Split (1)

train · 133k rows

text stringlengths 0 868k
Liquid - based cytology (lbc) as a technique was introduced and tried on pap smears . Thereafter, this technique was performed for non - gynecological cytology, including conventional fine needle aspiration cytology (fnac), guided fnac and fluid cytology . The thin - prep (tp) smears were consistently devoid of obscuring elements and the cells were adequately preserved and evenly dispersed . Pitfalls noticed as cytomorphologic alterations in lbcs are small - sized cell clusters, with more single cells than sheets . The cells are generally smaller, occasionally show spindling, chromatin detail is attenuated, nucleoli are more prominent, intranuclear inclusion is difficult to visualize, decrease of extracellular particles is seen, there is a decrease in the number of small mononuclear cells / red blood cells / myoepithelial cells and the background matrix is altered . The pathologist should be cautious in interpreting fine needle aspirations prepared using tp if that is the only methodology employed . The advantages of lbc, independent of diagnostic accuracy and morphology, have been well described . Although studies on lbc are documented for breast, non - gynecological specimen, thyroid, salivary gland and soft tissues, the authors supplemented bone lesions to all the above in their study . Lbc in fnac smears can be performed on aspirates from different organs like salivary gland, thyroid, lymph nodes, breast, bone and soft tissue and other usual and guided fnac samples . Processing of the samples is carried out using the tp kit, marketed by cytec corporation, malborough, ma, usa . In a comparison study, usually two passes are made . The first pass is performed for the conventional preparation (cp) and the second pass is for the tp preparation . Tp smears are superior to cp smears in fnac; this fact can be proved by performing a wilcoxon's signed rank test, p value <0.001 . Tp preparations are nowadays used in some sophisticated investigations like immunohistochemistry studies in breast lesions, non - hodgkin's lymphoma (nhl) and hodgkin's lymphoma (hl) in effusions, analysis of proliferating cell nuclear antigen (pcna), cell blocks from scraping of cytosmears and comparison with conventional cell blocks . The aim of our study was to determine the efficacy of lbc technology over conventional smear methods in fnac samples . The study was performed on patients attending the cytology outpatient department (opd) of the hospital over a period of 2 years ., samples were processed using the liquiprep processing kit and a special kit marketed by cytec corporation . Processing was performed manually in three steps, i.e. Collection, concentration and cellular encapsulation . The lp cytology processing kit contains a preservative solution and a cellular base . Using the lbc processing kit,, the samples were pushed into a preservative solution, approximately three - times the volume of the sample, and left as such for at least 1 h. this is followed by the next step, i.e. Concentration, where the preserved sample is centrifuged at 3000 rpm for 30 min . For cystic fluids, the supernatant fluid is discarded and, after adding the cleaning solution, it is again centrifuged for 15 min to increase its concentration . A pellet is produced, the supernatant fluid is discarded and a base solution of about 50 microl is added to the pellet to make a thin, homogenous suspension . This suspension was placed on an ethanol - cleaned glass slide and two circular smears of 1 cm diameter were made . The second option, which uses a cellular base solution, was used in certain cases, particularly if the sample contains necrotic substance or mucin . About 4 ml of cleansing solution was used in selected cases, along with the preservative solution, and the processing was performed in a similar fashion . Two passes were performed, the first pass was for cp and the second pass yielded material for the tp preparation, which was processed by the tp kit marketed by cytcec corporation . Different stains were used for staining the cp and lp smears, like he, pap and diff quick . The representative cs and lb preparations were compared by a semiquantitative scoring system using several criteria [table 1]. The concentration method used in the procedure was useful in the diagnosis of cystic lesions like aneurysmal bone cysts, warthin's tumor of salivary glands and metastatic carcinoma . Statistical analysis was performed using the wilcoxon signed rank test on the spss program (chicago, il, usa). Every cytological diagnosis was recorded and tabulated and compiled to yield the p - value . A total of 110 cases were studied, which were distributed among 30 cases of breast (10 fibroadenoma, four mastitis and 12 ductal carcinoma), 40 cases of lymph node (20 reactive hyperplasia, 12 granulomatous lymphadenitis, three lymphoma and five metastatic carcinoma), 10 cases of salivary gland (two sialadenitis, five mixed tumor, one warthin's tumor and two mucoepidermoid carcinoma), 18 cases of thyroid (10 colloid goiter, four thyroiditis and four carcinoma cases) and 12 cases of soft tissue and bone lesions (five benign and seven malignant). Comparison between cytological features in lbc and cs was carried out using the wilcoxon signed rank test separately for each organ in a tabular form, as shown in table 2 . In our study, in two cases of pleomorphic adenoma, one case of warthin's tumor and two cases of colloid goiter, a support of cs was needed due to pitfalls in lbc described above . Wilcoxon signed rank test statistics of lbc versus cp for breast cases, fibroadenoma, mastitis and ductal carcinoma were better diagnosed on lbc preparations due to clarity of the nuclear features [figure 1]. Comparison data for lymph nodes suggested that the rs cells were more easily diagnosed on lbc smears due to monolayering . Liquiprep cytosmear of the breast showing pleomorphic - looking ductal epithelial cells in a cluster and acinar pattern in a clear background in case of salivary gland lesions, the mixed salivary tumor was better visualized in the conventional smear because of preservation of the stromal component . Cystic neoplasms of the salivary glands were better appreciated in lbc smears because of concentration . In sialoadenitis, lbcs were not very useful in goiter and infectious lesions, but they proved very useful in neoplastic lesions [figure 2]. In lytic bone lesions like aneurismal bone cyst (abc), giant cell tumor (gct) and metastasis, liquiprep cytosmear showing papillary carcinoma of the thyroid in a clear background with nuclear grooving the study conducted by mygdakos et al . Lbc was favored over cs for evaluating gynecological specimens, which was approved by the fda in 1996 . Thereafter, lbc has been found to be useful in non - gynecological cytologic specimens like fnac and body fluids, both small and large volume, which have drawn variable conclusions . In conventional fnac smears, cells are admixed with debris, blood and exudates, which make the interpretation difficult . There is suboptimal preservation of cells and cellular obscuring by unwanted material, leading to a high proportion of cases reported as inadequate or unsatisfactory for assessment . To overcome this problem, the lbc technique was introduced, which preserves cells in a liquid medium and removes all debris, blood and exudates, either by filtration or density gradient interpretation, there is even distribution of cell material, lack of obscuring factors, no drying artifact and monolayering . In our study, fnac was performed from various sites like breast, lymph node, salivary glands, thyroid and bone and soft tissue . In fibroadenoma breasts, although stromal fragments were lost, lbc proved to be useful in the diagnosis based on visualization of ductal aggregates and bipolar cells . For duct carcinomas, the wilcoxon signed ranked test for thyroid lesions [table 2], lbc was not useful in goiter and infectious lesions . Lbc was not useful in cystic neoplasms like warthin's tumor, mucoepidermoid and adenoid cystic carcinoma and comparable to the study by parfitt et al . For bone and soft tissues, good results were obtained in lbc because of background clearing and concentration phenomenon . In all lesions of the lymph node, lbc proved to be a better option . Because of the pitfalls of lbc, as described above, in some selected cases of granulomatous lymphadenitis (lacking epitheloid cells), mucinous tumors (lack of mucin), colloid goiter (thin colloid fragmented) and pleomorphic adenomas of the salivary gland (myxoid background poor and present in droplets), a support on cs may prove useful . As observed by the authors, lbc of bony lesions do not require support of cs . Tp preparations are superior to cps with regard to clear background, monolayer cell preparation and cell preservation . It is easier and less time consuming to screen and interpret tp preparations because the cells are limited to smaller areas on clear backgrounds, with excellent cellular preservation . However, tp preparations are more expensive than cp and require some experience for interpretation . Lbc is strongly advocated in the best interest of public health, by improving the quality of the sample and reducing the likelihood of false - negative cytology results.
Eligible subjects were healthy individuals who voluntarily received routine comprehensive health check - ups, including computed tomography (ct) scan analyses of abdominal adipose tissue, from january to december 2008 at the seoul national university hospital healthcare system gangnam center . Data were collected through a questionnaire, anthropometric measurements, blood samples, and ct scans . Detailed descriptions of the method used for the measurement of abdominal adipose tissue have been published previously (8). In brief, a 5-mm thick umbilical level abdominal section from 16-detector row ct imaging of the abdomen was obtained . The cross - sectional area (cm) of the abdominal fat was calculated using rapidia 2.8 ct software (infinitt, seoul, korea). The vat area was defined as intra - abdominal fat bound by parietal peritoneum or transversalis fascia, and the sat area was calculated by subtracting the vat area from the total adipose tissue area . Because of the high colinearity between sat and vat, adjustments to the regression model or stratification of vat are insufficient to control for the effects of vat on sat . The ratio between sat and vat (sat / vat ratio [svr]) was therefore calculated and used in the current study . Mets was defined according to the modified national cholesterol education program adult treatment panel iii (9) and asia - pacific abdominal obesity criterion (10). Means with 95% ci and numbers of participants (%) with metabolic risk factors were compared across the svr quintiles . We used multivariate logistic regressions to evaluate the association between mets and svr after adjusting for age, smoking, alcohol consumption, bmi, menopausal status, and hormonal replacement therapy (women only). Data are expressed as odds ratio (or) [95% ci]; and p for trend . Detailed descriptions of the method used for the measurement of abdominal adipose tissue have been published previously (8). In brief, a 5-mm thick umbilical level abdominal section from 16-detector row ct imaging of the abdomen was obtained . The cross - sectional area (cm) of the abdominal fat was calculated using rapidia 2.8 ct software (infinitt, seoul, korea). The vat area was defined as intra - abdominal fat bound by parietal peritoneum or transversalis fascia, and the sat area was calculated by subtracting the vat area from the total adipose tissue area . Because of the high colinearity between sat and vat, adjustments to the regression model or stratification of vat are insufficient to control for the effects of vat on sat . The ratio between sat and vat (sat / vat ratio [svr]) was therefore calculated and used in the current study . Mets was defined according to the modified national cholesterol education program adult treatment panel iii (9) and asia - pacific abdominal obesity criterion (10). Means with 95% ci and numbers of participants (%) with metabolic risk factors were compared across the svr quintiles . We used multivariate logistic regressions to evaluate the association between mets and svr after adjusting for age, smoking, alcohol consumption, bmi, menopausal status, and hormonal replacement therapy (women only). Data are expressed as odds ratio (or) [95% ci]; and p for trend . Forty percent of men and 25% of women had elevated blood pressure, 31% of men and 15% of women had elevated fasting glucose, and 25% of men and 14% of women had mets . The mean sat and vat areas were 139.8 cm and 134.4 cm in men and 173.1 cm and 80.0 cm in women, respectively . The prevalence of elevated fasting glucose, elevated triglycerides (tgs), and reduced hdl cholesterol (hdl - c) significantly decreased as the svr quintile increased (26, 16, and 37% in quintile 1 vs. 5, 4, and 11% in quintile 5, respectively; all p for linear trend <0.05) robust linear decreases in these risk factors were also seen among men (supplementary table 1b). Ors of mets significantly decreased across all 5 quintiles of the svr after adjusting for covariates in both men (or 1.0 for quintile 1 vs. 0.5 in quintile 5; 95% ci 0.30.7 for quintile 5; p for linear trend <0.01) and women (or 1.0 for quintile 1 vs. 0.2 in quintile 5; 95% ci 0.10.5 for quintile 5; p for linear trend <0.01) (table 1). Unadjusted and adjusted ors and 95% ci from logistic regressions predicting the likelihood of mets for each of the svr quintiles * adjusted ors take into consideration age, smoking, alcohol consumption, bmi, and menopausal status, hormone replacement therapy (women only). Ors of mets significantly decreased across all 5 quintiles of the svr after adjusting for covariates in both men (or 1.0 for quintile 1 vs. 0.5 in quintile 5; 95% ci 0.30.7 for quintile 5; p for linear trend <0.01) and women (or 1.0 for quintile 1 vs. 0.2 in quintile 5; 95% ci 0.10.5 for quintile 5; p for linear trend <0.01) (table 1). Unadjusted and adjusted ors and 95% ci from logistic regressions predicting the likelihood of mets for each of the svr quintiles * adjusted ors take into consideration age, smoking, alcohol consumption, bmi, and menopausal status, hormone replacement therapy (women only). The purpose of this study was to assess the cross - sectional correlation of abdominal sat with mets in a korean study population . We found that as the svr increased, mets components such as reduced hdl - c, elevated tgs, and elevated fasting glucose decreased in both sexes . Furthermore, this relationship was maintained even after the adjustment for a variety of variables . Small adipocytes in sat play the role of powerful buffers, uptaking circulating free fatty acids and tgs in the postprandial period . But if they lose their function in adipogenesis or fat storage capacity in sat, fat begins to accumulate in tissues not suited for lipid storage such as vat . Peroxisome proliferatoractivated receptor- (ppar-) agonists stimulate the differentiation of adipocytes, resulting in increased accumulation capacity in sat (12). The ppar- coactivator 1 mrna expression is significantly higher in subcutaneous fat than in omental fat (13).this mechanism explained the finding that treatment with thiazolidinedione improves insulin sensitivity (6). Vat and sat differ in cytokine secretion profile such as leptin, adiponectin, interleukin-6, interleukin-8, plasminogen activator inhibitor 1, and angiotensin, which may play some role in the development of mets (14,15). Longitudinal associations of vat / sat change with mets, and with leptin and/or adiponectin level should be the focus of future studies . Gluteofemoral sat, which may act as a confounding factor, was not considered in the study . However, the current study included the analysis of a large dataset of ct - measured sat and vat . Moreover, the study population was generally healthy, which implies that the results can be applied to the general korean population.
Recurrent aphthous stomatitis (ras) is the most common recurrent lesion of the oral epithelium . The prevalence of ras was reported to be 40% in a population of children of the united states . A prevalence of 31 - 36% has been reported for ras among medical and dental students, compared with 10 - 20% in the general population . Although few data are available regarding the etiologies and management of aphthous lesions, factors such as inheritance, hormonal effect and immunological factors have been considered . Lesions usually begin due to local trauma, stress, certain foods or drugs, hormonal fluctuations or deficiencies in the vitamin b group, folate or iron . Apart from the different causes and predisposing conditions affecting the disease, pain, recurrence, self - limitation and epithelial damage are present in almost all lesions . Recurrent aphthous lesions are divided into three groups including: minor, major and herpetiform, based on the clinical appearance and prognosis of the disease . All the existing treatment options are based on symptomatic management, lesion count reduction and/or extending the lesion - free periods . Blood samples should then be assessed for deficiencies in serum iron, folate, ferritin and vitamin b12 . Most patients suffering from minor aphthous lesions need no special treatment or only local treatment to adequately reduce their symptoms or lesion counts as well as to increase the interval between aphthous episodes . In patients suffering from major aphthous lesions or in those susceptible to numerous minor lesions that are resistant to local treatment the administration of local antibiotics such as tetracycline was effective in aphthous lesion management, probably due to a secondary decrease in infection and the clinical improvement of lesions . Most therapeutic approaches are based on palliative rather than curative therapy, and none of them could prevent the recurrence of the symptoms avishan - e shirazi is a thyme - like essential oil (eo)-bearing plant that belongs to the lamiaceae family and grows extensively wild in the central and southern parts of iran, pakistan, and afghanistan . The dry aerial parts of the plant have been used for their flavor and preservative properties in the food products industry . In iran, zm is mainly used in traditional folk remedies for its antiseptic, analgesic, and carminative (antiflatulence and intestine - soothing) properties . It also has been reported that the eos and extracts of zm can stimulate innate immunity and have antibacterial and antifungal activities . Thus, the present study was aimed to investigate the therapeutic effects of zm for treatment of oral aphthous lesions . This triple blind clinical trial was performed on 28 patients who were randomly selected from all patients suffering from recurrent aphthous lesions who were admitted to the department of oral medicine, faculty of dentistry, babol university of medical sciences in the north of iran . The study protocol was approved by research review board and research ethics committee of babol university of medical sciences and we registered the protocol in the iranian clinical trials registry (irct201408076926n2). The inclusion criteria were as follows: presence of a minor solitary aphthous lesion in labial or buccal epithelium.no usage of other treatments for aphthous lesions.no reduction in pain, pain intensity or burning sensation at the time of admission compared to the 1 days of the occurrence of the lesion.willingness to participate in the study.age between 18 and 40 years . No reduction in pain, pain intensity or burning sensation at the time of admission compared to the 1 days of the occurrence of the lesion . The exclusion criteria were: patients with any systemic diseases or special syndrome that aphthous ulcer is one of its symptoms (behcet's syndrome); pregnant patients; those with aphthous lesions older than 4 days, patients subjected to any other treatment for at least 4 weeks before the start of the study and those who declined entering the study . Diagnosis of minor aphthae was made on the basis of the patient's health history, clinical examination and the presence of a well demarcated painful ulcer on the smooth unattached oral mucosa, which is surrounded by a light red areola . After explaining the objectives of the study, after that, the eligible participants were divided into zm- and placebo - treated groups randomly . The patients received a bottle of 0.5% zm eo or a bottle of placebo (distilled water with a cap scented with zm eo). Standard zm essence was obtained from barij essence pharmaceutical company (kashan, iran). All bottles were coded by a third person who did not involve in the project, so that the contents of the bottles remained unknown to the researchers and patients throughout the study . To administer the drug or placebo, 15 drops of drug / placebo were diluted into one half cup of cold water and used as a mouthwash for 2 min 3 times a day, once after each meal . This therapy was continued until complete healing (no ulcer and no burning sensation) was obtained . Patients were examined by the clinician on the 1, 5 and 7 days of treatment . The pain intensity was measured using a scale, which the patients completed every day for 10 days (before and after treatment). In total of 14 participants in each group (eight men and six women), all of them finished the study . A history of aphthous lesions was reported for 3 patients in the placebo group and 7 patients in the zm group (p = 0.236). During the 6-month follow - up, recurrence had occurred in 4 and 6 patients in the placebo and zm groups, respectively . The mean (standard deviation) treatment durations were 8.5 1.2 and 8.4 1.2 days in the placebo and zm groups, respectively (p = 0.765). Complete healing and burning sensation cut - off times (the time in which the patient had no pain thereafter) were significantly decreased in the zm group compared to the placebo group [table 1]. There were also significant differences between the lesion and halo diameters in the two groups [tables 2 and 3]. As illustrated in figure 1, the peak pain score occurred between days 3 and 5 . Mean (sd) complete healing and burning sensation cut - off times (days) in the placebo and zm groups mean (sd) halo diameters (mm) in the placebo and zm groups mean (sd) lesion diameters (mm) in the placebo and zm groups mean (standard deviation) pain intensity according to officinale in the placebo and zataria multiflora groups . Our findings revealed that the management of ras lesion with zm could indicate a significant decrease in the characteristic of the lesion (diameter of the lesion and halo), complete healing time and burning sensation of the patients . Ras is a common oral disorder of uncertain etiopathogenesis, and presently, its management is largely focused on symptomatic treatment . Ras causes considerable pain and distress for patients and presents a difficult management challenge for clinicians . Different classes of chemical and biochemical products have been reported to be of some benefit in the management of ras, but no definitive treatment is yet available . Zm eo has been reported to have antibacterial, antiviral, antioxidant, and anti - inflammatory properties . This study was undertaken to evaluate the therapeutic effects of zm eo for treatment of recurrent aphthous lesions . The results of the study showed that the complete healing time in the drug group was significantly shorter than that in the placebo group . In other words, using zm led to a reduction in the time required for the lesions to heal . A review of the literature yielded few reports on the effectiveness of zm eo in treating oral aphthous lesions . The mechanism of action that play the major role in the healing process of these lesions may due to its anti - microbial role and ant - oxidative effect on the aphtous reactivity . Nevertheless, there are many reports on the efficacy of other herbal drugs for treatment of the disease . In a study by mansoori et al ., zm eo effectively resulted in a faster pain relief and shorter healing period . In a study conducted by jafari et al . Zm extract was a more effective treatment than myrthus communis, which is reported to be effective in the treatment of ras . It was concluded that zm extract was an effective treatment for the management of minor aphthae . Antimicrobial and anti - oxidant activities of four tai plants (quercus infectoria, kaempferia galanga, coptis chinensis and glycyrrhiza uralensis) for aphthous ulcers were shown by mekseepralard et al . Previous studies have evaluated the therapeutic effects of satureja khuzestanica extract for the treatment of aphthous lesions of the oral epithelium . These studies have demonstrated the extract to be more effective than placebo in reducing the duration of suffering from pain and burning sensation as well as the time needed for complete clinical resolution . It has also been shown that myrtle is an effective treatment in terms of size change, pain severity, the level of erythema and exudation in ras . Moghadamnia et al . Evaluated the efficacy of licorice bioadhesive hydrogel patches for controlling the pain and reducing the healing time of recurrent aphthous ulcers . They found that licorice bioadhesive can be effective in the reduction of the pain and of the sizes of the inflammatory halo as well as the necrotic center of aphthous ulcers . In another clinical trial using herbal options muco - bioadhesive containing ginger officinale extract was indicated relieving pain of ras but had no efficacy on ulcer diameter, inflamed halo and healing time when compared to a placebo . Our study's limitation was the small sample size and the fact that we were not completely sure whether the patients consumed the zm as any form (mouthwash or food ingredient) in the follow - up period or not . Within these limitations, herbal medicines provide a wider range of treatment options for patients and practitioners . They have limited complications and can be useful alternatives to chemical medicines . According to our findings, zm can reduce the ras symptoms and characterisitic of the aphthous lesions compared to the placebo group . Future studies with larger sample sizes are suggested examining the role of zm in the management of ras . The authors of this manuscript declare that they have no conflicts of interest, real or perceived, financial or non - financial in this article . The authors of this manuscript declare that they have no conflicts of interest, real or perceived, financial or non - financial in this article.
