was derived . The following ratios were then calculated from the above measurements: the ratio between the lengths of the pulp and the tooth (x1)the ratio between the lengths of the pulp and the root (x2)the ratio between the mean widths of the pulp and the root (x3)the ratio between the lengths of the tooth and the root (x4). The ratio between the lengths of the pulp and the tooth (x1) the ratio between the lengths of the pulp and the root (x2) the ratio between the mean widths of the pulp and the root (x3) the ratio between the lengths of the tooth and the root (x4). The ratios of measurements were used rather than the measurements directly in the analysis in order to reduce the effect of a possible variation between the magnification and angulations of the radiographs . A single observer carried out all the measurements . To test the intraobserver reproducibility, a random sample of 30 radiographs all four morphological ratios x1, x2, x3, and x4 were used as variables for age estimation in the statistical analysis . The pearson product - moment correlation coefficient (pcc) was evaluated between chronological age and the predictive variables . Multiple regression analysis was then made, employing age as the dependent variable and the predictive variables as the independent variables . Besides evaluating the age using measurements from all six teeth, we also evaluated separate predictions restricted exclusively to either the maxillary or mandibular teeth . Patients were selected from the age group of 15 - 57 years, with a mean age of 34.9 years . Pcc between age and the morphological variables were significant except for x4 [table 2]. The correlation coefficient between age and tooth root length ratio was poor with the p value of 0.8973 showing less significance, indicating that occlusal wear is not well correlated with age . Pearson product - moment correlation coefficient from the calculated mean values, standard deviation (sd) and standard error of mean (sem) between the chronological age and the predicted age were determined, as presented in table 3 . Descriptive statistics figures 2,3 and 4 show the scatterplot diagrams between the chronological age and the predicted age when all six teeth, three maxillary teeth and three mandibular teeth, were used respectively . Plots of observed age against the predicted age using the regression model for all six teeth plots of observed age against the predicted age using the regression model for three maxillary teeth plots of observed age against the predicted age using the regression model for three mandibular teeth the relationship between these variables and the dependent variable could be expressed as y = a + b1 x1 + b2 x2 + b3 x3+ .bnxn + e. where y = predictive dependent variable value a = value of y when all xs are zero x1, x2, x3 = independent variables b = coefficients corresponding to the independent variables n = the number of independent variables the predictive variables x1, x2, and x3 were used as an input dataset in the multiple regression analysis, yielding the following regression formulas . It should be noted that x4 was not included in the multiple regression analysis, as it did not correlate significantly with age [tables 4 and 5]. Multiple regression analysis predicting chronological age from chosen predictors multiple regression analysis equation 1: when all six teeth were considered together age = -161.04 x1 + -28.30 x2 + -191.59 x3 + 236.98 (+ /-6.42) where x1, x2, and x3 are the mean values the coefficient of determination (r) for all six teeth was 0.7381, with a standard error of estimate of 6.42 years (f = 43.272). Analysis was done for only the maxillary teeth and the regression equation obtained was as follows: age = -175.18 x1 + -8.85 x2 + -127.96 x3 + 211.89(+/-7.31) where x1, x2, and x3 are the mean values the coefficient of determination (r) for only maxillary teeth was 0.6608, with a standard error of estimate of 7.3 years (f = 29.87). Analysis was done for only the mandibular teeth and the regression equation obtained was as follows: age = -167.89 x1 + -51.55 x2 + -151.32 x3 + 265.60 (+ /-7.85) where x1, x2, and x3 are the mean values the coefficient of determination (r) for only mandibular teeth was 0.6088, with a standard error of estimate of 7.8 years (f = 23.865). Dental age estimation requires the use of morphologic, radiographic, histological, and biochemical methods to estimate age - dependent changes in teeth . For age estimation, different methods are available; however, invasive methods using extracted teeth, ribs, and femurs cannot be used in living individuals . Assessment of sexual and skeletal maturation, radiological examination of bones, and also clinical and radiological examination of the dentition are noninvasive ways to determine age . Dental age estimation can be based on different properties of the dentition . Age estimation methods employ various forms of tooth modification, including tooth wear, root dentin transparency, tooth cementum annulation, racemization of aspartic acid, and apposition of secondary dentin ., bodeckar also established that the apposition of the secondary dentin was correlated with age . The secondary dentin is laid down by the odontoblasts throughout a person's life, causing a reduction in the size of the pulpal cavity . Secondary dentin deposition was introduced for age estimation in the method by gustafson, so that secondary dentin was one of the parameters in addition to attrition, periodontal recession, cementum apposition, apical translucency, and external root resorption . Presently, there is no evidence that the process of secondary dentin formation occurs in a linear manner, or that every age group needs the same time span to present itself with a defined amount of secondary dentin . Although linear regression is widely used in forensics to provide the estimate of the measurement, for instance the age at death or the living stature, it should be kept in mind that human growth is not a linear process . The quality of secondary dentin deposition is also influenced by factors like race, ethnicity, diet, and lifestyle . Authors have highlighted the need for population - specific formulas due to differences in ethnicity to achieve precise and accurate results . A study of radiographs of teeth is a nondestructive simple method to obtain information and is a technique used daily in dental practice . The advent of digital radiography has increased the quality of the images as also the ease of measurements and maintenance of records . The accuracy of digital method has been proven in intraoral radiography . In the present study, the selection of the dental parameters used for age assessment was based on their implementation in dental practice and on their reproducibility . Reviewing the literature, we found that age estimation using kvaal's method showed varied results, some underestimating the exact age by approximately 30 years, whereas some were as close as 8 - 9 years . Thus, we selected the maxillary central incisor, maxillary lateral incisor, maxillary second premolar, mandibular central incisor, mandibular lateral incisor, and mandibular second premolar for determining age for our study . In addition, the pulp root width was measured at three different levels, namely at the cej, at the midroot level, and at the apex . Correlation coefficients for x1, x2, and x3 were statistically significant, indicating that the ratios decrease with increasing age . However, the correlation coefficient for x4 was poor for all types of teeth, with the p value of 0.8973, showing less significance . A possible explanation could be that the whole length of the tooth was measured instead of only the crown, which has been shown to be strongly correlated with age . Statistically significant values were noted when maxillary or mandibular teeth were used alone . As in other studies, a higher correlation coefficient was obtained when all the six teeth were included, indicating that the more the information gained from the patient, the greater are the chances of an accurate age estimation; in addition, it would also reduce the effect of unusual anatomy of any one tooth . In the present study, x1 showed the strongest correlation compared to the width ratios as depicted in the study conducted by kvaal et al . A study conducted using conventional orthopantomograms using the equations of kvaal et al . Has shown a mean underestimation of age ranging 38 - 47 years when three to six teeth were included, whereas a study done on digital orthopantomograms showed an estimation of 8.3 years in an indian population . Patil et al . Concluded a standard error of estimate of 6.5 years with a modified kvaal's formula on a sample of the indian population . The accuracy of age estimation in this study was 6.42 years when all six teeth were included . The better accuracy may be due to the better resolution of digital intraoral periapical radiographs compared to orthopantomograms and also because of the exclusion of multirooted teeth and canines . Furthermore, we employed the paralleling technique, which helps in reducing angulation and technique errors and has better reproducibility . Some authors have indicated an inapplicability of the regression equations of kvaal et al . And pawensky et al . In younger populations . Our results, however, differ, as we could estimate the age in a population ranging 15 - 57 years old with an overall accuracy of 6.4 - 7.8 years with the design employed in our study using the kvaal's method . From this study, we have derived regression equations for age estimation in the indian population . It is also important to emphasize that any methodological approach to age assessment of a living individual establishes the physiological age, and that sexual, dental, or skeletal development is representative of the overall physical maturity and not chronological age . A careful approach to age determination is necessary, taking into consideration the influence of pathological conditions, ethnicity and gender variation . Therefore, comprehensive approaches to age estimation, which considers multiple maturity indicators, are superior to those which use non comprehensive methods . We conclude that the ratios x1, x2, and x3 are good indicators of age, while x4 is not correlated with age estimation in said population . According to the authors, the results of this study indicate that kvaal's method is a reliable method to estimate age in both young and older populations . With a few modifications of kvaal's method, we could estimate age with a standard error of estimate of 6.4 - 7.8 years in a sample of the indian population because of the small sample size of this study, we are conservative in our interpretation of the results . However, further studies can be carried out using the regression formulas derived in this study. |
Lung cancer has one of the highest cancer mortality rates in several countries worldwide, including korea . Although cancer treatments have improved in recent decades, lung cancer remains non - responsive to curative treatments . However, novel emerging molecular techniques have made it possible to investigate its molecular - level pathophysiology, identify specific causative oncogenes or tumor suppressor genes, and make progress toward new paradigms for cancer treatment . Compared with other cancers, lung cancer has an increased number of well - defined genetic changes and/or abnormalities and more molecularly targeted agents have been applied in clinical practice for its treatment . However, most of the molecularly targeted agents used in clinical practice are for adenocarcinoma, and few are available for squamous cell carcinoma . Sox2, a transcription factor encoded by the gene located at 3q26.33, plays a role in maintenance of embryonic stem cells . In addition, it is a yamanaka factor which induces pluripotent stem cells from somatic cells, along with c - myc, oct4, and klf4 . It is also involved in morphogenesis and homeostasis of the esophageal, tracheobronchial, and bronchiolar epithelium . Sox2 is expressed in bronchial epithelial cells, though not in alveolar cells or adenocarcinoma precursor lesions [4 - 6]. Sox2 is found exclusively in squamous cell carcinoma, where it is amplified and overexpressed at the gene and protein levels, respectively . However, only a small number of studies have investigated the association between sox2 and the clinical outcome of patients treated with radiotherapy . The aim of this study was to assess the prognostic significance of sox2 amplification and expression in squamous cell lung cancer patients treated using adjuvant radiotherapy . This retrospective study was approved by the institutional review board of our institution (irb no . A total of 158 non - small cell lung cancer (nsclc) patients who underwent pulmonary resection followed by adjuvant radiotherapy between 1996 and 2008 were identified . Squamous cell carcinoma was confirmed surgically in 71 patients, and clinical specimens were available from 36 patients . Of these, three patients were excluded from the analysis because of a lack of tumor tissue in their paraffin - embedded tissue blocks . The patients medical records were reviewed retrospectively for evaluation of clinicopathological characteristics and survival outcomes . After radical resection, all patients were determined to have pathologic tnm stage iii tumors according to the sixth edition cancer staging guidelines provided by the american joint committee on cancer . Fluorescent in situ hybridization (fish) was performed for analysis of sox2 gene amplifications on 4-m - thick formalin - fixed paraffin embedded (ffpe) tissue sections . Briefly, the sections were deparaffinized in xylene (twice for 10 minutes each), followed by immersion in 100% ethanol (twice for 5 minutes each) before hybridization . Pretreatment was performed according to the vysis protocol for ffpe tissue specimens . A sox2-specific dna probe (green) and a centromere 3-specific probe (red) were used (zytolight spec sox2/cen 3 dual color probe, zytovision, bremerhaven, germany). The sections were then denatured and hybridized with thermobrite (abbott molecular, des plaines, il) at 80c for 5 minutes, followed by an overnight at 37c . Post - hybridization washes were performed according to the vysis protocol for ffpe tissue specimens (abbott molecular), and dapi counterstaining was then performed . Semi - quantitative analysis of the sox2 amplification status was performed by comparing the number of green signals (sox2 target regions) to the number of red signals in each sample (reference regions). A non - amplified nucleus showed one green target signal for every corresponding red reference signal, with a green / red ratio of 1:1 (fig . Cases containing 2 - 9 more green target signals than red signals in at least 30% of their tumor cells were defined as having low - level sox2 amplification (fig . Cases with an additional 10 green signals in a cluster - like formation were defined as having high - level sox2 amplification (fig . All tissue slides were analyzed under a 100 oil immersion objective lens using a fluorescence microscope equipped with the appropriate filters . Four - micrometer - thick tissue sections were deparaffinized, rehydrated, and washed twice in buffer . The slides were incubated in hydrogen peroxide for 10 minutes to reduce nonspecific background staining due to endogenous peroxidases, and then washed four times in buffer . Primary antibodies against human sox2 (1:200, r&d systems, minneapolis, mn) were then applied, and slides were incubated according to the manufacturer s recommended protocols . The slides were washed four times in buffer, incubated with primary antibody enhancer for 20 minutes at room temperature, and then washed four times in buffer . Next, horseradish peroxidase polymer was applied to the slides, which were then incubated for 30 minutes at room temperature before washing four times in buffer, followed by incubation with hematoxylin and chromogen, washed four times in deionized water, and counterstained . The staining results were evaluated and each case was scored from 0 to 2, according to the intensity of nuclear staining in the tumor cells . The staining intensity of the normal bronchial epithelium served as the internal control and was given an arbitrary score of 1 . Each tumor was compared to the internal control and given a score of 1 (moderate expression) (fig . 1d) when the intensity was the same as that of the internal control, 2 (strong expression) (fig . Disease - free survival (dfs) was estimated from the time of diagnosis to the time of initial tumor relapse (local recurrence or distant) or death from any cause . Overall survival (os) time was measured from the time of diagnosis to death or last follow - up date . For univariate analysis, kaplan - meier survival analyses were used to estimate os and dfs, and differences in the survival rates were compared using log - rank tests . A cox proportional hazards model was used for multivariate analysis to evaluate prognostic factors influencing os and dfs . Hazard ratios (hr) are given with 95% confidence intervals (95% ci). Statistical significance was defined as a p - value of <0.05 for all analyses . Spss ver . 20.0 (ibm co., armonk, ny) was utilized for all statistical analyses . This retrospective study was approved by the institutional review board of our institution (irb no . A total of 158 non - small cell lung cancer (nsclc) patients who underwent pulmonary resection followed by adjuvant radiotherapy between 1996 and 2008 were identified . Squamous cell carcinoma was confirmed surgically in 71 patients, and clinical specimens were available from 36 patients . Of these, three patients were excluded from the analysis because of a lack of tumor tissue in their paraffin - embedded tissue blocks . The patients medical records were reviewed retrospectively for evaluation of clinicopathological characteristics and survival outcomes . After radical resection, all patients were determined to have pathologic tnm stage iii tumors according to the sixth edition cancer staging guidelines provided by the american joint committee on cancer . Fluorescent in situ hybridization (fish) was performed for analysis of sox2 gene amplifications on 4-m - thick formalin - fixed paraffin embedded (ffpe) tissue sections . Briefly, the sections were deparaffinized in xylene (twice for 10 minutes each), followed by immersion in 100% ethanol (twice for 5 minutes each) before hybridization . Pretreatment was performed according to the vysis protocol for ffpe tissue specimens . A sox2-specific dna probe (green) and a centromere 3-specific probe (red) were used (zytolight spec sox2/cen 3 dual color probe, zytovision, bremerhaven, germany). The sections were then denatured and hybridized with thermobrite (abbott molecular, des plaines, il) at 80c for 5 minutes, followed by an overnight at 37c . Post - hybridization washes were performed according to the vysis protocol for ffpe tissue specimens (abbott molecular), and dapi counterstaining was then performed . Semi - quantitative analysis of the sox2 amplification status was performed by comparing the number of green signals (sox2 target regions) to the number of red signals in each sample (reference regions). A non - amplified nucleus showed one green target signal for every corresponding red reference signal, with a green / red ratio of 1:1 (fig . 1a). Cases containing 2 - 9 more green target signals than red signals in at least 30% of their tumor cells were defined as having low - level sox2 amplification (fig . . Cases with an additional 10 green signals in a cluster - like formation were defined as having high - level sox2 amplification (fig . All tissue slides were analyzed under a 100 oil immersion objective lens using a fluorescence microscope equipped with the appropriate filters . Four - micrometer - thick tissue sections were deparaffinized, rehydrated, and washed twice in buffer . The slides were incubated in hydrogen peroxide for 10 minutes to reduce nonspecific background staining due to endogenous peroxidases, and then washed four times in buffer . Primary antibodies against human sox2 (1:200, r&d systems, minneapolis, mn) were then applied, and slides were incubated according to the manufacturer s recommended protocols . The slides were washed four times in buffer, incubated with primary antibody enhancer for 20 minutes at room temperature, and then washed four times in buffer . Next, horseradish peroxidase polymer was applied to the slides, which were then incubated for 30 minutes at room temperature before washing four times in buffer, followed by incubation with hematoxylin and chromogen, washed four times in deionized water, and counterstained . The staining results were evaluated and each case was scored from 0 to 2, according to the intensity of nuclear staining in the tumor cells . The staining intensity of the normal bronchial epithelium served as the internal control and was given an arbitrary score of 1 . Each tumor was compared to the internal control and given a score of 1 (moderate expression) (fig . 1d) when the intensity was the same as that of the internal control, 2 (strong expression) (fig . Disease - free survival (dfs) was estimated from the time of diagnosis to the time of initial tumor relapse (local recurrence or distant) or death from any cause . Overall survival (os) time was measured from the time of diagnosis to death or last follow - up date . For univariate analysis, kaplan - meier survival analyses were used to estimate os and dfs, and differences in the survival rates were compared using log - rank tests . A cox proportional hazards model was used for multivariate analysis to evaluate prognostic factors influencing os and dfs . Hazard ratios (hr) are given with 95% confidence intervals (95% ci). Statistical significance was defined as a p - value of <0.05 for all analyses . Spss ver . 20.0 (ibm co., armonk, ny) was utilized for all statistical analyses . The median patient age was 66 years (range, 48 to 73years), and 32 patients were male (97%). Most patients had an eastern cooperative oncology group (ecog) performance status of 0 or 1 (93.9%) and a positive smoking history (75.8%). Fourteen patients (42.4%) were classified as t3 or t4, and 27 patients (81.8%) as n2 or n3 . A positive margin of resection was found in 11 patients (33.3%), lymphovascular invasion and perineural invasion in seven patients (21.2%) and three patients (9.1%), and extranodal extension in four patients (12.1%). The median total dose and fraction size of radiotherapy were 59.4 gy (range, 50.4 to 69 gy) and 1.8 gy (range, 1.8 to 2 gy), respectively . Sox2 amplification was assessed using fish and protein expression was determined using immunohistochemistry in lung squamous cell carcinoma patients (fig . 1). High- and low - level amplification were observed in four (12.2%) and 18 patients (54.5%), respectively (table 1). Strong and moderate expressions were observed in eight (24.3%) and 18 patients (54.5%), respectively (table 1). Sox2 overexpression was defined as a score of 1 or 2, and no overexpression was defined as a score of 0 . Analysis of the correlation between sox2 gene amplification and protein expression showed significant association of sox2 overexpression with sox2 gene amplification (p=0.002) (table 2). Next, we analyzed the association between several clinicopathological characteristics and sox2 gene amplification and protein expression . However, no clinicopathological factor showed significant association with sox2 gene amplification or protein expression (table 3). The median follow - up period for the surviving patients was 58 months (range, 5 to 102 months). In prognostic analysis using kaplan - meier curves, sox2 overexpression was the only significant prognostic factor for os (yes vs. no; median, 73 months vs. 8 months; p=0.01) (table 4). Kaplan - meier curves also showed that patients with sox2 overexpression had significantly better os, as shown in fig . However, sox2 amplification did not show association with os (table 4, fig . Sox2 overexpression (hr, 0.1; 95% ci, 0.02 to 0.5; p=0.005) and age (hr, 0.33; 95% ci, 0.11 to 0.98; p=0.046) were the independent prognostic factors for os (table 4). In univariate analysis, age (<65 vs. 65; median, 96 months vs. 12 months; p=0.02) and total radiation dose (> 59.4 gy vs. 59.4 gy; median, 96 months vs. 30 months; p=0.04) were the significant prognostic factors for dfs (table 4). Sox2 overexpression showed a significant trend toward better dfs (p=0.08) (table 4, fig . 2c). Sox2 overexpression (hr, 0.15; 95% ci, 0.04 to 0.65; p=0.01) and total radiation dose (hr, 0.13; 95% ci, 0.02 to 0.7; p=0.02) were the independent prognostic factors for dfs (table 4). The median patient age was 66 years (range, 48 to 73years), and 32 patients were male (97%). Most patients had an eastern cooperative oncology group (ecog) performance status of 0 or 1 (93.9%) and a positive smoking history (75.8%). Fourteen patients (42.4%) were classified as t3 or t4, and 27 patients (81.8%) as n2 or n3 . A positive margin of resection was found in 11 patients (33.3%), lymphovascular invasion and perineural invasion in seven patients (21.2%) and three patients (9.1%), and extranodal extension in four patients (12.1%). The median total dose and fraction size of radiotherapy were 59.4 gy (range, 50.4 to 69 gy) and 1.8 gy (range, 1.8 to 2 gy), respectively . Sox2 amplification was assessed using fish and protein expression was determined using immunohistochemistry in lung squamous cell carcinoma patients (fig . 1). High- and low - level amplification were observed in four (12.2%) and 18 patients (54.5%), respectively (table 1). Strong and moderate expressions were observed in eight (24.3%) and 18 patients (54.5%), respectively (table 1). Sox2 overexpression was defined as a score of 1 or 2, and no overexpression was defined as a score of 0 . Analysis of the correlation between sox2 gene amplification and protein expression showed significant association of sox2 overexpression with sox2 gene amplification (p=0.002) (table 2). Next, we analyzed the association between several clinicopathological characteristics and sox2 gene amplification and protein expression . However, no clinicopathological factor showed significant association with sox2 gene amplification or protein expression (table 3). The median follow - up period for the surviving patients was 58 months (range, 5 to 102 months). In prognostic analysis using kaplan - meier curves, sox2 overexpression was the only significant prognostic factor for os (yes vs. no; median, 73 months vs. 8 months; p=0.01) (table 4). Kaplan - meier curves also showed that patients with sox2 overexpression had significantly better os, as shown in fig . However, sox2 amplification did not show association with os (table 4, fig . Sox2 overexpression (hr, 0.1; 95% ci, 0.02 to 0.5; p=0.005) and age (hr, 0.33; 95% ci, 0.11 to 0.98; p=0.046) were the independent prognostic factors for os (table 4). In univariate analysis, age (<65 vs. 65; median, 96 months vs. 12 months; p=0.02) and total radiation dose (> 59.4 gy vs. 59.4 gy; median, 96 months vs. 30 months; sox2 overexpression showed a significant trend toward better dfs (p=0.08) (table 4, fig . 2c). Sox2 overexpression (hr, 0.15; 95% ci, 0.04 to 0.65; p=0.01) and total radiation dose (hr, 0.13; 95% ci, 0.02 to 0.7; p=0.02) were the independent prognostic factors for dfs (table 4). Overexpression of sox2 is not associated with epithelial cell differentiation in the lungs, but its expression shows a notable increase in basal cell precursors (p63 + krt14 cells). Therefore, sox2 regulates the balance between self - renewal and differentiation by controlling the fate of basal cells and also triggers lung epithelial carcinogenesis . Sox2 play a role in various signal transduction pathways and exerts various biological effects via extensive networks involving upstream and downstream molecules and protein interactions . Egfr - src - akt signaling is relevant to the self - renewal of cancer stem cells and has an effect on side population cells in lung cancer . Several downstream effectors of sox2 have been identified including those involved in cancer stem cell - related signal transduction pathways . For example, c - myc, wnt1, wnt2, and notch1 play roles in non - small cell lung cancer cells . Sox2 was linked with apoptosis in non - small cell lung cancer via the mapk4-survivin pathway . Sox2 forms a network with cell cycle regulators including cyclin d1, cyclin e, and p27, as well as other biologically important pathways such as -catenin and transforming growth factor [16 - 18]. An analysis of the sox2 interactome using immunoprecipitation coupled with mass spectrometry analysis by fang et al . Found interactions between sox2 and proteins involved in dna repair, such as xrcc1, 5, and 6, which were associated with radioresistance in vitro and in human tissues [20 - 22]. In addition, cancer stem cell radioresistance can be explained by an increased recovery from dna damage and a decrease in production of reactive oxygen species . Therefore, sox2 might influence radioresistance through regulation of cancer stem cell activity . If sox2 increases radioresistance, sox2 overexpression would result in worse prognosis in irradiated patients, in contrast to our findings however, all patients enrolled in our study underwent surgery followed by postoperative radiotherapy, and most patients received adjuvant systemic chemotherapy . Thus, we concluded that our findings were not appropriate for investigating the relation between sox2 and radioresistance . Instead, we suggest that further studies designed for decisive examination of this point, such as a prospective study with lung squamous cell carcinoma patients who receive definitive radiotherapy, are required . Several previous studies investigated whether sox2 amplification was associated with prognosis in non - small cell lung cancer . Although some reported that sox2 amplification showed close correlation with poor prognosis, others reported that patients with amplification had a good survival outcome . These conflicting results arise from the limited availability of patient tissues and methods for investigation of sox2 amplification . However, our findings showed that sox2 amplification is not associated with survival . A meta - analysis utilizing the eight published series found significantly greater expression of sox2 in squamous carcinoma than in adenocarcinoma, which was associated with improved os . Similarly, multivariate analysis also showed that sox2 overexpression is the significant prognostic factor for os and dfs . Therefore, we suggest that overexpression of sox2 might be a positive prognostic factor in patients with lung squamous cell carcinoma . However, as several studies showed that the use of small interfering rna to knockdown sox2 decreased the growth and radioresistance of cancer cells in contrast to clinical studies, it remains unclear whether this could result in a feasible therapeutic approach . Therefore, further studies involving well - designed translational research from benchside to bedside are needed . To the best of our knowledge, this is the first study to investigate whether sox2 overexpression has prognostic significance in patients who underwent radiotherapy in nsclc, albeit only a small number of patients were included . Nevertheless, despite the high possibility, we cannot assume that postoperative radiotherapy changed the prognosis of patients and that sox2 is involved in this effect . Thus, further studies are certainly needed in order to validate the effect of postoperative radiotherapy on prognosis and the relationship between radiotherapy and sox2 . Still, based on our findings, it is meaningful that the prognostic value of sox2 overexpression was verified by utilizing the homogenous database of all patients treated with the whole definitive treatment scheme including radical surgery followed by postoperative radiotherapy . Primarily, it was retrospective in design and included only a small number of patients who underwent postoperative radiotherapy . We thought that sox2 overexpression showed a significant trend toward better dfs on the kaplan - meier curve in fig . 2c due to the small number of patients in spite of significant relationship between sox2 overexpression and progression - free survival in multivariate analysis . In addition, despite a very strong positive relationship between sox2 protein overexpression and gene amplification, gene amplification of sox2 did not show significant association with os or dfs, in contrast to sox2 overexpression . Similarly, in a recent large retrospective study, only sox2 overexpression showed significant association with better overall survival, although significant positive correlation was observed between sox2 protein overexpression and gene amplification . Furthermore, from an indepth review of our data, five patients with sox2 overexpression without gene amplification showed an excellent outcome of median os (60 months). Based on these findings, we suggest that a high sox2 protein level may affect the prognosis of lung squamous cell carcinoma patients more acutely than sox2 gene amplification . Consequently, we recommend an evaluation of the mechanism of sox2 overexpression with no gene amplification . Thus, further studies investigating other mechanisms of sox2 protein overexpression, such as chromosomal translocation or mutation without gene amplification, would also be necessary . In conclusion, sox2 overexpression could be a positive prognostic factor in lung squamous cell carcinoma patients treated with postoperative adjuvant radiotherapy . Further studies are needed to investigate whether sox2 is associated with radioresistance and how this could be exploited therapeutically. |
However, it is difficult to target the exact site of a microcalcification or non - palpable breast lesion if it is not detectable by ultrasound . Because stereotactic vacuum - assisted breast biopsy (vab) has a higher accuracy rate using a horizontal (x), vertical (y), and depth (z)-axis compared with ultrasound - guided vab for breast microcalcification or non - palpable lesions, it has been used as a reliable technique to localize and sample those breast lesions . Furthermore, if the targeting is successful, it is easier than ultrasound - guided vab or surgical biopsy . However, an expensive, dedicated prone table is necessary to perform prone - positioned stereotactic vab . Additionally, there are some limitations to upright stereotactic vab, such as inconvenience or a vasovagal reaction of patients . Although the lateral decubitus position is an alternative position for stereotactic vab, the breast lesion often moves in the lateral decubitus position, as identified in cranio - caudal (cc) or mediolateral - oblique (mlo) mammography views . Therefore, a true lateral mammography view is needed to overcome this problem, which is nearly identical to stereotactic mammography in a lateral decubitus position . We used the lateral decubitus position during stereotactic vab combined with true lateral mammography on 15 patients . Between january and june 2010, we performed stereotactic directional vab on 15 patients at the breast cancer center of pusan national university hospital . In all cases, the cc and mlo mammography planes were preferentially reviewed to identify non - palpable lesions with or without microcalcifications, and those lesions were classified according to the breast imaging reporting and data system (bi - rads). True lateral views of the mammographic images (ge medical systems, milwaukee, usa) were obtained in all cases before lateral decubitus positioning for stereotactic vab . The patient laid on a stereotactic vab table (digital stereotaxy with senographe ds interventional; ge medical systems) in the lateral decubitus position with the breast lesion facing up (figure 1). The scout view and 15 paired stereotactic mammography were performed to localize the breast lesion, which was compared with a true lateral view (figure 2). We calculated the horizontal (x) and vertical (y) distanced and the depth (z) from the zero point of the stereotactic vab device . Local anesthesia was performed with 2 ml of a 2% lidocaine injection under aseptic conditions . Stereotactic 15 paired mammographic views were obtained again after an 8-gauge vab probe (mammotome; ethicon - endosurgery, cincinnati, usa) was inserted to verify the site where the microcalcification was located . The needle position was corrected when the distance was more than 2 mm between the needle tip and the breast lesion . Each of two breast tissue specimens were collected from six clockwise directions (2, 4, 6, 8, 10, and 12 o'clock) and arranged in a regular sequence on a petri dish containing round filter paper (figure 3). The stereotactic vab was concluded when the breast lesion was identified by specimen mammography in more than two breast tissues . Additional sampling was performed when the breast lesion was still identified on stereotactic mammography or was not identified in specimen mammography . A post - procedure mammography view was obtained after a breast marker clip (johnson & johnson, ethicon - endosurgery, cincinnati, usa) was inserted . The breast was manually compressed at the procedure table . Only a piece of strip envelope (steri - strip; 3 m, st . Microcalcifications were observed in 12 (80.0%) of the 15 cases, and the remaining three cases (20.0%) showed non - palpable breast masses . Eight cases (53.3%) were classified as bi - rads category 3 and seven (46.7%) were category 4 (table 1). The morphological characters of the microcalcifications were scattered punctuate (n=5), clustered punctuate (n=4), amorphous (n=2) and pleomorphic (n=1). Non - palpable masses without microcalcifications were spiculated (n=2) and oval shape (n=1). Microcalcification clusters were 6 - 15 mm in diameter (mean, 10.3 mm) and masses were 6 - 8 mm in diameter (mean, 6.7 mm) (table 2). The mean patient age was 45.7 years (range, 33 - 63). Ten cases of microcalcifications were identified in the first specimen mammographic image, and the breast marker clip was located accurately in two cases of non - palpable masses after one procedure . The mean procedure time was approximately 30.1 minutes, and the average number and length of obtained core tissues was 14.4 (range, 9 - 26) and 2.7 cm (range, 0.8 - 3.3), respectively . No patient developed a vasovagal reaction such as nausea, vertigo, or syncope during the procedure . One week after the procedure, complications were identified by a physical examination and ultrasound . A minimal hematoma was observed in two cases (13.3%), which resolved spontaneously (table 3). In the histopathologic diagnoses of the stereotactic vab, 14 cases had benign breast lesions and 1 case was a ductal carcinoma in situ (dcis). Additional breast conserving surgery (quadrantectomy with a local flap) was performed for the malignant case . Among 12 cases of microcalcification on mammography, the microcalcification was confirmed in 11 (91.7%) by the pathological findings of normal stroma, benign ductules, fibrocystic changes, or dcis . Three cases without microcalcification on mammography were confirmed as sclerotic stroma with benign breast tissue . Fibroadenomas were identified in two cases, which were combined with fibrocystic changes and microcalcification (table 4). Stereotactic breast biopsy is a reliable procedure for localizing and sampling of breast tissue using mammography . Stereotactic vab has a high sensitivity (98%) and specificity (100%) and may provide a promising alternative to open breast biopsy [1,8 - 12]. Among various type of stereotactic breast biopsy, stereotactic vab is indicated for microcalcifications or non - palpable breast lesions not detectable by ultrasound . Bi - rads categories 3 or 4 for non - palpable breast lesions are usually applied for stereotactic breast biopsy, because category 5 or higher cases should be submitted to ultrasound - guided needle biopsy . Stereotactic vab is a very consistent and easy procedure if the needle is well located when targeting the breast lesion . Because accurate targeting is key for stereotactic vab, the needle should be inserted at the exact site of the calculated x, y, and z - axis points from the zero point, which is set in the vab machine . Furthermore, the complication rates for stereotactic vab are relatively lower than ultrasound - guided vab, because less breast tissue is collected . The failure rate for stereotactic vab is 3 - 10%, mostly due to a difficult procedure site or a complication such as a lesion near the skin, muscle or axilla . In our study, we did not encounter a case in which we could not use stereotactic vab, and a surgical operation was added only for a malignant lesion . Because no further procedures were performed for the other 14 benign lesions, the sensitivity and specificity of stereotactic vab could not be evaluated . A limitation of stereotactic vab is that less breast tissue volume is obtained than with ultrasound - guided vab . The procedure completion time for stereotactic vab is usually not indicated in studies and no definite guideline exists . We terminated the procedure when microcalcifications were seen in more than two tissues obtained for specimen mammography or when the breast marker clip was accurately located at a breast lesion on post - procedure mammography . Because stereotactic vab focuses on diagnosis and not treatment, but, the rate of atypical ductal hyperplasia (adh, 20.9%) or dcis (11.2%) can be underestimated . Therefore, identifying an adh or dcis during stereotactic vab warrants a further procedure or surgical excision . Although stereotactic vab is definitely an innovative diagnostic procedure, its disadvantages are that it is conducted in a prone position and that the unit is very large and expensive (approximately quadruple that of a regular unit). It is also difficult to perform stereotactic vab when the targeting site is close to the pectoralis muscle, axilla, or skin . In contrast, stereotactic vab in an upright position allows the breast lesion to be easily found with a scout image, which is almost same as the cc plane of original mammography . However, it is very difficult to maintain a stable position, because transient neck and back pain, as well as body numbness are common during the procedure, especially in the elderly . Moreover, patients can see the sharp devices, the wound and even blood, which cause anxiety, emotional stress, and possibly a vasovagal reaction, such as nausea, vertigo, or syncope . To compensate for the disadvantages of the prone or upright - positioning for stereotactic vab, a one - side decubitus position was used, which is more comfortable and stable for the patients, even if it has not been generally used . An expensive prone table is unnecessary for lateral positioning during stereotactic vab and it causes neither a vasovagal reaction nor neck, or back pain . But, it is more difficult to detect the breast lesion, because the lesions often moves, which is different from standard mammography . To alleviate this problem, we performed a true lateral mammography view before the procedure, which lengthened the procedure . Breast lesions could be easily identified on stereotactic mammography, because the targeted site was nearly the same as the pre - procedure true lateral view mammography . Our report has limitations such as the small number of cases with a short term follow - up and the absence of a comparison between stereotactic vab and other diagnostic procedures . According to several studies, 6 - 27% of benign breast lesions remain after a vab procedure, and it is difficult to distinguish between a post - procedural scar and residual lesion within 6 months . Therefore, long term follow - up is necessary to evaluate for a residual breast lesion . Although this report has simply introduced a diagnostic procedure, the usefulness of lateral decubitus positioning for stereotactic vab with true lateral mammography could be verified if a comparison between stereotactic vab and open biopsy or ultrasound - guided vab with a long term follow - up result was added. |
As rice yield is enormously affected by large number of pathogenic organisms, nematodes, fungi, insects and virus hence, understanding and exploitation of the root endophytic community for this high demand asian crop can result in the promotion of crop health . This could be an alternative approach towards eco - friendly potential natural source for biological control in disease management . Advances in high - throughput environmental genomic dna sequencing or metagenomic sequencing as well as various analytical tools and data resources has enabled us to understand the vast diversity of microorganisms, specially rare and uncultured microorganism and their phylogeny in community analysis . It also gives us insight into the enormous amount of functional gene diversity of a microenvironment . The low cost of this technology and easy generation of draft genomes from complex dataset has made metagenomics study a much popular technique bypassing the need for isolation and lab cultivation of individual microorganism . In this study, we thoroughly investigated the root endophytic microbial community present in the local cultivar of rice (oryza sativa l.) at different field condition of west bengal . The rice plants were selected at 60 days stage and were dug out from some selected wet land local rice fields which produces the bulk of the requirement of the population of kolkata . Average temp of the area was 86 f and soil ph ranges from ph 7.2 to ph 8.1 . Among 10 collected samples, two samples os01 and os04 the total number of reads obtained for sample os01 was 5,66,012 and that for sample os04 was 5,51,888 (fig . The community study revealed an abundance of over 50% for the members of firmicutes . In sample os01 the percentage was found to be 58.4% while in sample os04 it was 97% . At the genus level bacillus was the most dominant microbial member with abundance of over 50% in both the samples . In sample os01 gammaproteobacteria had a high abundance of 34.9% but in sample os04 the percentage was as low as 0.2% as evidenced in the heat map prepared with otu abundance of 200 or more (fig . 2 histogram representing total number of reads for both samples (os01 and os04). Samples were collected directly from field in and around kolkata in triplicates and were stored in sterile plastic bags . Surface sterilization of the root tips were then performed with 70% ethanol for 1 min followed by 1.2% (w / v) naocl solution for 15 min . Samples were then washed three times with sterile distilled water with shaking (10 min). The dna of each sample was isolated according to the protocol reported by bonet et al . The amplicon libraries were prepared using nextera xt index kit (illuminainc .) As per the 16s metagenomic sequencing library preparation protocol (part #15044223 rev . Primers for the amplification of the v3-v4 hyper - variable region [v3 forward oligo: cctacgggnbgcascag and v4 reverse oligo: gactacnvgggtatctaatcc] of 16s rdna gene of bacteria and archaea were used . The amplicons with the illumina adaptors were amplified by using i5 and i7 primers that add multiplexing index sequences as well as common adapters required for cluster generation (p5 and p7) as per the standard illumina protocol . The amplicon libraries were purified by 1 ampurexp beads and checked on agilent dna 1000 chip on bioanalyzer 2100 and quantified on fluorometer by qubitdsdna hs assay kit (life technologies). The library size of sample os01 and sample os04 were 634 bp and 622 bp respectively . The libraries were sequenced using the illumina sequencing chemistry to generate ~ 150 mb of data per sample . After obtaining the qubit concentration for the library and the mean peak size from bioanalyzer profile, library was loaded onto illumina platform at appropriate concentration (1020 pm) for cluster generation and sequencing . The kit reagents were used in binding of samples to complementary adapter oligos on paired - end flow cell . The adapters were designed to allow selective cleavage of the forward strands after re - synthesis of the reverse strand during sequencing . The copied reverse strand was then used to perform sequencing from the opposite end of the fragments . Our study revealed that in both the samples, the dominant member of rice root microbiome is bacillus and this data is well supported by other literatures, .qiime analysis indicated that shannon -diversity = 3.10 and no . Of observed species = 420 and the shannon -diversity = 2.40 and no . Of observed species = 297 for sample os01and for sample os04 respectively . At phylum level, both the samples are enriched with firmicutes followed by proteobacteria, bacilli, whereas gammaproteobacteria were the most abundant at class level in both the samples . At genus level, bacillus and acinetobacter were found to be the most abundant genus enriched in both the root samples . Moreover, our findings were also consistent with the reports of ji et al . 2014 where three major diazotrophic endophytic communities were identified as actinobacteria, gammaproteobacteria and bacillus . Although, the functional annotations of the endophytic bacterial community of our samples are still pending, however, the dominant groups suggests their probable role of atmospheric n2 fixation, a primary requisite for plant growth particularly in rice . Metagenome sequence data from this study are available at the ncbi sequence read archive (sra) and biosamples under accession numbers: samn06209694 and samn06209718 . Our study revealed that in both the samples, the dominant member of rice root microbiome is bacillus and this data is well supported by other literatures, .qiime analysis indicated that shannon -diversity = 3.10 and no . Of observed species = 420 and the shannon -diversity = 2.40 and no . Of observed species = 297 for sample os01and for sample os04 respectively . At phylum level, both the samples are enriched with firmicutes followed by proteobacteria, bacilli, whereas gammaproteobacteria were the most abundant at class level in both the samples . At genus level, bacillus and acinetobacter were found to be the most abundant genus enriched in both the root samples . Moreover, our findings were also consistent with the reports of ji et al . 2014 where three major diazotrophic endophytic communities were identified as actinobacteria, gammaproteobacteria and bacillus . Although, the functional annotations of the endophytic bacterial community of our samples are still pending, however, the dominant groups suggests their probable role of atmospheric n2 fixation, a primary requisite for plant growth particularly in rice . Metagenome sequence data from this study are available at the ncbi sequence read archive (sra) and biosamples under accession numbers: samn06209694 and samn06209718 . Psw-039/14 - 15 ero) by the university grants commission (ugc), new delhi, india. |
A 91-year - old gentleman presented with incidental finding of left neck of femur fracture on a routine radiograph . A quick review of the patient notes revealed a fall, with a lengthy hospital admission, approximately 1 year previously . Despite his initial inability to weight - bear and protracted slow progress with physiotherapy no further imaging of the hip was obtained beyond an initial, negative pelvic radiograph . Doctors must be bold in questioning a radiograph that does not fit with the clinical picture . Clinical suspicion of neck of femur fracture in the face of a negative radiograph necessitates further imaging to obtain a definitive answer . The more experienced doctor knows that some cases are not clear - cut, as between 2% and 10% are occult on conventional radiography [1 - 4]. In cases, where there is clinical suspicion of a neck of femur fracture, but imaging has been negative or equivocal, further imaging (e.g. Magnetic resonance imaging / computed tomography) is required . Hip fractures, like everything else, can be missed and this can have serious implications for patients . A delay of over 48 h from admission to surgery doubles the risk of death within 1 year postoperatively . Following a routine radiograph performed by his general practitioner a 91-year - old gentleman was referred to accident and emergency with an incidental finding of fractured left neck of femur (fig . 1). His general practitioner had requested a pelvic radiograph to further investigate the cause of this gentleman s left knee pain . Despite no falls within the previous year the radiograph demonstrated the well - corticated edges of an old fracture, and the patient was able to mobilize using his frame . Routine pelvic radiograph of a 91-year - old man requested by his general practitioner to further investigate the cause for his left knee pain old, left sided, displaced, intracapsular had as neck of femur fracture with well - corticated edges . Review of past incidents to find a cause for this neck of femur fracture quickly illuminated a possible event . Approximately 1 year prior, the patient had been admitted to hospital following a mechanical fall at home, after which he was unable to weight - bear . Clinical examination had demonstrated none of the salient features of a neck of femur fracture or had initial radiographs of the pelvis exposed a fracture (fig . Radiographs of the knee demonstrated no abnormality, yet the gentleman was unable to walk and was admitted . Lateral radiograph of the left hip from the same 91-year - old gentleman taken 1 year previously, following a fall . Anteroposterior radiograph of the left hip from the same 91-year - old gentleman taken 1 year previously, following a fall . Degenerative changes of the left hip joint are demonstrated although no obvious fracture is evident . Magnetic resonance imaging of his left knee was requested to exclude the possibility of soft tissue injury, which demonstrated a tear of the medial meniscus . Felt to be the cause of his delayed progress, further physiotherapy was encouraged and eventually this gentleman managed to mobilize independently with a frame . Hip fractures are often simple to diagnose clinically and radiologically, with initial imaging sensitivity estimated as 90 - 98% [1 - 4]. Approximately 75,000 femoral necks are fractured in the uk per annum and this is projected to rise further . If initial radiographs alone are used to exclude a neck of femur fracture then this poses the alarming possibility that up to 7,500 (of the known) neck of femur fractures could have been missed . Delays in diagnosis increase the risk of avascular necrosis, arthroplasty, nonunion, thromboembolic events, and mortality [9, 10]. This case and figures above demonstrates the need for clinicians to have a high index of suspicion when evaluating elderly patients following a fall . If there is clinical suspicion of a neck of femur fracture, then a negative radiograph is not enough and further imaging is required; magnetic resonance imaging - or computed tomography, if unavailable or contraindicated . The sheer prevalence of neck of femur fractures, combined with the knowledge that up to 10% are occult on radiograph [1, 2, 3, 4] necessitates clinicians to have a high index of suspicion of occult neck of femur fractures in elderly patients following a fall . Although occult fractures are well documented in the literature, hilton s law, as well as referred pain from the joint above or below, are reasons for the threshold for further imaging modalities to be lowered . The aim of this case report is to raise awareness, to encourage doctors to be bold in questioning a radiograph that does not fit with the clinical picture and to increase requests for further imaging to obtain a definitive answer; the numbers and guidelines are on your side . To encourage clinicians to question a radiograph that does not fit with the clinical findings of a neck of femur fracture and consider further imaging to obtain a more definitive picture |
Myotubular myopathy (mtm) is an x - linked congenital disorder (xlmtm) that is caused by mtm1 mutation1). In this condition, the small muscle fibers present a central area devoid of myofibrils and mitochondrial aggregates around the centrally located, often large nuclei2). Compared with other congenital myopathies, the onset of clinical signs is typically at or near birth, and affected infants are areflexic and floppy, exhibiting respiratory difficulty that usually requires ventilatory support4). The majority of mutations related to xlmtm have been identified in exons 3, 4, 8, 9, 11, and 126,7). Several cases have been reported since mtm was first described in 1986 in korea8,9). However, only one case was reported with regard to the genetic analysis of mtm in the korean population10). Here we report a case of myotubular myopathy in a neonate with a splice site mutation of mtm1 gene at the intron 10 region . A 2,930 gm male was born at 37 weeks and 5 days gestation age via emergency cesarean section in a local hospital . Polyhydramnios and reduced fetal movements were noted during the antenatal period . During the therapeutic amniocentesis in response to polyhydramnios, his apgar scores were 1 - 5 - 5 at 1, 5, and 10 minutes; he required resuscitation and intubation due to poor respiration . Subsequently, he was transferred to pusan national university yangsan hospital and was placed on ventilator support . His birth weight (2,930 g, 50th percentile), length (51 cm, 75th to 90th percentile), and head circumference (35 cm, 90th percentile) were within the normal range . He had no abnormalities based on the chest radiograph, but findings showed fractures on both his humerus which were splinted for treatment within one month (fig . His birth condition presented severe hypotonia, sucking impairment, and the absence of spontaneous movements . He then required mechanical ventilation from birth throughout his confinement at the hospital due to apnea . However, magnetic resonance imaging of the brain and electroencephalography showed no evidence of hypoxic ischemic encephalopathy . Postnatal blood gas analysis showed normal levels; echocardiography and screening blood tests for metabolic disease were also normal . No neonatal reflexes could be elicited and his posture was extremely floppy - frog like characterized by a long face (fig . Tests for congenital hypotonic disorders, including spinal muscular atrophy, myotonic dystrophy, pompe disease, prader - willi syndrome, and chromosomal disease were carried out . Muscle biopsy of the left biceps was performed and myotubular myopathy was confirmed based on the findings characterized by large centrally placed nuclei in myofibers (fig . Peripheral blood samples for the gene study were obtained from the patient and from his mother for x - linked myotubular myopathy . A mutation c.1261 - 1c> a was identified in the intron 10 of the mtm1 gene in this case . 4). He needed tube feeding for nutritional support and a tracheostomy for ventilator support . He was discharged after six months and was brought home with a mechanical ventilation support . Genomic dna was isolated from peripheral blood using quickgene dna kit (fujifilm life science, tokyo, japan). To analyze of mtm1 gene mutation, polymerase chain reaction (pcr) was performed by use of fourteen sets of primers designed in intronic flanking region containing all exons referred to genbank accession number nt_011726.13 . After amplification, pcr mixtures were run on 1.2% agarose gel in the presence of ethidium bromide to verify the size and purity of pcr products . After verifying that single specific pcr product was amplified, dna sequencing was performed using the same primers used in pcr, and bigdye terminatore v3.1 cycle sequencing kit (applied biosystems, foster city, ca, usa) according to manufacturer's instructions . Genomic dna was isolated from peripheral blood using quickgene dna kit (fujifilm life science, tokyo, japan). To analyze of mtm1 gene mutation, polymerase chain reaction (pcr) was performed by use of fourteen sets of primers designed in intronic flanking region containing all exons referred to genbank accession number nt_011726.13 . After amplification, pcr mixtures were run on 1.2% agarose gel in the presence of ethidium bromide to verify the size and purity of pcr products . After verifying that single specific pcr product was amplified, dna sequencing was performed using the same primers used in pcr, and bigdye terminatore v3.1 cycle sequencing kit (applied biosystems, foster city, ca, usa) according to manufacturer's instructions . Mutations in the mtm1 gene encoding myotubularin cause xlmtm, a well - defined subtype of human centronuclear myopathy4). Xlmtm is characterized by the early onset and presence of uniformly small muscle fibers with centrally placed nuclei3,4). Although centrally located nuclei can be found in many myopathies, clinical, genetic, and pathological factors can help distinguish these myopathies from xlmtm4). Clinical characterization of xlmtm has been comprehensive and the disorder has been found to give rise to a severe phenotype in males . It is present at birth with marked weakness and hypotonia, external ophthalmoplegia and respiratory failure due to the weakness of the muscles responsible for respiration11). Signs of antenatal onset include reduced fetal movements, polyhydramnios and thinning of ribs as seen on chest radiographs11); however, these manifestations are rarely observed in other congenital myopathies . The diagnosis of xlmtm has traditionally relied upon the identification of characteristic histopathologic changes in muscle samples from affected males . Because of the time required for molecular analysis of mtm1, the clinical diagnosis of xlmtm continues to rely upon muscle biopsy13). Hematoxylin and eosin - stained cross sections of xlmtm muscle show increased variability in fiber size, but this is generally not as extreme as what is seen in the dystrophic processes . The cardinal histopathologic feature of xlmtm is the presence of hypotrophic myofibers with relatively large, centrally placed nuclei3). The x - linked nature of this disorder facilitated genetic analysis, with linkage studies assigning the gene to xq28 in 199011). Laporte et al.1) isolated the mtm1 gene by positional cloning and named the gene product,' myotubularin' . In 1997, de gouyon et al.14) and laporte et al.15) carried out a complete gene sequencing of 15 coding exons and flanking intron . In several series, mutations were detected in 60% to 90% of individuals with xlmtm14,15). The majority of mutations were identified in exons 3, 4, 8, 9, 11, and 126,7). The first report concerning an xlmtm family with two affected infants diagnosed by muscle biopsy and gene analysis was released in korea8). A nonsense mutation arg486stop was identified in exon 7 of the mtm1 gene in that family . Moreover, we detected another splice site mutation of mtm1 gene c.1261 - 1c> a at the intron 10 region in a present neonate with xlmtm . Although, the diagnosis is confirmed by muscle biopsy, mtm1 mutation analysis is critical in consulting with the mother about prenatal family planning and antenatal genetic screening . Prenatal testing should still be offered to all women who might give birth to affected male infants3). The management is essentially supportive and/or rehabilitative, requiring a multidisciplinary approach11,17). In the majority of cases, the course is fatal within the initial months of life, but a proportion of affected males infants may survive into their teens or beyond 11,18,19). Therefore, physicians who care for the newborn should consider the possibility that a neuromuscular disorder might be present in a hypotonic infant . When a floppy infant is regarded to have hypoxic ischemic encephalopathy based on a perinatal circumstantial evidence, an accurate diagnosis should be established by carrying out appropriate clinical procedures . If a neuromuscular disorder is suspected, a muscle biopsy should be done . We report that a neonate initially misdiagnosed with hypoxic ischemic encephalopathy was diagnosed with a xlmtm with a splice site mutation of mtm1 gene at the intron 10 region. |
Hyperthyroidism, primarily caused by graves' disease, affects about 1 in 500 pregnancies . Although not common, it is important to recognise and treat maternal hyperthyroidism, because failing to do so can have detrimental effects . In the mother, untreated hyperthyroidism can cause spontaneous miscarriage, pregnancy induced hypertension, preterm labour, congestive cardiac failure, and thyroid storm; for the fetus this could mean still birth, intrauterine growth restriction, or low birth - weight . Further, hyperthyroid states in the mother have been associated with congenital anomalies including oesophageal atresia, tracheo - oesophageal fistula, and biliary tree atresia [2, 3]. There is also an association between the antithyroid drugs used to treat maternal hyperthyroidism and congenital anomalies . This association is most widely reported for carbimazole and its active metabolite, methimazole, such that the concept of a carbimazole embryopathy is being increasingly acknowledged amongst prescribing clinicians [49]. There has been no convincing link between the alternative thionamide drug propylthiouracil and birth defects despite the rate of placental transfer of the drug being the same as that of carbimazole . This has led to the endocrine society's current advice to use propylthiouracil as a first - line drug during pregnancy, if available, especially during first trimester organogenesis . Carbimazole or methimazole should be used only if propylthiouracil is not available or if the patient cannot tolerate or has an adverse response to it . Recognition of serious adverse effects of anti - thyroid drugs in pregnancy is dependent upon reporting of such effects by prescribing clinicians . Since 1964, the yellow card scheme has allowed healthcare professionals involved in prescribing in the uk to report suspected serious adverse drug reactions (adrs) to the commission on human medicines (chm)/medicines and healthcare products regulatory agency (mhra). The professional reporting the suspected adr submits a yellow card found at the back of the british national formulary, or electronically via the mhra website, giving brief clinical details supporting their suspicions that the drug is responsible for the adverse outcome(s) seen . In addition, pharmaceutical companies are legally required to report suspected serious adrs of their products . Since october 2005, patients have also been able to report suspected adrs through the yellow card scheme . In this paper, we aimed to establish whether spontaneous reporting via the yellow card scheme in the uk lends support to an association between congenital anomalies and the use of carbimazole or propylthiouracil in pregnancy . Data on all birth defects reported via the yellow card scheme in association with treatment with carbimazole or propylthiouracil between july 1963 and september 2010 was obtained in drug analysis prints from the mhra . Drug analysis prints give a complete listing of all uk spontaneous suspected adrs reported through the yellow card scheme by healthcare professionals, patients, and the pharmaceutical industry to the mhra and chm . They do not present a complete overview of the risks associated with specific medicines, and conclusions on the safety and risks of medicines cannot be made on the information contained in drug analysis prints alone . The drug analysis print from the mhra included 64 reports of birth defects following exposure to antithyroid drugs, reported between 1963 and 2010 . Of these, 54 reports came from healthcare professionals, 9 from pharmaceutical companies, and one from a patient . On review, one of the reports was found not to comprise birth defect and was excluded from further analysis . Figure 1 shows the total numbers of birth defects reported following exposure to carbimazole and propylthiouracil by decade . For carbimazole, three (5%) of these cases (with tracheo - oesophageal fistula, anencephaly, and unspecified congenital heart disease, respectively) have been reported as fatal . For propylthiouracil, only 6 cases with 11 congenital anomalies have been reported, but these have all been within the last 15 years . Table 1 describes the type of birth defects reported for carbimazole and propylthiouracil exposure in utero and the number of defects seen in conjunction with other anomalies in the same individual . Two - thirds of the cases with birth defects associated with both carbimazole and propylthiouracil exposure had multiple anomalies in the same individuals . Birth defects associated with carbimazole exposure included aplasia cutis, choanal atresia, tracheo - oesophageal fistula, patent vitellointestinal duct, and dysmorphic facies, which have been previously reported as components of carbimazole embryopathy . The doses of carbimazole used were known for 34 out of 57 cases (60%), and ranged between 5 mg and 60 mg daily (median 15 mg). Similarly, the dose of propylthiouracil, known for 5 out of 6 cases (83%), ranged widely from 50 mg to 350 mg daily (median 50 mg). There have been far fewer reports via the yellow card scheme of birth defects related to propylthiouracil exposure, but all the reports related to this drug have been within the last 15 years; this may reflect the fact that historically carbimazole has been the more widely prescribed drug in the uk, rather than it its rate of teratogenicity being significantly higher . There has been a 3.5-fold increase in ptu prescription relative to carbimazole since 1981 in the uk, which may have unmasked adverse effects that had previously gone unnoticed . Changes in prescribing trends are also reflected by data from the usa, where between 2002 and 2008, propylthiouracil use increased in women of childbearing age . Two previous studies comparing carbimazole with propylthiouracil showed no difference in the number of major congenital anomalies seen in babies exposed to these drugs in utero [12, 18]. However, both studies were relatively small . A study from sweden found 4 reports between 19952000 of infants born with oesophageal atresia and omphalocele or choanal atresia, 3 of whom had been exposed to methimazole in the first trimester; there was no association between these anomalies and propylthiouracil . A recent larger case control study which included over 18,000 cases with congenital malformations, 127 of whom were exposed to antithyroid drugs in the first trimester, showed a significant association between exposure to carbimazole / methimazole and choanal atresia or omphalocele . For propylthiouracil, there was a tentative suggestion of an association with situs inversus, renal agenesis, or dysgenesis and cardiac outflow tract malformations although these were not as strong as the associations reported for carbimazole . Consistent with these observations, we found five cases of choanal atresia and four cases of umbilical anomalies associated with carbimazole exposure in our study (table 1). There were no reports of situs inversus, renal agenesis, or cardiac malformations associated with propylthiouracil exposure (table 1). The nature of congenital malformations seen in our cases is wide ranging, keeping with previous reports of birth defects related to these drugs (table 1). Several of the congenital malformations associated with carbimazole exposure observed in this study, including aplasia cutis, choanal atresia, tracheo - oesophageal fistula, omphalocele, patent vitellointestinal duct, nipple abnormalities, and dysmorphic facies, have previously been reported in association with carbimazole / methimazole exposure in utero . Furthermore, two - thirds of the anomalies associated with carbimazole exposure occurred with other defects in the same cases, lending further support to an embryopathy as opposed to a single malformation which might have occurred spontaneously irrespective of exposure to teratogens or not . It should be noted that most of the anomalies seen following propylthiouracil exposure also did not occur in isolation, but given the small numbers for propylthiouracil, this should be interpreted with caution . Firstly, true prevalence of birth defects related to carbimazole and propylthiouracil cannot be calculated from the information we have collated . We do not know the total number of births to mothers with graves' disease over the study period, and we do not have data relating to the types of anti - thyroid drugs prescribed to pregnant women over the study period . In addition, yellow card data cannot be used as a reliable indicator of the frequency of suspected adrs to medicines . The number of reports received via the yellow card scheme does not directly equate to the number of people who suffer adverse reactions to drugs . It is recognised that this scheme is associated with an unknown and variable level of underreporting . The level of adr reporting may fluctuate between given years due to a variety of reasons, for example, a medicine being new, stimulated interest / publicity, and variations in exposure to the medicine . In this case, there is potential for bias in that prescribers may be more likely to make an association between a congenital anomaly and carbimazole given previous reports of an embryopathy related to the drug which is not the case for propylthiouracil . Similarly, carbimazole and propylthiouracil were introduced to the market at different times, and therefore, reporting bias means that they should not be directly compared . Secondly, causality cannot be proven . It is important to note that a report of an adr does not necessarily mean that it was caused by the drug . Many factors have to be taken into account in assessing causal relationships including temporal association, the possible contribution of concomitant medication, and the underlying disease . We do not have information on maternal thyroid function for our cases; this is important, because maternal hyperthyroidism itself is associated with congenital anomalies [2, 3]. Furthermore, in a cohort study of infants of mothers with graves' disease, the incidence of congenital malformations was significantly higher in infants whose mothers were hyperthyroid in the first trimester compared to those who were euthyroid, with a reported prevalence of 6% and 0.3% in the two groups, respectively . Thirdly, we do not have a complete data on the doses and durations of the carbimazole or propylthiouracil exposure in our cases . We only know doses used for 60% of patients treated with carbimazole and 83% of patients treated with propylthiouracil . Nevertheless, the multiple characteristic congenital anomalies we have reported in this study lend support to the teratogenicity of thionamide drugs, in particular carbimazole . This has important clinical implications, and prescribing physicians should be aware of the potential association with congenital anomalies whilst balancing this risk with that of uncontrolled maternal hyperthyroidism in pregnancy . There are few birth defects associated with propylthiouracil, but this should be interpreted in the context of higher historical prescription rates for carbimazole. |
The name granulosa cell tumor (gct) was proposed by von werdt in 1914 . To have primarily originated retroperitoneal gct is even rarer . In medical literature in english from 1938 till today, only 12 cases have been reported . Although, the histology of ovarian adult - type granulosa cell tumors (agcts) is well - documented, it is rarely encountered in cytological specimens and the identification of tumor cells is very difficult . Here . Per abdominal examination revealed a well - defined mass palpable in the left hypochondriac and lumbar regions . Computerized tomography (ct) of the abdomen revealed a solid heterogeneous mass lesion measuring 11.2 cm 8 cm 12 cm, consistent with retroperitoneal hematoma [figure 1a]. Ultrasonography (usg)-guided aspiration of the mass was performed and the smears were hypercellular with small, overlapping cell clusters and cells in a microfollicular pattern [figure 1b]. On enquiry, she gave a history of hysterectomy with bilateral salpingo - oophorectomy 22 years ago for uterine leiomyoma . With these cytological features and the clinical history, a diagnosis of extraovarian agct was proposed . We received multiple dark brown and necrotic tissue fragments together measuring 10 cm 8 cm 3 cm . The cut section of all fragments showed gray white, yellowish, and hemorrhagic areas . (a) ct showing a solid heterogeneous mass in the left anterior pararenal space compressing left kidney (b) cytology smear showing cells in microfollicular pattern (papanicolaou, 400) (c) cells in sheets and microfollicular pattern (h and e, 400) (d) tumor cells showing strong positivity for inhibin (inhibin, 400) histologically the neoplasm was composed of small round to oval neoplastic cells with predominantly microfollicular [figure 1c], diffuse, and watered - silk patterns . Immunohistochemistry (ihc) for inhibin and epithelial membrane antigen (ema) was done . The tumor was positive for inhibin [figure 1d] and negative for ema . With the typical histopathological features and ihc findings, a diagnosis of primary agct of retroperitoneum was confirmed . There are two subtypes: adult and juvenile, based on different clinical and histological features . Agct of the ovary is oftentimes a hormonally active stromal cell neoplasm that is distinguished by its ability to express aromatase and to secrete sex steroids such as estrogen . The histogenetic origin of extraovarian agct is thought to be from the ectopic gonadal stromal tissue from the mesonephros . The cytological smears of an agct are usually highly cellular of both single cells, syncytial aggregates, and follicular pattern . The cells are monomorphic with scanty to moderate amount of pale cytoplasm and monomorphic round to oval nuclei having longitudinal grooves and granular chromatin . Histologically, the tumor cells resemble normal granulosa cells with uniform, round or oval nuclei having finely granular chromatin and longitudinal nuclear grooves or folds . They show microfollicular, macrofollicular, trabecular, watered - silk, or diffuse patterns . Extraovarian gct should be differentiated from other tumors such as small - cell carcinoma, undifferentiated carcinoma, carcinoids, and lymphoma . Gct is positive for inhibin and calretinin and negative for ema whereas other tumors do not show positivity for inhibin and calretinin . The case of primary retroperitoneal gct is reported for its rarity after excluding previous ovarian origins and to describe its relevance to the histologic origin . Due to their rarity, agcts present a diagnostic challenge for cytologic preparations . We believe that sensitive cytologic evaluation, histopathologic correlation, taking clinical history, and a positive immunohistochemical reaction with inhibin could help us in practice . Surgery is the primary treatment for these tumors, however, long - term follow - up with history, clinical examination, and tumor markers are crucial for gcts, as later relapse is a common behavior for these unique tumors. |
Mitochondrial disease involves a group of rare disorders of mitochondrial dysfunction, which is usually the result of gene mutations in either mitochondrial dna (mtdna) or nuclear dna (ndna). Because mitochondria are the main source of energy production in cells and are present in all tissues except for red blood cells, clinical features manifest typically in tissues with the highest energy requirements including skeletal muscles, brain, myocardium, and endocrine systems . The clinical presentation is highly variable on the disease onset, symptoms, signs, severity, and prognosis . It is common for mitochondrial disease to present with constellations of symptoms, which allows them to be categorized into one of the several syndromes . Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke - like episodes (melas) is a progressive neurodegenerative disorder associated with polygenetic, maternally inherited mutations in mtdna . Approximately 80% of melas cases are caused by the mutation m.3243a> g of the mitochondrial transfer rna (trna) (leu (uur)) gene (mt - tl1). Thus, the genetic diversity and the unpredictable presentation and clinical course highlights the difficulties in diagnosing melas . Promisingly, some new research progresses have been made recently, including the characteristic functional magnetic resonance imaging (fmri) imaging, such as magnetic resonance spectroscopy (mrs), which can be used to determine the lactate level of brain, and proton magnetic resonance spectroscopic imaging (1h - mrsi) assessment can be used to predict disease severity . Be aware that other diseases may have similar muscle biopsy findings of mitochondrial myopathies (mm), including ragged red fibers (rrfs) and cytochrome oxidase (cox) negative fibers herein, we review and analyze the research progresses in melas in order to help make better diagnosis of this disease . Clinical manifestation of melas is highly variable, which makes it difficult to be timely accurately diagnosed . Given that mitochondria are the common pathway for the oxidative decarboxylation of fats, amino acids, and carbohydrates, it is understandable that mitochondrial dysfunction can impair cellular energy metabolism, which can be particularly apparent during periods of superimposed metabolic stress (e.g., exercise, infection, or prolonged fasting). Disease onset can occur at any age although typically the earlier the clinical phenotypes present in life, the severer the disease develops . For example, patients with the melas m.3243a> g gene mutation can present with the later adult - onset deafness and diabetes or fatal encephalomyopathy with seizures and stroke - like episodes (ses) in infancy . Less than 10% of patients with genetically confirmed melas present before the age of 1, whereas 6080% are diagnosed by the age of 15 . There are rare case reports in the literatures of patients presenting and being diagnosed as old as 80 years of age . The average observed age of death in melas patients was reported to be 1934.5 years (range 10.281.8 years), with 22% of death occurring younger than 18 years . The predominant feature of melas involves ses, which commonly presents acute cortical blindness, psychiatric disorder, dementia, or paralysis . . A wide range of clinical features can also present, including hearing loss, myopathy, neuropathy, migraine, epilepsy, ataxia, short stature, diabetes mellitus (dm), gastrointestinal disease, and cardiomyopathy . Previous studies have reported a large proportion of death attributable to cardiac causes in melas patients . Isolated mm severely affecting respiratory muscles is an uncommon clinical spectrum of m.3243a> g mitochondrial disease . Reported a prospective cohort study of 85 melas patients (the largest sample to date) from 35 families with the m.3243a> g mutation followed for up to 10.6 years . In that study, patients with melas had systemic symptoms including exercise intolerance (93%), gastrointestinal disturbance (90%), loss of hearing (70%), growth failure (40%; the presence of developmental delays and growth failure was associated with an earlier onset of melas), diabetes (39%), hirsutism (25%), night blindness (44%), and ptosis (41%). Further, the development symptoms of the patients consist of school difficulties (51%), child motor delay (39%), perinatal difficulties (34%), special education (34%), and speech delay (28%). Other studies have reported considerable diversity in the clinical phenotypes that result from pathogenic mutations, including nephrotic syndrome and an altered mental status . In 2013, a chinese case control study of 770 chinese han ethnicity dm patients and 309 healthy control individuals showed 13 (1.69%) individuals carrying the m.3243a> g mutation, which was not found in any of the healthy controls . The data suggested that the m.3243a> g mutation may be a risk for dm, especially in severe cases of the disease in the chinese han population . So far, the biomarkers of melas in blood are rarely identified . As a common marker of injured muscles, plasma creatine kinase levels in patients with melas are typically normal or slightly elevated, no more than five times the upper normal limit . As lactate acidosis is one of the cardinal signs of melas syndrome, the most specific laboratory data for melas include extremely elevated lactic acid and pyruvic acid levels in both plasma and cerebrospinal fluid (csf), and there is evidence that high lactate level is associated with increased mortality . Chinnery proposed that fasting blood lactate level above 3 mmol / l, or fasting csf lactate level above 1.5 mmol / l supports a diagnosis of mitochondrial disease . Elevated csf lactate level is a reliable marker pointing to mitochondrial origin of disease, even in children who have recently suffered short - lasting seizures . However, normal plasma or csf lactate level does not exclude the presence of a mitochondrial disorder . Unlike stroke, computed tomography (ct) has limited value in revealing brain lesions in melas, although there may be areas of focal infarction or bilateral basal ganglia calcifications on brain ct . Nevertheless, ct is often performed as it is widely available during the acute episodes of seizures and ses in melas patients . Mri is the main instrument used for the diagnosis of melas, along with the muscle biopsy and genetic studies . For example, during ses, brain mri t1wi and t2wi show signal changes similar to that of acute cerebral infarction . But serial mri typically reveals lesions that are not restricted to arterial territories, and that migrate over time . These lesions commonly affect the occipital and parietal lobes, although the deep gray matter such as the thalamus may also be affected, likely reflecting its high metabolic demand . Further, cortical lesions observed on mri preferentially affect the cortical ribbon, with relative sparing of the deeper white matter, again reflecting the higher metabolic demand of these regions . Diffusion - weighted imaging can also reveal a hyperintense lesion in the affected lobes . As there is restricted diffusion, there is also a reduced apparent diffusion coefficient, as seen in ischemic stroke . Interestingly, there is evidence that the clinical symptoms and mri / mra findings in some melas patients can improve (reversible vasoconstriction) within 4 weeks . In short, the brain lesions of melas in serial mri are quite different from that of acute ischemic stroke . Magnetic resonance spectroscopy (mrs) is a useful technology to help diagnose melas, as it allows assessment brain metabolites . As a result of mitochondrial dysfunction, aerobic energy transduction is impaired, hence patients with melas have high lactate levels in blood and csf . In melas, mrs can detect a higher than normal level of lactate in parts of the brain not acutely ischemic, thereby confirming a level of metabolic derangement . 1h - mrsi assessment of cerebral metabolism in m.3243a> g mutation carriers is also promising for identification of disease biomarkers and individuals at risk of developing the melas phenotype . Elevated central nervous system (cns) lactate as estimated by mrsi is associated with shorter survival, confirming previous observations that elevated lactate is associated with increased disease severity . Yu et al . Reported that mri could also show quantitative changes in oxygen extraction fraction (oef) at different phases of ses . The use of oxygen in the brain, especially for those brain regions involved in the disease is usually severely reduced after the episodes of melas . Further, oef is significantly reduced in the brain at the acute, subacute phase and interictal phase . Increased blood flow can be found in the stroke - like lesions at the acute and subacute phase . Ikawa et al . Also reported preclinical latent lesions in patients with melas by arterial spin labeling (asl) perfusion mri . Regional cerebral hyperperfusion is observed on asl perfusion mri in the preclinical phase more than 3 months before the clinical onset of ses in three melas patients . These hyper - perfused areas are not detected by conventional mri in the preclinical phase and developed into acute lesions at the clinical onset of ses, suggesting that asl imaging has the potential for predicting the emergence of ses . Positron emission tomography imaging can evaluate regional cerebral blood flow, redox energy states, and glucose metabolism in the living brain, and has been used to further elucidate the pathogenesis of acute stroke - like lesions . The acute melas lesions appear to have an initial increase in blood flow and glucose metabolism in response to oxidative stress . In the subacute phase, there is a decrease in blood flow and glucose use even under the condition of increased oxidative stress . A specific clinical feature of melas is mm, which presents as exercise intolerance and weakness . As the symptoms are the most common presentations of varied myopathy, it is strongly advised for patients who are suspected with melas to accept a muscle biopsy . Muscle biopsy is very helpful in confirming the diagnosis of melas, which mainly presents cox negative fibers and rrf . The muscle biopsy is typically performed from a limb muscle, such as the quadriceps femoris or deltoid . The major diagnostic feature is the presence of fibers deficient for cox activity (mitochondrial cytopathy), which represents poor activity of complex iv of the respiratory chain, encoded by both the mtdna and ndna genes . It is important to note that a low frequency of cox - deficient fibers is a normal finding in healthy aged individuals . Thus, in general, the detection of any cox - deficient fibers in individuals <50 years of age, or a higher frequency of cox - deficient fibers (> 5%) at any age, is strongly suggestive of a mitochondrial disorder . The identification of cox - deficient fibers is supported by serially staining muscle for cox followed by succinate dehydrogenase (sdh) that stains for complex ii, which is encoded entirely by nuclear genes . The demonstration of cox - deficient, sdh - positive muscle fibers exhibits the best sensitivity and specificity for mm . As a general rule, a mosaic appearance of cox negative fibers suggests an mtdna mutation due to the variable degrees of heteroplasmy among muscle cells, whereas uniformly decreased cox activity suggests an ndna mutation which would be equally present in all muscle cells . The sub - sarcolemmal accumulation of mitochondria is a classic feature of melas and mm, and can be demonstrated by sdh histochemistry (so - called ragged blue fibers) or the modified gomori trichrome stain so - called rrf . Again, a low frequency of rrfs (<5%) can be seen in healthy aged individuals . However, the detection of rrfs in individuals <50 years of age or> 5% rrf at any age is highly suggestive of mm, although even high levels can be secondary to other pathologies such as inclusion body myositis . Other characteristic features include the presence of strongly sdh - positive blood vessels seen in muscle of patients with melas harboring m.3243a> g . Electron microscopic (em) examination of serial frozen sections of these biopsies showed that the smooth muscle cells of the strongly sdh - reactive blood vessels contain marked proliferation of mitochondria, characteristic of patients with melas . Em can also be performed on muscle specimens and demonstrate a variety of abnormalities associated with mm, although these are rarely specific for mitochondrial diseases . However, em may provide minor diagnostic criteria for mitochondrial disease in some patients with normal histochemistry, and thus may contribute additional information in selected cases . Muscle histochemistry and/or em may be normal even in the context of genetically proven mitochondrial syndromes, particularly in the early disease course or when the biochemical defect does not involve complex iv . Rce is technically difficult to perform, even by specialist, and the results should be interpreted in the context of other examinations . Demonstrating an rce defect is a crucial diagnostic step in patients particularly children with normal or near - normal muscle histochemistry . Mitochondrial dna is a small (16,569 bases), circular, double - stranded molecule, lacking introns and possessing only one promoter region . Mtdna gives rise to two ribosomal rnas, 22 trnas, and 13 protein - encoding messenger rnas that contribute proteins to complexes i, iii, iv, and v of the oxidative phosphorylation system . During fertilization, each cell contains several mitochondria, and each mitochondrion contains numerous genomes, with hundreds of copies of mtdna in every cell . In this setting, the phenomenon of genetic heteroplasmy arises, where a proportion of genomes contain a mutation . Consequently, a pathogenic mtdna mutation can only cause a disease phenotype if the level of the mutation within a cell or tissue exceeds a threshold amount, which varies depending on the mutation and the tissue [figure 1]. Cell types and tissues within an individual vary in the proportion of abnormal mtdna and a given tissue can also have different levels over time . All of these are considered as the main pathogenesis of mitochondrial diseases caused by the pathogenic mutations of mtdna . Myopathy, encephalopathy, lactic acidosis, and stroke - like episodes, if mutational mtdna exceeds the threshold, the mitochondrial function is impaired . If the mutation does not exceed the threshold, the mitochondrial function may be normal . The mitochondrial trna (leu (uur)) gene (mt - tl1) appears to be a hotspot for pathogenic mtdna mutations . The phenotypic heterogeneity observed with several different mutations spanning only 59 bp of this gene is difficult to interpret . These phenotypes range from myopathy alone (3302a> g), to proximal and truncal myopathy and sudden death (3251a> g), to a disorder that often predominantly affects the cns including the melas syndrome (3243a> g, 3271t> c, 3252t> c). The most common mutation (bp 3243) itself has a very variable phenotype, which has also been found in patients with progressive external ophthalmoparesis, myopathy alone, diabetes, and deafness . Approximately 80% of melas cases are caused by the mutation m.3243a> g of the mt - tl1 gene, while 715% of melas patients have the 3271t> c mutation . Some case reports show that m. 4322g> a, 3251a> g, 3252t> c, 3256c> t, 3302a> g, 3697g> a, 3946g> a, 3949t> c, 3959g> a, 3995a> g, 12300g> a, and 13513g> a mutations also lead to melas . It is likely that more mutations might be found in patients with melas in the future . Genetic tests should be guided based on muscle biopsy findings, and these techniques are performed in combination . Mutation load can vary among tissues (including oocytes) in an individual and within a family . As blood cells have a high replication rate and selectivity against pathogenic mtdna abnormalities, however, it should not be assumed that mutation load is negligible, as it may be higher in other tissues . In this because melas is a group of rare disorders that presents with varied clinical phenotypes, it is, therefore, easy to misdiagnose . The first symptoms include exercise intolerance, seizures, paralysis, hemianopsia, mental anomaly, gastrointestinal disorders, respiratory muscles weakness, and arrhythmia . Patients with melas are usually sent to the emergency room, and are predominantly initially misdiagnosed as myasthenia gravis, epilepsy, cerebral infarction, encephalitis, gastrointestinal diseases, or heart diseases, leading to mistaken treatment and delayed therapeutic opportunity . Elevated plasma lactate levels and lesions mainly located in the cortex, with relative sparing of the deeper white matter on ct and mri, indicate suspected melas . Further investigation should be performed stepwise to confirm the diagnosis [figure 2]. Diagnosis flow chart . * represents the key elements for the right diagnosis of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke - like episodes . Current therapies include supplement of l - arginine, citrulline, atp, vitamins, riboflavin, and coq10 ., melas is a progressive neurodegenerative disorder associated with polygenetic, maternally inherited mutations in mtdna . The predominant feature of melas is ses, and the onset usually occurs in the second decade the main diagnostic feature of muscle biopsy is the presence of rrf and mosaic appearance of cox negative fibers . Mitochondrial genetic examination can confirm the diagnosis, the frequent mutations are 3243a> g, 3271t> c, and 3252t> c . New techniques of fmri especially 1h - mrsi and oef enhance the diagnosis of melas . The overall diagnosis should be based on not only the clinical manifestations, but also the laboratory findings from blood and csf biochemistry, neuroimaging, muscle biopsy, and genetic examination . Special attention should be paid because of the variability in disease stages and genetic heteroplasmy . For example, muscle biopsy may be normal in the early disease course, and mtdna abnormalities are not detectable in blood . The prognosis of melas patients depends on the location of genetic mutations, mutation load, and the onset of disease and interventions. |
Spanish hospital discharge database incidence rate ratios positive predictive value rotarix (glaxosmithkline biologicals rixensart belgium) rotateq (merck & co. inc . West point pa usa) self - controlled case series valencias vaccine information system two oral live - attenuated rotavirus vaccines are currently available in the global market: a monovalent human vaccine, rotarix (glaxosmithkline biologicals, rixensart, belgium), indicated as a 2-dose series in infants between the ages of 612 and 24 weeks, and a pentavalent bovine - human reassortant vaccine, rotateq (merck & co., inc ., west point, pa, usa), indicated as a 3-dose series starting at age 612 weeks and ending at age 32 weeks . Previously, an observed association between rotashield, the first licensed rotavirus vaccine, and intussusception, caused its withdrawal from the us market in 1999, only 9 months after licensure . The pre - licensure clinical trials for both rotarix (rv1) and rotateq (rv5), designed to exclude an association with intussusception of similar magnitude than that found for rotashield, did not find an association . However, after licensure, an increased risk, although of much lower magnitude, was found with both vaccines in australia, mexico, brazil, and the united states . Both vaccines, rv1 and rv5, have been available in spain since august 2006 and january 2007, respectively . Rotavirus vaccines in spain are not funded by the national health system, but are recommended by scientific societies and most pediatricians, and paid for by parents . Due to the incidental finding of circovirus dna contamination affecting both vaccines, the spanish medicines agency suspended rv5 distribution during june - november 2010, and rv1 distribution since march 2010 . As of this publication, rv1 remains suspended in spain . Intussusception risk varies across population and regions, and some studies have shown high background rates of intussusception in spain; a potential association with rotavirus vaccination could cause concern . Thus, our aim was to investigate such association in the valencia region, spain . We performed a hospital - based retrospective observational study during january 1, 2007 december 31, 2011 . Intussusception risk following rotavirus vaccinations was assessed using a self - controlled cases series (sccs) design . The sccs is a case - only design that uses individuals who had the event of interest during the study period; we applied the vaccinated cases only sccs approach, which uses only subjects who were exposed to a rotavirus vaccine . Therefore, inference is done within individuals, and time - fixed confounders are controlled implicitly by design . The observation period (follow - up person - time) for each individual is divided in predefined risk and non - risk periods based on exposure . Therefore, the event of interest falls either into a risk or a non - risk period . In our case, the risk periods were defined as days 17, and 821, post - vaccination, following each dose of any rotavirus vaccine . The study included assessment of the positive predictive value (ppv) of the intussusception code used in the spanish hospital discharge database, cmbd . Almost all the valencia region population (> 98%) is covered by the public health system, and all users have a unique identification number that allows linking all health care databases and all medical records . Potential intussusception cases among resident infants aged 642 weeks, irrespective of their rotavirus vaccination status, were identified from cmbd through the icd-9-cm code 560.0 in any diagnosis position . A review of hospitalization and primary care medical records of all potential cases was carried out using the standardized brighton collaboration case definition for intussusception (see the table s1 showing the brighton criteria in the appendix). First intussusception episodes considered confirmed (brighton level 1-level 2) were included in the analyses . In our study, the event date was the date of onset of symptoms . Lack of information or inconsistencies were confirmed through phone consultation with parents and verbal verification of the information in the childs vaccination card . Dose - specific incidence rate ratios (irrs), and their 95% confidence intervals (ci), were assessed to investigate the association between confirmed intussusception cases and rotavirus vaccines within the 2 predefined risk periods . The irr is estimated by within - individual comparisons of the incidence of the event of interest in risk and control periods using person - time denominators . Given the strong confounding effect of age, analyses were adjusted using, as reference, intussusception - hospitalized rates by age in unvaccinated valencia regions children during 20012011 . Specific rates by age were estimated using data from cmbd and from the spanish statistical office database (www.ine.es); the pattern was modeled using spline function (fig . 1). Figure 1.intussusception-hospitalized rates by age in unvaccinated valencia regions children aged less than 12 months during 20012011 . Intussusception - hospitalized rates by age in unvaccinated valencia regions children aged less than 12 months during 20012011 . The ppvs were assessed for the different categories of brighton collaboration case classification: (1) level 1, (2) level 1-level 2, and (3) levels 1-level 2-level 3 . Analyses were performed using stata / se 13.1 (statacorp lp texas, usa), r 3.0.3 (foundation for statistical computing, vienna, austria), sas 9.2 (sas institute, inc . ), and sas macros developed by bart spiessens . The study was conducted according to the existing legislation including the good epidemiological practices (cioms 2009), the helsinki declaration (seoul 2008) and the law 14/2007, of 3 july, on biomedical research, and was approved by the ethics research committee of the direccin general de salud pblica / centro superior de investigacin en salud pblica, which provided a waiver to access personal information and contact parents . The valencia region has an annual birth cohort of around 48,000 infants among a total population of approximately 5,000,000 inhabitants . Within the population of interest, infants aged 6 to 42 weeks discharged from hospitals of the valencia regions public health system, 151 potential hospitalized - intussusception cases were identified after having excluded duplicate episodes (children transferred to a reference hospital). Cases occurred in 147 infants, since 4 infants (3%) had a second episode . Medical records were available for all cases . Among first episodes, 125 cases (85.0%) were classified as level 1, 11 (7.5%) as level 2, 2 (1.4%) as level 3, 8 (5.4%) as insufficient evidence, and one case (0.7%) was discarded . Of 136 confirmed intussusception cases, 35 (26%) occurred in rotavirus - vaccinated children (fig . 2). Among them, 14 (40%), and 21 (60%) had received rv1 and rv5, respectively . The ppv of the diagnosis code for hospitalized intussusception cases (any discharge diagnosis position) was 93% (95% ci: 87%96%) for level 1-level 2 of diagnosis certainty . No differences by discharge diagnosis position or by calendar year were found (table 1). Table 1.positive predictive values according to the brighton collaboration case classification by discharge code position, and by calendar yearpositive predictive valuescasesnlevel 1% (95% ci)level 1- level 2% (95% ci)level 1-level 2-level 3% (95% ci)discharge code position 114886.5 (79.991.5)93.2 (87.996.7)94.6 (89.697.6) 1 or 214986.6 (80.091.6)93.3 (88.096.7)94.6 (89.797.7) any15185.4 (78.890.6)92.7 (87.396.3)94.0 (89.097.2)calendar year 20074481.8 (67.391.8)90.9 (78.397.5)95.5 (84.599.4) 20083086.7 (69.396.2)93.3 (77.999.2)93.3 (77.999.2) 20092584.0 (63.995.5)92.0 (74.099.0)92.0 (74.099.0) 20102889.3 (71.897.7)92.9 (76.599.1)92.9 (76.599.1) 20112487.5 (67.697.3)95.8 (78.999.9)95.8 (78.999.9)1any diagnosis position.abbreviations: positive predictive value (ppv); confidence interval (ci). Positive predictive values according to the brighton collaboration case classification by discharge code position, and by calendar year any diagnosis position . Three intussusception cases occurred within days 17 following first dose of a rotavirus vaccine (two after rv1 and one after rv5) resulting in a crude irr point estimate of 9.0 (95% ci: 0.986.5), and in an age - adjusted estimate of 4.7 (95% ci:0.374.1) within this risk window . The number of cases occurring within 17, 821, and 2242 days following each dose, and dose - specific irrs are shown in table 2 . Table 2.risk estimates for confirmed intussusception cases after rotarix/rotateq vaccination, vaccinees - only sccs approachvaccine doserisk period(days post - vaccination)number of casesnon - risk period(days post - vaccination)number of casesirr (95% ci)(crude)irr (95% ci)(age - adjusted)dose 1173224219.0 (0.986.5)4.7 (0.374.1)82111.5 (0.124.0)0.8 (0.113.9)dose 2171224221.5 (0.116.5)1.6 (0.132.3)82132.3 (0.413.5)3.9 (0.344.0)dose 3170224213.0 (0.248.0)non interpretable8210non interpretablenon interpretable*the observation period for each vaccine dose ends at day 42 post - vaccination.1non - interpretable irr due to very small numbers.abbreviations: intussusception (is); confidence interval (ci). Risk estimates for confirmed intussusception cases after rotarix/rotateq vaccination, vaccinees - only sccs approach the observation period for each vaccine dose ends at day 42 post - vaccination . Abbreviations: intussusception (is); confidence interval (ci). In this first post - licensure analytical study of the intussusception risk following rotavirus vaccination in europe, we investigated intussusception cases among infants discharged from all hospitals of the valencia regions public health system, which covers> 98% of the approximately 5 million population of the region, for a 5-year period . Therefore, it is unlikely that a significant proportion of the total cases of intussusception would have been seen in private hospitals . Also, vaccines administered in all public and some private health centers are recorded in siv, regardless of their inclusion in the official immunization schedule . A recent study has shown that, among all rotavirus vaccine doses distributed during 20092012, most (86%) were registered in siv as administered in children aged less than one year . Nonetheless, because of these concerns, we chose a sccs approach restricted only to vaccinated cases . This method implicitly controls for time - fixed confounders, and, because of the restriction to vaccinees, also minimizes potential misclassification bias, and eliminates the need to address the healthy vaccinee effect and the contraindication to vaccination issue found in some studies . An additional strength of this study is that intussusception diagnoses were confirmed through medical record review of all potential cases hospitalized . Our finding of an elevated intussusception risk point estimate during the first week following administration of the first dose of rotavirus vaccines was comparable in magnitude to estimates from similar studies performed in the united states, australia, and mexico . Despite having analyzed the whole population of a large region for 5 years, our findings were not statistically significant, maybe due to lack of study power . This is understandable given the rarity of intussusception and the low rotavirus vaccine coverage in the region during the study period (full - schedule coverage estimated for children aged under one year as ranging between 24% to 49%, based on distributed vaccine data). Because of the small size of the total vaccinated population, and our need to evaluate rotavirus vaccine safety for the region (regardless of specific vaccines used) both vaccines were evaluated jointly . Our finding of very few vaccinated cases despite a thorough multi - year investigation in a country which, according to previous studies, may have a large background rate of intussusception, is reassuring, and provides information that should contribute to deliberations about the need to include rotavirus vaccines in the official valencian and spanish calendars . This study has also shown that a high quality investigation of the safety of childhood vaccinations using valencias healthcare databases is possible . The high (93%) ppv found for a discharge diagnosis of intussusception has opened the door to the implementation of a larger study without the need to perform medical record reviews . Thus, we plan to continue the study for additional years, and invite also participation from other spanish regions . Moreover, following verification of the ppv of the discharge diagnosis codes in candidate sites, the study could be extended to include other european databases, thus gaining substantial power for the analysis of this rare event, even if vaccination coverage remains low . Such database integration will substantially improve the capacity for timely post - licensure assessments of the safety of any new vaccines introduced in europe . Spv, jdd, and jpb are working at fisabio - public health, institution that has ongoing research contracts with glaxosmithkline biologicals, sanofi pasteur msd, and merck & co., inc . Jdd, jpb and rgp have received support for grants and travel grants from glaxosmithkline biologicals, sanofi pasteur msd, and merck & co., inc . Spv has received travel grants for scientific congress from glaxosmithkline biologicals and sanofi pasteur msd . All authors were involved in interpretation of the results, the critical revision of drafts, and approved the final version of the manuscript. |
Paratuberculosis (map) is a causative agent of johne's disease or paratuberculosis, which is a chronic debilitating disease in ruminants that is characterized by incurable enteritis and persistent diarrhea . The disease is distributed worldwide and causes significant economic losses to the livestock industry because of premature culling and production losses . In the united states, map - positive herds experience economic losses of almost us $100 per cow and a disease cost of us $200 to 250 million annually . At the herd level, it has been estimated that more than 50% of dairy cattle farms were infected with map in most major dairy - producing countries . Moreover, the most recent herd level prevalence estimates are as high as 90% in the u.s . Dairy cattle industry . These findings indicate that an infection rate of map is increasing and there is a need to establish an efficient program for control of this pathogen . Clinical signs of the disease, such as diarrhea, loss of milk production and weight loss, are usually absent until two or more years after initial infection . Stages of the map infection can be divided into four categories according to severity of clinical signs, the potential for shedding organisms, and the possibility of detection using current diagnostic methods . The first stage, silent infection, is generally observed in young animals less than two years of age . . Furthermore, there are no cost - effective diagnostic methods to detect animals in this stage . Although animals in this stage still have no clinical signs of infection, they may be detected through cost - effective diagnostic tests such as serum enzyme - linked immunosorbent assay (elisa) and fecal culture . However, many of the animals in this stage are not detected by such tests because the animals shed organisms in an intermittent manner, and antibodies against map are usually produced when they are close to the next stage of disease (clinical stage). These undetected subclinical fecal shedders become a source of infection that consistently contaminate the environment . Therefore one of the major attempts is to identify map specific antigens that can be used in the interferon (ifn-) assay to measure th1-mediated immune response elicited by animals in the early stage of infection . Another attempt is to identify biomarkers of the map infected animals by analysis of transcriptional changes that show early responses to infection . Accordingly, host transcriptional profiles during the early stage of infection in mouse raw264.7 cells, map infected mouse models, and naturally infected cattle have been analyzed . There are three major approaches to reduce or eradicate the johne's disease, efficient management to decrease transmission, testing and culling, and vaccination . Although the incidence of johne's disease can be reduced by efficient management, eradication can only be accomplished when all the infected animals are detected and culled . Although diagnostic tests for johne's disease are improving, it is still not possible to detect all infected animals . For these reasons, testing and culling strategies using the present diagnostic methods are ineffective for eradication of the disease except when targeting only - high shedding animals . Under these circumstances, vaccination can be the best control strategy unless animals can be detected during early infection . This is because vaccination can reduce the incidence of map shedding and manifestation of clinical signs, which is more cost - effective than testing and culling . However, vaccination is probably the least accepted strategy because of several drawbacks, which are discussed in the next section of this review . Map can infect a wide range of animals, therefore, it is important to determine if wildlife can act as a maintenance host or act as spillover host because the infection can persist via intraspecies transmission alone in maintenance hosts . In fact, one of the difficulties of eradication of bovine tuberculosis is blocking contacts with livestock from wildlife such as badgers, brush - tailed possums, and white - tail deer . Some species susceptible to paratuberculosis such as farmed deer could maintain the infection when they are in high - density populations . In south korea, there have been several reports that map has infected wild boar, sika deer, and mouflon . In this review, the general characteristics of johne's disease with respect to the pathogenesis and immune response to map, as well as recent advances in development of vaccines were briefly examined . Map infection is initiated by ingestion of fecal material orally contaminated by map (fecal - oral route). Following ingestion, map can pass through the m cell, which is specialized for uptake of particles that mainly bind to bacteria and transport them into the submucosal layer . Like other mycobacterium, map is able to survive and replicate in non - activated macrophages by inhibiting phagosome - lysosome maturation . Map eventually causes the cell death of infected cells, after which liberated map can be phagocytosed by freshly accumulated macrophages and dendritic cells that are activated by cytokines such as tumor necrosis factor and ifn-. Ifn-, which plays an important role in activation of macrophages and t cells, is produced by infected cells, local t cells, and natural killer cells . Activated macrophages and dendritic cells produce interleukin (il) 12 and present antigen to nave cd4 + t cells through mhc class ii molecules . Il-12 triggers the differentiation of nave cd4 + t cells into t helper 1 (th1) cells . Th1 cells produce cytokines such as il-2 and ifn-, which play roles in promotion of expansion of antigen specific th1 cells and maturation of macrophages . These antigen specific responses change from innate immunity to cell mediated adaptive immunity . In the later stages of infection, therefore, it has been accepted that switching from th1 immune responses to th2 responses is the cause of disease progression . Many researchers investigated the immune regulatory mechanisms of host animals to identify causes of th1-th2 switches . An increase of il-10 production by regulatory t cells (tregs) or macrophages, which induces the down regulation of th1 responses and stimulation of antibody production, is considered to cause this switch . Along with tregs, the progressive decrease of cd4 + t cell population in local immune response has been shown to be accompanied by increasing t cell population . The cytokine mrna profiles of t cells demonstrated that subsets of bovine t cells encode il-10 and transforming growth factor, suggesting a potential regulatory role of t cells . Recently, however, a typical pattern of disease progression that can be explained by the th1-th2 switch was observed in only 40% of map - infected sheep with other cases showing simultaneous responses of both cellular and humoral immunity or cellular immunity only . A recent study using mathematical modeling suggested that th1-th2 switch may be a result of disease progression (increasing of extracellular bacteria) rather than cause . A similar study that used a mathematical model to analyze the correlation between th1, th2 expression and bacterial shedding revealed a positive correlation between the amount of bacteria and humoral immune response was observed . However, there was no evidence of competition or synergy between th1 and th2 immunity . This study also suggested that map - specific cellular immune responses were predicted to increase shedding, whereas in some animals it was predicted to suppress the shedding . As a result, it can be inferred that adaptive immune responses play a limited role in disease protection . However, these mathematical modeling studies have some vulnerable points because they cannot consider all of the parameters . Therefore, these results or hypotheses should be confirmed by both in vitro and in vivo studies . Another modeling study suggested that long - term subclinical infection may related to innate immunity rather than adaptive immunity . The results using structural models (villus model, granulomatous model) of local infection showed that the long subclinical phase was due to structural organization of the granulomatous lesion . Moreover, the authors predicted that intermittent shedding was due to changes in the recruiting efficiency of macrophages influenced by external factors such as hormonal changes (ex ., pregnancy, lactation). Recently, many researchers have been interested in development of live attenuated vaccines against map . These types of vaccines can elicit protective mucosal and systemic immune responses because the diverse antigens included in this vaccine can stimulate both innate and adaptive immunity . Another advantage of this vaccine is that manufacture of live attenuated vaccine is cost effective and easies than that of other vaccines such as subunit vaccines . Mutants of map have been made by phage - mediated techniques, transposon mutagenesis and allelic exchange mutagenesis . Many transposon mutant libraries have been created to identify virulence mechanisms thereby finding vaccine candidates . Direct mutagenesis using allelic exchange techniques has also been tried by deletion of genes already known to be pathogenic or essential for intracellular survival in m. tuberculosis or m. bovis . The rela, lsr2, and pkng mutants were generated by park et al . And each gene was known to be related to virulence factors in m. tuberculosis and m. bovis . Two of these candidates, rela and pkng were evaluated for virulence attenuation and efficacy as vaccine candidates using macrophages and ileal cannulation models of natural hosts (cattle) and goats . The result showed that rela mutant was a better vaccine candidate than pkng mutant based on virulence attenuation and inhibition of map challenge in baby goats . The wag906 (map1566), wag913, and wag915 (ppia) mutants were evaluated by scandurra et al . . Wag906 and wag913 were made by transposon mutagenesis using map 989 strain, and wag915 was made by allelic exchange of the ppia gene . These live attenuated vaccine candidates were evaluated using monocyte derived macrophages (mdm) apoptosis, il-10 production and animal models (mouse and goat). Mouse vaccinated with wag915 mutant reduced bacterial loads in the spleen and liver after challenge with map . The leud, mpt64, and seca2 mutants were constructed by allelic exchange of these three genes to develop effective live attenuated vaccine . The auxotroph leud mutant of m. bovis - bcg strain showed lower survival rates, and m. bovis leud mutant induced significant protective immune responses against a virulent m. bovis strain in cattle . The mpt64 gene is related to apoptosis of multinucleated giant cells, while the seca2 mutant of m. tuberculosis enhanced apoptosis of infected macrophages . Testing using the mouse model revealed that the most obviously attenuated mutant was leud mutant strain . In addition, leud mutant induced a significant reduction of inflammation and bacterial load compared with the non - vaccinated group . The sigl and sigh mutants that are knocked out of the sigma factor gene were selected as live attenuated vaccine candidates because the sigma factors involved in part of the global virulence regulation provide resistance to the host bactericidal activities . The sigl and sigh mutants showed attenuated virulence in mice, and these mutants elicited significant protective immune responses against map infection in mouse models . Recently, a three phase vaccine candidate evaluation strategy was established by johne's disease integrated program (jdip) research consortium to improve the efficiency of the efficacy test on the map live attenuated vaccines . Phase i is a screening test using the mdm model, phase ii is a challenge test using the mouse model, and phase iii is an evaluation of protective effects using a goat model . Subunit vaccines have been developed to overcome the drawbacks of whole - cell based vaccines . Whole - cell based vaccines interfere with the diagnosis of both tuberculosis and paratuberculosis in vaccinated animals . However, subunit vaccines using well defined recombinant map proteins or dna encoding immunogenic antigens can overcome the interference issues . Many attempts have been made to identify map antigens to develop subunit vaccines using genomic or proteomic analysis . Because the production of ifn- induced by th1-mediated immune responses is crucial to reducing the number of bacteria in the early stages of map infection, identifying antigens that induce strong th1 responses is essential to the development of subunit vaccines . Finding an antigen is also related to development of immunodiagnostic method as well as development of subunit vaccines . Several antigens were tested for their potential for use as a vaccine candidates: heat shock protein 70 (hsp70), antigen 85 complex proteins (ag85a, ag85b, and ag85c), lipoproteins (lprg and map0261c), ppe family proteins (map1518 and map3184), superoxide dismutase, and alkyl hydroperoxide reductases (ahpc, ahpd). Among many antigens, cattle vaccinated with hsp70 containing an adjuvant, dimethyl dodecyl ammonium bromide, showed reduced bacterial load compared with a non - vaccinated group in animals experimentally challenged with map . Furthermore, the cross - reactivity with serologic test of paratuberculosis was not observed when a preabsorption step with hsp70 was included, and hsp70 vaccination did not interfere with the skin test of tuberculosis, despite hsp70 being a major component of mycobacterial tuberculin . However, recent study suggested that the protective effects of hsp70 protein are due to b - cell activation and therefore the production of hsp70-specific igg1, instead of th1-mediated immune response producing ifn- . To date, researchers have only focused on cell - mediated immune responses to identify candidate vaccines . However, further studies are needed to understand protective mechanisms to map of host animals in greater detail, including humoral immune responses in the early stages of infection . Moreover, dna vaccines have advantages of storage and delivery because they are very stable . Several candidates were evaluated for their ability to induce protective immune responses; however, they were only evaluated in mouse models . Recently, combination of map - specific antigens and viral vectors was attempted to increase the ability of antigenic effects of dna vaccines . The advantage of viral vectored vaccines is to provide high delivery of antigens to antigen presenting cells, thereby increasing antigen specific cd4 + and cd8 + immune responses . The first map vaccine, which was developed in 1926 by vallee and rinjard, consisted of a live non - virulent map and oil based adjuvants . Since then, a number of whole - cell based vaccines, live attenuated vaccines and inactivated vaccines were developed to prevent bovine and ovine johne's disease . Currently, three commercial vaccines are all based on inactivated whole bacteria, mycopar, gudair, and silirum, of which only mycopar is approved for use in the united states . Mycopar is manufactured by boehringer ingelheim vetmedica inc . Using map strain 18 for use in cattle . Interestingly, strain 18 is not a map, although it is a member of the family of mycobacterium avium species . Gudair is manufactured by cz veterinaria in spain for use in sheep and goats using heat inactivated map f316 strain adjuvanted with mineral oil . An australian study revealed that vaccination could reduce the prevalence of map shedding with their longitudinal study . However, another cross - sectional study reported that shedding of map persisted in the majority of flocks, despite vaccination of lambs . An efficacy test with a randomized control of johne's disease in young farmed deer in new zealand revealed that vaccination of silirum reduced the prevalence of clinical disease . Meta - analysis of the efficacy of map vaccination, especially its production, epidemiological effects, and pathogenic effects, was conducted by bastida and juste in 2011 using previously published papers . From this meta - analysis, it was concluded that vaccination against map is a useful strategy for reducing contamination by this pathogen, production losses and pathologic effects . Despite the many advantages of vaccination, it has not been encouraged in cattle in most of countries because of several drawbacks mentioned in the introduction section . One major drawback of whole - cell based vaccination is interference with diagnostic tests currently used in bovine tuberculosis and paratuberculosis . These vaccines have the potential to produce false positive animals in serological tests for paratuberculosis such as elisa because the commercial elisa kit consisted of crude map antigens, which hinder differentiation of infected animals from vaccinated animals . The caudal fold skin test using m. bovis purified protein derivatives (ppd - b) is most widely used field screening tool for diagnosis of bovine tuberculosis . However, in the ifn- assay, stimulation with ppd - b produced robust responses similar to ppd - j (map purified protein derivatives) in map vaccinated animals . Because of this cross - reaction with other mycobacteria such as m. avium subspecies, comparative cervical test has been used as a complementary test to discriminate m. bovis infection from other mycobacterial infections by comparing the reactivity of each antigen using ppd - b and ppd - a (m. avium purified protein derivatives). However, this strategy may also cause problems with diagnostic sensitivity owing to the higher ppd - a reactivity because map vaccination can reduce the differences between ppd - b and ppd - a in m. bovis infected animals . Therefore, many countries that are running m. bovis eradication programs do not use vaccination policies however, these problems can be overcome by development of new diagnostic methods or vaccines . Emerging serologic tests using m. bovis specific antigens such as esat-6, cfp-10, and mpb83 did not produce positive results in map vaccinated animals . Another drawback of whole cell based vaccines is the substantial tissue damage at the injection site and accidental self - inoculation, which may cause serious side - effects . However, there is a vaccine adjuvanted with highly refined mineral oils such as silirum to reduce the formation of granuloma at the site of injection . Recently, many researchers have been interested in development of live attenuated vaccines against map . These types of vaccines can elicit protective mucosal and systemic immune responses because the diverse antigens included in this vaccine can stimulate both innate and adaptive immunity . Another advantage of this vaccine is that manufacture of live attenuated vaccine is cost effective and easies than that of other vaccines such as subunit vaccines . Mutants of map have been made by phage - mediated techniques, transposon mutagenesis and allelic exchange mutagenesis . Many transposon mutant libraries have been created to identify virulence mechanisms thereby finding vaccine candidates . Direct mutagenesis using allelic exchange techniques has also been tried by deletion of genes already known to be pathogenic or essential for intracellular survival in m. tuberculosis or m. bovis . The rela, lsr2, and pkng mutants were generated by park et al . And each gene was known to be related to virulence factors in m. tuberculosis and m. bovis . Two of these candidates, rela and pkng were evaluated for virulence attenuation and efficacy as vaccine candidates using macrophages and ileal cannulation models of natural hosts (cattle) and goats . The result showed that rela mutant was a better vaccine candidate than pkng mutant based on virulence attenuation and inhibition of map challenge in baby goats . The wag906 (map1566), wag913, and wag915 (ppia) mutants were evaluated by scandurra et al . . Wag906 and wag913 were made by transposon mutagenesis using map 989 strain, and wag915 was made by allelic exchange of the ppia gene . These live attenuated vaccine candidates were evaluated using monocyte derived macrophages (mdm) apoptosis, il-10 production and animal models (mouse and goat). Mouse vaccinated with wag915 mutant reduced bacterial loads in the spleen and liver after challenge with map . The leud, mpt64, and seca2 mutants were constructed by allelic exchange of these three genes to develop effective live attenuated vaccine . The auxotroph leud mutant of m. bovis - bcg strain showed lower survival rates, and m. bovis leud mutant induced significant protective immune responses against a virulent m. bovis strain in cattle . The mpt64 gene is related to apoptosis of multinucleated giant cells, while the seca2 mutant of m. tuberculosis enhanced apoptosis of infected macrophages . Testing using the mouse model revealed that the most obviously attenuated mutant was leud mutant strain . In addition, leud mutant induced a significant reduction of inflammation and bacterial load compared with the non - vaccinated group . The sigl and sigh mutants that are knocked out of the sigma factor gene were selected as live attenuated vaccine candidates because the sigma factors involved in part of the global virulence regulation provide resistance to the host bactericidal activities . The sigl and sigh mutants showed attenuated virulence in mice, and these mutants elicited significant protective immune responses against map infection in mouse models . Recently, a three phase vaccine candidate evaluation strategy was established by johne's disease integrated program (jdip) research consortium to improve the efficiency of the efficacy test on the map live attenuated vaccines . Phase i is a screening test using the mdm model, phase ii is a challenge test using the mouse model, and phase iii is an evaluation of protective effects using a goat model . Subunit vaccines have been developed to overcome the drawbacks of whole - cell based vaccines . Whole - cell based vaccines interfere with the diagnosis of both tuberculosis and paratuberculosis in vaccinated animals . However, subunit vaccines using well defined recombinant map proteins or dna encoding immunogenic antigens can overcome the interference issues . Many attempts have been made to identify map antigens to develop subunit vaccines using genomic or proteomic analysis . Because the production of ifn- induced by th1-mediated immune responses is crucial to reducing the number of bacteria in the early stages of map infection, identifying antigens that induce strong th1 responses is essential to the development of subunit vaccines . Finding an antigen is also related to development of immunodiagnostic method as well as development of subunit vaccines . Several antigens were tested for their potential for use as a vaccine candidates: heat shock protein 70 (hsp70), antigen 85 complex proteins (ag85a, ag85b, and ag85c), lipoproteins (lprg and map0261c), ppe family proteins (map1518 and map3184), superoxide dismutase, and alkyl hydroperoxide reductases (ahpc, ahpd). Among many antigens cattle vaccinated with hsp70 containing an adjuvant, dimethyl dodecyl ammonium bromide, showed reduced bacterial load compared with a non - vaccinated group in animals experimentally challenged with map . Furthermore, the cross - reactivity with serologic test of paratuberculosis was not observed when a preabsorption step with hsp70 was included, and hsp70 vaccination did not interfere with the skin test of tuberculosis, despite hsp70 being a major component of mycobacterial tuberculin . However, recent study suggested that the protective effects of hsp70 protein are due to b - cell activation and therefore the production of hsp70-specific igg1, instead of th1-mediated immune response producing ifn- . To date, researchers have only focused on cell - mediated immune responses to identify candidate vaccines . However, further studies are needed to understand protective mechanisms to map of host animals in greater detail, including humoral immune responses in the early stages of infection . Moreover, dna vaccines have advantages of storage and delivery because they are very stable . Several candidates were evaluated for their ability to induce protective immune responses; however, they were only evaluated in mouse models . Recently, combination of map - specific antigens and viral vectors was attempted to increase the ability of antigenic effects of dna vaccines . The advantage of viral vectored vaccines is to provide high delivery of antigens to antigen presenting cells, thereby increasing antigen specific cd4 + and cd8 + immune responses . The first map vaccine, which was developed in 1926 by vallee and rinjard, consisted of a live non - virulent map and oil based adjuvants . Since then, a number of whole - cell based vaccines, live attenuated vaccines and inactivated vaccines were developed to prevent bovine and ovine johne's disease . Currently, three commercial vaccines are all based on inactivated whole bacteria, mycopar, gudair, and silirum, of which only mycopar is approved for use in the united states . Mycopar is manufactured by boehringer ingelheim vetmedica inc . Using map strain 18 for use in cattle . Interestingly, strain 18 is not a map, although it is a member of the family of mycobacterium avium species . Gudair is manufactured by cz veterinaria in spain for use in sheep and goats using heat inactivated map f316 strain adjuvanted with mineral oil . An australian study revealed that vaccination could reduce the prevalence of map shedding with their longitudinal study . However, another cross - sectional study reported that shedding of map persisted in the majority of flocks, despite vaccination of lambs . An efficacy test with a randomized control of johne's disease in young farmed deer in new zealand revealed that vaccination of silirum reduced the prevalence of clinical disease . Meta - analysis of the efficacy of map vaccination, especially its production, epidemiological effects, and pathogenic effects, was conducted by bastida and juste in 2011 using previously published papers . From this meta - analysis, it was concluded that vaccination against map is a useful strategy for reducing contamination by this pathogen, production losses and pathologic effects . Despite the many advantages of vaccination, it has not been encouraged in cattle in most of countries because of several drawbacks mentioned in the introduction section . One major drawback of whole - cell based vaccination is interference with diagnostic tests currently used in bovine tuberculosis and paratuberculosis . These vaccines have the potential to produce false positive animals in serological tests for paratuberculosis such as elisa because the commercial elisa kit consisted of crude map antigens, which hinder differentiation of infected animals from vaccinated animals . The caudal fold skin test using m. bovis purified protein derivatives (ppd - b) is most widely used field screening tool for diagnosis of bovine tuberculosis . However, in the ifn- assay, stimulation with ppd - b produced robust responses similar to ppd - j (map purified protein derivatives) in map vaccinated animals . Because of this cross - reaction with other mycobacteria such as m. avium subspecies, comparative cervical test has been used as a complementary test to discriminate m. bovis infection from other mycobacterial infections by comparing the reactivity of each antigen using ppd - b and ppd - a (m. avium purified protein derivatives). However, this strategy may also cause problems with diagnostic sensitivity owing to the higher ppd - a reactivity because map vaccination can reduce the differences between ppd - b and ppd - a in m. bovis infected animals . Therefore, however, these problems can be overcome by development of new diagnostic methods or vaccines . Emerging serologic tests using m. bovis specific antigens such as esat-6, cfp-10, and mpb83 did not produce positive results in map vaccinated animals . Another drawback of whole cell based vaccines is the substantial tissue damage at the injection site and accidental self - inoculation, which may cause serious side - effects . However, there is a vaccine adjuvanted with highly refined mineral oils such as silirum to reduce the formation of granuloma at the site of injection . The most important factors to consider in vaccine studies are the mechanisms related to the host - pathogen interaction . Much more efforts are needed to understand exactly how bacteria can evade the host defense system, and these should focus on not only an adaptive immune system, but also innate immunity . Vaccines that can induce both immune responses may have improved protective effects . Despite some limitations, vaccines might still be an effective strategy to reduce or eradicate johne's disease in livestock industries. |
A 71-year old caucasian male with dilative cardiomiopathy and irrelevant family history was admitted to our hospital for the evaluation of a suspected liver disease . Laboratory findings revealed a slight anemia (hemoglobin level of 12,5 g / dl, hematocrit of 38%, red blood cells count of 3,9 mil / mm). Iu / l) and elevated gammagluta - myltranspeptidase (ggt=230 iu / l). Ultrasound showed multiple small hypo- and hyperechoic lesion foci, some cystic lesions with comet - tail echoes, the biggest cyst measured 8 mm in the vii segment (fig . Ct scan revealed multiple small cystic lesions; the largest hypodense nodule was in the vii hepatic segment with no peripheral or central enhancement (fig . Multiple small cystic lesions were detected with t1 hyposignal and t2 hypersignal, the largest being in segment vii (fig . Corroborating data from these imaging techniques with 6 month follow up, the final diagnosis was biliary hamartoma (complex von meyenburg). Biliary hamartoma is a benign congenital malformation of the biliary duct which was described for the first time in 1918 by von mayenburg, therefore it is also called von mayenburg complex (vmcs). Although jaundice and portal hypertension may arise as a result of mass effect, patients are usually asymptomatic . The biliary hamartomas may be single or multiple, with size ranging between 1 and 15 mm . Due to the small size of the lesions, histologically, it consists of disorganized and dilated bile ducts and ductules surrounded by fibrous stroma . The multiple comet - tail sign is thought to be the specific us finding of vmcs (6). It has been suggested that lesional echogenicity may depends on the number and size of the dilated bile ducts and on the degree of fibrosis . On contrast enhanced ct, biliary hamartomas are usualy of low attenuation and may have irregular margins . The majority of cases reported suggest that vmc does not show contrast enhancement . On mri, vmcs are described as hypointense on t1 and hyperintense on t2 in comparison with surrounding liver parenchyma . Although biliary hamartoma is a benign condition, there are some isolated reports of hepatic malignancies on a background of vmc, including hepatocellular carcinoma and cholangiocarcinoma . Biliary hamartomas usually presents as multiple small nodules and despite the fact that they are rare, they may be confused with liver metastatic disease, microabscesses, diffuse primary hepatocellular carcinoma, biliary cysts or caroli s disease . In conclusion, associating different imaging modalities with the follow - up are very useful in the diagnosis of biliary hamartoma . A correct diagnosis is established when typical imaging findings are present, otherwise histological confirmation might be needed. |
, individuals can live for 80100 years, much longer than in past generations . According to the who, the proportion of people over 60 years of age is increasing quickly and is expected to exceed 2 billion people worldwide by the year 2050 . Immune senescence comprises a set of changes occurring to the innate and adaptive immune responses that accompany human aging . Age - associated immune senescence is a catch - all phrase that has been used to describe a plethora of changes to the immune system over the lifespan . Immune aging is a complex process that comprises many reconstructions and regular changes rather than being a simple one - way reduction in all immune functions; thus, all parts of the immune system in immune senescence are not affected equally . For instance, it has been observed that natural immunologic structures that are common to all living things are less affected than are acquired immune system structures . Active participation of inflammation, which forms the most basic defense mechanism in the aging process, is also an indicator of this . The decline in immune function with age is unanimously recognized and supported by epidemiologic and clinical studies [46]. Many studies have demonstrated that immune functions and cells in the immune system are affected by aging . Some studies reported that differences in immune system due to aging vary between males and females . Sex - related differences in immune system susceptibility have also been observed in several mouse models and may be related to differences in the expression patterns of immune response genes . Understanding the basis of sex and age differences in immune response genes is important for developing new approaches to prevention, diagnosis, and treatment of diseases . Our aim in this study was to investigate how lymphocyte subgroups in peripheral blood are affected by aging among males and females . Study participants were 70 healthy individuals from 3 different age groups, observed from january 2010 to january 2012 . Participants were divided into 3 different groups according age: group 1 (n=20) was 2545 years old (10 males, 10 females), group 2 (n=25) was 4565 years old (12 males, 13 females), and group 3 (n=25) was older than 65 years old (13 males, 12 females). We determined the average levels of cd3 +, cd4 +, cd8 +, cd19 +, cd16+/cd56 +, cd3+/cd69 +, and cd19+/cd69 + by age group and sex . Individuals who were smokers or who had a chronic disease were excluded from the study . Collected data were statistically analyzed by kruskal - wallis - anova, with p<0.05 considered to be statistically significant . We found a significant reduction in the rate of cd3+t cells related with age, but no significant change in cd19 + b cell rates (p<0.005). Another noteworthy result was that the level of cd8+t cells was lower in males compared to females and varied by age group (p<0.005). Level of activated t and b cells did not differ by age group, but levels of activated b cells (cd19+/cd69 +) decreased with age in males (p<0.005) (figure 1). Projections indicate that by 2025 the world population over age 65 will be increasing 3.5 times as rapidly as the total population and the proportion of individuals age 60 years and older, which accounted for 10% of the world population in 2000, will increase to approximately 22% of the world population by 2050 . Aging is a highly complex and continuous process that affects almost all organ systems, causing molecular and physiological changes, both qualitatively and quantitatively . The aging of the immune system is a dynamic process that may at least partly reflect adaptation of the response to the evolving pathogen surroundings [16]. Aging is increasingly recognized as being associated with a pro - inflammatory state that plays an important role in the development of chronic diseases . Immune senescence comprises a set of changes occurring to the innate and adaptive immune responses that accompany human aging . These result in complex manifestations of still poorly defined deficiencies in the elderly population . In the evaluation of t and b cell activations, no change due to aging was observed in level of activated t cells . On the other hand, our results show that levels of activated t and b cells did not differ by age group . We found that that aging reduces activated b cell (cd19+/cd69 +) levels of males . Males have shorter life expectancy than females due to the effects of aging making them more sensitive . The immune system in males, we observed the lower cd8+t cell rates of males compared to those of females, especially when compared by age . Therefore, we especially wanted to observe the changes in peripheral blood lymphocytes of males and females who belong to different age groups . Recent studies have revealed that changes in the number of lymphocytes and a decrease in cell activation and proliferation appear with aging . However, the difference between males and females in immune senescence is still a hotly debated topic because many different factors may be involved . Differences between males and females in susceptibility to infection and differences in prevalence of autoimmune diseases by sex may help understand these differences in aging and health [25,12]. In general, it has been demonstrated in human and mouse studies that females produce stronger humoral and cellular immune responses against varied antigens than males do . This difference also plays a role in female allograph rejection, which has been demonstrated in mouse studies . For instance, it is reported that female estrogen stimulation, which leads telomerase induction by c - myc, has an anti - aging effect . Another theory that has been put forward about this topic in recent years suggests that depending on the development needs mitochondria in female cells have a better adaptation than male cells have [1113]. The immune response to infections, immunizations, and tumors in the elderly is quite different from that in young people . Our study shows that there may be differences between males and females in terms of immune senescence. |
The work of korean medical radiological technologists is divided into three areas: diagnosis, treatment, and nuclear medicine1 . The department of diagnostic radiology (department of radiology) is in charge of general x - ray examinations, magnetic resonance imaging, ultrasonography, and computerized tomography scans for conducting precise examinations of the inside of the body . The department of radiation oncology deals with cancer treatment, using high energy radiation to kill cancer cells; the department of nuclear medicine uses radioactive isotopes with cutting - edge technologies for diagnosis and treatment of certain cancers2 . To perform these responsibilities, radiological technologists are constantly required to perform physical work, such as lifting adult patients who cannot move adequately by themselves, pushing or pulling to move heavy equipment, and continuous work with a computer keyboard or mouse3, 4 . During these activities, radiological technologists are sometimes at risk for musculoskeletal disorders5 . The acts of moving patients who cannot move well by themselves and pushing and pulling heavy equipment, are known to be major causes of lower back pain, while the repetitive movements performed when utilizing computers for functions, such as use of the picture archiving communication system (pacs) and the order communication system (ocs), are causes of upper extremity musculoskeletal disorders6 . In these ways, the exposure of radiological technologists to the risks of work - related musculoskeletal disorders can be said to be increasing . However, because awareness of occupational safety for radiological technologists has been concentrated on exposure to radiation and on the necessary defense against radiation exposure, the issue of safety in relation to work - related musculoskeletal disorders has tended to be neglected . Because the significance of work - related musculoskeletal disorders has generally come to be recognized, a law was established in korea in 2005 that aims to prevention and control work - related musculoskeletal disorders . Based on this legislation, physical therapists have worked in different industrial fields to analyze work movements and organize educational programs to prevent work - related musculoskeletal disorders . Thus, the working area of physical therapists has been expanded to include this area7 . However, data that can be utilized by physical therapists in analyzing work - related musculoskeletal disorders is rarely reported, because ergonomic assessment is conducted only in certain types of jobs where there is high labor intensity . In general, hospitals are special workplaces in which the concept of medical personnel is stronger than the concept of workers, and the concept of medical practice is stronger than the concept of labor or work . However, since hospital workers are also workers who conduct physical activities using their bodies, they are also exposed to the risk of work - related musculoskeletal disorders . In particular, radiological technologists are exposed to higher levels of the risks relating to musculoskeletal disorders because they are forced to use inconvenient working postures due to the nature of their work, such as manually handling adult patients, frequently exceeding 60 kg in weight, without any generalized mechanical assistance . In these situations, they are required to adjust their own postures to accommodate the positions and weights of their patients8 . Hospital workers are repeatedly exposed to the risk of work - related musculoskeletal disorders, and frequently exacerbate the problem because they do not recognize, or are indifferent to the problem . To prevent and effectively control musculoskeletal disorders, the potential disorders should first be accurately diagnosed and classified, and then their scales should be evaluated6 . The aim of this study was to analyze, through ergonomic analyses, those motions most used by radiological technologists that can cause musculoskeletal disorders so that the results can be utilized as the basis for diagnosis, classification and prevention of occupational musculoskeletal disorders in radiological technologists . In this study, designed to assess the ergonomic risks of radiological technologists, a field survey was conducted on august 1 and august 2, 2013, at a hospital located in gangwon - do, republic of korea . This was a university hospital in which all three areas of radiological technologists work were performed . The purpose, method, and research process of the study were explained to the general manager of the department of radiology, and the field survey was conducted after getting his consent . The study s objectives and procedure were explained to the study subjects, and their consent was obtained . The study was approved by the ethics committee of the kangwon national university hospital institutional review board . The work processes performed by the radiological technologists were then videotaped from the left side, right side, and front so that the movements of their joints were clearly visible . Based on this data, the parts of the videotapes judged to demonstrate working postures that would impose the heaviest burdens on the technologists bodies were each captured and analyzed three times . The captured working postures were assessed and analyzed using the following ergonomic assessment methods: the rapid entire body assessment (reba), the rapid upper limb assessment (rula), the national institute for occupational safety and health lifting equation (nle), and the strain index (si). Three professors of industrial safety conducted the analysis to preserve the objectivity of the study . The professors assessed the scores through discussion and analyzed the different categories of working posture . Reba was developed for the purpose of analyzing the degree of exposure of the body to physical burden and the risk factors in the service industries, including nursing, cleaning, and other jobs with dynamic and unpredictable work postures . Different factors, including repetition, static work, working postures, and duration of working hours, among others, are evaluated in relation to two groups, group a (trunk, neck, leg) and group b (humerus, shoulder, forearm, wrist), using recorded video and direct observation . Reba categorizes the danger levels into 5 stages using a grading system with a 15-point scale and suggests appropriate safety measures9 . Rula enables convenient and swift assessment of the workload imposed by working postures by focusing on an upper limb analysis, whether in assembly work, service work, meat processing, dental clinic work, or video display terminal tasks, especially those involving the shoulders, wrists, neck, and other upper body parts . It divides the body parts into group a (upper arm, lower arm, wrist) and group b (neck, trunk, legs) and assesses them in terms of the number of movements, the static muscle work, force, and working postures as the workload parameters . Rula categorizes the danger levels into 4 stages using a grading system with a 7-point scale and suggests appropriate safety measures10 . The ovako working posture analysing system (owas) is an assessment technique developed by the ovako steel company to define and assess workers working postures in relation to their suitability for manual handling of heavy objects in the course of their work . Working postures are considered in relation to four items: the waist, the upper extremities, the lower extremities, and the weight of the object handled . The effects of these factors on the musculoskeletal system are divided into four levels, and the results are recorded11 . The si is a method for evaluating jobs to determine whether they expose workers to increased risk of developing musculoskeletal disorders of the distal upper extremity (due)12 . The due is defined as the elbow, forearm, wrist, and hand . Musculoskeletal disorders of the due include specific diagnoses (e.g., epicondylitis, peritendinitis, tendon entrapment at the wrist or finger, and carpal tunnel syndrome) and less specific symptomatic conditions related to the muscle - tendon units of the due . The si uses six task variables to describe hand exertions: intensity of exertion, duration of exertion, exertions per minute, hand / wrist posture, speed of work (how fast), and duration per day . Among these factors an si higher than 5 indicates the occurrence of potential danger to the upper extremity . An si below 3 indicates safety, while an si above 7 is considered very dangerous . This study was conducted to analyze the working postures of radiological technologists and to utilize the results for the prevention and treatment of their musculoskeletal disorders . Accordingly, their postures when moving patients, when pushing or pulling an apparatus, when conducting ultrasonography, and when handling a mouse for mri were analyzed . Individual postures were assessed and scored according to the waist, neck, leg, shoulder, elbow, wrist, wrist twisting, load, handling, and activity, and the assessment ratings were analyzed . Moving a patient was divided into a starting point and an ending point, and the postures at each point were assessed . At the starting point, in both the case when the radiological technologist was positioned on the right side of the patient and the case when the radiological technologist was positioned on the left side of the patient, the assessment rating was shown to be improve immediately therefore, the work of moving patients was shown to impose great burdens on the musculoskeletal system . Burdens on the waist and shoulder were shown to be high, and of all the assessments, the burden on the waist was shown to be the highest (table 1table 1.working postures for patient liftingworking posturerisk factorrebaowasrula(rt)rebaowasrula(lt)patient lifting starting pointwaist546546neck233233leg252141shoulder (upper arm)414414elbow (forearm)2323wrist2222wrist twisting1201load / force233233handle33activity2121as13481248ariiiiiipatient lifting ending pointwaist546445neck233233leg252252shoulder (upper arm)414414elbow (forearm)2323wrist2223wrist twisting1212load / force223233handle33activity2121as13481248ariiiiiireva, rapid entire body assessment; owas, ovako working posture analysing system; rula, rapid upper limb assessment; as, assessment score; ar, assessment rating; i, improve immediately). Reva, rapid entire body assessment; owas, ovako working posture analysing system; rula, rapid upper limb assessment; as, assessment score; ar, assessment rating; i, improve immediately in assessing the posture during mouse handling for mri, the right hand and left hand were assessed separately . The assessment ratings for both the left and right hands were commonly shown to be improve soon (reba) or improve immediately (rula). The mouse work required for mri was shown to impose large burdens on the neck, the shoulder, and the wrist (table 2table 2.mouse handling work postureworking posturesrisk factorright handleft handrebarularebarulamouse handlingwaist3434neck3535leg1111shoulder (upper arm)4444elbow (forearm)2323wrist2334wrist twisting1212load / force0000handle11activity2121as108108arsisireva, rapid entire body assessment; owas, ovako working posture analysing system; rula, rapid upper limb assessment; as, assessment score; ar, assessment rating; i, improve immediately; s, improve soon . ). The sis indicated that continuously handling a mouse with the right hand placed the hand in a little in danger and that the level of risk for the left hand was uncertain . In the case of the left hand, work done with severe flexion of the wrist and without any support was shown to be particularly problematic (table 3table 3.mouse handling work posture strain indexworking posturehand sideintensity ofexertionduration ofexertion (% of cycle)effortsper minutehand / wristposturespeed of workduration of taskper day (hours)si scoremouse handlingright3.00.51.51.51.51.05.06 a little dangerousleft3.00.51.02.01.01.03.00 uncertain). Ultrasonography work postures were assessed after dividing them into three levels, from cases in which the distance between the radiology technologist and patient was the shortest to cases in which the distance was the longest . The assessment ratings for reba were shown to be should be improved and improve soon and that for rula was shown to be improve immediately . The results showed that when the distance between the radiology technologist and the patient was longer, the burden on the neck and shoulder was greater (table 4table 4.ultrasonography work postureworking posturesrisk factorposture 1posture 2posture 3rebarularebarularebarulaposture 1 (close to the patient)waist212133neck242436leg313531shoulder (upper arm)333133posture 2 (middle)elbow (forearm)121223wrist122223wrist twisting121212load / force000000posture 3 (patients with distant)handle1 - 1 - 1-activity111111as6898108arshould be improved4 . Ireva, rapid entire body assessment; owas, ovako working posture analysing system; rula, rapid upper limb assessment; as, assessment score; ar, assessment rating; i, improve immediately; s, improve soon . ). The apparatus pushing work posture assessed was the radiological technologist s posture when pushing a heavy portable radiation apparatus to move it . The reba showed an assessment rating of should be improved and the rula showed an assessment rating of improve immediately . The load / force burdens were shown to be high (table 5table 5.apparatus pushing working postureworking posturerisk factorrebarulapushing apparatuswaist22neck11leg22shoulder (upper arm)22elbow (forearm)22wrist11wrist twisting01load / force23handle0-activity11assessment score78assessment ratingshould be improvedimprove immediately). Reva, rapid entire body assessment; owas, ovako working posture analysing system; rula, rapid upper limb assessment; as, assessment score; ar, assessment rating; i, improve immediately; s, improve soon . Reva, rapid entire body assessment; owas, ovako working posture analysing system; rula, rapid upper limb assessment; as, assessment score; ar, assessment rating; i, improve immediately; s, improve soon . This study was conducted to analyze the working postures of radiological technologists so that the results can be utilized for the prevention and treatment of musculoskeletal disorders . In this study, burdens on radiological technologists waists were shown to be high when they were moving patients for a ct scan . This result is supported by studies indicating that the lower back pain of radiological technologists is closely related to the frequency with which they assist in moving patients13 . The table for a ct scanner is just wide enough for a patient to lie on and is positioned at a height that is close to the hip joints of the radiological technologists . Therefore, when moving patients, they use force after bending substantially at their waists and stretching their arms out far . As the trunk is bent forward, the load on the lumbar region increases markedly14 . In addition, since the movements are made in the limited space of the ct scan room and the height of the table is fixed, the radiological technologist cannot take up a position that would distribute his or her weight to the lower extremities . Therefore, these movements can be understood to impose large burdens on the waist . As a measure to prevent the musculoskeletal disorders that can occur when moving patients, making the height of the table that the patient lies on adjustable so that the radiological technologists can also use their lower extremities when moving heavy patients and thereby distribute the force to their lower extremities although there are diverse causes of lower back pain, manual transporting work, such as pushing, pulling, transporting, loading, and unloading, is an important cause15 . Workers who are to engage in handling heavy objects should be adequately educated and trained in correct methods for lifting heavy objects, methods for lowering, methods for moving, methods for loading, working postures, exercises to prevent lower back pain, and other working methods before they are assigned to work in order to prevent lower back pain16 . This education and training should also be provided to radiological technologists to prevent lower back pain in them . In addition, habituation to the use of movement assistance systems, such as the easy - trans used when moving from sitting postures on a wheelchair or chair to a bed or when moving from a bed to a wheelchair, can also be a good way to reduce the burden on the waist and lower back . The assessment of postures during mouse handling for an mri scan showed that large burdens were imposed on the neck, shoulder, and wrist . Repetitive keyboard entries, continuous movements in fixed postures (static posture), inappropriate working postures, and prolonged periods of work cause pain in the neck, shoulder, elbow, wrist, and fingers, together with health hazards, such as numbness and tingling . Among hospital workers, radiological technologists show a high incidence of vdt syndrome, thereby supporting this study result . Therefore, to prevent not only vdt syndrome2 but also musculoskeletal disorders, a mouse pad with a wrist rest should be used for the right hand, and a support should be prepared for the left arm . In the case of ultrasonography working postures, larger burdens on the leg and neck were found when the patient s examination sites were located further away and the radiological technologist s upper extremities and arms were stretched further out . While maintaining a constant pressure, the radiological technologist is required to stretch his upper extremities out far while watching the computer monitor of the ultrasonography equipment . Due to this position, when the patient s examination sites are located further away, the neck and trunk must be twisted further, thereby increasing the burden on the neck . Therefore, the location of both the ultrasonography equipment and the patient should be arranged appropriately, and the computer monitor for the ultrasonography equipment should be situated at an appropriate level . The assessment of working postures when pushing a portable radiation apparatus showed that burdens on the musculoskeletal system increased as the weight of the apparatus being pushed by the radiological technologist increased . Therefore, measures to reduce the weight of portable radiation apparatuses should be sought . Among the radiological technologists in the department of diagnostic radiology the largest number of them reported pain in the lower extremity, followed by pain in the shoulder, hand, wrist, waist, neck, and elbow in order of precedence, and a higher ratio of females reported symptoms compared with males17 . In a study conducted by lee jin et al ., symptoms appeared most frequently in the shoulder, followed by the waist, neck, and leg / foot in order of precedence, and a slightly higher degree of fatigue was shown . The present study also showed that risks to the shoulder and waist were high, while the risks to the wrist and leg appeared to be highest, as was shown in the study of lee13 . Although some differences were shown between the present study and a study conducted by kim, the differences are considered attributable to the fact that the study conducted by kim was limited to radiological technologists . Radiological technologists are stressed due to the high tension of their work, and the muscles, blood vessels, and nerve tissues in their necks, shoulders, arms, hands, waists, legs, and knees are damaged or affected by their hard physical work, such as standing for most of their working hours, repetitive movements including waist flexion, and helping patients to move, together with static motions4 . Although the musculoskeletal disorders of radiological technologists occur in various regions of their bodies, they occur most frequently in the shoulder and the lumbar region . However, as the issue of occupational safety of radiological technologists has been focused on possible exposure to radiation and defense against radiation exposure, the issue of safety in relation to work - related musculoskeletal disorders has been neglected, and education and interest regarding the prevention of musculoskeletal disorders has been insufficient . Therefore, hospitals need to be educated regarding the concept of musculoskeletal disorders, and this needs to followed by education regarding prevention through use of correct working postures, exercise methods for radiological technologists. |
Work - related musculoskeletal disorders are the largest category of occupational diseases (1). These disorders have a high prevalence in countries around the world, and cause high costs and reduced quality of life in workers (2). Musculoskeletal disorders are identified by pain, discomfort, and inability of the joints, tendons and muscles, or tissues (3). These disorders often occur in the hands, elbows, wrists, neck, and shoulders (4). On the other hand, the wrist, hand, and arm are at a higher risk due to repetitive movements with awkward postures (3). Musculoskeletal disorders are the most common occupational injury in dentists (5). In dentistry, ergonomic risk factors include awkward posture in a static position for a long time (6 - 8). On the other hand, studies have shown that prolonged awkward postures increase the risk of musculoskeletal disorders of the neck, shoulders, and waist in dentists (9,10). Working habits such as bending of the neck, trunk rotation during operation, and static posture are known as the most important risk factors for musculoskeletal disorders in dentists (11,12). Considering the high prevalence of musculoskeletal disorders in the dentists, applying ergonomic interventions to improve the working conditions of the dentists seems to be highly important . Ergonomic intervention programs in dental occupation have focused on the design of dental equipment and tools . However, not enough attention has been paid to utilizing strategies to prevent and reduce musculoskeletal disorders (13,14). On the other hand, many participatory ergonomic intervention programs have been done in different industries to reduce and prevent musculoskeletal disorders (15,16). The multifaceted intervention program was developed for nurses, and the results demonstrated a significant reduction in the musculoskeletal complaints in nurses (17). On the other hand, previous studies revealed that the ergonomic intervention programs could reduce musculoskeletal disorders in the workplace (17). Therefore, the present study aimed at evaluating the multifaceted ergonomic intervention program, which included improved working conditions, identifying ergonomic risk factors, regular exercise, and discussion group meetings, to reduce musculoskeletal disorders in dentists . This interventional study was conducted on all dentists employed in dental clinic of milad hospital in tehran based census method . First, the purpose of the study was explained to the participants by the executive team . Inclusion criteria were as follow: lack of pregnancy in female dentists, lack of spine surgery, avoiding the use of pain relievers during the study, residing in tehran and full participation in the study . Dentists of the intervention group (n=50) underwent a multifaceted ergonomic intervention program for 8 weeks, and dentists of the control group (n=50) only received the measurements . The general nordic questionnaire of musculoskeletal symptoms was used to examine the reported cases of msds among the study population . Reported msd symptoms were limited to 12 months prior to the study (18). An 8-week ergonomic intervention program was designed to reduce the musculoskeletal disorders among the dentists . These multifaceted interventions were in 4 sections as follow: knowledge and training about ergonomics: training sessions were held for the participating dentists at the start of the multifaceted ergonomic program, which covered the basic ergonomic principles, ergonomic risk factors in dental occupation, and intervention components of the ergonomic program . Workstation modification: at this stage, according to the ergonomic risk factors in the dental occupation, participants were instructed on how to modify their working postures in different situations at the workplace . For example, the correct working posture and correct alignment of the equipment was explained to the dentists . Training and surveying ergonomics at the workstation: at this stage, working conditions were evaluated during the working shift for each dentist . In this evaluation, active discussion was used in this section . Ergonomic evaluation of workstation and its modification were performed for each dentist . A regular exercise program: at this stage, a physiotherapist introduced several stretches to the dentists . The nordic musculoskeletal questionnaire (nmq) was used to evaluate the effectiveness of the ergonomic interventions in the 2 groups after 3 and 6 months . At the end of this stage, the evaluation results were compared before and after the ergonomic intervention, and the effectiveness of the intervention program was determined . Approval was obtained from the research ethics committee of iran university of medical sciences at each participating site . Paired t - test was used to compare the prevalence of musculoskeletal disorders before and after the ergonomic intervention program at the end of the 3 and 6 months . Demographic data revealed that the meansd age of the dentists was 39.82 4.61 years in the intervention group, and it was 40.01 4.12 years in the control group . Table 2 demonstrates the results of the prevalence of musculoskeletal disorders in different parts of the body, before, and after the ergonomic intervention program in the 3 and 6 months follow - up . These results revealed that the ergonomic intervention program had a positive effect on reducing musculoskeletal disorders (p<0.05). The result of judgment about the usefulness of the multifaceted ergonomic intervention program showed that 98% of the dentists agreed with this multifaceted ergonomic intervention program . * repeated measure anova considering the mean age and work experience, the participants were relatively young and experienced . Therefore, their opinions about this multifaceted ergonomic intervention program are reliable . Average working hours per day was over 7.5, and this could increase the exposure to risk factors for musculoskeletal disorders . The present study showed positive results for the multifaceted ergonomic intervention program in reducing the prevalence of musculoskeletal disorders in dentists . The prevalence of musculoskeletal disorders in the intervention group at 3 and 6 months after the program reduced the musculoskeletal disorders in the neck, shoulder, arm, wrist, back, thigh, knees, and feet . On the other hand, the prevalence of musculoskeletal disorders in the control group increased in the neck, shoulder, arm, wrist, thigh, and knee . No significant difference was obtained between the prevalence of musculoskeletal disorders in the back and feet after 6 months in the control group, and this may be due to chronic low back pain in dentists . Study (19) in which a multifaceted ergonomic intervention program was conducted to resolve ergonomic risk factors . Moreover, their program focused on the opinions of dentists to reduce ergonomic risk factors . Used an intervention program (based on teaching the principles of ergonomics) to improve working conditions and reduce musculoskeletal disorders in nurses (20,21). In the present study, we designed an exercise program intervention including stretching exercise for dentists in the intervention group . Previous studies have shown that exercise and stretching could decrease the prevalence of low back pain and musculoskeletal disorders in nurses (22,23). Thus, exercise might be effective in reducing low back pain and musculoskeletal disorders in dentists as well . An interesting finding of this study was the interaction of time and group on each other, and their effect on the prevalence of musculoskeletal disorders in different parts of the body . This effect was more obvious when the interactive effect of time, the prevalence of musculoskeletal disorders and the multifaceted ergonomic intervention program were assessed . However, in the present study, only the interactive effect of time and prevalence of musculoskeletal disorders were assessed in the control group . Therefore, multifaceted ergonomic intervention program can effectively reduce the prevalence of musculoskeletal disorders in dentists . The results of the present study revealed that the multifaceted ergonomic intervention program could be used to solve the ergonomic problem in dentists by reducing the prevalence of musculoskeletal disorders and improving workplace ergonomics through identifying ergonomic risk factors, offering regular exercise, and conducting discussion group meetings . Iran university of medical sciences financially supported the present study, which was a part of a doctoral thesis research (number: 94 - 01 - 127 - 25814). This article was extracted from the thesis written by naser dehghan phd student at occupational medicine research center and by dr. |
Total knee replacement (tkr) is one of the most common orthopedic surgeries performed in the usa.1 most commonly, tkrs are performed as a result of the pain and decreased quality of life associated with osteoarthritis.2 as the us population ages and becomes more obese,3 it is expected that osteoarthritis rates, hence tkr rates, will continue to rise . Tkrs have increased from 31.2 per 100,000 person - years in 19711975 to 220.9 in 20052008.4 the demand for primary tkr is projected to grow by sixfold to 3.48 million in 2030.5 the high and rising incidence and prevalence of the tkr procedure in the usa indicates a large societal burden, especially for the medicare program, since it has been estimated that 75% of all tkr cases in the usa are performed on medicare beneficiaries.6 knee replacements represented the most rapidly increasing hospital inpatient costs for all payers from 2002 to 2004, with a mean cost of us$13,200 per admission and an aggregate cost of us$6.3 billion during 2004.7 while improvement of functioning is a goal of tkr,2 quadriceps muscle atrophy / weakness (maw) is a common problem for tkr patients.813 maw among these patients is typically the result of either muscle atrophy or the failure of voluntary muscle activation due to neurological impairment,8,9,11,13 and it has been shown to be associated with poorer functioning up to 2 years after the tkr.14 previous studies have indicated that maw exists among some tkr patients even before the tkr surgery8,9 and that patients are likely to have profound quadriceps maw from 1 month8 to 12 months10 after the tkr procedure . However, as far as we are aware, no previous research has attempted to quantify the differences in health care resource use, costs, or other medical outcomes between tkr patients with and without maw . The retrospective, naturalistic study described here was designed to begin to quantify the burden of maw among tkr patients . To this end, the main study objective was to examine differences of direct health care related costs and utilization in tkr patients between those with and without a diagnosis of maw . The timing of the first maw diagnosis recorded before or after the tkr surgery was also explored to assess its association with patient demographic, clinical, and economic characteristics . This study utilized data between january 1, 2005 through september 30, 2010 from the thomson reuters marketscan commercial claims and encounters (hereafter referred to as commercial) database and the medicare supplemental insurance (medicare) database . The databases include eligibility records and administrative claims from 33 million enrollees, 3 million of which are medicare eligible, covered by approximately 100 self - insured payers . The databases contain information on enrollment status, health plan type, and demographic characteristics such as age, sex, and region of residence . Information captured on pharmacy claims includes national drug code, dispense date, quantity, days supplied, and plan- and patient - paid amounts . On the medical service claims, details of health service encounters such as date and place of service, provider type, plan- and patient - paid amounts, and international classification of diseases, 9th revision, clinical modification (icd-9-cm) these administrative claims databases are fully compliant with the health insurance portability and accountability act of 1996 privacy requirements and can be used to track health care utilization and costs longitudinally using encrypted identifiers . To be included in the study, a patient was required to have an inpatient stay with an associated procedure code of tkr (icd-9-cm procedure code of 81.54 or current procedural terminology code 27447) between january 1, 2006 and september 30, 2009 . Patients who received a prior procedure of tkr during the period from 365 through 7 days prior to the index date were excluded . Patients were also required to have continuous insurance coverage from the 12 months before the index date (the pre - index period) through the 12 months after the discharge date recorded on the index hospital stay (the post - index period). Individuals in the commercial database were required to be 5064 years old at the index date, while those in the medicare database were required to be at least 65 years old as of the index date . Patients in the commercial and medicare databases were analyzed separately, and each of these two populations was further subdivided into three distinct cohorts: those with no diagnosis of maw (no maw; icd-9-cm 335.1x, 335.21, 359.xx, 728.2x, or 728.87) over the pre- and post - index periods, those diagnosed with maw before tkr (pre - maw), and those diagnosed with maw during or after tkr (post - maw). The following study variables were examined: patient characteristics: age, sex, region of residence, type of insurance coverage, and comorbid osteoarthritis, rheumatoid arthritis, and osteoporosis overall burden of chronic disease, as assessed by the charlson comorbidity index (cci), which measures 23 different categories of comorbidities with a score that is used to predict health care costs15,16 outcomes of interest related to the index hospitalization: length and cost of inpatient stay and discharge status (ie, discharge to a skilled nursing facility [snf], home, inpatient rehabilitation facility, short - term hospital, other facility, and other alive status) health care resource use assessments: hospitalizations, physician office visits, outpatient hospital visits, emergency room (er) visits, and the use of an snf, inpatient rehabilitation facility, home health care, physical therapy, or occupational therapy . Costs were calculated as total direct medical costs as well as inpatient, outpatient, and pharmacy costs . All costs were adjusted to 2011 us dollars using the medical care component of the consumer price index (cpi).17 descriptive analyses of the study variables were performed between the no maw (as reference), pre - maw, and post - maw cohorts . Chi - square statistics were used to test differences for categorical variables (eg, sex, region of residence, health plan type, comorbidities, discharge status of index stay, and proportion with resource use). Student s t - test was utilized for between - group age differences, while nonparametric wilcoxon rank - sum tests were utilized for cci, length of index hospital stay, and pre - index and postindex health care resource utilization, and health care costs . Specific resource utilization variables assessed included total days in hospital, number of physician office visits, outpatient hospital visits, and er visits . Controlling for age, sex, region of residence, health plan type, comorbid osteoarthritis, rheumatoid arthritis, osteoporosis, cci, pre - period resource use (any hospitalization, er, or outpatient hospital visit), and discharge status from the index hospitalization, multivariate generalized linear regression models with log - link and gamma distribution were applied to assess the association between maw and health care costs . The adjusted difference in health care costs for pre - maw and post - maw cohorts when compared with the no maw cohort were estimated by calculating the expected mean change of health care costs as of a change in the maw cohort variables while keeping all the other covariates constant.18 two - part models were estimated to generate the adjusted differences in health care costs associated with maw19 when at least 10% of the patients had zero costs . The probability of utilizing the service of interest was first estimated; in the second part, costs among those who utilized the service were estimated . The estimated costs were calculated as the predicted probability from the logistic regression (generated from the first part) multiplied by the expected cost conditional on having positive costs (from the second part). The adjusted difference in health care costs of pre- and post - maw cohorts compared with the no maw cohort was calculated as the mean difference among all individuals when their cohort variable was alternatively coded as 0 and 1 . A 95% confidence interval (ci) was estimated using the 2.5 and 97.5 percentiles of the 1,000 estimated adjusted difference estimates by bootstrapping the two - part model with 1,000 iterations.20 the difference was considered significant when the 95% ci did not include zero . Logistic regressions were employed to examine the impact of maw on the probability of having an all - cause or replacement - related rehospitalization in the post - index period . The explanatory variables included maw cohorts, age, sex, region of residence, health plan type, cci, comorbid osteoarthritis, rheumatoid arthritis, osteoporosis, discharge status from the index hospitalization, and pre - index any hospitalization, er, or outpatient hospital visit . All analyses were performed using sas (v 9.1; sas institute inc, cary, nc, usa) and p - values <0.05 were considered, a priori, statistically significant . This study included 53,696 patients aged 5064 years in the commercial population and 46,058 patients aged 65 or older in the medicare population (table 1). In the commercial population, the prevalence of maw prior to the tkr (pre - maw) was 0.9% and during or after the tkr (post - maw) was 4.6% . Maw was found to be present in approximately the same proportion in the medicare population, with 1.1% of individuals in the pre - maw and 4.2% in the post - maw cohorts . The mean age was approximately 58 years for the commercial population and 75 years for the medicare population . The majority of the patients in the commercial population lived in the south region, and were members of a preferred provider organization health plan . In contrast, the majority of the medicare population lived in the midwest region and belonged to a comprehensive health plan . Prevalence of osteoarthritis was high, with over 95% of the study population affected, and this is likely to be the main reason for tkr . The average length of stay of the index hospitalization ranged from 3.5 to 4.0 days across cohorts . However, total costs associated with the index hospitalization were higher for the commercial population than for the medicare population (~us$28,000 vs ~us$20,000). A higher proportion of patients from the commercial population was discharged to home than from the medicare population (~80% vs ~65%). Post - maw cohorts were significantly older, had a higher cci score, and were more likely to have comorbid osteoarthritis; they also had higher index hospitalization costs and a longer index hospital stay than the no maw cohort . The pre- and post - maw cohorts in the commercial population were more likely to be female and to have comorbid osteoporosis, and a higher cci score . Table 2 summarizes the health care utilization during the pre- and post - index periods . For both insurance populations (commercial and medicare), patients in the pre- or post - maw cohorts in general had significantly higher health care utilization, including more visits to the physician office and er and a significantly greater likelihood of an outpatient hospital or an er visit in both the pre- and post - index periods than the no maw cohort . The post - maw cohort also had a higher rate of hospitalization in both the pre- and post - index periods, while a higher rate of hospitalization was only observed in the pre - index period for the pre - maw cohort when compared with the no maw cohort . In addition, relative to the no maw cohort, the pre- and post - maw cohorts were more likely to have used an snf or to have received an occupational therapy in the post - period . The unadjusted health care costs in the pre- and postindex periods for each cohort are summarized in table 3 . In both the commercial and medicare populations, the pre - and post - maw cohorts had higher costs than the no maw cohort, except for the post - maw cohort in the commercial population . Nearly half of the costs resulted from outpatient services . In the post - index period, both the pre- and post - maw patients had significantly higher total health care costs than the no maw patients (commercial, us$26,965 pre - maw and us$27,521 post - maw vs us$19,814 no maw; medicare, us$24,081 pre - maw and us$27,663 post - maw vs us$16,539 no maw; all p <0.05). Total costs increased from the pre- to the post - index period the most for the post - maw cohort, followed by the no maw cohort but remained similar for the pre - maw cohort . The impact of maw on direct health care costs, controlling for cross - cohort differences, is presented in figure 1 . Among the commercial patients, those in the pre- and post - maw cohorts had significantly higher adjusted total costs than the no maw cohort (cost difference, us$2,737 pre - maw and us$6,640 post - maw; both p <0.05). Similarly, the medicare patients in the pre - maw and post - maw cohorts had significantly higher total adjusted costs than the no maw cohort (us$4,201 pre - maw and us$9,404 post - maw; both p <0.05). Outpatient costs appeared to be the largest contributor of cost differences in the medicare pre - maw, post - maw, and commercial pre - maw cohorts, while the commercial post - maw cohort had inpatient costs as the major contributor . Post - maw was associated with a significantly higher likelihood of being rehospitalized during the post - index period (table 4). Specifically, compared with the no maw patients, the post - maw patients had a 44% higher likelihood of being rehospitalized for any cause (or = 1.44; 95% ci: 1.321.57) and a 110% higher likelihood of a replacement - related rehospitalization (or = 2.10; 95% ci: 1.702.60) among the commercial population . Similarly, medicare patients in the post - maw cohort were found to be 1.79 times more likely to be rehospitalized for any cause (or = 1.79; 95% ci: 1.621.97) and 2.06 times more likely to have a replacement - related rehospitalization (or = 2.06; 95% ci: 1.432.97) compared with those in the no maw cohort . Patients in the pre - maw cohort were associated with a higher risk of replacement - related rehospitalization (or = 1.74, 95% ci: 1.052.90) in the commercial population when compared with those in the no maw cohort . Other factors associated with a significantly higher likelihood of rehospitalization for any cause included a higher cci score, a diagnosis of rheumatoid arthritis, a discharge to an snf, or a hospitalization or er visit during the pre - index period . The rate of tkr in the usa is projected to increase as the population ages and becomes more obese.5 the introduction of newer technologies that improve implant longevity in younger and more active patients has allowed the use of tkr in this younger and more active population . It has been estimated that the demand for primary tkr among patients less than 65 years old will exceed 50% by 2016.21 with the increasing burden of tkr on both commercial health plans as well as the medicare program due to an aging population, it is thus important to understand the resource utilization and costs associated with the procedure, and to identify the high - cost patients . To the best of our knowledge, this study is the first to compare the health care resource use, costs, and risk of rehospitalization among tkr patients with and without maw and our results have confirmed our hypothesis that maw is associated with more health care resource utilization and costs in patients receiving tkr . Similar to findings from previous publications on tkr, tkr was found to be more commonly performed in females,22,23 over 94% of the patients had osteoarthritis,23 and close to a quarter of patients had hospitalizations after the tkr.24 the average length of stay for tkr was shorter in this study (~3.5 days) than that reported in previous studies (4.9 and 4.3 days).22,23 the shorter hospital stay is not surprising, as post - surgery care has been shifted to rehabilitation over time.24 total costs associated with tkr hospitalization have been reported between us$9,989 and us$10,067,23 lower than the costs estimated in this study (commercial, us$28,268; medicare, us$20,445). The costs in the bastis et al study were adjusted to 2005 us dollars, while costs were adjusted to 2011 us dollars in this study . Medical cost inflation may at least partially account for the differences.17 additionally, the bastis et al study examined costs from a health care provider perspective rather than the payer perspective as shown in the current study . As far as we are aware, this study is the first to have investigated the burden associated with maw among patients undergoing tkr . Patients with maw had higher health care utilization and costs than those without maw . While early research on maw among tkr patients is limited, the findings of higher costs and health care resource use from the present analysis support a small observational study indicating pre - maw to be a predictor of poorer post - surgical functioning (greater likelihood of requiring a handrail to negotiate stairs) 2 years after the tkr.14 it should be noted, however, that this earlier study focused only on tkr patients with end - stage knee osteoarthritis, while the present study includes tkr patients with pre - index period, less severe osteoarthritis and musculoskeletal conditions other than osteoarthritis (eg, osteoporosis and rheumatoid arthritis). By documenting the impact of maw on health care costs and utilization associated with tkr, the present research provides relevant and important information to health care providers, payers, and tkr patients when evaluating and preparing for the surgery . The findings from this study demonstrate that the presence of maw is a key cost driver in this population undergoing tkr . In addition to being costly before tkr, pre - maw patients remained costly after their surgery . This finding is consistent with previous research reporting that pre - existing maw is likely to persist and, indeed, to worsen after tkr.10,12 patients developing maw during or after tkr had the greatest increase in health care costs, followed by patients with no maw, over the 12 months post - surgery . This result is in agreement with previous clinical research showing that the average tkr patient is likely to experience an approximately 60% reduction in quadriceps strength after surgery;8,9,13 such a profound decrease in strength would logically increase a patient s use of medical resources, which, in turn, would lead to higher direct costs . In contrast, the total costs remained unchanged from the 12-month pre - index period to the post - index period for patients in the pre - maw cohort . Further studies may need to examine why the costs changed differently for different types of tkr patients after the surgery, and whether there are interventions or proper management that can help prevent maw during or after tkr surgery . The identification of maw was solely based on diagnostic codes; therefore, maw patients might be misclassified if the diagnosis was not recorded on the claims . The analysis focused exclusively on patients with medical and prescription benefit coverage, and the findings may not be generalizable to other populations . Similarly, since we excluded patients who had a prior knee replacement procedure in the previous year and patients without continuous eligibility during the 12-month pre - index or post - index period, the findings are not generalizable to those who had a second surgery or those who died within a year post - surgery . Further, the use of medical claims data precludes the assessment of quality - of - life outcomes, indirect costs, or medical services paid solely out - of - pocket . Unobservable confounders might have biased the estimates . As a result, the findings from this analysis can only be interpreted as association, not causation . The identification of maw was solely based on diagnostic codes; therefore, maw patients might be misclassified if the diagnosis was not recorded on the claims . The analysis focused exclusively on patients with medical and prescription benefit coverage, and the findings may not be generalizable to other populations . Similarly, since we excluded patients who had a prior knee replacement procedure in the previous year and patients without continuous eligibility during the 12-month pre - index or post - index period, the findings are not generalizable to those who had a second surgery or those who died within a year post - surgery . Further, the use of medical claims data precludes the assessment of quality - of - life outcomes, indirect costs, or medical services paid solely out - of - pocket . Unobservable confounders might have biased the estimates . As a result, the findings from this analysis can only be interpreted as association, not causation . This analysis of patients with tkr showed that those with maw had a greater burden of health care resource use and costs as compared with patients without maw . Strategies targeting these high - cost patients may be considered to lessen the economic burden associated with this patient population. |