These studies have documented that diabetic cornea is vulnerable to many abnormalities such as corneal endothelial damage, recurrent corneal erosions, punctate epithelial keratopathy, persistent epithelial defects, impaired corneal sensitivity, ulcers, slowed wound repair, and superficial keratitis.13 morphological features of the corneal endothelium in diabetic patients recognized by a number of studies include a decrease in endothelial cell density (ecd) and polymorphism (decrease in the percentage of hexagonal cells [the normal percentage> 50%]) as well as polymegathism, which means increased coefficient of variation (cv) of cell area (cv values measured between 0.22 and 0.31 are considered normal and above 0.4 are abnormal) and increased central corneal thickness (cct).46 em-3000 specular microscope (cbd / tomey, phoenix, az, usa) is a noncontact specular microscope that avoids some disadvantages of the classic contact specular microscopes such as corneal ulceration and transmission of infectious diseases . It has the ability to assess corneal endothelium features and measure cct at the same time with accuracy of 10 m.7 the aim of this study was to compare corneal ecd, morphological features, and cct in type 2 dm with age - matched, nondiabetic control subjects using em-3000 specular microscope . In addition, correlation between these corneal changes and the duration of dm and severity of diabetic retinopathy (dr) and glycemic control (glycated hemoglobin [hba1c] level) were also assessed . It got the approval of research ethics committee of college of applied medical sciences, king saud university, and security forces hospital, riyadh, saudi arabia . All the participants signed comprehensive consent after explanation of the possible consequences of the study prior to investigations . The study included 57 patients (27 males and 30 females [57 eyes]) with type 2 dm and 45 control (nondiabetic) subjects (45 eyes [22 males and 23 females]). The age range of diabetic group was 4280 years (mean: 57.088.37 years), and the age range of the control group was 4076 years (mean: 50.808.39 years). All patients were recruited from ophthalmology department at security forces hospital, riyadh, saudi arabia, by nonrandomized convenience sampling method from february to april 2015 . The diagnosis of type 2 dm was based on the criteria of the world health organization (who).8 control patients did not have diabetes was confirmed by random blood sugar test . The mean duration of dm was 12.878.03 years (range: 140 years), and the mean value of hba1c was 8.57%2.09% (range: 6.3%17.2%). Exclusion criteria included presence of high myopia, history of past intraocular surgery or corneal disease or dystrophy such as fuch s endothelial dystrophy, active or previous eye infection or inflammation, previous ocular surgery or trauma, previous retinal photocoagulation, pterygium, entropion, trichiasis, contact lens wear, regular usage of any eyedrops or known tear - interfering systemic drugs (such as hormone replacement and antihistamines), systemic illness such as rheumatoid arthritis and systemic lupus erythematous that are known to impair tear function, pregnancy, labor, and glaucoma . Age, gender, duration of diabetes, most recent hba1c value, status of dr, other medical illness, and current medical treatment were recorded . In this study, only the right eye of each patient was tested . All subjects underwent a complete ophthalmic examination that included visual acuity assessment using the snellen chart, refraction using auto - refractometer (topcon, tokyo, japan), and intraocular pressure measurement using air puff tonometer, slit - lamp biomicroscopy, and fundus examination . The corneal endothelial structure and cct were examined in all eyes by noncontact specular microscopy using em-3000 specular microscope, and this examination was done by a single examiner . The endothelial structure was studied by measuring a variety of factors, including ecd, cv, and percentage of hexagonal cells . His / her chin was placed on the chin rest and his / her forehead rested on the special head area . The patient was asked to fixate his / her eye for a few seconds on the red light coming from inside the device until the instrument automatically took a clear image of the corneal endothelium and measured the cct at the same time . The diabetic eyes were classified into 3 groups according to the status of dr (group without dr, group with nonproliferative dr [npdr], and group with proliferative dr [pdr]). Also, they were divided into 2 groups according to dm duration (group with a duration of 10 years and group with a duration of> 10 years) and according to hba1c value (group with hba1c 7.5% and group with hba1c> 7.5%). The data were analyzed using spss 21 for windows software (ibm, armonk, ny, usa). An independent sample t - test was performed to compare the means of cct and corneal endothelium features in diabetic and control groups . The differences among 3 or more groups were analyzed by one - way analysis of variance . Pearson correlation test was performed to find the relationship between corneal changes and dm duration, hba1c%, and dr status . The study included 36 eyes without dr, 14 eyes with npdr, and 7 eyes with pdr . There were 26 eyes with dm duration of 10 years and 31 eyes with dm duration of> 10 years . Also, there were 24 eyes with hba1c 7.5% and 33 eyes with hba1c> 7.5% . Ecd was significantly lower in the diabetic cornea group (2,491.98261.08 cell / mm) than in the control group (2,629.68293.45 cell / mm) (p=0.014). Cv was higher in the diabetic cornea group (0.410.07) than in the control group (0.370.08) (p=0.008, which was considered statistically significant). Diabetic cornea group had lower percentage of hexagonal cells (33.24%10.25%) than control group (34.24%8.73%), but the difference was not statistically significant (p=0.603). Also, cornea was thicker in the diabetic group (545.6130.39 m) than control group (539.4229.22 m), but not statistically significant (p=0.301). A comparison of the mean values of cct, ecd, cv, and hexagonality between control and diabetic eyes is shown in table 3 . Eyes with dm duration of 10 years had higher ecd (2,509.38303.49 cell / mm) than eyes with dm duration of> 10 years (2,477.38223.61 cell / mm) (p=0.658), and they also had more hexagonality (35.61%9.87%) than those with dm duration of> 10 years (31.26%10.29%) (p=0.111), but the differences were not significant . Also, there were no significant differences in cct (p=0.431) and cv (p=0.927) between the 2 groups . A comparison of the mean values of cct, ecd, cv, and hexagonality between the diabetic groups according to the duration of dm is shown in table 4 . Specular microscope pictures taken from diabetic eyes with dm duration of> 10 years and 10 years are shown in figures 2 and 4 . Diabetic patients with hba1c% 7.5 had higher, but not statistically significant, ecd (2,537.62311.86 cell / mm) than those with hba1c%> 7.5 (2,458.78216.06 cell / mm) (p=0.293) and higher hexagonality (35.58%10.09%) than the other group (31.54%10.17%) (p=0.144). The mean of cv was significantly lower (p=0.017) in diabetic patients with hba1c% 7.5 (0.390.05) than in the other group (0.430.07). Also, there was no statistically significant difference in cct between the 2 groups (0.789). A comparison of the mean values of cct, ecd, cv, and hexagonality between the diabetic groups according to hba1c% is shown in table 5 . In addition, there were no significant differences between cct, ecd, cv, and hexagonality percentage of the corneal endothelial cells in diabetic patients without dr, with npdr, and with pdr (p=0.344, 0.806, 0.284, and 0.500, respectively) (table 6). Pearson correlation analysis showed that dm duration, hba1c levels, and severity of dr had no significant correlations with cct, cv, hexagonality, or ecd (table 7). Diabetic cornea may give the impression that is healthy, but actually it may suffer from many morphological features affecting its function later on . This fact was evidenced by several studies.16 in this study, we found that diabetic corneas showed a statistically significant reduction in mean corneal ecd of 5.24% (p=0.014) compared to the corneas in the control group . This was similar to the results of choo et al4 of 4.5% significant reduction in ecd (p<0.01) in malaysian type 2 dm patients . Also, the results of inoue et als9 study of the corneal endothelium and cct in type 2 dm in japan showed similar results of 4.1% (p=0.016) significant reduction in ecd in the diabetic group . However, results of storr - paulsen et als6 and siribunkum et als10 studies of corneal endothelium morphology in type 2 dm according to ecd were not consistent with our findings . The cv of corneal endothelial cells was found to be significantly increased in diabetic patients (p=0.008). This increase indicated the presence of polymegathism, in which endothelial cells enlarge to fill the gaps between adjacent cells . This result was concordant with those obtained by shenoy et al11 and lee et al,12 but not similar to those of sudhir et al5 and chen et al.13 also, our study demonstrated no significant difference in the percentage of hexagonal cells between the diabetic patients and the controls, which was in agreement with the results of sudhir et al,5 storr - paulsen et al,6 and inoue et al,9 and in disagreement with those of choo et al,4 and lee et al.12 many studies4,14,15 have explained the morphological features of diabetic cornea . This was established by the assessment of polyol (sorbitol aldose reductase) pathway in diabetic cornea . These studies documented that high glucose levels lead to increased activity of the aldose reductase, causing sorbitol buildup in the corneal epithelial and endothelial cells . Also, dm diminishes na k atpase activity of the corneal endothelium, resulting in morphological and permeability changes in diabetic cornea, thereby leading to corneal destruction . Furthermore, endothelial pump function was proven to be affected by decreased atp production as a result of slowing down of the krebs cycle in diabetic cornea . Regarding cct in our study, there was no significant difference between diabetic and control groups . This result was in concordance with those of choo et al4 and sudhir et al.5 other studies, for instance, storr - paulsen et al6 and lee et al,12 demonstrated a statistically significant increase in cct of diabetic compared to control subjects . As regards the comparison of the mean values of cct, ecd, cv, and cell hexagonality in patients with dm duration of 10 years and those with dm duration of> 10 years, no statistically significant difference was detected in all these morphological features in this study . This finding was in agreement with altay et al,16 who reported absence of statistically significant difference in cct between the 2 groups . However, lee et al12 documented that cct and cv were significantly higher in patients with dm duration of> 10 years compared with those with dm duration of 10 years, but there was no statistically significant difference regarding ecd and hexagonality between the 2 groups . Concerning the comparison of the mean values of cct, ecd, cv, and cell hexagonality in diabetic patients with hba1c 7.5% and those with hba1c> 7.5% in our study, no significant differences were detected between the 2 groups in cct, ecd, and hexagonality, but cv showed a statistically significant difference (p=0.017). Storr - paulsen et al6 found significantly lower ecd in patients with elevated hba1c, but without any influence on cct . However, altay et al16 documented significantly thicker cct in hyperglycemic condition than in euglycemic condition in the same patient before and after successful control of hba1c . Regarding the comparison of the mean values of cct, ecd, cv, and hexagonality between the 3 diabetic groups according to the status of dr, our study found no significant differences between the 3 groups . This finding was not in accordance with that of shenoy et al,11 who demonstrated significantly lower ecd in eyes with dr than those without dr . Pearson correlation analysis reported absence of significant correlations between dm duration, hba1c levels, and severity of dr and morphological features of diabetic cornea such as cct, cv, hexagonality, or ecd . These results were similar to those of choo et al.4 however, siribunkum et al10 found a significant correlation between dm duration and pleomorphism, polymegathism, and cct . This study documented that type 2 dm resulted in a significant reduction of ecd and increased cv (polymegathism). Also, diabetic cornea had increased cct and lower percentage of hexagonal cells than in the cornea of normal subjects, but this is not statistically significant . In addition, our study demonstrated that dm duration, hba1c levels, and severity of dr had no significant correlations with cct, cv, hexagonality, or ecd . In this study, patients with a history of laser photocoagulation were excluded due to its influence on the corneal structures.17 this exclusion produced a small sample size because most of diabetic patients who came to the clinic had undergone laser treatments . Therefore, further studies with a large sample size are recommended to verify the extent of corneal damage caused by type 2 dm.
Microbial control in the endodontic system represents a challenge to the solution of refractory infections when chemical and surgical procedures do not provide the desired response for control of infection . The chemomechanical preparation used during endodontic therapy is the main factor responsible for eliminating the microorganisms lodged into the root canal system20 . In most clinical situations, however, some cases demand the application of intracanal medication as an adjuvant therapy to resolve the infection . This occurs because microorganisms may colonize the endodontic system, demanding deeper and more guaranteed therapeutic action . In these cases, intracanal medication not only plays the role of inflammatory reaction moderator, but is also imperative to combat the remaining infection . In most cases, this resistance is related to microbial capacity to remain in a latent phase, at a low metabolic rate for a long period of time . However, environmental changes, such as coronal leakage, may lead to activation of these microorganisms and their consequent proliferation6,14 . Associations of antimicrobial agents have been proposed with the goal of increasing the spectrum of action and combating the persistent infection9,11,17 . The choice of vehicle associated with intracanal medication is also of paramount importance, as they are responsible for transporting the drug to the interior of the root canal systems and for the speed of its diffusion24 . The purpose of this study was to investigate the antimicrobial action of ciprofloxacin hydrochloride and metronidazole, and the vehicles polyethylene glycol and natrosol, either alone or associated, supported by the fact that intracanal medication is an important adjuvant of the endodontic treatment protocol . Twenty - three microbial strains were selected from the american type culture collection (atcc) and the university of taubat culture collection (ccut) (table 1). The susceptibility of the microorganisms to the antimicrobial agents metronidazole (henrifarma, china) and ciprofloxacin hydrochloride (pharmanostra, usa) and to the vehicles polyethylene glycol (pm 1000) and natrosol, was assessed, either alone and in the following associations: a) ciprofloxacin and metronidazole; b) ciprofloxacin and natrosol; c) ciprofloxacin and polyethylene glycol; d) metronidazole and natrosol; e) metronidazole and polyethylene glycol; f) ciprofloxacin, metronidazole and natrosol; and, g) ciprofloxacin, metronidazole and polyethylene glycol . The antimicrobial agents were submitted to filtration (0.22 m, millipore membrane) and the vehicles were sterilized by gamma radiation (co, gammacell, atomic energy of canada limited, canada). The mller - hinton agar (difco, detroit, mi, usa) dilution method was used to determine the minimum inhibitory concentration (mic)15 . Culture media were prepared, adding antimicrobial agents in two - fold serial dilutions, obtaining final concentrations of 16 to 0.25 g / ml of medium . For the vehicles, culture media containing 50, 45, 40, 35, 30 and 25% were used . For the associations, the substances were added to the culture media at the same concentrations and percentages used for the substances tested separately, in a total of 292 combinations . For each test, the selected microorganisms were plated in mller hinton agar and incubated at 37c for 24 hours . After growth and morphologic confirmation in smears stained by gram method, suspensions were prepared with isolated colonies and sterile saline in accordance with tube 0.5 (approximately 1.5 10 cells / ml) of mcfarland scale, for the bacteria, and tube 2 (approximately 10 cells / ml) for yeasts (recommendation of the national committee for clinical laboratory standards12,13). Next, aliquots of the suspensions were placed into the wells of the steers replicator, and then plated in the culture media . The plates were incubated at 37c for 24 hours and the occurrence of microbial growth was evaluated . The mic was defined at the lowest concentration of the drug that inhibited microbial growth . Minimum inhibitory concentration results for the antimicrobial agents ciprofloxacin and metronidazole, and for the vehicles (natrosol and polyethylene glycol) are shown in table 2 . R = resistant at the highest concentration tested (16 lg / ml or 50%); s = sensitive at the lowest concentration tested (0.25 g/ ml or 25%); interval of concentration of the tested products table 3 shows the results of the association of ciprofloxacin with the vehicles . Ciprofloxacin / natrosol association partially increased the effects of the products, also presenting effects against candida species . S = sensitive at the lowest concentration tested (0.25 g / ml or 25%); interval of concentration of the tested products table 4 shows the results of the association of metronidazole with the tested vehicles . Metronidazole/ polyethylene glycol association inhibited all microbial strains, using low concentrations of the antimicrobial agent, as well as low percentages of polyethylene glycol . Resistant at the highest concentration tested (16 lag / ml or 50%) s sensitive at the lowest concentration tested (0.25 g / ml or 25%) interval of concentration of the tested products the mic values of ciprofloxacin / metronidazole association and these with the vehicles are expressed in table 5 . The association of ciprofloxacin with metronidazole presented lower mic for the bacteria than ciprofloxacin alone, except for escherichia coli . Polyethylene glycol added to the formulation eliminated all bacteria, at the lowest concentration of antimicrobial agents and vehicles . The performance of ciprofloxacin / metronidazole / polyethylene glycol association was equivalent or lowest to the association ciprofloxacin / polyethylene glycol . R = resistant at the highest concentration tested (16 lag / ml or 50%); s = sensitive at the lowest concentration tested (0.25 g/ ml or 25%);> interval of concentration of the tested products . In all plates of culture media in which the antimicrobial agents and vehicles were not added (controls), there was growth of all microbial strains . These difficulties are generally related to the anatomic characteristics of the root canal system7, resistance to antimicrobial agents3,6 and the presence of apical biofilm18,25 . For cases of resistance to antimicrobial agents, the use of alternative medications, or the combination of antimicrobial agents is suggested to increase the spectrum of action and act particularly on the facultative anaerobic microorganisms . In endodontics, antimicrobial agents are used topically, due to the absence of blood irrigation in the root canal system at the time of therapy . In most cases, intracanal medication is used in aqueous solution, allowing the system to be well filled . However, the capacity to remain there and to have a prolonged action is limited and it is in contact with the healthy or contaminated periodontal fluid . The vehicle associated with the antimicrobial agents has a strict relationship with the time of action of the antimicrobial agent19, penetration of the medication in the root canal system2,24, in addition to the dissociation of the principle of the drugs5,8 . The results of the present study demonstrated, although metronidazole had no action against the tested microorganisms, which was expected, the ciprofloxacin/ metronidazole association resulted in a positive interaction, that is, there was synergism in this proposed combination . Slots, et al.21 (1990) found that the ciprofloxacin/ metronidazole association was more effective against enterobacteria collected from periodontal pockets than ciprofloxacin used alone . All mic values for this association were lower than those of ciprofloxacin used alone or combined with metronidazole . Another advantage of the association ciprofloxacin / polyethylene glycol was the effective action on yeasts resistant to the other formulations . All tested bacteria were sensitive to the association of ciprofloxacin and metronidazole with the vehicle polyethylene glycol, while c. albicans and c. tropicalis were eliminated with this vehicle in concentrations equal to or lower than 35% by volume of the solution . Metronidazole at 16 g / ml concentration and lower, associated with polyethylene glycol at a percentage of 30 to 50%, was responsible for eliminating all strains, including the yeasts . As the volume of polyethylene glycol in the culture media was reduced, the number of resistant strains increased . The results obtained were expected, since the action spectrum of metronidazole is selective for anaerobic bacteria . Therefore, the importance of the results is based on the knowledge of the interaction of metronidazole with the other studied substances . The effectiveness of the association of ciprofloxacin, metronidazole and natrosol shows a trend towards 100% sensitivity, as the concentration of the antimicrobial agents increases . For this combination of substances, the highest mic was 4 g / ml and 50% of natrosol . Similarity of the results with the group without the addition of metronidazole was noted . As metronidazole did not present action against the facultative anaerobic bacteria tested in this experiment, further studies are necessary with other species of microorganisms to assess the feasibility of its application . The vehicle polyethylene glycol was capable of eliminating 100% of the microorganisms tested with mic 40% . As the volume of polyethylene glycol was diminished (below 30%), some microorganisms were capable of growing, particularly c. albicans and c. tropicalis . It is interesting to point out that polyethylene glycol (pm 1000) is the vehicle that allowed greater dentinal penetration of the association calcium hydroxide, ciprofloxacin and metronidazole24 . When studied separately, natrosol prevented the growth of some microorganisms, particularly when administered in higher percentages . However, at no time was it capable of inhibiting the growth of all the microorganisms . The susceptible of the microorganisms to the vehicle polyethylene glycol was similar to that of the associations used in the present study . This suggests that the antimicrobial action demonstrated was exercised by the action of this vehicle . This may be related to the hydrophilic property of polyethylene glycol . Removing water from the culture media, the vehicle possibly did not allow microbial growth, as a certain amount of water is required to enable them to multiply and develop . It is suggested that further studies be conducted, to find whether this effect occurs inside the root canal system . The microbial concentration used for the suspension was determined by using the standard 0.5 on the mcfarland scale for bacteria and 2 for the yeasts, as the latter present a greater cellular volume12,13,15,18 . It must be emphasized that almost all clinical situations are solved by performing the simple endodontic technique, which complies with the conditional factors of good preparation of the root canal system . In spite of the usual therapeutic protocol, the medication here proposed can be indicated when the routine alternatives are not able of producing the desired effects . Analysis of the results obtained by the application of the experimental model allowed the following conclusions: ciprofloxacin showed antimicrobial action against all tested microbial strains, and its association with metronidazole was synergic . Ciprofloxacin associated with polyethylene glycol was the most effective combination for reducing the tested bacteria and yeasts.
The study protocol was approved by the ethics committee of the ministry of health and the school boards . A total number of 30 clusters including 7,493 girls (aged 620 years) were selected . Students with a history of acute or chronic diseases or any chronic medication use were excluded . In all subjects, height, weight, and pubertal stages general physicians determined pubertal stages under the supervision of specialists by visual inspection and palpation, using the criteria and definitions described by marshall and tanner.10 accordingly, breast stages 15 were determined by both inspection and palpation . Breast stage b2 corresponded to the breast bud stage with palpable glandular breast tissue and elevation of the papilla, stage b3 with further enlargement of the breast and areola with no separation of the contours, stage b4 where the areola and papilla form a secondary mound above the level of the breast, and stage b5 was assigned in case of the mature breast with projection of the papilla only . The onset of puberty was measured as the age at breast development at tanner stage 2 (b2). Stage ph2 was assigned with the presence of long, slightly pigmented hair (straight or curled). Participants were grouped by 1-year age intervals, which extended from the day of their birthday to the day before the next birthday . For comparison of different areas, we used the national classification of the provinces according to their climate, ethnicity of the population, geographic locations, and socioeconomic variables . Classification of iranian provinces to regions according to climate, geographic location, ethnicity and socioeconomic status we estimated the mean of the time of men - arche, b2-b5 and ph2-ph5 stages . Statistical analysis was done using spss version 15 (spss, chicago, il). Analysis of variance (anova) and post - hoc tests were used to compare the mean ages of menarche, pubarche, and telarche in different regions . We estimated the mean of the time of men - arche, b2-b5 and ph2-ph5 stages . Statistical analysis was done using spss version 15 (spss, chicago, il). Analysis of variance (anova) and post - hoc tests were used to compare the mean ages of menarche, pubarche, and telarche in different regions . We estimated the mean of the time of men - arche, b2-b5 and ph2-ph5 stages . Statistical analysis was done using spss version 15 (spss, chicago, il). Analysis of variance (anova) and post - hoc tests were used to compare the mean ages of menarche, pubarche, and telarche in different regions . Tehran had the lowest mean age of menarche, being 11.99 1.35 years, which was significantly lower than other 10 regions . The second region with lowest age at menarche was fars (12.40 1.27 years). The mean age at b2 stage of breast development was significantly lower in ghazvin - zanjan region (8.97 1.45 years) followed by the region consisting of khorasan jonobi and sistan balochestan (10.11 1.61 years; p = 0.003), boshehr - khouzestan region (10.05 1.21 years; p = 0.01), tehran - relatd cities (10.46 1.67 years; p <0.0001), fars (11.01 1.88 years; p <0.0001) and kordestan - lorestan - ilam region (9.94 1.25 years; p = 0.02). In fars region, the mean age at b2 stage of breast development (11.01 1.88 years) was higher than other regions except for mazendran - guilan and tehran - related cities regions . Figure 2 shows the mean age at b1-b5 of breast development in different regions in iran . Mean age (years) at menarche in different regions mean age (years) at various stages of telarche in different regions in iran the mean age at ph2 stage of pubarche in kordestan - lorestan - ilam region (10.70 1.23 years) was significantly higher than khorasan jonobi - sistan balochestan region (p <0.0001), boshehr - khozestan region (p <0.0001), tehran - relatd cities (p <0.0001), chaharmahal - kerman - isfahan region (p <0.0001), ghazvin - zanjan region (p <0.0001), and boshehr - khozestan region (p <0.0001). The mean age at ph2-ph5 of pubic hair development in different geographic locations of iran is presented in figure 3 . To the best of our knowledge, this is the first study of its kind to compare the pubertal stages in different geographic locations in a country . It should be acknowledged that such comparison is not feasible in many countries with small population and no significant diversity in climate and other geographic characteristics . We found that the mean age of menarche was significantly lower in tehran than all other regions . Tehran province, including the metropolitan city of tehran, is located in central part of the country with multiethnic population . Not only multi - ethnicity but also higher socioeconomic status and more industrialized lifestyle habits in tehran might be associated with earlier menarche age . In another study the mean age of menarche was 12.68 years in tehran in 2004.11 in our study conducted 2 years later, this age decreased to 11.99 1.35 years . Decreasing trend of menarche age is observed in many developed and developing countries.1213 it might be attributed to changes in socioeconomic status of people14 and increasing rate of obesity.12 ethnicity is documented as a factor that describes some international varieties of puberty age.1516 in the current study, the mean age at menarche and ph2 was higher in girls with kurd ethnicity than in other ethnicities . Kurd ethnicity is the third most prevalent ethnicity in iran after persian and azeri ethnicities . It can be suggested that the higher age of puberty in girls of this region might be attributed to their ethnicity as well as the cold climate and their high altitude mountainous region of living . In addition to ethnicity, the geographic characteristics may influence the age of puberty . In our study, the lowest mean age at b2 was documented in zanjan - ghazvin region, with mediterranean weather and spring rains, and population of azeri ethnicity . The earlier telarche in this region in comparison to other regions with azeri population might be attributed to environmental factors . Premature telarche is suggested to be associated with endocrine disrupting chemicals found in pesticides and plastics, with possible estrogenic and androgenic activities.1718 further investigations on environmental pollution might be necessary in this regard . The considerably high prevalence of overweight among young iranian children19 might decrease the age of puberty in the near future . The main limitation of this study was its cross sectional nature, and as a result, casualty cannot be ascertained . In addition, we considered the prominent ethnicity in each region; but some participants might have other ethnicities . We found significant differences in the age of pubertal stages of girls living in various regions with different ethnicity and geographic characteristics . Considering the impact of pubertal age on general health, more studies should be done about the lifestyle and environmental factors affecting the onset of puberty . Mem participated in the design and conducting the study; ar participated in the design and conducting the study and helped to draft the manuscript; rk drafted and edited the manuscript; pm conducted the statistical analyses and helped to draft the manuscript; ss participated in conducting the study; ga participated in the design and conducting the study; ha participated in conducting the study; np participated in conducting the study; sk in conducting the study; pp helped to draft and edit the manuscript; as participated in conducting the study.
Ubiquitination is a process in which one or multiple ubiquitin moieties are covalently attached to a substrate through an enzymatic cascade involving ubiquitin - activating enzyme (e1), ubiquitin - carrier protein (e2), and ubiquitin - protein ligase (e3). Formation of a ubiquitin lys48 chain on the -nh2 group of a substrate's internal lys residue (polyubiquitination) can target the substrate for degradation by the 26s proteasome . Ubiquitin can also be attached to the free -nh2 group in a substrate's n - terminus to promote proteasomal degradation . For example, polyubiquitination at lys63 is involved in inhibitor of nf-b (ib) kinase (ikk) activation . In addition, a linear polyubiquitin chain can be achieved by conjugating the c - terminal glycine of ubiquitin and the a - nh2 group of the n - terminal methionine of its neighbor ubiquitin . Substrates can also undergo monoubiquitination or multi - monoubiquitination adding one ubiquitin to one or multiple lys residues, respectively . Recent evidence suggests that ubiquitin can be linked to cys, ser, or thr residues in a substrate through thio- or oxy - ester bonds (i.e., esterification), though the physiological relevance of these modifications remains to be defined. Ubiquitin moieties can be released from a substrate by deubiquitinating enzymes . For an organism to function properly, proteins must be degraded after they undergo specific functions . Moreover, proteins that are misfolded or damaged during translation, folding, or translocation must be degraded and eliminated in time . Either blocked degradation of oncogenic proteins / growth - enhancing factors or accelerated degradation of growth - suppressing proteins may disrupt the pathways controlling cell cycle progression, cell death, or survival, leading to cancer development, (table 1). For example, the tumor suppressor cyld is mutated in several cancers, including cylindromatosis . The deubiquitinating activity of cyld for ikk is critical for its cylindromatosis - suppressive function . The ubiquitin ligase itch promotes the polyubiquitination and degradation of large tumor suppressor 1 (ltsa1), which is closely related to enhanced cell growth and epithelial - to - mesenchymal transition . Malt, mucosa - associated lymphoid tissue; aml, acute myeloid leukemia . Due to the critical roles of ubiquitination and the ubiquitin - mediated proteolysis in tumorigenesis and cell growth, it is a dipeptide boronate that specifically and reversibly blocks chymotrypsin - like activity of the proteasome in a variety of cancer cells . Although bortezomib inhibits nf-b activation and results in autophagy, this lethal effect of proteasome inhibition is probably due to loss of amino acid homeostasis . Notably, bortezomib has been used successfully as an anticancer drug for multiple myeloma and mantle cell lymphoma in the clinic,. Because ubiquitination is generally substrate - specific, the components of the ubiquitination pathway might be more specific drug targets for cancer therapy than the proteasome . Cullin - ring ubiquitin ligases (crls) are involved in cellular processes such as cell cycle progression, cell death signaling, dna damage, and stress responses . Nedd8 is a ubiquitin - like protein that modifies cullin and is required for the activity of crls . Because nedd8-activating enzyme (nae) catalyzes the first step in the nedd8 pathway, targeting crls via inhibition of nae may be a promising anticancer strategy . Indeed, mln4924, a selective inhibitor of nae, has potent tumor - suppressing activity in a wide range of tumors, including acute myeloid leukemia and diffuse large b cell lymphomas, . Apoptosis (i.e., programmed cell death) is a cellular suicide process that is important for embryonic development and maintaining the size of cell populations . The extrinsic pathway involves members of the tumor necrosis factor (tnf) receptor gene superfamily, which bind extracellular ligands and transduce intracellular signals during cell destruction . The intrinsic pathway does not involve receptor - mediated intracellular signaling, but induces signaling in mitochondria . In mammals, the intrinsic pathway is regulated by the bcl-2 family of proteins, the adaptor protein apoptotic protease - activating factor-1 (apaf-1), and the caspases . Bcl-2 family members include both anti - apoptotic (bcl-2, bcl - xl, bcl - w, and mcl-1) and pro - apoptotic proteins (bax, bak, bad, bid, and bim). The release of cytochrome c from mitochondria causes the formation of the apoptosome (apaf-1/caspase-9 complex), activates the downstream effector caspases, and finally results in cleavage of crucial substrates . Degradation of anti - apoptotic members is necessary for apoptotic progression, whereas degradation of pro - apoptotic members is required for the suppression of apoptosis, . The levels of anti- and pro - apoptotic molecules can be regulated by ubiquitination and proteasomal degradation . For example, trim17-mediated ubiquitination and subsequent degradation of mcl-1, an anti - apoptotic bcl-2 family member, triggers neuronal apoptosis . The pro - apoptotic bcl-2 member bax can be regulated by ubiquitination indirectly; the ubiquitin ligase trim39 inhibits apc / c cdh1-mediated ubiquitination and degradation of the bax activator moap-1, thus enhancing bax activation and apoptosis . Moreover, the levels of bcl2l10/bclb, an anti - apoptotic bcl2-like protein, are inversely correlated with survival in patients with several cancer types, including lung adenocarcinomas . The inhibitors of apoptosis proteins (iaps) have one to three baculovirus iap repeat (bir) domains and can block apoptosis by directly binding and inhibiting caspases, . Furthermore, almost all iaps have ubiquitin ligase activity, which is required for the ubiquitination of certain substrates involved in apoptosis . X - linked inhibitor of apoptosis protein (xiap) catalyzes the ubiquitination and degradation of caspase-3, . Apoptosis inducing factor (aif) is also a substrate of xiap, and ubiquitination at k255 of aif shows a non - degradable role of ubiquitination in caspase - independent cell death . On the other hand, for example, ubiquitin - specific protease 19 (usp19) is responsible for the inhibition of tnf--induced caspase activation and apoptosis in a ciap - dependent manner . The activity of iaps can be suppressed by pro - apoptotic factors, such as second mitochondria - derived activator of caspase (smac). Bruce / apollon is a large (528 kda), membrane - associated, essential iap in mammals . Furthermore, bruce / apollon can be degraded in a ubiquitin - dependent manner by the ubiquitin ligase nrdp1 during apoptosis . The tumor suppressor p53 maintains the integrity of the genome and regulates cell cycle, dna repair, and apoptosis . P53 promotes the activation of the pro - apoptotic bcl-2 family proteins and the release of cytochrome c. dysregulation of p53 is reported in numerous types of cancer . Several ubiquitin ligases, including mdm2, have been reported to promote ubiquitination and degradation of p53, while p53 is deubiquitinated and stabilized by ubiquitin - specific proteases (usps). Thus, inhibiting the activity of p53 ubiquitin ligases or activating p53 usps can be a strategy for cancer therapy . Hausp regulates the activities of mdm2 and p53 by deubiquitination, while vif1 and vif2 antagonize hausp and promote p53-dependent apoptosis . Translationally controlled tumor protein (tctp), which is down - regulated in tumor progression, inhibits mdm2 autoubiquitination and promotes mdm2-mediated ubiquitination and degradation of p53 . In addition, fanconi anemia complementation group f (fancf) monoubiquitinates fancd2, which is involved in the fa / brca dna damage response pathway . Silencing fancf elevates p53 activation in mitoxantrone - treated breast cancer cells . As a transcription factor involved in the extrinsic apoptosis pathway, nf-b activates the expression of genes that contribute to cell proliferation, metastasis, and suppression of apoptosis . Sharpin, a ubiquitin - binding and ubiquitin - like - domain - containing protein, promotes linear ubiquitination of nemo / ikbkg, an adaptor of ikks, and subsequent activation of nf-b signaling . Ib, which inactivates nf-b under normal physiological conditions, can be phosphorylated by activated ikk, ubiquitinated by scf, and finally degraded by the proteasome in response to dna damage, . Nrdp1 promotes ubiquitination and degradation of the epidermal growth factor receptor family member erbb3, which is upstream of nf-b activation, . In a word, ubiquitination plays an important role in the regulation of apoptosis, and the components involved in the ubiquitination of key substrates can be potential targets for cancer therapy (figure 1). Autophagy, once categorized as programmed cell death type ii, is a cellular process by which intracellular proteins, lipids, and organelles are degraded in the lysosomal compartment after delivery from other cellular compartments . There are three types of autophagy: macroautophagy, microautophagy, and chaperone - mediated autophagy . Although autophagy is generally thought to be non - selective, certain ubiquitinated proteins (e.g., catalase), organelles (e.g., peroxisomes and mitochondria), and invading bacteria have been shown to be selectively targeted for autophagic degradation ., 18 autophagy - related proteins (atgs) in yeast, namely atg110, atg1214, atg1618, atg29, and atg31, have been found to play a role in autophagosome formation . Atg8, called lc3 in mammals, is a ubiquitin - like protein present on autophagic membranes as a phosphatidylethanolamine (pe)conjugate . P62/sqstm1 or nbr1 binds both ubiquitin and lc3, probably providing a selective link between ubiquitinated substrates and autophagy . Nuclear dot protein 52 (ndp52), an autophagy receptor, targets intracellular ubiquitinated bacterial proteins for autophagic degradation . Misfolded polypeptides are usually recognized by molecular chaperones and degraded by the proteasome following polyubiquitination by ubiquitin ligases, such as chip and parkin . However, when misfolded proteins cannot be sufficiently removed by chaperone - mediated proteasomal degradation, protein aggregation occurs and may in turn inactivate the proteasome, resulting in cytotoxicity . Thus, p62/nbr1-mediated autophagic degradation may serve as an important compensatory mechanism for degradation of these ubiquitinated protein aggregates . The crosstalk between autophagy and apoptosis is necessary for controlling the balance between cell survival and death . Beclin 1, a mammalian atg6 ortholog, is a subunit of the class iii pi3-kinase complex . Beclin 1 interacts with bcl-2 via the bh3 domain in beclin 1 but can be released in starvation conditions to activate autophagy . This interaction can be terminated through c - jun n - terminal kinase (jnk)mediated phosphorylation of bcl-2 and tnf receptor - associated factor 6 (traf6)mediated ubiquitination of beclin 1, . Under extreme conditions that cannot be rescued by autophagy, jnk promotes hyperphosphorylation of bcl-2, resulting in the release of bax to execute apoptosis . Caspase - mediated cleavage of beclin 1 inhibits beclin 1induced autophagy, and the cleavage product, the c - terminal region (ct), enhances apoptosis by promoting the release of pro - apoptotic factors from mitochondria . Beclin 1 can also indirectly affect the crosstalk between apoptosis and autophagy by controlling the levels of p53, a tumor suppressor that promotes apoptosis under genotoxic stress, . Furthermore, p53 can down - regulate lc3 levels in starved cells, preventing the autophagy burst that may be dangerous for cells . Under normal conditions, p53 is kept at low levels by the ubiquitin ligase mdm2 . However, p53 levels can also be controlled by beclin 1 via regulating the deubiquitinating activity of usp10 and usp13 . Autophagy can target ubiquitinated misfolded proteins, caspases, and other cargo (such as damaged mitochondria and invading bacteria) for degradation, probably through p62 and nbr1 . Apoptosis and autophagy are counter - regulated in multiple steps, such as at p53, the beclin 1/bcl-2 interaction, the cleavage of beclin 1 into the c - terminal region by caspases, and the autophagic degradation of caspases . Ubiquitination can promote degradation of both p53 and beclin 1 and thus, controls the mutual regulation of apoptosis and autophagy . Ubiquitination can occur on not only the -nh2 group of an internal lys residue, but also the -nh2 group of the n - terminal residue of a substrate . Moreover, recent evidence suggests that ubiquitin can be attached to cys, ser, or thr residue on a substrate by esterification . These non - lys ubiquitinations might provide another layer of the regulation of protein functions, and further studies should focus on the identification of relevant substrates and physiological roles of these modifications . Future studies should also further explore how the ubiquitination of the critical proteins is involved in tumorigenesis and cancer therapy . Recent research efforts on cancer stem cells and personalized cancer genome sequencing are expected to help in this regard . Because the cytoprotection of autophagy and the evasion of apoptosis contribute to resistance to cancer therapy, it is important to unravel how these two pathways are mutually regulated . The investigation on this issue has just begun and deserves more attention, especially with regard to how ubiquitination is involved in the counter - regulation of these critical processes.