This intervention has potential complications such as surgical site infection (ssi), one of the most frequent nosocomial infections, with a reported prevalence of 2 - 38.7% . Prevention of ssi can be achieved by surgical hand disinfection, a standard and obligatory procedure used in all hospitals . The surgical hand antisepsis, performed before donning sterile glove and gown, is defined as a process to remove transient microorganisms and reduce the resident skin flora . Due to potential risk of surgical glove perforations occurring during surgery, it is necessary to reduce skin flora as high as possible, and use antibacterial solutions before gloves are worn . Since joseph lister had shown the importance of hand washing in the control of postoperative ssi, researchers have been trying to introduce preparations that have maximum efficacy on the density of resident flora . Hence, a variety of formulations have been produced and presented to the pharmaceutical market . Up to now, based on the formulations produced, two main groups of surgical hand disinfectants have been presented: (a) antibacterial soaps, used in traditional hand disinfection procedure, and (b) alcohol - based hand solutions, which are used in surgical hand rub procedure, as a waterless and brushless method . Alcohol - based hand rubs are known to be the most effective surgical hand antiseptics and are often preferred to antimicrobial soaps because they are broad - spectrum agents and have high antibacterial effect, act faster and in the shortest time, can be applied easily, and are better tolerated by skin . As marchetti et al . Reported, although antiseptic - based soap (betadine) significantly reduced the skin flora, just sterillium and softaman (two alcohol - based hand rubs), and hibiscrub (chlorhexidine) could meet the requirement of pren 12791 (an european standard for evaluating the antibacterial efficacy of surgical hand antiseptics). Hsieh, in a systemic literature review, showed hand rubbing for 3 min with an alcoholic disinfectant was more effective than 6 min of hand scrubbing using chlorhexidine gluconate (chg) 4% . Recently, hand rubs have also been increasingly used in the islamic republic of iran . With the widespread use of alcoholic disinfectants, health service managers are always trying to choose more efficient and cost - effective antiseptics . In addition, researchers around the world are constantly trying to compare the efficacy of these formulations to determine the effectiveness of them . For example, in a research conducted on 3 and 5 min hand disinfection with two hand rub products (ethanol- and isopropanol - based hand rubs), isopropanol hand rub caused better result in decreasing the skin flora . Kampf and ostermeyer, in a controlled trial, compared the efficacy of two alcoholic disinfectants (sterillium rub and avagard); their results showed that based on pren 12791, sterillium rub was more effective than avagard . Iranian pharmaceutical market is mainly composed of a variety of imported and domestic surgical hand disinfectants of different prices . Today in iran, economic sanctions have been led to sharp increases the price of imported products, therefore the ministry of health emphasizes the use of similar local products . Hence this study was conducted to compare the efficacy of two imported alcoholic hand rubs, sterilium and decosept, with that of domestic hand rub antiseptic, septicidine . If the domestic product's effectiveness is similar to that of foreign products, its use is suggested as it is less expensive . This quasi - experimental study was a clinical trial consisting of one group, with before and after design . This study was approved by the research ethics committee of hamadan university of medical sciences . The study was conducted on 20 healthy volunteers who were students or personnel of the university . Inclusion criteria were: (a) age more than 18 years, (b) having clean and short nails, and (c) not having used any substance with antibacterial activity 1 week before the study . Exclusion criteria were: (a) pregnancy, (b) afflicted with any skin diseases, and (c) presence of any cuts or abrasion on hands . The sample size was estimated to be 20 subjects for each treatment (paired sample), considering the kamp fetal article data and using the following equation for = 0.05 and = 0.2: the following surgical hand rubs were used: sterllium (45% 2-propanol, 30% 1-propanol, 0.2% mecetronium etilsulfate; bode chemie, hamburg, germany), septicidine pc (50% ethanol, 25% isopropanol, 0.5% chg; behban shimi, tehran, iran), decosept ha (44.7% 2-propanol, 21.9% 1-propanol, 0.1% benzalkonium chloride; borer chemie, zuchwil, switzerland). For recovering of skin flora, at least 1 week interval had been elapsed before every interven tion . Before treatment, subjects washed their hands with soft soap (sapokalinus2). After rinsing and drying of hands with non - sterile paper towel, bacterial culture samples of finger tips of both hands were taken (pre - value count). Then both hands were rubbed with one of the products under test . After disinfecting, to assess the immediate antibacterial effect, a sample as well as pre - value was taken from one randomly selected hand and the unsampled hand was gloved for 3 h. to evaluate the 3 h antibacterial effect, after removing the glove, sampling was performed similar to that of the immediate sample . Washing hands up to wrist was achieved according to the method recommended by the word health organization (who) and en12791 with 10 ml of sapokalinus for 1 min . Distal phalanges of each hand were rubbed in 9-cm diameter petri dish containing 10 ml of tryptic soy broth (tsb). For pre - value, dilutions of 10 and 10 of sampling fluid were prepared in tsb . For each dilution, 0.1 ml was spread over the surface of a tryptic soy agar (tsa) plate . For post - value sampling, 1 and 0.1 ml of undiluted sampling fluid and 0.1 ml from its 10 dilution all plates were incubated aerobically at 37c 1c for 2448 h. the interval between sampling and incubating was less than 30 min . The hand rubbing was practiced in accordance with the instruction of manufacturer as follows: for all hand antiseptics, the procedure was the same as that for standard hand rub, up to wrist . During the procedure, if hands nearly dried, additional volume of the product was applied to hands so they were being kept moist during disinfection phase . But the duration of application and, consequently, the volume of product were different for each product: for decosept, they were 3 min and 812 ml, for septicidine 6 min and 1014ml, and for sterillium 1.5 min and 47 ml, respectively . The three hand rubs were dispensed sterilely into the hollow of subjects palm . In order to normalize the data, pre and post treatment colony counts per milliliter of sampling fluid (cfu / ml) were inverted to 10 logarithmic values . The number of colony forming units (cfu) per plate for each dilution was recorded, and then the number of cfu per milliliter was calculated . The plate counts between 15 and 300 were chosen in order to calculate the cfu / ml . If the cfu of post - value plates were less than 15, these values were counted . If values in the range that could be entered into calculations were obtained from more than one dilution, their mean was used as the final logarithmic value . The following surgical hand rubs were used: sterllium (45% 2-propanol, 30% 1-propanol, 0.2% mecetronium etilsulfate; bode chemie, hamburg, germany), septicidine pc (50% ethanol, 25% isopropanol, 0.5% chg; behban shimi, tehran, iran), decosept ha (44.7% 2-propanol, 21.9% 1-propanol, 0.1% benzalkonium chloride; borer chemie, zuchwil, switzerland). Each subject applied all the hand rubs under investigation . For recovering of skin flora, at least 1 week interval had been elapsed before every interven tion . Before treatment, subjects washed their hands with soft soap (sapokalinus2). After rinsing and drying of hands with non - sterile paper towel, bacterial culture samples of finger tips of both hands were taken (pre - value count). Then both hands were rubbed with one of the products under test . After disinfecting, to assess the immediate antibacterial effect, a sample as well as pre - value was taken from one randomly selected hand and the unsampled hand was gloved for 3 h. to evaluate the 3 h antibacterial effect, after removing the glove, sampling was performed similar to that of the immediate sample washing hands up to wrist was achieved according to the method recommended by the word health organization (who) and en12791 with 10 ml of sapokalinus for 1 min . Distal phalanges of each hand were rubbed in 9-cm diameter petri dish containing 10 ml of tryptic soy broth (tsb). For pre - value, dilutions of 10 and 10 of sampling fluid were prepared in tsb . For each dilution, 0.1 ml was spread over the surface of a tryptic soy agar (tsa) plate . For post - value sampling, 1 and 0.1 ml of undiluted sampling fluid and 0.1 ml from its 10 dilution all plates were incubated aerobically at 37c 1c for 2448 h. the interval between sampling and incubating was less than 30 min . The hand rubbing was practiced in accordance with the instruction of manufacturer as follows: for all hand antiseptics, the procedure was the same as that for standard hand rub, up to wrist . During the procedure, if hands nearly dried, additional volume of the product was applied to hands so they were being kept moist during disinfection phase . But the duration of application and, consequently, the volume of product were different for each product: for decosept, they were 3 min and 812 ml, for septicidine 6 min and 1014ml, and for sterillium 1.5 min and 47 ml, respectively . The three hand rubs were dispensed sterilely into the hollow of subjects palm . In order to normalize the data, pre and post treatment colony counts per milliliter of sampling fluid (cfu / ml) were inverted to 10 logarithmic values . The number of colony forming units (cfu) per plate for each dilution was recorded, and then the number of cfu per milliliter was calculated . The plate counts between 15 and 300 were chosen in order to calculate the cfu / ml . If the cfu of post - value plates were less than 15, these values were counted . If values in the range that could be entered into calculations were obtained from more than one dilution, their mean was used as the final logarithmic value . The pre - value and immediate post - value log10 of the three products were: sterillium: 4.3 0.44 and 0.32 0.57, decosept: 4.07 0.53 and 0.81 0.84, and septicidine: 3.95 0.94 and 1.28 1.14, respectively . T - test showed the differences were significant, that is, the three hand rubs had immediate effect . Using anova test for comparison of immediate effect revealed significant difference among them, that is, the effects of products were not similar . Sterillium had the most and septicidine had the least immediate effect [table 1]. Comparison of the bacterial effect (immediate and 3 h) of the three surgical alcohol - based hand rubs after 3 h, the bacterial density of hands increased, but these counts (3 h post - value) were significantly lower than the pre - value: sterillium: 3.92 0.63 and 1.80 1.14, decosept: 3.86 1.44 and 1.94 1.10, and septicidine: 3.98 1.02 and 1.58 1.23 (t - test; p <0.0001). This means the 3 h effect of the antiseptics was the same [table 1]. Septicidine did not cause fast and immediate effect as the other products, but comparison of log10 immediate value and log10 after 3 h of t he products using t - test showed that only septicidine could retain the antibacterial effect after 3 h under the glove [table 2]. Comparison of immediate effect and 3 h effect of the three surgical alcohol - based hand rubs the density and composition of the skin normal flora may be influenced by various factors, including anatomical locale, age, sex, moisture, ph, and immune system . It has been estimated that about 1010 cfu / cm inhabit on the skin of a human adult . The skin microbes found in the most superficial layers of the epidermis are gram - positive cocci (staphylococcus epidermidis and micrococcus sp .) And corynebacteria such as propionibacterium sp . These are generally nonpathogenic or commensal; even some of them are mutualistic (offer a benefit). Sometimes potentially pathogenic staphylococcus aureus is found on the face and hands in individuals who are nasal carriers . Nevertheless, these flora do not cause infection, if the skin is intact . In patients undergoing surgery s. aureus and s. epidermidis were reported to be the two most common organisms causing ssi . One predisposing factor of ssi is the microorganisms carried by the hands of surgical team in case of using perforated surgical gloves; hence, surgical hand antisepsis is carried out to eliminate the transient flora and diminish the resident skin flora as much as possible . In this study, we found that all three alcoholic hand rubs were able to significantly reduce the skin colony count immediately and 3 h after disinfection . This result is similar to previously reported results . Despite the fact that these clinical trials used different methods, their results showed significant reduction in skin flora after the interventions . The efficacy of alcohol - based hand formulation is influenced by (a) the type, concentration, and volume of alcohol used, (b) duration of application, and (e) other disinfectant or auxiliary agent . In our study, sterillium, containing 1-propanol 30%, the best effective alcohol, and 2-propranol 45% (total 75%), led to the immediate decrease of resident hand flora . Similar to this, in some studies, it was found to be the most effective alcoholic hand rub among others with different alcohol types a nd longer application time . Among the short chain alcohols, comparison of an 80% ethanol - based hand rub, irrespective of the application time (1.5, 3, and 5 min), with propan-1-ol 60% (3 min) showed less significant effect than that of propane - based rub, and comparison of 1.5 and 3 min disinfection with propan-2-ol 75% and propan-1-ol 60% (3 min) demonstrated less significant effect of isopropanol - based hand rub . The 6 min hand rub with septicidine (contains ethanol 50%, 2-propanol 25%, and chg 0.5%) caused the least immediate effect; but after 3 h disinfection, any significant increase in resident flora did not reduce . It was concluded that septicidine could retain the antibacterial effect during 3 h; in other words, its effect persisted better, which may be related to the ingredient in septicidine (chg). Although reduction in resident flora after 3 h in comparison to the pre - value was significant for the two other formulations, skin flora increased after 3 h in comparison to the immediate value . To the best of our knowledge, there is no study concerning the effectiveness of septicidine . One minute application of a hand rub (hibistat containing chg 0.5%, isopropanol 70%; its formulation is nearly similar to septicidine), in comparison to 3 min disinfection with propan-1-ol 60%, caused significantly less immediate and 3 h effect . Effectiveness of each alcohol - based solution must be considered with time span . In this study, decosept, sterillium, and septicidine, respectively, within 3, 1.5, and 6 min, could achieve effective results . Very short application time may fail to show antibacterial efficacy or long application may not result in any further effect . Hence, it is an important factor to determine how long should be the contact time . Reported that hand rubbing within 1.5 and 3 min with sterillium and 1.5 min with sensiva (containing propan-1-ol 45%, propan-2-ol 28%, and lactic acid 3%) showed similar results, whereas 1.5 min disinfection with desderman (ethanol 78.2%, 2-biphenylol 0.1%) did not show acceptable results . In another study, two who formulations, ethanol 80% and isopropanol 75%, with 5 min application time were as effective as applying them for 1.5 and 3 min . Even when the most powerful alcohol, propan-1-ol 70%, plus chg 0.5% and ethanol 78% plus biphenyl-2-ol 0.1% were used for 1 min, they could not produce suitable effect . For each hand rub, the best antibacterial efficacy can be achieved by a certain application time that is recommended by the manufacturer . In clinic, this cannot be practiced . Some study reported surgical team disinfected their hand for shorter application time, which certainly resulted in less efficacy; therefore, it is necessary that surveillances are frequently undertaken and the importance of this influencing factor must be emphasized to surgeons and surgical technologists . Short application time of hand disinfectants is certainly accompanied with less volume of antiseptic products used . Because of saving time and applied volume, short application of disinfectant without any decrease in the quality of antiseptic effect is a known favorable clinical condition, which makes healthcare facilities use such products . Antiseptic dose is also a factor influencing their efficacy . In our study, the applied volume for total disinfection time was: 47, 812, and 1014 ml, respectively, for sterillium, decosept, and septicidine . Kampf and ostermyer studied the efficacy of 3 min disinfection with different doses of propan-1-ol . Based on the applied volume of the product under test, which was necessary keep the hand moist, they designated volunteers to three groups (6, 9, and 12 ml). As no significant differences were found among interventions, they concluded that the required volume of alcoholic hand rubs is the volume necessary to keep the hand wet, which varied according to the size, temperature, and activity of hands . To conclude, in this experiment, the alcohol concentrations of products were somewhat equal . The alcohol concentrations of sterillium, septicidine and decosept are 75, 75 and 66.6 percent respectively, that their concentrations were in range of effective alcohol concentration . In a study, sterillium rub containing ethanol 80% at 3 min disinfection led to better significantly effect on skin flora than avagard (ethanol 61% plus chg 1%). The authors concluded that the difference between the two disinfectants was related to the high concentration of ethanol in sterillium rub, whereas chg 1% could not enhance the antibacterial efficacy of avagard . Based on the results of the study, although decosept and septicidine had significant effect on skin flora, considering the factors that influence the antibacterial efficacy of alcohol - based hand rub (type, concentration, applied volume, and duration of contact with antiseptic), sterillium was the best product. |
The four major clinical symptoms of nms are hyperthermia, severe muscle rigidity, autonomic dysfunction, and altered mental status . To date, several diagnostic criteria have been proposed for nms . According to the diagnostic criteria of the fourth edition of the diagnostic and statistical manual of mental disorders, text revision (dsm - iv - tr),1 the major symptoms are hyperthermia and severe muscle rigidity, and minor symptoms are diaphoresis, dysphagia, tremor, incontinence, changes in level of consciousness (ranging from confusion to coma), mutism, tachycardia, elevated or labile blood pressure, leucocytosis, and laboratory evidence of muscle injury (eg, elevated creatine kinase [ck]). The presence of two or more of the ten minor symptoms is necessary for a diagnosis of nms . Levenson2 suggested that elevated serum ck level is a major symptom used to diagnose nms . This is in agreement with findings that serum ck is important for detecting nms.3,4 on the other hand, it has been reported57 that elevated ck levels are of relatively little importance in the diagnosis of nms . However, elevated ck concentrations have been found in over 90% of patients with nms.2,5,8 as elevated ck is prevalent in the early stage of nms,9 clarification of the temporal appearance of serum ck may assist in the diagnosis of nms . Numerous case reports on nms have been published, but there have been no detailed studies on how muscle rigidity develops during nms . Furthermore, the relationship between ck concentration and the degree of muscle rigidity over the time course of nms from onset has not been established . In the present study, changes in serum ck and degree of muscle rigidity, and the temporal relationship between these factors, were evaluated in a large number of patients with nms . Between 1985 and 2012, 38 patients were treated in the authors department for typical nms, characterized by a fever (temperature> 38c), muscle rigidity, altered consciousness, autonomic dysfunction, and abnormal laboratory findings including elevated ck and leucocytosis . In a case of suspected nms, body temperature and degree of muscle rigidity can be evaluated on a daily basis, but serum ck level cannot always be measured this regularly . In order to evaluate temporal alterations in serum ck, measurements must be taken several times during the episode of nms . Serum ck levels could be evaluated only two or three times during the nms episode in 12 of the 38 patients; therefore, it was difficult to evaluate temporal changes in serum ck in these 12 patients because the number of ck measurements was small . There were two patients in whom serum ck level could be evaluated first on day 7 after the onset of fever; therefore, it was difficult to evaluate the first weekly changes of serum ck in these two patients . Overall, 24 patients in whom serum ck level could be evaluated temporally were selected for the present study . As already noted, all 24 patients had hyperthermia (temperature> 38c), muscle rigidity, altered consciousness, and autonomic disturbances including diaphoresis, tachycardia, labile blood pressure, and hypersalivation, and all cases met the criteria for nms proposed in levenson,2 caroff and mann,5 and the dsm - iv - tr.1 a summary of patient characteristics is shown in table 1 . We have previously reported monoamine levels in cerebrospinal fluid in patients with nms.1012 specifically, cases 13 in table 1 correspond to cases 2, 4, and 5, respectively, in the first of these reports; cases 49 correspond to cases 14, 6, and 11 in the second report; and cases 1015 correspond to cases 16 in the third report . Cases 1 and 24 have been reported recently.13 the summary of temporal changes in ck and muscle rigidity in individual patients is shown in table 2 . The first day on which fever of unknown etiology is observed it should be noted that extrapyramidal symptoms persist in some patients with nms after hyperthermia has subsided.14 therefore, when patients become afebrile, disturbance of consciousness improves, and no autonomic dysfunction (ie, diaphoresis, tachycardia, and labile blood pressure) is observed, nms is considered to have resolved . Taking case 1 as an example, was measured first on day 2, and six times thereafter . Including a further measurement after improvement of nms, serum ck case 1 did not present with muscle rigidity until day 8 after the onset of fever . The nms evaluation scale proposed by sachdev15 was used to monitor temporal changes in muscle rigidity: 0, nil (no rigidity); 1, mild (slight rigidity present, particularly obvious on recruitment of muscles responsible for jaw clenching); 2, moderate (rigidity definitely present to a significant degree but produces no limitation of passive movement); and 3, severe (rigidity that produces some limitation of passive movement). The nms scale was proposed by sachdev in 2005, enabling us to evaluate patients encountered since 2005 directly using this scale . Prior to 2005, we evaluated the temporal degree of muscle rigidity in patients using the ashworth scale16 or the modified ashworth scale17 to evaluate the movement of joints . The obtained data enabled us to retrospectively evaluate the temporal degree by using the scale proposed by sachdev . Because we did not measure body temperature in the days before fever onset in all patients, we retroactively used temperature readings taken on day 3 and day 7 and added them to table 3 . Temporal changes (mean standard deviation) in body temperature, serum ck concentration, and degree of muscle rigidity during the course of nms are shown in table 3 . All statistical tests were conducted using spss version 11 for windows (ibm corporation, armonk, ny, usa). A one - way analysis of variance with dunnett s post hoc test was used to analyze changes in body temperature, serum ck levels, and degree of muscle rigidity . Baseline values of serum ck were considered to be those after recovery because values before fever were not available . The relationship between serum ck and degree of muscle rigidity was examined using pearson s correlation coefficient . Between 1985 and 2012, 38 patients were treated in the authors department for typical nms, characterized by a fever (temperature> 38c), muscle rigidity, altered consciousness, autonomic dysfunction, and abnormal laboratory findings including elevated ck and leucocytosis . In a case of suspected nms, body temperature and degree of muscle rigidity can be evaluated on a daily basis, but serum ck level cannot always be measured this regularly . In order to evaluate temporal alterations in serum ck, measurements must be taken several times during the episode of nms . Serum ck levels could be evaluated only two or three times during the nms episode in 12 of the 38 patients; therefore, it was difficult to evaluate temporal changes in serum ck in these 12 patients because the number of ck measurements was small . There were two patients in whom serum ck level could be evaluated first on day 7 after the onset of fever; therefore, it was difficult to evaluate the first weekly changes of serum ck in these two patients . Overall, 24 patients in whom serum ck level could be evaluated temporally were selected for the present study . As already noted, all 24 patients had hyperthermia (temperature> 38c), muscle rigidity, altered consciousness, and autonomic disturbances including diaphoresis, tachycardia, labile blood pressure, and hypersalivation, and all cases met the criteria for nms proposed in levenson,2 caroff and mann,5 and the dsm - iv - tr.1 a summary of patient characteristics is shown in table 1 . We have previously reported monoamine levels in cerebrospinal fluid in patients with nms.1012 specifically, cases 13 in table 1 correspond to cases 2, 4, and 5, respectively, in the first of these reports; cases 49 correspond to cases 14, 6, and 11 in the second report; and cases 1015 correspond to cases 16 in the third report . Cases 1 and 24 have been reported recently.13 the summary of temporal changes in ck and muscle rigidity in individual patients is shown in table 2 . The first day on which fever of unknown etiology is observed it should be noted that extrapyramidal symptoms persist in some patients with nms after hyperthermia has subsided.14 therefore, when patients become afebrile, disturbance of consciousness improves, and no autonomic dysfunction (ie, diaphoresis, tachycardia, and labile blood pressure) is observed, nms is considered to have resolved . Taking case 1 as an example, was measured first on day 2, and six times thereafter . Including a further measurement after improvement of nms, serum ck case 1 did not present with muscle rigidity until day 8 after the onset of fever . The nms evaluation scale proposed by sachdev15 was used to monitor temporal changes in muscle rigidity: 0, nil (no rigidity); 1, mild (slight rigidity present, particularly obvious on recruitment of muscles responsible for jaw clenching); 2, moderate (rigidity definitely present to a significant degree but produces no limitation of passive movement); and 3, severe (rigidity that produces some limitation of passive movement). The nms scale was proposed by sachdev in 2005, enabling us to evaluate patients encountered since 2005 directly using this scale . Prior to 2005, we evaluated the temporal degree of muscle rigidity in patients using the ashworth scale16 or the modified ashworth scale17 to evaluate the movement of joints . The obtained data enabled us to retrospectively evaluate the temporal degree by using the scale proposed by sachdev . Because we did not measure body temperature in the days before fever onset in all patients, we retroactively used temperature readings taken on day 3 and day 7 and added them to table 3 . Temporal changes (mean standard deviation) in body temperature, serum ck concentration, and degree of muscle rigidity during the course of nms are shown in table 3 . All statistical tests were conducted using spss version 11 for windows (ibm corporation, armonk, ny, usa). A one - way analysis of variance with dunnett s post hoc test was used to analyze changes in body temperature, serum ck levels, and degree of muscle rigidity . Baseline values of serum ck were considered to be those after recovery because values before fever were not available . The relationship between serum ck and degree of muscle rigidity was examined using pearson s correlation coefficient . The mean age of the study participants (12 men and 12 women) was 38 years (range 2160 years). There was great variability among the peak ck concentrations, ranging from 495 to 44,880 iu / l . As shown in table 1, there were only six patients who received intramuscular injections before fever onset . The mean number of ck measurements in each case was 7.4 (range 413) and the total number of measurements was 177 for the 24 cases . As also shown in table 2, the most common day for ck concentration to peak was day 2 of nms (seven cases), followed by days 3, 4 and 5 (three cases each). Mild muscle rigidity was observed in 17 of 24 cases (71%) before the onset of fever . During the course of nms, the strongest grade of rigidity, 3, was seen in 20 patients and grade 2 was seen in four patients . Nms resolved in 23 patients without sequelae and one patient (case 22) died . As shown in table 3, overall serum ck peaked on day 2 and normalized to 165 iu / l (mean) (normal range 46210) on day 12 . Pearson s correlation test demonstrated that serum ck concentration was positively correlated with the degree of muscle rigidity (r=0.0392, p <0.01 [figure 1]). The main findings of this study are: (1) serum ck peaked on day 2 after the onset of fever and returned to within normal limits by day 12; and (2) mild muscle rigidity was observed before the onset of fever in 17 of 24 cases (71%) and was worst on day 4 . Serum ck is usually elevated following intramuscular injection, strenuous exercise, trauma, muscular injuries, acute psychosis, and restraint . Hence, elevated ck is not specific to nms and is therefore not a reliable diagnostic parameter . The diagnosis of nms should be based on four clinical symptoms: fever, altered consciousness, muscle rigidity, and autonomic dysfunction . However, it has been established that elevated ck is found in over 90% of patients with nms.2,5,8 therefore, if patients treated with antipsychotics develop a fever of unknown cause and their serum ck levels are elevated nms should be suspected in addition to other conditions in which serum ck levels are elevated . If muscle rigidity is observed, the patient has a higher risk of developing nms . Therefore, it is important for diagnosing nms to understand how serum ck concentration and the degree of muscle rigidity change during the course of nms . Harsch18 reported that ck concentration peaked 2448 hours after onset in nine cases of nms, and rosebush and stewart19 reported among 24 episodes of nms a peak on days 2 and 3 after onset in 64% of episodes, on days 4 to 7 in 29%, and on day 1 in 7% . The present study is the first to examine temporal changes in serum ck in numerous nms cases, and the present results confirm the above findings . Muscle rigidity was observed in 17 of 24 cases (71%) before the onset of fever . Velamoor et al20 investigated 222 nms patients previously reported and concluded that mental status change or muscle rigidity was the initial manifestation in 82.3% of cases . Al did not evaluate when the degree of muscle rigidity became most severe; however, the results of the present study demonstrate a peak on day 4 after the onset of fever . Taken together, in many cases it appears that serum ck concentration rapidly increases after the onset of fever, peaks on day 2, and normalizes on day 12 . By contrast, mild muscle rigidity is present at the onset of nms in 71% of cases and peaks on day 4 . On the other hand, we reported exceptional cases of nms with regard to temporal changes in serum ck and muscle rigidity.13 as muscle rigidity first appeared after serum ck had normalized in cases 1 and 24, physicians should be aware of the existence of these uncommon findings . We calculated pearson s correlation coefficient to assess the relationship between serum ck levels and degree of muscle rigidity and noted a significant positive but weak correlation (r = 0.198). Serum ck is elevated in numerous situations . To conclude that elevated ck is significantly associated with degree of muscle rigidity, it is necessary to rule out other factors including intramuscular injection, strenuous exercise, and acute catatonia . Therefore, at present, we are unable to ascertain whether elevated ck is associated with muscle rigidity . Average body temperature peaked on days 1 and 2, and gradually decreased during the course of nms in 24 cases . It is possible that low - grade fever preceded the appearance of hyperthermia (temperature> 38c). As we did not measure body temperature on the day prior to hyperthermia onset in any cases, it is unclear whether body temperature generally peaks on day 1 or 2 of nms first, the study was carried out retrospectively to assess the degree of muscle rigidity . It will be necessary to examine this condition prospectively in a large sample population with nms . Second, serum ck was randomly measured in each patient; daily measurement of ck is difficult because nms is rare and measurement of serum ck is not a routine examination . In conclusion mild muscle rigidity was observed in about 71% of 24 cases, and the degree of muscle rigidity was worst on the fourth day, after which it gradually resolved . The findings of our study confirm physicians empirical knowledge of serum ck concentration and muscle rigidity in nms based on the data accumulated from numerous patients with this syndrome. |
The term cancer refers to a set of conditions that have the growth of cells that invade tissues and organs of the human body in common . The causes of cancer are varied, but psychological and behavioral factors such as chronic stress, depression, and social isolation may contribute to the initiation and progression of certain cancers [2, 3]. Conversely, cancer is a risk factor for the development of mental disorders . Symptoms of psychological and physical distress may emerge during cancer treatment in combination with disease systems [46]. Attention to the psychosocial aspects of the disease is equally important to cancer treatment, especially regarding psychopathologies because they significantly impact morbidity, low adherence to treatment, hospitalization duration, prognosis, quality of life, and patient survival [811]. The estimated prevalence of psychiatric disorders in individuals with cancer is approximately 20 to 50% [1214], and depression exhibits the highest rates [1518]. Psychiatric disorders and symptoms may represent an adjustment reaction to the disease condition, and these symptoms may also be associated with a general medical condition, such as delirium . Clinical complications and metabolic changes, such as hypercalcemia, anemia, vitamin b12 deficiency, and electrolyte imbalance, are also risk factors for mental disorders in cancer patients, especially depression . Therefore, the impact of the cancer and the associated clinical conditions may promote the development of psychiatric disorders, especially mood disorders and psychotic symptoms [20, 21]. Pathological anxiety may be present in physical diseases, medication and drug use, alcohol withdrawal, central nervous system depressants, and the so - called anxiety disorders [22, 23]. The prevalence of anxiety in cancer patients varies between 10 and 30% [24, 25], and it is often associated with the diagnosis stage, procedure performance, and uncertainty about the future [20, 21]. The abuse of psychoactive substances is directly associated with physical diseases, such as cirrhosis, cancer, and cardiovascular disease . The consumption of alcohol and tobacco is a well - established and prominent etiological factor in patients with malignancy in the lungs and esophagus . Mental disorders may appear as comorbidities with the clinical condition, which may negatively impact disease diagnosis and treatment and emotional and financial costs [911]. However, oncology clinicians poorly identify mental disorders and their most common symptoms, despite the good responses to pharmacological and/or psychosocial interventions [2831]. Knowledge of the prevalence of psychiatric disorders in this specific population may increase awareness and identification and mobilize resources for prevention and treatment [6, 32]. Early screening for behavioral and/or psychological / psychiatric disorders in patients seen in health care settings positively affects health care quality and decreases suffering and institutional operational costs . This study evaluated a statistically estimated sample of cancer outpatients at a hospital specializing in cancer according to the presence / absence of major mental symptoms / disorders using simple and quick screening instruments across different oncology specialties . Statistical calculations determined that a minimum sample size of 1,155 subjects was required with an error rate of 3% . The subjects were recruited from a single hospital specializing in cancer, and all subjects were receiving outpatient care (new or return cases) in different oncology specialties . The following exclusion criteria were adopted: severe cognitive impairment as qualitatively evaluated by the applicator and the absence of clinical conditions that would affect responses to the instruments . The following self - assessment scales were used for data collection: patient health questionnaire-4 (phq-4) screens for depression (phq-4 d brief version of phq-9) and anxiety (phq-4 a brief version of gad-7) indicators experienced during the prior two weeks . Copyright 2005) translated this version into brazilian portuguese;generalized anxiety disorder (gad-7) screens for typical indicators of anxiety disorders experienced during the prior two weeks . This instrument includes the two items from phq-4 a and more five items that enable screening of generalized anxiety disorder . Copyright 2005) translated this version into brazilian portuguese;fast alcohol screening test (fast) evaluates risky, harmful use and alcohol dependence syndrome . This version was translated and validated for brazilian portuguese; fagerstrm test for nicotine dependence (ftnd) measures the degree of physical dependence on nicotine . This version was translated and validated into brazilian portuguese .sociodemographic and clinical questionnaire assesses information about sociodemographic data (gender, schooling, civil status, professional situation, and religion) and treatments in mental health . Patient health questionnaire-4 (phq-4) screens for depression (phq-4 d brief version of phq-9) and anxiety (phq-4 a copyright 2005) translated this version into brazilian portuguese; generalized anxiety disorder (gad-7) screens for typical indicators of anxiety disorders experienced during the prior two weeks . This instrument includes the two items from phq-4 a and more five items that enable screening of generalized anxiety disorder . Copyright 2005) translated this version into brazilian portuguese; fast alcohol screening test (fast) evaluates risky, harmful use and alcohol dependence syndrome . This version was translated and validated for brazilian portuguese; fagerstrm test for nicotine dependence (ftnd) measures the degree of physical dependence on nicotine . Sociodemographic and clinical questionnaire assesses information about sociodemographic data (gender, schooling, civil status, professional situation, and religion) and treatments in mental health . The subjects were selected randomly in reference to the scheduling system of the hospital according to the medical consultation dates . Process no . 537/2011) and technical recommendations and entered into a database for analysis . Descriptive (e.g., mean, standard deviation, and percentage) and parametric statistics (e.g., student's t - test, chi - square, and pearson correlation test) were used for data analysis the sample included adult individuals (mean = 50.3; dp = 13.9) of both genders with a slight predominance of women (55.8%). The sample included subjects with incomplete / completed elementary school (59%), married or in a stable relationship (67.4%), with children (86.7%), and not active from a labor viewpoint (61.3%). A total of 79.5% of the sample followed some type of religion, most often catholicism (68%). Approximately 80% of the sample had no previous psychiatric / psychological history or psychiatric antecedents . The prevalence of different indicators of psychiatric disorders in the total sample and according to different oncology specialties is shown in table 1 . Anxiety's symptoms rates between 21.4% and 27.3% were observed for the total group, and gynecology, mastology, and thorax specialties were prominent (table 1). The prevalence of depression indicators was 18.5% for the total group, and gynecology, orthopedics, and thorax exhibited the highest rates . The percentage prevalence of these abuse rates was higher in the upper digestive, thorax, head and neck, and urology specialties, reaching levels in excess of 30% . Prevalence indicators for different sociodemographic characteristics of the sample are shown in tables 2 and 3 . Women had higher anxiety indicators prevalence rates than men, and unmarried subjects exhibited higher anxiety rates than married subjects . This difference according to marital status was observed using the phq-4 a instrument, but it was not confirmed using the gad-7 instrument . Higher rates of symptoms of depression were associated with females, unmarried, and widowed subjects and subjects who were professionally inactive . The rates of substance abuse (alcohol and tobacco) were more significant in men, married, and divorced individuals, subjects with less education, subjects who were not professionally active, and subjects who did not follow any religion (table 3). The comorbidity rate in the total sample and among different oncology specialties is also noteworthy: 27.1% of the sample exhibited at least one comorbidity, with a prevalence of cooccurrence of anxiety and depression of 11.8%, and 6.6% of the sample had more than two comorbidities . A total of 43.4% of patients in the thorax / lung specialty, 33.5% of the upper digestive specialty, and 29.8% of the urology specialty exhibited indicators of more than one mental disorder . Cancer and psychiatric symptoms / disorders are strongly associated, and the present study evaluated this association in cancer outpatients undergoing treatment . Screening instruments evaluated symptoms of depression, anxiety, and substance abuse / chemical dependence . The data showed depression indicators prevalence of 18.5%, which is greater than a previous brazilian epidemiological study of 9.4% but similar to a meta - analysis that reported a 16.3% depression rate in cancer patients at clinics and cancer hospitals . These data corroborate previous reports of the prevalence of depression in this clinical group . The prevalence of anxiety indicators varied between 21.4% and 27.3%, which are similar to primary care users (27.9%) as determined using observer - assessment interviews . These data reinforce the important association between physical disease and anxiety, regardless of treatment context . Moreover, the rate of anxiety indicators in this study is high compared to a previous study that diagnosed 7.6% of cancer patients with an anxiety disorder using a diagnostic interview . However, the choice of instrument may explain this difference, and the present study used screening instruments that measure anxiety symptoms rather than specific disorders . This level is higher than patients admitted to general medical specialties (9.8%) and hospitalized cancer patients (15.5%), who were all evaluated using a screening instrument . The tobacco abuse rate for the total sample was 40.2%, which was similar to the prevalence of 44% in patients admitted to gastroenterology and pulmonology wards using screening scales and diagnostic interviews . These findings suggest tobacco use as a possible risk factor, especially for oncological diseases of the respiratory system . The gynecology, mastology, and thorax specialties showed the highest rates of depression and anxiety indicators . One possible explanation for this finding is the exclusive presence of women in the first two specialties . Other evaluation studies of cancer patients reported that women subjects admitted to general hospitals or the general population exhibit high rates of depression and anxiety symptoms [31, 4145]. It is possible too that, in thorax specialty, the poorer prognosis can favor these rates . One study evaluated 987 patients with lung cancer and found depressive symptoms in most subjects . Another study evaluated patients with lung cancer using a self - administered hospital anxiety and depression scale (hads) and found that 37% had depression symptoms . One possible explanation for this result is suggested by two other studies that showed an increased likelihood of depressive episodes in subjects during nicotine withdrawal, and an even greater likelihood for patients with a history of previous depressive episodes [49, 50]. Therefore, patients with lung cancer may begin a process of reduction or remission of their smoking habit and develop withdrawal symptoms, which promotes the onset of depression and anxiety symptoms . Men predominated among patients abusing alcohol and tobacco, which has also been demonstrated in previous evaluations in the general population in different countries [39, 5153]. Therefore, these high rates and the behaviors associated with the male gender, who care less about health and engage in more risky behavior [5458], support the use of these substances as a risk factor for disease development [27, 5963]. The higher prevalence rates of alcohol and tobacco abuse in thorax / lung and upper digestive specialty patients and patients with tumors in the head and neck confirm this hypothesis . The data presented are consistent with the previous literature and attest to the high prevalence of indicators of psychiatric disorders in cancer patients, especially compared to the prevalence in the general population . These results support the conclusion that individuals with cancer are more vulnerable to the onset and development of psychiatric disorders . Conversely, the association between substance abuse and certain cancers indicates that substance abuse can be also a risk factor for disease development . This study was conducted using a large and statistically estimated sample, but the psychiatric indicators were evaluated using screening instruments . These instruments were validated previously and show adequate sensitivity and specificity, but they only provide the prevalence of indicators but do not indicate disorders per se . The subjects' self - perception also influences these instruments, which may be overestimated or underestimated, and this fact should be considered in data interpretation as well as the fact that all the patients come from a single treatment center . The high rates indicate the need to screen for psychiatric disorders in cancer patients, especially because of the damaging effects that psychiatric symptoms may exert on patient treatment . Active monitoring and early detection of symptoms may facilitate treatment adherence, decrease the duration of hospital stay, and assist in disease coping . The study also highlights the need for greater investment in prevention campaigns that discourage the use of legal substances, such as alcohol and nicotine, because these substances are risk factors in cancer development. |
Benign recurrent intrahepatic cholestasis (bric) is an autosomal - recessive cholestatic disorder which was first described by summerskill and walshe in 1959 in two patients with recurring cholestasis [2, 3]. Ten years later, tygstrup and jensen formulated the defining criteria as: (1) several episodes of pronounced jaundice with severe pruritus separated by symptom - free intervals lasting several months or years, (2) absence of a factor known to produce intrahepatic cholestasis (e.g. Drug intake, pregnancy, intoxication), (3) biomechanical signs of obstructive jaundice but with normal intrahepatic and extrahepatic bile ducts (visualized by cholangiography), and finally (4) bile plugs within ducts in histological specimens [1, 2, 4, 5]. Previously, summerskill - walshe - tygstrup syndrome has been regarded as an idiopathic disease [1, 2]. Meanwhile it is known that bric displays a genetic heterogeneity and is associated with mutations in the atp8b1 (bric 1) and abcb11 (bric 2) genes and belongs to the canalicular transport defects . As it typically does not lead to liver cirrhosis, it is considered as a benign liver disease . For the right diagnosis, both clinical and pathological features are pivotal [5, 6]. Therapeutically, in moderate cases, conservative treatment with cholestyramine, rifampicin [6, 7, 8], steroids, phenobarbital, ursodeoxycholic acid or 5-adenosylmethionine may be applied . In more severe cases, a nasobiliary drainage tube can be inserted, or surgical interventions such as partial biliary diversion or ileal bypass may be performed to relieve the patient's suffering . Despite these various possibilities, in some patients symptoms mostly pruritus may still be resistant [5, 9]. For such severe cases, new therapeutic approaches are required to avoid liver transplantation as the ultimate required therapy . In 1988, several attempts succeeded in lowering bile acids by plasmapheresis [10, 11]. Additionally, since 2001, albumin dialysis (molecular adsorbent recirculation system, mars) has been successfully applied to improve these patients medical condition and to significantly reduce serum bilirubin and bile acid levels [8, 12, 13]. In the case of our patient, the extracorporeal liver assist device prometheus (fresenius medical care, bad homburg, germany), which is frequently used in patients with severe cholestasis or liver failure as a bridging procedure to transplantation [14, 15], has been applied to resolve therapy - resistant pruritus . We report a 45-year - old caucasian woman with summerskill - walshe - tygstrup syndrome which was first diagnosed in 1998 . Despite extensive conservative therapy with prednisolone (510 mg / day), ursodeoxycholic acid (3 500 mg / day) and cholestyramine (3 4 g / day), she suffered from intermittent attacks of cholestatic jaundice, severe pruritus and anxious nervousness . On clinical examination usually, serum bile acids were elevated at 22.5 2.7 mol / l (normal <6 mol / l), while transaminases as well as -glutamyltransferase (-gt) and alkaline phosphatase (ap) remained at approximately normal values (<35 e, cmv, ebv and hsv) and immunological serology (ana, ama, anca, sma, sla, lkm, -globulin and igg / igm) were all negative . However, both the patient's grandmother and mother suffered from cholecystolithiasis . In march 2008 ultrasound examination revealed normal liver morphology without signs of obstructive cholestasis (diameter of the common bile duct 3 mm). Additionally, a liver biopsy was performed which demonstrated normal hepatocyte architecture without inflammatory cells or bile plugs within the canaliculi (fig . The first 3 dialysis cycles were performed in april 2008, followed by another 5 cycles in june 2008, leading to complete recovery and decreasing laboratory parameters . In the following years, bile acids were lowered significantly by 78% from an average of 22.5 2.7 to 7.3 1.7 mol / l (p = 0.003). Due to cicatrization of the dialysis catheter, a cimino - brescia fistula was finally applied in january 2011 . We here report a patient with characteristic features of bric, occurring frequently with insistent symptoms . She suffered from intermitting severe pruritus as well as infrequent jaundice . This disease is remarkable for its discrepancy between a rise in serum bile acids at the onset of each attack and a later rise in total serum bilirubin levels . Due to conservative treatment with prednisolone (510 mg / day), ursodeoxycholic acid (3 500 mg / day) and cholestyramine (3 4 g / day), in contrast, conservative treatment did not have any positive effects on agonizing pruritus . During this stage, laboratory parameters revealed the typical periodic elevation of total serum bilirubin and bile acids . However, transaminases, ap and -gt were less affected (<35 u / l). Whenever intractable pruritus appeared, liver dialysis using the prometheus system was performed . The first cycle was set after worsening of the patient's condition when a 7 fr nasobiliary drainage tube dislocated in march 2008 . In the following years, 3 up to 5 cycles of liver dialysis per session were necessary to normalize laboratory parameters and relieve the patient's suffering . This range for dialysis sessions is in accordance with other studies describing the application of prometheus in patients with insistent pruritus [16, 17, 18]. The pathogenesis of cholestatic pruritus is not completely clear . Besides bile acids, which apparently seem to play a major role as pruritogens, elevated levels of endogenous opioids and amphiphilic lysophosphatidic acid (lpa) in contrast to bile acids, lpa and autotaxin (the enzyme responsible for the transformation of lysophosphatidylcholine into lpa) plasma levels were demonstrated to correlate significantly with the severity of patients pruritus . Conservative treatment is based upon this knowledge as e.g. The bile acid sequestrate cholestyramine is recommended as the first - line treatment by easl and aasld . Involvement of the opioid system furthermore allows the application of opioid antagonists such as naltrexone to resolve pruritus . Reported positive effects of the serotonin re - uptake inhibitor sertraline actually indicate an involvement of the serotonin system . Despite these numerous mechanisms by which the pathogenesis of pruritus can already be affected therapeutically to relieve the majority of patients from pruritus, some of them remain resistant to these therapies . As severe pruritus may lead to reduced quality of life and even to suicide [16, 17], the necessity for an effective therapy becomes obvious . In these patients, e.g. With primary biliary cirrhosis, liver transplantation may become the ultimate therapeutic option . Until now, several studies have provided evidence for extracorporeal liver support systems, first for mars and later for prometheus, to be an effective and safe therapeutic alternative for patients with cholestatic pruritus [8, 12, 13, 16, 17]. With regard to the elimination of albumin - bound molecules such as bilirubin (strongly albumin - bound) or bile acids (less tightly albumin - bound), there are slight differences between these two methods . Krisper and stauber characterized the dialysis performance of prometheus as less selective to albumin - bound molecules and more efficient at the same time as compared to mars . Concerning bile acid removal, stadlbauer et al . Found similar efficiency for both prometheus and mars, while a change in the particular bile acid profile towards hydrophobic bile acids was observed only under prometheus treatment . Besides changes in white blood cell count, no adverse effects have been reported so far [18, 22]. Because of its rareness summerskill - walshe - tygstrup syndrome is first considered in the differential diagnosis of cholestasis after many years of extensive investigations . However, in some cases, prometheus liver dialysis appears to be a beneficial alternative for patients with bric - related symptoms mainly intractable pruritus |
1a) could not tolerate rgp lens - wearing and did not want to have a corneal transplant or other corneal surgeries . The ucva was 0.04 and the bscva was 0.7 with -3.75 -3.00 155a . In the left eye, the ucva was 0.02, and the bscva was 0.4 with -12.00 -3.50 30a . The corneal refractive power was 58.40 / 48.70 diopters 117a in the left eye (fig . He was told that the maximal possible visual correction would be 0.4 or less because irregular astigmatism could not be corrected with toric icl implantation . With informed consent, toric icl implantation after surgery, the manifest refraction became -0.75 180a with a ucva of 0.5 and bscva of 0.7 at 1 month, which then shifted to + 2.25 -0.50 180a with a ucva of 0.4 and bscva of 0.7 at 9 months, and to -1.75 180a with a ucva of 0.2 and bscva of 0.5 at 20 months . The anterior chamber depth, from the endothelium to the icl, decreased from 2.21 mm at 1 month to 2.13 mm at 9 months follow - up, corresponding with mild corneal flattening and transient hyperopic changes (fig . 1d), without any vault changes (fig . 1e and 1f). At the last follow - up, 20 months after surgery, the icl vault was decreased, resulting in mild deepening of the acd from 2.13 mm to 2.17 mm, and the manifest refraction results finally stabilized at mild myopic astigmatism (fig . The efficacy and safety index were 1.0 and 1.75 at 9 months and 0.5 and 1.25 at 20 months (table 1). Toric icl has been used as an alternative for the correction of high myopic astigmatism in eyes with stable keratoconus, though irregular astigmatism is a concern due to its ability to interfere with visual rehabilitation . The two - step procedure of combining intrastromal corneal rings and phakic intraocular lens implantation may be another alternative treatment option for keratoconus with high myopic astigmatism . Toric icl may have advantages in terms of expense, time, and being a one - step procedure . Toric icl implantation can improve clinically useful vision even if perfect vision cannot be achieved in patients with advanced stable keratoconus . In our case, the patient was satisfied with partial visual rehabilitation because his daily activities could be comfortably performed with his spectacles - corrected vision with his icl implants . There are still issues regarding toric icl target diopter, which may not be precisely calculated exactly in keratoconus and postoperative refractive changes due to keratoconus progression . We used the astigmatism decomposition method recommended by the manufacturer (staar surgical) to perform the toric icl power calculation . Exact calculation of the target diopter, however, is more difficult in keratoconus than in other high myopic astigmatism conditions due to the difficulty of achieving a precise keratometric reading and manifest refraction . Moshirfar et al . Reported that phakic icl selection for emmetropia in keratoconus eyes with high myopic astigmatism may lead to hyperopia . Our patient had a transient hyperopic shift that appeared to be associated with a suspicious progression of scarring that resulted in flattening of the cornea and subsequent shallowing of the anterior chamber depth . This hyperopic change resolved with decreasing the icl vault and the refraction stabilized by 20 months follow - up . Despite transient refractive changes during the follow - up, the visual improvement with correction was maintained, and the patient was satisfied with the postoperative vision and the lack of postoperative complications . It is important that the patient is well informed before the surgery of possible visual fluctuations and only a partial restoration of vision . Because toric icl aims to correct spherical and cylindrical errors, it cannot correct a large amount of high order aberrations caused by irregular shapes of the cornea . After a toric icl implantation, our patient still had a similar amount of high order aberrations despite correcting the high myopic astigmatism . Examples include patients with rgp intolerance, stable keratoconus, or fear of corneal surgery . To select suitable candidates, correction of high myopia and astigmatism with spectacles before the surgery should be tried in the clinic . Recently, to reduce both irregular astigmatism and high myopia, cross - linking, or corneal ring implantation combined with toric icl, has been newly adapted for treating keratoconus . Nevertheless, our case report suggests that toric icl implantation may be a possible alternative surgical option for the partial visual rehabilitation of high myopic astigmatism in keratoconus patients with rgp contact lens intolerance who do not want to have a corneal transplant or other corneal surgeries. |
The use of regenerative procedures before implant - prosthetic oral rehabilitation is required to counteract vertical and horizontal bone loss and, mostly, to obtain an adequate bone quantity and quality to ensure primary stability at implant insertion . Several bone grafting materials were proposed for bone regeneration, such as autogenous, allogenic and xenogenic biomaterials, or a combination of them and, as the biological response of host tissue can be related to biomaterial origin, attention was focused on the interactions occurring between grafts and host tissue . As already reported by mangano et al ., heterologous biomaterials were found to be as clinically efficient as autologous bone for their capacity of osteoconduction, even if little is known about their capability to be resorbed, and about the time they need to be fully replaced by newly formed bone tissue . In fact, a biomaterial showing a too rapid resorption rate may result unsuitable for bone augmentation procedures, because it could be completely resorbed before osteogenic cells have colonized the defect; on the other hand, a biomaterial showing no resorption could cause problems to the regeneration of bone with a lower osteogenesis ability in respect to native autologous bone . In literature, only a few studies were reported about the use of an equine - derived bone substitute, which seems to be able to induce osteoblast differentiation, to be resorbed in vitro by osteoclasts and to be successfully used in mandibular ridge augmentation . Moreover, the integration of a bone graft results in a remodeling process similar to the physiological bone healing event following a bone fracture . Bone remodeling occurs through different steps, which start from a lesion of the vascular structure at the site of the injury reducing the supply of nutrients and determining an initial bone resorption . The hematoma generated activates signaling molecules and growth factors, which stimulate proliferation and differentiation of osteo - progenitor cells . Among them, transforming growth factor- (tgf-) superfamily and angiogenic factors are included . In particular, tgf1 is essential for osteoblastic differentiation of mesenchymal precursors, it induces the synthesis of bone morphogenenetic proteins (bmps) and promotes osteoid and extracellular protein production such as collagen, osteopontin and osteonectin . Moreover, tgf-1 is an important factor for osteoclasts and osteoblasts coupling: in fact, it not only promotes the recruitment of hematopoietic osteoclast precursors, but also shows an inhibitory effect on bone resorption and stimulates the production of osteoprotegerin (opg). Opg is expressed by osteoblasts and regulates bone homeostasis by inhibiting osteoclastogenesis and bone resorption . Opg, binding to rankl on osteoblast / stromal cells, blocks the rankl / rank interaction between osteoblast / stromal cells and osteoclast precursors, inhibiting osteoclast precursor differentiation, reducing osteoclast production and regulating osteoclast - mediated resorption . Moreover, in such processes a main role is also played by angiogenic factors, among which vascular endothelial growth factor (vegf) is included . Vegf is produced by endothelial cells and osteoblasts and is involved in early bone remodeling phases since it controls osteoblast growth . The early phases of bone graft integration are followed by remodeling phenomena driven by molecules produced by osteoblasts, as bone sialoprotein (bsp) and secreted protein acidic and rich in cysteine (sparc), leading to new extracellular matrix deposition and to its subsequent mineralization . Bsp is a component of the extracellular matrix which plays important functions in the regulation of new bone apposition and remodeling . Bsp expression is up - regulated by factors inducing osteoblast differentiation, released by active osteogenic cells at the site of new bone formation, even though it has also been shown to promote osteoclastic resorption of mineralized surfaces . Sparc, also known as osteonectin, is a collagen - binding glycoprotein that appears to regulate cell growth through interactions with extracellular matrix (ecm) and cytokines . It is secreted by osteoblasts during bone formation, initiating a mineralization process and promoting mineral crystal formation . It is a modulator of the mineralizing process, essential for bone graft integration, such as the bone healing around dental implants . Based on this knowledge, the aim of our work was to analyze and to compare the molecular events switched on by autologous or heterologous bone graft insertion, focusing our attention on tgf1 expression and opg / rankl ratio, to analyze resorption process, and to estimate bone graft vascularization, new bone formation and its mineralization, through vegf, bsp and sparc expression evaluation, respectively . By understanding the mechanism underlying graft integration and by comparing the results obtained with the use of the heterologous bone substitute to that obtained with the use of autologous bone it should be verified if equinederived bone substitute possesses characteristic, which may permit a good integration within the host bone tissue, thus clinically ensuring an adequate primary stability to the implant and predictability of the implant - prosthetic rehabilitation . Twenty patients (13 males, 7 females; age ranging 4558) with inadequate bone volume in the posterior maxilla, were scheduled for bone augmentation procedures followed by implant placement . The patients were divided into two groups (n=10), according to the severity and morphology of the bone defect, mirroring classes c and f of the chiapasco's classification of the posterior maxilla (table 1). All patients received sufficient information about the inclusion in this study and gave written consent in accordance with italian legislation and with the code of ethical principles for medical research involving human subjects of the world medical association (declaration of helsinki). Ten patients (8 males, 2 females; age ranging 4554), having class c bone defects, underwent maxillary sinus augmentation procedure with a bone substitute of equine origin (biobone osteoconductor mix, biosaf in s.r.l ., ancona, italy) (group 1), and ten patients (5 males, 5 females; age ranging 4658), with class f bone defects, received an onlay bone graft and a maxillary sinus augmentation procedure with bone obtained from the parietal region of the calvaria (group 2). Table 1chiapasco's classification of the posterior maxilla.classheight of the residual ridgethickness of the residual ridgeinterarch distancea>5 mm <8 mm6 mmnormalb>5 mm <8 mm<6 mmnormalc<5 mm6 mmnormald<5 mm<6 mmnormale>5 mm <8 mm6 mmincreasedf>5 mm <8mm<6 mmincreasedg<5 mm6 mmincreasedh<5 mm<6 mmincreasedicompletely resorbed alveolar ridge with increased distance interarch and class iii skeletal relationships biobone osteoconductor mix is a reasorbable, collagen - deprived, and deantigenated osteoconductive biomaterial, obtained after a biological process of deantigenation at 37c in a humid atmosphere, made up of a corticocancellous mixture of equine origin (particles width 0.51 mm). The autologous bone blocks from the parietal region of calvaria were taken from calvaria under general anesthesia by a piezoelectric instrument (easy surgery, biosaf in s.r.l . ), shaped according to the dimension of the defects, properly fitted in the recipient site, and fixed with lag screw to rebuild the alveolar ridge . All gaps between the bone blocks and the recipient sites and the maxillary sinus were packed with bone chips obtained from the same donor site, and the grafted areas covered with a resorbable barrier (biobone collagen membrane, biosaf in s.r.l .) Post - operative healing was uneventful for all the patients, and therefore, after about 6 months they were scheduled for a second surgery for implant placement . Contextually the intervention of implant insertion, bone samples were retrieved by a 3 mm - diameter and 8 mm - height trephine bur under sterile saline solution irrigation in the sites of implant placement, in order to obtain significant specimens of bone regenerated with heterologous bone substitute in group 1 patients, while in group 2 patients bone samples were obtained from the lateral maxillary wall between the sites of implant placement . Samples of bone tissues were fixed in 10% phosphate - buffered formalin for 24 h, and decalcified in 10% tetrahydrated edta, according to data sheet (mielodec kit, bio - optica, milan, italy). Subsequently, they were dehydrated through ascending alcohols and xylene, and then paraffin embedded . Samples were dewaxed (xylene and alcohol at progressively decreasing concentrations), sliced 5 m thick and processed for hematoxylin - eosin staining and for immunohistochemical analysis . In order to detect tgf1, opg, rankl, vegf, bsp, and sparc proteins, immunohistochemistry was performed on 5 m - thick sections by means of ultravision lp detection system hrp polymer & dab plus chromogen (lab vision thermo, ca, usa). To reduce non - specific background staining due to endogenous peroxidase slides were then incubated in the presence of mouse anti - tgf1, anti - rankl and anti - sparc monoclonal antibodies, and rabbit anti - vegf polyclonal antibody (santa cruz biotechnology, santa cruz, ca, usa), mouse anti - opg monoclonal antibody (acris antibodies, herford, germany), and mouse anti - bsp monoclonal antibody (calbiochem, darmstadt, germany). Peroxidase was developed using diaminobenzidin chromogen (dab), and nuclei were hematoxylin counterstained . Randomly selected slides belonging to each sample were then observed by means of leica dm 4000 light microscopy (leica cambridge ltd, cambridge, uk), equipped with a leica dfc 320 camera (leica cambridge ltd) for computerized images . After digitizing the images obtained from the immunohistochemical stained sections, qwin plus 3.5 software (leica cambridge ltd) was used to evaluate tgf1, opg, rankl, vegf, bsp and sparc expression . Image analysis of protein expression was performed through the quantification of immunohistochemical brown chromogen, expressed as percentage of positive area respect to total area of the field, as an average value per ten fields, randomly chosen, for each sample at light microscope observation . Moreover, intensity of staining (is) was graded on a scale of 04, according to the following assesssments: 0, no detectable staining; 1, weak staining; 2, moderate staining; 3, strong staining; 4, very strong staining, as previously reported . The positive immunolabeling for tgf1, opg, rankl, and vegf was cytoplasmic; the positive immunolabeling for bsp and sparc was in the pericellular space . Quantification of immunohistochemical brown chromogen was performed at 20 magnification by three different researchers, and the final result was a mean value of the three separate evaluations . Cohen's kappa coefficient was applied to measure the agreement between the three observers and averaged over all three to evaluate overall agreement using the following grading: 00.2 (slight), 0.210.40 (fair), 0.410.60 (moderate), 0.610.80 (substantial), and 0.811.0 (almost perfect) negative control images were randomly chosen . The statistical significance of the results was evaluated by the wilcoxon, mann - whitney test, using r software, ver . After collecting results, the mean data were reported and showed in an histogram using excel 2010 for microsoft windows . Twenty patients (13 males, 7 females; age ranging 4558) with inadequate bone volume in the posterior maxilla, were scheduled for bone augmentation procedures followed by implant placement . The patients were divided into two groups (n=10), according to the severity and morphology of the bone defect, mirroring classes c and f of the chiapasco's classification of the posterior maxilla (table 1). All patients received sufficient information about the inclusion in this study and gave written consent in accordance with italian legislation and with the code of ethical principles for medical research involving human subjects of the world medical association (declaration of helsinki). Ten patients (8 males, 2 females; age ranging 4554), having class c bone defects, underwent maxillary sinus augmentation procedure with a bone substitute of equine origin (biobone osteoconductor mix, biosaf in s.r.l ., ancona, italy) (group 1), and ten patients (5 males, 5 females; age ranging 4658), with class f bone defects, received an onlay bone graft and a maxillary sinus augmentation procedure with bone obtained from the parietal region of the calvaria (group 2). Table 1chiapasco's classification of the posterior maxilla.classheight of the residual ridgethickness of the residual ridgeinterarch distancea>5 mm <8 mm6 mmnormalb>5 mm <8 mm<6 mmnormalc<5 mm6 mmnormald<5 mm<6 mmnormale>5 mm <8 mm6 mmincreasedf>5 mm <8mm<6 mmincreasedg<5 mm6 mmincreasedh<5 mm<6 mmincreasedicompletely resorbed alveolar ridge with increased distance interarch and class iii skeletal relationships biobone osteoconductor mix is a reasorbable, collagen - deprived, and deantigenated osteoconductive biomaterial, obtained after a biological process of deantigenation at 37c in a humid atmosphere, made up of a corticocancellous mixture of equine origin (particles width 0.51 mm). The autologous bone blocks from the parietal region of calvaria were taken from calvaria under general anesthesia by a piezoelectric instrument (easy surgery, biosaf in s.r.l . ), shaped according to the dimension of the defects, properly fitted in the recipient site, and fixed with lag screw to rebuild the alveolar ridge . All gaps between the bone blocks and the recipient sites and the maxillary sinus were packed with bone chips obtained from the same donor site, and the grafted areas covered with a resorbable barrier (biobone collagen membrane, biosaf in s.r.l .) Post - operative healing was uneventful for all the patients, and therefore, after about 6 months they were scheduled for a second surgery for implant placement . Contextually the intervention of implant insertion, bone samples were retrieved by a 3 mm - diameter and 8 mm - height trephine bur under sterile saline solution irrigation in the sites of implant placement, in order to obtain significant specimens of bone regenerated with heterologous bone substitute in group 1 patients, while in group 2 patients bone samples were obtained from the lateral maxillary wall between the sites of implant placement . Samples of bone tissues were fixed in 10% phosphate - buffered formalin for 24 h, and decalcified in 10% tetrahydrated edta, according to data sheet (mielodec kit, bio - optica, milan, italy). Subsequently, they were dehydrated through ascending alcohols and xylene, and then paraffin embedded . Samples were dewaxed (xylene and alcohol at progressively decreasing concentrations), sliced 5 m thick and processed for hematoxylin - eosin staining and for immunohistochemical analysis . In order to detect tgf1, opg, rankl, vegf, bsp, and sparc proteins, immunohistochemistry was performed on 5 m - thick sections by means of ultravision lp detection system hrp polymer & dab plus chromogen (lab vision thermo, ca, usa). To reduce non - specific background staining due to endogenous peroxidase slides were then incubated in the presence of mouse anti - tgf1, anti - rankl and anti - sparc monoclonal antibodies, and rabbit anti - vegf polyclonal antibody (santa cruz biotechnology, santa cruz, ca, usa), mouse anti - opg monoclonal antibody (acris antibodies, herford, germany), and mouse anti - bsp monoclonal antibody (calbiochem, darmstadt, germany). Peroxidase was developed using diaminobenzidin chromogen (dab), and nuclei were hematoxylin counterstained . Negative controls were performed by omitting the primary antibody . Randomly selected slides belonging to each sample were then observed by means of leica dm 4000 light microscopy (leica cambridge ltd, cambridge, uk), equipped with a leica dfc 320 camera (leica cambridge ltd) for computerized images . After digitizing the images obtained from the immunohistochemical stained sections, qwin plus 3.5 software (leica cambridge ltd) was used to evaluate tgf1, opg, rankl, vegf, bsp and sparc expression . Image analysis of protein expression was performed through the quantification of immunohistochemical brown chromogen, expressed as percentage of positive area respect to total area of the field, as an average value per ten fields, randomly chosen, for each sample at light microscope observation . Moreover, intensity of staining (is) was graded on a scale of 04, according to the following assesssments: 0, no detectable staining; 1, weak staining; 2, moderate staining; 3, strong staining; 4, very strong staining, as previously reported . The positive immunolabeling for tgf1, opg, rankl, and vegf was cytoplasmic; the positive immunolabeling for bsp and sparc was in the pericellular space . Quantification of immunohistochemical brown chromogen was performed at 20 magnification by three different researchers, and the final result was a mean value of the three separate evaluations . Cohen's kappa coefficient was applied to measure the agreement between the three observers and averaged over all three to evaluate overall agreement using the following grading: 00.2 (slight), 0.210.40 (fair), 0.410.60 (moderate), 0.610.80 (substantial), and 0.811.0 (almost perfect) negative control images were randomly chosen . The statistical significance of the results was evaluated by the wilcoxon, mann - whitney test, using r software, ver . After collecting results, the mean data were reported and showed in an histogram using excel 2010 for microsoft windows . Morphological analysis was performed at light microscope after hematoxylin - eosin staining (figure 1). In group 1 specimens the native bone tissue and connective tissue fibers could be identified . Moreover, the grafted biomaterial particles are easily distinguished (purple areas) due to their lack of tissue structure, as better shown by the inset . Group 2 sample shows large mineralized areas close to dense areas of connective tissue, within which newly formed bone is recognizable because of osteocyte lacunae lack and absence of lamellar organization (inset). Molecular modifications occurring after bone substitutes placement, concerning their ability to be integrated and to be clinically suitable, tgf-1 expression, essential for osteoblastic differentiation and osteoid and extracellular proteins production, do not show any statistically significant difference between the two experimental groups (figure 2); in fact, moderate tgf-1 immunolabeling is seen both in group 1 and group 2 . Moreover, since tgf-1 stimulates opg production, inhibiting the rankl / rank interaction, opg and rankl expressions were checked . Moderate opg immunolabeling is found in group 1 and weak opg immunolabeling in group 2, whereas weak rankl immunolabeling is seen both in group 1 and group 2 . However, group 1 samples show a mean ratio of about four fold higher than that observed in group 2 specimens (2.4 vs 1.1), due to the concomitant increase of opg and a significant decrease of rankl expression in samples from sites regenerated with the equinederived bone substitute (figure 3). When the expression of vegf, an angiogenic factor involved in early bone remodeling phases, was evaluated a very strong vegf immunolabeling in group 1 and strong vegf immunolabeling in group 2 magnification 20. group 1: bone tissue specimens obtained from equine - derived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area . Inset (40x) shows, in group 1 specimens, grafted biomaterial particles, in group 2 specimens, large mineralized areas within which newly formed bone can be recognized because of osteocyte lacunae lack and absence of lamellar organization; xb, xenogenous bone; ob, old bone; nb, new bone . Magnification 20. group 1: bone tissue specimens obtained from equine - derived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area . Inset (40x) shows, in group 1 specimens, grafted biomaterial particles, in group 2 specimens, large mineralized areas within which newly formed bone can be recognized because of osteocyte lacunae lack and absence of lamellar organization; xb, xenogenous bone; ob, old bone; nb, new bone . Figure 2a) immunohistochemical analysis of tgf1 expression in group 1 and group 2 specimens . Magnification 20. group 1: bone tissue specimens obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Moderate tgf1 immunolabeling of both group 1 and group 2 bone tissue; no tgf1 immunostaining is seen in negative control . B) graphic representation of densitometric analysis of tgf1 positive area sd, determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification . Magnification 20. group 1: bone tissue specimens obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), moderate tgf1 immunolabeling of both group 1 and group 2 bone tissue; no tgf1 immunostaining is seen in negative control . B) graphic representation of densitometric analysis of tgf1 positive area sd, determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification . Figure 3a) immunohistochemical analysis of opg expression in group 1 and group 2 specimens . Moderate opg immunolabeling in group 1 and weak opg immunolabeling in group 2 bone tissue; no opg immunostaining is seen in negative control . B) immunohistochemical analysis of rankl expression, in group 1 and group 2 specimens, respectively . Group 1: bone tissue specimens obtained from equine - derived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Weak rankl immunolabeling in both group 1 and group 2 bone tissue; no rankl immunostaining is seen in negative control . Moderate opg immunolabeling in group 1 and weak opg immunolabeling in group 2 bone tissue; no opg immunostaining is seen in negative control . B) immunohistochemical analysis of rankl expression, in group 1 and group 2 specimens, respectively . Group 1: bone tissue specimens obtained from equine - derived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Weak rankl immunolabeling in both group 1 and group 2 bone tissue; no rankl immunostaining is seen in negative control . Figure 4a) immunohistochemical analysis of vegf expression in group 1 and group 2 specimens . Magnification 20. group 1: bone tissue samples obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Very strong vegf immunolabeling in group 1 and strong vegf immunolabeling in group 2 bone tissue; no vegf immunostaining is seen in negative control . B) graphic representation of densitometric analysis of vegf positive area sd determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification (* p<0.05). Magnification 20. group 1: bone tissue samples obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Very strong vegf immunolabeling in group 1 and strong vegf immunolabeling in group 2 bone tissue; no vegf immunostaining is seen in negative control . B) graphic representation of densitometric analysis of vegf positive area sd determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification (* p<0.05). Finally, new bone formation and bone mineralizing processes were assessed taking into consideration bsp and sparc expression levels, respectively . Weak bsp immunolabeling in group 1 and moderate bsp immunolabeling in group 2 is seen, whereas weak sparc immunolabeling in group 1 and moderate sparc immunolabeling in group 2 is evidenced (p<0.001) (figure 5). For all densitometric evaluations, interobserver agreement, measured using the kappa coefficient, was 0.90 (almost perfect). Figure 5a) immunohistochemical analysis of bsp expression in group 1 and group 2 specimens, respectively . Weak bsp immunolabeling in group 1 and moderate bsp immunolabeling in group 2 bone tissue; no bsp immunostaining is seen in negative control . B) immunohistochemical analysis of sparc expression, in group 1 and group 2 specimens, respectively . Magnification 20. group 1: bone tissue specimenss obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), weak sparc immunolabeling in group 1 and moderate sparc immunolabeling in group 2 bone tissue; no sparc immunostaining is seen in negative control . C) graphic representation of densitometric analysis of bsp and sparc positive area sd determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification (* p<0.001; * * p<0.001). A) immunohistochemical analysis of bsp expression in group 1 and group 2 specimens, respectively . Weak bsp immunolabeling in group 1 and moderate bsp immunolabeling in group 2 bone tissue; no bsp immunostaining is seen in negative control . B) immunohistochemical analysis of sparc expression, in group 1 and group 2 specimens, respectively . Magnification 20. group 1: bone tissue specimenss obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), weak sparc immunolabeling in group 1 and moderate sparc immunolabeling in group 2 bone tissue; no sparc immunostaining is seen in negative control . C) graphic representation of densitometric analysis of bsp and sparc positive area sd determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification (* p<0.001; * * p<0.001). Morphological analysis was performed at light microscope after hematoxylin - eosin staining (figure 1). In group 1 specimens the native bone tissue and connective tissue fibers could be identified . Moreover, the grafted biomaterial particles are easily distinguished (purple areas) due to their lack of tissue structure, as better shown by the inset . Group 2 sample shows large mineralized areas close to dense areas of connective tissue, within which newly formed bone is recognizable because of osteocyte lacunae lack and absence of lamellar organization (inset). Molecular modifications occurring after bone substitutes placement, concerning their ability to be integrated and to be clinically suitable, tgf-1 expression, essential for osteoblastic differentiation and osteoid and extracellular proteins production, do not show any statistically significant difference between the two experimental groups (figure 2); in fact, moderate tgf-1 immunolabeling is seen both in group 1 and group 2 . Moreover, since tgf-1 stimulates opg production, inhibiting the rankl / rank interaction, opg and rankl expressions were checked . Moderate opg immunolabeling is found in group 1 and weak opg immunolabeling in group 2, whereas weak rankl immunolabeling is seen both in group 1 and group 2 . However, group 1 samples show a mean ratio of about four fold higher than that observed in group 2 specimens (2.4 vs 1.1), due to the concomitant increase of opg and a significant decrease of rankl expression in samples from sites regenerated with the equinederived bone substitute (figure 3). When the expression of vegf, an angiogenic factor involved in early bone remodeling phases, was evaluated a very strong vegf immunolabeling in group 1 and strong vegf immunolabeling in group 2 magnification 20. group 1: bone tissue specimens obtained from equine - derived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area . Inset (40x) shows, in group 1 specimens, grafted biomaterial particles, in group 2 specimens, large mineralized areas within which newly formed bone can be recognized because of osteocyte lacunae lack and absence of lamellar organization; xb, xenogenous bone; ob, old bone; nb, new bone . Magnification 20. group 1: bone tissue specimens obtained from equine - derived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area . Inset (40x) shows, in group 1 specimens, grafted biomaterial particles, in group 2 specimens, large mineralized areas within which newly formed bone can be recognized because of osteocyte lacunae lack and absence of lamellar organization; xb, xenogenous bone; ob, old bone; nb, new bone . Figure 2a) immunohistochemical analysis of tgf1 expression in group 1 and group 2 specimens . Magnification 20. group 1: bone tissue specimens obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Moderate tgf1 immunolabeling of both group 1 and group 2 bone tissue; no tgf1 immunostaining is seen in negative control . B) graphic representation of densitometric analysis of tgf1 positive area sd, determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification . Magnification 20. group 1: bone tissue specimens obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), moderate tgf1 immunolabeling of both group 1 and group 2 bone tissue; no tgf1 immunostaining is seen in negative control . B) graphic representation of densitometric analysis of tgf1 positive area sd, determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification . Figure 3a) immunohistochemical analysis of opg expression in group 1 and group 2 specimens . Moderate opg immunolabeling in group 1 and weak opg immunolabeling in group 2 bone tissue; no opg immunostaining is seen in negative control . B) immunohistochemical analysis of rankl expression, in group 1 and group 2 specimens, respectively . Group 1: bone tissue specimens obtained from equine - derived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Weak rankl immunolabeling in both group 1 and group 2 bone tissue; no rankl immunostaining is seen in negative control . Moderate opg immunolabeling in group 1 and weak opg immunolabeling in group 2 bone tissue; no opg immunostaining is seen in negative control . B) immunohistochemical analysis of rankl expression, in group 1 and group 2 specimens, respectively . Group 1: bone tissue specimens obtained from equine - derived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Weak rankl immunolabeling in both group 1 and group 2 bone tissue; no rankl immunostaining is seen in negative control . Figure 4a) immunohistochemical analysis of vegf expression in group 1 and group 2 specimens . Magnification 20. group 1: bone tissue samples obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Very strong vegf immunolabeling in group 1 and strong vegf immunolabeling in group 2 bone tissue; no vegf immunostaining is seen in negative control . B) graphic representation of densitometric analysis of vegf positive area sd determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification (* p<0.05). Magnification 20. group 1: bone tissue samples obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), negative control . Very strong vegf immunolabeling in group 1 and strong vegf immunolabeling in group 2 bone tissue; no vegf immunostaining is seen in negative control . B) graphic representation of densitometric analysis of vegf positive area sd determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification (* p<0.05). Finally, new bone formation and bone mineralizing processes were assessed taking into consideration bsp and sparc expression levels, respectively . Weak bsp immunolabeling in group 1 and moderate bsp immunolabeling in group 2 is seen, whereas weak sparc immunolabeling in group 1 and moderate sparc immunolabeling in group 2 is evidenced (p<0.001) (figure 5). For all densitometric evaluations, interobserver agreement, measured using the kappa coefficient, was 0.90 (almost perfect). Figure 5a) immunohistochemical analysis of bsp expression in group 1 and group 2 specimens, respectively . Weak bsp immunolabeling in group 1 and moderate bsp immunolabeling in group 2 bone tissue; no bsp immunostaining is seen in negative control . B) immunohistochemical analysis of sparc expression, in group 1 and group 2 specimens, respectively . Magnification 20. group 1: bone tissue specimenss obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), weak sparc immunolabeling in group 1 and moderate sparc immunolabeling in group 2 bone tissue; no sparc immunostaining is seen in negative control . C) graphic representation of densitometric analysis of bsp and sparc positive area sd determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification (* p<0.001; * * p<0.001). A) immunohistochemical analysis of bsp expression in group 1 and group 2 specimens, respectively . Weak bsp immunolabeling in group 1 and moderate bsp immunolabeling in group 2 bone tissue; no bsp immunostaining is seen in negative control . B) immunohistochemical analysis of sparc expression, in group 1 and group 2 specimens, respectively . Magnification 20. group 1: bone tissue specimenss obtained from equinederived bone substitute grafted area; group 2: bone tissue specimens obtained from calvaria bone grafted area; c(-), weak sparc immunolabeling in group 1 and moderate sparc immunolabeling in group 2 bone tissue; no sparc immunostaining is seen in negative control . C) graphic representation of densitometric analysis of bsp and sparc positive area sd determined by direct visual counting of ten fields (mean values) for each of five slides per specimens at 20 magnification (* p<0.001; * * p<0.001). Regenerative procedures employing autologous, homologous or heterologous bone grafts lead to bone defect repair through different biological mechanisms . The very good results obtained with the use of autologous bone grafts were widely demonstrated . Histological and clinical studies showed the possibility to have predictable results with the use of calvaria bone grafts, with no inflammatory phenomena and a minimum resorption rate during the healing period, along with a high rate of clinical success for the subsequent implant rehabilitation . Clinicians are constantly searching for a heterologous bone substitute that combines the osteo - regenerative features of autologous bone eliminating the limits imposed by the need for a second surgery . Most of the currently used heterologous grafts do not show ideal characteristics for bone regeneration such as osteogenic, osteoinductive and angiogenic potentials, biological safety, no size restrictions, long shelf life and reasonable cost . The present study aimed to evaluate, by morphological and immunohistochemical analyses, an equine bone substitute and an autologous bone graft, 6 months after the graft placement, in terms of ability of integration with the host tissue . Complete healing is obtained during the remodeling phase, when osteoblasts and osteoclasts cooperate to convert the callus of a fracture in a definitive functional bone structure . For this reason, the first step of our study was to evaluate tgf1 expression, as its role in osteoblast / osteoclast coupling was demonstrated . Both group 1 and group 2 show a discrete tgf1 expression, suggesting that bone remodeling phenomena occurred in all the grafted areas . To better elucidate the host tissue response to the different bone substitutes, attention was focused on the opg / rankl ratio, often used as a bone resorption index . In fact, opg, by inhibiting the rankl / rank binding, protects osteoclastsmediated bone resorption acting on osteoclasts differentiation from precursors . Recent studies showed an increasing expression and activity of rankl in bone pathologies characterized by bone resorption such as osteoporosis and osteoarthritis, and a compensatory increase of opg in bone diseases, such as paget's syndrome, in which an anomalous higher bone formation takes place . The balance between rankl and opg controls the osteoclast activity and undergoes an endocrine regulation . In fact, it is usually preferable to evaluate opg / rankl ratio rather than opg and rankl absolute values . Thus an opg / rankl ratio <1 suggests a rankl predominant activity, and, as a consequence, bone resorption events are predominant; on the other hand an opg / rankl ratio> 1 reveals opg greater activity and predominant in new bone formation processes . The specimens of both groups show an opg / rankl ratio> 1, suggesting that the bone protection process was predominant on rankl / rank cascade activation . However, the lower values of group 2 specimen led us to hypothesize that the integration between host bone and autologous graft could be at a more advanced stage in respect to group 1 specimens, since the occurrence of bone resorption and new bone apposition phenomena was nearer to balance in group 2 . This evidence is also confirmed by morphological analysis, that reveals a stronger integration between host tissue and bone graft in group 2 specimens while, on the contrary, in group 1 specimens some of the equine - derived biomaterial particles are still evident and few newly formed mineralized tissue areas can be observed . In order to support these morphological aspects, angiogenesis, new bone formation and mineralization processes angiogenesis has a crucial role in the regulation of bone remodeling and repair .. new blood vessel formation is essential to allow circulating osteoclast and osteoblast precursors to move towards the site of remodeling . Moreover, vegf supports osteoblast growth in the initial phase of bone graft integration . In our study, vegf expression is higher in group 1 specimens indicating that intense neo - angiogenic phenomena were occurring in heterologous bone grafted sites, six months after the maxillary sinus augmentation procedure . This evidence could point to the fact that in autologous bone grafts this phase was already ended . In previous reports from our laboratory, in fact, extra - oral autologous bone grafts, showing an intense angiogenesis phenomena four months after grafting, with vegf values significantly higher than in native bone tissue were found . Furthermore, the expression of molecules, such as bsp and sparc, index of graft consolidation involved in new bone formation and mineralizing activity, indicate that sites treated with calvaria bone graft seemed to reach earlier a higher stage of mineralization compared to the equine bone grafted specimens . Such results led us to conclude that host bone tissue, undergoing regenerative phenomena, positively reacted to the placement of both biomaterials . In particular, the equine - derived biomaterial shows good characteristics, in terms of both clinical and microscopic integration . However, at the same experimental time, sites treated with autologous bone clearly show a better organization, which could ensure a better primary stability to the implant and a higher predictability of the implant - prosthetic rehabilitation . In addition, in sites treated with autologous bone, a balance between matrix deposition and resorption is observed, suggesting that the regenerative process shows a higher rate of progression, than in sites treated with the equine bone graft in which this process seems to be slower. |
Graft versus host disease refers to the inflammatory and/or fibrosing manifestations that may arise at various times after transplantation of any organ containing lymphoid cells, which react against and damage tissues in the immunocompromised host . The gvhd syndrome has traditionally been subdivided into two syndromes: acute gvhd and chronic gvhd . Graft versus host reaction (gvhr) is the expression of gvhd in a specific organ . Transfusion - associated (ta) gvhd is a rare but probably underdiagnosed disorder, which, although usually fatal, may evolve into chronic graft - versus - host disease . A 55-year - old female presented with complaints of increased pigmentation all over body since 4 years . The pigmentation initially started over right thigh and later spread to involve the entire body within few months . The patient gave history of receiving 2 units of cross - matched, unrelated, compatible blood for low hemoglobin (7.5 g%) about 6 months prior to the onset of pigmentation . The patient had attained menopause about 15 years back with no history of irregular menses or menorrhagia previously . Palms and soles showed reticular hyperpigmentation with atrophic skin over digits [figures 1a, 1b and 2]. (b): reticulate hyperpigmentation present all over the body anterior aspect reticulate hyperpigmentation, atrophic skin over palms oral cavity showed reticular hyperpigmentation over buccal mucosa [figure 3]. Hair over the scalp was sparse and lateral eyebrows were lost [figure 4]. Nails showed longitudinal ridging, distal niche, pterygium formation and atrophic changes [figure 5]. Reticulate hyperpigmentation over buccal mucosa, lips non - scarring diffuse alopecia over scalp, reticulate hyperpigmentation over the face distal niche, longitudinal ridging and pterygium over finger nails dermatoscopic study of pigmentation showed reticular pattern with dark brown - black pigment granules concentrating more at the corners of the network . Based on history and clinical features, differential diagnoses of lichen planus pigmentosus, connective tissue disease and chronic graft versus host disease were considered and relevant investigations were done . Investigations showed microcytic hypochromic anemia with hemoglobin of 9.5 g%, raised esr (50 mm / hr), reactive crp with negative ana and ra factor . Her liver function tests, renal function tests, random blood sugar, serum calcium, uric acid, and thyroid profile were within normal limits . Histopathological examination showed thick basket weave and laminated orthokeratotic stratum corneum, flattened epidermis, focal hypergranulosis, basal cell vacuolization, individual necrotic keratinocytes at dermoepidermal junction and thick, innumerable melanophages with sparse lymphocytic infiltrate in widened papillary dermis [figures 6 and 7]. Histopathology 10 (h and e) thick basket weave, laminated orthokeratotic stratum corneum, flattened epidermis, focal hypergranulosis, basal cell vacuolization, individual necrotic keratinocytes at dermoepidermal junction and thick, innumerable melanophages with sparse lymphocytic infiltrate in widened papillary dermis histopathology 40 (h and e) prominent orthokeratosis, individual necrotic keratinocytes, basal cell vacuolization in the background of history of blood transfusion, onset of symptoms after 6 months of blood transfusion, clinical features and histopathologic features, a diagnosis of lichenoid variant of chronic cutaneous graft versus host reaction was made . The patient was started on oral prednisolone 40 mg od and azathioprine 50 mg od, topical emollients and advised regarding photoprotection . However, the patient failed to follow up after starting treatment . Gvhd occurs when immunocompetent t cells from a donor recognize and react against foreign tissue antigens in an immunocompromised host . It may be the result of autoreactive t cells that escape negative selection in the thymus which has been damaged by preconditioning treatment, acute gvhd and/or age - related atrophy . The th2 immune responses of these donor - derived cd4 + t cells then stimulate host b cells to synthesize autoantibodies . In addition, ifn production by activated t cells induces hla - dr expression on keratinocytes, making them targets for a similar reaction . It is commonly observed after allogeneic bone marrow transplantation, (regularly used in the management of leukemias, lymphoma, immunodeficiency and inborn errors of metabolism), but ta gvhd is only rarely reported . Ta gvhd is recognized to occur following transfusion of blood, after materno fetal transfer of lymphoid cells, and peripheral blood stem cell transfer . Although early reports of ta gvhd were recognized in immunocompromised hosts, more recent cases have been documented in immunocompetent transfusion recipients . It has been documented after transfusion of unirradiated blood components, whole blood, fresh (nonfrozen) plasma, red blood cells, and platelets . Transfusions from donors homozygous for an hla haplotype to a recipient sharing this haplotype may predispose to ta gvhd in immunocompetent patient . There is an extremely high fatality rate for established acute ta gvhd, reaching 90% in some reports . Because of the very high early mortality, chronic gvhd secondary to blood transfusion has only rarely been reported . It may appear de novo, or following acute gvhd, in continuity or after a variable symptom - free period . It is usually a multisystem disease; localized disease also occurs, in which individual organs (usually skin or liver) are affected . The severity of individual organ involvement does not correlate well with the overall survival; the patient's functional performance is a better indicator of survival . It can develop spontaneously or be triggered by several events, notably uv irradiation, physical trauma, zoster, or even borrelia infections . Lichenoid lesions occur early, typically on periorbital skin, ears, palms, and soles . A slowly progressive erythematous rash on the face, palms and soles becomes lichenoid, with changes resembling lichen planus in many sites . Thinning of the nails, pterygium formation, phimosis, or vaginal strictures may also develop . Oral involvement is very common, with areas of erythema and atrophy, lichenoid or hyperkeratotic plaques, ulceration, and atrophic glossitis . Reticulate patchy hyperpigmentation and, less commonly, hypopigmentation, poikiloderma, vitiligo (which may be total), erythema, atrophy, alopecia, multiple follicular papules, deep ulcerations of the buttocks and legs, and dystrophic nail changes are other features . Both acute and chronic gvhd cause an interface dermatitis which may be a lichenoid lymphocytic infiltrate or predominantly vacuolar damage of basal cells . Satellitosis is particularly suggestive of gvhd, although no single histological feature is pathognomonic . The lichenoid lesions are similar to acute gvhd lesions, with a superficial dermal lymphocytic infiltrate, moderate exocytosis, and a variable degree of keratinocyte necrosis . Igm may occur at the dermal epidermal junction, with granular deposits of igm, iga and c3 in the walls of dermal vessels . Corticosteroids are the first choice for the treatment of chronic gvhd, but approximately 30% of patients require secondary systemic treatment . The lichenoid variant is usually well - controlled with a combination of corticosteroids and cyclosporine . Cyclophosphamide, methotrexate, azathioprine, mycophenolate mofetil, pentostatin, or high - dose thalidomide and hydroxychloroquine may be used if the first - line therapy fails . Puva photochemotherapy and narrow - band uvb phototherapy are other options for skin involvement, while extracorporeal photochemotherapy may improve cutaneous as well as systemic involvement . Granulocyte colony - stimulating factor, antilymphocyte globulin, tacrolimus, biological therapies, including etanercept, and particularly rituximab, may be helpful for steroid - resistant disease . Patients with the lichenoid type of eruption have a worse prognosis, with 80% mortality at 10 years . Prevention includes gamma irradiation of the lymphocyte - containing blood products and the use of third- or fourth - generation leukoreduction filters, although not 100% efficacious . Graft versus host disease can be induced when blood products containing viable lymphocytes engraft in recipients after transfusion . We hereby report a case of graft versus host disease occurring 6 months post blood transfusion . The disease affected skin, mucosa, hair and nails of the patient with no systemic symptoms and histology was suggestive of lichenoid gvhd . Chronic lichenoid gvhd, a disease usually seen post solid organ transplantation can rarely occur post blood transfusion.it can be limited only to skin, mucosa, nail and hair, without any systemic involvement and not causing much of functional impairment . Chronic lichenoid gvhd, a disease usually seen post solid organ transplantation can rarely occur post blood transfusion . It can be limited only to skin, mucosa, nail and hair, without any systemic involvement and not causing much of functional impairment. |
The increase in bacterial antibiotic resistance is a serious problem, increasing both in severity and importance . Therefore, it is necessary to find means of limiting or even preventing the transmission of pathogens within medical facilities . Surfaces in patients surroundings, including the door knob or handle, are a relevant transmission route for viruses and microorganisms,,, . Hospital staff, visitors, cleaning services and others are a potential source of contamination for door handles . In particular, the nursing staff with a hand - disinfection rate of under 50%, can spread pathogens, as can other employees, 4.6% of whom have been found to be colonized with mrsa . One alternative to avoid this route of transmission is to equip doors with a foot - operated door opener rather than with a door handle . A device for opening the door with the foot was fitted flush into the door leaf . A pedal (figure 1 (fig . 1)) is integrated into the device, which is built into the bottom of the door leaf . To open the door, this pedal is pulled out with the foot from the inside of the device, while the foot constantly remains on the surface of the pedal . After completely pulling the pedal out, the door can be pushed open or pulled open while keeping light pressure on the pedal with the foot . The surface design of the pedal provides the necessary grip of the shoe on the pedal during the movement to be executed . Subsequently, the door will briefly remain in the open position before the door closer starts to pull the door back into its frame . Using the foot pedal alone, this device makes it possible to open the door without manual operation . After opening of the door, there is ample time to pass through the open door . The foot - operated door opener is optionally equipped with a soft - closing mechanism . As a result, while opening the door with the foot door opener, the door latch (figure 1 (fig . 1)) will be kept inside the door lock by a mechanism integrated into the foot door opener . Only after complete closing of the door (i.e., the door is back in its frame) is the door latch released by the mechanism: the door latch slowly and quietly returns to its normal position in the counterpart within the door frame . The function of the door handle and the door lock itself is not affected . In both cases, opening with the door handle or foot - operated door opener, the door latch is triggered, which means a change in the mechanics of the normal door handle with its lock is not necessary . Only if the door lock itself is locked is it impossible to open the door with either the handle or the foot door opener . Equipped with the soft closing mechanism, the noise generated by the door latch hitting the door frame is completely prevented, and the noise generated by the door latch quickly snapping back into its counterpart in the door frame is almost imperceptible . The foot door opener makes the door handle superfluous in most cases . In addition, the transport of items that must be carried with both hands, e.g., trays, is facilitated . Another means of opening doors without using the hands is provided by door handles designed to be operated with the forearm . However, this type of handle can still be operated by hand and is thus in danger of becoming contaminated . Nevertheless, when used correctly, the forearm - operated door opener reduces the risk of cross - infection . Where door handles are coated with oligodynamic effective metals such as silver and copper in nanocrystalline form, the antimicrobial action takes effect only many hours later, and a false sense of security is produced . Based on unproven efficacy within a relevant exposure time, inactivation through protein loading, and the absence of evaluations on possible toxic risks, coating door handles with such compounds is not a reasonable alternative to the foot - operated door opener . If used correctly, the mechanical foot - operated door opener can completely avoid the transfer of pathogens . Additional advantages include: no electrical energy is necessary for operationno follow - up costs arise, e.g., from consumablesthe functionality of the existing door lock is not compromised, andnothing protrudes from the plane of the door leaf . No electrical energy is necessary for operation no follow - up costs arise, e.g., from consumables the functionality of the existing door lock is not compromised, and nothing protrudes from the plane of the door leaf . With the foot - operated door opener described here instead of the traditional manually operated door handle, it is possible to open doors with a foot pedal . Contamination of door handles with pathogens is thus avoided . Stefan preiss is responsible for sales / production at sass - systeme gmbh axel kramer declares that he has no competing interests . Stefan preiss is responsible for sales / production at sass - systeme gmbh axel kramer declares that he has no competing interests. |
Although superimposition of serial lateral cephalograms has been used to investigate the pattern and amount of tooth movement, it cannot be used for precise evaluation of tooth movement in the three - dimensional (3d) coordinates . Recently, a 3d virtual model has been introduced to analyze the movement of individual teeth by superimposition of pre- and post - treatment models.1 - 4 cha et al.2 reported no significant difference in the horizontal and vertical movements of the maxillary central incisor and first molar between superimposition of pre- and post - treatment lateral cephalograms and superimposition of pre- and post - treatment 3d virtual models . In addition, lai et al.3 asserted that 3d analysis of serial dental models could provide detailed information on tooth movements, especially in the transverse direction . In a 3d virtual model study of class i bialveolar protrusion cases treated with first premolar extraction, sliding mechanics, and conventional anchorage, cho et al.4 reported that the maxillary posterior teeth showed significant mesial - in rotation and contraction toward the midsagittal plane . The orthodontic mini - implant (omi, known as a temporary anchorage device) has been used to provide maximum or absolute anchorage during en masse retraction of the maxillary anterior tooth, especially for the treatment of class ii division 1 (div.1) patients . However, few studies have been published regarding the treatment of class ii div.1 patients with extraction of the maxillary first premolars and the mandibular second premolars, sliding mechanics, and omis . Therefore, the purpose of this retrospective study was to compare the effect of conventional and omi anchorage on tooth movement and arch dimension change of the maxillary dentition in class ii div.1 patients treated with extraction of the maxillary first premolars and the mandibular second premolars and sliding mechanics using superimposition of 3d virtual maxillary models pre- and post - orthodontic treatment . The following inclusion criteria, regarding age, skeletal pattern, angle's classification, arch form, and treatment methods, were applied to the study cohort: 1) to reduce the residual growth effect, the minimum age for treatment for female patients was 14 years and that of male patients was 17 years; 2) patients had class ii div.1 malocclusion, full class ii canine and molar relationships, and tapered or ovoid symmetric arch form; 3) patients received treatment with extraction of the maxillary first premolars and the mandibular second premolars; and 4) sliding mechanics (0.022-in mbt brackets [3 m unitek, monrovia, ca, usa] with 0.019 0.025-in stainless steel wire) was applied in these patients . The patients were divided according to the anchorage method into a conventional anchorage group (ca group, n = 12; transpalatal arch and/or extraoral headgear) and an omi anchorage group (oa group, n = 12, omis inserted at the buccal attached gingiva between the maxillary second premolar and first molar on both sides, 6 mm - length, 1.6 mm - diameter, dual - top, jeil med . Although the average period for extraction space closure was significantly shorter in the oa group than in the ca group (8.7 months vs. 9.8 months, p <0.05), no significant difference in age or skeletal and dental relationships was observed between the two groups (table 1). The 3d virtual maxillary models before (t0) and after treatment (t1) were constructed using a 3d laser scanner and the 3txer program (orapix, seoul, korea). Since the palatal rugae5 - 7 and the mid - palatal area between the maxillary first and second molars4 are considered to be stable during orthodontic treatment, these areas were used as reference areas for superimposition of the 3d virtual maxillary models at the t0 and t1 stages using the best fit method (rapidform 2006, 3d systems korea, inc ., the occlusal planes of the 3d virtual models were compared with those of the patients' lateral cephalograms . After superimposition of the t0 and t1 3d virtual models, the angular difference of the occlusal plane between the t0 and t1 stages was measured . The amount of change in the frankfort horizontal (fh) to the maxillary occlusal plane angle between the t0 and t1 stages was measured on the lateral cephalograms (figure 2). If the angular difference between the 3d virtual models and lateral cephalograms was greater than 5, superimposition of the 3d models was repeated to correct the error.4 the facial axis (fa) point8 was used as a reference point because it does not change during orthodontic treatment compared with the incisal edge or cusp tip.4 at the fa point of an individual tooth, a 3d coordinate system was established to measure the angular variables (figure 3). The three reference planes were used to locate the origin point and to measure the linear variables (figure 4). The reference points were digitized three times with a two - week interval by single examiner . Intraclass correlation coefficients (icc) for reference point identification were computed to assess intra - examiner reliability (repeatability). Since the assessment of the intra - examiner reliability for reference point identification showed excellent icc values (table 2), the first digitized data were used . The linear variables (figure 5), angular variables (figure 6), and arch dimension variables (figure 7) at t0 and t1 stages were measured with the 3txer program (orapix). Since there were no differences in measurement of the variables between the right and left dentition, the data from both sides were combined . Mann - whitney u - test for independent groups and wilcoxon singed - rank test for dependent data were performed for statistical analysis . There was significant difference in the values of linear variables between the two groups at t0 stage (table 3). In the ca group, the maxillary central and lateral incisors (mxci and mxli) moved backward (5.3 mm, 5.0 mm, both p <0.001) and were intruded (0.5 mm, p <0.05; 0.8 mm, p <0.001), and mxli moved laterally (1.1 mm, p <0.001). Although there was no significant change in vertical displacement of the maxillary canine (mxc), mxc moved backward and laterally (5.2 mm, 0.8 mm, both p <0.001). The maxillary second premolar, and first and second molars (mxp2, mxm1, and mxm2) were extruded (0.5 mm, p <0.01; 1.5 mm, p <0.001; 1.5 mm, p <0.001), moved forward (1.5 mm, 1.4 mm, 1.3 mm, all p <0.001) and contracted (1.1 mm, p <0.001; 1.4 mm, p <0.001; 0.8 mm, p <0.01). In the oa group, mxci, mxli, and mxc moved backward (6.9 mm, 5.9 mm, 6.4 mm, all p <0.001) and were intruded (1.8 mm, 1.4 mm, 1.1 mm, all p <0.001) while mxli and mxc moved laterally (1.5 mm, 1.4 mm, all p <0.001). Mxp2, mxm1, and mxm2 moved forward (0.5 mm, p <0.01; 0.4 mm, p <0.05; 0.3 mm, p <0.01) and were extruded (0.5 mm, p <0.05; 1.4 mm, p <0.001; 1.7 mm, p <0.001), and mxp2 and mxm1 showed contraction (0.4 mm, 0.5 mm, both p <0.05). In the comparison of the amount of change between the ca and oa groups, the oa group showed more backward movement of mxci, mxli, and mxc (6.9 mm vs. 5.3 mm, p <0.001; 5.9 mm vs. 5.0 mm, p <0.05; 6.4 mm vs. 5.2 mm, p <0.001); more intrusion of mxci and mxc (1.8 mm vs. 0.5 mm, 1.1 mm vs. 0.4 mm, both p <0.01); less forward movement of mxp2, mxm1, and mxm2 (0.5 mm vs. 1.5 mm, p <0.05; 0.4 mm vs. 1.4 mm, p <0.001; 0.3 mm vs. 1.3 mm, p <0.001); and less contraction of mxp2 and mxm1 (0.4 mm vs. 1.1 mm, p <0.05; 0.5 mm vs. 1.4 mm, p <0.001) than ca group . The two groups did not show significant difference in the values of angular variables at t0 stage (table 4). In the ca group, mxci and mxli inclined lingually (6.1, 3.2, both p <0.001), and although mxp2, mxm1, and mxm2 did not show significant changes in inclination, they showed mesial tipping (4.0, p <0.01; 5.2, p <0.01; 6.7, p <0.001) and mesial - in rotation (5.1, p <0.001; 3.3, p <0.001; 3.0, p <0.01). In the oa group, mxci and mxli were inclined lingually (10.1, 4.1, both p <0.001) and rotated distally (5.3, p <0.001; 6.1, p <0.01). Mxc did not show significant changes in inclination or angulation except for mesial - in rotation (2.1, p <0.05). Although mxp2, mxm1, and mxm2 did not show significant changes in inclination, they showed mesial tipping (3.1, p <0.01; 2.5, p <0.01; 3.8, p <0.001). Among them, only mxp2 was rotated mesially (4.2, p <0.01). When the amount of change was compared between the ca and oa groups, the oa group showed more lingual inclination of mxli (4.1 vs. 3.2, p <0.05) and less mesial - in rotation of mxm1 and mxm2 (3.3 vs. 0.7, 3.0 vs. 0.5, both p <0.05) than ca group however, mxp2, mxm1, and mxm2 did not show significant difference in the amount of change in mesial tipping between two groups . At t0 stage, there were no significant differences in the values of the arch dimension variables (table 5). Although inter - maxillary canine width (imxcw) was increased in both groups (1.6 mm vs. 2.4 mm), there was no significant difference between the two groups . However, inter - maxillary second premolar width (imxp2w), inter - maxillary first molar width (imxm1w), and inter - maxillary second molar width (imxm2w) were significantly decreased in the ca group compared to the oa group (2.5 mm vs. 0.7 mm, 2.4 mm vs. 0.9 mm, 2.7 mm vs. 0.7 mm, all p <0.05). Although maxillary molar depth (mxmd) was decreased after treatment in both groups, there was no significant difference between the ca and oa groups (7.5 mm vs. 7.2 mm, respectively). There was significant difference in the values of linear variables between the two groups at t0 stage (table 3). In the ca group, the maxillary central and lateral incisors (mxci and mxli) moved backward (5.3 mm, 5.0 mm, both p <0.001) and were intruded (0.5 mm, p <0.05; 0.8 mm, p <0.001), and mxli moved laterally (1.1 mm, p <0.001). Although there was no significant change in vertical displacement of the maxillary canine (mxc), mxc moved backward and laterally (5.2 mm, 0.8 mm, both p <0.001). The maxillary second premolar, and first and second molars (mxp2, mxm1, and mxm2) were extruded (0.5 mm, p <0.01; 1.5 mm, p <0.001; 1.5 mm, p <0.001), moved forward (1.5 mm, 1.4 mm, 1.3 mm, all p <0.001) and contracted (1.1 mm, p <0.001; 1.4 mm, p <0.001; 0.8 mm, p <0.01). In the oa group, mxci, mxli, and mxc moved backward (6.9 mm, 5.9 mm, 6.4 mm, all p <0.001) and were intruded (1.8 mm, 1.4 mm, 1.1 mm, all p <0.001) while mxli and mxc moved laterally (1.5 mm, 1.4 mm, all p <0.001). Mxp2, mxm1, and mxm2 moved forward (0.5 mm, p <0.01; 0.4 mm, p <0.05; 0.3 mm, p <0.01) and were extruded (0.5 mm, p <0.05; 1.4 mm, p <0.001; 1.7 mm, p <0.001), and mxp2 and mxm1 showed contraction (0.4 mm, 0.5 mm, both p <0.05). In the comparison of the amount of change between the ca and oa groups, the oa group showed more backward movement of mxci, mxli, and mxc (6.9 mm vs. 5.3 mm, p <0.001; 5.9 mm vs. 5.0 mm, p <0.05; 6.4 mm vs. 5.2 mm, p <0.001); more intrusion of mxci and mxc (1.8 mm vs. 0.5 mm, 1.1 mm vs. 0.4 mm, both p <0.01); less forward movement of mxp2, mxm1, and mxm2 (0.5 mm vs. 1.5 mm, p <0.05; 0.4 mm vs. 1.4 mm, p <0.001; 0.3 mm vs. 1.3 mm, p <0.001); and less contraction of mxp2 and mxm1 (0.4 mm vs. 1.1 mm, p <0.05; 0.5 mm vs. 1.4 mm, p <0.001) than ca group . The two groups did not show significant difference in the values of angular variables at t0 stage (table 4). In the ca group, mxci and mxli inclined lingually (6.1, 3.2, both p <0.001), and mxli rotated distally (5.2, p <0.01). Although mxp2, mxm1, and mxm2 did not show significant changes in inclination, they showed mesial tipping (4.0, p <0.01; 5.2, p <0.01; 6.7, p <0.001) and mesial - in rotation (5.1, p <0.001; 3.3, p <0.001; 3.0, p <0.01). In the oa group, mxci and mxli were inclined lingually (10.1, 4.1, both p <0.001) and rotated distally (5.3, p <0.001; 6.1, p <0.01). Mxc did not show significant changes in inclination or angulation except for mesial - in rotation (2.1, p <0.05). Although mxp2, mxm1, and mxm2 did not show significant changes in inclination, they showed mesial tipping (3.1, p <0.01; 2.5, p <0.01; 3.8, p <0.001). Among them, only mxp2 was rotated mesially (4.2, p <0.01). When the amount of change was compared between the ca and oa groups, the oa group showed more lingual inclination of mxli (4.1 vs. 3.2, p <0.05) and less mesial - in rotation of mxm1 and mxm2 (3.3 vs. 0.7, 3.0 vs. 0.5, both p <0.05) than ca group . However, mxp2, mxm1, and mxm2 did not show significant difference in the amount of change in mesial tipping between two groups . At t0 stage, there were no significant differences in the values of the arch dimension variables (table 5). Although inter - maxillary canine width (imxcw) was increased in both groups (1.6 mm vs. 2.4 mm), there was no significant difference between the two groups . However, inter - maxillary second premolar width (imxp2w), inter - maxillary first molar width (imxm1w), and inter - maxillary second molar width (imxm2w) were significantly decreased in the ca group compared to the oa group (2.5 mm vs. 0.7 mm, 2.4 mm vs. 0.9 mm, 2.7 mm vs. 0.7 mm, all p <0.05). Although maxillary molar depth (mxmd) was decreased after treatment in both groups, there was no significant difference between the ca and oa groups (7.5 mm vs. 7.2 mm, respectively). In the present study, significant differences were observed between the ca and oa groups in the amount of backward movement of the mxci (5.3 mm vs. 6.9 mm, p <0.001) and forward movement of the mxm1 (1.4 mm vs. 0.4 mm, p <0.001). These findings indicate that the oa group showed more retraction of the anterior teeth (ca 79.7% vs. oa 94.5%) and less anchorage loss of the posterior teeth (ca 20.3% vs. oa 5.5%) compared to the ca group . Creekmore,9 ziegler and ingervall,10 and thiruvenkatachari et al.,11 have reported 33% to 37.5% of anchorage loss of the posterior teeth in conventional anchorage . In the oa group, we observed significant intrusion of the fa points on the mxci and mxli (1.8 mm and 1.4 mm), which is in contrast to the result of cho et al.,4 who observed 2 mm extrusion of the maxillary anterior teeth in conventional anchorage . This difference appears to have occurred due to an intrusive force vector that connects elastics or springs to omis (figure 8). Upadhyay et al.12 also reported 1.3 mm intrusion of the maxillary central incisors in class ii div.1 patients treated with omis to retract the maxillary anterior teeth . Although the fa points of the maxillary molars were extruded in both the ca and oa groups (mxp2, -0.5 mm vs. -0.5 mm; mxm1, -1.5 mm vs. -1.4 mm; mxm2, -1.5 mm vs. -1.7 mm; ca group vs. oa group, respectively), the difference between the two groups was statistically and clinically insignificant . The reason why the fa points of the maxillary posterior teeth were extruded in both ca and oa groups seemed to be related with changes in inclination (mxp2, 0.8 vs. 1.2; mxm1, 0.0 vs. 1.6; mxm2, -0.9 vs. 1.6; ca group vs. oa group, respectively), lateral displacement (mxp2, 1.1 mm vs. 0.4 mm; mxm1, 1.4 mm vs. 0.5 mm; mxm2, 0.8 mm vs. 0.3 mm; ca group vs. oa group, respectively), rotation (mxp2, 5.1 vs. 4.2; mxm1, 3.3 vs. 0.7; mxm2, 3.0 vs. 0.5; ca group vs. oa group, respectively), and resolution of the curve of spee in the maxillary arch . In both two groups, there was opposite movement in lateral displacement between the upper anterior and posterior teeth: distraction of the mxli and mxc (1.1 mm and 0.8 mm in the ca group, both p <0.001; 1.5 mm and 1.4 mm in the oa group, both p <0.001) and contraction of the mxp2 and mxm1 (1.1 mm and 1.4 mm in the ca group, both p <0.001; 0.4 mm and 0.5 mm in the oa group, both p <0.05). In addition, a significant difference existed in the amount of contraction of the mxp2 and mxm1 between the ca and oa groups (1.1 mm vs. 0.4 mm, p <0.05; 1.4 mm vs. 0.5 mm, p <0.001, respectively). The ca group had similar amounts of contraction in the posterior teeth to those described by cho et al.,4 who reported 1.2 mm to 1.4 mm in the posterior teeth . However, the oa group showed a nearly stable position of the posterior teeth in lateral displacement because omis could prevent or minimize the forward movement and mesial - in rotation of the posterior teeth, and a lateral force vector could avoid constriction of the arch (figure 8). The amount of lingual inclination of the mxci in the ca and oa groups (6.1 and 10.1, respectively) indicates that omis could produce more lingual inclination than conventional anchorage . Upadhyay et al.12 reported 12.4 lingual inclination of the mxci in class ii div.1 patients treated with omis; a similar finding was obtained in the present study . The amount of mesial - tipping of the mxm1 in the ca group (5.2) was similar to that reported by upadhyay et al.13; 4 in the conventional treatment of class ii malocclusion based on superimposition of the cephalograms . However, omis reduced mesial tipping of the mxm1 to 2.5 in the oa group, although there was no significant difference between the ca and oa groups . In the present study, the amount of mesial - in rotation of the mxc in the ca group (approximately 0.7) was similar to that reported by koh et al.14 (approximately 0.3 in the class i group) and different from that reported by cho et al.4 (distal - in rotation, 0.2). In addition, the amount of mesial - in rotation of the mxc in the oa group (2.1) was significantly greater than that reported by koh et al.14 the reason for this difference may be that the mxc rotated more mesially in the oa group than in the ca group due to rounding of the tapered arch form by alignment and en - masse retraction of the anterior teeth . The amounts of mesial - in rotation of the mxm1 and mxm2 in the ca group were approximately 3.0; this is similar to the result reported by cho et al.4 (approximately 4.0 in the class i group). However, the amounts of mesial - in rotation of the mxm1 and mxm2 in the oa group (0.7 and 0.5, respectively) were significantly lower than those reported by cho et al.4 these differences may help to establish the class i molar relationship and seem to be related to the effect of individual arch curvature, anchorage device, or treatment mechanics on the amounts of rotation of the mxm1 and mxm2 . There was a larger decrease in the imxp2w, imxm1w, and imxm2w in the ca group than in the oa group (2.5 mm vs. 0.7 mm, 2.4 mm vs. 0.9 mm, 2.7 mm vs. 0.7 mm, respectively, all p <0.05). The amount of decrease in the imxm1w in the ca group appears similar to that reported by ong and woods,15 who reported a 2.6 mm decrease in the maxillary intermolar width in the maxillary first premolar and mandibular second premolar extraction group using a preangulated edgewise appliance . However, in the oa group, since omis seemed to maintain the positioning of the maxillary posterior teeth and to produce less mesial - in rotation of the maxillary posterior teeth during space closure, the decrease in the imxp2w, imxm1w, and imxm2w was lower than in the ca group . Since the pattern and amount of changes in the fa point can be different from those of the incisal edge or cusp tip, the data obtained in this study should be carefully interpreted for clinical application . Although 3d virtual technology can be used to explain tooth movement and arch dimension change of the maxillary dentition, further studies are needed to define a clear methodology for superimposition of the mandibular dentition . In the treatment of class ii div.1 malocclusion, omis can provide less anchorage loss, mesial - in rotation of the maxillary posterior teeth, and less arch dimension change than does conventional anchorage during en - masse retraction of the maxillary anterior teeth. |
The cluster - chip captures ctc - clusters relying on the strength of cell - cell junctions as they flow under physiological flow speed through a set of triangular pillars (fig . The fundamental building block of the cluster - chip is formed by three triangular pillars, two of which form a narrowing channel that funnels the cells into an opening, where the edge of the third pillar is positioned to bifurcate the laminar flow . As blood flows, single blood cells and single ctcs divert to one of the two streamlines at the bifurcation, passing through the 12 m 100 m opening (fig . In contrast, ctc - clusters are held by the leading edge of the bifurcating pillar under a dynamic force balance, even if they are deformable enough to squeeze through either one of the openings (fig . Sharp bifurcating edge retains the captured ctc - cluster in both streamlines simultaneously and under this dynamic balance, cell - cell junctions within a ctc - cluster serve as points of support for a stable equilibrium (not possible for a single cell) while the bifurcating pillar serves as fulcrum (fig . The cluster - chip is optimized to handle cellular aggregates with processing flow speeds limited well below the physiological blood flow speed in human capillaries . Therefore, captured ctc clusters are not subjected to shear forces higher than those occur in vivo during circulation . 1d) is much lower than existing microfluidic and filter - based ctc isolation technologies . Yet the chip can interrogate clinical blood specimens at a rate of 2.5 ml / hr due to its highly parallel architecture (fig . The cluster - chip is purposely designed to also capture two - cell clusters because, our analysis shows ~92% of ctc - clusters are of oligoclonal nature, including the majority of two - cell clusters, and characterized by an elevated metastatic potential compared to single ctcs . The cluster - chip operates fundamentally different from filter - based technologies such as porous membranes or microfluidic traps . The cluster - chip captures cell clusters independent of their deformability allowing capture of ctc - clusters that might otherwise squeeze through a smaller pore (fig . 1). Moreover, captured clusters are retained under a dynamic force balance unlike filters where cells are primarily retained due to their surface tension and are exposed to damaging stresses . Finally the cluster - chip specifically captures cell clusters and does not trap single cells and this specificity enables clog - free processing of unprocessed whole blood samples . To characterize the device, we first spiked artificially formed clusters of the fluorescently labeled mda - mb-231 human breast cancer cells into unlabeled blood samples from healthy donors and captured them using the cluster - chip . To ensure against any chip - mediated cell aggregation, we introduced a 1:1 mixture of gfp - tagged single cells and mcherry - tagged clusters (230 cells) into whole blood, followed by cluster - chip capture (fig . All cancer cell clusters captured on the chip were exclusively mcherry positive, and all gfp - tagged single cells flowed unimpeded through the chip, without adhering to the captured clusters (fig . This is consistent with our probabilistic analysis, based on the rarity of ctcs within a blood specimen and the large number of uniformly distributed traps (supplementary fig . 2) to quantify the capture efficiency, we imaged and counted clusters captured on the cluster - chip and those that flowed through undetected (supplementary fig . The capture efficiency increases with the number of cells within the cluster and decreases with increasing flow rates (fig . The reduced capture at high flow rates may result from the failure of the dynamic force balancing smaller clusters, as well as the breaking up of captured clusters under higher shear stress . We therefore selected 2.5 ml / hr as the optimal flow rate, providing both high capture efficiency and high throughput (supplementary video 1). At 2.5 ml / hr, the cluster - chip captured 169/171 (99%) mda - mb-231 clusters with 4 cells (fig . The cluster - chip captured 28/40 (70%) of 3-cell clusters and 48/117 (41%) of 2-cell clusters . Distribution of captured 2-cell and 3-cell clusters to subsequent rows indicates that the capture efficiency for small clusters can further be improved by adding more rows (supplementary fig . 4). Also, the effectiveness of the ctc - cluster trap in capturing larger clusters (4-cell or more) at 2.5 ml / hr flow rate was confirmed as captured clusters were predominantly (> 80%) found in the first row . To ensure against possible damage to the captured clusters at 2.5 ml / hr, we compared the cluster size distribution in the spiked population with the captured population on the cluster - chip . We characterized the artificial clusters of fluorescently labeled mda - mb-231 cells using microscopy (supplementary fig . 5) followed by gently spiking into whole blood collected from a healthy donor (online methods). Comparison of the size distribution before and after processing show that cluster - chip does preserve the integrity of captured clusters (fig . . Moreover, majority (> 95%) of captured clusters were found in the first row excluding the possibility of damage due to bifurcating cluster traps . To compare the cluster - chip with filter - based isolation techniques, we processed simulated samples using the cluster - chip and membrane filters with 5m pore - diameter . Simulated samples were prepared by spiking clusters of mda - mb-231 cells into whole blood collected from healthy donors . We processed whole blood sample using the cluster - chip at 2.5 ml / hr at room temperature . The simulated samples processed with filters were diluted 1:10 (v / v) as whole blood samples led to clogging . In direct comparisons, the cluster - chip has higher cluster capture efficiency than membrane filters operated at different filtration pressures (0.11.5 psi) (fig . At 1.5 psi, typically used for filtration, we found that cluster capture is inefficient . At 0.1 psi, which is substantially lower than pressures typically employed for filtration, cluster capture efficiency increased to ~26% . At 0.1 psi, the effective whole blood processing rate of filter is comparable to the cluster - chip so further reduction is not practical (fig . Compared to single cell capture efficiencies reported for membrane filters, there may be two reasons for the lower cluster capture efficiency in our experiments . First, clusters are more likely to be lost during the wash step compared to single cells, which are partially or fully squeezed in pores . Second, we counted only intact clusters excluding some that were damaged (supplementary fig . Nevertheless, the operational conditions for filters were not optimized for clusters in our experiments and we cannot exclude that by changing some of the parameters, capture rate of viable clusters could increase . To compare the cluster - chip with another microfluidic platform, we processed matched specimens through the herringbone - chip (hb - chip), an antibody - based capturing chamber that we had first employed in detecting such clusters . We used three cell lines representing varying epcam expression levels observable across ctcs: mcf-7, representing high epcam - expressing epithelial breast cancer cells; mda - mb-231, mesenchymal triple - negative breast cancer cells with low epcam expression, and mcf10a - lbx1, an emt - induced breast cell line with virtually absent epcam expression . In direct comparisons, the cluster - chip had 50% and 400% higher efficiency than the anti - epcam coated hb - chip in capturing mcf7 and mda - mb-231 clusters, respectively (fig . Mcf10a - lbx1 clusters were not captured by the hb - chip, but were readily identified in the cluster - chip (10 differential capture) (fig ., the reliance on physical properties of clusters rather than on restricted cancer cell surface epitopes to isolate clusters makes the cluster - chip uniquely suited to studying cancers across different clinical settings . These include epithelial cancers in which activation of emt during cancer cell invasion triggers loss of epithelial markers, as well as non - epithelial cancers, such as melanoma . Besides sensitive capture, viable release of captured ctc - clusters is critically important for downstream molecular and functional assays . Despite the fact that clusters are not tethered to the cluster - chip through antibody - mediated interactions, we observed that release of captured ctc - clusters is incomplete, especially for large clusters, following reversal of the flow . Using reverse flow rates of 2.5250 ml / hr only succeeded in releasing 114/308 (37%) of captured clusters . To address this problem, we tested sample processing at lower temperatures, known to reduce non - specific cell adhesion . 3a), so as to cool the samples transiently, thereby avoiding prolonged cold exposure which is known to activate platelets . Processing samples at 4c substantially improved the cluster release efficiency: 188/236 (80%) of captured clusters were released under 250 ml / hr reverse flow . The improvement was particularly evident at low reverse flow speeds, which enabled the use of low shear forces, thereby enhancing release of viable cells (fig . Processing at 4c and release of clusters under 250 ml / hr reverse flow had no notable effect on cell viability (supplementary fig . We note that the cluster - chip technology is also compatible with non - adherent coating materials and sacrificial layer approaches . Processing blood samples at 4c also proved to substantially reduce non - specific binding by contaminating blood cells . In experiments with blood samples from healthy donors, the temperature - dependent reduction in on - chip leukocyte contamination was as high as 50-fold (fig . Moreover, less non - specific binding of leukocytes to the chip translates into a 15-fold higher product purity for cold - processed samples (fig . 3d), which is particularly important for downstream molecular applications . We applied the technology to blood samples collected from patients with metastatic cancer . Patients with breast cancer (n=27), melanoma (n=20) and prostate cancer (n=13) (supplementary table 1) provided consent according to an irb - approved protocol at massachusetts general hospital, and 4 ml of blood was directly processed through the cluster - chip, followed by immunofluorescence staining (online methods). We scored positive those clusters that were a) positive for specific and well - established cancer - associated markers for the disease type, and b) cd45 (leukocyte marker) negative . Previous studies indicate that those specific markers are very accurate for identifying bona fide cancer cells in circulation . A representative ctc - cluster from a patient with metastatic breast cancer is shown with on - chip capture (fig . In addition to fluorescence microscopic imaging of live cells, we used scanning electron microscopy (sem) to image fixed ctc - clusters on the chip from the same patient (fig ., we observed a ctc - cluster highly strained even under the very low flow speed in the cluster - chip . This case shows the extent that a ctc - cluster can deform and also points to the need for elasticity - independent capture mechanism of the cluster - chip, which the filter - based technologies fail to achieve . We identified ctc - clusters in 11/27 patients with breast cancer (40.7%, ~0.5 clusters / ml); 6/20 patients with melanoma (30%, ~0.15/ml) and 4/13 patients with prostate cancer (31%, ~0.28/ml) (fig . 4b). For some patients, multiple (23) blood samples were obtained and patients scored positive when a ctc - cluster was observed during at least one time - point . The number of cells within a ctc - cluster ranged from 2 to 19 cells and follows a trend toward exponential distribution (fig . We compared the number of ctc - clusters captured using the cluster - chip with the number of single ctcs simultaneously identified using ctc - ichip and found no correlation (supplementary fig . 9). When processing patient samples, we observed cell debris and fibrins, which did not interfere with chip operation due to large number of traps working in parallel . To test the versatility of the cluster - chip to address biology of ctc - clusters, we first measured tumor cell proliferation markers to explore intra - tumor cell heterogeneity, and then analyzed non - tumor cells that were adherent to tumor cells within the clusters . Staining for the proliferation marker ki67 correlates well with invasiveness and poor outcome in comparison with mitotic activity index or phospho - histone h3 staining . In a patient with metastatic breast cancer with large numbers of single and clustered ctcs, costaining of ctc - clusters for ki67, cytokeratin (tumor marker) and cd45 showed no notable difference between the proliferative index of these two cell populations: 34/64 (53%) ctcs within clusters were ki67-positive, compared with 162/439 (40%) single ctcs (fig . 5a and supplementary fig . The low shear stress of the cluster - chip also facilitates the identification of heterologous cell types that may be attached to tumor cells . Given recent progress in immunotherapy of cancer, the identification of leukocyte populations adherent to tumor cells in the circulation is of particular interest . Overall, we found non - tumor cells to be rare among clusters captured using the cluster - chip (<5% of 60 patients). While these cells consistently expressed of the pan - leukocyte marker cd45 (fig ., we used the cluster - chip to capture ctc - clusters from the blood of a breast cancer patient, released ctc - clusters in solution, stained them against the leukocyte cell surface markers, and then isolated intact ctc - clusters individually using a micromanipulator (fig ., we retrieved 15 ctc - clusters, and each of those clusters was individually subjected to rna - sequencing analysis using a next generation platform (solid 5500). Expression analysis revealed that a) all brx-11 ctc - clusters expressed low but detectable levels of ctc markers such as keratins, muc1, epcam and/or cdh1, b) 14/15 ctc - clusters expressed high levels of timp1, a matrix metalloproteinase widely associated to breast cancer cell survival and absent in wbcs, and c) all brx-11 ctc - clusters were associated to platelets transcripts, while control wbcs were not, consistent with previous reports (fig . Most ctc - clusters appeared to exist in a hybrid epithelial / mesenchymal state (supplementary fig . 11), a phenotype observed in instances of breast ctcs and consistent with the possibility of grouped migration . 5c) expressed transcriptional signatures of tissue - derived macrophages (e.g. High cd14, cd33 and cd68 expression) as well as cd45, keratins, timp1 and platelets transcripts (fig . No enrichment for other leukocyte subclasses were observed, including t cells, b cells, natural killer (nk) cells, hematopoietic stem cells (hscs) and granulocytes (fig . The cluster - chip captures ctc - clusters relying on the strength of cell - cell junctions as they flow under physiological flow speed through a set of triangular pillars (fig . The fundamental building block of the cluster - chip is formed by three triangular pillars, two of which form a narrowing channel that funnels the cells into an opening, where the edge of the third pillar is positioned to bifurcate the laminar flow . As blood flows, single blood cells and single ctcs divert to one of the two streamlines at the bifurcation, passing through the 12 m 100 m opening (fig . In contrast, ctc - clusters are held by the leading edge of the bifurcating pillar under a dynamic force balance, even if they are deformable enough to squeeze through either one of the openings (fig . Sharp bifurcating edge retains the captured ctc - cluster in both streamlines simultaneously and under this dynamic balance, cell - cell junctions within a ctc - cluster serve as points of support for a stable equilibrium (not possible for a single cell) while the bifurcating pillar serves as fulcrum (fig . The cluster - chip is optimized to handle cellular aggregates with processing flow speeds limited well below the physiological blood flow speed in human capillaries . Therefore, captured ctc clusters are not subjected to shear forces higher than those occur in vivo during circulation . 1d) is much lower than existing microfluidic and filter - based ctc isolation technologies . Yet the chip can interrogate clinical blood specimens at a rate of 2.5 ml / hr due to its highly parallel architecture (fig . The cluster - chip is purposely designed to also capture two - cell clusters because, our analysis shows ~92% of ctc - clusters are of oligoclonal nature, including the majority of two - cell clusters, and characterized by an elevated metastatic potential compared to single ctcs . The cluster - chip operates fundamentally different from filter - based technologies such as porous membranes or microfluidic traps . The cluster - chip captures cell clusters independent of their deformability allowing capture of ctc - clusters that might otherwise squeeze through a smaller pore (fig . 1). Moreover, captured clusters are retained under a dynamic force balance unlike filters where cells are primarily retained due to their surface tension and are exposed to damaging stresses . Finally the cluster - chip specifically captures cell clusters and does not trap single cells and this specificity enables clog - free processing of unprocessed whole blood samples . To characterize the device, we first spiked artificially formed clusters of the fluorescently labeled mda - mb-231 human breast cancer cells into unlabeled blood samples from healthy donors and captured them using the cluster - chip . To ensure against any chip - mediated cell aggregation, we introduced a 1:1 mixture of gfp - tagged single cells and mcherry - tagged clusters (230 cells) into whole blood, followed by cluster - chip capture (fig . All cancer cell clusters captured on the chip were exclusively mcherry positive, and all gfp - tagged single cells flowed unimpeded through the chip, without adhering to the captured clusters (fig . This is consistent with our probabilistic analysis, based on the rarity of ctcs within a blood specimen and the large number of uniformly distributed traps (supplementary fig . 2) to quantify the capture efficiency, we imaged and counted clusters captured on the cluster - chip and those that flowed through undetected (supplementary fig . The capture efficiency increases with the number of cells within the cluster and decreases with increasing flow rates (fig . The reduced capture at high flow rates may result from the failure of the dynamic force balancing smaller clusters, as well as the breaking up of captured clusters under higher shear stress . We therefore selected 2.5 ml / hr as the optimal flow rate, providing both high capture efficiency and high throughput (supplementary video 1). At 2.5 ml / hr, the cluster - chip captured 169/171 (99%) mda - mb-231 clusters with 4 cells (fig . The cluster - chip captured 28/40 (70%) of 3-cell clusters and 48/117 (41%) of 2-cell clusters . Distribution of captured 2-cell and 3-cell clusters to subsequent rows indicates that the capture efficiency for small clusters can further be improved by adding more rows (supplementary fig . The effectiveness of the ctc - cluster trap in capturing larger clusters (4-cell or more) at 2.5 ml / hr flow rate was confirmed as captured clusters were predominantly (> 80%) found in the first row . To ensure against possible damage to the captured clusters at 2.5 ml / hr, we compared the cluster size distribution in the spiked population with the captured population on the cluster - chip . We characterized the artificial clusters of fluorescently labeled mda - mb-231 cells using microscopy (supplementary fig . 5) followed by gently spiking into whole blood collected from a healthy donor (online methods). Comparison of the size distribution before and after processing show that cluster - chip does preserve the integrity of captured clusters (fig . . Moreover, majority (> 95%) of captured clusters were found in the first row excluding the possibility of damage due to bifurcating cluster traps . To compare the cluster - chip with filter - based isolation techniques, we processed simulated samples using the cluster - chip and membrane filters with 5m pore - diameter . Simulated samples were prepared by spiking clusters of mda - mb-231 cells into whole blood collected from healthy donors . We processed whole blood sample using the cluster - chip at 2.5 ml / hr at room temperature . The simulated samples processed with filters were diluted 1:10 (v / v) as whole blood samples led to clogging . In direct comparisons, the cluster - chip has higher cluster capture efficiency than membrane filters operated at different filtration pressures (0.11.5 psi) (fig . Typically used for filtration, we found that cluster capture is inefficient . At 0.1 psi, which is substantially lower than pressures typically employed for filtration, cluster capture efficiency increased to ~26% . At 0.1 psi, the effective whole blood processing rate of filter is comparable to the cluster - chip so further reduction is not practical (fig . Compared to single cell capture efficiencies reported for membrane filters, there may be two reasons for the lower cluster capture efficiency in our experiments . First, clusters are more likely to be lost during the wash step compared to single cells, which are partially or fully squeezed in pores . Second, we counted only intact clusters excluding some that were damaged (supplementary fig . Nevertheless, the operational conditions for filters were not optimized for clusters in our experiments and we cannot exclude that by changing some of the parameters, capture rate of viable clusters could increase . To compare the cluster - chip with another microfluidic platform, we processed matched specimens through the herringbone - chip (hb - chip), an antibody - based capturing chamber that we had first employed in detecting such clusters . We used three cell lines representing varying epcam expression levels observable across ctcs: mcf-7, representing high epcam - expressing epithelial breast cancer cells; mda - mb-231, mesenchymal triple - negative breast cancer cells with low epcam expression, and mcf10a - lbx1, an emt - induced breast cell line with virtually absent epcam expression . In direct comparisons, the cluster - chip had 50% and 400% higher efficiency than the anti - epcam coated hb - chip in capturing mcf7 and mda - mb-231 clusters, respectively (fig . Mcf10a - lbx1 clusters were not captured by the hb - chip, but were readily identified in the cluster - chip (10 differential capture) (fig ., the reliance on physical properties of clusters rather than on restricted cancer cell surface epitopes to isolate clusters makes the cluster - chip uniquely suited to studying cancers across different clinical settings . These include epithelial cancers in which activation of emt during cancer cell invasion triggers loss of epithelial markers, as well as non - epithelial cancers, such as melanoma . Besides sensitive capture, viable release of captured ctc - clusters is critically important for downstream molecular and functional assays . Despite the fact that clusters are not tethered to the cluster - chip through antibody - mediated interactions, we observed that release of captured ctc - clusters is incomplete, especially for large clusters, following reversal of the flow . Using reverse flow rates of 2.5250 ml / hr only succeeded in releasing 114/308 (37%) of captured clusters . To address this problem, we tested sample processing at lower temperatures, known to reduce non - specific cell adhesion . 3a), so as to cool the samples transiently, thereby avoiding prolonged cold exposure which is known to activate platelets . Processing samples at 4c substantially improved the cluster release efficiency: 188/236 (80%) of captured clusters were released under 250 ml / hr reverse flow . The improvement was particularly evident at low reverse flow speeds, which enabled the use of low shear forces, thereby enhancing release of viable cells (fig . Processing at 4c and release of clusters under 250 ml / hr reverse flow had no notable effect on cell viability (supplementary fig . We note that the cluster - chip technology is also compatible with non - adherent coating materials and sacrificial layer approaches . Processing blood samples at 4c also proved to substantially reduce non - specific binding by contaminating blood cells . In experiments with blood samples from healthy donors, the temperature - dependent reduction in on - chip leukocyte contamination was as high as 50-fold (fig ., less non - specific binding of leukocytes to the chip translates into a 15-fold higher product purity for cold - processed samples (fig . Patients with breast cancer (n=27), melanoma (n=20) and prostate cancer (n=13) (supplementary table 1) provided consent according to an irb - approved protocol at massachusetts general hospital, and 4 ml of blood was directly processed through the cluster - chip, followed by immunofluorescence staining (online methods). We scored positive those clusters that were a) positive for specific and well - established cancer - associated markers for the disease type, and b) cd45 (leukocyte marker) negative . Previous studies indicate that those specific markers are very accurate for identifying bona fide cancer cells in circulation . A representative ctc - cluster from a patient with metastatic breast cancer is shown with on - chip capture (fig . In addition to fluorescence microscopic imaging of live cells, we used scanning electron microscopy (sem) to image fixed ctc - clusters on the chip from the same patient (fig . 4a). In one case, we observed a ctc - cluster highly strained even under the very low flow speed in the cluster - chip . This case shows the extent that a ctc - cluster can deform and also points to the need for elasticity - independent capture mechanism of the cluster - chip, which the filter - based technologies fail to achieve . We identified ctc - clusters in 11/27 patients with breast cancer (40.7%, ~0.5 clusters / ml); 6/20 patients with melanoma (30%, ~0.15/ml) and 4/13 patients with prostate cancer (31%, ~0.28/ml) (fig . 4b). For some patients, multiple (23) blood samples were obtained and patients scored positive when a ctc - cluster was observed during at least one time - point . The number of cells within a ctc - cluster ranged from 2 to 19 cells and follows a trend toward exponential distribution (fig . We compared the number of ctc - clusters captured using the cluster - chip with the number of single ctcs simultaneously identified using ctc - ichip and found no correlation (supplementary fig . When processing patient samples, we observed cell debris and fibrins, which did not interfere with chip operation due to large number of traps working in parallel . To test the versatility of the cluster - chip to address biology of ctc - clusters, we first measured tumor cell proliferation markers to explore intra - tumor cell heterogeneity, and then analyzed non - tumor cells that were adherent to tumor cells within the clusters . Staining for the proliferation marker ki67 correlates well with invasiveness and poor outcome in comparison with mitotic activity index or phospho - histone h3 staining . In a patient with metastatic breast cancer with large numbers of single and clustered ctcs, costaining of ctc - clusters for ki67, cytokeratin (tumor marker) and cd45 showed no notable difference between the proliferative index of these two cell populations: 34/64 (53%) ctcs within clusters were ki67-positive, compared with 162/439 (40%) single ctcs (fig . 5a and supplementary fig . The low shear stress of the cluster - chip also facilitates the identification of heterologous cell types that may be attached to tumor cells . Given recent progress in immunotherapy of cancer, the identification of leukocyte populations adherent to tumor cells in the circulation is of particular interest . Overall, we found non - tumor cells to be rare among clusters captured using the cluster - chip (<5% of 60 patients). While these cells consistently expressed of the pan - leukocyte marker cd45 (fig ., we used the cluster - chip to capture ctc - clusters from the blood of a breast cancer patient, released ctc - clusters in solution, stained them against the leukocyte cell surface markers, and then isolated intact ctc - clusters individually using a micromanipulator (fig . 5c). From a single time - point, we retrieved 15 ctc - clusters, and each of those clusters was individually subjected to rna - sequencing analysis using a next generation platform (solid 5500). Expression analysis revealed that a) all brx-11 ctc - clusters expressed low but detectable levels of ctc markers such as keratins, muc1, epcam and/or cdh1, b) 14/15 ctc - clusters expressed high levels of timp1, a matrix metalloproteinase widely associated to breast cancer cell survival and absent in wbcs, and c) all brx-11 ctc - clusters were associated to platelets transcripts, while control wbcs were not, consistent with previous reports (fig . Most ctc - clusters appeared to exist in a hybrid epithelial / mesenchymal state (supplementary fig . 11), a phenotype observed in instances of breast ctcs and consistent with the possibility of grouped migration . 5c) expressed transcriptional signatures of tissue - derived macrophages (e.g. High cd14, cd33 and cd68 expression) as well as cd45, keratins, timp1 and platelets transcripts (fig . No enrichment for other leukocyte subclasses were observed, including t cells, b cells, natural killer (nk) cells, hematopoietic stem cells (hscs) and granulocytes (fig . We introduce a novel microfluidic technology that specifically isolates ctc - clusters from unprocessed blood samples of patients with cancer . The dynamic capture of multicellular structures as they are impaled on triangle structures under low flow conditions offers important new capabilities that are not readily achieved with current ctc isolation strategies . Existing technologies primarily target single ctcs and employ non - optimum processing conditions that result in lower sensitivity and specificity . Widely used batch purification techniques involve multiple processing steps that are likely to disrupt ctc - clusters . High - speed fluorescence imaging of minimally enriched blood samples are efficient for ctc - cluster detection but the low purity complicates downstream molecular analysis . Microfluidic devices optimized to isolate single ctcs can also isolate ctc - clusters, although substantial losses of clusters may be associated with the optimization of flow conditions for single ctc capture . Filtering blood samples through membranes with small pores may be effective, but these approaches employ high flow rates resulting in extremely high shear forces . As such, ctc - clusters are likely damaged or even squeeze through relatively smaller pores, as modeled in our computer simulation . Using the cluster - chip, we determined that ctc - clusters are heterogeneous, including both actively proliferating cells as well as apparently quiescent cells . Occasionally, ctc - clusters are also found associated with cells of the immune system, and our rna sequencing data revealed that these are most likely tumor - associated macrophages . This finding supports increasingly appreciated role played by tumor - associated macrophages in cancer progression . The fact that such tissue - derived macrophages travel with ctc - clusters in the bloodstream has implications for the ability to noninvasively monitor tumor - immune cell interactions, a potentially important benefit, given the increasing use of immune checkpoint blockade in the treatment of multiple different types of cancer . The cluster - chip enables label - free isolation of unfixed ctc - clusters from unprocessed whole blood specimens from patients with cancer . The reliance on structural properties of ctc - clusters is particularly important, given the variation in tumor epitope expression, as well as the ability of highly flexible clusters to pass through simple pores . The ability to capture ctc - clusters at relatively high frequency in patients with metastatic cancer and to release them for biological studies will enable detailed analyses of the physiological role of these clusters in the progression and metastasis of human cancer. |
Dislocation of an intraocular lens (iol) within the capsular bag is a rare, late complication of cataract surgery . Probably reduce the frequency of in - the bag iol dislocation but fail to prevent this complication fully . Frequency of in - the - bag iol dislocation increased with the development of cataract surgery technique . Previously reported factors associated with ctr and iol dislocation are pseudoexfoliation, uveitis, previous vitreoretinal surgery, high myopia, and trauma . This factors are identical in secondary in - the bag lens dislocation, without ctr support . It is not known which patients with predisposing factors are likely to benefit from ctr insertion and which patients require alternative iol fixation . The ctr device was introduced by hara and yamada, in the early 1990s, to stretch the lens capsule and retain the circular contour of the capsular bag equator after cataract removal, to prevent intraocular lens decentration and dislocation . Since then, various designs of ctrs have been in use . They are indicated in eyes with zonular weakness or dehiscence, including those with pseudoexfoliation syndrome, high myopia, mature cataract, and subluxated lenses, from marfan syndrome, ehlers - danlos syndrome, and other genetic diseases [7, 8]. There are fewer higher - order aberrations in eyes with a multifocal iol and a ctr than in eyes with a multifocal iol only . Management includes ctr removal, iol exchange, replacement with an anterior or a sutured posterior chamber iol, or suturing the iol through the bag to the iris or the sclera [11, 12]. Pseudoexfoliation syndrome has been the most frequently indicated factor in secondary in - the - bag iol dislocation . Retrospective series of 86 patients revealed that neither lens material nor lens design appears to play a role . Retrospective series available in the literature are very difficult to compare, as ctr insertion rates vary greatly between surgeons and depend on individual surgeon's experience and approach to dislocated lens . It would be a great advantage to be able to select the patients with zonule insufficiency, who can be fixed with ctr, from those, who require alternative iol fixation . We performed an analysis of the eyes with secondary iol / ctr complex dislocation within 5 years from surgery . Control group consisted of the eyes, where ctr was inserted and did not dislocate over the period of 5 years . Operating notes of 15 835 intraocular surgeries performed between january 2010 and december 2014 at the department of ophthalmology of the medical university of lodz were reviewed . 19 eyes of 17 patients' surgeries included ctr / iol complex removal or refixation, including removals associated and not associated with secondary lens implantation . 16 eyes of 15 patients (10 males and 5 female) aged from 49 to 82 years (mean 66.2 9.5) were analyzed . The time from primary cataract surgery was more than 5 years and one patient suffered blunt eye trauma, before ctr / iol complex dislocation was diagnosed . To select control group, we reviewed the notes of 10 789 cataract surgeries performed at the department of ophthalmology of the medical university of lodz between january 2007 and august 2010 . In 114 eyes of 106 patients, we identified 54 patients, remaining under the care of our out - patient department, who did not present with secondary iol dislocation, for 5 or more years . Age and sex matched group of 26 eyes of 26 patients (17 male and 9 female) aged from 56 to 85 (mean 68.9 7.2) were randomly selected from 54 and analyzed as a control group . 16 eyes of 15 patients, who presented with secondary ctr / iol complex dislocation within 5 years from primary surgery, were analyzed in respect ofcause of crystalline lens dislocation;preoperative or intraoperative diagnosis of lens dislocation or zonule dehiscence;axial length and iol power;pre - op refractive status;coexistent pathology.exclusion criteria were ctr / iol dislocation more than 5 years from primary surgery and blunt eye trauma as a cause of ctr / iol complex dislocation . We did exclude patients in whom trauma was the reason of crystalline lens subluxation before primary cataract surgery . The data were analyzed by means of descriptive statistics, and fisher's exact test and chi - squared test were used for significance . In all analyses, a statistically significant difference was assumed for p 0.05 . Cause of crystalline lens dislocation; preoperative or intraoperative diagnosis of lens dislocation or zonule dehiscence; axial length and iol power; pre - op refractive status; coexistent pathology . Axial lengths of the eyeball, refractive status, iol power, and timing of the diagnosis of zonule dehiscence and subluxation in analyzed groups are summarized in table 1 . In the group of patient with dislocation the axial length was 23.8 1.3 (from 21 to 29) and in the group without dislocation 20.7 1.2 (from 19 to 24), p = 0.008 . Preoperative diagnosis of zonule dehiscence was made in 13 patients with the dislocation group and in 7 patients without dislocation . Axial length of the eyeball in those patients was 23.8 1.1 from 21 to 29 and 20.6 0.8 from 19 to 22, respectively (p = 0.007). There were no statistically significant differences in any of the pathologies like clinically visible pseudoexfoliation, degenerative myopia, uveitis, glaucoma or ocular hypertension, and diabetes mellitus . Statistically significant difference was detected in the presence of the blunt eye trauma as a cause of lens subluxation . There were no cases in the dislocation group and 7 (26.9%) cases in the group without dislocation (p = 0.04). Axial length of the eyeball was statistically significant higher in the group of patients with ctr / iol complex dislocation . Two patients in this group had high degenerative myopia (axial length 28.4 mm and 29.5 mm, resp .) With myopic retinopathy . In both cases we performed second analysis of the group, having excluded this two cases of degenerative myopia and we repeated comparison with the control group . Statistical significance remained in respect of axial length of the eyeball (p = 0.009), iol power (p = 0.002), refraction in spherical equivalent (p = 0.001), and preoperative diagnosis of zonule dehiscence (p = 0.007). There were no statistically significant differences in clinically visible pseudoexfoliation (p = 0.9). Our retrospective analysis indicates that higher axial length of the eyeball and associated myopia and low iol power may be a strong predisposing factor to secondary dislocation of ctr / iol complex . We propose the hypothesis that longer axial length of the eyeball makes dislocation of the ctr / iol complex more likely especially the presence of pseudoexfoliation and other previously identified factors like uveitis, glaucoma, and vitreo - retinal surgery . It is likely that what makes difference is the diameter of the ctr / iol complex in relation to the diameter of the eyeball at the level of the ciliary processes . In cases where the diameter of the capsular bag stretched by the ring is significantly smaller than diameter of the eyeball at the level of ciliary body, where the ctr / iol complex is fixated, ctr fails to release the tension of the ciliary processes adequately and does not prevent further degeneration of the ciliary processes and makes dislocation more likely . There were no significant differences in the rate of pseudoexfoliation between the groups of patients with and without dislocation in our study . Pseudoexfoliation is most frequent factor responsible for zonule weaknesses [14, 15], but our findings help to understand why some patients with lens subluxation secondary to pseudoexfoliation remain stable with ctr and some patients suffer from secondary dislocation of the ctr / iol complex . It appears likely that axial length of the eyeball is one of the factors contributing . We decided to analyze the patients who presented with dislocation within 5 years from primary surgery . This decision was based on the assumption that early secondary dislocation is the one that surgeon would most like to prevent, and these patients would be the ones more likely to reveal predisposing features . Also the 5-year period from primary surgery to dislocation was based on the practicability of obtaining the control group . Composing a control group was a big challenge in this analysis, as it was difficult to obtain the patients who were operated on more than 5 years and still under the care of our department, to ascertain that no dislocation was present . In our series none of the patients with ctr / iol complex dislocation had blunt eye trauma as a reason for crystalline lens subluxation . Traumatic crystalline lens subluxations are due to mechanical rupture of the zonule in a specific area only and are not the reason for progressive zonule degeneration . Mutations in human fibrillin-1 and fibrillin-2, which are major constituents of tissue microfibrils, can affect multiple ocular components, including the ciliary zonule, lens, drainage apparatus, cornea, and retina . In ectopia lentis observed in marfan's syndrome, the fibers of the ciliary zonule appeared stretched or ruptured, consistent with a pathogenesis of haploinsufficiency, but in weill - marchesani syndrome, the problem appears to be aberrant formation of the zonule and the lens [18, 19]. Therefore, insights on the composition and formation of the zonule are especially valuable in the context of microfibril disorders . Fbn1, fbn2, and fbn3 can form homo- or heterotypic microfibrils [20, 21]. The anatomy of the zonular apparatus and its structural arrangement have been described previously using ultrasound biomicroscopy [22, 23] and scanning electron microscopy . The anterior zonule has a greater effect on the anterior lens surface, and the posterior zonule has a greater effect on the posterior lens surface . This may be due to the thickness difference between the anterior and posterior capsule and, potentially, the role of the hyaloid membrane and its connections with the posterior zonule, which could act together to augment the effect of posterior zonular tension . This may be another factor influencing the way ctr stretches the capsular bag following crystalline lens removal . In myopia, the mechanism for lens subluxation may be different than in pseudoexfoliation [4, 27]. Lens subluxation may be the result of progressive overstretching of the processes, and progressive elongation of the fibers, rather than degeneration and weakening without elongation which is more likely in pseudoexfoliation . Elongation of zonular processes may result from the disproportion between the crystalline lens size and the size of the eyeball . Following phacoemulsification, and ctr insertion, the capsule becomes more flat, and its diameter becomes larger than before surgery . In myopic eye it was not possible to obtain data on the stage of crystalline lens subluxation preoperatively and intraoperatively . It appears likely that the more the degrees of subluxation, the more the chance of ctr failure to secure it . Also the degree of zonule degeneration from pseudoexfoliation is not measurable at present and it is not possible to assess it unless subluxation is already present . Ctrs were inserted by different surgeons, and there may be in - between surgeon variation in the approach to the subluxated crystalline lens, but this inconsistency may only have a minimal impact on the conclusions . Axial length of the eyeball, myopia, and low iol power appear to play a role in secondary ctr / iol complex dislocation within 5 years from primary cataract surgery . Patients with cataracts or lens subluxation as the result of blunt eye trauma appear likely to remain stable with ctr . Preoperative diagnosis of lens subluxation increases the chances of secondary iol / ctr complex dislocation. |
The use of medical devices for temporary use or implantation in the blood circulation has resulted in an increased demand for evaluation of complications brought about by these devices . This resulted also in - better defined iso requirements for testing one important and relevant aspect of testing of medical devices is the condition of blood exposed to the device . Anticoagulation and flow conditions must be as similar as possible as in the clinical setting in order to achieve relevant test results . For some devices, including grafts, stents, and catheters, this implies similar anticoagulation treatment as used in clinical situations, but also high flow through or around the device to obtain relevant shear stress conditions [2, 3]. However, in some reports, blood was treated with other anticoagulants than in clinical situations . Animal models should be avoided if equally quality results may be obtained in other ways . In addition, animal blood has essential differences compared with human blood, particularly with regard to clotting and platelet function . Two types of in vitro flow models (often with human blood) have been used extensively: the modified chandler loop and the roller pump closed - loop system . The modified chandler loop consists of closed tubing partly filled with air . On rotation, devices in the tubing use of this system may induce artefacts due to major forces applied to blood elements and protein denaturation at the air - liquid interface [911]. This model appeared effective for short circulation times [1214], but intrinsic blood damage reduces sensitivity and does not allow prolonged exposure to blood . To overcome the disadvantages of these models, the hemobile was constructed . In addition, the tubing contains no air, and there is no mechanical device compressing the tubing . In this way it was attempted to reduce damage and activation and to simulate pulsatile flow in a frequency similar to the arterial circulation . The hemobile model was compared with the chandler loop and roller pump model for intrinsic damage to blood components and activation of platelets . The hemobile was further used in testing tubular structures made of various polymers to show its effectiveness in determination of hemocompatibility by means of in vitro circulation of human blood . Fresh human blood was obtained by vena puncture with a 19 gauge needle under low pressure from five healthy adult volunteers and anticoagulated with a clinical dose of heparin (1.5 iu / ml) (leo pharmaceutical products bv, weesp, the netherlands). Before starting the experiment, cell count (cell counter medonic ca 530, medonic, sweden) and platelet function analysis (platelet function analyzer-100) were performed and platelet aggregation was determined by adding 50 mmol adp to a mixture of 500 l of blood and 500 l of saline and with the use of a whole blood aggregometer (chrono log corp . Aggregometer, kordia life sciences, leiden, the netherlands) to confirm proper blood quality relevant for this study and to provide baseline characteristics . Three circulation models were compared; the modified chandler loop, roller pump, and hemobile model (figure 1). The principle of the modified chandler model is based on a chamber of air that remains on top of a vertical rotating circular loop (de spatel bv, roden, the netherlands). The roller pump is a nonocclusive pump for clinical use in extracorporeal circuits (stckert, munich, germany). The hemobile (haemoscan bv, groningen, the netherlands) consists of a cylinder, which is forced in a semirotating movement . On this cylinder the circular loop circuits can be positioned . Due to the semirotating movement and the slowness of blood, a pulsating movement of blood through the circuits is generated which mimics pulsatile flow . A ball valve ensures a directed flow of up to 40 ml / min through 3 mm tubing at 60 beats / min, thus creating shear stresses of 12 dynes / cm . Also, the flow wave form generated by the model is more physiological compared to the roller pump and chandler model . A comparative study was performed to assess intrinsic blood damage for three different closed - loop circulation models, without any test device in the circuit . Each set of experiments (three different circuits in triplicate) was performed five times with fresh venous blood from a different donor for each set . Due to restrictions of the chandler loop model, the flow through 3 mm tubing was limited to 25 ml / min (6 dynes / cm) in all experiments . The first set of experiments was performed under circumstances of similar flow (25 ml / min) in all three test systems . The following sets of experiments (n = 4) were performed with the roller pump and hemobile at an exceeded blood flow of 40 ml / min (12 dynes / cm), which resembles shear stresses in the coronary blood circulation . After these validation experiments, the hemobile was used to test the hemocompatibility of woven tubular structures from polyester (pet) fiber and dyneema purity uhmwpe fiber, in comparison with expanded polytetrafluoroethylene (eptfe) tubes . All experiments were performed with closed pvc tubing circuits (raumedic) with a length of 45 cm and an internal diameter of 3 mm . The hemobile circuits were fitted with a ball valve connector (halkey - roberts, street petersburg, fl, usa). The roller pump circuit was partially immersed in water, whereas the chandler loop and hemobile were completely placed in an oven (figure 1). The circuits of the roller pump and hemobile were filled with 4.5 ml of blood and the circuits rotating on the chandler loop system with 4.0 ml of blood and 0.5 ml of air . Cell count, platelet function analysis, and platelet aggregation measurements were performed on the circulated blood, as described above . The rest of the blood was mixed with 0.2 m edta and centrifuged at 11,000 g for one minute . Plasma was used for analysis of thromboxane b2 (txb2), thrombin - antithrombin iii (tat) complexes, elastase, and hemoglobin concentrations . Activation of the arachidonic acid pathway in platelets results in the release of the potent platelet aggregating agent thromboxane a2, which is rapidly converted to the inactive product txb2 . Txb2 was measured by means of an enzyme immunoassay (biotrak, amersham, uk), based on competition of labelled txb2 with sample txb2 . In this test the label is a peroxidase, which converts the substrate tetramethylbenzidine, yielding a yellow colour which is measured at 450 nm by a spectrophotometer (powerwave 200, biotek instruments, winooski, vt, usa). Thrombin formation during the in vitro experiments was determined by means of tat complexes in edta plasma . A tat elisa was performed with capture and detection of antibodies from cederlane laboratories (hornby, canada). Release of polymorphonuclear (pmn) elastase in vivo is a specific marker for inflammation reactions . Free in plasma, elastase is rapidly neutralised by 1-antitrypsin inhibitor to form a stable complex . Elastase was determined by elisa by means of capture antibody against human elastase and labelled detection antibody against alpha1 antitrypsin (affinity biologicals, ontario, canada). Complement activation was determined by elisa based on a mouse anti human c5 - 9 antibody (dako, glostrup, denmark) and goat anti - c5 detection antibody (quidel, san diego, ca, usa). Free hemoglobin as an index for erythrocyte damage was measured as described by harboe and using a spectrophotometer (power wave 200). The emptied pvc circuits and the incubated graft material were washed with tris - buffered saline (ph 7.4). Platelet adhesion onto the surface of the circuits was measured by means of a colorimetric assay, based on the presence of acid phosphatase in platelets . Platelet binding was measured based on the release of platelet acid phosphatase in citrate buffer (ph 5.4), containing p - nitrophenyl phosphatase and triton x100 . Substrate conversion is proportional to the amount of platelets, which was determined by a standard curve and platelet counting . Scanning electron microscopy (sem) was achieved on material fixated in 2% glutaraldehyde in cacodylate buffer, treated with osmium tetraoxide in cacodylate buffer and gold sputtered critical point dried samples . These were visualized at 2 kv (jeol 6301 f, jeol ltd ., anova was performed for all blood parameters to assess any difference in blood cell damage or activation between the circuits . Platelet - count was significantly reduced by the roller pump and by the modified chandler loop, but not by the hemobile (figure 2). Platelet function was partially decreased in all systems, in particular in the roller pump system . Platelet adhesion to the pvc tubing was lowest in the chandler loop (table 1). Txb2 and free hemoglobin were significantly higher after roller pump circulation than after chandler loop and hemobile circulation (table 1). Pump and hemobile could be applied at a flow of 40 ml / min, which was not possible with the chandler model . Platelet number remained higher, and hemolysis was lower in the hemobile circuits (table 2). Platelet count was reduced in the circuits containing a test chamber with eptfe, pet, or dyneema purity uhmwpe fiber by approximately 30% following circulation compared to baseline . Platelet function was reduced in all circuits to a similar extent (figure 3). Platelet binding based on the adhesion of antibody against the platelet gpiib receptor showed increased values on pet, whereas dyneema purity uhmwpe fiber had lowest gpiib receptors (figure 4). In the eptfe circuits, release of txb2 and tat was lowest, whereas elastase, complement activation, and hemolysis were lowest in dyneema purity uhmwpe fiber circuits (table 3). More detailed pictures showed platelets and fibrin usually separate and not as a dense thrombus on the surface . Differences between the 3 types of graft materials were not clear from these pictures, although eptfe seemed to remain more devoid of deposition than pet and dyneema purity uhmwpe fiber (figure 5). Initial experimental blood circulation models with a roller pump, already refined in previous studies [13, 14, 18], appeared efficient, reliable, and cost - effective to assess the haemocompatibility of grafts before their clinical use . However, blood damage induced by the pump caused a limitation of the exposure of the test object to circulating blood . The modified chandler loop model is currently most frequently used for these purposes [19, 20]. First, the continuous blood - air contact induces leukocyte and platelet aggregation, protein denaturation [911], and shear forces on particulate material, which can result in detachment [21, 22]. In our experiments, indeed less platelets were observed on tubing exposed to blood - air contact in the chandler loop than in the roller pump or hemobile circuit . The second disadvantage of the chandler loop is the limitation of blood circulation due to the requirement to keep the air on top of the circuit . Thus, our 3 mm tubing did not allow a blood flow over 25 ml / min, which is half of the arterial flow in the coronary system . At a flow of 25 and 40 ml / min, the hemobile could be used and was less traumatic for blood than the roller pump model . It is well known that any type of foreign body material can be thrombogenic by promoting the formation of thrombin and platelet activation, which facilitates platelets to adhere and to express surface receptors (gp iibiiia) of activated phase . Platelet binding becomes then irreversible and can promote more thrombus formation . Therefore, proper testing of the characteristics of graft material is an important issue in modulating blood interaction . The small tubular system used in the present models allows multiple tests with fresh human blood . The modified chandler loop and hemobile can be easily loaded with a number of circuits at a time . Fast screening of thrombogenicity of vascular grafts and other small medical devices is possible . The adjustable flow and shear and the pulsatility in the hemobile renders it in a model that allows standardised testing of these devices at the cost of low intrinsic blood damage, while closely mimicking the in vivo conditions . Our results indicated that the changes in circulating blood are most of all dependent on the material used in the test loop . Moreover a direct comparison of material surfaces was possible by using blood of the same donor for different circuits . The feasibility of the hemobile has been demonstrated by applying the model in hemocompatibility studies of different vascular graft materials . Woven tubes made of pet fiber and dyneema purity uhmwpe fiber have been compared to commercially available eptfe vascular graft . Our results showed that dyneema purity uhmwpe fiber has in many ways better properties than eptfe by lower activation of the inflammatory response and lower hemolysis . A limitation of in vitro models is mainly represented by the absence of an endothelial layer in the circulating system . Throughout the release of cytokines, the endothelium has a major role in mediating the interplay between the injured vessel wall and circulating blood cells [2426]. This is effectuated by the release of cytokines and (anti)thrombotic components as well as the expression of adhesion molecules . Prior to use in patients an animal model should prove the validity of the in vitro data . Nevertheless, all the other elements depicting the blood - graft phase boundary scene are present, while the use of human blood from one donor in test and control circuits is a major advantage for comparison of the materials. |
Congenital cystic adenomatoid malformations (ccam) of lung are rare congenital cystic lung lesions that arise from excessive proliferation of tubular bronchial structures . It is a rare lesion with incidence of 1 in 25,000 to 1 in 35,000 pregnancies and represents 25% of congenital lung malformations and 95% of congenital lung lesions . It was classified into 3 subtypes in 1977, and expanded into five types and renamed as congenital pulmonary airway malformation (cpam) by stocker in 2002 . Eighty percent of the lesions are recognized in neonatal period; however, there are reports even in adult population . Here, we have described two cases of ccam, stocker type ii and i, which were diagnosed by fetal autopsy . A 30-year - old g2 p1 l1, of nonconsanguineous marriage, had a normal antenatal course until 20.5 weeks of gestation, when she presented with history of per vaginal bleeding and abdominal pain since three days . ; she delivered a stillborn fetus, clinically it was concluded as inevitable abortion and after informed consent the fetus was sent for pathological examination . On autopsy, it was a male fetus weighing 1,450 g. external examination did not reveal any anomaly . On internal examination the right lung was enlarged (7 5 3 cm) cut - section showed cysts of varying sizes majority of them were <2 cm . On histology, right lungs showed multiple cysts relatively uniform in size resembling bronchioles, lined by stratified columnar epithelium, and having thin fibromuscular septa . Mucus production was not evident on periodic acid schiff (pas) staining [figure 1a - d]. All other visceral organs were congested, but well - developed and revealed no anomalies . With the above features, a pathological diagnosis of ccam stocker type ii was offered . (b and c) microscopy showing large cyst (bronchiole like) surrounded by small cysts, lined by stratified columnar epithelium and having thin fibromuscular septa (hematoxylin and eosin (h and e), 100). (d) high power of the large cyst showing lining epithelium (h and e, 400) a 29-year - old female g4 p3 l2, with history of 24.6 weeks of amenorrhea sought routine antenatal check - up . Her third baby girl died 3 days after birth, details of which was not available . Routine anomalous scan revealed polyhydramnios along with features of congenital diaphragmatic hernia (cdh). Pregnancy was terminated after informed consent and the fetus was sent for pathological evaluation . On autopsy, it was a female fetus . External examination revealed low set ears, short neck, and subcutaneous edema . On internal examination the left lung was enlarged (8 6 4 cm), and cystic in consistency . The enlarged left lung was pushing the diaphragm inferiomedially; hence, the spleen was found in umbilical region [figure 2a - c]. Cut - section of the left lung revealed multiple cysts, the larger one was occupying whole of the upper lobe [figure 2d]. On histology, left lung revealed cysts of varying sizes dominated by larger cysts accompanied by smaller cysts . The cysts were lined by flattened cuboidal epithelial cells having fibromuscular septa [figure 2e - g]. Focally, few of the cysts showed mucin production which was evident on periodic acid - schiff (pas) staining [figure 2h and i]. All other visceral organs were congested, but well developed and revealed no anomalies . With the above (a and b) gross photographs showing enlarged left lung occupying most of the thorax compressing heart and right lung . (c) gross photograph of enlarged left lung with hypoplastic right lung and heart . (d) cut - section of left lung showing multiple cysts, dominated by large cysts . (e) whole mount showing large cyst surrounded by small cysts (h and e, 2). (f and g) microscopy showing large cysts with surrounded small cysts, lined by flattened epithelium with fibromuscular septa (h and e, 100). (h and i) microscopy showing cysts with mucus production (arrow) (periodic acid schiff staining (pas), 100) a 30-year - old g2 p1 l1, of nonconsanguineous marriage, had a normal antenatal course until 20.5 weeks of gestation, when she presented with history of per vaginal bleeding and abdominal pain since three days . ; she delivered a stillborn fetus, clinically it was concluded as inevitable abortion and after informed consent the fetus was sent for pathological examination . On autopsy, it was a male fetus weighing 1,450 g. external examination did not reveal any anomaly . On internal examination the right lung was enlarged (7 5 3 cm) cut - section showed cysts of varying sizes majority of them were <2 cm . On histology, right lungs showed multiple cysts relatively uniform in size resembling bronchioles, lined by stratified columnar epithelium, and having thin fibromuscular septa . Mucus production was not evident on periodic acid schiff (pas) staining [figure 1a - d]. All other visceral organs were congested, but well - developed and revealed no anomalies . With the above features, a pathological diagnosis of ccam stocker type ii was offered . (b and c) microscopy showing large cyst (bronchiole like) surrounded by small cysts, lined by stratified columnar epithelium and having thin fibromuscular septa (hematoxylin and eosin (h and e), 100). (d) high power of the large cyst showing lining epithelium (h and e, 400) a 29-year - old female g4 p3 l2, with history of 24.6 weeks of amenorrhea sought routine antenatal check - up . Her third baby girl died 3 days after birth, details of which was not available . Routine anomalous scan revealed polyhydramnios along with features of congenital diaphragmatic hernia (cdh). Pregnancy was terminated after informed consent and the fetus was sent for pathological evaluation . On autopsy, it was a female fetus . External examination revealed low set ears, short neck, and subcutaneous edema . On internal examination the left lung was enlarged (8 6 4 cm), and cystic in consistency . The enlarged left lung was pushing the diaphragm inferiomedially; hence, the spleen was found in umbilical region [figure 2a - c]. Cut - section of the left lung revealed multiple cysts, the larger one was occupying whole of the upper lobe [figure 2d]. On histology, left lung revealed cysts of varying sizes dominated by larger cysts accompanied by smaller cysts . The cysts were lined by flattened cuboidal epithelial cells having fibromuscular septa [figure 2e - g]. Focally, few of the cysts showed mucin production which was evident on periodic acid - schiff (pas) staining [figure 2h and i]. All other visceral organs were congested, but well developed and revealed no anomalies . With the above (a and b) gross photographs showing enlarged left lung occupying most of the thorax compressing heart and right lung . (c) gross photograph of enlarged left lung with hypoplastic right lung and heart . (d) cut - section of left lung showing multiple cysts, dominated by large cysts . (e) whole mount showing large cyst surrounded by small cysts (h and e, 2). (f and g) microscopy showing large cysts with surrounded small cysts, lined by flattened epithelium with fibromuscular septa (h and e, 100). (h and i) microscopy showing cysts with mucus production (arrow) (periodic acid schiff staining (pas), 100) ccam is a rare developmental, non - hereditary, hamartomatous abnormality of lung with unknown etiology . It is usually a unilateral condition and restricted to one lobe, but can involve whole of one lung (as observed in our cases), or both the lungs . Based on the anatomical changes, development of human lung is subdivided into embryonal (3 - 7 weeks), pseudo glandular (7 - 17 weeks), canalicular (17 - 29 weeks), saccular (24 - 36 weeks), and alveolar (36 weeks to maturity). Ccam develops during the pseudo glandular and saccular period (7 - 35 weeks). Type i lesion constitute 50 - 70% and is composed of single or multiple large cysts (> 2 cm) lined by flattened, cuboidal cells frequently producing mediastinal herniation . Mucin production is unique to type i lesion (as observed in our case 2). Type ii lesion constitute 15 - 30% and are composed of multiple small cysts (<2 cm), lined by ciliated cuboidal to columnar epithelium, structure resembling that of respiratory bronchioles, and distended alveoli are present between the epithelium lined cyst . Type iii lesion constitutes 5 - 10% and are usually large bulky noncystic lesions producing mediastinal shift . Bronchial - like structures are lined by ciliated cuboidal epithelium and separated by masses of alveolus - sized structures by nonciliated cuboidal epithelium . Systemic anomalies reported in type ii lesions include; renal anomalies (b / l renal agenesis, abnormalities of ureter, bladder, and urethra), abdominal wall defects, central nervous system defects (hydrocephalus), spinal deformities, gastrointestinal defects (diaphragmatic hernia, jejuna atersia, tracheoesophageal fistula, and imforforate anus), cardiac anomalies (ventriculoseptal defects, tetralogy of fallot, and truncus arteriosis), sirenomelia, and anomalies of reproductive tract . In 2002 stocker, modified this classification by adding two more types (type 0 and iv) and renamed the lesion as cpam, type 0 of tracheobronchial origin has solid appearance with small and firm lungs; and microscopically shows bronchiolar type airway with cartilage, smooth muscle, and glands separated by abundant mesenchymal tissue . Type iv of distal acinar origin, has peripheral cystic type, large cysts (> 10 cm) lined by flattened epithelium and resting on loose mesenchymal tissue . The new classification is not much used as type 0 lesions are very difficult to differentiate from bronchogenic cyst and the similarities between type iv cyst and pleura pulmonary blastoma may cause problem in diagnosis . The diagnostic sonographic ultrasonographic feature of ccam is, multicystic lesions at the lung field and common differential diagnosis includes diaphragmatic hernia, bronchogenic cyst, cystic fibrosis, congenital lobar emphysema, and pulmonary sequestration . Ccam will have connections to tracheobronchial tree and derives its blood supply from pulmonary circulation . In contrast, pulmonary sequestration contains immature lung tissue without connection to tracheobronchial tree and derives its blood supply from aberrant systemic blood vessel . In the past, patients whose fetuses presented with presumed diagnosis of ccam were informed of poor prognosis and advised for termination, but recent studies revealed aggressive obstretric management and termination of pregnancy is not appropriate for patients with affected fetuses . Termination was offered to our case 2 since it was misdiagnosed as cdh in usg . For the lung masses, the intrauterine prognosis of the fetus is determined by fetal lung mass size (a single measurement of lung mass at the maximum diameter) or by the ccam volume ratio (cvr). Ccam volume is calculated by using a formula for prolate ellipse, with measurements of lung mass in three perpendicular planes . The cvr is calculated by dividing the ccam volume by head circumference (hc, measured in centimeter). Thus cvr = (l b w 0.52/hc). Cass et al ., in their large study observed that the size of the lung mass or cvr correlated strongly with the fetal outcome . The observed threshold values in their study were 5.2 cm for mass size and 2 for cvr . There was 100% survival of fetuses with mass values less than 5.2 cm and cvr <2 . In the fetuses with lung mass size more than 5.2 cm or cvr more than 2 were associated with marked mediastinal deviation, hydrops, ascites, and heart failure . If there are no signs of heart failure, then the fetuses will be benefited by maternal steroid therapy and serial thoracocentesis . The commonest presentation of ccam in postnatal life is progressive respiratory distress including tachypnea, grunting, retraction, and cyanosis; and in adults it usually presents as repeated chest infections . Chest x - ray, computed tomography (ct), and magnetic resonance imaging (mri) are helpful in diagnosis . The main complication of ccam in neonatal period is compression of the mediastinal structure producing cardiovascular compromise . In adult patient, ccam is a nidus for pneumonia, abscess formation, fungal infections, spontaneous pneumothorax, hemoptysis, air embolism, intralobar sequestration, and development of bronchogenic carcinoma . Serial antenatal sonographic evaluation, good obstetric care, and delivery at a tertiary care center are preferred plan of treatment for antenataly detected cases . Postnatal and in adults patients, lobectomy is the treatment of choice for symptomatic cases . Prognosis also depends on stocker type, type i lesions carry overall good prognosis . In type ii lesion, it is the associated anomalies that determine the prognosis . Type iii lesions carry bad prognosis as they are usually large and presents with cardiovascular compromise . Serial ultrasonographic evaluation, fetal lung mass size, cvr, and fetal echocardiography are needed for management of antenatally detected cases. |
Femtosecond laser flap creation systems like the femto ldv (ziemer ophthalmic systems ag, port, switzerland) have been successfully used in modern corneal and refractive surgery . Many femtosecond lasers like the ldv are offering advantages in terms of size, mobility, and safety . The femto ldv operates at high - pulse frequencies exceeding 5 mhz, approximately 1,000 times faster than other femtosecond laser technologies.1 this results in ultrashort laser pulses (200300 femtoseconds) of low - energy density, which reduces undesirable side effects and results in a smooth corneal stromal bed.1 some advantages of femtosecond technology over mechanical microkeratomes in flap creation for laser in situ keratomileusis (lasik) are well documented.28 still, both flap creation techniques can provide high safety and accuracy, and have become by many surgeons, the preferred method for flap creation in refractive surgery; however there is still little data available from paired - eye comparative studies . As these studies are performed on both eyes of the same patient, they represent an excellent tool to compare surgical setups, eliminating potential differences regarding the comparison of two different eyes of two different patients . In this study, one eye from each patient was randomly selected for femto ldv - assisted lasik treatment, while the fellow eye was operated using the amadeus ii microkeratome (amadeus; ziemer ophthalmic systems ag). The amadeus microkeratome operated at a blade oscillation frequency of 11,000 rpm and at a blade advance rate of 1.6 mm / second . The purpose of this study was to evaluate the flap predictability and the visual outcomes during a follow - up period of 6 months, investigating the potential advantages or disadvantages regarding both flap creation technologies . All procedures were performed at the eye clinic orasis / swiss eye research foundation in reinach, switzerland . Forty - four patients were included in the study; they underwent bilateral same - session lasik . The study was approved by the local institutional review board (kantonale ethikkommission ldv number 2006/11, aargau) and adhered to the tenets of the declaration of helsinki . The study included patients with the following types of refractive errors: myopia from 0.75 to 7.0; hyperopia; and astigmatism <+ 4.0 d. central corneal thickness was measured using corneal topography (orbscan ii version 3.0; bausch & lomb zyoptix) and was at least 500 m or more . Additional inclusion criteria were a minimum age of 21 years, normal corneal topographical findings with no suspicion of corneal ectatic diseases and a stable refraction of 0.5 d within the last 2 years before surgery . Patients were excluded if they had prior cataract or refractive surgery, abnormal corneal topographical findings, dry - eye syndrome, and/or amblyopia . Two patients who failed to comply with the follow - up program were excluded from the study . Patients were examined preoperatively and at the first day, first week, and first month, third month, and sixth month after surgery . All baseline examinations included slit - lamp examination, manifest refraction, objective refractometry (topcon, tokyo, japan), corneal topography (orbscan ii version 3.0; bausch & lomb zyoptix; bausch & lomb incorporated, bridgewater, nj, usa), pupillometry (procyon instruments ltd, london, uk), and wavefront aberrometry (zywave, bausch & lomb zyoptix; bausch & lomb incorporated, bridgewater, nj, usa). The visual outcomes were measured in snellen optotypes and then converted in logmar analogs.9 the visual outcome differences between the corrected distance visual acuity (cdva) at baseline and the uncorrected distance visual acuity (udva) at the first day postoperatively were set as the efficiency index for both groups . Trained optometrists who were unaware of the eye s group assignment measured the manifest refraction . Corneal morphology and corneal flap thickness were assessed intraoperatively directly after the flap was repositioned in place with the aid of optical coherence pachymetry (ocp) (technolas perfect vision gmbh) and at the first week postoperatively with the aid of confocal microscopy (heidelberg retinal tomograph ii; heidelberg engineering gmbh, heidelberg, germany). Measures of flap thickness deviation were made only at the center of the cornea . In this way, we could be sure of and objective to the measurement, since the center is, in our opinion, the best anatomical landmark to make comparisons among ocp and confocal microscopy findings . One eye of each patient was randomly chosen to undergo flap creation using the femto ldv, while the fellow eye underwent microkeratome . All patients were subjected to bilateral, same - session lasik using an excimer laser with an eye tracker (technolas 217p excimer; technolas perfect vision gmbh), performed by an experienced refractive surgeon . The best average aberrometry measurements were entered into the excimer laser for iris recognition without any manual adjustments . All patients were treated with a tissue - saving ablation profile, and the targeted outcome was set to emmetropia in all cases . All patients received a protective contact lens directly after surgery, and the patients were evaluated at the slit - lamp after 20 minutes . Topical therapy included topical combined corticosteroids with antibiotic eye drops (tobradex) four times daily for 2 weeks, and hourly preservative - free artificial tears (hyabak) during the first week postoperatively . For statistical analysis, medcalc version 12.7.5.0 was used . According to the distribution of data, all procedures were performed at the eye clinic orasis / swiss eye research foundation in reinach, switzerland . Forty - four patients were included in the study; they underwent bilateral same - session lasik . The study was approved by the local institutional review board (kantonale ethikkommission ldv number 2006/11, aargau) and adhered to the tenets of the declaration of helsinki . The study included patients with the following types of refractive errors: myopia from 0.75 to 7.0; hyperopia; and astigmatism <+ 4.0 d. central corneal thickness was measured using corneal topography (orbscan ii version 3.0; bausch & lomb zyoptix) and was at least 500 m or more . Additional inclusion criteria were a minimum age of 21 years, normal corneal topographical findings with no suspicion of corneal ectatic diseases and a stable refraction of 0.5 d within the last 2 years before surgery . Patients were excluded if they had prior cataract or refractive surgery, abnormal corneal topographical findings, dry - eye syndrome, and/or amblyopia . Two patients who failed to comply with the follow - up program were excluded from the study . Patients were examined preoperatively and at the first day, first week, and first month, third month, and sixth month after surgery . All baseline examinations included slit - lamp examination, manifest refraction, objective refractometry (topcon, tokyo, japan), corneal topography (orbscan ii version 3.0; bausch & lomb zyoptix; bausch & lomb incorporated, bridgewater, nj, usa), pupillometry (procyon instruments ltd, london, uk), and wavefront aberrometry (zywave, bausch & lomb zyoptix; bausch & lomb incorporated, bridgewater, nj, usa). The visual outcomes were measured in snellen optotypes and then converted in logmar analogs.9 the visual outcome differences between the corrected distance visual acuity (cdva) at baseline and the uncorrected distance visual acuity (udva) at the first day postoperatively were set as the efficiency index for both groups . Trained optometrists who were unaware of the eye s group assignment measured the manifest refraction . Corneal morphology and corneal flap thickness were assessed intraoperatively directly after the flap was repositioned in place with the aid of optical coherence pachymetry (ocp) (technolas perfect vision gmbh) and at the first week postoperatively with the aid of confocal microscopy (heidelberg retinal tomograph ii; heidelberg engineering gmbh, heidelberg, germany). Measures of flap thickness deviation were made only at the center of the cornea . In this way, we could be sure of and objective to the measurement, since the center is, in our opinion, the best anatomical landmark to make comparisons among ocp and confocal microscopy findings . One eye of each patient was randomly chosen to undergo flap creation using the femto ldv, while the fellow eye underwent microkeratome . All patients were subjected to bilateral, same - session lasik using an excimer laser with an eye tracker (technolas 217p excimer; technolas perfect vision gmbh), performed by an experienced refractive surgeon . The best average aberrometry measurements were entered into the excimer laser for iris recognition without any manual adjustments . All patients were treated with a tissue - saving ablation profile, and the targeted outcome was set to emmetropia in all cases . All patients received a protective contact lens directly after surgery, and the patients were evaluated at the slit - lamp after 20 minutes . Topical therapy included topical combined corticosteroids with antibiotic eye drops (tobradex) four times daily for 2 weeks, and hourly preservative - free artificial tears (hyabak) during the first week postoperatively . For statistical analysis, medcalc version 12.7.5.0 was used . According to the distribution of data, in the microkeratome (amadeus ii) group, the efficiency index at the first day, and until the first week after surgery, was reduced (p<0.0001). A significant improvement of the udva in comparison to the cdva at baseline was first observed by the end of the first month (p=0.0271). The deviation between intended flap thickness and the postoperative flap thickness measurement according to ocp was 16.8010.52 m for the microkeratome group and 6.475.19 m for the femtosecond laser group . In confocal microscopy, the deviation was 18.08 m 11.78 m for the microkeratome group and 4.28 m 3.24 m for the femtosecond laser group . With respect to paired t - tests, both comparisons of the means between the femtosecond laser and the microkeratome group using either ocp or confocal microscopy were statistically significant (p<0.001), while the difference between the type of measurement (ocp or confocal microscopy) for either group was not (figure 1). The efficiency index in the microkeratome group correlated with the difference between the intended flap thickness and the postoperative flap thickness measurement (p<0.038, r=0.28). A negative relationship was confirmed in the regression analysis (p<0.04, r=0.1428) regarding the difference in the m between the intended and achieved flap thickness and the postoperative efficiency index (figure 2). When expressing the visual outcomes as a logarithmic expression of the visual outcome (logmar) analogs,9 the microkeratome group lost 1.131.09 lines at the first day and 0.30.96 lines by the end of the first week . By the end of the first postoperative month, patients regained an average of 0.251.01 lines in comparison to the baseline measurements (p<0.001). In the femtosecond laser group, the efficiency index was stable (p=0.64). The udva was significantly increased at the end of the first week (p=0.0043; mean: 0.0020.13 logmar) and at the end of the first postoperative month when compared to the baseline cdva (p=0.001; mean: 0.0410.13). Overall, the efficiency index for the ldv group was higher than that for the microkeratome group . The average results of udva for both groups are displayed in table 2, and the average logmar results for both groups over the 6-month follow - up period are depicted in figure 3 . The difference in flap target thickness deviation and predictability between the femtosecond laser group and the microkeratome group was statistically significant (p<0.001), as shown in figure 1 . All eyes in the microkeratome group showed a minimal interface fluid accumulation, while the eyes in the femtosecond laser group did not . The sex of the patient, the dominance of the eye treated, the optical zone, the flap size, or the pupil size for either group did not correlate with the udva results in this study . Likewise, target spherical equivalent and root mean square were also not significantly different between groups . This prospective, randomized, masked, paired - eye study investigated the visual outcomes after lasik using two different devices for flap creation: the femtosecond laser ldv; and the amadeus ii . Overall results were excellent for both groups, with a udva of 20/20 or better at the first postoperative month . Overall, the efficiency index for the ldv group was higher than that of the microkeratome group, since the visual recovery in the microkeratome group was significantly delayed in comparison to the femtosecond laser group . Significant differences in visual acuity were evident between the two groups until the end of the first postoperative week . We could assume that this difference was due to a minimal interface fluid accumulation induced by the head or razor advancing system of the microkeratome and the oscillation of the microkeratome during flap creation . Complications, such as fluid accumulation or even debris at the interface, are frequent and well documented for both flap creation technologies.10,11,1723 the fluid accumulation in the microkeratome group resolved within a few days, and visual acuity recovery was noted as expected . Over the last few years, various studies regarding the accuracy of flap thickness creation with either the microkeratome or the femtosecond technology have surfaced.1216 measuring flap thickness deviation and comparing the two different flap creation systems is challenging and difficult . Recently, kanellopoulos and asimellis13 measured flap thickness deviation in a three - dimensional fashion including central, paracentral, and peripheral measurements . The comparison between the two different femtosecond lasers (fs60 and fs200) and a mechanical microkeratome (m2) showed a smaller flap thickness and a reduced variability in the intralase femtosecond in comparison to the microkeratome group . In this study, flap thickness deviation was measured only in the center of the cornea; since we used confocal microscopy and ocp for the measurement, the corneal center was the best and safest option, in our opinion, to use as an anatomical landmark to compare our findings . Our results demonstrated that flap creation with the femtosecond laser was more accurate and predictable . All flaps created using the femtosecond laser deviated significantly less from the intended flap thickness, as evaluated by confocal microscopy and ocp in comparison to the microkeratome group . Furthermore, the increased precision of the femtosecond laser seemed to have a direct effect on udva, since less deviation in terms of flap thickness from the intended value correlated with the udva postoperatively . A negative relationship was confirmed in the regression analysis regarding the impact of this difference between the intended and achieved flap thickness on the decrease of postoperative visual acuity . Several studies demonstrated the comparisons of these two flap creation technologies in terms of safety, flap thickness, flap predictability, udva, and stromal residual bed morphology.2228 durrie and kezirian2 reported that femtosecond laser (intralase) was superior to microkeratome (hansatome) for flap creation during lasik, providing lower postoperative astigmatism and trefoil . Rosa et al24 compared the flap thickness after microkeratome - assisted flap creation and femtosecond laser - assisted flap creation (intralase 60 khz) and concluded that flap predictability was superior in the femtosecond laser group . Although the visual outcomes we attained were excellent overall in both groups by the end of the first postoperative month, the superiority of the femtosecond laser technology was evident regarding the predictability and reproducibility of the flap thickness and the speed of visual recovery after the surgery . The ldv was extremely fast and safe, and it provided excellent visual outcomes; the amadeus microkeratome also produced remarkable results with the exception of the slower udva visual recovery . The microkeratome technology still represents a reliable method for customized lasik procedures.6,27,29,30 nevertheless, the ldv femtosecond laser provides superior results by more closely creating the desired flap thickness, thus accelerating the visual recovery in comparison to microkeratome.7,24,29,30 although microkeratome technology still provides reliable results and improvements in udva, it cannot outperform femtosecond technology . Flap creation with femtosecond technology is superior with respect to flap thickness predictability, reproducibility, and faster udva rehabilitation for the patient . Flap thickness deviations could possible play a role in delaying the visual acuity recovery of the patients. |
It is estimated that more than 4 million adults had diabetes in 2011, which showed 35% increment during past 7 years . Expanding epidemic of obesity is responsible in large part for a high prevalence of diabetes mellitus and impaired fasting glucose among iranian adults . Therefore, an increase in the risk of cardiovascular diseases including coronary heart disease (chd), is anticipated . In fact, the presence of diabetes is somehow considered equivalent to that of a history for chd . Consequently, the coexistence of diabetes and hypercholesterolemia further raises the risk of cardiovascular morbidity and mortality . Effective lipid lowering therapies especially statins are widely available to decline the cardiovascular risk across a wide range of patients particularly those with type 2 diabetes . Patients with type 2 diabetes are benefitted from statin therapy by decreasing the risk of chd and related clinical outcomes . Unfortunately, despite the availability of effective pharmacologic treatment and well - publicized therapeutic guidelines, elevated serum cholesterol levels remain uncontrolled in patients with hypercholesterolemia especially those with diabetes . The percentage of controlled cholesterol among united states adults receiving treatment increased from 45.0% in 1999 - 2000 to 63.6% in 2009 - 2010 . However high low - density lipoprotein (ldl) cholesterol remains the common problem in health care system . Significant gap between expected and actual benefit of statins may be attributed to the lack of enough follow - up or inappropriate titration of the starting statin dose . In addition, poor adherence may be considered amongst the most important reasons of failure to achieve the goals for dyslipidemia . In a retrospective cohort study, the proportion of days covered by statin treatment was 79% among elderly patients (23.5% with diabetes) during the first 3 months . Although adherence fell dramatically to 42% after 120 months follow - up . To the best of our knowledge, there is not enough information regarding statin adherence and/or goal attainment rates of ldl cholesterol of patients with type 2 diabetes in developing countries . To address these issues, we conducted a study to evaluate the adequacy of diabetic patients adherence to statin therapy for lipid management in a research based community clinic in iran . We conducted a prospective clinical study in patients with type 2 diabetes under treatment with statins . Iemrc is one of the largest outpatient diabetes research centers in the central part of iran which also provides medical care and educational program for patients with diabetes . The study protocol of this observational research project was approved by the institutional board for human studies at isfahan university of medical sciences (registration number, 3,87,311). All patients received a 15 min explanation of the study protocol in simple language by the principal investigator farsaei and if they announced to join the study, they were recruited . They also were free to leave the study whenever they want without depriving from normal medical care . All patients who took statins were identified during 3 months and included to the study . Among enrolled patients who did not have documented ldl cholesterol within 90 days after study inclusion or those who did not keep their scheduled visit 3 months after their initial visit were excluded . Totally, 204 patients with diabetes and prescription of statins were included during a 3-month sampling period . Pharmacist interviewed patients and filled out demographic data (age, body mass index [bmi], sex, education) and statin information (type, dose and initial number of prescribed statin) in data gathering form . In addition, data regarding ldl cholesterol over the same period were included to evaluate the relationship between ldl level and statin adherence . Since metformin could have a significant effect on lipid profile, data regarding administration dose of metformin were also gathered to compare between groups . All included patients were asked to return 3 months after initial visit for counting remained statins and calculate statin adherence . Subsequently, in the second visit remained medications in blisters were counted in all participants and adherence was calculated . In our study with pill count method, adherence of patients was expressed as a percentage of medicines taken during 3 months relative to the number of medicines that should have been taken during the same period . In addition, self - reporting was used to report medication behavior of patients during 3 months . In the same manner patients declared taking <80% of their prescribed statins were considered nonadherent to their treatment . Medication possession ratio (mpr) was also calculated during 3 months of study to evaluate its correlation with mean ldl cholesterol level . Continuous variables were expressed as mean standard deviation and categorical data as a percentage . Kolmogrov - smirnov test was carried out to assess the distribution of continuous variables . Student's t - test, chi - square, and mann whitney u - test were used to evaluate results . In addition, pearson correlation was used to evaluate the association between mpr and ldl cholesterol level ., chicago, il, usa), and two - tailed p <0.05 was considered for statistical significance in all analyses . The research protocol for this study was approved by the board of human studies of the isfahan university of medial sciences . Continuous variables were expressed as mean standard deviation and categorical data as a percentage . Kolmogrov - smirnov test was carried out to assess the distribution of continuous variables . Student's t - test, chi - square, and mann whitney u - test were used to evaluate results . In addition, pearson correlation was used to evaluate the association between mpr and ldl cholesterol level . Data processing was performed by spss statistical software version 11.5 software (spss inc ., chicago, il, usa), and two - tailed p <0.05 was considered for statistical significance in all analyses . The research protocol for this study was approved by the board of human studies of the isfahan university of medial sciences . Among 204 patients met inclusion criteria, 46 patients were excluded during the study and final analyses were conducted with the data from 158 patients who completed the study [figure 1]. Lovastatin was prescribed for more than 98% of patients in our study with dose of 10.2 3.7 mg daily and <2% of patients received atorvastatin or simvastatin as cholesterol lowering agent . Follow - up chart of the studied patients overall, 20.3% (n = 32) of patients were considered nonadherent to statin therapy and only 31.6% (n = 50) of patients achieved their ldl cholesterol goal <100 mg / dl . Although higher percent of males had adherence 80% to statin therapy than females but there was no significant difference between genders [table 1]. Once again, the rate of ldl goal attainment was higher among men however it was not significant [table 2]. Furthermore, other demographic characteristics including age, bmi, control of diabetes (hemoglobin a1c) and education did not significantly affect on adherence and ldl goal achievement [tables 1 and 2]. Demographic characteristics of the studied patients and adherence to statin therapy ldl cholesterol goal attainment and related factors in this study, patients with adherence 80% had lower total and ldl cholesterol than those with adherence <80% (p <0.01). Moreover, adherent patients reached therapeutic goal significantly more than those who were considered non - adherence to statin therapy (p <0.01). In addition, number of prescribed medications had a significant effect on statin adherence and ldl goal attainment . <100 mg / dl had lower prescribed medication in comparison with adherence <80% or ldl 100 mg / dl, respectively . According to self - reporting, most of studied population (69%) were adherent to statin and 49 patients (31%) were nonadherent . The mean of mpr of statins during 3 months was 0.89 0.24 and pearson correlation showed the weak inverse relationship between mpr and ldl cholesterol, however this was not statistically significant (r = 0.16, p = 0.08). A chi - square test showed that there was a significant relationship between adherence reporting by pill counting and self - reporting (p <0.01). Since 92% of self - reported adherent patients were also considered, adherent based on pill counting and 50% of patients who reported non - adherence to statin treatment had adherence <80% according to pill counting . The most frequent barrier to adherence was reported as forgetting to take statins (50%). Discontinuation of medication when ldl cholesterol had been controlled or when patients were outside their home were other frequent factors related to non - adherence . In addition, an insufficient amount of prescribed statins which led to finish them before next visit and experienced side effects such as headache and gastrointestinal problems are other reasons of non - adherence to statins in patients with type 2 diabetes . In spite of the importance of adherence to statin therapy for achieving therapeutic goals, there are limited reports about adherence to statin therapy and its associated factors especially in developing countries . Meaningful reduction in ldl cholesterol was shown to be associated with pill count exceeding 80% . Therefore, we also considered the adherence when patients took more than 80% of pills that should have been taken . However, a recent evaluation of 248 iranian patients with type 2 diabetes showed more than one - third of them were non - adherence to oral hypoglycemic agents . Moreover, the overall prevalence of therapeutic noncompliance of patients with diabetes was 67.9% in saudia arabia . Our results revealed that according to the pill counting, at least one fifth of patients with type 2 diabetes were nonadherent to statin treatment . In addition, both pill count and self - report agreed in defining adherent and nonadherent patients . Unfortunately, there is not any database for medications in community pharmacies which demonstrates adherence in iran so we considered pill counting and self - reporting to evaluate that . Other reports showed different range of adherence to statin therapy which may be related to study population, setting and method of adherence measurement . In these studies, more than 60% of patients had good adherence to statin therapy especially during the 1 month of treatment . A meta - analysis in 2012 showed 49.0% and 90.3% of patients were adherent to statins in observational and randomized studies respectively after 1-year follow - up . In comparison to conducted studies, relatively high level of adherence reported by patients in our study . This comparison is not rational because of heterogeneities of study population and method of adherence assessment between studies . In addition, pills may be lost or stolen rather than taken which can affect pill count and consequently adherence measurement . However, pill count and self - report have some limitations that cause overestimation of adherence but significance of this result is that we could find a significant relationship between adherence measured by pill counting and ldl goal attainment . Small percentage of our study population had reached ldl cholesterol <100 mg / dl (31.6%). It is similar to conducted studies reported overall 32 - 44% of patients with diabetes and dyslipidemia attained their ldl cholesterol level <100 mg / dl . These findings show that in spite of the importance of statin therapy to decrease risk of chd, the major proportion of patients receiving statin therapy did not achieve ldl cholesterol goal . It seems inadequate adherence to statin therapy yet remains the main reason of this failure in developing and also developed countries . Poly - pharmacy is common among patients with type 2 diabetes which implies to the prescription of oral hypoglycemic, antihypertensive and lipid - lowering medications for an individual . It is also a growing barrier to adherence and attainment of therapeutic goal . In a similar manner, in our study nonadherent patients had more prescribed medications . In addition, limited time spent during office or clinic visits contributes to inadequate attention to multiple aspects of this care . It is necessary to increase awareness of the most important causes of non - adherence and find solutions to improve adherence . Forgetting is one of the most frequent causes of non - adherence in patients with diabetes which also reported in our study, inasmuch as it has also been mentioned a barrier to insulin injection especially in patients with type 2 diabetes . Therefore the development of interventions such as using daily pill box or filling log books of daily medication use may be useful to improve adherence . Another previous study also demonstrated an improvement of adherence and related outcomes in patients with type 2 diabetes by involving a pharmacist in the multidisciplinary team . However, more studies will be needed to evaluate the effects of different interventions on adherence . In addition, patient education and better interactions of patient and health care team will have the enormous effect on improving medication adherence . Although because of our local culture, we could not evaluate this factor but a recent cohort study showed a decrease in adherence with decreasing income in patients with established cardiovascular disease especially among men aged 40 - 64 years . Therefore, other studies will be needed to focus on other risk indicators associated with non - adherence to statin medications with diabetes especially in developing countries . There is controversy that increased medication adherence is associated with reduced healthcare expenses particularly during the years immediately following the onset of diabetes . Adherence measurement, by using pharmacy record data about refilling prescription, may be easier and more precise than pill counting . Therefore the development of these systems is necessary in different setting of health care system . Finally, it should be mentioned pill count can be used to identify patients who are nonadherent to statin therapy and at high risk for failure to achieve ldl cholesterol goals . Non - adherence to statins seems to be a significant issue in health care system for diabetic patients in iran . Emphasis should be put on health care delivery systems and policy organizations to improve health care providers and patient alliance and promote clinical programs to enhance medication adherence . Finding novel methods to improve adherence has giant potential to improve health outcomes and potentially decline health care costs . According to most probable barriers to adherence in our study, patient education and using pill boxes to decrease forgetting to take medication seems to be useful to increase adherence . All authors contributed for the design, data collection, data analysis and manuscript preparation. |
In cases of paraesophageal hiatal hernia with gastric volvulus, which is referred to as upside - down stomach, the first choice is surgical treatment . In high - surgical - risk patients, endoscopic repositioning and gastropexy is useful to ensure a good quality of life . However, there are no detailed reports regarding recurrent cases of upside - down stomach after endoscopic treatment; therefore, the risks of recurrence are unknown . We had a case of recurrent upside - down stomach after endoscopic repositioning and gastropexy that indicated the limits of endoscopic treatment and the risk of recurrence, as reported here . An 88-year - old woman with periodic vomiting and inability to eat was admitted to our hospital on three separate occasions where she received conservative treatment for a few days . Because of her advanced age, complications (bedridden state, left hemiplegia after cerebral infarction, heart failure) and poor general condition, the minimally invasive method of endoscopic repositioning and gastropexy was performed . The stomach was reduced to the normal anatomic position, and the anterior stomach wall was fixed to the abdominal wall in three places as widely as possible (fig . Chest and abdominal computed tomography showed the gastric fornix in the abdominal cavity, but the gastric corpus was above the diaphragm with organoaxial volvulus (fig . She was then diagnosed with a recurrent upside - down stomach after endoscopic repositioning and gastropexy . She was initially managed conservatively and had a nasogastric tube inserted, but her condition did not improve . Although her anterior stomach wall had been fixed to the abdominal wall in three places as widely as possible in the last hospitalization, she again presented with upside - down stomach . We concluded that it was impossible to prevent the recurrence of an upside - down stomach by endoscopic therapy . Therefore, we treated the condition with a laparoscopic repair of hernias and gastropexy . Using a laparoscope, we observed that the anterior stomach wall was adhered to the abdominal wall in three places from the antrum to the lower corpus of the stomach (fig . The upper corpus of the stomach was rotated and herniated into the esophageal hiatus (fig . However, it quickly returned into the esophageal hiatus with rotation because of the adhesion between the omentum and the esophageal hiatus (fig . This adhesion was peeled off and the crura were closed by a primary suture (fig . The cardial part of the stomach wall was fixed to the crura, and the anterior stomach wall was fixed in three places to the abdominal wall widely from the upper corpus to the antrum (fig . The suture used for fixing the stomach wall was removed 44 days after the operation . A paraesophageal hiatal hernia is a herniation of the gastric fundus anterior to a normally positioned esophagogastric junction . In large paraesophageal hernias, the entire stomach can be herniated with volvulus, which we refer to as upside - down stomach . Surgical intervention comprising reduction of the stomach in the gastric lodge and calibration of the hiatus adding a gastropexy or antireflux procedure is the first choice of treatment for this condition . Although publications describe the results of retrospective studies, the hospital stay after laparoscopic repair of paraesophageal hiatal hernias was shorter than that after conventional surgery . The morbidity reported in patients treated by conventional surgery exceeded the morbidity reported in laparoscopically operated patients, and follow - up was longer for conventional surgery . The recurrence rate after laparoscopic repair for large hiatal hernias was higher than after conventional repair . Reoperative findings were intraluminal mesh erosion, esophageal stenosis, dense fibrosis, esophageal perforation and intragastric migration [5, 6]. Considering the recurrence and reoperation rates, the differences between mesh repair and primary repair were small and perhaps clinically inconsequential . In our case, the esophageal hiatus was not so large and could be closed easily; therefore, we did not use mesh . The addition of a fundoplication in the laparoscopic repair of paraesophageal hiatal hernia minimized postoperative reflux symptoms . When no objective evidence of reflux was seen preoperatively, an antireflux procedure was not necessary . In our case, a fundoplication, therefore, was not performed and reflux symptoms were not observed following the procedure . For upside - down stomach, preventing recurrence of volvulus, a gastropexy is added to repair the paraesophageal hiatal hernia . In our case, the anterior stomach wall was fixed in three places to the abdominal wall widely from the upper corpus to the antrum . Many patients with upside - down stomach are not candidates for surgical therapy because of advanced age or comorbid conditions . For these patients, endoscopic repositioning and fixation by percutaneous endoscopic gastrostomy (peg) can be performed [10, 11]. In our case, one reason is the narrow range where the stomach wall can be fixed endoscopically, although the fixation was performed as widely as possible . Therefore, performing endoscopic gastropexy fixation of the stomach by 2 pegs is recommended [12, 13]. In our case, the anterior stomach wall was fixed to the abdominal wall in three places as widely as possible . However, as observed with a laparoscope, the anterior stomach wall was adhered only from the antrum to the lower corpus of the stomach, and the upper corpus of the stomach was rotated and herniated into the esophageal hiatus . In endoscopic gastropexy, the stomach wall is fixed by penetrating the peg tube or stomach wall fixture through the stomach wall and the abdominal wall . To avoid penetrating the chest wall and the lungs, the range of abdominal wall which can be fixed to the stomach wall since the stomach wall cannot be pulled caudally, unlike in the surgical approach, the range of stomach wall which can be fixed to the abdominal wall is limited from the antrum to the lower corpus of the stomach . As a result the other reason for recurrence is the adhesion between the omentum and the esophageal hiatus . Therefore, a repeated case has risks of recurrence of upside - down stomach after endoscopic treatment . In conclusion, although endoscopic repositioning and gastropexy for upside - down stomach can be a useful alternative method in high - risk patients, some cases may recur . Repeated upside - down stomach caused by adhesions has risks of recurrence after endoscopic treatment . To use this therapy more effectively, we hope that more cases will be reported and the risks of recurrences revealed. |
Endocrine - disrupting contaminants pose an insidious threat because exposure in early life during development can lead to subtle irreversible organizational effects that may be masked until the offspring reach maturity . Some chemicals with endocrine - disrupting properties may also cause transgenerational effects (effects carried across generations as a consequence of events that happen during the lifetime of the previous generation). For example, in laboratory experiments, nonylphenol caused poor survival in the subsequent generation of the pacific oyster, crassostrea gigas (nice et al . 2003), and octylphenol caused developmental abnormalities in the subsequent generation of japanese medaka, oryzias latipes (gray et al . Similarly, rodent experiments with the drug diethylstilbestrol (des) illustrate that an increased susceptibility for tumors is transmitted from the des grandmothers to subsequent generations . For example, when des was administered to pregnant mice, not only their offspring but also their granddaughters (newbold et al . 1998) and grandsons (newbold et al . 2000) had higher rates of certain tumors . For example, a study of boys born to women exposed to des in utero suggested that there is an increase in hypospadias (klip et al . If an endocrine - disrupting chemical (edc) has the ability to bioaccumulate, then female adults may detrimentally pass on some of their body burden to their offspring during critical developmental periods while the young are in the womb or in the egg, despite the fact that the adult s intake of the chemical may no longer be current . Moreover, because the female ova are formed at the fetal stage and environmental contaminants have been found in follicular fluid, it may be that offspring can be affected directly by their grandmother s exposure . Delayed effects may also arise for a number of other reasons, not the least of which because it may take some time for persistent chemicals to reach levels of concern or to be transported in the environment to the organism or ecosystem where they exert their effect . Effects caused by endocrine disruption are even now likely to be passing unnoticed because only a very small fraction of the many wildlife species on the planet have been investigated . Even in prominent species such as fish, endocrine disruption effects may be being missed . The abnormal production of the egg yolk protein vitellogenin in male fish has now been found in several countries (damstra et al . 2002), but was probably going on for many years before its detection in several polluted u.k . Furthermore, studies are complicated because effects may be different even in closely related species . For example, vitellogenin production was not found in male sand gobies from estrogen - contaminated estuaries in the united kingdom, but instead they exhibited deformed and feminized urogenital papillae, which is the structure used by both sexes to deposit gametes (matthiessen et al . However, behavior provides a sensitive integrated end point of many complex processes, and in wildlife, altered behavior may detrimentally affect survival . Even small deficits in brain function could render the animal less able to escape predation, catch prey, find a mate, and rear offspring . This is exemplified by a controlled experiment showing that the pollutants present in sewage sludge affect the emotional reactivity and exploratory behavior of lambs (erhardt and rhind 2004). Unfortunately, in the arctic, pcbs have now reached such high levels that in some representatives of numerous mammalian species (including polar bears, arctic fox, reindeer, mountain hares, wolverines, walrus, grey whales, seals, steller sea lions, harbor porpoise, walrus, minke whale, killer whales and narwhal) they exceed those levels that have been associated with subtle neurobehavioral effects in the offspring of rhesus monkeys and humans (amap 2004). However, despite that pcbs can alter thyroid hormone levels, it is still not clear whether these neurobehavioral effects are mediated by endocrine disruption . Sex hormone disruption may particularly affect breeding behavior . To mate with a female, a male may have to display courtship behavior, build a nest, and chase or show some dominance . Even if the concentrations of endocrine - disrupting compounds in the environment are not sufficient to cause structural effects and reverse sexual physiology, small adjustments in behaviors could still be devastating to reproductive success . In wild birds, manmade chemicals have already been associated with altered pairing and impaired parenting behavior (fox et al . 1978; hunt and hunt 1977; kubiak et al . 1989; mccarty and secord 1999). For example, developmental exposures to mixtures of common industrial pollutants or to vinclozolin, an antiandrogenic sex hormone disrupting fungicide, can affect the sexual behavior and erectile function of rabbits such that some males exposed to the mixture prefer male teasers to achieve erection and ejaculation (veeramachaneni et al . 2001) or they show no sexual interest in mounting females or males (veeramachaneni 2000, 2004, 2006). In fish, bell (2001) found that the courtship and territorial behavior of the male stickleback fish (gasterosteus aculeatus) is affected at the levels of ethinylestradiol found in some rivers . For example, kiesecker (2002) found that edcs may reduce the resistance of amphibians to parasitic diseases . Similarly, organochlorines in the arctic have been associated with deficits in the functioning of the immune system in polar bears (lie et al . Immune suppression is also believed to have played a role in the devastating mass dieoffs of seals with viral infections (hall et al . 1992). However, it is still not clear whether these reported examples of immune system suppression are mediated by endocrine disruption . Nevertheless, the immune system is known to communicate and cooperate with the neuroendocrine system (damstra et al . 2002), such that some investigators consider the immune system to be a subpart of the endocrine system (t colborn, personal communication, 2004). Disruption of the adrenocorticoid system could also lead to increased susceptibility to environmental stressors such as severe weather or predatory or human disturbance . For example, love et al . (2003) reported impaired cortisone stress response in captive kestrels exposed to an environmentally relevant level of pcbs . Moreover, fish studies show that chronic exposure to a wide range of contaminants can inhibit normal stress responses (pottinger 2003). Most species are vulnerable to edcs because the endocrine system has been conserved during evolution and, therefore, has many similarities in all vertebrates, and in some invertebrates . Therefore, it is likely that endocrine disruption is more widespread than has been currently reported . Already, a review by miyamoto and burger (2003) has noted that over 200 species are either known or suspected to have been affected by endocrine - disrupting substances, including examples from all five major vertebrate classes, and from at least two invertebrate phyla . Research is needed to identify sensitive species that can be used as sentinel species in the wild . The research conducted on amphibians by hayes et al . (2003) also points to the need to ensure that species in decline are fully investigated as to the potential effects of pollutants, including endocrine disruptors . For example, bees are important pollinators of crops and wild flowers, and research into the impact of the insecticides diflubenzuron and fenoxycarb on honeybees has demonstrated that nonpersistent compounds that interfere with insect hormone systems can have long - term effects on these social insects (environmental data services ltd 2004). However, current registration approval schemes for pesticides do not pay sufficient attention to the long - term effects on nontarget species, and there could be significant effects on species such as bumblebees that reproduce slowly, several of which are already endangered . Responsible parties, particularily corporations, should provide more resources to develop the much - needed screens and tests to identify chemicals that can disrupt the hormone system . Although some research is under way, much still needs to be done . In vitro receptor binding assays for estrogen and androgen disruptors have been developed, but these tests can miss some in vivo activity . For example, these assays would not detect chemicals that interfere with steroid biosynthesis and metabolism, such as those that disrupt important steroidogenic enzymes like 5-reductase and aromatase . Also, given the importance of the brain in guiding all species through life, more research is needed into thyroid hormone disruption and into the mechanisms of developmental neurotoxicity . Important subtle behavioral effects need to be identified and investigated, and new test methods must be developed, as many such effects would not be picked up in current testing programs . More research is also needed into chemical disruption of the adrenal glands and corticosteroid hormone disruption, with effort focused on laying the foundations for test methods development . Furthermore, robust nonvertebrate animal test methods must be developd because such techniques tend to be quicker and cheaper and are more publicly acceptable . Nevertheless, the current lack of test methods to identify all chemicals that may have hormone - disrupting properties should not be an excuse for regulatory inaction . Some currently available test methods are sufficient to raise concern regarding the potential endocrine - disrupting properties of some substances . Meetings of the organisation for economic co - operation and development task force on endocrine disrupters testing and assessment are instrumental in deciding which test methods should be prioritized for development and international validation and harmonization . Such decisions should be based on scientific deliberations involving independent scientists, and moreover should be informed by prior discussions as to which tests are considered most important for use in legislative frameworks in the participating countries . To promote more input from independent scientists, we need resources or research credits for academic scientists who devote time to these activities . In 1997 the international endocrine disrupter workshop on edcs was held 2324 january 1997 in washington, dc . This workshop was a collaborative effort of the smithsonian institution, the united nations environment programme, the white house office of science and technology policy, and the u.s . Environmental protection agency . At this meeting, delegates considered whether edcs should be the focus of global coordinated action, including legislative action . However, they acknowledged that a prerequisite to any further consideration would be a written global assessment of the state of the science . This document was therefore commissioned and subsequently published by the world health organization (damstra et al . 2002), with the following definition for edcs: an endocrine disruptor is an exogenous substance or mixture that alters function(s) of the endocrine system and consequently causes adverse health effects in an intact organism, or its progeny, or (sub)populations . However, wwf is concerned about this definition being used in legislation, as it could result unnecessarily in long delays in confirming which chemicals fall within the scope of the definition . If a substance were required to meet this definition before it could be subject to certain legislative controls, the observed effect would have to be proved a consequence of the endocrine disruption . It would not be enough for a chemical to be shown to alter hormone levels or for an impact to be causally linked to that chemical . Unless the mechanism of action was established beyond doubt to be mediated by the endocrine system (rather than the changes in the endocrine system being a consequence of another mechanism of toxicity), the chemical would not be eligible to be judged an endocrine disruptor . Yet even for a well - studied effect such as eggshell thinning caused by ddt, it is not known with certainty whether this thinning is mediated by endocrine disruption . Similarly, as exemplified by cigarettes and lung cancer, it may take decades for a causal mechanism(s) to be identified . Therefore, it is important that the strict control of such substances not depend on the absolute certainty as to the causal mechanism . Wwf considers that, particularly for legislative purposes, the term edc should not be overly restricted . Hormones do not work alone; rather, they require auxiliary systems, including enzymes, neurotransmitters, growth factors, and other proteins, which wwf suggests should all be considered as much a part of the endocrine system as the hormones themselves . The salient point about edcs is that they hijack biochemical messenger systems, often by mimicking or blocking the action of the bodies own chemical messengers, so that even small doses at the wrong time may cause subtle but important alterations . It is disruption of the bodies internal signaling mechanisms during development that is really the issue, and, as such, perhaps the term edcs should be broadened to include signaling or system disruptors . The european commission is now trying to press ahead on the legislative front and is proposing in its reach (registration, evaluation, authorisation and restriction of chemicals) regulation to enable edcs to be brought under strict controls so that their usage could require prior authorization [european commission (ec) 2003]. Moreover, the granting of an authorization for use would be subject to certain stringent conditions . Hopefully, the eu reach legislation has obviated the need for an agreed definition as such, or proof of the causal mechanism, by proposing that substances, such as those having endocrine disrupting properties . . . Could be subjected to the prior authorization requirement . However, as of 2005 the negotiations on reach were not yet finalized . First, many chemicals are not tested at low dose levels or at the most sensitive exposure period . And even if they were, it may be that the statistical power of such laboratory tests is simply not adequate to pick up effects that occur in a small proportion of the exposed organisms . The concern is that because edcs act on a biochemical system that is already active, it may be that for some chemicals there is no threshold for certain effects . Second, the assessment factors used in the risk assessment may be inadequate, particularly considering all species may be vulnerable to hormone disruption . For example, in the eu risk assessment process, laboratory tests are used to find the predicted no effect concentration, or safe level . In this process, assessment factors of 1,000, 100, or 10 are typically used to extrapolate from the test species to the world at large, depending on whether data for several test species are available . However, it is clear that for chemicals with certain modes of action, these assessment factors are often inadequate, as species sensitivity distributions can cover from 2 to> 5 orders of magnitude (escher and hermens 2002). For endocrine disruptors, for example, work by oehlmann and colleagues (2006) has shown that some mollusk species are far more sensitive to bisphenol a than the typically tested organisms . Third, the risk assessment process does not consider the fact that in the wild, there is exposure to many chemicals with potentially additive effects . The effects of other stressors also need to be considered because many factors will make animals in the wild more vulnerable to these stressors than those in the laboratory . Adverse needs to be less restrictive, or there is a danger that legislation will be used only to control chemicals already known to be harmful in the wild rather than to try to prevent harm . Unlike human risk assessment, where the aim is to protect every person, in environmental risk assessment, the aim is to protect only the population level however, wwf considers that ecological risk assessment should move away from regulating chemicals on the basis of the concentration for which there is good evidence for predicting population - level effects and move toward protecting the individual organism . This change should come about because current risk assessment methodology presents too much regulatory difficulty to prove that certain effects will ultimately lead to a reduction in the population level . Unfortunately, the distinctions made between findings that are likely to affect the population level and those that are not may be unrealistic and somewhat artificial, as there is no accepted way of reliably distinguishing between them in laboratory tests . For example, effects on spermatogenesis in fish may not affect the population level in the laboratory, but this outcome may not hold true in the wild where males have to compete for females, and the conditions are generally less optimal . Even small deficits in sperm production in the wild might lead to population - level effects that would not be apparent in the laboratory . Currently, there is a lack of data on the effects of edcs on the genetics of fish populations . However, fewer males contributing to the next generation would be a concern because it is generally believed by conservationists that a considerable proportion of breeding individuals is necessary if a genetically viable population is to be sustainable [institute for environment and health (ieh) 2004]. In the eu for example, kwak et al (2001) exposed swordtail fish (xiphophorus helleri) to bisphenol a and observed a significant reduction in sword length . The draft risk assessment report (ec 2003) stated the following: significance of the changes in sword length is not understood . It is thought that the length of the sword has an influence on mating success, with female fish preferring males with longer swords, but it is not clear what degree of change should be considered to be significant . However, wwf argues that any alteration in a secondary sexual characteristic is likely to affect the female s choice of breeding partner and is likely linked to a survival strategy so that altered pairing might make the population less able to cope with other stresses . Similarly, wwf argues that behavioral effects observed in test systems, such as altered exploratory behavior, should also be considered adverse and likely to affect a population . Guidance is certainly needed on the types of behavioral data that should be collected during laboratory or field studies and how they should be interpreted in the risk assessment . To summarize, wwf suggests that ecological risk assessment should move toward protection of the individual rather than just the population level and that even subtle changes should be considered adverse . Effects should certainly be considered adverse if they could reasonably be conjectured to give rise to a population - level effect . The complexities of ecosystems and the numerous threats and stressors they face are such that the environment should be given the benefit of any doubt . Such a cautious approach is necessary because if the population level of just one species is directly adversely affected, this effect may then have unforeseen consequences for many other species . In line with such an approach, some delegates at a recent round table meeting convened by the u.k . Department of the environment food and rural affairs also supported regulatory action on edcs if significant effects were seen in individual animals, even if the impact on populations was unknown or uncertain (ieh 2004). Finally, there is another issue that has dogged risk assessment, and that is how to decide on the correct interpretation when there are contradictory study findings . Over the last decade, numerous studies by independent academic scientists have been strongly criticized or refuted by scientists working for industry . Scientific debate and challenge is needed, but the vested interests of industry need to be recognized as forces that may not always work for the public good (ong and glantz 2001). For example, regarding tobacco, wise (1998) suggested that industry funding can influence results . He showed that review articles written by authors with affiliations to the tobacco industry were 88 times more likely to conclude that passive smoking is not harmful than if the article were written by authors with no connection to the tobacco industry . To end controversies over conflicting studies and to enable continued objective input into the risk assessment of certain chemicals, funds should be allocated for blind duplicate studies in the laboratories of those scientists who have found effects . In addition, there needs to be funding for academic laboratories and laboratories managed by regulatory agencies because studies must be seen to be impartial to ensure confidence in their results . In conclusion, endocrine disruption is likely to be affecting more than the couple of hundred or so species currently suspected or known to be affected . There is, therefore, a need to ensure continued research into endocrine disruption and to establish pragmatic ways of bringing chemicals of concern under tighter controls . It is essential to improve current regulatory frameworks and to adapt them to current knowledge . Furthermore, to counterbalance the vested interest of industry and to help policymakers consider all aspects, independent scientists should be encouraged to work not only on pure scientific research but also at the science / policy interface . Wwf maintains that to protect biodiversity, we need regulatory frameworks worldwide to prevent the use of chemicals with properties that cause much concern, certainly where safer alternatives exist . Regulation of chemicals should become more protective and precautionary, particularly in the interpretation of what effects should be considered adverse . Unfortunately, current legislation is such that pollution control has largely been a matter of shutting the stable door after the horse has bolted. |
Weight bias, or the stigma towards and negative stereotypes about individuals who have large bodies, has been described as researchers have found weight bias to be the fourth most frequently reported form of discrimination and determined a 66% increase in its occurrence between 1995 and 2006 . Individuals who live in large bodies are stereotypically characterized as being lazy, sloppy, weak - willed, physically and sexually unattractive, and gluttonous . Research has documented weight bias in the attitudes of health care professionals, success in education, hiring practices in the workforce, interpersonal relationships of individuals with large bodies, and the influence of the media on weight bias . Research has also documented numerous physical and psychological health consequences of weight bias, including, but not limited to, increased stress, decreased motivation to engage in physical activity, increased binge - eating behaviour, and depression . Research areas such as fat studies, health care, and psychology have recognized weight bias as an important issue for research and professional practice . However, despite the common interest in weight bias, each area remains relatively segregated to the point where each perspective may be associated with specific journals as the common outlets for research and review articles, with little overlap . Activists and researchers have been described as being fundamentally engaged in framing contests over the nature and consequences of excess body weight [14, p. 869]. Saguy and riley posited that, when such framing contests represent opposing positions, it may undercut the integration of the insights achieved by the conflicting perspectives . Consequently, few attempts have been made to name common interests for moving forward with interdisciplinary research . Previous researchers have noted that body weight is often framed in one of two opposing ways: through the lens of body diversity or through the lens of excess weight as a preventable health risk [14, 15]. Each way of framing body weight constructs a different social problem and entails a different solution . Each of the various perspectives engaged in weight bias research takes a unique position in understanding and explaining the origins and consequences of weight bias . Further, research areas also have different approaches to language, with some more frequently using the word fat to refer to individuals who have large bodies and others more frequently using the words overweight or obese . Differences are also present with respect to preference for person - first (e.g., person with obesity) or identity - first (e.g., fat person) language . In recent years, person - first language has become increasingly popular, as researchers have proposed that person - first language promotes openness and aids in the reduction of stigma and prejudice [16, 17]. This discussion has continued, however, as scholars in the area of disability studies have also argued for the continued use of identity - first language together with person - first language as a way to claim identity and to promote pride . Proponents of using both person - first and identity - first terms flexibly have stated that it may acknowledge the roles and perspectives of different groups and that it will also allow for the opportunity to ask about preferred terms . In relation to the field of weight bias, this may resemble openness to using both person - first (e.g., person with obesity) and identity - first (e.g., fat person) language, depending on the context as well as individual preference . The purpose of this paper was to conduct a literature review of selected disciplines that contribute to weight bias research in order to overview the common, potentially competing, and emerging perspectives on this topic . Weight bias research was selected from multiple research disciplines, including fat studies, feminist literature, health at every size (haes), health care, psychology, and sociology . The review targeted papers that provided a current conceptual and theoretical overview of different perspectives of weight bias . The similarities among, and differences between, each of these perspectives were examined with regard to five research questions: (a) what is the language used to refer to weight and individuals with large bodies? (b) through what general lens is discussion of weight bias approached? (c) what theoretical positions are used to discuss the source or causes of weight bias? (d) what consequences of weight bias are identified? And (e) how are these consequences discussed with regard to influence on weight - based inequity? In the following discussion, we introduce three perspectives of weight bias with regard to these five questions: the weight - centric perspective, the non - weight - centric perspective, and health at every size perspective . In addition to these perspectives, we also provide a brief overview of literature pertaining to the social determinants of health, as it supports our discussion of weight - based inequity identified among the three perspectives . Finally, we introduce a focus on social justice as a uniting perspective that offers a foundation for advancing interdisciplinary research on weight bias . Saguy and riley described disagreements that surface when obesity is framed from different perspectives . For example, groups that understand obesity through a body diversity framework, versus a preventable risk framework, would have varying opinions about if or why higher weights have adverse health consequences, what an ideal weight is or whether a universal ideal weight even exists, why people gain weight, why some weigh more than others, and whether weight loss improves health (p. 874). These body diversity and preventable risk frameworks have been commonly identified in the literature using the terms weight - centric and non - weight - centric or health - centric [1820]. Researchers have also referred to these frameworks as weight - normative and weight - inclusive . For the purposes of this paper, these terms will also be used to frame our discussion, with clarification . The term weight - centric has been previously defined as having the six following tenants: (a) the belief that weight is under individual control, (b) the belief that weight gain is caused by an imbalance in caloric intake and energy usage, (c) the belief that health status can be predicted by weight, (d) the belief that excess body weight causes disease and early death, (e) the belief that methods for successful long - term weight loss involve the modification of eating and exercise patterns, and (f) the belief that losing weight will result in better health . However, for the purposes of this paper, the term weight - centric will be used to refer to research that typically discusses weight bias through a consideration of body weight and increasing rates of overweight and obesity, without the assumption of the six tenants described by o'hara and gregg . Finally, it is also important to note that the perspectives described below are not mutually exclusive but may be regarded as emerging distinctions within the field of weight bias . The literature represented in this paper provides a brief overview of each perspective and is not intended to be a comprehensive literature review . Articles for this paper were identified through two large multidisciplinary databases (i.e., academic search complete and web of science), with a focus on identifying articles that presented a broad theoretical overview of one or more perspectives in addition to more focused experimental and correlational study - based articles . Multiple keyword search terms were used to aid in the collection of a broad range of articles representing each perspective . Various combinations of the following keyword search terms were used: anti - fat bias, body diversity, body size, body weight, epidemiology, fat acceptance, fat bias, fat oppression, fat shaming, fat stigma, fat studies feminism, health at every size, inequality, obesity, obesity stigma, weight bias, and weightism . This resulted in 173 articles that were reviewed for examination and comparison of the differing perspectives of weight bias that informed the current discussion . Articles were then scanned for the language used to refer to weight and individuals with large bodies as well as the theoretical orientation of the article in order to determine the perspective that the article best represented . The weight - centric perspective is characterized by the investigation of weight bias through the lens of increased prejudice and discrimination based on body weight, influenced in part by increasing rates of obesity [4, 22]. This perspective often includes researchers from fields such as health care and psychology, who identify weight bias as a prevalent social issue in need of further understanding . Much of the research from this perspective has focused on documenting the prevalence of weight bias and discrimination within life domains (e.g., employment) and among health care professionals and preprofessionals [4, 24]. Researchers have also examined the association of weight bias with other attitudes, such as racism and physical appearance concerns, as well as fundamental beliefs that serve as the basis for a political, economic, or social system [1, 25]. When referring to weight, researchers from the weight - centric perspective tend to use the terms overweight and obesity . When referring to individuals with large bodies, researchers tend to use both person - first (i.e., person with obesity) [26, 27] and identity - first (i.e., obese person) [8, 28] language . Professional associations such as the american psychological association encourage the use of person - first language and person - first language has become increasingly popular within the medical community . It is important to note that the current weight - centric perspective on weight bias has grown from a strong history of research documenting weight bias, especially among health professionals and that this perspective has been, and continues to be, critiqued due to the medicalization of body weight . Weight has been used as an easily measurable proxy for health and, as such, individuals' weight and health have often been confounded . More specifically, researchers have critiqued obesity research as contributing to the belief that weight is within individual control, that it is as simple as calories in versus calories out, that weight and health are inextricably related, that excess weight causes disease and death and losing weight will result in health, and that methods for long - term weight loss are known and effective [15, 20, 30, 31]. Although there is no consensus within this perspective, researchers tend to utilize attribution theory to understand the origins of weight bias . Attribution theory proposes that individuals are motivated to seek out causal explanations for outcomes or conditions and that negative bias towards individuals with large bodies arises from the tendency for weight to be regarded as under personal control [1, 22]. Research in attribution theory has suggested that when conditions are regarded as uncontrollable, individuals are likely to display increased liking and pity but that when conditions, such as obesity, are perceived as controllable, individuals are likely to display dislike, anger, and negative judgments . Such reactions, specifically feelings of disgust, have been linked to weight bias and the treatment of individuals with large bodies . Many researchers have regarded weight bias as occurring due to the view of obesity as a behavioural disorder that ignores the complexity of its causation and positions it as something to be treated or eradicated through behavioural change [3, 27, 34]. Researchers have asserted that complex biological processes are often overlooked in favour of common misconceptions, such as obesity being the result of low physical activity or an unhealthy diet and that anyone with willpower can lose weight . Further, the success of behaviour modification obesity interventions is often measured through how much weight a person loses; however, weight is not a behaviour . It would seem that the focus on the outcome of weight loss is measured without the consideration of the complex biological and contextual influences and that individual willpower and behaviour are commonly regarded as the cause of obesity . More recently, researchers from the weight - centric perspective have also proposed that weight bias reflects the degree to which an individual has bought into social standards of attractiveness . Over the last several decades, ideal body standards have shifted, with the ideal body for women being prescribed as thin, with large breasts and toned muscles, and the ideal body for men being prescribed as lean and muscular, with wide shoulders and a narrow waist [3739]. Recent research has provided support for the relationship between the internalization of thin - ideal body standards and weight bias . For example, the physical appearance concerns related to the internalization of the thin - ideal may serve to increase disgust reactions towards individuals with large bodies, thus increasing weight bias . Researchers have also suggested that weight bias is influenced by the tendency to make comparisons based on body weight . Social comparison theory asserts that individuals are motivated to compare and evaluate their own opinions and abilities with the opinions and abilities of others, which instills a sense of validation . Previous researchers have suggested that weight bias is a form of downward social comparison that serves to increase the self - esteem of the individual making the comparison . For example, a social comparison perspective of weight bias asserts that individuals may compare their bodies to people who have larger bodies in order to feel better about their own body size, thus perpetuating weight bias . Researchers operating from the weight - centric perspective have also identified significant negative consequences of weight bias . Among these, researchers have identified depression, increased binge - eating behaviour, anxiety, and stress, as well as decreased motivation to engage in physical activity . Although researchers from this perspective have focused less on how weight bias influences social inequity, researchers have suggested that negative beliefs and judgments tend to be greater for girls and women with large bodies compared to men [45, 46]. Research has also suggested that weight bias can impact patient quality of care as well as equality of patient care, as health care professionals may spend less time with patients with large bodies and provide fewer treatment options . Finally, it is important to note that researchers have stated that the consequences of experiencing weight bias may be more harmful than simply having a large body and that perhaps the health consequences attributed to obesity may be better explained by weight bias . The non - weight - centric perspective is characterized by the tendency to approach discussion of weight and weight bias by taking a critical stance to the popular obesity discourses [49, 50]. This perspective often includes researchers from interdisciplinary fields such as fat studies and feminist studies, as well as sociology, who identify that weight has become an indicator for social status whereby large bodies are regarded as less successful and less attractive . Researchers from this perspective seek to understand discourses beyond the medicalization of obesity and to build a body - accepting and embodied culture [30, 49, 50], where the focus is on health, not weight . In other words, from this perspective, body size is conceptualized as existing on a continuum of natural body diversity and is not something that is to be corrected . Researchers from the health - centric perspective examine the broader social forces that aid in shifting attention and concentration away from the fat body itself and more towards positioning and contingent systems and structures [49, p. 1020 more specifically, researchers in this area have examined weight bias in relation to a broad array of topics including body shame and sexual health [51, 52], media influence [5355], the fashion industry, education [5759], public health [60, 61], and health care . In addition, feminist researchers have also been critical of the lack of attention paid to weight bias in relation to the attention paid to other weight - related topics, such as eating disorders . Vincent roehling proposed that weight bias may be an issue more congruent with the second wave of feminism, in that it tends to impact white middle - class women the most, and may be incompatible with mainstream feminist thought that has emphasized the influences of gender, race, socioeconomic status, sexual orientation, and their intersections . Shaw and lee described current feminist thought as being inclusive and affirming of all women, as well as seeking to promote equality and justice for all women . Not only is an increased focus on weight within feminist thought important with regard to weight bias, but also it might highlight the similar barriers and systemic issues that create the social conditions for the occurrence of both eating disorders and weight bias . When referring to weight, researchers from the health - centric perspective tend to use terms such as fat, fatness, or fat bodies as well as identity - first (i.e., fat person) [15, 30] language when referring to individuals with large bodies . Many researchers and activists from this perspective use the word fat intentionally as a way to reclaim power, to remove shame and stigma, and to position fat as one of many possible identity descriptors [15, 49]. In addition to being critical of the language used to describe weight and individuals with large bodies, researchers from the fat perspective examine weight bias through numerous theoretical approaches, including critical analysis of obesity discourses, critical fat studies [15, 66], feminist poststructuralism, and intersectionality . Each of these theoretical approaches will be discussed below . Researchers who have approached weight bias through a critical examination of obesity discourses have identified two competing frames . The first frame is considered the dominant weight and beauty discourse, which recognizes the slender body as attractive and successful and large bodies as unhealthy, diseased, and representing failure, which results in body size being regarded as an individual responsibility [15, 30, 31]. Alternatively, the second frame recognizes this discourse as originating in western patriarchal culture and that these widespread messages serve to devalue female body size and shape with serious consequences [30, 31]. Despite these two competing discourses this discourse is problematic, as the ongoing discussion of large bodies as an epidemic, infection, or a plague leaves no room for the acceptance of natural body diversity . By being complicit with this discourse of the obesity epidemic, researchers have asserted that large bodies will continue to be excluded, marginalized, and regarded as immoral [15, 31]. Similar to the critical analysis of obesity discourses, critical fat studies have been described as a position that disputes weight bias in two ways . First, by placing emphasis on the complex nature of body weight, critical fat studies challenges the dominant framing of obesity as an unbalanced relationship between calories in and calories out and as a personal choice [44, 61]. Rather, critical fat studies reframes body weight as a natural form of body diversity . Second, critical fat studies seeks to challenge the assumption that large bodies are a serious threat to individual health as well as other universal scientific truths' often presented in research consistent with the dominant obesity discourse [15, p. 100, 66]. More specifically, researchers from this perspective challenge incorrect and biased assumptions about weight and body size that occur in research, policy, entertainment media, news media, and public health campaigns . Many researchers within the non - weight - centric / health - centric perspective who operate within feminist studies approach the discussion of weight bias using poststructuralism, which emphasizes the examination of how the body and identity are shaped through social relations as well as cultural and institutional beliefs [30, 62]. This framework allows for the consideration of diverse perspectives like race, ethnicity, socioeconomic status, and ability, among others, and provides a lens for an in - depth examination of personal experiences, relationships and contextual meanings of relations of power between individuals finally, many researchers also conduct research through the lens of intersectionality, which has been defined as the examination of the interactions of multiple forms of oppression and the outcome of these interactions with regard to power [50, 67, 68]. This research has allowed for further understanding of the differential effects that weight bias has on social equality with regard to gender, race, socioeconomic status, and sexual orientation [66, 67]. Many researchers have maintained that weight bias is deeply gendered and that body size matters differently for men and women in the identity positions available to them [31, p. 159]. Nurka asserted that a slender body is one of the demands of good womanhood and that it is connected with feminine identity and success (p. 168). Weight bias and its intersections have been described by researchers from the non - weight - centric perspective as contributing to an oppressive social context for individuals with large bodies, where large bodies are visual representations for immorality [49, 69]. In addition to acknowledging that weight bias contributes to an oppressive social context, researchers have identified other consequences of dominant weight discourses for women with large bodies, including weight - based harassment and social exclusion, disordered relationships with food, the draining of women's energy and resources with regard to seeking weight loss and fad diets, normalizing female body anxiety, and the reinforcement of the cultural belief that women should control their desires . Health at every size (haes) has been described as a non - weight - centric, transdisciplinary movement [18, 19] comprising researchers from all disciplinary backgrounds, who approach weight bias through the consideration of weight and the position that societal obsessions with thinness and dieting are unhealthy and do not allow for natural body diversity . Rather than focusing on weight loss, the haes paradigm focuses on health promotion and improving the emotional, physical, and spiritual well - being of individuals of all sizes [18, 58]. Specifically, researchers from this area promote self - acceptance, body diversity, and improved health behaviours regardless of size, such as engaging in physical activity for pleasure and intuitive eating behaviours [18, 58]. Haes researchers have critically examined and challenged weight - related assumptions and the use of body mass index (bmi) as an indicator of health and have provided evidence for the need for a paradigm shift within health care [18, 73]. More specifically, haes interventions do not focus on weight as an outcome; rather, behavioural health indices such as intuitive eating, body esteem, and psychological functioning are more relevant measures of success [74, 75]. Although the haes paradigm is relatively new, with the majority of research published beginning in the year 2000, researchers from this perspective have commented on the potential clinical application of the haes paradigm [72, 73], the application of haes to public health [19, 76] and dietetics, and have examined the long - term effects of haes interventions . When conducting research within the paradigm, haes researchers tend to use language consistent with both perspectives when referring to both weight (e.g., overweight, obesity, and fat) and individuals with large bodies (e.g., obese person and fat person) [18, 19, 79], as well as the term people of size . Haes researchers have approached the understanding of weight bias through a critical examination of healthism . Researchers have stated that healthism has cemented discourses of health and weight as being under the almost exclusive control of the individual, who is viewed as having the responsibility and obligation to strive for the perfect body [79, 81]. This healthism, and the accompanying fitness movement, prescribes specific practices and beliefs that serve to externally regulate individual and collective bodies as well as reinforce the internalization of bodily self - control in the name of health [79, p. 358]. Further, researchers have asserted that the dominant healthism discourse and the strive for bodily perfection intentionally exclude the consideration of the social determinants of health, such as socioeconomic status, employment status, education, lack of access to physical activity, and lack of access to health care [79, 82]. Haes researchers have maintained that the discourses of health and weight that contribute to weight bias have significant consequences for individuals with large bodies, including being regarded as unattractive and unhealthy, demotivating healthy behaviours, and avoidance of health care . Through this perspective, weight bias is regarded as, in part, responsible for reinforcing and privileging slimness in a culture that promotes health at one size [18, p. 358]. Further, healthism and weight bias also serve to decontextualize health from the structural and social forces that impact people's lives, with serious consequences for the health care and health outcomes of individuals with large bodies [79, 82]. The above review of the three emerging perspectives and approaches in weight bias research suggested that each perspective approaches discussion of weight bias from a unique point of view . However, similarities among these perspectives exist with regard to how weight bias is conceptualized and understood . In addition there are similarities and differences between the perspectives with regard to how weight bias is termed, the consequences of weight bias, and how these consequences influence social inequity . In the early 2000s, research in public health and epidemiology began to rapidly multiply, with researchers consistently documenting the social and environmental disparities in health . Diez roux and mair discussed the trends driving the increased interest in neighbourhoods and health . First, they posited that researchers have increasingly recognized that explanations focusing solely on the responsibility of the individual for ill - health are inadequate and fail to capture the complex social and structural factors that contribute to weight . Second, diez roux and mair suggested that researchers have experienced a renewed interest in examining the causes of social inequities in health, including but not limited to differences between racial and ethnic groups . Third, researchers and policy makers have increasingly begun to consider the health effects of policies such as housing or urban planning policies . Results from research investigating the social and environmental disparities in weight have suggested that factors including socioeconomic status, the neighbourhood environment, race and ethnicity, gender, and level of education all influence disparities in weight [86, 87]. Researchers from various countries around the world have observed that the rates of obesity are highest among individuals from nondominant racial and/or ethnic backgrounds as well as individuals of low socioeconomic status [87, 88]. In addition to these factors, researchers have also suggested that having a low level of educational attainment and being female also play a significant role in the social patterning of weight [89, 90]. Finally, these researchers have also examined the role of the neighbourhood environment with regard to weight disparity and have suggested that neighbourhoods with lower density of sports facilities and supermarkets, lower availability of fair - priced healthy food, and decreased walkability, as well as greater perceived hazards, show an increase in the incidence of obesity [84, 86]. Congruent with the lens of intersectionality, the highest rates of obesity occur among the most disadvantaged individuals those who experience disadvantage in two or more areas of inequity . Although the majority of epidemiology researchers documenting the disparities with regard to weight have focused discussion on overweight and obesity specifically, some researchers have also discussed the impact of these social disparities with regard to weight bias . In their literature review on the relationship between gender, socioeconomic status, and obesity, broom and warin suggested that women have the most to lose from social and economic disparities in weight, especially with regard to weight bias in employment . Conducted a longitudinal study of education, income, and occupational class on obesity and suggested that, together with disparities in weight, the increased mediatization of the thin - ideal could strengthen weight bias and discrimination in the workplace, especially for women . Given the social and psychological health consequences associated with weight bias, researchers have concluded that the increasing disparities in weight are a critical public health problem, adding cumulative disadvantage to vulnerable individuals [91, 94]. As such, we would argue that one of the fundamental concepts that could bind competing perspectives on weight bias is an examination of social justice . Although the research areas reviewed above may differ with regard to the theoretical lens used to understand weight bias and the language used and identify different consequences and social inequities resulting from weight bias, each research area has recognized weight bias as an important social issue . Despite this recognition, however, weight bias has yet to be widely discussed as an important social justice issue . Although the term social justice is not often used when discussing weight bias, a strong history of research from each perspective described above has situated it as such . Researchers have documented the many negative assumptions and stereotypes based on body weight have demonstrated that weight bias has increased in recent decades and have consistently established the systematic occurrence of weight bias within society, such as within the media, health care, education, employment, and interpersonal relationships . Researchers have also pointed to the broad social forces that continue to reinforce the power and privilege given to thinness, which serve to deny natural body diversity [14, 30, 62, 67, 79]. Results have also documented the significant physical and mental health consequences of being victims of weight bias and discrimination [3, 79]. Finally, researchers have established the influence of weight bias on social inequity, with differences in disparity influenced by gender, race, socioeconomic status, and sexual orientation [66, 67], which may especially influence access to, and quality of, health care . In our collective effort towards weight - based equality, it may seem as though social justice, a term used to describe the value emphasizing equitable opportunity, action to amend systemic oppression, and participation of all individuals in order to aid them in achieving maximum potential [95, 96], has been missing from our research . In recent years, few researchers have recognized weight bias as an important social justice issue to be addressed in research, policy, and practice [13, 49, 69, 97]. In discussing weight bias as a social justice issue, van amsterdam recognized that differences in ability, race, and gender have previously been framed as solely biological in nature to justify systemic oppression and that social justice activism has resulted in the recognition of these categorizations as socially constructed . Previous researchers have stated that weight bias is socially sanctioned bigotry [70, p. 250] and that if we care about social justice, we need to figure out whether the suffering of fat people in virtue of violating the thinness norm is permissible [50, p. 221 young argued that the greater social system and the perpetrators of weight bias are unable to adequately and effectively discuss weight without putting thinness on a pedestal and that obesity discourse has eluded one of the greatest political, social, and cultural movements of the twentieth (and late nineteenth) century feminism we assert that social justice must be placed at the forefront of the discussion of weight bias, rather than as an indirect or subtle recognition . We echo young's statement that there is no authentic, credible space where the oppression associated with fat, can be spoken about (p. 251) and call for such credible spaces to be carved out in weight bias literature . It is in the direction of naming weight bias as a social justice issue that we invite continued debate between disciplines and an effort to find common ground to address the societal and structural inequalities that impact people with large bodies . Although each of the different perspectives taken among weight bias researchers has unique approaches to understanding and examining weight bias; each perspective recognizes weight bias as an important social issue surrounding a discourse of weight as being within individual control . Each perspective has also identified specific social and individual consequences of weight bias, as well as the ways in which weight bias is related to social inequities . Our review of the common perspectives taken in weight bias research revealed differences in how weight bias is termed, conceptualized, and understood . Most notably, there is consensus among each perspective that weight bias is influenced by the pervasive belief that weight is within individual control . There is also consensus that weight bias has negative consequences ranging from individual health consequences to social oppression and that these consequences influence social inequity when intersected with gender, race, ses, and sexual orientation . Perhaps the consideration of such similarities, increased attention to social and structural inequalities, and openness to differing perspectives on language, including the use of both person - first and identity - first language, can fuel the future of research in weight bias to occur in a space where divergent views are respected in the name of social justice . Although limited, previous researchers have also called for increased interdisciplinarity with regard to weight bias research and activism [69, 79]. Mansfield and rich stated that obesity discourse can be critically examined from multiple perspectives, but that those who critique discourse are united by a common commitment and desire towards challenging dominant approaches to health which are solely weight - centric (p. 359 - 360). They propose that researchers, practitioners, and policy makers who critique obesity discourse need to work across artificial barriers . They argue that increased involvement with the knowledge and perspectives of diverse fields may benefit weight bias activism . Clare and colleagues proposed that such integration may be fostered through applied interdisciplinarity, which focuses on strategically utilizing the knowledge and skills of various areas regarded as stakeholders of a specific issue . In this discussion, we have invited researchers to recognize weight bias as an important social justice issue and to consider ways that our unique and combined efforts might address the aversive conditions under which body size is demarcated in our society as a space for the maltreatment and oppression of people . In addition, we called for researchers from various areas to work across professional boundaries in a joined effort for social change . Working towards increased interdisciplinarity between the various research areas and increased recognition of weight bias as an important social justice issue will serve people of every size. |
Hip fractures remain a major cause of morbidity and mortality among the aging population of the united states . According to the center for disease control, there are 586 000 admissions annually for fractures in people aged 65 or older . Of these fractures, nearly half, 273 000, were hip fractures, defined as either femoral neck or intertrochanteric fractures, excluding pathologic fractures . In addition, of the 324 000 admissions for hip fracture in all age - groups, an overwhelming 84% were in people aged 65 and older . Greater than half of patients with a hip fracture show a measurable decline in functional status after their injury, often necessitating secondary care facility admission . The risk of mortality in an elderly individual 3 months after hip fracture is greater than 4 times that of one without, and the risk of death at 1 year is twice that of a comparable uninjured person, and studies have demonstrated that decreased preoperative function is predictive of increased postoperative morbidity and mortality, emphasizing the importance of improved postoperative cognition and exercise for maximizing functional outcome after a hip fracture . Estimates of total cost to the health care system for hip fractures, including both hospital and posthospital care, are up to us$30 billion annually in the united states . Despite increased emphasis on bone health, given the rapidly increasing elderly populace, the associated costs of hip fracture care are only expected to continue to rise . Postoperative pain control remains difficult in the aging population, and opioid analgesia dominates current pain management strategies . Pharmacokinetics and pharmacodynamics are more complex in elderly persons who experience higher peak effect and longer duration of action of opioids due largely to decreased renal and hepatic clearance as well as a change in body composition including an increase in adipose tissue, decrease in lean body mass, and decrease in total body water . This puts them at increased risk of respiratory depression, constipation, delirium, pulmonary complications, and oversedation . Despite pain - induced complications such as delirium, many physicians are reluctant to prescribe opioid analgesics to elderly patients for fear of potential resultant opioid - induced adverse effects . Postoperative pain has been associated not only with delirium but also with prolonged bed rest following surgery . These disruptions in physical therapy (pt) and postoperative ambulation lead to a relative increase in risk of thromboembolism and functional impairment, which in turn may result in significantly longer hospital lengths of stay, long - term functional impairment, and other costs . Not surprisingly, improved functional outcomes, both short term and long term, are associated with superior patient performance in inpatient pt sessions . Any obstacles to pt participation by either opioid - induced side effects or undertreated pain will have a deleterious effect on functional recovery . Many opioid - related adverse drug events occurring in hospitals led the joint commission to publish a sentinel event alert with opioid use guidelines . Evidence - based guidelines do exist for prescribing opioids in acute and postoperative pain, but numerous studies show that these guidelines are rarely followed and pain control remains a difficult issue, especially in geriatric patients . Although caution is warranted in opioid analgesia use, compromising adequate pain control for fear of adverse effects these fears have facilitated the desire for nonopioid analgesics to be utilized as often as possible . Traditional nonsteroidal anti - inflammatories (nsaids) and cox-2 inhibitors have been shown to be efficacious in postoperative pain control but also have their own limitations, primarily the risk associated with their use in patients with impaired renal and/or cardiovascular function . Acetaminophen has a well - established analgesia profile and a more reliable bioavailability when administered intravenously versus orally or rectally and does not have a significant effect on kidney function in the postoperative period . The safety and efficacy of its use in patients aged 65 years and older have been shown to be comparable to that in younger patients without a need for dosing adjustments . Intravenous (iv) acetaminophen has repeatedly been shown to be a safe and efficacious analgesic in major orthopedic surgery . Although other studies have successfully demonstrated that the use of acetaminophen can reduce opioid use in the perioperative time period, no published studies have evaluated its effect on patient outcomes . In june 2012, the hip fracture committee at our institution adopted the use of scheduled iv acetaminophen in patients with hip fractures as the standard of care . The aim of this study was to determine whether the implementation of scheduled perioperative iv acetaminophen during hip fracture treatment for those aged 65 and older influenced the following: (1) length of hospital stay, (2) pain level, (3) narcotic use, (4) rate of missed pt sessions, (5) adverse effects, (6) gastrointestinal disturbance, and (7) discharge disposition . After institutional review board approval was obtained for a retrospective comparative cohort study, a search utilizing current procedural terminology (cpt) codes 27235, 27236, 27244, and 27245 was performed . All patients aged 65 years and older admitted to the orthopedic service at a level 1 trauma center who received operative treatment by 1 of the 6 fellowship - trained orthopedic surgeons over a 2-year period, from june 1, 2011, through may 31, 2013, were identified . Group 1 consisted of patients treated for 1 year before the initiation of a standardized iv acetaminophen pain control protocol on june 1, 2012, and group 2 consisted of those treated for 1 year after the protocol was initiated . All other aspects of the geriatric hip fracture protocol remained consistent throughout this 2-year period . Ninety - seven fractures were excluded for the following reasons: admission to a nonorthopedic service (55), subtrochanteric (13), pathologic (8), periprosthetic (8), simultaneous orthopedic injuries requiring operative intervention (8 fractures in 7 patients, including simultaneous bilateral hip fractures in 1 patient), and perioperative death (5). This resulted in 332 patients with 336 intertrochanteric or femoral neck fractures (169 in group 1 and 167 in group 2), classified as arbeitsgemeinschaft fr osteosynthesefragen / orthopaedic trauma association (ao / ota) 31-a or 31-b . Bilateral hip fractures were included in 4 patients with nonsimultaneous injuries that occurred at a mean of 11 months (range 5 - 19) apart . The patients had a mean age of 82.6 years (range 65 - 101). Group 1 received oral acetaminophen as well as a combination of oral and iv narcotics, all of which were ordered on an as - needed basis for pain control . Although the specifics varied from patient to patient, orders for oral acetaminophen were 1000 mg every 8 hours, oral narcotics typically consisted of tramadol 50 mg every 6 hours and/or oxycodone 5 to 10 mg every 4 hours, and iv morphine was ordered as 2 to 4 mg every 2 hours . The standardized pain management protocol at our institution for group 2 consisted of iv acetaminophen administered to patients with a hip fracture in 1000-mg increments every 8 hours for a minimum of 24 hours from the time of admission or until they were taken to surgery if that time period exceeded 24 hours . Throughout that time they were given iv narcotics for breakthrough pain as needed, ordered at the same frequency as group 1 . Patients were transitioned to as - needed oral acetaminophen and traditional narcotics after the initial time period ended . Patients also continued receiving iv acetaminophen if they were unable to tolerate oral medications and/or traditional narcotics . We performed a retrospective chart review and collected data for patient demographics (eg, age, body mass index [bmi], and sex), in - hospital variables (eg, diagnosis, surgical treatment, time to the operating room, and doses of acetaminophen received), and outcome measures (eg, length of stay, total narcotic usage, pain score, pt sessions missed, discharge location, and adverse effects). The primary outcome variable for our study was length of stay (days from admission to discharge). Pain score was documented using 10-point visual analog scale (vas) with word descriptors . Mean pain score was calculated from 4 points in time: the first entry at admission, 6 hours postoperatively, 24 hours postoperatively, and the last entry before discharge . Narcotic use was calculated by converting all doses of oral and iv opioid narcotics to cumulative milligrams of morphine - equivalent using equianalgesic tables . The percentage of missed pt sessions was calculated as the ratio of pt sessions missed to the total number of pt attempts . Gastrointestinal disturbance was determined using the number of as - needed bowel motility and antiemetic agents used . Discharge to a secondary care facility was defined as a skilled nursing facility, subacute rehabilitation, or acute rehabilitation, versus discharge to independent living at home . A power analysis based on length of stay as the primary outcome variable indicated that with = .05 and = .20, a statistically significant difference would be detected with a sample size of 284 patients (142/cohort). Descriptive statistics were completed to provide the mean, standard deviation, range, percentages, and distribution of variables . Quantitative data, including length of stay, narcotic use, acetaminophen use, bowel motility use, antiemetic use, pain score, and hours to surgery, were analyzed using the unpaired t test, while nominal data, including missed pt sessions and discharge location, were analyzed using the chi - square test . Quantitative data are reported as mean standard deviation, while nominal data are reported as percentages . Separate multivariate regression analyses were performed using length of stay, pain score, total narcotic usage, and pt sessions missed as dependent variables, while age, iv acetaminophen use, sex, bmi, time to the operating room, diagnosis, pain score, and narcotic use were used as independent variables . A logistic regression analysis was also performed using discharge location as the dependent variable and the same independent variables . Multivariate regression data are reported as the coefficient, while logistic regression results are shown as odds ratios and 95% confidence intervals . Significance for all analyses was assessed at p <.05 . Analyses were performed using spss v21.0 (ibm, armonk, new york). There was no statistically significant difference in demographic data (age, sex, diagnosis, surgical treatment, and bmi) or time from admission to the operating room between the 2 cohorts (table 1). Oral acetaminophen was significantly less and iv acetaminophen was significantly greater in group 2 (table 1). Outcome variables are reported in table 2, and group 2 had a statistically significant shorter mean length of hospital stay, lower mean pain score, lower mean narcotic usage, lower percentage of pt sessions missed, and higher likelihood of discharge home instead of to a secondary care facility . The 2 groups did not show a statistically significant difference in as - needed bowel motility agent or antiemetic medication use . Utilization of iv acetaminophen was consistently a statistically significant predictor of decreased length of stay, decreased pain scores, lower narcotic usage, and fewer missed pt sessions when controlling for all other variables (table 3). Increased bmi predicted increased narcotic use . Increased narcotic use predicted increased length of stay . Younger age, iv acetaminophen use, male sex, earlier surgery, and lower narcotic use increased the likelihood of discharge to home with statistical significance (table 4). Table 1.baseline data: demographic and in - hospital data by treatment group . Group 1 (n = 169)group 2 (n = 167) p valueage, years 83.3 8.2 (65 - 101)81.8 8.0 (66 - 101).08sex .85 male45 (27%)46 (28%) female124 (73%)121 (72%) fracture .33 femoral neck81 (48%)78 (47%) intertrochanteric88 (52%)89 (53%) surgical treatment .81 arthroplasty71 (42%)68 (41%) internal fixation98 (58%)99 (59) body mass index 25.2 6.7 (13.4 - 57.1)26.3 5.5 (16.1 - 41.5).10time from admission to or, hours 17.1 10.8 (1 - 65)15.3 8.1 (0 - 56).09total acetaminophen, doses 8.7 6.2 (0 - 35)9.2 5.0 (0 - 30).48oral acetaminophen, doses 8.5 6.3 (0 - 35)5.4 5.1 (0 - 27) <.001 iv acetaminophen, doses 0.2 1.2 (0 - 12)3.7 (0 - 12) <.001 abbreviations: iv, intravenous; or, operating room . Reported as mean standard deviation (range). Reported as number (percentage). *p indicates statistical significance 0.05 . Group 1 (n = 169)group 2 (n = 167) p valuelength of stay, days 4.4 3.8 (1.2 - 13)3.8 1.7 (1.5 - 11.4) <.001*pain score (vas scale) 4.2 2.1 (0 - 9.2)2.8 1.8 (0 - 7.7) <.001*narcotic use, mg morphine - equivalent 41.3 135.9 (0 - 189.7)28.3 30.5 (0 - 204.3) <.001*daily narcotic use, mg / day 9.6 .8.1 (0 - 49.9)7.8 8.7 (0 - 53.2).05*bowel motility agents, doses 1.0 .1.4 (0 - 10)0.8 1.0 (0 - 4).29antiemetic agents, doses 0.8 .1.4 (0 - 11)0.7 1.3 (0 - 7).48missed pt sessions,% 21.8 121.1 (0 - 66.7)10.4 17.9 (0 - 100) <.001*discharge location .001 * home12 (7%)32 (19%) secondary care facility157 (93%)135 (81%) abbreviations: vas, visual analog scale; mg, milligrams; pt, physical therapy . Reported as mean standard deviation (range). (a) length of stay coefficient p value(b) pain score coefficient p valueage.07age0.028 <.001*iv acetaminophen0.581 <.001*iv acetaminophen2.5 .001*sex.16sex.94bmi.09bmi.84time to or0.058 <.001*time to or.94diagnosis.93diagnosis.25pain score.76pain scorexxnarcotic use0.009 <.001*narcotic use.54(c) narcotic use coefficient p value(d) missed pt sessions coefficient p valueage1.23 <.001*age.49iv acetaminophen15.14 <.001*iv acetaminophen11.4 <.001*sex.18sex.74bmi0.94 .001*bmi.17time to or0.44 .01*time to or.71diagnosis.71diagnosis.51pain score.54pain score.33narcotic usexxnarcotic use.10abbreviations: iv, intravenous; bmi, body mass index; or, operating room; pt, physical therapy . Multivariate regression analyses for length of stay (a), pain score (b), total narcotic use (c), and missed pt sessions (d), with coefficients for all variables that demonstrated statistical significance for one or more regressions. *p indicates statistical significance 0.05 . Variableunitodds ratio (95% ci) p valueage1 year of increasing age1.1 (1.1 - 1.2) <.001*iv acetaminophenincremental dose of iv acetaminophen0.37 (0.18 - 0.77).008*sexfemale gender2.1 (1.0 - 4.3) <.001*bmin / a.86time to or1 hour of increased time to or1.1 (1.0 - 1.1).026*diagnosisn / a.64pain scoren / a.45narcotic use10 mg morphine - equivalent1.2 (1.02 - 1.3).03*abbreviations: ci, confidence interval; iv, intravenous; bmi, body mass index; or, operating room; mg, milligrams; n / a, not available . Logistic regression analysis with odds ratios and confidence intervals listed for those variables demonstrating statistical significance as predictive of likelihood of discharge to a secondary care facility as opposed to home. *p indicates statistical significance 0.05 . Abbreviations: iv, intravenous; or, operating room . Reported as mean standard deviation (range). Reported as number (percentage). * abbreviations: vas, visual analog scale; mg, milligrams; pt, physical therapy . Abbreviations: iv, intravenous; bmi, body mass index; or, operating room; pt, physical therapy . Multivariate regression analyses for length of stay (a), pain score (b), total narcotic use (c), and missed pt sessions (d), with coefficients for all variables that demonstrated statistical significance for one or more regressions . * p indicates statistical significance 0.05 . Regression analysis: odds of discharge to secondary care facility . Abbreviations: ci, confidence interval; iv, intravenous; bmi, body mass index; or, operating room; mg, milligrams; n / a, not available . Logistic regression analysis with odds ratios and confidence intervals listed for those variables demonstrating statistical significance as predictive of likelihood of discharge to a secondary care facility as opposed to home . Hip fractures are a common problem in the elderly population of the united states, having substantial impact, including patients functional decline and economic burden to the health care system . A vast majority of hip fractures are treated operatively, and opioid - based pain control remains a mainstay in treatment of perioperative pain . However, opioid - based regimens are associated with a number of adverse side effects that may complicate a patient s perioperative care . An institutional geriatric hip fracture program was well established by the time of our data collection . Recent studies have shown the effectiveness of geriatric hip fracture programs in improving patient outcomes . Our institution s hip fracture committee further standardized hip fracture care by adopting a scheduled iv acetaminophen protocol for perioperative pain management . Our data demonstrated no statistical significance in total acetaminophen use between the 2 groups, but we did note a difference between the 2 routes of administration for the groups . As group 2 used a higher ratio of iv to oral acetaminophen, the improvements in our determined outcome measures with iv acetaminophen use supports the iv route of administration as more beneficial in improving outcomes . Studies have shown that iv acetaminophen not only reaches a higher peak plasma concentration than oral acetaminophen but also that iv acetaminophen reaches that point earlier . It has also been shown that gastric emptying and gastrointestinal absorption is slowed in the elderly individuals, patients in a normal postoperative state, and those who have received opioid narcotics, resulting in potentially slower absorption of oral acetaminophen . These serve as potential explanations for the increased efficacy of the iv route of acetaminophen observed in our study . Other studies have demonstrated the importance of early surgery on fewer in - hospital complications, improved functional outcome, increased return to independent living, and decreased mortality . In this study, there was no statically significant difference in length of time from admission to the operating room between the 2 groups . Our data reinforced the findings of increased rate of home discharge with early surgery, but in addition we found that iv acetaminophen use was independently predictive of improved outcomes and a higher likelihood of home discharge when controlling for time from admission to the operating room in our analysis . Intravenous acetaminophen usage was also predictive of decreased vas pain scores as well as decreased narcotic usage, both of which are factors universally known to be common causes of delirium . As such, in addition to the intrinsic value of decreasing patients perioperative pain, iv acetaminophen has the potential to be a useful medication in indirectly reducing delirium in the elderly population by reducing the likelihood of delirium resulting from both inadequately controlled pain and opioid narcotic use . Chin et al demonstrated that a standardized regimen of scheduled analgesics improves participation in pt following hip fracture surgery, and recent studies have shown that early functional outcome is predictive of improved 1-year mortality . Our results also demonstrated improved postoperative participation in pt and that iv acetaminophen use was the only variable to demonstrate statistical significance in doing so . We utilized a historical control (group 1) and found no difference between the 2 groups for any confounding variables . In addition, the large cohort sizes provided statistical power to determine significance for many variables . Furthermore, the geriatric hip fracture and the iv acetaminophen institutional protocols were consistently followed . However, our study is not without its limitations, many of which are inherent to its retrospective nature . The ability to measure and compare outcome variables was limited by the data consistently available within the electronic medical record . Mortality rate, readmission, pre- and postfracture objective functional capacity scores, and prehospital residence were not included . Additional narcotic - induced adverse effects, including pulmonary complications, respiratory depression, and oversedation, were not consistently available . Also, during the time of this study, there were no protocols in place that required consistent, objective documentation of episodes of delirium or causes for missed pt sessions . Furthermore, although the geriatric hip fracture program was well established before the initiation of this study, it is possible that immeasurable variables, such as education of physical therapists and nursing staff to the program s goals and efficiency of care management personnel in the discharge process, improved throughout the period of our data collection, thus having a confounding effect . Prospective, randomized trials are therefore needed to delineate such effects, while including all desired outcome measures, including standardized functional outcome scores, hospital readmission rates, and mortality rates . The cost of iv acetaminophen will vary by institution, but in our study it was more expensive than oral acetaminophen and all individual iv and oral opioid medications . Whether this cost is offset or even overcome by decreased length of hospital stay and/or decreased use of all other pain medications as such, in addition to comparative effectiveness research, it is essential for future research to include a cost analysis . In the geriatric hip fracture population, pain control is an important aspect of patient care, yet narcotic use is complicated by a number of factors . The utilization of scheduled perioperative iv acetaminophen as part of a standardized protocol for geriatric hip fractures is efficacious for shortening hospital length of stay, controlling pain and decreasing narcotic use, improving participation in pt, and increasing home discharge rate . Other areas of orthopedics have demonstrated the benefit of iv acetaminophen, and this study supports its use in the geriatric hip fracture population. |
Acute myeloid leukemia a cancer of the blood and bone marrow is the most common type of acute leukemia in adults which usually quickly gets worse if not treated . The treatment of aml varies according to one's age, general condition at diagnosis, and cytogenetic parameters . Diagnosis is made when blood and bone marrow samples show a large number of leukemia cells . Aml is further subdivided into eight subtypes, labeled m0 to m7, basing on the type of blood cells affected, by the method of flow cytometry . For most patients aged 69 or younger, the first line treatment consists primarily of chemotherapy, which is usually divided into two phases: induction and post remission (or consolidation) therapy . The goal of induction therapy is to achieve a complete remission by reducing the amount of leukemic cells to an undetectable level where as the goal of consolidation therapy is to eliminate any residual undetectable disease and achieve a complete cure . Induction therapy for such patients (except the m3 subtype), under the age of 70 typically includes cytarabine (ara - c), an anthracycline (such as daunorubicin or idarubicin and occasionally etoposide chemotherapy . These medications are given over a six- to seven - day period, followed by three or more weeks of recovery period, for the patient to recover from the treatment . 7 + 3 (or 3 + 7), because the cytarabine is given as a continuous iv infusion for seven consecutive days while the anthracycline drug is given for three consecutive days also intravenously . Invasive fungal infections (ifi) due to aspergillus, fusarium, and mucorales species, and pneumocystis jirovecii infections are a frequent complication of neutropenia due to such intensive chemotherapy for acute leukemias . Out of these ifi, invasive aspergilosis (ia) is a significant cause of life - threatening infection in severely immunocompromised patients, especially those with aml . Several challenges exist in the treatment of such ifis because early and correct diagnosis of such fungal infections is usually difficult as these saprophytic fungi are usually resistant to the conventional drugs, and hence monotherapy with antifungal agents is often unsuccessful . Treatment for ifis has been the use of either amphotericin b deoxycholate or lipid formulations of amphotericin b. however, certain studies indicate that invasive aspergillosis do not respond well to amphotericin b, even when lipid formulations are used . However the therapeutic strategy of aspergillosis has been totally modified with the emergence of echinocandins . The echinocandins are a class of intravenous antifungal agents that represents a promising advancement in the treatment of invasive fungal infections due to the candida and aspergillus species . Currently, two echinocandin antifungal agents, micafungin (mycamine) and caspofungin (cancidas) are approved by the food and drug administration (fda) which have documented activity against invasive candidiasis and refractory aspergillus . Cancidas (caspofungin acetate) is a sterile, lyophilized product for intravenous infusion that contains a semisynthetic lipopeptide (echinocandin) compound synthesized from a fermentation product of glarea lozoyensis . It is indicated in empirical therapy for presumed fungal infections in febrile, neutropenic adults and pediatric patients (3 months and older) and in those who are refractory to or intolerant to other antifungal therapies . Thus caspofungins have the advantages of a broad spectrum of activity, favorable tolerability profile, with no hepatotoxic or nephrotoxic adverse effects . With the event of the ongoing post marketing surveillance with this drug, till date but here we report a new unreported side effect of caspofungin in a patient of aml with no past history of cardiac disease, who developed complete heart block, during treatment with cansidas for pulmonary aspergillosis . We report the case of a 58-year - old female who was admitted to the medicine department of s.c.b medical college and hospital, cuttack in june 2010 because of generalized lymphadenopathy and vomiting . Her peripheral blood smear showed leukocytosis with a wbc of 93,500/microliters, and the bone marrow picture revealed a predominance of blast cells . She was treated with 3 + 7 induction therapy, where daunorubicin was given in a dose of 60mg / m / day for 3 days and cytarabine in a dose of 100 mg/ m / day for 7 days . Subsequently she received high dose cytosine arabinoside in a dose of 3 gm / m / dose . After 9 days of this high dose chemotherapy she developed mucosal toxicities and high fever with cough during the hospital course . Although there was a slight decrease in her temperature and moderate improvement in her general condition, she developed sudden tachypnea, dyspnea, fever, bilateral pulmonary infiltrates and acute respiratory distress on the sixteenth day for which she had to be put in a ventillator . Pulmonary ct scan was performed which showed bilateral diffuse pulmonary infiltrations suggesting fungal or bacterial pneumonia . Diagnosis of invasive pulmonary aspergillosis (ipa) was done on the basis of isolation of an aspergillus species from the sputum and from bronchoalveolar lavage samples . Basing on the laboratory diagnosis she was administered a single loading dose of 70-mg of caspofungin as intravenous infusion over a period of 1 h. but 45 minutes after the start of the infusion, she developed bradycardia and hypotension which did not respond to frequent fluid boluses . The ecg showed complete atrioventricular (av) block . In spite of cardiopulmonary resuscitation, invasive aspergillosis is a frequently encountered infection in aml patients undergoing induction chemotherapy due to prolonged and profound neutropenia as a sequel of chemotherapy where antifungal therapy remains the main stay of treatment . Cardiac involvement by aspergillus is though rare, may result from contagious spread from the lungs or from hematogenous spread . Pericardial and myocardial aspergillosis are rare manifestations of systemic aspergillosis which can result in arrhythmias and death . Caspofungin are generally well tolerated drugs for drug - related adverse events reported till date is not considered serious . Infusion - related adverse events though reported in 2 patients (5.1%) were judged to be mild in intensity . Caspofungins release histamine in peripheral blood cells, so possible histamine - mediated symptoms ranging from severe fatal anaphylaxis to milder side effects like rashes, facial swelling, pruritus, sensation of warmth, or bronchospasm have been reported . Reported cardiovascular side effects with caspofungins include hypotension (up to 20%), tachycardia (up to 8%), hypertension (up to 6%) and arrhythmia, atrial fibrillation, bradycardia, cardiac arrest, myocardial infarction (in less than 5%). We also searched the literature about cardiac side effects of caspofungins but such acute cardiac events have not been reported during the first dose of cancidas infusion . A study created by ehealth me based on 37 reports from fda and user community reports that caspofungins can cause heart attack in less than 2%, coronary artery disease in 0.05% of people . On oct, 8, 2011: 1,906 people reported to have side effects when taking cancidas . Among them, 37 people (1.94%) had cardiac arrest out of which 71.43% were males in comparision to 28.57% who were females . 29.79% of the people who had cardiac arrest with caspofungins were more than 60 yrs of age . The top conditions associated with these people were aspergillosis, candida sepsis, fungal infection, atrial flutter, septicaemia . It is postulated that histamine released by caspofungins caused the av block in our patient . Though histamine release is a common feature of such infusion related side effects, however cardiac arrest due to hypokalemia which is a very rare side effect (23.4% with amphotericin as compared to 9.9% with caspofungins) was not provided by the family, we were unable to show possible cardiac fungal involvement that could be responsible for the complete heart block in our patient . Caspofungins as antifungal therapies for disseminated fungal infections are being increasingly used, although the safety of these regimens has never been established . Clinicians should be cognizant that chb is a potential side effect of caspofungin for the treatment of disseminated fungal infections. |
During the last 30 years, several studies have been conducted all over the world in order to investigate the possible sex differences in oral health status and behavior in populations of various age groups and characteristics . Most of these studies concluded that females bear a higher burden of dental caries compared to males . Higher caries prevalence among females has been traditionally attributed to: (a) earlier tooth eruption among girls and hence, longer exposure of their teeth to the cariogenic oral environment, (b) easier access to food supplies by women and frequent snacking during food preparation, (c) vomiting, neglected oral hygiene, and nutritional changes during pregnancy, and (d) social factors (e.g., women's social role in the society and family, ritual fasting). Recently, evidence has been provided to demonstrate that higher caries rates in women may also be explained by differences in salivary composition and flow rate, hormonal fluctuations during puberty, menstruation and pregnancy, and genetic variations . On the other hand, it is generally accepted that with the exception of puberty and pregnancy, females exhibit lower periodontal diseases prevalence and severity than males . This difference is mainly attributed to better oral health behavior and hygiene status among females while hormonal and other physiological and behavioral differences between the two genders may also contribute to the higher risk for periodontal diseases in males than in females . Over the last 3035 years, there has been evidence of decreasing caries prevalence in children and adolescents in developed countries due to improvements in oral health behaviors, increased exposure to fluorides, and application of effective caries prevention programs . On the contrary, the prevalence of dental caries among middle - aged adults was high as the disease affected nearly 100% of the population in a majority of the studies while most developed countries showed high decayed, missing, and filled teeth (dmft) values . However, in some studies a decline in caries experience has been reported that is mainly attributed to a reduction in missing teeth . Trends in periodontal diseases are more complicated but it seems that a decline in gingivitis during adolescence is common in developed countries, reflecting an increased social awareness and better oral hygiene . There is also evidence that the prevalence of severe periodontal diseases in middle - aged adults is declining . Although there are plenty of data concerning the prevalence and severity of dental caries and periodontal diseases in children, adolescents, and middle aged adults, changes in the oral health of young adults are not well - documented while most studies concerning this age group include convenient samples of university students and military personnel . In greece, epidemiological data concerning the oral health and hygiene status as well as the oral health behaviors of young adults have been collected among dental students in 1981, 2000, and 2010 . During these 30 years, significant changes took place in the curriculum of athens dental school . The number of dental courses in the first six semesters gradually increased while some medical courses were geared to the needs of dental medicine . Furthermore, in 1981 and 2000, third year students did not participate in clinical experiences, whereas in 2010 they had to achieve a defined level of clinical competency before advancing to the fourth year . These changes might have a significant impact on the oral health status and behavior of dental students . The aims of this study were to investigate possible changes in the oral health status and behavior of greek dental students over time, and to meta - analyze these findings in order to test the hypothesis that females have better oral health behavior as well as better oral hygiene and periodontal status but exhibit higher dental caries experience than males . All greek students who attended the sixth semester of athens dental school, and specifically the preventive dentistry course were invited to participate in the survey in 1981, 2000, and 2010 . The students age range was 1925 years (mean age 21.3 years, 22.2 years, and 21.0 years, respectively). In each of these years, all the students were examined but because of a reduction in the number of students admitted in the dental school during the 1990s, the sample size was 180 students in 1981, 109 in 2000, and 96 in 2010 . The attrition rate was 10.4%, 4.4%, and 3% in 1981, 2000, and 2010, respectively . The examinations were performed at a university dental clinic using dental mirrors and periodontal probes . Prior to each survey, four dental doctor of philosophy (phd) students (12 examiners in total) were trained and calibrated . Interexaminer reliability and agreement were assessed with an experienced investigator (e - mh) as the gold standard . For the examined indices, levels of concordance were very good (kappa coefficient 0.83) in all three surveys (0.83, 0.84, and 0.86 in 1981, 2000, and 2010 surveys, respectively). The ethical committee of athens dental school gave its approval prior to the start of the study, and informed written consent forms were obtained from all the participants . The clinical recorded variables were coronal caries, periodontal status, and oral hygiene status . Coronal caries was measured using the dmft index and was diagnosed at the caries into dentine threshold . The periodontal conditions were measured using the community periodontal index (cpi) and are presented according to the highest score recorded for each person (indicating the prevalence of conditions). The oral hygiene status was recorded by means of the simplified oral hygiene index (ohi - s). Behavioral data were collected through a structured questionnaire that was completed face - to - face at the time of the clinical examination . These questionnaires included simple questions about oral hygiene habits such as brushing frequency and the reason for visiting a dentist . The internal consistency of this survey was satisfactory (cronbach's alpha coefficient 0.90). The outcome variables were dmft, cpi, and ohi - s scores of the subjects as well as brushing frequency and reason for dental attendance . Initial data analysis relied on descriptive statistics; bivariate examination of statistical associations was conducted performing chi - square and nonparametric tests (kruskal wallis and mann whitney u), using gender and year of examination as the independent variables . Mann whitney u tests were also applied for performing post hoc pairwise group comparisons when the kruskal finally, in order to meta - analyze data by gender concerning the outcome variables recorded in every one of the three surveys (cpi scores were recorded only in 2000 and 2010), mantel haenszel and continuous outcomes methods were used . Because there were three possible pairwise comparisons, the bonferroni - adjusted p value needed for significance at the 0.05 level was 0.05/3 or 0.017 . The analyses of coded data were performed using ibm (armonk, ny) statistical package for the social sciences (spss) statistics software version 20.0 . The data concerning brushing frequency and reason for visiting a dentist by gender and year of examination are presented in table 1 . As can be seen, regular tooth brushing (twice per day) was claimed by 57%, 82.6%, and 83.5% of the respondents in 1981, 2000, and 2010, respectively but these differences were significant only between 1981 and 2000/2010 (= 34.626, p <0.017). The percentage of those reporting that they brushed their teeth less than once a day was relatively low in 1981 (9.5%) and very low in 2000 and 2010 (0.9% and 1.1%, respectively). Females brushed their teeth more often than males while significant differences by gender were found in the survey of 1981 (= 23.709, p <0.017) and in the summarized data of meta - analysis [summary odds ratio (or): 1.95 and 95% confidence interval (ci): 1.083.54]. Brushing frequency and reason for visiting a dentist of greek dental students by gender and year of examination and meta - analysis of the data the percentage of students who attended a dentist for checkup was significantly increasing over the years, from 39% in 1981 to 64.4% in 2000 and to 80% in 2010 (table 1, = 46.075, p <0.017). Bivariate as well as meta - analysis of the data showed that no significant difference was observed by gender . The mean ohi - s values in the overall samples in 1981, 2000, and 2010 were 0.76, 0.74, and 0.43, respectively [table 2]. Statistically significant differences were observed between the survey of 2010 and those of 1981 and 2000 (kruskal wallis test, p <0.017). Women had better oral hygiene status than men in 1981 and 2000 but the observed differences were significant only in 1981 (mann whitney u test, p <0.017). On the contrary, the oral hygiene status of males was slightly better than that of females in 2010 . Meta - analysis of the data indicated that males had in summary higher ohi - s score than females (summary mean: 0.133) but this difference did not reach statistical significance . Oral hygiene status of greek dental students by gender and year of examination and meta - analysis of ohi - s scores the percentage of subjects with healthy periodontium in the overall sample was 22.9% in 2000 and 11.5% in 2010 [table 3]. On the other hand, the percentages of students with calculus and shallow pockets of 45 mm were lower in 2010 than in 2000 (24% and 6.2% versus 56% and 8.3%, respectively). The most frequently observed condition in 2000 was calculus (56%) and in 2010 was bleeding (58.3%). Deep pockets of more than 6 mm were not observed in any of the two surveys . The number of persons who had as highest cpi score 0 and 1 was significantly higher in 2010 than in 2000 (69.7% versus 35.8%, = 23.647, p <0.017). Chi - square tests as well as meta - analysis of the data showed that no significant differences were observed genderwise although meta - analysis indicated that females were less prone to have higher cpi score than males (summary or: 0.61 and 95% ci: 0.281.32). Periodontal health of greek dental students by gender and year of examination and meta - analysis of cpi scores the percentages of caries - free students in 1981, 2000, and 2010 were 2.2%, 18.3%, and 19.8%, respectively, and the mean dmft scores were 10.53, 5.56, and 3.55, respectively [table 4]. Filled teeth (ft) were the major component of the dmft index in all three surveys . The mean dmft score was significantly decreasing over time (kruskal wallis test, p <0.017). The analysis of the results by gender revealed no significant differences in dmft scores (mann whitney u test, p> 0.017) as well as in the percentages of caries - free students (or1981: 3% and 95% ci: 0.30629.400, or2000: 1.305 and 95% ci: 0.4683.641, or2010: 0.645 and 95% ci: 0.2041.919). The above findings were confirmed by the meta - analysis of the data, indicating that males and females had an almost similar risk of developing caries since caries - free summary or was found very close to 1 (summary or: 1.05 and 95% ci: 0.4202.620). Caries experience of greek dental students by gender and year of examination and meta - analysis of caries - free odds ratios the data concerning brushing frequency and reason for visiting a dentist by gender and year of examination are presented in table 1 . As can be seen, regular tooth brushing (twice per day) was claimed by 57%, 82.6%, and 83.5% of the respondents in 1981, 2000, and 2010, respectively but these differences were significant only between 1981 and 2000/2010 (= 34.626, p <0.017). The percentage of those reporting that they brushed their teeth less than once a day was relatively low in 1981 (9.5%) and very low in 2000 and 2010 (0.9% and 1.1%, respectively). Females brushed their teeth more often than males while significant differences by gender were found in the survey of 1981 (= 23.709, p <0.017) and in the summarized data of meta - analysis [summary odds ratio (or): 1.95 and 95% confidence interval (ci): 1.083.54]. Brushing frequency and reason for visiting a dentist of greek dental students by gender and year of examination and meta - analysis of the data the percentage of students who attended a dentist for checkup was significantly increasing over the years, from 39% in 1981 to 64.4% in 2000 and to 80% in 2010 (table 1, = 46.075, p <0.017). Bivariate as well as meta - analysis of the data showed that no significant difference was observed by gender . The mean ohi - s values in the overall samples in 1981, 2000, and 2010 were 0.76, 0.74, and 0.43, respectively [table 2]. Statistically significant differences were observed between the survey of 2010 and those of 1981 and 2000 (kruskal wallis test, p <0.017). Women had better oral hygiene status than men in 1981 and 2000 but the observed differences were significant only in 1981 (mann whitney u test, p <0.017). On the contrary, the oral hygiene status of males was slightly better than that of females in 2010 . Meta - analysis of the data indicated that males had in summary higher ohi - s score than females (summary mean: 0.133) but this difference did not reach statistical significance . Oral hygiene status of greek dental students by gender and year of examination and meta - analysis of ohi - s scores the percentage of subjects with healthy periodontium in the overall sample was 22.9% in 2000 and 11.5% in 2010 [table 3]. On the other hand, the percentages of students with calculus and shallow pockets of 45 mm were lower in 2010 than in 2000 (24% and 6.2% versus 56% and 8.3%, respectively). The most frequently observed condition in 2000 was calculus (56%) and in 2010 was bleeding (58.3%). Deep pockets of more than 6 mm were not observed in any of the two surveys . The number of persons who had as highest cpi score 0 and 1 was significantly higher in 2010 than in 2000 (69.7% versus 35.8%, = 23.647, p <0.017). Chi - square tests as well as meta - analysis of the data showed that no significant differences were observed genderwise although meta - analysis indicated that females were less prone to have higher cpi score than males (summary or: 0.61 and 95% ci: 0.281.32). Periodontal health of greek dental students by gender and year of examination and meta - analysis of cpi scores the percentages of caries - free students in 1981, 2000, and 2010 were 2.2%, 18.3%, and 19.8%, respectively, and the mean dmft scores were 10.53, 5.56, and 3.55, respectively [table 4]. Filled teeth (ft) were the major component of the dmft index in all three surveys . The mean dmft score was significantly decreasing over time (kruskal wallis test, p <0.017). The analysis of the results by gender revealed no significant differences in dmft scores (mann whitney u test, p> 0.017) as well as in the percentages of caries - free students (or1981: 3% and 95% ci: 0.30629.400, or2000: 1.305 and 95% ci: 0.4683.641, or2010: 0.645 and 95% ci: 0.2041.919). The above findings were confirmed by the meta - analysis of the data, indicating that males and females had an almost similar risk of developing caries since caries - free summary or was found very close to 1 (summary or: 1.05 and 95% ci: 0.4202.620). Caries experience of greek dental students by gender and year of examination and meta - analysis of caries - free odds ratios dental students constitute a special population group concerning their oral health status and behavior since they have the best access to information and motivation for the prevention and treatment of oral diseases . For this reason, they usually have better oral health behavior and lower cpi scores compared to students of other academic disciplines . On the other hand, their caries experience was found to be similar to that of other university students . This can be explained by the fact that dmft index is irreversible while for caries initiation and development, a sufficiently long period of time is needed . However, it seems that their dental education affects dmft components since it was noticed that a decrease in the number of carious lesions was accompanied by an increase in the number of fillings as the students progressed from one academic year to the next . Thus, the findings of this study were primarily compared to the ones pertaining to the oral health status and behaviors of dental students resulting in the best possible comparability . The analysis of data concerning the oral health behavior of the dental students showed that the majority of them brushed their teeth at least twice daily in all three surveys, and that this practice has greatly improved since 1981 . Therefore, it becomes obvious that students attending the sixth semester of their studies are aware of the importance of oral hygiene in the prevention of oral diseases, especially during the last decade . The percentage of greek dental students who brushed their teeth regularly was similar or higher than that observed in the same population group of most other countries . Significant changes have also been observed in the reason for visiting a dentist since the percentage of students who attended the dentist for checkup was doubled during a period of 30 years (from 39% in 1981 to 80% in 2010). Similar findings have been reported for belgian dental students between 1989 and 1994, indicating a better understanding of the importance of regular dental attendance over time . The oral hygiene status of the dental students examined, as measured by the ohi - s index, demonstrated a significant improvement in 2010 compared to 1981 and 2000, mainly due to the remarkable decrease of the di - s component . The differences observed between 1981 and 2010 could be attributed to the fact that a significantly higher percentage of students brushed their teeth twice daily in 2010 (83.5%) than in 1981 (57%). Therefore, it is very likely that students examined in 2010 brushed their teeth more effectively . The findings of the study concerning the periodontal status of students indicate an improvement over time since the percentage of those who had the highest of score 2 and 3 was significantly lower in the survey of 2010 compared to that in 2000 . This difference between the two surveys resulted mainly from the remarkable decrease in the number of those with calculus . A plausible explanation for this observation is the frequent removal of calculus among students who attended a dentist for checkup, the number of which was significantly greater in the survey of 2010 . The level of coronal caries experience in greek dental students was found to be significantly decreasing over the years . This finding may be mostly attributed to the observed improvements in health behavior of the participants and especially to the increased frequency of tooth brushing with fluoridated toothpastes . Furthermore, since a gradual increase in the number of students attending a dentist for checkup was noticed, a parallel increase in the number of students receiving topical fluoride treatments is probable . The mean dmft score in 2010 (3.55) was similar to that observed for dental students in finland, spain, tunisia, and india and lower than that reported for dental students in serbia, lithuania, poland, and croatia . Therefore, caries experience in greek dental students can be considered as satisfactory compared to recent studies conducted in other countries in the same population group . The significant improvement in the oral health status and behavior of greek dental students observed over time [tables 14] can be partly attributed to the overall improvement in the dental health status and behavior of children and adolescents over the last 30 years that is carried over into adult age . However, changes in athens dental school's curriculum such as the increase of dental courses in the first 3 years (from 10 in 1981, to 22 and 24 in 2000 and 2010, respectively), and the increase of clinical practice by 1 year may have also played a role in this improvement . The effect of gender on the oral health status and behavior of students was initially tested by bivariate analysis and then by meta - analysis of the data . We considered meta - analysis as the most appropriate methodology in order to test the hypothesis of the present study since it comprises the effect sizes as well as the precision of the included studies and avoids problems associated with the statistical conclusions arising from individual tests . In addition, the degree of between - study homogeneity was relatively high since the subjects were of similar origin (in each survey almost 60% of the students came from athens and 40% from the provinces) and the recorded indices were identical . Furthermore, since socioeconomic determinants have been identified as very important for patients in their utilization of dental care services and although there is no information about the socioeconomic status of the students included in this study, they all lived in an urban environment (athens) for at least 3 years at the time when the surveys took place and had more or less the same opportunities to obtain education and health care . Therefore, all the subjects of the sample were considered to be of a similar educational background . According to the results of the bivariate analysis, the only significant differences between males and females were observed in the study of 1981 and concerned brushing frequency and oral hygiene status . This meant that females brushed their teeth significantly more often and had a better oral hygiene status than males . However, according to meta - analysis of the data only tooth brushing frequency was significantly affected by gender . The finding that females had more positive behavior than males concerning brushing frequency was in accordance with those reported for dental students of several other countries this difference could be attributed to the fact that women usually care more about their body and appearance and therefore, they may be more concerned about adopting behaviors and habits, which promote their dental health . Also, it has been reported that women have lower oral health self - assessment and thus, they tend to be more ready to adopt better oral health behavior as they age or acquire dental health knowledge, compared to men . The hypothesis that females have better oral hygiene and periodontal status but exhibit higher dental caries experience than males is not supported by the findings of this study . The lack of significant difference in ohi - s scores between the two genders is probably due to the fact that male and female dental students are equally informed about oral hygiene instructions and consequently they are equally able to remove dental plaque effectively . The above observation may also explain the lack of significant difference in cpi scores between males and females since it is well - documented that the periodontal health is greatly affected by the oral hygiene status . Furthermore, several previous studies in dental students as well as in adolescents and young adults have not found significant differences in cpi scores by gender . On the other hand, some other studies therefore, it seems that gender differences in periodontal health are more pronounced in older individuals, primarily due to prolonged exposure to risk factors . Meta - analysis of the present study's data concerning caries prevalence indicated that young males and females had an almost similar risk of developing caries . This finding is actually contradictory to what is widely known and documented, according to which higher caries rates were found more often among females than males, especially in mature adults . Consequently, caries experience differences by gender seem to be reduced during the last few years but this is attributable to as yet unknown factors . Therefore, further research is required probably focusing not only on the traditional and well - established factors, which are related to gender difference in caries but also on more unexplored causes such as the increased use of noncariogenic sugar substitutes, the widespread use of antibiotics by both genders, and herd immunity, which may eliminate the gender gap in caries prevalence and experience . The present study had several limitations . To begin with, as it has already been mentioned, dental students constitute a special population group concerning their oral health status and behavior . Therefore, the findings of this study were primarily compared to the ones pertaining to the oral health status and behaviors of dental students, and they were not generalized to other similar age groups . Also, the number of participants was relatively small in each survey although the attrition rates were low . Further, no specific information was provided on the socioeconomic status of the students included in this study . Finally, certain information was retrieved from the students reports (e.g., brushing frequency) and therefore, they were subject to recall bias . In conclusion, the results of the present study suggest a significant improvement in the oral health status and behavior of greek dental students over time . This observation can be partly attributed to the overall improvement in the dental health status and behavior of children and adolescents over the last 30 years that is carried over into adult age . However, changes in the curriculum, such as the increased time of clinical practice and the integration of a significant number of dental courses in the first 3 years, may have also played a role in this improvement . Additionally, differences in oral health between young males and females appeared to be eliminated or at least reduced during the last 30 years . Since these findings are supported by some relatively recent reports, further research is required in order to detect some as yet unknown factors, which may be responsible for this change. |
In the last three decades, magnetic resonance imaging (mri) has been used for noninvasive assessment of the prostate and surrounding structures . Initially, prostate mri was only based on morphologic assessment, using t1-weighted imaging (t1wi) and t2-weighted imaging (t2wi) sequences . Its role was primarily for loco - regional staging of the prostate cancer as it provided limited capability to distinguish between benign pathological tissue and clinically insignificant tumors from significant prostate cancer . To increase the diagnostic accuracy, anatomic t2wi and functional mri sequences - such as dynamic contrast enhanced mri (dce - mri), diffusion - weighted imaging (dwi) with its derivate apparent - diffusion coefficient (adc) map and hydrogen 1 mr spectroscopic imaging (mrsi) - were combined in an integrated multiparametric mri (mp - mri) examination . The technological advances, combined with a growing interpreter experience, have substantially improved the detection of clinically significant prostate cancer, which is critical for reducing mortality, and increased confidence in ruling out benign diseases and dormant malignancies, in order to reduce unnecessary biopsies and treatment . In 2012 the european society of urogenital radiology (esur) working group developed the guidelines for mp - mri of the prostate . The acquisition protocols were then proposed, in order to provide the prostate imaging reporting and data system (pi - rads), which relays the probability of cancer risk and its aggression . Recently, the pi - rads version 2 was developed, including the following changes: (a) the concept of a dominant sequence depending on the location of the lesion; (b) the statement that dce - mri should be scored positive if early focal enhancement is present and negative, if not or if diffuse enhancement is noticed, instead of using the curve - type analysis described in pi - rads version 1; (c) for positive dce - mri results, the pi - rads score should be increased by one point, if it makes a clinically relevant difference; (d) finally, an overall pirads score, on a scale of 15 is assigned, according to the revised rules from pi - rads version 2 . In the second version of pi - rads, clinically significant cancer is defined on pathology as gleason score 7 (including 3 + 4 with prominent gleason 4 component), and/or volume 0.5 cc, and/or extraprostatic extension . This definition is intended to standardize reporting of mp - mri and correlation with pathology for clinical and research applications . The aim of this study is to evaluate the diagnostic performance of mp - mri at 1.5-tesla (1.5-t), for the detection of clinically significant prostate cancer . A total of 90 patients with clinically suspected prostate cancer were examined by mp - mri, between october 2013 and february 2016, in a prospective single - center study . We included in this study patients with clinically significant prostate cancer proved on biopsy or prostatectomy . The patients with a history of positive prostate biopsy and the patients who were treated for prostate cancer were excluded . Finally, 39 patients - mean age 68.02 years (ranging from 51 to 78 years) were included in this study . Written informed consent was obtained from all the patients included in the study, in order to use their laboratory, imaging and histopathologic data . The study was carried out in agreement with the code of ethics of the world medical association (helsinki declaration) for experiments involving human subjects . All patients were examined by using a 1.5-tesla equipment (magnetom avanto, siemens healthcare, erlangen, germany). The same mp - mri protocol was used for all patients: axial t2wi, sagittal t2wi, coronal t2wi, axial dwi with adc map, axial t2 fat - sat, coronal t1wi and axial dce - mri (table i). For dce - mri a bolus injection of 0.1 mmol / kg body weight of gadolinium - based contrast agent followed by a saline flush of 20 ml was given . The examinations were read by a radiologist with 3 years of experience in prostate - mri . The images were analyzed using the syngo vb17 software with the commercially available applications (siemens medical solutions, erlangen, germany) and osirix viewer . Suspected lesions were noticed in mri reports and were categorized according to the pi - rads 2 lexicon; a pirads score was assigned for all mr abnormalities . For 17 patients examined between october 2013 and december 2014, the version 1 pi - rads score was initially used . Once the pi - rads version 2 scoring system was available, a revised pi - rads score was reported for these patients without modifying the initial mri report . The transition from pi - rads version 1 to pi - rads version 2 was made in order to use the same scoring system for all of the patients examined in the study . The mr findings were reported as positive if pirads 3, pirads 4 or pirads 5 lesions were present and negative if only pirads 1 or pirads 2 findings were identified . A standardized multiparametric - mri reporting scheme - modified after rothke et al . - all 39 patients underwent a standard 12 core transrectal ultrasonography (trus)guided biopsy; additional targeted cores were picked up in 7 patients, from mr suspected lesions . During the study period, 4 of 39 patients with prostate cancer underwent radical prostatectomy . Antibodies used were p63 (clone 7jul, novocastra), high molecular weight cytokeratin (clone 34betae12, novocastra) and also alpha - methylacyl - coa racemase (amacr, p504s, clone epmu1, novocastra). Antigen retrieval was performed with a pressure cooker and hier method . A pathologist with 8 years of experience in prostate pathology examined the slides, using an olympus bx43 microscope . The clinically significant cancer was defined, according to pi - rads version 2 system, as gleason score 7, and/or volume 0.5 cc, and/or extraprostatic extension . When prostatectomy was not performed and only biopsy result was available, we defined a clinically significant prostate cancer core as gleason score 7, and/or having a cancer length greater than 5 mm . The standard of reference was settled by the results of systematic trus - guided biopsy: a patient was considered true positive if biopsy specimens showed pathologically positive results and true negative if biopsy result was negative . Numerical variables were descriptive presented . For testing normality distribution of the numerical variables we used the kolmogorov - smirnov test . For comparison of numerical variables, the student test, mann - whitney and kruskal - wallis (depending on its distribution) were used . A total of 90 patients with clinically suspected prostate cancer were examined by mp - mri, between october 2013 and february 2016, in a prospective single - center study . We included in this study patients with clinically significant prostate cancer proved on biopsy or prostatectomy . The patients with a history of positive prostate biopsy and the patients who were treated for prostate cancer were excluded . Finally, 39 patients - mean age 68.02 years (ranging from 51 to 78 years) were included in this study . Written informed consent was obtained from all the patients included in the study, in order to use their laboratory, imaging and histopathologic data . The study was carried out in agreement with the code of ethics of the world medical association (helsinki declaration) for experiments involving human subjects . All patients were examined by using a 1.5-tesla equipment (magnetom avanto, siemens healthcare, erlangen, germany). The same mp - mri protocol was used for all patients: axial t2wi, sagittal t2wi, coronal t2wi, axial dwi with adc map, axial t2 fat - sat, coronal t1wi and axial dce - mri (table i). For dce - mri a bolus injection of 0.1 mmol / kg body weight of gadolinium - based contrast agent followed by a saline flush of 20 ml was given . The examinations were read by a radiologist with 3 years of experience in prostate - mri . The images were analyzed using the syngo vb17 software with the commercially available applications (siemens medical solutions, erlangen, germany) and osirix viewer . Suspected lesions were noticed in mri reports and were categorized according to the pi - rads 2 lexicon; a pirads score was assigned for all mr abnormalities . For 17 patients examined between october 2013 and december 2014, once the pi - rads version 2 scoring system was available, a revised pi - rads score was reported for these patients without modifying the initial mri report . The transition from pi - rads version 1 to pi - rads version 2 was made in order to use the same scoring system for all of the patients examined in the study . The mr findings were reported as positive if pirads 3, pirads 4 or pirads 5 lesions were present and negative if only pirads 1 or pirads 2 findings were identified . A standardized multiparametric - mri reporting scheme - modified after rothke et al . - all 39 patients underwent a standard 12 core transrectal ultrasonography (trus)guided biopsy; additional targeted cores were picked up in 7 patients, from mr suspected lesions . During the study period, antibodies used were p63 (clone 7jul, novocastra), high molecular weight cytokeratin (clone 34betae12, novocastra) and also alpha - methylacyl - coa racemase (amacr, p504s, clone epmu1, novocastra). A pathologist with 8 years of experience in prostate pathology examined the slides, using an olympus bx43 microscope . The clinically significant cancer was defined, according to pi - rads version 2 system, as gleason score 7, and/or volume 0.5 cc, and/or extraprostatic extension . When prostatectomy was not performed and only biopsy result was available, we defined a clinically significant prostate cancer core as gleason score 7, and/or having a cancer length greater than 5 mm . The standard of reference was settled by the results of systematic trus - guided biopsy: a patient was considered true positive if biopsy specimens showed pathologically positive results and true negative if biopsy result was negative . Numerical variables were descriptive presented . For testing normality distribution of the numerical variables we used the kolmogorov - smirnov test . For comparison of numerical variables, the student test, mann - whitney and kruskal - wallis (depending on its distribution) were used . The mean age of the examined patients was 68.026.38 years, ranging between 51 and 78 years . 10.3% of patients were between 5059 years, 43.6% ranged from 60 to 69 years and 46.2% were older than 70 table ii . The mean psa taken from blood samples was 22.6939.34 ng / ml, with a median psa of 12.95 ng / ml . Patients were categorized based on psa value as follows: patients with psa <10 ng / ml 38.5% (15), patients with psa ranging from 10 to 20 ng / ml 28.2% (11) and with psa> 20 ng / ml 33.3% (13). In our series, 8 patients (20.5%) had prior negative biopsies and 31 patients (79.5%) had no previous biopsies; we found no statistically significant difference regarding the psa values between these two groups 25 patients had mr abnormalities, which were stratified according to the pi - rads 2 lexicon: focal abnormalities (1), lesions (3), masses (4), nodules (5), diffuse (4), multifocal (4), regional abnormalities (4). Pirads 5 was the dominant score (35.9%) in our mri reports (figure 2). We found a statistically significant difference regarding the distribution of pirads score between the psa groups (p=0.011) table iv . All 39 patients underwent the standard transrectal ultrasonography (trus)guided biopsy; 7 patients had additional targeted cores on mr suspected lesions . 20 patients had positive biopsies and gleason 7 was the dominant score (35.9%) table v. there was no statistically significant difference regarding the gleason score distribution between the psa groups . We found a statistically significant difference between the mri reports in the psa groups (p=0.016) table vi . The psa groups differed significantly regarding the biopsy results (p=0.003) table vii . Sensitivity, specificity, positive predictive value and negative predictive value were calculated among the whole group (table viii). The highest incidence of prostate cancer was for males between 7079 years (46.2%). The result is consistent with data provided by the cancer report in north - western region of romania . In our study, the mri reports were positive for 25 (64.1%) of 39 patients, of which 12 patients had high psa levels (20 ng / ml) table vi . We found a statistically significant difference between the mri reports and the psa groups (p=0.016). Pirads 1 and pirads 2 lesions were found more frequently in patients with psa value <10 ng / ml (9 of 15 patients). In the group with psa20 ng / ml, pirads 4 and pirads 5 lesions were predominant (12 of 13 patients). A statistically significant difference regarding the distribution of pirads score between psa groups was found (p=0.011). . Demonstrated that the benefit of mri and targeted biopsy increases with the increasing level of psa . Recent studies that included patients with psa levels> 10 ng / ml, reported the sensitivity, specificity, accuracy, ppv and npv for the detection of prostate cancer using combined mri, between 6995%, 6396%, 6892%, 7586% and 8095%, respectively [914]. In our series of patients, trus - guided biopsies were positive in 20 patients (51.3%) of which 11 had a psa 20 ng / ml . 19 patients (48.7%) had negative biopsies, 12 of them having low psa levels (<10 ng / ml). We found a statistically significant difference between the biopsy results and the psa groups (p=0.003). Our overall sensitivity and specificity for mp - mri detection of clinically significant prostate cancer detection were 100% and 73.68%, respectively . Evaluated the clinical value of dwi and dce - mri in combination with t2wi for the detection of prostate cancer, in a series of 83 consecutive male patients, taking as reference the systematic biopsy results . They reported a sensitivity of 95%, a specificity of 74% and an accuracy of 86% . In a retrospective study of 2011, tamada et al . Reported a sensitivity of 83% and a specificity of 80% for combined mri techniques (t2wi, dce - mri and dwi) in prostate cancer detection, on a per - patient basis . Their study evaluated a series of 50 patients and reference test was the12 cores trus - guided systematic biopsy . The accuracy, ppv and npv reported were 82%, 91% and 67%, respectively . . Found great variations in the detection of clinically significant prostate cancer in a systematic review of the literature from 2015 . 12 studies (1981 patients) were included in this meta - analysis of which 5 were prospective studies . Six studies were performed at 3-t scanner, two studies used a 1.5-t unit, and four studies alternately used 1.5- and 3-tesla equipments . The selected studies performed prostate mri with at least two functional techniques (dw - mri, dce - mri or mrsi) in addition to anatomical t2wi . Sensitivity ranged from 58 to 96%, specificity from 23 to 87% and accuracy from 44 to 87% . The npv and ppv for the detection of clinically significant disease ranged from 63 to 98% and from 34 to 68%, respectively . The authors have concluded that mp - mri is able to detect significant prostate cancer in biopsy - nave males and men with prior negative biopsies . The high npv of mp - mri is important to the clinician because mp - mri could be used to rule out significant disease . In our study, the positive predictive value and the negative predictive value were 80% and 100%, respectively . Eight of 39 patients had prior negative biopsies . In 4 patients the mri report was positive and in 3 cases the prostate cancer was confirmed by trus - guided biopsy (two patients had gleason 7 and one had gleason 6). Assessed the performance of multiparametric mri in patients with prior negative trus - guided biopsy and showed that mp - mri had good performance for detecting and ruling out clinically significant prostate cancer, with a se of 90% and a npv of 95% . They concluded that mp - mri can be used as a triage test in the population with persistently elevated psa levels following a negative biopsy and thereby identify patients who can avoid unnecessary prostate biopsy . A published study in 2014 by itatani et al . Reported a clinical npv for mp - mri of 89.6% for clinically significant prostate cancer, over a longitudinal follow - up period of 5 years . Therefore, the authors concluded that mp - mri can to rule out clinically significant prostate cancer before biopsy some potentially influential factors need to be discussed . A limit of our study is the lack of accurate correlation between the mr localization of suspicious lesions and the trus - guided biopsy . Using the mr - in bore biopsy or the mri - ultrasound fusion techniques could exceed this limit . Some recent studies have shown that the detection of more clinically significant cancers in the mri - guided biopsy compared with systematic biopsy, improve the biopsy performance and the diagnostic benefits [17,2023]. The positive mri was reported per patient and not per lesion and this might potentially influenced our data . Another limit of this study was that we used only one reader for mp - mri examinations . Therefore, studies on larger groups of patients, with multiple readers are needed to confirm our data . Our results show that 1.5 t mp - mri has a high sensitivity for the detection of clinically significant prostate cancer and high negative predictive value in order to rule out significant disease. |
Idiopathic generalized epilepsy (ige) is characterized by various combinations of generalized tonic clonic seizures, absence seizures, myoclonus (blumenfeld, 2005; zhang et al ., 2011), and generalized spike - and - wave discharges (gswds) observed during interictal periods on electroencephalography (eeg) recordings (hamandi et al ., 2006; moeller et al ., 2011; zhang et al ., 2011). Focal spike wave complexes occasionally are observed interictally in patients with ige, although ictal eeg recordings show only generalized - onset seizures and no focal - onset seizures in ige (drury and henry, 1993; seneviratne et al ., 2012). Unlike focal or partial epilepsy, which has a confined range of influence, ige affects the whole or a larger portion of the brain often without obvious, known cause (engel, 2001). Among drug - resistant epilepsy, patients with focal epilepsy may receive surgical resection to become seizure free . On the other hand, patients with generalized epilepsy do not have such a treatment option . Recently deep brain stimulation (johnson et al ., 2013) has been hypothesized as a way to treat epilepsy patients (fisher et al ., 2010). Therefore, it is important to distinguish the driver (or source) versus recipient (or sink) to understand how the epileptic activities propagate to the entire brain . In the recent decades, it has been generally agreed that the highly interconnected circuitry of the cortex and thalamus plays a crucial role for generalized epilepsy (blumenfeld, 2005). There is general agreement that both cortex and thalamus participate in the generation of typical spike wave seizures, but their relative importance is still unclear . Previous works using eeg functional magnetic resonance imaging (fmri) and anatomical mr - based study (bernhardt et al ., 2009) indicated the involvements of thalamus, default mode network (fox et al . 2001), cerebellum, caudate nuclei and corticocortical networks in the generations of gswds (bernhardt et al . However, the exact interplay between the cortical and sub - cortical structures remains to be further explored . The goal of the present study is to use noninvasive, multimodal imaging techniques to elucidate the underlying mechanisms that generate gswds in ige patients . Specifically, we aim to map the cortical networks associated with gswds and investigate the causality between cortex and thalamus during gswds . We first performed eeg - informed fmri analysis and identified regions of interest (roi). We then tested the specific connectivity patterns by seed - based connectivity analysis in fmri data . The seeds include both regions determined by the eeg - informed fmri analysis and additional ones identified by eeg waveforms . Rois that exhibited network properties, i.e. The ones that share temporal profile with remote regions, were further subjected to the granger causality analysis to identify sources and sinks within the networks . Eeg and fmri are two noninvasive neuroimaging tools used in epilepsy research and clinical applications . Eeg has the benefit of having high temporal resolution but often suffers from limited spatial resolution . With the advancement of source imaging techniques (he et al ., 2011; he and ding, 2013; holmes et al ., 2010; koessler et al ., 2010; lantz et al ., 2003), successfully localizing epileptic activity in focal epilepsy is possible (ding et al ., 2007; he and ding, 2013; lai et al . ; lu et al ., 2012a; michel et al ., 2004; sohrabpour et al ., 2015; yang et al ., 2011). However, very few studies have looked into using dense - array eeg to study the temporal dynamics of the sources in ige (jung et al ., 2005). With complementary high spatial and temporal resolution, simultaneous fmri and eeg (he and liu, 2008; liu and he, 2008) has been shown to provided valuable information in diagnosis of epilepsy (pittau et al ., 2012; zhang et al ., 2015). Seed - based connectivity analysis using resting state fmri is another common technique in the studying of both healthy and diseased neurological networks (greicius et al ., 2009; moeller et al ., 2011; o'muircheartaigh et al ., 2012). Using this technique, remote areas that share the same temporal characteristics can be identified . Compared with eeg - informed fmri, seed - based connectivity analysis does not rely on precise knowledge of the eeg event timing, which can be difficult to obtain given the noisy signal collected concurrently with fmri . However, it requires prior knowledge in determining the rois as seeds . In our study, we used regions identified by the eeg - informed fmri result as seed in conjunction with other areas that may potentially be involved in the network activities in generating gswds . By using seed - based analysis, we can obtain a more specific network level activity than using eeg - informed fmri alone . Once we establish a network that is involved in generating gswds, the next question is which node in the network is driving the others . Directed connectivity measures based on the concept of granger causality (granger, 1969) has been proposed (babiloni et al ., 2005; goebel et al ., 2003; kaminski and blinowska, 1991) to discern the causal relationship among different temporal series . The direction can be estimated with the following rationale: the driver is earlier than the recipient implying that the driver contains information about the future of the recipient not contained in the past of the recipient while the reverse is not the case . The directed transfer function (dtf) has been used to quantify the directionality and strength of the connectivity profile among different brain regions (kaminski and blinowska, 1991). Dtf has been successfully applied in the field of epilepsy research, to identify sources (active or efferent sources) and sinks (passive or afferent sources) that may play important roles in generating seizures and interictal activities (ding et al . Built upon the dtf method, which computes the overall connectivity strength in a given time window, an adaptive dtf (adtf) method was developed to study the time - variant propagation of interictal spikes (wilke et al . The adtf method may be able to capture the temporal dynamics of the propagation and shed light in the inter - play among the networks in the genesis and propagation of gswds . The overall aim of this work is to use noninvasive, multimodal imaging techniques to map the brain networks associated with gswds and investigate the functional connectivity between cortex and thalamus during gswds . The novelty of the current work lies in using multimodal neuroimaging approaches to identify the critical roles of thalamocortical networks in generalized spike and wave discharges, including electrophysiological recordings (eeg), hemodynamic recordings (bold fmri), eeg - informed fmri and functional connectivity mapping . Ten patients (mean age 33 14, three females) with idiopathic generalized epilepsy syndromes were recruited from the department of neurology of the university of minnesota, usa . The patients included in this study were selected based on the criteria that there were visible interictal gswds recorded from clinical eeg (with rare focal spikes only if gswds were frequent interictally), normal brain mri (or normal brain ct in subjects 5 and 10), and a clinical diagnosis of ige . The study has been approved by the institutional review board of the university of minnesota . Ten healthy volunteers (ages 2131 years, 26 2.4 years, 6 males) participated in this study . All subjects had written consent according to a protocol approved by the institutional review board of the university of minnesota . A total of two functional mri scans, each lasting for 6 min, were recorded from each subject while lying in the mr scanner quietly . One electrode was placed on patients' back to record cardiac activity for noise removal purpose . Electrode impedances were brought below 20 k. the eeg was amplified using mr - compatible amplifiers (brainamp mr 64 plus, brainproducts, germany) and recorded at 1000 hz . Two sessions of eeg were recorded both inside and outside of the scanner experiment . During outside scanner recording, we recorded simultaneous eeg and fmri for at least a total of 40 min for each patient . The mr gradient artifact was removed using a principal component analysis (pca)-based optimal basis set (obs) algorithm (niazy et al ., 2005). When detecting and removing the cardioballistic artifact (cba), ecg signal from a single electrode on the subject's back, the timing of each heartbeat artifact in this channel was determined using an r - peak detection algorithm adapted from liu et al . The final artifact correction procedure is based on a combination of ica, obs, and an information - theoretic rejection criterion (liu et al ., 2012). Briefly, the signal is decomposed into independent components, which are rejected if the mutual information between the component's time course and the cba artifact is sufficiently high . The remaining components are then divided into epochs around each heartbeat and an optimal basis set is obtained across all epochs to fit and remove the artifacts . Detection of bad electrodes and data epochs was performed before cba detection, and again after cba correction . Electrodes were first re - referenced to a common average of electrodes connected to the same amplifier, and then to the combined average . Together with eeg data obtained from outside of mr scanner, the eeg signal was filtered and down - sampled to 256 hz . We used 3 t siemens magnetom trio and skyra mr scanners (germany) with 16 channel head coil . The echo planar imaging (epi) volumes underwent several preprocessing steps including three - dimensional (3-d) motion correction, slice scan time correction and linear trend removal . All fmri data were pre - processed for slice scan time correction, 3-d motion correction and temporal filtering . Matlab based toolbox spm8 (ashburner et al ., 2010) was used for eeg - informed fmri analysis . Brainvoyager qx software (brain innovation, maastricht, netherlands) was used for the seed - based connectivity analysis ., there were 176 contiguous sagittal slices with 1 mm slice thickness (matrix size: 256 256; fov: 256 mm 256 mm; tr / te = 20 ms/3.3 ms). Whole - brain functional images with bold contrast were acquired using gradient echo planar imaging sequence (32 axial 3-mm thick interleaved slices with 0.3-mm gap; tr / te = 2000 ms/30 ms; flip angle = 90; matrix size: 64 64; fov: 192 mm 192 mm). Structural mris were normalized via alignment to the anterior posterior commissural line and then transformation into talairach space . Fmri data were spatially coregistered to the anatomical mri . Independent component analysis (ica) is a widely used data - driven technique to separate spatio - temporal signals into spatial components that are independent from each other through the selected time segment . Infomax ica algorithm (bell and sejnowski, 1995; delorme and makeig, 2004) was used to decompose the spatio - temporal electrophysiological data into multiple independent components (ics) using a time - by - space formulation . Ica was performed on eeg obtained both in and out of the scanner to identify gswd related components for the subsequent eeg - informed fmri analysis . In the eeg - informed fmri analysis, the important issue is the identification of gswd timing based on eeg collected in the scanner . Although the artifact removal algorithm used was adequate in removing the majority of noise, it is still possible that some gswds were distorted by the residual noise and were rendered difficult to identify using visual inspection . Compared to baseline activity, gswds are characterized by synchronized large amplitude discharges that are present in multiple channels . Such large changes in activities are visible in both raw eeg and independent components related to the gswd activities . Therefore, the temporal correlation between the two signals can be used in this study for the selection of gswd components . This method is similar to what was previously described in seizure imaging (yang et al ., 2011). Once an ic of interest was identified from out - scanner eeg, it can be used as a benchmark for the ic selection from in - scanner eeg . The detailed steps are as follows . For eeg obtained outside of the scanner, timing of each gswd each 10 s time window containing one or multiple gswds was selected and concatenated to form a gswd - dense eeg . The cross correlation between the time course of each ic and the averaged time course of all of the eeg channels the ic with the maximum absolute cross correlation valued was selected as most representative of the gswd activity . The correlation between the spatial map of the selected ic from in - scanner eeg and that from out - scanner eeg was computed to ensure accuracy . Since both spatial maps from in and out of the scanner represent the same gswd activities, the two should share similar spatial pattern . The timings of gswd were then identified basing on the time course of the selected ic . The regressor of the general linear model (glm) was constructed using identified time points convolving with the canonical hemodynamic response function (hrf) (jann et al ., 2008; marques et al ., 2009). The final design matrix was composed of the regressor that represents gswd activity and the 6 movement parameters as previously described (marques et al ., 2009). The group level analysis was performed using spm8 (ashburner et al ., 2010). Individual t - statistic images were averaged using random - filed theory to correct for multiple comparison errors . Fmri data were filtered using a band - pass filter (0.0090.15 hz) to reduce low frequency drift and high - frequency noise (lowe et al ., the rois used in this study were informed by the eeg - informed fmri results, with additional seeds added based on eeg waveform in bilateral superior frontal regions where there are strong gswd discharges observed on eeg . Such areas include the left and right superior gyri and the middle frontal superior gyrus . A seed in the anterior nucleus of the thalamus was also included, as it was the stimulation target of the sante trial (fisher et al ., 2010). Seeds were selected in the brainvoyager software by referencing talairach client's (lancaster et al ., 2000, 1997) archive of talairach labels and selecting a central coordinate for each seed . The time courses of both seed coordinates was regressed against all brain voxel time courses to create two brain maps of r - values for each fmri scan . A p - value threshold less than 0.05 with correction via bonferroni multiple comparisons was used to identify which voxels were significantly correlated with the seed location . All images were smoothed using a 2.0 mm full width at half maximum (fwhm) gaussian kernel within brainvoyager . The resulting voxels were clustered and counted to record a total volume of significantly correlated connectivity for each fmri scan . At the group level, a second - level, random - effects analysis was performed . Connectivity maps were created with the same threshold levels and smoothing parameters described above . Only voxels with correlation less than the p - value of 0.05 corrected using the bonferroni method, are reported as significant across subjects . In each of the selected well - formed gswds, an epoch of approximately 400 ms before and 600 ms after the peak of the spike was extracted for the subsequent continuous source localization as described above . The distributed current density of the underlying neuronal activity was estimated to obtain the source waveform at each voxel . Time series of the source waveforms corresponding to three rois, i.e. Left mediodorsal nucleus of the thalamus, right mediodorsal nucleus of the thalamus and the medial frontal cortex, were selected . These anatomical locations were chosen based on analysis previously described in the seed - based connectivity analysis . The three source waveforms were subjected to the dtf computation, similar to the procedure previously described (ding et al ., 2007; lu et al ., 2012b). Nonparametric permutation tests were conducted to test the significance of the obtained directional dtf values . The threshold was set at p <0.01 to consider a dtf value as significant . As a step toward computing the overall dtf value between two time series, the contribution of each frequency point, at 1 hz increment, was computed automatically . Since different frequencies might carry information differently, dtf output at each frequency point was averaged across all spikes spanning from 1 to 125 hz to show the contributions of different frequency bands . Additionally, adaptive dtf (wilke et al ., 2011, 2008) was performed on individual spikes to study the time varying feature of the information flow at different time points of the spike slow wave complex . This measure will aid in delineating the temporal changes of the connectivity strength and determining the dynamics in initiation and propagation of the gswds . 1c shows the histogram of the temporal cross - correlation coefficients between each ic and the global field potential . The cross correlation between the spatial weight of this ic and that of out - scanner eeg is 1 . The cross correlation between the time course of the selected ic and the averaged time course of all the eeg is 0.73 . On a group level, the correlation between the spatial weight of the selected ic and that of out - scanner eeg is 0.99 0.01 . The cross correlation between the time course of the selected ic and the mean global field potential is 0.71 0.05 . The highest activations were observed in anterior cingulate cortex, bilateral mediodorsal nuclei, left caudate nucleus, bilateral insula and bilateral sensorimotor areas . Seed - based connectivity analysis with seed in left, right superior gyrus, and the insula showed these regions are connected bilaterally (fig . 3a, b and e). But seeds in middle frontal superior gyrus, caudate nucleus and sensorimotor cortex are only temporally correlated to the close vicinities (fig . Group average of seed - based analysis in acc for both patients with ige and healthy controls are shown in fig . The total voxel counts among all activities that are correlated to the acc were significantly different between patients with ige and healthy controls (p <0.05 by nonparametric wilcoxon test, fig . 4b). There was a linear positive trend between the degree of connectivity between acc and the thalami, reflected by the number of voxels in the thalami that are correlated with the acc time course, and the frequency of gswds (fig . 4c). Activities in the thalami that are correlated with acc are located in the bilateral mediodorsal nuclei . Group comparison of seed - based analysis in mediodorsal nuclei of the thalamus between patients with ige and healthy controls are shown in fig . The total voxel counts among all activities that are correlated to the mediodorsal nuclei were significantly different between patients with ige and healthy controls (p <0.05, fig . 5b). There was a similar linear trend between the degree of connectivity and the frequency of gswds (fig . The blue and two red dots represent the acc area in the medial frontal cortex and the two mediodorsal nuclei respectively . The arrows between the dots indicate the directionality of the flow, where the arrows are pointing from one area, the source toward another, the sink . The strengths of the information flowing from the medial frontal cortex is only about half in strength as the reverse direction . The difference in strength between the two directions is statistically significant (p <0.05). The time varying feature of the causality as results of the adtf analysis is shown in fig . The blue and red traces show the group averaged temporal changes of the connectivity during gswd . The most significant exchange seems to occur as early as 50 ms before the peak of the spike, initiated by the thalamus . The averaged information flow spanning the entire frequency range (1125 hz) is plotted in fig . There is a considerable variability but alpha and low gamma bands appear to have the most contribution . Seed - based connectivity analysis was performed with a focus on two specific structures: anterior cingulate cortex in the medial frontal lobe and the mediodorsal nuclei in the thalamus . These two structures have been previously mentioned in works of ige but not been specifically studied . However, it was also thought that the sources can be much more distributed only with center of gravity located near to the midline instead of having the actual focus in the medial frontal cortex . Using the seed - based connectivity analysis, we were able to specifically target this region and find its remote connections in the thalamus . Surprisingly, activity of just the mediodorsal nuclei, not the entire thalamus, is significantly correlated to the medial frontal lobe . Activation in mediodorsal nuclei has been previously seen anecdotally in a patient with history of generalized tonic - clonic seizure (aghakhani, 2004). In agreement with this finding clonic seizure . Another previous study by moeller and colleague found that in 6 children patients with ige (moeller et al ., 2008). They saw symmetrical medial thalamic activation, which is also in agreement with our observation . When we put the seed in the mediodorsal nuclei, its connectivity with the medial frontal cortex was replicated as expected in the ige patients and again absent in healthy controls . In fact, the specific cortical projections of mediodorsal nucleus to the frontal cortex has long been reported in rodents and monkeys (krettek and price, 1977; leonard, 1969; price and drevets, 2010). However, the different degree of connection between ige patient group and the control group is unexpected . It may be explained that a strengthened connection between the two structures in each patient can make the spread of gswds and seizure activity progress quickly . Furthermore, the degrees of connectivity between these two structures also seem to be positively correlated, albeit not statistically significant, with the discharge rate of gswds . On ige patients showed slight difference in connectivity for seed in the left mediodorsal nucleus of the thalamus compared with control . The reason they did not see bithalamic correlation, or the connection between the thalamus and the cingulate cortex could be due to the fact that moeller and colleagues selected the gswd - free periods for their analysis, where we did not make such selection . Therefore, the effect they observed is weaker compared with ours . However, bilateral superior gyri and the middle frontal superior gyrus, where strong gswds are observed from raw eeg, do not seem to be involved in a thalamocortical level network activity . Bilateral insulae showed such correlation as well . Despite the preprocessing steps taken in reducing the effect of noise, the periphery of the cortex is still prone to movement artifacts in the fmri recording therefore, seed - based analysis in close vicinity of the periphery may contain erroneous connection caused by noise rather than neurophysiological activities, as seen in fig . (1995) reported that the anterior executive region formed by acc around the rostrum of the corpus callosum has numerous projections into motor systems, which can be linked to the motor response such as uncontrolled jerking movement in tonic there is also evidence indicating correlation between the neural activity in the acc and the degree of consciousness in patients with disorders of consciousness (doc) (qin et al ., 2010). It was shown that slow delta wave activity was generated in the frontal area accompanying loss of consciousness post secondarily generalized partial seizures and complex partial seizures (blumenfeld et al ., 2009; yang et al ., 2012 this may partially explain another significant symptom of generalized epilepsy, such as the momentary loss of awareness during or post seizures . The central role of mediodorsal nuclei has been shown in the interconnected medial frontal cortico - striato - pallido - thalamic and amygdalo - striato - pallido - thalamic networks in multiple animal models ranging from rats to monkeys (price and drevets, 2010; ray and price, 1993, 1992; russchen et al ., 1987). The projections from mediodorsal nuclei to the amygdala and hippocampus form important circuitries that regulate emotions and memory (price and drevets, 2010). Not surprisingly, depression and memory loss are some of the prominent comorbidities in patients with epilepsy (hesdorffer et al ., 2000; however, we did not see explicit change in the seed - based functional connectivity between mediodorsal nuclei and amygdala or hippocampus we initially hypothesized that the degree of global connectivity to the thalamus, which is defined as the total voxel counts within the brain that are correlated to the seed in the thalamus, may be indicative of the rate of occurrence of gswds . However, it appeared not to be the case . Instead, the number of voxels in the thalamus that are connected with the acc alone appears to be positively correlated to the rate of gswds . Since acc is probably related to the gswd signals, the degree of connection between thalamus and acc may be able to serve as a predictor of the level of activity observed on scalp . However, because of the limited recording period (up to 2.5 h total) of eeg in each patient, the actual gswd rate may deviate from the value we obtained . This limitation could influence the strength of the correlation between the connectivity and discharge rate . In this study, we used canonical hrf to convolve with spike timing to construct regressor in the eeg - informed fmri step . Canonical hrf is the most widely used function to represent the link between electrophysiological activity and the corresponding hemodynamic activity . However, there have been several recent studies pointing out that a canonical hrf may not be the best in presenting the actual function, as it may vary from person to person or may even change from location to location (bai et al ., 2010; levan et al .,, we opted for canonical hrf basis functions with time and dispersion derivatives which can model small differences in the latency and the duration of the peak response (ashburner et al ., 2010). Dtf and adtf of eeg activity have been previously applied in finding driving sources in epileptic activities (ding et al ., 2007; he et al ., 2011; lin et al ., 2009; our dtf findings showed a reciprocal causal relationship between the frontal cortex and the thalamus, where thalamus serves more as a driver . Specifically, mediodorsal nuclei of the thalamus have strong projection to the medial frontal cortex in the acc area . The reverse projection is much weaker in comparison, approximately at half of the strength . The reciprocal directionality of granger causality is generally accepted (ding and he, 2013). This particular thalamocortical reciprocal relationship is also in agreement with the understanding of the interconnected thalamocortical circuitry in generating spontaneous spike waves in ige (blumenfeld, 2005). The crucial role of thalamus as part of the cortico - thalamo - cortical network, in sustaining seizures has been shown recently by paz et al . In a rat model with optogenetics (paz et al ., 6c), which shows the temporal evolution of the connectivity strength, thalamus seems to play an important role from the initiation to the propagation of the gswds . The main changes in the connectivity strength from the thalamus to the cortex occur as early as 50 ms before the start of the spike . Fmri, information exchange among the thalamocortical precedes the peak of the spike gswd, though the changes we observed occur only 50 ms prior to the gswd events, as opposed to the seconds level window observed by moeller et al . First, due to volume conduction effect, the time courses extracted using weighted minimum norm type of inverse source estimation algorithms might be smeared . Other source localization approaches, such as nulling, where nulling constraints are used to cancel signals from specific cortical locations beamforming (cheung et al . 2010), might be able to decrease such effects . However, these methods are not without their own limitations . For example, nulling beamformer requires that we know the locations and extent of the sources to be canceled . Such information is often not available in practical applications . Another potential issue with our model is that we only studied the relationships between the medial frontal cortex and the mediodorsal nuclei of the thalamus . This is because these structures were implicated by our eeg - informed fmri and fmri connectivity analysis . Other anatomical entities, such as other nuclei in the thalamus that were not included in the present study, or hippocampus, may potentially play a role in the network of generating gswds as well . Although seed - based connectivity analysis was performed on anterior nucleus and caudate nucleus of the thalamus (supplementary fig . Clusters that are temporally correlated to the seeds were confined to the close vicinity of each seed itself . It is possible, but unlikely, that the network activity was not in the form of temporal correlation and thus was not detected by our analysis method . Lastly, other causality measures, such as phase slope index (psi) (marzetti et al ., 2008; nolte et al ., 2008), effective connectivity methods (dcm) (friston, 2009; murta et al ., 2012) and structural equation models (sem) may provide additional insight . Since such methods all require prior anatomically motivated assumptions, this acc - mediodorsal nuclei network may serve as a model framework . A few other approaches using different recording systems may also help circumvent the volume conduction issue . It was disputed whether fmri can be a viable tool to study causal relationships, especially in the context of epilepsy research (david et al . It has been shown recently that by using a faster sampling rate, at the order of 250500 ms repetition time (tr) it was possible to detect a multivariate network using granger causality in several simulation studies (deshpande et al ., 2010a, b). Unfortunately, the tr used in our study ranged from 2000 to 2500 ms . It may be too slow to delineate meaningful causal information at a scale of milliseconds or lower . With advancement in mri acquisition techniques using multiband approaches, tr can be shortened to 400 ms (feinberg et al ., 2010; uurbil et al ., 2013). At this rate, we may be able to extract causal information using fmri time courses in future studies . Invasive recording using intracranial electrodes planted in the thalamus and cortex may provide the most direct measures of the neurophysiological activity and dynamic changes of gswds . Similar approach using granger causality and electrocorticalgraphy (ecog) have been previously applied in seizure imaging with success (wilke et al ., 2011, 2010, 2008). The source of gswd is located in the medial frontal lobe, more specifically, at the anterior cingulate cortex (acc). (1994) used regional dipoles to localize source of generalized epilepsy activities, and the location of equivalent dipole was around the midline of baso - frontal area . This location suggested by eeg source localization appeared to be plausible, given the general predominance of eeg in fronto - central region (aghakhani, 2004; montalenti et al ., 2001). However a few recently published works suggested that potential spurious results may be yielded when applying source estimation methods to wide spread spike and wave discharges (daunizeau et al ., 2010; kobayashi et al ., 2005; wennberg and cheyne, 2013). Wennberg and cheyne (2013) reported that despite intracranial evidence of cortical origins, the scalp eeg during k - complex was localized to deep brain regions using either dipole localization or distributed current density source imaging . While this finding was based on a low - density scalp electrode configuration (27 electrodes) in patients in whom intracranial eeg was available, wennberg and cheyne's results suggested the possibility of mislocalization of widespread bi - hemispheric activities to mid - deep brain (these authors also examined 87-ch scalp eeg in one healthy human volunteer without ieeg recordings). In our study, since there were no intracranial recordings in the patients studied, we cannot preclude the possibility of mislocalization of eeg sources due to technical limitations in solving the eeg inverse problem . However, our high - density eeg recording- (64-channel) based source analysis did return source locations that are in agreement with the eeg - informed fmri results, a technique (gotman et al ., 2005) that is not based on inverse solutions . The middle frontal region was implicated by both approaches in the group of patients we studied . Another approach is to integrate bold fmri to improve the eeg source localization accuracy (dale and sereno, 1993; daunizeau et al ., 2010, 2009; by combining the complementary strengths of eeg and fmri, we showed consistent results concerning the originating and propagation of gswds . Eeg - informed fmri revealed multiple brain regions that may be involved in gswds . By means of seed - based fmri, we tested the specific network level activity and found temporal correlation between cortical and bithalamic bold activities . According to the granger causality analysis the mediodorsal nuclei of the thalamus appears to serve as the main driver from the initiation and throughout the propagation of the gswds . Once validated, this work may provide insight in understanding the enigmatic etiology of generalized epilepsy and offer guidance in treatments . B. time course of an example of independent component that has the highest correlation with the gswd activity . C. source localization using the spatial map of the independent component in b. d. source localization at different time points of the gswds . B. time course of an example of independent component that has the highest correlation with the gswd activity . C. source localization using the spatial map of the independent component in b. d. source localization at different time points of the gswds. |