The south american sea lions (otaria flavescens, carnivora: otariidae) are common pinnipeds living along the eastern and western coasts of south america and are generally found in peru, chile, argentina, and south brazil [16]. Along the chilean coastal shores, more than 200 colonies of free - ranging sea lions a vast amount of data on feeding ecology, reproduction, life history parameters, and population dynamics of these otariid species was published [716]. Several studies have also addressed aspects of the helminth fauna of south american sea lions, comprising single species records, taxonomy, and population studies of some parasitoses [5, 1422]. However, very little is known on protozoan parasite infections of these free - ranging marine mammals . Although their natural habitat is the marine environment, several pinniped and cetacean species are found in rivers containing fresh water . As such, a stable population of south american sea lions has been established within the city of valdivia, chile, resulting in permanent colonization for 20 years now . These animals have adapted extremely well not only to the fresh water of the river but also to human activities in the river calle - calle, such as regular ship- and boat - trafficking, rowing, kayaking, and sealing activities . Sea lion colony is allocated approximately 7 km upstream from the ocean shore and animals mainly feed on fish captured by themselves in the river (mainly carps, trouts, and salmons) or on remains of the local fish market . This unusual urban colony of south american sea lions consists of more than 72 individuals and is exclusively composed of males . The age of these animals varies from 2 to 15 years but some animals might be even older . Given that o. flavescens need to rest after swimming and diving activities, the sea lions in valdivia utilize river floats, riverside piers, and footways along the river promenade as recreation areas with all of them being allocated in close proximity to inhabitants, tourists, domestic pets, or the local fish market . Since some of these animals behave rather aggressive towards humans, animals, or even vehicles and additionally tend to expand their territory into the city center, the local city authorities have established a sea lion task force which should prevent the animals from harming humans and withhold them to premises alongside the river shore . However, given that these animals nowadays represent a tourist attraction, direct contacts of humans with these animals or their faeces as well as faecal contamination of the river water or the terrestrial environment cannot be avoided . The present study therefore aimed to identify the actual gastrointestinal fauna in these free - ranging sea lions within their natural habitat in the river of the city of valdivia, chile, and to gain some insights in their potential zoonotic impact on public health issues . South american sea lions (o. flavescens) were studied along the shores of the river calle - calle of the city of valdivia, chile . The study area encompassed 3 km and comprised river floats, riverside piers, footways along the river promenade, and the local fish market with all of them being allocated in close proximity of humans and domestic pets (figures 1(a), 1(b), 1(c), and 1(d)). Whenever defecation occurred, scat samples were immediately collected and transferred into 2 ml plastic tubes (eppendorf). Parasitological analyses were conducted at the institute of parasitology, justus liebig university giessen, germany . Coproscopical analyses were performed by using the standard sodium acetate acetic acid formalin (saf) technique . The saf technique was used for the detection of parasite eggs, cysts, sporocysts, and oocysts within faecal material in marine mammals as described elsewhere . Additionally, a carbol fuchsin - stained faecal smear (cfs) was carried out for the detection of cryptosporidium oocysts . Moreover, coproantigen elisas (prospect, oxoid) were performed for the detection of cryptosporidium and giardia antigens in faecal samples . The parasitological identification of eggs and cysts was based on morphological criteria referring to previous reports [24, 26, 27]. All sampling procedures were conducted in accordance with institutional ethic commission of university austral of chile and the current chilean animal law . Giardia - positive sea lion samples were further analyzed for the presence of g. intestinalis dna by conventional and nested pcr detecting the beta - giardin gene (assemblage c). Genomic dna was extracted from sea lion faecal material using the dna extraction stool kit (qiagen) according to the mammalian faecal protocol . Briefly, 1 ml of ethanol - fixed faeces was lysed in asl buffer containing 30 glass beads (4 mm diameter), under permanent stirring conditions . The dna was thereafter purified using an anion exchange column (qiagen) and eluted in 100 l of distilled water . For the conventional g. intestinalis - pcr, the following specific oligonucleotide sequences were used: the forward oligonucleotide -giardin g7f: 5-aagcccgacgacctcacccgcagtcg-3 and the reverse oligonucleotide -giardin g759r: 5-gaggccgccctggatcttcgagacgac-3 . The pcr was performed in a total volume of 25 l containing 5 l faecal dna sample, 5 l faecal dna (1: 100), 1 l g7f oligonucleotides (10 m), 1 l g759r oligonucleotides (10 m), dntps 0.5 l (10 m), 0.5 l taq - polymerase (1 u/l; peqlab), and 14.5 l h2o . The following thermocycle profiles were used: 95c for 5 min, 35 cycles at 95c for 30 s, 65c for 45 s, and 72c for 1 min and 30 s followed by a final extension step at 72c for 5 min and a final hold at 20c . Pcr amplificates were visualized in gelred - stained 2% agarose gels (biotium incorporation). In addition, a g. intestinalis - nested pcr was performed . For the nested pcr the following forward oligonucleotide sequences of giarf were used: 5-gaacgagatcgaggtccg-3 and reverse oligonucleotide sequence of giarr: 5-ctcgacgagcttcgttgtt-3 . The following thermocycle profiles for the nested pcr were used: 95c for 5 min, 35 cycles at 95c for 30 s, 50c for 40 s, and 72c for 1 min and 30 s followed by a final extension step at 72c for 5 min . Pcr amplificates were visualized using gelred - stained 2% agarose gels as described above (biotium incorporation). Parasitological analyses of faecal samples of south american sea lions revealed 8 different protozoan (4) and metazoan (4) taxa . The metazoan parasites consisted of trematodes (one species), cestodes (one species), and nematodes (two species). A complete list of the parasite stages and their prevalence is given in table 1 . The most prevalent metazoan parasites found in this urban sea lion colony were anisakidae gen . The most prevalent protozoan parasites were cryptosporidium (10%), giardia, and isospora showing the same prevalence (5.3%). Balantidium infections were detected at lower prevalence (2.5%, table 1). Within the metazoan endoparasites, the nematodes were the most rich in species (two species) followed by cestodes and trematodes with one species each . Referring to parasite genus level these parasitological findings included four new host records (cryptosporidium, giardia, balantidium, and otostrongylus) for o. flavescens . To our best knowledge, the genus balantidium had only been described in fin whales (balaenoptera physalus) from the north atlantic . All other protozoan parasites have already been reported for other marine mammals [4, 5, 17, 19, 20, 24, 30]. Some of the protozoan (3) and metazoan (2) endoparasite genera detected in sea lions bear an anthropozoonotic potential, such as cryptosporidium, giardia, balantidium, diphyllobothriidae gen . Although sea lion faecal samples were immediately fixed in 70% ethanol after collection in the field in order to avoid dna degradation, this goal was not successfully achieved . Thus no adequate giardia dna was possible to be extracted for further detailed molecular identification . Common collection methods for analyses of gastrointestinal parasites of wild sea lions generally rely on sections of accidentally stranded animals or on dead animals obtained from marine zoos [5, 14]. Several studies are restricted to the helminth parasite fauna of south american sea lions and include several single species records [4, 5, 15, 16, 1822, 31]. Conversely, by obtaining fresh faecal samples from resting sea lions, this record reveals unique insights into the actual gastrointestinal parasite fauna of free - ranging sea lions within their natural habitat . In the present survey, 8 different parasite taxa were detected in individual sea lion faecal samples covering a respectable range of parasitic taxa . The parasitological diagnosis based on morphological criteria revealed as quite a challenge since very little data on parasitic eggs, larvae, cysts and oocysts for sea lions are available in literature . Thus, the photo galleries provided here might supply a supportive tool for future parasitological research activities on sea lions and other marine mammals since many of the parasites described here infect a wide range of marine mammals, such as sea otters, seals, sea elephants, baleen, and toothed cetaceans . The most prevalent parasitic stages found in the current study were eggs of anisakidae gen . Sp . However, owing to undistinguishable egg morphologies, characterization on species level was not possible . Based on parasite frequencies, these eggs most probably belong to the genera contracaecum, pseudoterranova, or anisakis since these parasite species appear to be quite common in south american sea lions [5, 31]. Thus, south american sea lions are known as definitive hosts for the zoonotic nematodes anisakis spp ., contracaecum ogmorhini, and pseudoterranova cattani [5, 31]. Ascarids parasitize either freely in the stomach or firmly attached, often as clusters, to the gastric mucosa . Mucosal penetration via larvae and adults can cause severe ulcers, gastritis, and perforation . Moreover, allergic reactions against epitopes of anisakis simplex major allergen (ani s1) have been reported to occur in humans after the reexposure to these parasites [35, 36]. Consistent to our findings, at least three different diphyllobothriid cestodes have previously been recorded in chile, two freshwater species (diphyllobothrium latum and d. dendriticum) and one marine species (i.e., adenocephalus pacificus (diphyllobothrium pacificum)) [37, 38] and also in the intestine of stranded sea lions from patagonia, but at a higher prevalence (26.8%). Diphyllobothriasis in sea lions generally is innocuous, but debilitation or even death of parasitized hosts might result in cases of high parasitic burdens . In addition, diphyllobothriasis also represents an important fish - borne zoonosis worldwide [3943]. Trematode infections in the pancreas and liver occur in almost all marine mammals by members of the genera campula, zalophotrema, oschmarinella, and orthosplanchus . Additionally, also the genera apophallus, ascocotyle, ogmogaster, and pocitrema have been reported as intestinal parasites of otariids [5, 44]. These may induce necrosis of the parenchymal tissue, chronic fibrotic hepatitis, enteritis, and even meningoencephalitis by aberrant trematode migrations . Furthermore, the trematode genera pricetrema and nanophyetes have been reported to parasitize sea lions in the northern hemisphere . Whilst pricetrema resides in the liver, nanophyetes infects the small intestine . Infections with the crenosomatid nematode otostrongylus in pinnipeds are generally associated with respiratory clinical manifestations, primarily in young animals . Interestingly, some sea lions of the current study showed strong coughing episodes, thereby expelling vast amount of mucus . Based on the current findings this might indicate the presence of clinical otostrongylosis within the valdivian colony . The parasitological findings of the study also included four new parasite host reports for o. flavescens, namely, cryptosporidium, giardia, balantidium, and otostrongylus, thereby providing a broader insight into the spectrum of parasitoses of this marine species . In addition, the protozoan parasites (i.e., cryptosporidium, giardia, and balantidium) clearly bear zoonotic potential and are considered as typical water - borne / food - borne diseases . In consequence, the urban sea lion colony in valdivia may function as relevant reservoir for these protozoans since the animals reside at the shore of the river and in close proximity to humans, pet animals, and especially in direct contact to the products of local fish market . Within the genus balantidium, b. coli is the only species of trichostome ciliates nowadays considered as pathogenic for mammals [48, 49]. Consistent with these findings, balatidium infections in free - ranging fin whales (balaenoptera physalus) from the north atlantic ocean were recently diagnosed, indicating that this terrestrial disease is circulating in the marine environment . More importantly, b. coli infections have been demonstrated in humans and pigs in chile [50, 51]. As seen for balantidiasis, giardiasis and cryptosporidiosis have an almost cosmopolitan distribution . Cryptosporidium and giardia are two common aethiological parasites of infectious enteritis in humans and animals [52, 53]. These enteric protozoans are usually transmitted by the faecal - oral route, following the ingestion of infective stages (oocysts or cysts). Moreover, marine mammals are well known as final hosts of giardia and cryptosporidium [24, 5458]. Keeping in mind that the urban sea lion colony is close to populated riversides and that some touristic activities, such as photos with sea lions or kayaking with sea lions, are becoming more popular, sea lions may become infected by human excretions or vice versa . As seen for giardiasis, cryptosporidium infections can cause severe diarrhoea in terrestrial mammals; nonetheless, very little is known on the pathogenesis of cryptosporidiosis within the marine ecosystems [24, 55]. An essential component of the control of these diseases, from a public health perspective, is a better understanding of the sources and routes of transmission in different geographical regions . Unfortunately, the current knowledge and understanding of the ecto- and endoparasite fauna (especially protozoan species) in free - ranging sea lions are still very scarce . Although some parasitoses, such as hookworm (e.g., uncinaria hamiltoni) or ascarid (contracaecum ogmorhini, pseudoterranova cattani, and anisakis spp . ), infections are discussed as pathogenic species for sea lions, the total parasite fauna of marine vertebrates has unfortunately not obtained sufficient attention, so far [24, 59]. In conclusion, this study adds some new anthropozoonotic parasite records to free - ranging sea lions and calls for more integrated research to avoid the exposure of humans and domestic animals with these parasites . In particular, regular monitoring programs should be established by local authorities for public health issues and for sea lion populations living in close proximity to human beings.
In 2014, the szent - gyrgyi prize for progress in cancer research was awarded to james allison, phd, chairman of the department of immunology at the university of texas md anderson cancer center (figure 3). Allison's pioneering cancer research in the area of immunotherapy led to the successful development of immune checkpoint therapy and the first drug approved by the us food and drug administration for the treatment of metastatic melanoma . In bestowing the award, nfcr's selection committee recognized allison's momentous achievement in the fight against cancer and his extraordinary leadership in the modern era of oncology . While mainstream cancer research and treatment focused for decades on radiation therapy and chemotherapy, dr . Allison's trailblazing work in immunotherapy using the body's own immune system to fight off cancer never ceased . Dr . Allison has revolutionized the way science approaches cancer treatments, said sujuan ba, phd, co - chair of the 2014 szent - gyrgyi prize selection committee and chief operating officer of nfcr (figure 4). He is on the front line in the war against cancer and could not be more deserving of this award . This year's szent - gyrgyi prize celebrates the world - renowned immunologist who opened the doors for an understanding of fundamental immune mechanisms and who used this newly found knowledge to advance cancer immunotherapy in a spectacular way, said dr . Alex matter, chief executive officer of the experimental therapeutics centre & d3, astar, singapore, winner of the 2013 szent - gyrgyi prize, and chair of this year's prize selection committee . He has validated the immunotherapy approach and turned previously widely held beliefs on their heads with his discoveries . His work is extremely significant and constitutes a turning point in the history of progress in cancer treatments . Dr . Allison earned his bachelor of science in microbiology in 1969 and his phd in biological science from the university of texas, austin, the us, in 1973 . He was appointed a professor of immunology and director of the cancer research laboratory at the university of california, berkeley in berkeley, california, the us, in 1985 . In 2004, he moved to the memorial sloan - kettering cancer center in new york, new york, the us, where he was director of the ludwig center for cancer immunotherapy, chair of the immunology program, david h. koch chair in immunologic studies, and attending immunologist . In 2012, he joined md anderson cancer center, where he currently holds the position of professor and chair of immunology and executive director of the center's immunotherapy platform . Dr . Allison is a member of the national academy of sciences and the institute of medicine, a howard hughes medical institute (hhmi) alumnus, and a fellow of the american academy of microbiology and the american association for the advancement of science . He has received numerous awards, including a recent aacr / su2c / cri cancer immunotherapy dream team grant, for which he will serve as the team leader . In december 2013, he was awarded the breakthrough prize in life sciences for his work . The cancer research community has been brewing the idea of harnessing the immune system to fight cancer for decades, but early attempts all failed . At least in part that was because we did not understand how complicated the immune system is . There are also a lot of signals that are required to stop an immune response, said dr . You have to stop an immune response or it will destroy you you'll just get collateral damage ., it was understood that recognition of antigens by the t - cell antigen receptor was not sufficient to activate an immune response; there had to be another co - stimulatory signal at the same time, and that kind of signal could only be provided by highly specialized cells . Making an analogy to driving a car, dr . Every t cell has a different one, and unless you activate that, nothing is going to happen . But unless you get the gas pedal pushed at the same time, it's going to be an ineffective immune response . The gas pedal in this analogy was a co - stimulatory molecule called cd28 . In the mid-1990s, dr . Cytotoxic t - lymphocyte - associated antigen 4 (ctla-4), which was known to compete with cd28was not an analogous co - stimulatory molecule, but actually quite the opposite . If cd28 is the gas pedal, ctla-4 is the brakes, and ctla-4 was only induced after the t cells were activated . It immediately occurred to me and to others in my lab that this might be the reason that attempts to vaccinate therapeutically against cancer wouldn't work because every time you gave vaccination gave the go signal that resulted in inducing the off signal as well, said dr . If we could just block that signal, take it out of the pathway by something as simple as an antibody we could just let t - cell receptor and the gas pedal go to the floor and the t cells keep going, and hopefully eradicate the tumor cells . This was the paradigm shift: we're not treating the tumor cells, we're treating the immune system . We're treating the patient, we're treating his or her t cells, said dr . Therefore, this has the possibility of becoming a treatment for all types of cancer . This is a gross simplification, obviously, but the cancer cell's irrelevant . You're just making the immune system attack something that oughtn't to be there, whether it be melanoma, lymphoma, renal cancer, or colon cancer . Anything that kills tumor cells under inflammatory conditions will present tumor antigens to t cells, priming them for response . So an anti - ctla-4 approach could also increase the effect of certain chemotherapies, radiotherapy, hormone therapy, or even new targeted therapies that kill tumor cells . It could give memory to other therapies that kill tumor cells and give you that long - lived response that lasts for the rest of your life . The experiments started in mice, and the results were stunning . In our early experiments we cured between 90% and 100% of the mice in most of these experiments, and the mice were permanently immuned when re - challenged with the tumor . Allison . All we were doing was covering up this one molecule out of all the things that are going on when the host immune system is detecting the tumor and turning tumor growth and inevitable death of the mice to a cure and long - lived immunity to re - challenge . In the late 1990s, dr . Allison's lab teamed up with medarex to make completely human antibodies to ctla-4 . The resulting drug, ipilimumab, it's been incredibly successful, having at least anecdotal responses in many kinds of cancer, including melanoma, renal cancer, prostate cancer, glioblastoma, pancreatic cancer, ovarian cancer, and lung cancer and the adverse effects are a lot milder than what you see with conventional chemotherapy . During his acceptance speech at the award ceremony, dr . Allison presented the story of a woman named sharon, who developed metastatic melanoma in her late 40s and subsequently failed every therapy . Allison, she just said she wanted to live long enough to see her sons graduate from high school . Sharon was placed on the phase i trial of ipilimumab and got a single dose at 3 mg / kg . Six months later, she was completely clear of tumor . And she's still completely tumor free, with no need for subsequent therapy at all, and now she's 14 years out . There are similar anecdotes for patients with metastatic melanoma to the brain, completely cured, and patients with prostate cancer and bone metastases, completely gone after anti - ctla-4 treatment . The real proof was in an 800-patient, randomized, placebo - controlled trial of ipilimumab in metastatic melanoma . Median survival increased four months for patients in this trial, a result that had never been achieved with any therapy for metastatic melanoma . Even more remarkably, the survival curve flattens out at about 23% at two and a half years and goes out to three years, three and a half, four years, four and a half, and is absolutely flat . Recently there was actually a 5,000 patient retrospective study [that] showed that people who make it three years after this single round of therapy do not die of melanoma; they die of something else . Ctla-4 is not the only molecule involved in down - regulating the immune response, and not all patients respond to anti - ctla-4 treatment . Work with another signaling molecule, programmed cell death 1 (pd-1; which competes with the ignition switch and not the gas pedal, as the ctla-4 molecule does), demonstrated not just similar outcomes, but in fact, additive effects when combined with ipilimumab . We're at a point where we know that immunotherapy by checkpoint blockade works can we predict who's going to respond and who won't respond? How do we identify the best combinations to use, to try to raise the efficacy? In addition, the concentration of translational research was on moving the median survival a few months to the right [of the curve] what ipilimumab showed is that you can do that, but you can also get a tail on the curve where you get durable survivals that last for years and decades even of those patients . Our goal now in this field is really to raise that tail not to move the median, but to raise the tail of the response to as high as we can get it in as many cancer types as we can get it, said dr . And i'm really optimistic that we can do that pretty soon, with continuing support for the basic science from the [national cancer institute, national institutes of health], as well as from the national foundation for cancer research . But also for support of the more translational aspects of this that you don't get from the [national cancer institute]they don't provide [this support]; you can get [it] only from organizations like the national foundation for cancer research that enable us to make that jump from basic demonstration that ctla-4 is an important regulatory molecule to letting us show that it works in preclinical and clinical models . The 2014 szent - gyrgyi prize selection committee was chaired by alex matter, md, and co - chaired by sujuan ba, phd . Other selection committee members included leaders in cancer research and drug development from academic institutes and biotech and pharmaceutical industries: steven d. averbuch, md, bristol - myers squibb company; webster k. cavenee, phd, ludwig institute for cancer research; zhu chen, md, phd, shanghai jiao tong university; sara courtneidge, phd, sanford - burnham medical research institute; carlo m. croce, md, the ohio state university; stan kaye, md, royal marsden nhs foundation trust; marsha a. moses, phd, boston children's hospital; richard o'reilly, md, memorial sloan kettering cancer center; scott d. patterson, phd, amgen, inc . ; peter k. vogt, phd, the scripps research institute; and yi michael wang, md, phd, general secretary of nfcr . 2013 - alex matter, md chief executive officer, experimental therapeutics centre, agency for science, technology and research (astar), singapore . 2012 - zhu chen, md, phd professor, school of medicine of the shanghai jiao tong university; chairman, chinese medical association; former minister of health of china, shanghai, p. r. china . 2012 - zhen - yi wang, md professor, school of medicine of shanghai jiao tong university; honorary director, shanghai institute of hematology, shanghai, p. r. china . 2011 - beatrice mintz, phd professor and jack schultz chair in basic science, fox chase cancer center, philadelphia, pennsylvania, us . 2010 - peter k. vogt, phd professor, department of molecular and experimental medicine, the scripps research institute, la jolla, california, us . 2009 - ronald a. depinho, md president, md anderson cancer center, houston, texas, us . 2008 - carlo m. croce, md director, human cancer genetics program; director, institute of genetics, the ohio state university, columbus, ohio, us . 2007 - webster k. cavenee, phd director, ludwig institute for cancer research, san diego branch; distinguished professor, university of california, san diego, california, us . 2006 - harold f. dvorak, md mallinckrodt professor emeritus of pathology, harvard medical school; chief, department of pathology, beth israel deaconess medical center, boston, massachusetts, us.
The anterior choroidal artery (achoa) supplies several important structures including the optic tract, geniculate body, posterior limb of internal capsule, globus pallidus, cerebral peduncle, uncus, amygdala, ventrolateral nucleus of thalamus, and choroid plexus . The vascular injury of achoa may result in severe neurological deficits such as hemiplegia, hemianesthesia, hemianopsia, decreased consciousness, and extrapyramidal symptoms . Therefore, complete knowledge about vascular anatomy of achoa is very important before surgical or endovascular manipulations . Although several detailed reports about anatomical variations of achoa have been reported, transposition of achoa as to posterior communicating artery (pcoma) origin was demonstrated only in 3 reports2 - 4). We report a case with ruptured cerebral aneurysm arising from pcoma, which originated from the internal carotid artery (ica) distal to the origin of achoa . A 40-year - old woman presented with sudden onset of headache . Computed tomography (ct) revealed subarachnoid hemorrhage (sah) which was slightly predominant in the left basal and sylvian cisterns . Two small aneurysms arose from both distal supraclinoid ica, these were observed on ct angiograms (fig . Cerebral angiography demonstrated a small aneurysm arising from left fetal type of pcoma with suspicion of rupture and the other small aneurysm originating from right pcoma or perforating branch of ica . In this study, left achoa originated from ica proximal to the origin of fetal type of pcoma (fig . Achoa usually arises from the posterolateral wall of ica, a few mm distal to the origin of pcoma, and it provides blood supply to the important neural structures around crural and ambient cisterns . The achoa can have several variations in the course, size, number, branching pattern, and brain region supplied by this artery1). Among them, there have been several anomalies related to the origin of achoa including transposition of achoa and pcoma, origin from pcoma, origin from junction of ica and pcoma, and origin from middle cerebral artery4,5). The clinical findings of transposed achoa cases including present one are summarized in table 1 . All of the transpositions of achoa occurred in the left side . Among all the cases, our case showed sah due to ruptured aneurysm arising from fetal type of pcoma among multiple cerebral aneurysms founded and achoa originating from ica proximal to pcoma . Typically, achoa runs posteromedially within the crural cistern and continues ambient cistern to enter the choroidal fissure . The proximal portion of this artery is cisternal segment and following portion becomes intraventricular segment1). The transposed achoa in the previous cases including ours did not seem to affect the vascular territory or course despite of unusual vascular arrangements . The achoa can be exposed or manipulated in surgical approaches into the pathological lesions around temporal lobe or involving supraclinoid ica . Although the achoa aneurysms accounting for 4% of all cerebral aneurysms are not so common, vascular injury of achoa with small caliber supplying the eloquent areas may be critical because of the possibility of significant morbidity and mortality . And, another caution is that achoa do not have significant collateral flows despite a potential anastomosis with posterior choroidal artery3). We tried to preserve pcoma itself and all perforating branches arising from it because of the possibility to compromise the collateral flows of fetal type pcoma . It is notable that careful review of the preoperative angiograms helps to find unexpected vascular anomalies which may impose an additional surgical risk.