Alzheimer's disease (ad) is the most common form of dementia with a progressive course . Ad pathology evidences neuronal damage in specific vulnerable brain regions and circuits involved in memory and language, namely, the hippocampus and cerebral cortex, which appears to be preceded by synaptic and neuronal dysfunction . From a pathology perspective, the presence of extracellular plaques, mainly composed of amyloid beta peptide (a), a 39- to 42-aminoacid residue peptide, derived from the processing of amyloid precursor protein (app), and intraneuronal neurofibrillary tangles, consisting of tau protein aggregates, constitute, important hallmarks of the disease and serve, as a dividing line between ad and other dementias [14]. Demented individuals who do not have plaques and tangles does not qualify for a diagnosis of ad, but the simple presence of plaques and tangles do not distinguish demented from nondemented individuals since brains of aged nondemented individuals frequently contain plaques and tangles . Although the etiology of ad is largely unknown, it has been hypothesized that multiple factors, including genetic components, oxidative stress, intracellular and/or extracellular accumulation of a, excitotoxicity, inflammation, mitochondrial dysfunction, alteration of cytoskeleton and synapse components and neuronal loss, may play important roles in the onset of the disease . One hypothesis that may account for the heterogeneous nature of ad and the fact that aging is the most obvious risk factor is the increased generation of reactive oxygen species (ros); indeed, neurons are extremely sensitive to attack by destructive free radicals . The oxidative stress theory of aging holds that a progressive and irreversible accumulation of oxidative damage caused by ros impacts on critical aspects of the senescence process, contributing to impaired physiological function, increasing incidence of disease, along with a reduction in life span . Although low and intermediary levels of ros are physiologically important, high ros concentrations above the clearance capacity of the cell cause oxidative stress, mitochondrial dysfunction, cellular damage, and, in numerous cases, cell death, thus pointing oxidative stress as a potential unifying mechanism contributing to age - related pathologies and, in particular, to ad [9, 10]. Lipid peroxidation is one of the major outcomes of free - radical - mediated injury leading to the generation of a variety of relatively stable end products . The ones that have been most extensively studied, both in brain and biological fluids, such as cerebrospinal fluid (csf), plasma, urine of ad and mild cognitive impairment (mci) patients, are malondialdehyde (mda), trans-4-hydroxy-2-nonenal (hne), and f2-isoprostanes (f2-isops). Indeed, several studies have demonstrated significantly increased levels of mda and thiobarbituric acid reactive substances (tbars) in ad [1113] and mci brains, particularly in regions where neurofibrillary tangles and senile plaques typically accumulate . Hne, one of the most toxic products of lipid peroxidation, is, like mda, diffusible and highly reactive with other biomolecules being able to covalently modify proteins, thus affecting their function . Increased levels of free hne and hne - protein adducts have been described in the brains of mci and ad patients compared to controls [1519]. In addition, increased levels of f2-isops have been documented in different brain regions of ad in comparison to cognitively normal individuals [2022]. This increase of f2-isops was demonstrated to be specific of ad - type dementia and did not occur in cases of frontotemporal dementia . F2-isops have also been investigated in brain of mci subjects . Increased levels of these lipid peroxidation products were documented in different brain regions of mci subjects compared to controls; however these data were not confirmed by other authors . Within proteins, all amino acids can be attacked by ros, but sulphur - containing and aromatic amino acids are the most susceptible . The oxidation of amino acids mainly leads to the formation of carbonyl groups, while peroxynitrite can nitrate tyrosine groups and form the stable compound 3-nitrotyrosine (3-nt). Increased levels of protein carbonyls have been detected in the superior and middle temporal gyri of patients with early - stage ad and mci and also in the hippocampus and parietal lobe of ad patients compared to controls [14, 25, 26], but unchanged in the cerebellum, which is consistent with the regional pattern of histological changes in ad . On the other hand, increased 3-nt immunoreactivity has been also detected in regions of the cerebral cortex affected by neurodegeneration in ad patients, with a distribution similar to protein carbonyls . Moreover, high levels of protein nitration were found in inferior parietal lobes and hippocampi of mci patients . Protein oxidation in ad does not seem to be a random process but rather involves specifically more susceptible proteins that have been identified through redox proteomic studies . Many of the proteins that have been identified so far, as oxidatively modified in the brain of ad patients and mci subjects, are either mitochondrial proteins or proteins that are known to interact with mitochondria; these include glyceraldehyde 3-phosphate dehydrogenase (gapdh), voltage - dependent anion channel (vdac), lactate dehydrogenase (ldh), malate dehydrogenase (mdh), adenosine triphosphate (atp) synthase - alpha chain, beta - actin and/or aconitase [18, 3032]. Ros, and particularly the hydroxyl radical, can react with all components of the dna molecule, causing different kinds of damage . Dna injury has been investigated in ad and mci subjects mainly through the analysis of dna strand breaks and the presence of specific oxidized dna bases and adducts, of which 8-hydroxy-2-deoxyguanosine (8-ohdg) is the most commonly investigated . Several postmortem studies have reported significant dna fragmentation in the brain of ad subjects compared to nondemented controls, especially in areas that are more prone to neurodegeneration [3336]. A buildup of 8-ohdg was detected in brain tissue from ad subjects, that was most prominent in mitochondrial dna (mtdna) of the parietal cortex . These results were confirmed by another report showing that the presence of oxidized nucleosides was inversely related to the neurofibrillary tangle content, further suggesting that dna oxidation could precede lesion formation . This hypothesis was further corroborated by a study by wang and coauthors who observed higher indices of oxidation in mtdna from neocortical regions of mci subjects compared to controls, but similar to the ones observed in ad patients, suggesting that dna oxidation was indeed an early event in the pathogenesis of the disease . Rna is more vulnerable to oxidation than dna and can be easily attacked by the hydroxyl radical . Evaluated the levels of 8-hydroxyguanosine (8-ohg) as a marker of oxidative damage to rna . Immunohistochemical analysis of neurons in particularly vulnerable brain areas of ad patients showed a marked accumulation of 8-ohg, that was negatively correlated with the duration of the disease and the extent of a deposition . These findings have been further extended by shan and collaborators that showed a large increase in the extent of messenger rna (mrna) oxidation in the frontal cortex, but not in the cerebellum of ad patients [41, 42]. It was also demonstrated that increased levels of 8-ohg in the parahippocampal gyrus were already present in mci subjects, compared to controls, but similar to the levels found in ad patients, suggesting that rna oxidative damage is an early event in ad pathology . Very recently, multiple biochemical markers of oxidative stress and antioxidant defenses were analyzed in frontal cortex postmitochondrial supernatant, mitochondrial, and synaptic fractions from age - matched noncognitively impaired, mild cognitive impairment (mci), mild ad, and ad subjects . In this study, a strong correlation was observed between levels of synaptic lipid peroxidation, protein oxidation and nitration, and the subjects' global cognitive status . Changes in levels of the antioxidants glutathione (gsh), superoxide dismutase (sod), and catalase (cat) also strongly correlated with the minimental status examination (mmse) score . Previous studies found both increased and reduced activity of antioxidant enzymes in ad and mci brain . In studies assessing oxidative damage in brain, the possibility of artifacts due to postmortem delay cannot be completely ruled out . However, in most of the referred studies postmortem interval was conveniently short (15 hours), matched between patients and control samples and therefore should not have a significant effect on the discussed parameters . In fact, a few studies [33, 47] have examined the influence of postmortem delay in oxidative damage measures, and similar levels have been found in rapid (<1 h) and conventional autopsy tissue (up to 8 hours). Overall, these findings support the idea that the unbalance between ros generation and detoxification by antioxidants is an early event that plays an important role in the progression of the disease . In cells, multiple pathways and enzymes can generate ros . These include, as an example, complexes i and iii of the mitochondrial respiratory chain in the mitochondrion, nicotinamide adenine dinucleotide phosphate (nadph) oxidase (nox), xanthine oxidase, or nitric oxide synthase (nos). Mitochondria produce ros and reactive nitrogen species (rns) during the normal aerobic activity . This accounts for the generation of superoxide (o2), mainly produced at complex i and complex iii of the electron transport chain, and nitric oxide (no). No controls mitochondrial respiration and both cytotoxic, as well as cytoprotective effects have been described to be due to this rns . Depression of atp synthesis through oxidative phosphorylation by no has been mainly attributed to the inhibition of mitochondrial complex iv . In fact, no - induced inhibition of complex iv is completely and quickly reverted upon its removal, suggesting that the inhibition of mitochondrial complex iv by no can be better described as a functional control of cell respiration . Importantly, if these two molecules (o2 and no) encounter each other, they undergo a fast spontaneous reaction leading to production of peroxynitrite (onoo). For this purpose, classical antioxidant pathways, such as superoxide dismutase (sod2 in the matrix and also sod1 at the intermembrane space) and the glutathione cycle, play a relevant role in detoxifying increased mitochondrial ros levels . Although it is unclear whether the decline in antioxidants precedes the increase in oxidants during ad progression, their levels are certainly not capable of neutralizing enhanced ros generation . In this perspective, oxidative stress is also seen as an imbalance that has its origins in genes and in the way in which gene expression is regulated . At the center of this new focus is a transcription factor named nuclear factor (erythroid - derived 2)-like 2, or nrf2 (described further in this paper), the master regulator of the antioxidant response, modulating the expression of hundreds of genes, including the familiar antioxidant enzymes . Evidence from ad postmortem brain, as well as cellular and animal ad models, shows that a triggers mitochondrial dysfunction by interaction with different mitochondrial targets, including the outer mitochondrial membrane omm, intermembrane space, inner mitochondrial membrane imm, and the matrix . The consequent impairment of oxidative phosphorylation, ros production, mitochondrial dynamics, and the interaction with mitochondrial proteins may be related to a toxic effect caused by intracellular a. indeed, a has been described to accumulate intracellularly, a process linked to early stages in the neuropathological phenotype of ad . Within the cells, aggregated a1 - 42 may appear as dense packed granules . Moreover, intracellular a is present in mitochondria from brains of ad transgenic mice and ad patients . A progressively accumulates in mitochondria and is associated with decreased activity of complexes iii and iv and a reduction in the rate of oxygen consumption . Importantly, a can be transported into mitochondria via the translocase of the outer membrane (tom) machinery in a process independent of the mitochondrial membrane potential . Concordantly, many studies have shown mitochondrial abnormalities in ad, as expressed both by energy deficits and the potentially toxic production of free radicals . Imaging and biochemical studies in brain and peripheral samples obtained from ad patients revealed alterations in both extramitochondrial and mitochondrial metabolic pathways . Accordingly, reduced cerebral glucose transport and pyruvate levels through glycolysis were observed in the temporal cortex of ad subjects . Moreover, deregulation of tricarboxylic acid cycle and oxidative phosphorylation system coupled to altered mitochondrial dynamics were also found [55, 56], along with the well - defined deficit in mitochondrial complex iv . Thus, mitochondria are susceptible organelles in ad, largely contributing for disease - related ros generation and ad pathogenesis . Both mitochondrial ros production and ca handling (which is necessary for the activity of mitochondrial dehydrogenases) are considered the centre of important biological processes, and their deregulation has been implicated in a number of human pathologies, including neurodegenerative diseases like ad . Due to localized high ca concentration in microdomains close to mitochondria, ca is rapidly accumulated within mitochondria (e.g.,) influencing energy function by activating mitochondrial matrix dehydrogenases to produce more nadh, donating more electrons through complex i, and thus driving the synthesis of atp . Thus, the role of mitochondria as reservoirs of ca and apoptotic proteins and producers of ros is pathologically linked to neurotoxicity in both ad and aging brain . However, most investigators agree that mitochondria from ad subjects differ from those of age - matched, nondemented subjects [3, 5961]. The role of mitochondrial ros as inducers of ca deregulation is well established, and a major cause of ros production has been linked to ca deregulation, along with reduced mitochondrial atp levels . Thus, oxidative stress and ca regulation are intricately linked and can cooperatively contribute to ad pathogenesis [60, 61]. In fact, the lack of histones in mtdna renders them vulnerable organelles to oxidative stress [7, 8]. Mitochondrial - targeted ros scavengers, without interfering with physiological ros signaling, therefore represent a promising novel therapeutic approach to the treatment of neurodegenerative diseases like ad [8, 60]. In recent studies the mitochondrial antioxidant mitoq (mitoquinone mesylate: [10-(4,5-dimethoxy-2-methyl-3,6-dioxo-1,4-cycloheexadienl - yl) decyl triphenylphosphonium methanesulfonate]) prevented increased production of ros and the loss of mitochondrial membrane potential in cortical neurons subjected to a and further prevented cognitive decline, synaptic loss, caspases activation, and oxidative stress in female of 3xtg - ad mice . To better access mitochondrial dynamics and how a affects the function of this organelle, researchers mainly use in vitro strategies . In pyramidal neurons from the hippocampus of ad patients, the levels of intracellular a1 - 40 and 42 were found to be 3 and 10 m, respectively, higher than those found in control individuals, which are in the range of the concentrations used in numerous in vitro studies . In fact, by using isolated rat brain mitochondria treated with a, both mitochondrial transmembrane potential and the mitochondrial capacity to accumulate ca were shown to be decreased and to cause a complete uncoupling of respiration . Moreover, mitochondrial accumulation of a reduced oxygen consumption and mitochondrial electron transport chain activity [65, 66]. The progressive accumulation of a within this organelle was shown to be linked to mitochondrial abnormalities, like mtdna defects and altered mitochondrial gene expression, along with changes in mitochondrial dynamics, axonal transport, and also synaptic degeneration [50, 60]. Deregulated ca levels are also detrimental to mitochondrial function, and therefore impaired ca homeostasis may play a role in ros generation, a aggregation, and damage to mitochondria in ad . A can further promote intracellular ca increase in a deleterious positive feedback loop, suggesting that a accumulation can deregulate ca levels and vice versa . In fact, l-, p- and n - type ca channels activity can be modulated by a, an effect apparently mediated primarily by a-induced ros production . A was also shown to promote excessive release of ca from endoplasmic reticulum (er), which may underlie mitochondrial ca dyshomeostasis and ros generation, thereby disturbing organelle functioning and, ultimately, damaging neurons, as described above . The mild or gradual energy disturbance, described above, may influence ros generation (namely, through disruption of the mitochondrial respiratory chain) and cause the oxidative damage of different molecules and the formation of the high conductance mitochondrial cyclophilin d - associated permeability transition pore (ptp). This is followed by the release of proapoptotic factors, particularly cytochrome c and apoptosis - inducing factor (aif) and the activation of caspases in charge of the execution phase of the apoptotic cascade . In this perspective, apoptosis through the intrinsic pathway has been largely described to play an essential role in ad pathogenesis . In response to apoptotic signals, loss of mitochondrial membrane potential associates with mitochondrial membrane permeabilization to evoke cytochrome c release and the activation of the initiator caspase-9 . Although many reports support the occurrence of mitochondrial - linked apoptosis, as observed following exposure to a, other researchers have not seen an increase in apoptosis . Previous reports described that the hippocampus of ad brains displayed dna fragmentation, but only few cells showed morphological characteristics of apoptosis . This has been opposed by studies in cell and animal models of ad overexpressing the antiapoptotic protein bcl-2 . In this regard, we previously showed that bcl-2 is neuroprotective against apoptotic cell death caused by a(2535). Additionally, overexpression of bcl-2 in 3xtg - ad mice improved place recognition memory, reduced caspase activation, and attenuated app processing, leading to decreased formation of extracellular plaques and neurofibrillary tangles . Synapses are sites of high energy demand and extensive ca fluctuations since synaptic transmission requires high levels of atp and constant regulation of intracellular ca concentration, rendering synaptic mitochondria vital for maintenance of synaptic function and transmission . Recent studies in postmortem frontal cortex obtained from mci individuals or mild / moderate and late - stage ad patients demonstrated a significant disease - dependent increase in oxidative markers mainly localized to the synapses . Interestingly, the levels of oxidative markers significantly correlate with mmse suggesting an involvement of oxidative stress in ad - related synaptic loss . A recent study also demonstrated mitochondrial morphologic alterations in neurons obtained from different brain areas of postmortem human ad brains concomitantly, with loss of dendritic branches and depletion of dendritic spines . In ad, synaptic dysfunction and the loss of synapses are in fact early pathological features, probably due to defects in synaptic mitochondria, which lead to alterations in cognitive function, and, interestingly, this seems to be related to ros production and altered ca dynamics at the synapse . In mouse hippocampal neurons, a was demonstrated to impair mitochondrial movements, reduce mitochondrial length, and cause synaptic degeneration . Compared with nonsynaptic mitochondria, synaptic mitochondria showed a greater degree of age - dependent accumulation of a and mitochondrial alterations . The fact that synaptic mitochondria, especially a-rich synaptic mitochondria, are more susceptible to a-induced damage highlights the central importance of synaptic mitochondrial dysfunction to the development of synaptic degeneration in ad . Indeed, synaptic mitochondria are more sensitive to ros than nonsynaptic mitochondria . In ad, synapses are the primary sites of ca deregulation due to overactivation of glutamate receptors . These receptors are concentrated on postsynaptic spines of neuronal dendrites where they are subjected to particularly high levels of ca influx, oxidative stress, and atp demand . Therefore, they are likely sites at which neurodegenerative processes are initiated in aging and early ad, thus playing an important role in decreased synaptic function . In addition, the apoptotic process has been shown to be activated locally in synaptic compartments after exposure to a in vulnerable ad neuronal populations . With this in mind, in the next section we discuss the role of n - methyl - d - aspartate receptors (nmdars), a subtype of glutamate receptors, in mitochondrial ca regulation and ros formation in ad - associated neurodegeneration . Ionotropic glutamate receptors mediate most excitatory neuronal transmission in the brain and play essential roles in the regulation of synaptic activity . In fact, ca influx through nmdars induced by synaptic activity is required for many types of synaptic plasticity and underlies some forms of learning and memory . Very recently, the selective roles for glun2a and glun2b subunits of the nmdars in long - term potentiation (ltp) and long - term depression (ltd), respectively, were reported . However, excessive ca influx due to overactivation of nmdars may result in excitotoxic cell death in many neurological disorders, including ad (figure 1). Depending on their specific response to different pharmacological agents, ionotropic glutamate receptors can be subdivided into nmdars, -amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid (ampa) and kainate receptors [81, 82]. A oligomers were shown to induce inward currents, intracellular ca increase, mitochondrial ca overload, oxidative stress, mitochondrial membrane depolarization, and apoptotic cell death through a mechanism requiring nmdar and ampar activation in both rat cortical neurons and hippocampal organotypic slices . Functional nmdars are heterotetramers composed of two glycine - binding glun1 subunits assembling with two glutamate - binding glun2 (glun2a glun2d) subunits or, alternatively, glun3 (glun3a and/or glun3b) subunits which can replace glun2 . The most widely expressed nmdars contain the obligatory subunit glun1 plus either glun2b or glun2a or a mixture of the two . Glun2b and glun2d subunits are expressed at high levels in early developmental stages (prenatally), whereas glun2a and glun2c expression is first detected near birth . Nmdars exhibit high ca permeability and voltage - dependent channel block by extracellular mg, properties of both physiological and pathological importance . Channel blockade by mg reduces ca influx at membrane voltages near rest but is relieved during neuronal excitation . Recent studies have reported activation of the ros - producing nox after nmdar stimulation in response to intrastriatal administration of glutamate in mice . In contrast, mice lacking nox2 were less vulnerable to excitotoxicity, presented reduced levels of ros production and protein nitrosylation, decreased microglial reactivity and calpain activation, suggesting that nox is stimulated by ca entry through ionotropic glutamate receptors . Recent results also demonstrate that not only glutamate excitotoxicity and/or oxidative stress alter mitochondrial fission / fusion, but that an imbalance in mitochondrial fission / fusion in turn leads to nmdar upregulation and oxidative stress, suggesting a new vicious cycle involved in neurodegeneration that includes glutamate excitotoxicity, oxidative stress, and mitochondrial dynamics . Although nmdars activation is essential for memory formation, therapeutic actions of memantine, an uncompetitive open channel blocker of nmdars, include slowing of neuronal loss due to nmdars excitotoxicity, thus correcting for an excitation - inhibition imbalance . Indeed, memantine is widely prescribed as a memory - preserving drug for moderate- to late - stage ad patients, suggesting that the therapeutic effect of memantine derives predominantly from nmdars inhibition . However, it appears paradoxical that inhibition of nmdars slows memory loss associated with ad, considering that nmdars activation is essential for memory formation . A oligomers were previously reported to coimmunoprecipitate with extracellular domains of the glun1 subunit, suggesting a direct interaction of a with nmdars . Using transfected hek293 cells, it has previously been shown that a mediates necrotic cell death through changes in ca homeostasis in hek293 cells selectively expressing glun1/glun2a subunits, but not glun1/glun2b subunits . However, in rat primary cortical cultures it was recently demonstrated that a1 - 42 preparation containing both oligomers (in higher percentage) and monomers directly interacts with cell function by disturbing intracellular ca homeostasis through activation of glun2b - containing nmdars . Moreover, the same preparation of a1 - 42 induced microtubule disassembly, reduced neurite length and dna fragmentation in mature hippocampal cells, which were largely prevented by the selective nmdar antagonists mk-801 (noncompetitive antagonist), memantine and ifenprodil (glun2b subunit antagonist), suggesting a role for extrasynaptic glun2b - containing nmdars in a toxicity, as recently shown by mota and colleagues (in press). Application of a monomers and low - n oligomers (dimers and trimers) secreted from chinese hamster ovary cells that stably overexpress human app bearing the val717phe familial ad mutation was shown to mimic a state of partial nmdar blockade, reducing nmdar activity and nmdar - dependent ca influx . Accordingly, neurons from a genetic mouse model of ad were found to express reduced amounts of surface glun1 subunit, and a1 - 42 was also found to reduce surface expression of the glun1 subunit, in both cortical and hippocampal neurons [91, 92]. On the other hand, glun2a- and glun2b - nmdars appear to have opposite roles in regulating intracellular ca in the presence of a1 - 42 in rat cortical cultures . These findings support the concept that dysregulation of intracellular ca homeostasis is induced by a possible interaction of a with nmdars, particularly of the glun2b subtype . In addition, it was also demonstrated that in the ad brain and human cortical neurons, excitatory synapses containing the glun2b subunit of the nmdar appear to be the main sites of oligomer accumulation . In this study, a oligomers colocalized with synaptic markers, and this effect was counteracted by ifenprodil and memantine, blocking the ion channel formed by the nmdar . There is a growing body of evidence that nmdar activity has the potential to promote survival or death in neurons of the central nervous system, which may be related to differences in synaptic versus extrasynaptic nmdar signaling . It was recently demonstrated that extrasynaptic, but not synaptic, nmdars activity stimulates neuronal amyloidogenic -secretase - mediated app processing and increases a production in primary cultures of cortical neurons . Interestingly, in this study, memantine inhibited extrasynaptic nmdar - induced app protein expression as well as neuronal a release in a dose - dependent manner . In fact, the differences between synaptic and extrasynaptic pools could be due to the way they are activated: brief saturating activation in the case of synaptic nmdars, compared with chronic, low - level activation of extrasynaptic nmdars by bath application of glutamate . Differences in the properties of intracellular ca transients evoked by these different stimuli may differentially affect signaling, even if the overall ca load is similar [96, 97]. Ca influx through nmdars activation also seems to have opposite consequences on neuronal fate, according to their cellular localization [98, 99]. Stimulation of synaptic nmdars induces prosurvival events through the activation of camp response element - binding protein (creb) and the extracellular signal - regulated kinase (erk) cascade . Conversely, ca influx through extrasynaptic nmdars overrides these functions coupling to a dominant creb shut - off pathway causing creb dephosphorylation, which is less well tolerated, triggering decreased mitochondrial membrane potential and cell death . Thus, a distinct nmdars activation signaling pathway was postulated, depending on their localization . Synaptic stimuli evoke caentry through both glun2a- and glun2b - containing nmdars and, in contrast to excitotoxic activation of extrasynaptic nmdars, produce only low - amplitude cytoplasmic ca spikes and modest nondamaging mitochondrial ca accumulation . However, nmdar signaling can also be due to differences in the composition of the nmdars as opposed to the location of the receptors . Thus, it has been suggested that excitotoxicity is triggered by the selective activation of nmdars containing the glun2b subunit [103, 104] irrespective of its location (synaptic or extrasynaptic), as glun2a - containing nmdars promote survival . Accordingly, ca entering through glun2a or glun2b subunits - containing nmdars was shown to have antiapoptotic activity or mitochondrial dysfunction and cell death, respectively . The er is a multifunctional organelle that plays a central role in many essential cellular activities, such as folding, assembly and quality control of secretory and membrane proteins, disulfide bond formation, glycosylation, lipid biosynthesis, ca storage and signaling . Under stress conditions, such as perturbed ca homeostasis or redox status, elevated secretory protein synthesis rates, altered glycosylation levels, and hypercholesterolemia, unfolded or misfolded proteins accumulate in the er lumen leading to er stress . To relieve stress and reestablish homeostasis, the er activates intracellular signal transduction pathways, collectively termed the unfolded protein response (upr), which reduces the influx of newly synthesized proteins into the er through induction of general translational arrest and induces the transcriptional upregulation of genes that enhance the er protein - folding capacity and quality control . During upr, the er also employs proteasomal (er - associated degradation, erad) and autophagic pathways to degrade mis- or unfolded proteins . Three specialized er stress - sensing proteins involved in the canonical mammalian upr pathway have been identified: protein kinase r - like endoplasmic reticulum kinase (perk), inositol - requiring enzyme 1 (ire1) and activating transcription factor 6 (atf6). Upon er stress, the er chaperone glucose - regulated protein 78 (grp78) dissociates from these er transmembrane sensors and promotes their activation, inducing phosphorylation and oligomerization of ire1, and perk, and translocation of atf6 to the golgi where it is cleaved by site 1 and site 2 proteases (s1p and s2p). Active ire1 processes the mrna encoding x - box binding protein 1 (xbp1), a transcription factor that upregulates genes encoding mediators of protein folding, erad, organelle biogenesis, and protein quality control . Perk activation reduces protein load in the er by decreasing general protein synthesis through phosphorylation of the initiation factor eukaryotic initiation factor 2 (eif2) which paradoxically increases selective translation of activating transcription factor 4 (atf4) mrna . The atf4 protein is a member of the bzip family of transcription factors that activates the expression of several upr target genes involved in antioxidant responses, apoptosis, and autophagy . In er stressed cells, atf6 is cleaved at the golgi apparatus, and the released cytosolic domain translocates to the nucleus where it increases the expression of er chaperones, erad - related genes, and proteins involved in organelle biogenesis . However, when er stress is prolonged or too severe, these adaptive mechanisms fail to restore protein - folding homeostasis, thus shifting adaptive programs toward the induction of apoptotic signaling to eliminate irreversibly damaged cells . Unresolved and prolonged er stress leads to perturbed ca homeostasis, increased protein accumulation, loss of er function, and activation of apoptotic cascades . Under these conditions, the level of the upr - induced cell death mediator c / ebp - homologous protein (chop) increases and activates the transcription of gadd34, which interacts with protein phosphatase i to catalyze eif2 dephosphorylation [109, 110]. Deletion of chop gene partially protects both cells and animals from er stress - mediated cell death . The upr is known to initiate other proapoptotic events as well, including c - jun n - terminal kinase (jnk) phosphorylation, cleavage of er - specific caspases such as caspase-12, and disruption of cellular ca homeostasis . In the past few years, er stress has been largely implicated in the pathogenesis of multiple human diseases, including neurodegenerative disorders [107, 115]. Several studies support that upr activation upon er stress is one of the main players in synaptic dysfunction and neuronal death occurring in ad [116118]. In postmortem brain tissues from ad patients, a significant increase in the levels of er stress markers, including phospho - perk, phospho - eif2, and phospho - ire1, the transcription factor xbp1, the chaperone grp78, and the downstream mediator of cell death chop has been reported, compared with age - matched controls, suggesting that the prolonged activation of the er stress response is involved in the neurodegenerative process in ad [119122]. Furthermore, recent studies revealed a connection between upr activation and autophagic pathology in ad brain since the levels of microtuble - associated protein light chain 3 (lc3), an autophagosome marker, are increased in neurons displaying upr activation . Recent evidence obtained in an ad transgenic mice model, in which caspase-12, grp78 and chop are strongly up - regulated, further implicates er stress induction in the pathogenesis of ad . Familial ad - linked presenilin-1 (ps-1) mutations downregulate the upr and lead to er stress vulnerability . The mechanisms by which mutant ps-1 affects the er stress response are attributed to the inhibited activation of er stress transducers such as ire1, perk, and atf6 . On the other hand, in sporadic ad, it was found that the aberrant splicing isoform (ps2v), generated by exon 5 skipping of the presenilin-2 (ps-2) gene transcript, downregulates the signaling pathway of the upr . Several evidences support that a deposition and er stress are interrelated events in ad . A global molecular profile of hippocampal and cortical gene expression revealed that er stress - related genes are differentially regulated during the initial and intermediate stages of a deposition . On the other hand, it was proposed that a is generated within the er lumen as a result of deficits in axonal transport . It was also found that in transgenic mice expressing app(e693) (app(osk)) intraneuronal a oligomers accumulate in the er in hippocampal neurons and cause cell death by inducing er stress . Additionally, the involvement of caspase-12 activation in a-induced synaptic toxicity was recently demonstrated in cortical and hippocampal synaptosomes isolated from 3xtg - ad mice . Several evidences demonstrate that a is also able to trigger an er stress response in vitro [132134]. In primary cortical neurons, both fibrillar and oligomeric a have been shown to upregulate grp78 concomitantly with activation of the er stress - mediated apoptotic cell death pathway [135, 136]. However, recent evidences obtained in cultured hippocampal neurons support that interaction of a oligomers with nmdar, in particular with the glun2b subunits, occurs upstream of deregulation of er ca homeostasis and upregulation of er stress markers (costa et al ., unpublished data). Perturbation of er ca homeostasis, a trigger for the accumulation of unfolded or misfolded proteins and activation of the er stress response, seems to play an important role in the onset or progression of neuronal dysfunction in ad [117, 137]. Significantly, a markedly decrease of calreticulin immunoreactivity (er ca binding protein) was described in ad postmortem brain . Recent studies in ad transgenic mice have shown that enhanced ca response is associated with increased levels of ryanodine receptors and altering synaptic transmission and plasticity mechanisms before the onset of histopathology and cognitive deficits [139, 140]. Moreover, mutant ps-1 interacts with the inositol-1,4,5-trisphosphate (ip3) receptor (ip3r)-associated ca release channel, resulting in ca signalling abnormalities [141, 142] that have been suggested to be an early pathogenic event in ad involved in presynaptic dysfunction . Recently, it was discovered that ps-1 and ps-2 can form low - conductance channels, leading to passive er ca leak . These results provided potential explanation for abnormal ca signaling observed in familial ad cells with mutations in pss . App overexpression was shown to potentiate chop induction and cell death in response to er ca depletion . Similarly, a depletes er ca through ip3r- and ryr - mediated ca release, thus increasing intracellular ca levels and compromising cell survival [136, 146]. In addition, a-induced perturbation of intracellular ca homeostasis in neurons was shown to be correlated with an increase of the specific isoform of the ryanodine ca channel ryr3 expression and activity . 4-phenylbutyrate (pba), acting through its chemical chaperone - like activity and via the transcriptional activation of a cluster of proteins required for the induction of synaptic plasticity and structural remodeling, was shown to mitigate er stress . In the tg2576 mouse model of ad, er stress was accompanied by reversal of learning deficits, clearance of intraneuronal a accumulation, and restoration of dendritic spine densities of hippocampal ca1 pyramidal neurons . Additionally, the same authors demonstrated that chronic administration of pba, starting before the onset of disease symptoms, prevents age - related memory deficits in tg2576 mice, associated to a decrease in a pathology and inflammation . Wiley and colleagues also demonstrated that pba ameliorates the cognitive and pathological features of ad in the appsweps1delta9 ad transgenic mice . In app - overexpressing cells, pba blocked the repressive effects of the er stressors tunicamycin and thapsigargin upon app proteolysis, upr activation, and apoptosis . Furthermore, silencing chop gene expression was shown to protect against ad - like pathology triggered by 27-hydroxycholesterol in rabbit hippocampus . Recently, it was demonstrated that activation of the perk - eif2 upr pathway prevents a-induced neuronal er stress . Furthermore, the active form of the transcription factor xbp1 was shown to be neuroprotective in flies expressing a and mammalian cultured neurons treated with a oligomers, which was mediated by the downregulation of ryr3, preventing the accumulation of free ca in the cytosol . In addition, dantrolene and xestospongin c, pharmacological inhibitors of er ca release, were shown to prevent a-induced apoptotic cell death [154, 155]. Er stress - induced apoptotic cell death involves a mitochondrial component [156, 157]. Er directly communicates with mitochondria through close contacts referred as mitochondria - associated membranes (mams) that promote ca transfer from er to mitochondria thus maintaining mitochondrial metabolism and cell survival [158160]. The molecular bridges that regulate the contacts between er and mitochondria include the ip3r on the er and the vdac, which are physically coupled through the cytosolic chaperone glucose - regulated protein 75 kda (grp75). In addition, the dynamin - related gtpase mitofusin 2 (mfn2) on the er forms homoheterodimers with mfn1 or mfn2 on mitochondria to keep the tight contacts between the two organelles . Moreover, pacs-2 (mainly localized at the er) and dynamin - related gtpase protein 1(drp1) indirectly control the distance between the two organelles through regulation of mitochondrial morphology and distribution . The chaperone sigma-1 receptor (sig-1r) is able to sense ca concentrations in the er and controls the amount of ca released through the ip3r that can be transmitted to mitochondria . Disruption of contact sites and impairment of ca coupling between er and mitochondria have profound consequences for cellular function and in extreme cases lead to apoptosis . In fact, decreasing the space between both organelles promotes mitochondrial ca overload that can lead to the opening of the ptp, dissipation of the mitochondrial membrane potential and activation of apoptotic cell death, and, on the other hand, an increase in the distance between the two compartments inhibits ca transmission, compromising ca - dependent regulation of mitochondrial metabolism and consequently cell viability . Accordingly, during the adaptive phase of er stress, an early increase in cellular bioenergetics and mitochondrial metabolism occurs but during the cell death response, er stress exerts profound deleterious effects on mitochondrial function and activates an apoptotic pathway which depends crucially upon ca transfer from the er to the mitochondria [135, 168]. The mam is responsible for this transfer since its disruption, achieved by sirna knockdown of pacs-2, results in the inhibition of er ca release and apoptosis onset . Furthermore, apoptotic stimuli known to act through ca release from the er induce a prolonged increase in the mitochondrial ca concentration [154, 155, 169, 170]. Several members of the bcl-2 family, such as bcl-2 itself, bax and bak, naturally localize to both mitochondria and the er and modulate ca content in both organelles, controlling the amount of er - releasable ca that can reach mitochondria triggering apoptotic cell death [154, 171176]. Transmission of a ca signal from er to mitochondria was demonstrated to be associated with ip3-induced opening of ptp and, in turn, cytochrome c release . Similarly, phosphorylation of ip3r by akt reduces cellular sensitivity to apoptotic stimuli through a mechanism that involves diminished ca flux from the er to the mitochondria . Cytochrome c released from mitochondria can also bind to er ip3r and promotes ca release through this channel . Released er ca triggers the extrusion of a large amount of cytochrome c from all the mitochondria in the cell, amplifying the death signal [180, 181]. It has been reported that mobilization of drp1 to mitochondria, under er ca release conditions, can trigger mitochondrial cristae remodelling, facilitating cytochrome c release and subsequent apoptosis [182, 183]. However, recruitment of drp1 to mitochondria upon sustained ca release from the er was described to protect from apoptosis by fragmenting the mitochondrial network and blocking ca transmission . Despite the evidence that demonstrates the involvement of mitochondrial and er dysfunction in ad pathogenesis, the role of er - mitochondria crosstalk in this neurodegenerative disorder has not been clarified so far . It was recently shown that ps-1 and ps-2 are highly enriched in a subcompartment of the er that is related with mam . In sh - sy5y cells and primary neuronal cultures, overexpression of ps-2, and more drastically its familial ad mutants, was demonstrated to increase the physical interaction between er and mitochondria thus facilitating mitochondrial ca uptake . Moreover, the association of hyperphosphorylated tau with er membranes was detected in ad brains and also in the brain of asymptomatic mice that overexpress mutant tau . Interestingly, these mice exhibited more contacts between er membranes and mitochondria, suggesting that accumulation of tau at the surface of er membranes might contribute to tau - induced neurodegeneration through impairment of mitochondrial function . Recent studies performed in mtdna - depleted 0 cells challenged with toxic a described the activation of an er stress - induced apoptotic cell death pathway that requires the presence of a functional mitochondrial . In a-treated cortical neurons, it was previously demonstrated that ca released from er, through ip3r and ryr channels, is implicated in the depolarization of the mitochondrial membrane, release of cytochrome c upon translocation of bax to mitochondria and activation of caspase-9 [135, 136], thus implicating the er / mitochondria crosstalk in neurodegeneration occurring upon a exposure . This communication was also corroborated by the evidence obtained with cybrids, which recapitulate the mitochondrial defect (inhibition of complex iv of the electron transport chain) observed in ad [9, 189]. In these cells, markers of er stress - induced apoptotic cell death were shown to be increased by a treatment in comparison with controls suggesting that a-induced er stress is enhanced under mitochondrial dysfunction conditions ., the first thing that comes to our mind is mitochondrial - driven ros generation . However, could er be another important source of ros in ad? Mainly during protein synthesis, 25% of cellular ros are produced in the er as a consequence of the activity of oxidoreductases, a family of proteins that catalyze protein folding reactions [191193]. After the entry of nascent proteins in the er, disulfide bond formation must occur to ensure their correct maturation and function . This reaction is catalyzed by the protein disulfide isomerase (pdi) that accepts electrons from thiol residues in the polypeptide chain substrate leading to its oxidation [194, 195]. To continue its activity, pdi must be reoxidized, a process that is guaranteed by oxidoreductin 1 (ero1). In order to recycle itself, ero1 transfers electrons to molecular oxygen, leading to the production of ros . In ad patients, no substantial alterations were observed in pdi levels when compared to controls; however this may not imply about its net activity . In fact, it was reported that the activity of pdi may be inhibited by no, since increased levels of s - nitrosylated pdi were found in the brain of sporadic ad patients . As a consequence, polyubiquitinated proteins accumulate, which may thus activate the upr . Ero1 is retained in the er through its interaction with pdi and the erp44 [199, 200]. Beside this interaction, erp44 also binds to the ip3r leading to its inhibition, a process that is dependent on ph, ca concentration and redox state . In this way, erp44 works as a sensor of the environment in the er lumen . When this erp44-ip3r connection is disrupted, er ca is released through this channel into the cytosol . This process may rely on the presence of ero1, since prolonged ero1 activation is expected to originate a hyperoxidizing environment in the er lumen, which may lead to the formation of disulfide bonds in the ip3r, disrupting the repressive interaction between erp44 and ip3r . Interestingly, ero1, one of the two ero1 proteins expressed in human, was described to be localized on mam, which is highly enriched in ip3r, suggesting that human ero1 regulates ip3r - ca signaling on the mam . The ca released from er can then enter directly into mitochondria, through the omm vdac or the imm ca uniporter (mcu), leading to the increase in mitochondrial ca content, ros production, and the opening of the ptp [207, 208]. This sequence of events is expected to occur in ad and can be hypothesized to underlie the increase in cellular ros triggered upon er ca release observed in a-treated cortical neurons (figure 1). Several er functions, such as chaperone - mediated protein folding and refolding and the maintenance of ca gradients, are atp - dependent processes . During the upr, er chaperones like grp78 are upregulated, and consequently higher levels of atp must be delivered to the er, requiring an increase in atp production by the mitochondrial respiratory chain, with the consequent enhancement of ros production . Similarly, the er ca leak that occurs under prolonged stress conditions could obligate the sarco(endo)plasmic reticulum ca - atpase (serca) to increase the rate of entry of ca to the er lumen, causing atp depletion and subsequent increase of ros production within the mitochondria . Another consequence of upr activation, in an attempt to recover from protein unfolding or misfolding, is the depletion of the antioxidant gsh . The function of gsh in the er needs to be fully elucidated; however it has been suggested that gsh acts as a reductant, either by maintaining er oxidoreductases in a reduced state or by directly reducing nonnative disulphide bonds in substrate folding proteins . This may explain why the er lumen contains a relatively high concentration of oxidized glutathione (gssg), driving the gsh: gssg ratio to approximately 3: 1 [192, 212]. During upr, the overload of unfolded proteins enhances ero1 activity, leading to an increase in oxidized pdi levels, which requires higher levels of gsh . The subsequent conversion to gssg leads to a depletion of the gsh pool . Another hypothesis for this decrease is that the stimulation of ero1 activity increases the generation of ros that reacts with gsh, decreasing its levels, which further increases ros levels (figure 1). In ad adams and colleagues have suggested that gsh levels increase in the ad brain as a compensatory mechanism following damage in specific brain regions . In an opposite manner, aksenov and coworkers moreover, gsh levels were described to be decreased in red blood cells from male ad patients and in experimental models of ad [215, 216]. It has been previously shown that gsh levels decrease in cortical neurons treated with a, and this decrease was correlated with the release of ca from the er . This datum is further supported by previous results showing that depletion of gsh occurs in neurons treated with a fibrils . Therefore, a-driven gsh depletion might contribute to the impairment of quality control mechanisms operating at the er, leading to the accumulation of unfolded / misfolded proteins . Gsh is not the only antioxidant defense that may be reduced in ad as a consequence of er stress and ros formation . When the upr is induced, the er senses the increase in ros and increases antioxidant defenses, namely, through the perk signaling pathway that coordinates the convergence of er and oxidative stress . One of these antioxidant responses involves the phosphorylation of nrf2 by perk, followed by its dissociation from the microtubule - associated protein keap1 (kelch - like ech - associated protein 1), which allows the dislocation of nrf2 from the cytosol to the nucleus [209, 218]. Once in the nucleus, nrf2 binds to the antioxidant response element (are) to activate the transcription of several phase ii detoxification enzymes and antioxidant enzymes . Nrf2 activation also contributes to the maintenance of gsh levels, which in turn buffers the accumulation of ros during the upr . Several studies allow us to speculate that the increase in ros observed in ad may be linked, at least in part, to a deregulation of nrf2 activity (figure 1). Indeed, not only nrf2 was described to be predominantly cytoplasmatic in hippocampal neurons from ad patients, resulting in decreased nuclear levels, but also nrf2-are pathway was shown to be attenuated in app / ps1 transgenic mouse brain at the time of a deposition . The potential protective role of nrf2 in ad is further supported by the demonstration of a significant reduction in spatial learning deficits of aged app / ps1 mice, observed when nrf2 is overexpressed in this ad model . Li and colleagues have demonstrated that chop induces ero1 upregulation, which causes the activation of the er ip3r . The ca released from er can enter the mitochondria, promoting ros generation as described above, but can also activate the enzyme calcium / calmodulin - dependent protein kinase ii (camkii), which triggers mitochondrial - mediated apoptosis (figure 1). Camkii can further induce nox that activates a protein kinase r (pkr-) activating protein, leading to sustained pkr - mediated chop expression, amplifying the pathway induced by this er stress - related transcription factor . In ad patients, during the initial stages of the disease, the expression of all 3 isoforms of nox was shown to be significantly increased, activating nox - associated pathways and contributing to ad progression . The connection between chop upregulation and nox signaling in ad remains to be further clarified but it seems to be a good target for future therapeutic perspectives . Another positive feedback is played by ros itself that can sensitize both ca - release channels and serca at the er membrane [227229]. Ros or rns can oxidize critical thiols in the ryr, causing ca release . On the other hand, oxidation of serca inhibits their ability to transport ca to the er lumen, increasing cytosolic ca concentration . From the data exposed above it is possible to conclude that the er could be, by its nature, an important source of ros in ad, which impacts on cell survival upon perturbation of normal er function . Due to the close communication between er and mitochondria, er stress occurring in ad brain can be expanded to the mitochondria releasing its malicious oxidative power that can further trigger apoptotic cell death pathways . Therefore, targeting these cellular sources of ros may bring strong therapeutical outcomes for this neurodegenerative disease . With the move towards development of disease - modifying treatments, there is a need for more accurate diagnosis of ad in its early stages . Therefore, much attention has been paid to the identification and validation of biological markers of the disease . Markers that specifically reflect the onset of pathology may have a profound impact both on early diagnosis and on detection of treatment effects in the near future . Established csf biomarkers exist for early ad: total and hyperphosphorylated tau (tau and p - tau) that reflect ad - type axonal degeneration and the 42 amino acid isoform of amyloid (a1 - 42) that reflects senile plaque pathology . These biomarkers have recently been incorporated in the new proposed revised criteria for ad [232, 233]. However, these classical markers do not capture all the pathological changes that take place in the brain of ad patients, and its clinical application is limited by the invasive nature of its collection . Impaired bioenergetics, increased production of ros, and oxidative injury are, as seen above, important features of ad pathology that occur early in the course of the disease . These findings have spurred the development of assays for markers that reflect these processes both in tissue, csf and peripheral fluids . The methodology mostly used to assess oxidative damage is through the detection of products of free radical attack against biomolecules (lipids, proteins, and nucleic acids). Additionally, several compounds of the antioxidant defense system can be measured and used as complementary information regarding the oxidant / antioxidant balance of the organism . Results on lipid peroxidation in plasma and peripheral blood cells have been inconsistent, with several authors demonstrating increased levels of free mda or tbars in serum / plasma [234239] or in erythrocytes [240, 241] of ad patients and mci subjects, whereas others did not confirm these findings [242244]. Interestingly, a few studies have shown that the highest tbars levels were found in apoe-4 carriers [13, 241], suggesting that apoe genotype affects the extent of the oxidative stress - induced damage . Free hne has also been assessed in ventricular csf from patients with ad, and significantly elevated levels were found in comparison to age - matched controls, while no differences were detected in the levels of hne - protein adducts . Similar to what has been reported for mda and tbars, the results of the determination of hne in peripheral fluids of ad and mci subjects have been somewhat inconclusive . Some authors have demonstrated elevated plasma levels of hne in ad patients, compared to controls [243, 246], while others did not observe any differences . An interesting study reported increased levels of mda and hne in peripheral cells (skin fibroblasts and lymphoblasts) derived from familial ad patients, carrying app and ps-1 mutations, while no differences in these lipid peroxidation markers were found between sporadic ad cases and controls . Increased levels of f2-isops were also found both in postmortem ventricular csf from ad patients [20, 249] and in lumbar csf collected in vivo [250, 251], correlating with clinical severity and other biomarkers of the disease, like csf a1 - 42 and tau [252, 253]. Several studies on mci subjects also found increased levels of csf f2-isops [251, 254, 255], including longitudinal studies, that have shown that csf f2-isops levels rise after 12-month followup and that the rate of increase is higher in mci subjects that progress to ad, compared to healthy controls and stable mci . In fact, longitudinal evaluation of csf f2-isops seems to be useful in predicting future cognitive deterioration both in cognitive normal and mci subjects and in increasing the diagnostic accuracy of prodromal ad [255, 257]. One study in particular suggests that the determination of csf isoprostanes could be useful in monitoring the effectiveness of experimental antioxidant treatments . The quantification of isoprostanes in peripheral fluids of ad patients and mci subjects has however yielded conflicting results . Some studies have found elevated levels of f2-isops in the urine [252, 259] and plasma of ad patients and mci subjects, but further studies did not confirm these results [260, 261]. Overall, it seems that data regarding oxidative damage to lipids in the central nervous system is fairly consistent in showing increased markers of lipid peroxidation in early stages of ad . Furthermore, multiple physiological and pathological conditions can influence the levels of lipid oxidative damage in peripheral fluids, such as diet, physical activity, smoking habits, and comorbidities like diabetes, cardiovascular disease, and cancer that are known to increase oxidative damage . Therefore, when analysing the levels of lipid peroxidation markers in peripheral fluids in ad patients and mci subjects, it is extremely important to control for potential confounders . Protein carbonyls are usually detected with 2, 4-dinitrophenylhydrazine (dnph) by a simple spectrophotometric assay . Carbonyl content has also been studied in plasma, with some studies failing to show an increase in this protein oxidation marker in ad patients [243, 262] and mci subjects . Recent studies, however, have demonstrated increased plasma concentrations of protein carbonyls in ad patients and mci subjects, compared to controls, and also in peripheral lymphocytes isolated from ad patients . Protein nitration, detected by nitrotyrosine immunoreactivity, has been studied not only in the brain but also in csf . By employing sensitive hplc methods, five - to eightfold increases in the levels of 3-nt have been found in the ventricular and lumbar csf of ad patients when compared with cognitively normal controls [264, 265]. These results, however, were not confirmed by a different study using a gas chromatography coupled with mass spectroscopy approach, where the majority of ad patients had 3-nt csf levels similar to the controls . The discrepancies between these studies are probably due to the different sample preparation and analysis methods and to the possible in vitro formation of 3-nt in the csf samples . Similarly to what has been shown for protein carbonyls, increased levels of 3-nt have also been reported in plasma and lymphocytes of ad patients compared to controls . Dna injury, assessed through increased levels of 8-ohdg, has also been shown in intact dna extracted from ventricular csf [267, 268] or in lumbar csf of ad patients . Studies using dna extracted from peripheral tissue have also demonstrated increased levels of dna oxidation, thus suggesting the systemic nature of oxidative damage in ad . Increased levels of 8-ohdg and oxidized purines and pyrimidines in the peripheral lymphocytes and leukocytes of ad and mci patients have been demonstrated [235, 270, 271] and also an increased urinary excretion of oxidized nucleosides in ad patients . The potential of dna oxidation levels as a biomarker for ad has been questioned, however, due to the overlap between ad and controls and to its lack of specificity, as increased dna oxidation seems to be present in other neurodegenerative conditions, such as amyotrophic lateral sclerosis and parkinson's disease . Besides dna, oxidation of rna can also be used as a marker of oxidative stress, through the determination of 8-ohg levels . Interestingly, those were found to be fivefold increased in the csf of ad patients compared to controls, being unaltered in the serum . Contradictory results have been reported regarding the peripheral activity of cellular antioxidant enzymes in ad patients . While some studies have not found any differences in the activity of these enzymes in red blood cells of ad or mci subjects as compared to controls [234, 241, 242], others have reported an increased activity of glutathione peroxidase, catalase, and superoxide dismutase [236, 239, 240], but decreased activity of the latter enzymes has also been found [238, 274, 275]. Regarding nonenzymatic antioxidants, including glutathione, uric acid, carotene, lycophene, vitamins a, c, and e, work from several groups has demonstrated decreased plasmatic levels in ad patients [234, 269, 276] and mci subjects [263, 275, 276], with some authors suggesting that progression to ad might be related to depletion of antioxidant defenses . One of the most investigated nonenzymatic antioxidants is probably vitamin e, the most powerful chain - breaking antioxidant, with reduced levels reported not only in plasma [234, 241, 275, 276] but also in csf and brain parenchyma of ad patients . Antioxidant intervention in animal models of ad showed a significant reduction in oxidative stress, a deposition, and also behavioral improvements [281, 282]. However, in ad clinical trials, antioxidants have shown only a marginal positive effect on disease progression [283, 284], and subsequent mci trials with antioxidants indicate that vitamin e ingestion has no benefit on the risk of progression to ad [285, 286]. The lack of success of these trials [287289] likely arises from a combination of factors, including using the wrong dose in an unbalanced monotherapy, not monitoring the drug levels and surrogate markers for the in vivo therapeutic effect of the drug of interest and starting the therapy very late in the disease stage . The failure of simple antioxidants to reverse ros damage has prompted the need of other mitochondrial - targeted therapies, such as acetyl - l - carnitine - carnitine (a compound that acts as an intracellular carrier of acetyl groups across the inner mitochondrial membrane), mitovite (a compound that results from the conjugation of vitamin e with the lipophilic triphenylphosphonium cation tpp+making the antioxidant selectively accumulate inside the mitochondria), szeto - schiller peptides (small cell permeable antioxidants that target mitochondria in a potential - independent manner), or dimebon (the russian antihistamine laterpirdine), as reviewed elsewhere [290, 291]. The failure of antioxidant therapy to attenuate disease progression [285, 286] might also be explained by the fact that oxidative stress could be a necessary but insufficient factor for the development of disease, that is dependent upon additional factor(s) for the onset of underlying pathogenesis . Nevertheless, early intervention to prevent chronic oxidative stress, and thereby ameliorate one of the factors for the development of the disease, should influence and reduce the risk of ever developing the disease . Indeed, the role of oxidative stress in the pathogenesis of ad has moved from an epiphenomenon to one of the earliest events in disease pathogenesis, occurring prior to the onset of symptoms and associated with the brain regions typically affected in the disease [14, 28, 3840, 43, 251]. The hypothesis, based on in vitro cell culture experiments, that a causes oxidative stress has been challenged by in vivo studies where oxidative stress chronologically precedes a deposition . In fact, a accumulation is associated with reduced levels of oxidative stress [3840]. Therefore, the identification of valuable reliable peripheral markers of oxidative damage would be of utmost importance for researchers and clinicians . The standardization of assessment methods and the consideration of potential confounders are critical to reduce the inconsistencies that have been reported between studies . Moreover, many of these studies have been done by comparing ad patients and/or mci subjects with healthy controls and not with other neurodegenerative diseases, so specificity is still an issue . Oxidative stress has been found increasingly implicated in a number of neurodegenerative disorders including ad, parkinson's disease (pd), and amyotrophic lateral sclerosis (als). However, even if a process is not specific to ad pathogenesis, such as oxidative damage, its biomarkers may be useful in the context of clinical and imaging studies to monitor disease progression and optimize therapy . Increased sensitivity and specificity can probably be achieved by using a panel of different biochemical indices that target different pathological processes and can provide a more accurate picture of the oxidative balance of the organism . It is a slowly progressive and chronic neurodegenerative disorder, in which cognitive impairment is related to synapses degeneration and neuronal death occurring in the limbic system and specific regions of the cerebral cortex . The accumulation of a in senile plaques and the intraneuronal aggregates of hyperphosphorylated tau protein are recognized hallmarks of the disease whose cause still remains unknown . Several lines of evidence show that mitochondria dysfunction, ca deregulation, and oxidative stress are prominent factors in ad cellular pathology . Mitochondria, where free oxygen radicals are generated as by - products from the electron transport chain and from enzymes of the tricarboxylic acid cycle, are main sources and simultaneously main targets of ros . Toxic a oligomers may induce ca influx into neurons, rendering neurons vulnerable to excitotoxicity, through the activation of glutamate nmdar, and apoptosis . Glutamate excitotoxicity and/or oxidative stress have been shown to alter mitochondrial fission / fusion and an imbalance in mitochondria dynamics in turn leads to nmdar upregulation and oxidative stress . In addition, a accumulates in mitochondria and thereby impairs the activity of mitochondria respiratory chain and reduces atp synthesis and the mitochondria ca buffering capacity, causing elevated cytoplasmic ca levels and oxidative stress . A was also shown to promote er stress and excessive release of ca from er which may underlie mitochondrial ca dyshomeostasis and ros generation, thereby disturbing organelle functioning and, ultimately, damaging neurons . Mitochondria and the er are closely linked morphologically and functionally, and considerable crosstalk of cell death proteins, promoted by ros and high ca levels, occurs between these two organelles . The ca transport systems of the er are also sensitive to oxidative stress being directly exposed to er / mitochondria - generated ros . The resulting abnormal cellular ca load can trigger cell death by activating proteases, reinforcing signals leading to caspase activation, such as cytochrome c release from mitochondria, or by triggering other catabolic processes mediated by lipases and nucleases . A-associated ca deregulation, impaired bioenergetics, increased production of ros, and oxidative injury to lipids, proteins, and nucleic acids, associated to impairment of antioxidant defences, are important features of ad cellular pathology that occur early in the course of the disease . It can be hypothesized that the progression to ad may be related to the incapacity of the antioxidant system to counterbalance the oxidative injury, leading to disruption of cell redox signaling . In this context, development of reliable oxidative stress biomarkers and new antioxidant strategies should be proposed as primary prevention measures, even before significant plaque deposition or cognitive decline. |
As the impact of neural signaling on cancer becomes clearer, it is imperative that stress - sensitive steps in cancer progression are identified for the development of targeted interventions . The findings presented here suggest that targeting either neural or inflammatory signaling activated by stress may limit metastatic dissemination and cancer - related mortality (fig . 1). This is in line with recent retrospective epidemiologic studies linking -blocker use to improved cancer outcomes . We now demonstrate that -blocker use in cancer patients is linked to reduced tumor cell dissemination to lymph nodes . These findings provide a mechanistic rationale for ongoing clinical trials using -blockers as a possible treatment option for patients with cancer . Activation of the sympathetic nervous system increases levels of catecholamines, norepinephrine (ne), and/or epinephrine (e). Tumor - associated macrophages respond to ne / e by secreting inflammatory molecules such as prostaglandin e2 (pge2), which drive the production of vascular endothelial growth factor c (vegfc) in tumor cells . Various points in this signaling cascade can be targeted using drugs such as -blockers (bbs) or non - steroidal anti - inflammatory drugs (nsaids). Activation of the sympathetic nervous system increases levels of catecholamines, norepinephrine (ne), and/or epinephrine (e). Tumor - associated macrophages respond to ne / e by secreting inflammatory molecules such as prostaglandin e2 (pge2), which drive the production of vascular endothelial growth factor c (vegfc) in tumor cells . Various points in this signaling cascade can be targeted using drugs such as -blockers (bbs) or non - steroidal anti - inflammatory drugs (nsaids). The research described here was funded by the australian national health and medical research council (1008865 and 1053535), the australian research council (le110100125), the national cancer institute (ca160890), the australian and new zealand college of anaesthetists (n13/002), the co - operative research center for cancer therapeutics and the national breast cancer foundation. |
All authors declare that they have no conflicts of interest . Supporting grant provided by kci europe holding b.v. |
Retinoblastoma is the most common intraocular malignancy in childhood, and represents about 3% of all pediatric disease . Retinoblastoma, a diagnosis that affects not only vision but also survival for many individuals, is also the most common intraocular tumor of childhood . The incidence of retinoblastoma is generally the same worldwide, at 1 case per 15 000 to 20 000 live births, corresponding to about 9000 cases every year . The mortality rate of retinoblastoma in children is about 4070% in asia and african countries, and 35% in europe, canada, and the usa . Early retinoblastoma damage to the visual system may include pathophysiologic changes in the retina and corneal nerve head, and orbital corneal nerve damage . Therefore, we speculate that the change in or injuries of the cornea may reflect or correlate with retinoblastoma status . In this study we focused on biomarkers obtained from electroencephalography (eeg) recordings to reflect corneal nerve injury in retinoblastoma in the eyes - closed resting state . Previous studies have also investigated corneal nerve injury in eyes of humans and animals . Several classical eeg biomarkers have recently been identified for predicting prognosis of retinoblastoma patients, including 5 different frequencies and powers . According to our clinical observations, eeg band power may be correlated with corneal nerve injury in retinoblastoma patients . Thus, in this study we compared clinical eeg recordings with cornea confocal microscope results, and explored the use of eeg in retinoblastoma patients . This research was approved by the ethics committee of weifang medical university . Written informed consent was obtained from parents or legal guardians for participation in the study . Twenty consecutive patients who had been referred due to retinoblastoma to the department of ophthalmology, affiliated hospital of weifang medical university between 2010 and 2014 participated in this study . These 20 patients all had nonhereditary unilateral retinoblastoma presenting as intraocular tumor requiring primary enucleation . Retinoblastoma in this study was diagnosed according to the method of dean et al . . The visual analysis was performed on standard bipolar montages with electrode positions according to the 10 to 20 international systems . The detailed processes of the eeg examination were performed as reported by zeng et al . . To observe the status of the subbasal never plexus, more than 3 representative images were evaluated for analysis . Three masked and independent investigators evaluated the morphology of the corneal nerve and the subbasal nerve plexus, performed according to a previous report . The evaluation of the total length of nerve fibers represents the nerve density in the micrometers / frame (158, 700 m). We designated the number of main nerves under a microscope as the main nerve trunks . We designated the number of nerve branches as the nerve branching under a microscope . Using a microscope, we designated all of the nerves as the total nerves, including nerve branches and the main nerve trunks . This research was approved by the ethics committee of weifang medical university . Written informed consent was obtained from parents or legal guardians for participation in the study . Twenty consecutive patients who had been referred due to retinoblastoma to the department of ophthalmology, affiliated hospital of weifang medical university between 2010 and 2014 participated in this study . These 20 patients all had nonhereditary unilateral retinoblastoma presenting as intraocular tumor requiring primary enucleation . Retinoblastoma in this study was diagnosed according to the method of dean et al . . The visual analysis was performed on standard bipolar montages with electrode positions according to the 10 to 20 international systems . The detailed processes of the eeg examination were performed as reported by zeng et al . . To observe the status of the subbasal never plexus, more than 3 representative images were evaluated for analysis . Three masked and independent investigators evaluated the morphology of the corneal nerve and the subbasal nerve plexus, performed according to a previous report . The evaluation of the total length of nerve fibers represents the nerve density in the micrometers / frame (158, 700 m). We designated the number of main nerves under a microscope as the main nerve trunks . We designated the number of nerve branches as the nerve branching under a microscope . Using a microscope, we designated all of the nerves as the total nerves, including nerve branches and the main nerve trunks . A total of 20 patients (11 girls and 9 boys) were included, with a median age of 58 months (range, 43 to 127 months). According to the intraocular international retinoblastoma classification (iirc), there were 0 patients with extreme low risk (group a), 1 patient with low risk (group b), 1 patient with intermediate risk (group c), 16 patients with high risk (group d), and 2 patients with extreme high risk (group e). Figure 1 shows the changes of the dominant power bands within delta and theta bands . The eeg pattern of the retinoblastoma patients was characterized by a distinct increase in the delta (figure 1, p<0.01) and significant decrease in the theta power (figure 1, p<0.05). The results of cornea confocal observation showed that the corneal branch nerve fiber density was decreased significantly compared to the normal individuals . However, the density of the tumid and dendritic nerves was significantly increased compared to the normal individuals . The basal epithelium curving nerves were also significantly increased in the eyes of retinoblastoma patients (figure 2a). However, the subbasal nerve plexus remained normal (figure 2b). These results show that the corneal nerve was significantly damaged in eyes of retinoblastoma patients . In order to investigate the correlation between corneal nerve injury and the eeg spectra power, the results indicated that corneal nerve injury was positively correlated with the delta eeg spectra power (figure 3a, p<0.05) and the corneal nerve injury was negatively correlated with the theta eeg spectra power (figure 3b, p<0.05). This suggests that the eeg spectra power changes may reflect corneal nerve injury in retinoblastoma patients . We found that the sensitivity and specificity of the increased delta power and decreased theta power in the diagnosis of retinoblastoma patients were different . In increased delta power (delta> 3.8), sensitivity and specificity were 75% and 85%, and in decreased theta power (theta <4.3) sensitivity and specificity were 80% and 80%, respectively (table 1). If compounded in parallel, the sensitivity of detecting corneal nerve injury was 75% and the specificity was 88% . If compounded in series, the sensitivity and specificity were 85% and 67%, respectively (table 1), which is appropriate for the diagnosis of corneal nerve injury in retinoblastoma patients . A total of 20 patients (11 girls and 9 boys) were included, with a median age of 58 months (range, 43 to 127 months). According to the intraocular international retinoblastoma classification (iirc), there were 0 patients with extreme low risk (group a), 1 patient with low risk (group b), 1 patient with intermediate risk (group c), 16 patients with high risk (group d), and 2 patients with extreme high risk (group e). Figure 1 shows the changes of the dominant power bands within delta and theta bands . The eeg pattern of the retinoblastoma patients was characterized by a distinct increase in the delta (figure 1, p<0.01) and significant decrease in the theta power (figure 1, p<0.05). The results of cornea confocal observation showed that the corneal branch nerve fiber density was decreased significantly compared to the normal individuals . However, the density of the tumid and dendritic nerves was significantly increased compared to the normal individuals . The basal epithelium curving nerves were also significantly increased in the eyes of retinoblastoma patients (figure 2a). However, the subbasal nerve plexus remained normal (figure 2b). These results show that the corneal nerve was significantly damaged in eyes of retinoblastoma patients . In order to investigate the correlation between corneal nerve injury and the eeg spectra power, spearman rank correlation analysis was performed . The results indicated that corneal nerve injury was positively correlated with the delta eeg spectra power (figure 3a, p<0.05) and the corneal nerve injury was negatively correlated with the theta eeg spectra power (figure 3b, p<0.05). This suggests that the eeg spectra power changes may reflect corneal nerve injury in retinoblastoma patients . We found that the sensitivity and specificity of the increased delta power and decreased theta power in the diagnosis of retinoblastoma patients were different . In increased delta power (delta> 3.8), sensitivity and specificity were 75% and 85%, and in decreased theta power (theta <4.3) sensitivity and specificity were 80% and 80%, respectively (table 1). If compounded in parallel, the sensitivity of detecting corneal nerve injury was 75% and the specificity was 88% . If compounded in series, the sensitivity and specificity were 85% and 67%, respectively (table 1), which is appropriate for the diagnosis of corneal nerve injury in retinoblastoma patients . The eeg method of prognosis used in this study agrees with previous reports on use of the corneal nerve for disease diagnosis and prognosis [1315]. However, using eeg to diagnose corneal nerve injury in retinoblastoma patients has not been explored in previous studies . The 3 goals of retinoblastoma diagnosis, treatment, and improvement are saving the patient s life, eyes, and vision . In our previous study, we examined the eeg power bands and analyzed their relationship with corneal nerve injury . We observed not only increased power in the prevailing eeg power bands, but also a moderate shift of the dominant frequency peak toward faster theta and delta . This might be because retinoblastoma afflicts the corneal nerve, which is related with visual activity . Our results show that the delta power was increased and theta power was decreased in retinoblastoma patients compared to normal individuals . In clinical ophthalmology, the pathogenesis of many diseases, such as herpes simplex keratitis, glaucoma, and retinoblastoma, may affect the corneal nerves [5,1820]. The cornea is the most densely innervated part of the human body, containing myelinated a and unmyelinated c fibers derived from the ophthalmic division of the trigeminal nerve . Therefore, corneal confocal microscope analysis is always used in the diagnosis of corneal nerve damage . Our results indicate decreased corneal branch nerve fiber density, as well as the appearance of the dendritic particles and tumid neurons, which suggests that retinoblastoma might induce corneal nerve injury . Therefore, we analyzed the correlation between corneal nerve injury and the delta and theta power of eeg . The results indicated that the corneal nerve injury was positively correlated with the delta power and negatively correlated with the theta power of eeg . Actually, the changes in eeg theta and delta power was very slight and short - term . Our study indicated that the theta and delta power were mainly observed in the high - risk stage (group d) of retinoblastoma, according to the iirc classification and that the changes in eeg powers cannot be obtained in many patients or at other stages . Therefore, we speculate that the changes in delta and theta power are transient and are related to iirc stage for the retinoblastoma . In our study, the sensitivity of the increased delta power and decreased theta power in the diagnosis of corneal nerve injury were 75% and 80%, respectively and the specificity was 85% and 80%, respectively . If compounded in parallel, the specificity of corneal nerve injury was 88% and if compounded in series, the sensitivity was 85%, and it was obviously higher than in other groups . If this method can help determine whether the corneal nerve is already injured in retinoblastoma patients, it will provide useful a reference for follow - up, adjunctive therapy, and the prognosis of retinoblastoma patients . The changes in delta and theta of eeg appear to be associated with occurrence of corneal nerve injury . Useful information can be provided for evaluating corneal nerve damage of retinoblastoma patients through analyzing eeg power bands. |
Spontaneous perforation of rectum is a rare event; however evisceration of the small bowel through the perforated site without predisposing factors is extremely rare, complex and worth reporting . The operative findings revealed it to be a case of spontaneous perforation of rectum with evisceration of the small bowel through the perforation . Sudden increase in the intra - abdominal pressure leads to the perforation in the chronically deranged rectal wall and pushes the small bowel loops into the pelvis and through the perforated rectum to appear transanally . Evisceration of small bowel through a spontaneous perforation in rectum is an extremely rare event . Although 55 cases of evisceration of small bowel through anus due to perforation of rectum have been documented in world literature since the first report in 1827 by benjamin brodie, the number of cases without any significant predisposing factor is very less . The article reports a case of spontaneous perforation of rectum with evisceration of small bowel in a normal bowel without an apparent cause which is an extremely rare presentation . A 14 years old male was admitted with the chief complaint of acute lower abdominal pain which started suddenly after he passed stools . The abdomen was tender on deep palpation in the left iliac fossa and bowel sounds were sluggish . However, on per rectal examination gut loops were felt in the anal canal and finger was stained with blood thereby making intussusception the most probable diagnosis . A lump was felt in the left iliac fossa once the patient was anaesthetized for surgery . Peroperative findings revealed a distended and a tubular sigmoid colon (intussusception like appearance) and twisting of ileal loops around the sigmoid colon simulating ileo - sigmoid knotting . On further mobilization and gentle traction on the ileal loops gangrenous segment of ileum became evident till it finally emerged out from a longitudinal perforation (approximately15 mm) in the anterior wall of rectum just above the peritoneal reflection (fig . Rectal tear was closed primarily in single layer after taking the biopsy from the whole edge which revealed non specific inflammation . On repeated questioning in postoperative period patient denied any history suggestive of constipation, rectal prolapse, trauma, weight lifting, rectal instrumentation or homosexual activity; however intermittent straining at stools was present . Figure showing rectal perforation and the gangrenous segment of ileum which had eviscerated through the perforated rectum . Urinary bladder (small square), the peritoneal reflection (thin arrow) and the rectal perforation (thick arrow) are clearly visible . Spontaneous rectal perforation usually occurs due to excessive straining on the anterior rectal wall with a pre - existing pathology like, diverticulosis, colitis, ulceration, malignancy, adhesions, irradiation, rectal and uterine prolapse and as a consequence of iatrogenic injuries and blunt trauma abdomen . . Chronic strain because of the underlying pathology causes progressive deepening of rectovesical and rectouterine pouches and the rectal wall becomes thin and weak as it is unsupported . Contraction of the abdominal muscles increases the intra - abdominal pressure and spontaneous perforation occurs through this thinned out area, mostly at the ant mesenteric border where the blood supply is poorest . Similarly, in a constipated patient the changed defecation pattern in some individuals per se causes a preliminary lesion in the intestinal wall which becomes friable due to chronic inflammation of its layers and may perforate . Nevertheless intestinal evisceration through the perforated gut without any contamination of the peritoneal cavity is enigmatic and little difficult to explain . In a recent study presumed that two factors predisposed patients to this unusual complication: one was the sudden increase in intra - abdominal pressure and the other was the presence of rectal prolapse . Whatever the mechanics involved the sudden increase in the intra - abdominal pressure seems to be the main contributing factor . It pushes the ileal loops into the rectovesical / rectouterine pouch which violently presses upon the anterior rectal wall . As the week rectal wall gives way the ileal loops sneak in . This seems to be the only plausible explanation for the spontaneous act particularly when there are no signs of peritonitis as in our case . In a perforated simple ulcer of rectum there is an area of induration around edges while a spontaneous perforation appears slit like, runs longitudinally (rarely transversally) with minimal signs of inflammation . It can occur in all age groups, the youngest one reported was six years old and oldest being ninety six years old . The treatment follows basic surgical principles . If reduced bowel is not viable it should be resected and followed by anastomosis or ileostomy depending upon the condition of the patient and contamination involved . In the follow up period patients should be investigated to detect exact etiology and cause specific management will prevent recurrence and complications . Therefore, one must remember that per rectal palpation of bowel loops may be more than just rectal prolapse or intussusception. |
Animals: this study was conducted in compliance with the guidelines for the care and use of laboratory animals, and the protocol was approved by the animal experimentation committee of nippon veterinary and life science university (approval number 1083). Twelve mixed - breed male and female cats (age, 2.2 0.3 years; range, 1.72.5 years; and weight, 3.3 0.9 kg) were used . Before experimentation, all cats underwent general clinical examination, blood and serum biochemical analyses, electrocardiography, radiography and echocardiography . Cats were housed in individual cages and fed a commercial maintenance diet (royal canin male care and female care, tokyo, japan). Study design: the study design was based on a similar study conducted in dogs . One group received the angiotensin - converting - enzyme inhibitor (acei), benazepril (fortekor, elanco animal health, kobe, japan) and was labeled the acei group; and the other group received pimo (vetmedin, boehringer ingelheim vetmedica, inc ., each group was composed of an equal number of animals of both sexes (3 males and 3 females). Cats in the acei group received benazepril at a dosage of 0.25 mg / kg q24 hr at 08:00 am for 506 days . Cats in the pimo group received pimo at a dosage of 0.25 mg / kg q12 hr at 8:00 am and 8:00 pm for 506 days . All cats underwent cardiac auscultation, heart rate measurement, echocardiography, doppler examination and blood pressure measurement . We also performed hematocrit measurement and serum biochemical analyses that included total protein, albumin, blood urea nitrogen, creatinine, sodium and potassium levels . All analyses were performed before drug administration (day 0) and at days 16, 50, 118, 202, 320, 409 and 506 after starting drug administration . Plasma iohexol clearance (pcio) was performed to measure the glomerular filtration rate (gfr) on days 0, 125, 323 and 506 . All examinations were performed to assess whether cardiac pathological findings occurred in connection with hemodynamic and cardiac structural changes . Animals were not fed for 8 hr prior to examinations, but were allowed free access to drinking water . To allow the same investigator the time to examine all 12 cats, the examinations were performed between 2:00 pm and 6:00 pm on each assessment day . Echocardiography and doppler examination: cats underwent continuous echocardiography monitoring with an ultrasound unit (vivid 7, ge healthcare japan, tokyo, japan) equipped with a 3.56.9 mhz transducer, without sedation or anesthesia . The same trained investigator (takemura) performed all examinations to exclude possible inter - observer variability, and all measurements were obtained from three consecutive cardiac cycles within the same time frame . The ratio of the left atrial diameter to the aortic diameter was obtained from the right parasternal short - axis view using the b - mode method . The thickness of the anterior and posterior mitral valve leaflet was measured using the left apical four - chamber view, whereas end - diastolic interventricular septum thickness, end - diastolic left - ventricular internal dimension, end - diastolic left - ventricular free - wall thickness and fractional shortening (fs) were measured from the right parasternal short - axis view using the m - mode method (the leading edge to leading edge method). Fs was calculated according to the following equation: fs (%) = [(diastolic left - ventricular internal diameter - systolic left - ventricular internal diameter)/diastolic left - ventricular internal diameter] 100 . Any development of mitral valve or tricuspid valve regurgitation was monitored by doppler examination . All cats were well - hydrated and had fasted for 12 hr before measurements . Iohexol (omnipaque 300, daiichi sankyo co., ltd ., tokyo, japan) was administered at a dosage of 90 mg iodine / kg via the cephalic vein (time 0), and heparinized blood was sampled at 120, 180 and 240 min after administration . The area under the curve (auc) was estimated from the slope (a) and intercept (a) of the elimination phase of the curve, as determined by linear regression analysis of the final three plasma samples . Clearance (cl) values were calculated using the following formula: cl (ml / min)=dose of iohexol / auc, where auc = a / a . The pcio values were then calculated as follows: pcio (ml / min)=(0.990778cl)(0.001218cl), with the pcio values standardized for body weight . Measurement of blood pressure: blood pressure was measured non - invasively by the oscillometric method using a hemomanometer (bp100d, fukuda m - e kogyo co., ltd ., tokyo, japan) according to the 2007 american college of veterinary internal medicine guidelines . Necropsy examination and histopathology: all cats were euthanized by intravenous administration of sodium pentobarbital and potassium chloride on day 507 . Histopathological examinations were performed by a veterinary pathologist (machida) who was blinded to the treatment groups . A complete post - mortem examination was performed on each cat immediately after euthanasia . Tissue samples collected at necropsy were fixed in 10% neutral buffered formalin and processed using routine methods for paraffin embedding . We then stained 5-m thick sections with hematoxylin and eosin for light microscopy . Selected sections of cardiac tissue, including the septal and parietal valve leaflets of the mitral valve and myocardia, were stained with masson s trichrome, periodic acid - schiff, alcian blue (ph 2.5) and toluidine blue . Parameters were not normally distributed by kolmogorov - smirnov analysis and were expressed as medians (25th and 75th percentiles). Comparison between the baseline parameters of both groups was performed using the mann - whitney u test . Changes in parameters measured after drug administration were evaluated by repeated measures analysis of the variance with a split plot design . This test was conducted with the observation day as the intra - subject factor and the drugs (pimo and benazepril) and animals as the inter - subject factors . If p<0.05 was found for the observation day and drug interactions in the analysis of variance, a post - hoc multiple comparison was conducted using the mann as shown in table 1table 1.summary of characteristics at day 0 in both groupsacei grouppimo groupp valuebody weight (kg)3.6 (2.6, 4.2)3.1 (2.6, 3.9)0.937age (year)1.8 (1.8, 1.8)1.8 (1.8, 2.3)0.937heart rate (bpm)154 (136, 210)166 (162, 180)0.588sbp (mmhg)113 (110, 134)139 (129, 154)0.180dbp (mmhg)67 (57, 85)82 (75, 84)0.380alb (g / dl)2.1 (2.0, 2.1)2.1 (2.1, 2.2)0.310alt (u / l)57.0 (51.8, 69.8)82.0 (72.5, 89.3)0.093bun (mg / dl)20.6 (19.4, 22.8)24.8 (22.5, 25.4)0.093cre (mg / dl)0.9 (0.8, 1.0)0.9 (0.9, 1.0)0.818na (meq / l)156.0 (156.0, 157.5)157.5 (157.0, 158.8)0.132k (meq / l)3.8 (3.6, 4.0)3.7 (3.5, 3.8)0.818cl (meq / l)122.5 (121.3, 123.8)123.0 (122.3, 124.5)0.589pcio (ml / min / kg)2.9 (2.7, 3.2)2.8 (2.2, 3.9)0.937laao1.4 (1.3, 1.4)1.3 (1.2, 1.3)0.485ivsd (mm)0.4 (0.3, 0.4)0.3 (0.3, 0.4)0.132lvidd (mm)1.6 (1.5, 1.6)1.6 (1.2, 1.7)0.818lvpwd (mm)0.4 (0.4, 0.4)0.3 (0.3, 0.4)0.310fs(%)33.9 (33.2, 38.3)37.6 (35.0, 41.0)0.394aml (mm)0.1 (0.1, 0.1)0.1 (0.1, 0.1)0.394pml (mm)0.1 (0.1, 0.1)0.1 (0.1, 0.1)0.699values are presented as medians (25th and 75th percentile). Abbreviations: pcio, plasma iohexol clearance; laao, left atrium to aortic root ratio; ivsd, end - diastolic interventricular septum thickness; lvidd, end - diastolic left - ventricular internal dimension; lvpwd, end - diastolic left - ventricular posterior wall thickness; fs, fractional shortening; aml, anterior mitral valve leaflet; pml, posterior mitral valve leaflet ., there were no significant differences in baseline parameters between the groups (p>0.05). Body weight, heart rate, and systolic and diastolic blood pressures did not show significant changes during the 506-day study period, and there were no significant differences between the groups (p0.162; table 2table 2.cardiovascular measurements by day of treatment with pimobendan or benazeprilday01650118202320409506body weight (kg)acei group3.7 (2.7, 4.2)3.7 (2.7, 4.2)3.8 (2.6, 4.2)3.8 (2.6, 4.2)4.2 (3.1, 4.6)4.3 (3.2, 4.6)4.2 (3.3, 4.3)4.4 (3.5, 4.5)pimo group3.2 (2.6, 4.0)3.2 (2.6, 4.0)3.2 (2.5, 4.1)3.2 (2.5, 4.2)3.7 (2.8, 4.7)3.7 (3.0, 4.6)3.8 (2.9, 4.6)3.9 (2.9, 4.6)heart rate (bpm)acei group155 (136, 211)150 (139, 174)161 (146, 201)165 (139, 179)np171 (153, 177)169 (151, 191)185 (157, 196)pimo group166 (163, 181)172 (138, 188)163 (157, 175)170 (159, 177)np172 (170, 180)177 (160, 195)188 (163, 200)sbp (mmhg)acei group113 (111, 134)110 (106, 122)126 (123, 137)131 (129, 131)np130 (125, 138)138 (127, 143)139 (135, 145)pimo group139 (130, 154)133 (124, 147)130 (126, 142)141 (128, 147)np122 (115, 147)136 (128, 143)141 (127, 147)dbp (mmhg)acei group67 (58, 85)59 (55, 72)66 (63, 77)68 (65, 76)np76 (62, 80)72 (67, 79)90 (86, 93)pimo group82 (75, 84)68 (63, 79)68 (66, 83)79 (76, 84)np87 (77, 90)80 (77, 83)80 (69, 95)values are presented as medians (25th and 75th percentile) for body weight, heart rate, and systolic and diastolic blood pressure (sbp and dbp, respectively) in both groups before (day 0) and at days 16, 50, 118, 202, 320, 409 and 506 after drug administration . No significant differences were observed for all parameters between two groups (p0.059).). In addition, no significant differences were observed for any parameters between the groups during the study (p0.093; table 3table 3.hematocrit and biochemistry measurements by day of treatment with pimobendan or benazeprilday01650118202320409506hematocrit (%) acei group36 (35, 38)34 (32, 38)34 (33, 38)40 (36, 42)37 (35, 44)38 (38, 40)35 (32, 39)39 (36, 42)pimo group38 (36, 41)35 (34, 38)36 (33, 40)40 (38, 41)37 (34, 38)37 (32, 41)33 (33, 39)37 (35, 40)total protein (g / dl)acei group7.0 (6.5, 7.2)7.3 (6.8, 7.6)7.0 (6.7, 7.3)6.7 (6.5, 6.9)7.4 (7, 7.4)7.4 (7.1, 7.6)7.0 (6.7, 7.1)7.3 (7.1, 7.5)pimo group6.8 (6.7, 6.8)7.1 (6.8, 7.2)7.3 (7.0, 7.3)6.5 (6.4, 6.7)7.2 (7.0, 7.4)7.1 (7.0, 7.2)6.7 (6.5, 6.8)7.1 (6.6, 7.2)albumin (g / dl)acei group2.1 (2.1, 2.1)2.2 (2.1, 2.2)2.2 (2.1, 2.2)2.0 (1.9, 2.2)2.2 (2.1, 2.2)2.1 (2.0, 2.1)2.1 (2.1, 2.2)2.3 (2.2, 2.4)pimo group2.1 (2.1, 2.2)2.2 (2.2, 2.3)2.2 (2.1, 2.2)2.1 (2.1, 2.2)2.2 (2.2, 2.3)2.2 (2.1, 2.3)2.2 (2.1, 2.2)2.3 (2.3, 2.4)bun (mg / dl)acei group20.6 (19.4, 22.8)26.7 (26.0, 27.0)26.8 (25.4, 29.3)24.4 (23.4, 25.3)32.1 (28.7, 32.3)23.8 (20.8, 24.3)23.3 (21.4, 26.5)21.8 (21.3, 25.9)pimo group24.8 (22.5, 25.4)28.3 (26.2, 30.7)26.9 (26.6, 28.5)25.5 (23.3, 28.6)33.7 (30.9, 36.9)26.7 (24.6, 27.9)27.7 (24.3, 30.4)23.9 (23.3, 24.4)creatinine (mg / dl)acei group0.9 (0.8, 1.0)0.9 (0.8, 1.0)1.0 (0.8, 1.1)0.8 (0.7, 0.8)0.9 (0.7, 0.9)1.1 (0.9, 1.1)1.0 (0.8, 1.0)0.9 (0.8, 0.9)pimo group0.9 (0.9, 1.0)0.9 (0.8, 0.9)0.9 (0.8, 0.9)0.8 (0.8, 0.9)0.8 (0.7, 0.9)0.9 (0.9, 1.0)0.8 (0.7, 1.0)0.8 (0.8, 0.9)sodium (meq / l)acei group156 (156, 158)155 (153, 155)156 (154, 157)153 (152, 154)154 (153, 155)154 (153, 154)152 (151, 153)148 (147, 150)pimo group158 (157, 159)155 (155, 155)156 (155, 157)153 (153, 154)156 (154, 156)156 (153, 158)154 (153, 154)149 (148, 151)potassium (meq / l)acei group3.8 (3.6, 4.0)3.9 (3.7, 3.9)3.9 (3.7, 3.9)4.5 (4.2, 5.1)4.0 (4.0, 4.0)4.1 (4.0, 4.3)3.8 (3.5, 3.9)4.3 (4.2, 4.6)pimo group3.7 (3.5, 3.8)3.9 (3.7, 4.3)4.3 (4.1, 4.6)4.3 (4.1, 4.5)3.8 (3.7, 3.8)3.9 (3.6, 4.1)3.7 (3.6, 3.8)4.1 (4.0, 4.3)values are presented as medians (25th and 75th percentile) for hematocrit and biochemistry measurements in both groups before (day 0) and at days 16, 50, 118, 202, 320, 409 and 506 after drug administration . No significant differences were observed for all parameters between the two groups (p0.093). Abbreviations: acei, angiotensin - converting enzyme inhibitor; pimo, pimobendan . ). Specifically, we did not detect any cardiac murmurs, and the hematocrit and serum biochemical parameters remained unchanged and comparable between groups . However, although pcio remained stable for both groups (p0.200), it was significantly lower at day 506 than at baseline in the acei group (p<0.05; table 4table 4.plasma iohexol clearance by day of treatment with pimobendan or benazeprilpcio (ml / min / kg)day0125323506acei group2.9 (2.7, 3.2)2.4 (2.2, 2.9)2.3 (2.1, 2.9)2.1 (2.0, 2.2)pimo group2.8 (2.2, 3.9)2.8 (2.4, 3.1)2.5 (2.1, 2.8)2.3 (2.1, 2.6)values are presented as medians (25th and 75th percentile) for plasma iohexol clearance (pcio) values in the two groups before drug administration (day 0), and at days 125,323 and 506 after drug administration . No significant differences were observed for pcio value between the two groups (p0.200). Abbreviations: acei, angiotensin - converting enzyme inhibitor; pimo, pimobendan . ). There were no significant changes in echocardiographic measurements during the treatment period (table 5table 5.echocardiography measurements and the radiographic vertebral heart score by day of treatment with pimobendan or benazeprilday01650118202320409506laao (cm)acei group1.37 (1.34, 1.39)1.35 (1.28, 1.43)1.37 (1.24, 1.45)1.43 (1.27, 1.5)1.47 (1.28, 1.6)1.24 (1.19, 1.44)1.16 (1.1, 1.23)1.15 (1.12, 1.17)pimo group1.26 (1.23, 1.33)1.42 (1.36, 1.5)1.31 (1.22, 1.5)1.3 (1.21, 1.32)1.34 (1.11, 1.4)1.37 (1.33, 1.42)1.37 (1.24, 1.39)1.15 (1.09, 1.19)ivsd (cm)acei group0.37 (0.34, 0.44)0.36 (0.34, 0.38)0.44 (0.39, 0.49)0.36 (0.34, 0.45)0.4 (0.39, 0.43)0.39 (0.38, 0.39)0.43 (0.43, 0.44)0.41 (0.38, 0.44)pimo group0.31 (0.3, 0.35)0.35 (0.34, 0.37)0.42 (0.38, 0.43)0.34 (0.3, 0.37)0.38 (0.33, 0.43)0.35 (0.34, 0.38)0.44 (0.42, 0.46)0.43 (0.36, 0.46)lvidd (cm)acei group1.57 (1.52, 1.58)1.7 (1.49, 1.84)1.56 (1.43, 1.76)1.74 (1.47, 1.75)1.67 (1.54, 1.79)1.55 (1.48, 1.66)1.62 (1.48, 1.7)1.67 (1.59, 1.74)pimo group1.56 (1.25, 1.67)1.62 (1.48, 1.68)1.5 (1.37, 1.68)1.61 (1.35, 1.66)1.58 (1.5, 1.75)1.52 (1.33, 1.72)1.52 (1.44, 1.58)1.46 (1.32, 1.58)lvpwd (cm)acei group0.38 (0.36, 0.41)0.34 (0.33, 0.37)0.4 (0.35, 0.42)0.38 (0.33, 0.41)0.4 (0.36, 0.41)0.41 (0.38, 0.42)0.42 (0.37, 0.47)0.43 (0.42, 0.44)pimo group0.35 (0.32, 0.37)0.35 (0.32, 0.44)0.4 (0.35, 0.46)0.34 (0.33, 0.37)0.38 (0.37, 0.41)0.4 (0.36, 0.42)0.43 (0.39, 0.47)0.4 (0.4, 0.47)fs (%) acei group33.9 (33.2, 38.3)36 (35.4, 36.9)40.8 (37.9, 43.8)34.4 (31.3, 39)43.4 (39.7, 46.4)41.4 (36.3, 46.6)44.5 (39.4, 47.9)43.9 (42.7, 45.2)pimo group37.6 (35, 41)32.5 (30.4, 38.5)43.7 (36.1, 52.4)37.8 (29.3, 39.2)33.9 (28.9, 41.9)40.4 (32, 47.5)42.7 (38.9, 47.4)42.7 (35.8, 48.3)aml (cm)acei group0.1 (0.09, 0.12)0.09 (0.08, 0.09)0.16 (0.14, 0.19)0.14 (0.11, 0.15)0.13 (0.1, 0.15)0.12 (0.1, 0.13)0.11 (0.1, 0.11)0.14 (0.09, 0.16)pimo group0.09 (0.08, 0.1)0.1 (0.09, 0.1)0.13 (0.1, 0.15)0.14 (0.12, 0.15)0.14 (0.12, 0.16)0.13 (0.1, 0.16)0.11 (0.08, 0.12)0.1 (0.09, 0.13)pml (cm)acei group0.13 (0.1, 0.14)0.1 (0.09, 0.1)0.13 (0.11, 0.14)0.14 (0.12, 0.14)0.1 (0.08, 0.11)0.1 (0.09, 0.11)0.12 (0.11, 0.13)0.12 (0.09, 0.14)pimo group0.12 (0.11, 0.12)0.1 (0.09, 0.11)0.12 (0.1, 0.13)0.14 (0.12, 0.14)0.16 (0.12, 0.19)0.11 (0.11, 0.13)0.11 (0.1, 0.14)0.11 (0.09, 0.16)values are presented as medians (25th and 75th percentile) for echocardiography measurements and the radiographic vertebral heart score in both groups before (day 0) and at days 16, 50, 118, 202, 320, 409 and 506 after drug administration . Abbreviations: acei, angiotensin - converting enzyme inhibitor; pimo, pimobendan; laao, left atrium to aorta ratio; ivsd, end - diastolic interventricular septum thickness; lvfwd, end - diastolic left - ventricular free - wall thickness; lvidd, end - diastolic left - ventricular internal dimension; fs, fractional shortening; aml, anterior mitral valve leaflet; pml, posterior mitral valve leaflet; vhs, vertebral heart score . ), and no significant differences were observed between the two treatment groups (p0.148). Abbreviations: pcio, plasma iohexol clearance; laao, left atrium to aortic root ratio; ivsd, end - diastolic interventricular septum thickness; lvidd, end - diastolic left - ventricular internal dimension; lvpwd, end - diastolic left - ventricular posterior wall thickness; fs, fractional shortening; aml, anterior mitral valve leaflet; pml, posterior mitral valve leaflet . Values are presented as medians (25th and 75th percentile) for body weight, heart rate, and systolic and diastolic blood pressure (sbp and dbp, respectively) in both groups before (day 0) and at days 16, 50, 118, 202, 320, 409 and 506 after drug administration . No significant differences were observed for all parameters between two groups (p0.059). Values are presented as medians (25th and 75th percentile) for hematocrit and biochemistry measurements in both groups before (day 0) and at days 16, 50, 118, 202, 320, 409 and 506 after drug administration . No significant differences were observed for all parameters between the two groups (p0.093). Values are presented as medians (25th and 75th percentile) for plasma iohexol clearance (pcio) values in the two groups before drug administration (day 0), and at days 125,323 and 506 after drug administration . No significant differences were observed for pcio value between the two groups (p0.200). Values are presented as medians (25th and 75th percentile) for echocardiography measurements and the radiographic vertebral heart score in both groups before (day 0) and at days 16, 50, 118, 202, 320, 409 and 506 after drug administration . Abbreviations: acei, angiotensin - converting enzyme inhibitor; pimo, pimobendan; laao, left atrium to aorta ratio; ivsd, end - diastolic interventricular septum thickness; lvfwd, end - diastolic left - ventricular free - wall thickness; lvidd, end - diastolic left - ventricular internal dimension; fs, fractional shortening; aml, anterior mitral valve leaflet; pml, posterior mitral valve leaflet; vhs, vertebral heart score . The septal and parietal valve leaflets of the mitral valve were slightly thickened in three cats in the acei group and two cats in the pimo group (fig 1fig . 1.macroscopic and histological findings of the mitral valves from cats administered either pimobendan (a & b) or benazepril (c & d).). The thickened valves were opaque and white, but the surface was smooth and glistening with no evidence of thrombus formation . Macroscopic and histological findings of the mitral valves from cats administered either pimobendan (a & b) or benazepril (c & d). All cats had mild - to - moderate histopathological changes in both mitral valve leaflets, with the distal halves being more affected than the proximal halves . The main pathological condition was deposition of acid mucopolysaccharides, primarily within the spongiosa layer of the valve leaflet (fig 1). Valvular fibrosis was also present, although it was not the predominant histological feature, and inflammatory infiltrates were absent . Therefore, the spongiosa layer was expanded, with focal disruption of the fibrosa by mucopolysaccharide - rich spongiosa, although there were no apparent qualitative or quantitative differences between the groups with respect to the development of these valvular lesions . No other valvular, vascular or myocardial lesions were detected in either of the groups, and no histopathological changes were detected in other visceral organs . This study demonstrates that long - term administration of pimo did not produce significant pathological cardiac lesions / adverse effects in healthy cats, which suggests that pimo might not have the same adverse effects in cats as those reported in dogs . However, although no other valvular, vascular or myocardial lesions were detected, all cats did develop mild - to - moderate myxomatous mitral valve degeneration . The lesions of the mitral valve leaflets included deposition of acid mucopolysaccharides, primarily within the spongiosa layer of the valve leaflet, and valvular fibrosis . All cats in both groups had these changes, and the magnitude of change was equivalent between the two groups . Indeed, neither pimo nor benazepril showed any tendency toward a change in echocardiography measurements or gfr during the study, making it unlikely that these caused the myxomatous mitral valve degeneration . In an early study of the incidence of cardiovascular disease in cats, of the 202 cats examined at necropsy, 12 (5.9%) had mitral valve lesions (including endocarditis, fibrosis and stenosis) and 17 (8.4%) had myocardial lesions (including hypertrophy, hemorrhage, infarct and fibrosis). In our cats, the prevalence of mitral valve degeneration was much higher, but no cat had clinical evidence of mitral regurgitation during the study period . These pathological mitral valve changes were only slight compared with the degree of myxomatous mitral valve degeneration previously observed in dogs . Because no studies have been reported on the development of mitral valve changes with age in healthy cats, it is unclear whether the myxomatous mitral valve degeneration seen in our cats occurred spontaneously, as a natural consequence of aging . Myocardial lesions were not detected in cats treated with either benazepril or pimo . In a previous case report of two dogs treated with pimo however, these dogs were treated with pimo without any prior echocardiographic examination . Excluding this case report, no adverse effect has been demonstrated conclusively on the myocardia following treatment with pimo in cats, dogs or humans . The adverse effect of pimo on mitral valves in dogs may be caused by increased cardiac contraction, although a direct effect on the valves cannot be excluded . This effect has not been reported in humans, suggesting that there may be species specificity in the pharmacological action of pimo . It has been reported that, even with the same dose of pimo administered to cats and dogs, the plasma elimination half - life (1.3 0.2 hr and 0.5 hr, respectively) and cmax (34.5 6.59 ng / ml and 3.09 0.76 ng / ml, respectively) differed considerably . In addition, the elimination half - life and effect on cardiac contractility of pimo are simply not associated in dogs . Thus, the tissue concentration and hemodynamic effects of pimo might be different in cats . In cats with hypertrophic cardiomyopathy, it has been shown that the addition of pimo to the standard treatment for congestive heart failure can prolong survival times . These cats received a median dose of 0.49 mg / kg / day (25th to 75th percentile, 0.400.67 mg / kg / day) of pimo . The dosage used in our study, which was 0.25 mg / kg twice daily, could therefore be considered sufficient for clinical efficacy in improving cardiac function in cats . However, there was no difference in cardiac changes between the cats administered pimo (0.25 mg / kg twice daily) and benazepril . It is unlikely that pimo at 0.25 mg / kg twice daily has a direct cardiac effect in healthy cats . The present study has shown only that pimo with clinically effective dose for cats may not have cardiac adverse effect on cats . Extra - cardiac adverse effects of pimo in cats include salivation, vomiting, agitation, anorexia and constipation [7, 9, 13]. However, no such adverse effects were evident in any cat in this study . In this study, there were no significant changes in heart rate, blood pressure or gfr after administration of pimo, suggesting that pimo does not influence the hemodynamics of healthy cats . In dogs with experimental mitral insufficiency, kanno et al . Reported that pimo significantly increased renal blood flow, but not gfr . Furthermore, research has shown that pimo did not alter renal function in healthy dogs and that gfr in dogs receiving pimo was not significantly different from gfr in dogs receiving benazepril . First, because the optimal dose of pimo is unknown for cats, we used the same dose of pimo as that used to treat dogs . In all prior studies into the use of pimo in cats, the dosage used was 0.25 mg / kg q12 hr [7, 9, 13]. Given that the plasma elimination half - life and cmax differ considerably between cats and dogs, the required dose and frequency of administration of pimo in cats may differ from those in dogs . Despite all previous studies on pimo for cats selected the dosage based on that previously used dosages for dogs [7, 9, 13, 16], no clinical adverse effects were reported . In addition, one study showed that using the same dose of pimo in cats as in dogs prolonged the survival time in cats with hypertrophic cardiomyopathy . These results suggest that the use of pimo in cats at the same dosage as that used in dogs does not produce a clinical disadvantage . Other methods such as the ejection fraction may be required to observe the true effect of pimo on cardiac contraction . In addition, pimo has been shown to accelerate left - ventricular isovolumetric relaxation and to improve distensibility in conscious dogs with tachycardia - induced heart failure . In our study, evaluation of cardiac relaxation, including the e / a ratio and isovolumetric relaxation time, was not performed . Thus, the cardiac effects of pimo on echocardiography might not have been accurately assessed . A third limitation is that only healthy cats were used, which contrasts with a prior study in dogs . However, no study has evaluated the adverse effects of pimo on the mitral valves of healthy dogs . Mitral regurgitation in cats is often caused by systolic anterior motion associated with cardiomyopathy . A further study is justified to evaluate the possible effects of pimo on mitral regurgitation in cats with cardiomyopathy . In conclusion, neither pimo nor benazepril administration was associated with cardiac lesions in healthy cats, suggesting that both agents can be used in cats without the risk of cardiotoxicity . However, future studies are needed to examine the adverse cardiac effects of pimo in cats with pre - existing heart disease . In addition, there is a need to examine age - related alterations in the hearts of healthy cats. |
Functional dyspepsia (fd) is a heterogeneous disorder characterized by the presence of recurrent or persistent symptoms thought to originate in the gastroduodenal region without any organic, systemic or metabolic disease that is likely to explain the symptoms.1 the pathophysiology of fd is considered to be multifactorial and not completely understood . Several mechanisms have been proposed to be of importance, such as delayed gastric emptying, impaired proximal gastric accommodation to a meal, gastric hypersensitivity to distension, abnormal duodenojejunal motility, and psychological disturbance.2 - 6 the stomach is traditionally believed to be mainly responsible for the genesis of dyspeptic symptoms . More recent studies have shown a number of sensorimotor and structural duodenal abnormalities in fd . Abnormal motor and sensory responses to duodenal acid or lipids have been demonstrated in patients with fd.7 - 11 duodenal eosinophilia has been reported in fd patients.12 focal t - cell aggregates, decreased cd4 + cells and increased macrophage counts have been observed in the duodenum of patients with presumed post - infectious fd (pi - fd), which indicates impaired ability of the immune system to terminate the inflammatory response after acute insult.13 these studies suggest the possibility that the duodenum is involved in the pathophysiology of fd . Thus, in the present review, we aimed to address duodenal implications in the pathophysiology of fd . The majority of fd patients have normal acid secretion,14 and gastric sensitivity to acid does not seem to be abnormal in those patients.15 however, acid suppressive therapy provides symptomatic relief in a subset of fd patients.16 generally, acid suppressive therapy using proton - pump inhibitors seems beneficial to the patients whose predominant symptoms are epigastric pain, burning sensation or gastroesophageal reflux symptoms . Samsom et al.7 reported that duodenal acid infusion induced nausea in a subset of fd patients, but not in healthy controls, suggesting the presence of duodenal hypersensitivity to acid in fd patients . However, other studies found that dyspeptic symptoms such as nausea could be induced by duodenal acidification in healthy volunteers . Duodenal acid perfusion (0.2 n, 5 ml / min) for 15 minutes significantly increases symptom scores of discomfort, bloating, nausea, and epigastric burning in healthy subjects, compared with saline infusion.17 similarly, it has been demonstrated that dyspeptic symptoms including fullness, bloating, nausea, satiety, epigastric burning and epigastric pain are induced by duodenal acid infusion in healthy volunteers.18 in fd patients with prominent nausea, no significant differences in dyspeptic symptom scores were observed before and after duodenal acid infusion, and between duodenal saline and acid infusion.8 therefore, studies on the presence of duodenal hypersensitivity to acid in fd patients and its role in the pathophysiology of fd remain controversial . Since the number of study subjects in previous studies is small, a 24-hour ambulatory duodenal ph monitoring has shown increased spontaneous duodenal acid exposure in fd patients.8,19 duodenal acid exposure is reported to be significantly increased in fd patients during the daytime and after a meal . Fd patients with increased spontaneous duodenal acid exposure have more severe dyspeptic symptoms than fd patients with normal duodenal acid exposure.8 the possible mechanisms underlying increased duodenal acid exposure present in a subset of fd patients include impaired duodenal acid neutralization and reduced duodenal acid clearance . Whereas, reduced duodenal acid clearance due to a decreased duodenal motor response to acid has been demonstrated in fd patients.7,8 thus, reduced duodenal acid clearance seems to play a role in increasing duodenal acid exposure in fd patients . The mechanism through which increased duodenal acid exposure contributes to the generation of dyspeptic symptoms remains to be elucidated . H stimulates acid sensors such as transient receptor potential vanilloid 1 on the afferent nerves in the duodenum, followed by the release of calcitonin gene - related peptide and nitric oxide.20 therefore, acid can directly stimulate chemosensitive afferent pathways from the duodenum . Given that chemical stimulation is able to induce sensitization at the peripheral or the spinal level,21 stimulation of duodenal afferents by acid indeed, a barostat study during duodenal infusion of saline or acid in healthy subjects revealed that duodenal acid infusion increased gastric mechanosensitivity.22 intraduodenal acid infusion induces an enterogastric feedback, which suppresses propagated antral waves, stimulates isolated pyloric pressure waves and delays gastric emptying.23 - 25 the greater the concentration of acid in the duodenum, the greater is the inhibition of gastric emptying.26 accordingly, it is conceivable that increased duodenal acid exposure results in excessive enterogastric feedback and delays gastric emptying . On the other hand, duodenal ph influences the regularity of the migrating motor complex and alkaline ph is needed for the initiation of a phase iii.27 thus, prolonged duodenal acidification might inhibit the occurrence of a phase iii . A recent study in healthy volunteers showed that duodenal acid perfusion did not affect the occurrence and duration of a phase iii but induced antral hypomotility.17 these findings suggest that duodenal acidification induces or aggravates dyspeptic symptoms through its effects on gastric motor function . Therefore, the prolonged duodenal exposure to acid seems to be responsible for the generation of dyspeptic symptoms through the induction of gastric motor and sensory dysfunction . Postprandial gastric hypersensitivity to distension plays a crucial role in the generation of dyspeptic symptoms in fd.28 in contrast to healthy controls, dyspeptic patients have increased sensitivity to both gastric distension and intraduodenal lipid.29 most fd patients experienced nausea and bloating during lipid infusion, but remained asymptomatic during saline infusion . Controls reported no symptoms during lipid infusion.29 duodenal lipid infusion can differentiate fd from healthy controls . After lipid infusion, 95% of fd patients are outside the normal range of controls for first sensation, bloating and/or discomfort thresholds to gastric distension, compared with 65% in the fasting state.11 different chemical composition of nutrients in the duodenum results in different sensory responses to gastric distension, which cannot be explained by changes in gastric tone.30 intraduodenal lipid, but not glucose, enhances gastric mechanosensitivity in patients with fd but not in healthy subjects.31 moreover, in fd patients, nausea is more common during lipid than glucose infusion and does not occur during saline . These findings suggest the presence of duodenal hypersensitivity to lipid in fd patients.31 thus, duodenal lipid can be involved in the generation of dyspeptic symptoms through duodenal hypersensitivity to lipid and its enhancing effects on gastric sensitivity . Long chain and medium chain triglycerides have different effects on perception, gastric tone, and gut hormonal release . Intraduodenal infusion of long chain triglycerides induces satiation, fullness and nausea, reduces gastric tone, and increases plasma levels of cholecystokinin (cck), gastric inhibitory polypeptide, neurotension, and pancreatic polypeptide . In contrast, intraduodenal infusion of medium chain triglycerides reduces gastric tone, but does not affect perception or plasma gut hormone levels.32 therefore, long chain triglycerides seem to be more potent in inducing symptoms than medium chain triglycerides . Since gastric relaxation per se may occur without significant changes in plasma gut hormone levels and perception, symptoms associated with long chain triglycerides are likely to be attributed to gut hormonal changes including cck . Indeed, dyspeptic symptoms induced by intraduodenal lipid infusion are alleviated by the cck - a receptor antagonist dexloxiglumide,33 suggesting that cck plays a crucial role in inducing sensations associated with intraduodenal lipid . Cck is involved in the control of food intake and the perception of satiety . Moreover, cck modulates upper gastrointestinal function such as gastric emptying . Accordingly, an altered response to cck might lead to gastric motor dysfunction and dyspeptic symptoms . The cck test is considered to be positive when the intravenous cck-8 infusion reproduces the patients' symptoms, while placebo infusion does not . A previous study has demonstrated that a high proportion of the patients with dysmotility - like fd have an abnormal response to cck-8 infusion.34 this abnormal response to cck may play a role in the genesis of dyspeptic symptoms in fd . Therefore, duodenal lipids seem to be responsible for the generation of dyspeptic symptoms in fd through the induction of gastric motor and sensory dysfunction or the altered response to released cck . Table 1 shows the summary of previous studies on abnormal responses to duodenal acid or lipids in fd . Previous studies revealed that ghrelin enhanced gastrointestinal motility and gastric emptying in humans.35 - 38 plasma ghrelin levels fall following meals,39 which may become a satiety signal suppressing food intake . A recent study has shown abnormally low preprandial ghrelin levels and the absence of significant postprandial decrease of ghrelin levels in a subset of dysmotility - like fd patients,40 suggesting the role of ghrelin in the pathophysiology of fd . Ghrelin is produced mainly by enteroendocrine cells in the oxyntic glands of the stomach, which seems to be possibly modulated by a vagovagal reflex . However, little is known about the influence of duodenal nutrients on ghrelin secretion, warranting further investigation . Mast cells induce eosoniphil migration and eosinophils activate mast cells.41 mast cells are closely related to enteric nerves in ibs patients42 and increased mast cell numbers have been reported in the proximal and distal gut of diarrhea - predominant ibs patients.43,44 activated mast cells release tryptase, histamine and prostaglandin d2.45 mucosal mast cell mediators from ibs patients excite rat nociceptive visceral sensory nerves, which suggests the involvement of mast cells in the mechanism underlying visceral hypersensitivity in ibs.46 degranulation from mast cells and eosinophils leads to neural stimulation and smooth muscle contraction, which in turn results in gastrointestinal symptoms, such as abdominal pain and bloating.47 while a significant increase in mast cells has not been observed in the duodenum of patients with fd, duodenal eosinophilia in fd has been described.12,48 higher values of eosinophils are detected in the duodenum of dyspeptic patients, whereas gastric eosinophil counts are not altered in fd . Early satiety is reported to be associated with duodenal eosinophilia,12 which should be explained by further studies . The association of mural eosinophilia and symptomatic gastric motor dysfunction has been demonstrated.49 duodenal eosinophilia has not been reported in patients with ibs, while duodenal mast cells are significantly increased in ibs.48 thus, duodenal mast cell hyperplasia seems to be related to ibs and eosinophilia to fd . Eosinophils secrete multiple cytokines, chemokines and neuroactive chemicals.45 in animal models, eosinophils have been suggested to cause gastrointestinal dysmotility and impaired gastric relaxation.50,51 whether duodenal eosinophilia in humans can influence gastrointestinal sensory and motor function warrants further investigation . Moreover, the role of duodenal eosinophilia in the genesis of dyspeptic symptoms needs to be further studied . Like post - infectious ibs prevalence of dyspepsia and ibs during a 1-year follow - up in a cohort of adult patients affected by a salmonella gastroenteritis outbreak was prospectively evaluated.52 both dyspepsia and ibs were significantly more prevalent in exposed subjects compared with unexposed subjects.52 these findings suggest development of fd after acute inflammatory insult, which is called pi - fd . An increased number of lamina propria t cells, mast cells, and enterochromaffin cells have been observed in the colon or ileum of patients who have developed pi - ibs.43,44 the mediators released by these activated cells may stimulate sensory afferent pathways and induce visceral hyperalgesia . Whether these inflammatory changes are simultaneously involved in the pi - fd is associated with persisting focal t - cell aggregates, decreased cd4 + cells and increased macrophages in the duodenum.13 enterochromaffin cell counts are not altered in pi - fd.13 early satiety, weight loss, nausea and vomiting are more frequently reported in patients with presumed pi - fd.53 helicobacter pylori (h. pylori) infection, gastric emptying, and gastric sensitivity do not seem to be associated with pi - fd, whereas a high prevalence of impaired gastric accommodation is observed in patients with presumed pi - fd.54 this impairment is suggested to be attributable to a dysfunction at the level of gastric nitrergic neurons . Indeed, the number of duodenal intraepithelial lymphocytes is significantly increased in h. pylori positive fd patients due to a higher number of cd8 + cd3 + intraepithelial lymphocytes, although there is no change in h. pylori negative patients . Cd95/fas and hla - dr expressing cd3 + intraepithelial lymphocytes show a significant reduction in the h. pylori negative fd group.54 h. pylori colonization on the gastric mucosa enhances inflammatory cell infiltration, which may persist after the eradication of h. pylori.55 whether h. pylori infection could contribute to immune activation observed in the duodenal mucosa of h. pylori positive fd patients should be further investigated . The causative factors related to the development of pi - fd and the role of duodenal immune activation in the generation of dyspeptic symptoms need further investigation . Several recent studies have suggested the involvement of duodenal abnormalities in the pathophysiology of fd . Duodenal abnormalities observed in fd patients include duodenal hypersensitivity to acid, increased duodenal acid exposure, abnormal responses to duodenal lipids or released cholecystokinin, and duodenal immune activation . Whether these abnormalities in the duodenum play a crucial role in the generation of dyspeptic symptoms needs to be further elucidated . Further investigations on the relationship between duodenal abnormalities and well - known pathophysiologic mechanisms of fd are required . Furthermore, the causative factors related to the development of duodenal abnormalities in fd warrant further study. |
The international union of pure and applied chemistry (iupac) project of collection, compilation, and critical evaluation of solubility data of bromides and iodides of the scandium group and all lanthanides in water and aqueous systems containing either halide acids, halide salts, or organic compounds is under preparation . As a result of their similarity to the chlorides, which were recently evaluated, the bromides and iodides in the lanthanide series unfortunately, the corresponding results show a large scatter when ordered according to the atomic number . In fact some solubility values of bromides predicted by correlation with chlorides seem to be more reliable than the experimental ones . As sufficient experimental data at various temperatures were available, the water - rich fragment of the labr3h2o equilibrium phase diagram has been formed and depicted . Several regularities, with respect to stoichiometry and solubility of compounds formed, were observed during investigations of the aqueous ternary systems . The complex iodides of various lanthanides display more regularities in their properties than the bromides do . This is a brief assessment which is a continuation of the critical evaluation of solubilities of rare earth metal halides in water - containing systems . It would seem that bromides and iodides of rare earth metals are less significant than chlorides . However, running through chemical abstracts one may find plenty of contemporarily important applications of these compounds in technology and science: for production of alloys and compounds, as catalysts in organic synthesis and polymerization, as corrosion inhibitors, as converting materials for various kinds of spectroscopy, as lighting and laser materials, as solid electrolytes for lithium batteries, and as dyes for glass, ceramics, and ink . Investigation of the solubility equilibria in ternary and multicomponent systems is useful for the detection of eventual formation of double salts, complex compounds, and solid solutions of the hydrates . The knowledge about such systems may improve the extraction and refining processes of rare earth metals . Although a number of solubility studies of rare earth metal bromides and iodides were published, there is no systematic critical evaluation of these results so far . The first step of such a procedure after the data collection is an estimation of experimental precision and accuracy . Unfortunately, this information was seldom available in the papers . In the case of bromides, the laboratories of nishimura et al . And voigt achieved precision in some experiments of 0.1% and in the laboratory of qiao et al . The rest of the laboratories did not report any uncertainties and we estimate that the precision was then (15)% . In the case of iodides, the laboratory of alikberova specified the precision as 0.2% or even 0.05%, but in this case we prefer a less optimistic estimate of 0.5%, and we appraise that precision in other laboratories, which did not specify it, was (15)% . We selected the most reliable values from the existing solubility data collection for the bromides and iodides and they are presented in fig . 1 . For comparison, fig . 1 also contains the recommended values of the solubility of rare earth metal chlorides at 298.2 k [13]. These values are precisely known within 0.1%, and therefore they may be used as the reference data basis.fig . 1selected solubilities of rare earth metal halides lnx3 in h2o: lnbr3 at 298 or 303 k (triangles), lni3 at 273 k (squares), and lncl3 (recommended values) at 298.2 k (circles) selected solubilities of rare earth metal halides lnx3 in h2o: lnbr3 at 298 or 303 k (triangles), lni3 at 273 k (squares), and lncl3 (recommended values) at 298.2 k (circles) if one intends to follow the solubility changes with regard to the atomic number (or ionic radius) of the rare earth metal one should compare the solute salts which possess the same stoichiometry and crystal structure of its hydrate . Concerning the chlorides one observes two parabola - like curves: the first one being placed between la and pr chlorides when the equilibrium solid phase is isostructural triclinic lncl37h2o and the second one extending between nd and lu (including also y) when the equilibrium solid phase is isostructural monoclinic lncl36h2o . As a result of their similarity to the chlorides, the bromides form the isostructural triclinic lnbr37h2o phase for la, ce, and pr and the isostructural monoclinic lnbr36h2o phase for lanthanides between nd and yb . However, there are contradictory opinions about the stoichiometry of the equilibrium solid phase for the range ho to lu; it is either the isostructural monoclinic lnbr36h2o or monoclinic lnbr38h2o phase [912]. In the case of iodides, isostructural orthorhombic lni39h2o was identified for the lanthanide range of la to er and isostructural monoclinic lni38h2o for the range of tm to lu; however, different ranges of the solid solute existence were reported [11, 12]. It is a well - known fact that structures and stoichiometries of ybr3 and yi3 hydrates resemble those typical for lanthanides, but crystals of scbr3 and sci3 hydrates are dissimilar compared with the corresponding lanthanide compounds . 1 are quite smooth; the solubility changes gradually reach the minimum at tbcl3 . In the case of bromides thus, the expected similarity between the chloride and bromide s solubility dependence on the atomic number is blurred . Because the mean molal activity coefficients of concentrated solutions, the enthalpies of formation of the hydrates, and their dehydration and lattice energies for the isostructural bromides as well as chlorides change smoothly with the rare earth metal atomic number, the reliable solubility results for the bromides should form a parallel - like curve moved a fraction up in comparison to the chlorides curve . On the basis of this assumption, we feel empowered to predict the solubilities of the bromides more reliably than they were determined . The predicted solubilities for the bromides from nd to yb, which form hexahydrates, at about 300 k, are collected in table 1.table 1selected experimental and predicted solubility of lnbr3 in h2o at about 300 k when the equilibrium solid phase was isostructural lnbr36h2osalt t (k) x 1 (experimental) x 1 (predicted)salt t (k) x 1 (recommended)ndbr3 3030.0740.075ndcl3 298.20.066pmbr3 3000.073pmcl3 298.20.064smbr3 3030.0630.071smcl3 298.20.062eubr3 2980.0780.070eucl3 298.20.061gdbr3 2980.0690.070gdcl3 298.20.061tbbr3 3030.0690.069tbcl3 298.20.060dybr3 2980.0730.070dycl3 298.20.061hobr3 3000.071hocl3 298.20.062erbr3 3030.0760.073ercl3 298.20.064tmbr3 3000.074tmcl3 298.20.065ybbr3 3030.0730.076ybcl3 298.20.067the predicted values were obtained by addition of 0.009 to the recommended solubilities of lncl3 in h2o at 298.2 k from mioduski et al . [13] selected experimental and predicted solubility of lnbr3 in h2o at about 300 k when the equilibrium solid phase was isostructural lnbr36h2o the predicted values were obtained by addition of 0.009 to the recommended solubilities of lncl3 in h2o at 298.2 k from mioduski et al . [13] the predicted values were obtained by the addition of x = 0.009 to the recommended mol fraction values for chlorides [13]; the value 0.009 is the mean difference of the solubility data between all bromides and chlorides . Thus, the parabola - like curve for the chlorides has been moved up by x = 0.009 on the mol fraction scale to predict the solubility of bromides . We are convinced that our predictive values are more reliable than the very scattered experimental data . As was shown in the case of labr3 the temperature dependence of the solubility near 300 k is very small, about 0.0002 in mol fraction per k; therefore the difference of temperatures in table 1 is not essential in such predictions . If in the range ho to yb the equilibrium solid phase at about 300 k is of lnbr38h2o type then the predicted solubility values for the bromides of these elements in table 1 will be invalid . A similar procedure may be proposed for the bromides of la pr which form heptahydrates; however, the only reliable value of the solubility is known for labr3 . Because most of the chlorides and iodides form different crystal structures and there are less thermodynamic data for the iodides (the enthalpies of formation and dissolution of lni3 in water both exhibit a smooth dependence on the atomic number with a small break at gd) a similar prediction procedure for the iodide solubilities would be premature; however, the solubility changes in the rare earth metal iodides row between la and eu should be distinctly more smooth than that experimentally observed, and probably the solubility minimum value for eui3 is fortuitous . The equilibria between solids and aqueous solutions in these systems are reached after a very long time . The solubilities of lnbr3 and lni3 depend explicitly on ph in the saturated solutions which is exemplified best by the investigation of the ho2o3 solubility in hi solution . When ho2o3 and hi were taken in stoichiometric ratio (1:6) to form hoi3 then solubility of this salt reached the highest value . When ho2o3 was in excess then the less soluble ho2i(oh)5 salt was formed, this may be interpreted as the following hydrolysis reaction:1\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$2{\text{hoi}}_3 + 5{\text{h}}_{\text{2}} {\text{o}} \rightleftharpoons {\text{ho}}_{\text{2}} {\text{i}}\left ({{\text{oh}}} \right)_5 + 5{\text{hi}}$$\end{document} when hi was in excess relative to ho2o3 then the solubility of hoi3 clearly decreased, presumably due to the common ion effect . Therefore, the proper ph of the solution and the correct stoichiometry of the salt lni3 should be strictly controlled because only then is its solubility the highest . Complexation of the rare earth ions with an excess of either br or i, separately, is rather weak in the corresponding solutions; however, as was shown during the investigations of ternary systems with other halide salts, double salts may be formed in the corresponding ternary systems . It is sure that the investigations of the iodides must be performed in an oxygen - free atmosphere to avoid decomposition of the iodides and subsequent iodine evolution . Hence, the solubility measurements of the iodides were preferably performed at 273 k and quite seldom at higher temperatures . Likewise, during careful observations of the bromides during the experiments we have noticed a light bronzing of the samples which may mean that the analogous oxidation of bromides may also occur . There are the special cases of eui3 and ybi3 which due to the dismutation - like reactions form quite stable salts in their divalent state with an evolution of either br2 or i2, probably also influencing the solubility determinations . Unfortunately, the solubilities of the divalent bromides and iodides were not determined but these salts also seem to have good solubility . It appears that the method of experimental determination of solubility plays a secondary role in the uncertainty of the results because, quite frequently, the values obtained in one laboratory also showed drastic differences for analogous systems of the neighboring rare earth elements . The following methods of analysis of the saturated solutions have been used: titration of ln ions with edta solution, spectrophotometric determination in the case of simultaneous analysis of two ln metals, precipitation of ln oxalate with ignition to ln2o3 and weighing, an oxidimetric titration in the case of ce, argentometric titration of br or i ions (sometimes with the potentiometric detection of equivalent point), and precipitation of agi and weighing . Exceptionally, the isopiestic technique was used in the case of scbr3 solubility determination and some differential scanning calorimetry (dsc) experiments were performed for labr3 . If either the ln or the br (or i) content was analyzed only whereas the stoichiometry of a salt was not precisely checked then the possibility of erroneousness of the solubility determination increased . When the solubility experiments are extended to higher temperatures then one will be faced with some experimental difficulties due to the hydrolysis reaction written schematically for bromides:2\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\text{lnbr}}_3 + {\text{h}}_{\text{2}} {\text{o}} \rightleftharpoons {\text{lnobr}} + 2{\text{hbr}}$$\end{document} the use of a high pressure and acid - resistant apparatus is indispensable under such experimental conditions . Because the undesirable reaction (2) is a moderately fast process it is suggested to perform a short thermal analysis run rather than an extended solubility equilibration . Probably due to the mentioned difficulties, the solubility determinations at higher temperatures were only effectively performed for the labr3h2o system with the use of chemical analysis of the equilibrated phases as well as some complementary dsc measurements . The solubility results obtained for this system between 298 and 393 k allowed one to formulate the proper solubility equation . As was observed in the case of many chloride systems [13], the experimental values of labr3 solubility in water collected in table 2 do not fit, and they should not fit, to the simple linear equation: 3\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\ln} x_{1} = a + bt^ {- 1} $$\end{document}which can be valid for non - electrolyte solutions . On the left - hand side of eq . 3, the ionic mol fractions should be taken into account.table 2experimental solubilities of labr3 in h2o at various temperatures t (k) m 1 x 1 equilibrium solid phasereferences2584.280.0714?this work2654.300.0718?this work2664.320.0721?this work2704.460.0744?this work2704.460.0744?this work2884.4630.07442labr38h2o2984.520.07530labr39h2o (estimated)4.8000.07959labr37h2o4.8220.07992labr37h2o4.6540.07818labr37h2o4.7080.07818labr37h2o298.24.760.0790labr39h2o (?) 3034.4610.07439labr38h2o4.50.075labr38h2o4.6960.07800labr38h2o4.8120.079774.7670.079083084.7420.07870labr37h2o4.6790.07774labr37h2o4.7510.07884labr37h2o4.7930.07948labr37h2o3134.8850.080884.8360.080103184.9820.08236labr37h2o4.9360.08166labr37h2o3235.2930.087055.2080.085774.9000.08111labr37h2o4.9030.08116labr37h2o3285.1030.08419labr37h2o5.0790.08383labr37h2o3334.9960.08257labr37h2o5.0040.08269labr37h2o5.0900.08399labr37h2o4.9630.08207labr37h2o4.9960.08257labr37h2o3385.2190.08594labr37h2o5.1200.08445labr37h2o3435.2710.08672labr37h2o5.1860.08544labr37h2o5.2420.08629labr37h2o3485.1900.08550labr37h2o5.2240.08601labr37h2o5.1680.08517labr37h2o5.1310.08461labr37h2o3535.4830.08990labr37h2o5.4620.08958labr37h2o3585.6200.09194labr37h2o5.6700.09268labr37h2o3635.8330.09509labr37h2o5.7590.09400labr37h2o3685.8120.09478labr37h2o5.8460.09528labr37h2o5.8300.09504labr37h2o5.8660.09557labr37h2o3736.1780.10015labr37h2o6.1790.10016labr37h2o3786.3700.1029labr37h2o6.4610.1043labr37h2o3836.7420.1083labr37h2o6.7830.1089labr37h2o8.5800.1339?8.6910.1354?3888.1420.1279labr37h2o8.1590.1281labr37h2o9.9940.1526labr33h2o10.1280.1543labr33h2o389.60.1250labr37h2o390.710.0420.1532labr33h2o39310.3600.1573labr33h2o experimental solubilities of labr3 in h2o at various temperatures therefore, the following equation, used by the iupac subcommittee on solubility and equilibrium data [19, 20], was taken into account:4\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\ln} \left\ {{x_{1}^{v} \left ({1 - x_{1}} \right)^{r} \left ({v + r} \right)^{v + r} r^ {- r} \left [{1 + \left ({v - 1} \right)x_{1}} \right]^ {- (v + r)}} \right\} = a + bt^ {- 1} + c {\ln} t + dt $$\end{document}where x1 is the solubility of the salt expressed in mol fractions, t the absolute temperature in k, v the number of ions produced upon salt dissociation, r the number of solvent molecules in the formula of the solid solvate equilibrated . The constants a, b, c, and d can be derived from a fitting procedure if more than four solubility results are at our disposal, and r and v are known from other experiments . Thus, the following solubility equation was obtained by fitting to the solubility data (from table 2) for labr37h2o in the temperature range 298389.6 k:5\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\begin{aligned} {\ln} \left\ {{x_{1}^{4} \left ({1 - x_{1}} \right)^{7} \left ({4 + 7} \right)^{4 + 7} 7^ {- 7} \left [{1 + (4 - 1)x_{1}} \right]^ {- (4 + 7)}} \right\} & = 515.5885 - 14,145.966t^ {- 1} \\ & \quad - 89.79261 {\ln} t + 0.14468 t \\ \end{aligned} $$\end{document} in other systems, the corresponding solubility data were either not reliable (as for the ybr3h2o) or a considerable part of the data related to different equilibrium phases (as for the lai3h2o system) and then eq . 4 loses its validity . Concerning the composition of equilibrium phases at higher temperatures, the thermogravimetric technique in connection with differential thermal analysis (dta) (or dsc) was found to be very informative . It was well proved for labr37h2o that with an increase of temperature the following dehydration stages were observed:6\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\text{labr}}_{3} \cdot 7{\text{h}}_{2} {\text{o}} \to {\text{labr}}_{3} \cdot 3{\text{h}}_{2} {\text{o}} \to {\text{labr}}_{3} \cdot {\text{h}}_{2} {\text{o}} \to {\text{labr}}_{3} \to {\text{laobr}} \to {\text{la}}_{2} {\text{o}}_{3} $$\end{document} this behavior is distinctly reflected in the experimental run shown in fig . 2 . 2 tg thermogravimetric [as relative mass decrement, (m 1 m 2)/m 1], tdg differential thermogravimetric [as mass decrement in time, (m/t)], and dta differential thermal analysis (as voltage difference between thermocouple legs, v) curves of labr37h2o . The experiment was performed on a dta / tg ssc 5200 (seiko instruments), with a heating rate 5 k / min, in a pt crucible, in ar atmosphere tg thermogravimetric [as relative mass decrement, (m 1 m 2)/m 1], tdg differential thermogravimetric [as mass decrement in time, (m/t)], and dta differential thermal analysis (as voltage difference between thermocouple legs, v) curves of labr37h2o . The experiment was performed on a dta / tg ssc 5200 (seiko instruments), with a heating rate 5 k / min, in a pt crucible, in ar atmosphere the observed scheme for the bromide hexahydrates of heavier lanthanides was simpler, as it is exemplarily shown for smbr36h2o:7\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$${\text{smbr}}_{3} \cdot 6{\text{h}}_{2} {\text{o}} \to {\text{smbr}}_{3} \cdot {\text{h}}_{2} {\text{o}} \to {\text{smbr}}_{3} \to {\text{smobr}} \to {\text{sm}}_{2} {\text{o}}_{3} $$\end{document} however, as a result of its similarity to the chlorides [13], the bromide should also be able to form smbr33h2o at a slower heating rate than that applied by mayer and zolotov . Consequently, one may predict that the phase diagrams of other lnbr3h2o systems should be similar in the form of the liquidus shape, composition, and stability of the equilibrium solid phases (types of the hydrates). Likewise, the lighter ln iodides dehydrate gradually according to the following reaction chain:8\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\pr {\text{i}}_{3} \cdot 9{\text{h}}_{2} {\text{o}} \to \pr {\text{i}}_{3} \cdot 6{\text{h}}_{2} {\text{o}} \to \pr {\text{i}}_{3} \cdot 3{\text{h}}_{2} {\text{o}} \to \pr {\text{i}}_{3} \to \pr {\text{oi}} \to \hbox{pr}_{2} {\text{o}}_{3} $$\end{document}whereas dyi39h2o, hoi39h2o, eri38h2o, tmi38h2o, ybi38h2o, and lui38h2o decompose to the anhydrous lni3 salts in one step according to heini et al . . Crystallographic studies of the hydrates confirmed that they were isostructural: monoclinic p21/n for lnbr38h2o (ho lu), triclinic \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$p\bar 1$$\end{document} for lnbr37h2o (la pr), monoclinic p2/n for lnbr36h2o (nd dy), orthorhombic pmma for lni39h2o (la lu), unindexed (probably monoclinic) for lni38h2o (tm lu), monoclinic p2/n for lni36h2o (la tb), and unindexed for lni33h2o (la nd) [10, 12, 2224]. This detailed information is useful for calculation and depiction of the partial lnbr3h2o and lni3h2o phase diagrams . Analogous y compounds have the typical structures of other heavy ln halides; however, sc compounds are different . In the case of chlorides, it was possible to draw many of the lncl3h2o phase diagrams on the water - rich side . However, in this case, there were sufficient data to construct only the part of the labr3h2o phase diagram depicted in fig . 3 . We are convinced that the rest of the labr3h2o phase diagram is qualitatively similar to the well - known lacl3h2o phase diagram .fig . 3water - rich part of the labr3h2o equilibrium phase diagram . Filled squares experimental data shown in table 2; straight line values calculated by eq . 5 water - rich part of the labr3h2o equilibrium phase diagram . Filled squares experimental data shown in table 2; straight line values calculated by eq . 5 for the design of the labr3h2o equilibrium phase diagram we used the results of the thermogravimetric, dta, crystallographic, and solubility studies in the extensive temperature range 298393 k which were supplemented by dsc experiments at lower temperatures . Temperature of the congruently melting labr37h2o was determined to be 389.6 0.5 k. an example of the dsc run is shown in fig . 4differential scanning calorimetry cycle curve (expressed as heat flow divided by sample mass, /m) of a mixture of labr37h2o (35.74 mg) and h2o (7.55 mg). The experiment was performed on a dsc q 1000 (ta instruments) in ar atmosphere differential scanning calorimetry cycle curve (expressed as heat flow divided by sample mass, /m) of a mixture of labr37h2o (35.74 mg) and h2o (7.55 mg). The experiment was performed on a dsc q 1000 (ta instruments) in ar atmosphere one may easily see that both very asymmetrical exothermic and endothermic peaks, being distant for almost 20 k, are in fact related to the same phase transition because the heat exchanged during the crystallization and melting of labr3 is practically the same . The very sharp exothermic peak informs us that the crystallization in this system occurs with a significant undercooling effect . This is an additional argument explaining why the experiments with the presented systems are experimentally so difficult . We are continuing investigations at compositions of labr3 lower than 0.07 mol fraction to get more complete information about the water - rich part of this phase diagram . Unfortunately, the phase diagrams of other bromides and iodides still await construction due to the lack of sufficient solubility data at various temperatures, a precise estimation of the composition of the hydrates, and their decomposition temperatures . Many experimental papers were devoted to the aqueous ternary systems of lnbr3 or lni3 with inorganic and organic compounds as third components . As we mentioned earlier, the solubilities of the majority of bromides or iodides being investigated decreased upon addition of either hbr or hi . Table 3 shows an example of the decreasing solubility of lui3 with increasing content of hi in the solution; the decrease measured was substantial.table 3solubility of lui3 in aqueous hi solutions at 273 k concentration of hi (mol kg)solubility of lui3 (mol kg)03.613.512.507.291.409.121.1112.90.4815.30.33 solubility of lui3 in aqueous hi solutions at 273 k investigations on the ternary systems of lnbr3 with kbr showed that they display a eutonic - type equilibrium, whereas double salts of general formula 2lnbr35csbrnh2o were formed with csbr; the double salts were also formed in the presence of hbr as the fourth component . Neither nai, ki, nh4i, nor rbi formed double salts with lni3 in the aqueous ternary systems . When i2 was present in lni3 solutions then polyiodide ions (i3, i5) were detected in respective solutions; however, a crystallization of the corresponding polyiodide salts was not observed due to their high solubility . A complete solid miscibility of lacl3 and labr3 heptahydrates was found in the lacl3labr3h2o system . In the investigations of some lni3lni3h2o systems, a good solid miscibility of both lni39h2o and lni39h2o was observed when differences of the ionic radii of ln and ln were smaller than 5%; for larger differences a limited solid miscibility was observed with sometimes unexplained exclusions . Interaction of lnbr3 with urea and its derivatives (thiourea, acetamide, biuret, acetylurea) was investigated unsystematically; however, some general observations may be formulated . Acetamide, biuret, and acetylurea showed affinity to the bromides resulting in a precipitation of complex compounds, whereas no complexes were identified with thiourea and such systems were of eutonic type . If a complex formation was found with one lanthanide bromide then its analogues were also found for other lanthanide bromides; nevertheless the stoichiometry of such compounds may be changed in the series . The systems of organic compounds with the iodides were more intensively investigated than with the bromides . All lanthanide iodides formed a complex with urea (ch4n2o) of general formula lni35ch4n2o and this complex with the heavy lanthanides displayed almost constant solubility of 5.6 0.1 mol kg, whereas for the light lanthanides the solubility values were scattered irregularly between 4.7 and 8.0 mol kg . An additional presence of i2 in the system led to the formation of lni34i25ch4n2o10h2o (la tm) or lui33i25ch4n2o7h2o . Thiourea (ch4n2s) formed the lni32ch4n2s10h2o series of compounds and the pertinent solubilities measured were scattered between 3.5 and 6.0 mol kg, but many of these solubility values were estimated from small figures and may therefore be accurate to only 0.5 mol kg . Urotropine hydriodide (c6h12n4hi) formed lni3c6h12n4hi14h2o complexes and biuret (c2h5n3o2) formed eri34c2h5n3o2; the corresponding solubility results were presented only graphically and could not be precisely evaluated . A quite smooth dependence of solubility ordered according to the atomic number of the lanthanide was displayed by the complexes with antipyrine (c11h12n2o) of general formula lni36c11h12n2o; the corresponding solubility results are presented in table 4.table 4solubility of antipyrine complexes lni36c11h12n2o in h2o at 273 k starting saltsolubility (mol kg)lai3 0.217cei3 0.090ndi3 0.070smi3 0.056gdi3 0.046dyi3 0.047eri3 0.031ybi3 0.027lui3 0.024 solubility of antipyrine complexes lni36c11h12n2o in h2o at 273 k quite unexpectedly, for these complex compounds we observe much more regular changes of the solubilities than were observed for the simple bromides and iodides . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited. |
Uropathogenic escherichia coli (upec) are one of the most important etiologic agents of urinary tract infection (uti) (1, 2). Uti is the most frequent human bacterial infection all around the world (2). It is estimated that annually global economy spends more than six billion dollars on uti (3). Studies show that about 50% of women and 12% of men get uti during their life (4). Also 20% to 30% of women experience recurrent infections within 6 - 12 months (3, 4) several virulence factors such as fimbriae, toxins, and siderophores contribute to the colonization and pathogenicity of upec (6). Virulence factors are specific traits enabling e. coli to overcome host immune system and cause various diseases (7). Virulence genes are located on transmissible genetic elements and/or in particular regions on the chromosome that are called pathogenicity islands (8). Pathogenicity islands are associated with the genome of pathogenic strains (9) and led to coordinate horizontal transfer of virulence genes between strains of one species or even related species (10). Upec strains also have other various types of virulence factors such as adhesins, toxins and iron uptake systems that facilitate colonization and persistence of the bacteria in the urinary tract (11). Attachment of the bacterium to the uroepethelium is the main step to initiate and develop uti (12). Adhesins, such as p - fimbriae, help the bacteria to resist against urinary lavage and invade epithelial cells (13). P - fimbriae are one of the most important adhesions encoded by pap (pyelonephritis - associated pili) genes and could act as predictors of pyelonephritis (12). Other important virulence characteristic of upec is serum resistance; the ability that protects bacteria against bactericidal activity of serum (12). The gene trat is a surface exclusion protein that mediates resistance to serum (14). Identification of virulence factors can be useful for diagnosis and therapeutic strategies (15). Studies show that antibiotic resistance is increasing among upec strains every year (16). The high antimicrobial resistance of upec significantly reduces the therapeutic options and increases the treatment costs and mortality rates (17, 18). To the authors best knowledge; few data are available regarding the virulence factors and antimicrobial resistance patterns of upec strains in iran . The current study aimed to investigate the virulence associated determinants as well as their patterns of antibiotic resistance in upec isolated from hospitalized patients with uti . One - hundred and fifty non - duplicate e. coli strains were isolated from urine samples of hospitalized patients with uti at shahid beheshti hospital in kashan, iran, from december 2012 to june 2013 . A positive urine culture (10 cfu / ml) indicated uti . The isolates were referred to the department of microbiology, kashan university of medical sciences and identified as upec, using standard biochemical tests (19). All the strains were stored at -70c in tryptic soy broth (tsb) medium supplemented with 10% glycerol . The antibiotic susceptibility patterns were determined using the disk diffusion method according to the clinical and laboratory standards institute (clsi) guidelines (20). The following antimicrobials were tested: amoxicillin - clavulanic acid (amc: 20/10 g), ampicillin (amp: 10 g), aztreonam (atm: 30 g), cefoxitin (fox: 30 g), ceftriaxone (cro: 30 g), ciprofloxacin (cip: 5 g), gentamicin (gen: 10 g), nalidixic acid (na: 30 g), nitrofurantoin (nit, 300 g), ceftazidim (caz: 30 g), trimethoprim - sulfamethoxazole (sxt: 25 g) and imipenem (imp: 10 g). Results were interpreted as susceptible or resistant according to criteria recommended by the clsi and the manufacture protocols (mast companies, uk). Bacteria were pelleted from 1.5 ml lb broth and suspended in 200 l of sterile deionized water and incubated at 100c for 10 minutes . Pcr assays were used to detect pap (pilus associated with pyelonephritis), trat (serum resistance associated) genes and pai marker of the pathogenicity island of the upec . The following primers were used to amplify virulence genes: 5-gcaacagcaacgctggttgcatcat-3 and 5-agagagagccactcttatacggaca-3 for pap gene to detect a 336-bp amplicon, 5- ggtgtggtgcgatgagcacag-3 and 5- cacggttcagccatccctgag-3 for trat gene to detect a 290-base pair amplicon, and 5-ggacatcctgttacagcgcgca-3 and 5 - tcgccaccaatcacagccgaac-3 for pai marker to detect a 930-bp amplicon (10). The virulence genes were amplified in a total volume of 25 l including 5 l of template dna, 2.5 l of 10 reaction buffer, 1 l (10 pmol) of each of the forward and reverse primers, 0.5 l of 200 m of dntp, 1.5 mm mgcl2, and 1.25 u taq dna polymerase . Pcr condition was as follows: 2 minutes at 94c and 30 cycles including denaturation at 94c for 60 seconds, annealing at 63c for 30 seconds, extension at 72c for 90 seconds and 72c for 5 minutes for the final extension in a thermal cycler apparatus (eppendorf master cycler, ma, germany). The gels were stained in ethidium bromide for 15 minutes and visualized in gel document system (biorad, uk). The sizes of the dna bands were determined by comparing them with a 100-bp dna ladder as the molecular size marker (100 bp dna ladder, mbi fermentas). The purified pcr products were sequenced using the abi capillary system (macrogen research, seoul, korea). One - hundred and fifty non - duplicate e. coli strains were isolated from urine samples of hospitalized patients with uti at shahid beheshti hospital in kashan, iran, from december 2012 to june 2013 . A positive urine culture (10 cfu / ml) indicated uti . The isolates were referred to the department of microbiology, kashan university of medical sciences and identified as upec, using standard biochemical tests (19). All the strains were stored at -70c in tryptic soy broth (tsb) medium supplemented with 10% glycerol . The antibiotic susceptibility patterns were determined using the disk diffusion method according to the clinical and laboratory standards institute (clsi) guidelines (20). The following antimicrobials were tested: amoxicillin - clavulanic acid (amc: 20/10 g), ampicillin (amp: 10 g), aztreonam (atm: 30 g), cefoxitin (fox: 30 g), ceftriaxone (cro: 30 g), ciprofloxacin (cip: 5 g), gentamicin (gen: 10 g), nalidixic acid (na: 30 g), nitrofurantoin (nit, 300 g), ceftazidim (caz: 30 g), trimethoprim - sulfamethoxazole (sxt: 25 g) and imipenem (imp: 10 g). Results were interpreted as susceptible or resistant according to criteria recommended by the clsi and the manufacture protocols (mast companies, uk). Bacteria were pelleted from 1.5 ml lb broth and suspended in 200 l of sterile deionized water and incubated at 100c for 10 minutes . Pcr assays were used to detect pap (pilus associated with pyelonephritis), trat (serum resistance associated) genes and pai marker of the pathogenicity island of the upec . The following primers were used to amplify virulence genes: 5-gcaacagcaacgctggttgcatcat-3 and 5-agagagagccactcttatacggaca-3 for pap gene to detect a 336-bp amplicon, 5- ggtgtggtgcgatgagcacag-3 and 5- cacggttcagccatccctgag-3 for trat gene to detect a 290-base pair amplicon, and 5-ggacatcctgttacagcgcgca-3 and 5 - tcgccaccaatcacagccgaac-3 for pai marker to detect a 930-bp amplicon (10). The virulence genes were amplified in a total volume of 25 l including 5 l of template dna, 2.5 l of 10 reaction buffer, 1 l (10 pmol) of each of the forward and reverse primers, 0.5 l of 200 m of dntp, 1.5 mm mgcl2, and 1.25 u taq dna polymerase . Pcr condition was as follows: 2 minutes at 94c and 30 cycles including denaturation at 94c for 60 seconds, annealing at 63c for 30 seconds, extension at 72c for 90 seconds and 72c for 5 minutes for the final extension in a thermal cycler apparatus (eppendorf master cycler, ma, germany). The gels were stained in ethidium bromide for 15 minutes and visualized in gel document system (biorad, uk). The sizes of the dna bands were determined by comparing them with a 100-bp dna ladder as the molecular size marker (100 bp dna ladder, mbi fermentas). The purified pcr products were sequenced using the abi capillary system (macrogen research, seoul, korea). A total of 150 e. coli strains were isolated from patients admitted to the various wards of shahid beheshti hospital, kashan, iran, were analyzed . Urine samples were from patients of both genders (78% females, 22% males) aged between 1 - 95 years, and the mean age of 50 years . The morphology exhibited gram - negative short rod bacteria arranged in single or paired forms . In biochemical examination all the isolates revealed positive reaction in indole and methyl red (mr) tests, negative reaction in voges proskauer (vp) and citrate utilization tests . Of the 150 e. coli strains isolated from uti, 9 (6%) were susceptible to all tested antimicrobials tested whereas 111 (74%) showed resistance to more than three antimicrobial families and identified as multidrug - resistant (mdr). Fifty - eight (38.7%) isolates were resistant to three to six antibiotics, and 53 isolates (35.3%) were resistant to more than seven antibiotics . One isolate was resistant to imipenem and 84 (56%) isolates demonstrated resistance to the extended spectrum -lactam antibiotics in disk diffusion test . Totally, the virulence genes were detected in 126 (84%) upec isolates; however in 24 strains (16%) none of these virulence genes were found . Thirty - nine strains (26%) had only one virulence gene, 72 strains (48%) two genes; combinations of three virulence genes were observed in 15 (10%) strains . Also pcr products of pap and trat genes and pais markers after electrophoresis on agarose gels are shown in figure 1 . According to the virulence determinants, the trat gene was the most common virulence gene and was detected in 111 (74%) of the isolates . The pais markers and the pap gene were found in 92 (61.3%), and 25 (16.6%) of the isolates, respectively (table 3). The virulence associated genes were distributed in eight distinct patterns that the most common pattern was trat positive, pai positive, and pap negative (table 4). It revealed that pcr products of 336 bp, 290 bp and 939 bp amplicons were pape allele, trat gene and pai icft073 marker, respectively . Electrophoresis of pcr product on 1.8% agarose gel; (a) lanes m: 100-bp dna ladder as the molecular size marker; lane 1: pcr mix with no template (negative control); lane 2: positive control for trat gene; lanes 3 and 5- 10: the trat gene was detected in upec strains; lane 4, trat -negative upec strain . (b) lanes m: 100-bp dna ladder as the molecular size marker; lane 1: pcr mix with no template (negative control); lane 2: positive control for pap and pai genes; lane 3 - 4, 9 - 10, 15, 18 and 20: the pap and pai negative upec strains; lanes 5 - 6, 8, 11 - 12, 16, and 19: pai - positive upec strains; lane 14: pap - positive upec strain; lanes 7, 13 and 17: upec strains that were positive for both pap and pai genes . The results of antibiotic susceptibility testing are shown in table 1 . Of the 150 e. coli strains isolated from uti, 9 (6%) were susceptible to all tested antimicrobials tested whereas 111 (74%) showed resistance to more than three antimicrobial families and identified as multidrug - resistant (mdr). Fifty - eight (38.7%) isolates were resistant to three to six antibiotics, and 53 isolates (35.3%) were resistant to more than seven antibiotics . One isolate was resistant to imipenem and 84 (56%) isolates demonstrated resistance to the extended spectrum -lactam antibiotics in disk diffusion test . Totally, the virulence genes were detected in 126 (84%) upec isolates; however in 24 strains (16%) none of these virulence genes were found . Thirty - nine strains (26%) had only one virulence gene, 72 strains (48%) two genes; combinations of three virulence genes were observed in 15 (10%) strains . Also pcr products of pap and trat genes and pais markers after electrophoresis on agarose gels are shown in figure 1 . According to the virulence determinants, the trat gene was the most common virulence gene and was detected in 111 (74%) of the isolates . The pais markers and the pap gene were found in 92 (61.3%), and 25 (16.6%) of the isolates, respectively (table 3). The virulence associated genes were distributed in eight distinct patterns that the most common pattern was trat positive, pai positive, and pap negative (table 4). It revealed that pcr products of 336 bp, 290 bp and 939 bp amplicons were pape allele, trat gene and pai icft073 marker, respectively . Electrophoresis of pcr product on 1.8% agarose gel; (a) lanes m: 100-bp dna ladder as the molecular size marker; lane 1: pcr mix with no template (negative control); lane 2: positive control for trat gene; lanes 3 and 5- 10: the trat gene was detected in upec strains; lane 4, trat -negative upec strain . (b) lanes m: 100-bp dna ladder as the molecular size marker; lane 1: pcr mix with no template (negative control); lane 2: positive control for pap and pai genes; lane 3 - 4, 9 - 10, 15, 18 and 20: the pap and pai negative upec strains; lanes 5 - 6, 8, 11 - 12, 16, and 19: pai - positive upec strains; lane 14: pap - positive upec strain; lanes 7, 13 and 17: upec strains that were positive for both pap and pai genes . Escherichia coli is the cause of more than 80% of urinary tract infections in all age groups and can lead to renal failure if remained untreated for a long time (2, 21). Better knowledge of the properties of virulence and its antibiotic resistance pattern helps clinicians to anticipate the development of infection in the patients . Surface virulence factors of upec including adhesions, are responsible for colonization of bacteria in the urinary tract . The frequency of pap gene in upec isolates in the present study was lower compared to those of found in brazil, tunisia, china, (5, 6, 22), but is in agreement with the results of studies conducted by usein et al . And santo et al . Who reported the gene frequencies of 17% and 14%, respectively (14, 21). According to the literature, the frequency of pap gene can vary from 0% to 77% (5, 8, 10, 11). The diversity in frequency of pap gene among different studies can be due to the fact that upec strains utilize a variety of adhesins to bind to the urinary epithelial cells, and start the infection . Hence, the strains lacking the pap operon may use other adhesins encoding operons such as afa, and sfa for binding . Johnson et al . (10), reported a frequency of 71% for pai - markers among upec isolated from the patients with urosepsis in the usa . In a survey conducted by navidinia et al . (23), a prevalence of 89% was documented for these markers in upec strains . It is documented that the pathogenicity islands (pais) capable of horizontal virulence genes transfer between species; therefore, a frequency of 61.3% for pai markers in upec strains isolated from hospitalized patients is notable . Usually, the invasive pathogens are highly resistant to the lethal activity of serum and the role of trat- protein in resistance of bacteria to serum is very important . A study in the usa on blood samples from patients with urosepsis showed that trat is a common gene among immune - compromised patients (10). Oliveira et al . (11) showed that 76%of the urine samples were contaminated with multidrug - resistant bacteria carrying trat gene and kudinha et al . Reported a frequency of 77% (2) for trat gene among e. coli strains isolated from patients with cystitis . These results are compatible with those of the current study, which suggest that the trat, as a common and important virulence factor, could be considered as a target for therapeutic interventions . In the current study, eight distinct patterns were identified among the upec strains; whereas, high heterogeneity of the virulence genes compositions were documented in other studies (10, 11). Urinary tract infection is one of the most common bacterial infections and increased antibiotic resistance has complicated the treatment of such infections . Seventy - four percent of upec strains demonstrated multidrug - resistance phenotype and showed resistance to more than three of the tested antimicrobials in the present study . High frequency of antibiotic resistance among upec strains were reported in previous studies in iran (8, 24). Johnson et al . (10) reported 50% multidrug - resistant e. coli among the species isolated from urine specimens . Finding of the current study showed a high rate of resistance to ampicillin, cotrimoxazole, nalidixic acid and ciprofloxacin . Studies from other countries also reported the high frequency of resistant to antibiotics in e. coli strains isolated from urine samples (8, 25 - 27). Treatment failure with the first line drugs like ampicillin, cotrimoxazole, nalidixic acid has led to excessive prescription of floroquinolons and extended spectrum cephalosporins for treatment of wide range of infections including uti, gastroenteritis, lower respiratory tract infection, and other infections in iran . Floroquinolons, including ciprofloxacin, are not recommended as first - line antibiotics for the treatment of uti, but they are generally advised for the empirical therapies . Regarding the results of the current study, 61.3% resistance to ciprofloxacin, which may result from discriminate use of this antibiotic in iran, is considerable . Also, resistance to third generation cephalosporins, such as ceftazidim, and (27) who reported 46.4% and 55% resistance in e. coli to ceftazidime, respectively; but are in contrast with oliveira et al . (11) findings who documented 1% ceftriaxone - resistant upec . Resistance to extended spectrum cephalosporins has increasing considerably in developing countries like iran, and it was primarily due to the ample and discriminate use of antibiotics in these countries . In the present study, similar results obtained from other studies (28, 29). In mexico, the rate of resistance to amoxicillin - clavulanic acid in e. coli strains isolated from outpatients with uncomplicated uti was 19.6% (28). In another study on community - acquired urinary tract infections in italy, the rate of amoxicillin - clavulanate - resistant e. coli isolates was 18.2% (29). Because of the relatively low antibiotic resistance rate, this drug can be recommended for the treatment of urinary tract infections . According to the findings of the current study, upec strains showed high sensitivity to nitrofurantoin, which confirms the results of other studies (30, 31). Sensitivity to nitrofurantoin may result from decreasing the use of this drug (32). As nitrofurantoin is unable to create appropriate level in blood flow, it is used only for treatment of uncomplicated utis, and not recommended for complicated uti and systemic involvements . The present study showed high resistance to aztreonam, which was in accordance with the findings of navidinia et al . Who demonstrated that 78% of upec strains were resistant to aztreonam (23). High resistance to aztreonam was reported by pobiega et al . Among the extended - spectrum -lactamases (esbl)-producing e. coli strains (33). Resistance against aztreonam may be associated with the production of esbl enzymes by esbl - producing strains, which breakdown beta - lactam ring in this antibiotic . Identifying one imipenem resistant upec and four isolates with reduced susceptibility to this antibiotic were other interesting findings of the current study . Most studies have reported 100% sensitivity to imipenem (1, 31), but the resistance to imipenem in e. coli strains isolated from urine samples was indicated in other studies (34). As carbapenems are advising for the treatment of severe infections caused by esbl - producing e. coli, emerging resistance to this antibiotic is a place of major concern in treating infections caused by such resistant bacteria . In conclusion, finding of the current study showed that the trat gene and pai markers were highly prevalent among upec strains isolated from hospitalized patients in kashan; hence, they could be considered as useful targets for prophylactic interventions . Also, in the current study high resistance was observed against the antibiotics widely used for the treatment of urinary tract infection; therefore, to reach better therapeutic outcomes, empiric treatment regimens have to be modified. |