Transposases are enzymes that catalyze the movement of mobile genetic elements in and between genomes and are the most abundant and ubiquitous genes in nature (1). Most often, transposases are part of transposable elements (tes), which encode only the transposase gene and some short flanking sequences necessary for transposition . Classically, tes are considered to be selfish genetic elements or parasitic dna with no purpose other than reproducing themselves (24). However, in more recent years, it has become clear that tes are not always parasites, but can also have beneficial effects that increase the fitness of their bacterial host (for reviews of the ongoing debate, see references 35). Tes (especially is elements) are involved in gene deletions, gene duplications, genome rearrangements, gene regulation, and horizontal gene transfer (for a review, see references 6 and 7), all of which can have beneficial effects on the host population by generating genomic diversity and thus enabling adaptation to environmental changes (810). Therefore, transposase expression and, thus, transpositional activity are usually very low (11), because the mutagenic effects of transposases would drive their hosts into extinction, thereby also eradicating their own existence (12). Accordingly, a large variety of mechanisms for the tight regulation of transposase expression exists at both the transcriptional and translational levels (11). Tes and, thus, transposase genes are particularly enriched in the genomes of some mutualistic symbionts (here called symbionts) and some pathogens that have recently transitioned or are transitioning to an obligate, host - associated lifestyle (5, 13). In contrast, tes are absent in the reduced genomes of most obligate, host - restricted bacteria that have been associated with their host over long evolutionary time periods (tes absent in 65% of the genomes from symbionts classified as obligately intracellular in newton and bordenstein). There are, however, some ancient obligate intracellular bacteria, such as wolbachia pipientis wmel and candidatus amoebophilus asiaticus, that have high numbers of tes in their genomes (14, 15) (tes present in 35% of the genomes from symbionts classified as obligately intracellular in newton and bordenstein). It has been shown that te expansion in bacteria in transition to an obligate, host - associated lifestyle plays a crucial role in the emergence and early evolution of pathogens (8, 1618) and symbionts (19, 20). Currently, there is much uncertainty about the factors that lead to high te loads in host - restricted bacteria, and several hypotheses have been put forth (reviewed in reference 3). The two main hypotheses, which represent partially opposing views, are (i) the selective advantage hypothesis and (ii) the relaxed natural selection hypothesis . In (i), te expansion is selected for because it is beneficial for symbionts and pathogens transitioning to an obligate lifestyle, for example, by providing enhanced genomic plasticity for faster adaptation to the host environment (8, 9, 21). In (ii), temporary te expansion in the genomes of host - restricted bacteria is due to a reduced effectiveness of natural selection against deleterious transpositions (5). The relaxed natural selection, according to this second hypothesis, is caused by genetic drift due to small population sizes during transmission of symbionts from one host generation to the next, and the fact that when symbionts reside within a host, many of their genes become superfluous and can thus act as neutral integration sites for tes . These two hypotheses can also explain the evolutionary processes involved in te expansion in ancient obligate intracellular bacteria that have a reduced genome, yet still have high te numbers in their genomes . For these ancient symbionts, the intracellular arena hypothesis explains how tes first reenter their genomes: host switching events bring these symbionts into contact with other bacteria during coinfection within the same host and thus enable the uptake of foreign tes (13, 14). These newly acquired tes then multiply in the genomes of the ancient symbionts either (i) because they confer a selective advantage or (ii) due to reduced effectiveness of natural selection in the intracellular environment (5, 22). A recent study that tested hypothesis (ii) by subjecting escherichia coli for 4,000 generations to simulated conditions of relaxed natural selection raised doubts as to whether relaxed natural selection alone can account for te expansion (21), because no te expansion occurred under the tested conditions . Although plague et al . (21) noted that there are several possible reasons why [their] experiment may not have adequately tested the [relaxed natural selection] hypothesis, they hypothesized that other factors, including increased transposase activity, might have enabled the massive te expansion observed in host - restricted bacteria . Common to both hypotheses (i) and (ii) is that they explain te expansion in host - restricted bacteria within the confines of the paradigm that transposase expression and, thus, transpositional activity are always low . High numbers of transposase genes were recently described in endosymbionts of the gutless marine oligochaete olavius algarvensis (23). O. algarvensis inhabits shallow water sediments in the mediterranean and lacks both a digestive and an excretory system, relying instead for nutrition and waste recycling on a symbiotic community of two gammaproteobacterial sulfur oxidizers (1 and 3 symbionts), two deltaproteobacterial sulfate reducers (1 and 4 symbionts), and a spirochete (23, 24). The symbiotic bacteria cooccur in an extracellular space just below the worm s cuticle and above the host s epidermal cells where they are in direct contact with each other and have access to solutes <70 kda from the environment that can easily diffuse through the worm s cuticle (25). Metagenomic analyses of o. algarvensis showed that the 1 symbiont has a remarkably high percentage of transposases in its genome, at nearly 21% of all genes, followed by the 3 symbiont with 7.5% and the 1 symbiont with 2.3% (23, 26). Nothing is currently known about the factors that have led to such high te numbers in some of the o. algarvensis symbionts . We assume that the association with the 1 symbiont is ancient because these symbionts occur in many gutless oligochaete species from around the world, indicating that the common ancestor of all gutless oligochaetes may have already had the 1 symbiont (25). However, the genome of the 1 symbiont shows no signs of reduction (23). The associations with the 3 and deltaproteobacterial symbionts may be more recent, as these symbionts are found in some but not all gutless oligochaetes (27); the genomes of these symbionts are also not reduced (23). The transmission mode of symbionts in gutless oligochaetes has been examined only in two host species from bermuda and appears to be vertical (28). However, occasional horizontal uptake of bacteria from the environment during egg deposition in the surrounding sediment cannot be excluded . Thus, the o. algarvensis symbionts could acquire new tes from both environmental sources and cooccurring symbionts . The aim of this study was to examine how the high percentage of tes in the o. algarvensis symbiont genomes affects their expression . Interestingly, the relationship between high te loads and transposase expression and activity has, to our knowledge, so far not been explored . Our metaproteomic analyses revealed that the 1 and 1 symbionts express a surprisingly high number of their transposase proteins, many of which are intact and possibly active, and we hypothesize that abundant transposase expression plays a key role in te expansion . Worms were collected as described previously (24) and either frozen immediately or symbionts were enriched via isopycnic centrifugation by layering the worm homogenate on top of a histodenz (sigma) multistep density gradient . Symbionts were separated from each other and from host tissue by 1 h of centrifugation at 4c as described by kleiner et al . High proteome coverage was achieved, i.e., 2,265 symbiont proteins were detected, via automated 24-h two - dimensional liquid chromatography followed by tandem mass spectrometry (ms / ms) with a hybrid linear ion trap - orbitrap (thermo fischer scientific) as described in detail by kleiner et al . Protein databases, peptide and protein identifications, and all ms / ms spectra are available from http://compbio.ornl.gov/olavius_algarvensis_symbiont_metaproteome/, and detailed data on expressed transposases are available from http://compbio.ornl.gov / olavius_algarvensis_symbiont_transposases/. We detected the highest number of transposase proteins ever reported in bacteria in the 1 symbiont of o. algarvensis (22 proteins) (table 1). Additionally, we detected two transposase proteins in the 1 symbiont and two transposase proteins that could not be unambiguously assigned to a given symbiont (table 1). We did not obtain good proteome coverage for the 3 symbiont due to its low abundance in o. algarvensis and were therefore unable to determine if any of its numerous transposase genes were expressed . To compare our data to other studies, we searched for reports of transposase expression at the protein level and found that the highest numbers were found in free - living bacteria and not in host - associated bacteria . The highest numbers of expressed transposases were seven in a proteome of the cultured bacterium deinococcus radiodurans (29) and eight in a metaproteome of the uncultured leptospirillum group ii bacterium from acid mine drainage (30). To our knowledge, transposase expression has so far not been examined at the protein level in symbionts or pathogens with high te numbers in their genomes . Overview of all expressed transposases grouped according to shared peptide matches accession numbers refer to the jgi img / m database (http://img.jgi.doe.gov/cgi-bin/m/main.cgi). Some of the transposases that were identified as not intact may actually be intact and only appear to be fragmented due to the incomplete nature of the symbiont metagenome . Identified with an unassigned symbiont metagenome fragment . This number is bigger than the actual number, 134, because one transposase fell into two groups . Transposases comprised up to 1.95% of the total 1 symbiont protein (see table s1 in the supplemental material) and up to 0.084% of the total 1 symbiont protein (table s2). The abundance of transposases (as estimated from label - free proteomic quantitation) in the 1 symbiont was greater than that of some of its most abundant housekeeping proteins, such as the atpase b subunit (1.15%), malate dehydrogenase (0.38%), and 6-phosphofructokinase (0.35%) (24). Within the context of natural microbial communities, highly abundant transposase protein expression has, so far, only been reported from a microbial biofilm in acid mine drainage; however, relative abundances were estimated at less than half of the amounts observed here (30). Since many transposase genes are present in multiple, nearly identical copies in the symbiont metagenomes (23, 26), the 26 groups of transposase genes (table 1) could be encoded by as many as 134 transposase gene sequences in the metagenome (see table s3 in the supplemental material). Given that proteins encoded by almost - identical sequences with identical tryptic peptides cannot be distinguished from each other by mass spectrometry - based proteomic analyses, we were not able to identify which of the 134 transposase genes were expressed and if multiple copies of identical genes were expressed . Therefore, we assigned the transposases that were identified with similar sets of peptides to 12 different groups (table 1; see also table s4 in the supplemental material) and used this grouping to identify the minimal set of transposases that must be expressed to explain all transposase - related peptides . We classified the 26 nonredundant transposases into is element families using blastp against the curated is finder database (31) (http://www-is.biotoul.fr/) and found that they belong to at least 10 different is element families in the 1 symbiont and 2 families in the 1 symbiont (table 1). Previous studies have reported increased transposase expression in response to stressful conditions (29, 32). However, relative abundances were much lower than those detected in our study . To exclude the possibility that transposase expression in the o. algarvensis symbionts was caused by stressful conditions during the 1 hour long symbiont enrichment procedure, we did a qualitative comparison of their proteomes with those of symbionts that were frozen in whole worms immediately following removal from the sediment . We also measured high levels of transposase expression in these immediately frozen symbionts (see tables s1 and s3 in the supplemental material). Thus, we conclude that the observed transposase expression is not due to stressful sampling and enrichment conditions but rather reflects expression under natural environmental conditions . We inferred that some of the expressed transposases are active by excluding the two main reasons for potential inactivity: (i) transposase genes could be in the process of gene degradation so that their expression would lead to incomplete and potentially inactive transposases and (ii) the expression of some transposase genes is regulated through programmed translational frameshifting, which would lead to the translation of a truncated, nonfunctional version of the transposase protein (6, 11, 33). First, we checked for indications that the expressed transposase genes were intact rather than in a state of gene degradation . We compared the gene sizes and protein sequences to those of closely related transposases in the is finder database and compared their protein domain structures with the domain structure of similar transposases using the domain organization feature available on pfam (http://pfam.sanger.ac.uk/search). We found that around half of the expressed transposase genes were intact, whereas for the other half, we were not able to exclude the possibility that they were in some stage of degeneration (table 1). Second, we checked the literature and found that only the is families of four out of the 26 detected transposases are known to be regulated by programmed translational frameshifting (11) (table 1). Therefore, we assume that the majority of the expressed transposases are translated to full - length proteins . Additional evidence for the expression of full - length transposase proteins comes from our proteomic data . For some of the identified transposases, we detected peptides not only in the beginning part of the protein but also in the middle or at the end of the protein, a finding which indicates that the protein was translated from beginning to end (http://compbio.ornl.gov/olavius_algarvensis_symbiont_transposases/) our results show that the paradigm that transposase expression in bacteria must be tightly regulated and generally low to prevent the host population from going extinct does not always hold true . We present evidence at the protein level that transposases are abundantly expressed in beneficial symbionts with high te numbers in their genomes . This high expression of transposases indicates that the mechanisms typically found in bacteria for their tight regulation have been disabled or no longer exist, for example, possibly through mutations in proteins that are involved in transposase regulation (20, 34, 35). The fixation of such mutations may be enabled by the relaxed purifying selection suggested by moran et al . For symbionts and pathogens that recently transitioned to an obligate, host - associated lifestyle (20). Currently, it is not possible to determine if abundant transposase expression is present in other symbionts and pathogens with high te numbers, because no comparable proteomic datasets exist for these bacteria . However, many recent studies have shown high transcription of transposase genes in symbionts and pathogens (15, 3640), which may indicate that abundant transposase expression is common in these bacteria . However, the presence of these transcripts does not represent conclusive evidence for transposase expression because it is possible that they are not translated into proteins due to regulatory mechanisms (11, 15, 37). Based on the high numbers of transposase proteins in the o. algarvensis 1 symbiont and abundant transposase transcription in other symbionts and pathogens, we speculate that high transposase expression is one of the key factors in te expansion in host - restricted bacteria . As discussed above, an experiment that simulated conditions of relaxed natural selection failed to cause te expansion after 4,000 generations in e. coli . If, as we speculate, high transposase expression is the major catalyst for te expansion, the mutations that lead to increased transposase expression might have simply not occurred yet in the plague et al . Additional studies that investigate transposase expression in pathogens and symbionts are needed because high transposase expression may be an important factor in the sometimes very rapid emergence and evolution of new obligate symbionts and pathogens from facultative ones . The remarkably high expression of transposases in the o. algarvensis 1 symbiont raises the question of how the symbiont can function over evolutionary time periods given the likelihood that high transposase expression leads to an increase in deleterious mutations . In other organisms that are confronted with frequent transpositions, genome rearrangements and disruptions, it has been suggested that polyploidy buffers against the detrimental effects of the factors that lead to these genome disruptions such as transposable elements, introns, heat and ionizing radiation (4144). Polyploidy has recently been shown for several symbionts, including sulfur - oxidizing symbionts of clams (45), and it is possible that it also plays a role in the o. algarvensis 1 symbiont . To gain a better understanding of how the o. algarvensis 1 symbiont deals with high transposase expression, it would be crucial to know specifically how high the transpositional activity of the abundant transposases is . Do the symbionts have multiple genome copies that buffer against the deleterious effects of transposase activity? To answer these questions, we are currently sequencing the genomes of single symbiont cells to examine how common transposition events are within the same individual host, within the host population, and between host populations . Worms were collected as described previously (24) and either frozen immediately or symbionts were enriched via isopycnic centrifugation by layering the worm homogenate on top of a histodenz (sigma) multistep density gradient . Symbionts were separated from each other and from host tissue by 1 h of centrifugation at 4c as described by kleiner et al . High proteome coverage was achieved, i.e., 2,265 symbiont proteins were detected, via automated 24-h two - dimensional liquid chromatography followed by tandem mass spectrometry (ms / ms) with a hybrid linear ion trap - orbitrap (thermo fischer scientific) as described in detail by kleiner et al . Protein databases, peptide and protein identifications, and all ms / ms spectra are available from http://compbio.ornl.gov/olavius_algarvensis_symbiont_metaproteome/, and detailed data on expressed transposases are available from http://compbio.ornl.gov / olavius_algarvensis_symbiont_transposases/. We detected the highest number of transposase proteins ever reported in bacteria in the 1 symbiont of o. algarvensis (22 proteins) (table 1). Additionally, we detected two transposase proteins in the 1 symbiont and two transposase proteins that could not be unambiguously assigned to a given symbiont (table 1). We did not obtain good proteome coverage for the 3 symbiont due to its low abundance in o. algarvensis and were therefore unable to determine if any of its numerous transposase genes were expressed . To compare our data to other studies, we searched for reports of transposase expression at the protein level and found that the highest numbers were found in free - living bacteria and not in host - associated bacteria . The highest numbers of expressed transposases were seven in a proteome of the cultured bacterium deinococcus radiodurans (29) and eight in a metaproteome of the uncultured leptospirillum group ii bacterium from acid mine drainage (30). To our knowledge, transposase expression has so far not been examined at the protein level in symbionts or pathogens with high te numbers in their genomes . Overview of all expressed transposases grouped according to shared peptide matches accession numbers refer to the jgi img / m database (http://img.jgi.doe.gov/cgi-bin/m/main.cgi). Some of the transposases that were identified as not intact may actually be intact and only appear to be fragmented due to the incomplete nature of the symbiont metagenome . Identified with an unassigned symbiont metagenome fragment . This number is bigger than the actual number, 134, because one transposase fell into two groups . Transposases comprised up to 1.95% of the total 1 symbiont protein (see table s1 in the supplemental material) and up to 0.084% of the total 1 symbiont protein (table s2). The abundance of transposases (as estimated from label - free proteomic quantitation) in the 1 symbiont was greater than that of some of its most abundant housekeeping proteins, such as the atpase b subunit (1.15%), malate dehydrogenase (0.38%), and 6-phosphofructokinase (0.35%) (24). Within the context of natural microbial communities, highly abundant transposase protein expression has, so far, only been reported from a microbial biofilm in acid mine drainage; however, relative abundances were estimated at less than half of the amounts observed here (30). Since many transposase genes are present in multiple, nearly identical copies in the symbiont metagenomes (23, 26), the 26 groups of transposase genes (table 1) could be encoded by as many as 134 transposase gene sequences in the metagenome (see table s3 in the supplemental material). Given that proteins encoded by almost - identical sequences with identical tryptic peptides cannot be distinguished from each other by mass spectrometry - based proteomic analyses, we were not able to identify which of the 134 transposase genes were expressed and if multiple copies of identical genes were expressed . Therefore, we assigned the transposases that were identified with similar sets of peptides to 12 different groups (table 1; see also table s4 in the supplemental material) and used this grouping to identify the minimal set of transposases that must be expressed to explain all transposase - related peptides . We classified the 26 nonredundant transposases into is element families using blastp against the curated is finder database (31) (http://www-is.biotoul.fr/) and found that they belong to at least 10 different is element families in the 1 symbiont and 2 families in the 1 symbiont (table 1). Previous studies have reported increased transposase expression in response to stressful conditions (29, 32). However, relative abundances were much lower than those detected in our study . To exclude the possibility that transposase expression in the o. algarvensis symbionts was caused by stressful conditions during the 1 hour long symbiont enrichment procedure, we did a qualitative comparison of their proteomes with those of symbionts that were frozen in whole worms immediately following removal from the sediment . We also measured high levels of transposase expression in these immediately frozen symbionts (see tables s1 and s3 in the supplemental material). Thus, we conclude that the observed transposase expression is not due to stressful sampling and enrichment conditions but rather reflects expression under natural environmental conditions . We inferred that some of the expressed transposases are active by excluding the two main reasons for potential inactivity: (i) transposase genes could be in the process of gene degradation so that their expression would lead to incomplete and potentially inactive transposases and (ii) the expression of some transposase genes is regulated through programmed translational frameshifting, which would lead to the translation of a truncated, nonfunctional version of the transposase protein (6, 11, 33). First, we checked for indications that the expressed transposase genes were intact rather than in a state of gene degradation . We compared the gene sizes and protein sequences to those of closely related transposases in the is finder database and compared their protein domain structures with the domain structure of similar transposases using the domain organization feature available on pfam (http://pfam.sanger.ac.uk/search). We found that around half of the expressed transposase genes were intact, whereas for the other half, we were not able to exclude the possibility that they were in some stage of degeneration (table 1). Second, we checked the literature and found that only the is families of four out of the 26 detected transposases are known to be regulated by programmed translational frameshifting (11) (table 1). Therefore, we assume that the majority of the expressed transposases are translated to full - length proteins . Additional evidence for the expression of full - length transposase proteins comes from our proteomic data . For some of the identified transposases, we detected peptides not only in the beginning part of the protein but also in the middle or at the end of the protein, a finding which indicates that the protein was translated from beginning to end (http://compbio.ornl.gov/olavius_algarvensis_symbiont_transposases/). Our results show that the paradigm that transposase expression in bacteria must be tightly regulated and generally low to prevent the host population from going extinct does not always hold true . We present evidence at the protein level that transposases are abundantly expressed in beneficial symbionts with high te numbers in their genomes . This high expression of transposases indicates that the mechanisms typically found in bacteria for their tight regulation have been disabled or no longer exist, for example, possibly through mutations in proteins that are involved in transposase regulation (20, 34, 35). The fixation of such mutations may be enabled by the relaxed purifying selection suggested by moran et al . For symbionts and pathogens that recently transitioned to an currently, it is not possible to determine if abundant transposase expression is present in other symbionts and pathogens with high te numbers, because no comparable proteomic datasets exist for these bacteria . However, many recent studies have shown high transcription of transposase genes in symbionts and pathogens (15, 3640), which may indicate that abundant transposase expression is common in these bacteria . However, the presence of these transcripts does not represent conclusive evidence for transposase expression because it is possible that they are not translated into proteins due to regulatory mechanisms (11, 15, 37). Based on the high numbers of transposase proteins in the o. algarvensis 1 symbiont and abundant transposase transcription in other symbionts and pathogens, we speculate that high transposase expression is one of the key factors in te expansion in host - restricted bacteria . As discussed above, an experiment that simulated conditions of relaxed natural selection failed to cause te expansion after 4,000 generations in e. coli . If, as we speculate, high transposase expression is the major catalyst for te expansion, the mutations that lead to increased transposase expression might have simply not occurred yet in the plague et al . Additional studies that investigate transposase expression in pathogens and symbionts are needed because high transposase expression may be an important factor in the sometimes very rapid emergence and evolution of new obligate symbionts and pathogens from facultative ones . The remarkably high expression of transposases in the o. algarvensis 1 symbiont raises the question of how the symbiont can function over evolutionary time periods given the likelihood that high transposase expression leads to an increase in deleterious mutations . In other organisms that are confronted with frequent transpositions, genome rearrangements and disruptions, it has been suggested that polyploidy buffers against the detrimental effects of the factors that lead to these genome disruptions such as transposable elements, introns, heat and ionizing radiation (4144). Polyploidy has recently been shown for several symbionts, including sulfur - oxidizing symbionts of clams (45), and it is possible that it also plays a role in the o. algarvensis 1 symbiont . To gain a better understanding of how the o. algarvensis 1 symbiont deals with high transposase expression, it would be crucial to know specifically how high the transpositional activity of the abundant transposases is . Do the symbionts have multiple genome copies that buffer against the deleterious effects of transposase activity? To answer these questions, we are currently sequencing the genomes of single symbiont cells to examine how common transposition events are within the same individual host, within the host population, and between host populations . Organism normalized spectral abundance factor (nsaf) values (relative abundance) for the 1 symbiont transposases . Minimum number of 1 symbiont transposase proteins needed to explain all detected peptides (according to the grouping in table s4 in the supplemental material). The values in the table are nsaf, which indicate the relative abundance of the respective protein in relation to all identified 1 symbiont proteins . Minimum number of 1 symbiont transposase proteins needed to explain all detected peptides (according to the grouping in table s4 in the supplemental material). The values in the table are nsaf, which indicate the relative abundance of the respective protein in relation to all identified 1 symbiont proteins . Table s3, xls file, 0.1 mb . Identified transposases grouped according to the peptides with which they were detected.