From organometallic catalysis to biology, metal ions are ubiquitous in both natural and synthetic processes . Catalytic metal centers are found in all different classes of enzymes, accounting for 44% of oxidoreductases, 40% of transferases, 39% of hydrolases, 36% of lyases, 36% of isomerases, and 59% of ligases . These metal centers can play a variety of roles during the catalytic step, which include activating nucleophiles, acting as redox centers, and facilitating optimal positioning of the reacting system . Metal ions also appear to play an important role in determining enzyme specificity, as demonstrated by a number of studies showing that metal substitutions cannot only change the observed catalytic activity but even generate completely new activities in an enzyme . Therefore, understanding the factors that determine metal binding specificity and their function within the context of enzyme reactivity is a complex problem . Over the past decades, the availability of more accurate experimental and computational techniques has helped to elucidate various structural and electronic aspects of the role of metals in biomolecular systems . However, while providing valuable information, each of these techniques has its own limitations . From an experimental point of view, correct assignment of the identity of the metal ion and its coordination pattern still remain a significant challenge . On the other hand, while computational approaches such as molecular dynamics and monte carlo simulations have made it possible to study metal ions not only in solution, but also in biomolecular systems, there are often still difficulties with obtaining stable and physically meaningful descriptions of metal centers in biomolecular simulations . Ideally, one would want to move to a full quantum mechanical (qm) description of the metal ion, as is being increasingly done in a range of qm / mm studies of biochemical reactions . Nevertheless, this is not a trivial issue, as, despite significant advances in this area, there are still substantial errors in reproduction of physicochemical properties associated with current quantum mechanical treatments of metal centers . Additionally, the very high computational cost makes a qm description untenable with increasing system size, particularly if one wants to perform substantial configurational sampling in free energy calculations . A number of strategies have been adopted in order to incorporate metal ions into classical simulations for various force fields . These can be broadly classified into three distinct strategies: the nonbonded soft - sphere model, the covalent bond approach, and the dummy - model approach . The simplest of these is the nonbonded soft - sphere model, in which the metal ligand interactions are simply described through electrostatic and van der waals potentials . This approach has been successfully used to describe alkali and alkaline - earth ions, and also modified to include the effects of polarization and metal - to - ligand charge transfer on zn systems . Nevertheless, it appears to be inadequate when it comes to more complex situations such as systems containing multinuclear metal centers with closely located metal ions, or for the correct treatment of transition metals . In the latter case, the challenge becomes to obtain a parameter set that can simultaneously reproduce both solvation free energies and metal water distances . On the other hand, covalent or bonded approaches, which have been widely used to model, for instance, zn - metalloenzymes, suffer from the fact that they include predefined covalent bonds between the metal and ligands, thus not allowing for ligand exchange and/or interconversion between different coordination geometries . Additionally, this approach includes challenges such as the large number of parameters to be optimized (which also makes it highly system specific), dependence on the choice of internal coordinates, and double counting of the electrostatic and lennard - jones interactions . The final strategy, namely the dummy - model approach, provides a promising solution to these problems . In this approach, the metal center is described by a set of cationic dummy atoms connected around a central atom in the specific coordination geometry to be attained (figure 1). The dummy model was specifically introduced to solve the problems with modeling transition - metal ions, where manifestations of crystal field effects lead to a more complicated pattern of solvation energies for the transition - metal ions compared to alkali and alkaline - earth ions . This makes it challenging to obtain both the correct solvation free energy and metal oxygen distances using a standard soft - sphere model . The fact that this is a nonbonded model means that while the positions of the dummies are normally adjusted to the metal coordination in the relevant binding site, this is a transferable model that can be used in sites with coordination geometries other than that which was originally intended, and where changes in the ligand coordination occur, without the need for any further parametrization (see, e.g., ref (17) and the ca model presented in this work). (a) schematic representation of the dummy model used in this work . (b) representative active site of human glxi where the active site metal has been replaced by an octahedral dummy model to represent zn . The central atom and the dummy atoms are shown in gray and white, respectively . . Reproduced by permission of the pccp owner societies . In the present work, we extend the scope of the original model to three biologically relevant transition metals, namely, ni, co, and fe, as well as refining the existing parameters in the literature for mn, zn, mg, and ca . In all cases, our parameters are able not only to reproduce the relevant radial distribution functions (rdf) in aqueous solution (i.e., the metal oxygen distances) but also to consistently reproduce experimental solvation free energies . We have tested our model using two different popular water models (spc and tip3p) and show that our parameters are easily transferable to any force field that describes nonpolar interactions using a lennard - jones potential . Finally, we demonstrate our parameters in action by modeling metal substitution in the active site of the human and e. coli variants of glyoxalase i. we believe that the parameters presented in this work provide a valuable resource for the molecular simulation community, while also providing a foundation for the subsequent parametrization of other metal centers . As our starting point for the present work, we have used the octahedral dummy atom model originally presented by qvist and warshel in 1990 . The original octahedral dummy model consists of six particles with fractional positive charges, henceforth referred to as dummy atoms, placed around a central particle in an octahedral geometry (see figure 1). Each of the dummy particles possesses a charge of +, while the center of the system possesses a charge n6. Therefore, the total complex retains the net charge of n+ possessed by the metal center of interest . Such charge delocalization away from the center is particularly advantageous in the case of systems with multinuclear metal centers, as re - distributing the charge prevents excessive repulsion between the metal centers . For this reason, this model has been shown to also be useful for maintaining crystallographic structures in the case of alkaline - earth metals such as ca and mg, and the parameters for these metals have been further refined in the present work . The geometry of the dummy complex itself is kept rigid by the imposition of large force constants on the metal dummy bonds (see table 1). However, as there are no bonds between the dummy complex and the surrounding ligands, overall rotation of the six - center frame about the nucleus is allowed, and no internal forces are associated with such rotation . Here, it should be noted that as the dummy complex is allowed to freely rotate around the metal center, the coordination geometry is not constrained to the geometry of the dummy model used, but rather, the system is free to exchange ligands on the relevant time scale, provided the simulations are run for a sufficiently long time . An example of such flexible ligand coordination was demonstrated, for example, in the case of carbonic anhydrase, where an octahedral dummy model was used to describe a zinc center with tetrahedral coordination . Ub = kb(b b0), where kb is in kcal mol and r0 is in . 0), where k is in kcal mol rad and 0 is in degrees . Where lennard - jones parameters are given in units of [kcal mol] for ai and [kcal mol] for bi . Geometric parameters that successfully maintain the octahedral conformation of the dummy model have been previously presented in the literature, and they have been used, with some modifications, in the present work . Additionally, as in previous work, negligible van der waals parameters were used on the dummy atoms (table 1); therefore, the remaining parameters that required adjustment are the van der waals parameters on the metal center, as well as the distribution of charges between the metal center and the peripheral dummy atoms . The derivation of the relevant van der waals parameters for the metal centers under study has been done using the corresponding metal aquo complexes, [m(h2o)x], where x indicates the number of water molecules in the first coordination sphere and n+ indicates the total charge of the system . Metal aquo complexes have been extensively studied using both experimental and theoretical approaches . Additionally, once the metal center has been rigorously parametrized in aqueous solution, it is then possible to transfer the parameters to a different environment such as an enzyme active site . In atomistic force fields, the simplest description of the nonbonded interactions between atoms involves an electrostatic term, expressed by a coulomb potential, as well as a van der waals term, expressed by a lennard - jones potential (note, however, that more complex functions to describe these interactions are being increasingly used in the literature; see, for instance, refs (4951)). The potential function, uij, used in this work has the following form:1where aij and bij are the geometric lennard - jones parameters for the interaction between atoms i and j. the lennard - jones parameters are defined per atom type as ai and bi (table 1) and are combined using the geometric rule: aij = aiaj and bij = bibj, where ai = aii1/2 and bi = bii1/2 . In the present work, the van der waals coefficients ai and bi were systematically refined in order to fit simulated properties to known experimental values . The total charge of the metal was distributed on both the central and dummy atoms following warshel s model for zn and mg (although other charge distributions have also been used in the literature). Note that, with rigorous parametrization, either approach should work, provided that the relevant nonbonded parameters are fitted carefully and the system is tested for both stability and its ability to reproduce relevant observables . In order to validate our parameter sets, we aimed to reproduce experimentally observed solvation free energies and m o distances, as well as testing the stability of our parameters in selected enzyme active sites . These properties were chosen as they allow us not only to validate structural parameters for the specific model but also to validate our electrostatic treatments . Calculations of solvation free energies provide one of the most direct benchmarks for this, as they directly quantify electrostatic (ion dipole) interactions of the metal with its surroundings . Clearly, because the dummy model still uses a limited parameter set, there exist more than one combination of parameters that can reproduce individual observables; however, by iteratively refining our parameters to consistently reproduce a range of relevant observables, we obtain a more robust and reliable parameter set . The solvation free energy is calculated using the following expression:2the first term, gmmfep, refers to the free energy of charging the ion in water . The second term in eq 2, gborn, is a correction term that accounts for the error introduced by use of a finite interaction cutoff radius for the electrostatic interactions . This correction can be estimated from the born formula (in kcal / mol), as was done in ref (13):3where qi is the net charge of the solute, and rborn is the radius of the cavity in the macroscopic medium with dielectric constant (t) in which the charge is embedded . Gcav refers to the cavitation energy, which corresponds to the cost of creating a cavity in the solvent for the solute . This value is expected to be in the region of + 2.5 kcal / mol, as discussed in refs (13 and 24). Finally, gcorrstd.state corresponds to the (1.85 kcal / mol) correction to the experimentally cited solvation free energy associated with moving the metal ion from the gas phase (standard state of 1 atm) to solution (standard state of 1 these last two terms cancel out to within 1 kcal / mol, and their effect on the total calculated energetics is therefore expected to be negligible . Gmmfep is obtained from a standard free energy perturbation (fep) simulation, mapping from q = 0 to n+ in n discrete steps which represent intermediates between the initial and final states:4here, m represents an ensemble average on the mixed mapping potential (um):5where u0 and un are the initial and final states, respectively; and m is a mapping parameter that changes from 0 to 1 in fixed increments during the simulation . Now while accurately reproducing experimental solvation free energies is a very important benchmark for electrostatics, the challenge in this case is that there can be significant variation in the results obtained from different experiments; this issue has also been commented on by other authors . For example, even in the simple case of mg, marcus, rosseinsky, and noyes provide solvation free energies of 437.4, 455.5, and 452.2 kcal / mol, respectively . As can be seen from table 2, noyes and rosseinsky both estimate similar solvation free energies, whereas marcus cites substantially different values due to the way the solvation free energy of the proton is treated . Considering these potentially large variations, we have decided, for consistency, to remain with using the values that are extensively tabulated by noyes as our frame of reference, although it should be pointed out that despite the large absolute values of these deviations, they are only a smaller percentage of the total solvation free energies (which are all in the range of several hundred kilocalories per mole). As outlined in section ii, our starting point is an octahedral dummy model, using existing geometric parameters available in the literature . These parameters were slightly modified in order to obtain a tighter dummy model (table 1). The resulting metal dummy model was then complexed with six water molecules and immersed in an 18 water sphere, with both spc and tip3p water models being used for comparison purposes . To reproduce the experimental density and polarization of water molecules close to the sphere boundary, radial and polarization restraints were used according to the scaas algorithm as implemented in the program q. the shake procedure was applied to all solvent molecules, and the nonbondend pair list was updated every 30 steps . A weak harmonic restraint of 0.5 kcal/(mol) was applied to the dummy model to keep it close to the center of the sphere . The time step of the simulation was set to 1 fs, a nonbonded cutoff of 10 was used, and electrostatic interactions beyond this cutoff were treated with the local reaction field (lrf) method . Once solvated, the system was first subjected to a short initial molecular dynamics (md) equilibration of 5 ps at 20 k, 5 ps at 100 k, and 50 ps at 300 k, in order to relax the water sphere around the dummy . Subsequently, fep calculations were performed in 101 steps . At each step, the system was simulated for 50 ps and potential energies were saved every 0.005 ps . In the calculation of the energy ensemble, the first 5% of each trajectory was discarded as equilibration and the energy was estimated as an average of a fep calculation in both forward and backward directions . In order to obtain statistically meaningful data and assess the convergence of the calculations, in all cases, five replicas were obtained using different random number generator seeds . Finally, an independent 1 ns md simulation was carried out at 300 k in order to obtain data to calculate the corresponding radial distribution function and metal coordination number, during which data were collected every 0.5 ps for analysis, discarding the first 10% of the simulation as equilibration . Crystal structures of both the human and e. coli(66) variants of glyoxalase i (glxi) were obtained from the protein data bank (pdb ids 1qip(65) and 1f9z, respectively). For the simulation of the human variant, the crystal structure used was obtained in complex with the product analogue s - p - nitrobenzyloxycarbonylglutathione (nbc - gsh) at 1.72 resolution . In this system gln33, glu99, glu172, his126, and two water molecules coordinate the native zinc ion . For the md simulations, the product analogue was removed from the active site . For the simulations of the e. coli variant of glxi, the native e. coli ni glxi structure bound protein (1.50 resolution) was used as a starting point for simulations with all relevant metal ions . Note that crystal structures of this enzyme in complex with co, cd, and zn have also been reported from the same authors; however, these structures are at lower resolution than that of native enzyme . In the ni - complexed structure four protein residues (his5 and glu56 from one monomer and his74 and glu122 from the other) and two water molecules are coordinated to the metal . Note that, for both the human and e. coli variants, the first seven residues from each chain were not included, as they were not accurately traced from the electron density maps . Additionally, one of the two water molecules coordinating the metal center was replaced by a hydroxide ion, due to the expected low pkas of transition metal coordinating water molecules . The md simulations of the protein systems were performed using the q simulation package and the opls - aa force field . The system was solvated using a spherical droplet of tip3p water molecules with a 24 radius centered between the two subunits for both human and e. coli variants of glyoxalase (allowing us to capture both active sites in our simulation sphere). In order to prevent glu residues from artificially doubly coordinating to the catalytic metal center due to the identical charge on both carboxylate oxygens used in most force fields, the charges of the oxygen atoms of coordinating glu side chains were modified to 0.918/0.750 . This captures some of the true polarization of these residues in the real system, and the degree of polarization of each residue was based on examining charge distributions obtained from calculations using model systems involving acetate bound to a metal center coordinated by five extra water molecules, averaged over all metals considered in this work . The atomic charges were fit to the electrostatic potential at points selected according to the merz kollman scheme using the b3lyp density functional and 6 - 31 g * basis set, as well as implicit solvation using the polarizable continuum model (pcm). These calculations were performed using gaussian 09 . Once the enzyme had been prepared for simulation, the relevant dummy model was placed into each active site such that the central atom overlaid with the metal center in the original crystal structure . After this, the system was heated from 1 to 300 k in a stepwise manner with initial random velocities taken from a maxwell boltzmann distribution (increasing step size from 0.1 to 1.0 fs). The systems were then equilibrated for 20 ns using a 1 fs time step and a weak harmonic restraint of 0.1 kcal/(mol) on the heavy atoms . Net charges were assigned to ionizible residues located within 18 of the center of the sphere . The first 10% of each simulation was considered the equilibration time, and thus removed from the final analysis of the system . Unless stated otherwise, the other md parameters were used as described in the previous section . As our starting point in our parametrization protocol, we tested the performance of the currently available parameters for mn, zn, mg, and ca . The data from these simulations are shown in table 3 . While the original parameters perform well, reproducing m o distances for ca, zn, and mg, they showed larger differences for mn . In terms of the free energy of solvation, the parameters for zn provide slightly lower values compared to the experiment (by 4 kcal / mol), while for mn, ca, and mg values of 4, 24, and 30 kcal / mol more negative are obtained, respectively . Finally, we also examined the performance of a recent dummy model of ca, as shown in table 3 . Note as an aside that comparison to standard soft - sphere models is complicated for the transition metals presented in this work, as it is not possible to simultaneously reproduce the complicated solvation patterns of transition metals and the physical m o distance with the same parameter set (see the discussions in refs (32 and 34)). However, for comparison, we calculated solvation free energies of the standard soft - sphere models for ca, mg, and zn using the tip3p water model (see supporting information table s1 and figure s1). All values are averages and standard deviations over five trajectories, as outlined in the main text . O distances for all of the water molecules bound to the metal were monitored along the simulation . Only for calcium, which shows a rapid water exchange, the m o distance was directly taken from the peak of the rdf (see supporting information figure s1). Kb = 1600 (kcal mol) and k = 250 (kcal molrad) and no bond between dummies . Kb = 640 (kcal mol) and k = 55 (kcal molrad). Kb = 540 (mol) and k = 55 (kcal molrad) and no bond between dummies . The parameters used for the calculations in table 3 were subsequently refined, in order to reproduce both m o distances and solvation free energies, and used as starting points for the parametrization of the other metals . As mentioned before, the existing geometric parameters available in the literature for mg were slightly modified for the new dummy models in order to obtain a tighter dummy model with better structural agreement with experiment while maintaining reasonable thermodynamic properties (table 1). The calculated solvation free energy values as well as the m o distances for the new dummy models are shown in table 4 . O radial distribution functions (g(r)), as well as the coordination numbers for the first coordination shell obtained from integration over the first m o peak (n[g(r)]), are shown in figure 2 . All values are averages and standard deviations over five trajectories, as outlined in the main text . O distances for all of the water molecules bound to the metal were monitored along the simulation . Only for calcium, which shows a rapid water exchange, the m o distance was directly taken from the peak of the rdf (see supporting information figure s1). We would like to remind the reader that, as outlined in section ii, it is difficult to select the appropriate metal solvation free energy against which to parametrize our systems due to the large deviations in the experimental values reported by different workers . For consistency between our different systems, we keep here to the data presented by noyes in ref (54), which includes thermodynamic parameters for a wide range of metal centers, thus capturing the relative effect of the different metals . As can be seen from table 4, in all cases, we obtain extremely good agreement with experimental values using the tip3p water model, which is the model for which our systems were originally parametrized . Upon changing the water model from tip3p to spc we still are within the range of experimentally measured values; however, a systematic deviation of 2 kcal / mol is obtained in the calculated solvation free energy for all metals . This error corresponds to less than 1% of the total value . On the other hand, this shift to lower values is also in line with the change in charge distribution when moving from tip3 to spc water model, with the spc water molecules being slightly less polarized than their tip3p counterparts (oxygen partial charges for spc and tip3p are 0.820 and 0.834, respectively). Therefore, our parameters provide a good transferrable starting point, which could be fine - tuned if necessary for a different water model . Despite the slight deviation in solvation free energy for the spc model, the calculated m o distances lie within the range of observed values, with an estimated standard error of 0.04 . Additionally, for all of the systems examined in this work, except calcium, integration of the rdf gives a coordination number of 6, in agreement with the existence of an octahedral arrangement of water molecules around the dummy model . In the case of ca, the integration gives a coordination number of 7, and, as discussed below, experimental values fall in the range of 68 for this metal, further highlighting the geometric flexibility of our dummy model . Here, it is important to emphasize that this octahedral arrangement was not user - defined, but rather, the nonbonded parameters provided in table 1 are sufficient to attain this configuration both in aqueous solution and enzyme active sites after just a few picoseconds of relaxation from any arbitrary starting position of the dummy model . Therefore, the water molecules surrounding the metal automatically reorganizes in order to create the correct coordination sphere around the metal . We would also like to note that because the model presented here is completely nonbonded, this should allow for ligand exchange around the metals which is important if one wants to study the long time scale dynamical behavior of metal ions in biological systems . However, due to the long time scales of ligand exchange for the systems presented here, with the exception of calcium (which will be described later) no ligand exchange was observed around the first coordination shell of the metal, and the metal maintained stable coordination for the duration of the simulations, in agreement with experimental results which show that this process takes place on average in the microsecond time scale . Radial distribution functions (g(r), y1-axis) and coordination number (n[g(r)], y2-axis) corresponding to the first hydration shells of (a) ni, (b) co, (c) mg, (d) mn, (e) zn, and (f) fe, obtained as outlined in the main text using the dummy - model parameters presented in table 1 . In all cases, the m o g(r) are represented by solid lines and the n[g(r)] by dashed lines . For calcium a different behavior the coordination geometry for this metal is quite flexible and strongly influenced by the second coordination sphere, with coordination number ranging from six to eight and ca o distances in the range of 2.392.46 depending on the coordination number . For this model, the coordination number was found to be seven as is often the case in biological systems (see figure s2) and water exchange, taking place via a substitution mechanism, was observed in the picosecond time scale, in agreement with experimental reports . As mentioned above, recently a seven - coordinated ca dummy model was also presented by saxena and sept, which was successfully tested in the calbindin system . In the present work, in addition to structural properties, we also provide better thermodynamic properties, extending the scope of this model to systems where the metal ion is directly involved in chemical reactivity and therefore where correct solvation of the metal ion is crucial . In order to test the parameters presented in this work in an actual biological system, we have performed molecular dynamics simulations of our dummy models for different metal centers in the active site of both human and e. coli variants of glyoxalase i (glxi, ec 4.4.1.5) as a representative system . Glxi is a member of the metalloglutathione transferase superfamily, which catalyzes the first of two reaction steps in the detoxification of cytotoxic methylglyoxal (mg) via the conversion of nonenzymatically produced hg - gsh hemithioacetals to s - d - lactoylglutathione (figure 3), thus playing a critical detoxification role in cells . This enzyme has an absolute requirement for metal ions, showing a completely different response to the binding of different metals, depending on the species from which the enzyme originates . Despite the low sequence identity (36%), both enzymes are structurally related, with three of four metal ligands conserved (the fourth ligand in e. coli has been assigned to his5, replacing gln33 in homo sapiens (h. sapiens); figure 4). Glxi variants from h. sapiens, saccharomyces cerevisiae (s. cerevisiae) and pseudomonas putida (p. putida) are zinc - dependent enzymes . In these systems, replacement of the native zinc ion with other divalent metal ions (such as mn and co) yields an enzyme that, while active, has generally slightly impaired catalytic activity . Here, interestingly, only mg can fully restore the enzyme s catalytic activity . In contrast, the glxi variant from e. coli is completely inactive in the presence of zn, but fully active in the presence of ni and partially active with co, cd, and mn . The fact that both variants from s. cerevisiae(81) and p. putida(82) are active with zn and also feature the replacement of gln by his suggests that swapping this residue is not the only culprit for the critical difference in activity . Computational studies on the human glxi variant have shown that the metal ion plays a key role in the stabilization of the enolate intermediate (figure 3). Other experimental studies have also suggested that the role for the metal ion is activating bound water molecules for nucleophilic attack . Proposed reaction mechanism for glyoxalase i. the mechanism involves a base extracting a proton from the c1 atom of the hemithioacetal of glutathione followed by reprotonation at c2 . This proposed mechanism is based on that from ref (90). In order to test our parameters, we have studied both the human and e. coli variants of glxi by means of molecular dynamics simulations in order to explore not just the structural stability of the system but also potential structural rearrangements around the different metal centers . Glxi provides an ideal test system for our parameters, as it is an enzyme that shows some level of activity with almost all of the metal centers presented in this work . Therefore, we have performed 20 ns of molecular dynamics simulations with each metal center as outlined in section iii.2, to show that the system is stable without the need for additional constraints or artificial bonds (the rmsd of the backbone atoms is shown in supporting information figures s3 and s4 to illustrate this fact). Here, we have taken both the native forms of the human (zn) and e. coli (ni) enzymes, as well as replacing the catalytic metal centers with mn, co, and mg in the human form and mn, co and zn in the e. coli variant . Because all metals ions under consideration can substantially lower the pka of the water molecules bound to them (pka: ni <co <zn <mn <mg), this greatly increases the probability of having one water molecule in its deprotonated form . Therefore, we have modeled one of the two water molecules as a hydroxide ion, as outlined in the simulation setup (note that the cost of deprotonating a second water molecule in the presence of the additional negative charge of the hydroxide ion would be expected to be substantially higher). Superposition of the e. coli ni glxi structure from (blue) on the h. sapiens glxi zn glxi (yellow). Two residues from each domain form the active site, which is situated in a barrel formed only on dimerization . The metal and its coordinating residues are shown in a ball and stick representation with the zinc colored yellow and nickel blue (top right). This figure was created from the atomic coordinates deposited as pdb entries 1qip and 1f9z and is partially adapted from ref (66). In the glx i variant from e. coli, the coordination sphere of the active site metal ion is composed of four protein residues (his5 and glu56 from one monomer and his74 and glu122 from the other) and two water molecules . Table 5 compares the calculated backbone rmsd between the time - averaged dynamics structure and the crystal for the different metals in the two active sites (distinguished by the subscripts a and b). The results for the different metal ions are generally very similar, with the two active sites showing almost identical results . As can be seen from the backbone rmsd values for the different metals, the protein structure is well preserved, and the octahedral conformation remains stable during the simulation time . Additionally, no ligand exchange is observed on these time scales . Rmsds for the protein backbone have been calculated by taking into account only the atoms within 20 of the system center, i.e., those that are inside the solvent sphere and are not subject to any restraint . Subscripts a and b refer to the metal centers in active sites a and b from the different monomers respectively . Substitution of the different metal ions in the active site of glxi (table 6) does not change the overall structure of the protein, in agreement with structural analysis of different crystal structures of this enzyme in complex with other metal ions . As expected, however, there are a number of subtle changes in the active site architecture upon metal substitution . Specifically, the ligand coordination distances from the mn center are larger than for co and ni, which is also consistent with the trend in increasing metal radii as one moves across the series of metals studied (mn> co> ni zn; see ref (71)). Additionally, in the case of mn, longer average distances of about 2.32.4 are observed between the metal center and the two coordinating histidines (his74 and his131, located on the x y plane and on the z - axis respectively; cf . Figure 5), while shorter metal ligand distances are observed between the metal and the charged carboxylate groups of glu122 and glu182 . Following from this, and as would be expected, the observed average m o distance to the hydroxide ion is slightly shorter than that to the water molecule . In the cases of co and zn glxi crystal structure (pdb ids, 1fa6 and 1fa5, respectively, last four rows). Note that because these dimeric enzymes have two metal - binding sites, subscripts a and b refer to the two different sites, respectively . A similar trend is seen for all other metal ions examined, with overall distances contracted in line with the changing metal radii described above . In the two cases for which experimental distances were known from crystal structures (co and ni, from pdb ids 1fa6 and 1fa5, respectively,), our calculated average distances are all within 0.10.2 of the experimental value . Interestingly, in the case of co where there are differences in the m o distances in the two active sites from the crystal structure, we were also able to reproduce this difference computationally . Finally, no substantial distortion is observed in the case of zn, suggesting that the origin of the deactivation of this enzyme by zinc is simply not structural but rather more complex . Coordination sphere of the catalytic metal centers in the active site of the (a) e. coli and (b) h. sapiens glxi variants, where the active site metal has been replaced by the octahedral dummy model . The central atom and the dummy atoms are shown in blue / yellow and silver, respectively, and the surrounding ligands have been highlighted to show the stability of the metal coordination sphere after 20 ns of md . In the human glxi variant, the metal coordination is virtually identical, with the exception of the fact that one of the histidines of the e. coli variant has been replaced by a glutamine (gln26). As indicated in tables 7 and 8, the initial distances between the zn ion and the atoms bound to it are around 2.0, with the exception of one of the water molecules, for which the o zn distance is 2.8 and for which a much lower density is found when analyzing the density map . Similar to the e. coli variant, the human glxi enzyme is also homodimeric, with both monomers being very close in structure to each other . This is particularly evident in the active site, where very similar interatomic distances are obtained from the two active sites . In this case the largest distance in all cases is observed for the interaction with his126 followed by gln33, while the two glu residues show a much tighter interaction, following the trend observed for the e. coli variant . All distances are very similar, about 2.0, and gln33 shows a shorter distance compared to the analogous histidine in the e. coli variant . Rmsd for the protein backbone have been calculated by taking into account only the atoms within 20 of the system center, i.e., those that are inside the solvent sphere and are not subject to any restraint . Subscripts a and b refer to the metal centers in active sites a and b from the different monomers respectively . As in the previous case, no major structural changes were observed upon metal substitution, and all of the metals studied for these variants showed a stable octahedral coordination during the simulation time . The main difference among the metals studied is found in the m o/n distances . Considering the effect of the metal center has been suggested to be the stabilization of the enolate intermediate, these differences could already give some insight about the stabilization of this substrate when bound to the metal . Experimental distances were obtained from the corresponding zn glxi crystal structure (pdb i d, 1qip). The zinc ligand distances for the transition state analogue bound - protein structure (pdb i d, 1qin) are shown in parentheses.b subscripts a and b after each metal refer to the relevant active site . In the hipc gsh complex the oxygen atoms of the hydroxycarbamoyl group of the inhibitor replace the two oxygen atoms . Metal ions are crucial to biology, fulfilling a range of chemical and structural functions that make life possible, but accurately describing metal centers in molecular simulations remains a significant bottleneck in computational chemistry and biology . Ideally, one would like to have a full quantum mechanical description of the metal center, particularly as this would allow one to correctly describe ligand - to - metal charge transfer, and changes of spin state in the case of transition metals . However, while complex metal centers are by now routinely modeled in computational organometallic chemistry and in qm / mm studies of biological systems, the high computational cost associated with using a density functional theory based description of the metal center makes use of such an approach untenable in long time scale biomolecular simulations . Additionally, while there have been substantial advances in classical force field based descriptions of metal ions, one still often has to resort to using either artificial restraints or bonds in order to maintain stable coordination geometry . While this is fully reasonable in shorter simulations where the metal center only plays a structural role, it does not allow for ligand exchange in long time scale simulations and also becomes problematic in studies of chemical reactivity, where a flexible coordination sphere around the metal can become essential . Qvist and warshel proposed a solution to this problem in 1990, presenting a nonbonded octahedral dummy model to describe transition metals, which allowed one to capture fundamental properties of the metal center such as m o distances and solvation free energies, without the need for any artificial constraints or bonds . This approach has been adopted by other workers since then and extended to a range of metals with both octahedral and tetrahedral coordination geometries . However, the parameters presented have still been adjusted for specific force fields, and in the case of tetrahedral zinc also specific coordination geometries without the consideration of solvation effects (although this is not possible in the case of a tetrahedral zinc model, which, while common in enzyme active sites, has no counterpart in aqueous solution). We demonstrate that while a classical model will, per definition, lack a proper description of electronic properties, we can nevertheless reproduce important structural and physical properties such as metal ligand coordination distances and solvation free energies . As a test of the reliability of our parameters to maintain correct coordination in enzyme simulations, we have also performed simulations of different dummy models in the active sites of the human and e. coli variants of glxi, demonstrating that our models not only maintain stable coordination geometries, but also capture the subtle geometric changes that would be expected upon metal substitution without the need for any artificial bonds or constraints . We believe that the parameters described herein are an important and useful aid to the broader scientific community in the study of the role of metal ions in complex biological systems. |
Epidermoid cysts are benign developmental malformations arising from abnormal epithelial constituents of ectodermal tissue formed during the fetal period . These lesions can be seen anywhere in the body, with the occurrence of approximately 7% in the head and neck region and their incidence in the oral cavity makes up for 1.6% of the total occurrences and they constitute <0.01% of all the cystic lesions of the oral cavity . Epidermoid cysts of the oral cavity, in adults, are mostly seen on the floor of the mouth and in other locations including the labial, palatine tonsil and in the soft palate . In infants incidence is highest in the floor of the mouth and lowest in the soft palate . Only four cases have been reported in literature of epidermoid cysts in infants involving the soft palate . We present here a report of a 9-month - old female patient who underwent surgery for cleft palate and growth on the uvula of soft palate clinically diagnosed as a benign fibrous tumor which was confirmed by histology as epidermoid inclusion cyst . A 9-month - old indian infant was brought to the cleft care center for a surgery of cleft palate and associated growth in the soft palate . Family history was not significant and her mother had an uncomplicated delivery . On physical examination, the patient was alert and intraoral examination revealed a cleft palate involving the soft palate and a whitish, oval shaped, solitary solid mass with pale overlying mucosa located behind the uvula and right side of the soft palate measuring approximately about 1 cm 1 cm [figure 1]. No other external facial or neck cysts, sinuses or lesions were noted and the rest of the intraoral space was unremarkable . A provisional diagnosis of benign fibrous tumor was considered and differentials included salivary gland neoplasms and benign tumors of muscular origin . The patient was admitted to the hospital for the surgery of cleft palate as the medical history was irrelevant . Surgery was performed under general anesthesia, surgery was uneventful, and the patient recovery was good . Histopathological examination revealed a parakeratinized stratified squamous epithelium with flattened rete ridges and a cystic space with keratin flecks . The patient is under follow - up and there is no evidence of recurrence even after 1.5 years . Clinical image revealing cleft palate with a whitish, oval shaped, solitary solid mass with pale overlying mucosa located behind the uvula and right side of the soft palate (a) gross specimen creamish white in color and soft in consistency; (b) cut section of the gross specimen showing cystic space; (c) photomicrograph demonstrating the cystic cavity containing keratin (h&e stain, 40) (d) photomicrograph demonstrating parakeratinized stratified squamous epithelium with flattened rete ridges and the cystic space with keratin flecks (h&e stain, 100 histopathological image demonstrating epithelium and keratin (h&e stain, x40) high power view of the epithelium and keratin in the lumen (h&e stain, x100) photomicrograph showing keratinizing epithelium and keratin flecks in the lumen (h&e stain, 100) histopathological figure at 10 photomicrgraph showing keratin flecks (h&e stain, x200) a thorough search using the keywords such as soft palate, pediatric / congenital, and epidermoid cyst / dermoid cyst/ in various combinations was made in pubmed . A keyword search using pidermoid cyst, palate, cleft in the pubmed literature revealed 10 cases, but none of them were associated with a cleft soft palate table 1 . Reported cases of epidermoid cysts of soft palate and uvula dermoid cysts were classified by new and erich in 1937 as acquired implantation, congenital teratoma and congenital inclusion dermoid cysts and by meyer in 1955 as true dermoid cysts, epidermoid cysts and teratoid cysts . A true dermoid cyst is lined with keratinized epithelium and has skin appendages like hair follicles or sebaceous glands . An epidermoid cyst is lined with simple squamous epithelium and does not contain skin appendages . A teratoid cyst in addition to skin appendages contains other tissues such as muscle, bone and cartilage . According to new and erich, who conducted a study on 1495 cases, the common location was anal region (44.5%) followed by ovarian (42.1%) region . The overall incidence of pediatric head and neck cysts was 7%, with the periorbital region being the most common site . This is equally consistent with the study by pryor et al . Which concentrated on pediatric dermoid cysts of the head and neck, in which 61% of head and neck dermoid cysts were periorbital in location . In neither of these series, were cysts of the soft palate mentioned . Dermoid cysts and epidermoid cysts can be acquired or congenital, but in infants, they are usually congenital . During the 6 week of gestation, the secondary palate begins to develop . It starts initially as two outgrowths from the maxillary prominences which are oriented in a vertical direction and layout on either side of the tongue . During 8 week, these palatine shelves orient themselves in a horizontal direction and the tongue descends downward as mandible elongates and the fetal head tilts upward . The palatal shelves continue to grow toward each other and contact at the medial edge epithelia . A transient midline epithelium or midline seam is formed at this time and as the growth of head increases the seam thins into a single layer of cells and undergoes disintegration completely resulting in the merging of the mesenchymal portion of two palatal shelves by the process of fusion . This process of shelf elevation and fusion takes place about a week later in girls than in boys which explain why girls are more prone than boys for cleft palate formation . In contrast, after the fusion of palatal shelves the soft palate uvula forms through migration and proliferation of two confluenced sub epithelial mesenchymal growth centers at the posterior edge of the newly formed palate with a groove between them filled by merging . Failure of the merging process during soft palate and uvula development can result in complete or partial clefts of the soft palate and uvula . And hence, in distinction to the previous epidermoid cysts that were reported on the soft palate, in the present case cleft of secondary palate might have developed due to lack of fusion and merging; and the epidermoid cyst would have developed due to aberrant ectodermal entrapment in the uvular area followed by reactivation of these cleaved cells . Identification of epidermoid cyst is essential in neonates as they may cause difficulty and obstruction in breathing and swallowing which might turn out to be fatal. |
This effect is associated with adverse outcomes including impaired coagulation (3), increased incidence of surgical wound infections, prolonged hospitalization (4), and myocardial ischemia (5). Despite the absence of environmental exposure of a wound or abdominal viscera, exposure of the abdominal cavity to large volumes of cold, dry carbon dioxide gas used for insufflation has been implicated as a potential source of heat loss during laparoscopy (6, 7, 8). Therefore, the effects of aminophylline (85% theophylline, 15% ethylendiamine) are similar to those of caffeine . Aminophylline has been shown to elicit thermogenesis and improve cold tolerance in rats (9, 10) and increase the metabolic rate in lambs during cold stress (11). Since there have been no reports on the thermogenic effects of aminophylline in humans, we tested the hypothesis that aminophylline reduces the decrease in core body temperature during laparoscopic vaginal hysterectomy (lvh) requiring pneumoperitoneum . This was a prospective, randomized, blinded clinical trial . After obtaining written informed consent from all patients, fifty patients scheduled for elective lvh were enrolled between 40 to 60 yr of aged with american society of anesthesiologists (asa) physical status i or ii . Patients with a history of cardiovascular, pulmonary, or thyroid disease; dysautonomia; fever; aminophylline intake within a day before surgery; or who were transfused were excluded from this study . The patients were randomly divided into an aminophylline group (n=25) and a saline control group (n=25) using a computer - generated randomization list . The ambient operating room (or) temperature was maintained around 21 (12). Upon arrival in the operating room, standard anesthetic monitors were applied, including ecg, a non - invasive blood pressure monitor, and pulse oximetry . To evaluate the depth of anesthetization, bis monitor (a-3000 bis monitor, aspect medical system, covidien, ma, usa) sensors (bistm quatro, aspect medical system, norwood, ma, usa) were attached to the patient's forehead and temple . A skin temperature probe was attached to the index finger of the non - infused arm . After induction, a urinary catheter was inserted to measure hourly urine output . To prepare the study drug, aminophylline (10 mg / kg) was mixed with saline in a syringe to a volume of 100 ml by an independent researcher . Fifteen minutes before inducing anesthesia, 10 ml (1 mg / kg) of the study drug was administered intravenously over 1 min as an initial infusion . An esophageal temperature probe was inserted into the lower esophagus immediately after intubation in order to measure the core temperature . The remaining 90 ml of the study drug was administered intravenously at a rate of 50 ml / hr for next 108 min using a syringe pump . Anesthesia was maintained with 1 - 3 vol% of sevoflurane and 2 l / min each of nitrous oxide and oxygen to obtain bis values between 45 and 55 . The lungs were ventilated with a tidal volume of 7 - 10 ml / kg and a respiratory rate of 8 - 12 breaths / min to maintain an end - tidal carbon dioxide (etco2) value between 30 and 35 mmhg . The pneumoperitoneal pressure was maintained at 12 mmhg to decrease the risk of venous carbon dioxide embolism . The average temperature of inflow gas was 21, and the temperature of the outflow was 32. the tidal volume and respiratory rate were set to maintain an etco2 between 35 - 40 mmhg after pneumoperitoneum . Ephedrine was given slowly, and additional doses were given at 10 min intervals, as needed . Lactated ringer's solution and 6% hydroxyethyl starch in normal saline (ns) solution (voluven, fresenius kabi, bad homberg, germany) were administered at a maximum dose of 50 ml / kg . Lactated ringer's solution was infused at a constant rate of 6 ml / kg / hr . Body temperature was measured in the post - anesthesia care unit (pacu) using a tympanic thermometer (thermoscan irt 1020, braun, germany). In the pacu, a bair hugger forced - air warmer (augustine medical inc ., eden prairie, mn, usa) was applied to patients who had a tympanic temperature below 36. the skin temperature, mean blood pressure, and heart rate were recorded 15 min before inducing anesthesia (t-15), immediately after intubation (tintu), and at 15 min intervals (t15-t105) after intubation . Esophageal temperature was recorded immediately after intubation (tintu) and at 15 min intervals (t15-t105) afterward . The room temperature, fluid intake, urine output, and estimated blood loss were recorded at t105 . To estimate the sample size needed, a pilot study was conducted measuring core body temperature of ten control patients . For the power calculation, we assumed an equal standard deviation for the aminophylline infusion group . A sample size of 22 patients per group provided 80% power with a two - tailed =0.05 to show a difference of 0.3 between groups . To compensate for an estimated dropout rate of 10%, continuous data within the groups, such as temperature and hemodynamic variables, were compared with repeated measures of anova followed by paired t - tests with bonferroni correction for multiple comparisons . Student's t - test or chi - square test was used to compare variables between the groups, where appropriate . In all tests, the study protocol was approved by the institutional review board for human research at the catholic university of korea st . The nature of the study was explained to all patients, each of whom provided written informed consent before the beginning of the study, in accordance with the principles of the declaration of helsinki (revision of edinburgh, 2000). The study protocol was approved by the institutional review board for human research at the catholic university of korea st . The nature of the study was explained to all patients, each of whom provided written informed consent before the beginning of the study, in accordance with the principles of the declaration of helsinki (revision of edinburgh, 2000). Patient characteristics and perioperative data, including room temperature, fluid intake, urine output, and blood loss, did not differ significantly between the groups . In the aminophylline group, esophageal temperatures at t45, t60, t75, t90, t105 (p values are in the order of 0.024, 0.053, 0.025, 0.011, 0.017) and index finger temperatures at t15, t30, t45, t60, t75, t90, t105 (p values are in the order of 0.001, 0.029, 0.020, 0.010, 0.028, 0.042, 0.024) were significantly higher than in the saline control group (table 1) (fig . The esophageal temperatures decreased significantly from tintu at t15-t105 in the saline control group (p values were in the order of 0.040, 0.006, <0.001, <0.001, <0.001, <0.001, <0.001) and at t45-t105 in the aminophylline group (p values were in the order of 0.039, 0.011, 0.002, the index finger temperature at t105 in the saline control group decreased significantly from tintu (p=0.045) (fig . Heart rates in both groups were significantly higher at tintu than at t-15 (p=0.025 in the saline control group, p=0.014 in aminophylline group). Mean blood pressures in the aminophylline group were significantly lower at t45-t105 than at t-15 (p<0.001) (fig . This study demonstrated that an aminophylline infusion reduced the changes in core and skin temperature compared to a saline control during lvh requiring pneumoperitoneum . Aminophylline, like caffeine, is a methylxanthine that has been shown to elicit thermogenesis and improve cold tolerance in rats (9, 10). It has also significantly improved cold tolerance in lean sprague - dawley rats, regardless of age or thermogenic capacity . Aminophylline (18.7 mg / kg intraperitoneal) significantly improved thermogenesis and cold tolerance in both lean and corpulent rats without any age - related difference (13). (11) reported that aminophylline has potential as a treatment for hypothermia or to improve recovery from hypothermia in lambs by increasing metabolic rate during cold stress at 16 and 32 mg / kg doses . Vestal et al . (14) reported that methylxanthine derivatives, such as caffeine and theophylline, stimulated epinephrine and norepinephrine release from the sympathoadrenal system . In six healthy males, a 262% increase in plasma epinephrine and a 64% increase in plasma norepinephrine during a high - dose infusion of theophylline (plasma theophylline level of 20 g / ml) resulted in dose - dependent cardiovascular and metabolic effects . Plasma concentrations of glucose and free fatty acids (ffas) also increased, but insulin secretion was inhibited (14). Caffeine (15) and aminophylline also block adenosine receptors (16), which is an effect that may have a greater impact on metabolism than the inhibition of phosphodiesterase (17). The combined effects are expected to enhance lipolysis, glycogenolysis and gluconeogenesis and hence contribute to enhanced maximal thermogenesis (10). After anesthesia is induced, core hypothermia is largely caused by a redistribution of body heat from the core to the periphery (1). Most anesthetics cause arterial and venous dilation as well as thermoregulatory vasodilation in the arteriovenous shunt (18, 19). Ikeda et al . (20) stated that hypothermia during general anesthesia develops in three distinct phases: 1) an initial, rapid decrease in core temperature, resulting largely from an internal core - to - peripheral redistribution of body heat; 2) a slower, linear decrease in core temperature that results from heat loss exceeding metabolic heat production (21); and 3) a core - temperature plateau resulting from decreased cutaneous heat loss (22) and metabolic heat constrained to the core thermal compartment in patients becoming sufficiently hypothermic to trigger thermoregulatory vasoconstriction (23). In this study, the core temperature gradients in the aminophylline group during sevoflurane anesthesia decreased significantly less than in the saline control group . These data suggest that aminophylline effectively maintained the core temperature through a thermogenic effect despite reduced peripheral thermoregulatory vasoconstriction . Since there are no data on the thermogenic effect in humans, we cannot determine the therapeutic range of aminophylline infusion doses . (11) reported that, in lambs, a dose of more than 16 mg / kg of aminophylline can improve recovery from hypothermia by increasing metabolic rate during cold stress, whereas 8 mg / kg of aminophylline did not affect metabolic rate . Although this was the first study to report the thermogenic effect of aminophylline in humans, we hoped positive results . Therefore, we chose an aminophylline dose high in the therapeutic range (10 mg / kg). 1 mg / kg of aminophylline was administered as an initial infusion at 15 min before inducing anesthesia, and the remaining 9 mg / kg was administered intravenously after intubation at a rate of 50 ml / hr for 108 min using a syringe pump . Another limitation is that the study was performed only in women that underwent laparoscopic gynecologic surgery requiring pneumoperitoneum . Other types of surgeries in both sexes should be investigated further . In summary, this is the first study to report the thermogenic effect of aminophylline in humans . We found that an intraoperative infusion of aminophylline reduced the decreases in core and skin temperature during lvh requiring pneumoperitoneum . These data suggest that aminophylline maintains core temperature through a thermogenic effect despite reduced peripheral thermoregulatory vasoconstriction . Aminophylline, therefore, may be a useful and supplemental thermogenic agent to prevent hypothermic conditions when limited facilities are available to provide supplemental heat. |
To foster greater coordination on surveillance, research, education, and prevention of tickborne diseases, cdc established ticknet during 2007 . Ticknet is a public health network that includes partners from state health departments and academic institutions collaborating through the emerging infections program (eip), staff of state and local health departments collaborating through the epidemiology and laboratory capacity (elc) cooperative agreement, and cdc staff in the division of vector - borne diseases and the division of parasitic diseases and malaria . Ticknet provides funding to state and local health departments through the elc cooperative agreement to help sustain and enhance routine surveillance for tickborne diseases . Approximately 18 state and local health departments are funded annually for lyme disease surveillance, with priority given to states with a reported incidence of lyme disease greater than the national average and to bordering states where the disease may be spreading . During 2014, an additional 7 state and local health departments received elc funding to support surveillance for other tickborne diseases . Together with elc funding for program support, funding through eip has allowed ticknet partners in maryland, minnesota, and new york to undertake special studies to quantify underreported tickborne diseases . These studies include a review of patient charts and codes from the international classification of diseases, ninth edition, and provide insights into the use of electronic medical records for public health surveillance . Other studies in massachusetts, minnesota, and new york are examining ways to streamline the evaluation of positive laboratory reports by using random sampling methods ., ticknet partners at eip sites in connecticut, maryland, minnesota, and new york conducted a survey of commercial, clinical, and state laboratories to evaluate practices and volume of testing for 5 leading tickborne diseases . Collectively, 7 large commercial laboratories reported testing 2.4 million patient specimens for evidence of b. burgdorferi infection during 2008, at an estimated cost of $492 million . After correcting for test sensitivity, specificity, and stage of illness, the overall frequency of infection among patients for whom samples were tested was estimated at 12% . Applied to the total number of specimens, this percentage yielded an estimated 288,000 true b. burgdorferi infections (range 240,000444,000) among source patients during 2008 (18). Results of this study will be compared with results of other ongoing cdc studies to estimate the overall frequency of lyme disease and other tickborne infections in the united states . To better quantify the public health burden of tickborne diseases, ticknet eip partners in connecticut, maryland, minnesota, and new york have undertaken a study to quantify current costs associated with individual cases of lyme disease . Begun during 2014, the cost of lyme disease study uses a prospective survey design to capture individual and societal costs of lyme disease, including out - of - pocket medical costs, nonmedical costs, and productivity losses, as well as total direct medical costs to society by using billing codes from enrolled patients providers . This estimate will be used to guide impact assessments of current and future prevention methods . As an adjunct to personal protective measures such as use of insect repellents, several yard - based interventions have been proposed to reduce tick abundance in the home environment . To assess the efficacy of such interventions in preventing human illness, ticknet sites have instituted a series of studies to evaluate the efficacy of novel and commercially available prevention strategies . One study, a randomized, blinded, placebo - controlled, multistate trial assessing the effectiveness of acaricide barrier sprays, will cover 2,700 households in 3 states, with outcomes measures including tick density on acaricide - treated properties, the number of tick human encounters, and the number of tickborne diseases in humans . A second study, begun in connecticut during 2012, uses a similar design to evaluate the effectiveness of bait boxes that apply fipronil to rodents that are the reservoirs of b. burgdorferi . Used by veterinarians to prevent flea and tick infestations on dogs, fipronil kills ticks on the rodents for several weeks and may potentially interrupt the local transmission cycle of b. burgdorferi . Recent experience indicates that additional tickborne pathogens are waiting to be discovered . In collaboration with the tennessee and minnesota health departments, the mayo clinic, and vanderbilt university, ticknet has recently initiated a study to identify novel agents of tickborne disease . Over the next 3 years,> 30,000 clinical specimens from us patients with suspected tickborne diseases will be screened by using high - throughput molecular methods designed to detect bacteria, followed by use of genomic sequencing to characterize detected pathogens . The ultimate goal is to better describe the epidemiologic and laboratory features associated with recognized and novel tickborne pathogens and to guide the development of new diagnostic methods . Although sometimes overlooked, tickborne diseases pose an increasing threat to public health . Factors driving the emergence of tickborne diseases are poorly defined, but current prevention methods are clearly inadequate . Addressing this problem requires a multidisciplinary approach with input of entomologists, epidemiologists, educators, and infectious disease and communications specialists . Built on the pillars of the eip and the elc cooperative agreements, ticknet provides a collaborative network that brings together these resources at the federal and state levels to enhance surveillance, improve prevention, and identify new tickborne diseases. |
In order to assess sexual well - being and provide treatment or education for iranian women's sexuality, it is necessary to understand their sexuality and the meanings they give to sexual behaviors . Sexual behavior is a complex concept that is difficult to measure . According to webster's online dictionary, the manner of conducting oneself and sexual simply means whatever relates to sex, the sexes or sexual reproduction. Thus, sexual behavior would be an act by someone that expresses their sexuality . In the archive for sexology, erwin j. haeberle introduces sexual as a word with double meaning, referring to human anatomy as well as to human behavior . He defines sexual behavior as erotic behavior . Therefore, in contrast with webster, the critical dictionary in the archive for sexology defines human reproduction as asexual behavior because it concentrates on the biological facts without reference to the erotic feelings of the man and the woman involved . The functional analysis of sexual behaviors has led researchers to develop instruments to gather observable data . In order to change subjective meanings to observable data, the researchers need to extract meanings from the contexts and populations they seek to measure . Many sexually related measures and instruments have been published; they measure perceptions, attitudes, beliefs and so on . However, the contexts from which the concepts and meanings were extracted to develop these instruments vary . Doubtless, their reliability in measuring sexual behaviors as socially constructed, complex and dynamic phenomena can be questioned . In order to determine a research approach for the context of iranian women's sexuality, review and assessment of existing instruments was essential . After a brief overview of the existing instruments measuring non - risky sexual behaviors among heterosexual women, we look at their cultural appropriateness to measure sexual behaviors within an iranian context . Finally, because we find these instruments insufficient, we suggest criteria for cultural - specific sexually related measures in the iranian settings . For the purpose of this paper, we searched literature using medline, pub - med, psychinfo and cinahl from june 2006 to june 2011 . The mesh terms used to search title and abstract included sexuality, sexual behavior, questionnaire and sexual behavior and questionnaire or sexually related measure, sexually related tools limited to human, female, english and reproductive age . Focused exclusively on the concept of sexual behavior, we screened titles and abstracts . Considering that not all abstracts highlighted the specified population and name of the applied tools, these articles were found in full, and methods sections were reviewed to identify populations and the tools used . Retrieved articles were included if they used a structured instrument(s) to measure sexual behaviors of the female population . We excluded those studies whose outcome of interest included risky sexual behaviors or sexual behaviors measured among same sex relationships . We excluded same sex relationships because this form of relationships is illegal and deniable in iran . If the original paper was unavailable, we selected the article that used the given tool to measure the study outcomes . In this stage, tools in languages other than english, those employed just for menopausal women and those not related to sexual behaviors were excluded . Using gagnon and simon sexual script theory as the theoretical framework, cultural appropriateness (i.e. Understanding and language of sexuality, ethics, and morality) was our selection criteria for the instruments . Evaluation of the 143 articles revealed that a majority of them (65%) had utilized the female sexual function index (fsfi) in their research . The second most used scale was the pelvic organ prolapsed / urinary incontinence sexual function questionnaire (pisq-12), utilized in 10.4% of the final articles . The golombok - rust inventory of sexual satisfaction (griss) and the arizona sexual experience scale (asex) were the next most used instruments by 6.9% and 5.6% of articles, respectively . We reviewed all instruments and determined the subscales as well as measurement types [table 1]. We categorized these instruments into three groups based on their working definitions of sexual behavior and theoretical frameworks . These instruments were reviewed by the authors, who are iranian experts in sexology, reproductive health, and epidemiology . Of 50 instruments, we found 19 tools applicable in the iranian culture [table 2]. The third group included those which were focused on a specific sexual problem rather than looking at sexual behaviors overall [table 4]. The multidimensional derogatis sexual functioning inventory (dsfi) did not fit into any of those three categories . With this overview, it appears that there are significant challenges to using these instruments in iranian contexts . Instruments features including the subscales compatible scales for iranian culture instruments incompatible with iranian culture problem - focused instruments inspiring gagnon and simon's description of sexual behaviors defined with social scripts, understanding and language of sexuality, ethics, and morality are the main cultural determinants of sexual norms in the iranian society . In her linguistic analysis of sexuality expression of iranian women, merghati - khoei has revealed the ways of developing terminology and cultural explanations, which are juxtaposed with the exploration of the development of women's sexuality . Iranian women expressed their sexuality differently from western women even though they understood and talked about the same issues . There is, however, a hesitation when it comes to discussing or reporting the emotional aspects of sexual encounters . The power of culture in dictating daily language for females has been highlighted in morocco as an arab - islamic context . Similarly, culturally meaningful ambiguity in language guides iranian people's behavior . Even though persian vocabulary, concepts and expressions about sexual matters exist in art, poetry and the beauty of nature, these linguistic resources are not applied in daily life to express sexuality . For example, the sexual attitude scale (sas), certainly a well - designed tool for use within many cultures measures a person's awareness toward her / his sexual interests and needs as well as sexual - self judgment . Communication of sexual needs or interests with others is another feature of this tool . As a neglected subject matter in the iranian culture, questioning people about their sexual needs and interests or sexual - self concept seems impractical . Sexuality is an unspoken issue, and individuals might not be linguistically skilled to communicate their sexuality with an interviewer . In sum, the art of using a rich vocabulary of metaphors and euphemisms is a characteristic of iranian speech, used to communicate and encapsulate matters not normally spoken explicitly . For example, for fluent english speakers phrase marital life may indicate all kinds of relationships within a marital framework, while in farsi zendegi - e - zanashoyi (literally marital life) has sexual connotations and is usually understood to mean the sexual relationship between husband and wife . Another difficulty in asking about sexuality during a study is the struggle between conscious embarrassment and sexual talk . By conscious embarrassment, we mean the shame, prohibition and modesty about sex . The majority of the women who participated in merghati - khoei's qualitative study pointed out that they were not culturally expected to be straightforward or frank in expressing sexual matters . For example, the sexual desire inventory tends to measure sexual desire as a biologic factor . Out of 14 items, 4 focus on masturbation and 2 items ask about having interest in casual sex . In iranian contexts, none of these 6 items would be posed by researchers or responded to by the participants . Why human have sex? (ysex) is another example, which measures number of variables . For instance, some of the items focus on motivations leading people to out - of - wedlock or casual sex . Although casual or extra marital sex happens in every society, questioning iranians about these behaviors is not ethically and religiously possible or feasible . This assertion is based on the common assumptions . In iran, people strongly hold onto the traditional culture of sexuality based on purity (paki), chastity (nejabat), honour (aberoo) and honesty (sedagat) underlying the family structure . There is also the belief commonly permeating iranian society that people are fairly innocent in terms of sexuality compared with non - muslim or western societies . However, with these assumptions we cannot minimize the impact of factors such as modernization, worldwide communication and cultural transformations in younger generations and the way they learn about sex, practice and develop their sexual understandings . Undoubtedly, these factors change behaviors and attitudes . Social conduct and religiosity define the ethical aspect of sexuality in the iranian culture . In iran the teachings of islamic principles tie strongly to shia interpretations, which form the basis for iranians understandings of sexuality . The expression of sexuality is considered legitimate only within the framework of islamic marriage (nikah). Moreover, as shown in merghati et al . Study, sexual obedience was seen as the primary goals of the committed muslim woman . The concept of nejabat (modesty) is the most important ethical code applied to an iranian woman who is not sexually expressive . In contrast, islamic scholar morteza motahari pointed out the islamic clear guidelines toward sexuality, leading neither to any sense of sexual deprivation and frustration, nor to any repressed or inhibited sexual desire . However, in the islamic doctrine freeing sexual desire and lifting of traditional moral restraints is not accepted . As a criterion, religiosity has significant effects on iranian women's sexual understandings; and that experts working in the fields of gender and sexuality need to be sensitive to the notion that some muslim women may not speak out their sexuality as an indicator of submission to religious codes, of modesty and of being an idealized muslim wife . In her linguistic analysis of sexuality expression of iranian women, merghati - khoei has revealed the ways of developing terminology and cultural explanations, which are juxtaposed with the exploration of the development of women's sexuality . Iranian women expressed their sexuality differently from western women even though they understood and talked about the same issues . . There is, however, a hesitation when it comes to discussing or reporting the emotional aspects of sexual encounters . The power of culture in dictating daily language for females has been highlighted in morocco as an arab - islamic context . Even though persian vocabulary, concepts and expressions about sexual matters exist in art, poetry and the beauty of nature, these linguistic resources are not applied in daily life to express sexuality . For example, the sexual attitude scale (sas), certainly a well - designed tool for use within many cultures measures a person's awareness toward her / his sexual interests and needs as well as sexual - self judgment . Communication of sexual needs or interests with others is another feature of this tool . As a neglected subject matter in the iranian culture, questioning people about their sexual needs and interests or sexual - self concept seems impractical . Sexuality is an unspoken issue, and individuals might not be linguistically skilled to communicate their sexuality with an interviewer . In sum, the art of using a rich vocabulary of metaphors and euphemisms is a characteristic of iranian speech, used to communicate and encapsulate matters not normally spoken explicitly . For example, for fluent english speakers phrase marital life may indicate all kinds of relationships within a marital framework, while in farsi zendegi - e - zanashoyi (literally marital life) has sexual connotations and is usually understood to mean the sexual relationship between husband and wife . Another difficulty in asking about sexuality during a study is the struggle between conscious embarrassment and sexual talk . By conscious embarrassment, we mean the shame, prohibition and modesty about sex . The majority of the women who participated in merghati - khoei's qualitative study pointed out that they were not culturally expected to be straightforward or frank in expressing sexual matters . For example, the sexual desire inventory tends to measure sexual desire as a biologic factor . Out of 14 items, 4 focus on masturbation and 2 items ask about having interest in casual sex . In iranian contexts, none of these 6 items would be posed by researchers or responded to by the participants . For instance, some of the items focus on motivations leading people to out - of - wedlock or casual sex . Although casual or extra marital sex happens in every society, questioning iranians about these behaviors is not ethically and religiously possible or feasible . This assertion is based on the common assumptions . In iran, people strongly hold onto the traditional culture of sexuality based on purity (paki), chastity (nejabat), honour (aberoo) and honesty (sedagat) underlying the family structure . There is also the belief commonly permeating iranian society that people are fairly innocent in terms of sexuality compared with non - muslim or western societies . However, with these assumptions we cannot minimize the impact of factors such as modernization, worldwide communication and cultural transformations in younger generations and the way they learn about sex, practice and develop their sexual understandings . Undoubtedly, these factors change behaviors and attitudes . Social conduct and religiosity define the ethical aspect of sexuality in the iranian culture . In iran the teachings of islamic principles tie strongly to shia interpretations, which form the basis for iranians understandings of sexuality . The expression of sexuality is considered legitimate only within the framework of islamic marriage (nikah). Moreover, as shown in merghati et al . Study, sexual obedience was seen as the primary goals of the committed muslim woman . The concept of nejabat (modesty) is the most important ethical code applied to an iranian woman who is not sexually expressive . In contrast, islamic scholar morteza motahari pointed out the islamic clear guidelines toward sexuality, leading neither to any sense of sexual deprivation and frustration, nor to any repressed or inhibited sexual desire . However, in the islamic doctrine freeing sexual desire and lifting of traditional moral restraints is not accepted . As a criterion, religiosity has significant effects on iranian women's sexual understandings; and that experts working in the fields of gender and sexuality need to be sensitive to the notion that some muslim women may not speak out their sexuality as an indicator of submission to religious codes, of modesty and of being an idealized muslim wife . To investigate sexual behaviors in an iranian context, we recognize the importance of identifying or developing an instrument to assess sexual behavior domains among women in the particular context of iranian culture . We thought that such an instrument would be essential tool for achieving a more systematic and in - depth understanding of iranian women's sexuality, may be useful in applied settings, and would advance sexuality research as a whole . No matter the context or use, however, measuring a construct such as sexual behavior is subjective and therefore entirely dependent on self - report . It has been argued that iranian women may not report properly if they believe sexuality has nothing to do with health . For example, a woman's inability to gain sexual pleasure due to painful intercourse might not be defined as a sexual health problem to be reported, whereas other people would consider it as a sexual health problem for the woman . This suggests the idea that the culture of sexuality affects people's interpretations of sexually related problems . Developing a contextualized instrument to measure the domains of sexual behavior would allow sexuality and gender researchers to better answer questions related to the influence of culture in those domains, sexual scripts across diverse cultures, and other factors influencing sexual health outcomes . In the 1970s, gagnon and simon's sexual conduct represented the first truly sociological analysis of sexual behavior . Gagnon and simon defined sexual behavior within a new theoretical framework of social scripts. They produced a critique that moved us beyond the objective definition of sexual behavior: our concern here is to understand sexual activities of all kinds as the outcome of a complex psychological process of development, and it is only because they are embedded in social scripts that the physical acts themselves become possible it is neither fixed by nature or by the organs themselves . The very experience of sexual excitement that seems to originate from hidden internal sources is in fact a learned process and it is only our insistence on the myth of naturalness that hides these social components from us . The character through a cultural scenario in which they take up, internalize and enact culturally prescribed normative roles; interpersonal scripts in which they make a suitable identity based on desired expectations and intrapsychic scripting in which they make the self in relation to social life . Thus, sexual practice is separated from the biology of the body and one's sexuality is strongly formed by the very complex social world . Having investigated the history of human sexuality, we believe sexuality is influenced by the society, culture and era in which people live . Within an iranian context, we therefore recognized existing instruments targeting non - risky sexual behaviors among heterosexual women are insufficient to measure sexual behaviors . We categorized instruments as culturally compatible or incompatible based on the sexuality domains they tend to measure . The instruments, by which the biological aspects of sexual behaviors are measured were found applicable for any given community or population, the iranian context included . Alternatively, those measuring outcomes related to subjects attitudes, understanding or sexual scripts were identified as culturally incompatible . Most of the tools seem reasonable candidates for use in the iranian culture and society with minor revisions [table 1]. Review of these instruments shows that most of them are functional based, such as the most used scale in literature, (fsfi). Other well known tools, such as the arizona sexual experience scale (asex) and the golombok - rust inventory of sexual satisfaction (griss), are also functional based . Some other tools are problem - focused [table 3] and specific to measure only disorder - based outcomes . We argue that the medically oriented instruments employed in the field are drawn from concepts and meanings based on investigations conducted in western societies . Yet as researchers, we sometimes found ourselves disappointed by the level of difficulty, which we professionals encountered in fitting our participants into those biomedical frameworks . The culture - bound nature of sexuality limits the research - based information in iran . In our society, the lack of information in the sexual domain will be most productively addressed first through research attention to subjective concepts . Lack of sufficient knowledge in the field of sexuality in iranian contexts, makes it important to identify normative sexual behaviors qualitatively before applying problem - oriented tools in research . There are social and cultural challenges arising from the recognition that iranians use culturally specific sexual expressions . These expressions may construct different ways of perceiving sexuality that are not easily translatable or even understandable by outsiders . This means that sexuality is a complex phenomenon embedded in various meanings and understandings, not merely objective and measurable behavior . Explaining those meanings and perceptions makes sexuality a dynamic phenomenon through one's life time . How we know what we know changes periodically and therefore, creating an epistemological crisis in knowledge as well as the research process . However, scholars in science and human behavior such as skinner have powerfully questioned the reliability of subjective measures of private events such as sexual behaviors . We concluded that the published instruments are well - designed and used worldwide; however, we must also acknowledge that the sexual scripts of iranian women define sexual behaviors differently, limiting their communication in the research setting and compromising the compatibility of these instruments . Therefore, exploring and analyzing the lexicon and expressions used by the iranian women creates a ground for developing a culturally comprehensive measure, which can adequately examine how these women explain their sexual behaviors. |
The 2,6-bis (1.1-dimethylethyl)-4-methylphenol (bht), also known as butylhydroxytoluene, is a lipophilic (fat soluble) organic compound that is primarily used as an antioxidant food additive as well as in cosmetics, pharmaceuticals, jet fuels, rubber, petroleum products, and electrical transformer oil . Bht is prepared by the reaction of p - cresol (4-methylphenol) with isobutylene (2-methylpropene) catalysed by sulfuric acid . The species mesembryanthemum crystallinum (family: aizoaceae, order: caryophyllales), also termed the common ice plant, has emerged as a model organism in plant molecular physiology . The plant's rise to relative fame started with the serendipitous discovery of a stress - inducible switch from c3 photosynthesis to crassulacean acid metabolism (cam) [5, 6]. A second major area of interest centres on the plant's extreme stress tolerance, particularly tolerance to high salinity . The plant thrives in coastal area under climatic conditions characterized by short, cool, moist winters and long dry summers . Mesembryanthemum crystallinum shows five distinct growth phases during its life cycle (i.e., germinating seedlings, juvenile, adult, flowering, and seed forming). Historically, physicians used leaf juice to soothe inflammation of the mucous membranes of the respiratory or urinary system . In europe, the fresh juice has been used to treat water retention and painful urination and to soothe lung inflammation . During normal metabolism, plants generate reactive oxygen species (ros), including superoxide radical (o2), hydrogen peroxide (h2o2), hydroxyl radical (ho), and singlet oxygen (o2). Ros are overproduced in plants under stress, including drought and desiccation, salt stress, chilling, heat shock, heavy metals, ultraviolet radiation, air pollutants, such as ozone and so2, mechanical stress, nutrient deprivation, pathogen attack and high light stress . To mitigate the oxidative damage initiated by ros, the aim of this study is to select a method for a better extraction of bht from the leaves of the halophyte plant mesembryanthemum crystallinum . The leaves of the halophyte plant mesembryanthemum crystallinum were collected from their natural biotope in the two periods june 2007 and december 2008 (figures 1 and 2). Method 1 (sanches et al .) 10 g of plant leaves were mixed in the presence of acetonitrile (2 ml) and hexane (20 ml), after centrifugation 10 minat 1,036 g, organic fraction was suppressed . The bht concentration of the extract was determined in the different plant growth stages in parallel with the antioxidant activity . 10 g of plant leaves were mixed in the presence of acetonitrile (2 ml) and hexane (20 ml), after centrifugation 10 minat 1,036 g, organic fraction was suppressed . The bht concentration of the extract was determined in the different plant growth stages in parallel with the antioxidant activity . Method 2 (bouftira et al .) 25 g of plant leaves were mixed in the presence of methanol 80% containing ascorbic acid 50 mm . After centrifugation, 14000 g, at 4c, the supernatant was collected . 25 g of plant leaves were mixed in the presence of methanol 80% containing ascorbic acid 50 mm . After centrifugation, 14000 g, at 4c, the supernatant was collected . Free radical scavenging activity of plant extract was determined by using a stable free radical, (1,1-diphenyl-2-picryl - hydrazyl) dpph . Dpph solution was prepared at a concentration of 0.024 mg / ml in ethanol . During assay, 1 ml of the crude extract was mixed with 1 ml dpph solution . The mixture was incubated in the room temperature for 30 min; absorbance was recorded at 517 nm (cam spec m230/330 uv visible spectrophotometer, uk). Synthetic butylated hydroxytoluene (bht) was used as a standard for the investigation of the antiradical activity . The percentage of remaining dpph (% dpph rem) at the steady state was determined as follows:% dpph rem = 100 cdpph / cdpph (t = 0), where cdpph (t = 0) is the initial dpph concentration and cdpph is the dpph concentration at the steady state . A hewlett packard 1100 analytical hplc was used with a gradient elution method; within 2 min, the mobile phase was acetonitrile - water (65 + 35), after which the acetonitrile was raised to 100% within 15 min . The total runtime of each analysis was 30 min to ensure cleaning of the column between samples . The flow rate was 1 ml / min and the injection volume 20 l . Bht was identified by comparison of its retention time and uv spectra with those of an injected pure standard in the hplc method . The concentration of bht was determined in g / ml / g of fresh leaves (figure 1). Bht spectra were detected at 280 nm by analytical hplc (figure 2); the different spectra were compared between the plant growth stage and the bht standard (10 mg / ml). The results (figure 3), by using method 1 of extraction showed that the seedlings stage has the highest antiradical activity (65,24 0,27). Figure 4 showed the comparison of antiradical activity between the two methods (method 1 and 2). At the same plant growth stage (floraison), the extraction by method 1 has higher antiradical activity (51 0,82) in comparison with method 2 (32,33 2,05). The results showed that mesembryanthemum crystallinum extract at seeds stage has the highest bht concentration . At this period, the plant leaves are purple resulting from tolerance to stress of environment . In the seeds stage the light stress can attribute in part to stimulate the plant for the synthesis of bht . It was proved that m. crystallinum after irradiation with high light irradiance displays a rapid cell - specific accumulation of plant secondary metabolites in the upper leaf epidermis: a phenomenon that is not detectable with salt or drought stress . The results of this study showed also that the method of extraction influences the yield of bht . The method using hexane and acetonitrile is better than that using methanol 80% for bht extraction . The extraction method must allow complete extraction of the compounds of interest, and it must avoid their chemical modification . Water and aqueous mixture of ethanol, methanol, and acetone are commonly used for plant extraction . The purple - coloured dpph is a stable free radical, which is reduced to a, a - diphenyl - b - picrylhydrazine (yellow coloured) by reacting with an antioxidant . Antioxidants interrupt free radical chain oxidation by donating hydrogen from hydroxyl groups to form a stable end product, which does not initiate or propagate further oxidation of lipids . The data obtained showed that the antioxidant activity was higher at seedlings stage in comparison with the other plant stages . In fact, m. crystallinum accumulates more bht at floraison stage in comparison with seedlings stage . The plant accumulates, at seedlings stage, other antioxidant compounds which work in association with bht . At the floraison stage, this study also showed that the method of extraction is in relation with the antioxidant activity . The method using hexane and acetonitrile (51 0,82) for extraction showed higher antioxidant activity than those using methanol 80% (32,33 2,05). Many medicinal plants are investigated for their antioxidant activity in relation with the methods of extraction and the solvent used . It was found that higher amounts of polyphenols and anthocyanins are found in methanol and ethanol extracts than in water extracts . It means that they are more efficient in cell walls which have unpolar character and cause polyphenols to be released from cells . More useful explanation for the decrease is ascribed to the enzyme polyphenol oxidase, which degrades polyphenols in water extracts whereas in methanol and ethanol they are inactive . In conclusion, the results of this study are very important; we obtained a better method for bht extraction. |
Brain abscess in young infants is extremely rare and usually associated with a previous history of bacterial meningitis or septicemia . Here we report a cerebellar abscess mimicking brain tumor with atypical clinical and paraclinical presentations . A two - month old previously well - baby boy was referred to us with persistent vomiting, strabismus and developmental regression . The brain imaging showed a right cerebellar mass with multiple small cysts inside the lesion . Elevated serum alfa - fetoprotein associated with cystic and solid posterior fossa mass proposed the preoperative diagnosis of teratoma but tumor cells were not found inside the pathology specimen . The interest of this case lies in the atypical features of clinical and radiological evaluations in a young infant associated with an abnormal alfa - fetoprotein level of serum . Intracranial mass lesion in early infancy is very rare which may include hemorrhage, infection (abscess), congenital or developmental disorder and brain tumors[1, 2]. Alfa fetoprotein (afp) has an important role in the initial diagnostic evaluation as well as in the follow - up of these tumors . Brain abscess is a focal, intracerebral infection that begins as a localized area of cerebritis and develops into the collection of pus surrounded by a well - vascularized capsule . Uncommonly in children, it occurs after infection of a contiguous structure, such as otitis, sinusitis and mastoiditis or as a result of hematogenous spread from a remote site, especially in children with cyanotic congenital heart disease or after meningitis[4, 5]. Here we report a rare cerebellar abscess in a very young infant which mimicked a tumor in laboratory and radiological investigations . A 2-month old male infant was presented to children's medical center with enlarging head circumference, persistent vomiting, strabismus and developmental regression since two weeks ago . He was the second child born from non sanguineous parents by cesarean section due to being repeated . He found two and four centimeters head enlargement during the first and second month of life respectively . At admission his vital signs were stable . The child was irritable with wide and tense fontanel and a setting sun eye was present . The anterior fontanel was 45 cm wide and the posterior fontanel measured around 1 cm . He had no prior history of fever, skin infection, ear discharge, trauma or bleeding tendency . Examination of central nervous system did not reveal any cranial nerve palsy or focal neurological deficit except for right side vith nerve palsy and setting sun eye . Cardiovascular and respiratory system were within the normal limits except for small patent foramen ovale that was suggested to be managed conservatively . Hemoglobin was 12mg/100ml, white blood cells count were 12170/mm with 72% polymorphs, 1% band cells, and platelets 300,000/mm . Gr / l (reference range for this age: 0 - 20 gram / l) and coagulation tests were normal . Cerebrospinal fluid (csf) taken from ventricles was totally normal without high afp level . Brain computed tomography scan revealed left cerebellar hypodense non - homogenous mass with severe hydrocephalus and periventricular edema . Magnetic resonance imaging (mri) demonstrated a right cerebellar non homogenous mass, which occupied most part of the right cerebellum; it had cystic and solid components, isointense in t1-weighted and isointense to hyperintense in t2-weighted images with patchy ring enhancement . The lesion was herniated from the foramen magnum (figs . 1, 2). Sagittal view, t1 weighted image reveals hypo to isointense cystic and solid mass of posterior fossa with hydrocephalus . Sagittal view after gadolinium injection shows irregular ring enhancement of the cystic part a cerebellar tumor, most probably teratoma, was thought to be the most likely diagnosis . A purple gray mass was evident from the surface, no cerebellar cortex was found at the surface . The mass destroyed all right cerebellar tissue except for the superior surface and extended to the lateral wall of fourth ventricle . Postoperative period was unremarkable except for partial right facial nerve paresis and occasional fever that recovered after one week with antibiotics . Staphylococcus aureus was cultured from the cyst material that was sensitive to vancomycin and amikacin . Treatment was carried out with vancomycin 60 mg / kg in four divided doses and amikacin 15 mg / kg in three divided doses for 4 weeks . Pathological examination revealed granulation tissue, fibrosis, inflammatory infiltration and gliosis without any tumor cells inside the specimen . Hiv elisa and assessment of cellular and humoral immunity to rule out immunodeficiency were normal . We have reported a young infant with staphylococcal cerebellar abscess that mimicked tumor according to elevated serum afp and neuroimaging . Ring - enhancing lesion in the cerebellum can be inflammatory or neoplastic process which should be differentiated due to different treatment and prognosis . Alfa - fetoprotein is a glycoprotein produced in the embryonic liver, intestine and yolk sac . The normal half - life of afp is around 4 - 6 days, disappears rapidly after birth and approaches to adult level after about the 10th month of life . An elevated serum afp strongly suggests the presence of primary liver cancer or germ cell tumor[2, 3]. Brain abscesses include 2 - 5% of intracranial mass lesions, mostly located in the cerebrum but involve cerebellum uncommonly . The most common causative organisms are gram - negative bacteria (proteus, klebsiella, citrobacter) in the first months of life while staphylococcus aureus is rare[36]. Usually infant's status is not good and in spite of all evolution in the diagnosis and treatment the morbidity and mortality are still significant in this age group . Bacteria can reach to the intracranial space through hematogenous spread, meningitis, penetrating trauma, surgery, or local spread from the paranasal sinuses, mastoid air cells or emissary veins[4, 5]. Cerebellar abscess in the children is seen mostly subsequent to otogenic diseases with high mortality and morbidity due to inability to control the infection and posterior fossa compression . Cerebellar symptoms and neurological problems of intracranial hypertension due to 4 ventricle compression are expected signs and symptoms of cerebellar abscess but young infants and neonates may not exhibit these neurological symptoms . The child was a well baby since two weeks before admission without any history of infection . The abscess in this patient was an established lesion with severe damage to adjacent cerebellum that could show a long standing infective process and suggest hematogenous spreading of infection at first days of life or even from placenta in the prenatal period . It can be proposed that bacteria find access to intracranial space through patent foramen ovale . Although it is suggested that in young infants breast milk can be a source for staphylococcus related infections . Afp levels 4 or more orders of magnitude above normal range in young infants but the level was more than 10 order of magnitude in this patient . It is suggested that the afp half life can be longer than normal in some persons specially in low - birth - weight infants which cause higher level of afp in these infants . There was no history of liver disease or low birth weight and the level of afp decreased significantly after surgery . So we do not have any explanation for this high level of afp in this rare case of cerebellar abscess . A young infant with staphylococcus cerebellar abscess is reported which mimicked tumor due to elevated serum afp and neuroimaging . High afp has not been reported in abscess nevertheless and there is no reason for this high level of afp in this rare case of cerebellar abscess . To find an explanation for this association we propose evaluation of afp in young children with brain abscess . If this association is justified afp can be considered as a marker to follow the course of the disease. |
Traumatic abdominal wall hernia (tawh) has been defined as herniation through disrupted musculature and fascia associated with adequate trauma, without skin penetration, and no evidence of a prior hernia defect at the site of injury . They are rare and over the past century 50 have been reported in the literature . Some reports advocate a conservative approach with operative intervention at a later stage if indicated, whereas others have promoted immediate surgical intervention . We present a case of a 27-year - old male with significant disruption to his anterior abdominal wall with associated thoracoabdominal injuries who was managed operatively . A 27-year - old male with no past medical history was the driver and sole occupant of a car which crashed through a fence at 80 kph and hit a lamp post . He was wearing a seatbelt, the airbags did not deploy and despite the significant intrusion into the passenger space, he extricated himself unaided . The primary survey identified decreased air entry at the base of the right lung and right - sided abdominal and lower chest tenderness . Abrasions were evident over the anterolateral abdominal wall and a large, right - sided abdominal swelling was noted . Trauma series computed tomography (ct) scans demonstrated a flail segment between the sixth and eight ribs with disruption of the intercostal muscles and a small right haemothorax (fig . The right abdominal wall was ruptured the right rectus abdominis muscle had been torn from its costal attachments to the midpoint . The hepatic flexure of the colon had herniated through the intercostal muscles of the eighth and ninth ribs and was lying adjacent to the fractured ribs (fig . 1c). Both small and large bowel had herniated through the abdominal wall lateral to rectus abdominis, but remained covered by external oblique (fig . Herniation of small and large bowel immediately adjacent to the fractured ribs raised the suspicion of occult bowel injury not detected on ct . Figure 1:(a d) initial ct imaging performed as part of the secondary survey . (a d) initial ct imaging performed as part of the secondary survey . The ribs were re - opposed with absorbable polyglycolic acid sutures and a chest drain inserted . At laparotomy, it was noted that the hernia sac contained omentum, the bowel having reduced spontaneously under general anaesthesia . A small rent in the mesentery of the proximal small bowel was noted . The abdominal defect was repaired with a 20 30 cm sheet of cross - linked acellular porcine dermal collagen (permacol, covidien, gosport, hants, uk) which was sutured to the margins of the fascial defect with interrupted nylon sutures, using a bridge technique, with a 5-cm underlay on the left . Post - operatively, the patient was managed in the intensive care unit for 24 h. a seroma that developed at the hernia site after 1 week was treated conservatively . Sitting up from lying down position and hip flexion caused difficulty, but improved with intensive physiotherapy . He had a persistent seroma at the hernia site . A repeat ct of the thorax and abdomen at 10 weeks demonstrated no residual defect in the anterior abdominal wall and resolution of the seroma (fig . 2). Tawh remains a rare clinical entity and insufficient evidence exists to provide clear protocols for surgical management . There are three key issues in managing this condition: whether to operate or not, which reconstructive technique to use and which mesh to use, if any . There are case reports where a conservative approach has been adopted, although these are mainly in the paediatric group and are secondary to handlebar type injuries with minimal disruption to the abdominal cavity [3, 4]. A conservative or delayed operative management strategy for low energy tawh may be feasible, but high - energy tawh are often associated with significant intra - abdominal injuries and an operative approach via midline laparotomy has been advocated . For incisional hernia repair, the use of mesh has become the gold standard because of a significant reduction in recurrence rates compared with primary suture repair . Synthetic meshes are, however, associated with complications including erosion, fistulation and chronic infection . Due to the potential for contamination in cases of high - energy tawh repair, a primary suture repair technique has been recommended by some authors because of the high (50%) wound infection rate even when mesh was not used . Primary suture repair may not be feasible if there is substantial domain loss . It would also be contraindicated if the lateral abdominal wall muscles have retracted and require component separation, as in our case . The potential for contamination, high rates of wound infection and the need to place mesh adjacent to recently herniated bowel raises a debate between the merits of synthetic and biologic meshes . Abdominal wall repair with both absorbable and non - absorbable synthetic meshes in the presence of contamination has led to high rates of mesh infection, fistulation and even death . Biologic meshes provide a collagen scaffold for native tissue to infiltrate and they are remodelled over time . A recent systematic review has demonstrated that cross - linked biologic meshes can be used with low rates of hernia recurrence and few complications . We utilized cross - linked acellular porcine dermis (permacol, covidien, gosport, hants, uk), which has been reported to have a degree of resistance to bacterial collagenase activity and the optimum durability for effective hernia repair whilst still allowing native tissue ingrowth . Management strategies should be tailored to the individual patient, but tend to favour operative intervention . In view of the high risk of wound infection there are case reports where a conservative approach has been adopted, although these are mainly in the paediatric group and are secondary to handlebar type injuries with minimal disruption to the abdominal cavity [3, 4]. A conservative or delayed operative management strategy for low energy tawh may be feasible, but high - energy tawh are often associated with significant intra - abdominal injuries and an operative approach via midline laparotomy has been advocated . For incisional hernia repair, the use of mesh has become the gold standard because of a significant reduction in recurrence rates compared with primary suture repair . Synthetic meshes are, however, associated with complications including erosion, fistulation and chronic infection . Due to the potential for contamination in cases of high - energy tawh repair, a primary suture repair technique has been recommended by some authors because of the high (50%) wound infection rate even when mesh was not used . It would also be contraindicated if the lateral abdominal wall muscles have retracted and require component separation, as in our case . The potential for contamination, high rates of wound infection and the need to place mesh adjacent to recently herniated bowel raises a debate between the merits of synthetic and biologic meshes . Abdominal wall repair with both absorbable and non - absorbable synthetic meshes in the presence of contamination has led to high rates of mesh infection, fistulation and even death . Biologic meshes provide a collagen scaffold for native tissue to infiltrate and they are remodelled over time . A recent systematic review has demonstrated that cross - linked biologic meshes can be used with low rates of hernia recurrence and few complications . We utilized cross - linked acellular porcine dermis (permacol, covidien, gosport, hants, uk), which has been reported to have a degree of resistance to bacterial collagenase activity and the optimum durability for effective hernia repair whilst still allowing native tissue ingrowth . Management strategies should be tailored to the individual patient, but tend to favour operative intervention . In view of the high risk of wound infection |
Genome - wide association (gwa) analysis has provided the first effective strategy to allow a systematic dissection of the genetic basis of common, complex, multifactorial traits . Although for many of these we remain some distance from a complete enumeration of causal mechanisms, there have already been substantial advances in understanding of disease - the role of autophagy in inflammatory bowel disease and cell adhesion in autism, for instance . However, for most common traits the proportion of the overall phenotypic variance explained remains small, limiting the extent to which prediction of individual disease risk is possible . There is growing speculation about the mechanisms that might account for the substantial proportion of trait heritability that remains to be characterized . This speculation has repercussions well beyond recondite theoretical discussion about the genetic architecture of complex traits . With advances in technology (particularly next - generation sequencing) and growing enthusiasm for funding large - scale gene discovery efforts, hypotheses about the nature of this so - called' genetic dark matter' have a direct bearing on research strategies . Recently, this debate has seemed increasingly polarized between those who feel a continued search for common susceptibility variants is of limited value, because all that remains to be found are variants of vanishingly small effect, and those who feel that, pending reductions in costs that will allow high - quality, whole - genome sequence data to be generated in adequately powered sample sizes, there is virtue in persisting with an approach of proven worth . There is good reason to assume that this' dark matter' is neither an illusion created by inflated estimates of heritability nor the consequence of marked non - additivity of effects . If so, then the sum total of genetic variance should largely be explicable in terms of the main effects of all the risk alleles of various types (single nucleotide polymorphisms, indels, copy number variants (cnvs) and inversions), allele frequencies (rare, low - frequency and common) and effect sizes . So far, the only parts of this' space' explored systematically are those occupied by rare, penetrant alleles (principally through linkage analysis of monogenic phenotypes) and common, mostly low - effect alleles (accessible through gwa analysis). As we seek to make sensible decisions about the direction of future discovery efforts - in terms of the characteristics of the variants we are seeking and the technologies we should use to find them - we need to understand what the exploration of the' known' genetic landscape can tell us about the parts that remain largely uncharted . One long - standing view is that complex trait susceptibility is predominantly a matter of common variants . Common variants collectively account for most individual variation in dna sequence, and the same might be expected to be the case for phenotypic variation . If true, the results of gwa studies so far indicate that most of the as - yet - undiscovered variants must (in europeans at least) have very small effects, because the high coverage and large sample sizes used will have left few, if any, large common - variant effects undiscovered . Evidence (for example, from large - scale meta - analyses) is, for many traits, consistent with the notion of a long' polygenic tail' of small effects, but it remains unclear how much of overall heritability can be explained under this model . The idea that complex - trait susceptibility involves a very large number of variants of modest effect has led some to suggest that the value of all such discoveries is diminished, on the basis that one learns little about the biology of disease if too many genes are implicated . However, for many phenotypes, the overall salience of the loci of greatest effect emerging from gwa studies (the pathways implicated and the relationships to monogenic forms of the same traits) argues forcefully against such a nihilistic interpretation . The contrasting viewpoint holds that common - trait susceptibility derives mostly from the action of rare or low - frequency variants . Although such variants account for less individual sequence variation than common variants, there may be a disproportionate effect on disease susceptibility . The more recent origin of low - frequency variants may allow alleles with more dramatic phenotypic effects to be represented in the population . Also, large - effect alleles may cause phenotypic disturbances that are not as easily buffered by compensatory changes during development as are well tolerated, small - effect, common - variant alleles . Recent evidence that large, rare cnvs are associated with behavioral and psychiatric disease phenotypes supports this view . Some argue that such a rare variant architecture is precisely what one would expect for diseases causing low reproductive fitness, though this rationalization fails to explain the high yield of common - variant signals reported for other diseases, such as type 1 diabetes, that were, until recently, fatal during early life . It has even been suggested that many of the common - variant associations discovered by recent gwa studies may turn out to be due to the concerted action of multiple low - frequency and rare causal variants . The nod2 (card15) signal for crohn's disease indicates that this is certainly possible . For many diseases, however, evidence that common - variant associations are consistent across multiple ethnic groups represents a strong counter to such a model: one would expect the linkage disequilibrium patterns around recent rare and low - frequency causal variants to result in far more inter - ethnic heterogeneity than is actually observed . Although both extreme positions have merit, the likelihood is that, for most diseases, the architecture of predisposition features causal variants that have a wide range of allele frequencies and effect sizes . For most complex traits, the absence of compelling signals from linkage studies conducted in families segregating multifactorial diseases imposes an upper bound to feasible effect sizes; even so, it is easy to show that a limited number of low - frequency susceptibility alleles of medium effect could go a long way to explaining missing heritability . For example, the effect of a low - frequency variant with a population minor allele frequency of 1% and a per - allele odds ratio of 3, when measured in terms of sibling relative risk (a commonly used measure of familial aggregation), exceeds that of the largest common - variant effect known for type 2 diabetes (around tcf7l2). Twenty such variants across the genome would account for most of the unexplained heritability for this condition . Such a constellation of variants could provide a respectable tool for individual disease prediction, and the variants discovered would (because of their relatively large effect size) be valuable resources for detailed molecular and physiological study . The extent to which variants with these characteristics are segregating in the population remains unknown, but this is an area in which the combination of next - generation sequencing technologies and large - scale association analysis provides a powerful stimulus to discovery . Early results of this approach (such as the identification of low - frequency variants within the ifih1 gene that have a marked effect on type 1 diabetes susceptibility) are encouraging . Ultimately, we can expect large - scale, high - depth, genome - wide sequencing to enable the systematic exploration of the entire allele - frequency, effect - size space and provide empirical resolution of many of these issues . However, there remain serious financial, logistical and analytical barriers to the implementation of this technology, and the number of such experiments that could be supported by the major funders is, for the time being, limited . All this means that, for the next few years, the power of next - generation sequencing will need to be used carefully if a profusion of underpowered discovery efforts is to be avoided . Efforts targeted to specific genomic regions (around particular candidate genes or pathways or exons across the genome, for example) are attractive because high coverage of the selected areas in large sample sizes can be generated at reasonable cost . Whole - genome sequencing will, for now, be restricted to low - pass coverage across respectable sample sizes, or high - depth coverage in smaller, highly selected, phenotypically extreme sample sets . The genomic distribution of disease - effect loci will have a major impact on the success of these alternative approaches (figure 1). If the low - frequency and rare variants influencing a given trait are disproportionately located in the same loci as the common variants that have been found to date, then targeted follow - up of regions revealed by gwa studies will be a powerful approach, and extending the range and scope of gwa analysis (to other ethnic groups, for example) should be a particularly efficient strategy . If, on the other hand, the' dark matter' variants have little positional (or biological) overlap with those already known, then genome - wide resequencing is likely to be the only practical way to find them . The evidence so far (overlap between monogenic and multifactorial loci; growing numbers of loci with multiple independent association signals; extensive pleiotropy, and so on) provides some support for the former view . Effort in tracking down common susceptibility variants, as well as being valuable in its own right, should therefore guide researchers towards other types of causal variants . Two possible versions of the state of nature are presented (see text). In one (' even'), causal variants differing in terms of allele frequency (color scale) and effect size (height of bar) are distributed randomly across the genome: the location of common - variant (red / orange) associations of modest effect provides no guide to the location of lower - frequency variants (yellow / green), some of which have quite large effects . In the other (' lumpy'), causal variants congregate around certain genomic positions (' genes'): gwa studies that reveal the location of the common - variant associations will also reveal the positions of lower - frequency variants, and the proportion of disease biology explained by the loci discovered through gwa studies will be far greater than the proportion of variance explained would suggest . With only limited empirical data to guide future locus - discovery efforts, extrapolation from the modest proportion of genetic variance so far explained is fraught with danger . The menu of possible research strategies is large, but each choice makes some implicit assumption about the characteristics of the variants being sought and the genomic architecture of the disease under consideration . Given uncertainties over the true state of nature, it is difficult to say which approaches will be most productive . This argues for open minds, a healthy disdain for orthodoxy, and careful exploration of the technological and methodological options . At the same time, it is important that the next wave of large - scale discovery efforts is designed so as to test assumptions about trait architecture and technological performance so that lessons of generic value to the field can be learned . I thank the many colleagues around the world who contributed to the discussions that informed this article. |
Diabetes mellitus (dm) is a medical disorder which affects an increasing large proportion of the population across different age groups . Though it is prevalent globally, it poses a particular health challenge in resource constrained low and middle income countries . The two commonest forms of the disorder, diabetes type i (t1 dm) and type ii (t2 dm) have different pathophysiological mechanisms . Dm affects multiple organ systems and is associated with poor quality of life and even reduced life expectancy . It has been suggested that diabetes (both t1 dm and t2 dm) is associated with increased occurrence of certain psychiatric disorders . Suicidal ideas as well as suicide attempts are potentially life threatening psychiatric emergencies that occur more frequently in patients with dm than in the general population . Many studies have focused on the relationship that dm shares with psychiatric disorders, especially depressive disorder . This narrative review was conducted to understand the existing literatures on relationship between diabetes and suicide . We aimed at reviewing the literature on rates of occurrence of suicidal ideas and attempts in patients with diabetes, the risk factors for suicidality, the common and unique methods for suicidal attempts in such patients, and management of such patients . Pubmed (including pubmed central) and google scholar were used to identify published studies . Searches were carried out using medical subject headings (mesh) terms diabetes mellitus and suicide. Additional searches were carried out using related keywords of articles were evaluated and were classified according to the broad subject related to suicidality in dm . Further studies were identified using cross - references from the identified text and by going through the related citations . The full - texts of the identified studies were obtained and assessed for their content . The manuscripts were categorized according to broad themes like epidemiology, elaboration of risk factors for suicide, and management issues . Discrepancies in the interpretation of the literatures were resolved through mutual discussion between the authors . The studies that have assessed the occurrence of suicidal ideas, attempts and deaths in patients with dm have been summarized in [table 1]. Studies assessing occurrence of suicidal behaviour in patients with diabetes mellitus studies have assessed suicidal ideations using different tools including structured interview schedules such as mini international neuropsychaitric interview (mini), rating scales (such as beck depression scale suicidality item), and a single question relating to suicidal ideations . The size of the population assessed have varied from less than 100 to over 80,000 . Studies have come mainly from scandinavian countries and usa, though there are few studies from other countries too . The rates of suicidal ideation and suicidal attempt has been reported to be as high as 26.4% and 13.3%, respectively . Some of the studies focusing on suicidal ideation and attempts in patients with dm have found that suicidal risk is higher in patients with diabetes . However, two studies have found that patients with diabetes had lower rate of suicidal ideation as compared to healthy controls and patients with other medical disorder . Depression has been reported to be the most common psychiatric disorder in persons with dm who attempted suicide . Data about suicide completers among the patients with dm have primarily come from cohort studies and studies based on health registries . The proportion of cases reported to be due to suicide has varied from 0.55% to as high as 40% . Most of the studies which have reported rates of suicides in t1 dm population has given vales in the range of 5 - 15% . The low rate found in one specific study could be ascribed to the fact that this study looked exclusively at t2 dm cases where mortality can result due to a host of medical complications due to diabetes or other concurrent medical illnesses . Standardized mortality rate (smr) provide a better approximation in such situations as it looks at comparison with the age specific mortality . There too, diabetes has been associated with smr of more than one, which suggests greater mortality rates in this population especially males . Many demographic variables have been explored for putative association with suicidality in patients with dm . Males seems to have a greater risk in completing suicides . In a sample of patients from nigeria, the study conducted on 646 patients with dm found suicidality to be significantly associated with poorer glycemic control . A large korean study has shown that depression acts synergistically with diabetes in increasing the chances of having suicidal ideations . Other psychological factors like stress have also been suggested to play a role in suicidal ideations and attempts in patients with dm . Multivariate analyses has showed that female sex, severity of childhood abuse, history of alcohol abuse, and depression were significantly and independently associated with having attempted suicide . The literatures relating to risk factors for suicidal behavior among patients with dm is not very extensive . However, it has been reported that probably risk factors related to suicide in general and those of chronic medical illnesses do apply in context of dm as well . Risk factors can be inherent to the patient's characteristics like coping skills, personality profile, additional psychiatric illness including depression and alcohol use disorder, and presence of hopelessness . Past history of suicide attempt and family history of completed suicide present additional risk factors . This is compounded by illness related and situational risk factors like lack of social support, adverse life events, exacerbation of the illness and gradual accrual of diabetes related complications . Access to means of self harm is another factor which determines whether a suicidal plan is executed or not . A range of risk factors and protective factors determine the overall suicidal risk in a particular patient and the reader is referred to more comprehensive sources for understanding of suicide risk factors in general . [figure 1] provides a simplistic model of how different factors aggregate to confer suicidal risk . A simplistic model to explain how different factors aggregate towards risk of suicidal behaviour patients with dm present some unique characteristics of suicide attempts . This can be ascribed to easy availability and accessibility to a potentially lethal means of suicide in the form of injectable insulin . Subcutaneous or intravenous injection of insulin can cause hypoglycemia which can cause death if it is severe and lasts for a prolonged period of time . Biguanides, like metformin, can cause lactic acidosis when taken in larger than necessary amounts . [table 2] provides a list of the medications that have been used for suicidal attempts . Medications for diabetes treatment that have been reported to be used for suicidal attempts as evident from the table, insulin has been widely used in suicidal self - harm attempts in patients with dm . Probably, the first report of use of high dose of insulin with a suicidal intent in a diabetes patient dates back to 1934 when a 50-year - old female patient consumed 400 u of insulin apparently being depressed due to financial issues . Subsequently, there have been reported cases of suicidal self - administration of insulin where the patients had recovered fully after prompt medical treatment . Not only regular insulin, but its congeners like insulin glargine and lispro have also been used for self - harm attempt . Use of insulin as a means of suicidal attempt seems to be more common in patients with t1 dm than t2 dm . This could be due to the fact that t1 dm can only be treated with insulin and consequently is more regularly accessible to these patients . For treatment of patients with t2 dm, many other pharmacological agents are prescribed which cannot be administered through an invasive route . Information about the use of oral anti - diabetic mediations for self harm has come mainly from case reports . Oral medications like glipizide and gliclazide have been used for attempted suicide in patient with dm . Metformin has been used in massive quantities with an intent to self - harm in a few patients . Use of excess doses of metformin results in lactic acidosis which may result in cardiac arrest and even death . Other medications that have been used in excess quantities with suicidal intent include liraglutide, phenformin, and sitagliptin . Apart from the above, suicidal attempts in patients with dm have involved excess consumption of sugary substances leading to hygerglycemic state . A case of fatal self - induced hyperglycemia by drinking excess amounts of sugared tea has been reported for a 15year - old boy with diabetes . Similarly, a case of fatality has been reported with the use of sugary solution in a patient with dm . There have been reports of use of other medications, notably psychotropics, like antidepressants and antipsychotics, for suicidal attempt by patients with dm . Danger of abuse of antidiabetic therapy for suicidal attempts is not confined to the patient, but even extends to the other family members who live along with the patient . Use of insulin and other medications for treatment of dm has also been described in family members who had taken the patient's medications for suicidal attempt . Suicide risk assessment can be conducted as a part of screening for depression or otherwise . Many brief screening questionnaires for depression like primary health questionnaire-9 (phq- 9) and beck depression inventory (bdi) have questions relating to suicidal ideation . Specifically asking about current suicidal ideas directly (and not in a roundabout indirect manner) it has been seen that asking about suicidal ideas do not implant such ideas in the person assessed, but missing on such questioning due to hesitation on the part of the therapist may lead to missed opportunities to screen for suicidal behavior . Specific instruments to assess suicidality are also available for comprehensive assessment of patients with suicidal ideation sad persons is a mnemonic that can be used for remembering the risk factors for suicide and includes male sex, older age, depression, previous attempt, ethanol abuse, rational thinking loss (hopelessness), social supports lack, organized plan, no spouse and, sickness (presence of medical illness). It is important to conduct a detailed psychiatric evaluation to assess for the presence of disorders like depression, anxiety disorders, substance use disorders, and personality disorders . Medical history focusing on complications due to diabetes and other medical co - morbidities should be documented and treatment reviewed . Adherence to treatment in the past and the present can give pointers towards presence of underlying depression . In case a diagnosis of depression is made in patients with diabetes showing suicidality, appropriate treatment should be initiated . Attention must be paid towards drug interactions and impact of the psychotropic medications on glucose levels . Some of the selective serotonin reuptake inhibitors (ssris) would be preferred choice as they improve glycemic control, while tricyclic antidepressants (tcas) and mirtazapine should be avoided . Second generation antipsychotics usually have the propensity to cause impaired glucose metabolism and first generation antipsychotics should be preferred when antipsychotics need to be given for control of psychotic symptoms . This may include hospitalization, 24-hour surveillance and monitoring, and avoidance of potentially fatal articles like sharps and medications in the vicinity of the patient . Medications for the treatment of diabetes like insulin and oral hypoglycemic agents should be supervised and kept away from easy accessibility of the patient . Suicide risk assessment should be conducted frequently and high risk precautions should continue till risk is deemed to be consistently low . Management of patients who have attempted self - harm in recent past should be given priority as an emergency . If a patient has consumed excess doses of oral hypoglycemic agent or injected insulin in large amounts, then regular blood sugar monitoring should be conducted . Dextrose infusion is utilized to prevent blood glucose from falling too low . In some situations, insulin levels can be monitored over time to determine the critical period and when the dextrose infusions can be slowly tapered away . Lactic acidosis is a potential problem for patients who have been receiving biguanides like metformin . Supportive measures like fluid correction and electrolyte balance should continue for the management of the patient . After stabilization of the patient, a psychiatric consultation should be sought for assessment and management . The salient features of management of patients with suicidality in patients with dm are highlighted in table 3 . Pubmed (including pubmed central) and google scholar were used to identify published studies . Searches were carried out using medical subject headings (mesh) terms diabetes mellitus and suicide. Additional searches were carried out using related keywords of articles were evaluated and were classified according to the broad subject related to suicidality in dm . Further studies were identified using cross - references from the identified text and by going through the related citations . The full - texts of the identified studies were obtained and assessed for their content . The manuscripts were categorized according to broad themes like epidemiology, elaboration of risk factors for suicide, and management issues . Discrepancies in the interpretation of the literatures were resolved through mutual discussion between the authors . The studies that have assessed the occurrence of suicidal ideas, attempts and deaths in patients with dm have been summarized in [table 1]. Studies assessing occurrence of suicidal behaviour in patients with diabetes mellitus studies have assessed suicidal ideations using different tools including structured interview schedules such as mini international neuropsychaitric interview (mini), rating scales (such as beck depression scale suicidality item), and a single question relating to suicidal ideations . The size of the population assessed have varied from less than 100 to over 80,000 . Studies have come mainly from scandinavian countries and usa, though there are few studies from other countries too . The rates of suicidal ideation and suicidal attempt has been reported to be as high as 26.4% and 13.3%, respectively . Some of the studies focusing on suicidal ideation and attempts in patients with dm have found that suicidal risk is higher in patients with diabetes . However, two studies have found that patients with diabetes had lower rate of suicidal ideation as compared to healthy controls and patients with other medical disorder . Depression has been reported to be the most common psychiatric disorder in persons with dm who attempted suicide . Data about suicide completers among the patients with dm have primarily come from cohort studies and studies based on health registries . The proportion of cases reported to be due to suicide has varied from 0.55% to as high as 40% . Most of the studies which have reported rates of suicides in t1 dm population has given vales in the range of 5 - 15% . The low rate found in one specific study could be ascribed to the fact that this study looked exclusively at t2 dm cases where mortality can result due to a host of medical complications due to diabetes or other concurrent medical illnesses . Standardized mortality rate (smr) provide a better approximation in such situations as it looks at comparison with the age specific mortality . There too, diabetes has been associated with smr of more than one, which suggests greater mortality rates in this population especially males . Many demographic variables have been explored for putative association with suicidality in patients with dm . Males seems to have a greater risk in completing suicides . In a sample of patients from nigeria, the study conducted on 646 patients with dm found suicidality to be significantly associated with poorer glycemic control . A large korean study has shown that depression acts synergistically with diabetes in increasing the chances of having suicidal ideations . Other psychological factors like stress have also been suggested to play a role in suicidal ideations and attempts in patients with dm . Multivariate analyses has showed that female sex, severity of childhood abuse, history of alcohol abuse, and depression were significantly and independently associated with having attempted suicide . The literatures relating to risk factors for suicidal behavior among patients with dm is not very extensive . However, it has been reported that probably risk factors related to suicide in general and those of chronic medical illnesses do apply in context of dm as well . Risk factors can be inherent to the patient's characteristics like coping skills, personality profile, additional psychiatric illness including depression and alcohol use disorder, and presence of hopelessness . Past history of suicide attempt and family history of completed suicide present additional risk factors . This is compounded by illness related and situational risk factors like lack of social support, adverse life events, exacerbation of the illness and gradual accrual of diabetes related complications . Access to means of self harm is another factor which determines whether a suicidal plan is executed or not . A range of risk factors and protective factors determine the overall suicidal risk in a particular patient and the reader is referred to more comprehensive sources for understanding of suicide risk factors in general . [figure 1] provides a simplistic model of how different factors aggregate to confer suicidal risk . A simplistic model to explain how different factors aggregate towards risk of suicidal behaviour this can be ascribed to easy availability and accessibility to a potentially lethal means of suicide in the form of injectable insulin . Subcutaneous or intravenous injection of insulin can cause hypoglycemia which can cause death if it is severe and lasts for a prolonged period of time . Biguanides, like metformin, can cause lactic acidosis when taken in larger than necessary amounts . [table 2] provides a list of the medications that have been used for suicidal attempts . Medications for diabetes treatment that have been reported to be used for suicidal attempts as evident from the table, insulin has been widely used in suicidal self - harm attempts in patients with dm . Probably, the first report of use of high dose of insulin with a suicidal intent in a diabetes patient dates back to 1934 when a 50-year - old female patient consumed 400 u of insulin apparently being depressed due to financial issues . Subsequently, there have been reported cases of suicidal self - administration of insulin where the patients had recovered fully after prompt medical treatment . Not only regular insulin, but its congeners like insulin glargine and lispro have also been used for self - harm attempt . Use of insulin as a means of suicidal attempt seems to be more common in patients with t1 dm than t2 dm . This could be due to the fact that t1 dm can only be treated with insulin and consequently is more regularly accessible to these patients . For treatment of patients with t2 dm, many other pharmacological agents are prescribed which cannot be administered through an invasive route . Information about the use of oral anti - diabetic mediations for self harm has come mainly from case reports . Oral medications like glipizide and gliclazide have been used for attempted suicide in patient with dm . Metformin has been used in massive quantities with an intent to self - harm in a few patients . Use of excess doses of metformin results in lactic acidosis which may result in cardiac arrest and even death . Other medications that have been used in excess quantities with suicidal intent include liraglutide, phenformin, and sitagliptin . Apart from the above, suicidal attempts in patients with dm have involved excess consumption of sugary substances leading to hygerglycemic state . A case of fatal self - induced hyperglycemia by drinking excess amounts of sugared tea similarly, a case of fatality has been reported with the use of sugary solution in a patient with dm . There have been reports of use of other medications, notably psychotropics, like antidepressants and antipsychotics, for suicidal attempt by patients with dm . Danger of abuse of antidiabetic therapy for suicidal attempts is not confined to the patient, but even extends to the other family members who live along with the patient . Use of insulin and other medications for treatment of dm has also been described in family members who had taken the patient's medications for suicidal attempt . Depression and adjustment problems are common in patients with dm and require attention . Suicide risk assessment can be conducted as a part of screening for depression or otherwise . Many brief screening questionnaires for depression like primary health questionnaire-9 (phq- 9) and beck depression inventory (bdi) have questions relating to suicidal ideation . Specifically asking about current suicidal ideas directly (and not in a roundabout indirect manner) it has been seen that asking about suicidal ideas do not implant such ideas in the person assessed, but missing on such questioning due to hesitation on the part of the therapist may lead to missed opportunities to screen for suicidal behavior . Specific instruments to assess suicidality are also available for comprehensive assessment of patients with suicidal ideation sad persons is a mnemonic that can be used for remembering the risk factors for suicide and includes male sex, older age, depression, previous attempt, ethanol abuse, rational thinking loss (hopelessness), social supports lack, organized plan, no spouse and, sickness (presence of medical illness). It is important to conduct a detailed psychiatric evaluation to assess for the presence of disorders like depression, anxiety disorders, substance use disorders, and personality disorders . Medical history focusing on complications due to diabetes and other medical co - morbidities should be documented and treatment reviewed . Adherence to treatment in the past and the present can give pointers towards presence of underlying depression . In case a diagnosis of depression is made in patients with diabetes showing suicidality, appropriate treatment should be initiated . Attention must be paid towards drug interactions and impact of the psychotropic medications on glucose levels . Some of the selective serotonin reuptake inhibitors (ssris) would be preferred choice as they improve glycemic control, while tricyclic antidepressants (tcas) and mirtazapine should be avoided . Second generation antipsychotics usually have the propensity to cause impaired glucose metabolism and first generation antipsychotics should be preferred when antipsychotics need to be given for control of psychotic symptoms . This may include hospitalization, 24-hour surveillance and monitoring, and avoidance of potentially fatal articles like sharps and medications in the vicinity of the patient . Medications for the treatment of diabetes like insulin and oral hypoglycemic agents should be supervised and kept away from easy accessibility of the patient . Suicide risk assessment should be conducted frequently and high risk precautions should continue till risk is deemed to be consistently low . Management of patients who have attempted self - harm in recent past should be given priority as an emergency . If a patient has consumed excess doses of oral hypoglycemic agent or injected insulin in large amounts, then regular blood sugar monitoring should be conducted . Dextrose infusion is utilized to prevent blood glucose from falling too low . In some situations, insulin levels can be monitored over time to determine the critical period and when the dextrose infusions can be slowly tapered away . Lactic acidosis is a potential problem for patients who have been receiving biguanides like metformin . Supportive measures like fluid correction and electrolyte balance should continue for the management of the patient . After stabilization of the patient, a psychiatric consultation should be sought for assessment and management . The salient features of management of patients with suicidality in patients with dm are highlighted in table 3 . Suicidal thoughts and behaviors are a clinical and public health challenge in patients with dm . There are studies to suggest that dm is associated with greater frequency of suicidal thoughts and attempts, though there are a couple of studies which report to the contrary . The standardized mortality ratio due to suicide seems to be higher for patients with dm . Easy access to lethal means in the form of insulin and oral hypoglycemic agents seems to make attempt easy . Regular screening for suicidal ideas and appropriate psychiatric management of the symptoms can help in reducing potentially fatal outcomes. |
Melanoma is the sixth most common malignancy in the united states; there were an estimated 68,120 new cases of invasive melanoma in 2010 with 8,700 deaths due to the disease 1, 2 . When compared to younger age groups, mortality is significantly higher in the elderly implicating age as a poor prognostic factor 3 . As the proportion of the elderly among the world population continues to grow3, nearing 20% in developed countries4, so will the importance of melanoma characterization and proper risk stratification in that age group . The clinical presentation and pathological characteristics in melanoma of the elderly differ from that of their younger counterparts . Melanoma of the elderly has been shown to be more common in men and to be discovered later in its development . The incidence of ulceration, high mitotic index, and advanced breslow thickness have been shown to be higher in older age groups5 - 8 . Paradoxically, despite lower overall survival in elderly with malignant melanoma, the rate of positive sentinel lymph nodes (sln) decreases with age3, 9 - 11 . This observation remains unexplained but is likely related at least in part to atrophy of skin lymphatics that occur with age12 . Given the differing clinical presentation, pathological characteristics, and heightened mortality rates of elderly melanoma patients, we aimed to compare disease characteristics and clinical outcomes of patients 70 years of age and older versus under 70 years old . We reviewed 610 patients with malignant melanoma requiring sln biopsy entered into a prospective sln database from mayo clinic arizona, treated from june 1997 to june 2010 . Disease characteristics and clinical outcomes were compared between patients 70 yrs vs. <70 yrs of age . Subset analysis was performed with a breakdown between age groups of <50, 50 - 59, 60 - 69 and> 70, but the statistical power of this analysis was limited due to the smaller number of events in the groups . Primary melanoma anatomic locations were divided in four locations: head and neck, lower extremity, trunk, and upper extremity . Characteristics of the primary melanoma that were analyzed included: breslow's depth, t - stage (<1 mm, 1 - 2 mm, 2.01 - 4 mm,> 4 mm), ulceration, tumor infiltrating lymphocytes (til), preexisting nevus, angiolymphatic invasion, perineural invasion, and mitotic rate . Disease outcome measures included type of recurrence (local / in - transit, regional, systemic), time to recurrence, time to local / in - transit recurrence, disease - specific mortality, and overall mortality . Continuous variables were compared between groups using two - sample independent samples t - tests . Disease outcomes were plotted using kaplan - meier curves and compared between groups using cox proportional hazards models . The mean age in the <70 years old group was 52.2 (14 - 69). Among the elderly group (70 yrs), the mean age was 77.3 (70 - 97), there was a greater predominance of men, 153 (65%) compare to those <70 yrs, where men comprised 56% (p=0.04), table 1 . The location of melanomas was significantly different between the elderly and younger patients (p<0.001). The elderly patients had a higher proportion of head and neck melanomas (34%) relative to the younger patients (19%), whose most prevalent site was the trunk (35%). Elderly patients had thicker tumors, with 43% of elderly patients had a t3 or t4 melanoma compared to 23% in the non - elderly (p<0.001). Patients with age 70 had a greater mean number of mitotic figures, 3.6/mm vs. 2.7/mm (p=0.005) including a greater preponderance of lesions with a high mitotic rate> 5/mm (29% vs 17%, p=0.003 . Tumors in the elderly were less likely to arise from a pre - existing nevus, 17% vs. 36% (p=0.003). Overall, the prevalence of sln metastases was similar between elderly and non - elderly patients . When the incidence of sln metastases was stratified by t stage (t1/t2 and t3/t4), the rate of positive slns was dramatically less common in elderly patients with t3 or t4 melanoma versus their younger counterparts (18% vs. 33%, p=0.02). The median follow up time was 3.8 years (range 0 - 12.6 years). The elderly patients had a higher rate of recurrence (including local / in - transit, regional, or systemic recurrence) relative to the younger patients (25.2% vs 9.1% 5 years after surgery; hazard ratio [hr]=2.6, p<0.001; figure 1a). Additionally, the elderly patients had a higher rate of local / in - transit recurrence (14.5% vs 3.4% 5 years after surgery; hr=3.6, p<0.001; figure 1b) and systemic recurrence (14.9% vs 6% 5 years after surgery; hr=1.83, p=0.05; figure 1c). Subset analysis of age groups <50, 50 - 59, 60 - 69 and> 70 showed progressively worse outcomes with age, as expected . Recurrence - free survival rates in the subset analysis were 91.8%, 85.6%, 82%, and 60% respectively for age groups in ascending order . Relative to age group <50, hazard ratios for the age groups 50 - 59, 60 - 69, and> 70 were 1.98 (p=0.08), 2.15 (p=0.03), and 5.42 (p<0.001) respectively . 5-year mortality rate from all causes was greater in the elderly group, 29.8% vs. 12.3% 5 years after surgery (hr=3.0, p<0.001; figure 2a). Additionally, 5-year disease - specific mortality was higher for those 70 years old: 16.1% vs. 8.2% (hr=2.3, p=0.004; figure 2b). In a multivariate model of melanoma - specific survival, age remained significant after adjusting for known prognostic factors of tumor thickness and positive sln status . In our cohort of patients undergoing sln biopsy, melanoma in the elderly was more common on the head and neck, less likely to arise from a pre - existing nevus, had greater mean tumor thickness and more mitotic figures than melanoma in their younger counterparts . Additionally, higher t - stage melanoma in the elderly was less likely to result in positive sentinel node biopsy . They were more likely to have recurrence, including a higher rate of local / in - transit recurrence and systemic recurrence . Studied 399 patients with melanoma who underwent sln biopsy and compared patients 50 years vs.> 50 years . They found the melanoma patients> 50 to have thicker lesions and a higher incidence of ulceration but no difference in the incidence of lymph node metastases . Overall survival was worse among the group> 50 and age was a significant prognostic variable in multivariate analysis13 . Data from the seer database and medicare enrollment and claims files, showed that increasing age after 65 years and melanoma detection by a dermatologist were significantly predictive of survival on multivariate analysis in a population of over 2000 patients 14 . In a large dataset of 17,600 melanoma patients, age was an independent prognostic factor for overall survival which was consistent within each thickness subgroup9 . Worse prognosis in the elderly may be attributable to the fact that the elderly, especially elderly men, melanoma has been shown to have a more rapid growth rate15, thicker tumors16 and histologic ulceration16 . Age as a poor prognostic factor may be the result of weakened immune defense mechanisms 17, 18, which may play a role in melanoma progression . Lastly, competing co - morbidities are much more prevalent in older patients, further contributing to higher overall mortality . Elderly melanoma patients have been shown to present with tumors of advanced breslow level 3, 9, 19, 20 . Late diagnosis has been implicated as a cause for thicker melanoma with poor prognosis in the elderly . Some reasons may include scarcely visible anatomical locations of new pigmented lesions (i.e. Scalp, back), loss of a partner's input on home examination, poor vision, less importance placed on changing lesions, and confusing new or changing benign seborrheic keratoses for pigmented lesions21, 22 . Studies have shown disproportionately low screening of elderly men despite this population accounting for 44% of melanoma cases discovered23 . Higher incidence of head and neck melanoma is likely attributable to cumulative photodamage and higher incidence of lentigo maligna melanoma as patients age . Showed that lentigo maligna melanoma was the only melanoma subtype with increasing incidence over a ten - year period and was more common in men 65 years 24 . As the percentage of elderly persons in the world's population continues to grow, physicians performing melanoma screening should devote heightened attention to heavily sun - exposed sites where melanoma is more and more commonly discovered . Our data confirmed previously reported findings that the elderly are less likely to have melanoma associated with a pre - existing nevus25 . Malignant progression may be the result of continuous and cumulative photodamage to melanocytes not within a nevus26 . This has clinical implications to patient education and early detection of melanoma in that age group . When counseling elderly patients regarding self - screening, a shift of focus from characteristics of changing nevi (abcde of melanoma) to awareness of any new growths may lead to more routine screening and earlier detection . Our data demonstrated that the mitotic rate in the elderly melanoma patients was higher than their younger counterparts . Mitotic rate has been associated with worse clinical outcomes in melanoma patients and has been identified as an independent prognostic factor in multiple studies 27 - 29 . In a multifactorial analysis of 10,233 patients with clinically localized melanoma, mitotic rate was the second best prognostic factor of survival behind tumor thickness 29 . In a series of more than 1200 cases, higher mitotic rate tumor burden has also been implicated as a factor contributing to a greater likelihood of local / in - transit recurrence and poor clinical outcomes 30 . . Showed mitotic rate is associated with positive sln, but the impact of mitotic activity on sln result was less in the elderly compared to younger cohorts 31 . Our data was consistent with these observations as our elderly population had more mitotic figures, greater number of non - regional recurrences, and worse clinical outcomes . Additionally, they had a lower positive sln rate, indicating that mitotic activity had less impact on sln result in the elderly compared to younger patients . In advanced t - stage melanoma, despite worse disease - specific and overall mortality, the elderly had far fewer cases of positive sln biopsies . Studied 5 age groups of melanoma patients in a large series of over 3000 patients . They showed a progressive decline in incidence of sln metastasis with increasing age across all five age groups . The oldest group (> 60 years) had a positive sln rate of 14.4%, significantly less than the next nearest age groups 3 . Our cohort of elderly patients (70 years) demonstrated a comparable rate of positive sln in 11% . The reason for fewer cases of positive sentinel lymph node biopsies remains uncertain but may be accounted by altered lymphatic drainage in the elderly12 . Although the mode of spread in any cancer is never certain, it appears that like younger patients, melanoma in the elderly principally spreads along lymphatic routes as there are more in - transit metastases noted in this age group 32 . Uv irradiation has been shown to induce vegf - a - mediated damage of cutaneous lymphatic channels 33, 34 . Lifelong accumulation of photodamage is likely contributory to disruption of lymphatic channels, as well as gravity - dependent degeneration, disallowing complete migration of tumor cells to the sentinel node in areas of atrophied lymphatic channels in the elderly . Time to recurrence has been shown to be an independent predictor of post - recurrence survival35 . Additionally, advanced age at the time of recurrence diagnosis has been associated with poor prognosis 36 - 38 . Studied 279 melanoma patients with recurrence and found that those patients who had recurrence in 12 months or less from treatment of primary melanoma had significantly worse post - recurrence survival and progression - free survival rates35 . A recent long - term follow - up study of 2487 patients showed that advanced age, male sex, high pn, and distant metastases as the first site of recurrence were associated with worse survival outcomes after the manifestation of recurrent disease38 . Subset analysis of age groups <50, 50 - 59, 60 - 69,> 70 was of limited statistical power because of small number of events in each group . Data was retrieved only from patients undergoing sentinel lymph node biopsy; given the potential selection bias, it may not be valid to generalize conclusions to the entire elderly population with melanoma . Lastly, the follow - up period is limited to a mean of 3.8 years, which may influence outcome data to reflect more poorly on the elderly population . Given the differing clinical presentation, primary melanoma characteristics, and disparate disease - specific outcomes of melanoma in the elderly compared to non - elderly patients, clinicians and surgeons should be mindful of proper screening and risk - stratification of elderly patients when participating in their care . Due to the higher risk of in - transit disease, follow - up should focus on loco - regional recurrences . Many adjuvant clinical trials are geared to patients with lymph node positive disease . Due to the fact that the elderly have a much lower incidence of lymph node positive disease but otherwise poorer prognosis, age may need to be included when developing clinical trials in order to evaluate the efficacy of adjuvant therapy in this patient population. |
On april 21, 2008, three whooper swans (2 adults and 1 juvenile) were found dead at lake towada, akita prefecture, japan (figure 1). It was taken to the wildlife protection center in akita but had to be euthanized that day in moribund status . Homogenates from the tracheas, cloacas, and internal organs of 3 swans were pooled and inoculated into embryonated chicken eggs for virus isolation . Map of japan and nearby countries, with enlargement of the northern part of the country (inset) showing location of lake towada . Agents were confirmed to be type a influenza viruses by a commercial rapid antigen assay kit and were excluded from being newcastle disease virus by the hemagglutination inhibition test with newcastle - specific antiserum . After those tests conducted at the animal hygiene service center, viruses were brought to the national institute of animal health, tsukuba, japan, for further analysis . The viruses were subtyped as h5n1 with a panel of antiserum, and 1 yielded from cloaca homogenates was designated as a / whooper swan / akita/1/2008 (wsak08) and was further analyzed . Wsak08 was shown to be highly pathogenic to chickens by an intravenous administration of 10-fold diluted infectious allantoic fluid . This result coincides with the sequence analysis of the hemagglutinin (ha) gene, showing that the ha protein possesses a series of basic amino acids (pqrerrrkr) at the cleavage site . Phylogenetic analysis of the ha1 region of the ha gene (figure 2) showed that wsak08 belongs to clade 2.3.2 and is clearly distinguishable from the hpaivs previously isolated in japan in 2004, a / chicken / yamaguchi/7/2004 (clade 2.5), and in 2007, a / chicken / miyazaki / k11/2007 (clade 2.2). Although sequence data were not found in genbank, a / common magpie / hong kong/5052/2007 reportedly resides in the same clade (9). Antigenic analysis of wsaki08 with a panel of antiserum and monoclonal antibodies showed low reactivity against antibodies in the panel (appendix table). A> 32-fold reduction from homologous titers of all hyperimmune serum used postinfection duck serum against a / chicken / yamaguchi/7/2004 and a / chicken / miyazaki / k11/2007 did not react with wsak08 . None of the monoclonal antibodies against ha protein of a / chicken / yamaguchi/7/2004 reacted with wsak08 . Thus, wsak08 is genetically and antigenically distinguishable from the hpaivs that caused previous outbreaks in japan . Phylogenetic tree constructed based on the hemagglutinin (ha) 1 region (966 bp) of the ha gene of the highly pathogenic avian influenza viruses (h5n1). Clade designation follows the criteria proposed by the world health organization / world organisation for animal health / food and agriculture organization h5n1 evolution working group (8). Representative strains of the previous highly pathogenic avian influenza outbreaks in japan are in boldface . Ab436731ab436738) showed that it does not contain amino acid substitutions conferring resistance to adamantane or neuraminidase inhibitors . Unlike many isolates related to qinghai lake strains that have spread worldwide the neuraminidase protein has a 20-aa deletion at aa 49 to 68 in the stalk region . Nonstructural protein 1 has a 5-aa deletion at aa 80 to 84, commonly observed in currently circulating hpaivs (h5n1) in southeastern asia . Whooper swans breed in northern eurasia and winter in europe and eastern asia i.e., china, the korean peninsula, and japan . In japan, 35,00038,000 whooper swans spend every winter primarily in hokkaido, tohoku, and the hokuriku area (10). In the lake towada area, 300 whooper swans arrive beginning in late october; they leave the area between late march and late april (11). In late march, summer birds begin to arrive . According to results of satellite tracking of 8 swans (12), as well as the results of banding studies since 1961 (13), whooper swans that winter in japan migrate from the northern end of honshu island to eastern hokkaido, by means of sakhalin, and reach eastern siberia, where they breed . To our knowledge, there have been no reports of whooper swans that winter on the eurasian continent migrating north through japan . In light of the migratory route mentioned above, the whooper swans found dead at lake towada were most likely recently infected with hpaiv (h5n1) in japan . It is unlikely that the swans were infected before they flew to japan in autumn, maintained the virus within the flock, and then suddenly developed the disease after no apparent infections for several months . Although the susceptibility of a certain species of birds to a subtype h5n1 virus may be different depending on the virus strain (14), whooper swans as well as mute swans have been considered to be susceptible species to hpaiv (h5n1), as they showed a fulminant course of disease at the outbreak in germany in 2006 (7). The possibility that the swans were infected by domestic fowl is low because there has been no report of hpai among domestic fowl in japan since the beginning of 2008 . One possible explanation is that other wild birds brought the virus from outside the country . Although it is not known whether any birds wintering on the continent migrate north through japan, passage visitor birds such as wader birds migrate from south to north through japan in spring; summer birds, e.g., egrets, swallows, songbirds, and some raptors, come to japan from the south in spring for breeding . Also, the possibility of anthropogenic introduction of virus, such as by inappropriate importation of birds, meats, or materials, cannot be excluded . In conclusion, genetic analysis demonstrates that the virus that killed the 4 swans in japan in 2008 is genetically distinguishable from the strains that caused previous poultry outbreaks in japan, ruling out a possibility of resurgence of previously introduced hpaiv in japan . After the incident we describe, 2 other whooper swan cases of hpaiv (h5n1) infection were confirmed in eastern hokkaido in early may . Possible involvement of wild birds in the introduction of the virus to japan requires further scrutiny . Antigenic analysis of whooper swan / akita/1/2008 highly pathogenic avian influenza virus (h5n1) versus related isolates * |
Starvation and other altered metabolic conditions such as immobilization, denervation, aging, and unloading states induces loss of muscle mass1,2,3,4 . To study the signal transduction of atrophy in particular, various cell culture models have been developed5,6,7 . In many studies, exogenous cytokines such as tnf-, glucocorticoids such as dexamethasone, and serum - free starvation of cultured cells have been used as atrophy models to confirm the mechanisms of whole skeletal muscle atrophy in vivo8,9,10 . The elevated degradation of proteins in skeletal muscle atrophy and serum - free starvation is commonly coupled with activation of the protein ligases such as muscle specific ring finger-1 (murf-1) and atrogin-11, 4, 5, 11 . Meanwhile, cofilin is a ubiquitously expressed protein in mammalian cells and thereby regulates the actin filament dynamics and reorganization and other functions12,13,14 . Furthermore, cofilin binds to actin molecules, changing fibrous actin to globular actin13 . This process is enabled by the dephosphorylation of cofilin by phosphatases12, 15 . On the other hand, phosphorylation of cofilin abolishes the cofilin activity and inhibits its severing function12, 16 (fig . 1cfig . 1.change in phosphorylation of protein and schematic representation of the cellular response caused by serum - free starvation with low glucose . Morphologic (a - a30, a - b100) and immunoblotting (b) analyses in the starved l6 myoblasts . Fbs, fetal bovine serum; h, hours; e. period, experimental period; hg, high - concentration glucose; lg, low - concentration glucose; p - cofilin, phosphorylated cofilin; r, receptor; f - actin, fibrous actin; g - actin, globular actin; rho - rac - cdc42, rho family small gtpases; rock, rho - associated protein kinase; pak, p21-activated protein kinase; ssh, cofilin - specific phosphatases slingshot; skeletal mcs, skeletal muscle cells . ). However, the changes in phosphorylation of cofilin in starvation - induced atrophy are not fully understood . Therefore, we investigated the changes in the phosphorylation of cofilin in l6 myoblasts during serum - free starvation with low glucose . Change in phosphorylation of protein and schematic representation of the cellular response caused by serum - free starvation with low glucose . Morphologic (a - a30, a - b100) and immunoblotting (b) analyses in the starved l6 myoblasts . Fbs, fetal bovine serum; h, hours; e. period, experimental period; hg, high - concentration glucose; lg, low - concentration glucose; p - cofilin, phosphorylated cofilin; r, receptor; f - actin, fibrous actin; g - actin, globular actin; rho - rac - cdc42, rho family small gtpases; rock, rho - associated protein kinase; pak, p21-activated protein kinase; ssh, cofilin - specific phosphatases slingshot; skeletal mcs, skeletal muscle cells . L6 myoblasts from rat neonate skeletal muscle were separated into control and serum - free starvation groups1 . The control group of l6 myoblasts was purchased from the american type culture collection (rockville, md, usa) and cultured in dulbecco s modified eagle s medium containing 10% fetal bovine serum, 100 u / ml penicillin, 100 g / ml streptomycin, 200 mm glutamine, and 4,500 mg / l high - concentration d - glucose . The serum - free starvation group of l6 myoblasts grown to 6070% confluence and undernourished in dmem containing 1,000 mg / l low - concentration d - glucose without fbs for 3, 6, 12, 24, 48, and 72 h, respectively1 . After each experimental treatment, cells were lysed with an extraction buffer (20 mm hepes, ph 7.5, 1% nonidet p-40, 150 mm nacl, 10% glycerol, 10 mm naf, 1 mm na3vo4, 2.5 mm 4-nitrophenylphosphate, 0.5 mm pmsf, and one tablet of complete proteinase inhibitor cocktail [roche, indianapolis, in, usa]). The morphological changes in l6 myoblasts with or without each experimental treatment were visualized with an inverted microscope (ae30/31, motic incorporation, richmond, bc, canada). To measure the phosphorylation of cofilin proteins (3045 g / lane) were separated on 12% polyacrylamide sodium dodecyl sulfate gels and then transferred electrophoretically to a polyvinylidene fluoride membrane (millipore; bedford, ma, usa)2 . Anti - cofilin antibody was purchased from santa cruz biotechnology (santa cruz, ca, usa). Antibody - specific bands were quantified using an image analyzer (bio - rad). The protocol for the study was approved by the committee of ethics in research of the university of yongin, in accordance with the terms of resolution 5 - 1 - 20, december 2006 . The data were statistically evaluated using student s t - tests for comparisons between pairs of groups and by anova for multiple comparisons . A p value of <0.05 was considered to be statistically significant . L6 cell sizes and numbers were diminished as a result of serum - free starvation in a time - dependent manner (fig . Phosphorylation of cofilin was significantly decreased after 3, 6, 12, 24, 48, and 72 hours of starvation compared with those of the control groups (n=34, fig . 1b, table 1table 1.changes in expression and phosphorylation of cofilin of l6 myoblasts during serum - free starvation with low glucoseexperimental periodcofilin (%) p - cofilin (%) 0 hour (control)100.00.0100.00.03 hours252.329.5 * 20.76.1 * 6 hours242.720.7 * 25.34.6 * 12 hours201.026.2 * 24.76.3 * 24 hours198.722.9 * 26.35.9 * 48 hours196.022.1 * 24.35.4 * 72 hours176.314.4 * 18.05.5*data were presented as the mean sem . The basal levels of abundance and phosphorylation in controls (0 hour) were considered to be 100% . * compared with the 0 hour control, p<0.05 . ). However, the expression of cofilin was significantly increased after 3, 6, 12, 24, 48, and 72 hours of starvation compared with the expression of cofilin in the control groups (n=34, fig . P, phosphorylated protein . The basal levels of abundance and phosphorylation in controls (0 hour) were considered to be 100% . * compared with the 0 hour control, p<0.05 . Skeletal muscle atrophy and joint contracture have proven to be significant orthopaedic problems in the area of physical therapy3, 17, 18 . The skeletal muscle is the largest organ with high plasticity in the human, comprising about 50% of the total body weight . Maintenance of muscle mass and neuromuscular function is important for activities daily living (adl) in patients1, 2, 19, and maintenance of muscle mass in particular is related in part to optimal nutrient absorption and use . In contrast, nutrient starvation and disuse have in part the potential to negatively impact muscle mass such as through skeletal muscle atrophy20,21,22,23 . Our previous study reported that the ubiquitin protein ligases murf-11 and atrogin-1 (data not shown), markers of muscle atrophy, are increased in atrophied gastrocnemius muscle strips and involved in the development of serum - free starvation - induced atrophy in l6 myoblasts . Simultaneously, extracellular signal - regulated kinase 1/2 (erk1/2), stress - activated protein kinase / c - jun nh2-terminal kinase (sapk / jnk), and p38 mitogen - activated protein kinase (p38mapk) are involved in atrophy caused by cast immobilization of a hind limb and serum - free starvation of l6 myoblasts1, 2 . Also, our previous report demonstrated that cast immobilization of rat gastrocnemius muscles increases the expression of tissue myoglobin24 . Meanwhile, cofilin in eukaryotic cells binds to actin and plays a role in actin dynamics and reorganization involved in cast immobilization - induced atrophy14, 25 . Phosphorylation of cofilin is achieved by lim kinases and thereby inhibits the actin binding, severing, and depolymerizing activities of cofilin16, 25 (fig . Furthermore, the kinases responsible for this phosphorylation are rho - associated protein kinase and p21-activated protein kinase, which are downstream kinases of the rho family small gtpases26,27,28 . On the other hand, dephosphorylation of cofilin is mediated by the cofilin - specific phosphatases slingshot12, 15 (fig . Although cofilin is essential for maintenance of skeletal muscle mass12, it has not been reported that phosphorylation of cofilin is related to atrophy caused by serum - free starvation in the area of physical therapy . However, further systematic studies in the area of physical therapy such as electrotherapy, neurotherapy, hydrotherapy, and others are needed to confirm the mechanism of cofilin under atrophic conditions29,30,31 (fig . In summary, the phosphorylation of cofilin was decreased in starved skeletal muscle cells . The present results suggest that serum - free starvation - induced atrophy may be in part mediated by cofilin from l6 myoblasts. |
Testing and treatment are key elements in the effort to control hiv, and testing services are rightly considered as the gateway to the treatment facilities . Data suggest that hiv - infected individuals who are aware of their status are more likely to adopt risk reduction behaviour than those who are not as discussed by higgins et al . . With a diagnosis of aids, consideration may be given to the initiation of antiretroviral treatment, which reduces viral load and infectivity as discussed by rotheram - borus et al . . From a public health perspective, it is advisable to recommend testing to those at risk for hiv and to make testing easily accessible . The idea is to detect every hiv positive whether it belongs to high risk group, a pregnant woman, or a patient of tuberculosis or reproductive tract infection approaching the health system for health needs and refer him / her to the nearest antiretroviral therapy (art) centre . Providing quality laboratory services for hiv testing to all those who need point - of - care (poc) testing of hiv refers to the practice undertaken by health care professionals of providing pretest counseling, posttest counseling, and a preliminary hiv antibody result at the time of testing outside of a designated laboratory . The standard methods of hiv testing (enzyme linked immunosorbent assay (elisa) or western blot with confirmatory testing using p24 antigen detection or viral nucleic acid detection) can take several days for result availability as discussed by arora et al . . A significant proportion of individuals who agree to undergo hiv serologic testing do not return to the hiv testing site to receive their test results as discussed elsewhere [46]. Poc testing of hiv attempts to address delay in detection of hiv status by providing preliminary antibody results . Poc tests can be most useful in resource limited settings (rls) or outreach settings where there is lack of well - trained laboratory technicians, poor physical infrastructure, extremes of climate, and lack of uninterrupted power supply, all of which impact the use of laboratory technologies . Rapid hiv test kits are designed to test for hiv antibodies . These deliver results within about 20 minutes of a specimen being taken; so, results are available within a single consultation . Rapid test devices (rtds) are typically capillary flow tests for use on whole blood (e.g., fingerprick), plasma, urine, or oral fluid as discussed elsewhere [710]. They detect hiv antibodies against hiv 1 and 2 antigens produced by oligopeptide synthesis or recombinant dna technology . Quick turnaround time, ease of sampling, performance and reading results, no requirement of cold chain, and specialized equipment make these tests highly suitable in rls . Since, oral fluid / saliva testing is more convenient, noninvasive and safe for laboratory workers, it can serve as an alternative for screening as well as surveillance purposes as discussed by garg et al . . Oral fluid sampling for hiv could particularly benefit the uptake among children and injectable drug users who may have collapsed blood vessels however, not all rtds are usable at the point - of - care (e.g., they require serum separation but still give results in a few minutes). Any hiv poc test approved for use is required to have sensitivity and specificity equivalent to hiv screening test kits (elisa) approved for laboratory use as discussed by shott et al . . The field has also advanced with the development of over - the - counter (otc) self - testing options for hiv and multiplexed platforms that allow for simultaneous detection of infections associated with hiv, such as hepatitis b and c and syphilis . Researchers believed that home testing could be valuable in empowering individuals to manage their hiv risks; in helping couples to learn their partners' hiv status before the initiation of sexual relations; and in addressing the three principal barriers to wider hiv - test acceptance: stigma, convenience, and privacy as described by walensky and paltiel . Fda approved the oraquick in - home hiv test, the first over - the - counter home use rapid hiv test kit to detect the presence of antibodies to hiv-1 and hiv-2 . Fourth generation hiv rtds that detect both antigen and antibodies (architect hiv ag / ab combo assay, alere determine hiv 1/2 ag / ab combo assay) are being developed . They allow for early detection of hiv infection, prior to the emergence of hiv antibodies, therefore reducing the window period of antibody detection . These tests, however, need validation and extensive performance evaluation in diverse field settings . Poc testing of hiv is not designed for screening the general population; it is to be used to screen patients at high risk for hiv . This makes it suitable for use in targeted clinical scenarios where the immediate administration of antiretroviral drugs is recommended to reduce the risk of transmission or in cases where the patient's management may be altered by the availability of a reactive test result . Testing pregnant women for hiv at the time of labor and delivery is the last opportunity for prevention of mother - to - child hiv transmission (pmtct) measures, particularly in settings where women do not receive adequate antenatal care . However, hiv testing and counseling of pregnant women in labor is a challenge, especially in resource - constrained settings . In india, many rural women present for delivery without any prior antenatal care . Those who do get antenatal care are not always tested for hiv, because of deficiencies in the provision of hiv testing and counseling services as discussed elsewhere [17, 18]. Poc testing should be provided to women with risk factors for hiv infection, but no recorded hiv status presenting in established labour as access to immediate hiv results improves the judicious use of antiretroviral prophylaxis as discussed by cohen et al . . Knowledge of the source of the individual's hiv status during an evaluation of blood and body fluid exposure can help to determine more precisely those situations where hiv prophylaxis might be useful . Hiv poc testing of source individuals offers an opportunity to eliminate anxiety and the unnecessary use of postexposure prophylaxis in the exposed person . In some clinical situations, it may be critical to have a rapid hiv diagnosis so that immediate and appropriate therapy or further diagnostic work - up can be provided, for example, a patient with risk factors for hiv who presents with pneumonia for which differential diagnosis would include pneumocystis jirovecii pneumonia or patients undergoing hemodialysis . Consenting patients who are at high risk for hiv (needle stick source, from endemic area, injectable drug users, sexual partner with aids or positive hiv, history of unprotected sexual intercourse, multiple sex partners, sex partner of high risk person(s), sex worker, and homosexual men) and who have not had an hiv test in the previous 3 months, or who are unaware of their hiv status as discussed by d. r. arora and b. arora . Poc testing is acceptable, feasible, and leads to timely entry of people with hiv positive tests into the health care facility as discussed by kendrick et al . . Also among the std clinic attendees presenting with genital ulcer, hiv reactivity (4%) was found to be statistically significant as discussed by arora et al . . Poc hiv testing requires pre- and posttest counseling to be modified from the usual hiv counseling that accompanies standard hiv testing . However, certain clinical situations may make detailed pretest counseling difficult, for example, rapid testing for pregnant women in labour . In these situations, informed consent is a process of communication that enables a person to make a reasonable and informed decision . Pretest counseling is critical in preparing patients for the implications of the test, and in cases of reactive test results, ensuring that they return for confirmatory test results . Posttest counseling provides information on risk behaviour, potential links to community resources, and rationale for behaviour changes needed to reduce risk . In the case of a nonreactive test result, the counseling session provides the opportunity for an exchange of information on the individual's perceived risks and cofactors and on harm reduction and prevention . Patients with risk activities in the last 3 months may not have detectable antibodies at the time of the test . These patients should be counseled as to the need for repeated hiv testing and on the need to protect their partners when engaging in high risk activities . With reactive test results, the implications are just as great in terms of reduction in risk of transmission, provision of health care information, and referral to art centres . In contrast to the situation in standard hiv testing, the health care workers in the poc setting assume responsibility for specimen collection, testing, and counseling of the patient . Adequate resources, appropriate training, and the implementation of quality assurance practices will be critical in ensuring the proper administration of the test and the correct interpretation of the test result . Rtds are generally satisfactory for the detection of uncomplicated hiv infection (or its absence) but are less sensitive than lab - based elisas and automated systems for detecting early infections (seroconversion). Also specificity of rtds is lower than conventional elisas although it can be improved by immediate repeat of all rtd positives as discussed by kagulire et al . . Since these may not be reliable in the window period and appropriate repeat testing should be advised, no currently available rtds incorporate hiv p24 antigen detection in contrast to the commonly used conventional combination elisa laboratory tests which are more sensitive in early hiv infection . Ease of testing might lead to people being tested without their voluntary, specific, and informed consent . This is a particular risk where patients are anaesthetised (e.g., occupational exposure) or unable to communicate (e.g., woman in labour) or otherwise lack capacity to make decisions . Appropriate training on the use of kits, reading of results, detection of errors, quality assurance, counseling, and regular assessment of staff who will be performing poc testing is required for providing point - of - care testing as discussed by kabra and kanugo . A small number of people who are not hiv infected will produce a positive (reactive) result when tested with an hiv antibody test kit, including the rapid test . Because of this, all reactive test results must be confirmed using a laboratory - based confirmatory test . The importance for confirmatory testing at an approved hiv testing laboratory needs to be emphasized to rule out the possibility of a false - positive result in the rapid hiv test and to confirm a true positive result . Costs and adverse events associated with the use of hiv poc tests (labour, training, test kit, and cost of antiretroviral medication in response to false reactive result) will be compared to the cost and adverse events associated with untreated hiv infection resulting in transmission to the newborn (among women with no prenatal testing), use of antiretroviral medications when not required (in cases of occupational exposure), and increased morbidity and mortality associated with delay in hiv status detection of an acutely ill patient . The cost - effectiveness of routine hiv screening in health care settings, even in relatively low - prevalence populations, is similar to that of commonly accepted interventions, and such programs should be expanded as discussed by sanders et al . . Access to antiretroviral therapy (art) has increased dramatically over the past decade in low- and middle - income countries . However, successful management of hiv requires patients receiving art to be monitored routinely to assess treatment efficacy and detect treatment failure due to drug resistance . The standard of care to monitor art is quantitative viral load testing based on plasma hiv rna concentration as discussed by volberding and deeks . Although cd4 count has also been used to monitor art, recent studies suggest that it may not detect early treatment failure adequately as discussed by moore et al . . Poc test for cd4 count could help clinicians in resource limited settings to decide when to start antiretroviral treatment, and a poc test for viral load would be of great value in identifying treatment failure and the need for second - line treatment . Poc devices for cd4 immunologic monitoring and viral load assay are currently being evaluated as discussed elsewhere [2830]. If validated, these devices could rapidly and accurately identify cd4 counts with minimal operator training, infrastructural setup, and with less cost than standard laboratory - based equipment such as flow cytometers for cd4 count or rt - pcr for viral load assay . Waltham, ma, usa) is a who prequalified simple, effective point - of - care cd4 count test . It gives a cd4 count in 20 minutes from a finger stick or venous sample . Recent evaluations in zimbabwe and mozambique have shown good performance in comparison to flow cytometry as discussed elsewhere [27, 28]. Visitect cd4 is a disposable, semiquantitative point - of - care rapid test for the determination of cd4 counts in whole blood . Visitect cd4 can guide treatment decisions at the point - of - care, without the need for extensive training or sophisticated equipment . The test is a convenient solution for use in laboratories and remote clinics worldwide and provides a visual treat or no treat result within 40 minutes . Antiretroviral drugs, especially stavudine (nucleoside reverse transcriptase inhibitors), are associated with severe side effects such as lactic acidosis, pancreatitis, and hepatitis as discussed by arora et al . . Poc tests for toxicity monitoring (e.g., lactate, renal function tests, and liver function tests) are also being evaluated as discussed elsewhere [33, 34] and will help in monitoring drug toxicity in patients . Tuberculosis is one of the most common opportunistic infection in developing countries as discussed by arora et al . . Therefore, there will also be a need for rapid poc detection of opportunistic infections . Decentralization of laboratory services is required to detect the maximum possible number of hiv - positive patients and to put them on antiretroviral therapy . They may improve patient care especially in outreach settings for hard to reach groups and in obstetric management . The particular public health interest in the use of point - of - care testing for hiv is its ability to contribute to health goals which include preventing new hiv infections, reducing the number of hiv individuals who are unaware of their status, and promoting linkage of hiv - positive individuals to care . The ethical framework surrounding informed consent for a rapid test is the same as for a standard blood test, but the dissemination of testing and potential lack of experience of staff administering tests and handling the results requires careful consideration. |
We searched medical literature analysis and retrieval system online (medline) and excerpta medica database (embase) from inception to 1 july 2009 for articles evaluating the effect of diabetes on any prognostic outcome in cancer patients . Our overall search strategy included terms for diabetes (e.g., diabetes, glucose intolerance, hyperglycemia), cancer (e.g., cancer, malignant neoplasm), and prognosis (e.g., mortality, survival, recurrence) and was limited to english language human studies . Our overall search targeted articles that met the following three criteria: 1) evaluated any prognostic outcome by glycemic status, 2) evaluated a cancer population, and 3) contained original data . The current review further required articles to evaluate short - term postoperative mortality after initial cancer surgery, including 30-day and hospital mortality . To be included in our meta - analysis, articles had to meet either of the following two criteria: 1) report a risk estimate (e.g., hazard ratio [hr], relative risk [rr], or odds ratio [or]) relating preexisting diabetes to subsequent death and an estimate of precision such as a standard error or 95% ci or 2) report rates of short - term mortality in patients with and without diabetes as well as the prevalence of diabetes in the study population . Disagreements were settled by consensus or a third review for adjudication . Abstracted data included study population characteristics, health outcomes (specifically short - term postoperative mortality for this report), adjustment variables, and study quality . Quality was assessed using elements of the strengthening the reporting of observational studies in epidemiology (strobe) checklist for cohort studies that we considered important for quality in these studies (6). To judge quality, we abstracted information on population source; method of diabetes and outcome ascertainment; whether diabetes was the primary exposure variable or one of a group of prognostic variables; and adjustment for confounders . Articles reporting unadjusted or adjusted risk estimates (or, rr, or hr) and confidence intervals (cis) or standard errors (ses) were included in the meta - analysis . An unadjusted or was calculated for manuscripts reporting rates of mortality, study sample size, and prevalence of diabetes . If an article only reported multiple risk estimates by subgroup, these estimates were input separately into our meta - analysis . We attempted to contact four authors for additional unreported information necessary for inclusion in the meta - analysis, but none were able to furnish the required information . Additionally, cancer sites with at least three studies meeting inclusion criteria are discussed in more detail . For the meta - analysis, potential sources of heterogeneity between studies were assessed using cochran's q and i statistics (7). Due to substantial between - study heterogeneity, we calculated a pooled or including all estimates using the dersimonian - laird method for a random - effects model, which weights individual studies by the inverse of the variance (8). We also calculated separate pooled estimates for population - based and clinic - based cohorts, as well as studies evaluating diabetes as the primary exposure or among prognostic factors . Next, we performed the duval and tweedie nonparametric trim and fill procedure to further assess the potential effect of publication bias . This method considers the possibility of hypothetical missing studies, imputes their ors, and recalculates a pooled estimate (9). Finally, we evaluated the influence of each study on the overall estimate by calculating a random - effects pooled or, omitting each estimate one at a time . We searched medical literature analysis and retrieval system online (medline) and excerpta medica database (embase) from inception to 1 july 2009 for articles evaluating the effect of diabetes on any prognostic outcome in cancer patients . Our overall search strategy included terms for diabetes (e.g., diabetes, glucose intolerance, hyperglycemia), cancer (e.g., cancer, malignant neoplasm), and prognosis (e.g., mortality, survival, recurrence) and was limited to english language human studies . Our overall search targeted articles that met the following three criteria: 1) evaluated any prognostic outcome by glycemic status, 2) evaluated a cancer population, and 3) contained original data . The current review further required articles to evaluate short - term postoperative mortality after initial cancer surgery, including 30-day and hospital mortality . To be included in our meta - analysis, articles had to meet either of the following two criteria: 1) report a risk estimate (e.g., hazard ratio [hr], relative risk [rr], or odds ratio [or]) relating preexisting diabetes to subsequent death and an estimate of precision such as a standard error or 95% ci or 2) report rates of short - term mortality in patients with and without diabetes as well as the prevalence of diabetes in the study population . Disagreements were settled by consensus or a third review for adjudication . Abstracted data included study population characteristics, health outcomes (specifically short - term postoperative mortality for this report), adjustment variables, and study quality . Quality was assessed using elements of the strengthening the reporting of observational studies in epidemiology (strobe) checklist for cohort studies that we considered important for quality in these studies (6). To judge quality, we abstracted information on population source; method of diabetes and outcome ascertainment; whether diabetes was the primary exposure variable or one of a group of prognostic variables; and adjustment for confounders . Articles reporting unadjusted or adjusted risk estimates (or, rr, or hr) and confidence intervals (cis) or standard errors (ses) were included in the meta - analysis . An unadjusted or was calculated for manuscripts reporting rates of mortality, study sample size, and prevalence of diabetes . If an article only reported multiple risk estimates by subgroup, these estimates were input separately into our meta - analysis . We attempted to contact four authors for additional unreported information necessary for inclusion in the meta - analysis, but none were able to furnish the required information . Additionally, cancer sites with at least three studies meeting inclusion criteria are discussed in more detail . For the meta - analysis, potential sources of heterogeneity between studies were assessed using cochran's q and i statistics (7). Due to substantial between - study heterogeneity, we calculated a pooled or including all estimates using the dersimonian - laird method for a random - effects model, which weights individual studies by the inverse of the variance (8). We also calculated separate pooled estimates for population - based and clinic - based cohorts, as well as studies evaluating diabetes as the primary exposure or among prognostic factors . Next, we performed the duval and tweedie nonparametric trim and fill procedure to further assess the potential effect of publication bias . This method considers the possibility of hypothetical missing studies, imputes their ors, and recalculates a pooled estimate (9). Finally, we evaluated the influence of each study on the overall estimate by calculating a random - effects pooled or, omitting each estimate one at a time . Our literature search yielded 8,828 articles, of which 20 were eligible for inclusion in the present systematic review of the risk of preexisting diabetes on short - term postoperative mortality in cancer patients after initial surgical treatment . Descriptive data and main results from these studies are presented according to cancer site (table 1). Of these 1). Study characteristics and main results asa, american society of anesthesiology; dm, diabetes; na, not available; ng, normoglycemic . Used four - level definition of diabetes based on oral glucose tolerance test results . Nineteen articles included in our systematic review evaluated postoperative, 30-day, or hospital mortality in cohorts of patients who had undergone cancer surgery; one article evaluated a composite outcome of hospital mortality or morbidity . Studies evaluated the effect of preexisting diabetes in patients with colon or colorectal (n = 5) (1014), esophageal and/or gastroesophageal junction (n = 5) (1519), liver (n = 2) (20,21), lung (n = 4) (2225), pancreatic (n = 2) (26,27), stomach (n = 1) (28), and prostate cancer (n = 1) (29). The prevalence of diabetes, where reported, ranged from 1 to 42% with a median of 10% . Quality varied across studies (see supplemental table, available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc09-1721/dc1). Five studies used population - based cohorts, and the other 15 used clinic - based cohorts . Two studies ascertained diabetes by a blood test, and the remainder used medical records (n = 18). A few studies used death registries (n = 3) to ascertain vital status, but most studies used medical records or study follow - up (n = 17). Only three studies focused specifically on diabetes; the remaining 17 studies investigated diabetes as one potential prognostic variable among many . Twelve studies reported unadjusted percentages or risk estimates of preexisting diabetes on short - term mortality, whereas the other eight reported adjusted estimates . Of the 10 studies that reported simple percentages comparing cancer patients with and without preexisting diabetes, four reported that diabetes was associated with significantly higher short - term mortality, four reported nonsignificant differences, and two did not report a statistical comparison . Neither of the two studies reporting unadjusted estimates from regression models found a significant difference . Of the 10 adjusted estimates (eight studies) from regression models, five indicated significantly increased risk of postoperative mortality, one reported significantly increased risk of postoperative mortality or morbidity, and four found nonsignificant associations . No studies reported that diabetes was associated with significantly decreased short - term postoperative mortality . Our search yielded at least three studies of colon / colorectal cancer, esophageal / gastrointestinal junction cancer, and lung cancer . We did not perform meta - analysis by cancer site because of insufficient number of studies with adjustment and the high degree of heterogeneity . Five studies evaluated the risk of diabetes on postoperative mortality in colon (10,12) or colorectal (11,13,14) cancer . (12) both evaluated small clinical populations (n = 99 and n = 71, respectively) of patients> 70 years of age undergoing emergency surgery for colon cancer . Both studies reported high rates of postoperative mortality (50.5 and 53.5%, respectively) and found a significant survival advantage for patients without diabetes in a simple comparison of postoperative mortality rates . Little et al . (11) and jullumstr et al . (14) evaluated larger clinical cohorts (n = 727 and n = 1,194, respectively) of colorectal cancer patients and reported unadjusted rates of 30-day mortality in patients with and without diabetes . Little et al . (11) found that patients with diabetes had a significantly increased risk of 30-day mortality (8.2 vs. 2.4%, p = 0.02) in a cohort of patients with colorectal cancer that was metastatic to the liver and who underwent hepatic resection . (14) found no significant difference in 30-day mortality between patients with and without diabetes (6 vs. 5%, p = 0.61) in a cohort of colorectal cancer patients . Finally, davila et al . (13) evaluated the risk of 30-day mortality in 32,621 colorectal cancer patients with and without diabetes from the veteran's affairs database . After adjustment for confounders, they observed a significant increase in risk for patients with diabetes (hr 1.19 [95% ci 1.041.36]). Five studies reported the risk of diabetes on postoperative mortality in patients undergoing treatment for cancer of the esophagus or gastroesophageal junction (1519). Karl et al . (17) and abunasra et al . (18) reported rates of 30-day mortality in clinical populations with cancer of the gastrointestinal junction or gastrointestinal junction / esophagus, respectively . Both reported higher rates of 30-day mortality among patients with diabetes (13 vs. 1%, p not reported; and 11 vs. 4%, p = 0.030, respectively). (16) reported that, after adjustment for confounders, diabetes was not associated with 30-day mortality in a clinical cohort of 432 patients undergoing curative esophagectomy (or not reported; p <0.05). 15) found that a four - level ordinal definition of diabetes based on an oral glucose tolerance test significantly predicted hospital complication mortality (or 1.19 per level; p = 0.024) in an adjusted prediction model in a clinical cohort of 100 esophageal cancer patients . Finally, wright et al . (19) found that concomitant diabetes in 2,315 cancer patients undergoing esophagectomy from the society of thoracic surgeons' database was associated with an adjusted or of 1.19 (p = 0.009) for the composite outcome of hospital morbidity or mortality . Four studies investigated the effect of diabetes on postoperative mortality in patients with lung cancer (2225). In a cohort of 12,439 patients from california hospitals, romano and mark (22) found that diabetes was associated with an increased risk of 30-day mortality in lung cancer patients undergoing lesser resections (or 1.5 [95% ci 1.12.2]) but not in patients undergoing complete pneumonectomy (1.4 [0.72.9]). Duque et al . (24) found a nonsignificant association between diabetes and 30-day mortality (1.83 [0.684.91]) in 605 lung cancer patients from 16 hospitals in spain . Au et al . (23) and dominguez - ventura et al . (25) studied older clinical populations, and each found nonsignificant associations between diabetes and 30-day mortality . Of the 20 studies with 22 risk estimates included in our systematic review, we excluded six estimates for the purpose of meta - analysis: four estimates for lack of sufficient information (16,23,26,28) and two for use of different exposure or outcome definitions from other included studies (15,19). Thus, we included in the meta - analysis 15 studies reporting 16 risk estimates . Figure 2 displays the results of the meta - analysis of the 16 estimates in order of magnitude . Compared with their nondiabetic counterparts, cancer patients with preexisting diabetes had greater odds of mortality after surgery (or 1.85 [1.402.45]). Although the studies included in the meta - analysis spanned different continents and cancer sites, the risk estimate was above the null in 15 of 16 estimates and significantly above the null in 9 of 16 estimates . This relationship was attenuated, but still statistically significant, after excluding unadjusted estimates (1.51 [1.132.02]; table 2). Age (n = 4), sex (n = 4), and other comorbidites (n = 4) were adjustment variables in the majority of these studies (see table 1 for a complete list in each study). The pooled risk estimates were lower in population - based cohorts (1.51 [1.132.02]) than clinic - based cohorts (2.28 [1.463.58]), likely because the former reported adjusted risk estimates and the latter did not . Estimates were similar in the three studies where diabetes was the primary exposure variable (1.69 [0.733.88]) and the 12 studies where diabetes was one among several prognostic variables (1.88 [1.382.55]). We observed evidence of publication bias according to the begg test (p = 0.096) and the egger plot (p = 0.001) (supplemental fig ., p = 0.011; and i = 50.5%, p = 0.011). To reduce the influence of publication bias b), and the adjusted risk estimate was attenuated but remained significant (or 1.52 [1.13 2.04]). Meta - analysis and pooled ors of postoperative mortality in 15 studies comparing cancer patients with and without preexisting diabetes . Pooled ors of postoperative morality in cancer patients with and without preexisting diabetes analysis of influence for the overall pooled estimate revealed that the risk of postoperative mortality among patients with diabetes remained significant with the omission of each study in turn (data not shown). When the analysis of influence was repeated in the five studies that reported adjusted estimates, the pooled risk estimate ranged from or 1.32 (95% ci 1.101.59) to 1.73 (1.232.43) and remained statistically significant with the omission of each study . Our literature search yielded 8,828 articles, of which 20 were eligible for inclusion in the present systematic review of the risk of preexisting diabetes on short - term postoperative mortality in cancer patients after initial surgical treatment . Descriptive data and main results from these studies are presented according to cancer site (table 1). Of these 1). Study characteristics and main results asa, american society of anesthesiology; dm, diabetes; na, not available; ng, normoglycemic . Used four - level definition of diabetes based on oral glucose tolerance test results . Nineteen articles included in our systematic review evaluated postoperative, 30-day, or hospital mortality in cohorts of patients who had undergone cancer surgery; one article evaluated a composite outcome of hospital mortality or morbidity . Studies evaluated the effect of preexisting diabetes in patients with colon or colorectal (n = 5) (1014), esophageal and/or gastroesophageal junction (n = 5) (1519), liver (n = 2) (20,21), lung (n = 4) (2225), pancreatic (n = 2) (26,27), stomach (n = 1) (28), and prostate cancer (n = 1) (29). The prevalence of diabetes, where reported, ranged from 1 to 42% with a median of 10% . Quality varied across studies (see supplemental table, available in an online appendix at http://care.diabetesjournals.org/cgi/content/full/dc09-1721/dc1). Five studies used population - based cohorts, and the other 15 used clinic - based cohorts . Two studies ascertained diabetes by a blood test, and the remainder used medical records (n = 18). A few studies used death registries (n = 3) to ascertain vital status, but most studies used medical records or study follow - up (n = 17). Only three studies focused specifically on diabetes; the remaining 17 studies investigated diabetes as one potential prognostic variable among many . Twelve studies reported unadjusted percentages or risk estimates of preexisting diabetes on short - term mortality, whereas the other eight reported adjusted estimates . Of the 10 studies that reported simple percentages comparing cancer patients with and without preexisting diabetes, four reported that diabetes was associated with significantly higher short - term mortality, four reported nonsignificant differences, and two did not report a statistical comparison . Neither of the two studies reporting unadjusted estimates from regression models found a significant difference . Of the 10 adjusted estimates (eight studies) from regression models, five indicated significantly increased risk of postoperative mortality, one reported significantly increased risk of postoperative mortality or morbidity, and four found nonsignificant associations . No studies reported that diabetes was associated with significantly decreased short - term postoperative mortality . Our search yielded at least three studies of colon / colorectal cancer, esophageal / gastrointestinal junction cancer, and lung cancer . We did not perform meta - analysis by cancer site because of insufficient number of studies with adjustment and the high degree of heterogeneity . Five studies evaluated the risk of diabetes on postoperative mortality in colon (10,12) or colorectal (11,13,14) cancer . (12) both evaluated small clinical populations (n = 99 and n = 71, respectively) of patients> 70 years of age undergoing emergency surgery for colon cancer . Both studies reported high rates of postoperative mortality (50.5 and 53.5%, respectively) and found a significant survival advantage for patients without diabetes in a simple comparison of postoperative mortality rates . Little et al . (11) and jullumstr et al . (14) evaluated larger clinical cohorts (n = 727 and n = 1,194, respectively) of colorectal cancer patients and reported unadjusted rates of 30-day mortality in patients with and without diabetes . Little et al . (11) found that patients with diabetes had a significantly increased risk of 30-day mortality (8.2 vs. 2.4%, p = 0.02) in a cohort of patients with colorectal cancer that was metastatic to the liver and who underwent hepatic resection . (14) found no significant difference in 30-day mortality between patients with and without diabetes (6 vs. 5%, p = 0.61) in a cohort of colorectal cancer patients . Finally, davila et al . (13) evaluated the risk of 30-day mortality in 32,621 colorectal cancer patients with and without diabetes from the veteran's affairs database . After adjustment for confounders, they observed a significant increase in risk for patients with diabetes (hr 1.19 [95% ci 1.041.36]). Five studies reported the risk of diabetes on postoperative mortality in patients undergoing treatment for cancer of the esophagus or gastroesophageal junction (1519). Karl et al . (17) and abunasra et al . (18) reported rates of 30-day mortality in clinical populations with cancer of the gastrointestinal junction or gastrointestinal junction / esophagus, respectively . Both reported higher rates of 30-day mortality among patients with diabetes (13 vs. 1%, p not reported; and 11 vs. 4%, p = 0.030, respectively). (16) reported that, after adjustment for confounders, diabetes was not associated with 30-day mortality in a clinical cohort of 432 patients undergoing curative esophagectomy (or not reported; p <0.05). Zhang et al . (15) found that a four - level ordinal definition of diabetes based on an oral glucose tolerance test significantly predicted hospital complication mortality (or 1.19 per level; p = 0.024) in an adjusted prediction model in a clinical cohort of 100 esophageal cancer patients . Finally, wright et al . (19) found that concomitant diabetes in 2,315 cancer patients undergoing esophagectomy from the society of thoracic surgeons' database was associated with an adjusted or of 1.19 (p = 0.009) for the composite outcome of hospital morbidity or mortality . Four studies investigated the effect of diabetes on postoperative mortality in patients with lung cancer (2225). In a cohort of 12,439 patients from california hospitals, romano and mark (22) found that diabetes was associated with an increased risk of 30-day mortality in lung cancer patients undergoing lesser resections (or 1.5 [95% ci 1.12.2]) but not in patients undergoing complete pneumonectomy (1.4 [0.72.9]). Duque et al . (24) found a nonsignificant association between diabetes and 30-day mortality (1.83 [0.684.91]) in 605 lung cancer patients from 16 hospitals in spain . (25) studied older clinical populations, and each found nonsignificant associations between diabetes and 30-day mortality . Of the 20 studies with 22 risk estimates included in our systematic review, we excluded six estimates for the purpose of meta - analysis: four estimates for lack of sufficient information (16,23,26,28) and two for use of different exposure or outcome definitions from other included studies (15,19). Thus, we included in the meta - analysis 15 studies reporting 16 risk estimates . Figure 2 displays the results of the meta - analysis of the 16 estimates in order of magnitude . Compared with their nondiabetic counterparts, cancer patients with preexisting diabetes had greater odds of mortality after surgery (or 1.85 [1.402.45]). Although the studies included in the meta - analysis spanned different continents and cancer sites, the risk estimate was above the null in 15 of 16 estimates and significantly above the null in 9 of 16 estimates . This relationship was attenuated, but still statistically significant, after excluding unadjusted estimates (1.51 [1.132.02]; table 2). Age (n = 4), sex (n = 4), and other comorbidites (n = 4) were adjustment variables in the majority of these studies (see table 1 for a complete list in each study). The pooled risk estimates were lower in population - based cohorts (1.51 [1.132.02]) than clinic - based cohorts (2.28 [1.463.58]), likely because the former reported adjusted risk estimates and the latter did not . Estimates were similar in the three studies where diabetes was the primary exposure variable (1.69 [0.733.88]) and the 12 studies where diabetes was one among several prognostic variables (1.88 [1.382.55]). We observed evidence of publication bias according to the begg test (p = 0.096) and the egger plot (p = 0.001) (supplemental fig . To reduce the influence of publication bias, we used the trim and fill method for both adjusted and unadjusted estimates . B), and the adjusted risk estimate was attenuated but remained significant (or 1.52 [1.13 2.04]). Meta - analysis and pooled ors of postoperative mortality in 15 studies comparing cancer patients with and without preexisting diabetes . Pooled ors of postoperative morality in cancer patients with and without preexisting diabetes analysis of influence for the overall pooled estimate revealed that the risk of postoperative mortality among patients with diabetes remained significant with the omission of each study in turn (data not shown). When the analysis of influence was repeated in the five studies that reported adjusted estimates, the pooled risk estimate ranged from or 1.32 (95% ci 1.101.59) to 1.73 (1.232.43) and remained statistically significant with the omission of each study . We found that preexisting diabetes conferred a 50% increased risk of mortality in newly diagnosed cancer patients after surgery . This additional risk was present across a range of cancers and a range of surgical cancer treatments . It was not explained by confounding factors, publication bias, or undue influence by a single study . Strengths of our study include a comprehensive systematic review of the literature by a multidisciplinary team including specialists in cancer, diabetes, and epidemiologic methods . Limitations of the literature and of our systematic review and meta - analysis deserve comment . First, the published literature showed great heterogeneity in population demographics and in assessment of confounders . Despite the use of appropriate meta - analytic techniques with random - effect models, we were unable to account fully for these differences . However, we continued to observe a significant association when limiting our pooled estimate to adjusted models, most of which were high - quality studies performed in large cohorts . Second, we found no studies evaluating the effect of diabetes on postoperative mortality in women with breast or endometrial cancer . A notable gap in the literature is data regarding diabetes' effect on short - term survival in cancer patients who do not undergo surgery . This gap may be especially important because diabetes is known to influence treatment decisions and might steer some patients toward nonsurgical treatment (2). Previous studies of preexisting diabetes and the risk of postoperative or in - hospital mortality related to noncancer surgery have shown mixed results (30,31). However, there are two main pathways through which preexisting diabetes might specifically influence postoperative mortality risk after cancer surgery . Diabetes is a well - established risk factor for infection and for infection - related mortality in the general population . In addition to these factors is perioperative hyperglycemia, which predicts in - hospital infection likely related to acute effects on leukocyte function (32). In a population of bone marrow transplantation recipients, who are highly susceptible to infection, derr et al . (33) reported positive associations between preneutropenia glycemia and risks of any infection and bloodstream infection . The second pathway to postoperative diabetes is a chronic risk factor for atherosclerosis in multiple vascular beds, including the coronary arteries, and is a strong predictor of myocardial infarction and cardiovascular disease death in the general population (34). Superimposed on long - standing atherosclerosis are short - term effects of hyperglycemia on platelet function and thrombotic tendency (35). Perioperative renal failure (e.g., diabetes - related contrast nephropathy), in addition to diabetes - related chronic kidney disease (36), may also aggravate cardiovascular risk . These observations raise a therapeutic question: might improvements in perioperative diabetes care reduce the risk of postoperative mortality after cancer surgery? There are no clinical trials that address this question directly . Trials and quasi - experimental studies of improved glycemic control in the setting of noncancer surgery have been generally favorable (37,38). However, randomized controlled trials of intensive insulin therapy to achieve glycemic control in surgical intensive care units have yielded mixed results (39,40). The main implication of our study is that oncologists, surgeons, and cancer patients should be aware of the excess postoperative mortality risk related to diabetes when considering treatment options . Future research should investigate physiologic pathways to mortality risk and determine whether improvements in perioperative diabetes care can reduce postoperative mortality. |