Joubert syndrome (js) was initially described in 1968 in 4 siblings with agenesis of the cerebellar vermis presented with episodic hyperpnea, abnormal eye movements, ataxia, and intellectual disability1). Several years later, a pathognomonic midbrain - hindbrain malformation the molar tooth sign (mts)was detected first in js2), and then in several other conditions previously considered as distinct entities . This neuroradiological sign is now represented as a mandatory criterion for the diagnose of js . Js can be assumed in all infants presented with hypotonia, altered respiratory pattern, abnormal eye movement, and developmental delay3). In the newborn period, episodic hyperpnea, a subtle facial appearance, and abnormal eye movements nystagmus, colobomas, strabismus, ptosis, and retinal pigmentation are associated with eye abnormalities in neonates3). Concomitant symptoms of ptosis, anisocoria with unilateral miosis, and unilateral enophthalmos, which are compatible with horner syndrome (hs), have not been documented in the children of js children thus far . We now describe a neonate of js presented with hypotonia and unique eye abnormalities of nystagmus, ptosis, anisocoria, and unilateral enophthalmos . To the best of our knowledge, a 2-month - old boy was referred to the pediatric neurology clinic due to bilateral nystagmus, bilateral ptosis with left - dominant, left - sided enophthalmos, and anisocoria since the second week after birth . The patient was the first baby of a healthy 28-year - old mother and a healthy 32-year - old father . The baby was a 3,050 g (10th25th percentile) infant born at gestational age of 38 weeks by normal vaginal delivery after an uneventful pregnancy . His height was 48.5 cm (25th50th percentile), with a head circumference of 33 cm (10th25th percentile). After birth, the baby had laryngomalacia, hypotonia, and a systolic murmur best heard at the upper left sternal border . An electrocardiogram and echocardiogram revealed normal sinus rhythm, and a small sized secundum atrial septal defect . On physical examination, both pupils promptly reacted to light, but unilateral miosis and enophthalmos of the left eye and left - dominant bilateral ptosis were observed, which could be indicative of hs (fig . Other physical examination findings were unremarkable . In order to evaluate the symptoms of hs and horizontal nystagmus, magnetic resonance imaging (mri) of the orbit, orbit and brain mri showed hypoplastic cerebellar vermis and a narrowed anteroposterior diameter of the midbrain with a characteristic of molar tooth appearance (fig . 2), which were compatible with typical findings of js . Neck mri showed no definite lesion or mass around the cervical sympathetic nerve chain, thymus, and mediastinum as the underlying cause of hs . Laboratory examinations including renal and hepatic function tests and an abdominal ultrasonography showed normal findings . Left - sided visual loss was found in ophthalmological examinations, and neither coloboma nor pigmentary retinal changes were observed . No abnormality was noted in an audiological test and follow - up electrocardiogram and echocardiogram . Molecular genetic test was not performed . Clinical development at the age of 10 months was global delayed, as explained by the following: he could not babble, follow with or turn his eyes on objects, control his head, sit independently, or hold his bottle . He underwent ophthalmologic surgery (bilateral frontalis operation) due to persistent visual disturbance by bilateral ptosis, and had distinct improvement of ptosis; however, unilateral enophthalmos, and anisocoria remained (fig . He is currently actively undergoing rehabilitation therapy, and will be regularly monitored through comprehensive developmental examination and follow - up imaging tests, including hepatorenal, cardiac, and ophthalmologic test . The gross photos of the figure were permitted by his parents through the informed consent . Js is a rare autosomal - recessive disorder, which is characterized by midbrain - hindbrain malformation mainly in the form of agenesis or dysgenesis of cerebellar vermis3). The incidence rate is 1 out of 800,000 to 100,000 per a year in the newborn5). Describe several diagnostic criteria; (1) cranial mri findings demonstrating the mts on axial imaging with these three components: midline cerebellar vermis hypoplasia, deepened interpeduncular fossa, and thick, elongated superior cerebellar peduncles, (2) hypotonia in infancy, (3) global developmental delay / mental retardation, and (4) one or both of the following (not absolutely required but supportive of the diagnosis): (i) irregular breathing pattern in infancy (episodic tachypnea and/or apnea), and (ii) abnormal eye movement (nystagmus, jerky eye movements, and difficulty with smooth visual pursuits). Pathological findings of mts correspond to an image of severe hypo - dysplasia of the cerebellar vermis with midline clefting, fragmentation of cerebellar nuclei and heterotopias of purkinje - like neurons, along with dysplasia of the pontine and medullary structures such as the basis pontis, reticular formation, inferior olivary, dorsal column, and solitary tract nuclei . Moreover, typical findings are expressed by the lack of decussation both of the superior cerebellar peduncles and of the corticospinal tracts at the medullary pyramids6). A diagnosis of js should be assumed in all infants presented with hypotonia, abnormal eye movement and developmental delay . Especially, a neonate of js shows the characteristic physical signs and symptoms (table 1)3). The infant may lie in a froglike position, and moderate to severe hypotonia can be observed3). The most common presented feature in the newborn period is an abnormal breathing pattern, characterized by episodic hyperpnea23). The distinctive short alternate episodes of apnea and hyperpnea or episodic hyperpnea lone, sometimes described as panting like a dog, may intensify with stress and progressively improve with age, usually disappearing around sixth months23). The 7 children were diagnosed with js at younger than 1 year old of age78910), and the case of neonatal onset was only one7). The cardinal symptoms of them were unexplainable episodic tachypnea alternating with apnea during neonatal period, abnormal ocular movement, hypotonia, ataxia, and developmental delay . In rare cases most of the patients showed nystagmus, saccadic palsy, or congenital ocular motor apraxia as the abnormal ocular movement, however, one 7-month - old boy had a severe vision loss as leber's congenital amaurosis8). Ocular and oculomotor involvement is common in js2411), however, it has variable phenotypes among patients with js . Colobomas, nystagmus, strabismus, ptosis, and abnormal retinal pigmentation are noted in neonates3). Genetype - phenytype correlations have stressed the predictive value for specific mutations of retinal involvement . Retinal involvement is present in about 80% of patients with ahi1 and cep290 mutations12). Ocular misalignment is common in js411), because the lesions of cerebellum lead to dysmetric and slow saccades . This patient showed unique eye abnormalities with transient nystagmus, anisocoria and enophthalmos, and eyelid ptosis . When both anisocoria and ptosis are coexistent, one must consider 2 main possible causes: a third nerve palsy (parasympathetic pathway) or a hs (sympathetic pathway)13). In most cases, a third nerve palsy can usually have disconjugate gaze with limitations of eye movements . Hs is a problem of the disturbance of the oculosympathetic pathway13), which is bilaterally originating in the hypothalamus, descending ipsilaterally in the reticular formation of the brainstem, eventually synapsing with the second - order neuron in the lower cervical or upper thoracic spinal cord . The second - order neuron enters the sympathetic chain, which then ascends within the soft tissues of the neck, outside of the spinal cord, where it is vulnerable to disruption at various locations . It finally synapses within the superior cervical ganglion to form the third - order neuron . This third - order neuron forms a plexus surrounding the carotid artery and into the cavernous sinus, finally innervating the dilator muscle of the iris and the mller muscle in the upper and lower eyelids . Hs is characterized by a combination of ptosis due to superior tarsal muscle palsy, enophthalmos due to mller muscle palsy, rising of inferior eyelid due to inferior tarsal muscle palsy, miosis, and anhidrosis of the involved face when there is a defect of the sympathetic nerve route from hypothalamus to the orbit14). Typical causes include birth trauma, neuroblastoma, vascular anomalies of the large arteries, and chest surgery . If there is no history of birth trauma, an acquired hs in children should prompt evaluation for a tumor, particularly paraspinal neuroblastoma . Imaging studies, such as mri of the head, neck, chest, and abdomen, as well as the measurement of urine catecholamines should be evaluated . These variable ocular phenotypes might be supported by a third nerve palsy and multiplex neuropathological findings of the cerebellar vermis and of several pontine and medullary structures . It may arise from the genetic heterogeneity of js and related disorders15). In conclusion, we describe an infant of js with unique eye abnormalities, likely as symptoms of hs . It may suggest that a neonate or young infant with diverse eye abnormalities should be considered for early neuroimaging to evaluate the underlying etiology, although there may be no focal neurologic deficit or significant developmental delay . Furthermore, once a diagnosis of js has been made, a further evaluation to assess the possibility of multiorgan involvement should be considered in children.
The patient was a 77-year - old female patient admitted for surgery for the chief complaint of an intraductal carcinoma in the left breast that was diagnosed at another hospital . The plain chest radiographs taken 3 years earlier showed " no detection of abnormal findings ", and dyspnea occurred during exercise from 2 years earlier . During a physical examination performed in march 2009, she was diagnosed with intraductal carcinoma in the left breast, 3.8 cm in size, with the possibility of invasion to the lower areola . In the presurgical tests, 1). The bronchial endoscopic examination revealed the deposition of dark pigmentation (anthracotic patches) in the distal area of the right main bronchus, right middle lobe, right lower lobe and area from the left upper lobe to the left lower lobe, as well as a narrowing of the bronchial lumen of the right middle lobe due to fibrosis (fig . Chest computed tomography revealed atelectasis in the right middle lobe associated with a calcified and ruptured lymph node and anthracofibrosis in the entire airway (fig . The presurgical pulmonary function test showed a fvc, fev1 and fev1/fvc of 1.59 l (73%), 1.04 l (71%) and 66%, respectively . With the exception of a mild increase in liver enzymes in the blood test performed before surgery, no special findings were detected in the electrocardiogram, cardiac ultrasonography, and other tests . The patient tested positive to the m. tuberculosis polymerase chain reaction test performed after the bronchial endoscopic examination, and she was placed on antituberculosis medicines from 3 weeks before surgery . For the induction of anesthesia, 200 mg thiopental, 50 mg rocuronium, and 50 g fentanyl were injected, and the anesthesia was maintained with 2.0 - 2.5 vol% sevoflurane, 1 l / min oxygen, and 1 l / min air . Because of the characteristics of the planned modified radical mastectomy, a large change in position from the supine position was not required, and a laryngeal mask airway (proseal #4) was used instead of endotracheal intubation to minimize airway stimulation . To reduce respiratory secretion, 0.2 mg glycopyrrolate was injected intramuscularly during the induction of anesthesia . In the preparation for airway hemorrhage that might occur accidentally during the perioperative period after inducing anesthesia, the arterial blood pressure and central venous pressure were monitored by inserting a 20 g and 7 fr, 3 lumen vascular catheter into the right radial artery and right internal jugular vein respectively . In arterial blood gas analysis performed at the initiation of surgery under the conditions of 0.5 fio2, 37 mmhg etco2, and 100% spo2, the ph was 7.480, pco2 was 37.1 mmhg, po2 was 286.0 mmhg, hco3 was 27.0 mmol / l, be was 3.4 mmol / l, hb was 10.7 g / dl, hct was 31%, na was 136.0 the respiratory tidal volume, respiratory rate, peak pressure and pulse oximetry saturation level was 360 ml per respiration, 10 - 14 times, 15 mmhg and 100%, respectively . The operation time was 1 hour 20 minutes, anesthesia time was 1 hour and 50 minutes, and surgery was completed without special events . Arterial blood gas analysis was performed at the time of the induction of mild hypercapnia by manual ventilation to recover self respiration and awaken the patient from anesthesia under the conditions of 0.5 fio2, 45 mmhg etco2, and 100% spo2 . The results revealed a ph of 7.365, pco2 of 49.5 mmhg, po2 of 233.6 mmhg, hco3 of 27.7 mmol / l, be of 1.7 mmol / l, hb of 11.1 g / dl, hct of 33%, na of 136.3 mmol / l, k of 3.45 mmol / l, ca of 1.04 mmol / l, and glu of 108 mg / dl . After the recovery of sufficient self respiration, the laryngeal mask airway was removed under the inflation state, and endotracheal suction was not performed . She recovered smoothly from anesthesia, and was transported to the ward via a recovery room ., she did not live in a mining area, and farmed in yeongcheon city, gyeongsangbuk - do, which is believed to be less polluted than the larger cities . She did not have prior history of tuberculosis or treatments for tuberculosis, and was a non - smoker . Therefore, the cause of the anthracofibrosis in this patient was speculated to be an undiagnosed tuberculosis infection . She was confirmed to have bronchial tuberculosis by the positivity for m tuberculosis polymerase chain reaction performed prior to surgery . As the mechanism for the deposition of pigment within the bronchus and fibrosis associated with tuberculosis, there is a theory that inflammation in the tubercular lymph nodes induces tuberculosis in the endobronchus through the bronchial wall, resulting in pigment deposition and stenosis . Consequently, endobronchial anthracofibrosis is the state of the development of the most undesirable sequelae of endobronchial tuberculosis . Chung and lee suggested that endobronchial tuberculosis progresses in 6 stages . Among these stages, the infiltration of submucosal lymphocytes into the bronchus forms granulation tissues, and endobronchial stenosis occurs inevitably in cases in whom the disease progresses more than this decisive stage . Therefore, the most important point in the treatment of endobronchial tuberculosis is not to miss the critical time . For this, a bronchial endoscopic examination is required for both diagnosis and treatment . Anthracofibrosis associated with tuberculosis and tubercular endobronchial diseases occur more often in females than males (2.4 times and 5.4 times, respectively). The typical characteristics of patients with bronchial stenosis due to anthracofibrosis are elderly women, without a prior history of pneumoconiosis or smoking, a chief complaint of cough without systemic symptoms or dyspnea, and findings of segmental or lobar consolidation on the plain chest radiographs . In addition, chest computed tomography reveals diverse bronchial abnormalities surrounded by soft tissue or lymph nodes . The most common invaded area is the right middle lobe bronchus, and an active tuberculosis infection is demonstrated in more than 60% patients, which concurs with the present findings . Huh and kang reported a case of an 84-year - old male patient with undiagnosed endobronchial anthracofibrosis before surgery, who developed severe endobronchial hemorrhage after endotracheal suction by a routine method performed in the recovery room . In the recovery room, the hemorrhage began while inserting a suction catheter through an endotracheal tube and aspirating airway secretion . Although the blood was aspirated continuously, the volume did not decrease, and the patient was transported to the intensive care unit . Bronchial endoscopy was performed to stop the hemorrhage, where at that time, together with a large hematoma, bronchial fibrosis and the deposition of dark pigment in a wide area of the right main bronchus adjacent to the carina were detected . The patient showed repeated deterioration and improvement, and acute respiratory distress syndrome developed on the day 5 after surgery . The patient died of multiple organ failure on day 63 after surgery . In our case, to reduce the risk of endobronchial hemorrhage, the amount of airway secretion was reduced using anticholinergic agents, and endotracheal suction using a suction catheter was not performed . The entire length of the endotracheal tube (mallincrodt medical inc ., ireland) with a 7.0 mm inner diameter, which is generally used for the general anesthesia in adult women, is approximately 34 cm when it is firmly fitted with force to prevent the separation of the connector from a catheter . When a 12 fr suction catheter (pvc suction catheter, qingdao sewoon medical co. ltd ., china) was pushed to the end through this endotracheal tube, even the suction catheter completely passed the end of the endotracheal tube, and descends to the lumen of the bronchus by approximately 13 cm . If a 14 fr suction catheter with a slightly larger inner diameter is used, it would enter the lumen of the bronchus by approximately 12 cm . Considering that the length of korean women from the upper incisors to the carina is approximately 18.5 - 25 cm, a suction catheter could enter the lumen of the lobar bronchus readily . In our case, pigment deposition plaque due to anthracofibrosis were formed at the distal area of right main broncus, and presented in the right middle and lower lobe and the left upper and lower lobe, too . Therefore, if endotracheal suction was performed without paying particular attention, a suction catheter possibly irritates the anthracofibrotic lesion at the distal area of the right main bronchus, and may induce the development of mass hemorrhage . The standard guidelines for the airway management for the cases with anthracofibrosis have not been established . In cases placing endotracheal tubes, particularly during the recovery of anesthesia, severe cough may develop due to bronchial stimulation and more hemodynamic changes may occur during the insertion and removal of the endotracheal tube . It is possible that in cases using the laryngeal mask airway, as in our case, direct airway stimulation on the vocal cord and the proximal area of trachea could be decreased relatively . Nevertheless, if it is not installed accurately, saliva, etc . In addition, in cases with obstructive lung diseases due to endobronchial anthracofibrosis, adequate ventilation may be impossible with the laryngeal mask airway only . In our case, sufficient ventilation was achieved only by the placement of a laryngeal mask airway, and the maintenance of anesthesia and recovery were achieved without a large amount of airway secretion . Similar to surgery that must use a laparoscope, for cases in whom an endotracheal tube must be inserted because of the characteristics of surgery itself requiring a high airway pressure, it would be desirable to assess the accurate position of anthracofibrosis lesions by performing a bronchoscopic examination in advance, to use agents that could reduce the level of airway secretion, and to restrain the use of a suction catheter as much as possible . In conclusion, for anthracofibrosis patients, anesthesia plans should be made by considering the possibility of the development of severe hemorrhage within the bronchus if airway suction is performed without paying attention . In korea, where the incidence of tuberculosis is high, there is a strong likelihood of undiagnosed endobronchail anthracofibrosis in elderly women . Therefore, it is important to minimize airway stimulation . If continuous abnormal hemorrhage is detected after endotracheal suction, it is important to consider the possibility of massive hemorrhage within the bronchus caused by underlying anthracofibrosis . In addition, in cases with anthracofibrosis findings detected accidentally during the endobronchial manipulation using a bronchoscope, it is highly probable that undiagnosed tuberculosis would be the cause.