Since the discovery of chagas' disease in 1909 (chagas, 1909), major leaps in trypanosoma cruzi biology have been achieved and have resulted in gradually improving advanced techniques for direct parasite observation (florentino et al ., 2014). Optical and electron microscopy (de souza, 2008) are the most commonly used advanced techniques . Early in vitro optical microscopy images of cultured cells infected with t. cruzi were first reported by meyer et al . Barasa described its life cycle stages in mammalian cells: invasion, intracellular growth and differentiation and cell egress (meyer et al ., 1942). Since then, imaging of live t. cruzi in its different evolutive forms has become routine in research laboratories . Detailed information has been acquired using modern techniques, such as multidimensional confocal and electron microscopy (florentino et al ., 2014). Live imaging is emerging as a powerful tool to examine how parasites interact with host cells and tissues, as well as their vectors (amino et al . Bioluminescence detection of luciferasetransfected pathogens have enabled researchers to identify infection loci and disease development in real time in experimental animal models (amino et al ., 2005). Plasmodium spp was the first protozoan parasite to be successfully imaged in intravital observations at the singlecell level (amino et al ., 2005). Using bioluminescence, t. cruzi has also been tracked in infected mice (umekita et al ., 2001, hyland et al ., 2008, henriques et al ., 2014, lewis et al ., 2014) and vectors (henriques et al ., 2012). However, intravital microscopy is limited by tissue penetration depths of up to a few hundred microns and blurring due to the overlaying connective tissue . To circumvent these limitations, some strategies can be adopted such as extracting more superficial tissues in the area of interest: for example, thinning skull without removing it and image intravascular and extravascular t. brucei through the remaining bone (myburgh et al ., however, in order to image deeper areas, ex vivo explants of tissues and organs have been used as a tool to monitor cell migration and distribution (bajnoff et al ., 2008, mort et al ., 2014). Here, we describe a simple method to detect individual t. cruzi forms millimetres inside infected tissues and organs: slicing a specimen to gain access to the interior, then imaging ex vivo slices . The balb / c or c57bl/6 mice infected with transfected t. cruzi trypomastigotes were sacrificed at the acute phase of infection (8 days). After organ removal and sectioning, slices were placed in a coverslip bottom dish, immersed in culture medium and imaged in a confocal microscope equipped with an environmentally controlled stage (fig . Amastigote nests of live ggfp parasites were visualized in the following selected organs: spleen, heart, intestine and liver (fig . 1). Because the amastigotes were mostly immotile, optical sectioning through nests revealed the disposition of parasites and surrounding hoechstlabelled nuclei (fig . 1, arrowheads). Tridimensional images of some parasite nests also revealed intermediate flagellated forms among amastigotes (fig . 2b, arrowhead). Live intermediate forms were also recorded in the nests within the intestinal tissue (fig . The sectioned heart, spleen, liver and intestine of the mice infected with g gfp or cl dsred trypomastigotes (8 dpi) were maintained ex vivo in dishes with culture medium and observed by confocal microscopy . A. unconventional linear amastigote arrays imaged in intestine sections of mice infected with ggfp parasites . The approximate nest dimensions on the right: 59 m (x, y) 15 m (z); left: 117 m (x, y) 24 m (z). The approximate nest dimensions: 56 m (x, y) 10 m (z). C. threedimensional reconstruction of a ggfp amastigote heart nest . The approximate nest dimensions: 38 m 72 m 15 m . Although nest morphology varied in different sections and tissues (fig . 1), singlecell linear arrangements of amastigotes formed unusually shaped agglomerates within the intestinal tissue (fig . Nests containing highly motile trypomastigotes were found in the spleen and liver (movies s2, s3). Parasites were imaged at the singlecell level within nests ranging from 10 up to almost 200 m wide, for up to 8 h (movie s4). Highly motile trypomastigotes were found sometimes free in the tissues or sharing nests with other trypomastigotes, amastigotes or intermediate forms (movie s1). It is possible, however, that trypomastigotes are freed as a consequence of bladepromoted nest disruption . To our knowledge, this is the first description of t. cruzi imaging from inside infected tissues at the singlecell level . This method can provide, with good resolution, new information about parasite behaviour inside host tissues and the nature of neighbouring cells and elucidate infection mechanisms . A similar technique has brought relevant data on toxoplasma gondii intestinal infection (coombes et al ., 2013). Therefore, the tool described here could be applied to examine areas with different depths in organs and tissues infected with other several pathogens, for instance, t. gondii within brain cysts or leishmania chagasi inside liver macrophages . Transfected g (tc i, gfp) (cruz et al ., 2012) and cl (tcvi, dsred) (brener et al ., 1963) parasite strains were cycled as epimastigotes in lit medium or vero cell culture monolayers as trypomastigotes, as previously described (cruz et al ., 2012). Trypanosoma expression construct (ptrexdsrm) containing dsred fluorescent protein was prepared using standard protocols . Briefly, an open reading frame coding the monomeric variant of dsred was amplified by the polymerase chain reaction using oligonucleotides dsrmbf (5ggatccatggacaacaccgaggac3) and dsrmhr (5aagcttctactgggagccggagtg3) containing bamhi and hindiii restriction sites respectively (lower case). Amplicons were resolved on agarose gels, purified, cloned into pgemt easy vector (promega corporation, fitchburg, wi, usa) and sequenced for confirmation . The insert was subcloned into ptex vector (kelly et al ., 1992), finally, the ptexdsrm plasmid was digested with xbai and xhoi restriction enzymes, and the insert was subcloned into ptrex vector (vazquez et al ., 1999) parasite transfections were performed using a gene pulser xcell electroporation system (biorad) as described by (ramirez et al ., 2000). Briefly, 4 10 epimastigotes and 10 g of plasmid dna were mixed in 0.4 cm gap electroporation cuvettes . Samples were submitted to two consecutive pulses of 450 v and 500 f . Parasites were transferred to 5 ml of fresh lit medium and incubated at 26 c for 48 h before selecting for transfected parasites with 200 g / ml of g418 . Parasites appears 58 days postinfection in the liver (cruz et al ., 2012). Cl parasites are more infective and give rise to widespread acute murine infections (lenzi et al ., 1996). All experiments involving animal work were conducted under the brazilian national committee on ethics research ethic guidelines, which are in accordance with international standards (cioms / oms, 1985). The committee on ethics of animal experiments of the universidade federal de so paulo approved the protocol described in this study (permit number: ceua 33710910/14). During experimental procedures balb / c or c57bl/6 mice were infected using an intraperitoneal injection of tissue culturederived gfptransfected g strain (cruz et al ., 2012) or dsredtransfected clstrain trypomastigotes . Mice with parasitemia were monitored every 1 days as previously described (brener, 1962). One day after parasitemia peaked (around day 8 pi for the cl strain and extended for all experiments), animals were sacrificed, and organs were removed . Slices were cut with a sandwich of gem singleedge blades and immersed in phosphatebuffered saline containing 1 m hoechst 33342 (invitrogen, carlsbad, ca, usa) to label nuclei . Samples were then cyanoacrylate glued to coverslips or inverted onto glassbottom dishes (mattek corporation, ashland, ma, usa) in rpmi1640 medium supplemented with 10% fetal bovine serum (gibco, life technologies, brazil). Ex vivo specimens were transferred to a stage top incubator at 37c and 5% co2 with controlled humidity (tokai hit, japan) on a leica sp5 ts confocal microscope . Samples were imaged with a 63 1.40 oilimmersion objective using the resonant scanner (8000 hz) mode for the heart, liver, spleen and intestine (fig . Transfected g (tc i, gfp) (cruz et al ., 2012) and cl (tcvi, dsred) (brener et al ., 1963) parasite strains were cycled as epimastigotes in lit medium or vero cell culture monolayers as trypomastigotes, as previously described (cruz et al ., 2012). Trypanosoma expression construct (ptrexdsrm) containing dsred fluorescent protein was prepared using standard protocols . Briefly, an open reading frame coding the monomeric variant of dsred was amplified by the polymerase chain reaction using oligonucleotides dsrmbf (5ggatccatggacaacaccgaggac3) and dsrmhr (5aagcttctactgggagccggagtg3) containing bamhi and hindiii restriction sites respectively (lower case). Amplicons were resolved on agarose gels, purified, cloned into pgemt easy vector (promega corporation, fitchburg, wi, usa) and sequenced for confirmation . The insert was subcloned into ptex vector (kelly et al ., 1992), finally, the ptexdsrm plasmid was digested with xbai and xhoi restriction enzymes, and the insert was subcloned into ptrex vector (vazquez et al ., 1999) parasite transfections were performed using a gene pulser xcell electroporation system (biorad) as described by (ramirez et al ., 2000). Briefly, 4 10 epimastigotes and 10 g of plasmid dna were mixed in 0.4 cm gap electroporation cuvettes . Samples were submitted to two consecutive pulses of 450 v and 500 f . Parasites were transferred to 5 ml of fresh lit medium and incubated at 26 c for 48 h before selecting for transfected parasites with 200 g / ml of g418 . Parasites appears 58 days postinfection in the liver (cruz et al ., 2012). Cl parasites are more infective and give rise to widespread acute murine infections (lenzi et al ., 1996). All experiments involving animal work were conducted under the brazilian national committee on ethics research ethic guidelines, which are in accordance with international standards (cioms / oms, 1985). The committee on ethics of animal experiments of the universidade federal de so paulo approved the protocol described in this study (permit number: ceua 33710910/14). During experimental procedures balb / c or c57bl/6 mice were infected using an intraperitoneal injection of tissue culturederived gfptransfected g strain (cruz et al ., 2012) or dsredtransfected clstrain trypomastigotes . Mice with parasitemia were monitored every 1 days as previously described (brener, 1962). One day after parasitemia peaked (around day 8 pi for the cl strain and extended for all experiments), animals were sacrificed, and organs were removed . Slices were cut with a sandwich of gem singleedge blades and immersed in phosphatebuffered saline containing 1 m hoechst 33342 (invitrogen, carlsbad, ca, usa) to label nuclei . Samples were then cyanoacrylate glued to coverslips or inverted onto glassbottom dishes (mattek corporation, ashland, ma, usa) in rpmi1640 medium supplemented with 10% fetal bovine serum (gibco, life technologies, brazil). Ex vivo specimens were transferred to a stage top incubator at 37c and 5% co2 with controlled humidity (tokai hit, japan) on a leica sp5 ts confocal microscope . Samples were imaged with a 63 1.40 oilimmersion objective using the resonant scanner (8000 hz) mode for the heart, liver, spleen and intestine (fig . A) organs are placed onto a cold paraffin surface and slices cut with a sandwich of gem single edge blades . Posterior immersion in cold pbs containing 1 m hoechst 33342 to label nuclei is not shown . (b) samples are cyanoacrylate glued to coverslips and inverted onto glassbottom dishes (mattek corporation, usa) in culture medium . In (b) an alternative method is presented in which samples are glued to a starched fabric mesh . (c) ex vivo specimens are placed in a stage top incubator at 37 c and 5% co2 with controlled humidity on a confocal microscope . Trypanosoma cruzi epimastigotelike forms in the intestine . Flagellated epimastigotelike forms observed in an ex vivo intestine section of a ggfp infected mouse at 8 dpi, acquired for 27 seconds with one second intervals . The nest dimensions are 56 m (x, y) x 10 m (z). Actively moving trypomastigotes observed in an ex vivo liver section of a ggfp infected mouse at 8 dpi, acquired for 90 minutes with one minute intervals . Actively moving trypomastigotes observed in an ex vivo liver section of a cldsred infected mouse at 8 dpi, acquired for 1 minute with one second intervals . Threedimensional reconstruction of amastigote forms observed in an ex vivo liver section of a ggfp infected mouse at 8 dpi, acquired for 11 hours with thirty minutes intervals. |
Antenatal care (anc) services are considered to be the key element in the primary health care delivery system of a country, which aims for a healthy society . Over the past 60 years, the maternal health situation in the country has been staggering despite several changes in a rapidly evolving socioeconomic environment . The roles and responsibilities of primary care physicians have also been revised continuously in this context . Under their leadership, different cadres of health workers have been appointed to address the problem . As deadline for millennium development goals is approaching, the need for improving the standard of maternal care is more than ever . In the last decade, as per the national data, health indicators keeping in view the gap between the target and reality, national rural health mission (nrhm) was launched in april 2005, to improve the rural health care delivery system and health status of the people . Accredited social health activists (ashas) were introduced at the village level for motivating the beneficiaries to utilize the antenatal care services provided by the government health facilities . Under supervision of auxillary nurse midwives (anm) and physicians at primary health care level, ashas were planned to play the role of a connecting bridge between community and first level government health sector . These groups of health care providers, along with anganwadi workers (aww), build the base line of rural health services in the country . They, under the mission, seek to provide universal access to equitable, affordable and quality maternal health care, as well as to bring about an improvement in the health status of the pregnant women belonging to underprivileged sections of the society . In this perspective, the present study aimed to find out the determinants of utilization of antenatal care services by the beneficiaries in rural lucknow . The present study, cross - sectional in nature, was conducted among rural beneficiaries in lucknow district from august 2009 to july 2010 . Lucknow, a district in uttar pradesh (up), north india, is having 33.3% of the population living in rural area . The rural part of the district has a literacy rate of 61.8% overall and 52.3% among the females . A rdw was defined as a post natal woman who had delivered a baby during the period from january 2009 till june 2010 . The percentage of women attending antenatal care was 64.2% in rural up, based on the findings of nfhs-3 . Sample size was calculated with a relative precision of 10% and a design effect of 1.5 . Sample size calculation was done using formula to estimate a proportion requirement for 95% confidence . Considering non - response, an additional list of rdw (comprising of 10% of the sample size) was kept ready for every village . In case of absence or unwillingness of the rdw, the list was utilized . Multistage random sampling was used for selecting villages . In the first stage, out of nine community health centers (chcs) in lucknow, two were chosen randomly . In the second stage, two primary health centers (phcs) were selected randomly from each chc, thus four phcs were included in the study . Under each phc, two sub centers were taken within five km and two sub centers were taken more than five km away from the respective phc . In each of the sub centers thus selected, two villages were selected, one in which sub centre is located and any other village, selected via random sampling . Thus, the study covered 32 villages, which includes equal (16 each) number of sub centre villages (scv) and non - sub centre villages (nscv). List of rdws was collected from ashas and awws and then systematic random sampling was followed to pick up the requisite number of beneficiaries . The study was conducted after clearance from the institutional ethical committee and permission from the superintendents of the concerned chc . A pretested structured interview schedule was used to collect required information . Among independent variables, age, religion, caste, type of family, education, socio economic status (ses), parity, and timing of registration were considered . For calculating ses, modified pareek's classification for rural area data entry and analysis were done using pasw statistics version 19.0 (spss inc ., fisher's exact test were used to compare the rdws who took at least three antenatal care visits and who did not . Results were expressed in terms of odd's ratio (or) and confidence interval (ci). Independent variables that were significant at univariate level were included in multivariate model for avoiding confounding . Backward logistic model, based on likelihood ratio, was used to find predictors for institutional deliveries at government hospitals . The fit of final model was assessed using hosmer - lemeshow goodness - of - fit test . Multistage random sampling was used for selecting villages . In the first stage, out of nine community health centers (chcs) in lucknow, two were chosen randomly . In the second stage, two primary health centers (phcs) were selected randomly from each chc, thus four phcs were included in the study . Under each phc, two sub centers were taken within five km and two sub centers were taken more than five km away from the respective phc . In each of the sub centers thus selected, two villages were selected, one in which sub centre is located and any other village, selected via random sampling . Thus, the study covered 32 villages, which includes equal (16 each) number of sub centre villages (scv) and non - sub centre villages (nscv). List of rdws was collected from ashas and awws and then systematic random sampling was followed to pick up the requisite number of beneficiaries . The study was conducted after clearance from the institutional ethical committee and permission from the superintendents of the concerned chc . A pretested structured interview schedule was used to collect required information . Among independent variables, age, religion, caste, type of family, education, socio economic status (ses), parity, and timing of registration were considered . For calculating ses, modified pareek's classification for rural area data entry and analysis were done using pasw statistics version 19.0 (spss inc ., fisher's exact test were used to compare the rdws who took at least three antenatal care visits and who did not . Results were expressed in terms of odd's ratio (or) and confidence interval (ci). Independent variables that were significant at univariate level were included in multivariate model for avoiding confounding . Backward logistic model, based on likelihood ratio, was used to find predictors for institutional deliveries at government hospitals . The fit of final model was assessed using hosmer - lemeshow goodness - of - fit test . About half (54.5%) of the rdws were above the age of 25 years . Overall, 85.5% of the rdws took at least three anc services during their pregnancy (95% ci: 81.8% - 88.9%) and 53.7% of them got registered during the first trimester of pregnancy (95% ci: 49.1% - 59.1%). Chcs and anganwadi centers (awc) were the most common (50.9% and 48.6%, respectively) sources of antenatal care services for them . For scv, sub centre was the most common (52.3%) source followed by chc (45.5%) for antenatal care services . For nscv, awc was the most common (63.1%) source followed by chc (56.3%), for the same services [table 1]. Distribution of rdws according to the source of antenatal care during their last pregnancy * at the comparison between the profiles of the women who went for three anc visits and who did not, significant difference was found in terms of age, ses, and timing of registration . About 89.1% rdw above the age of 25 years took three or more such visits . Majority (91%) of the pregnant women who got them registered early went for more number of antenatal visits . The influence of religion, caste, education, family type or parity was not prominent though higher utilization was seen with increasing education [table 2]. Comparison of the profile of the rdws based on three antenatal care visits on simple logistic regression, no significant relation was found between three anc visits and religion, caste, education, family type or parity of the rdws . However, significant relation was found between three ante natal care visits and age (or = 1.189, 95% ci = 1.029 3.433), ses (or = 1.888, 95% ci = 1.009 3.533), and timing of antenatal registration (or = 2.667, 95% ci = 1.427 4.984). Women with age more than 25 years, higher ses, and early registration were found to be more likely to get three or more number of antenatal visits [table 3]. Factors associated with three antenatal care visits by the rdws on simple logistic regression at multivariate level, significant variables in the model were age of woman (or = 2.107, 95% ci = 1.132 3.923) and timing of registration (or = 2.817, 95% ci= 1.487 5.338) [table 4]. The result of hosmer - lemeshow goodness - of - fit test was not significant (p = 0.683, df = 6). Overall correct classification result indicated that 85.5% of the rdws are predicted rightly about their number of antenatal visits . The study found that all the studied beneficiaries got themselves registered for antenatal care services . However, the findings are different from the observation of murthy, which showed that for phc / sc villages, the coverage was more than other villages . No such difference was found in the present study with regard to presence of sub centre in the village and this could be attributed to presence of asha in every village . Majority of the beneficiaries attended three or more anc check - up and they got themselves registered most commonly in the first trimester of pregnancy . It was observed in the present study that chc and awc were the most common sources of antenatal care services for the beneficiaries . This is not consistent with a previous study, which found that most of the pregnant females went to sub centre or phc . Preference for chc in the present study might be due to provision of lab facilities, while awcs were chosen due to their presence in every village . Among different factors, less age has earlier been established as the determinant for three or more anc visits . In contrary to these studies, the present study suggests that increased age is associated with at least three antenatal visits . This might be due to increased awareness and more familiarity with the health workers with increasing age . The doctors at the phc and chc level should be more elaborate to the young pregnant ladies, as the latter, many a times, lack sufficient information . As per our study, ses was associated with adequate number of anc visits although after controlling for other variables, it could not come out as significant . Previous studies also pointed towards economic factor as a predictor . In an area where three fourth of the population survive in a low standard of living, economic factors providing free care or conditional cash transfer will continue to be weighed against loss of daily wages in financially staggering part of the society . Without an overall improvement in the standard of living, nothing more it is thought to pave way for longer period of contact between rdw and health workers . That explains higher tendency of early registered women to go for three or more number of anc visits . This finding is important, since it implies that encouraging early registration will ensure better maternal health in a long run . Although it was not statistically significant, it is worth noting as several other studies in the past recorded the role of education in deciding health seeking attitude of pregnant women . Education, on the other hand, by imparting awareness and autonomy to the women, encourages utilization of maternal services and leads to demand for maternal health care services . To sum up more importantly, the introduction of ashas at the rural level seemed to have influenced the health care seeking attitude of the rdws . It's too early to say that ashas have changed the face of primary health care over past few years . Setbacks are still there but it has been proved that ashas could play a pivotal role in improvising the health seeking attitudes of rural population . Primary care physicians should also motivate the rdws for regular ante natal visits . At this stage of pregnancy, women are usually more receptive to their advices . This opportunity should be utilized today for the sake of a better maternal health tomorrow . Evaluation of nrhm at the grass root level through a community - based approach, meticulously collected data and finding out the predictors for three anc visits are few strengths of this study . On the other hand, dependence of the sampling procedure on the completeness of the lists of rdws, retrieved from asha and aww, second, recall bias was not an impossible factor as the clients were asked regarding their pregnancies in this cross sectional study . Third, we did not ask for the reasons for getting less number of antenatal care visits . Elicitation of such causes would have revealed the views of the rdws in this regard . In addition, a longitudinal study will help in better understanding of the role of socio demographic as well as behavioral factors for sufficient antenatal care . Evaluation of nrhm at the grass root level through a community - based approach, meticulously collected data and finding out the predictors for three anc visits are few strengths of this study . On the other hand, dependence of the sampling procedure on the completeness of the lists of rdws, retrieved from asha and aww, is one of the limitations . Second, recall bias was not an impossible factor as the clients were asked regarding their pregnancies in this cross sectional study . Third, we did not ask for the reasons for getting less number of antenatal care visits . Elicitation of such causes would have revealed the views of the rdws in this regard . In addition, a longitudinal study will help in better understanding of the role of socio demographic as well as behavioral factors for sufficient antenatal care . Elder rdws and those with early registration were found to be more likely to have at least three antenatal care visits . Encouraging early registration and more focus on young mothers should be the thrust areas in maternal health program . Younger mothers are easily convincible, personal interaction with them on part of asha could bring in successful changes in behavior . Counseling for early registration should also get priorities, as it would be the first step for sufficient antenatal care visits to the health facility . Under nrhm, there is improvement in anc coverage but health sector is yet to get 15% of the clients convinced, who are availing less care during their pregnancy . Besides, conditional cash transfer has certain limitations in indian perspective, corruption being on of them . Until there are improvements in terms of quality of care and community participation, it will remain challenging to achieve higher coverage of anc in rural areas . It is, therefore, recommended to focus on the predictors at individual as well as community level to bring about development in maternal health care utilization. |
A 73-year - old female was admitted for surgical removal of a left renal pelvic mass . She has taken antihypertensive agents for 30 years and received percutaneous coronary intervention due to stable angina 3 years ago . During routine follow - up, a renal mass was incidentally detected 2 months ago . Laboratory values revealed a marginal elevation of serum creatinine (1.21 mg / dl). The ultrasonography showed an echogenic mass within the renal pelvis and mild dilation of several calyces . The calcified lesion was not found on plain radiograph of the abdomen (kidneys, ureters, and bladder). An abdominopelvic computed tomography revealed a noncalcified soft tissue mass in the left renal pelvis on precontrast enhancement scan . The cut surface of the resected specimen revealed a 532 cm - sized, well - defined ovoid, cystic mass which was compactly filled with white and reddish tan - colored amorphous materials in the pelvis . Histologically, the cystic lumen contained multiple keratinous materials and much of the cystic lining epithelia were denuded ., santa cruz, ca, usa) and cytokeratin 7 (ck7) (1:100; dako, glostrup, denmark) was performed to identify epithelium - specificdifferentiation . In contrast, most of the cells in the lining of squamous epithelia were negative for these urothelial specific antibodies . However, some portion of the squamous epithelia interestingly contained a few uroplakin - positive cells (fig . Even though the epidermoid cyst of the kidney is a very rare to be characterized, the typical features of the lesion can be summarized as follows . The clinical symptoms are flank pain, gross hematuria, or lower urinary tract symptoms . The calcified inhomogeneous lesion, combined renal stone, and previous renal surgery are other important clinical clues for the renal epidermoid cyst (table 1). To date, two cases of epidermoid cyst in the renal pelvis have been reported . They also showed a typical calcified lesion combined with renal stone like other renal epidermoid cysts . With these reasons, it seemed hard to think of epidermoid cyst as a presumptive diagnosis before surgery in this case . To the best of our knowledge, this case of a noncalcified epidermoid cyst in the renal pelvis is the first report in the english literature . The histology of a typical epidermal cyst that was lined by stratified squamous cells with laminated keratins . Although epidermoid cyst of the skin is a common lesion resulted from implantation of epidermis into the dermis, histogenesis of epidermoid cyst in the kidney remains uncertain . As a possible histogenetic mechanism, either epidermal embryonic remnants of wolffian ducts or traumatic implantation of transformed epithelial cells during renal operation have been proposed . The extension of squamous metaplastic changes from the upper ureter to the pelvocalyceal system in prolonged irritative condition induced mostly by stones is considered as the other plausible explanation . However, the cellular basis of squamous metaplasia is not fully understood in this rare condition . The apical surface of urothelium is highly specialized as it is covered almost by urothelial plaques which are composed of uroplakins . Four uroplakins (ia, ib, ii, and iii) have been isolated and are considered to be biochemical markers of terminal urothelial differentiation . Ck7 is an intermediate filament proteins expressed in a wide variety of simple epithelia but not in the squamous epithelia . It is well known that vitamin a deficiency can induce keratinizing squamous metaplasia in a variety of epithelia including urothelium . The urothelial keratinization in the vitamin a - deficient mice bladder occurred heterogeneously adjacent to areas lined with normal appearing urothelium . The sharp boundary between the keratinized epithelium and the seemingly normal urothelium was maintained with no intermediated cells . According to the our histologic examination, nearly almost of the urothelial cells in the cystic lining were positively stained against both uroplakin ii and ck7, but most of the squamous epithelial cells were negative for these antibodies . The two epithelia were sharply delineated and more distinctly distinguishable in the immunohistochemical stained sections . These features were similar with heterogenous metaplasia of the animal urothelium in the previous study . However, some squamous epithelia contained a few uroplakin - positive cells and ck7-positive cells to some extent . Even though the significance of few uroplakin expressions in squmous epithelium should be evaluated by other studies, is this an indirect evidence of the direct transformation of umbrella cells to squamous metaplasia or dedifferenctiation of metaplastic squamous epithelium to urothelium? |
In total, 131 of 140 consecutive patients with figo stage (1988 figo staging) i - ii eoc, who underwent primary surgery and postsurgical chemotherapy in the uppsala - rebro medical region during the 5-year period from january 1, 2000, to december 31, 2004, were entered into this study . All samples were collected with the patient s informed consent (131 of 140 patients accepted) and were in compliance with the helsinki declaration19 and used in accordance with the swedish biobank legislation and ethical review act (approval by uppsala ethical review board, decision ref . There were 131 available tumors for analysis of p53 and p27, 130 tumors for pten and bax, and 129 tumors for analysis of p21, c - myc, and puma (lower numbers because of technical issues in the staining process). Modified surgical staging according to the european organisation for research and treatment of cancer surgical staging20 was undertaken in 34 (26%) of 131 cases, and in the remaining 77 patients (74%), surgical staging was regarded as minimal or inadequate . All patients had chemotherapy 4 to 6 weeks after primary surgery, usually (n = 105) paclitaxel 175 mg / m and carboplatin (area under the curve = 5) at 3-week intervals usually in 4 courses or single - drug carboplatin in 4 to 6 courses . The mean follow - up time was 65 months (range, 5110 months). Survival was defined as date of confirmed histological diagnosis after primary surgery to date of recurrence, death, or last visit . The specimens were obtained from the paraffin blocks containing the embedded tissue removed from the tumor at primary surgery, and after staining with hematoxylin - eosin, they were classified and graded by a single pathologist . The tissue microarrays were constructed as described previously.21 two tissue core specimens (diameter, 0.6 mm) from all 131 ovarian carcinomas were arranged in 3 recipient paraffin blocks . The presence of tumor tissue on the arrayed samples was verified by hematoxylin - eosin stained section by a pathologist . Five - micrometer - thick sections were cut from each multitissue block and were put on coated slides and dried overnight at 37c . The sections were pretreated by heath - induced epitope retrieval in target - retrieval solution (dako, glostrup, denmark), ph 6, or edta buffer, ph 9, for 7 + 7 minutes in microwave oven (99c). Blocking with peroxidase information about the primary antibodies and ihc analyses can be found in previous studies.1518 the ihc stainings were interpreted by 2 of the authors (i.s . And t.s . ). At the time of evaluation, a semiquantitative analysis22 was used, and the stainings were graded as negative, +, + +, and + + + for p53, p21, p27, c - myc, pten, and bax, and all those markers were dichotomized into negative and positive (+, + +, + + +) cases.23 however, for puma, weak positive staining (+) was graded as negative (), and moderate / strong staining (+ + /+++) graded as positive . The staining for p21 and p53 was considered to be positive when there was a strong, granular staining of the nuclei of the majority of tumor cells, but the staining for p27 and pten was considered to be positive when strong granular staining of the nuclei and cytoplasm of the tumor cells was found . Localization for c - myc staining was nuclear, cytoplasmic, and membranous in the tumor cells . However, the cases, which were interpreted as positive, showed strong granular and punctuate staining of the cytoplasm in most of the tumor cells . Weak cytoplasmic staining for puma was detected in tumor cells in almost all tumors evaluated . As negative staining of cytoplasm hardly was detected in this series of patients, our findings were limited to weak or moderate / strong staining of cytoplasm . The survival curve was generated by using the kaplan - meier technique, and differences between these curves were tested by the log - rank test . The logistic regression model was used for both univariate and multivariate analysis with recurrent disease and tumor type (i / ii) as the endpoint, respectively . All tests were 2-sided, and the level of statistical significance was p 0.05 . The statistica 12.0 (statsoft) statistical package for personal computers was used for the analyses . The specimens were obtained from the paraffin blocks containing the embedded tissue removed from the tumor at primary surgery, and after staining with hematoxylin - eosin, they were classified and graded by a single pathologist . The tissue microarrays were constructed as described previously.21 two tissue core specimens (diameter, 0.6 mm) from all 131 ovarian carcinomas were arranged in 3 recipient paraffin blocks . The presence of tumor tissue on the arrayed samples was verified by hematoxylin - eosin stained section by a pathologist . Five - micrometer - thick sections were cut from each multitissue block and were put on coated slides and dried overnight at 37c . The sections were pretreated by heath - induced epitope retrieval in target - retrieval solution (dako, glostrup, denmark), ph 6, or edta buffer, ph 9, for 7 + 7 minutes in microwave oven (99c). Blocking with peroxidase information about the primary antibodies and ihc analyses can be found in previous studies.1518 the ihc stainings were interpreted by 2 of the authors (i.s . And t.s . ). At the time of evaluation, a semiquantitative analysis22 was used, and the stainings were graded as negative, +, + +, and + + + for p53, p21, p27, c - myc, pten, and bax, and all those markers were dichotomized into negative and positive (+, + +, + + +) cases.23 however, for puma, weak positive staining (+) was graded as negative (), and moderate / strong staining (+ + /+++) graded as positive . The staining for p21 and p53 was considered to be positive when there was a strong, granular staining of the nuclei of the majority of tumor cells, but the staining for p27 and pten was considered to be positive when strong granular staining of the nuclei and cytoplasm of the tumor cells was found . Localization for c - myc staining was nuclear, cytoplasmic, and membranous in the tumor cells . However, the cases, which were interpreted as positive, showed strong granular and punctuate staining of the cytoplasm in most of the tumor cells . Weak cytoplasmic staining for puma was detected in tumor cells in almost all tumors evaluated . As negative staining of cytoplasm hardly was detected in this series of patients, our findings were limited to weak or moderate / strong staining of cytoplasm . The survival curve was generated by using the kaplan - meier technique, and differences between these curves were tested by the log - rank test . The logistic regression model was used for both univariate and multivariate analysis with recurrent disease and tumor type (i / ii) as the endpoint, respectively . All tests were 2-sided, and the level of statistical significance was p 0.05 . The statistica 12.0 (statsoft) statistical package for personal computers was used for the analyses . Patients characteristics are demonstrated in table 1 . The study population included 79 type i tumors (65.8%) and 52 type ii tumors (34.2%). The number of recurrences in the complete series was 34 (26%) of 131, and 22 of these patients died because of disease . In the complete series, recurrent disease was associated with figo substages (p = 0.0005), figo grade (p = 0.030), adequate surgical staging (p = 0.033), and residual disease (p = 0.001). The 5-year disease - free survival rate was 68%, the disease - specific survival rate was 76%, and the overall survival rate was 71% . Patients characteristics (n = 131) the mean age of patients with type i tumors (57.2 years) did not differ from that in type ii group (60.7 years) (table 2). However, the group of patients with type i tumors had significantly (p = 0.039) higher body mass index (bmi) compared with the type ii group . Residual tumor after primary surgery (all 6 patients in figo stage iic) occurred more frequently (p = 0.025) in type ii tumors . Recurrent disease was more frequently (p = 0.025) found among patients with type ii tumors, and it was a trend (p = 0.054) toward better disease - free survival among patients of type i tumors (fig . Clinical features compared between types i and ii tumors disease - free survival was compared between patients with type i tumors (n = 79) and type ii (n = 52) tumors in the study . In previous studies1517 including the total series of patients (n = 131) and18 including 105 (adjuvant taxane chemotherapy) of 131 patients, respectively, results from ihc for some cell cycle associated proteins and several combinations of those have already been presented . The status of protein expression (positivity / negativity) for the apoptosis regulators, p53, c - myc, bax, puma, and pten and the cell cycle regulatory proteins p21 and p27 and some combinations of those is presented (table 3) and compared between types i and ii tumors . Positive staining for p53 and p27 alone was more frequently detected in type ii tumors (fig . Concomitant positivity for p53 and negativity for p21 (p53p21) and concomitant positivity for bax and negativity for p53 (baxp53) also were more frequently found in type ii tumors compared with expression status for alternative combinations of biomarkers detected in type i tumors . Differently, concomitant positivity for p21 and p27 (p21p27), concomitant positivity for c - myc and negativity for p53 (c - mycp53), concomitant positivity for c - myc and p21 (c - mycp21), and concomitant negativity for puma and p53 (pumap53) were more frequently detected in type i tumors compared with expression status for alternative combinations of those biomarkers found in type ii tumors . Protein expression of apoptosis regulators versus types i and ii ovarian tumors (n = 131) immunohistochemical results for type ii tumor (high grade serous) are demonstrated: a, high grade serous carcinoma with strong positivity for p27 . D, high grade serous carcinoma with p53-expression . Concomitant positivity for p53 and negativity for p21, positivity for p27, and negativity for c - myc in an epithelial ovarian tumor might strengthen the diagnostic option of type ii tumor ovarian carcinoma . Results are shown in tables 4a - c for univariate and multivariate logistic regression analyses . In table 4a, with recurrent disease as endpoint, figo stage, tumor type (i vs ii), bmi in the 2 groups, and p53 status all were independent predictive factors for recurrent disease . In a multivariate logistic regression analysis with type i / ii tumors as endpoint, recurrent disease and status of p53 or p53p21 were not introduced in the multivariate model together because of strong correlation between them . In table 4b, age, status of c - myc, and concomitant positivity for p53 and negativity for p21 all were independent predictive factors . In a separate multivariate logistic regression analysis with type i / ii tumors also as endpoint (table 4c), age, bmi, p27 status, and recurrent disease all were independent predictive factors . A. predictive factors for recurrent disease (univariate and multivariate logistic regression analysis) b. possible predictive factors that distinguish types i and ii tumors eoc in figo stages i - ii (univariate and multivariate logistic regression analysis) c. possible predictive factors that distinguish types i and ii tumors eoc in figo stages patients characteristics are demonstrated in table 1 . The study population included 79 type i tumors (65.8%) and 52 type ii tumors (34.2%). The number of recurrences in the complete series was 34 (26%) of 131, and 22 of these patients died because of disease . In the complete series, recurrent disease was associated with figo substages (p = 0.0005), figo grade (p = 0.030), adequate surgical staging (p = 0.033), and residual disease (p = 0.001). The 5-year disease - free survival rate was 68%, the disease - specific survival rate was 76%, and the overall survival rate was 71% . The mean age of patients with type i tumors (57.2 years) did not differ from that in type ii group (60.7 years) (table 2). However, the group of patients with type i tumors had significantly (p = 0.039) higher body mass index (bmi) compared with the type ii group . Residual tumor after primary surgery (all 6 patients in figo stage iic) occurred more frequently (p = 0.025) in type ii tumors . Recurrent disease was more frequently (p = 0.025) found among patients with type ii tumors, and it was a trend (p = 0.054) toward better disease - free survival among patients of type i tumors (fig . Clinical features compared between types i and ii tumors disease - free survival was compared between patients with type i tumors (n = 79) and type ii (n = 52) tumors in the study . In previous studies1517 including the total series of patients (n = 131) and18 including 105 (adjuvant taxane chemotherapy) of 131 patients, respectively, results from ihc for some cell cycle associated proteins and several combinations of those have already been presented . The status of protein expression (positivity / negativity) for the apoptosis regulators, p53, c - myc, bax, puma, and pten and the cell cycle regulatory proteins p21 and p27 and some combinations of those is presented (table 3) and compared between types i and ii tumors . Positive staining for p53 and p27 alone was more frequently detected in type ii tumors (fig . Concomitant positivity for p53 and negativity for p21 (p53p21) and concomitant positivity for bax and negativity for p53 (baxp53) also were more frequently found in type ii tumors compared with expression status for alternative combinations of biomarkers detected in type i tumors . Differently, concomitant positivity for p21 and p27 (p21p27), concomitant positivity for c - myc and negativity for p53 (c - mycp53), concomitant positivity for c - myc and p21 (c - mycp21), and concomitant negativity for puma and p53 (pumap53) were more frequently detected in type i tumors compared with expression status for alternative combinations of those biomarkers found in type ii tumors . Protein expression of apoptosis regulators versus types i and ii ovarian tumors (n = 131) immunohistochemical results for type ii tumor (high grade serous) are demonstrated: a, high grade serous carcinoma with strong positivity for p27 . Concomitant positivity for p53 and negativity for p21, positivity for p27, and negativity for c - myc in an epithelial ovarian tumor might strengthen the diagnostic option of type ii tumor ovarian carcinoma . Results are shown in tables 4a - c for univariate and multivariate logistic regression analyses . In table 4a, with recurrent disease as endpoint, figo stage, tumor type (i vs ii), bmi in the 2 groups, and p53 status all were independent predictive factors for recurrent disease . In a multivariate logistic regression analysis with type i / ii tumors as endpoint, recurrent disease and status of p53 or p53p21 were not introduced in the multivariate model together because of strong correlation between them . In table 4b, age, status of c - myc, and concomitant positivity for p53 and negativity for p21 all were independent predictive factors . In a separate multivariate logistic regression analysis with type i / ii tumors also as endpoint (table 4c), age, bmi, p27 status, and recurrent disease all were independent predictive factors . A. predictive factors for recurrent disease (univariate and multivariate logistic regression analysis) b. possible predictive factors that distinguish types i and ii tumors eoc in figo stages i - ii (univariate and multivariate logistic regression analysis) c. possible predictive factors that distinguish types i and ii tumors eoc in figo stages i - ii (univariate and multivariate logistic regression analysis) findings from the present study have confirmed that types i and ii ovarian tumors exhibit different clinicopathological and ihc features . This is confirmed by previous studies on the basis of morphologic and molecular genetics, showing, that the 5 main histological types of ovarian cancer can be classified into types i and ii.2,7 positive staining for the apoptosis regulator p53, concomitant positivity for p53 and negativity for the cell cycle regulator p21 (vs other combinations in one group), and positive staining for the cell cycle regulator p27 were more frequently detected in type ii tumors . Differently, positive staining for the apoptosis regulator c - myc was more frequently seen in type i tumors . Our findings related to the ihc differences between types i and ii tumors are supported by earlier studies.4,10,24 differences in clinical aspects between types i and ii tumors have also been noted . Thus, patients with type ii tumors were of higher age, had lower bmi, and had more often recurrent disease than patients with type i tumors . Previous studies have reported that patients with low - grade serous carcinoma are younger than those with high - grade serous tumors and that there is an elevated risk for eoc in women with higher bmi for type i tumors.24,25 furthermore, recurrent disease occurred more frequently among patients in the subgroup of type ii tumors, which had 3.8 times increased risk of recurrent disease compared with women with type i tumor . In our series, there was a trend (p = 0.054) for better disease - free survival for patients with type i tumors compared with patients with type ii tumors (fig . Of the eoc patients will present at diagnosis with stage i - ii disease with a favorable survival . However, about 30% of those patients will have recurrent disease and survival that is comparable with survival after recurrent disease for patients with stage iii - iv disease.1 in our study limited to figo stages i - ii, the recurrence rate was 26% for all patients with types i and ii tumors in 1 group, and in multivariate analysis, the figo stage was the strongest (odds ratio [or], 4.7) clinical predictive factor for recurrent disease . In a study from canada26 on 605 patients in figo stages i - ii, the figo stage was a strong (or, 8.0) predictive factor for tumor recurrence . The p53 status was also an independent predictive factor for recurrent disease in the present study with an or of 4.2 . This has been confirmed in other studies.27,28 in a meta - analysis including 62 studies, a hazard ratio of 1.47 for p53 status was found with overall survival as endpoint.29 there is mounting evidence that types i and ii ovarian tumors develop along different molecular pathways,4,6 and tumor type is considered to reflect different diseases with different clinical behavior, response to chemotherapy, and prognosis.26 the apoptosis regulator p53 was an independent predictive factor for type ii tumor only in combination with the cell cycle regulator p21 . Thus, the ihc profile of p53 positivity and concomitant negativity of the cell cycle regulator p21 was unique for type ii tumors . The p21 gene is the primary mediator of p53-induced cell cycle arrest, and cells lacking functional p53 express only low levels of p21.10 presence of the cell cycle regulator p27 alone was mostly (or, 3) detected in type ii tumors, and an or of 0.3 for p27 status with recurrent disease as endpoint meant 70% decreased risk for a patient with p27 positivity of the tumor to have recurrent disease . In 1 study,30 the p27 status alone was related to better survival or in combination with p53 in another study.15 differently, presence of the apoptosis regulator c - myc was a predictive factor for type i tumor in a logistic regression analysis . The proposed model by assigning different ovarian tumors into 2 categories (types i and ii) based on clinical, morphological, and molecular genetic characteristics facilitates understanding the pathogenesis of ovarian cancer.31 type i tumors are considered as slowly growing neoplasm through borderline tumors, but according to 1 study,32 it is possible that some serous type i tumors can progress to serous type ii tumors . How could this new proposed model, which divides ovarian tumors into 2 different artificial types of tumors, become helpful in the clinics? At present, adjuvant therapy for ovarian cancer is mainly dependent on figo stage and grade rather than type, and many hospitals have recommended that patients with ovarian carcinoma in figo stage ia of tumor grade 1 should not receive adjuvant therapy.33 type i tumors, which are considered resistant to traditional chemotherapeutic agents, may in the future have treatment guidelines, which are different from type ii tumors.24 the grade assignment lacks reproducibility depending on the grading system used, and tumor grade does not alone reflect the biological differences of the different types . Based on improvements in how many types are assigned by pathologists, the reproducibility of typing is much better than that of grading.34,35 differences in the ihc profile for p53 p21 status, p27 status, and c - myc status between types i and ii tumors were detected in the present study . Concomitant positivity for p53 and negativity for p21, positivity for p27, and negativity for c - myc in an epithelial ovarian tumor might strengthen the pathological diagnosis of type ii tumor ovarian carcinoma . Thus, our findings might be useful in the histopathologic distinction of types i and ii ovarian carcinoma, and the use of designed panels, based on observations in a defined tumor material, as in this series, may increase the diagnostic options . Tumor type has more reproducibly assigned than grade and identifies a larger cohort of women with stage i / ii ovarian carcinoma with favorable outcomes and therefore is superior to grade in estimating risk of death from ovarian carcinoma.26 however, some authorities in the field are in some disagreement with the new classification into 2 groups, designed as types i and ii tumors . Thus, clear cell carcinoma exhibits morphologic, molecular, and clinical features that do not entirely resemble either type i or type ii tumors, and unlike other type i tumors, clear cell carcinoma is designed as high grade at presentation.36,37 this is in agreement with recent findings from zannoni et al,36 where they show that clear cell ovarian carcinoma should be studied separately, but still in comparison with the groups of types i and ii tumors . It is likely, that serous type ii carcinomas containing cells with clear cytoplasm have erroneously been classified as clear cell type i carcinoma in different studies.38 according to prat,2 the classification into just 2 types (i and ii) is artificial and limits progress in understanding the biology of the less common types of ovarian carcinoma . Limitations of this study correspond to the relative limited number of patients included and the tissue microarray technology, where only 2 0.6-mm core biopsies were obtained from each specimen for analysis as ovarian carcinomas can be very heterogeneous, and such specimens may not be representative of the tumor in some cases . Finally, the method of semiquantitative analysis22 was used for the interpretation, where all markers were dichotomized into negative and positive groups.23 however, our findings might be useful in the pathologic diagnosis of distinction of types i and ii epithelial ovarian carcinoma. |
Four years prior to the h - mrs study a 13-year - old girl suffered from an abscess on the back of her right knee, which was then therapeutically drained . Two years later, the patient was referred to our hospital for the first time with a non - inflamed swelling of the right calf . Conventional mri with t1- and t2-weighted sequences and magnetic resonance angiography did not indicate any tumor or hemangioma, but an enlargement of the medial portion of the right gm was clearly depicted (fig . Clinical examination did not show significant differences between the legs concerning muscular strength or the pattern of reflexes . After all, a larger circumference of 3 cm of the right calf was stated compared to the left side, interpreted as muscular hypertrophy . Partial denervation or irritation of related branches of the tibialis nerve due to the former abscess and its treatment was supposed to be the reason for the hypertrophy of the gm . A muscle biopsy was not performed due to normal morphology and a lack of muscular dysfunction . For assessment of muscular lipids under these specific pathologic conditions, a combined mri and h - mrs examination the aim of the examination was to evaluate whether there is any substantial local effect on the lipid stores in the affected muscle and its agonist . The results of the patient were compared to the data from both calves of four healthy young (age 30 - 35 years) volunteers without any history of metabolic or muscular diseases . All subjects gave written consent, and the studies were approved by the local ethics committee of the university school of medicine . Mr examinations were performed on a 1.5 tesla whole - body system (magnetom vision; siemens, erlangen, germany). In both legs two muscles of the calf were examined: the sol and the medial portion of the gm, both being functional agonists and muscles with high oxidative capacity . Standard multi - planar t1- and t2-weighted imaging allowed assessment of possible changes in muscular signal characteristics and of hyper- or hypotrophy . Positioning for localized h - mrs was performed on the t1-weighted images as indicated in figure 1 . Localized h spectra with a voxel size of 2.4 cm were recorded from representative regions in the muscles using the standard extremity coil for radiofrequency excitation and signal recording . The region of interest (roi) was positioned in the central part of the muscles in order to avoid contributions from macroscopic fatty layers between the muscle groups and field distortions due to large vessels or bony structures . It is known from chemical shift imaging (csi) examinations that the imcl level tends to be rather homogeneous inside a specific muscle while emcl contributions show more variations for changed roi position (18). Spectra were recorded using a stimulated echo acquisition mode (steam) technique with tr = 2 s / te = 10 ms / tm = 15 ms and with frequency selective water suppression . The recorded signals underwent common post - processing procedures, which included the following: gaussian filtering with maximum at 0 ms and half maximum after 150 ms, fourier transformation, constant and linear phase correction . For both, sol and gm muscles, total muscle lipids (tml) were measured as the area under the signal curve in fixed frequency borders (tml; 1.3 - 1.8 ppm, covering all methylene signals). In addition, the methyl creatine signal (3.05 - 3.25 ppm; maximum signal set to 3.15 ppm) was calculated for each spectrum . Since fibre orientation in gm leads to overlapping signals from imcl and emcl, separate imcl values could only be determined for sol (frequency borders: 1.3 - 1.5 ppm), where both signal portions were distinguishable in the spectrum . Tml and imcl values are given as signal ratios between the integral lipid signals and the integral of the creatine signal . Values in the control group were compared by a student's t - test after passing a normality test . Four years prior to the h - mrs study a 13-year - old girl suffered from an abscess on the back of her right knee, which was then therapeutically drained . Two years later, the patient was referred to our hospital for the first time with a non - inflamed swelling of the right calf . Conventional mri with t1- and t2-weighted sequences and magnetic resonance angiography did not indicate any tumor or hemangioma, but an enlargement of the medial portion of the right gm was clearly depicted (fig . Clinical examination did not show significant differences between the legs concerning muscular strength or the pattern of reflexes . After all, a larger circumference of 3 cm of the right calf was stated compared to the left side, interpreted as muscular hypertrophy . Partial denervation or irritation of related branches of the tibialis nerve due to the former abscess and its treatment was supposed to be the reason for the hypertrophy of the gm . A muscle biopsy was not performed due to normal morphology and a lack of muscular dysfunction . For assessment of muscular lipids under these specific pathologic conditions, a combined mri and h - mrs examination the aim of the examination was to evaluate whether there is any substantial local effect on the lipid stores in the affected muscle and its agonist . The results of the patient were compared to the data from both calves of four healthy young (age 30 - 35 years) volunteers without any history of metabolic or muscular diseases . All subjects gave written consent, and the studies were approved by the local ethics committee of the university school of medicine . Mr examinations were performed on a 1.5 tesla whole - body system (magnetom vision; siemens, erlangen, germany). In both legs two muscles of the calf were examined: the sol and the medial portion of the gm, both being functional agonists and muscles with high oxidative capacity . Standard multi - planar t1- and t2-weighted imaging allowed assessment of possible changes in muscular signal characteristics and of hyper- or hypotrophy . Positioning for localized h - mrs was performed on the t1-weighted images as indicated in figure 1 . Localized h spectra with a voxel size of 2.4 cm were recorded from representative regions in the muscles using the standard extremity coil for radiofrequency excitation and signal recording . The region of interest (roi) was positioned in the central part of the muscles in order to avoid contributions from macroscopic fatty layers between the muscle groups and field distortions due to large vessels or bony structures . It is known from chemical shift imaging (csi) examinations that the imcl level tends to be rather homogeneous inside a specific muscle while emcl contributions show more variations for changed roi position (18). Spectra were recorded using a stimulated echo acquisition mode (steam) technique with tr = 2 s / te = 10 ms / tm = 15 ms and with frequency selective water suppression . The recorded signals underwent common post - processing procedures, which included the following: gaussian filtering with maximum at 0 ms and half maximum after 150 ms, fourier transformation, constant and linear phase correction . For both, sol and gm muscles, total muscle lipids (tml) were measured as the area under the signal curve in fixed frequency borders (tml; 1.3 - 1.8 ppm, covering all methylene signals). In addition, the methyl creatine signal (3.05 - 3.25 ppm; maximum signal set to 3.15 ppm) was calculated for each spectrum . Since fibre orientation in gm leads to overlapping signals from imcl and emcl, separate imcl values could only be determined for sol (frequency borders: 1.3 - 1.5 ppm), where both signal portions were distinguishable in the spectrum . Tml and imcl values are given as signal ratios between the integral lipid signals and the integral of the creatine signal . Values in the control group were compared by a student's t - test after passing a normality test . A transverse t1-weighted image of the patient's lower legs is depicted in figure 1 indicating an enlarged transsection area of approximately 50% of the right gm when compared to the left side . Other muscles of the lower leg do not show any remarkable difference in size or morphology when compared to the left side . When the same calibration of the mr system (coil system, transmitter, receiver, signal calibration, post - processing) was applied, integral values of the creatine signals at 3.15 ppm of both muscles, the sol and the gm, did not reveal any remarkable side differences (sol: 34.0 versus 32.0 a.u . The h - spectra indicate a tml in the left gm of 24.0 and a clearly higher content of 38.7 in the right hypertrophic gm (integral lipid values referenced by integral of creatine in the same spectrum) (fig . The spectra from the gm showed high quality (narrow line width), but did not allow the separation of imcl and emcl signals, due to the unfavourable orientation of the muscle fibres with respect to the static magnetic field . The lateral portion was not investigated due to the flat shape of the muscle and the artefacts expected in h - spectra when the voxel would be positioned too close to the subcutaneous fatty tissue (fig . 1). In contrast, h - spectra of sol clearly distinguish between emcl and imcl signals (fig . 2c, d). Those spectra show a difference in imcl between the right and the left leg of the patient: imcl content of the right sol - the same side as the hypertrophy of gm - is clearly lower compared to the left sol (9.2 versus 14.7). In the control group individual creatine values were similar for the left and right calf (sol: 32.9 1.6 versus 35.4 1.5, p = 0.1; gm: 25.8 1.8 versus 29.0 1.8, p = 0.3). Table 1 summarizes the tml data in the control group and indicates also comparatively moderate side differences: for sol the tml values of the normal controls revealed no significant difference between both sides (18.4 3.0 versus 17.0 2.8; p = 0.5). Total muscle lipid values of the patient's sol muscles (19.3 and 18.2) were within the range of the control group . For the gm the patient presented a tml of 24.0 for the left side that was within the normal range, but a clearly higher value of 38.7 for the hypertrophic right gm (table 1). To proof the relation between the muscular lipid content of the agonistic gm and sol, tml - ratios were calculated (tml - ratio = tmlgm / tmlsol) for each leg . For the patient's hypertrophic right leg the tml - ratio amounted to 2.1 (versus 1.13 0.16 in the control group) (fig . Tml - ratio of the (unaffected) left leg of the patient was in the middle range of the normal controls (1.24 versus 1.24 0.20) (fig . A transverse t1-weighted image of the patient's lower legs is depicted in figure 1 indicating an enlarged transsection area of approximately 50% of the right gm when compared to the left side . Other muscles of the lower leg do not show any remarkable difference in size or morphology when compared to the left side . When the same calibration of the mr system (coil system, transmitter, receiver, signal calibration, post - processing) was applied, integral values of the creatine signals at 3.15 ppm of both muscles, the sol and the gm, did not reveal any remarkable side differences (sol: 34.0 versus 32.0 a.u . The h - spectra indicate a tml in the left gm of 24.0 and a clearly higher content of 38.7 in the right hypertrophic gm (integral lipid values referenced by integral of creatine in the same spectrum) (fig . The spectra from the gm showed high quality (narrow line width), but did not allow the separation of imcl and emcl signals, due to the unfavourable orientation of the muscle fibres with respect to the static magnetic field . The lateral portion was not investigated due to the flat shape of the muscle and the artefacts expected in h - spectra when the voxel would be positioned too close to the subcutaneous fatty tissue (fig . 1). In contrast, h - spectra of sol clearly distinguish between emcl and imcl signals (fig . 2c, d). Those spectra show a difference in imcl between the right and the left leg of the patient: imcl content of the right sol - the same side as the hypertrophy of gm - is clearly lower compared to the left sol (9.2 versus 14.7). In the control group no remarkable intra - individual differences in the circumferences of the legs were found . Individual creatine values were similar for the left and right calf (sol: 32.9 1.6 versus 35.4 1.5, p = 0.1; gm: 25.8 1.8 versus 29.0 1.8, p = 0.3). Table 1 summarizes the tml data in the control group and indicates also comparatively moderate side differences: for sol the tml values of the normal controls revealed no significant difference between both sides (18.4 3.0 versus 17.0 2.8; p = 0.5). Total muscle lipid values of the patient's sol muscles (19.3 and 18.2) were within the range of the control group . For the gm the patient presented a tml of 24.0 for the left side that was within the normal range, but a clearly higher value of 38.7 for the hypertrophic right gm (table 1). To proof the relation between the muscular lipid content of the agonistic gm and sol, tml - ratios were calculated (tml - ratio = tmlgm / tmlsol) for each leg . For the patient's hypertrophic right leg the tml - ratio amounted to 2.1 (versus 1.13 0.16 in the control group) (fig . Tml - ratio of the (unaffected) left leg of the patient was in the middle range of the normal controls (1.24 versus 1.24 0.20) (fig . As shown in multiple mri studies, certain muscular pathologies show specific changes in mr images (19). Mr imaging characteristics of denervated hypertrophic musculature can include excessive amounts of interspersed fatty septa within the muscle (19 - 22). (19) only found an isointense enlargement of the muscle, but spectroscopy was not performed to investigate the emcl and imcl content . (23) earlier described spectroscopic changes of the total lipid signal in hypertrophied muscle undergoing botulinum toxin therapy . It should be noted that spectral quality and the aspect of the two different lipid compartments was not given at that time . The case presented in our study was diagnosed as paradoxical hypertrophy with neurogenic origin based on clinical history even though other subjective supportive clinical data were absent . Inflammatory and dystrophic muscular diseases were excluded by clinical history and functional tests as well . There were no typical patterns revealing systemic muscular disease or pathological blood test showing increased creatinine kinase levels . On clinical database and conventional mri, this pathologic case can be considered as both true hypertrophy and pseudohypertrophy of neurologic origin (19, 23). By performing h - mrs signals of muscular lipids true hypertrophy of skeletal muscle leads to a different composition of intracellular metabolites because the increase in muscle mass demands energy substrates such as imcl (15, 17, 18). In our case, the hypertrophic gm on the right side showed an elevated tml content while its agonistic ipsilateral sol did not show significant differences in total muscular lipids, but lowered imcl when compared to the left side . Side differences in four healthy volunteers serving as controls were less pronounced compared to the patient . However, there is an age difference between the patient and the controls . It is known from the literature on localized h - mrs of musculature in vivo and from our experience with several hundreds of examinations in metabolic studies that h - mrs spectra of skeletal musculature show only minor age dependences (mainly with slightly increased fractions of emcl in the elderly). Furthermore, the normal leg of the patient shows signal patterns in the spectra which are very similar to the controls (table 1). The increased total lipid signal of the right hypertrophic gm cannot unambiguously be attributed to imcl or emcl since fibre orientation of this muscle in relation to the b0 field (parallel to the body axis) led to markedly superimposed signal contributions in the spectrum . Compared to sol, fibres in gm are more angulated with respect to the b0 (magnetic field strength), resulting in a lower separation of the lipid fractions as demonstrated by boesch et al . (6). On the other hand, since there are no signs of fatty degeneration or increased amount of fatty septa of this muscle in conventional imaging, the measured extremely high tml level in the hypertrophic muscle is most probably due to an increased amount of imcl in this muscle . Since there was no neurological deficit of the right gm on electrophysiological examination, hypertrophy of gm and the increased level of lipids in this muscle can be interpreted as a result of muscle training . The reason might be the irritation of the tibialis nerve resulting in a modification of the electrical stimulation pattern of this muscle resulting in increased activity of this muscle and consecutively to higher storage of lipids within the muscle cell . The agonistic right sol performed less physical activity leading to a decreased muscular lipid content compared to the contralateral sol . (17) who found a higher imcl content in muscles of well - trained subjects . To our knowledge this is the first clinical case of isolated, externally induced hypertrophy of a muscle in which h - mrs was performed to quantitatively assess muscular lipid content . In musculature with fibre orientation nearly along the body axis (and along the applied outer magnetic field) even separate determination of metabolically highly active imcl and less active emcl is possible (5, 6, 10). In conclusion, h - mrs could be helpful in the assessment of muscle metabolism in cases with partial denervation or nerve irritations . Follow - up studies with h - mrs could become a tool for monitoring the success of therapeutic interventions. |
While multiple studies have examined complication rates after spinal surgery, few studies have focused on risk factors for pulmonary complications after spine surgery . The rates of pulmonary complications after spine surgery has been reported to range from 0.9% to 5%, but methodology and definitions vary from study to study.1,2,3,4 the objective of this study is to identify risk factors for pulmonary complications after spine surgery . Study design: registry study inclusion criteria: all patients who underwent spinal surgery from january 1, 2003 to december 31, 2004 at harborview medical center and the university of washington medical center . Patients younger than 18 years of age patients with incompletely recorded surgical invasiveness scores . Patients with surgical invasiveness scores of 0, as these included patients who did not undergo spinal surgery (risser casting or closed reduction under general anesthesia). Patient population: the spine end results registry at the university of washington medical center is a prospectively recorded database of patients who underwent spinal surgery from january 1, 2003 to december 31, 2004 at harborview medical center or the university of washington medical center in seattle wa . Detailed information with 2-year follow up regarding patient demographic, medical comorbidity, disease severity, surgical invasiveness and adverse outcomes were prospectively recorded as described by mirza et al5 (table 1). Outcome: the primary outcome measure was the occurrence of a pulmonary complication in the 2-year period after spinal surgery . A detailed list of all pulmonary complications with definitions used is summarized in table 2 . Univariate analysis evaluating the association between each categorical variable and a pulmonary complication was performed using pearson's chi - square test or fisher's exact tests (where cell counts were low). Univariate analysis evaluating the association between each continuous variable and a pulmonary complication was performed using unpaired t - tests . Multivariate log - binomial regression was used to determine the association between each risk factor and a pulmonary complication, while controlling for other predictive factors . Risk factors were included in the multivariate log - binomial regression model if they were deemed of clinical importance by the study investigators or if their univariate association had a p - value <.10 . We examined congestive heart failure, asthma, chronic obstructive pulmonary disease, and diabetes as individual risk factors and subsequently examined and adjusted the charlson comorbidity score minus these two components to avoid conflagration of our risk calculation.7 of the 1,745 patients, 38 were excluded because they were younger than 18 years of age and 100 were excluded for surgical invasiveness scores of 0 (risser casting or closed reduction under general anesthesia). Fifteen had missing invasiveness scores, leaving 1,592 patients for analyses (figure 1). Thirty two percent smoked, 12% were illicit drug users and 11% had diabetes and 13% had a defined past cardiac health history . We found degenerative cases to comprise 62% of our study cohort, with 23% to be traumatic . Posterior only surgery was performed in 59% of patients, anterior only in 18% of patients and revision surgery constituted 18% of our patients (table 1). The mortality rate from pulmonary complications was 3.61 per 1,000 persons per year . In the univariate analysis, age older than 65, presence of smoking, diabetes, copd, chf, elevated charlson comorbidity score, indication for surgery of nondegenerative nature (ie, trauma, tumors), cervical and thoracic level surgery compared to lumbar surgery, and increased surgical invasiveness were all statistically significant risk factors for pulmonary complication after spine surgery (table 3). In the multivariate analysis, male gender, copd, chf, diabetes mellitus, age greater than 65 years, diagnosis (nondegenerative), thoracic level surgery and surgical invasiveness were statistically significant risk factors for pulmonary complication (table 4). Patient selection and sampling rr = relative risk, ci = confidence intervals all factors listed in the table were included in the final model . We observed a cumulative incidence of pulmonary complications after spine surgery to be 9% . Reported incidences after spine surgery range from 0.9% to 5%, but definitions of pulmonary complications and study populations vary from study to study.1,2,3,4 our reported rate of pulmonary complications is nearly triple that of the highest previously reported incidence firstly, we recorded all pulmonary complications that occurred within two years after spine surgery . This inclusive approach likely contributes to the elevated rate of pulmonary complications that may not necessarily be related to the index spine procedure . The large patient population in our study reflects a very diverse patient population, including individuals with serious spinal disorders and major comorbidities who typically seek care in a tertiary care center like ours . This creates a negative selection bias from which tertiary care institutions like ours frequently experience when compared to institutions with very selective care approaches . In addition, the closer one looks at complications the more they appear to occur . As in any such study, identification of the amount of pulmonary complications led to the creation of care teams including perioperative medicine consult services and spine surgery anesthesia care teams to standardize care protocols and improve consistency of implementation of medical treatment recommendations . While many of these risk factors are intuitive, these data allow for quantification of these risks and may aid the clinician in decision making and counseling of patients . Strengths: our large sample size and the quality of our data on several possible predictive variables for a pulmonary complication make this a very exhaustive analysis . Our analysis methods using multivariate regression allowed us estimate the effect of several risk factors on the probability of a pulmonary complication, while controlling for other possible predictive factors . Limitations: when groups are not randomized, selection bias comparing groups or risk factors may lead to a distortion of the findings based on confounding . Our data were collected prospectively using an ongoing spine registry created for enhanced quality assurance with monitoring and recording of all surgical activity, recording of preoperative baseline data and postoperative follow - up visits at defined intervals . We also identified several potential risk factors that may influence pulmonary complications and carefully controlled for them in a regression analysis . Future research should involve building prediction models whereby the probability of a complication can be predicted for each patient who undergoes spine surgery based on their composite of risk factors . This prediction model would need to be externally validated in another population of spine surgery patients . In this study, the cumulative incidence of pulmonary complication after spine surgery was 9% . Risk factors for pulmonary complications after spine surgery include age greater than 65 years, diabetes, previous cardiac history, revision surgery, elevated charlson morbidity score, greater surgical invasiveness . We are unaware of a similar undertaking . Of course an interesting follow - up study would be to see if any specific care measures that have been changed by the investigators have reduced the incidence of pulmonary complications . The other point not directly addressed in this study is the influence of antibiotics, application of a standardized postoperative respiratory care protocol for known at - risk patients, and intraoperative anesthesiologic management of patients . For instance, presence of intraoperative hypotension, requiring resuscitation, the number of blood transfusions, fresh frozen plasma or colloids as well as type and duration of intravenous antibiotic prophylaxis may be variables to consider . These are variables which usually cannot readily be gathered from a retrospective study . The value of a study like this, is that a potentially underestimated clinical problem can now be studied prospectively in a more detailed fashion . No doubt this study advances our awareness of pulmonary problems and more invasive spine surgery in an ill population. |
In many inflammatory responses, polymorphonuclear leukocytes (pmnls) are among the first cells to exit the blood stream and migrate to an inflammatory site, where they become fully activated . This activation is a two - stage process: pmnls first encounter a stimulus that does not activate the cells directly but leaves them in a primed then, upon encountering a second stimulus in the inflamed site, the transition into a fully activated state will occur [1, 2]. This process involves the production of free radicals and release of granule enzymes into the surrounding milieu . Therefore, tight regulation of pmnl activation is needed throughout the steps of infiltration from the blood stream to the inflamed site in order to prevent damage to the vascular wall and the extracellular matrix (ecm). One of the ecm components is heparin (in the form of heparan sulfate), a soluble molecule that plays a major role in defining the physical and chemical properties of the ecm . Heparin, which is commonly used as a blood anticoagulant, is also known to have anti - inflammatory effects; however, the mechanism of these biological activities remains largely unknown [4, 5]. Some of heparin's anti - inflammatory effects are mediated through the modulation of cellular activation, particularly of pmnls [69]. Heparin decreases phorbol myristate acetate (pma), n - formyl - methionyl - leucyl - phenylalanine (fmlp), and opsonized zymosan - induced superoxide production, a decrease which is even greater when the pmnls are primed by platelet activating factor (paf). Heparin reduces fmlp - stimulated pmnl adhesion to endothelial cells and decreases the release of beta - glucuronidase and lysozyme from stimulated pmnls . In addition, heparin has been shown to inhibit leukocyte recruitment and chemotaxis in response to zymosan - activated serum . Recently, it was shown that immobilized heparin can mediate cell adhesion via interaction with the pmnl integrin mac-1 (cd11b / cd18, m2). Mac-1 is one of the most versatile adhesion molecules, with ligands of various biological functions . One of these functions is the induction of a signal transduction cascade that substantially augments apoptosis of activated pmnls . The above data, especially the known apoptotic effect of heparin on pmnls [13, 14], led us to hypothesize that priming of pmnls renders them more susceptible to the apoptotic effects of heparin and that apoptosis induced by heparin is mediated in part by heparin interactions with cd11b, which is highly expressed on the surface of primed pmnls . In order to test our hypothesis, we used pmnls isolated from hemodialysis (hd) patients as a model of in vivo primed cells and pmnls isolated from healthy controls (nc) primed ex vivo with paf . Our results indicate that primed pmnls, regardless of their priming origin (ex vivo or in vivo), are more susceptible to the apoptotic effect of heparin compared to nonprimed pmnls . We also show that heparin binds to cd11b, leading to apoptosis that can be blocked with neutralizing antibodies against cd11b . Blood was drawn from 17 patients on chronic hemodialysis and 24 age- and gender - matched healthy control subjects (nc). Blood for the determination of biochemical and hematological parameters and for the isolation of pmnls was drawn after an overnight fast . Blood was collected into citrate tubes from the arterial line of all the hd patients immediately before a dialysis session . All patients underwent hemodialysis three times a week; each dialysis treatment lasted 4 hours and was carried out with low flux polysulfone membranes (f8, fresenius medical care, bad homburg, germany). The water for dialysis met the standards of the association for the advancement of medical instrumentation (aami). Patients with evidence of acute or chronic infection or malignancy or who had received blood transfusion within 3 months prior to blood sampling were excluded . All participants signed an informed consent for blood sampling, and the study was approved by the institutional committee in accordance with the helsinki declaration . Isolated pmnls (> 98% pure, approximately 10 cells per isolation) were resuspended and counted in phosphate buffered saline (pbs, beit haemek, israel) containing 0.1% glucose . Pmnl priming was assessed by the rate of superoxide release and by the surface levels of cd11b, as described previously . The rate of superoxide release was determined after cell stimulation with 0.32 10 m phorbol 12-myristate 13-acetate (pma; sigma, st . The assay is based on superoxide dismutase (sod) inhibitable reduction of 80 m cytochrome c (sigma, st . The change in optical density was monitored at 549 nm, as described previously . Expression of cd11b on pmnls in whole blood was determined using the fc500 flow cytometer (beckman - coulter). 50 l of blood was incubated for 10 min with anti - cd11b - pe conjugated monoclonal antibody (immunotech, marseille, france), followed by red blood cell lysis (q - prep method; coulter corporation, hialeah, fl, usa). To enable gating on the pmnl population, anti - cd16, conjugated to pc5 monoclonal antibody (iq products), was used . Surface levels of cd11b on pmnls are expressed as mean fluorescence intensity (mfi), after subtracting the nonspecific background . Paf (sigma, usa), a known dose - dependent priming agent of pmnls, was used for the in vitro priming of nc pmnls in three concentrations: 1 pm, 1 nm, and 1 m . Cells were incubated with paf for 15 minutes at room temperature and then washed with pbs . In paf - stimulated pmnls where cd11b intensity was measured and in experiments where cd11b was blocked, 5 minutes after the initiation of incubation with paf, mouse anti - human - cd11b - pe was added . Cd11b expression was measured as described above for whole blood, but without the lysis step . The effect of heparin was studied on three types of isolated pmnls: normal control (nc) pmnls, paf - stimulated nc pmnls, and hd pmnls . All cells were incubated for 30 min at room temperature with 25, 50, and 100 u / ml sodium heparin (kamada, beit kama, israel) diluted in pbs . In order to measure time - dependent effects of heparin, nc and hd pmnls were incubated with 100 u / ml sodium heparin for 300 min at room temperature . The percentage of apoptotic pmnls was based on annexin - v - fitc binding according to the manufacturer's recommendations (annexin - v / fitc kit, bender medsystems diagnostics gmbh, vienna, austria). Annexin - v - fitc and propidium iodide (pi) were added to the cell suspension and incubated for 10 min in the dark at room temperature . Pi staining is a dye - exclusion assay that discriminates between cells with intact membranes (pi negative) and permeabilized membranes (pi positive). The cell population showing annexin - v/pi was considered viable; annexin - v+/pi was considered as an early apoptotic population . Separated pmnls (5 10) were incubated with anti - cd11b - pe or its isotype control- (ic-) pe for 10 minutes, washed, and incubated for 30 minutes with 25 u / ml heparin . This dose of heparin was chosen since it is the minimal dose that caused a statistically significant difference in apoptosis between primed and nonprimed pmnls . Apoptosis in pmnls was detected using the following: (a) annexin - v - fitc binding was measured as mentioned above without the addition of pi . The percentage of apoptotic cells was compared with apoptosis detected using fitc - labeled annexin - v, added after preincubation with ic - pe (immunotech, marseille, france). The positive cutoff point was determined by fitc - isotype controls (iq products, netherlands), added after preincubation with ic - pe . (b) pmnls (5 10) were cytospinned and apoptosis was detected with an axioscop 2 upright fluorescence microscope, using the in situ cell death detection kit (tunel staining, roche molecular biochemicals). Cells (2 10) were incubated at room temperature for 0, 30, and 90 minutes in pbs with and without heparin (100 u / ml), stained with trypan blue solution (0.4% in hbss), and counted . Separated pmnls (5 10) were incubated with anti - cd11b - pe or its isotype control for 10 minutes, washed, and assayed for heparin binding by two different methods: (a) the pmnls were further incubated with 25 u / ml sodium heparin . The percentage of pmnls that bound heparin and the intensity of heparin binding to pmnls were determined by flow cytometry using mouse anti - human heparan sulfate - fitc (united states biological, massachusetts). The ab was generated by immunization with liposome - intercalated membrane hs proteoglycans and recognizes an epitope present in many types of human heparan sulfate including heparin . The epitope includes n - sulfated glucosamine residues that are critical for the reactivity of the antibody . The ab does not react with hyaluronan, chondroitin sulfate, dermatan sulfate, keratan sulfate, or dna [20, 21]. The positive cutoff point was determined by fitc - isotype control (iq products, netherlands), added after preincubation with anti - cd11b - pe . The percentage of heparin bound cells and the intensity of heparin binding to pmnls detected in this experiment were compared with cells detected using fitc - labeled anti - heparan sulfate, added after preincubation with ic - pe (immunotech, marseille, france). The positive cutoff point was determined by fitc - isotype controls (iq products, netherlands), added after preincubation with ic - pe . (b) the pmnls were further incubated with 25 u / ml fitc - labeled heparin (molecular probes, eugene, or) in pbs for 30 minutes at room temperature . The intensity of heparin binding to pmnls was determined by fc500 flow cytometer (beckman - coulter). Data are expressed as mean sd . In the box and whiskers presentations, the horizontal line in the middle shows the median (50th percentile), the top and bottom of the box indicate the 75th and 25th percentiles, respectively, and the whiskers show the maximum and the minimum values . The two - paired wilcoxon signed ranks test was used for comparing two dependent groups . Pmnl priming was manifested by increased rates of superoxide release and amplified levels of membrane cd11b [1618]. Preincubation of isolated normal control (nc) pmnls with increasing concentrations of paf caused a dose - dependent increase in the rate of superoxide release from pma - stimulated pmnls (p <0.05, figure 1(a)). In addition, the expression of cd11b was higher in paf - treated nc pmnls compared to nontreated nc pmnls (p <0.05, figure 1(b)). We reported previously that pmnls from hemodialysis (hd) patients are primed . To confirm these results the rate of superoxide release following pma stimulation was higher in pmnls isolated from hd patients compared to paf untreated nc cells (33.5 4 versus 24.7 5 nmoles/10 cells/10 min, resp ., p <0.05, figure 1(a)) and was similar to the rate achieved by stimulation with the highest concentration of paf . The expression of cd11b was also higher in hd pmnls than in nc pmnls (61 25 versus 29 11 mfi, resp ., p <0.05, figure 1(b)) and comparable to the levels measured in nc cells stimulated with the highest concentration of paf . We have previously reported that heparin exerts an apoptotic effect on pmnls . To determine whether primed pmnls are differently affected by heparin compared to nonprimed cells, we exposed 3 groups of pmnls: nc, 1 m paf - stimulated nc, and hd pmnls, to increasing concentrations of heparin for 30 min (figure 2). We used 1 m paf - stimulated nc since the rate of superoxide release and the expression of cd11b on these ex vivo primed cells were similar to in vivo primed cells, isolated from hd patients (figure 1). Incubation of pmnls with increasing concentrations of heparin resulted in an increase in early apoptosis in all three groups, however to a much greater extent in hd pmnls (figure 2(b)). The increase in hd pmnl apoptosis was significant at all heparin concentrations versus without heparin (p <0.05), while in nc pmnls and paf - stimulated nc pmnls significance was achieved only at 100 u / ml of heparin (p <0.05). Moreover, the maximal percentage of early apoptotic pmnls was 8% in nc and 10% in paf - stimulated nc whereas 17% apoptotic cells were detected in hd pmnls . Incubation of pmnls with increasing concentrations of heparin caused a significant increase in apoptosis (early + late) in all three groups of pmnls, however to a much greater extent in paf - stimulated nc and hd pmnls with both groups showing similar dose - dependent responses (figure 2(c)). The increased degree of apoptosis in paf - stimulated nc and hd pmnls was significant at all heparin concentrations versus without heparin (p <0.05), while in nc pmnls significance was detected only at 100 u / ml of heparin (p <0.05). The effect of heparin on paf - stimulated nc and hd pmnls was much greater than its effect on nc pmnls (p <0.05 nc versus hd and paf - stimulated nc at all heparin concentrations). The maximal percentage of apoptotic pmnls in nc was only 14%, whereas 22% apoptotic cells were detected in paf - stimulated nc and hd pmnls . Priming is also reflected by the rate of superoxide release from pma - activated pmnls . To determine whether apoptosis induced by heparin modulates activation of primed pmnls, we investigated the dose - dependent effect of heparin on the rate of superoxide release . A significant reduction in the rate of superoxide release was observed in all groups of pmnls (p <0.05 for all heparin concentrations versus no heparin; figure 2(d)). Moreover, paf - stimulated nc and hd pmnls showed lower rates of superoxide release versus nc pmnls . The decreased rate of superoxide release was maximized at heparin concentrations of 25 u / ml for nc pmnls and 50 u / ml for 1 m paf - stimulated nc and hd pmnls . This result suggests that the effect of heparin is greater with increased priming; the maximal inhibition in the rate of superoxide release from primed pmnls was approximately three times higher than in unprimed cells . To determine whether heparin exerts a similar time - dependent apoptotic effect on primed versus quiescent cells, we incubated nc and hd pmnls with 100 u / ml of heparin up to 300 min (figure 3). We used 100 u / ml of heparin as it was the only heparin concentration that induced apoptosis in nc pmnls (figures 2(b) and 2(c)). Heparin induced early apoptosis in both hd and nc pmnls at all time points during the incubation, while without heparin, these cells did not exhibit enhanced early apoptosis at any time point (figure 3(a)). Moreover, heparin caused an oscillatory apoptotic pattern of hd and nc pmnls reaching apoptotic peaks at 30 and 210 min for hd pmnls and 90 and 210 min for nc pmnls . When detecting total apoptosis (early + late), the oscillatory apoptotic patterns of hd and nc pmnls were similar regarding the apoptotic peaks, but with an augmented percentage of apoptotic cells at all points (figure 3(b)). To test whether the oscillatory pattern could be explained by the loss of apoptotic cells in the ex vivo incubation, we counted the nc and hd pmnls with and without heparin up to 90 min . This assay revealed that during the 30 min of incubation most of the cells (nc, hd) were still alive, while after 90 min a significant decrease in hd pmnl count was found (figure 3(c)). Based on these results, all incubation experiments were for 30 minutes to avoid significant cell disintegration in vitro . Paf stimulation resulted in a dose - dependent increase in heparin binding to pmnls (figures 4(a)4(c)). Pretreatment of paf - stimulated pmnls with anti - cd11b antibodies completely prevented heparin binding to pmnls, indicating that heparin binds to pmnls, at least partially, via cd11b (figure 4(c)). These results heparin binding intensity to unstimulated nc pmnls was 6.22 0.19 mfi and increased to 13.15 1.76 mfi after stimulation with 1 m paf, demonstrating increased heparin binding with increased priming . Pretreatment of paf - stimulated pmnls with anti - cd11b antibodies completely prevented heparin binding to pmnls with heparin - fitc intensity reduced to 6.48 0.57 mfi . In a second set of experiments depicted in figure 4(d), fitc - conjugated anti - heparin antibodies were used to detect the percentage of paf - stimulated pmnls which bound heparin . The more primed the pmnls, the higher the percentage of cells that bound heparin . This binding was also prevented by preincubation with anti - cd11b antibodies applied before the addition of heparin (figure 4(d)). These results indicate that heparin binding is mediated by cd11b and that the higher the priming state is, the more the heparin binds to pmnls . Paf - stimulated nc pmnls showed increased apoptosis dependent on the cell priming state when incubated with heparin (figures 5(a) and 5(b)) and apoptosis was increased concomitantly with increases in cell priming . Anti - cd11b which prevents the binding of heparin to pmnls abolished the apoptotic effect of heparin at all paf concentrations (figure 5(b)). In addition, anti - cd11b also prevented the binding of heparin to primed pmnls isolated from hd patients and almost completely abolished the apoptosis induced by heparin (figure 5(b)). The effect of 25 u / ml heparin on apoptosis of nc pmnls was also examined before and following the stimulation with 1 m paf, using the tunel assay . Very few apoptotic cells (with green nuclei, ~2%) were observed in nc pmnls (figure 5(c)(1)) and nc pmnls stimulated by paf (figure 5(c)(2)) without exposure to heparin . When nc pmnls were exposed to 25 u / ml heparin, the percentage of apoptotic cells increased to 6 2%, together with 25% cell loss (figure 5(c)(3)). When paf - stimulated nc pmnls were exposed to 25 u / ml heparin, the percentage of apoptotic cells increased to approximately 22 5% (figure 5(c)(4)), concomitantly with 65% cell disappearance . Exposure of the cells to anti - cd11b - pe antibodies prior to the addition of heparin completely abolished the apoptotic effects of heparin and cell disappearance (figures 5(c)(5) and 5(c)(6)) on both nc pmnls and nc pmnls stimulated by paf . Under the same conditions, exposure to isotype - controls- (ic-) pe (instead of to anti - cd11b - pe) did not prevent the apoptotic effects of heparin and cell disappearance (figures 5(c)(7) and 5(c)(8)). These results clearly demonstrate that heparin - mediated apoptosis depends on pmnl priming . In order to detect whether exposure of the cells to heparin causes loss of primed pmnls, we further stained the paf - primed pmnls with anti - cd11b - pe (figure 6). Thirty percent of the paf - treated cells that were not exposed to heparin showed elevated levels of cd11b, supporting their primed state . When these cells were exposed to heparin, no primed pmnls or decreases in cell count could be seen . Since heparin causes a decrease in superoxide release (figure 2(d)) and at the same time it induces apoptosis via cd11b, it was interesting to find out whether blocking cd11b would have an effect on superoxide release . Paf - stimulated nc pmnls incubated with ic showed increased rates of superoxide release which were dependent on the extent of the cell priming: the greater the priming state, the greater the rate of superoxide release (pmnls; figure 7). Heparin (25 u / ml) prevented this increase in superoxide release (pmnls + heparin; figure 7). Paf - stimulated nc pmnls, incubated with anti - cd11b but not with heparin, showed a similar increased rate of superoxide release as with ic, which was also dependent on the extent of the cell priming (pmnls + anti - cd11b; figure 7). When anti - cd11b was added to pmnls prior to the incubation of the cells with heparin (pmnls + anti - cd11b + heparin), the effect of heparin in terms of inhibition of superoxide release was abolished (figure 7). Our novel finding is that heparin exerts its apoptotic effect on primed pmnls by binding to their cd11b . Moreover, heparin causes a significant dose - dependent decrease in the rate of superoxide release from pmnls, blocking primed cells from further activation, partially explaining the anti - inflammatory effects of heparin . It has been previously reported that heparin induces apoptosis in a dose - dependent manner in nc pmnls . In the present study, 30 min incubation with heparin enhanced apoptosis in separated human pmnls in a dose - dependent fashion, however to a much greater extent in primed paf - stimulated nc and hd pmnls . In nc pmnls, the increase in apoptosis was mild and became significant only at 100 u / ml of heparin . Interestingly, apoptosis time courses for nc or hd pmnls incubated with heparin displayed an oscillatory pattern, with nc apoptosis lagging that of the hd pmnls . This oscillatory behavior can be explained by the fact that 100 u / ml of heparin caused a time - dependent increase in apoptosis both in nc and in hd pmnls (however faster and to a much greater extent in hd). The decline in apoptosis, for example, after 90 min for hd pmnls and only after 150 min for nc pmnls, can be explained by disappearance of the apoptotic cells as shown in our ex vivo survival studies: almost 4050% of the hd pmnls disappeared after 90 min, probably by disintegration . Why do we see another increase after the nadirs? We suggest that the next apoptotic peak is the result of an increase in cd11b expression in vitro during incubation in pbs (data not shown), which in the presence of heparin will result in apoptosis . Nevertheless, in the absence of heparin, such an increase in cd11b is not accompanied by enhanced apoptosis . Another possible explanation for increased apoptosis after 30 minutes can arise from a toxic effect . While we specifically measured priming and apoptosis, we do recognize that cell counts were decreasing over time (an effect we referred to as cell disintegration), which may suggest toxicity . Yet, when measuring cell activation, we made sure to count the same number of cells for each time point . Thus, even if cell toxicity is possible due to prolonged activation, the rate of superoxide release and levels of cd11b were measured on viable cells and support our conclusion that heparin can increase apoptosis through its actions mediated by cd11b . Increases in pmnl priming as expressed by increased levels of cd11b and superoxide release resulted in dose - dependent increases of heparin binding to pmnls . This increased binding is demonstrated both by the augmented intensity of heparin bound to the pmnls and by the percentage of cells binding anti - heparin antibodies following incubation with heparin . In all experiments anti - cd11b antibodies competed with heparin for binding to cd11b, supporting the proposed mechanism of heparin - cd11b interactions as previously reported [11, 12]. Moreover, the percentage of pmnls that bind heparin depends on the initial priming state of the cells; that is, a higher priming state results in a higher percentage of cells binding heparin . Finally, increases in cell priming resulted in augmented apoptosis by heparin in pmnls, which was abolished by anti - cd11b antibodies added prior to the addition of heparin . Heparin inhibited superoxide release from pmnls and to a greater extent when cells were primed, such as hd and paf - stimulated nc pmnls . This indicates that heparin exerts its effect mainly on the subpopulation of cells that are primed and are more abundant in hd and paf - stimulated pmnls . Since the population of primed pmnls is the major contributor to superoxide release, rendering them apoptotic by heparin results in a decreased rate of superoxide release . These important findings indicate that the rates of superoxide release are increased due to a primed subpopulation of cells . In addition, the inhibitory effect of heparin on superoxide release from pmnls was also abolished by anti - cd11b antibodies added prior to the addition of heparin . Altogether, this study suggests a novel role for the interaction of heparin and pmnl cd11b, resulting in cell apoptosis . Apoptosis induced by heparin occurs when cd11b levels are increased or, in other words, when a subpopulation of primed pmnls exists . As a result, heparin plays an anti - inflammatory role by making the primed cells apoptotic and preventing leakage of pmnl contents into the surrounding milieu . Heparan sulfate, a less sulfated form of heparin, is also known to bind to the pmnl cd11b, and recently we found it can promote apoptosis in separated pmnls (data not shown), a characteristic that is dose - dependently affecting superoxide release from stimulated pmnls . More interesting, however, is the in vivo presence of heparan sulfate in the ecm and on the endothelial cell surface of vascular walls . Our studies on heparin raise the intriguing possibility that heparan sulfate may limit and/or regulate, to a certain degree, tissue injury and vascular damage by uncontrolled degranulation and release of reactive oxygen species and toxic contents into the surrounding milieu by activated transmigrating pmnls. |
Zonisamide (zns) is an antiepileptic drug that has recently been approved in many countries . It is also effective for the management of migraine, neuropathic pain, essential tremor, anxiety, and other conditions . Recently, zns has been approved as a new adjunctive therapy for motor complications of parkinson's disease (pd) in japan . More recently, zns was reported to be effective for the management of impulse control behavior in pd, suggesting potential effects on non - motor pd symptoms . Dream enactment associated with aggressive, violent behavior can carry a serious risk of injury to patients, as well as to spouses or caretakers . We describe a patient with pd who had vivid nightmares and dream - enacting behavior that resolved after treatment with zns . In 2009, a 71-year - old man with a history of pulmonary surgery noticed tremor of the left hand and akinesia . In march 2010, he showed features of moderate parkinsonism, including masked face, stooped posture, bradykinesia, left - side - dominant rigidity, and resting tremor . Bradykinesia, rigidity, and resting tremor responded to treatment with pramipexole (0.5 mg / day). Since july 2010, his wife was awakened nearly every night because of the patient's aggressive or violent behavior during the middle of the night . For example, he suddenly flew up or walked, collided with furniture or walls, cried out, or exercised his limbs noisily . He was often injured . On the nights he presented with this behavior, he remembered having vivid nightmares, such as being chased by a cat, bear, or his wife or of fighting with a thief or grandchild . Interviews with the patient's wife indicated that this aggressive, violent behavior during the night occurred sometimes in 2009 . In april 2011, stooped posture and lumbar pain developed, which were attributed to pramipexole . We switched from pramipexole (1.0 mg / day, once before sleep) to zns (25 mg / day, once before sleep). Before switching to zns, motor and non - motor symptoms were as follows: the scores on parts i, ii, iii, and iv of the unified parkinson's disease rating scale (updrs) were 3, 5, 17, and 0, respectively . The scores on the mini - mental state examination (29/30) and frontal assessment battery (18/18) were normal . The heart - mediastinum 123i - metaiodobenzylguanidine uptake ratio was significantly decreased . Because he noticed reduced olfactory sensitivity, we assessed olfactory recognition ability by using the odor stick identification test for japanese (osit - j), as described previously . Briefly, the osit - j tests for 13 kinds of odors familiar to japanese people (curry, cooking gas, perfume, japanese cypress, india ink, menthol, nattou [fermented soybeans]/sweaty socks, rose, putrid smell, wood, roasted garlic, condensed milk, japanese orange). We asked the patient to choose an answer among four possible odor names, one of which was correct, plus detectable but not recognizable and odorless. He could identify four odors (perfume, curry, cooking gas, and condensed milk). The identification rate was 33%, consistent with that of patients with olfactory disturbances (36 34%). The score on the pittsburgh sleep quality index (ranging from 14 for normal to 56 for unsleeping) was 16, and the 2-point increase above normal was ascribed to difficulty in sleeping caused by nightmares . His wife was no longer awakened since the patient's aggressive and violent behavior had resolved . We obtained informed consent from the patient and tested whether pramipexole elicited nightmares or violent behavior . First, he was given pramipexole (0.5 mg / day) in the context of stable doses of zns (25 mg / day) for 2 weeks . Our patient showed aggressive and violent behavior associated with vivid nightmares, which probably preceded such behavior, during the middle of the night . This disorder strongly suggested a rapid - eye - movement sleep behavior disorder (rbd). In our patient, who had rbd dopamine agonists can lead to vivid dreams, nightmares, and parasomnia - like motor activity, but rbd in our patient was not induced by rechallenge with pramipexole . In patients with pd, pramipexole was reported to be effective for rbd, but to worsen rem sleep electromyographic abnormalities on video - polysomnography . One study showed that pramipexole did not improve rbd in pd, and the authors mentioned that rbd in pd may be either 2 different stages of the same condition or 2 completely different conditions . This can explain our observations during treatment with pramipexole, but we believe that pramipexole did not alter rbd in our patient since the wife's interviews indicated that rbd was evident before starting pramipexole . This notion is supported by the results of a previous study showing that the frequency and severity of rbd were unaffected by pramipexole therapy . However, our finding raises an open question whether zns is useful for treating rbd in patients with early pd . Dream generators are suppressed by inhibition of brainstem locomotor pattern generators, which can modify dream content in rbd . Dopaminergic dysfunction may play a role in the pathophysiology of rbd and dopamine modulates the expression of locomotion and other rhythmic motor patterns in neural circuits known as central pattern generators . A zns - induced effect on the dopaminergic system might have modulated or inhibited brainstem locomotor pattern generators, consequently suppressing vivid nightmares, leading to the resolution of dream - enacting behavior . Our experience suggests that zns potentially might be effective for the management of vivid nightmares or dream - enacting behavior in patients with early pd . The authors report no conflicts of interest . There was no financial disclosure related with this work. |
Scleroderma renal crisis is an infrequent but life - threatening complication of systemic sclerosis (ssc). It was previously associated with significant morbidity, including chronic renal failure and dialysis, and high mortality . However, since the advent of angiotensin converting enzyme (ace) inhibitors, the outcome of src has improved dramatically . There is also a perception among experts that the incidence of src has fallen over the past years . This is thought to be due in part to the more liberal use of ace inhibitors to treat raynaud's phenomenon and hypertension in ssc . Given the benefits of ace inhibitors in src and the perceived decrease in incidence in src, some experts have advocated the use of prophylactic ace inhibitors even in the absence of raynaud's or hypertension . However, others have argued that there is no clear rationale for this since it has been demonstrated that most ssc patients do not have hyper - reninemia prior to the onset of src . In addition, recent retrospective data in patients with src suggested that ace inhibitors prior to the onset of src may have worse outcomes than those not taking these drugs [57]. This has been hypothesized to be due to the fact that those on ace inhibitors may have normotensive src and diagnosis may thus be delayed in these patients . Given the belief that the incidence of src seems to have fallen over the past years due to the increasing use of ace inhibitors, some experts have proposed undertaking a large, simple randomized trial to confirm this finding . However, concerns based on the preliminary data that suggests that patients taking ace inhibitors who develop src may have worse outcomes remain . Thus, prior to undertaking a large, randomized trial, we believed that there was a real need to obtain additional data to assess whether in fact the use of ace inhibitors prior to the onset of src was associated with worse outcomes . We therefore undertook a study to determine whether ssc patients with incident src on ace inhibitors immediately prior to the onset of src have worse outcomes, defined as dialysis dependence or death after one year than those not on these drugs prior to the onset of src . The purpose of this paper is to describe the methodology and preliminary data of this study . In particular, we wish to highlight the advantages and disadvantages associated with using survey methodology via the internet to study uncommon vascular manifestations of ssc . Prospective, international cohort study of subjects identified through an ongoing web - based survey . In september 2008, we compiled an e - mail list of physicians with an interest in ssc from the canadian scleroderma research group, the scleroderma clinical trials consortium, the eular scleroderma trials and research (eustar) group, and other international collaborators, in particular from colombia, mexico, and australia . Thereafter, 589 participating physicians were sent an e - mail every second friday afternoon asking them simply: have you diagnosed a case of src in the past two weeks . They were asked to check a yes / no box . If the answer was no, and in most cases it was, then that was all that was required of them for that period . If the answer was yes, they were then asked to answer a simple, short survey about their case requiring about 5 minutes to complete . The survey was developed and conducted using surveymonkey, a simple, inexpensive, web - based survey tool . We initially intended to collect cases over a 52-week period, but since we were still identifying new cases at the end of that period, we chose to continue the survey beyond that point . For the purposes of the study, a patient was diagnosed with src if he / she was diagnosed with src by the recruiting physician . We nevertheless collected data on the signs and symptoms that the physicians relied on to make their diagnosis (box 1). The survey allowed us to collect data on the following variables: patient demographics (age, sex, race / ethnicity), disease characteristics (limited versus diffuse, disease duration, autoantibodies), blood pressure and renal function prior to the onset of the src, current use of ace inhibitor or arb immediately prior to src onset, and if so, reasons for such use (raynaud's, hypertension, prophylaxis because of concurrent corticosteroid use, simple prophylaxis); name of drug, current dose, concomitant medications, including glucocorticoids, cyclosporine and nonsteroidal anti - inflammatories, signs and symptoms used to diagnose src . The primary outcomes of interest were defined as death or dialysis one year after the onset of src . One year after a patient was identified, a simple follow - up case report form is sent to the recruiting physician . At study completion, the rates of dialysis or death after one year in ssc patients with src exposed to ace inhibitors at the time when they developed src will be compared to the rates in those not on ace inhibitors at the time they developed their src . The main objective of this study was to determine whether there was harm associated with using ace inhibitors prior to the onset of src . In computing an estimated sample size, we made the following assumptions: (1) estimated prevalence of ace inhibitor exposure prior to the onset of src approximately 25% (ratio of exposed to non - exposed 1: 3); (2) prevalence of death or dialysis after one year in the nonexposed of approximately 50%; (3) risk of death or dialysis associated with exposure approximately twofold, and (4) loss to follow - up of about 10% . We thus calculated that a total sample of approximately 60 subjects would be needed to have 80% power to detect the estimated increased risk in poor outcomes in those exposed compared to those unexposed to ace inhibitors . Central research ethics approval was obtained for this study from the ethics review board of the jewish general hospital, montreal, canada . Some recruiting physicians also sought local ethics approval prior to enrolling patients into the survey . As of february 2010, fifteen months after the start of the survey, we had identified 76 incident cases of src (figure 1). Mean age of the cohort was 53 (12 years), 68% were women, 72% were white, 68% had diffuse ssc, and median disease duration since the onset of the first non - raynaud's symptom was 1.5 years (table 1). Approximately half of the cases were from canada and the united states, and the other half from elsewhere around the world . Fifteen percent (15%) of patients were positive for an rna polymerase autoantibody (although not all centers tested for this antibody) and 42% for a speckled antinuclear antibody (figure 2). Of the 76 patients, 66 (87%) had a hypertensive src and 10 (13%) a normotensive src according to the recruiting physician . Twenty - two percent (22%) of the patients were on an ace inhibitor and 5% on an arb immediately prior to the onset of the src (table 2). Of these, 16 of the 66 (24%) with hypertensive crisis and 5 of the 10 (50%) with normotensive crisis were on an ace inhibitor or an arb prior to the onset of src . Over 50% of the patients were also on glucocorticoids immediately prior to the onset of src, at a mean dose of 17 mg / d of prednisone (or its equivalents). Of the 66 patients classified as hypertensive, 64 satisfied the proposed criteria for hypertensive src mentioned in box 1 . Of the 10 patients classified as normotensive, 4 satisfied the proposed criteria for normotensive src mentioned in box 1 . To date, we have collected one - year follow - up data on approximately 1/3 of the cohort . Of these, over 50% have died or remained on dialysis after one year . Collection of one - year follow - up data on the remainder of the patients is ongoing . Whether ace inhibitors are associated with a worse prognosis for patients with src is an important clinical question, in particular given the widespread availability of these drugs and their perceived benefits in reducing the incidence of src . However, given the rarity of src, designing a prospective study to address this question is not without considerable logistical problems . Using an international, web - based cohort study design, we identified 76 incident src cases over approximately 15 months . We thus believe that this is a feasible method of recruiting a substantial number of patients to study this infrequent vascular manifestation of ssc . We had made several assumptions to compute our desired sample size, including that approximately 25% of subjects would be exposed to ace inhibitors and that the rate of death and/or dialysis after one year would approach 50% . Thus, after approximately one more year of follow - up, we should have sufficient power to address the important clinical question of the prognosis of patients who develop src while on ace inhibitors compared to those not on these medications . In order to maximize enrollment for this study, we compiled an extensive list of 589 physicians from around the world with an apparent interest in ssc (i.e., identified from well - established ssc research groups and through international ssc networks), we designed a simple survey requiring less than 5 minutes to complete and we sent out the survey every 2 weeks so as to increase the possibility that the recruiting physician would have easy access to the clinical data . Indeed, many physicians contacted us to enquire whether they could enroll patients who had had their src in the past and were being seen in follow - up . Unfortunately, those patients were not eligible because, having survived their src sufficiently long, these prevalent cases were in fact survivors and including them could have biased our results . The most important one was that there was no gold standard to define src . Given that the recruiting physicians were identified through ssc research groups and had an apparent interest in ssc, we chose to rely on their expert opinion . Moreover, we also collected data on the signs and symptoms that they relied on to make their diagnosis . In this preliminary analysis, most patients satisfied the proposed criteria for hypertensive src (box 1). However, additional work will be needed to validate a more sensitive definition of normotensive src . The study had been approved by the principal investigators' ethics committee, the data collected for the purposes of this study were obtained through chart review by a treating physician, no direct patient contact was required, and patients were identified using depersonalized study codes . Nevertheless, some recruiting physicians preferred to obtain ethics approval from their local ethics committees . Unfortunately, this imposed a certain workload on them and we did not have funds to support them in this regard . Although this may have delayed initial recruitment in those centers, many participants nonetheless pursued ethics approval presumably based on enthusiasm for the project . Thirdly, although the tool that we used to create the survey was very user - friendly, inexpensive, and allowed us to integrate important data quality checks, it allows only basic data analysis . More detailed analysis will require time - consuming data manipulation to transfer the data into more sophisticated programs . Alternative data acquisition formats are available and could be considered for future studies involving more complicated analyses . Finally, we have had to invest a lot of effort in obtaining one - year follow - up data . The follow - up case report form is somewhat longer and requires approximately twenty minutes to complete . A central research assistant has had to work diligently to encourage recruiting physicians to complete these forms . Contacting them personally by telephone we did not have funds to pay for local research assistants to fill the follow - up forms . Whether this could also have contributed to more efficient collection of follow - up data our study will be unable to answer another very important question; that is, whether ace inhibitors are associated with a reduction in the incidence of src . That study would require following patients with mostly early ssc, some exposed and others unexposed to ace inhibitors, until the occurrence of src . Since src is infrequent, the sample size for such a cohort study exceeds 1000 . Nevertheless, that study using our current design could be feasible . Recruitment would most likely have to occur over several years and strategies to maintain interest in recruitment would have to be developed . On the other hand, the costs of maintaining an ongoing web - based survey are really quite minimal . When we sent the biweekly e - mails, we asked the participants to answer whether or not they had seen a case of src in the past two weeks, and if so, go on to fill out the survey . Thus, it is difficult to know whether they indeed had not seen a case or whether they were not participating (during that particular time period). It is possible that some cases were seen but not entered into the survey, and it is conceivable that their disease characteristics may have been different from those of the cases included in the survey (e.g., some may have had worse and others milder disease). Thus, the response rate and the effect of a nonresponse bias in this study are uncertain . Second, patients who did not have access to a participating physician or those with subclinical disease (e.g., normotensive src) whose src may have been overlooked by a physician were not captured in this survey . Thus, our results are generalizable to patients diagnosed with src and entered into this survey by a participating physician . On the other hand, every two weeks we contacted well over 550 participants identified as members of well - established scleroderma research groups or colleagues of such groups from around the world . Src is a serious complication of ssc and we thus believe that many if not most src cases were, at some point, brought to the attention of one of these perceived ssc experts . In conclusion, using an international, web - based prospective cohort design, we identified 76 incident of src cases over approximately 15 months . Twenty - two percent (22%) of them were on an ace inhibitor immediately prior to the onset of their src . Follow - up data collection to determine rates of death and/or dialysis after one year according to exposure to ace inhibitor prior to src onset is ongoing . The methodology used for this study is innovative and emphasizes that interinstitutional and international collaboration can contribute significantly to the study of infrequent vascular manifestations of ssc . The ultimate success of this study will depend largely on the goodwill of the recruiting physicians who will have to invest additional time and effort in collecting and providing us with the most complete follow - up data possible . Their dedication will hopefully allow us to answer one of the most pressing ongoing questions related to src in the near future. |
Male sprague - dawley rats (charles river, wilmington, ma) of 220250 g were housed in the yale animal resource center, fed a standard pellet diet (prolab 3000; agway, syracuse, ny), and maintained on a 12-h day / night cycle . Experimental protocols were in accordance with laboratory animal care guidelines and were approved by the yale animal care and use committee . Briefly, animals received intraperitoneal injections of regular insulin (10 u / kg humulin r; lilly, indianapolis, in) to produce 3 h of hypoglycemia on 3 consecutive days, resulting in tail vein glucose levels of 3040 mg / dl . After 3 h, animals were given access to food and allowed to return to euglycemia . On the following day, nmr experiments were performed . During surgical preparation for in vivo nmr experiments, animals were anesthetized with 3% halothane, underwent tracheotomy, and were ventilated with a mixture of 30% o2/69% n2o/1% halothane via a small - animal ventilation system (harvard apparatus, holliston, ma). The left femoral artery was catheterized for continuous monitoring of blood pressure, plasma sampling, and blood gas analysis (table 1). Core body temperature was measured and maintained at 37 1c using a water heating pad . Isotopically labeled substrates were infused into a separate line using computer - controlled pumps (harvard apparatus). Animals were then placed into a plastic holder with a surface coil positioned directly on top of the scalp for nmr experiments . Effect of [2-c]acetate infusions on physiological variables and substrates (concentrations andc - enrichments) measured in arterial plasma of control and 3drh rats under euglycemic and hypoglycemic conditions the natural abundance ofc (1.1%) was subtracted from the percentage enrichments (% e). * p <0.05 and p <0.01 for control vs. 3drh; p <0.05 and p <0.01 for euglycemia vs. hypoglycemia . N.d ., non - detectable . For this study, 2 mol / l [2-c]acetate (99%c - sodium salt; cambridge isotopes, andover, ma) at ph = 7 was infused into 3drh (n = 8) and control (n = 8) animals under basal euglycemic conditions . Animals had free access to food the night before the experiment to avoid significant ketone body accumulation . A bolus continuous infusion of labeled acetate designed to produce steady - state plasma levels was given according to the following protocol: 6.25 mol min g from 0 to 15 s, 0.875 from 15 s to 4 min, 0.5 from 4 to 8 min, and 0.25 thereafter . Because of the uncertainty associated with this method of determining neuronal pdh flux (vpdhn), we performed a coinfusion study with [1-c]glucose and unlabeled acetate to measure vpdhn more directly . For this study, 1.1 mol / l [1-c]glucose (99%c; cambridge isotopes, andover, ma) was coinfused with 2 mol / l acetate into 3drh (n = 8) and control (n = 8) animals under basal euglycemic conditions . Unlabeled acetate was infused in identical doses as in the protocol described above, and 20 min later [1-c]glucose was administered as a bolus of 4.05 mol g min for 15 s followed by stepped exponential reduction of infusion rates every 30 s for the next 8 min, arriving at a steady rate of 0.051 mol g min for the remainder of the experiment . Regular insulin (50 mu kg min) was used during the initial 30 min to prevent plasma glucose from increasing in association with the labeled glucose infusion . For this study, 2 mol / l [2-c]acetate was infused into 3drh (n = 8) and control (n = 8) animals during acute insulin - induced hypoglycemia . Animals were fasted overnight before a hyperinsulinemic - hypoglycemic clamp study (50 mu kg min) in which a variable infusion of 20% dextrose (hospira, lakeforest, il) was used to maintain plasma glucose at the target level of 2.1 0.2 2b) were measured every 10 min in between nmr scans using a beckman glucose analyzer 2 (beckman coulter, fullerton, ca). Infusion rates of labeled acetate were reduced by 20% compared with the euglycemic studies to optimize physiological parameters, such as blood pressure, blood ph, po2, and pco2 . The time point at t = 0 min indicates the beginning of the c - labeled acetate infusion and spectral acquisition . After placement of the animals into the scanner, in vivo nmr spectroscopy was performed during the respective infusions in a 9.4 t horizontal bore magnet (magnex; scientific, oxford, u.k .) Equipped with a 9-cm - diameter gradient coil insert (490 mt / m, 175 s; resonance research, billerica, ma). The magnet was interfaced to an avance console (bruker, billerica, ma). Spectra were obtained from a 14-mm - diameter surface radiofrequency coil tuned toh (400 mhz).c - inversion and decoupling radiofrequency pulses (100 mhz) were delivered by two orthogonally positioned coils driven in quadrature . Localizedh-[c] nmr spectra were obtained from a volume of 180 l (6 5 6 mm), centered in the middle of the cortex . Field homogeneity was optimized by adjustment of first- and second - order shims using the automated fastmap algorithm (16), achieving a line - width - at - half - height of 15 hz . Localization was achieved with the laser (localized by adiabatic selective refocusing) pulse sequence and water suppression by chess 4 (chemical shift selective 4) imaging (1719). Spectra were collected with repetition at a time of 2.5 s (20). At the end of the experiment, animals were removed from the magnet, and brains were frozen in situ using liquid nitrogen while mechanical ventilation was continued to preserve labile metabolites (21,22). Brain extracts and plasma samples for high - resolution nmr spectroscopy were prepared using a procedure described previously (23,24). Metabolite concentrations andc - enrichments were measured usingh-[c] nmr at 11.7 t on a bruker avance vertical bore spectrometer . Metabolic fluxes were determined by fitting the two - compartment model of astrocytic and neuronal metabolism depicted in fig . 1, which is based on the time courses ofc - enrichment of the c4 position of glutamate and glutamine (glu4 and gln4) during the infusion of [2-c]acetate (fig . 3a) and the c - enrichment of glu3 and gln3 at the end of infusion (fig . The measured time course of [2-c]acetate in the brain was used instead of plasma acetate levels to eliminate uncertainties associated with acetate transport kinetics . Mass and isotopic flows from [2-c]acetate to glial and neuronal glutamate and glutamine pools were expressed as coupled differential equations (see the supplementary materials, available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db08-1664/dc1) within the cwave 3.0 software package (25) running in matlab 7.0 (mathworks, natick, ma). The equations were solved using a first - order runge - kutta algorithm, and fitting optimization was achieved using simulated annealing hybridized with a levenberg - marquardt algorithm (26) with fixed values for vcyc / vtcan and vkbn, where vcyc indicates the rate of the glutamate / glutamine neurotransmitter cycle, vtcan indicates the rate of neuronal tricarboxylic acid cycle, and vkbn indicates the rate of neuronal -hydroxybutyrate utilization . The vcyc / vtcan ratio was calculated from the steady - statec percentage enrichments of glu4 and gln4 from [2-c]acetate according to the following (24): where n and a designate the neuronal and astroglial compartments, respectively . We assumed that glutamate was distributed between neurons (90%) and astroglia (10%) and glutamine was located entirely in astroglia . The steady - state enrichment of astroglial glu4 was assumed to equal that of gln4; thus, the percentage enrichment of neuronal glutamate is given by glu4n = (glu4 gln4 0.1)/0.9 . The correction factor ci removes contributions to glu4n (at the level of acetyl - coa) from metabolism ofc - labeled plasma products derived from [2-c]acetate metabolism in peripheral tissues, e.g., plasma glucose - c1 (and/or lactate - c3) and -hydroxybutyrate (bhb)-c4/c2 (for details on calculation of this correction factor, see the supplemental materials). A: representative stack of in vivo h-[c] difference spectra acquired over time, revealing gradual accumulation of brain [2-c]acetate and its subsequent appearance in the stable metabolite pools of glu4, glu3, gln4, and gln3 . B: representative high - resolution h-[c] spectra of brain tissue extracts used to further resolve the metabolite concentrations and enrichments of different carbon positions of glutamate - c4,3,2 (glu4,3,2); glutamine - c4,3,2 (gln4,3,2); gaba - c2,3,4, aspartate - c3 (asp3); alanine - c3 (ala3); and lactate - c3 (lac3). Combination of these two measurements revealed the time courses of label accumulation in these metabolite pools, which were then used in the two - compartment model of brain metabolism to determine the metabolic fluxes . P values were calculated using student's t test using microsoft excel, and p 0.05 was considered to be statistically significant . Monte - carlo analysis of each animal's dataset was performed with cwave to assess the distribution of uncertainties in the model parameters for individual animals (27) (see supplemental materials). The uncertainties in monte carlo fitting were smaller than the group variabilities for each parameter reported in this study, indicating that treatment differences were not obscured by uncertainties associated with data fitting . Briefly, animals received intraperitoneal injections of regular insulin (10 u / kg humulin r; lilly, indianapolis, in) to produce 3 h of hypoglycemia on 3 consecutive days, resulting in tail vein glucose levels of 3040 mg / dl . After 3 h, animals were given access to food and allowed to return to euglycemia . During surgical preparation for in vivo nmr experiments, animals were anesthetized with 3% halothane, underwent tracheotomy, and were ventilated with a mixture of 30% o2/69% n2o/1% halothane via a small - animal ventilation system (harvard apparatus, holliston, ma). The left femoral artery was catheterized for continuous monitoring of blood pressure, plasma sampling, and blood gas analysis (table 1). Core body temperature was measured and maintained at 37 1c using a water heating pad . Isotopically labeled substrates were infused into a separate line using computer - controlled pumps (harvard apparatus). Animals were then placed into a plastic holder with a surface coil positioned directly on top of the scalp for nmr experiments . Effect of [2-c]acetate infusions on physiological variables and substrates (concentrations andc - enrichments) measured in arterial plasma of control and 3drh rats under euglycemic and hypoglycemic conditions the natural abundance ofc (1.1%) was subtracted from the percentage enrichments (% e). * p <0.05 and p <0.01 for control vs. 3drh; p <0.05 and p <0.01 for euglycemia vs. hypoglycemia for this study, 2 mol / l [2-c]acetate (99%c - sodium salt; cambridge isotopes, andover, ma) at ph = 7 was infused into 3drh (n = 8) and control (n = 8) animals under basal euglycemic conditions . Animals had free access to food the night before the experiment to avoid significant ketone body accumulation . A bolus continuous infusion of labeled acetate designed to produce steady - state plasma levels was given according to the following protocol: 6.25 mol min g from 0 to 15 s, 0.875 from 15 s to 4 min, 0.5 from 4 to 8 min, and 0.25 thereafter . Because of the uncertainty associated with this method of determining neuronal pdh flux (vpdhn), we performed a coinfusion study with [1-c]glucose and unlabeled acetate to measure vpdhn more directly . For this study, 1.1 mol / l [1-c]glucose (99%c; cambridge isotopes, andover, ma) was coinfused with 2 mol / l acetate into 3drh (n = 8) and control (n = 8) animals under basal euglycemic conditions . Unlabeled acetate was infused in identical doses as in the protocol described above, and 20 min later [1-c]glucose was administered as a bolus of 4.05 mol g min for 15 s followed by stepped exponential reduction of infusion rates every 30 s for the next 8 min, arriving at a steady rate of 0.051 mol g min for the remainder of the experiment . Regular insulin (50 mu kg min) was used during the initial 30 min to prevent plasma glucose from increasing in association with the labeled glucose infusion . For this study, 2 mol / l [2-c]acetate was infused into 3drh (n = 8) and control (n = 8) animals during acute insulin - induced hypoglycemia . Animals were fasted overnight before a hyperinsulinemic - hypoglycemic clamp study (50 mu kg min) in which a variable infusion of 20% dextrose (hospira, lakeforest, il) was used to maintain plasma glucose at the target level of 2.1 0.2 2b) were measured every 10 min in between nmr scans using a beckman glucose analyzer 2 (beckman coulter, fullerton, ca). Infusion rates of labeled acetate were reduced by 20% compared with the euglycemic studies to optimize physiological parameters, such as blood pressure, blood ph, po2, and pco2 . The time point at t = 0 min indicates the beginning of the c - labeled acetate infusion and spectral acquisition . For this study, 2 mol / l [2-c]acetate (99%c - sodium salt; cambridge isotopes, andover, ma) at ph = 7 was infused into 3drh (n = 8) and control (n = 8) animals under basal euglycemic conditions . Animals had free access to food the night before the experiment to avoid significant ketone body accumulation . A bolus continuous infusion of labeled acetate designed to produce steady - state plasma levels was given according to the following protocol: 6.25 mol min g from 0 to 15 s, 0.875 from 15 s to 4 min, 0.5 from 4 to 8 min, and 0.25 thereafter . Because of the uncertainty associated with this method of determining neuronal pdh flux (vpdhn), we performed a coinfusion study with [1-c]glucose and unlabeled acetate to measure vpdhn more directly . For this study, 1.1 mol / l [1-c]glucose (99%c; cambridge isotopes, andover, ma) was coinfused with 2 mol / l acetate into 3drh (n = 8) and control (n = 8) animals under basal euglycemic conditions . Unlabeled acetate was infused in identical doses as in the protocol described above, and 20 min later [1-c]glucose was administered as a bolus of 4.05 mol g min for 15 s followed by stepped exponential reduction of infusion rates every 30 s for the next 8 min, arriving at a steady rate of 0.051 mol g min for the remainder of the experiment . Regular insulin (50 mu kg min) was used during the initial 30 min to prevent plasma glucose from increasing in association with the labeled glucose infusion . For this study, 2 mol / l [2-c]acetate was infused into 3drh (n = 8) and control (n = 8) animals during acute insulin - induced hypoglycemia . Animals were fasted overnight before a hyperinsulinemic - hypoglycemic clamp study (50 mu kg min) in which a variable infusion of 20% dextrose (hospira, lakeforest, il) was used to maintain plasma glucose at the target level of 2.1 0.2 2b) were measured every 10 min in between nmr scans using a beckman glucose analyzer 2 (beckman coulter, fullerton, ca). Infusion rates of labeled acetate were reduced by 20% compared with the euglycemic studies to optimize physiological parameters, such as blood pressure, blood ph, po2, and pco2 . The time point at t = 0 min indicates the beginning of the c - labeled acetate infusion and spectral acquisition . After placement of the animals into the scanner, in vivo nmr spectroscopy was performed during the respective infusions in a 9.4 t horizontal bore magnet (magnex; scientific, oxford, u.k .) Equipped with a 9-cm - diameter gradient coil insert (490 mt / m, 175 s; resonance research, billerica, ma). The magnet was interfaced to an avance console (bruker, billerica, ma). Spectra were obtained from a 14-mm - diameter surface radiofrequency coil tuned toh (400 mhz).c - inversion and decoupling radiofrequency pulses (100 mhz) were delivered by two orthogonally positioned coils driven in quadrature . Localizedh-[c] nmr spectra were obtained from a volume of 180 l (6 5 6 mm), centered in the middle of the cortex . Field homogeneity was optimized by adjustment of first- and second - order shims using the automated fastmap algorithm (16), achieving a line - width - at - half - height of 15 hz . Localization was achieved with the laser (localized by adiabatic selective refocusing) pulse sequence and water suppression by chess 4 (chemical shift selective 4) imaging (1719). Spectra were collected with repetition at a time of 2.5 s (20). At the end of the experiment, animals were removed from the magnet, and brains were frozen in situ using liquid nitrogen while mechanical ventilation was continued to preserve labile metabolites (21,22). Brain extracts and plasma samples for high - resolution nmr spectroscopy were prepared using a procedure described previously (23,24). Metabolite concentrations andc - enrichments were measured usingh-[c] nmr at 11.7 t on a bruker avance vertical bore spectrometer . Metabolic fluxes were determined by fitting the two - compartment model of astrocytic and neuronal metabolism depicted in fig . 1, which is based on the time courses ofc - enrichment of the c4 position of glutamate and glutamine (glu4 and gln4) during the infusion of [2-c]acetate (fig . 3a) and the c - enrichment of glu3 and gln3 at the end of infusion (fig . The measured time course of [2-c]acetate in the brain was used instead of plasma acetate levels to eliminate uncertainties associated with acetate transport kinetics . Mass and isotopic flows from [2-c]acetate to glial and neuronal glutamate and glutamine pools were expressed as coupled differential equations (see the supplementary materials, available in an online appendix at http://diabetes.diabetesjournals.org/cgi/content/full/db08-1664/dc1) within the cwave 3.0 software package (25) running in matlab 7.0 (mathworks, natick, ma). The equations were solved using a first - order runge - kutta algorithm, and fitting optimization was achieved using simulated annealing hybridized with a levenberg - marquardt algorithm (26) with fixed values for vcyc / vtcan and vkbn, where vcyc indicates the rate of the glutamate / glutamine neurotransmitter cycle, vtcan indicates the rate of neuronal tricarboxylic acid cycle, and vkbn indicates the rate of neuronal -hydroxybutyrate utilization . The vcyc / vtcan ratio was calculated from the steady - statec percentage enrichments of glu4 and gln4 from [2-c]acetate according to the following (24): where n and a designate the neuronal and astroglial compartments, respectively . We assumed that glutamate was distributed between neurons (90%) and astroglia (10%) and glutamine was located entirely in astroglia . The steady - state enrichment of astroglial glu4 was assumed to equal that of gln4; thus, the percentage enrichment of neuronal glutamate is given by glu4n = (glu4 gln4 0.1)/0.9 . The correction factor ci removes contributions to glu4n (at the level of acetyl - coa) from metabolism ofc - labeled plasma products derived from [2-c]acetate metabolism in peripheral tissues, e.g., plasma glucose - c1 (and/or lactate - c3) and -hydroxybutyrate (bhb)-c4/c2 (for details on calculation of this correction factor, see the supplemental materials). A: representative stack of in vivo h-[c] difference spectra acquired over time, revealing gradual accumulation of brain [2-c]acetate and its subsequent appearance in the stable metabolite pools of glu4, glu3, gln4, and gln3 . B: representative high - resolution h-[c] spectra of brain tissue extracts used to further resolve the metabolite concentrations and enrichments of different carbon positions of glutamate - c4,3,2 (glu4,3,2); glutamine - c4,3,2 (gln4,3,2); gaba - c2,3,4, aspartate - c3 (asp3); alanine - c3 (ala3); and lactate - c3 (lac3). Combination of these two measurements revealed the time courses of label accumulation in these metabolite pools, which were then used in the two - compartment model of brain metabolism to determine the metabolic fluxes . P values were calculated using student's t test using microsoft excel, and p 0.05 was considered to be statistically significant . Monte - carlo analysis of each animal's dataset was performed with cwave to assess the distribution of uncertainties in the model parameters for individual animals (27) (see supplemental materials). The uncertainties in monte carlo fitting were smaller than the group variabilities for each parameter reported in this study, indicating that treatment differences were not obscured by uncertainties associated with data fitting . Within 1 min of initiating the [2-c]acetate infusion, a steady - state plasma level of 10 mmol / l was reached and maintained throughout the 100-min experiment . There was rapidc - labeling of plasma bhb at the c4 position (reaching 18%) and at the c3 position of plasma lactate (2.5%) in both control as well as 3drh pretreated animals . A 30% increase in blood glucose concentration occurred in both groups during the acetate infusion, without any detectable c - labeling of glucose (table 1). Brain [2-c]acetate accumulation in the in vivo nmr spectra was immediately observed, suggesting that metabolic flux would not be limited by blood - brain barrier transport of acetate in either group (table 2). Although animals from both groups showed similar plasma glucose levels, exposure to antecedent recurrent hypoglycemia resulted in 34% higher brain glucose concentrations (1.27 0.04 and 1.72 0.08 mol / g for control and 3drh, respectively; p = 0.002), suggesting an increased glucose transport capacity in the 3drh group . Brain extract metabolite concentrations (mol / g) andc - percentage enrichments (% e) at the end of the [2-c]acetate infusion the natural abundance ofc (1.1%) was subtracted from the percentage enrichments . * p <0.05 3drh vs. control; p <0.01 hypoglycemia vs. euglycemia within a group . N.d the vcyc / vtcan ratio, representing the coupling between glutamate / glutamine cycling and the neuronal tca cycle, had no significant change after exposure to recurrent hypoglycemia (0.58 0.05) in comparison to controls (0.51 0.03, p = 0.15).figure 4 (top panels) shows the group averages for c time courses of glu4 and gln4 during [2-c]acetate infusion in control and 3drh animals under euglycemia . Group - averaged data are depicted in the upper panels, whereas representative individual animals with best fits of the two - compartment metabolic model appear in lower panels ., gln4 control;, gln4 3drh;, glu4 control;, glu4 3drh . Although brain acetate metabolism (cerebral metabolic rate [cmr]ac) did not differ significantly between 3drh and control animals (0.15 0.01 vs. 0.16 0.01 mol g min for control vs. 3drh, p = 0.2), brain glucose metabolism (cmrgl) under euglycemia was increased in the 3drh animals by 43 4% (0.46 0.3 vs. 0.66 0.5 mol g min for control vs. 3drh, p = 0.003) (fig . This increase was further reflected by a 50% increase of vpdhn in the neuronal compartment (0.70 0.08 vs. 1.06 0.09 mol g min, p = 0.008), suggesting an overall increased capacity to utilize glucose . Total brain tca cycle activity increased as a consequence (1.03 0.05 vs. 1.45 0.07 mol g min, p <0.004). Because the metabolism of labeled acetate does not result inc label flow through pyruvate dehydrogenase, vpdhn is instead calculated by the metabolic model based on several dilutional fluxes, with the main contribution coming from unlabeled glucose . B: percentage change in metabolic rates from euglycemia (eu) to hypoglycemia (hypo) within groups, calculated as: [(euglycemia hypoglycemia)/euglycemia] 100 . The plasma glucose level during the coinfusion of [1-c]glucose and unlabeled acetate 1 mmol / l in the control and 8.1 0.8 mmol / l in the 3drh group (p = 0.11). Throughout, acetate concentrations were comparable between the groups as well as in comparison to the labeled acetate infusions, described above . In contrast, we did not observe labeling of bhb, but we did see a significantly higher degree of [3-c]lactate labeling in the plasma (9.5 0.4 vs. 6.4 0.06% fe for control vs. 3drh, p = 0.02). The rate of isotopic enrichment of the brain glutamate pool was considerably higher than that of glutamine (fig . 4), a reflection of the metabolic compartmentalization and the higher contribution of glucose - derived metabolites to neuronal metabolism . Because lactate uses the same metabolic pathway as glucose in the brain, it equally contributes to vpdhn . The two - compartment model, using thec time courses of plasma glucose and lactate as well as brain glu4 and gln4, was therefore used to calculate vpdhn . Comparing results from the [2-c]acetate infusion with this direct determination of vpdhn using [1-c]glucose revealed essentially the same values (0.75 0.05 and 1.09 0.07 mol min g for control and 3drh, respectively; p = 0.003) (fig . 5a), thereby confirming our finding of increased vpdhn in the 3drh group . In this experiment the hyperinsulinemic - hypoglycemic clamp maintained plasma glucose levels constant at 2.1 0.2 mmol / l in both groups during the infusion of [2-c]acetate (fig ., a 20% higher glucose infusion rate was required in these animals to maintain the same degree of glycemia . The other physiological parameters were controlled at similar levels, and plasma concentrations of acetate, lactate, and bhb were comparable between groups (table 1). The most striking change was a decrease in bhb labeling from 17.9 3.9 to 3.3 1.9% (p <0.001) after exposure to recurrent hypoglycemia (table 2), consistent with the presence of reduced peripheral ketones in the context of increased peripheral acetate utilization . Furthermore, during hypoglycemia, brain concentrations of gaba in 3drh rats were increased by 50% (p = 0.05) compared with controls, without significant changes ofc - enrichment of gaba . When comparing the time courses of glu4 and gln4 for the 3drh and control groups, we observed no obvious differences in the rates of gln4 labeling and only small changes in glu4 labeling (fig . We constrained two parameters in fitting the metabolic model to the time course data: the ratio of glutamate neurotransmitter cycling to neuronal tca cycle flux (vcyc / vtcan) and the rate of neuronal ketone body utilization (vkbn). In the current study, blood bhb enrichment was 17.9 and 3.3% at the end of the [2-c]acetate infusion in hypoglycemic control and 3drh animals, respectively, which led to relatively small contributions (and corrections in eq . 1) (supplementary materials) of 2.1% (= 100 0.179 0.12) and 0.2% (= 100 0.033 0.12). Including these corrections in eq . 1 had only minor and insignificant (p = 0.17) effects on the calculated values of vcyc / vtcan for the control (0.52 0.07) and 3drh (0.64 0.09) animals . Vkbn was set to 0.04 0.02 (3drh) and 0.04 0.01 (control) based on individual plasma bhb concentrations . Together with the brain [2-c]acetate concentration, the time courses of label appearance inc brain acetate, plasma bhb, brain glu4, gln4, and end points of glu3 and gln3, we determined the metabolic fluxes of 3drh versus control animals under hypoglycemic clamp conditions (fig . Although we observed a 24 5% lower vpdhn in 3drh animals compared with controls (p = 0.004) and a decrease in total tca cycle flux (1.12 0.02 vs. 0.91 0.08 mol min g, p = 0.007), the other parameters remained similar between the groups (cmrac p = 0.2, vgln p = 0.3, vpdha p = 0.4, and vcyc p = 0.2). Comparing metabolic fluxes of control animals under euglycemic and hypoglycemic conditions, we found no significant changes in overall brain acetate metabolism (cmrac, p = 0.5). In controls, brain glucose consumption (cmrgl) in response to hypoglycemia was increased by 16 1% (p <0.05), mostly due to an increase in glucose - related fluxes in the neuronal compartment, namely vpdhn (37 3%, p <0.01) and vtcan (40 3%, p = 0.05). In contrast, astroglial glucose uptake (vpdha) was decreased by 32 5% (p = 0.01), suggesting a redistribution of glucose consumption to maintain neuronal function, as reflected by a preserved brain total tca cycle activity (fig . However, in a response opposite to controls, a significant 40 5% decrease in cmrgl (p <glucose flux in the astrocytic compartment dropped by 75 20% (vpdha, p <0.001) and in neurons by 36 4% (vpdhn, p = 0.005). The combined effect of these decreases in both compartments is a resultant total brain tca cycle activity decrease by 37 4% (p = 0.001). Comparing the relative contributions of acetate and glucose when going from euglycemia to hypoglycemia (cmrac / cmrgl), the control group showed a 12% decrease (p = 0.06), whereas 3drh rats revealed a 24% increase (p = 0.006), indicating an increased relative contribution of acetate to brain metabolism in 3drh animals under hypoglycemic conditions . In this context, however, it is important to note that at baseline euglycemic conditions, 3drh animals already show a 43% higher degree of brain glucose consumption (cmrgl) than control animals (p = 0.004). Within 1 min of initiating the [2-c]acetate infusion, a steady - state plasma level of 10 mmol / l was reached and maintained throughout the 100-min experiment . There was rapidc - labeling of plasma bhb at the c4 position (reaching 18%) and at the c3 position of plasma lactate (2.5%) in both control as well as 3drh pretreated animals . A 30% increase in blood glucose concentration occurred in both groups during the acetate infusion, without any detectable c - labeling of glucose (table 1). Brain [2-c]acetate accumulation in the in vivo nmr spectra was immediately observed, suggesting that metabolic flux would not be limited by blood - brain barrier transport of acetate in either group (table 2). Although animals from both groups showed similar plasma glucose levels, exposure to antecedent recurrent hypoglycemia resulted in 34% higher brain glucose concentrations (1.27 0.04 and 1.72 0.08 mol / g for control and 3drh, respectively; p = 0.002), suggesting an increased glucose transport capacity in the 3drh group . Brain extract metabolite concentrations (mol / g) andc - percentage enrichments (% e) at the end of the [2-c]acetate infusion the natural abundance ofc (1.1%) was subtracted from the percentage enrichments . * p <0.05 3drh vs. control; p <0.01 hypoglycemia vs. euglycemia within a group . N.d the vcyc / vtcan ratio, representing the coupling between glutamate / glutamine cycling and the neuronal tca cycle, had no significant change after exposure to recurrent hypoglycemia (0.58 0.05) in comparison to controls (0.51 0.03, p = 0.15).figure 4 (top panels) shows the group averages for c time courses of glu4 and gln4 during [2-c]acetate infusion in control and 3drh animals under euglycemia . Group - averaged data are depicted in the upper panels, whereas representative individual animals with best fits of the two - compartment metabolic model appear in lower panels ., gln4 control;, gln4 3drh;, glu4 control;, glu4 3drh . Although brain acetate metabolism (cerebral metabolic rate [cmr]ac) did not differ significantly between 3drh and control animals (0.15 0.01 vs. 0.16 0.01 mol g min for control vs. 3drh, p = 0.2), brain glucose metabolism (cmrgl) under euglycemia was increased in the 3drh animals by 43 4% (0.46 0.3 vs. 0.66 0.5 mol g min for control vs. 3drh, p = 0.003) (fig . This increase was further reflected by a 50% increase of vpdhn in the neuronal compartment (0.70 0.08 vs. 1.06 0.09 mol g min, p = 0.008), suggesting an overall increased capacity to utilize glucose . Total brain tca cycle activity increased as a consequence (1.03 0.05 vs. 1.45 0.07 mol g min, p <0.004). Because the metabolism of labeled acetate does not result inc label flow through pyruvate dehydrogenase, vpdhn is instead calculated by the metabolic model based on several dilutional fluxes, with the main contribution coming from unlabeled glucose . B: percentage change in metabolic rates from euglycemia (eu) to hypoglycemia (hypo) within groups, calculated as: [(euglycemia hypoglycemia)/euglycemia] 100 . The plasma glucose level during the coinfusion of [1-c]glucose and unlabeled acetate was maintained at 9 1 mmol / l in the control and 8.1 0.8 mmol / l in the 3drh group (p = 0.11). Throughout, acetate concentrations were comparable between the groups as well as in comparison to the labeled acetate infusions, described above . In contrast, we did not observe labeling of bhb, but we did see a significantly higher degree of [3-c]lactate labeling in the plasma (9.5 0.4 vs. 6.4 0.06% fe for control vs. 3drh, p = 0.02). The rate of isotopic enrichment of the brain glutamate pool was considerably higher than that of glutamine (fig . 4), a reflection of the metabolic compartmentalization and the higher contribution of glucose - derived metabolites to neuronal metabolism . Because lactate uses the same metabolic pathway as glucose in the brain, it equally contributes to vpdhn . The two - compartment model, using thec time courses of plasma glucose and lactate as well as brain glu4 and gln4, was therefore used to calculate vpdhn . Comparing results from the [2-c]acetate infusion with this direct determination of vpdhn using [1-c]glucose revealed essentially the same values (0.75 0.05 and 1.09 0.07 mol min g for control and 3drh, respectively; p = 0.003) (fig . In this experiment the hyperinsulinemic - hypoglycemic clamp maintained plasma glucose levels constant at 2.1 0.2 mmol / l in both groups during the infusion of [2-c]acetate (fig ., a 20% higher glucose infusion rate was required in these animals to maintain the same degree of glycemia . The other physiological parameters were controlled at similar levels, and plasma concentrations of acetate, lactate, and bhb were comparable between groups (table 1). The most striking change was a decrease in bhb labeling from 17.9 3.9 to 3.3 1.9% (p <0.001) after exposure to recurrent hypoglycemia (table 2), consistent with the presence of reduced peripheral ketones in the context of increased peripheral acetate utilization . Furthermore, during hypoglycemia, brain concentrations of gaba in 3drh rats were increased by 50% (p = 0.05) compared with controls, without significant changes ofc - enrichment of gaba . When comparing the time courses of glu4 and gln4 for the 3drh and control groups, we observed no obvious differences in the rates of gln4 labeling and only small changes in glu4 labeling (fig . We constrained two parameters in fitting the metabolic model to the time course data: the ratio of glutamate neurotransmitter cycling to neuronal tca cycle flux (vcyc / vtcan) and the rate of neuronal ketone body utilization (vkbn). In the current study, blood bhb enrichment was 17.9 and 3.3% at the end of the [2-c]acetate infusion in hypoglycemic control and 3drh animals, respectively, which led to relatively small contributions (and corrections in eq . 1) (supplementary materials) of 2.1% (= 100 0.179 0.12) and 0.2% (= 100 0.033 0.12). Including these corrections in eq . 1 had only minor and insignificant (p = 0.17) effects on the calculated values of vcyc / vtcan for the control (0.52 0.07) and 3drh (0.64 0.09) animals . Vkbn was set to 0.04 0.02 (3drh) and 0.04 0.01 (control) based on individual plasma bhb concentrations . Together with the brain [2-c]acetate concentration, the time courses of label appearance inc brain acetate, plasma bhb, brain glu4, gln4, and end points of glu3 and gln3, we determined the metabolic fluxes of 3drh versus control animals under hypoglycemic clamp conditions (fig . Although we observed a 24 5% lower vpdhn in 3drh animals compared with controls (p = 0.004) and a decrease in total tca cycle flux (1.12 0.02 vs. 0.91 0.08 mol min g, p = 0.007), the other parameters remained similar between the groups (cmrac p = 0.2, vgln p = 0.3, vpdha p = 0.4, and vcyc p = 0.2). Comparing metabolic fluxes of control animals under euglycemic and hypoglycemic conditions, we found no significant changes in overall brain acetate metabolism (cmrac, p = 0.5). In controls, brain glucose consumption (cmrgl) in response to hypoglycemia was increased by 16 1% (p <0.05), mostly due to an increase in glucose - related fluxes in the neuronal compartment, namely vpdhn (37 3%, p <0.01) and vtcan (40 3%, p = 0.05). In contrast, astroglial glucose uptake (vpdha) was decreased by 32 5% (p = 0.01), suggesting a redistribution of glucose consumption to maintain neuronal function, as reflected by a preserved brain total tca cycle activity (fig . However, in a response opposite to controls, a significant 40 5% decrease in cmrgl (p <0.001) was observed in response to hypoglycemia (fig . Glucose flux in the astrocytic compartment dropped by 75 20% (vpdha, p <0.001) and in neurons by 36 4% (vpdhn, p = 0.005). The combined effect of these decreases in both compartments is a resultant total brain tca cycle activity decrease by 37 4% (p = 0.001). Comparing the relative contributions of acetate and glucose when going from euglycemia to hypoglycemia (cmrac / cmrgl), the control group showed a 12% decrease (p = 0.06), whereas 3drh rats revealed a 24% increase (p = 0.006), indicating an increased relative contribution of acetate to brain metabolism in 3drh animals under hypoglycemic conditions . In this context, however, it is important to note that at baseline euglycemic conditions, 3drh animals already show a 43% higher degree of brain glucose consumption (cmrgl) than control animals (p = 0.004). In this study, we measured the rates at which glucose and an alternate fuel (acetate) is oxidized under different glycemic conditions . Measurements of brain metabolism in animals exposed to recurrent hypoglycemia resulted in two main observations . First, after antecedent recurrent hypoglycemia, basal brain glucose metabolism at euglycemia is increased in comparison to controls . This increase was mainly attributable to higher neuronal glucose oxidation, suggesting that when glucose is present in sufficient amounts, neurons are better able to use glucose . Second, under standardized relatively severe hypoglycemic conditions, 3drh animals showed a decrease in brain glucose consumption in neurons and astroglia, which contrasts with control animals, in which neuronal glucose metabolism was preserved (fig . Thus, there is a fundamentally different metabolic response of neurons to hypoglycemia between 3drh and control animals: whereas acetate consumption remained comparable under euglycemia and hypoglycemia in both groups, acetate comprised a greater relative contribution to total brain oxidation . Controversy exists regarding the relative degree of cognitive impairment caused by acute hypoglycemia in patients with type 1 diabetes compared with nondiabetic subjects (rev . In (28)). This may be in part a consequence of metabolic adaptations that occur in response to different degrees of antecedent exposure to hypoglycemia (29,30). In a previous study using the same rodent model, 3drh animals subjected to a spatial memory test under euglycemia performed better than controls, whereas they did worse during acute hypoglycemia (9). The current observation of higher total tca cycle activity under euglycemia and lower activity under hypoglycemia in 3drh animals parallels this biological effect . The better performance under euglycemia in 3drh animals may be related, in part, to changes in glucose transport across the blood - brain barrier, resulting in a higher brain glucose level at comparable plasma glucose, an effect we also observed using microdialysis in previous studies of our 3drh model (9,15). The 34% increase in brain glucose levels measured here in the 3drh group at euglycemia is consistent with the 17% increase reported in type 1 diabetic patients with hypoglycemia unawareness at euglycemia (10). Furthermore, our data establish that the higher brain glucose concentration is not the consequence of a decrease in glucose utilization, but instead occurs despite accelerated brain glucose metabolism . To overcome the relative uncertainty associated with using [2-c]acetate, a predominantly glial fuel, for the calculation of glucose consumption the measured neuronal pdh flux in 3drh animals (1.06 0.10 vs. 1.09 0.07 mol min g for [2-c]acetate vs. [1-c]glucose) was the same for both substrates, further supporting the accuracy of our metabolic model . In this animal study, transporter kinetics were saturated by an infusion of [2-c]acetate at a level higher than is ethically and technically permissible in comparable human studies . The acetate infusion resulted in reliable brain acetate measurements, which then allowed us to accurately determine metabolic fluxes independent of potential changes in monocarboxylic acid transport transporter activity at the blood - brain barrier, which are anticipated in the context of exposure to recurrent hypoglycemia (13). In the current study, all animal groups (euglycemic and hypoglycemic) showedc - labeling of bhb from [2-c]acetate (table 1), likely because of its rapid metabolism in the liver . Bhb labeled withc at c4 and c2 would contribute toc - labeling of glutamate - c4, as well as other carbon positions . At euglycemia (control and 3drh), mmol / l), such that labeling of glutamate - c4 would be negligible . However, during hypoglycemia, baseline bhb levels were elevated (1 . The lower rate of brain glucose utilization in hypoglycemic 3drh animals is not likely attributable to increased consumption of ketone bodies . Bhb levels were the same in both groups, and brain levels were not detected, implying similar blood - to - brain concentration gradients the driving force for bhb utilization in the brain . Furthermore, if bhb utilization had been greater in 3drh compared with control animals, there would have been greater dilution of brain glutamate - c4 enrichment relative to control animals, which was not seen (14.3 vs. 13.9%, p = 0.14) (table 2). The contribution of acetate to astroglial tca cycle flux (cmrac / vtcaa) under hypoglycemia a similar value for the ratio cmrac / vtcaa was reached in both groups (0.71 0.19 and 0.67 0.26 for control and 3drh, respectively), suggesting that acetate metabolism was saturated in each case . This value is very similar to the maximal value predicted for cmrac / vtcaa in human subjects with type 1 diabetes (0.69 0.17) (13). Assuming that our rat model of recurrent hypoglycemia mimics relevant features of glial metabolism in humans, the difference noted previously between type 1 diabetic and control subjects are likely related to an increase in transporter activity . It is possible that reduced neuronal tca cycle activity in the context of preserved glycolytic flux may have caused the elevated lactate levels we observed in the brains of 3drh animals under hypoglycemia . This lactate was less enriched and could have been either derived from endogenous brain glycogen stores or derived directly from unlabeled brain glucose . However, because our model does account for labeled as well as unlabeled lactate as a contribution to neuronal pdh flux and the final labeled glutamate and glutamine pools were comparable, these possibilities are not likely explanations for the significant decrease in vpdhn we observed . 3drh animals showed higher gaba levels during acute hypoglycemia, which was not observed in control animals (table 2). Other studies from our group have, in fact, demonstrated a threefold increase in gaba in hypothalamic interstitial fluid (31) and increased long - term potentiation in hippocampal slice preparations in rats exposed to recurrent hypoglycemia (32). Because gaba is an inhibitory neurotransmitter and increased levels could reduce neuronal activity as well as metabolic demand under hypoglycemic conditions in 3drh animals, this could be a cause of the reduced neuronal tca cycle activity we observed in our study . In summary, our study provides the first evidence that recurrent hypoglycemia increases neuronal glucose metabolism under euglycemia . Under hypoglycemia, glucose metabolism decreased, whereas acetate utilization remained constant, the latter supporting a greater relative fraction of total oxidative metabolism . Neuron - specific alternate fuels may therefore provide a means of reducing the risk of hypoglycemia - induced brain injury in intensively treated diabetic patients. |
A recent study by moore et al found that the aspects of attention most affected by pain are those essential for the completion of complex tasks that require the processing of multiple cues and complex attention control . Furthermore, after investigating cognitive executive function and attention, oosterman et al concluded that in chronic pain conditions, sustained attention performance is diminished while mental flexibility, planning, and inhibition appear to remain intact . In addition, in patients with headache, diminished executive function and complex attention control have been reported and a recent meta - analysis by berryman et al revealed small to moderate executive function performance impairment in people with chronic pain but the authors note a lack stringent control for possible influencing factors and methodology . Conversely, a study by suhr in 28 fibromyalgia patients, 27 chronic pain patients, and 21 controls revealed that differences in cognitive function were not apparent when controlling for fatigue, pain, and depression, which attests to the complexity of neuropsychological impairment in persons with pain . To our knowledge, neurocognitive impairment due to chronic musculoskeletal pain has yet to be investigated in the working population among those specifically performing specialized and repetitive movement tasks (e.g., laboratory technicians). It could be speculated that a decline in psychomotor speed could negatively affect cognitive abilities including psychomotor speed and complex attention tasks, as people with chronic pain often exhibit decreased rate of force development (rfd) and neural drive to the painful muscles . Exercise intervention studies compiled in several reviews show promising effects on cognitive performance in the domains of processing speed, memory, and executive function in healthy older adults but the research in healthy work - able women is to our knowledge scarce . However, the effects of mindfulness meditation interventions on cognitive flexibility, attentional focus, and emotional regulation, which are important elements of overall cognitive function, have been reported showing positive correlations with meditation practice in both adolescents and adults . Andersen et al found an 18% lowered maximal voluntary force production whereas rfd (i.e., rate of rise in contractile force at the onset of contraction) was reduced by 54% in women with chronic trapezius myalgia compared with pain - free controls . Andersen et al suggested that rfd is a more sensitive measure of mechanical muscle performance in painful conditions than maximal muscle strength . In support of these findings ervilha et al reported that the initial (100 ms) agonistic electromyography burst activity was particularly suppressed during dynamic contractions in conditions of upper limb muscle pain . The effect of muscle pain on the ability to produce muscular force rapidly is predominantly caused by neural mechanisms rather than muscular atrophy, because average trapezius muscle mass and fiber size do not seem to differ between women with and without chronic neck pain . In occupational settings, such neuromuscular changes are likely to influence the worker's motor strategy and compensatory activation of agonistic and antagonistic muscles to fulfill specific job demands . Concurrently, modification in neuro - mechanical function may contribute to aggravation or spreading of pain accompanied by an escalating imbalance between work demands and individual musculoskeletal resources, consequently affecting work participation, and overall quality of life . A multitude of physiological parameters are known to influence rfd in pain - free individuals, including efferent neural drive to the muscles encompassing both motor neuron recruitment firing frequency, muscle fiber size and composition, and viscoelastic properties of the muscle - tendon complex . Additionally, rfd obtained in various time intervals is affected by different physiological parameters, where early - phase rfd (<40 ms from onset of contraction) is mainly affected by intrinsic contractile properties of the muscle whereas late - phase rfd is more reliant on maximal voluntary contraction (mvc). Several studies have shown promising and effective reductions in upper limb musculoskeletal pain in response to specific strength training performed at the workplace . With a biomechanical approach to pain - relief, several studies have reported increased rfd paralleled by an augmented rate of electromyography rise in chronically painful neck / shoulder muscles following interventions of progressive strength training . Thus, it seems that progressive strength training has the ability to counteract the observed inhibition in initial activation of painful muscles, consequently leading to increased rfd . The aim of the present study was to evaluate the effect of a multifaceted intervention strategy with physical-, cognitive-, and mindfulness training elements versus a reference group on neurocognitive performance, mvc and rfd in female laboratory technicians with chronic upper limb pain . We hypothesize between - group neurocognitive performance improvements and increased rfd following the intervention period, as pain may inhibit motor output and neurocognitive function . During spring / summer of 2014 our research team conducted a randomized controlled intervention trial at a large pharmaceutical company in copenhagen, denmark . Briefly, we performed a single - blinded trial with allocation concealment, in a 2-armed parallel group format among female laboratory technicians . The participants were parallel - assigned to receive either a 10-week physical - cognitive - mindfulness training intervention or continue following already implemented company guidelines for reducing work - related musculoskeletal pain of the upper extremity and low back . Primary and secondary outcomes on musculoskeletal pain and work related stress have previously been reported . Prior participant enrolment we registered the study in the clinicalttrials.gov register: implementation of physical exercise at the workplace (irma09) laboratory technicians, registration no . Nct02047669 . Ethical approval was obtained from the danish national committee on biomedical research ethics (the local ethical committee of frederiksberg and copenhagen; h-3 - 2010 - 062) as part of the research program this study, as well as the previously published studies describing the protocol, primary- and secondary outcomes adhere to the criteria of the revised consolidated standards of reporting trials 2010 statement for reporting randomized trials . All experimental conditions conformed to the declaration of helsinki . At the time of enrolment, the eligible participants (n = 112) all had chronic musculoskeletal pain in 1 or more of the following regions: upper back, lower back, neck, shoulders, elbows, or hands / wrists . To fulfill the definition of chronic pain all following criteria were met for at least 1 of these body regions: pain intensity of 3 (010 visual analogue scale [vas] supported by drawings from the nordic questionnaire) during the last week, pain frequency of 3 days during the last week, pain lasting at least 3 months . Participants with typical exclusion criteria, for example, severe hypertension (> 160/100), were allowed to participate in the less strenuous part of the training intervention if their general practitioner provided consent . We excluded participants with life - threatening diseases, and pregnancy was considered a contraindication to the training . Consort flow diagram showing the flow of participants through the study . To allocate the participants, a random numbers table in the sas statistical software was generated, thus allowing a randomized distribution of the laboratory technicians to either a physical - cognitive - mindfulness training (pcmt) intervention group or a reference group (ref). This allocation was performed after the participants had answered a baseline questionnaire providing information on descriptive characteristics and perceived level of musculoskeletal pain (table 1). Furthermore, participants were informed that it was unknown which treatment model would work best for reducing pain and they were instructed not to reveal their particular intervention to colleagues or study assessors . Following group allocation each participant was invited to complete a test battery consisting of an extensive clinical examination by a specialized physical therapist, a neurocognitive assessment, and a series of physical function measurements of the shoulder external rotator complex . The entire test battery lasted approximately 90 minutes and all assessors were blinded to participant allocation . Upon conclusion of the 10-week intervention the participants were asked again to fill out the questionnaire on musculoskeletal pain and complete the test battery for follow - up measurements . All participants were at the time of enrolment in the 25th to 74th percentile in the 6 domains of neurocognitive function, age- and gender matched for normative scores, which according to the central nervous system vital signs (cnsvs) guidelines are described as average with normal function and capacity . Participant characteristics, neurocognitive performance, and muscle function at baseline after group allocation; presented as mean (sd). Neurocognitive function was assessed by the cnsvs (cns vital signs, morrisville, nc) computerized test battery, which has been shown to be a stable and reliable assessment of cognitive function with high validity . The 5 included subtests were (in administered order): symbol digit coding test, shifting attention test, finger tapping test, stroop test, and continuous performance test . The tests themselves are online versions of standard measures of cognitive task performance and have previously been described and tested for reliability and validity in the literature . The test runs were highly consistently delivered: the test battery is automatically presented to the participants with written instructions and a short practice round immediately followed by the actual tests in the selected battery . Time to completion of the full test battery was between 20 and 30 minutes depending on how long the participants needed to read the instructions . The cnsvs can be administered in a variety of languages, including danish, which was the setting during this trial . Briefly, the subtests provided domain measures of: psychomotor speed, reaction time (measured in milliseconds), complex attention, cognitive flexibility, processing speed, and executive function . The scores of each of the domains were calculated either as differences between correct and erroneous responses within each subtest, or summation of the responses from 2 or more subtests according to the specifications of domain calculations of the cnsvs . For reference, each domain indicates the following: psychomotor speed is a measure of how well a subject perceives, attends, responds to complex visual - perceptual information, and performs simple fine motor coordination . It is an expression of the ability to perform simple motor skills and dexterity through cognitive functions (e.g., use of precision instruments or tools) and performing mental and physical coordination (e.g., driving a car or playing a musical instrument). Reaction time is a measure of how quickly the subject can react to a simple and increasingly complex direction set . Examples of this include driving a car, attending to conversation, and responding to a set of simple instructions . Complex attention is defined as the ability to track and respond to a variety of stimuli over lengthy periods of time and/or perform complex mental tasks requiring vigilance . Cognitive flexibility describes how well the person is able to adapt to rapidly changing and increasingly complex sets of directions and/or to manipulate the information . This can be exemplified as reasoning skill, switching tasks, decision - making, impulse control, and strategy formation . Processing speed is how well a person recognizes and processes information (e.g., fine motor coordination or visual - perceptual ability). Executive function is defined as how well a person recognizes rules, categories and performs in rapid decision - making tasks . In everyday life executive function is the ability to sequence and manage multiple tasks simultaneously and the ability to quickly respond to changing sets of instructions . Mvc and rfd of the shoulder external rotators were assessed during concurrent isometric external rotation of the gleno - humeral joint using a custom - built dynamometer with 2 strain gauge load cells (kis-2, 1 kn, vishay transducers systems, germany). Participants were seated upright in a chair with the elbow of their dominant arm flexed at 90 while applying outward - directed force to a vertical oriented handlebar (dynamometer setting) in front of them, thus creating external rotation of the gleno - humeral joint . The anterior part of the forearm was supported by the dynamometer setting and allowed the participants to brace against during the isometric mvc . The participants performed 3 mvcs separated by a 30 seconds rest period, and were instructed to apply force to the dynamometer as fast and forcefully as possible . Rfd was determined during 4 time intervals (030, 050, 0100, and 0200 ms from onset of contraction). The attempt yielding the highest rfd in the respective time interval was selected for statistical analysis . Raw mvc force signals were sampled at 1000 hz and subsequently low pass filtered (15 hz cut - off frequency, fourth - order zero - lag butterworth filter) using a custom - made matlab program (mathworks). On a separate occasion, our research team also performed test participants (n = 32; 15 men and 17 women; mean [standard deviation]; age: 32 years (8.7), height: 174.0 cm (9.0), weight: 69.5 kg (13.6), bmi: 22.7 (2.5)) performed the dynamometer testing of the shoulder external rotation on 2 separate occasions, 1 week apart, in accordance with the testing protocol used in the present study . All participants were instructed not to perform any exercises for 48 hours leading up to the reliability measures and were also asked not to engage in any new physical activities between the first and second test rounds . Lastly, all participants were instructed to be adequately hydrated and well rested before testing on both occasions ., we introduced a multifactorial 10-week intervention to the pcmt group consisting of joint mobility exercises focusing on precise motor control, 4 different strength training exercises with elastic bands, cognitive behavioral therapy in which education and counseling about fear of movement, the positive effects of movement, as well as de - catastrophizing pain were the main focus areas, and mindfulness group - training . Joint mobility / precise motor control training, strength training using elastic resistance bands, cognitive behavioral therapy, focusing on fear avoidance behavior and pain education, were grouped together and administered in brief 20 minutes sessions 4 times per week by a professional trainer with a relevant background . The elastic resistance exercises primarily consisted of 1 to 2 sets of approximately 10 reps using a resistance band equaling 15 to 20rm of 3 to 4 different upper extremity exercises (e.g., shoulder lateral raise, shoulder external rotation, and wrist extension). The primary emphasis during the physical training was on the precise motor control exercises and the behavioral aspects . Precise joint mobility and motor control exercises included various shoulder, neck, elbow, and wrist rotations in more or less challenging body positions . Further, the instructor was also encouraged to include exercises for other regions (e.g., hip, sacro - illiac joint, and low back) to all, or individual participants, if there was a specific need . Examples of both the elastic resistance exercises and the precise joint mobility / motor control exercises have previously been published . Mindfulness sessions were kept separate from the physical training and were administered once weekly by a psychologist specialized in stress and yoga . To address possible confounding factors, we tracked (i.e., asked by questionnaire at baseline and follow - up): number of days using pain medication within the last week, number of treatment sessions (e.g., by a medical doctor, physical therapist, or other types of health personnel) for pain in the back, neck, shoulders, elbows, or hands / wrists within the last month . The ref group served as a control group adhering to on - going company initiatives as described elsewhere . All statistical analyses were performed in accordance with the intention - to - treat principle by including all subjects in the analysis regardless of actual participation or dropout . Between - group differences of neurocognitive- and musculoskeletal function at follow - up were determined by a linear mixed model using proc mixed of the sas statistical software, version 9.2 (sas institute, cary, nc). Fixed factors were treatment, time and treatment by time interaction . Analyses of neurocognitive- and physical function were controlled for neurocognitive performance and physical function at baseline, respectively . A priori power analysis based on previous measurements reveals that 27 participants of each group for 95% power, type i error probability of 5% is sufficient to test the null - hypothesis of equality (alpha = 0.05, beta = 0.05). Given an estimated 10% dropout rate we aimed at recruiting at least 30 participants for each group . Results are reported as between - group least square means (95% confidence interval). During spring / summer of 2014 our research team conducted a randomized controlled intervention trial at a large pharmaceutical company in copenhagen, denmark . Briefly, we performed a single - blinded trial with allocation concealment, in a 2-armed parallel group format among female laboratory technicians . The participants were parallel - assigned to receive either a 10-week physical - cognitive - mindfulness training intervention or continue following already implemented company guidelines for reducing work - related musculoskeletal pain of the upper extremity and low back . Primary and secondary outcomes on musculoskeletal pain and work related stress have previously been reported . Prior participant enrolment we registered the study in the clinicalttrials.gov register: implementation of physical exercise at the workplace (irma09) laboratory technicians, registration no . Nct02047669 . Ethical approval was obtained from the danish national committee on biomedical research ethics (the local ethical committee of frederiksberg and copenhagen; h-3 - 2010 - 062) as part of the research program this study, as well as the previously published studies describing the protocol, primary- and secondary outcomes adhere to the criteria of the revised consolidated standards of reporting trials 2010 statement for reporting randomized trials . At the time of enrolment, the eligible participants (n = 112) all had chronic musculoskeletal pain in 1 or more of the following regions: upper back, lower back, neck, shoulders, elbows, or hands / wrists . To fulfill the definition of chronic pain all following criteria were met for at least 1 of these body regions: pain intensity of 3 (010 visual analogue scale [vas] supported by drawings from the nordic questionnaire) during the last week, pain frequency of 3 days during the last week, pain lasting at least 3 months . Participants with typical exclusion criteria, for example, severe hypertension (> 160/100), were allowed to participate in the less strenuous part of the training intervention if their general practitioner provided consent . We excluded participants with life - threatening diseases, and pregnancy was considered a contraindication to the training . To allocate the participants, a random numbers table in the sas statistical software was generated, thus allowing a randomized distribution of the laboratory technicians to either a physical - cognitive - mindfulness training (pcmt) intervention group or a reference group (ref). This allocation was performed after the participants had answered a baseline questionnaire providing information on descriptive characteristics and perceived level of musculoskeletal pain (table 1). Furthermore, participants were informed that it was unknown which treatment model would work best for reducing pain and they were instructed not to reveal their particular intervention to colleagues or study assessors . Following group allocation each participant was invited to complete a test battery consisting of an extensive clinical examination by a specialized physical therapist, a neurocognitive assessment, and a series of physical function measurements of the shoulder external rotator complex . The entire test battery lasted approximately 90 minutes and all assessors were blinded to participant allocation . Upon conclusion of the 10-week intervention the participants were asked again to fill out the questionnaire on musculoskeletal pain and complete the test battery for follow - up measurements . All participants were at the time of enrolment in the 25th to 74th percentile in the 6 domains of neurocognitive function, age- and gender matched for normative scores, which according to the central nervous system vital signs (cnsvs) guidelines are described as average with normal function and capacity . Participant characteristics, neurocognitive performance, and muscle function at baseline after group allocation; presented as mean (sd). Neurocognitive function was assessed by the cnsvs (cns vital signs, morrisville, nc) computerized test battery, which has been shown to be a stable and reliable assessment of cognitive function with high validity . The 5 included subtests were (in administered order): symbol digit coding test, shifting attention test, finger tapping test, stroop test, and continuous performance test . The tests themselves are online versions of standard measures of cognitive task performance and have previously been described and tested for reliability and validity in the literature . The test runs were highly consistently delivered: the test battery is automatically presented to the participants with written instructions and a short practice round immediately followed by the actual tests in the selected battery . Time to completion of the full test battery was between 20 and 30 minutes depending on how long the participants needed to read the instructions . The cnsvs can be administered in a variety of languages, including danish, which was the setting during this trial . Briefly, the subtests provided domain measures of: psychomotor speed, reaction time (measured in milliseconds), complex attention, cognitive flexibility, processing speed, and executive function . The scores of each of the domains were calculated either as differences between correct and erroneous responses within each subtest, or summation of the responses from 2 or more subtests according to the specifications of domain calculations of the cnsvs . For reference, each domain indicates the following: psychomotor speed is a measure of how well a subject perceives, attends, responds to complex visual - perceptual information, and performs simple fine motor coordination . It is an expression of the ability to perform simple motor skills and dexterity through cognitive functions (e.g., use of precision instruments or tools) and performing mental and physical coordination (e.g., driving a car or playing a musical instrument). Reaction time is a measure of how quickly the subject can react to a simple and increasingly complex direction set . Examples of this include driving a car, attending to conversation, and responding to a set of simple instructions . Complex attention is defined as the ability to track and respond to a variety of stimuli over lengthy periods of time and/or perform complex mental tasks requiring vigilance . Cognitive flexibility describes how well the person is able to adapt to rapidly changing and increasingly complex sets of directions and/or to manipulate the information . This can be exemplified as reasoning skill, switching tasks, decision - making, impulse control, and strategy formation . Processing speed is how well a person recognizes and processes information (e.g., fine motor coordination or visual - perceptual ability). Executive function is defined as how well a person recognizes rules, categories and performs in rapid decision - making tasks . In everyday life executive function is the ability to sequence and manage multiple tasks simultaneously and the ability to quickly respond to changing sets of instructions . Mvc and rfd of the shoulder external rotators were assessed during concurrent isometric external rotation of the gleno - humeral joint using a custom - built dynamometer with 2 strain gauge load cells (kis-2, 1 kn, vishay transducers systems, germany). Participants were seated upright in a chair with the elbow of their dominant arm flexed at 90 while applying outward - directed force to a vertical oriented handlebar (dynamometer setting) in front of them, thus creating external rotation of the gleno - humeral joint . The anterior part of the forearm was supported by the dynamometer setting and allowed the participants to brace against during the isometric mvc . The participants performed 3 mvcs separated by a 30 seconds rest period, and were instructed to apply force to the dynamometer as fast and forcefully as possible . Rfd was determined during 4 time intervals (030, 050, 0100, and 0200 ms from onset of contraction). The attempt yielding the highest rfd in the respective time interval was selected for statistical analysis . Raw mvc force signals were sampled at 1000 hz and subsequently low pass filtered (15 hz cut - off frequency, fourth - order zero - lag butterworth filter) using a custom - made matlab program (mathworks). Participants (n = 32; 15 men and 17 women; mean [standard deviation]; age: 32 years (8.7), height: 174.0 cm (9.0), weight: 69.5 kg (13.6), bmi: 22.7 (2.5)) performed the dynamometer testing of the shoulder external rotation on 2 separate occasions, 1 week apart, in accordance with the testing protocol used in the present study . All participants were instructed not to perform any exercises for 48 hours leading up to the reliability measures and were also asked not to engage in any new physical activities between the first and second test rounds . Lastly, all participants were instructed to be adequately hydrated and well rested before testing on both occasions ., we introduced a multifactorial 10-week intervention to the pcmt group consisting of joint mobility exercises focusing on precise motor control, 4 different strength training exercises with elastic bands, cognitive behavioral therapy in which education and counseling about fear of movement, the positive effects of movement, as well as de - catastrophizing pain were the main focus areas, and mindfulness group - training . Joint mobility / precise motor control training, strength training using elastic resistance bands, cognitive behavioral therapy, focusing on fear avoidance behavior and pain education, were grouped together and administered in brief 20 minutes sessions 4 times per week by a professional trainer with a relevant background . The elastic resistance exercises primarily consisted of 1 to 2 sets of approximately 10 reps using a resistance band equaling 15 to 20rm of 3 to 4 different upper extremity exercises (e.g., shoulder lateral raise, shoulder external rotation, and wrist extension). The primary emphasis during the physical training was on the precise motor control exercises and the behavioral aspects . Precise joint mobility and motor control exercises included various shoulder, neck, elbow, and wrist rotations in more or less challenging body positions . Further, the instructor was also encouraged to include exercises for other regions (e.g., hip, sacro - illiac joint, and low back) to all, or individual participants, if there was a specific need . Examples of both the elastic resistance exercises and the precise joint mobility / motor control exercises have previously been published . Mindfulness sessions were kept separate from the physical training and were administered once weekly by a psychologist specialized in stress and yoga . To address possible confounding factors, we tracked (i.e., asked by questionnaire at baseline and follow - up): number of days using pain medication within the last week, number of treatment sessions (e.g., by a medical doctor, physical therapist, or other types of health personnel) for pain in the back, neck, shoulders, elbows, or hands / wrists within the last month . The ref group served as a control group adhering to on - going company initiatives as described elsewhere . All statistical analyses were performed in accordance with the intention - to - treat principle by including all subjects in the analysis regardless of actual participation or dropout . Between - group differences of neurocognitive- and musculoskeletal function at follow - up were determined by a linear mixed model using proc mixed of the sas statistical software, version 9.2 (sas institute, cary, nc). Analyses of neurocognitive- and physical function were controlled for neurocognitive performance and physical function at baseline, respectively . A priori power analysis based on previous measurements reveals that 27 participants of each group for 95% power, type i error probability of 5% is sufficient to test the null - hypothesis of equality (alpha = 0.05, beta = 0.05). Given an estimated 10% dropout rate we aimed at recruiting at least 30 participants for each group . Results are reported as between - group least square means (95% confidence interval). Test retest reliability measures of the custom - made dynamometer setup on the shoulder external rotation showed high reliability for mvc and rfd at 0 to 30 ms, 0 to 50 ms, 0 to 100 ms, and 0 to 200 ms with an icc at 0.95, 0.92, 0.93, 0.92, and 0.91, respectively . As previously reported, 3 participants of the intervention study from each group dropped out of without providing information as to why . Consequently, 53 participants from each group completed the follow - up testing and questionnaire on musculoskeletal pain . There were no between - group changes at 10-week follow - up on any of the neurocognitive domains . Between- and within group differences at 10-week follow - up on neurocognitive domain scores; presented as least square mean (95% confidence interval). There were no between - group changes at 10-week follow - up on either mvc or rfd at 0 to 30 ms, 0 to 50 ms, 0 to 100 ms, or 0 to 200 ms . Table 3 summarizes the results on physical function of the shoulder external rotators for each group and between groups at 10-week follow - up . Between- and within group differences at 10-week follow - up on muscle function (maximum voluntary contraction [n] and rate of force development [n / s]) of the shoulder external rotator; presented as least square mean (95% confidence interval). The present study demonstrates that neither neurocognitive performance, as measured by the cnsvs test battery of neurocognitive function, nor physical function measured by mvc and rfd of the shoulder external rotators was improved by a 10-week physical - cognitive - mindfulness training intervention at a company worksite compared with a reference group following the company's ongoing health initiatives . Primary outcomes on musculoskeletal pain and stress have previously been reported but as those parameters are a part of discussing the results of the present study, they are included here as reference . In brief, average pain of the 6 regions between groups at 10-week follow - up was 1.0 (1.4 to 0.6) (p <0.0001). Stress score was not different at 10-week follow - up between groups (p = 0.16). Finally, an explorative dose response analysis showed that pain decreased on average 0.6 points (010 vas) per average weekly attended physical - cognitive training session, whereas pain increased per weekly attended mindfulness session by 0.15 (010 vas). The lack of improvement in mvc and rfd is in contrast to other interventions and investigations using strength training to reduce chronic and nonchronic musculoskeletal pain . A possible explanation for the lack of improvement in rfd in the present study may be attributed to a relatively low intensity of the physical training . That is, strength training is per definition training that increases muscle strength, but we did not find any change in muscle strength as result of the present training regimen . As described previously by our research team, the intervention did in fact have physical training elements but focused mostly on motor control training and precise joint mobility . It is therefore reasonable to speculate that the mechanical load placed on the body during training was not sufficient to cause adaptations in rfd, as there is a minimal load necessary to increase neural drive and stimulate type ii fiber hypertrophy . As an example, andersen et al found improvements in rfd of the trapezius muscle following high - intensity progressive resistance training and jay et al have likewise reported increases in rfd and to a lesser extent increases in maximal strength following short duration progressive resistance training using elastic bands . Both of these studies utilized a progressive resistance training model with higher work intensities, which is a noteworthy contrast to the present study and therefore a reasonable explanation for the observed lack of improvement in rfd . Regardless of the lack of changes in physical function our research team has previously reported a 52% (average of 6 body regions) decrease in musculoskeletal pain in the same population of female laboratory technicians . Based on the aforementioned research on rfd of chronically painful muscles, we expected to see an increase in rfd following the intervention period, as pain suggestively could inhibit motor output . Musculoskeletal pain may not have been a limiting factor for muscle strength in the present population of laboratory technicians, and the present results suggest that pain reductions may not always lead to increased rfd . This is in contrast to the findings by andersen et al showing a significant correlation between pain reductions and increases in rfd . In our previous study reporting the changes in pain following the intervention, the average pain (010 vas) of the 6 body regions was 2.9 and 2.6 for the pcmt and ref groups respectively, with pain scores up to 3.5 for the neck and 4.0 for the shoulders before intervention commencement . These pain levels are similar to other studies demonstrating changes in rfd following resistance training, indicating that the female laboratory technicians in the present study had sufficient chronic musculoskeletal pain for us to expect increases in rfd . Similar to the lack of changes in physical function, we did not observe any changes in neurocognitive performance as tested by the cnsvs neurocognitive assessment software . This is in contrast to previous findings, which generally show pain subtly affecting some but not all domains of cognitive function either in a direct or indirect manner . For example, a review by moriarty et al states that neurocognitive impairment is commonly associated with the pain experience being a severe obstacle to daily activities and rehabilitation strategies, especially in the chronic pain population . As mentioned previously, oosterman et al found only diminished sustained attention performance while mental flexibility, planning, and inhibition appeared to remain intact when investigating cognitive executive function and attention and suhr found that although fibromyalgia patients had more memory complaints and reported more fatigue, pain, and depression, they did not differ from healthy controls in cognitive performance . These observations on cognitive performance and pain are noteworthy and should be taken into account . In the present study, it is very likely that the intensity of pain experienced by the participants was not severe enough to affect neurocognitive performance significantly . Furthermore, the participants were not cognitively impaired at baseline, which makes it difficult to improve further . Pain has previously been shown to modulate cerebral activity during cognitive performance tasks, but uniformity of the modulation is divergent . Rmy et al found that a positive modulation effect on thermo - nociception (thermal hot stimulation 4649c) was observed in the midcingulate and the dorsomedial prefrontal cortex . Conversely, a negative modulation effect was observed in perigenual cingulate cortex, insula, and medial thalamus . We do not know which brain regions were active during the neurocognitive assessment in the present study, nor do we know what kind of brain activity chronic musculoskeletal pain of the magnitude reported by the laboratory technicians, elicits . Consequently, it can be speculated that overall modulatory brain activity did not change due to an insufficient pain sensation . This can be supported by the degree of pain induced to detect cortical activity changes by rmy et al . In their study, the participants reported the hot stimulus (4649c), inducing pain of more than 6 on a 0 to 10 vas scale, which is much higher than the musculoskeletal pain reported by our participants . It may therefore be speculated that the laboratory technicians were not experiencing sufficiently intense pain to affect cognitive performance, which explains the lack of change in neurocognitive performance . The randomized controlled design with parallel assigned, concealed allocation, and blinded examiners reduced the risk of systematic bias and is therefore a major strength . Further, the limited number of drop - outs and the intention - to - treat analysis, which inherently accounts for missing values, are also noteworthy strengths . Finally, our dynamometer setup was highly reliable for testing physical function and was performed by the same test leader, which both contribute to the strengths of this study . However, an important limitation was the inability to blind participants to the treatments as well as the intervention consisted of several different elements . Participant outcome expectations are a limitation in intervention trials but in the present study we informed participants before group allocation that we did not know which treatment would work the best and whichever treatment at the end of the trial that proved to be the most effective in reducing musculoskeletal pain would be offered to the participants of the group not having received that particular treatment during the intervention . Finally, the seemingly nonconsensus about how cognitive function, and what domains to be included in the evaluation hereof, should be mentioned . For instance, veldhuijzen et al used only 2 single tests (the stroop color - word test and the multi - source interference test) to evaluate cognitive decline in fibromyalgia patients versus health controls, which lead them to conclude that cognitive inhibition remained intact but a decline in mental processing and/or psychomotor speed was evidenced . Clearly, a uniform definition of what is included as domains in cognitive processing is undetermined and constitutes a limitation to the present study as the cnsvs test battery does include psychomotor speed as a domain of cognitive function and processing ability . The randomized controlled design with parallel assigned, concealed allocation, and blinded examiners reduced the risk of systematic bias and is therefore a major strength . Further, the limited number of drop - outs and the intention - to - treat analysis, which inherently accounts for missing values, are also noteworthy strengths . Finally, our dynamometer setup was highly reliable for testing physical function and was performed by the same test leader, which both contribute to the strengths of this study . However, an important limitation was the inability to blind participants to the treatments as well as the intervention consisted of several different elements . Participant outcome expectations are a limitation in intervention trials but in the present study we informed participants before group allocation that we did not know which treatment would work the best and whichever treatment at the end of the trial that proved to be the most effective in reducing musculoskeletal pain would be offered to the participants of the group not having received that particular treatment during the intervention . Finally, the seemingly nonconsensus about how cognitive function, and what domains to be included in the evaluation hereof, should be mentioned . For instance, veldhuijzen et al used only 2 single tests (the stroop color - word test and the multi - source interference test) to evaluate cognitive decline in fibromyalgia patients versus health controls, which lead them to conclude that cognitive inhibition remained intact but a decline in mental processing and/or psychomotor speed was evidenced . Clearly, a uniform definition of what is included as domains in cognitive processing is undetermined and constitutes a limitation to the present study as the cnsvs test battery does include psychomotor speed as a domain of cognitive function and processing ability . A 10-week physical - cognitive - mindfulness training intervention did not improve maximal strength or rfd of chronically painful muscles . These findings are contradictory to previous findings, both in the field of musculoskeletal pain rehabilitation and neurocognitive function . Furthermore, testing pain - derived impairment of neurocognitive function may lack validity without monitoring different brain regions, as the modulation of cognitive performance is not uniform in the cortex . In the present study, however, pain intensity may not have been sufficiently severe to limit neurocognitive function. |