A patient with severe papulopustular rosacea (ppr) and severe background erythema responded well to a treatment regimen consisting of a short course of antibiotics in combination with a corticosteroid, followed by monotherapy with isotretinoin.in patients with very severe, inflamed disease, it is necessary to achieve a rapid response with a fast - acting combinatorial treatment regimen to reduce the inflammation.patients with severe ppr and an inflammatory component can respond rapidly when treated using a multimodal, tailored approach . Because rosacea presents as a spectrum of overlapping symptoms of variable severity, it is important to adapt treatment decisions to individual clinical presentations . Papulopustular rosacea (ppr) is a commonly encountered subtype of rosacea characterized by the presence of persistent central facial erythema (background erythema), accompanied by central facial inflammatory lesions (papules and/or pustules). Patients with ppr often present with lesional and perilesional erythema, which is found around and immediately contiguous to a papule or pustule and contributes to the overall appearance of facial redness . Agents currently approved for the treatment of the inflammatory lesions of rosacea are known in clinical practice for their additional effect of decreasing the overall severity of facial erythema, as a result of the reduction of the lesional and perilesional erythema . However, these agents are not indicated in the treatment of background erythema, which typically persists after clearance of the inflammatory lesions . Alternative treatments for the symptoms present in patients with ppr include short courses of second - generation macrolides such as clarithromycin and azithromycin, which have demonstrated a fast onset of action and a good safety profile in the treatment of patients with ppr [3, 4]. These agents may therefore prove useful as an off - label treatment in patients with severe disease who do not respond to tetracycline therapy, or when isotretinoin is contraindicated . In addition, although corticosteroids are not indicated for use in rosacea, their short - term use may be considered in patients with severe disease who present with signs of rosacea fulminans . There is an increasing awareness of the need to repair and protect the skin barrier as part of the treatment strategy when prescribing treatments aimed at strongly targeting the inflammatory component . It is known that an impaired skin barrier leads to a heightened and potentially chronic inflammatory response . Repairing and protecting the skin barrier will decrease the risk of this process occurring, while also reducing the incidence of dermatological adverse events [7, 8]. Here, we report a case of severe ppr with an important inflammatory component . A strategy aimed at strongly targeting the inflammation upfront in may 2014, a 30-year - old caucasian woman presented to our department (fig . For the past 4 years, the patient had suffered from severe ppr (principally on the forehead, cheeks, and chin) with signs of rosacea fulminans, as well as severe background erythema in the central facial and forehead regions . She had previously been treated with metronidazole 7.5 mg / g cream and permethrin 50 mg / g cream, which had not provided a reduction in the number of inflammatory lesions . She had also been prescribed doxycycline modified - release 40 mg for 18 months, which had also proved unsuccessful in reducing the inflammation.fig . 1patient with rosacea presenting with overlapping symptoms of severe inflammatory lesions and severe background erythema, receiving sequential treatment with azithromycin 500 mg plus prednisolone, isotretinoin 10 mg, and topical brimonidine 3 mg / g gel; topical metronidazole 7.5 mg / g was administered throughout the entire period . A may 2014 (baseline): patient with severe papulopustular rosacea, with signs of rosacea fulminans, and severe background erythema at initial presentation . B june 2014 (4 weeks after baseline): 4 weeks after initiation of treatment with azithromycin 500 mg three times weekly plus once - daily prednisolone (30 mg for 1 week; 10 mg for 3 weeks), in combination with metronidazole 7.5 mg / g cream twice daily . C july 2014 (8 weeks after baseline): following a further 4 weeks of azithromycin 500 mg three times weekly, in combination with once - daily prednisolone 5 mg treatment; the patient continued to apply metronidazole 7.5 mg / g cream twice daily . Isotretinoin d october 2014 (25 weeks after baseline): following 4 months of treatment with isotretinoin 10 mg once daily . E december 2014 (32 weeks after baseline): following a further 2 months of treatment with isotretinoin 10 mg once daily in combination with brimonidine 3 mg / g gel applied to the left side of the face 3 h before presentation to our outpatient department . F march 2015 (43 weeks after baseline): following an additional 3 months . Treatment with isotretinoin 10 mg once daily was stopped after 9 months; treatment with metronidazole 7.5 mg / g cream twice daily was continued . The patient had applied brimonidine 3 mg / g gel to the left side of her face on the morning of the visit to the clinic patient with rosacea presenting with overlapping symptoms of severe inflammatory lesions and severe background erythema, receiving sequential treatment with azithromycin 500 mg plus prednisolone, isotretinoin 10 mg, and topical brimonidine 3 mg / g gel; topical metronidazole 7.5 mg / g was administered throughout the entire period . A may 2014 (baseline): patient with severe papulopustular rosacea, with signs of rosacea fulminans, and severe background erythema at initial presentation . B june 2014 (4 weeks after baseline): 4 weeks after initiation of treatment with azithromycin 500 mg three times weekly plus once - daily prednisolone (30 mg for 1 week; 10 mg for 3 weeks), in combination with metronidazole 7.5 mg / g cream twice daily . C july 2014 (8 weeks after baseline): following a further 4 weeks of azithromycin 500 mg three times weekly, in combination with once - daily prednisolone 5 mg treatment; the patient continued to apply metronidazole 7.5 mg / g cream twice daily . Isotretinoin d october 2014 (25 weeks after baseline): following 4 months of treatment with isotretinoin 10 mg once daily . E december 2014 (32 weeks after baseline): following a further 2 months of treatment with isotretinoin 10 mg once daily in combination with brimonidine 3 mg / g gel applied to the left side of the face 3 h before presentation to our outpatient department . F march 2015 (43 weeks after baseline): following an additional 3 months . Treatment with isotretinoin 10 mg once daily was stopped after 9 months; treatment with metronidazole 7.5 mg / g cream twice daily was continued . The patient had applied brimonidine 3 mg / g gel to the left side of her face on the morning of the visit to the clinic at presentation, the patient reported feelings of hopelessness, indicating a profound impact of the disease on her quality of life . Following diagnosis of ppr with severe background erythema, different treatment options were evaluated . In such a severe case, a specific strategy tailored to the patient was essential, particularly given the lack of success with prior regimens, which seemed to indicate that a more potent treatment regimen was needed in this patient to combat the inflammation upfront . Isotretinoin was initially considered; however, because the patient was not taking hormonal contraception at the time of her visit to our department, this therapy was contraindicated . The patient was offered a gynecology appointment to start hormonal contraception, so that isotretinoin could be an option in the future . The patient was initially prescribed an 8-week regimen of azithromycin 500 mg three times weekly (taken in the morning) in combination with prednisolone 30 mg once daily (reduced to 10 mg once daily after 1 week). The choice of this regimen was based on results from the literature showing that a rapid response can be obtained with a multimodal, tailored approach with a short course of macrolide antibacterials . Furthermore, the use of corticosteroids over the short term is not strictly contraindicated in the treatment of rosacea and can be considered as an option to reduce inflammation in patients who present with signs of rosacea fulminans . Metronidazole 7.5 mg / g cream twice daily was continued with this combination therapy . After 4 weeks of treatment, a reduction in the inflammatory lesion count was observed (fig . A slight decrease in the severity of facial redness was also seen, especially on the forehead, most likely resulting from a reduction in lesional and perilesional erythema . The patient continued to take azithromycin 500 mg three times weekly and the prednisolone dose was reduced to 5 mg once daily . In addition, the patient continued to apply metronidazole 7.5 mg / g cream twice daily . During examination of the patient s face 1 month later, only a small number of inflammatory lesions were present (fig . The severity of erythema remained similar to that observed during the previous visit, indicating a reduction in the severity of the inflammation . Therapy with azithromycin 500 mg three times weekly and prednisolone 5 mg once daily was stopped; treatment with isotretinoin 10 mg once daily (taken with the main meal) was initiated, and application of metronidazole 7.5 mg / g cream twice daily was continued . When the patient returned to our department 4 months later, no inflammatory lesions were present; however, the erythema had worsened on the forehead and cheeks (fig . The patient continued to apply metronidazole 7.5 mg / g cream twice daily, as well as isotretinoin 10 mg once daily for further improvement and as maintenance therapy to prevent relapse of inflammatory lesions . Treatment with brimonidine 3 mg / g gel, used as needed and applied in the morning, was initially started to the left side of her face in order to assess the impact of this agent on the background erythema (split - face assessment). Brimonidine, a highly selective 2-adrenergic receptor agonist, is approved for the symptomatic treatment of facial erythema in adults with rosacea, in a formulation of brimonidine 3 mg / g gel (mirvaso; galderma international, la dfense, france). This agent has previously been shown to be an effective option in the treatment of moderate to severe erythema, with a good safety profile . In december 2014, 2 months after commencing treatment with brimonidine 3 mg / g gel on the left side of her face and while continuing treatment with isotretinoin 10 mg once daily to maintain remission of inflammatory lesions, the patient returned to our department, showing mild erythema on the right side of the face, with background erythema cleared on the left side of the face (fig . 1e). Of note, during the treatment period with brimonidine 3 mg / g gel, the patient did not experience any dermatological adverse events that required her to stop treatment temporarily . At the most recent visit to our department in march 2015, the patient showed an increase in erythema severity on the right side of her face (not treated with brimonidine 3 mg / g gel) compared with the previous visit, reflecting the dynamic and changing nature of this symptom . The left side of the face, treated with brimonidine 3 mg / g gel on the morning of the visit to the clinic, remained clear of erythema (fig . Isotretinoin treatment was stopped and the patient was advised to continue maintenance therapy with metronidazole 7.5 mg / g cream twice daily and brimonidine 3 mg / g gel . Here, we have reported the case of a patient with severe, inflamed ppr with a high inflammatory lesion count and severe erythema . Although corticosteroids are not generally recommended for the treatment of rosacea, because the level of inflammation in this patient was high, and similar to levels seen in patients with rosacea fulminans, it was decided that the initial course of treatment should consist of azithromycin 500 mg three times weekly in combination with prednisolone (initially 30 mg once daily and then gradually reduced and stopped). Following this short course of treatment, the next step was to continue decreasing the inflammation with isotretinoin 10 mg once daily monotherapy, and finally isotretinoin 10 mg once daily with brimonidine 3 mg / g gel on one side of the face to address the background erythema component of the disease . In cases of recalcitrant ppr, oral isotretinoin can be used over a 3- to 4-month treatment period to achieve a complete clearance of inflammatory lesions . In selected cases, a longer duration of therapy may be required in order to achieve an adequate level of improvement . In this case, following 4 months treatment with isotretinoin, all inflammatory lesions had disappeared . Treatment was continued for another 5 months to ensure maintained remission of inflammatory lesions . As the skin permeability barrier is often impaired in rosacea, causing additional skin sensitivity and irritation, metronidazole 7.5 mg / g cream twice daily was applied throughout the courses of treatment, based on its proven effects in reducing skin irritation, transepidermal water loss, and erythema . Based on the positive outcome seen overall, the patient is currently on maintenance therapy with metronidazole 7.5 mg / g cream twice daily and brimonidine 3 mg / g gel, with no relapse of disease . In patients with very severe, inflamed rosacea, a multimodal, tailored approach with a short course of macrolide antibiotics in combination with corticosteroids is needed to strongly address the inflammatory component upfront and improve patient outcomes; corticosteroids are not strictly contraindicated in the treatment of rosacea if used for a short period to reduce inflammation showing signs of rosacea fulminans . In these patients, long - term therapy is needed to improve outcomes, with isotretinoin being effective in further reducing inflammatory lesions count and in maintaining remission . The patient experienced a continuous reduction in the severity of her erythema, which was further improved with the use of brimonidine 3 mg / g . The lack of reported dermatological adverse events with this topical treatment could in part be due to the continued application of metronidazole; we believe metronidazole contributed to repairing and protecting the skin barrier, helping to restore skin barrier function and consequently lessening inflammation . For complex cases such as this one, it has been acknowledged that careful selection and use of a combination of clinical treatments is essential to treat the individual . We believe that the publication of additional multifaceted cases such as the one presented here will help to facilitate the development of such guidelines.
The typical adult individual seen by a primary care physician most likely believes that cancer screening is a good idea, but without comprehending the trade - off of harms to benefit or the uncertainties surrounding their magnitude . The simplistic but effective mantra that early detection saves lives is one cause of the general enthusiasm for cancer screening . In the united states (u.s . ), a double standard exists: women are encouraged to participate in screening mammography, while men are advised to make informed decisions regarding prostate screening, although the fundamental issues to consider are very similar . While professional society screening guidelines generally promote breast screening, they may be influenced by intellectual and financial conflicts of interest and generally have a poor evidence base compared with, for example, those from the u.s . For informed choice to occur, the estimates of harms and benefit from screening mammography, along with their uncertainty, must be effectively communicated to women . One challenge is that important screening harms are often not mentioned or misrepresented in promotional campaigns for screening and in the medical literature . Primary care physicians are a trusted source of information about cancer screening, but many are not trained in interpreting and presenting cancer screening statistics, which are often complex or even counterintuitive . The goal of this review is to inform primary care physicians about four central screening principles applicable to mammography, so that they can help women make an informed decision on whether or not to participate . Breast cancer screening is a type of secondary prevention that is justified if the screening technology can identify and advance the diagnosis of otherwise lethal tumors and earlier treatment for this asymptomatic disease is more effective than usual treatment . In addition, this benefit must outweigh any harms from the screening intervention . In order for screening to be beneficial and reduce mortality and mastectomy rates, screening must reduce the incidence rate of advanced disease . In measuring advanced disease, stage is a less robust measure than size, as detection methods and stage definitions change over time . Have shown that there has been no decrease in the incidence rate of tumors over 2 cm in six western countries with population screening through many years, including the united states . Found identical decreases in advanced stage incidence in screened and unscreened areas of norway where breast screening was introduced in a staggered fashion, creating a control group . In the u.s . There has been a slight reduction in the incidence rate of regional metastatic cancers, but none in the rate of distal (stage 4) metastatic disease, even though screening mammography has existed for 30 years (fig . 1). The findings from norway suggest caution rather than uncritically attributing the reduction in regional metastatic cancer in the u.s . To screening, as such a reduction can happen unrelated to this . Surveillance, epidemiology, and end results data for invasive breast cancers without metastases, with regional metastases, and those with distant metastases involving other organs at diagnosis, as well as ductal carcinoma in situ lesions (dcis) are included, for women aged 4084 years at diagnosis, apart from dcis (50 + years). There was no decline in the occurrence of cancers with distant metastases over the observation period, a slight decline for cancers with regional metastases, and vast increases for both localized and in situ cancers . Since screening likely has little or no impact on the incidence rate of advanced disease, the most plausible explanation for the large and persistent increase in both in situ lesions and localized breast cancers wherever screening has been implemented is overdiagnosis . Overdiagnosed tumors are those screen - detected cases that would never present clinically or cause any problems in a woman's lifetime . Overdiagnosis means that many healthy women will receive unnecessary surgery, chemotherapy, endocrine therapy, and radiation, and this overtreatment can only cause harm . Tumors, but this claim ignores extra treatment caused by overdiagnosis and is based on what seems intuitively correct rather than on evidence . Even if some individual women with earlier detected disease receive less invasive therapy, overall the number of women with surgeries increases . The randomized trials showed that screening participation increases lumpectomy and mastectomy rates by 30% and 20%, respectively . In situ lesions were rare before screening, and now most cases are detected as microcalcifications with mammography (fig . 1). In both the u.s . And the united kingdom, the proportion of in situ cases treated by mastectomy are 29%, and these new cases likely account for much of the increase in mastectomy rates due to screening . In the u.s ., about 20% of all diagnosed breast cancers and one - third of screen - detected cancers are in situ cases . Newer screening technology such as digital mammography, computer - aided detection, and magnetic resonance imaging likely increase overdiagnosis . Earlier detection does not necessarily improve prognosis either, because adjuvant therapy and chemotherapy are effective in all prognostic groups, even for metastatic disease . In fact, improved treatment has caused the majority of the impressive declines in breast cancer mortality over the past 20 years . Countries that introduced screening late have experienced declines in breast cancer mortality that are equal to, and sometimes larger than, countries that introduced breast screening early . This conclusion is supported by the fact that reductions in breast cancer mortality across europe have been about 50% in women who are below the screening age (<50 years), which is considerably more than in age groups most often invited (about 30% in women aged 5069 years). With better medical treatment, the absolute benefit of screening declines as there are fewer breast cancer deaths to prevent, a development that will continue with further advances in treatment . The u.s . Breast cancer death risk without screening for women age 50 is now 9/1000 over 15 years, a decrease from 11/1000 in 19781980 due to better treatment . Breast cancer awareness means women are more likely to notice a smaller symptomatic tumor than in the past, adding to this development . Screening statistics must be interpreted with caution, since they are subject to several biases . Many have difficulty distinguishing between the most reliable effect estimate for a screening intervention, reduced all - cause mortality rates in randomized trials, from two misleading but often cited screening statistics: increased survival - time and stage distribution percentages . Instead of all - cause mortality, disease - specific mortality in the breast cancer screening trials was chosen because many fewer trial participants were required, but it is biased (e.g., due to uncertain attribution of cause of death and may be misleading because of increased mortality from other causes due to overdiagnosis). Overdiagnosis leads to overtreatment with radiotherapy and chemotherapy and thus increased mortality from heart disease and other malignancies that may entirely outweigh the benefit in terms of reduced breast cancer mortality . Only all - cause mortality avoids these biases and measures both the major benefit and harm, but the benefit of breast screening on all - cause mortality is so small that hundreds of thousands of participants are required to test if the effect is there . The randomized trials, including> 600,000 women, did not show an effect on total mortality, which tells us that the absolute benefit of the intervention must be quite small, if it is there . The relative risk reduction (rrr) for disease - specific mortality in the screening mammography trials was 10%20%, but this number can be misleading and is not informative on its own . For informed choice, a woman needs to know the absolute benefit or absolute risk reduction (arr), which is the rrr times the base rate for the breast cancer death risk without screening . For u.s . Women at age 50 years, this base rate is about 5/1000 over 10 years . The base rate over 10 years for women in the swedish trials, which excluded women with a preexisting breast cancer diagnosis, was 3.4/1000 . The cochrane review of all the screening trials calculated an arr of 0.5 percentage points, which means that 2000 women need an invitation to screening to avoid one breast cancer death over a 10 year period . A different perspective is obtained by presenting the mortality benefit in relation to the higher base rate of all - cause death risk . Routine screening starting at age 50 with an arr of (0.15 * 5/1000) or 0.8/1000 is equivalent to a rrr of (0.8/37) or 2.2% using all - cause mortality (fig . Routine screening increases a nonsmoking woman's overall survival chance from 96.3% (1003.7) to 97.1% over 10 years . Women's inaccurate and exaggerated perceptions of the benefit of screening are a challenge in promoting informed choice . In a 2003 survey, more than half of u.s . Women thought that screening mammography can prevent or reduce the risk of contracting breast cancer . Most believed that the rrr was over 50%, and the arr was greater than 80/1000 . This is 100 times the actual benefit of 0.8/1000, and twice the all - cause death risk . Women by smoking status (age 40 and 50 years) compared with the breast cancer death risk and lives extended through screening . Starting at age 50, 713 women die from something else for every breast cancer death . The absolute risk reduction (arr) or benefit from routine screening mammography is the assumed relative risk reduction (rrr) times the breast cancer death risk without screening . The arr in absolute numbers is the same as lives extended through inviting 1000 women to routine screening . Instead of using the arr, some patient organizations like the susan g. komen foundation argue that screening improves survival time . Lead - time bias means that earlier diagnosis through screening will increase the measured survival - time from diagnosis as one will live longer knowing about the cancer, regardless of whether screening makes people live to an older age . Because there is more time available to detect slow - growing rather than fast - growing tumors, routine screening will preferentially detect slow - growing and more indolent tumors, and is less likely to catch fast - growing, more lethal tumors . These biases mean that women with screen - detected tumors will inevitably have a longer survival time and a more favorable prognosis than clinically detected ones, even if screening has no real benefit . Overdiagnosed tumors therefore all have a very favorable prognosis and survival time but contribute to making survival time noninformative . The second misleading statistic is changes in cancer stages observed after screening due to lead - time and length biases . There is an increase in percentage of localized cancers as a fraction of total cancers (accounting for size, affected lymph nodes, and metastases) with screen - detected versus symptomatic cancers (fig . The correct measure is the rate (say, per 100,000) of advanced tumors in a population . As esserman et al . Have shown, the best - case screening scenario has a declining advanced cancer rate with a stable total cancer rate, because every case of early detection of an invasive cancer or in situ lesion causes one less case of advanced cancer (true stage - shift). The worst - case screening scenario has a stable advanced cancer rate with a growing total cancer rate, because all early detection is overdiagnosis (no stage shift). In summary, an increase in the percentage of localized cancers always occurs, regardless if screening is effective, just like improved survival time . The increased percentage of localized breast cancers (stages 0 and 1, <2 cm) after screen - detection does not prove screening is beneficial . This result is due to lead - time bias and length bias (overdiagnosis). Likewise, the increased percentage of smaller invasive tumors after screen - detection does not prove a morbidity or mortality benefit . Finally, case - control and cohort studies that measure exposure or screening participation regularly estimate double or triple the benefit, with rrrs of 30%40%, or more . However, we know from recalculations of results from the randomized trials that the case - control design can yield effect estimates of more than a 50% reduction in breast cancer mortality when in fact there is none . The apparent, but spurious, effect is caused by selection or volunteer bias; those who choose to go for screening are generally healthier and less likely to die from breast cancer, as well as from many other causes . Some researchers claim to avoid this bias when they use statistics that count only women who attend screening, but reliably adjusting for selection bias, the size of which varies and is unknown in a given setting, is likely not possible . A systematic review of seventeen relevant population studies concluded that the benefit of screening mammography today is probably smaller than in the randomized trials . 3). A 10-mm diameter tumor has 1 billion cells after 29 doublings, and assuming a median volume doubling time of 260 days, is about 20.7 years old . In the united states, the median symptomatic invasive tumor is about 21 mm (20 mm = 32 doublings, 22.8 years), and the median screen - detected invasive tumor is 14 mm (13 mm = 30 doublings or 1 cm, 21.4 years). The difference in average size would therefore seem to be about 7 mm or 1.4 years, but in reality it is smaller because the many small, overdiagnosed tumors exaggerate the difference . In the randomized trials, the mean diameter of tumors in the screened groups was 16 mm (16 mm = 31 doublings), and in the control groups it was 21 mm . The 5 mm size difference, including the overdiagnosed tumors, represents just over one volume doubling, or 340 days, which is 4% of a tumor's lifetime . Again disregarding overdiagnosis, the time difference between u.s . Screen - detected (21.4 years old) and clinically detected (22.8 years old) tumors (or two doublings) would be at most 520 days . Screening mammography therefore likely advances the time of diagnosis (lead - time) by far less than the 27 years that is usually assumed in studies of overdiagnosis that attempt to compensate for this lead - time effect . Women with breast cancer do not die from the primary tumor, but from metastatic disease . Only tumors that metastasize during the part of the tumor's lifetime when it can be detected by mammography but is not yet symptomatic may have their prognosis improved . We know that some very small tumors send out micrometastases below the mammogram threshold, while some large symptomatic tumors have late occurring or no metastases . The window narrows even more because in order to be successful, the screen - detection must occur before the tumor metastasizes . For every 5 mm of tumor growth, node - positivity increases by about 5% . Based on the mean 16-mm screened group tumor size from the trials, 35% of tumors would have already metastasized before being detectable . Given the mean size in the control group of 21 mm, which is also the median size of u.s . Symptomatic tumors today, 40% of tumors would have metastasized . Therefore, 5% would metastasize during the screening window, yielding a plausible rrr of breast cancer mortality of 12% due to screening . In summary, a 1- to 2-year window is too narrow for screening mammography to have a large effect . Each concentric circle depicts one volume doubling of an invasive breast tumor (time scale). The difference in median tumor size between screen - detected and clinically detected tumors (57 mm) is one to two of 32 tumor - doubling times . We provide a decision model with a summary of possible outcomes for women considering screening (fig . 5). About 55% of breast cancers diagnosed in the u.s . Are screen - detected, with symptomatic tumors diagnosed in women who did not screen, or as interval cancers between screening rounds . A u.s . Woman with a screen - detected in situ lesion or invasive cancer will have a true positive mammogram . Using optimistic and pessimistic screening scenarios as limits, she may be helped, hurt, or her prognosis unchanged (table 1). For the baseline scenario single screening round for women ages 5059 years, for every 100 women with screen - detected cancer, over 15 years, 8 will have their lives extended . This estimate of lives saved is optimistic, and is probably fewer than 5 lives saved . Since 21 women die despite screen - detection, of the remaining 79 survivors, 10% (8/79) are cured by earlier treatment, but over half of the survivors (42/79) are overdiagnosed and harmed . These findings are contrary to the popular belief that screen - detection is synonymous with cure, reflecting the lack of balanced messaging regarding screening mammography . Simplified screening mammography decision model with benefit and harms . The top branch, or no screening decision, shows that some early cancers do not progress to cause symptoms . With screening (bottom branch), many of these lesions are detected earlier, resulting in the harm of overdiagnosis . Although some otherwise lethal cases can be cured from earlier treatment, most cases that are not overdiagnosis remain curable or remain lethal despite screen - detection . Since mammography is imperfect, some cancers are not detected (false negatives), and some healthy women are recalled for additional testing and biopsy (false positives). Women with screen - detected cancer equivalent to true positive mammograms in figure 5 . Includes invasive cancer and in situ lesions . The baseline scenario is 15% relative risk reduction from screening and 30% overdiagnosis (1.30/1.0 or 23% (0.3/1.30) of diagnosed cancers). The ranges correspond to optimistic (20%/10%) and pessimistic (10%/50%) screening scenarios . The ranges correspond to optimistic (35%/10%) and pessimistic (25%/50%) screening scenarios . Besides overdiagnosis of screen - detected cancers, false - positive radiologist interpretations are another important screening harm in healthy women (fig . The associated diagnostic imaging recalls can lead to negative (benign) core - needle and open surgical biopsies in up to 19% of women after 10 mammograms . These recalls are much more common than overdiagnosis and happen at least once to 40%60% of u.s . We estimated single round screening events associated with 100 screen - detected cases by age (table 2). Recent insurance data reveal that recall and biopsy rates are much higher compared with data utilized in 2009 by the u.s . Preventive services task force besides direct patient costs, there are other indirect and intangible harms from false - positive recalls that require further investigation . Estimated single - round screening events and performance measures for 100 women with screen - detected cancer performance measures are breast cancer surveillance consortium 20002005 data from nelson et al ., 2009 unless specified . Insurance claims data based on 20102013 from alcusky et al ., 2014, second row ages 5064, third row ages 6575 years . Women showed that less than 10% have been informed by their physicians of the possibility of overdiagnosis and overtreatment after cancer screening . Breast cancer patients may have been overtreated because of screening mammography over the last 30 years, or 31% of diagnosed cancers in the screened age group (70,000 women annually). Extensive overdiagnosis of invasive breast cancer and in situ lesions has been confirmed by the 25-year follow - up of the randomized canadian screening trial . As the physical, psychological and economic consequences of unnecessary cancer diagnoses and treatment are substantial, primary care physicians have an ethical duty to discuss overdiagnosis before ordering or recommending a screening mammogram . Once a cancer is detected, it is currently not possible to distinguish life - threatening from indolent cases . The nordic cochrane centre has produced an evidence - based leaflet on screening mammography, available in 17 different languages, to facilitate discussion with patients . We provide a decision model with a summary of possible outcomes for women considering screening (fig . 5). About 55% of breast cancers diagnosed in the u.s . Are screen - detected, with symptomatic tumors diagnosed in women who did not screen, or as interval cancers between screening rounds . A u.s . Woman with a screen - detected in situ lesion or invasive cancer will have a true positive mammogram . Using optimistic and pessimistic screening scenarios as limits, she may be helped, hurt, or her prognosis unchanged (table 1). For the baseline scenario single screening round for women ages 5059 years, for every 100 women with screen - detected cancer, over 15 years, 8 will have their lives extended . This estimate of lives saved is optimistic, and is probably fewer than 5 lives saved . Since 21 women die despite screen - detection, of the remaining 79 survivors, 10% (8/79) are cured by earlier treatment, but over half of the survivors (42/79) are overdiagnosed and harmed . These findings are contrary to the popular belief that screen - detection is synonymous with cure, reflecting the lack of balanced messaging regarding screening mammography . Simplified screening mammography decision model with benefit and harms . The top branch, or no screening decision, shows that some early cancers do not progress to cause symptoms . With screening (bottom branch), many of these lesions are detected earlier, resulting in the harm of overdiagnosis . Although some otherwise lethal cases can be cured from earlier treatment, most cases that are not overdiagnosis remain curable or remain lethal despite screen - detection . Since mammography is imperfect, some cancers are not detected (false negatives), and some healthy women are recalled for additional testing and biopsy (false positives). Women with screen - detected cancer equivalent to true positive mammograms in figure 5 . Includes invasive cancer and in situ lesions . The baseline scenario is 15% relative risk reduction from screening and 30% overdiagnosis (1.30/1.0 or 23% (0.3/1.30) of diagnosed cancers). The ranges correspond to optimistic (20%/10%) and pessimistic (10%/50%) screening scenarios . The ranges correspond to optimistic (35%/10%) and pessimistic (25%/50%) screening scenarios . Besides overdiagnosis of screen - detected cancers, false - positive radiologist interpretations are another important screening harm in healthy women (fig . The associated diagnostic imaging recalls can lead to negative (benign) core - needle and open surgical biopsies in up to 19% of women after 10 mammograms . These recalls are much more common than overdiagnosis and happen at least once to 40%60% of u.s . We estimated single round screening events associated with 100 screen - detected cases by age (table 2). Recent insurance data reveal that recall and biopsy rates are much higher compared with data utilized in 2009 by the u.s . Preventive services task force besides direct patient costs, there are other indirect and intangible harms from false - positive recalls that require further investigation . Estimated single - round screening events and performance measures for 100 women with screen - detected cancer performance measures are breast cancer surveillance consortium 20002005 data from nelson et al ., 2009 unless specified . Insurance claims data based on 20102013 from alcusky et al ., 2014, second row ages 5064, third row ages 6575 years . Women showed that less than 10% have been informed by their physicians of the possibility of overdiagnosis and overtreatment after cancer screening . Breast cancer patients may have been overtreated because of screening mammography over the last 30 years, or 31% of diagnosed cancers in the screened age group (70,000 women annually). Extensive overdiagnosis of invasive breast cancer and in situ lesions has been confirmed by the 25-year follow - up of the randomized canadian screening trial . As the physical, psychological and economic consequences of unnecessary cancer diagnoses and treatment are substantial, primary care physicians have an ethical duty to discuss overdiagnosis before ordering or recommending a screening mammogram . Once a cancer is detected, it is currently not possible to distinguish life - threatening from indolent cases . The nordic cochrane centre has produced an evidence - based leaflet on screening mammography, available in 17 different languages, to facilitate discussion with patients . The principle of informed choice and the harm of overdiagnosis are well recognized in prostate cancer screening, and both are applicable to screening mammography . Screening mammography is a complex topic, and many seemingly plausible screening statistics are misleading . Overdiagnosis distorts screening statistics and can change the delicate balance between benefit and harms from positive to negative . Primary care physicians can use the principles explained here to help women make their own informed decisions.