Leptin plays an important role in the regulation of body weight due to reducing food intake and increasing energy expenditure (1).leptin can signal the body fat level to the brain to control energy homeostasis by regulating the activity of neurons in the hypothalamus . In a study, leptin in maternal plasma increased from 15.5 9.0g / l in the 18 week of pregnancy to 17.710.7 g / l in the 35 week (2). Also, leptin contributes greatly to the growth and development of the embryo, fetus and infant (3), because it is synthesized by placental tissue and changes with adipocity and glucose metabolism in pregnancy (4). Neuropeptide y, a polypeptide containing 36 amino acids, is a potent orexigenic agent that regulates eating behaviour . Neuropeptide y is synthesized in the hypothalamic arcuate nuclei and secreted by nerve terminals in the paraventricular nucleus . The major stimuli for neuropeptide y synthesis and secretion are food deprivation, reduced circulating insulin levels and elevated serum glucocorticoid levels . Therefore, neuropeptide y initiates the outflow of efferent stimuli in the brain, resulting in increased appetite and food intake (5).previous studies have suggested that neuropeptide y is involved in hyperphagia during pregnancy and lactation (6).in a study, the mean plasma neuropeptide y concentration was higher in pregnant women during the first trimester of gestation compared to non - pregnant women . In another study, the mean plasma l in non - pregnant women; this value was 144 13 and 156 24 pmol / l in the second and third trimesters of pregnancy, respectively (7). It seems that the leptin - neuropeptide y mechanism counteracts the vasoconstriction attributable to the preeclamptic changes in the placenta and may cause trophic changes in placental tissue through its receptors . Placental neuropeptide y production could not affect theneuropeptide y concentrations in the maternal or fetal circulation (8, 9). Insulin is a hormone which plays a key role in the metabolism of blood glucose, causing the glucose level to decrease in the blood and increase in the liver . In addition, an increase in fat is usually accompanied with an increase in insulin (10). Insulin also inhibits food intake in animals through modulating neuropeptide y expression (11).on the other hand, the up - regulation of maternal islet function has a vital role in accommodating the heightened demand for insulin during pregnancy . In 0, 45, 90, 135 and 180 minutes after glucose loading in pregnant women, the mean plasma insulin level was 25.2, 77.2, 57.0, 57.8 and 44.7 u / ml, respectively . Ramadan is the ninth month in themuslim lunar calendar.ramadan fasting is one of the five pillars of islam.the majority of muslims fast from dawn to dusk during the whole month of ramadan . The daily fast (neither food nor drink) in ramadan lasts nearly 12 - 19 hours every day depending on the geographic location and the season (12). The fasting muslims usually have 2 meals per day, iftar at sunset and sahari before dawn (13). Many pregnant muslim women fast during ramadan every year worldwide . Fasting during pregnancy in the form of skipping breakfast and other meals pregnancy is a state characterized by physiologicalhyperphagia (14) and modifications in maternal adiposity which causes an increase in adipose tissue mass during the early phase, followed by a decrease in the fat mass during the late phase . In a study conducted on animals, lipogenic pathway was predominant during the earlier phase, but it grew more active in the final phase (15).increased insulin secretion stimulates triglycerides synthesis (16), and increased fat stores stimulate the release of leptin by the adipocytes (17, 18). Consequently, leptin inhibits neuropeptide y secretion, while energy loss is accompanied by reduced leptin secretion and stimulated neuropeptide y synthesis (19). Very little research exists on those pregnant women who fast during ramadan, and no research has yet examined the effect of fasting on leptin, neuropeptide y and insulin level during pregnancy . Because leptin, neuropeptide y and insulin are involved in the modulation of energy balance, we attempted to evaluate these parameters during ramadan and after ramadan in fasting pregnant women . Thiscross sectionalstudy was conducted in the ramadan of 2012 (from july 21 to august 18) in shahrekord university of medical sciences, iran . This study was conducted on 39 healthy volunteer fasting pregnant women aged 18 - 45 years, with a gestational age of 7 to 39 weeks and a mean (sd) of 22.4 (7.9) weeks . All the participants signed an informed written consentin which the experimentalprocedures was described in detail, and they were excluded from the study if they had diabetic mellitus, hypertension or if they were smokers . All the participants abstained from food and drink during the day from dawn to sunset and ate only during the night and completed fasting till the end of ramadan . This research was approved by the scientific advisory and ethics committee of shahrekord university of medical sciences . The participants were weighed barefoot with light clothes, standing on a standard pro - calibrated balance . To determine body mass index (bmi), body mass was measured to the nearest one kg and height to the nearest one cm . At the end of ramadan, fasting venous samples were taken at 1:00 - 2:00 a.m. to measure the serum level of leptin, neuropeptide y and insulin . Serum leptin levels were measured by radioimmunoassay according to the instructions of the manufacturer (linco, st . Neuropeptide y was assayed through competitive radioimmunoassay by direct assay without extraction using reagents (euro - diagnostica ab, sweden). The human insulin specific radioimmunoassay detects insulin with a sensitivity of 2 m u / ml . Blood glucose was measured by the hexokinase kit (pars azmoon co., iran). All measurements were done five times on 0, 7th, 14th and 28th day of ramadan and on the14th day post - ramadan . The parametric repeated measures anovawas applied to determine whether any changes occurred among the variables of interest during the study . The multivariate f - tests of greenhouse - geisser were used for within the subject analysis due to the violation of sphericity assumptions . The tests of within - subject contrast were used to compare the mean of measurements . Statistical significance was defined as p <0.05 and analysis was performed by spss . Thirty nine healthy fasting pregnant women voluntarily participated in this cross - sectional study with the following conditions: an age range of 17 to 42 years and a mean of 26.9 (6.4), gestational age of 7 to 35 weeks with a mean of 21.9 (7.5) and a bmi of 18.3 to 35.9 kg / m2 with a mean of 25 (4.2) at the beginning of the study . The results relevant to the concerned variables including serum fasting blood sugar (fbs), insulin, neuropeptide y and leptin are demonstrated in table 1, and the trends are shown in figs . Two weeks after compared with the fourth week (p= 0.009) two weeks after compared with the second week (p=0.018) two weeks after compared with the fourth week (p=0.002) two week after compare to the fourth week (p=0.001) during the study, the weight and bmi of women did not change significantly . Fbs decreased significantly during ramadan and increased significantly after ramadan in such a way that the level of estrogen at the end of ramadan was the lowest of all . Therefore, fbs was significantly higher two weeks after ramadan compared to the end of ramadan (p= 0.009) (fig . 1). No significant change was found in the insulin level during the study . 3): leptin level decreased until the second week, and then it increased at the end of ramadan and it decreased again significantly two weeks after ramadan compared to the fourth week of ramadan (p= 0.02). A monotonous increasing trend was found in neuropeptide y during ramadan and two weeks after ramadan on such a way that neuropeptide y was significantly higher two weeks after ramadan than its value at the end of ramadan (p= 0.001) (fig . Serum leptin was correlated with bmi corresponding measurementat the second and fourth weeks of ramadan and at two weeks after ramadan . However the mean of leptin during the first, second and third trimesters and in the postnatal stage was higher in pregnant women compared to the non - pregnant because of the increase in food intake with the advancement of pregnancy (20). Leptin concentration gradually elevated during the first to third trimesters with a peak at 28th week, and its levels were significantly correlated with maternal weight and bmi (21).on the other hand, the increase of leptin levels during pregnancy may be due to a decrease in the rate of leptin clearance from maternal blood circulation (22, 23). The elevation of the serum leptin during pregnancy has also been reported by other investigators (24).also, previous studies indicated that short - term total fasting or a chronic reduction in caloric intake resulted in the reduction of leptin by 30% to 66% of basal level (25, 26).leptin secretion decreases in response to fasting (27) and increases in response to positive energy balance induced by overfeeding (25). Because energy intake increases during ramadan, it is possible that the elevated levels of leptin in this study may have been due to the compensatory increase in food intake during the night (28). Our findings support those of previous studies.in our study, serum leptin level in the fourth week of ramadan significantly increased and was correlated with bmi in the second and fourth weeks of ramadan . A study showed that plasma leptin is secreted in a pulsatile fashion with peak levels at night and a nadir at noon (29).also, there is evidence that the diurnal rhythm of leptin secretion is related to the meal pattern and that shifting meal time causes a comparable shift in plasma leptin rhythm (30).because ramadan fasting was associated with a forward shifting of lunchtime by approximately 8 hours per day in our study, this shifting caused an increased level of leptin in the circadian pattern of leptin with progressive proximity toward the peak nocturnal level . Therefore, the elevation of serum leptin level in our study may be due to the changes in shifting meal time because serum leptin is considered to reflect the state of nutrition and energy reserve (31).furthermore, serum leptin and its potential role in pregnancy bmi have been reported (32). In the present study, during ramadan and two weeks after ramadan the serum level of neuropeptide this finding is in accordance with that of previous studies indicating that the level of neuropeptide y mrna content in the arcuate nucleus significantly increased during pregnancy (33).on the other hand, it has been demonstrated that diet restriction and starvation rapidly induce an accumulation of neuropeptide y in the paraventricular nucleus by increasing neuropeptide y mrna level in the arcuate nucleus (34).a study on rats also showed a very high concentration of prepro - neuropeptide y mrna following 96 hours of food deprivation (35).therefore, the elevation of neuropeptide y in our study may be due to the progression of pregnancy and fasting from dawn to dusk during the whole month of ramadan . Nevertheless, in another study, the neuropeptide y decreased during ramadan in non - pregnant women (36). In our study, insulin increases in pregnant and non - pregnant women in ramadan because fasting insulin and leptin are closely correlated with weight loss in obese women . In the present study, leptin, neuropeptide y and insulin were considerably higher in fasting pregnant women compared to the baseline levels obtained in the previous studies conducted on non - fasting pregnant women; and this could be due to the need for more energy in fasting pregnant women who experience increased decomposition of lipid tissue . Then, they consume more food and as a result their blood glucose and insulin increase, and the additional glucose causes the blood to turn into fat . Having no control group was one of the limitations of this study . However, we measured the normal levels of serum leptin, neuropeptide y and insulin in non- fasting pregnant women as well . The results of this study revealed that circulating insulin and leptin relatively increased in pregnant women during ramadan fasting . In addition, it was found that serum neuropeptide y level progressively increased during ramadan and two weeks after ramadan . However, the increase in serum neuropeptide y was similar to that of leptin in fasting pregnant women . These data provide an insight into the important role of leptin and neuropeptide y in the long term regulation of energy balance in pregnant women, with chronic diurnal fasting . Also, these results show that the level of factors considered in this study were higher in fasting pregnant women compared to non - fasting pregnant women . Leptin levels were correlated significantly with bmi during and after fasting, but neuropeptide y had no relationship with bmi . The most important finding which was derived from this study was the lack of negative feedback between leptin and serum neuropeptide y concentrations in fasting pregnant women during ramadan . This study was supported by research and technology department of shahrekord university of medical sciences (grant no . 963). |
Pneumopericardium is defined as the presence of air - fluid level in the pericardial sac and has been reported to result from a spontaneous or iatrogenic cause of underlying disease.1) it is a rare condition but is important in the differential diagnosis of chest pain . Posteroanterior chest radiographs typically reveal air - fluid level and a radiolucency of air surrounding the cardiac boarder is outlined by a fine line representing the pericardial sac . Although severe complications occur in some patients, the iatrogenic pneumopericardium is self - limiting and requires no specific therapy.2) we discuss a case of iatrogenic pneumopericardium in a young man who underwent pericardiocentesis due to tuberculous pericardial effusion . A 20-year - old man was referred to the hospital with extensive pericardial effusion on a computed tomography . The patient had a history of pulmonary tuberculosis for 2 years and had taken anti - tuberculosis medication for the past 8 months . Physical examination showed stable vital signs: blood pressure, 131/65 mmhg; pulse rate, 92 bpm; respiratory rate, 26 per minute; body temperature, 36.5. posteroanterior chest radiographs showed cardiomegaly without any lung lesion (fig . 1). An emergent echocardiogram showed a large circumferential pericardial effusion and diastolic right atrium collapse without respiratory variation of the mitral inflow . The left ventricular ejection fraction was estimated to be 60% . A 7fr arrowgard blue catheter (arrow international inc, bernville, pa, usa) was used for subxiphoid pericardiocentesis . Over 1,000 ml of serous fluid was drained from the pericardial sac over the following 12 hours . The pericardial fluid was a lymphocyte dominant exudate, containing protein 6.5 g / dl, albumin 3.6 g / dl, lactate dehydrogenase 466 u / l and white blood cell 7,200 cells/l (lymphocyte 84%). Polymerase chain reaction for mycobacterium tuberculosis deoxyribonucleic acid was negative with pericardial fluid and adenosine deaminase in pericardial effusion was 96 iu / l (normal, 5 to 23 iu / l).3) on day 5 after the pericardiocentesis the patient developed a pleuritic chest pain . His blood pressure was 110/70 mmhg, heart rate was 72 bpm, and respiratory rate was 20 per minute . Follow up chest radiographs showed a new lucent outline around the heart with a clear lung, representing the existence of air - fluid level in the pericardial space (fig . 3). Echocardiography revealed scanty pericardial effusion, a bright echogenic spot swirling in the pericardial cavity and an absent tamponade (fig . The diagnosis of pneumopericardium can be made by conventional chest radiographs, ct, or echocardiography.5) in posteroanterior chest radiographs, a continuous thin radiolucent rim of air and air - fluid level follows the cardiac silhouette and is outlined by a fine line representing the pericardial sac.2) pericardiocentesis with extended catheter drainage is a safe treatment for managing clinically significant pericardial effusions and can be performed effectively under local anesthesia.6) the subxiphoid window should be the standard initial procedure in most patients requiring drainage for effusive pericardial disease . It is less morbid than the transthoracic approach and allows a shorter hospital stay.7) for our patient we hypothesized that pneumopericardium was induced by chance due to forced coughing during drainage after pericardiocentesis . In tension pneumopericardium, rapid fluid resuscitation and emergent echo - guided pericardiocentesis, followed by pericardial drainage, should be performed . If the hemodynamic condition is stable, the underlying condition should be treated and the patient should be monitored closely.2) the patient was in a tolerable state, so we treated him conservatively and removed catheter drainage . The current case showed that pneumopericardium is a rare complication of pericardiocentesis, which occurs as a result of a leaky drainage system or direct pleura - pericardial communication. |
Multiple myeloma (mm) is a b - cell neoplasia which is characterized by an malignant proliferation of aberrant plasma cells in the bone marrow . Renal impairment and bone resorption are among the most important consequences of this disease [1 - 3]. Novel treatment options are urgently needed and are being developed [4 - 6]. In mm malignant plasma cells usually produce excessive amounts of monoclonal proteins, which may involve intact immunoglobulins or serum free light chains (sflc) or both . In a study of 1027 patients with newly diagnosed mm, kyle et al . Sflc play a crucial role in mm induced renal damage and are probably the most important cause of renal failure in these patients . In healthy individuals production of sflc this " physiologic " amount of sflc gets rapidly cleared and degraded by the kidneys . However, sflc production in mm can reach 30 g / day exceeding the clearance capacity of the kidneys . Sflc are normally transported to the interstitium of the kidney via specific receptors in the proximal tubule . Overload of these receptors by excessive amounts of sflc results in an overflow of them to the distal tubule . Sflc entering the distal tubule usually bind to uromucoid (tamm - horsfall protein) and form casts, which obstruct tubular fluid flow, leading to disruption of the basement membrane and interstitial damage [8 - 12]. The amount of sflc necessary to cause renal impairment has recently been studied by nowrouisan et al . . The median serum concentration associated with overflow proteinuria and hence tubular damage were 113 mg / l for kappa and 278 mg / l for lambda light chain, respectively . Thus, this level corresponds to a daily production of light chains about 5 g. reduction of sflc levels therefore represents a potential strategy to improve renal function in acute renal failure in mm . In this regard prompt initiation of an effective chemotherapy protocol is a precondition for success, but additional supportive treatment options are increasingly discussed in this regard . Studies were initiated to investigate the use of plasma exchange in patients with mm and acute renal failure but failed to show any significant benefit on renal function . In the present manuscript we report on a new type of renal replacement therapy (rrt), namely rrt using a protein leaking membrane . Protein leaking membranes are characterized by an increased pore size of the dialyzer membrane promoting the elimination of middle sized molecules such as sflc . These membranes were initially developed to improve the clearance capacity for inflammatory mediators in critically ill septic patients . Particularly one hemofilter, the hco1100 has been extensively studied in the regard . In this paper we analyzed the efficacy of the protein leaking membrane hco1100 to eliminate sflc in kappa light chain mm patients with acute renal failure necessitating rrt . The elimination capacity of the hco1100 was studied in the hemodialysis and hemodiafiltration mode and was compared to standard hemodialysis procedures as well as to plasma exchange . Four consecutive patients with kappa light chain mm were included in this study . All patients necessitated rrt due to acute renal failure . Baseline laboratory evaluation included blood creatinine, estimated creatinine clearance (mdrd formula), urea, acid base and electrolyte household . Before and after each renal replacement session sflc levels were measured using latex - enhanced nephelometric immunoassays (the binding site, schwetzingen, germany) adapted to the bn prospec nephelometer (dade - behring, eschborn, germany). L for the sflc lambda assay with control sera (n = 10) provided by the binding site . Hemodialysis and hemodiafiltration procedures were performed with a dialysis device allowing the online preparation of ultrapure hemofiltration replacement fluids if required (ak200s, gambro dialysatoren gmbh, hechingen, germany). Polyamide high flux hemofilter (polyflux 140h, polyflux 210h, steam sterilized, gambro dialysatoren gmbh, hechingen, germany) were used for standard hemodialysis . For standard hemodiafiltration membrane specifications for the high flux hemofilter polyflux 140h (pf 140h) and polyflux 210h (pf 210h) are as follows: effective surface area 1.4 qm for pf 140h and 2.1 qm for pf 210h, wall thickness 50 m, inner diameter 215 m, membrane pore size ~ 5 nm, ultrafiltration coefficient 60 (ml / h, mmhg) for pf 140h and 85 (ml / h, mmhg) for pf 210h, cut off point 30 - 40 kd, sieving coefficient for vitamin b12 (molecular weight 1.35 kd) and inulin (molecular weight 5.20 kd) 1.0, for 2 microglobulin (molecular weight 11.8 kd) 0.7 . For rrt (either hemodialysis or hemodiafiltration) with the protein leaking membrane a newly designed high cut off hemofilter, the polyamide hco 1100 hemofilter (hco 1100, effective surface area 1.1 qm, steam sterilized, gambro corporate research, hechingen, germany) was used . The high cut off hemofilter is characterized by an increased pore diameter of ~10 nm with a membrane thickness of 50 m and an internal diameter of 215 m . The in vivo cut off point of the membrane is approximately 60 - 80 kd . The hemofilter has been designed to increase the in - vivo permeability for substances in the molecular weight range up to 60 kd . Basic features of this new hemofilter have been recently described [18 - 21]. Whenever the protein leaking membrane was applied regular controls of plasma albumin and total protein were performed (pre - and post dialysis). In case of high transmembrane protein losses a balanced substitution of human albumin was uniformly set at 200 ml / h, dialysate flow rate was 500 ml / min . The ultrafiltration rate was based on the individual fluid balance of the patients . In a subgroup of patients sflc kappa - clearances in the initial phase (10 min after start of treatment) and at the end of therapy were calculated as follows: clearance (ml / min) = dialysate concentration of flc / inlet serum concentration of flc dialysate flow rate . A roller blood pump device was used for plasma exchange (bsm 22, gambro hospal germany). A standard plasmafilter (gambro pf 2000n, gambro, lund, sweden) was chosen . 2500 ml of fresh frozen plasma were given in exchange during a 2.5 h session . Paired data were compared using the wilcoxon rank sum test, unpaired data by the mann - whitney - u - test . Patient 1 was a 73-year - old male who had previously received 6 cycles of chemotherapy with melphalan and prednisolone . At the time of admission he had acute renal failure with a creatinine level of 11.3 mg / dl (egfr 5 ml / min). Chemotherapy with adriamycin and dexamethasone was initiated . In order to reduce the amount of sflc two treatment sessions of plasma exchange were performed (figure 1). For uremia control rrt had to be started . Six sessions of high flux hemodialysis (figure 2) with a median ultrafiltration rate of 1680 ml (range 900 - 2600 ml) per session were applied . Reduction rate (%) of sflc kappa with hemodialysis using the high flux membrane pf 140h . Patient 2 was a 70-year - old female who had developed mm induced acute renal failure with a creatinine of 3.4 mg / dl and an estimated gfr of 14 ml / min at hospital admission . The patient was treated with hemodialysis thrice weekly using a standard high flux hemofilter as well as the protein leaking membrane on day 15, 18 and 25 (figure 3). Reduction rate (%) of sflc kappa with hemodialysis using the protein leaking membrane hco1100 . Patient 3 was a 61-year - old woman with a long known history of light chain mm disease . Previously, this patient had been treated with various chemotherapy protocols, including high - dose chemotherapy with autologous stem cell transplantation, thalidomide and dexamethasone, bortezomib, lenalidomide and dexamethasone . She was admitted to the hospital due to mm induced acute renal failure . At admission creatinine was 5.4 mg / dl (egfr 9 ml / min). Treatment was started with three sessions of hemodialysis using the protein leaking membrane (figure 4). The hemodialysis procedures were followed by 5 sessions of hemodiafiltration using the same hemofilter (figure 5). After hemodiafiltration 4 sessions of standard hemodialysis using a standard hemofilter (pf 140h, gambro) were performed (figure 4). Reduction rate (%) of sflc kappa with hemodiafiltration applying the hco 1100 and pf210h hemofilter . Although chemotherapy was promptly initiated, the patient developed progressive disease with an increase of sflc kappa from 5740 mg / a detailed sequence of the hemofilters used in this patient is given in figures 4 and 5 . This previously untreated patient was admitted to our hospital due to hypercalcaemia of 3.7 mmol / l and acute renal failure with a creatinine of 5.3 mg / dl (egfr 12 ml / min). A total of 9 hemodialysis sessions with a median ultrafiltration rate of 415 ml (range 0 - 1500 ml) were performed . Simultaneously furthermore the patient received 7 sessions of hemodiafiltration (hc1100) with a median ultrafiltration of 550 ml (range 0 - 1500 ml) (figure 7). Our data reveal that hemodiafiltration with the protein leaking membrane hco 1100 was superior to all other extracorporeal replacement strategies in eliminating sflc from circulating blood (figure 8). With the protein leaking membrane hco 1100 a median reduction rate of 40.8% (range 13.9% -66.4%) was achieved during hemodiafiltration and 23.7% (range -32.9% -55.8%) during hemodialysis (p = 0.017) (figure 8). Eliminating the extremes (there were two protein leaking membrane hemodialysis sessions were the sflc increased during dialysis, probably due to an highly active disease) significance still remained in favor for the hemodiafiltration mode (p = 0.04). Of interest, the percentage decline of sflc kappa during plasma exchange was only 14.5% and 9.9%, respectively (figure 1). In the same patient high flux hemodialysis achieved a median reduction rate of 21.4% (range -7.4% -32.7%, figure 2). Box - whiskers - plot: summary of median sflc kappa reduction rates by different renal replacement strategies . The median overall reduction rate for conventional high flux hemodialysis was 21.2% (range -7,5% 41.5%). Comparing the small (pf 140h) versus the large surface area membrane (pf 210h) revealed a slight, but statistically not significant advantage in favor for the large surface area membrane (p = 0.66). Nevertheless, a significant difference was found between standard high flux hemodiafiltration (pf 210h) and hemodialysis (pf 210h), in favor for the hemodiafiltration mode (p = 0.005) (figure 8). In parallel best clearance rates were achieved during hemodiafiltration with the protein leaking membrane followed by hemodialysis with the protein leaking membrane . Maximum clearances were achieved in the initial phase of the treatment with values reaching up to 25 ml / min during hco 1100 compared to 5 ml / min during conventional therapy (pf 210h). However, even when the protein leaking membrane was used clearance rates declined to around 10 ml / min at 4 hours . Blood pressure drops were equally distributed between standard high flux treatments and treatments performed with the protein leaking membrane . Median albumin values before and after treatment with the protein leaking membrane were 3.3 (range 3.1 - 3.7) and 3.4 (range 3.3 - 3.89), respectively . Patient 1 was a 73-year - old male who had previously received 6 cycles of chemotherapy with melphalan and prednisolone . At the time of admission he had acute renal failure with a creatinine level of 11.3 mg / dl (egfr 5 ml / min). Chemotherapy with adriamycin and dexamethasone was initiated . In order to reduce the amount of sflc two treatment sessions of plasma exchange were performed (figure 1). For uremia control rrt had to be started . Six sessions of high flux hemodialysis (figure 2) with a median ultrafiltration rate of 1680 ml (range 900 - 2600 ml) per session were applied . Reduction rate (%) of sflc kappa with hemodialysis using the high flux membrane pf 140h . Patient 2 was a 70-year - old female who had developed mm induced acute renal failure with a creatinine of 3.4 mg / dl and an estimated gfr of 14 ml / min at hospital admission . The patient was treated with hemodialysis thrice weekly using a standard high flux hemofilter as well as the protein leaking membrane on day 15, 18 and 25 (figure 3). Reduction rate (%) of sflc kappa with hemodialysis using the protein leaking membrane hco1100 . Patient 3 was a 61-year - old woman with a long known history of light chain mm disease . Previously, this patient had been treated with various chemotherapy protocols, including high - dose chemotherapy with autologous stem cell transplantation, thalidomide and dexamethasone, bortezomib, lenalidomide and dexamethasone . She was admitted to the hospital due to mm induced acute renal failure . At admission creatinine was 5.4 mg / dl (egfr 9 ml / min). Treatment was started with three sessions of hemodialysis using the protein leaking membrane (figure 4). The hemodialysis procedures were followed by 5 sessions of hemodiafiltration using the same hemofilter (figure 5). After hemodiafiltration 4 sessions of standard hemodialysis using a standard hemofilter (pf 140h, gambro) were performed (figure 4). Reduction rate (%) of sflc kappa with hemodiafiltration applying the hco 1100 and pf210h hemofilter . Although chemotherapy was promptly initiated, the patient developed progressive disease with an increase of sflc kappa from 5740 mg / a detailed sequence of the hemofilters used in this patient is given in figures 4 and 5 . This previously untreated patient was admitted to our hospital due to hypercalcaemia of 3.7 mmol / l and acute renal failure with a creatinine of 5.3 mg / dl (egfr 12 ml / min). A total of 9 hemodialysis sessions with a median ultrafiltration rate of 415 ml (range 0 - 1500 ml) were performed . Simultaneously furthermore the patient received 7 sessions of hemodiafiltration (hc1100) with a median ultrafiltration of 550 ml (range 0 - 1500 ml) (figure 7). Our data reveal that hemodiafiltration with the protein leaking membrane hco 1100 was superior to all other extracorporeal replacement strategies in eliminating sflc from circulating blood (figure 8). With the protein leaking membrane hco 1100 a median reduction rate of 40.8% (range 13.9% -66.4%) was achieved during hemodiafiltration and 23.7% (range -32.9% -55.8%) during hemodialysis (p = 0.017) (figure 8). Eliminating the extremes (there were two protein leaking membrane hemodialysis sessions were the sflc increased during dialysis, probably due to an highly active disease) significance still remained in favor for the hemodiafiltration mode (p = 0.04). Of interest, lowest sflc kappa elimination rates were achieved with plasma exchange . The percentage decline of sflc kappa during plasma exchange was only 14.5% and 9.9%, respectively (figure 1). In the same patient high flux hemodialysis achieved a median reduction rate of 21.4% (range -7.4% -32.7%, figure 2). Box - whiskers - plot: summary of median sflc kappa reduction rates by different renal replacement strategies . The median overall reduction rate for conventional high flux hemodialysis was 21.2% (range -7,5% 41.5%). Comparing the small (pf 140h) versus the large surface area membrane (pf 210h) revealed a slight, but statistically not significant advantage in favor for the large surface area membrane (p = 0.66). Nevertheless, a significant difference was found between standard high flux hemodiafiltration (pf 210h) and hemodialysis (pf 210h), in favor for the hemodiafiltration mode (p = 0.005) (figure 8). In parallel best clearance rates were achieved during hemodiafiltration with the protein leaking membrane followed by hemodialysis with the protein leaking membrane . Maximum clearances were achieved in the initial phase of the treatment with values reaching up to 25 ml / min during hco 1100 compared to 5 ml / min during conventional therapy (pf 210h). However, even when the protein leaking membrane was used clearance rates declined to around 10 ml / min at 4 hours . Blood pressure drops were equally distributed between standard high flux treatments and treatments performed with the protein leaking membrane . Median albumin values before and after treatment with the protein leaking membrane were 3.3 (range 3.1 - 3.7) and 3.4 (range 3.3 - 3.89), respectively . In this study we analyzed different modes of extracorporeal elimination techniques for reducing sflc kappa in patients with kappa light chain mm associated nephropathy requiring dialysis . We compared a novel type of hemofilter, a so - called protein leaking membrane, applied in a hemodialysis and hemodiafiltration mode to standard procedures such as high flux hemodialysis and hemodiafiltration as well as plasma exchange . We found a superiority in favor for the protein leaking membrane particularly when applied in the hemodiafiltration mode . High flux hemofilters, particularly high flux membranes with a large surface area reached surprisingly good reduction rates for sflc kappa . However, when the clearance rates were analyzed, a significant advantage in favor for the protein leaking membrane was found . Up to 10 fold higher clearance rates were achieved with the protein leaking membrane compared to the high flux hemofilter (pf 210h). They are normally cleared in 2 - 4 hours at 40% of the glomerular filtration rate . However, removal may be significantly prolonged in patients with renal failure and can reach up to 2 - 3 days in mm patients in complete renal failure . Free light chains are distributed in similar concentrations in serum, extra - vascular compartment and in tissue edema fluid . The intra - vascular compartment probably contains only 15 - 20% of the total amount . Thus, redistribution from the interstitium into the vascular compartment occurs which makes a long extracorporeal treatment session necessary for an effective removal of sflc . Clark et al . Studied the effects of plasma exchange on clinical course of mm patients . They performed 5 to 7 plasma exchanges in their patients and found that it did not reduce a composite outcome of death, dialysis dependence, or glomerular filtration rate at 6 months . However, they initiated the study before the routine availability of the immunoglobulin free light chain assay, thus sflc were not investigated and subgroup analyses for light chain diseases could not be performed . Very recently, cserti and co - workers studied sflc concentration in two patients and found that plasma exchange failed to effectively lower sflc levels . Plasma exchange was performed using a continuous - flow cell separator . In our study plasma exchange the plasma exchange volume was 2.5 l, which is a standard dose for plasma exchange . Based on this finding and having in mind the results from clark and co - workers we decided not to proceed with plasma exchange in light chain mm since the low serum reduction rates do not compensate for the potential risks (allergic reaction, infections etc). Hemodialysis with newly designed protein leaking membranes may represent an alternative strategy to clear sflc more effectively . Due to an increased pore size of these membranes the elimination of middle sized molecules including sflc is eased . Very recently hutchison and co - workers studied the impact of different protein leaking membranes on the capacity to clear sflc . Excellent clearance rates for both kappa and lambda light chains were reported which translated in a significant removal of sflc in light chain mm patients with acute renal failure ., we analyzed the gambro hco 1100 membrane in the hemodialysis and hemodiafiltration mode extending the results of hutchison and co - workers . The maximum reduction rate for sflc kappa was 66% which is line with the data reported by hutchison . Interestingly, we observed a high variability in the inter - and intra - patient reduction rate for sflc kappa during hco 1100 rrt which is best explained by a variable activity status of the underlying disease . While patient 2 and 4 had a more or less constant sflc kappa reduction rate of around 25 to 30% over time (indicating a stable disease activity), patient 3 showed an increase in sflc kappa on day 1 of the first cycle of chemotherapy with adriamycin and dexamethasone from 4320 mg / l before starting hco 1100 dialysis to 5740 values increased even further in the dialysis free interval and reached 9739 mg / l on the consecutive dialysis day (predialysis value). The missing fall in sflc kappa can be clearly interpreted as a sign of rapid disease progression . A switch in chemotherapy to bortezomib a highly effective chemotherapy is a precondition for treating mm associated nephropathy and must be initiated simultaneously to the rrt . After the first cycle of chemotherapy with adriamycin and dexamethasone sflc decreased from 6270 mg / l (day1) to 3500 mg / l (day14), but then increased up to 6450 mg / l (day 28) again . Thus, we changed the regimen to bortezomib and dexamethasone . At day 16 after starting this chemotherapy regime sflc dropped to 48.8 mg / l . Here, a combination of an effective chemotherapy and hemodialysis led to a very good result . Importantly, the observed rebound phenomenon after rrt also results from the distribution of sflc into the different body compartments . Only around 20% of the total amount of sflc are found in circulating blood whereas 80% lay in the so called " third compartment " . Redistribution processes have to take place before these " trapped " sflc can be eliminated . Hence, sustained elimination procedures are required . Rrt with some protein leaking membranes can lead to substantial transmembrane protein losses particularly when used on a extended daily base as propagated by hutchison et al . . However, in our study population a severe protein depletion was not observed . In conclusion, extracorporeal elimination strategies with the protein leaking membrane hco 1100 may be a new and promising adjuvant treatment strategy for patients with sflc nephropathy requiring dialysis . Hemodiafiltration and to lesser extend also hemodialysis with the hco 1100 hemofilter are able to eliminate substantial amounts of sflc kappa in mm patients . However, a rebound phenomenon is observed which not only demands a prolonged and repeated treatment strategy but also an effective chemotherapy protocol as a precondition for renal recovery. |
Hypertrophic cardiomyopathy (hcm) is a genetically heterogeneous heart muscle disorder characterized by myocardial hypertrophy in the absence of abnormal loading conditions . While it has been recognized for many decades that some patients with the disease die suddenly from ventricular arrhythmia, data from contemporary studies suggest that the annual risk of sudden cardiac death (scd) is in the range of 1% . Some risk factors have been shown to be associated with an increased risk of scd in patients with hcm . The challenge for clinicians is to identify the small cohort of patients who are at a higher risk in order to target potentially lifesaving therapy such as implantable cardioverter defibrillators (icd). Fragmented surface electrocardiogram (ecg fqrs) has been identified as a useful risk marker in other clinical conditions; however, its use in arrhythmic events in patients with hcm has not been suggested . We report a case of an 18-year - old girl with hcm and aborted scd and implanted with an icd . Her surface 12-lead ecg evolved from normal to fqrs complex in less than 7 years . During a 2-year follow - up, she presented with recurrent syncope . At that time, her 12-lead electrocardiogram (ecg) showed sinus rhythm, q - waves and negative t - waves in leads v5 and v6 with a qrs duration <120 ms . [figure 1, left panel]. Her echocardiogram depicted an asymmetrical left ventricular hypertrophy with an interventricular septum measuring 22 mm and no intraventricular gradient . During the screening, secondary causes of left ventricular hypertrophy such as systemic hypertension, congenital disease and valvular diseases were ruled out . Her first degree relatives were screened with ecg and echocardiogram, however, no phenotypic hcm was found . The patient remained asymptomatic under treatment with atenolol 50 mg / day for 7 years, when she suffered a cardiac arrest following an episode of emotional stress . Ventricular fibrillation (vf) was detected and terminated by an external electrical shock . During hospitalization, an echocardiogram showed massive left and right ventricular hypertrophy with a septal thickness of 38 mm and absence of intraventricular gradient [figure 2]. The surface 12 lead ecg showed q - waves in leads i, avl, v5, v6, left ventricular strain pattern, inverted t - waves, and a qrs duration of 130 ms with fqrs in all leads . [figure 1, right panel] a dual chamber icd (maximo dr 7278, medtronic, inc, mn, usa) was implanted . The patient was discharged and treated with atenolol 50 mg twice a day . During the two - year follow - up, anti - tachycardia pacing was effective in numerous occasions to convert vt into a normal sinus rhythm; however, on 2 occasions, shocks were necessary to resolve the arrhythmia . Atenolol dose was increased and the patient has remained asymptomatic since the last six months . In the left panels, 12-lead electrocardiogram (ecg)at the age of nine (2002), depicting sinus rhythm, pr interval 160 ms, qtc 380 ms and q - waves in leads v5, v6 with negative t - waves . In the right panel, 12-lead ecg on admission at the age of sixteen (2009), depicting sinus rhythm; pr interval 130 ms and delayed left atrial depolarization (the second vector of the p - wave is delayed, most likely by fibrosis of the interatrial septum); deep q - waves in leads i, avl, v5, and v6, diffuse t - wave inversion, qrs duration 130 ms and different morphologies of fqrs, including various rsr patterns parasternal large axis view (left) and apical four - chamber view (right) depicting global thickened of the left ventricular walls and right ventricle and interatrial septum involvement . Ivs: interventricular septum; la: left atria; lv: left ventricle; ra: right atria; rv: right ventricle the stratification of risk in hcm in clinically stable patients is predicated on generally accepted noninvasive markers . The accepted risk factors in hcm include family history of 1 hcm - related scds, 1 episode of unexplained syncope, massive left ventricular (lv) hypertrophy (thickness 30 mm); nonsustained vt on serial ambulatory 24-hour holter, and hypotensive or attenuated blood pressure response to exercise . The ecg has traditionally been a part of the non - invasive evaluation for patients with hcm and though various electrocardiographic abnormalities were described, most of them correlated with the magnitude and extent of ventricular hypertrophy; however, did not reflecte increased risk per se . Some investigators have attributed the disturbed myocardial electrical properties in hcm to the distinctive anatomical substrate of hypertrophied and disorganized myocytes . Indeed, ventricular electrogram fractionation (delayed myocardial activation) has been documented by programmed ventricular extrastimulation in patients with hcm and induced vf; however, was absent in patients without vf . Recently, das et al . Described the presence of fqrs in patients with coronary artery disease (cad). The fqrs was defined in the 12-lead ecg as the presence of an additional r - wave (r) or notching in the nadir of the r - wave or the s - wave, or the presence of> 1 r (fragmentation) in 2 contiguous leads, corresponding to a major coronary artery territory . Fragmented qrs in the presence of wide qrs complexes (120 ms), such as bundle branch block (bbb), premature ventricular complexes (pvcs) and paced qrs complexes (pqrs), was defined by the presence> 2 notches in the r - wave or the s - wave, since bbb already have two notches or peaks present in two contiguous leads (3). Fqrs has been associated with inhomogeneous activation of the ventricles due to myocardial scar and/or ischemia, which could predict arrhythmic events as well as death . The underlying mechanisms of fragmentation have been supported by autopsy studies of patients with myocardial infarction (mi) and left ventricular aneurysm . These studies showed that the presence of fqrs was associated with a significant myocardial necrosis alternating with viable myocardial tissue and interspersed in abundant fibrous tissue . Distribution and pattern of the scar depends on the disease states . In cad, myocardial scars are segmental and subendocardial or transmural, whereas in nonischemic cardiomyopathy the scars are patchy and mid myocardial or subepicardial, predominantly in the perivalvular areas . In the presented case, myocardial scars are probably the cause of localized conduction block leading to an additional r or notching of the r wave or s - wave . Endocardial and epicardial mapping in patients with cad or dilated cardiomyopathy with ventricular arrhythmias have revealed fractionated electrograms over a wide area surrounding the myocardial scar . Fqrs is not specific for cad, and was also observed in other myocardial diseases such as dilated cardiomyopathy, some congenital heart diseases, arrhythmogenic right ventricular cardiomyopathy and brugada syndrome . To the best of our knowledge, this is the first report of a patient with hcm and rapidly progressive fqrs, with documented malignant ventricular arrhythmias treated by an icd . The progressive fragmentation of the qrs and the presence of malignant ventricular arrhythmias, lead us to speculate on the value of fqrs as a predictor of ventricular arrhythmias in patients with hcm ., in a long series of 330 patients with hcm and high - risk criteria of scd with icd implantation, compared the relationship of electrocardiographic findings and appropriate icd therapies . During a follow - up of 3.7 3.0 years, 17% of the patients had appropriate icd discharges . The authors found no distinctive ecg characteristics in patients with and without appropriate icd interventions . Bongioanni et al . Found in 241 patients with hcm that a qrs duration 120 ms had an odds ratio of 5.2 for all - cause cardiovascular death; however, was not found to predict scd . Hypothetically, the lack of correlation of malignant ventricular arrhythmias with ecg abnormalities supports the notion that scd likely depends on transient electrophysiologic status and by interacting with the underlying substrate, such as vascular ischemia, neuroendocrine or electrolyte imbalance . Such transient injuries are consistent with the unpredictable nature of hcm - related scd that may occur years after diagnosis, and often without any warning . In the presented case, the fqrs probably reflects a more severe myocardial disease, manifested by severe progression of ventricular hypertrophy . Fqrs should be investigated in larger series of patients as a possible new risk factor and predictor of arrhythmic events in patients with hcm . Fqrs should be tested in a larger series of patients as a possible new risk factor and predictor of arrhythmic events in patients with hcm. |
Refractory ascites causes abdominal distention, abdominal pain and dyspnea and thereby aggravates patient quality of life and activities of daily living . The effect of abdominal paracentesis is temporary, but loss of albumin and globulin can cause deterioration of nutritional and immune status and lowered colloid osmotic pressure . Cell - free and concentrated ascites reinfusion therapy (cart) is a treatment which maintains albumin and globulin by filtration, concentration, and reinfusion of drained ascites . The advantages of this method are that albumin transfusion can be employed sparingly, and the risk of infection or allergic reaction is thus reduced . However, cart is dangerous to spontaneous bacterial peritonitis (sbp) patients because inadvertent reinfusion of filtrated, concentrated endotoxins in ascites has caused adverse effects of temporary fever and shock . We report our pursuit of cart for refractory ascites in sbp after finding that ascites were negative for endotoxins . A 58-year - old japanese male with end - stage renal failure due to chronic glomerulonephritis and receiving chronic hemodialysis since 1980 underwent kidney transplantation from an unrelated donor in october 1998 . This case was also complicated by chronic hepatitis c. in january 2004, liver cirrhosis with a child - pugh score of 6 points (grade a) was diagnosed based on total serum bilirubin (t - bil) of 0.7 mg / dl, serum albumin (s - alb) of 2.8 g / dl, prothrombin time - international normalized ratio (pt - inr) of 1.1, and medical control of ascites . During follow - up, immunosuppressive therapy consisted of mycophenolate mofetil (500 mg / day), tacrolimus hydrate (2 mg / day), and prednisolone (7.5 mg / day). In november 2004, 160 mg / day furosemide and 4 mg / day thiazide were administered for increased ascites, but the effect was insufficient . On december 26, 2004, the patient was hospitalized for fever, abdominal pain, dyspnea, and copious ascites . On admission, patient height was 167.6 cm, body weight 59.2 kg, body temperature 39.2c, blood pressure 154/92 mm hg, and pulse 72 beats / min . Table 1 presents the laboratory findings on admission, including a white blood cell count of 8,500/l and a c - reactive protein (crp) level of 11.3 mg / dl . Based on t - bil 2.6 mg / dl, s - alb 2.7 g / dl, pt - inr 1.1, and the presence of refractory ascites, liver cirrhosis with a child - pugh score of 9 points (grade b) was diagnosed . The ascites were exudative and demonstrated a specific gravity of 1.032, total protein of 3.1 g / dl, total albumin of 1.6 g / dl, rivalta's reaction positive, and polymorphonuclear leukocyte (pmn) count of 940 cells / mm . Renal failure was identified based on a blood urea nitrogen (bun) level of 55 mg / dl and s - cr of 2.3 mg / dl . Tacrolimus trough concentration was not problematic, at 6.2 ng / ml; urinalysis was also normal; fractional excretion of urea nitrogen (feun) was low, at 20%; and on this basis, prerenal failure was diagnosed . Abdominal computed tomography scan and abdominal ultrasound showed copious ascites, but there was no evidence of abscess, perforation, or penetration . 1 presents the clinical course and treatment pursued . Immediately after ascites puncture, we began empirical antibiotic therapy with ceftriaxone intravenously (1 g / day), and mycophenolate mofetil and tacrolimus hydrate were discontinued . Two days after initiation of treatment, body temperature was normal, and abdominal pain had ceased, but the copious ascites were not improved . Abdominal paracentesis (3 l / day) and albumin transfusion (25%, 100 ml / day) were performed 6 times, but the effect was temporary, and control of ascites was poor . S - alb decreased to 1.8 g / dl, renal failure deteriorated, urinary volume declined, and ascites increased yet further . Due to normal urinalysis and low feun of 20%, aggravation of prerenal failure was a suspected factor . Because the pmn count in ascites decreased to 58 cells / mm and ascites were also endotoxin negative (0.8 pg / ml), cart was initiated, with 3.0 l of ascites filtrated and concentrated to 0.3 l in 120 min . The concentrated fluid was drip - infused back into the patient at the rate of 0.15 l / h . The apparatus used was the plascit 01 and the columns used were model ahf - mow for the ascites filtration and the model ahf - unh for the ascites concentration, all manufactured by asahi kasei medical (tokyo, japan). At such time, s - alb rose gradually, and the level of ascites decreased . Cart was performed a total of 6 times, and ascites were well controlled, with no observation of fever, hypotension, or other adverse effects . Biochemical results also improved to t - bil 0.7 mg / dl, s - alb 3.2 g / dl, bun 37 mg / dl, s - cr 1.2 mg / dl, and crp 0.0 mg / dl . No findings suggesting rejection of a transplanted kidney were observed, mycophenolate mofetil (500 mg / day) and tacrolimus hydrate (2 mg / day) were reinitiated, and the patient was discharged . The diagnostic criteria for sbp are bacterial growth from the ascitic fluid plus an ascitic pmn count of more than 250/l, or ascitic fluid with a pmn count of more than 500/l, even in the absence of a positive culture . In this case, sbp was diagnosed on the basis of an ascitic pmn count of 940 cells / mm and the absence of an obvious intra - abdominal source of infection . Sbp is thought to result from a combination of factors inherent in cirrhosis and ascites, such as prolonged bacteremia secondary to compromised host defense, intrahepatic shunting of colonized blood, and defective bactericidal activity within the ascitic fluid . Some 40% to 50% of all patients with sbp have negative cultures of both blood and ascitic fluid, as in this case [4, 5]. Since the 1985 seminal study, which showed better outcomes with cefotaxime than with the combination of ampicillin and tobramycin, third - generation cephalosporins have been the agents of choice in the management of sbp . Subsequently, several studies have reinforced the role of third - generation cephalosporins in an effort to determine the optimal dose and duration of therapy [5, 6, 7, 8, 9]. Guidelines for sbp have been published by the international ascites club and suggest several antibiotics that may be used for empirical treatment, including cefotaxime, cefonicid, ceftizoxime, ceftriaxone, ceftazidime, and amoxicillin - clavulanic acid . Based on the reports cited, we selected ceftriaxone, and given the prerenal failure status, dosage was reduced to 1 g / day . Acute renal failure develops in 33% of patients with sbp and is a major cause of death . After abdominal paracentesis, intravenous infusion of albumin has been used to avoid reduction of the effective volume and prerenal failure [12, 13]. A randomized, controlled study of patients with sbp showed that patients receiving cefotaxime with a high - volume albumin transfusion (1.01.5 g / kg) were significantly less likely to have irreversible renal failure and had lower mortality . Japan, however, relies on imports for 70% of its albumin formulations, which complicates high - volume albumin transfusion (e.g., 1.01.5 g / kg). Cart is a treatment which maintains albumin and globulin by filtration, concentration, and reinfusion of drained ascites . A single cart treatment reportedly can reinfuse approximately 60 g of albumin, and this amount corresponds to a high - volume albumin transfusion capable of reducing the associated risk of infection or allergic reaction . However, cart is more expensive than the high volume of albumin transfusion (60 g) in japan (90,000 vs. 60,000 yen). Cart cannot eliminate endotoxins, which present a danger to sbp patients as a risk of endotoxin shock or temporary fever . Sbp is deemed resolved when all signs of infection have disappeared and the ascitic fluid pmn count is below 250 cells / mm . In our case, cart was pursued after the pmn count in ascites decreased to 58 cells / mm and the ascites were found to be endotoxin negative . At such time, no shock or temporary fever was observed . Though administration of prednisolone (7.5 mg / day) as immunosuppressive therapy may have prevented occurrence of a temporary fever, we believe that cart is a safe treatment even for endotoxin - negative sbp patients. |
Zinc is considered as a useful material for cooling water treatment in light water nuclear power plants . A trace amount of soluble zinc injected into the coolant water suppresses co buildup in water piping systems and reduces the gamma ray dose rate from the piping system carrying the coolant [16] and this method has been successfully applied to several nuclear reactors that were used for power generation . However, the use of natural zinc does not provide the maximum benefit due to the adverse effects that are brought about by an increase in radioactive zn levels caused by the neutron activation of zn in the reactor core . The use of depleted zinc, i.e., depleted in isotope zn, was found to be more effective to reduce this radiation dose in the cooling water system . The separation of zinc isotopes is therefore of high interest within nuclear science and technology . Nowadays, zinc isotopes can be obtained using the most advanced centrifuge technology in the world, but this method requires a relatively large amount of energy and therefore has economic restrictions . The present technique could not meet the increasing demands of the zn depleted zinc isotopes in the world . Compared to this physical method, chemical exchange methods utilizing equilibrium processes have been considered to require less energy consumption and present more economical and environmental clean advantages . The use of chromatographic techniques for the enrichment of isotopes has been regarded as a promising method for large scale production of enriched isotopes . Chromatography operated in the band displacement manner was found to be an efficient process and was characterized by maintaining the self - sharpening band boundaries at both migration band ends . Isotope separation based on ion exchange involves equilibrium formation between the stationary phase resin and the mobile phase solution . The ion exchange displacement chromatography has been successfully applied to the separation of isotopes of various elements in complex formation systems especially for those using hydroxycarboxylates as ligands [812]. Malate, citrate, lactate and edta are important ligands that can form a wide variety of complex species with metal ions [13, 14]. Chelating exchange resins have a relatively large zinc adsorption capacity and may be caused by the functional group of the chelating resin . The present study continued the effort to carry out zinc isotope separation by the use of chelating exchange resin . Chromatographic experiments were designed using the four ligands mentioned above in order to elucidate the isotope effect present during zinc complexation . Emphasis was placed on the impact of ligands on the separation coefficient () and the separation coefficient per unit mass differences (/m) observed during the separation processes . The chromatographic system used in the present study consisted of five pyrex columns (100 cm long and 1.0 cm i.d .) And a high pressure pump (nihon seimitsu np - kx-100) that was used for controlling the flow rate of the feeding solution . Columns were connected in series with a teflon tube . In order to monitor the column pressure, a pressure gauge with a safety device was placed between the first column and the pump . The temperature was set at 298 1 k throughout the experiments by circulating thermostated water through an extension water jacket out of the columns . An automatic fraction collector (frc-2100, iwaki asahi techno glass, tokyo, japan) was used for collecting the effluents into small fractions (ca . The columns were packed with the commercially available chelating exchange resin d850 (hangzhou zhengguang resin co., hangzhou, china). The functional group of this macroporous exchange resin was based on ch2n(ch2cooh)2 and the particle size of the resin was 0.40.6 mm . At the beginning of the chromatographic operation packed column was conditioned by elution with 2.0 mol l hcl solution in order to remove impurities followed by redistilled water . A 0.1 mol l zncl2 with 0.01 mol l hcl solution were used as feeding solution until the length of the zinc adsorption band became ca . The zinc band was then eluted at a flow rate of 6.0 0.1 ml h using 0.1 mol l ligand solutions . These were prepared from malic acid, citric acid, lactic acid, and edta, with ammonia solution, respectively . The eluting solutions were adjusted to each corresponding ph value and transferred to the top of the column . After collection of the zinc fractions the resin was regenerated to the h form using 2.0 mol l hcl solution in order to continuously run the five packed columns . The operating conditions for the zinc isotope separation is summarized in table 1.table 1chromatographic experimental conditions of zinc isotope fractionation using different ligandscomplex systemzn edtazn malatezn citratezn lactateeluting agent(nh4)2edta (0.1 mol l, ph = 7.5 0.2)(nh4)2malate (0.1 mol l, ph = 7.4 0.2)(nh4)3citrate (0.1 mol l, ph = 7.2 0.2)nh4lactate (0.1 mol l, ph = 7.3 0.2)resinmacroporous, particle size 0.40.6 mm, total exchange capacity 1.8 mmol ml, water content 4856%, ch2n(ch2cooh)2 functional grouptemperature (k)298 1feed solution0.1 mol l zncl2 + 0.01 mol l hcl solutionmigration length (m)9.5flow rate (ml h)6.0 0.1 chromatographic experimental conditions of zinc isotope fractionation using different ligands the zinc concentrations obtained from each fraction was measured by an atomic adsorption spectrophotometer (ana-182f type) using the emission line at 213.9 nm and sensitivity calibration was performed before measurements . The mass determination of the feed solution and fraction samples taken from the front band region were performed by inductively coupled plasma mass spectrometry (icp - ms, x7 series and supported by thermo electron corporation) with the zinc concentration of 30 ppb diluted with 0.5% hno3 . The dwell time for zn, zn and zn was 10 ms and for zn and zn was 20 ms . For each isotope measurement, the number of scans were 200 and the measurement error was within 0.2% . The chromatographic system used in the present study consisted of five pyrex columns (100 cm long and 1.0 cm i.d .) And a high pressure pump (nihon seimitsu np - kx-100) that was used for controlling the flow rate of the feeding solution . Columns were connected in series with a teflon tube . In order to monitor the column pressure, a pressure gauge with a safety device was placed between the first column and the pump . The temperature was set at 298 1 k throughout the experiments by circulating thermostated water through an extension water jacket out of the columns . An automatic fraction collector (frc-2100, iwaki asahi techno glass, tokyo, japan) was used for collecting the effluents into small fractions (ca . The columns were packed with the commercially available chelating exchange resin d850 (hangzhou zhengguang resin co., hangzhou, china). The functional group of this macroporous exchange resin was based on ch2n(ch2cooh)2 and the particle size of the resin was 0.40.6 mm . At the beginning of the chromatographic operation packed column was conditioned by elution with 2.0 mol l hcl solution in order to remove impurities followed by redistilled water . A 0.1 mol l zncl2 with 0.01 mol l hcl solution were used as feeding solution until the length of the zinc adsorption band became ca . The zinc band was then eluted at a flow rate of 6.0 0.1 ml h using 0.1 mol l ligand solutions . These were prepared from malic acid, citric acid, lactic acid, and edta, with ammonia solution, respectively . The eluting solutions were adjusted to each corresponding ph value and transferred to the top of the column . After collection of the zinc fractions the resin was regenerated to the h form using 2.0 mol l hcl solution in order to continuously run the five packed columns . The operating conditions for the zinc isotope separation is summarized in table 1.table 1chromatographic experimental conditions of zinc isotope fractionation using different ligandscomplex systemzn edtazn malatezn citratezn lactateeluting agent(nh4)2edta (0.1 mol l, ph = 7.5 0.2)(nh4)2malate (0.1 mol l, ph = 7.4 0.2)(nh4)3citrate (0.1 mol l, ph = 7.2 0.2)nh4lactate (0.1 mol l, ph = 7.3 0.2)resinmacroporous, particle size 0.40.6 mm, total exchange capacity 1.8 mmol ml, water content 4856%, ch2n(ch2cooh)2 functional grouptemperature (k)298 1feed solution0.1 mol l zncl2 + 0.01 mol l hcl solutionmigration length (m)9.5flow rate (ml h)6.0 0.1 chromatographic experimental conditions of zinc isotope fractionation using different ligands the zinc concentrations obtained from each fraction was measured by an atomic adsorption spectrophotometer (ana-182f type) using the emission line at 213.9 nm and sensitivity calibration was performed before measurements . The mass determination of the feed solution and fraction samples taken from the front band region were performed by inductively coupled plasma mass spectrometry (icp - ms, x7 series and supported by thermo electron corporation) with the zinc concentration of 30 ppb diluted with 0.5% hno3 . The dwell time for zn, zn and zn was 10 ms and for zn and zn was 20 ms . For each isotope measurement, the number of scans were 200 and the measurement error was within 0.2% . The mechanism of zinc isotope separation by chelating exchange chromatography is illustrated in fig . 1the fractionation mechanism and isotope ratio curve of zinc using chelating exchange chromatography the fractionation mechanism and isotope ratio curve of zinc using chelating exchange chromatography chromatography was conducted in a band displacement manner . At the rear band boundary of zinc ions, the adsorbed zinc ions were released from the resin, as indicated in eq . 1, and formed complexes with the ligand supplied by the eluent where superscript bars denote the resin phase:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\overline{{{\text{zn}}^{2 +}}} + \left ({{\text{nh}}_{4}} \right)_{2} {\text{l}} \to \, \overline{{2{\text{nh}}_{4}^ {+}}} + {\text{znl}} $$\end{document} during the elution through the zinc adsorption band, the isotope exchange reaction (eq . 2) took place repeatedly between zinc carboxylate complexes in the external solution phase and the zinc ions on the resin phase:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\overline{{^{\text{h}} {\text{zn}}^ {2 +}}} + ^{\text{l}} {\text{zn l}} \rightleftarrows \overline{{^{\text{l}} {\text{zn}}^ {2 +}}} + ^{\text{h}} {\text{zn l}} $$\end{document}where the superscripts h and l denote the heavier and lighter zinc isotopes, respectively . When the zinc carboxylate complex species reached the front boundary of the zinc adsorption band, the zinc complexes dissociated and the free zinc ions were re - adsorbed onto the resin phase (eq . 3):\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\overline{\text{zn l}} + 2 {\text{h}}^ {+} \to \, \overline{{{\text{h}} _ {2} {\text{l}}}} + {\text{zn}}^ {2 +} $$\end{document} the results obtained by the above mentioned chemical reactions and isotopic analysis are plotted in fig . . 2chromatographic profile of zinc effluent concentration and isotopic ratios using the citrate ligand chromatographic profile of zinc effluent concentration and isotopic ratios using the citrate ligand the zinc concentration found in the effluent fraction corresponded to the front band of zinc adsorption in the columns . The same analyses were performed for the other three ligands that were found to give similar results (not shown). Since the stability constant of zinc complex species is larger than that of ammonium complex species [16, 17] and the total selectivity of the chelating exchange resin for zinc ions is higher than that for protons, the eq . 1 and eq . 3 at rear and front boundaries tended to proceed to the right side and resulted in the formation of sharp boundaries at both edges of the band . 2) that the heavier zinc isotopes were enriched at the front edge and the lighter zinc isotopes enriched at the rear boundary by the present chelating exchange resin . The results were interpreted by the mechanism that the heavier zinc isotopes were preferentially fractionated into the zinc complex species present in aqueous solution and moved down at a relatively faster velocity to the front edge while the lighter zinc isotopes were retained in the form of zinc ions on the resin and eluted down at a lower velocity, resulting in the accumulation at the rear boundary . The results suggested that the equilibrium constant of eq . 2 should be larger than unit one in each operated system . This was consistent with the prediction that the heavier zinc isotopes were expected to fractionation into the strong bound chemical species based on the theory of isotope effects in molecular vibration . The isotope separation coefficient is used to evaluate chromatographic performance and can be calculated based on eq . 4 which was derived by spedding and kakihana [18, 19]:\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\varepsilon = \alpha - 1 = \sum {{\frac{{q_{i} \left| {r_{i} - r_{o}} \right|}}{{qr_{o} (1 - r_{o})}}}} $$\end{document}where refers to the isotope fractionation factor, or the single stage separation factor; q is the amount of zinc in fraction sample, q the total amount of adsorbed zinc on the resin, ri the isotopic percentage of zn, and the subscripts i and o are the fraction number and the original sample, respectively . The separation coefficients were calculated in each operation from the isotopic enrichment curve of the front boundary and are listed in table 2.table 2separation coefficients of zinc in ligand complex systems by chelating exchange resinzn malatezn citratezn lactateseparation coefficient (10)zn / zn7.165.526.175.96zn / zn3.082.512.682.83 separation coefficients of zinc in ligand complex systems by chelating exchange resin each ligand gave distinct values and edta was found to result in the strongest coordination bond with zinc ions as judged by the relatively large value . When compared to the lactate, citrate and malate ligand systems, the different value might relate to the complex chemical species in solution . It was reported that the existence of binuclear complexes of metal ions was probably the reason why the separation coefficient had a large value in the ligand system . In an uranyl carboxylate complex system the existence of binuclear uo2 complexes might create the condition for large isotope fractionation and the separation coefficients followed the order malate> citrate = tartrate> lactate [22, 23]. On the contrary, the separation coefficients of vanadyl carboxylate system followed the inverse order lactate> citrate>> malate . Table 3 presents the separation coefficient and the related data of the isotopic pair of zn / zn obtained in this work along with the results reported from the vo, cu, gd and uo2 in malate and edta ligand exchange systems [9, 10, 2427].table 3chromatographic separation coefficients of metal ions in ligand complex systemsmetal ionmeasured isotopic paircomplex formation systemt (k)separation coefficient, (10)referencezn68/64malate2985.52present workcitrate6.17lactate5.96edta7.16vo50/51malate2981.0lactate2.4citrate2.2cu63/65malate3122.8edta3230.13gd158/160malate3120.092edta3320.25uo2235/238malate2982.2edta2980.6 chromatographic separation coefficients of metal ions in ligand complex systems regarding the isotopic pair zn / zn (table 3) the separation coefficients found for lactate and citrate were slightly larger than those observed in a malate system and the value with corresponding ligands obtained in the present work was much larger than that in vanadium system . Apart from the complex structure of zinc and vanadium with those ligands, the large mass difference between zn and zn could also contribute to the formation of a relatively large separation coefficient . Zinc was found to display a much larger separation coefficient when compared with separation coefficients determined for cu, gd, uo2 (table 3). For a zinc / edta ligand a larger value was observed in comparison with the other three ligands and as far as cu and uo2 were concerned, the separation coefficients in edta were found smaller than those observed in a malate system . The different metal complex structure in ligands and the ph value of the solution used in the present work might have significant impact on results . Further experiments were needed in order to elucidate the mechanism involved in the formation of zinc isotope separation coefficient using different ligand systems . In general, the isotope effect or the isotope separation coefficient depended on the temperature . Theoretically, is proportional to m and inversely proportional to the square of both the atomic weight m and the absolute temperature t: \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\varepsilon \propto \updelta m / m^{2} t^{2} $$\end{document} table 4 provides an overview of zinc isotope separation coefficient per unit mass differences using a number of different exchange resins [2831].table 4separation coefficient per unit mass differences (/m) for the isotopic pair of zn / zn using different exchange resinsresin typefeed solutiontemperature (k)zn / zn /m (10)referencebenzo-12-crown-4 resin0.5 mol l zncl22981.12benzo-15-crown-5 resin0.5 mol lzncl22982.02[28, 31]benzo-15-crown-5 resin0.08 mol l zncl23231.32benzo-15-crown-5 resin0.05 mol l zncl23131.68benzo-15-crown-5 resin0.05 mol l zncl23431.42benzo-18-crown-6 resin0.5 mol l zncl22981.98dibenzo-18-crown-6 resin0.5 mol l zncl22981.60[28, 31]strongly acidic cation exchange resin0.05 mol l zn(no3)23330.80chelating exchange resin0.1 mol l zncl2 with edta solution2981.79present work0.1 mol l zncl2 with malate solution1.380.1 mol l zncl2 with citrate solution1.540.1 mol l zncl2 with lactate solution1.49 separation coefficient per unit mass differences (/m) for the isotopic pair of zn / zn using different exchange resins it can be seen that each type of resin had different /m values . The average /m value for the isotopic pair of zn / zn found in the present study was 1.55 10 which was in agreement with our previous publications using benzo crown resins . When this type of resin is used the cavity size can affect the /m value significantly, especially when using the benzo-12-crown-4 resin . Benzo-15-crown-5 resin with 0.5 mol l zinc chloride was determined to have the largest value (table 4). It was shown that with the same benzo crown resin and feed solution, the /m value was affected by operation temperature where a high temperature had a small value in alignment with eq . Performed the zinc isotope separation by using a strongly acidic exchange resin and obtained a value for /m where the isotope effect occurred during cation exchange between the acidic resin and liquid phase . The present study indicated that the determined /m value was much larger than that of ban et al . Which meant that the present chelating exchange resin might form a more stable binuclear complex with zinc ions and could successfully applied to the zinc isotope separation . Zinc isotope separations were studied by displacement chromatography in malate, citrate, lactate and edta systems . The zinc isotope fractionation was confirmed and the lighter isotope was found to be preferentially located on the resin stationary phase . Separation coefficients were calculated for each tested system where the edta ligand was found to make a more stable coordination bond with zinc ions that resulted in large values . The average /m value for the isotopic pair of zn / zn was determined to be 1.55 10 which was in agreement with that obtained from benzo crown resins and much larger than that determined in strongly acidic cation exchange resins. |
One aspect of the fascination with biology is the contrast between the overwhelming detail of nature and its order . Deus creavit, linnus disposuit, was linnus famous, not so humble summary of the two sides and who cared for which . The friendly and modest country gentleman darwin had little of linnus's self - image, but shared his obsession with the nitty - gritty of flora and fauna, since early childhood . The idea of evolution must have come forth as gratifyingly simple to him and to any biologist immersed in the richness of nature . To a mathematician, it invites further reduction into a more or less axiomatic theory, where everything can be derived from first principles . It is successful albeit (of course!) Criticized for simplistic genetics as well as ecology . A critique more on grounds of principle is that it treats populations as infinite and even as a continuous matter . Recently, mlard, champagnat, lambert and co - authors have published a sequel of seminal articles [24], and others, reformulating classical adaptive dynamics in terms of population - size - dependent birth - and - death processes, then passing to various limits by letting first the carrying capacity grow, so that populations become infinite, then mutational steps shrink to zero . The present paper presents another such oversimplified model, going back to the ideas of, and indeed in a certain sense the simplest possible, still retaining indispensable properties of a population under evolution . In our view, they are as follows . (1)any such population is finite and consists of reproducing individuals. (2)individuals are characterized by their traits. (3)together with population size (of the own species as well as competitors) traits may influence reproduction. (4)but they do not determine it: there is a variation in the reproductive behaviour between individuals of the same kind and, seemingly, in the same circumstances. (5)at reproduction, there is a probability for mutation, resulting in a child with a trait different from its mother. (6)the resulting population survives or not, depending upon chance and fitness . Individuals are characterized by their traits . Together with population size (of the own species as well as competitors) traits may influence reproduction . But they do not determine it: there is a variation in the reproductive behaviour between individuals of the same kind and, seemingly, in the same circumstances . At reproduction, there is a probability for mutation, resulting in a child with a trait different from its mother . Still, passage to limits of infinite populations may help to uncover underlying structure, or exhibit its aspects more clearly . But this is a tool only and it should occur explicitly, so as not to hide difficulties, avoid mistakes and also render investigations into the accuracy of approximations feasible . There is no all - embracing continuity of properties from the finite to the infinite; infinite populations need not die out, even though their finite counterparts necessarily do, if bounded and allowing variation in reproduction between individuals . Usually, in models, furthermore, not only is the carrying capacity of the habitat large (tending to infinity) but also mutation steps small (infinitesimal), and two limits thus involved, the order between them possibly significant . A deterministic description of individual life remains an illusion: there is randomness in life . The simplest stochastic reproduction conceivable assumed here is asexual binary splitting . Following the adaptive dynamics tradition, we disregard mating thus, we assume that each individual either gets two children in the next generation or none . The habitat concerned has a carrying capacity k, and if there is only one population present, of size n, the probability of an individual successfully splitting is taken to be k/(k + n). Given the population size, individuals reproduce independently . If there are several morphs present, the number n is replaced by a linear combination of the various population numbers and coefficients expressing the strength of competition . Again, a gaussian form of these coefficients will be assumed in the last section . The carrying capacity can be different for different species; k can depend upon the trait considered . Then we write k(t), t being a real number, the trait, which can be thought of as abstract, like a reproductivity measure, or in a very concrete manner, like the length of a beak . In the last section, we shall work with a specific gaussian form of dependence of carrying capacity upon trait . At reproduction, mutation may occur with some small probability which we will assume to be neither trait nor population - dependent; with a probability, a newborn with a mother with trait t turns out to be a mutant, then with a random trait normally distributed around t. time structure is stripped to its bare bones: only the successive (non - overlapping!) Generation size are counted, or alternatively everybody is supposed to have the same life - span of one season . Clearly, when compared with the many - faceted phenomenon of evolution, such a mathematical sketch is nothing but a caricature . Still, though reproduction and time structure are the simplest possible, they retain a fundamental affinity to reality . Other properties are more arbitrary, like the form of dependence on the environment or the normal distribution of mutational steps or in the form of certain coefficients . The former has some historical precedence, in the papers cited and earlier, but nothing else to speak for it than its ability to yield a reproductive behaviour changing with the relation of population size to carrying capacity and prevalence of competing species . The assumption of normal distributions is also ad hoc though a central limit style argument from many small effects might have passed through the minds of the first proponents of this distribution for mutational steps . (in other contexts, it has been argued that mutational steps should follow extreme value distributions, since only the most advantageous mutations result in viable children .) But actually, we shall not use more of the normal distribution of mutational steps than the fact that deviations are of the order of the standard deviation, a fact that is much more generally true . And in many regards, this specific model is just a representative, and many of its properties, like those building on second moment properties, large deviation theory, quasi - stationarity and early growth and ultimate extinction, extend to more general structures . In the next two sections, neither the mutation probability nor any mutation step distribution will occur, though in section 3 the fact that we consider two populations, one of which called the resident starts from its carrying capacity, the other called the mutant population starting from one individual, certainly reflects having a mutation probability in mind, which is taken to be small enough for the first population to have grown to its carrying capacity before the mutation occurs . In section 4, these mechanisms will be made explicit . The difference from the series of papers by champagnat, ferrire, mlard and lambert lies in our taking discrete time, non - overlapping generations, i.e. Galton watson - style processes as the simple pure structure for first study . The model population is, thus, a binary, population - size - dependent galton watson branching process . It starts from a positive integer number z0 = z and is then recursively given by the random variable nj is the number of children of individual i in generation n. these are independent and identically distributed, given the population size zn, or indeed the whole past population history, z0, z1,, zn . We refer to the process value zn as population size (at time or generation n). Since reproduction is identically distributed for all individuals in the same generation and the distribution, given zn, is the same for all generations n, we shall often delete the suffices, at least when not referring to several individuals in one context . The trait dependence of the carrying capacity k is suppressed, since we consider only one trait, and no mutations yet . K should be thought of as a large number, and later we shall let it tend to infinity . It is important to grasp this single trait process not only for its own sake but also for the analysis of the complete model with mutation and several traits . Obviously, it behaves like a subcritical branching process whenever the population is greater than k, like a supercritical process for all population sizes smaller than k, and it is critical if the size is precisely k (then necessarily an even integer). Since thus the population has a bounded expectation, it follows that the extinction probability is p(zn 0, as n) = 1 (cf . 108 ff .] Or). Ultimately, it dies out . Under the level therefore, it tends to increase, while this is the case, and it is prone to reach large values (around k) before ultimate extinction . In fact, we shall show that the time to extinction is very large, with an overwhelming probability . The population will settle at a quasi - stationary regime, in the sense that it will fluctuate around the value k for a time period that is exponentially long in k, until it finally dies out . For a 0, write ta for the first time the population reaches, or passes, a, from below or above, depending upon the starting position . For short, let t = t0 be the time of extinction . What is the relation between these two random variables for large a? Indeed, it is only rarely that the process dies out before reaching a level dk, if 0 <d <1 is small or the starting number z large . Let 0 <d <1 . Then for any 1 z dk, in this, and elsewhere, the probability or expectation indexed by z, pz, ez means the probabilities of such a population starting from size z0 = z. no index either indicates z = 1, or else some completely different probability measure . Such assertions are proved by comparison with suitably chosen (not population size dependent) simple galton watson branching processes, about which much is known . In the present case, consider such a binary splitting process with the probability of begetting zero children being d/(d + 1). Call it n. since x/(1 + x) is an increasing function of x, any k <dk yields hence, as long as population size stays below dk, the probability of producing no offspring is smaller than the corresponding probability pertaining to this classical galton watson process . Therefore, clearly the probability that our process becomes extinct by time n, without crossing dk, is smaller than the corresponding probability for the binary galton watson process n. the latter must be smaller than the galton [8, p. 113]) that is the smallest root of the quadratic equation which is simply d. hence, thus, with a positive probability, the population will not die out but reach sizes at the order of the carrying capacity . Sooner or later whatever the starting number z, carrying capacity k and time (generation) n, and ez[t] e. the elementary inequality yields hence, and the upper bounds on the probabilities follow by induction and another elementary inequality, 0 <1 u <e for 0 <u <1 . The second assertion follows by summation: a corresponding lower estimate can be deduced but it is irrelevantly small . Instead, note that we already know that with a positive probability the process will move from any starting point up to the vicinity of the carrying capacity . By large deviation theory, it will stay there a very long time until by a random perturbation it leaves the area (if it were deterministic, it would get stuck) and by chance becomes extinct . This is why the upper exponential bound derived indeed gives a survival time of the right order; persistence time is exponential in the carrying capacity . Introduce the density process xn = zn / k, and note that the offspring distributions are in fact functions of the density, we have that where the nj are the offspring numbers in the nth generation, explicitly indexed, and are indeed independent and distributed like twice a bernoulli random variable with the parameter p(xn) = 1/(1 + xn). Writing m(xn) = 2p(xn) for the offspring mean when the density is xn = zn / k, and centring the variables of the sum in the usual central limit fashion, we obtain with and we can write this clearly, e[n + 1] = 0 and hence, a central limit theorem argument shows that the noise term in equation (2) is of order 1/k . It follows that the process xn, which does of course depend upon k, converges (in various senses), as k, to the deterministic sequence {xn}, defined by an initial value x0 and the recurrence xn + 1 = f(xn). This is a sort of law of large numbers; a corresponding central limit theorem is available in . However, this convergence also pinpoints the difference between stochastic and deterministic systems . Indeed, if x0 = 0, then for all n, xn = 0 since 0 is a fixed point of f. in its awkward way, this is how the deterministic system tells us that extinction is certain . For other outcomes, we need z0/k x0> 0, as k . In other words, the population should become comparable to k in order to get attracted to the stable fixed point 1 . However, by proposition 1, we know that this will occur with a high probability, and after that xn will be approximated, for large k, by xn with a positive starting value . The process will be near 1 for late times n and this means that the original population size process zn will be near k. the deterministic dynamics being globally attractive, zn will aim at moving towards k; only the event of extinction can prevent this . Now, due to the random nature of the density process, exhibiting small but persistent perturbations from xn, ultimately there will be an exit from the levels [d k, d'k], 0 <d <1 <d', due to large deviations of random terms . Wentzell theory and was developed in, but the present special setting, the problem of exit from a domain, was solved in . Under some assumptions, it was shown that if the deterministic system has a stable fixed point, then the perturbed system will stay in the domain of attraction of this point for an exponentially long time, e in the special case of our model, where summands are (twice) binomial random variables, there is a direct proof, using a large deviation result due to janson, stating c explicitly . Since, in the present context, our interest in this process is rather as a representative of a broad class of population models, proof and results specific for that model will be published elsewhere . If the process starts from a small number z of individuals, then the time it takes to reach the level dk (if it does not die out) is at least of an order approximated by the binary galton watson process with mean 2/(1 + d) and at most of an order corresponding to such a process with mean reproduction 2k/(k + 1), i.e. Of order log dk, since for any galton watson process n we will have five population developments with k = 50 . By exponential growth, the conclusion will follow that the time to reach d k is of the order log d k; for details cf . . Close to k, our process is near critical and approach will be slower; it is well known that a non - extinct critical branching process tends to grow linearly, and our process being on the supercritical side will tend to reach the carrying capacity quicker than in linear time (1 d)k . Actually, it can be proved that linear time is correct . In conclusion, if the population does not die out before reaching high levels, the time until extinction is of the order e consider the distribution of xn, given that xn> 0, for fixed k. as n, this converges to a proper distribution function called the quasi - stationary distribution . When in this setting k, all probability concentrates at the point 1 . This was shown in and is also contained in the more general setting of . Indeed, the existence of quasi - stationary distributions is a consequence of the krein simulations exhibit first the quick growth and ensuing quasi - stabilization of five populations starting from one ancestor (figure 1) and then the pseudo - stable distribution (figure 2). After some, probably a long, time, the population will experience its first mutation giving rise to a new population . By then, the original resident population will be in its quasi - stationary stage; mutation probabilities are thus taken to be small . The new, mutant population has just one member, its ancestor . The basis of adaptive dynamics can then be said to be furnished by the branching process fact that the new population either dies out or else embarks on exponential growth, in which case the old resident dies out, or the two populations will coexist for a time span that is exponential in the carrying capacity . The process starts from a pair (z0, z0) of positive integers, the first component denoting the size of the resident and the second that of the mutant population, when the mutation appears . Thus, z0 is in the vicinity of the carrying capacity and z0 = 1 . Transitions from generation n to n + 1 are described by where nk, k = 1, 2,, are independent given the preceding generation zn and satisfy and now, this process has two competing types, but it is not genuinely multi - type, in the sense that none of them can produce children with the other trait . The interaction coefficient is supposed to be positive but less than one, and the same in both directions . This means that interaction is taken as symmetric, an assumption that is not at all necessary . Indeed, taking them it may be noted that though the specific form of dependence is certainly ad hoc, it has some historical precedence, going back at least to . We assume that the resident population starts exactly at its carrying capacity, which is a1k . Then the mean reproduction of the mutant in a generation with z mutants present will be it follows that the mutant is subcritical throughout, if a2 <a1, and indeed dominated by a subcritical binary galton watson process with the splitting probability a2/(a2 + a1). By, the probability that the maximum m of the latter reaches j is of the order hence, for large carrying capacities, the mutant population will die out directly, never coming close to k with overwhelming probability . Histogram of a population size for the last 500 of 10,000 generations with k = 50 . If instead and k large enough, the mutant population will instead start supercritically, and either die out as above or else grow at a geometric rate for some time, much as in the preceding section . It is illustrated in the following figure, which shows five runs of a population system with = 0.7, a1k = 40 and a2k = 70 . In three cases the resident prevailed, the invader dying out very quickly, and in two runs, the invader took over (figure 3). We proceed to have a look at the qualitative behaviour of the process and the domains of super- and subcriticality (figure 4). They will be given in terms of the (x1 = z1/k, x2 = z2/k)-plane in which the process has a supercritical, critical and subcritical reproduction, respectively . Solving the inequalities for the mean offspring number greater than one yields that these regions are five competitive population evolutions, k = 100, = 0.7, a1 = 0.4 and a2 = 0.7 . In two of them (red and orange lines), the invader takes over . Note that the boundary is where one of the populations is critical; it consists of two segments of straight lines . The point at which both processes are critical is since 0 <<1, there are three possibilities for this point the remaining case x1 <0, x2 <0 can be ruled out, since it implies both that> a1/a2 and that> a2/a1, and hence> 1 . As an example, we give the following picture for x1 <0, x2 <0 made with and where we take k as the scale unit of the graph . The domain a above the two lines corresponds to subcriticality of both populations, the left intermediate domain b is where the mutant is subcritical and the resident supercritical and the right intermediate domain c corresponds to supercriticality of {zn} and subcriticality of {zn}, whereas the domain below the two lines corresponds to their being supercritical . This is precisely the situation where coexistence may be realized . Like in the single trait setup, the process {(zn, zn)} scaled by k, the density process, can be approximated by a two - dimensional dynamical system for large values of k. the latter has a fixed point at (x1, x2) and is attracted to it . Combine this with the fact that the density process is non - negative to see that the co - existence case is when the fixed point lies in the positive quadrant x1> 0, x2> 0 and corresponds to the condition like in the single trait case, the two - trait process must die out . But the process being supercritical for small population sizes, both populations will settle to a quasi - stationary regime, in the sense that their sizes will fluctuate around the values k x1 and k x2 for an exponentially long time (in k), provided the new trait gets established, in the sense that its size becomes comparable to k. thus, the probability of this happening is needed . Estimates from below and from above the probability of more or less direct extinction are established in the following proposition, pointing at a1/a2 as a rough indicator . We omit the suffixing starting point (which is (a1 k, 1)). The probability of the mutant dying out while the resident remains above the level dk, 0 <d <a1, is at least similarly, the probability of the mutant population dying out before it reaches the level b k, b <a2, while the resident remains below the level u k, u> a1, is in this b, u can be so chosen that u + b <a2 . Proof on the set {t <tu k} {t <tb k} {n <t}, zn <u k and zn <b k. hence, the probability of the new trait to reproduce successfully is provided u + b <a2, the splitting probability is larger than one - half . Selecting u in the range a1 <u <a2/ allows us to choose 0 <b <a2 u <1 . This leads to the upper bound . Bounding the splitting probability from above on the set {t <td k} yields and the lower bound for the extinction probability of the mutant . We proceed to bounding the probability of the mutant dying out, while the resident remains close to the carrying capacity . For z> d k, the mutant survival probability satisfies we note that for large k, we will have that say . For i 1 and j d k, since the expression in the middle decreases with i. hence, thus, for any k . A similar argument can be used to find an exponential bound for mutant survival probabilities, given that the resident does not surpass high levels . Like the single trait process, considered in section 2, the present process behaves as a deterministic dynamical system perturbed by small noise, which is, however, not to be forgotten . Write the density process xn = zn / k, xn = zn / k and note that the offspring distributions, as given in the beginning of this section, are again functions of the density . As before, denote the offspring mean by m(x) when the density is x, m = (m1, m2), and write the deterministic dynamics is given by and it is also easy to see that the noise term when the system is at x is of order 1/k . Hence, we can write equations (9) and (10) as the function f in equation (11) that generates this system has two fixed points 0 and this is exactly the point at which both reproductions are critical . The determinant of partial derivatives shows that 0 is repelling, since = 4 there . At the point x, the determinant of partial derivatives is which allows deriving conditions for stability <1 of that fixed point in terms of the parameters, a1, a2 . Indeed, the deterministic system has four equilibrium points (0, 0), (a1, 0), (0, a2) and (x1, x2). As pointed out the fixed point corresponding to (x1, x2) lies in the positive quadrant only if is less than the maximum of a2/a1 and a1/a2 . In that case if> a1, the point (a1, 0) is stable, so the second morph goes extinct . If> a1/a2, (0, a2) is stable, and the former resident goes extinct having investigated one lone species and the joint behaviour of a resident and a mutant, we return to the well - established special model sketched in section 1, determined by gaussian functions . It is controlled by five parameters: k,, 1, 2 and 3, with the following interpretation . That 1 <<1, and a morph with trait t has the carrying capacity explaining the role of 1, in what sense it describes how carrying capacity varies for different traits, with the maximum k(0) = k for the trait value t = 0 . In a polymorphic population, the competition between two morphs t1 and t2 is quantified by the coefficient depending only on the difference |t1 t2| and reaching its maximum value (t, t) = 1 for individuals with the same trait value . Mutation in a monomorphic population occurs at a rate of the order mutations per individual and time unit . From the preceding analysis, the mutation rate should be taken to satisfy e 1/k, the constant c defined in equation (3), so as to avoid repeated mutations during the time while one mutant establishes itself, while guaranteeing mutations during the residence . In adaptive dynamics, this would be formulated as conditions on mutations not occurring in ecological time spans, but (almost) certainly in an evolutionary time scale . Given a mutation, the new trait value t2 then has the normal conditional density function implying symmetry in the step distribution and that larger changes in trait value are less probable . The process starts from a finite number of individuals of a finite number of different traits . Traits in the various generations are denoted by vectors (t1, t2,, tp), where p can vary from generation to generation . Denote the number of individuals with trait t in the nth generation by zn(t). Given the vector (zn(t1), zn(t2),, zn(tp)), individuals of the nth generation reproduce independently, splitting into two with the probability otherwise begetting no child . Each child is a mutant with probability, the mutant's trait being normally distributed around its mother's, and with the variance . This is an informal (but precise!) Description of a discrete - time stochastic process, whose states are counting measures on . If it starts from one individual at say t1, it will develop according to section 2 (with k(t1) replacing k), until the first mutation occurs . Then we find ourselves in the circumstances of section 3 with as defined by equation (15), a1 = exp(t1/(21)), and a2 = exp(t2/(21)), k = k(0), according to equation (14). After some algebra from the inequality a2> a1 (equation (4)), we arrive at a simple condition for the mutants possibly being able to establish themselves: if t2 <t1, then also t2 <t1 . If t1> 0, the second condition is empty, whereas if t1 <0, t2 must be at a considerable distance left of t1, which is not feasible due to the smallness of . We conclude that residents with traits on the right half - axis can only establish mutants to the left of them, and vice versa . Indeed, the situation is summarized by the condition being necessary for establishment, whatever be the position of t1, and equivalent to t2/t1 (, 1) (1/,). This means that in the monomorphic phase, the trait value will move towards zero until it reaches a -neighbourhood of zero . Then the trait value may jump in both directions and moreover the first evolutionary branching becomes plausible . Indeed, the reverse invasion condition is equivalent to t2/t1 (,) (1,). When both conditions are fulfiled, the pair of trait values (t1, t2) may coexist . In a slightly more precise wording, we start the process from a monomorphic population, say with trait t0 = t> 0 . The population will either die out or (quasi-)establish itself at its carrying capacity . In the latter case, sooner or later at a random time v1, a successful mutant will replace it, and the trait will have moved to tv1, where it will stay until the next successful mutation v2, until finally it would have come so close to zero, so as to render branching possible, the trait being of the order of . Then {tn} will take the value of two traits . Thus, we obtain a stochastic process with values in n, about which many interesting questions can be posed . What is the time to the first successful mutation? When will the first branching occur, or rather, what is the distribution of the waiting time until a monomorphic population turns dimorphic, the distribution to the next change in number of morphs, etc . How can the stochastic movement {tn} in trait space be described? And how the degree of polymorphism (the development of the number of coexisting species)? What limiting behaviours can be discerned, when k and 0? For birth - and - death processes, many of these matters have, as pointed out, been discussed by mlard, champagnat et al . As one of the referees pointed out, the basic method used here, domination by not - size - dependent branching processes during time periods when populations sizes satisfy certain inequalities, invites usage also in more realistic, age - dependent or general branching processes . Vatutin was supported by the ras programme mathematical control theory and intas 03 - 51 - 5018. |
There appears to have been consensus in the past decades in classifying systemic sclerosis (ssc) according to extension of skin involvement as limited and diffuse, using the elbows and knees as limits to distinguish between them . However, although this has been used to dissect two more or less distinct clinical subsets, there are patients who do not fit this classification and several others have been proposed [1, 2]. The growing demonstration that autoantibodies specific for ssc such as anticentromere, anti - scl-70 (anti - topoisomerase 1), and more recently a variety of antinucleolar antibodies, particularly anti - rna polymerase 3, correlate with these subsets and/or visceral manifestations has led to them being used to predict clinical subsets in early disease and also raise awareness for the possibility of certain organ involvement (anti - scl-70 and interstitial lung disease [3, 4], anticentromere associated with digital ulcers, debatably pulmonary hypertension, and anti - rna polymerase 3 with renal crisis). Decades ago, barnett classified ssc as type 1 (only sclerodactyly), type 2 (acrosclerosis - distal but may reach up to elbows and/or knees plus face), and type 3 (diffuse skin involvement) (figure 1). Patients with type 2 had an intermediate degree of both skin and organ involvement compared to type 1 (less) and type 3 (more) [810]. This classification by barnett was extensively discussed in an editorial by masi many years later . The division into three categories according to extension of skin involvement was not agreed to by others, who could not find real differences between what we could call types 1 and 2 as determined by barnett [1, 2]. A similar classification but this time with 4 categories, proposed by giordano et al . Simultaneously, as reasonable stress was laid on early disease detection, the extent of cutaneous involvement was perhaps not considered so relevant, particularly as opposed to the autoantibodies as subset identifiers . However, truth is that many patients present with evolving disease, and all of ssc specific antibodies are not widely available in many parts of the world, the best example being anti - rna polymerase . Many years ago but with a small number of patients, we noted that the limited subgroup could be, indeed, separated clinically as barnett had suggested according to skin involvement into patients with only fingers, which we proposed to call crest, and those with skin distal to elbows and knees but proximal to mcp or mtp joints, which we proposed to call creat (a instead of s for acrosclerosis). In that report, crest patients had more anticentromere antibodies than those with creat and the presence of anti - scl-70 occurred more frequently in the patients with creat than those with crest . Small numbers did not allow for detection of clinical differences . Over the past decades, many of the larger series [416] and particularly the eustar database, one of the largest registries, have not differentiated subsets within the limited form (scleroderma sine scleroderma excluded). Very recently however, in a very large series from a single center followed for years, the hopkins group emphasized just this, showing differences between the two limited groups and stressing the higher prevalence of lung disease and anti - scl-70 antibodies in the type 2 (barnett) or intermediate form when compared with type 1, a behavior more similar to the diffuse form, and similar to what we had supported and barnett proposed years ago . Their conclusion was that dividing into limited and diffuse as we do now left out an intermediate form with different clinical and serological characteristics . Since over the years it was our feeling that this subsetting was clinically useful, we always registered extension of skin involvement in our patients, particularly identifying those with intermediate form within the lssc . We therefore decided to examine the clinical and serologic characteristics of our patients with limited disease seen over the last decade to see if we could find differences within them according to the degree of skin involvement . Rheumatology section database, patients with icd 9 code 710.1 (scleroderma) in the inpatient hospital database, patients with the item: scleroderma, crest, or other synonyms as registered in the hospital's electronic clinical history; and laboratory database: patients with positive anticentromere, antinucleolar, or anti - scl-70 results . All medical records so identified were then manually reviewed to confirm diagnosis and obtain demographic data such as date of onset, clinical characteristics, and serologic profile . Only cases fulfilling acr 1980 criteria were included and were classified as diffuse or limited according to leroy's criteria . This difference in distribution was established considering the involvement of skin at its maximum extension at any point in the disease course . Within the limited subset, they were separated into sclerodactyly (only fingers) and acrosclerosis (fingers and up to elbows and/or knees, face) (barnett's types 1 and 2). Ssc clinical manifestations were considered to be present if predefined criteria were met during the course of the illness . Organ involvement definitions were the following: (1) upper gastrointestinal tract (one or more of the following: manometry with esophageal dysmotility, esophagram with gastroesophagic reflux or peristaltic alterations, or upper endoscopy with esophagitis, (2) pulmonary hypertension (ph): echocardiogram with estimated pulmonary systolic artery pressure equal to or greater than 40 mmhg or right heart catheterization with mean pulmonary artery pressure at rest over 25 mmhg, (3) interstitial lung disease (ild): pulmonary interstitial disease observed in high resolution computerized tomography (hrct) or pulmonary function tests with vital forced capacity (vfc) lower than 70% of the expected and/or carbon monoxide lung diffusion (dlco) test under 80% of the expected, (4) echocardiographic alterations (aside from ph): left or right ventricular diastolic dysfunction in absence of arterial hypertension or pulmonary hypertension, respectively, or pericardial effusion, (5) digital ulcers: active digital ulcers or pitting scars confirmed by a physician, (6) renal involvement: history of scleroderma renal crisis (abrupt onset of accelerated arterial hypertension and/or rapidly progressive renal failure). Laboratory detection methods were indirect immunofluorescence on hep-2 cells (antinuclear antibodies, antinucleolar, and anticentromere). Chi - square analysis was used to determine significant differences between sets of categorical data and fisher's exact test when appropriate . Two hundred and thirty four ssc patients (216 females) fulfilled the established criteria . Female / male ratio was 12: 1; 24% had diffuse ssc and 76% limited (64% sclerodactyly and 12% acrosclerosis). Ten - year survival rate was 80% for limited and 70% for diffuse variants, respectively (hr: 0.88, 95% ci: 0.71.1). Anti - scl-70 was present in 16%, anticentromere in 53%, and nucleolar ana in 7% of overall patients . Several characteristics in the acrosclerosis (type 2) group were more similar to the diffuse patients than those with type 1 (sclerodactyly). In patients with acrosclerosis, duration of raynaud's was shorter, and they had significantly more anti - scl-70 and less anticentromere antibodies than those with type 1 . In particular, interstitial lung disease (ild) was significantly more prevalent in type 2 group and similar to type 3 . Comparisons between patients with acrosclerosis and diffuse disease are presented in table 2, showing no differences in clinical manifestations . As described elsewhere, autoantibodies were associated with visceral involvement and also with clinical subset . In univariate analysis, anticentromere antibodies were associated with pulmonary hypertension, or of 8.25 (ci 1.935.7), and inversely correlated with ild (or 0.18, ci 0.110.29). They were also associated with limited disease, or 34.4 (ci 10.2116.6). When performing multivariate analysis adjusting by disease subset, association between anticentromere and pulmonary hypertension was lost . All of the patients with ph had lssc (11 with sclerodactyly and 1 with acrosclerosis) except for one patient with diffuse disease with anticentromere antibodies . In summary, in multivariate analysis, both anti - scl-70 (or 5.2, ci 1.517.6, p = 0.08) and diffuse disease (or 4.1, ci 1.213.5, p = 0.021) were associated with ild . These findings are very similar to those recently described by cottrell et al . Within the limited patients, dissecting between what could be barnett's type 1 and 2 subsets . Our results support the initial description by barnett et al . That there is an intermediate form of ssc between the some of these patients, albeit with limited scleroderma because skin involvement does not exceed elbows and/or knees, have a clinical behavior which can be described as intermediate between the strictly limited to fingers patients and those with diffuse disease . In particular, a sort of gradient from milder to more severe disease was confirmed in our patients, as suggested by barnett many years ago . This was also shown by the hopkins group in a much larger number of patients . Indeed, in type 2 as defined by barnett, serology may be more similar to the diffuse type and different from type 1 . The gradient is also reflected by the accompanying antibodies which further define visceral involvement such as pulmonary hypertension and interstitial lung disease . These results appear to confirm that extension of skin involvement within limited ssc may identify two different subsets with clinical and serologic characteristics . Autoantibodies, in many cases present years prior to diagnosis and established skin disease, play an essential role here as predictors of clinical subsets and visceral involvement . However, some of these are not widely available . Furthermore, many patients present with established disease, although early, and in these a clinical approach contemplating extent of skin involvement coupled with the classic autoantibodies may indeed be useful and support a division within the limited form which may have useful clinical implications . A retrospective review of data in the large registries trying to document skin extension may or may not confirm this . The problem may arise in the fact that since the extension of skin involvement within limited disease was not considered important, this may not have been adequately registered . Our smaller series completely agrees with the data shown by the hopkins group with a very large number of patients . We believe identifying these differences within limited ssc is useful and resuscitating the intermediate form or barnett type 2 within limited ssc may contribute to a better clinical assessment of systemic sclerosis. |
Factitious disorder (fd; pathomimia), which has been described as both disease and deception, presents to the clinician as one of the most challenging conditions in medical experience . Sick role seeking in contrast to external incentives acting as the motivating factor in the latter . Categorized as an axis i dsm iv condition, it is diagnosed when there is an intentional production or feigning of physical or psychological signs or symptoms where the incentive is to assume the sick role and external incentives for the behavior are absent . In dsm iv, four subtypes of fd are mentioned fd with predominantly psychological signs and symptoms, fd with primarily physical signs and symptoms, fd with combined physical and psychological signs and symptoms, and fd not otherwise specified . In the expanded international statistical classification of diseases and related health problems, revision 10 (icd-10), fd (f68.1) is defined as repeated and consistent feigning of symptoms with obscure motivation for the behavior and is best interpreted as a disorder of illness behavior and the sick role . Another related condition is fd by proxy, which was described initially by meadow as the deliberate production or feigning of physical or psychological symptoms or signs in another person who is under that individual's care, and is commonly perpetrated by mothers against infants or young children . Interestingly, there has also been a case report on concurrent presence of fd and fd by proxy . Munchausen by internet, where a person may post false stories of his illness on internet forums to gain attention . Patients with fd have an unusually long, rich, and changing historical and clinical profile . So also, fd has high chances of occurrence of medico - legal issues . Fd appears to be relatively common in specialty medical settings rather than psychiatric setting yet, it often goes unrecognized and undiagnosed . Prevalence of fd varies depending on the type of the patient population studied, study setting, and even clinician's index of suspicion . A community study from italy reported the prevalence to be 0.1%, whereas it was 9.3% in referrals to the national institute for allergy and infectious disease with fever of unknown origin (fuo) lasting over 1 year . Prevalence of fd in neurology inpatients was reported to be 0.3% in a german study . Prevalence in psychiatry inpatients also varies from 0.5 to 8% . Among psychiatry referrals in a general hospital, one study found 10 patients to be diagnosed with fd among 1288 referrals, making the prevalence 0.78% [table 1]. There are very few reports of fd from developing countries, such as the study regarding fuo in argentina that reported four cases of fd amongst 113 cases of fuo and the case reports from other countries . Prevalence of factitious disorder after a thorough search in medline, pubmed, embase, medknow databases, we came across a few case reports from india of varied presentations like factitious schizophrenia, multiple physical and sexual complaints, and oliguria, whereas detailed case series and long - term studies are yet to be reported . Fd is generally seen more commonly among females, especially those who are associated with healthcare field . A retrospective study of 93 patients of fd at the mayo clinic showed that 42% patients were female health workers . Although it is clear that people with fd have a higher rate of comorbid psychiatric disorders, feigning of symptoms itself should be an evidence for psychological distress: while an act of malingering may be considered adaptive, by definition, a diagnosis of a factitious disorder always implies psychopathology (apa, 1980: 285). Dsm axis i disorders depression and anxiety disorders have been reported, but the data are scanty . Practical difficulties in the diagnosis of psychiatric disorders in people with fd include factors such as varied presentations in different medical specialities, lesser index of suspicion in specialists, presentation in emergency settings where one cannot afford to wait for being investigated extensively to avoid untoward happenings, and lack of thorough knowledge about the symptoms and disease in one who is presenting . This study from a neuropsychiatric center aims at reviewing the database for the clinical details of patients with diagnosis of fd from the year 2001 to 2010 . It aims to provide information which would be useful in increasing the awareness and understanding about fd at a neuropsychiatric center in a developing country . Categorized as an axis i dsm iv condition, it is diagnosed when there is an intentional production or feigning of physical or psychological signs or symptoms where the incentive is to assume the sick role and external incentives for the behavior are absent . In dsm iv, four subtypes of fd are mentioned fd with predominantly psychological signs and symptoms, fd with primarily physical signs and symptoms, fd with combined physical and psychological signs and symptoms, and fd not otherwise specified . In the expanded international statistical classification of diseases and related health problems, revision 10 (icd-10), fd (f68.1) is defined as repeated and consistent feigning of symptoms with obscure motivation for the behavior and is best interpreted as a disorder of illness behavior and the sick role . Another related condition is fd by proxy, which was described initially by meadow as the deliberate production or feigning of physical or psychological symptoms or signs in another person who is under that individual's care, and is commonly perpetrated by mothers against infants or young children . Interestingly, there has also been a case report on concurrent presence of fd and fd by proxy . Munchausen by internet, where a person may post false stories of his illness on internet forums to gain attention . Patients with fd have an unusually long, rich, and changing historical and clinical profile . So also, fd has high chances of occurrence of medico - legal issues . Fd appears to be relatively common in specialty medical settings rather than psychiatric setting yet, it often goes unrecognized and undiagnosed . Prevalence of fd varies depending on the type of the patient population studied, study setting, and even clinician's index of suspicion . A community study from italy reported the prevalence to be 0.1%, whereas it was 9.3% in referrals to the national institute for allergy and infectious disease with fever of unknown origin (fuo) lasting over 1 year . Prevalence of fd in neurology inpatients was reported to be 0.3% in a german study . Prevalence in psychiatry inpatients also varies from 0.5 to 8% . Among psychiatry referrals in a general hospital, one study found 10 patients to be diagnosed with fd among 1288 referrals, making the prevalence 0.78% [table 1]. There are very few reports of fd from developing countries, such as the study regarding fuo in argentina that reported four cases of fd amongst 113 cases of fuo and the case reports from other countries . Prevalence of factitious disorder after a thorough search in medline, pubmed, embase, medknow databases, we came across a few case reports from india of varied presentations like factitious schizophrenia, multiple physical and sexual complaints, and oliguria, whereas detailed case series and long - term studies are yet to be reported . Fd is generally seen more commonly among females, especially those who are associated with healthcare field . A retrospective study of 93 patients of fd at the mayo clinic showed that 42% patients were female health workers . Although it is clear that people with fd have a higher rate of comorbid psychiatric disorders, feigning of symptoms itself should be an evidence for psychological distress: while an act of malingering may be considered adaptive, by definition, a diagnosis of a factitious disorder always implies psychopathology (apa, 1980: 285). Dsm axis i disorders depression and anxiety disorders have been reported, but the data are scanty . Practical difficulties in the diagnosis of psychiatric disorders in people with fd include factors such as varied presentations in different medical specialities, lesser index of suspicion in specialists, presentation in emergency settings where one cannot afford to wait for being investigated extensively to avoid untoward happenings, and lack of thorough knowledge about the symptoms and disease in one who is presenting . This study from a neuropsychiatric center aims at reviewing the database for the clinical details of patients with diagnosis of fd from the year 2001 to 2010 . It aims to provide information which would be useful in increasing the awareness and understanding about fd at a neuropsychiatric center in a developing country . This study describes the nature of psychiatric diagnoses and treatment in patients who were identified to have fd at a neuropsychiatric center in southern india during the 10-year period between 2001 and 2010 . The national institute of mental health and neurosciences (nimhans), bangalore, india is a multidisciplinary institute for patient care and academic pursuit in mental health and neurosciences . It has a daily psychiatry outpatient turnover of more than 400 patients . At nimhans, an initial screening of the patients postgraduate trainees from the disciplines of psychiatry, psychiatric social work, and psychology do the detailed evaluation and discuss with a consultant psychiatrist . A diagnosis is made if the condition of the patient fulfills the criteria as per icd-10 . The details are entered into computerized database after appropriate coding of each case record . Using this computer database, we identified all individuals with fd between the years 2001 and 2010 . The study was a retrospective chart - based review and there were no individual patient identifiers involved in the analysis and reporting . During the above - mentioned period, 81,176 (52,364 men and 28,812 women) patients were assessed . Prevalence of diagnosed fd is, therefore, 0.985 per 10,000 patients in this sample . Of all these patients, one had history of chronic depression and two had history suggestive of sub - syndromal depressive symptoms . Personality problems were diagnosed in three patients, of whom two had anxious avoidant personality traits and another patient had histrionic personality disorder . Psychosocial issues like interpersonal problems with in - laws, over - involved parents, and self - medication were present in three patients . Also, one patient had history of dermatitis artefacta and another had history of henoch schonlein purpura . The socio - demographic and clinical details of the cases are presented in table 2 . Only eight individuals had a diagnosis after screening over 80,000 cases seen in the center over a 10-year period . Prevalence of diagnosed fd is, therefore, 0.985 per 10,000 patients in this sample, which is on lower side when compared to 0.5 - 8% reported in other studies . Judging by the projected prevalence of fd in the population and the higher prevalence of mental health problems, perhaps this is likely to be the tip of the iceberg . It is possible that people who attracted the diagnoses of fd are the individuals in whom the presentation was typical and severe . Four of the patients presented with anxiety symptoms, suggesting the need to observe for anxiety symptoms in suspected cases of fd . Perhaps, persons with physical symptoms as fd present to medical or surgical settings, whereas those with psychological, emotional, and behavioral factitious symptoms seek psychiatric hospitals . Thus, it is important for the psychiatrists to take a detailed history of previous admissions and treatment, along with investigation reports while assessing individuals with fd . The second issue is authenticity of the reports as the patients can change the name and claim the report to be theirs . Hence, one has to be careful before making any diagnosis . In this patient subtype, there is, however, a high use of psychotropic medications and this reflects a symptom - focused approach . Individuals in this sample received counselling with a psycho - educational focus that included information on the nature of fd and its relation to the problems that they had presented with . Most of the patients did not turn up for follow - up after discharge, whereas one patient absconded when doctors tried to confront the patient with the diagnosis and management plan . However, as no clear structured methods are available to diagnose the fd and no clear guidelines are available to confront, precautionary methods need to be taken to avoid untoward outcomes like absconding and denial for follow - up . Perhaps, the improvement in the awareness of the nature of the problem among the patients as well as the relatives may lead to better coping strategies and minimize the reliance on the medications . There is a need for improving the awareness of fd among mental health professionals as well as general practitioners, as the disorder can be very challenging to the health care professionals . While the assessment and management of fd is integrated in the practice of professionals who specialize in mental health, this is not the case for general practitioners . There is a need to build a multidisciplinary approach in the management of the disorder, as well as for improving the ongoing support with self - support groups, supported employment and carer support . However, patients were assessed by a psychiatric trainee and a consultant psychiatrist before the diagnosis was made . Information gathered using a semi - structured interview was recorded in the case notes and diagnoses were made according to the icd-10 criteria . It can be estimated using prevalence figures available from other countries that india has about 1.3 million people with fd . However, majority of people with this condition unfortunately remain undiagnosed and may be subjected to extensive medical investigations . Although there are some case reports on fd, there is still a paucity of research . This is a retrospective study based on screening of all adults seen in the outpatient clinic of a tertiary institution over a 10-year period . Only eight individuals have been diagnosed as having fd in this time - frame, and a review of their clinical features and management indicates the use of psychotropic medications based approach for comorbidity and symptomatic treatment . The findings from this study point to the need for further research in this area. |
Palliative sedation is considered as one of the last resorts to relieve the refractory symptoms among dying cancer patients . The prevalence of refractory symptoms in advanced cancer is high (50 - 84%) with the number of individual refractory symptoms ranging from 1 to 27 . Although majority of the refractory symptoms can be controlled, some may remain refractory and uncontrolled till the end and may remain unrelieved despite administering all possible treatments that are available . Palliative sedation is found to be one of the few options to relieve these intractable sufferings at the end of life . The first ever reported study, on palliative sedation at home settings published in 1990, found that more than 50% of patients die with uncontrolled physical symptoms that can be controlled only by means of sedation when other means of treatments fail to relieve the suffering . Is it ethical to make the patient sleep and be unaware of one's surroundings at the time of death? Is palliative sedation a modified form of euthanasia? In addition to these, there has always been a concern whether palliative sedation shortens the life span of advanced cancer patients . Although some studies report a shortening of life span following palliative sedation, others show evidence to the contrary . The variation in results appears to be related to the sample studied, method of palliative sedation used as well as the way in which survival times have been calculated . This systematic review intends to study the available evidence regarding the effect of palliative sedation on survival time among adult terminally ill cancer patients and answers to the question: does palliative sedation shorten survival time? A systematic literature search was done in the following databases: medline, embase, psycinfo, the cochrane central register of controlled trials (central), cinahl, and scopus to identify papers that investigated the effect of survival time in terminally ill cancer patients receiving palliative sedation . The publications were restricted to 1980 onwards and to papers published in the english language only . The following key words were used in combinations: conscious sedation, palliative sedation, terminal sedation, continuous deep sedation, carcinoma, neoplasm, life span, survival, end of life care, palliative care, terminal care, and refractory symptoms . In addition, a thorough hand search of the references of relevant papers was done . The authors of reputed articles on palliative sedation in different countries were contacted and requested to share their research . Letters to editor, case studies, case series, reviews, and descriptive articles were excluded it was quite evident from earlier search that there were no randomized controlled trials (rct) available on this topic . Therefore, it was decided to include two types of studies: prospective trials with adequate control / comparative group which studied mean survival time (mst) as an outcome of palliative sedation.retrospective studies with comparative group and mst as an outcome . Prospective trials with adequate control / comparative group which studied mean survival time (mst) as an outcome of palliative sedation . Days or hours from the start of palliative sedation to the time of death (or)the time between the last admission and time of death . Days or hours from the start of palliative sedation to the time of death (or) the time between the last admission and time of death . We decided to use the second definition time between the last admission and time of death) in this review because the first definition would not allow us to use a comparative group (comparative group is a group which was comparable to the index group but did not receive palliative sedation). Data were extracted using a specifically designated data collection form and the following were recorded: first author, year of publication, sample size, type of study (prospective and retrospective), study setting (hospice, hospital, and home care), number of patients sedated, indications for sedation, drugs used for sedation with dosage, mode of sedation (intermittent / continuous and mild / deep), mean and/or median length of sedative use (days / hours), and mean and/or median of overall survival (days / hours). Two researchers independently screened the abstracts of all the studies that were identified by the electronic database searches and hand search . The inclusion criteria included: adult cancer patients with one or more physical refractory symptoms, palliative sedation given with any sedative, dose, or frequency, presence of a comparative group, andmst measured in hours or days from the start of last admission until death . Adult cancer patients with one or more physical refractory symptoms, palliative sedation given with any sedative, dose, or frequency, presence of a comparative group, and mst measured in hours or days from the start of last admission until death . Exclusion criteria included: studies in which more than 50% of study population had a non - malignant condition and where mst was not available for the non - sedated group . Studies which met the inclusion criteria were assessed for their methodological robustness independently by both researchers according to the criteria developed by hawker's et al . As this systematic review included both prospective and retrospective studies, hawker's criteria were found most suitable to assess the quality of the included studies . Though the first publication of hawker's criteria had nine items, subsequent publication included ten items, where item six was split into two (ethics and bias). These criteria assess each part of the study as good, fair, poor, and very poor based on the clarity and relevance of data presented . Each item is scored on a four - point scale (one being very poor and four being good). Descriptive data were used to measure the mst in days which was the primary outcome of this review . Because of the divergent study design and marked variability among the nature of participants, interventions, and outcomes of the included studies, it was not possible to combine the data and perform meta - analysis . A systematic literature search was done in the following databases: medline, embase, psycinfo, the cochrane central register of controlled trials (central), cinahl, and scopus to identify papers that investigated the effect of survival time in terminally ill cancer patients receiving palliative sedation . The publications were restricted to 1980 onwards and to papers published in the english language only . The following key words were used in combinations: conscious sedation, palliative sedation, terminal sedation, continuous deep sedation, carcinoma, neoplasm, life span, survival, end of life care, palliative care, terminal care, and refractory symptoms . In addition, a thorough hand search of the references of relevant papers was done . The authors of reputed articles on palliative sedation in different countries were contacted and requested to share their research . Letters to editor, case studies, case series, reviews, and descriptive articles were excluded it was quite evident from earlier search that there were no randomized controlled trials (rct) available on this topic . Therefore, it was decided to include two types of studies: prospective trials with adequate control / comparative group which studied mean survival time (mst) as an outcome of palliative sedation.retrospective studies with comparative group and mst as an outcome . Prospective trials with adequate control / comparative group which studied mean survival time (mst) as an outcome of palliative sedation . Days or hours from the start of palliative sedation to the time of death (or)the time between the last admission and time of death . Days or hours from the start of palliative sedation to the time of death (or) the time between the last admission and time of death . We decided to use the second definition time between the last admission and time of death) in this review because the first definition would not allow us to use a comparative group (comparative group is a group which was comparable to the index group but did not receive palliative sedation). Data were extracted using a specifically designated data collection form and the following were recorded: first author, year of publication, sample size, type of study (prospective and retrospective), study setting (hospice, hospital, and home care), number of patients sedated, indications for sedation, drugs used for sedation with dosage, mode of sedation (intermittent / continuous and mild / deep), mean and/or median length of sedative use (days / hours), and mean and/or median of overall survival (days / hours). Two researchers independently screened the abstracts of all the studies that were identified by the electronic database searches and hand search . The inclusion criteria included: adult cancer patients with one or more physical refractory symptoms, palliative sedation given with any sedative, dose, or frequency, presence of a comparative group, andmst measured in hours or days from the start of last admission until death . Adult cancer patients with one or more physical refractory symptoms, palliative sedation given with any sedative, dose, or frequency, presence of a comparative group, and mst measured in hours or days from the start of last admission until death . Exclusion criteria included: studies in which more than 50% of study population had a non - malignant condition and where mst was not available for the non - sedated group . Studies which met the inclusion criteria were assessed for their methodological robustness independently by both researchers according to the criteria developed by hawker's et al . As this systematic review included both prospective and retrospective studies, hawker's criteria were found most suitable to assess the quality of the included studies . Though the first publication of hawker's criteria had nine items, subsequent publication included ten items, where item six was split into two (ethics and bias). These criteria assess each part of the study as good, fair, poor, and very poor based on the clarity and relevance of data presented . Each item is scored on a four - point scale (one being very poor and four being good). Descriptive data were used to measure the mst in days which was the primary outcome of this review . Because of the divergent study design and marked variability among the nature of participants, interventions, and outcomes of the included studies, it was not possible to combine the data and perform meta - analysis . A total of 442 studies were identified from the search and 421 articles were excluded on the basis of title and abstract [figure 1]. Twenty - one studies were scrutinized and of which nine studies were excluded as they did not meet the inclusion criteria . Refer table 2 for details . Details of excluded studies of the remaining 12 studies, one study was excluded as it had poor score when the quality appraisal tool was applied . Four studies were conducted in hospital, four in hospice, two studies were conducted in home care, and one study in both hospital and hospice . Intermittent and continuous sedation were used in combination in six studies, whereas one study used continuous sedation alone . The level of sedation varied from mild to deep . Of the three studies that mentioned the level of sedation, one study used both deep and mild sedation, whereas the other study used only deep sedation . Haloperidol, levomepromazine, lorazepam, phenobarbitone, chlorpromazine, and promethazine were the other sedatives used . Details of sedatives used mst was calculated from the time of last admission until death . For those studies which were conducted at home care settings, mst was measured from the onset of home care until death . In this review, mst ranged from 8 to 63.9 days in the sedated group . In the non - sedated group, it ranged from 6 to 63.3 days . In two studies, mst was of longer duration in studies conducted in home settings compared to those conducted in hospital and hospice . Two studies which were conducted at home settings reported mst of 25 and 63.9 days, respectively . However, all the 11 studies stated that the difference between the sedated and non - sedated groups was not statistically significant . The comparison of mean survival time between sedated and non - sedated group although this was not the primary outcome of this review, eight studies reported mean duration of sedation in addition to mst . Mst was calculated from the time of last admission until death . For those studies which were conducted at home care settings, mst was measured from the onset of home care until death . In this review, mst ranged from 8 to 63.9 days in the sedated group . In the non - sedated group, it ranged from 6 to 63.3 days . In two studies, mst was of longer duration in studies conducted in home settings compared to those conducted in hospital and hospice . Two studies which were conducted at home settings reported mst of 25 and 63.9 days, respectively . However, all the 11 studies stated that the difference between the sedated and non - sedated groups was not statistically significant . Although this was not the primary outcome of this review, eight studies reported mean duration of sedation in addition to mst . The main goal of palliative care is to provide symptom relief for patients who are suffering from multiple physical symptoms . When all possible medical treatments fail to relieve the intractable suffering in dying patients, palliative sedation is chosen to provide relief from suffering rather than to hasten death . A previous review found that the effect of palliative sedation on life span in advanced cancer patients is inconsistent between the studies . However, this review had also included studies which did not have a comparative group . Another review that explored the feasibility of palliative sedation at home settings showed palliative sedation as a feasible option of treatment for patients who were dying at home . This review analyzed six studies out of which four did not have a comparative group . Mst in our review is not comparable with these two reviews as the definition chosen for mst is from the time of last admission until death . This wide range could be due to inclusion of studies in home care settings, wherein mst was measured from the day of enrollment until death . At home setting, patients enrolled under home care program may not be as terminally ill at the time of enrollment compared with patients in hospice or hospital settings . Their condition may be less serious and co - morbidity may be considerably less . In addition to this finding, this review found that the mst in sedated group is similar or higher compared with the non - sedated groups . This is consistent with the findings of a review conducted in home care settings . Among the studies which are included in the review, those studies that do not have a comparison group reported the mean duration of sedation as survival time the mean duration of sedation ranged from a low of 2.5 days to a high of 4.3 days . De graeff et al . In a review, that was intending to set standards on palliative sedation, do not recommend opioids as a suitable sedative for palliative sedation . It further states that even very high doses of opioids could not induce sedation in terminally ill cancer patients . However, two studies in our systematic review used morphine as a sedative . Stated that the mean dose of morphine used for sedation was 41.2 mg / day . However, this study did not report any adverse effect of morphine or its association with mst . Chiu et al . Mentioned the use of morphine but did not state the dose used for sedation or its association with mst . Both the studies did not mention whether morphine was effective in inducing sedation compared with other sedatives used in their study . Palliative sedation can cause non - serious side effects such as decreased level of consciousness that results in reduced communication capacity . Of the eleven included studies, . Found no difference in the level of consciousness until 3 days before death between sedated and non - sedated groups . Used an ad hoc scale to measure level of consciousness and found sedated patients became more drowsy and unresponsive 3 days prior to death . Found that the level of consciousness became low as the midazolam dose increased during the last days . However, this review could not find any serious side effects of palliative sedation in terminal cancer patients such as respiratory suppression without arrest, aspiration, paradoxical reaction, fatal respiratory, and circulatory suppression . Three of the included studies reported the level of symptom relief achieved through palliative sedation as one of the outcomes . Reported good symptom control in sedated group (68% and 58%, respectively) and 34% and 40% in non - sedated groups, respectively . Chiu et al . Reported that overall 71.4% of the study population achieved symptom relief . Although sedation is mainly indicated for intractable and refractory physical symptoms, literature supports that sedation can be given for psycho - existential issues . European association for palliative care recommend that the decision to sedate for psycho - existential issues needs to be taken only after consulting with experts in the field . Only one study in our review described how the decision to sedate for psycho - existential suffering was taken . It stated that psychologist with expertise in palliative care was consulted before the decision to start sedation . Of the eleven studies included in this review, six of them described psycho - existential reasons as one of the indications for sedation and two studies showed a higher percentage of psycho - existential distress . Mentioned that 6% of patients were sedated for psycho - existential suffering alone and 18% were sedated for both refractory physical and psycho - existential issues . Muller - busch et al ., in a retrospective study, found that 40% required sedation for psycho - existential issues and the need for sedation for psycho - existential issues had been showing an increasing trend over the 7 year study period . The author explains that this could be because of well - controlled physical symptoms due to accessible palliative care over the years in germany, which probably led to less requirement of sedation for refractory physical symptoms and more for psycho - existential issues . The strengths of this review include the use of different search engines, namely medline, psycinfo, embase, cinahl, cochrane central, and scopus . The search was done in large database such as medline, scopus, and cochrane central so as to cover the large number of journal articles . Embase which is a database for pharmacological agents was searched as this review involves sedatives . The database cinahl was searched to find the journals published in nursing care as palliative sedation is one of the therapeutic measures of last days of dying patients . The authors of reputed articles on palliative sedation in different countries were sent letters and were requested to share their research . All palliative care physicians in india, the editor of indian journal of palliative care, and the secretary of the indian association of palliative care were e - mailed to share their researches, thesis, and articles waiting to be published . Though every attempt was made to acquire studies that were not published, we might have missed dissertation, published, and other unpublished works . The major limitation of this review is inclusion of more retrospective studies as there was a paucity of well - conducted prospective studies in this topic . Therefore, studies which investigated the mst as a secondary outcome have also been included in this review . There are no rct that has been conducted on this area of research so far, as per our search . The prospective studies did not use blinding, so there could be bias in the outcome measurement . Also performing quality control of selected articles was a difficult task, as there are limited tools available to assess the quality of observational studies . The quality of evidence used according to this tool is poor as this has included only observational studies . The findings of results could not be combined because of divergent study design of the included studies and the heterogeneity of data prevented us from performing a meta - analysis . Mst was not statistically different between sedated and non - sedated groups in any of the included studies in this review . However, the finding that in all studies regardless of setting, patient group, and different types of palliative sedation, the mst that did not differ from the comparison group is an important finding . However, this conclusion needs to be taken with consideration of the methodology, study design, and population studied of the included studies in this review . Although it is ideal that the systematic review includes only methodologically sound prospective studies, in a situation where a new and a rare intervention is being studied, an initial systematic review needs to consider including retrospective studies as well . This might pave the way for design and conduct of appropriate prospective studies that will provide valid results to conduct a systematic review on this topic in future . Pragmatic trials yield results that are more useful for the clinician in situations that require different treatment options that can often not be controlled . So conducting pragmatic trials methods might be a better solution for answering the question of survival times in palliative sedation and larger multicentric pragmatic trials may be the way forward. |
Currently, many researchers have studied the infants microbiota to understand its cellular mechanisms, bacterial composition, and influencing factors but the bacterial colonization is a complex process . In past, until 2006, the healthy neonatal stools were considered sterile at birth (1, 2) except in harmful medical conditions such as amniotic membrane rupture or amnionitis . However, recently the colonization has proved to begin during the prenatal period by identifying the bacteria in amniotic fluid, meconium, and umbilical cord (2, 3). The intestine of newborns already contains various bacteria before birth (3). In the beginning, newborns maintain low concentrations of microbiota, but a large shift initiates with introduction of solid foods and becomes similar to those of adults by the age of two (1, 3). Many factors influence this process: delivery method, feeding, gestational age, antibiotics exposure, and prenatal environmental exposure (4). In recent study, a geographical influence has been observed, suggesting geographical gradient in the composition of the gut microbiota in europe (5). Many european studies have shown geographical differences in the composition of microbiota (1, 6 - 8), but only few studies have been done in east asia . This study has examined the microbiota composition of healthy newborns born in cities by conducting both culture and molecular analyses . Then, real - time polymerase chain reaction (pcr) and terminal restriction fragment length polymorphism (t - rflp) analysis have quantitatively detected bacterial groups by their phylogenies (9, 10). The aim of this study was to understand and characterize the microbiota composition of healthy korean newborns in cities . 128 healthy full - term neonates of both sexes, were born in january 2009 to february 2010 in seoul st . Inclusion criteria were as follows: uncomplicated pregnancy, no congenital abnormality, no pre - and postnatal maternal use of antibiotics, no signs of infection, and no antibiotics treatment of the neonate . We excluded prematurity, low birthweight neonates, and ones who received postnatal antibiotics or any medical treatment . Second samples were collected from 15 neonates when the first was insufficient or defecated immediately after the first one . We used 143 samples for bacterial composition and 107 time - recorded samples for bacterial detection by time difference . The stools were put in a stool container and frozen at -80c, then transported in an icebox . This study follows an approved protocol that follows the guidelines of our institutional review board (irb) and the amended declaration of helsinki . Samples were put in six culture plates to determine the amounts of total bacteria, anaerobes, gram - positive bacteria, coliforms, lactobacilli, and bifidobacteria, total bacterial count (bhi, difco), gram - positive bacteria (columbia, difco), coliforms (vrb, difco), anaerobes (wc, difco), lactobacillus (mrs with 0.02% of nan3, tokyo chemical industry, japan), and bifidobacterium (tos - propionate agar, yakult, japan). In t - rflp analysis, only 30 samples were used for bacterial dna extracts because dna extraction could be performed only in stools with greater than 10 cfu / g . Stools of 50 mg were washed three times with te buffer (ph 8.0) and the dispersion with 500 l . It was centrifuged (hanil, korea) at 14,000 rpm . After discarding the supernatant, the mixture of 200 mg of glass beads, 600 l of te buffer, 600 l of phenol, and 100 l of 10% sds homogenized twice in fast - prep (mp bio, usa) and was hold at 70 c for 10 min . After 5 min of centrifugation at 4,000 rpm, samples were put with 6 l of 3 m na - acetate and 600 l of isopropanol, then mixed by several inversions . After centrifugation at 14,000 rpm, it was washed with 50 l of 70% ethanol . The repeatedly with 70% ethanol washed sample was dried at room temperature and added 200 l of te buffer . For purification of template dna and amplification of 16s rdna, template dna was extracted and purified by the manufacturer s protocol for high pure pcr template preparation kit (roche, germany). 16s rdna region of purified dna was amplified using universal primer with fam fluorescent markers, 7f (5agagtttgatcctggctcag3) and 1492r (5ggttaccttgttacgactt3) were labeled at 5. the 50 ng/l mold of dna was mixed with each primer . Pcr (accupower hf pcr premix, bioneer, korea) was initiated 50 l at 95c for 5 minute followed by 30 cycles at 95c for 30 second, 50c for 30 second, and 72c for 90 second for amplification . After 30 times of amplification, the reaction was completed at 72c for 10 minutes . Electrophoresis of the amplified pcr was performed with 1% agarose gel at 100 v for 30 minute . Wizard sv gel and pcr clean - up system (promega) purified the amplified 16s rrna . Restriction enzymes, hhai (takara, 2,000 u) and mspi (takara, 3,000 u), were used to cut the purified pcr product . Hhai (2.0 l) was mixed and incubated with 10x m - buffer (1.0 l). Hhai enzyme (1.0 l) and deionized water (6.0 l) were put at 37c for 3 hours . Mspi (2.0 l) was mixed and incubated with 10x t - buffer (1.0 l), mspi enzyme (1.0 l), bsa (1.0 l of 0.1%), and deionized water (5.0 l) at 37c for 3 hours . Data were analyzed using computer software in the statistical package for the social sciences (spss standard version 19.0; ibm spss inc . In order to find the relationship between lactobacillus and coliforms, the spearman correlation coefficient was used . For cluster analysis, bionumerics ver . 5.0 software (applied maths, saint - martens - latern, belgium) interpreted the t - rflp pattern of the restriction enzymes, hhai and mspi . Total bacteria, anaerobes, gram - positive bacteria, coliforms, lactobacilli, and bifidobacterium were examined (table 1). Each stool culture resulted in bacterial counts of about 10 - 10 cfu / g . The total bacterial culture showed 61.5% growth (88/143, range 3.33 10 - 3.81 10 cfu / g) and 38.5% no growth (figure 1). Bacterial growth showed anaerobes (59.1%), g + bacteria (42.4%), lactobacilli (34.1%), coliforms (28.5%), and bifidobacteria (2.1%). Abbreviations: bhi, brain heart infusion; mrs, lactobacillus agar acc . To de man, rogosa and sharpe; tos, propionate agar; vrb, violet red bile; wc, wilkins - chalgren . Percentage of bacterial growth from each plate: total bacteria, 61.6%; anaerobes, 59.1%; g (+) bacteria, 42.4%; lactobacilli, 34.1%; coliform, 28.5%; bifidobacteria, 2.1% . Within 24 hours after birth, 66.4% (71/107) of the stools passed, whereas 33.6% (36/107) of stools passed after> 24 hours of birth . Before 24 hours, gram (+) growth was 46.5% (33/71) shown in gray box; no growth in white box, 53.5% (38/71). Coliform growth was 77.8% (28/36) in gray box with no growth of 22.2% (7/36) in white box . There are more bacteria grown in stools passed> 24 hours of birth (p = 0.009). Defecation time was recorded in 107 samples with the latest time being 36 hours and average time 14 7.03 hours after birth . 71 stools (66.4%, range 3.33 102 - 1.54 10 cfu, average 2.63 2.81 cfu) were defecated within 24 hours after birth . 36 stools (36.6%, range 5.96 10 - 3.81 10 cfu, average 6.0 3.39 cfu) passed after 24 hours of birth . Significant difference between the growth of bacteria according to the stool defecation time showed in total bacteria (p <0.001), anaerobes (p = 0.003), and lactobacilli both coliforms and lactobacilli showed a higher growth in stools> 24 hours after birth (average 3.08 2.85 cfu for coliform, 4.62 3.49 cfu for lactobacilli) than <24 hours . The blue bar represents stools passed within 24 hours after birth and red bar represents the stools passed after 24 hours . Coliforms were likely to be gram + bacteria (average 3.32 3.5 cfu) and anaerobes (4.43 3.49 cfu) seemed to be the dominant microbiota in stools passed within 24 hours, although not significant . Coliforms were likely to be found in lactobacilli negative medium . Among 72 samples, 40 stools showed the growth of lactobacilli and 48 stools of coliforms, both growth in 16 stools . The spearman correlation coefficient rho between the two groups was r = -0.463 (p <0.001), statistically significant (figure 3). In culture analysis, most of coliform - present plates show lactobacilli negative medium and vice versa . In 72 stools, bacteria diversity was determined by means of t - rflp extracting bacterial dna of 30 samples . Two restriction enzymes, hhai and mspi, have been used to identify diversity . Cutting with hhai, all samples showed peaks around 373 - 375 bp, one showed multiple peaks at 86, 221, and 592 bp with a few other minor peaks . Different patterns of peaks allowed us to differentiate stool samples by their diversity (figure 4 a). In mspi, all samples showed a peak at 495 bp, many in 70, 79, 565 bp peaks (not shown in data)., the dendrogram was constructed using ward s algorithm with 30 samples clustered into two well - defined groups using a hierarchical cluster of hhai and mspi digestion based on t - rflp (figure 4 b). The upper cluster contained the samples number 16, 20, 4, 5, 1, 7, 11, 6, 10, 23, 3, 18, and 23, while the lower cluster contained the others . The 16s rdnas were extracted from samples and amplified with the universal primers 27f and 1492r . Each peak represents a terminal restriction fragment of a specific length that corresponds to a bacterial phylotype . Out of 30 samples, the t - rflp patterns of 26 samples were similar . B, hierarchical clustering analysis of microbiota of meconium based on t - rflp pattern derived from hhai and mspi digestion . The x - axis shows the% of similarity and 1 - 30, indicates the sample number . The gut of healthy newborns was non - sterile, had inter - individual bacterial profiles with diversity and similarity to infants in western countries . It is the first large molecular study of neonatal microbiota to date in south korea . To obtain accurate results amplification of 16s rrna is a good method to profile the microbial diversity (11, 12). As expected, most stools (61.5% of total bacterial cultures) were not sterile . In a past korean study in 2006, the first stools of fifteen healthy korean newborns were found to be almost sterile (1). 24 hours after birth, there was a bacterial shift with negative correlation between coliforms and lactobacilli . By analyzing six culture plates, we found that gram - positive bacteria and anaerobes were dominant flora and early colonizers of the first stool, and this illustrated a typical pattern for gut microbiota (13, 14), while lactobacillus and bifidobacterium were less dominant (table 1). The beneficial microbiota (lactobacillus and bifidobacterium) were present in low numbers in the early life of the healthy korean neonates . A range of facultative anaerobes, such as enterobacteriaceae, streptococcus, and staphylococcus, initially dominated the gut . As the available oxygen is consumed, strict anaerobes, including bifidobacterium, bacteroides, and clostridium proliferate (8). Facultative anaerobes are the first colonizers, but strict anaerobes become abundant later, in which bifidobacteria dominate within days or weeks after birth, ultimately reaching levels that are similar to those of adults by the age of two (15). This result of culture - based study seems to follow the colonization pattern classically described . Bifidobacterium and lactobacillus are widely known to be beneficial to intestinal immunity and considered as members of healthy microbiota (16). In general, bifidobacteria colonies by one month of age (7), and the first anaerobes are able to reach high levels in most neonates within the first to second week of life, followed by members of the firmicutes (17). Bifidobacterium genus has appeared differently in european studies, showing to have geographical influence, more dominant in northern european countries than in southern regions and remained at low colonization rates until day 90 in healthy greece infants (5, 18). As in other western countries, bifidobacteria in this study have shown a low composition (table 1). In different defecation times (figure 1), greater numbers of bacteria were found in delayed stools . Anaerobes and gram - positive bacteria decreased, while the total number of bacteria increased with the rise of coliforms and lactobacilli after 24 hours . (3) found that the colonization patterns of gas - forming coliforms, especially e. coli, were more prevalent in colicky infants when compared to healthy infants . In a study comparing the healthy microbiota to allergic colitis, the main differences were in counts of bifidobacteria, clostridia, and total anaerobes with no significant differences in the growth of lactobacilli, coliforms, and enterococci (19). In this study, the increase of lactobacillus was significant, while the increase of coliforms was insignificant in healthy infants . This result suggests that the dynamics of microbiota could occur in the short time of 24 hours after birth . Coliforms are detrimental to the human gut, have a strong correlation with inflammatory bowel disease and exist highly in infants with necrotizing enterocolitis, hirshsprung s disease, and eczema (7, 9, 20). In contrast, lactobacilli are beneficial to gut by promoting adherence of intestinal epithelial cells and inducing mucin secretion in vivo (21). This mechanism inhibits the adherence and invasion of enteropathogenic e. coli and modulates the activation of dendritic cells (22). In plates with lactobacillus, this could explain the consequence of the earlier colonization of lactobacilli that may play a role in affecting the intestinal immunity to disfavor coliform growth . This suggests that the specific early colonizing bacteria can determine the establishment of healthy gut immunity by their dynamic relationships with other bacteria . Many studies have already proven that low diversity of gut microbiota at an early age is strongly correlated with the development of inflammatory and allergic disease in an affluent society (23, 24). In the cluster analysis, our findings showed bacterial diversity with different clustering patterns; enterococcus faecium, enterococcus durans, enterococcus hirae, and streptococcus mutans dominated cluster while the other group did not (figure 4 a). In a diverse stool, enterococcus is the dominant flora . This early establishment of diversity explains the existence of inter - individuality in healthy first stools . The present study has limitation in showing the relation of gut microbiota to onset of disease and lacks clinical information of subjects and other maternal factors . However, many recent studies have found that composition of gut microbiota during early infancy is associated with asthma (25) or inflammatory disease in children . This study confirmed that the healthy microbiota of korean neonates is non - sterile, in which anaerobes dominate, with low bifidobacteria, and diverse with inter - individuality . Understanding the healthy gut microbiota in infancy, may make it possible to determine core bacteria for healthy microbiota throughout life and find strategies to treat conditions associated with a disrupted gut (14). Although the exact mechanism of microbiota in maturation of immunity is elucidated, the hygiene hypothesis and the microflora hypothesis support that intestinal diversity and different bacterial composition affect the development of inflammatory disease by breaking the balance between th1 and th2 (26). The modified microflora hypothesis proposes that the overly hygienic and western lifestyle limit general microbial exposure and alter the colonization of the infants gut . Overall, this study supports microflora hypothesis by showing westernized and various microbiota compositions of the first stools . This study contributes to further understanding of healthy microbiota and presents preliminary findings to support the whether and how these different microbiota compositions relate to onset of disease in early infancy need to be further investigated . This study paves the way for future study about modulating microbiota of infant into healthy gut. |
A number of inborn [15] and acquired [613] neuropathologies are associated with impaired function of the mitochondrial 2-oxoglutarate dehydrogenase multienzyme complex (ogdhc). Ogdhc comprises multiple copies of the three catalytic components: the thiamine diphosphate - dependent 2-oxoglutarate dehydrogenase (e1o), the lipoyl - bearing dihydrolipoamide succinyl transferase (e2o), and the fad - binding dihydrolipoamide dehydrogenase (e3). Coupled action of the components is required for an important regulatory step in the mitochondrial tricarboxylic acid cycle, the oxidative decarboxylation of 2-oxoglutarate (reaction 1, where r = ch2ch2cooh) generating energy in the form of nadh, and macroergic compound succinyl - coa: (1) to reveal molecular mechanisms of the association between neuropathologies and ogdhc function, we introduced specific inhibitors of ogdhc, which have been successfully applied in recent years for cellular [1619], tissue, and animal studies . Having the phosphonate residue instead of the leaving carboxyl group of 2-oxoglutarate, these synthetic inhibitors target the starting and rate - limiting e1o component of ogdhc in a highly specific manner, imitating transition state of the e1o - catalyzed step [15, 22]. Hence, application of such phosphonate analogs of 2-oxoglutarate allows modeling the states when a decrease in the ogdhc activity is observed . In particular, such a decrease occurs in brains of patients with neurodegenerative diseases, including alzheimer's [9, 10, 13] and parkinson's [6, 11] diseases, wernicke - korsakoff syndrome, and progressive supranuclear palsy . It is important to note that 2-oxoglutarate is the glutamate precursor in the glutamate synthesis from glucose de novo . In view of this, the irreversible degradation of 2-oxoglutarate by ogdhc (reaction 1) is intimately related to the synthesis / degradation of excitatory (glutamate) and inhibitory (gaba) neurotransmitters . Indeed, the perturbed flux through the complex was shown to affect the amino acid levels, which may explain the developmental impact of the ogdhc regulation, shown in our previous paper . In the present work, we apply the ogdhc inhibitor succinyl phosphonate to study the behavioral impact of the ogdhc function in adult rats . We show a compensatory response of cortex and striatum to the ogdhc inhibition, which correlates with behavioral changes . Increasing the inhibition or combining the inhibition with hypoxia may abrogate the response . The antagonistic action on ogdhc of the hypoxic stress and synthetic inhibitor is of potential therapeutic significance . All experiments were performed with consent to helsinki declaration on the guide for the care and use of laboratory animals, defining the conduct of ethical research on laboratory and other animals . Animals were kept at 21 2c on standard ration and 12/12 h light / dark cycle . Wistar rats of about 200 g (males) or 250300 g (females) were used in the experiment . Pregnant rats were exposed to hypobaric hypoxia at day 910 of pregnancy by placing in a decompression (altitude) chamber of 3.3 l volume, with a vacuum pump mez mohelnice acute hypoxia was achieved by decreasing the atmospheric pressure in 1 min to 145 mm hg, correspondent to 11500 m altitude . Sp was introduced to animals at 5 and 25 mg / kg by intranasal application of the water solution of the trisodium salt, with the physiologic solution substituting for sp in all reference groups . In the study of the sp influence on hypoxic effects they were estimated in the standard tests: open - field, elevated plus maze; light - dark chamber, and closed plus maze . Video - recording and easy track program were used to follow behavior . To increase the assessment power, different tests were also employed to exclude the animal adaptation to experimental conditions when the time dependence of the behavioral changes was studied . The parameters presented in figures correspond to those which showed statistically significant changes (p <.05) and the changes at the level of trends (p <.1). The latter provided additional support for the statistically significant changes, thus increasing the conclusion accuracy . After physiological monitoring has been performed, the animals were sacrificed by decapitation; cortex and striatum were excised on ice quickly, frozen in liquid nitrogen, and stored at 70c until assay . Each sample corresponded to one animal, with the ogdhc assay in a sample repeated 3 - 4 times at three different protein concentrations . This was done to ensure that the activity is estimated in the interval where the dependence of the reaction rate on the catalyst concentration is linear . Preservation of the linearity at low and high protein concentrations attests to the absence of the multienzyme complex dissociation upon dilution and of the interfering activities consuming the produced nadh, respectively . Sigma, usa . It was performed using statistica 6.0 software, inc .. values are expressed as means sem . Dispersion of the ratios of the affected to control values (%) was calculated by taking into account experimental errors in determination of both values as in . Statistical significance of the differences in the parameter mean values was tested by one - way analysis of variance (anova) followed the student - newman - keuls post hoc test . Statistical significance of the differences in the animal stratification by the resistance to hypoxia was assessed by the fisher's exact test . Behavior was assessed within 4 h (figure 1) and the next day (figure 2) after application of sp . All together, the results of the open field, elevated plus maze and closed plus maze tests pointed to increased exploratory activity and decreased anxiety, resulting from the sp application . An increase in exploratory activity was obvious from statistically significant elevations in the hole inspections (figure 1(a)), coming out into light (figure 1(b)), rearing and crossing the center (figure 2). Visits and time per a round in the closed plus maze showed a trend to decrease (figure 2), suggesting improved orientation ability and inspection efficiency . Along with the mentioned above increase in the coming out into light (figure 1), the shorter grooming times (figures 1(a) and 2) pointed to decreased anxiety . It is noteworthy, that these effects were not pronounced when the sp - treated animals were imposed to stress . That is, under stressful conditions of the light - dark chamber, no statistically significant changes in the exploratory activity and anxiety were detected 24 h after the treatment (data not shown). Thus, the sp - induced increases in exploratory activity and risk behavior do not persist under potentially dangerous conditions when animal is challenged with a bright light . The difference of the animal response to the sp treatment, revealed under comfortable and stressful conditions, is indicative of a certain adequacy of the response, supporting its behavioral rather than motoric origin . Remarkably, increasing sp to 25 mg / kg did not always increase the behavioral effect of 5 mg / kg sp, often even alleviating effects of the low dose (figures 1 and 2). At the same time, elevating sp tended to decrease the moving episodes (figure 1(a)) and muscle force (data not shown). It thus appears that at 25 mg / kg the systemic action of sp increases, with the muscle ogdhc inhibition obviously causing energetic impairment and muscular weakness . Thus, there is a specific window of the sp doze where the ogdhc inhibitor increases the exploratory activity and decreases anxiety of experimental animals . After the behavioral parameters were assessed, the animals were sacrificed and the ogdhc activity in the extracts of cortex and striatum determined (figure 3). The cortex activity was increased at 5 mg / kg sp, returning to the control level at 25 mg / kg sp (figure 3(a)). Sp also increased the ogdhc activity in striatum (figure 3(b)), with the maximal effect achieved already at a low doze . Thus, increases in the ogdhc activity of cortex and striatum correlate with the increased exploratory activity and decreased anxiety of the animals, as observed under comfortable conditions in the open field, elevated plus maze and closed plus maze tests . In neurodegenerative diseases, the metabolic stress is often increased by hypoxia, in which damaging action is associated with the elevated ros and glutamate excitotoxicity . In cellular experiments, sp was shown to protect from the glutamate - induced ros and excitotoxicity [16, 17, 21]. Owing to this, we tested if sp would show a protective action on the behavioral and biochemical changes induced by hypoxia . We used the previously established model, in which acute hypoxia was created in a decompression chamber with female rats sensitized to the insult by pregnancy [21, 24, 31]. Protective action of sp was observed already during the acute hypoxia in decompression chamber . Within an animal group, the resistance to hypoxia assessed by both physiological and behavioral parameters is known to vary, defined as low, medium, or high when the time before collapsing under hypoxic conditions is less than 5 minutes, between 5 and 10 minutes, and 10 minutes and more, respectively [24, 32]. Figure 4 shows that pre - conditioning with a low doze of sp (5 mg / kg) increased the percentage of the highly resistant animals at the expense of the medium resistant group . The sp - induced increase in the number of animals highly resistant to hypoxic conditions exhibits the protective effect of the pretreatment with the ogdhc effector upon acute hypoxia . The behavioral effects were determined in the most reactive low resistant rats 24 hours after recovery from the hypoxia - induced collapse . Compared to the males assessed at the same time after the sp treatment (figure 2), pregnant females showed more resistance to the action of sp per se (figures 5 and 6). That is, sp alone did not significantly influence the behavioral parameters in the open field or elevated plus maze tests . Only the grooming time was significantly decreased by the low sp doze in both females (2-fold, figure 6) and males (3-fold, figure 2), indicative of the sex - independent anxiolytic effect of sp on animals . Remarkably, not only sp, but also hypoxia per se showed an anxiolytic effect . However, the latter was expressed in the rat sensitivity to light rather than grooming . That is, hypoxia caused the statistically significant increase in the looking out into light (figure 6), with the freezing time tending to decrease (figure 5), but did not change the grooming time (figure 6). Thus, a certain degree of similarity in the action of both sp and hypoxia was revealed, although the common anxiolytic effect was expressed in different behavioral parameters, such as grooming or light sensitivity in the sp or hypoxia treatments, respectively . Noteworthy, the sp pre - treatment abrogated the hypoxia effects, exposing the protective action of sp upon hypoxia . That is, the hypoxia - induced changes in the locomotor activity and freezing time were abolished in the sp - treated animals (figure 5), as was the statistically significant increase in the looking out into light (figure 6). Analysis of the ogdhc activity in cortex of pregnant females provided further evidence on the sp - induced protection from the hypoxic effects . As seen from figure 7, hypoxia increased the ogdhc activity in cortex, whereas pre - treatment with sp returned the ogdhc activity to the control level . The data of figure 7 also support the conclusion that the ogdhc activity level correlates with behavioral parameters . That is, the hypoxia - induced behavioral effects (figures 5 and 6) were accompanied by the up - regulation of the cortex ogdhc, with the combined action of hypoxia and sp returning both the ogdhc activity (figure 7) and behavioral parameters (figures 5 and 6) close to the norm . Thus, the pre - treatment with a low sp doze (5 mg / kg) normalized the hypoxia - induced changes in the cortex ogdhc activity (figure 7) and behavioral parameters (figures 5 and 6), increasing the proportion of rats exhibiting the high resistance to hypoxia (figure 4). This means that the sp pre - treatment protected from hypoxia on biochemical, behavioral, and physiological levels . In male rats treated with the ogdhc inhibitor sp, we revealed increased exploratory activity and decreased anxiety (figures 1 and 2) concomitant with increases in the ogdhc activity in cortex and striatum (figure 3). That is, the impaired cognition in patients with neurodegenerative diseases was observed along with the decreased ogdhc activity in their brains, whereas in animal model we observe increased exploratory activity with the orientation and inspection efficiency tending to improve (figures 1 and 2), when the brain ogdhc activity is elevated (figure 3). It should be kept in mind that the ogdhc activity assayed in brain extracts under standard test conditions is not equal to the flux through ogdhc inside brain cells . The flux may differ dependent on the cell type, being determined, in particular, by the substrate concentrations within the cellular mitochondria, which are most probably different from those in the standard assay system in vitro . However, the activity assays do show that (i) application of sp induces the brain response at the level of the ogdhc regulation, and (ii) the response is to up - regulate ogdhc, obviously compensating for the enzyme inhibition by sp . The compensatory response of brain to the ogdhc inhibition by sp (figure 3) may occur through activation of internal mechanisms of the ogdhc stimulation, for example, by protein - protein interactions, posttranslational modifications, increased synthesis . In particular, increased synthesis of the first component of ogdhc, e1o, was observed in response to the acute ethanol - induced stress . Besides, in addition to its action as the reversible ogdhc inhibitor, sp is a protector of ogdhc from an irreversible inactivation occurring in the course of catalysis [16, 17]. During a certain time period, this protective effect may manifest itself as an apparent increase in the ogdhc activity compared to the control value with the unprotected enzyme (figure 3). It cannot, however, be the only reason for the increase, as the latter may be observed in the absence of sp as well . That is, the ogdhc activity of cortex increases also as a result of acute hypoxia in pregnant rats (figure 7). Worth noting, also in this case the elevation of the ogdhc activity in cortex is accompanied by increased exploratory activity and decreased anxiety (figures 5 and 6). In our earlier work on the developmental impact of the brain ogdhc activity, we observed the sex - determined differences in the brain ogdhc expression and reactivity to sp . The present study confirms dependence of the behavioral impact of the ogdhc regulation on the animal physiology, as behavior of pregnant females is less responsive to sp than that of males . Nevertheless, the sex - independent anxiolytic effect of sp was also observed, with the low doze of sp decreasing the grooming time in both males (figures 1(a) and 2) and females (figure 6). Remarkably, both earlier and here, the sp action exhibited an interplay with different stresses . For instance, in males, the sp - induced increase in exploratory activity and decrease in anxiety were pronounced only under comfortable test conditions (figures 1 and 2), but not under the stress conditions of the light - dark chamber (data not shown). Likewise, in pregnant rats exposed to hypoxia, the sp pre - treatment abrogated most of the hypoxia - induced behavioral changes (figures 5 and 6). Combination of the hypoxic stress with sp also reduced the brain ogdhc activity elevated by hypoxia (figure 7). Our data thus point to the antagonistic action of stress and sp at both biochemical and behavioral levels . This antagonism could be used to protect from the negative effects of the metabolic stress . In particular, we show the protection in the hypoxic model, where sp not only normalized the behavioral parameters (figures 5 and 6) and ogdhc activity in cortex (figure 7), but also increased the proportion of rats highly resistant to hypoxia (figure 4). Earlier, we suggested that metabolic stress accompanying the onset of neurodegeneration increases an irreversible inactivation of ogdhc [34, 35], which may also lead in appearance of aberrant enzyme forms with an elevated ability to catalyze hazardous side reactions . This irreversible damage of the ogdhc function occurring in neurodegenerative diseases [7, 36] may be alleviated through the reversible inhibition of ogdhc by sp due to several reasons . First of all, the inhibition by sp may induce compensatory effects up - regulating ogdhc (figure 3). Furthermore, as shown earlier, sp binding to the active site protects the essential groups of enzyme from irreversible modifications causing inactivation [16, 17]. The sp binding also prevents the enzyme from catalysis of the side reactions, including production of ros and enzyme - bound radicals irreversibly damaging ogdhc . The work presented here extends our previous in vitro and in situ studies to animal experiments, showing that reversible inhibition of ogdhc under conditions of metabolic stress may indeed normalize both the behavior (figures 5 and 6) and brain ogdhc activity level (figure 7). It is probable that up - regulation of ogdhc occurs also in response to its irreversible inactivation upon initial stages of the neurodegenerative diseases . However, when the inactivatory conditions persist with the up - regulated ogdhc not protected, the cellular compensatory ability is exhausted, eventually resulting in the increasing damage of the brain mitochondrial metabolism . In contrast, the protective effects of sp described above would allow cells to combine the ogdhc up - regulation with the enzyme protection, which may underlie cellular ability to overcome metabolic stress . Up - regulation of the brain ogdhc activity correlates with increased exploratory activity and decreased anxiety . The up - regulation under metabolic stress may be adjusted by reversible inhibition of ogdhc, normalizing the biochemical and behavioral deviations. |
Glucose-6-phosphate isomerase (gpi) deficiency is the third most common red blood cell enzymopathy, after glucose-6-phosphate dehydrogenase (g6pd) and pyruvate kinase (pk) deficiency and is similarly associated with hereditary nonspherocytic hemolytic anemia (hnsha). The sole clinical manifestation in the majority of patients is chronic hsnha, ranging from mild to severe . Most cases of gpi deficiency are diagnosed during the neonatal and childhood period . To date, only two cases of prenatal diagnosis of gpi deficiency have been reported . Additionally, cases of postnatal diagnoses of hydrops caused by gpi deficiency were documented, usually without survival of the affected child 2,3 . In this case report, we describe a family in which two siblings have congenital hsnha due to gpi deficiency . The first child was diagnosed at the age of 3 years, the second was monitored antenatally with repeated doppler ultrasound and was eventually treated for fetal anemia with repeated intrauterine transfusions . To our knowledge, this is the first case of prenatal diagnosis of gpi deficiency in cord blood, followed by successful intrauterine treatment of gpi - deficient fetal anemia . A 33-year - old woman was referred to our center at 17 weeks of gestation because of an increased risk of fetal anemia . Their first child, a 5-year - old girl, was born after an uneventful pregnancy and did not suffer from extreme neonatal jaundice or anemia . She was diagnosed with gpi deficiency at the age of 3 years after her first documented acute hemolytic episode with signs of jaundice, severe anemia, and hemoglobinuria . Following extensive investigation dna analysis showed the girl to be homozygous for the c.1615g> a, p.(asp539asn) missense mutation in gpi . Both the mother and father were found to be heterozygous for the same mutation . At present, the girl remains clinically well, has normal growth and neuropsychological development but has evident chronic hemolysis treated with folic acid . She has had infrequent exacerbations of hemolysis associated with minor childhood infections but nonsevere enough to warrant erythrocyte transfusions . The current pregnancy was the fourth pregnancy of this couple, following two early miscarriages . The parents refrained from early diagnostic chorionic villus biopsy or amniocentesis (because of the risk of miscarriage), but instead opted for ultrasound monitoring for signs of fetal anemia (measurement of the mca doppler peak systolic velocity (mca - psv)). The pregnancy was followed up on a weekly basis, from 16 weeks of gestation onward . At 26 weeks of gestation, fetal anemia was suspected, based on an increased mca - psv of> 1.5 multiples of the median (mom) (fig.1). There is suspicion of fetal anemia when vmax in the middle cerebral artery exceeds 1.5 mom . The first iut was given transplacentally in the umbilical cord root at 27 weeks of gestation . Pretransfusion cord blood was obtained for diagnostic testing, the fetal hemoglobin level was 7.4 g / dl . An uncomplicated intravenous transfusion of donor blood was performed, resulting in a posttransfusion hemoglobin concentration of 13.5 g / dl . Genetic analysis of fetal cells confirmed that the second child was also homozygous for the aforementioned mutations in the gpi gene . After the diagnosis was made, folic acid was prescribed to the mother in a daily dosage of 5 mg . Another two iut's were performed at gestational weeks 30 and 34 (table1). Based on the fact that the fetus needed repetitive intrauterine transfusions from 27 weeks of gestation onwards, labor was induced at 37 weeks to avoid further intrauterine transfusions . A girl was born vaginally with apgar scores of 9 and 10 at 1 and 5 min, respectively . The cord blood ph was 7.25 and her weight was 3620 g. neonatal jaundice was apparent immediately after birth . The child required no exchange or top - up transfusions and was discharged at day 7 . At 4 weeks of age, despite resolving hemolytic parameters (decreasing bilirubin and ldh) the girl remained reticulocytopenic and required an additional blood transfusion for symptomatic anemia . Two weeks after transfusion, spontaneous recovery of hemoglobin concentration was observed, with rising reticulocytes (105 10/l), normal bilirubin (11 mol / l), normal ldh (241 u / l), and low haptoglobin (<0.1 she remains well and transfusion - independent at the current age of 5 months, while receiving folic acid replacement therapy . Intrauterine transfusion data for the treatment of fetal anemia volume transfused: volume of transfused red blood cells . Gpi is a dimeric enzyme which catalyzes the reversible conversion of glucose-6-phosphate and fructose-6-phosphate, the second step in glycolysis . The gpi gene is located on the long arm of chromosome 19 and 31 mutations in the gpi gene are currently listed in the human gene mutation database (www.hgmd.cf.ac.uk). The majority of these mutations are missense mutations affecting key interactions of the enzyme's active site 5 . Gpi - deficient patients are either homozygous or compound heterozygous for such mutations, and are clinically characterized by chronic hemolytic anemia with hemolytic crises during infection or after ingestion of hemolytic drugs 6 . The current therapy consists of blood transfusions and splenectomy for the most severe hemolytic cases 3,7 . It has been suggested that mutant gpi is inactivated faster with increasing rbc cell age than the wild - type enzyme 8 . The manifestation in affected fetuses might therefore be milder because of the shorter lifespan of fetal rbcs . However, if fetal hydrops develops due to gpi deficiency, the prognosis is usually very poor 2,9 . In the literature, performed the first prenatal gpi deficiency diagnosis at 28 weeks of gestation by assessing the gpi characteristics in amniotic fluid cells . Gpi deficiency was considered after the neonatal death of a previous child with hydrops . The second child in this family was diagnosed antenatally as compound heterozygous for two different mutant gpi alleles and received an exchange transfusion after birth, which took place at 35 weeks of gestation 2 . Provided a first trimester gpi deficiency diagnosis on trophoblast cells obtained from chorionic villus sampling 1 . In the present case, instead, close fetal surveillance by ultrasound scanning was performed on a weekly basis, to monitor for signs of fetal anemia . The diagnosis was confirmed by genetic analysis of dna of cord blood cells, sampled before the first iut . Iut is universally accepted as an efficient treatment for fetal anemia . In the leiden university medical center, serving as the dutch national referral center for fetal therapy since 1965, it was the first time iuts were performed for fetal anemia due to gpi deficiency . We prescribed folic acid supplementation to the mother to prevent the occurrence of megaloblastic anemia in the fetus . Postdelivery the girl also received folic acid, as is standard in patients with hemolytic anemia . This is a well - known phenomenon in children that received intrauterine transfusions and is thought to be induced by reduction in their own erythropoietin production . The parents are both heterozygous for both mutations suggesting that although they were reported to be nonconsanguineous it is very likely that they stem from a common ancestor . One possibility could be early exposure to oxidant agents which can trigger episodes of hemolysis . However, obstetric history of the second pregnancy showed no infection or known ingestion of oxidant drugs or food . Whitelaw et al . Also reported a family of two affected siblings with different disease severity 2 . Pointed out that patients with the same mutation and deficient gpi activity can present with varying degrees of anemia and clinical impairment 7 . Our findings confirm that the hemolytic episodes caused by gpi deficiency are unpredictable and emphasize the importance of prenatal monitoring of fetuses at risk . In conclusion, hemolytic anemia due to gpi deficiency can be severe and life threatening during fetal life . We recommend frequent ultrasound monitoring for prenatal management of pregnancies in which there is an increased risk of fetal gpi deficiency, when parents decline early invasive testing . In this case, repeated intrauterine blood transfusions appeared to be effective for the treatment of severe fetal anemia due to gpi deficiency and may additionally have prevented the development of fetal hydrops and demise. |
Ampc is responsible for resistance to cephalosporins and esbls confer resistance to all -lactams except for the carbapenem family . Carbapenemases, particularly metallo -lactamases (mbl), hydrolyze all -lactam antibiotics with the exception of monobactams . Coexistence of multiple -lactamases in clinical isolates of p. aeruginosa is common, causing resistance to almost all -lactam antibiotics (7). Another important factor contributing to the pathogenesis of p. aeruginosa in causing fatal infections is its potential to form biofilms on biotic and abiotic surfaces (8). The bacterial populations in biofilms are usually more resistant to antibiotics and host - mediated clearance strategies compared to their planktonic counterparts, giving rise to chronic infections that are notoriously difficult to eradicate (9, 10). Bacteria growing in biofilms produce one or more extracellular polymeric matrices which hold the cells of the biofilm community together . Polysaccharides are important components of the biofilm matrix, as they contribute to the overall biofilm architecture and to the resistance of biofilm - grown bacteria to certain antibacterial agents (11). At least three exopolysaccharides have been shown to be involved in biofilm formation by p. aeruginosa, including alginate, psl, and pel (12). Among these, psl is a mannose - rich polymer with an essential role in the initial steps of biofilm formation by non - mucoid p. aeruginosa as well as in its maintenance . Psl forms a helical structure around p. aeruginosa cells which increases the cell - to - surface and cell - to - cell interactions necessary for biofilm formation (13, 14). Synthesis of psl is mediated by the psl gene cluster (psla - pslo) and psla has been reported to be the first and most important gene necessary for psl synthesis (15, 16). Due to the suggested role of psla in the initial steps of biofilm formation by p. aeruginosa, we studied the association between biofilm formation and the psla gene carriage in burn isolates of p. aeruginosa . We also evaluated the potential to form biofilm in relation to antibiotic resistance and the production of ampc, mbl and esbl -lactamases among the isolates . Sixty - two isolates of p. aeruginosa were collected from hospitalized burned patients in shahid motahari hospital, iran, from august to october 2011 (17). The isolates were maintained in brain - heart infusion broth (becton dickinson, franklin lakes, nj) containing 10% dimethyl sulfoxide (dmso) at -20c until use . The antibiotic susceptibility of the isolates had been previously determined for 13 antibiotics by the disc diffusion method (17). Staphylococcus epidermidis strains rp62a and rp62na were used as positive and negative controls for biofilm production, respectively (18). Biofilm formation was determined by the microtiter plate assay, as previously reported (18). Briefly, 200 l of a 1:100 dilution of each overnight grown bacterial culture in trypticase soy broth (tsb) (merck, germany) was inoculated into four wells of a 96-well flat bottomed polystyrene plate (greiner bio - one inc . Following incubation at 37c for 22 - 24 hours, the cultures were removed and the wells were washed twice with 200 l of phosphate buffered saline (pbs, ph = 7.4) and dried at room temperature . Biofilms were stained with 0.1% safranin (merck, germany) solution in water for 15 minutes and the plates were washed in distilled water and dried at room temperature . The optical density (od) of the biofilms was measured at 492 nm using an elisa reader (stat fax 2100, awareness tech inc . Biofilm formation was considered negative at ods below 0.12, weakly positive at ods 0.12 - 0.24 and strong positive at ods> 0.24 (18). Each test was repeated on three different days and the results were reported as the mean of the obtained values . Pcr amplification of the psla gene was carried out using the following primers: psla - f, 5-cactggacgtctactccgacgatat-3; psla - r, 5-gtttcttgatcttgtgcagggtgtc-3 (bioneer, korea), generating an amplification product of 1119 bp (20). The reaction mixture (25 l) contained 1 l of the extracted dna, 1.5 mm mgcl2, 0.4 mm of each dntp, 10 pm of each primer and one unit of taq dna polymerase (cinnagen, iran). Amplifications were performed in a thermal cycler (peqlab, germany) using the following program: an initial incubation at 94c for 10 minutes, followed by 30 cycles of one minute denaturation at 94c, 30 seconds annealing at 55c and one minute extension at 72c followed by 10 minutes at 72c . The amplification products were separated on 1% agarose gels, stained with red safe (intronbio, korea), and visualized using an image analysis system (uvitec, st john s innovation centre, uk). Briefly, the turbidity of overnight grown bacteria in mueller - hinton (mh) broth (merck, germany) was adjusted to mcfarland standard 0.5 before inoculating mh agar plates . An imipenem disc (10 g) was placed on the bacterial lawn 10 mm apart from a blank disc (edge to edge), to which, 10 l of an edta solution (0.5 m, ph: 8) was added before incubation at 37c for 24 hours . Presence of an extended growth inhibition zone between the two discs was interpreted as positive for mbl production . Briefly, a blank disc moistened with sterile saline was inoculated with a few colonies of the test strain . The disc was then placed next to a 30-g cefoxitin disc (mast, uk) on the surface of an mh agar plate, previously inoculated with a lawn of escherichia coli atcc 25922 and incubated overnight at 37c . A flattening or an indentation of cefoxitin inhibition zone adjacent to the disc containing the test strain indicated ampc -lactamase production . Esbl production was detected by the double - disc synergy test (ddst), as described before (17). Discs containing ceftazidime (30 g) and cefepime (30 g) were placed 15 mm apart from an amoxicillin / clavulanic acid disc (20 + 10 g) on bacterial lawns before overnight incubation at 37c . Esbl production was detected when synergy was observed between the inhibition zones of cephalosporins and amoxicillin / clavulanic acid discs . Phenotypic confirmatory test for esbl production was performed by placing a ceftazidime disc (30 g) alone and ceftazidime with clavulanic acid (10 g) on bacterial lawns before incubation at 37c overnight . An increase of 5 mm in the inhibition zone around the combination disc was considered as esbl production . Comparison of -lactamase production between biofilm - negative and biofilm - forming isolates was carried out by the mann - whitney test, using spss v19 . Sixty - two isolates of p. aeruginosa were collected from hospitalized burned patients in shahid motahari hospital, iran, from august to october 2011 (17). The isolates were maintained in brain - heart infusion broth (becton dickinson, franklin lakes, nj) containing 10% dimethyl sulfoxide (dmso) at -20c until use . The antibiotic susceptibility of the isolates had been previously determined for 13 antibiotics by the disc diffusion method (17). Staphylococcus epidermidis strains rp62a and rp62na were used as positive and negative controls for biofilm production, respectively (18). Biofilm formation was determined by the microtiter plate assay, as previously reported (18). Briefly, 200 l of a 1:100 dilution of each overnight grown bacterial culture in trypticase soy broth (tsb) (merck, germany) was inoculated into four wells of a 96-well flat bottomed polystyrene plate (greiner bio - one inc ., the cultures were removed and the wells were washed twice with 200 l of phosphate buffered saline (pbs, ph = 7.4) and dried at room temperature . Biofilms were stained with 0.1% safranin (merck, germany) solution in water for 15 minutes and the plates were washed in distilled water and dried at room temperature . The optical density (od) of the biofilms was measured at 492 nm using an elisa reader (stat fax 2100, awareness tech inc . Biofilm formation was considered negative at ods below 0.12, weakly positive at ods 0.12 - 0.24 and strong positive at ods> 0.24 (18). Each test was repeated on three different days and the results were reported as the mean of the obtained values . Pcr amplification of the psla gene was carried out using the following primers: psla - f, 5-cactggacgtctactccgacgatat-3; psla - r, 5-gtttcttgatcttgtgcagggtgtc-3 (bioneer, korea), generating an amplification product of 1119 bp (20). The reaction mixture (25 l) contained 1 l of the extracted dna, 1.5 mm mgcl2, 0.4 mm of each dntp, 10 pm of each primer and one unit of taq dna polymerase (cinnagen, iran). Amplifications were performed in a thermal cycler (peqlab, germany) using the following program: an initial incubation at 94c for 10 minutes, followed by 30 cycles of one minute denaturation at 94c, 30 seconds annealing at 55c and one minute extension at 72c followed by 10 minutes at 72c . The amplification products were separated on 1% agarose gels, stained with red safe (intronbio, korea), and visualized using an image analysis system (uvitec, st john s innovation centre, uk). Briefly, the turbidity of overnight grown bacteria in mueller - hinton (mh) broth (merck, germany) was adjusted to mcfarland standard 0.5 before inoculating mh agar plates . An imipenem disc (10 g) was placed on the bacterial lawn 10 mm apart from a blank disc (edge to edge), to which, 10 l of an edta solution (0.5 m, ph: 8) was added before incubation at 37c for 24 hours . Presence of an extended growth inhibition zone between the two discs was interpreted as positive for mbl production . Briefly, a blank disc moistened with sterile saline was inoculated with a few colonies of the test strain . The disc was then placed next to a 30-g cefoxitin disc (mast, uk) on the surface of an mh agar plate, previously inoculated with a lawn of escherichia coli atcc 25922 and incubated overnight at 37c . A flattening or an indentation of cefoxitin inhibition zone adjacent to the disc containing the test strain indicated ampc -lactamase production . Esbl production was detected by the double - disc synergy test (ddst), as described before (17). Discs containing ceftazidime (30 g) and cefepime (30 g) were placed 15 mm apart from an amoxicillin / clavulanic acid disc (20 + 10 g) on bacterial lawns before overnight incubation at 37c . Esbl production was detected when synergy was observed between the inhibition zones of cephalosporins and amoxicillin / clavulanic acid discs . Phenotypic confirmatory test for esbl production was performed by placing a ceftazidime disc (30 g) alone and ceftazidime with clavulanic acid (10 g) on bacterial lawns before incubation at 37c overnight . An increase of 5 mm in the inhibition zone around the combination disc was considered as esbl production . Comparison of -lactamase production between biofilm - negative and biofilm - forming isolates was carried out by the mann - whitney test, using spss v19 . Of the 62 test isolates, 27 (43.5%) formed biofilm, of which 18 (66.7%) were strong and 9 (33.3%) were weak producers with an average od492 of 0.582 0.015 and 0.194 0.001, respectively . Presence of the psla gene was observed in all biofilm producers, showing a strong association between psla gene carriage and biofilm formation . The amplification product of psla gene for a number of p. aeruginosa burn isolates (1119 bps) is shown in figure 1 . No significant difference was observed between the antibiotic susceptibility profiles of biofilm - positive and biofilm - negative isolates . Production of esbl, mbl and ampc -lactamases by non - biofilm and biofilm producers is presented in figure 2 . Among the biofilm producing isolates, 19 (70.3%) were mbl producers, 17 (62.9%) produced ampc, and 9 (33.3%) were positive for esbl production . Production of ampc, mbl and esbl in biofilm - negative isolates occurred in 12 (34.2%), 11 (31.4%) and 7 (20%) isolates, respectively . As observed, mbl and ampc productions were significantly higher in biofilm - positive strains (p = 0.003 and p = 0.02, respectively). Coproduction of ampc and mbl was significantly higher in biofilm - positive isolates (n = 12, 44.4%) compared to biofilm negative ones (n = 7, 20%) (p = 0.00). Finally, three biofilm - positive (11.1%) and one biofilm - negative isolates (2.8%) produced all three -lactamases . The degree of biofilm formation in relation to -lactamase(s) production is shown in figure 3 . As observed, strong biofilms were formed by the isolates that coproduced mbl and ampc as well as the strains that had all three -lactamases (od492: 0.46 0.020 and 0.36 0.060, respectively). The isolates that produced one -lactamase type formed weak biofilms (mbl producers od492: 0.17 0.015, esbl producers od492: 0.15 0.005 and ampc producers od492: 0.13 0.012). Non--lactamase - producing strains did not form biofilms (od492: 0.043 0.001). C+, control; l, 1 kb dna ladder; lanes 2 to 20, some test isolates . P. aeruginosa is capable of causing chronic infections mostly due to its potential to form biofilms (16). The hallmarks of a mature biofilm include production of an extracellular matrix and increased resistance to antibiotics (11). In a recent study, 96% of p. aeruginosa burn wound isolates were shown to form moderate to strong biofilms in vitro (21). Showed the high potential of biofilm formation by clinical isolates of p. aeruginosa regardless of the specimen source (22). The association between the potential to form strong biofilms by p. aeruginosa and antibiotic resistance has also been shown (23). We found no significant difference between the antibiotic susceptibility profiles in biofilm - positive and biofilm - negative burn isolates of p. aeruginosa . In this research, 43.5% of our p. aeruginosa burn isolates formed biofilms, the majority of which (66.7%) were strong biofilms . Presence of the psla gene was shown as a good predictor of biofilm formation in non - mucoid isolates of p. aeruginosa in a number of studies (13, 15, 20). Aeruginosa burn isolates, suggesting a strong correlation between biofilm formation and psla gene carriage . We also observed that 14.2% of the biofilm - negative isolates harbored the psla gene . Hou et al . Found that psla gene was present in 31% of biofilm - negative ophthalmic p. aeruginosa isolates (20). This may suggests that gene presence does not necessarily result in its expression and biofilm formation is regulated by a complicated network of factors in addition to the psla gene . The same observation has been made for biofilm formation in s. epidermidis (18). Presence of different types of -lactamases including ampc, esbl and mbl and the association of some of these enzymes with biofilm formation in p. aeruginosa has been shown in a number of studies (5, 24, 25). In our study, mbl, ampc and esbl production occurred in 48.3% (30/62), 46.7% (29/62) and 25.8% (16/62) of the isolates, respectively . However, mbl and ampc production were significantly higher in biofilm - positive strains than biofilm - negative ones (70.3% vs. 31.4%, 62.9% vs. 34.2%, respectively). Coproduction of different -lactamases has been observed by other investigators (5, 7, 26). We detected mbl and ampc coproduction in 30.6% of our isolates (19/62), the majority of which were biofilm - positive (63.1%). Of the four isolates (6.4%) that produced all three enzymes, 3 (75%) were biofilm - positive . Figure 3 shows the degree of biofilm formation in relation with -lactamase production among our isolates . Showed that p. aeruginosa isolates harboring mbl gene produced strong to moderate biofilms in vitro (24). In another study, a highly significant association was found between the degree of biofilm formation and mbl production in p. aeruginosa (25). Similar results have been shown for proteus mirabilis, where the potential to form biofilm was significantly higher in -lactamase (ampc and esbl)-producing strains (27). However, another study showed that esbl (but not mbl or ampc) inhibited biofilm formation by impairing the twitching motility which plays an important role in micro - colony formation in p. aeruginosa (28). In conclusion, biofilm formation correlated with psla gene carriage as well as mbl and ampc -lactamase production in burn isolates of p. aeruginosa . More importantly, the isolates with multiple -lactamase phenotypes produced strong biofilms in comparison to the strains with one type of -lactamase that formed weak biofilms or -lactamase - negative isolates that did not form biofilm at all. |
Tuberculosis (tb) is a communicable infectious disease, spread almost exclusively by coughed aerosols carrying pathogens from the mycobacterium tuberculosis (mtb) complex . Tb is characterized pathologically by necrotizing granulomatous inflammation usually in the lung, although almost any extra - pulmonary site can be involved . Tb remains one of the most significant infectious causes of mortality and morbidity worldwide . As reported by the world health organization (who) it causes disease among 9.6 million people each year and ranks alongside the human immunodeficiency virus (hiv) as a leading cause of death worldwide . In 2014, 1.5 million tb deaths were reported and among them approximately 140,000 were children . The number of tb deaths is unacceptably high because with a well - timed diagnosis and appropriate treatment, almost all people with tb can be cured . Therefore all efforts to fight tb must be intensified . Additionally, it is estimated that one - third of the world s population is latently (asymptomatically) infected with mtb, and approximately 3 to 10% of these infected individuals are likely to progress to active disease during their life . The risk of reactivation and subsequent disease and mortality is significantly increased in individuals with hiv coinfection and therapy with tnfa inhibitors . Approaches to decrease tb morbidity and mortality, along with mtb transmission, rely on effective treatment, correct diagnosis, and prevention of infection and disease . Effective therapy is central to any strategy for controlling tb and biomarkers that indicate initiation of successful treatment could facilitate development of alternative treatment strategies . In fact, in the remoxtb clinical trials experience, despite early effectiveness (superior early bactericidal activity and 2-month culture conversion rates in patients treated with moxifloxacin compared to the standard regimen), the 4-month - regimen was less effective than the standard 6-month regimen in preventing tb recurrence . Moreover, correct and efficacious treatment is also needed to avoid multidrug - resistant (mdr)-tb . Globally, an estimated 3.3% of new tb cases and 20% of previously treated cases had mdr - tb in 2014 . This translates into an estimated 480,000 people having developed mdr - tb in 2014 with a treatment success rate of only 48% . Patients with mdr - tb urgently require treatments that quickly eradicate active infection while preventing emergence of additional resistance, which otherwise causes treatment failure and death . Active tb diagnosis is based on the detection of mtb in sputum, which depends on the presence of necrotic infection foci in proximity to the airways . The diagnosis then is based on sputum smear and culture, and more recently positive genexpert mtb / rif tests . Microscopy is largely available and highly specific, but lacks sensitivity, missing the diagnosis in over one third of patients seeking care . Mycobacterial culture remains the gold standard for tb diagnosis, but provides results only after considerable delay (3 - 4 weeks). All these diagnostic tests require a mtb - positive sputum while many active tb patients, including hiv - coinfected individuals, diabetes patients, and children, often do not present with mtb positive sputum . In pulmonary tb a positive microbiological diagnosis inevitably means the presence of mtb in the airway secretions, such that in all likelihood mtb has been already transmitted to others . By definition, sputum diagnostics are not useful in extra - pulmonary disease, the diagnosis of which relies on samples (tissue or biological fluids as pleural-, cerebral-, synovial - fluids) collected by invasive procedures . For all of these reasons, there is need for the development of highly sensitive and specific diagnostic tests for tb to rapidly identify - or rule out - the presence of active disease . These tests need to perform in endemic settings with limited laboratory facilities, at low cost, using easily accessible non - sputum based samples such as blood, urine, or breath . These are the four high priority target product profiles (tpps) recently published by the who as a result of a consensus meeting on new tb diagnostics . Therefore the urgent need to search for biomarkers (defined as measurable characteristics that indicate normal or pathogenic biological processes, or pharmacological responses to therapeutic intervention) needs to be highlighted: biomarkers can serve as surrogate endpoints in clinical trials, and can be used to improve treatment outcome by informing therapeutic decisions for individual patients . Sputum culture conversion using solid medium is the best - characterized tb biomarker for successful treatment, having been examined in many studies either as a simple measure (e.g. Month 2 culture status) or in more complex forms requiring subsequent negative cultures (e.g. Stable culture conversion). However, as reported above, in the remoxtb trial patients developed recurrent tb despite negative sputum cultures at month 2 . This is a priority for the tb research field and has the potential to impact not only research but also clinical practice globally . In this paper we will review most of the recent advances in research into tb biomarkers for the diagnosis of active tb, latent tb infection (ltbi) and prevention of tb disease . We may distinguish biomarkers related to the pathogen and to the host (figure 1). From the pathogen perspective, mtb products could be detected directly in blood, sputum or urine . Mtb dna can be detected in blood and urine of pulmonary tb patients with a better sensitivity than mtb culture from the same biological fluid . The mtb cell wall component lipoarabinomannan (lam) has been proposed as tb biomarker; however the available commercial test on urine has a poor sensitivity . Although unsatisfactory as yet, in hiv - infected patients the mtb dna and lam detection in urine may be an important tool to consider especially for those advanced cases with low cd4 t - cell counts . The mtb ag85 complex is a 30 - 32 kd family of three proteins (ag85a, ag85b, and ag85c) with enzymatic mycolyl transferase activity involved in the coupling of mycolic acids to the arabinogalactan of the cell wall and in the biogenesis of the cord factor . The detection of ag85 in blood and urine, however, shows highly variable performance in different studies . Among the host biomarkers, there are various non - sputum based - assays for active tb diagnosis, relying on serum, plasma, urine or stimulated or unstimulated blood . Considering serum or plasma products, mtb specific antibody detection is not a promising diagnostic approach due to heterogeneity of the response to mtb ., moreover who negatively advised on the use of such tests for diagnosing active tb disease . The evaluation of serum micro - rnas has shown different levels of accuracy for diagnosing active tb in drug - sensitive and drug resistant tb . A broad range of potential transcriptional tb biomarkers has been reported . Modular and pathway analysis revealed that the neutrophil driven interferon (ifn)-inducible gene profile, consisting of both type 2 (ifn) and type i (ifn) ifn signaling represented a significant tb signature detectable in the peripheral blood from pulmonary tb patients . These findings have been also validated in other populations,, and in several studies could differentiate tb from other respiratory infections and inflammatory diseases . Moreover it has been shown that disease activity increased the signature whereas treatment decreased it integrated analysis of gene expression signatures obtained in eight independent studies revealed additional pathways that are likely to contribute to discrimination of tb disease from other diseases . Diagnostic signatures to distinguish tb from other diseases and from ltbi were also found in children from south africa, malawi and kenya . However one of the major challenges in the evaluation of new childhood tb diagnostic is the lack of a reference, due to the difficulty of microbiological diagnosis of active disease . Taking all these studies together it is important to mention that the minimum tpp requirements are not yet satisfied in terms of sensitivity and specificity . The complexity of the analysis and the expensive molecular techniques related to the transcriptional profiles make it currently difficult to be used as routine diagnostic tests unless easier technologies are developed . The interferon (ifn) inducible protein 10 (ip10) was found to be increased in the unstimulated plasma of children and adults with active tb, and has been evaluated by different methodologies including also innovative technologies based on lateral flow assays using the interference - free, fluorescent up converting phosphor (ucp) labels in multicenter studies conducted in africa . Interestingly, ip10 can be also detected in the urine of adult patients, ugandan children with active tb, and ip10 levels decreased after efficacious therapy . In comparison with blood, urine biomarkers offer the advantage of non - invasive sample collection, especially in children, and also pose lower bio safety risks for health care workers . Flow - cytometry has been proposed as a potential tool to help improving tb diagnosis . Advancement in multiparametric flow cytometry allows the simultaneous evaluation of several immune functions in single cells such as cytokine production and memory status . Polyfunctional t - cells, cells able to produce more than one cytokine simultaneously, have been described as part of immune response to different pathogens such as viruses, bacteria and worms . Moreover t - cells coproducing ifn, tnf and il2 have been associated with protective t - cell immune responses in hiv non - progressors subjects . Studies evaluating the role of polyfunctional t - cells in tb did not show consistent results . Active tb has been associated with either monofunctional tnfcd4 t - cells, or double functional ifntnfa cd4 t - cells, or triple functional ifntnfil2 cd4 t - cells . By contrast, studies on activation and memory status of mtb - specific t - cells seem to be more consistent, even when comparing patient populations enrolled at different sites or using different experimental settings . Effector t - cells expand during active mtb replication, whereas memory cells associate with control and eradication of mtb infection . In particular, it has been shown that active tb is associated with a decrease in cd27 surface expression on circulating mtb - antigen stimulated cd4 t - cells . Recently, a novel t - cell activation marker - tb (tam - tb) assay was described for diagnosis of active tb in children . The tam - tb assay has been validated in an adult population in tanzania and is based on the ratio of the median fluorescence intensity of all cd4cd27 t - cells over the median fluorescence intensity of mtb - specific cd4cd27 t - cells (cd27 mfi ratio). This approach has also been tested in an adult population from a low tb endemic country and confirmed discrimination between different stages of tb infection . Another interesting blood - based study showed that the expression of immune activation markers cd38 and hla - dr and proliferation marker ki-67 on mtb - specific cd4 t - cells associated with mtb load . The modulation of these markers accurately distinguishes active from ltbi with 100% specificity and over 96% sensitivity . These markers also correctly classified individuals who had successfully completed tb therapy, indicating a correlation with the decrease in mycobacterial load following treatment . Interestingly, recently the t - cell activation has been described also as an immune correlate of risk for tb development in bcg - vaccinated infants . Among the untargeted discovery approaches to identify new markers for tb patients stratification, the transcriptomic, proteomic, or metabolomic approaches have been used . In particular tientchieu et al . Evaluated the transcriptomic and metabolic profiles of subjects infected with two different lineages of mtb, the m. africanum (maf) and mtb before and after anti - tb therapy to access the differences in host factors and/or biological processes associated with disease pathology and response to treatment . Peripheral blood gene expression profiles were not different between maf- and mtb - infected patients pre - treatment but differed significantly post - treatment, and these were mainly associated with immune responses and metabolic diseases . Notably, the upstream regulator hepatocyte nuclear factor 4- regulated about 15% of the genes differentially expressed between the groups post - treatment . The serum metabolic profiles were similar between maf- and mtb - infected patients both pre- and post - treatment, but significantly different between pre- and post - treatment, particularly in mtb- than in maf - infected groups . Using different approaches, as the mass spectrometry or protein chip technology, it is possible to have a proteomic profiling of many peptides when comparing tb patients and healthy subjects . Analysis of sera for host markers showed that transthyretin, c - reactive protein and neopterin might discriminate tb patients from subjects with other infectious and inflammatory conditions with high accuracy . Similarly, sputum may also be used to analyze proteomic profiles, as data on smear - negative vs. smear - positive tb patients were significantly different from those found in control subjects . Volatile organic compounds (vocs) in breath may contain biomarkers of active pulmonary tb derived directly from the infectious organism (e.g. Metabolites of mtb) and/or from the infected host (e.g. Products of oxidative stress). A breath test based on the detection and quantification of vocs identified potential biomarkers of active pulmonary tb with 85% accuracy in symptomatic high - risk subjects . However, detection of vocs is technically difficult because most breath vocs is excreted in picomolar concentrations (parts per trillion), and most analytical instruments currently used cannot detect vocs at such low concentrations . The absence of satisfactory tools for monitoring tb therapy efficacy impedes optimal clinical management of patients, especially for extra - pulmonary tb where it is not possible to detect mtb in sputum, precluding the possibility to make a link between sputum culture and clinical outcome . The majority of publications investigating treatment response biomarkers failed to articulate the intended use and underlying tpp . Furthermore, most studies compared changes in proposed biomarkers over time during treatment without testing, or being powered to test, the correlation with patient outcome, i.e., relapse - free cure (figure 2). Study comparisons of xpert mtb / rif, smear microscopy and culture using both solid and liquid media have shown that the xpert mtb / rif assay has high sensitivity (97%) but poor specificity (49%) to identify culture positive specimens when xpert is used as a binary readout . The quantitative measurement from the xpert mtb / rif assay, showed that the change in quantitative sputum bacterial load correlated with smear grades, solid culture grades, and time to liquid culture positivity . This quantitative data may be used in the future to predict clinical outcome of patients . Considering that the xpert mtb / rif test detects dna from dead as well as live mtb, a recent study proposed to perform the quenching of dna detection from dead mycobacteria by adding propidium monoazide (which quenches pcr - mediated detection of dna from dead mycobacteria) to specifically detect only viable bacilli . This test seems promising since a positive correlation with time to positivity of mtb cultures on liquid media was reported . Concerning the host side, the development of biomarkers able to monitor mtb load is still far from reality . Recently, cliff et al . Reported that cytotoxic cell gene expression signatures, expressed at diagnosis might predict disease relapse after initial successful cure (sputum conversion), indicating that host factors are important indicators of treatment success . The first profiles of a response to tb therapy were reported by joosten et al . It has been shown that plasma vascular endothelial growth factor (vegf) concentrations at 2 weeks of therapy correlated positively with time to sputum conversion . Similarly, hemeoxygenase-1 (ho-1) and matrix metalloproteinases (mmps) levels correlated with clinical outcome of pulmonary tb, although contrasting findings were reported . This is likely due to the inhibition of mmp by co, a product of mtb - induced ho-1 activity, observed in vitro after infection with mtb in human macrophages . Other factors as il11 receptor antagonist, 2-antiplasmin, proteasome activator complex subunit 1, and serum amyloid a predicted sputum conversion with an estimated 80% sensitivity and specificity . The chemokine ip10 that has increased in the unstimulated plasma of children and adults with active tb has also been measured in dry plasma spots as biomarker for therapy response . In addition, ip10 kinetics in the first week of tb therapy has been proposed as a tool to confirm a clinical diagnosis and guide specific therapy . Radiological severity has been classified with different scores to predict treatment outcome in adults with pulmonary tb using different tools . High - resolution 3-dimensional imaging helps evaluating the pulmonary tb burden during therapy . In the lungs, a quantitative volumetric change in the uptake of 2-deoxy-2-[18f]-fluro - d - glucose (fdg) after 2 and 6 months of tb therapy has been detected by positron emission tomography / computed tomography (pet / ct) quantification and this modulation could be correlated with treatment outcome . However, due to machine equipment, complexity, cost and radiation exposure, the use of pet / ct approach is still restricted to clinical trials . As reported above modulation of cd27 evaluated by flow cytometric studies may be a novel marker not only for active tb diagnosis but also therapy monitoring . The same may hold true for the modulation of cd38, hla - dr and proliferation marker ki-67 . In analogy to cancer, an expansion of myeloid derived suppressor cells (mdscs), which have a remarkable ability to suppress t - cell responses, has been observed in the lung and blood of patients with active tb whereas a contraction is reported after efficacious anti - tb therapy . Tb therapy significantly decreased the in vitro ifn response induced by peptides selected from esat-6 and cfp-10 in patients with active tb in studies conducted in europe, uganda, and india, suggesting that this response can be a tool to monitor anti - tb treatment efficacy . Using a clinically pragmatic approach, ltbi is defined by the presence of a specific immune response detected by an ifn release assay (igra) or the tuberculin skin test (tst) (figure 3) in the absence of lung lesions of active tb in xray images, in individuals from whom it is not possible to isolate mtb . Igra [quantiferon tb gold in tubes (qiagen, venio, the netherlands; qft - git) and t-spot.tb (oxford immunotec, marlborough, ma, usa)] measure in vitro ifn production by whole blood elisa or an enzyme - linked immunospot (elispot) assay on peripheral blood mononuclear cells (pbmc), respectively . Blood is stimulated with mtb - specific antigens, which are deleted from the genome of m. bovis bcg and are not present in most environmental mycobacteria . Tst is based on skin infiltration caused by intradermal injection of purified protein derivative (ppd), which is a crude mixture of antigens many of which are shared by mtb, m. bovis, bcg and several species of environmental mycobacteria . A particular benefit of in vitro testing is that there is a laboratory test with negative and positive controls, and that one visit suffices . In contrast to the tst, these in vitro tests may discriminate true negative responses from energy . Recently an updated version of the qft - git has been launched (https://www.qiagen.com/it/about-us/press-releases/pressreleaseview?id=%7bc861949e-df50-475b-8148-b4c70034c49e%7d&lang=en). Results from ongoing studies will show if the test has a better accuracy compared to the old qft - git . It should be noted that both tst and igras share limitations: a low accuracy in immune - compromised patients, impossibility to distinguish between ltbi and active disease, which is a major issue in tb endemic areas, and low predicting values for active tb diagnosis . Several efforts have been undertaken to distinguish ltbi from active tb, with no clear success probably due to the fact that ltbi is characterized by a high heterogeneity of tb lesions that may depict as a broad spectrum of conditions that overlap in part with those seen in active disease . Some subjects show only the remnant of a waning infection, while others show a slowly progressing form of disease, or a chronic non - progressing infection . In the qft - git format the chemokine ip10 has been suggested as an alternative marker for ifn, with high accuracy in the hiv - infected patients . Besides igra, several approaches for ltbi identification have been proposed: evaluation of plasma concentrations of epidermal growth factor fractalkine, ifn, il4, monocyte chemoattractant protein (mcp)3, ip10; evaluation of serum pro - inflammatory cytokines il6, ip10, mcp1; detection of plasma levels of markers involved in the toll - like receptor 4 pathway, like soluble cd14 and myeloid differentiation-2 . A recent study on ltbi subjects demonstrated that mtb - specific cd4 + t - cells have a characteristic chemokine expression signature (ccr6cxcr3ccr4), and that the frequency of these cells is increased in ltbi subjects compared with healthy donors (129). This study suggested a possible role of specific subsets of cd4 t - cells in the containment of mtb and raises interesting questions on the possible role of these cells . In particular the transcriptional profile of ccr6cxcr3ccr4cd4 t revealed characteristics important for tb containment, since gene expression profiles correlated with tb susceptibility genes, enhanced t - cell activation, cell survival and cytotoxic response . Stimulation with the so called mtb latency antigens, such as rv1733c, rv2029c, rv2628 and hbha, seem promising tools to identify ltbi subjects and distinguish recent ltbi from remote ltbi . If confirmed in larger studies, these results may have important implications for risk stratification when deciding to initiate preventive therarpy . As discussed above, among the t - cell based biomarkers, polyfunctional t - cells have been explored as potential biomarkers by multiparametric flow technology . In animal models, i.e. Mice, vaccine - induced protection against mtb infection however the correlation of this polyfunctional cytokine profile with protective efficacy of bcg vaccination was absent in humans, as reported in a cohort of bcg - immunized infants monitored for 2 years . Similar results were obtained in a tb vaccine study based on mva85a (modified vaccinia virus ankara expressing antigen 85a . In addition, polyfunctional t - cells have been reported at increased frequencies in active tb . These studies suggest that polyfunctional t - cells play a role in vaccine induced protection against tb in animal models, but do not represent a correlate of bcg - induced or natural protection in humans, as they are also present in active tb . Th17 cells are long lived and can become memory cells, despite expressing markers characteristic of terminally differentiated cells, and have self - renewal capacities . Th17 cells preserve the molecular signature that is characteristic of t stem cell memory (tscm). It has been shown that mice lacking il17a receptor, despite being able to control acute infection, are unable to stably maintain long - term control of mtb infection . Recently it has been shown that the requirement for il17 in host protection against mtb in the mouse model is mtb strain dependent . Il17 was dispensable for protective immunity against the lab - adapted strain h37rv while necessary for protection against mtb hn878, a hypervirulent mtb strain . Il17 is important in vaccine - mediated protection in tb . Following bcg and esat-6 peptide immunization, antigen - specific th17 cells localized in the lungs and were critical for the recruitment of th1 cells to the lung after mtb challenge . Innate immune responses are conventionally thought to provide immediate protection before the adaptive immune response is generated, thus contributing towards early containment of the pathogen . However, a growing number of studies suggests their involvement in the recall response and protection during secondary challenge, as shown by the generation and long - term maintenance of nk cells in response to viral infections such as those with cytomegalovirus (cmv) and hepatitis c virus (hcv). There are studies ongoing to evaluate the role of nk memory cells in mtb protection . T - cells recognize a variety of unrestricted, unprocessed and small phosphate antigens . In the mouse model, during the early phase of infection with mtb, t - cells secreting ifn and il17 with cytotoxic effector functions are recruited to the lungs . Expansion of t - cells in response to bcg vaccination and their presence in mtb - specific recall response are also reported in the nonhuman primate macaque model . In addition, t - cells reduce the viability of intracellular mtb via mechanisms dependent on perforin or granulysin . These data, together, indicate not only that t - cells are present during mtb infection and following bcg vaccination but that, in humans, they are capable of restricting mtb growth . Also many other components of the innate immune system participate in the control of mtb infection, but this is beyond the scope of this brief review . There is a pressing need for new biomarkers in tb at all different levels discussed above . Though studies on new candidate biomarkers are numerous, validation and independent confirmation are rare, unfortunately . Efforts are needed to reduce the gap between the exploratory up - stream identification of candidate biomarkers, the validation of biomarkers against clear clinical endpoints in different populations, and the development of simple point of care tests for use in low resourced settings. |
Molluscum contagiosum (mc) is a commonly encountered cutaneous viral infection in children, its hallmark being spontaneous resolution . Despite its benign nature, active therapy may be desirable to prevent further spread, relieve symptoms, prevent scarring, and for cosmetic, and social reasons . Parental concern is valid as these lesions appear unsightly and the affected children may face isolation by their peers . Treatment modalities include: mechanical destruction by curettage, cryotherapy or evisceration; chemical destruction of the lesions using potassium hydroxide (koh) or cantharidin; immunomodulatory agents such as topical imiquimod, tretinoin and oral cimetidine; and the antiviral agent cidofovir . In spite of options galore, no single therapy has consensus approval for the treatment of mc in the pediatric age group . Mechanical destruction of lesions is the easiest method among adults, but in children, owing to fear and lower tolerance of pain, these methods cannot be used routinely . Studies examining response to laboratory pain stimuli in children have shown that asians demonstrated more pain sensitivity compared to other ethnic groups . Furthermore, parents do not favor frequent visits to the hospital as children exhibit high levels of anticipatory anxiety . Thus, there is a need for a therapeutic modality that can be used at home and is not painful . It has been used in various concentrations, that is, 5%, 10%, and 20%, for the treatment of mc . It has been shown to possess an excellent safety profile in the treatment of cutaneous viral diseases . Taking this into consideration, we undertook a randomized comparative study to assess and compare the efficacies of 10% koh aqueous solution and 5% imiquimod cream for the treatment of mc in the pediatric age group . After obtaining permission from the institutional ethics committee, 40 patients between the age group of 1 - 18 years with minimum 3 lesions of mc were recruited to this study . Patients with eyelid involvement, secondary infection and history of hypersensitivity to imiquimod were not enrolled in the study . Details of symptoms, duration, family history, site, and number of lesions were recorded . Patients were divided by the lottery method into two groups; a and b, each containing 20 patients . Patients in group a were given 5% imiquimod cream in 0.25 g sachets (galderma) and their parents advised to apply it as a thin layer, rubbing it until it was no longer visible . Patients in group b were given 10% koh solution with instructions to the parents to apply using a tooth pick after covering the surrounding area with petrolatum and avoid any spillage over normal skin . Both groups were advised to apply the respective agents at night and wash off in the morning, 3 times a week for 12 weeks or until the lesions cleared, whichever was early . Patients were followed up at 4, 8 and 12 week of treatment . On each visit, clinical response to treatment, efficacy, and tolerability parameters were evaluated . The clinical response to treatment was graded as complete clearance, partial clearance and no change . Data were analyzed using chi - square test, fishers exact test and friedman test, whereas pairwise comparison was done by wilcoxon signed rank test and mann - whitney test . Maximum number of cases were in the age group of 5 - 10 years (42.5%) and females 24/40 (60%) outnumbered males 16/40 (40%). There was no significant variation between the two groups in terms of age and gender . A positive family history was obtained in 18 of the 40 patients (45%). Only three patients gave history of atopy, out of which 2 patients had eczema surrounding the lesions . Most common site of occurrence was the face followed by chest and neck, which were involved in 22, 9, and 6 patients, respectively . At the end of this study, group a showed complete clearance of lesions in 10 (50%) out of the 20 patients, with none showing clearance by 4 weeks, 2 patients showing complete clearance by 8 weeks and the rest by 12 weeks . Group b showed total clearance of lesions in 17 (85%) out of 20 patients, out of which 2 patients were cleared of lesions by 4 weeks, another 5 by the end of 8 weeks and 10 more patients by 12 weeks [figure 1]. Number of patients who showed complete disappearance of lesions initial distribution of number of lesions was statistically similar between two groups with p = 0.470 . A steady decline in the mean value of the lesions was noted in both the study groups throughout the follow - up period . The mean lesional count decreased from 7.20 3.381 standard deviation (sd) to 0.90 1.294 sd at the end of 12 weeks in patients treated with imquimod [figure 24]. The comparison between the number of lesions at baseline and the number of lesions at week 12 was found to be statistically significant with p = 0.000 in group a patients . The mean lesional count decreased from 7.10 5.057 sd to 0.20 0.523 sd at the end of 12 weeks with 10% koh solution [figure 57]. This reduction in the number of lesions at the end of 12 weeks was statistically significant p = 0.000 in group b patients . Disappearance of lesions following treatment with imiquimod before and after treatment with imiquimod pigmentary disturbance seen following treatment with potassium hydroxide before and after treatment with potassium hydroxide overall, a better response was shown by patients who received koh as compared to those who received imiquimod, and the difference was statistically significant as p = 0.010 at 1 and 2 follow - up; and p = 0.019 at the last follow - up [table 1]. Comparison of reduction in the lesional counts between the two groups five (25%) of 20 patients receiving imiquimod developed new lesions whereas no new lesions were seen in those who received koh . Of the 20 patients who received koh solution, 10 (50%) showed adverse effects, whereas of the 20 patients who received imiquimod, only 4 (20%) showed adverse effects . The result was significant statistically with p = 0.18 . The most common side effect observed after treatment with koh was pigmentary disturbances, 6 out of 20 patients showed hypopigmentation, whereas 4 showed hyperpigmentation and one patient showed ulceration [figure 8]. Five of these patients also complained of burning sensation . The most common adverse effect seen with imiquimod was erythema, (2 patients). A comparison of adverse effects seen in both the groups was highlighted in figure 9 . The faster onset of action and better efficacy of 10% koh can be ascribed to its potent tissue destructive ability whereas imiquimod acts by inducing cell mediated immunity, hence the delayed response . This can also explain the continued appearance of new lesions in patients receiving imiquimod and not koh as the early destruction caused by koh may prevent autoinoculation . At the end of 12 weeks, metkar et al . The authors found complete clearance of lesions in 8 (57%) out of 14 patients with imiquimod, and 8 (42.1%) out of 19 patients with koh . This is in contrast with the finding of our study . In the study by seo et al ., absolute clearance of lesions was seen in 8 (57%) of 14 patients with imiquimod, and 10 (77%) out of 13 patients with koh, which is in accordance with the sfindings of our study . This can be attributed to the fact that there was only one giant mc lesion in our study, the remaining being small lesions . In the study by mahajan et al . Puri observed complete clearance of genital mc lesions in 27 (75%) of the 36 patients with once daily application of 5% imiquimod . Both the studies indicate that daily application of koh and imiquimod brings about better efficiency and at a faster rate . Four (20%) out of 20 patients receiving imiquimod showed adverse effects, with 2 showing erythema, 1 showing scaling and 1 showing hypopigmentation . In the study conducted by barba et al . This may be attributed to the daily application of imiquimod in this study, as opposed to thrice weekly in ours . Mosher and lio reported febrile seizures and cytokine dermatitis with the use of imiquimod, which we did not come across . In those who received 10% koh, 10 (50%) out of 20 patients showed adverse effects, 6 patients showed hyperpigmentation and 4 showed hypopigmentation, 5 of these patients complained of burning . Ulceration with secondary infection, erythema, itching and scaling were seen in one patient each . Parent of the patient who developed ulceration reported having applied excessive amounts of koh 10% hoping for a faster recovery . It was found that superficial ulceration could not be avoided even with brief careful application of koh by the parents . In the same study, 2 patients had to discontinue due to severe stinging . This could have occurred due to daily application of 20% koh in this study in contrast to thrice weekly application of 10% koh in our study . Romiti et al . Did a study on 5% koh in the treatment of mc and they found that it was tolerated well by children, the findings in the study by rajouria and co - workers further strengthened this view . Thus, it can deduced that the unfavorable aftermath of koh can be reduced by using it in a lower concentration . In their comparative study, seo et al . Observed adverse effects including erythema, ulceration, scaling and hyperpigmentation in 6 (46%) out of 13 patients in the imiquimod group and 6 (42%) out of 14 patients in the koh group . Two patients in the imiquimod group and 1 in the koh group discontinued the treatment because they could not tolerate the local irritation . In the study conducted by metkar et al ., 15 (78.9%) out of 19 on koh, whereas 10 (55.5%) out of 18 patients on imiquimod developed adverse effects . Systemic side effects of imiquimod were not seen and no patient discontinued the treatment due to adverse effects . Both 5% imiquimod cream and 10% koh solution have turned out to be modalities that are safe, efficacious, and easily usable at home . In a resource poor country like ours, curettage would be the best option, but in the case of recurrence of lesions, children may not allow to repeat the procedure owing to pain and fear . In this scenario, judicious application of 10% koh solution seems to be prudent as it is inexpensive and efficient, albeit with a few minor adverse effects . If the parents can bear the cost without any serious detriment, then 5% imiquimod cream appears to be a better option as its adverse effects are almost negligible . Further studies need to be done with respect to various concentrations of koh and a standardized mode of delivery of the drug . What's new: 5% imiquimod cream, which has been used successfully in the treatment of genital warts, has proven its mettle in resolving lesions of mc . Koh solution when used in the concentration of 10% is effective and safe in treating mc. |
The assessment of intravascular volume and the adequacy of volume resuscitation are among the most difficult clinical challenges . Systolic blood pressure, heart rate and urine output change minimally in early hemorrhagic shock . Hypotension, tachycardia, cold extremities, decreased urine output and poor capillary refill are only present in patients who have lost in excess of 30% of their blood volume (classiii hemorrhage). Furthermore, both the central venous pressure and the changes in the central venous pressure in response to volume loading are poor indicators of intravascular volume and recruitable cardiac index . While flow to the brain and the myocardium is preserved in patients with' compensated shock', splanchnic and renal perfusion may be seriously compromised . Splanchnic hypoperfusion leads to both functional and structural changes in the gut mucosa, with increased permeability and translocation of bacteria and bacterial products . Increased mucosal permeability has been strongly associated with the development of the multiorgan dysfunction syndrome . The expedient detection and correction of tissue hypoperfusion associated with' compensated shock' may limit organ dysfunction, may reduce complications and may improve patient outcome . It is probable that the earlier tissue hypoperfusion is detected and corrected, the greater the likelihood that outcome will be improved . Indeed, rivers and colleagues reported a 32% relative reduction in the 28 day, all cause mortality of patients with severe sepsis who received early aggressive volume resuscitation in the emergency department . Used the central venous oxygen saturation as the endpoint of resuscitation in the intervention group, while treatment in the control group was guided by standard clinical endpoints including the central venous pressure . While their study clearly demonstrates the value of early aggressive volume resuscitation, the use of central venous oxygen saturation to guide early resuscitation is not practical and has important limitations . The base excess (be) has become the standard endpoint of resuscitation in trauma patients . Remarkably, while the be has been demonstrated to be of prognostic value, it has never been assessed prospectively in trauma patients . The use of the be is based on the principle that tissue hypoxia associated with poor perfusion will result in the generation of hydrogen ions and a metabolic acidosis . However, it is probable that tissue hypoperfusion may occur in the absence of a significant change in the be . Furthermore, as significant time is required for the liver and kidney to regenerate bicarbonate, it can be expected that there will be a long lag phase between the correction of intravascular volume and normalization of the be . Both of these assumptions are elegantly demonstrated in the study by totapally and colleagues reported in the present issue of critical care . In a rat hemorrhage model these authors demonstrated that the be responded slowly to changes in intravascular volume and that there was a significant increase in the be only when the mean arterial blood pressure fell by greater than 50% . However, totapally etal . Demonstrated that changes in the esophageal carbon dioxide gap closely mirrored changes in the intravascular volume . Similar findings have been reported by other investigators . In patients with penetrating trauma, baron and colleagues demonstrated that sublingual carbon dioxide measurements correlated well with the degree of blood loss . Both ivatury and colleagues and kirton and coworkers have demonstrated that gastric intramucosal ph correlates well with the degree of injury and that optimizing the gastric intramucosal ph in the first 24 hours following trauma is associated with a reduction in the incidence of organ failure and death . The study by totapally and colleagues suggests that the be is an insensitive indicator of the degree of the intravascular volume deficit following hemorrhage and that it responds slowly to volume resuscitation . Esophageal and sublingual capnometry, however, appear to provide near instantaneous information regarding the degree of the volume deficit and the adequacy of volume resuscitation . This technology is simple and noninvasive, and is ideally suited for use in the emergency room and the trauma bay . The esophageal or sublingual pco2 gap may prove to be a useful endpoint for the resuscitation of trauma victims . The author has received a research grant from optical sensors inc, minneapolis, mn, usa, the manufacturer of the nellcor n-80 capnoprobe sl device. |
During july and august 2012, investigators from cdc s viral special pathogens branch reviewed shipping records from facility b and subsequent distributors and notified health departments in states that had received potentially infected mice during january 1may 7, 2012; frozen mice were considered a low public health risk and were not traced . Health departments were provided with a list of facilities that had purchased these mice, educational resources about lcmv, and an algorithm to determine whether potentially infected mice remained at these purchasing facilities resulting from the presence, comingling, or breeding of these mice, which would maintain lcmv among the mouse population (figure 1). As a result of varying state statutes concerning regulation and licensing of pet stores and animal breeders or distributors, the government agencies that had jurisdiction to perform these investigations included local and state departments of public health, environmental health, food safety, and agriculture . Algorithm used to determine whether mice were potentially infected with lymphocytic choriomeningitis virus (lcmv) during a multistate investigation, united states, 2012 . This algorithm was used to determine whether 1) potentially infected mice remained at the facilities being assessed, 2) mice from the original shipment remained, 3) offspring from these mice remained, or 4) shipments of mice had been comingled or had shared equipment with mice from the original shipment . Lcmv is easily maintained in a mouse colony, and a clear break among the population (i.e., a time when no remaining mice are maintained and equipment is disinfected) is necessary to ensure that no ongoing infection continues . State investigators interviewed purchasing facility managers by telephone, mail, email, or in person to determine whether potentially infected mice remained on the premises and to encourage euthanization of these mice . Interviews also assessed whether pregnant, ill, or immunocompromised employees might have been exposed to lcmv by directly handling potentially infected mice or bedding or equipment used for the mice . Because of risk for severe disease, facility managers were asked to offer serologic testing to these employees for lcmv igm and igg, which was performed by cdc by using elisa as described (10). No additional case - finding activities were conducted . Because of resource limitations, diagnostic testing of live mice at purchasing facilities was not conducted . Reviews of shipping records indicated that 304,000 live mice distributed by facility b were shipped to 561 purchasing facilities: 543 pet stores, 11 breeders or distributors, and 7 zoos or aquariums in 21 states, potentially exposing thousands of employees and pet store mouse purchasers to lcmv . Facility b had shipped mice to 4 subsequent distributors; the largest was located in georgia, and it had shipped> 183,000 mice to 420 purchasing facilities in 16 states (figure 2). Interviews of facility managers at purchasing facilities revealed that 48% still had potentially infected mice;> 10,000 mice were subsequently euthanized . The most common reason for still having potentially infected mice was comingling of rodent shipments, followed by breeding or still having mice from the original shipments . The distribution of mice potentially infected with lymphocytic choriomeningitis virus originating from facility a to 500 pet stores and other animal facilities in 21 states, united states, 2012 . Serologic testing was performed on blood samples from 34 pet store or zoo employees from 6 states who self - identified as pregnant or ill, were potentially exposed to lcmv, and agreed to serologic testing . Fourteen were pregnant; 1 had aseptic meningitis; and 23 reported nonspecific symptoms including fever, headache, body aches, cough, and vomiting . These captive feeder mice had a wide and complex distribution chain, potentially exposing thousands of persons to lcmv . No additional human cases were identified after distribution of these mice; none of the pet store or zoo employees tested had serologic evidence of infection . Although no additional human cases were identified, euthanasia of all potentially infected rodents was recommended to mitigate potential risk . Wild mice that access captive breeding populations are often the source of infection of captive rodent populations (8,11). After being introduced, lcmv transmission is easily maintained among mouse colonies and is difficult to recognize because mice do not appear ill . Because persistently infected mice pass infection to their offspring, the number of infected mice in a breeding colony can quickly multiply . Mice can be persistently infected without having serologic evidence of infection (12); thus, lcmv can be missed by serologic screening alone . Therefore, preventing introduction of the virus into breeding colonies, depopulation of infected rodents, and correct use of personal protective equipment are the most efficient ways to mitigate human exposure . We recommend preventive measures at each point in the distribution process, both domestically and abroad (table) (1315). More research is needed to develop methods for detecting lcmv in rodents at distributors and pet stores . Employees tested were a fraction of those who had had contact with potentially infected mice . Also, pet store mouse purchasers and purchasing facility employees were difficult to contact, and no pet store customers were tested . Frozen feeder mice are considered pet food and can be regulated by the food and drug administration (fda), but neither fda nor the us department of agriculture has the authority to regulate live mice and rats because they are not regulated under the animal welfare act (7 cfr 2132, may 13, 2002, www.aphis.usda.gov/animal_welfare/downloads/awa/awa.pdf) and the food, drug and cosmetics act (21 cfr 500, april 1, 2012, www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfcfr/cfrsearch.cfm?cfrpart=500&showfr=1). Therefore, regulatory authority falls to the states, which have an array of regulations governing the handling, breeding, and distribution of rodents, including the licensing of pet breeders and distributors (15; thomas edling, pers . Because of the lack of consistent regulation, we recommend that state and federal partners and rodent industry advisory groups work with breeders, distributors, and pet stores to increase awareness of lcmv infection and implement recommended best practices (table) to prevent introduction of lcmv into captive rodent populations, prevent subsequent dissemination of potentially infected rodents, and reduce the potential for human exposure and disease among employees and consumers of pet stores and rodent breeding facilities . Multistate lcmv outbreak, united states, july 2012: recommendations for trace - back and safe disposal of potentially lcmv - infected mice. |
About 40% of all tumors located in the posterior fossa are low - grade astrocytomas [7, 15, 17]. When these tumors are totally resected, the prognosis is very favorable with more than 90% of patients being cured without additional treatment . The overall survival rate for children who had gross total resection of low - grade gliomas was reported to be 99% . However, after incomplete resection, the prognosis is unpredictable [5, 10, 13]. In many cases, the tumors will progress; however, in some cases, the tumor will have arrested growth or even tumor regression will occur [5, 10]. Relatively little attention has been paid in the literature in determining the incidence of arrested growth or spontaneous regression after partial resection of low - grade cerebellar astrocytomas and documenting such cases in detail . There is controversy about whether patients with tumor remaining after surgery should receive radiation therapy . It is also unclear whether only patients with incomplete resection require follow - up and for how long . Because of the lack of information on arrested growth and tumor regression after incomplete resection of low - grade cerebellar astrocytomas in children, the aim of this study was to provide more information on these phenomena by reviewing cases of patients with cerebellar astrocytoma who underwent surgery at our hospital . We reviewed all cases of patients under 16 years of age who were diagnosed with cerebellar astrocytoma and underwent surgery at kaohsiung medical university hospital from january 1983 to december 2011 . Medical charts, imaging findings, operative notes, histopathological reports, and survival times of 12 patients with cerebellar astrocytoma were reviewed for the purpose of evaluating the patients prognosis; patients lost to follow - up were excluded . The clinical data for the 12 patients in this study are summarized in table 1 . Six patients were boys and six were girls . Their age at the time of diagnosis ranged from 3 to 16 years . Nine patients (75%) presented with gait disturbance, eight (66.7%) with headache, six (50%) with vomiting, and four (33.3%) with a visual problem . The tumor was located in the midline in seven patients (58.3%), in the left cerebellum in three patients (25%) and in the right cerebellum in two patients (16.7%).table 1clinical features of 12 children with cerebellar astrocytomacase no.age at diagnosis (years)gendertumor sitesurgeryhistologyradiotherapymalignant transformationvp shuntreoperationoutcomefollow - up (years)115mmidlinesubtotalgr i++ (gr i to gr ii)+after 2 yearsdeceased at age 382329fmidlinesubtotalgr i++ (gr i to gr iii)+after 15 yearsgood25315fleft cerebellumsubtotalgr ii+after 8 yearsgood2443fleft cerebellumtotalgr iafter 4 yearsgood21515mmidlinetotalgr ii+good20616fleft cerebellumsubtotalgr i+after 6 yearsgood18714mleft cerebellumtotalgr igood1887mmidlinesubtotalgr ii+good1695mmidlinesubtotalgr igood12106fmidlinesubtotalgr i+after 2 yearsgood101116fright cerebellumtotalgr igood91210mright cerebellumtotalgr igood3 clinical features of 12 children with cerebellar astrocytoma the tumor was totally removed in five patients (41.7%) whereas seven patients (58.3%) had only partial tumor removal . There were no signs of type 1 neurofibromatosis such as neurofibromas or caf au lait spots over the body . Histological examination of surgical specimens showed that nine tumors were classic pilocytic astrocytoma (grade i) and three were diffuse (grade ii) astrocytoma . One patient who had total resection (case 4) and five patients who had partial resection (cases 1, 2, 3, 6, and 10) underwent a second surgical operation . In addition, three patients with subtotal resection, all of whom had the tumor located in the midline, received a ventriculoperitoneal shunt . Among the seven patients who had incomplete tumor resection in the initial operation, five patients (71.4%) had tumor progression detected during follow - up and two patients (28.6%) did not have any tumor progression detected during follow - up of 17 years (case 6) and 11 years (case 9). The time at which progression occurred is indicated by time of reoperation in table 1 . In one of these two patients who did not have tumor progression (case 9), serial t1 mri with gadolinium demonstrated tumor regression from february 2008 to january 2011 with the tumor getting smaller (fig . Among the five patients who had total resection, one patient (case 5) with diffuse astrocytoma (grade ii) received radiation therapy . Five of the patients with subtotal resection were treated with radiation therapy, which is still used in some hospitals for patients with subtotal resection of cerebellar low - grade astrocytomas . Post - irradiation follow - up of the patients irradiated for residual tumor revealed that in one patient (case 1) there was malignant transformation from grade i to grade ii at 2 years after surgery and in another patient (case 2) there was malignant transformation from grade i to grade iii (anaplastic astrocytoma) at 15 years after surgery . One of the patients (case 3) with partial tumor resection who was treated with radiation therapy developed radiation - induced anaplastic meningioma over the supratenorium after 23 years of follow - up (fig . 1serial brain mri scans of case 9 show regression of the cerebellar astrocytomafig . 2 a mri scan of case 3 reveals anaplastic meningioma over the supratenorium left parietal lobe . B brain ct scan reveals total removal of the meningioma serial brain mri scans of case 9 show regression of the cerebellar astrocytoma a mri scan of case 3 reveals anaplastic meningioma over the supratenorium left parietal lobe . B brain ct scan reveals total removal of the meningioma among the 12 patients, 11 were alive at the end of the study . One patient (case 1) died of pneumonia 23 years after undergoing surgery . The clinical data for the 12 patients in this study are summarized in table 1 . Six patients were boys and six were girls . Their age at the time of diagnosis ranged from 3 to 16 years . Nine patients (75%) presented with gait disturbance, eight (66.7%) with headache, six (50%) with vomiting, and four (33.3%) with a visual problem . The tumor was located in the midline in seven patients (58.3%), in the left cerebellum in three patients (25%) and in the right cerebellum in two patients (16.7%).table 1clinical features of 12 children with cerebellar astrocytomacase no.age at diagnosis (years)gendertumor sitesurgeryhistologyradiotherapymalignant transformationvp shuntreoperationoutcomefollow - up (years)115mmidlinesubtotalgr i++ (gr i to gr ii)+after 2 yearsdeceased at age 382329fmidlinesubtotalgr i++ (gr i to gr iii)+after 15 yearsgood25315fleft cerebellumsubtotalgr ii+after 8 yearsgood2443fleft cerebellumtotalgr iafter 4 yearsgood21515mmidlinetotalgr ii+good20616fleft cerebellumsubtotalgr i+after 6 yearsgood18714mleft cerebellumtotalgr igood1887mmidlinesubtotalgr ii+good1695mmidlinesubtotalgr igood12106fmidlinesubtotalgr i+after 2 yearsgood101116fright cerebellumtotalgr igood91210mright cerebellumtotalgr igood3 clinical features of 12 children with cerebellar astrocytoma the tumor was totally removed in five patients (41.7%) whereas seven patients (58.3%) had only partial tumor removal . There were no signs of type 1 neurofibromatosis such as neurofibromas or caf au lait spots over the body . Histological examination of surgical specimens showed that nine tumors were classic pilocytic astrocytoma (grade i) and three were diffuse (grade ii) astrocytoma . One patient who had total resection (case 4) and five patients who had partial resection (cases 1, 2, 3, 6, and 10) underwent a second surgical operation . In addition, three patients with subtotal resection, all of whom had the tumor located in the midline, received a ventriculoperitoneal shunt . Among the seven patients who had incomplete tumor resection in the initial operation, five patients (71.4%) had tumor progression detected during follow - up and two patients (28.6%) did not have any tumor progression detected during follow - up of 17 years (case 6) and 11 years (case 9). The time at which progression occurred is indicated by time of reoperation in table 1 . In one of these two patients who did not have tumor progression (case 9), serial t1 mri with gadolinium demonstrated tumor regression from february 2008 to january 2011 with the tumor getting smaller (fig . 1). Among the five patients who had total resection, one patient (case 5) with diffuse astrocytoma (grade ii) received radiation therapy . Five of the patients with subtotal resection were treated with radiation therapy, which is still used in some hospitals for patients with subtotal resection of cerebellar low - grade astrocytomas . Post - irradiation follow - up of the patients irradiated for residual tumor revealed that in one patient (case 1) there was malignant transformation from grade i to grade ii at 2 years after surgery and in another patient (case 2) there was malignant transformation from grade i to grade iii (anaplastic astrocytoma) at 15 years after surgery . One of the patients (case 3) with partial tumor resection who was treated with radiation therapy developed radiation - induced anaplastic meningioma over the supratenorium after 23 years of follow - up (fig . 2 a mri scan of case 3 reveals anaplastic meningioma over the supratenorium left parietal lobe . B brain ct scan reveals total removal of the meningioma serial brain mri scans of case 9 show regression of the cerebellar astrocytoma a mri scan of case 3 reveals anaplastic meningioma over the supratenorium left parietal lobe . B brain ct scan reveals total removal of the meningioma among the 12 patients, 11 were alive at the end of the study . One patient (case 1) died of pneumonia 23 years after undergoing surgery . In this study, we analyzed the long - term follow - up results of 12 patients with childhood cerebellar astrocytoma: five of whom had total tumor resection and seven of whom had subtotal tumor resection . As expected, total tumor removal was an important prognostic factor . However, two patients with subtotal resection did not have tumor progression and one of these patients had spontaneous tumor regression which was well documented on serial mri . Half of the patients, including five with subtotal resection were treated with radiation therapy . We found that complete resection of cerebellar astrocytoma is an important prognostic factor, indicating a more favorable prognosis than subtotal resection . This was also the conclusion of a much larger study by villarejo et al . Who reviewed 203 cases of low - grade cerebellar astrocytoma . They also found that that location, size, and histology of tumors have a significant effect on prognosis; the tumors located in one hemisphere, that are small in size, and are either cystic or have a cystic posterior nodule have a better prognosis . However, beebe et al . In a study of 103 children with low - grade cerebellar astrocytomas found that cognitive and adaptive outcome was not related to tumor location . In a prospective study of 518 children with low - grade glioma, wisoff et al . They found that the only factor that was highly predictive of progression - free survival in multivariate analysis was gross total resection; location, histological type, and age were not significant independent predictors of progression - free survival . A number of studies have looked at various measurements of outcomes in patients with cerebellar astrocytomas, although without considering whether tumors were completely resected or not during surgery . In a study that looked at not only neurological outcomes of surgery but also behavioral and emotional adjustment and health - related quality of life (hrqol) in children with low - grade cerebellar astrocytomas, it was found that although 43% of patients had neurological sequelae, 19% had cognitive deficits that caused significant problems in schools, and 27% had emotional adjustment disturbances, the patients rated their hrqol as normal or in some instances actually higher than healthy controls . In contrast, it has been reported that in patients treated for low - grade astrocytoma, qol was significantly decreased in every domain except for emotions . It has also been found that in patients with cerebellar astrocytoma who were treated surgically, during follow - up ranging from 1 year to almost 9 years, numerous deficits in various combinations and different degrees were detected including apraxia, motor neglect, and dysarthric characteristics plus other deficits such as language, memory, and behavioral problems . The authors noted that whereas cerebellar pilocytic astrocytoma is generally considered to be a benign tumor that is associated with a good long - term quality of life, they found that following surgical treatment it results in long - term neurocognitive disturbances resulting in a high percentage of children needing special education . Galloway et al . Studied 370 consecutive patients with solid tumors or leukemia who were treated with curative radiotherapy . They found that 18 second tumors occurred in 16 patients and, that during long - term follow - up, the risk for second tumor does not plateau . The authors concluded that despite the risk of a second tumor the primary threat to survival is failure to control the primary tumor and therefore radiotherapy should be used selectively . In our study, six patients received radiotherapy and two cases (cases 1 and 2) had malignant transformation of tumor, and another (case 3) had radiation - induced anaplastic meningioma develop over the supratenorium . Radiation - induced meningiomas have been reported in the literature [4, 9]. We do not recommend radiation therapy for partial resection of childhood cerebellar astrocytoma because it has not been demonstrated in most studies to reduce the rate of recurrence or prolong overall survival . It should be noted, however, that hadjipanavis et al . Found radiotherapy to be useful for treating patients with recurrent or subtotal resection of pilocytic astrocytoma . We also do not recommend radiotherapy because cerebellar astrocytomas are insensitive to radiation therapy and there is a risk of radiation - induced necrosis as well as second malignancy . The rate of malignant transformation was very high in our study (33.3%), especially considering that such transformation is considered to be a rare event . One possibility is a biopsy sampling error 2 years after surgery . For patients who have tumor progression, surgery for tumor removal our study showed that after partial excision a small proportion of cerebellar astrocytomas do not progress or even regress . Among the seven patients in our study with partial resection, in one there was arrested growth and in another there was regression; the other five patients had progression . These phenomena of arrested growth and regression have been reported in a number of studies [5, 7, 1114]. . Found that among 50 residual cerebellar astrocytomas, 16% demonstrated arrested growth and 32% demonstrated spontaneous regression . As have a number of other authors, we recommend a wait and see policy for patients with partial resection in which the patients are followed up with mri [5, 7, 11, 12]. The mechanism of spontaneous regression of cerebellar astrocytoma is unknown . Among the various mechanisms suggested have been immunologic mechanisms, induction of differentiation, and elimination of a carcinogen, ischemic tumor necrosis, and apoptosis . . Found that the mean time for tumor regression in their series was 13.6 months which led them to suggest that the mechanism involved ischemic necrosis and/or apoptosis . . Showed that an apoptosis marker, apoptag, was positive within the cerebellar astrocytoma of a patient with tumor regression, which was an indication that the mechanism of regression may have involved the apoptosis - related genes . Assessment of long - term outcome did not include evaluation of cognitive function, emotional disturbances, behavior disorders, educational problems, or hrqol . We have documented that patients with subtotal removal of cerebellar astrocytoma can have arrested tumor growth or spontaneous tumor regression during long - term follow - up . Following partial resection of pediatric cerebellar astrocytoma, we recommend that the patients be followed up a wait and see approach with surveillance using mri . We found that several tumors treated with radiotherapy after surgery had malignant transformation and do not recommend adjuvant radiation treatment for children with cerebellar astrocytoma who have subtotal resection . More research is needed on the prognosis of patients with subtotal resection of cerebellar astrocytoma. |
Over the past 30 years there has been a dramatic increase in the prevalence in obesity in the us, from 18% in the 80s to approximately 35% in 2010 [1, 2]. In parallel, there has been an increase in the prevalence of asthma from 30.7 to 53.8 per thousand population between 1980 and 1994 . A prospective epidemiologic study demonstrated a positive independent association between obesity and the incidence of adult onset asthma . Obesity is associated with a dose - dependent increase in the odds of incident asthma [8, 9]. Leukotrienes (lt) are potent lipid mediators of inflammation derived from arachidonic acid known to play a critical role in the pathogenesis of asthma . Arachidonic acid is acted upon by the enzyme 5-lipoxygenase to synthesize ltb4 and cysteinyl leukotrienes (cys - lt c4, d4, and e4). Both cys - lt and ltb4 are released by neutrophils, eosinophils, mast cells, peripheral blood monocytes, and macrophages and are involved in the pathogenesis of obstructive lung disease . Lt synthesis has been shown to be increased in peripheral blood leukocytes [11, 12], airway macrophages, and eosinophils from asthmatics compared to cells from healthy controls . Interestingly, obese subjects that had reduced responsiveness to inhaled corticosteroids with increasing body mass index (bmi) demonstrated a stable response to treatment with the lt modifier, montelukast . Therefore, lts may play a greater role in the pathogenesis of asthma in obese subjects compared to nonobese patients . Obesity is a proinflammatory state associated with increased systemic cytokine levels such as tumor necrosis factor, interleukin-1, and interleukin-6 and other classical mediators produced by adipocytes termed adipokines . One such adipokine is leptin, a 16 kd protein synthesized by adipocytes and involved in the regulation of food intake and energy balance . Levels of plasma leptin correlate with total body fat stores, being elevated in obesity and reduced in weight loss . Leptin has been shown to enhance proinflammatory cytokine expression, specifically to upregulate th1 cytokines and the eicosanoid, lt [19, 20]. In contrast to the proinflammatory effects of leptin, adiponectin is predominantly an anti - inflammatory mediator, mainly involved in glucose control and fatty acid metabolism, that is synthesized in adipose tissue and plasma levels of adiponectin are decreased in obesity . A role for leptin in promoting pulmonary inflammation and bronchoconstriction has been demonstrated in murine models of obesity and asthma [21, 22]. However, data supporting a role for leptin in the prevalence or severity of asthma in adult humans, independent of bmi, are inconsistent . Adiponectin has also been shown to play a role in animal models of asthma but, in contrast to leptin, this adipokine attenuates pulmonary inflammation [24, 25]. The impact of reduced serum adiponectin levels in humans with asthma is, like leptin, not clearly defined . Preliminary data from our laboratory demonstrate increased plasma leptin levels in obese asthmatics compared to obese nonasthmatics . Leptin levels also tended to increase in asthmatics compared to nonasthmatics whether they were obese or nonobese . In view of the positive association between leptin and lt level, we examined cys - lt levels in the exhaled breath condensate (ebc) and peripheral blood leukocytes of asthmatics compared to nonasthmatics and obese compared to nonobese subjects . All subjects were 1865 years old with or without asthma, male and female, with ethnicity and race distribution of the community's population seen at the university of michigan health centers . The nonasthmatic subjects were healthy volunteers without a history of lung disease . Fully informed consent was obtained from each subject before entry into the study . Bmi calculations were determined by dividing the weight by the square of the height (kg / m). Asthmatic and nonasthmatic subjects were studied based on bmi, (1) normal bmi (2024.9 kg / m) and (2) obese bmi (> 30 kg / m) to maximize potential differences on cys - lt synthesis . Diagnosis of asthma was based on history, physical exam, and pulmonary function testing including peak expiratory flow rate (pefr) (l / min) (asthmacheck, respironics, inc . Approximately 50% of the asthmatics had spirometry, with forced expiratory volume in one - second (fev1) measurements . Peak flow meter and bmi values were determined in all subjects on the day of the study . An asthma questionnaire was administered which includes frequency of day and night time asthma symptoms . Exclusion criteria included current smokers within the past 6 months and previous smokers> 20 pack years, intercurrent infection, and treatment with lt - modifier drugs, aspirin, nonsteroidal anti - inflammatory agents, and oral steroids . Aspirin sensitive asthmatics were excluded because of their tendency to display excess cys - lt synthesis at baseline . Exhaled breath condensate (ebc) was collected with rtube to determine airway lining fluid levels of cys - lt levels [29, 30]. The exhaled air cools below the dew point by transfer of heat to a chilled condenser surface . Cys - lt were determined by enzyme immunoassay (eia) (cayman chemicals, ann arbor, mi). Samples were run in duplicate, neat, and diluted, using a competitive assay based on a high - affinity monoclonal antibody measuring cys - lt . The lower range detection limit (80% b / b0) was 34 pg / ml . Significant numbers of both male and female patients were studied because of possible greater levels of leptin and lt in women than in men . A volume of 5 ml of heparinized whole blood was layered over 3.5 ml of a mixture of sodium metrizoate and ficoll (1-step polymorphs, accurate chemical & scientific corporation, westbury, ny) in a 15 ml centrifuge tube . The sample was centrifuged at 450 g for 30 min in a swing - out rotor at 22c . Adipokines, leptin, and adiponectin were measured in the plasma by enzyme immunoassay (eia) according to the protocol described . Plasma leptin levels were determined spectrophotometrically using commercially available colorimetric eia kits (millipore, ma usa) and run according to the manufacturer's instructions . The coefficient of variation for duplicate samples was 3.7% and the lower limit of detection was 0.5 ng / ml . Similarly, plasma high molecular weight adiponectin (linco research, a subsidiary of millipore, st . Charles, mo) was run in duplicate according to the manufacturer's directions (lld: 8.1%, 0.5 ng / ml . ). Blood samples were drawn from patients at the same time of the day, in the morning, and when patients were in the fasting state . Total ige levels were determined in all subjects (clinical pathology laboratory, university of michigan). We measured lt levels in pbm from subjects obese and nonobese with and without asthma . Pbm were isolated from whole blood by ficoll (one step, accurate chemical & scientific corp, westbury, ny) centrifugation and adherence, as previously described . Cells were> 90% pbm by differential staining and viability> 95% by trypan blue exclusion . Isolated pbm were resuspended in lipopolysaccharide - free dulbecco's modified eagle medium at 0.5 10/ml and adhered for 1 h at 37c in a humidified atmosphere of 5% co2/95% o2 for eia . The cells were stimulated ex vivo with 1 m calcium ionophore a23187 (calbiochem - behring corp . Final concentrations of dimethyl sulfoxide (0.05%) added to cultures had no effect on either cell viability or eicosanoid synthesis . This compound liberates intracellular calcium from intact cells and releases arachidonic acid from cell membranes . The eicosanoid products were measured by eia . Our study was designed to have 80% power with a type i error 5% to detect significant differences between asthmatics and normal subjects, as well as between obese and nonobese asthmatics . From the preliminary data, we estimate the median log ltb4 levels in exhaled breath condensate for nonobese asthmatics as 50 pg / ml, corresponding to a median log level of 3.90 . The study is powered to detect a doubling in the median lt levels for the obese compared to the nonobese groups . Based on preliminary data and to achieve the above differences 20 subjects were needed in each group, that is, 80 total for the four groups: obese asthma, nonobese nonasthma, asthma nonobese, and obese nonasthma . Mean and standard deviations for normally distributed data were calculated and differences between groups determined by student's t - test . For skewed data mann - whitney tests correlations and partial correlations were performed using pearson's coefficient . For the evaluation of possible associations between each study variable (dependent) and bmi (independent), linear regression was performed . Multivariable regression analysis was performed for leptin, adiponectin, and ebc cys - lt levels, adjusting for age, gender, and asthma status . We evaluated the association with bmi categories as well as bmi as a continuous variable . Comparison of study variables among the four groups was performed with one - way analysis of variance (anova). We set out to study four groups of subjects: obese asthmatics, nonobese asthmatics, obese nonasthmatics, and nonobese nonasthmatics . The bmi of the control and obese subjects were recruited to obtain optimal separation of the groups (table 1). Mean peak flow meter (pfm) readings of the asthmatics and nonasthmatics were also significantly different (table 1). There was no difference in pfm between obese and nonobese (82.5 21 versus 80.3 12.2 l / min, p = ns) asthma subjects . There was also no significant difference in fev1 between obese and nonobese asthmatics (74.6 19.4 versus 91.5 12.5% predicted, p = 0.052). The asthma control test (act) questionnaire was lower in obese asthma (19.8 11.9) compared to nonobese asthma (22.1 1.6) patients, p = 0.01 . Total ige levels were different but quite variable in both asthmatics and nonasthmatics (326 519 versus 73 124 ku / l, p = 0.004). There was no difference in ige levels between obese and nonobese asthmatics (315 448 versus 336 586 ku / l, p = 0.13). The gender breakdown was 64% female (36% male), which was as close as we could get to equality in recruitment . Males (35.2 12.2 years) and females (35.1 12.7 years) displayed no difference in age . No significant difference occurred in bmi between the genders, obese (36.5 5.7 versus 38.4 4.6 years male: female) or nonobese (23.6 1.3 versus 22.5 1.7). The recruitment age in the subjects, asthma versus nonasthma subjects, was not significantly different (32.7 12.3 versus 37 12.1 years, p = 0.31). Obese subjects were generally older, displaying an age - related increase in fat mass (obese 41.8 11.6 versus nonobese 27.7 8.4, p <0.001). Obese asthmatics were on average older than nonobese asthmatics (40.6 12.8 versus 25.5 5.9 years, p <0.001). Twelve of the obese subjects had a diagnosis of obstructive sleep apnea (osa). Gastroesophageal reflux disease (gerd) was more common in obese than nonobese (8/42 versus 3/40 subjects) subjects . Gerd was equally distributed between asthmatics and nonasthmatics (6/42 versus 5/40 subjects). The asthmatics studied had mild to moderate persistent disease with all of them on ics (42 subjects). None of the asthmatics were on leukotriene modifier therapy, since that was an exclusionary criterion for subject recruitment . As expected, fasting leptin levels were higher in obese subjects than nonobese subjects (32.7 20.2 versus 8.5 6.3 ng / ml, p = 0.0001). There was no significant difference in leptin levels between asthmatics and nonasthmatics (table 2). Mean leptin levels were higher in females than in males (26.4 21 versus 12.4 12.3 ng / ml, p <0.05). Female asthmatics had higher leptin levels than males with asthma (31.6 24.1 compared to 13.1 11.9 ng / ml, p = 0.01). Leptin levels were higher in obese female asthmatics compared to obese male asthmatics (52.1 18.6 versus 20.8 11.6 ng / ml, p <0.001). Leptin levels in female asthmatics were 31.6 24.1 compared to females without asthma 20.9 3.7 ng / ml, p = 0.03 . Leptin levels in men with and without asthma were 13.1 11.9 and 11.7 8.5 ng / ml, respectively (p = 0.29). Leptin's correlation with weight is 0.77 which was significant (p <0.0001). When it was adjusted for asthma, it is 0.78 (p <0.0001). The correlation of leptin with asthma is 0.17 (p = 0.119). There was also a positive correlation between leptin and the female gender (p = 0.001). Using multiple linear stepwise regression only weight and gender (female) had a positive correlation, when the variables age, gender, weight, and asthma were considered . Using anova, leptin was significantly different between the four groups: obese asthmatics, nonasthma nonobese, asthma nonobese, and nonasthma obese . Obese asthmatics had significantly higher levels than both nonobese asthmatics and nonobese nonasthmatics (p <0.0001) (figure 1). The only groups that were not statistically different were the obese asthmatics and obese nonasthmatics (p = 0.27). Adiponectin was decreased overall in the obese versus nonobese subjects (mean 9.3 4.7 versus 14.1 20 g / ml, p <0.05), as expected . There was no difference in adiponectin levels between asthmatics compared to nonasthmatics (table 2). As noted for leptin, mean adiponectin levels were higher in females than in males (14.1 5.5 versus 7.2 3.1 g / ml, p <0.05) especially in nonobese . This was also true for obese females who had higher mean levels compared to obese males (11.3 4.8 versus 6.4 2.7 g / ml, p <0.05). Males with asthma display lower mean levels of adiponectin than those seen in females with asthma (6.9 2.8 versus 13.3 5.6 g / ml p <0.05). Adiponectin's correlation with weight is 0.44 which was significant (p <0.0001). The correlation of adiponectin with asthma was 0.10 but was not significant (p = 0.36). There was a positive correlation between adiponectin and act (0.35) which did reach significance (p = 0.002). When adjusted for asthma it was a positive correlation (0.36) and was significant (p = 0.001). Linear regression demonstrated a negative correlation between adiponectin and obesity . Using multiple linear stepwise regression, there was a negative correlation with weight and a positive correlation with gender when the variables age, gender, weight, and asthma were considered . Anova demonstrated that adiponectin was significantly different between the four groups: obese asthmatics, nonasthma nonobese, asthma nonobese, and nonasthma obese . Obese asthmatics had lower adiponectin levels than nonobese nonasthmatics (p <0.008) (figure 2). Obese nonasthmatics also had lower adiponectin than nonobese nonasthmatics (p = 0.017). Since both leptin and adiponectin are increased in women compared to men, we next examined the leptin / adiponectin ratio as a method to better compare genders with regard to the role of adipokines in the pathogenesis of asthma in obesity . The mean leptin / adiponectin ratio was 2.8 3.6 in women compared to 2.1 1.9 in men (p = 0.15). Obese subjects had a significantly higher mean ratio than nonobese subjects (4.3 3.5 versus 0.78 0.8, p <0.01). Asthmatics did not have a significantly higher mean ratio compared to nonasthmatics (table 2). Although the mean leptin / adiponectin ratio trended to be higher in patients with worse airway obstruction (pfr <80% predicted), it did not reach statistical significance (p = 0.26). Linear regression demonstrated a positive correlation between leptin / adiponectin ratio and weight (p = 0.0001), as well as age (p = 0.0001). Using multiple linear stepwise regression, there was a correlation with weight (p = 0.0001). Anova demonstrated that leptin / adiponectin ratio was significantly different between the four groups: obese asthmatics, nonasthma nonobese, asthma nonobese, and nonasthma obese . Obese asthmatics had higher leptin / adiponectin ratios than nonobese nonasthmatics (5.3 4.3 versus 0.75 0.9, p <0.0001) and nonobese asthmatics (p <0.0001) (figure 3), but not obese nonasthmatics (p = 0.16). This was mainly accounted for by female obese asthmatics (6.3 4.9 versus 3.3 1.7 for males, p = 0.03). Exhaled breath concentrate (ebc) cys - lt levels were higher in all asthmatics compared to nonasthmatics (table 2). There was no difference in ebc cys - lt levels between obese and nonobese subjects (66.1 29.00 versus 62.8 29.1 g / ml, p = 0.3). Obese asthmatics had higher ebc cys - lt levels than nonobese nonasthmatic subjects (73 29.7 versus 57 28.1 g / ml, p = 0.05). The correlation of ebc with obesity was 0.11 (p = 0.34). Ebc correlation with asthma was 0.23 which is significant (p = 0.04). When this is adjusted for bmi it was 0.24 (p = 0.03). Multiple regression analysis revealed a significant correlation between ebc cys - lt and asthma (p = 0.04). There was no correlation with weight, age, gender, ics, or osa . Anova demonstrated no difference between four groups, likely due to the variability of the samples . The greatest difference was between obese asthmatics and nonobese nonasthmatics but only reached a p value of 0.3 (figure 4). Pbm cys - lt production was higher in females than males (222 132 versus 142 116 g / ml, p <0.05). Pbm cys - lt levels were comparable in the asthmatic versus nonasthma subjects (197 148 versus 190 115 g / ml, p = 0.4). However, in view of the increased variability of the pbm cys - lt levels, there were no significant increased values in obese asthmatics compared to nonobese nonasthmatics . The main findings of this study are the following: (1) plasma leptin levels are increased in obese asthmatics compared to obese nonasthmatics . This was mainly accounted for by higher leptin levels in females, and especially obese female asthmatics . (3) the leptin / adiponectin ratio was significantly higher in obese asthmatics compared to nonobese nonasthmatics . (4) ebc cys - lt levels were higher in asthmatics than in nonasthmatics . (5) pbm cys - lt levels were higher in women than in men, irrespective of asthma or obesity . An important finding in our study was the association between leptin and asthma, and specifically in obese asthmatics . Leptin levels are thought to be higher in females because of increased percentage body fat in women as well as increased secretion of leptin from adipose tissue . The latter may be related to increased estradiol levels and its effect of increased leptin secretion from adipose tissue . Leptin has been noted to be a proinflammatory adipokine driving the immune system towards a predominant th1 phenotype . Leptin receptors have been described in the airway and investigators have shown a correlation between plasma and bal levels . Leptin deficient mice display reduced lt synthesis, and exogenous leptin augments lt production in macrophages from these animals . Obesity has also been associated with an alteration in adipokines that predispose to neutrophilic inflammation . However, other investigators have demonstrated decreased inflammation in the airways of obese asthmatics, which is reversed by weight loss . Recently, it has also been shown that leptin may also affect the airway diameter through noninflammatory pathways by inhibiting the cholinergic pathway . Although we have shown an association between leptin and asthma, population studies by sutherland et al . Have shown no such association . Sampling of nonfasting subjects, some of whom smoked, can affect leptin levels and may explain the differences in conclusions of these studies . In contrast to leptin, adiponectin levels are decreased in obesity and tend to increase in starvation . It has a number of metabolic actions including increasing insulin sensitivity, diminishing atherosclerosis, and being generally anti - inflammatory . Although adiponectin receptors have been detected in the lungs, serum levels do not consistently correlate with bal fluid levels . This finding may be explained by the fact that active transport of adiponectin, which is a large molecule (full length form), may be necessary for penetration into the airways . Higher adiponectin levels have been associated with lower asthma prevalence rates in women . In our population, obese asthmatics had lower adiponectin levels than nonobese nonasthmatics . However, the higher levels of adiponectin in women compared to men, as was noted for leptin, may be the confounding variable, which detracts from the association of lower adiponectin levels in obese asthmatics compared to other groups . Cross - sectional analysis of an asthmatic population, who were nonfasting and smokers, did not demonstrate an association between adiponectin and asthma . An increased leptin / adiponectin ratio is associated with asthma compared to control subjects without asthma . The increased leptin / adiponectin ratio is also associated with severe asthma compared to mild to moderate asthma . In our study, however, in our study the leptin / adiponectin ratio was not associated with asthma or increased airway obstruction . The reduced responsiveness to inhaled corticosteroids with increasing bmi, with a relatively stable response to montelukast, has been previously described . Sutherland et al . Also examined the comparative effects of bmi in response to asthma controller medication . By contrast, they demonstrated that inhaled corticosteroids were superior to lt modifiers at all bmi levels, in patients who were underweight compared to those with morbid obesity . In our study we demonstrated that ebc cys - lt levels correlated with asthma, being higher in asthmatics than in nonasthmatics . Other investigators have demonstrated an association between bmi and urine cys - lt in obese asthmatics . Obese patients had significantly higher values of lte4/creatinine in urine compared to subjects who were preobese and in the normal range . In a linear regression model using the same model, log leptin and log adiponectin presented positive and negative associations, respectively, with lte4/creatinine in urine . This was because of the increased variability noted with ebc samples, which may also explain the marginal increase in ebc cys - lt levels in obese asthmatics in our study . The other problem is the inability to adequately standardize dilution factors for ebc across subjects . An alternative explanation is that alveolar cys - lt synthesis may not be as important as airway levels . A recent study demonstrated elevated submucosal but not sputum eosinophil levels in obese subjects with severe asthma [47, 48]. This may explain the elevated urine cys - lt levels in obese subjects compared to ebc measurements . In our cohort subjects with the older obese women phenotype trended to have increased leptin and ebc cys - lt levels with worse pulmonary function . Recently, investigators have demonstrated that bmi was associated with the incidence of asthma in women but not in men . Furthermore, adult onset nonatopic asthma has become the most common type of asthma in women . Investigators have demonstrated that both testosterone (negative) and estrogen (positive) were associated with alterations in adipokines, specifically leptin levels . We detected no significant difference between premenopausal obese women with asthma compared to nonobese patients . There was no decline in leptin levels in asthma with age, in postmenopausal compared to premenopausal subjects matched for bmi . The increase in bmi with age may have offset the effect of any change in estrogen / testosterone levels on adipokine levels as subjects increased in years . We did document that pbm from female subjects had higher cys - lt levels than that of male subjects . This has been noted by other investigators and may in part be due to suppression of 5-lo enzymatic activity by testosterone . Although pbm cys - lt levels were trending higher in asthmatics than nonasthmatics, this did not reach significance . Increased plasma leptin levels in women may be associated with the elevated pbm cys - lt production noted in females . Poorly controlled osa has been shown to worsen asthma control, in part through increased release of proinflammatory mediators during episodes of hypoxia and disrupted sleep . Nocturnal gerd may exacerbate asthma with aspiration of acid, during inhalation against a closed airway, following episodes of upper airway obstruction . Like osa, the incidence of gerd is also increased in obese subjects and may exacerbate airway disease after eating . Gerd can result in reflex bronchospasm from irritation of the esophagus or directly spilling into the airway with gross reflux . Although both osa and gerd were more common in obese than nonobese subjects in our study, the incidence was equally distributed in the asthmatic and nonasthmatic groups . It is a relatively small study number - wise, examining the role of obesity in the pathogenesis of asthma . Although the diagnosis of asthma was made by a physician with history, physical examination, and pulmonary function testing, spirometry or methacholine challenge testing was not performed . In addition, a number of variables to assess the role of ebc cys - lt readings limited the interpretation of results . Inhaled corticosteroids can result in ~18% reduction in ebc cys - lt levels, but we wanted to include asthmatics that were with mild to moderate severity . Although adipokines can be affected by the gender and the menstrual cycle, we did not determine the reproductive hormone concentrations in our premenstrual patients . Despite these issues, there was good characterization and separation of subjects between the control group and obese subject group . In addition, the asthmatics were well characterized compared to the nonasthmatics with peak flow rates and asthma control test questionnaires . Furthermore, the significance of the study was improved since we studied predominantly moderate persistent asthmatics all on inhaled corticosteroid therapy . None of the asthmatics were on lt modifier medications . In summary, we have demonstrated that leptin levels and the leptin / adiponectin ratio are increased in obese asthmatics compared to obese nonasthmatics . Proinflammatory mediators, cys - lt, were increased in obese asthmatics compared to nonobese nonasthmatics . Adipokines, especially in obese female asthmatics, may promote an asthma phenotype that has become more prevalent and results in difficult to control airway disease. |
During recent years, the use of cellular phone among adults, teenagers and children has been increased all over the world . The concern on the possible health hazards of radiofrequency electromagnetic fields (rf - emf) emitted by mobile phones on human health has been growing in many societies (1). Recent studies have investigated a variety of biological effects of emfs, on somatic cells, germinal tissues, the rates of cell proliferation and reproductive capacity of animals (2, 3). More specifically, the biological effects of emf can be grouped into thermal and non - thermal . The thermal effects will ultimately lead to an increase in the local temperature, and the non - thermal type is indirectly associated with temperature changes, but includes some other changes in the tissue by the emf (4). Up to now, numerous studies reported that the adverse effects of cell phone on reproductive system were due to non - thermal health effects (57). On the other hand, some scientists have reported that electromagnetic radiation generated by cell phone has no adverse effect on the fertility or reproduction of mammals, including humans (8, 9). In general, the possibility of cell phone radiation affecting the cell proliferation has raised concerns of the effects on early embryo development in many species . Also, others reported reduction in the survival rate of murine early embryos in conditions of extremely low - frequency magnetic fields (50 hz) (elf - mf) exposure, while it was higher in embryos obtained by in vitro fertilization (ivf) compared with natural breeding (nb) derived embryos (10). Results indicated that the hazardous effect of emf on living organisms is associated with frequency and intensity of the waves (11). However, the cell phone technology commonly has frequency radiation between 9001800 mhz . Up to now a study of emf in pregnant rats suggested that exposure to mobile phone for 30 min could alter the normal development and increase the risk of skeletal system abnormalities of rat fetuses (12). Reported that exposure to cell phone radiation caused the damage in the developing lens of a chick embryo (13). In recent years, the animal and in vitro models are used mainly to provide useful information of the possible adverse effect of emf on the living organism, which may complement the in vivo studies . In the present study, an in vitro model was used to assess the morphological parameters, survival rate and development of mouse early stage embryos obtained by nb as consequences of exposure to the cell phone radiation during incubation . For the control and experimental groups, a total of 40 mice (20 females and 20 males), 6 week old and sexually mature (balb / c), were obtained from animal house of research and clinical center for infertility, yazd, iran . The mice were housed on a 12 hr light and 12 hr dark cycle at 2024c and humidity- controlled (55%15%) condition in animal room . Injection of 10 iu of pregnant mare s serum gonadotropin folligon (pmsg; intervet, holland) followed by 10 iu of human chorionic gonadotropin (hcg; organon, holland) after 48 hr . In this study, mice with visible copulation plugs were sacrificed by cervical dislocation, and then ovary burses were surgically removed and collected in hamsf10 medium . Under stereomicroscope (olympus.szx16, japan), zygotes were dissected out from the swollen ampulla and treated with hyaluronidase (80 iu / ml, irvine scientific, usa). The collected zygotes were transferred into 100 l of g1 medium (vitrolife, sweden) and incubated for 5 hr in standard incubator . Next, 2-cell embryos were divided into two groups of control (n=150) and experimental (n=150). Also, the embryos were cultured for a maximum of 4 days up to the blastocyst stage under liquid paraffin at 37c/5% co 2 . For recording any delay or abnormality during incubation, the morphology of the developing embryos was monitored daily under an inverted microscope (te300; nikon, tokyo, japan) equipped with heating stage . The experimental zygotes were exposed to emf emitted from a commercially cellular phone (huawei ascend y300, china) with carrier frequency of 9001800 mhz and specific absorption rate (sar) ranged from 0.683 to 0.725 w / kg . The cell phone was held horizontally and parallel to the zygotes culture medium inside the co 2 incubator (memmert, germany) while the bottom of the phone being placed 1 cm above the upper from the stage of incubator . For exposure, the cell phone was kept on talk mode and distance between the phone and embryos was> 10 cm . The total duration of exposure was 30 min / day in one dose and exposures started on the second day of incubation for 4 days . The control zygotes were kept at the 5% co 2 incubator for 4 days without exposure to cell phone radiation . Briefly, embryos were graded as follows: grade a: equal blastomeres without fragmentation, grade b: slightly unequal blastomeres, up to 10% cytoplasm fragments, grade c: unequal blastomeres up to 50% fragments and large granules, grade d: unequal blastomeres with significant fragmentation and large black granules . Also, grades a and b were considered as high quality embryos, whereas grades c and d were low quality ones . Blastocyst staining with pi and h33258 was performed for identification of viable cells described by hosseini et al . Briefly, the blastocysts were washed twice in phosphate buffer saline free of calcium (pbs) and magnesium . Then, they were incubated for 30 min in preequilibrated staining solution pi (cat no: p4127; 300 g / ml) and hoechst (cat no h33258: 5 g / ml). For removing residual dyes, embryos were washed three times in warm pbs, and stained embryos were fixed in 2.5% glutaraldehyde for 5 min at room temperature, and washed again in pbs . Fixed embryos were mounted in a drop of glycerol between two lines of paraffin wax . Prepared samples were examined under epifluorescence microscope (olympus bx51, japan) to distinguish early to completely necrotic cells as red vs. live cells as dark blue . Data were analyzed using spss software version 20 (spss, chicago, il, usa). The shapiro - wilk test was applied for evaluation of normal distribution of the data . Student s t - test and mann - whitney u test were used for statistical analysis . For the control and experimental groups, a total of 40 mice (20 females and 20 males), 6 week old and sexually mature (balb / c), were obtained from animal house of research and clinical center for infertility, yazd, iran . The mice were housed on a 12 hr light and 12 hr dark cycle at 2024c and humidity- controlled (55%15%) condition in animal room . Injection of 10 iu of pregnant mare s serum gonadotropin folligon (pmsg; intervet, holland) followed by 10 iu of human chorionic gonadotropin (hcg; organon, holland) after 48 hr . In this study, mice with visible copulation plugs were sacrificed by cervical dislocation, and then ovary burses were surgically removed and collected in hamsf10 medium . Under stereomicroscope (olympus.szx16, japan), zygotes were dissected out from the swollen ampulla and treated with hyaluronidase (80 iu / ml, irvine scientific, usa). The collected zygotes were transferred into 100 l of g1 medium (vitrolife, sweden) and incubated for 5 hr in standard incubator . Next, 2-cell embryos were divided into two groups of control (n=150) and experimental (n=150). Also, the embryos were cultured for a maximum of 4 days up to the blastocyst stage under liquid paraffin at 37c/5% co 2 . For recording any delay or abnormality during incubation, the morphology of the developing embryos was monitored daily under an inverted microscope (te300; nikon, tokyo, japan) equipped with heating stage . The experimental zygotes were exposed to emf emitted from a commercially cellular phone (huawei ascend y300, china) with carrier frequency of 9001800 mhz and specific absorption rate (sar) ranged from 0.683 to 0.725 w / kg . The cell phone was held horizontally and parallel to the zygotes culture medium inside the co 2 incubator (memmert, germany) while the bottom of the phone being placed 1 cm above the upper from the stage of incubator . For exposure, the cell phone was kept on talk mode and distance between the phone and embryos was> 10 cm . The total duration of exposure was 30 min / day in one dose and exposures started on the second day of incubation for 4 days . The control zygotes were kept at the 5% co 2 incubator for 4 days without exposure to cell phone radiation . Briefly, embryos were graded as follows: grade a: equal blastomeres without fragmentation, grade b: slightly unequal blastomeres, up to 10% cytoplasm fragments, grade c: unequal blastomeres up to 50% fragments and large granules, grade d: unequal blastomeres with significant fragmentation and large black granules . Also, grades a and b were considered as high quality embryos, whereas grades c and d were low quality ones . Blastocyst staining with pi and h33258 was performed for identification of viable cells described by hosseini et al . Briefly, the blastocysts were washed twice in phosphate buffer saline free of calcium (pbs) and magnesium . Then, they were incubated for 30 min in preequilibrated staining solution pi (cat no: p4127; 300 g / ml) and hoechst (cat no h33258: 5 g / ml). For removing residual dyes, embryos were washed three times in warm pbs, and stained embryos were fixed in 2.5% glutaraldehyde for 5 min at room temperature, and washed again in pbs . Fixed embryos were mounted in a drop of glycerol between two lines of paraffin wax . Prepared samples were examined under epifluorescence microscope (olympus bx51, japan) to distinguish early to completely necrotic cells as red vs. live cells as dark blue . Data were analyzed using spss software version 20 (spss, chicago, il, usa). The shapiro - wilk test was applied for evaluation of normal distribution of the data . Student s t - test and mann - whitney u test were used for statistical analysis . There were insignificant changes in the rate of embryo survival to the blastocyst stage in the experimental group after exposure to emf emitted from cell phone, compared with control group (table 1). Analysis revealed that the percentage of necrotic embryos at the 2-cell stage was significantly higher in experimental group compared with controls (22.7% vs. 12.7%, respectively; p=0.03). In addition, there was insignificant change in the rate of embryo survival to the blastocyst stage in the experimental group (60.6%) after exposure to emf emitted from cell phone, compared to controls (69.3%; p=0.1). Further analysis demonstrated that there were no differences between control and experimental groups in the percentages of high quality embryos (figure 1). Development of preimplantation embryos under exposure to emf (9001800 hz) the p - value between exposed and control samples was calculated using student s t - test for coupled data changes in cleavage rates of embryos after exposure to emf (9001800 hz). Hqe = high quality embryo the loss of cell viability was found by significant increase in the percentage of dead cells within experimental blastocysts (p=0.002, figure 2). In general, it was found that emf exposure caused changes in membrane permeability, late apoptotic, and early necrotic blastomeres . A) in control group, no necrotic cell was observed using excitation wavelength (350461 nm) which confirmed that all the cells of the stained blastocyst were alive . B) experimental blastocyst with major irregularities in size, color and density of individual cells under fluorescence microscopy with excitation wavelength (535617 nm). Red blastomeres show necrotic cells (green line) (200x) comparison of blastocysts live and dead cells counts in control and experimental groups p - value according to independent samples t - test, p - value according to man - whitney u test there were insignificant changes in the rate of embryo survival to the blastocyst stage in the experimental group after exposure to emf emitted from cell phone, compared with control group (table 1). Analysis revealed that the percentage of necrotic embryos at the 2-cell stage was significantly higher in experimental group compared with controls (22.7% vs. 12.7%, respectively; p=0.03). In addition, there was insignificant change in the rate of embryo survival to the blastocyst stage in the experimental group (60.6%) after exposure to emf emitted from cell phone, compared to controls (69.3%; p=0.1). Further analysis demonstrated that there were no differences between control and experimental groups in the percentages of high quality embryos (figure 1). Development of preimplantation embryos under exposure to emf (9001800 hz) the p - value between exposed and control samples was calculated using student s t - test for coupled data changes in cleavage rates of embryos after exposure to emf (9001800 hz). The loss of cell viability was found by significant increase in the percentage of dead cells within experimental blastocysts (p=0.002, figure 2). In general, it was found that emf exposure caused changes in membrane permeability, late apoptotic, and early necrotic blastomeres . A) in control group, no necrotic cell was observed using excitation wavelength (350461 nm) which confirmed that all the cells of the stained blastocyst were alive . B) experimental blastocyst with major irregularities in size, color and density of individual cells under fluorescence microscopy with excitation wavelength (535617 nm). Red blastomeres show necrotic cells (green line) (200x) comparison of blastocysts live and dead cells counts in control and experimental groups p - value according to independent samples t - test, p - value according to man - whitney u test this is the first study to specifically analyze the effects of exposure to 8001900 mhz radiation from cell phone on the mouse preimplantation embryos . Since in ivf technology, the embryos are generated and cultured in in vitro condition, any environmental disruption, including emf exposure may affect their survival and developmental abilities . These electromagnetic waves have periodically changed between positive and negative, and the speed or the number of changes per second, is called frequency with hertz as its unit . The concerns about risk of malformations from exposure to cell phone are increasing (10). Therefore, the consequences and effects of exposing the in vitro produced mouse embryos to a cell phone radiation (in talk mode) on subsequent embryo survival were assessed . The measurement of the rf energy absorbed to the person s body during a call position is called sar . Also, most phones have sar range from 0.1 to 1.2 w / kg . The maximum sar for the used cell phone in our study ranged from 0.683 to 0.725 w / kg . Luo et al . (2006) evaluated the effects of extremely low frequency electromagnetic fields (elfemfs) exposure on mouse preimplantation embryos . Their results showed a significant delay in the cleavage rate of the exposed two and eight - cell compared to control embryos . They concluded that the delaying effects of emfs are consistent with the dna damaging effects of elfemfs on embryos (16). Then, subsequent dna repair was noticed which was activated by cell - cycle checkpoints and this time - out another study suggested that oxidative stress caused delay in the embryonic development (19). In addition, it was noticed that the majority of the embryos in emf - exposed group died at the 2-cell stage compared with controls . Also, there were significant differences between control and experimental groups in embryos after exposure to emf (p=0.03). Moreover, the survival of embryos to the blastocyst stage does not guarantee that the embryos are normal because, the most remarkable finding of this study was a progressive decrease of the live cells within exposed blastocysts compared with control group . Pi and hoechst staining was applied in order to determine the viable cell numbers of blastocysts . However, this novel technique has a potency to enter into all cells but, the live cells with intact cell membrane appeared in blue and not permeable to pi, while dead cells appeared as red, because in the cells with altered cell membrane both pi and h33258 stain could enter the cells, staining the nuclear chromatin . The loss of cell viability observed by staining of hoechst and pi is a plausible explanation in which emf exposure caused changes in membrane permeability . Also, apoptosis is a physiologic process which could regulate the cell number of blastocysts, especially inner cell mass (icm) which is formed during the blastocyst stage with elimination of injured cells . This phenomenon is seen among over 80% of in vivo produced mouse blastocysts that had one or more dead cells on days 45 of development (20). In this (2007) demonstrated that within minutes of exposure to radiation emitted from cell phone in mammalian cells, rapid production of reactive oxygen species (ros) takes place which is mediated by activation of plasma membrane nadh oxidation (21). In fact, ros are highly reactive molecules and damaging cell membranes and dna (22). However, beraldi et al . Were assessed a consequences of exposing the in vitro and in vivo produced murine embryos to extremely low - frequency electromagnetic fields (elf - mf) on subsequent embryo survival rate and rate of embryo survival after exposure to elf - mf was significantly decreased in vitro embryos that obtained by ivf compared with natural breeding group (p<0.01) (10). Conversely, in this study, there was insignificant change in the rate of embryo survival to the blastocyst stage in the experimental group (60.6%) compared to controls (69.3%; p=0.1). In another study, panagopoulos et al . Showed that both types of radiation, gsm 900 mhz (global system for mobile telecommunications) or dcs 1800 mhz (digital cellular system) in drosophila melanogaster induced cell death of ovarian egg chambers up to 55% compared to the control group . Although they could not extrapolate, the ovarian cell death could be due to apoptosis in response to the electromagnetic stress or necrosis by the electromagnetic radiation (23). Furthermore, it has been shown that subjecting the cells to environmental stress could be related to an increased synthesis of stress proteins including heat - shock proteins (hsp), not obtained by heat only (24). In this (2003) examined the effects of a discontinuous mobile phone radiation (900/1900 mhz; sar_1.4 w / kg) on reproduction and development in drosophila . They reported that cell phone radiation increases levels of the hsp70 and components of signal transduction pathways . Also, they showed both types of elf and rf emitted from cell phone are capable of affecting the cell functions (25). These findings are similar to earlier studies, which suggested that an increase in hsp70 as a result of rf field had progressive stimulatory effects on cell function, specifically the stimulation of cell (2629). From these experiments, it can be concluded that the emf can be considered as an environmental stress factor . In addition, mezhevikina et al . Showed that emfs increase the resistance of embryos to undesirable environmental conditions and play stimulating role in the early development of embryos (30). On the contrary, grigorev et al . On the other hand, our data showed that there were no differences between groups in the rates of embryo survival to the blastocyst stage . Furthermore, our results are in agreement with some studies that have revealed 50 hz elf - mf in in vitro condition does not directly perturb mouse embryo development to the blastocyst stage . However, some loss of cell viability was observed in exposed group compared with the control (32, 33). Since many factors could influence the outcome of experiments in emf research, such as the exposure conditions, cell types, the frequency of mobile phone use, and duration period, so, there could be some inconsistency in the observations . Also, the average time of mobile phone use in a day as half an hour could be investigated for each individual . Since, digital telephones use frequencies between 1850 and 1990 mhz, mobile phone with radiofrequency radiation between 9001800 mhz was used in this research . Our results imply a probable role of ros in the adverse effects of emf from a cell phone in subsequent embryo survival rates . In conclusion, normal embryonic development up to the blastocysts indicates that emf - exposure commonly did not have major adverse effects on the development of mouse preimplantation embryos, but it could increase the rates of dead cells in blastocysts . It was also found that emf exposure caused loss of cell viability and changes in membrane permeability and apoptosis. |
Kawasaki disease, first described by tomisaku kawasaki in japan in 1967, is an acute systemic vasculitis of unknown etiology involving the small and medium - sized vessels with predilection for coronary artery involvement . The disease affects infants and children under the age of 5 years with no racial predilection and a sex ratio of 1.5:1 in favor of male children . Typically, the disease is a multisystem febrile vasculitis with predominant cardiovascular manifestations . If untreated, it can lead to development of coronary artery aneurysm in nearly 25% of patients and systemic vascular aneurysms in less than 2% cases . A 6-month - old male infant was brought to the emergency department with complaints of fever for 1 month, passage of dark stools for 1 week, and discoloration of upper extremity for 2 days . The child was referred for doppler imaging (philips hd 11 xe ultrasound machine, philips usa) of the upper extremity and sonography of the abdomen on emergent basis . Doppler usg showed partially thrombosed fusiform aneurysm of right subclavian artery, axillary artery, brachial artery, and non - thrombosed aneurysm of the right subclavian artery [figure 1a and b]. Color doppler image shows non - thrombosed aneurysm of left subclavian artery (a) with partially thrombosed fusiform aneurysm of right subclavian artery (b) subsequently, ultrafast low - dose ct angiography (philips brilliance 40 slice ct scanner; philips usa) was done in emergency settings which confirmed the color doppler findings and additionally showed aneurysms of bilateral common carotid, extracranial internal and external carotid, and bilateral vertebral arteries [figure 2]. There were aneurysms involving multiple coronary arteries, with giant fusiform aneurysm of left anterior descending artery measuring 13 mm [figures 3 and 4]. Ct angiography of thoraco - abdominal aorta revealed small saccular aneurysm at the origin of celiac artery measuring 29 25 mm, with fusiform dilatation of superior mesenteric artery [figure 5a and b]. There were non - thrombosed fusiform aneurysms of bilateral common iliac artery and common femoral artery without the involvement of the main aortic trunk [figure 6]. Ct angiography (coronal mip image) shows dilated bilateral subclavian and axillary arteries with hypodense non - enhancing thrombus within the right subclavian also, fusiform aneurysms of bilateral extracranial carotid and vertebral arteries are noted (short arrows) axial ct angiography image at the level of aortic sinus shows giant aneurysm of left anterior descending artery (short arrow) with aneurysm of right coronary artery (long arrow) volume - rendered image (left anterior oblique view) shows giant fusiform aneurysm of left anterior descending artery aneurysms of branches of abdominal aorta . Ct angiography sagittal mip image (a) shows aneurysm of superior mesenteric artery (arrow). Volume - rendered image (b) shows saccular aneurysm measuring 29 25 mm at the origin of celiac artery (arrow) ct angiography coronal mip image shows fusiform aneurysms of bilateral common iliac and femoral arteries based on the imaging features, a possibility of infantile panvasculitis was considered . Review of the clinical parameters revealed normochromic - normocytic anemia, leukocytosis, and elevated erythrocyte sedimentation rate (esr; 43 mm in first hour) and c - reactive protein (34 mg / l). The blood cultures and peripheral smears were negative for microbes and had no malarial parasites [table 1]. Based on the clinical history of conjunctivitis, fleeting rash, swelling of extremities, and multiple aneurysms of medium to small - sized vessels, a diagnosis of infantile atypical kawasaki disease was made . Apart from the supportive management, the infant was started on intravenous immunoglobulin, but succumbed to death on the third day of admission . Kawasaki disease or mucocutaneous lymph node syndrome is a multisystem idiopathic vasculitis affecting medium - sized vessels . The diagnosis is made based on the amalgam of clinical criteria which occur in a sequential and fleeting progression, thus proving a diagnostic challenge . The defining criteria for the diagnosis of kawasaki disease include fever for at least 5 days and four of the following five principal features: conjunctivitis, mucositis, cervical lymphadenopathy, truncal rash, and edema of the extremities . Atypical forms of the disease are not rare and are defined as the disease with three principal features or coronary artery involvement with less than three principle diagnostic criteria . The higher incidence of the atypical form of the disease in infantile age group and the unusual presentations lead to a delay in diagnosis and management, consequently increasing the complication rates . Coronary artery aneurysms, the most serious complication of the disease, occur in up to 25%, whereas other systemic aneurysms occur in less than 2% cases . Majority of the mortality in kawasaki disease is attributed to cardiovascular events secondary to these aneurysms . Aneurysm formation is a major cause of morbidity and mortality in children with kawasaki disease with increased risk in patients with delayed diagnosis, age less than 6 months or more than 9 years, male gender, prolonged (> 14 days) or persistent fever despite treatment, leukocytosis, elevated esr, low albumin, hyponatremia (<135 thus, the diagnosis of kawasaki disease is suspected on the basis of clinical features and an exclusion of other possibilities . The possible differential diagnoses in the given case of infantile vasculitis consisted of takayasu disease, fibromuscular dysplasia, infective vasculitis, and kawasaki disease . Takayasu's arteritis is a panarteritis of young adults with involvement of aorta and its main branches with the possible involvement of coronary or pulmonary vasculature . Aneurysms and dilatation in aorto - arteritis commonly involve the ascending aorta and aortic arch . Fibromuscular dysplasia is a congenital non - inflammatory angiogenic dysplasia with predominant involvement of the renal vasculature in young females and classically shows string of beads appearance of angiography . To conclude, this report emphasizes the role of a radiologist in emergency settings in suspecting the diagnosis and the role of imaging in diagnosis of clinically silent aneurysms in infantile atypical kawasaki disease. |
Heart disease is a major consequence of obesity, which is in turn strongly associated with major risk factors for coronary atherosclerosis such as hypertension, hyperlipidemia, diabetes, and sleep - disordered breathing . However, studies increasingly suggest that obesity also has direct effects on the heart that may not result from atherosclerosis . Abundant evidence shows an association between obesity and structural and functional changes in the heart in both humans and animals . Many of these changes, such as left ventricular (lv) hypertrophy, left atrial (la) enlargement, and subclinical impairment of lv systolic and diastolic function, are believed to be precursors of more overt forms of cardiac dysfunction and heart failure . The data suggest that long - standing severe obesity may eventually lead to heart failure, and several studies suggest that patients with fatty liver are particularly subject to cardiac complications [3, 4]. These observations led us to the hypothesis that, as with obesity - associated fatty liver, obesity would cause upregulation of facilitated long - chain fatty acid (lcfa) uptake by cardiomyocytes, leading to ectopic triglyceride accumulation in the heart and a consequent cardiomyopathy . To test that hypothesis, we examined three murine obesity models: c57bl/6j mice chronically fed a high - fat diet, leptin - deficient ob / ob mice, and leptin - receptor - deficient db / db mice, with a combination of functional, histologic, biochemical, and molecular studies . Facilitated uptake of long - chain fatty acids (lcfa) by cardiomyocytes, heart weights and left ventricular mass, and cardiac triglyceride content were increased and cardiac ejection fractions decreased in all three models . These results suggest that a general relationship exists between obesity and cardiac dysfunction, that obesity cardiomyopathy is an integral component of the clinical manifestations of obesity, and that increased facilitated cardiomyocyte uptake of lcfa is an important mechanism contributing to the pathogenesis of obesity cardiomyopathy . Male c57bl/6j, db / db, and ob / ob mice were purchased from jackson laboratories (bar harbor, me) at 6 wks of age . Upon receipt mice were housed in group cages in a temperature - controlled facility with a 12 h light: dark cycle, with free access to water and to a standard chow diet (labdiet 5001, pmi, st . Starting at 8 weeks of age c57bl/6j mice were divided at random into 2 groups . One group, designated as controls (c), as well as the db / db and ob / ob mice, continued to receive the chow diet . The other c57bl/6j group was fed a high - fat diet (hfd) containing 35% lard (55% of calories from fat; bio - serv, frenchtown, nj). All mice were euthanized at 20 1 wks of age after an overnight (12 hr) fast . All applicable institutional and governmental regulations concerning the ethical use of animals were followed during this research . The experimental protocol was approved by the institutional animal care and use committee (iacuc) of columbia university medical center . Euthanasia was accomplished with intraperitoneal injections of ketamine (0.1 mg / g) and xylazine (0.01 mg / g). At sacrifice mice solution via the aorta, hearts were removed for isolation of single cell suspensions of cardiomyocytes . Protocol 2: abdomens were opened as above, and hearts were removed without perfusion and weighed . One portion of each heart was frozen for subsequent biochemical measurements; a second portion was placed in neutral buffered formalin for subsequent paraffin embedding, sectioning, and staining with hematoxylin and eosin (h&e) and mallory's trichrome . The remainder was embedded in oct compound (tissue - tek, sakura finetek usa, inc ., subsequently, serial 7 m thick sections were collected on poly - d - lysine - coated slides and stained with oil red o (oro) and hematoxylin . Blood glucose was measured with a glucose meter (one - touch, lifescan, inc ., additional blood was collected from the inferior vena cava at sacrifice and promptly separated by centrifugation . The following serum measurements were performed in our laboratory using commercial kits: free fatty acids (ffa, wako chemicals usa, inc, richmond, va); triglycerides (l - type tg h, wako chemicals usa); total cholesterol (cholesterol e, wako pure chemical industries, osaka, japan); ast (stanbio, boerne, tex). Leptin and insulin concentrations were determined by immunoassay at the hormone research core laboratories of vanderbilt university . Total cardiac protein content was determined with the bsa protein analysis kit (thermo scientific, rockford, ill), and cardiac triglyceride and cholesterol contents were determined, after folch extraction, with wako kits (cholesterol e and l - type tg h) according to the manufacturer's instructions . Histological images of oro - stained cardiac sections were observed at 250x with a nikon eclipse 80i microscope and captured with a nikon digital dxm 1200 c camera, using a standard exposure for all photographs . Semiquantitative estimates of neutral lipids in these sections from each mouse were performed by two independent observers (fg, pdb) who were blinded to the experimental protocol, according to the following scale: () no positive staining, 0 points; (+) occasional oro - positive droplets observed by searching in at least 5 high power fields (hpfs), 1 point; (+ +) small oro - positive droplets present in most hpfs, 2 points; (+ + +) obvious, larger oro - positive droplets in all hpfs, 3 points; (+ + + +) many still larger oro - positive droplets, sometimes in clumps, in all hpfs, 4 points . An average score for each mouse was calculated from the scores of the two observers . For the 57 samples analyzed for this study the mean difference in lipid scores between the two observers was 0.12 0.04 (se) points . The slope of the regression line between the two sets of scores was 0.96 (r = 0.94, p <0.001). Hearts were fixed with 2.5% glutaraldehyde in 0.1 m sorenson's buffer (0.1 m h2po4, 0.1 m hpo4, ph 7.2) for at least 12 h. samples were postfixed with 1% oso4 in 0.1 m sorenson's buffer for 1 h. en bloc staining with 1% tannic acid in water was followed by washing and staining with 1% uranyl acetate . Tissues were then embedded in lx-112 (ladd research industries, inc, williston, vt, usa). Sections of 60 nm were cut on an mt-7000 rmc ultramicrotome, placed on mesh copper grids (electron microscope sciences, hatfield, pa), stained with 1% uranyl acetate and 0.4% lead citrate, and examined under a jeol jem-1200 exii electron microscope . Mice were anesthetized with 1.52% isoflurane until they were unconscious, and 11.5% isoflurane was continuously administered thereafter throughout the study . The mouse was then placed on a heated pad with electrocardiographic leads attached to each limb . Echocardiography was performed with vevo770 (visualsonics, toronto, canada) instrument, which is designed for use in small animals . B - mode and m - mode two - dimensional (2d) images were obtained in a parasternal short - axis view . An experienced operator blinded to the mouse information performed these measurements . In the m - mode short - axis images, anterior and posterior wall thicknesses (aw, pw) and lv end diastolic and systolic dimensions (lvedd, lvesd) were measured at the midpapillary muscle level . Lv percent fractional shortening (% fs), which reflects the change in lv diameter between the contracted and relaxed states, ejection fraction (ef), and lv mass (lvm) were calculated according to teichholz et al . Using b - mode short - axis images at the midpapillary level as (1)%fs=[lveddlvesdlvedd]100, (2)ef (%) = {[7.02.4 + lvedd](lvedd)3 [7.02.4 + lvesd](lvesd)3} {[7.02.4 + lvedd](lvedd)3}100, (3)lvm={1.04(aw+pw+lvedd)3lvedd3}0.8 . Equations (2) and (3) incorporate correction factors previously shown to optimize results [9, 10]. After digestion of heart tissue with collagenase ii, mouse cardiomyocytes were isolated as described [1113], using a protocol which had been shown to yield excellent rat cardiomyocyte preparations . Viability was assessed by trypan blue staining, and only preparations in which 80% of cardiomyocytes excluded trypan blue were used . Cells in suspension were counted under a microscope and concentrations adjusted to 1.5 10 cells / ml for use in oleic acid (oa) uptake assays . Using rapid filtration methods well established in our laboratory [1417], the initial uptake velocity of oa into cardiomyocytes at 37c from media containing 500 m bsa was determined in duplicate over 15 sec at five different unbound oleate concentrations . Uptake is linear over this time frame, and we have established that under these conditions measured uptake principally reflects inwardly directed transmembrane long - chain fatty acid (lcfa) transport, relatively independent of either unstirred water layer effects or intracellular binding or metabolism [1416]. Based on multiple prior studies in both rodents and man [1722], values for initial oleate uptake velocity at the 5 studied concentrations of unbound oleate were fitted by computer to (4), using saam ii software as modified for implementation on a lap - top computer [23, 24]. This equation indicates that lcfa uptake is the sum of a saturable plus a nonsaturable function of the unbound lcfa concentration in plasma . Thus, (4)uptake ([oau])=[vmax[oau]km+oau]+k[oau], where uptake ([oau]) is the rate of uptake of labeled oleic acid (pmol / sec/50,000 cells) at unbound oleic acid concentration [oau] (nm), vmax (pmol / sec/50,000 cells) and km (nm) are, respectively, the maximal uptake rate of the saturable uptake component and the unbound oa concentration at half - maximal uptake velocity (nm), and k (ml/50,000 cells / sec) is the rate constant for nonsaturable oa uptake . Total rna was extracted from cardiac tissue samples using qiaamp rna mini kits (qiagen inc, valencia, calif) according to the manufacturer's protocol . First - strand cdnas were synthesized using taqman reverse transcription reagent kits (applied biosystems, foster city, calif), with random hexamer primers . Pcr reactions were performed in a total volume of 50 l containing 500 ng cdna on the 7300 real - time pcr system using sybr green pcr master mix (applied biosystems) as detailed in the manufacturer's guidelines . We used genormtm kit 2 m (beta-2-microglobulin), gapdh (glyceraldehyde 3-phosphate dehydrogenase), ubc (ubiquitin c) (primerdesign ltd, uk), and 18srna (idt, san jose, calif) for housekeeping gene analysis . Primer sequences were selected with the use of primer 3 software (s. rozen, h. skaletsky http://frodo.wi.mit.edu/primer3/). We used got2 (glutamate oxaloacetate transaminase 2, mitochondrial), slc27a1 (long - chain fatty acid transport protein 1), slc27a6 (long - chain fatty acid transport protein 6), cd36 (fatty acid translocase), and scd1 (stearoyl coa desaturase-1) and fasn (fatty acid synthase) primers (idt, san jose, calif) to quantitate the expression levels of these genes . We also used ndufaf4 (nadh dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4), ndufa8 (nadh dehydrogenase (ubiquinone) 1 alpha subcomplex, 8), sdhd (succinate dehydrogenase complex, subunit d, integral membrane protein), cox5b (cytochrome c oxidase, subunit vb), cox6b1 (cytochrome c oxidase, subunit vib polypeptide 1), cox6c (cytochrome c oxidase, subunit vic), uqcrc2 (ubiquinol cytochrome c reductase core protein 2), uqcrfs1 (ubiquinol - cytochrome c reductase, rieske iron - sulfur polypeptide 1), and atp5j (atp synthase, h+ transporting, mitochondrial f0 complex, subunit f) and atp5h (atp synthase, h+ transporting, mitochondrial f0 complex, subunit d) primers to quantitate oxidative phosphorylation - associated gene expression and a primer to examine expression of peroxisome proliferator - activated receptor gamma coactivator-1 (pgc-1). For detection of cd36 and fatty acid transport protein 1 (fatp1), total protein extracts were prepared from murine heart with use of cell lysis buffer (ripa buffer, teknova). Particulate material was removed by centrifugation, and protein concentration was determined using the bca protein assay kit . Equal amounts of total protein (50 g / sample) were subjected to electrophoresis in nupage 412% bis - tris gels (invitrogen, carlsbad, calif) and then electrophoretically transferred to a nitrocellulose membrane . Nonspecific binding was blocked by incubation of membranes with nonfat dry milk (5%) for at least 1 h at room temperature . The blots were incubated with the following primary antibodies: rabbit anti - mouse fatp1 (santa cruz, calif) or goat anti - mouse cd36 (r & d systems, minneapolis, minn). Each primary antibody was incubated for 2 h or overnight at a dilution of 1: 500 . Goat anti - rabbit and donkey anti - goat igg secondary antibodies (1: 1,000 dilution; santa cruz biotechnology) were used to identify primary antibody binding sites . All the western blot results were analyzed by scanning densitometry and densitometric image analyzer software (image j, national institutes of health, bethesda, md (http://rsb.info.nih.gov/ij/download/)). Single comparisons were examined with student's t - tests, with statistical significance set at p 0.05 . For the parameters reported in tables 1 and 2, each of the three experimental groups was compared to the control group (principal goal, three comparisons); the three experimental groups were also compared with each other (secondary goal, three more comparisons). Analysis was by one way anova, followed by post hoc t - tests, using the pooled standard deviation in computing standard errors of group differences . Application of the bonferroni correction would have required setting the limit of significance at p 0.008 (0.05 divided by 6, the number of intergroup comparisons). We have therefore simply reported the p values for these post hoc tests in the legends of tables 1 and 2 . Any p value that is below the bonferroni - corrected value of 0.0083 can be taken as definitively significant, whereas other p values (0.05> p> 0.0083) can be considered only as exploratory or suggestive . The mean age of the studied mice was 139 1 days and was equivalent in all four groups . Hfd - fed (37.95 1.11 g, n = 19), db / db (51.78 0.57 g, n = 7), and ob / ob (62.5 0.53 g, n = 22) mice, collectively designated the obesity groups, were all significantly heavier than chow - fed c57bl/6j controls (26.58 0.24 g, n = 30). Values for blood glucose, homa - ir and serum insulin, leptin, total fatty acids, triglycerides, cholesterol, and ast values will be found in a prior publication dealing with the pathogenesis of hepatic steatosis in these same animals . Briefly, blood glucose was significantly increased only in the hfd group, serum insulin in the db / db and ob / ob groups, and serum leptin in the hfd and db / db groups, but the homeostasis model assessment of insulin resistance (homa - ir), calculated as previously described in mice, was significantly increased in all obesity groups . Serum cholesterol was also elevated in all three obesity groups, but triglycerides were increased only in the hfd and ob / ob animals . Although the total lcfa concentration was somewhat greater in all experimental groups than in controls, in none of the groups was the increase statistically significant . However, in contrast to total lcfa, the increase in unbound lcfa (lcfau), which provides the driving force for lcfa uptake, was statistically significant in all experimental groups . Serum ast was significantly increased in db / db and ob / ob but not hfd mice . Heart weights and triglyceride content were increased in all obesity groups; heart cholesterol content was increased in ob / ob and db / db but not hfd animals (table 1). Heart weights (figure 1: r = 0.65), cardiac triglyceride content (r = 0.80), and cardiac cholesterol content (r = 0.62) were all significantly correlated with body weight (p <0.01 in each instance). Oro - positive lipid droplets were rare in control cardiomyocytes (figure 2(a)). Despite a significant increase in biochemical measurements of tg in the hfd group, only occasional oro - positive lipid droplets were observed by light microscopy in hfd myocardial cells (figure 2(b)), but marked lipid accumulation was seen in db / db and ob / ob mice (figures 2(c) and 2(d)). In transmission electron microscopic images, lipid droplets were seen in the hearts of hfd animals, but lipid droplets were both larger and more abundant in db / db and ob / ob mice (figures 2(e), 2(f), 2(g), and 2(h)). Semiquantitative grading of oro - stained cardiac sections did not show appreciable differences in the average grade of lipid deposition between hfd (0.54 0.14) and control (0.6 0.13) mice; however, in db / db (2.4 0.38) and ob / ob (3.4 0.14) groups, the grade of lipid deposition was, respectively, 4 times and 6 times higher than in the c and hfd groups (p <0.01). By echocardiographic measurement, both aw and echocardiographic estimates of left ventricular mass were also increased in hfd (101.89 4.86 mg), db / db (101.74 4.6 mg), and ob / ob mice (112.20 1.0 mg) compared to c (85.25 3.17 mg) and were highly correlated with tissue measurements of total heart weight (r = 0.98, p <0.01). The end systolic diameter (lvesd) averaged 2.50 0.08 mm and the end diastolic diameter (lvedd) 4.03 0.08 mm in control mice . Although the average lvesd was increased in the obesity groups, the lvedd was similar in all groups (table 2, figure 3(a)), so that the obesity groups did not meet the basic criteria for a dilated cardiomyopathy . Percent fs, which was 38 1.1% in c, decreased to 33 0.6% in hfd, 30 1.3% in db / db, and 29 1.0% in ob / ob mice (p <0.01 versus control for each group) (figure 3(b)). Similarly, ef decreased in hfd (56 0.7%), db / db (52 1.8%), and ob / ob mice (51 1.4%) compared to c (62 1.4%) (p <0.01 versus control for each group) (figure 3(b)). Ef was negatively correlated with body weight (r = 0.70, p <0.01) and cardiac tg (r = 0.83, p <0.01) across the four groups studied (data not shown). As previously reported in adipocytes and hepatocytes [5, 26], uptake of [h]-oleic acid by isolated mouse cardiomyocytes consisted of the sum of a saturable plus a nonsaturable component . In all groups studied, the saturable component predominated over the physiologic range of unbound oleic acid concentrations . Typical uptake curves in control, hfd, db / db, and ob / ob cardiomyocytes are shown in figure 4(a). Saturable cardiomyocyte lcfa uptake, reflected in an increased vmax, was increased in each of the obesity groups (figure 4(b)). The mean vmax in hfd, db / db, and ob / ob mice was 1.4, 2.0, and 3.2 times that in control mice . The increases were only significant in the db / db mice (p <0.05), but not in the ob / ob animals, which had the greatest mean increase, due to greater scatter in the data . There was a significant nonlinear correlation between vmax and serum insulin in the groups (r = 0.91, figure 4(c)), consistent with increasing levels of insulin resistance in the obesity group animals . Gene expression ratios for the cardiac lcfa transporters, got2, slc27a1, slc27a6, and cd36, and of critical enzymes involved in de novo lcfa synthesis, scd1 and fasn, are shown in figure 5(a). Got2, encoding the transporter fabppm / masp - at, was upregulated only in ob / ob mice; slc27a1, which encodes fatp1, was significantly upregulated in all three of the obesity groups; cd36, encoding cd36/fat, was significantly upregulated in both ob / ob and db / db animals . Our western blot analysis confirmed that both cd36 and fatp1 were upregulated in the obesity groups (figure 5(b)). The expression ratio for cd36, in particular, was highly correlated with the [h]-oleic acid uptake vmax in all of the obesity groups, with an r = 0.99 (p <0.01) for the gene expression data (figure 5(c)) and r = 0.93 for the protein expression (western blot) results . There was a lesser degree of correlation between vmax and the slc27a1 expression ratio (r = 0.65, data not shown). By contrast, slc27a6, which encodes the putative cardiac transporter fatp6, was not upregulated in cardiomyocytes from any of the obesity groups . While not a transporter per se, lipoprotein lipase (lpl) can increase lcfa uptake by hydrolyzing the triglycerides of circulating lipoproteins, making their component lcfa available for facilitated uptake . We found the lpl expression ratio to be significantly elevated (p <0.01) in db / db (1.78 0.05) and ob / ob (1.72 0.1) but not hfd (1.07 0.07) animals . Local lcfa concentrations in myocardial capillaries in the former strains may therefore be higher than those we measured in bulk plasma, with correspondingly greater absolute rates of facilitated lcfa uptake, but the extent of this local increase in lcfa concentrations cannot be directly measured . Fasn, encoding fatty acid synthase, and scd1, which encodes stearoyl co - a desaturase 1, were both significantly upregulated in db / db and ob / ob mice . A small increase in scd1 in hfd animals based on the results of gene expression microarray studies in obese human fat, we assayed in mouse cardiomyocytes the expression of 10 genes in the kyoto encyclopedia of genes and genomics (kegg) oxidative phosphorylation pathway that are components of the four mitochondrial electron transport and the atp synthase complexes . Ndufaf4 and ndufa8 (complex i, nadh dehydrogenase); sdhd (complex ii, fumarate reductase); cox5b, cox6b1, and cox6c (complex iii, cytochrome c reductase); uqcrc2 and uqcrfs1 (complex iv, cytochrome c oxidase); atp5j and atp5h (complex v, f - type atpase) were all downregulated to approximately the same extent in all three obesity groups (figure 5(d)). Genes within these complexes have been reported to be downregulated in several tissues in both man and experimental animals in association with obesity, diabetes, and insulin resistance [3034]. In preliminary studies, expression of peroxisome proliferator - activated - receptor gamma coactivator-1 (pgc-1) was downregulated by 40% in ob / ob and 39% in db / db animals . Less widely appreciated, although it was first discovered by harvey nearly 400 years ago, it is an apparently nonarteriosclerotic cardiomyopathy designated cor adiposum, or fatty heart, which is again being increasingly recognized in severely obese patients [3639]. As already noted, cardiac complications of obesity are particularly prevalent in patients with nafld [3, 4], a phenomenon that may be explained in part by the high degree of correlation (r = 0.81, p <0.01) observed between the cardiac triglyceride content reported in the present study and the previously reported hepatic triglyceride content in the same animals . The average body weights of our hfd - fed, db / db, and ob / ob mice were 1.3, 1.9 and 2.3 times those of control animals, corresponding very roughly in human terms to obesity, morbid obesity, and super obesity, respectively, and all had hepatic steatosis . The elevations in blood glucose and serum ffa and tg seen in these obese mice parallel what is observed in comparably obese humans . Each mouse group studied also had significant ectopic myocardial lipid accumulation and a corresponding decrease in lv contractility, suggesting that they might be models for human obesity cardiomyopathy . Lipid - associated cardiomyopathies in mutant and transgenic mice [4043] further stimulated us to examine the hearts of mice on whose livers we had initially focused . We have compared basic pathophysiologic features of three widely studied mouse models of obesity corresponding values in normal control animals . In db / db and ob / ob animals in contrast, in c57bl/6j mice fed a hfd, leptin signaling is initially normal . The pathogenetic diversity of the models studied suggests that the observations made can, at least tentatively, be considered representative of the obese state in general . While cardiac function has been studied in ob / ob, db / db, and hfd - fed mice separately, we believe this to be the first study directly comparing them . Our studies show that an increase in total body weight due to any of several different mechanisms is significantly correlated with an increase in both heart weight and cardiac tg content . These data parallel findings in man . As with hepatic steatosis [4547], increased myocardial tg content can result from one or more of several processes that increase cardiomyocyte lcfa or tg uptake or synthesis or decrease lcfa metabolism or tg export . In contrast to our findings in the liver, in which facilitated lcfa uptake was increased only in obesity models with normal leptin signaling, the vmax for saturable lcfa uptake is upregulated in isolated mouse cardiomyocytes from all obesity groups . We examined the associations between reduced cardiac function and body weight, cardiac tg content, lcfa uptake vmax and serum levels of lcfa and triglycerides by linear regression . Reductions in ejection fraction (ef) and fractional shortening of the left ventricle during systole (% fs) were strongly negatively correlated with body weight (r = 0.98), cardiac tg content (r = 0.98), and lcfa uptake vmax (r = 0.97) across all of the obesity groups . These correlations were significantly stronger than those between cardiac function and serum levels of either lcfa (r = 0.79) or tg (r = 0.62). Our studies were not specifically designed to identify the individual contributions of the many components of the obese phenotype to the observed reductions in cardiac function . However, these results do not suggest that either increased circulating levels of fatty acids or hypertriglyceridemia is as important as obesity per se or obesity - associated increases in cardiac lcfa uptake and triglyceride accumulation . Our technique for studying cellular lcfa uptake, in which measurements are made over 1530 sec, is unique in determining unidirectional, facilitated influx rates, largely independent of intracellular binding and metabolism . In specific settings results obtained by this approach have been shown to be highly correlated with the expression of specific lcfas transporters [5, 19]. Alternative approaches, in which labeled lcfa are injected intravenously into living animals and hepatic lcfa content determined minutes later, reflect a much more complex process which, in addition to cellular influx, is influenced by changes in blood flow, intracellular binding, efflux, esterification, oxidation, and possibly other processes, each subject to its own genetic regulation . Four proteins have been proposed as important cardiac lcfa transporters: cd36, also known as fatty acid translocase or fat, plasma membrane fatty acid binding protein (fabppm), which has proven identical to mitochondrial aspartate aminotransferase (maspat), and fatty acid transport proteins 1 and 6 (fatp1 and fatp6). In the present study, when assayed by both qpcr and western blot, upregulation of the cd36 (cd36) and slc27a1 (fatp1) genes and proteins was found in the hfd, db / db, and ob / ob groups, confirming that cd36 and fatp1 play an important role in cardiomyocyte lipid accumulation . The gene for fabppm / maspat (got2) was upregulated in ob / ob mice . Expression ratios for cd36 were especially highly correlated with vmax across all of the obesity groups . In addition to transporters, upregulation of stearoyl - coa desaturase-1 (scd1) gene was observed in all the obesity groups; fatty acid synthase (fasn) was significantly upregulated in both db / db and ob / ob mice, suggesting that, as in the liver, increased de novo lcfa synthesis may contribute to the increased cardiomyocyte triglyceride levels in these animals . Numerous prior publications indicate that obesity can influence the structure and function of the heart in mouse, rat, and man [4856]. An association of local lipid accumulation and cardiac dysfunction was reported in early human studies and has been meticulously confirmed . Left ventricular hypertrophy and decreased contractility, typical features of the cardiomyopathy of human obesity, were also the pattern consistently observed in the present mouse studies . The relationship between myocardial lipids and cardiac function was established conclusively by chiu et al ., who created a line of transgenic mice selectively overexpressing myocardial long - chain acylcoa synthetase (acas). By esterifying lcfa after initial uptake into cardiac myocytes, thereby preventing their otherwise rapid passive efflux, overexpression of this enzyme has the effect of trapping lcfa within these cells, where their subsequent metabolism leads to accumulation of toxic lipid species . This is initially associated with cardiac hypertrophy, followed by left ventricular dysfunction and early death . A second transgenic line that overexpresses the myocardial lcfa transporter fatp1 has a similar, but not identical, cardiomyopathy . Generation of reactive oxygen species from increased lcfa oxidation and mitochondrial injury have been considered important pathogenetic processes in the development of both lipid- and alcohol - associated cardiomyopathies . Epicardial fat has a rapid lipolytic rate . Since the heart is immediately downstream of its visceral (extra- and intrapericardial) fat depots and has a first - pass relationship with respect to any lcfas released from them, this results in increased cardiac delivery and uptake of lcfa, which would tend to become virtually continuous with the onset of antilipolytic insulin resistance . Therefore, it is not surprising that obesity in many settings is associated with changes in cardiomyocyte morphology, mitochondrial number, and contractile function . Increased mitochondrial number has been described, for example, in the hearts of ob / ob [52, 54] and db / db mice . Based on these data it has been suggested that mitochondrial dysfunction and impaired myocardial energetics may contribute to contractile dysfunction in the hearts of these mice and of obese patients, increasing their susceptibility to heart failure [55, 59]. Our demonstration of coordinated down - regulation of 10 genes involved in the cardiac mitochondrial oxidative phosphorylation and atp synthesis pathway in all three obesity models studied is entirely consistent with this hypothesis . Our data provide strong evidence that upregulation of facilitated lcfa uptake is an important mechanism contributing to increased myocardial lipid accumulation across a spectrum of mouse models of obesity . The data also point to cd36 and fatp1 as the transporters principally responsible for the increase in lcfa uptake . The contribution of increased de novo lcfa synthesis, suggested by qrt - pcr studies of the expression of relevant genes, requires further functional confirmation . Finally, the coordinate down - regulation of 10 genes in the mitochondrial oxidative phosphorylation / atp synthesis pathway suggested down - regulation of peroxisome proliferator - activated receptor coactivator-1 (pgc-1), a key regulator of cardiac mitochondrial functions including mitochondrial fatty acid oxidation, atp synthesis, and lipid homeostasis [5961]. Preliminary observations reported above strongly suggest that pgc-1 is indeed downregulated in at least some models of obesity . We postulate that pgc-1-mediated decreased atp synthesis will prove to be responsible for the reductions in% fs and ef observed in these models . In this study we have established a clear relationship between obesity, increased cardiac triglyceride content, and cardiac dysfunction in mice with a spectrum of causes for obesity . This suggests that cardiomyopathy, rather than being a novelty, is an integral part of the spectrum of obesity - related disorders . We have also established that increased facilitated transport of lcfa into the cardiomyocyte is an important pathogenic mechanism in this process . We have also identified other genes of interest, future studies of which may explain many of these findings . These include peroxisome proliferator - activated receptor gamma coactivator-1 (pgc-1), a master regulator of lipid and energy metabolism, as well as those involved in atp synthesis . Despite these data, the precise processes by which cardiomyocyte lipid accumulation leads to myocardial dysfunction remain to be elucidated . Whether they are the same as those described as nevertheless, the many similarities between the present cardiac findings in mice and analogous human data suggest that these mice may be useful models for human obesity cardiomyopathy, particularly given the limitations in obtaining human cardiac tissue for study . Moreover, the correlations we observed between body weight, myocardial lipid accumulation, and decreased lv function, over a weight spectrum ranging from normal to super obesity, suggest that the recent observations of myocardial dysfunction in severely obese patients may be the tip of a much larger iceberg. |
Femoroacetabular impingement (fai) is being increasingly recognized as a common cause of hip pain in the young, active patient population [16]. Longitudinal studies have demonstrated that the presence of fai increases the risk of developing osteoarthritis (oa) [7, 8] through the abnormal static and dynamic stresses applied to the labrum and cartilage [911]. Treatment options for fai vary widely [1214] and are typically dependent upon symptoms, amount of oa present and osseous anatomy . Multiple studies have demonstrated that the presence of radiographic oa results in suboptimal improvement in outcome scores following hip arthroscopy for fai [1518]. Magnetic resonance imaging (mri), frequently used in the work up and evaluation of patients who are potential candidates for fai surgery, has variable sensitivity and specificity in the identification of cartilage lesions [1922]. In the absence of radiographic oa, however, arthroscopic surgery to address cartilage and labral pathology as well as abnormal femoral and acetabular contour has proven effective at improving clinical outcome scores and allowing athletes to return to play [2325]. Despite promising results, the revision rate after while residual deformity is the most common reason for revision hip arthroscopy, there has recently been an increased emphasis on biological factors leading to suboptimal outcomes following hip arthroscopy . Ross et al . Compared three - dimensional hip morphology of symptomatic hips prior to revision arthroscopy to the three - dimensional morphology of a cohort of patients not requiring a revision arthroscopy . Residual deformities were present in 45 of 50 patients (90%) in the cohort undergoing revision arthroscopy . Dwyer et al . Examined a cohort of 182 patients who had undergone revision arthroscopy and noted that the location of chondral damage was an important predictor of revision arthroscopy . Other studies investigating the clinical response following intra - articular anesthetic injection or the relationship between femoral anteversion and symptom resolution following arthroscopy for fai found no correlation [29, 30]. Several basic science and clinical experiments have provided evidence for the role of proinflammatory molecules in the development of arthritis . Identified a protein complex of fibronectin and aggrecan that was present in patients with a painful meniscal tear that was absent in asymptomatic controls . Our group previously reported the presence of an elevated cartilage breakdown product [fibronectin aggrecan complex (fac)] in patients with cartilage damage noted at the time of hip arthroscopy . Fibronectin, a large glycoprotein, and its proteolytic fragments have demonstrated to be chondrolytic toward cultured cartilage explants in in vitro studies [32, 33] and after injection into the knee joints of animal models [32, 34, 35]. Aggrecan is a high - molecular - weight proteoglycan component of the articular cartilage extra - cellular matrix . Fibronectin, by way of catabolic cytokines, has been demonstrated to cleave aggrecan, thereby leading to cartilage degradation and joint disease . As the presence of oa has shown to negatively affect outcomes, it is possible that further detection of cartilage or inflammatory pathology not evident on imaging or conventional work up methods may assist in predicting clinical response to arthroscopic intervention and therefore help in determining the optimal surgical candidates . The purpose of this study was to determine whether hip synovial fluid cytokine concentrations correlated with post - operative clinical outcomes at a minimum of 2 years following hip arthroscopy for fai . Institutional review board approval was received and informed consent was obtained from each study participant . Seventeen patients who underwent hip arthroscopy for fai and whom we previously reported cytokine values were targeted for inclusion . These patients were recruited from the arthroscopic arm of our previous study in which we evaluated the cytokine concentrations in hips of those patients undergoing either hip arthroscopy or arthroplasty . Inclusion criteria for this cohort and the previous arthroscopic cohort included age greater than 18 years, signs and symptoms of hip pain as well as imaging results consistent with fai and those patients electing to undergo hip arthroscopy . Exclusion criteria included radiographic evidence of oa, history of prior trauma to the involved hip or history of inflammatory arthritis . All patients presented with the complaint of hip pain and underwent a thorough work - up (history, physical exam, radiographs and mri, when applicable). Patients were offered surgical intervention after a documented trial and failure of non - operative treatment and clinical response following a diagnostic intra - articular anesthetic injection . Each patient completed patient reported clinical outcomes questionnaires prior to surgery [modified harris hip score (mhhs), western ontario and mcmaster universities arthritis (womac) index, and the international hip outcomes tool (ihot-33)] and at a minimum of 2 years following surgical intervention for fai . For follow - up on the mhhs, patients were asked whether they had any limitations of motion . If they responded that their motion was normal, maximum scores were given for this section of the mhhs . Intra - operative findings recorded included articular cartilage and labrum status, and operative procedure(s) performed included microfracture, labral repair and/or labral debridement . Standard practice at the time of this investigation was to perform microfracture for full - thickness cartilage defects greater than 7 mm from the acetabular rim, labral debridement when intra - substance labral tearing was present and labral repair when chondrolabral separations were present . The anterolateral portal was established with an 18-gauge spinal needle placed over a guide wire under fluoroscopic guidance . After the camera was placed in the anterolateral portal, the spinal needle was introduced to establish the posterolateral portal, which was visualized piercing the posterolateral capsule and entering the joint . After portal establishment, synovial fluid was obtained by injecting 10 ml of sterile normal saline intra - articularly and aspirating back the fluid . All lavasate was collected prior to being placed into 2-ml tubes with 130 l of protease inhibitor (roche diagnostics, indianapolis, in) and dissolved in phosphate - buffered saline solution (0.045 tablet / ml sample) at a ph of 7.4 . The tubes were then frozen at 80c until cytokine analysis was performed . The choice of inflammatory molecules assayed was representative of typical molecules observed in a variety of inflammatory conditions . The synovial fluid biomarkers measured were fac, interferon-, interleukin (il)-6, il-1 receptor (il-1ra), il-1b, monocyte chemoattractant protein-1, eotaxin, macrophage inflammatory protein-1, interferon - inducible protein 10, platelet - derived growth factor - bb, regulated upon activation normal t cell expressed and presumably secreted, tumor necrosis factor-, and vascular endothelial growth factor . Following the protocol established by the manufacturer, the concentrations were determined through the use of a panel of human multiplex inflammatory cytokines and the bioplex 200 system (bio - rad laboratories, hercules, ca). The assay was performed through the use of antibody linked polystyrene beads with various fluorophore levels and has been validated against standard enzyme - linked immunosorbent assays (elisa). The relative concentration of each sample of each cytokine was compared with standard positive and negative control concentrations provided by the manufacturer . Fac concentration was reported as optical density as determined by the use of a heterogeneous sandwich elisa . Pre and post - operative questionnaire scores were compared with a paired t - test and the association between intra - operative cytokine concentration and post - operative questionnaire score was performed with pearson s correlation coefficient (spss v.21, ibm incorporated, sommers, ny). Follow - up clinical outcome scores for 16 of the 17 patients (94%) were available at a minimum of 2-year follow - up . The cohort consisted of 4 males and 12 females with an average age of 38.9 11.2 years at the time of operation . Of the 16 patients available for follow - up, 6 patients underwent both cheilectomy and acetabuloplasty, 4 underwent acetabuloplasty, 2 underwent cheilectomy only and 4 underwent neither acetabuloplasty nor cheilectomy but rather had labral debridement or repair, chondroplasty or capsular plication . No patients that provided 2-year follow - up had undergone interval operations on the operative hip . Statistically significant pre - operative to post - operative improvement was seen in mhhs (p <0.0001), womac (p <0.0001) and ihot-33 (p <the mean mhhs improved from 61.9 to 82.5 {mean difference = 20.6 [95% confidence interval (ci) 13.627.6]}, womac scores improved from 42.7 to 16.4 (mean difference = 26.3 [95% ci 17.834.8]) and ihot-33 scores improved from 44.6 to 83.4 (mean difference = 38.9 [95% ci 29.448.4]). The mean cytokine values for the entire cohort are listed in table i. figure 1 demonstrates the mean analyte concentration compared with measured ihot-33 score . Patients were dichotomized into groups with a score below (blue) and above (green) the median ihot-33 value of the entire cohort . Table i.cytokine values in hip synovial fluidcytokinemeansemfac (od)1.0520.361ifn- (g / ml)29.04714.155il-637.85320.534il-1ra879.174512.799il-1b1.2730.661mcp-128.1109.854eotaxin7.9154.661mip-15.0010.828ip-10171.07343.704pdgf - bb262.348159.806rantes318.47890.539tnf62.04334.918vegf140.26440.863tnf, tumor necrosis factor; rantes, regulated upon activation normal t cell expressed and presumably secreted; ip-10, interferon - inducible protein 10; mip, macrophage inflammatory protein; mcp, monocyte chemoattractant protein; ifn, interferon; vegf, vascular endothelial growth factor; sem, standard error of the mean; od, optical density; pdgf - bb, platelet - derived growth factor - bb . Mean concentration of all analytes broken down by patient groups . Patients were dichotomized into groups with a score below (blue) and above (green) the median ihot-33 value of the entire cohort . Cytokine values in hip synovial fluid tnf, tumor necrosis factor; rantes, regulated upon activation normal t cell expressed and presumably secreted; ip-10, interferon - inducible protein 10; mip, macrophage inflammatory protein; mcp, monocyte chemoattractant protein; ifn, interferon; vegf, vascular endothelial growth factor; sem, standard error of the mean; od, optical density; pdgf - bb, platelet - derived growth factor - bb . No significant correlation was seen between any of the synovial fluid cytokine values and the 2-year follow - up outcome scores . No significant correlation was found between any cytokine value and the difference between pre - operative and post - operative questionnaire scores . This investigation sought to determine whether synovial fluid cytokine concentrations correlated with clinical outcomes at a minimum of 2 years following hip arthroscopy for fai . The hypothesis of increased cytokine concentrations correlating to decreased clinical outcomes (or less improvement in outcome scores) was not supported by the data and no statistically significant relationship was found between these measures . The number of arthroscopic hip operations continues to increase with the improved understanding of fai as a cause of hip pain . Radiographic evidence of severe pre - operative oa has been repeatedly shown to be associated with worse clinical outcomes [1518]. Although arthroscopy for fai in patients with hip pain and without radiographic evidence of oa has overall been effective at improving pain and clinical outcome scores, a subset of these patients do not achieve optimal outcomes . There are many potential reasons for a lack of optimal clinical outcomes following hip arthroscopy . The most commonly cited cause of sub - optimal clinical outcome is residual or incomplete correction of bony deformity [27, 3840]. It is possible that oa of the hip at the time of the initial fai operation may be underreported, as these studies report those undergoing revision hip arthroscopy . Patients with persistent hip pain after arthroscopic fai surgery, in the realm of hip oa, often are treated with hip arthroplasty and thus not included in these aforementioned revision hip arthroscopy series . Unaddressed hip instability is yet another recognized cause of failed hip arthroscopy [40, 41] and cadaveric studies examining capsular and labral contributions to hip instability highlight the importance of addressing and managing capsular defects [42, 43]. Additionally, early cartilage damage or joint inflammation, which may not be detectable by radiography or mri, may also contribute to poor post - operative outcomes . In an investigation of patients requiring revision hip arthroscopy, the presence of chondral damage on the anterior acetabulum was a positive predictor for revision arthroscopy . Patients with evidence of mild chondral damage of the anterior acetabulum were nearly two times more likely to undergo revision, while those with moderate to severe chondral damage on the anterior acetabulum were 1.5 times more likely to undergo revision . Of note, the presence of chondral damage to the femoral head and superior, lateral and posterior acetabulum were not predictive of revision . This data, however, require patients to undergo surgery to determine their status with regard to the need for revision surgery and/or post - operative outcomes . Rather, a more suitable method to determine outcomes following hip arthroscopy would be one in which surgical intervention is not required . This could come in the form of pre - operative assessment of joint status through a combination of imaging as well as cytokine profiling, which could be obtained through pre - operative aspiration potentially at the same time as a diagnostic injection or arthrogram . Our group s previous study collected hip synovial fluid from a cohort undergoing arthroscopy (those who had minimal to no radiographic oa) and another cohort undergoing arthroplasty (those who had radiographic evidence of oa) and analyzed the cytokine concentration differences between cohorts . This work identified a biomarker (fac), which was shown to be elevated in patients undergoing hip arthroscopy for fai when compared to those undergoing arthroplasty for oa . Additionally, it was found that those patients undergoing arthroscopy who were noted to have cartilage loss requiring microfracture at the time of operative intervention had elevated levels of fac compared to those with less cartilage loss who did not meet the indication for microfracture . This previous study did not find a relationship between biomarker concentration and pre - operative assessment scores; however, it did not study the relationship between cytokine concentration and change in outcome scores . Although the data presented in this study do not support the ability of cytokine concentrations to predict clinical outcomes, there is potential to identify a subset of biomarkers, which will not only lead to better patient selection and pre - operative counseling but may also lead to a better understanding of hip pain and avenues by which to direct potential therapeutic targets . The ability to determine cartilage status via synovial fluid aspirate may be useful in predicting joint pathology prior to surgical intervention and therefore help to determine which patients may be most amenable to intervention for fai . The lack of significant correlation between cytokine values and patient reported outcome assessments may be due to the fact that 2-year follow - up may not be long enough to detect clinical differences between patients who may respond more positively to arthroscopic intervention in the hip . Dwyer et al . Reported that revision operations occurred at an average of 3.1 2.8 years after the index operation . Additionally, it may be due to the large variability of cytokine concentrations that were observed between patients . While no normative data exist regarding synovial fluid cytokine concentrations in those with fai, gene expression profiles of synovial fluid in hips with rapidly destructive coxopathy, oa, osteonecrosis and rheumatoid arthritis also demonstrated large variations in il-1, il-6, il-8 and tumor necrosis factor- between subjects . Finally, it is possible this study was underpowered to detect a significant difference in some of the attempted analyses . For example, a post - hoc power analysis revealed that to see a statistically significant correlation between fac concentration and post - operative mhhs scores, 44 patients per group would have been required . To conclude that a statistically significant correlation existed between fac and ihot-33 scores, 58 patients per group would have been needed . Given the sample size of 17 patients, this study was not powered to detect significant correlations between fac and clinical outcomes based on these post - hoc analyses . Furthermore, it is possible there was a dilutional effect that influenced the synovial fluid samples . Great care was taken to adhere to the sample collection protocol while performing the lavage and obtaining the aspirations . Despite the fact that the volume of saline injected was standardized, it is possible that the presence of a joint effusion created a dilutional effect that influenced the sample obtained . This limitation is likely minimal as no significant joint effusions were present at time of aspiration . Although there were no apparently grossly contaminated samples, the effect of blood and other contaminants on cytokine concentrations is not well described . There was no correlation between synovial fluid cytokine concentrations and post - operative clinical outcome scores at a minimum of 2 years following hip arthroscopy for fai . Larger and longer - term investigations are warranted to further evaluate the relationship of intra - operative cytokine concentration and clinical outcomes after hip arthroscopy . G.d.a . Serves as a consultant and has stock options in cytonics, inc . And |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.