H bonds in complex molecules represents a most useful but also one of the most challenging transformations in organic chemistry . Over the past two decades, notable advances in the area of chemical c h oxidation involving the use of oxidizing reagents, biomimetic supramolecular complexes, or transition metal catalysts have disclosed opportunities to afford the oxidation of electronically activated c h sites could be targeted for oxidation by taking advantage of proximal directing groups pre - existing or preinstalled in the target compound . Despite this progress, the vast majority of c h bonds in molecules of high complexity, in particular isolated, (stereo)electronically unbiased c the use of cytochrome p450 enzymes constitutes an attractive alternative strategy toward the oxyfunctionalization of unactivated c these biological catalysts can provide a valuable complement to chemical oxidation strategies as their site - selectivity could be, in principle, steered toward a remote c h site in a given compound by influencing their molecular recognition properties via protein engineering . In practice, however, fine - tuning the regio- and stereoselectivity of p450s toward a predefined position in a non - native substrate of interest has represented a fundamental problem . Various factors contribute to complicate these efforts including, among others, the difficulties inherent to controlling the site - selectivity of the p450-catalyzed oxidation reaction via rational design, the notoriously rare occurrence of variants with the desired selectivity properties within engineered p450 libraries, and the requirement for laborious and time - consuming analyses (i.e., via hplc or gc) for regio / stereoselectivity determination . As a result, this goal has been historically met with only limited or partial success also when ingenious ad hoc high - throughput assays reporting on the p450 regio- or stereoselectivity on a given substrate had been applied . Alternatively, considerable screening efforts need to be invested for any single substrate, as exemplified by a recent study focused on improving the regioselectivity of a testosterone - hydroxylating p450 (50% 94%), an effort that required the analysis of several thousand engineered variants (> 9,000) by hplc . Clearly, more general (i.e., substrate - independent) and streamlined strategies to gain access to p450 catalysts with refined regio- and stereoselectivity are needed in order to make p450 catalysis accessible for chemical synthesis . Artemisinin (1, art; figure 1a), a naturally occurring sesquiterpene lactone of prominent value in the pharmacological treatment of human malaria, exemplifies the scope and limitations of currently available tools for late - stage functionalization of a complex molecule . Over the past two decades, extensive synthetic efforts directed at elaborating this molecule in search for improved antimalarial agents have been largely confined to the lactone ring, and primarily c10 and c9, which can be readily accessed through chemical methods . Whereas substitutions at c10 have yielded derivatives of clinical relevance such as artesunate, artemether, and artemisone (figure 1a), methods to functionalize sp c h sites in the upper hemisphere of the molecule, and in particular positions c7 and c6a, would be highly desirable, as these positions constitute major target sites during phase i metabolism of this molecule in humans, a process that contributes to the rapid clearance and undesirably short in vivo half - life of artemisinin - based antimalarials . These sites have also remained inaccessible to chemical oxidation via iron - based catalysts, which have preference toward the more (stereo)electronically activated tertiary c h bond in c6 . On the other hand, attempts to hydroxylate artemisinin by means of oxidizing microbial strains have resulted in mixtures of multiple (over)oxidation products and/or a large extent of art deoxygenation to give deoxoartemisinin, which lacks the endoperoxide bridge essential for biological activity . (a) chemical structure of artemisinin (1, art) and artemisinin - based antimalarial drugs . Using artemisinin as a model substrate, we developed and report here an efficient, new strategy for developing highly regio- and stereoselective p450 catalysts for the oxyfunctionalization of a set of predefined, isolated c the described approach hinges upon three key elements, namely (1) the generation of p450 catalyst diversity via mutagenesis of first - sphere active site residues in a parent p450; (2) mapping of the active site configurations of the resulting p450 variants via high - throughput fingerprinting to rapidly identify the library members with potentially unique regio / stereoselectivity features; and (3) prioritization of these variants via a general method of fingerprint - based prediction of p450 reactivity toward the target substrate (i.e., artemisinin). We demonstrate how this rationally driven, systematic strategy enabled the rapid optimization of an unselective artemisinin - hydroxylating p450 variant (figure 1c) into a set of p450 oxidation catalysts with highly refined regio- and stereoselectivity for the hydroxylation of each of the three unactivated sp c h bonds in positions c7 and c6a of artemisinin . Importantly, the entire procedure required the empirical testing of only a handful of p450 variants via conventional hplc - based analyses and yielded a set of synthetically useful p450 catalysts for the selective, late - stage oxyfunctionalization of a relevant yet previously inaccessible region of artemisinin scaffold at both preparative scales and in high yields . The starting point of this work was fl#62, an engineered variant of the catalytically self - sufficient fatty acid monooxygenase p450bm3 from bacillus megaterium . In previous studies, fl#62 was found to exhibit a broad substrate profile that comprises large decaline- and steroid - based compounds . Accordingly, we envisioned this variant could also accept the bulky tricyclic terpene artemisinin (figure 1b) as a substrate for oxidation . Upon testing, fl#62 was indeed found to be capable of hydroxylating art with high activity, i.e., supporting about 340 total turnovers (ttn) in the presence of a nadph cofactor regeneration system . In comparison, wild - type p450bm3 showed no art - oxidation activity . The site - selectivity of fl#62 was poor, however, producing a mixture of 7(s)-hydroxy - art (2), 7(r)-hydroxy - art (3), and 6a - hydroxy - art (4) in a 83:10:7 ratio (figure 1c). This notwithstanding, the aliphatic c h bonds targeted by this enzyme resided in the relevant, upper hemisphere of the art scaffold, overlapping in two cases (3, 4) with those targeted by human liver p450s, making fl#62 a promising starting point toward evolving selective p450 catalysts for the oxidative activation of each of these sites . To this end, our first step involved altering the fl#62 active site via mutagenesis . In p450bm3, more than a dozen amino acids extend their side chains into the heme cavity and the long hydrophobic substrate channel connecting the latter to the protein surface . Among these, mutation of those that are most proximal to the heme (referred to here as first - sphere residues) was expected to have the largest impact on the orientation of the enzyme - bound artemisinin above the reactive iron center and, thus, on the regio- and stereoselectivity of fl#62 . Accordingly, a series of active site libraries were constructed via site - saturation mutagenesis (nnk) of first - sphere residues 74, 78, 81, 82, 87, 181, and 184, which lie within 12 from the heme iron and within 5 from the terminal carbons of n - palmitoylglycine in the substrate - bound structure of p450bm3 heme domain (figure 2). First - sphere residues along the i helix (e.g., a264, t268) were not taken into consideration because of their structural role or involvement in catalysis, while a328 was excluded because most substitutions at this site would likely disfavor access of the bulky terpene to the heme . Overall, the size of the resulting libraries included more than 10 members, many of which, in all likelihood, would be misfolded or functionally redundant as a result of deleterious or neutral mutations, respectively . Crystal structure of p450bm3 (heme domain) in complex with n - palmitoylglycine (pdb code 1jpz(24)). The bound substrate is displayed as sphere models (orange), and the heme is displayed as stick model (red). The dotted circle highlights the first - sphere active site residues targeted for mutagenesis in this study . To rapidly identify the most relevant fraction of these libraries, namely, the variants that not only are functional but also have the highest probability to exhibit altered regio- and stereoselectivity in art oxidation this method provides a means to quickly map the active site geometry of these enzymes via a set of structurally diverse and conformationally rigid chromogenic probes (compounds p1p5, figure s1 in the supporting information). Accordingly, a total of 12,500 recombinants from the mutagenesis libraries were fingerprinted in 96-well plates using probes p1p5 and a purpald - based colorimetric assay for quantification of probe activity (figure 3a). The acquired fingerprints were then compared against each other in order to identify the p450 variants with a unique profile, this feature indicating that the corresponding enzyme possesses a unique active site configuration . Using this approach, about 1,950 out of the 12,500 screened variants were determined to be catalytically competent (criterion:> 10% of parent enzyme activity on at least one of the fingerprint probes). Among these, 522 variants were established to be functionally unique (criterion: larger than 20% variation on at least one of the five fingerprint components compared to the parent enzyme and any other member of the library) and thus worthy of further consideration . Notably, this fraction represented only the 4.1% of the original library, highlighting the efficiency of this tier-2 procedure in drastically reducing the number of candidate enzymes to consider in the subsequent steps . Fingerprint - based strategy to guide the discovery of regio- and stereoselective artemisinin - hydroxylating p450 catalysts . (a) schematic summary of the process of identification of the functionally diverse p450 variants from the active site libraries via high - throughput fingerprinting followed by fingerprint comparative analysis (tier 2). (c) outline of the method applied to predict art reactivity via multivariate fingerprint analysis (tier 3)., we sought to develop a tool to further guide our search for art - hydroxylating variants within this collection of 522 functionally diverse p450 catalysts . Since art shares little or no structural similarity with any of the fingerprint probes, a p450 reactivity prediction approach alternative to the one previously implemented in the context of probe - related substrates was required . To this end, we envisioned that a more general strategy based on fingerprint multivariate analysis could prove useful in the context of a probe - unrelated target substrate like art . As outlined in figure 3b, this method relies on generating a fingerprint - based model predictive of art reactivity by correlating p450 fingerprints with experimental art oxidation activities across a small subset (training set) of the enzyme collection . Since the fingerprints relay information on the p450 active site shape and geometry, this process translates into finding a fingerprint signature that defines an active site configuration compatible with art binding and, thus, its oxidation . The model is then applied to rank the entire collection of fingerprinted p450s according to their predicted art hydroxylation activity . According to this design, a training set of 20 p450s was assembled using fl#62 and 19 randomly chosen variants from the 522-member p450 collection (training set a, table s2 in the supporting information). The art - hydroxylating activity for each of these enzymes was measured in ttn from small - scale reactions followed by derivatization of the art hydroxylation products with benzoyl chloride and hplc analysis . The derivatization procedure was implemented to enable sensitive and precise quantification of the reaction products as art contains no strong chromophores . Out of the 19 variants, four exhibited art hydroxylation activity, supporting up to about 110 total turnovers and showing varying regio- and stereoselectivity (table s2 in the supporting information). These experiments also indicated that only a small fraction (20%) of this p450 catalyst collection would be expected to be active on art . To generate the fingerprint - based model predictive of art reactivity, the experimental art activities were then correlated with the fingerprints of the corresponding p450s across the whole training set via multiple linear regression analysis (mlr) (figure 4a), which provides a statistical tool to analyze the correlation between a dependent variable y and multiple independent variables potentially correlated with y (equation: y = b0 + b1x1 + b2x2 +...+ bnxn). In the applied mathematical function, y corresponded to relative art activity and the five fingerprint components were the five independent variables x1...x5 . From the resulting best - fit regression coefficients, a fingerprint - based model was obtained, which was then applied to rank the remaining p450s in the collection according to their predicted art reactivity (high - scoring = predicted art active, low - scoring = predicted art inactive) (figure 4b). (a) plot of experimental versus calculated art activity from multiple linear regression analysis of art reactivity / fingerprint correlation across p450 training set a (table s1 in the supporting information). (b) ranking of the 522 p450 variants according to their predicted artemisinin activity calculated based on the fingerprint - based model (training set a). (c) total turnovers in art hydroxylation for the 50 top - scoring p450 variants (solid box in panel b) arranged from the most to the least active variant . Guided by these predictions, we focused our attention on the 50 best - scoring p450 variants from the ranking list (figure 4b, solid box), which were characterized for art hydroxylation activity . Gratifyingly, we found that 78% (39/50) of these variants showed art - hydroxylation activity at synthetically useful levels (> 100 ttn; average = 323 ttn, figure 4c). Furthermore, nearly half of the correctly identified variants (22/50) were found to possess higher art - hydroxylating activity than the parent enzyme, with one (ii - c3) supporting almost twice as many total turnovers (602 vs 339) (figure 4c). Notably, the hit rate achieved using this method (78%) greatly exceeded that expected from random sampling of the collection (20%). In order to further assess the quality of these predictions, we then tested the twenty lowest - scoring variants from the ranking list (figure 4b, dotted box), which were expected to have minimal or no activity on art . 90% of these p450s (18/20) show no detectable oxidation activity on the compound, with the two active variants supporting only up to 130 ttn . The fraction of false negatives (10%) within this group was thus lower than the expected occurrence of art - active p450s from random sampling (20%), further supporting the reliability of the predictions and functionality of the method to generate them . Since the p450 catalysts in the collection were preselected to possess unique active site geometries (figure 3a), the 42 art - reactive variants identified using the strategy described above were expected to exhibit markedly different regio- and stereoselectivity in art oxidation, ideally displaying the sought - after high selectivity toward c7-, with both s and r stereoselectivity, and c6a - hydroxylation . Inspection of the product distribution of these variants confirmed our expectations (table s3 in the supporting information). Importantly, as many as five variants (12% of the pool) were found to exhibit 95% selectivity for c7 hydroxylation with s - stereoselectivity . Among these, the triple mutant iv - h4 displayed the desired absolute regio- and stereoselectivity for this transformation, in addition to supporting higher ttn than the parent enzyme (table 1). On the other hand, three variants showed much improved (> 70%) selectivity for 7(r)-hydroxylation (table s3 in the supporting information), which is produced in only 10% relative ratio with the parent enzyme . Among these, variant ii - h10 displayed absolute regio- and r - stereoselectivity for hydroxylation of this site, thereby providing a second, exquisitely selective p450 catalyst for c7-oxyfunctionalization with complementary stereoselectivity compared to iv - h4 (figure 5). Finally, p450 catalysts with improved 6a - hydroxylation activity were also captured through the strategy, with the best variant (ii - e2) hydroxylating this position with considerably higher (48%), albeit still suboptimal, regioselectivity compared to fl#62 (7%) (table s3 in the supporting information). The comparatively lower occurrence of 6a - hydroxylating p450s within these first - generation variants could be explained on the basis of the low level of 6a - hydroxylation activity in the parent enzyme combined with the higher strength of this primary c h bond compared to the secondary ones in c7 . Importantly, the improvement in 6a - selectivity in ii - e2 was accompanied by an increase in catalytic activity (338 393 ttn, table 1), making this variant a promising intermediate toward further refining 6a - selectivity via another round of directed evolution . Mutations in fl#62 vs p450bm3 are v78a, f81s, a82 v, f87a, p142s, t175i, a180 t, a184v, a197v, f205c, s226r, h236q, e252 g, r255s, a290v, l353v . Rates are measured over initial 30 s. ratio between product formation rate and nadph oxidation rate in the presence of artemisinin . Overview of the divergent evolution process leading to the selective art - hydroxylating p450 variants . By sequencing, ii - e2 was determined to carry three active site mutations (a78n / s81f / v82a), which left additional first - sphere positions available for mutagenesis (figure 2). Accordingly, a triple site - saturation library (74/181/184) was constructed based on this enzyme, from which 3,000 recombinants were subjected to high - throughput fingerprinting followed by fingerprint comparative analysis according to the tier-2 procedure of figure 3a . This step revealed the occurrence of just 50 unique - fingerprint p450s out of a total of 120 catalytically active variants (1.6% of the library). After expanding the training set to include ii - e2 (= training set b), these 50 variants were scored based on their predicted art reactivity according to the tier-3 method of figure 3b as described above for the fl#62-derived variants (figures s2 and s3 in the supporting information). Upon evaluation of the 25 top - scoring variants, we found that about half (52%) were capable of hydroxylating art, supporting up to 474 ttn (average: 146 ttn) (table s4 in the supporting information). On the other hand, 90% (9/10) of the predicted inactive ones (bottom - ranking) furthermore, nearly two - thirds (8/13) of the correctly identified art - active variants exhibited significantly improved 6a - selectivity (> 80%) compared to ii - e2 (table s4 in the supporting information). Most importantly, this approach enabled the identification of two highly regioselective p450 catalysts for c6a hydroxylation, namely, x - e12 (94% selectivity) and x - f11 (92% selectivity), thereby completing our desired divergent evolution process (figure 5). For x - e12, the improvement in 6a - selectivity was accompanied by a reduction in catalytic activity (113 vs 393 ttn in ii - e2). In contrast, x - f11 was found to support nearly as many turnovers as ii - e2 and higher ttn than the initial enzyme fl#62 (table 1). To determine whether potentially interesting catalysts could have been missed in this process, these studies revealed the occurrence of only two additional art - oxidizing variants, none of which showed superior performance in terms of either regioselectivity or ttn compared to those already identified (table s4 in the supporting information). Based on these results, we concluded that the method allowed efficient capturing, within the top one - fifth (10/50) and half (25/50) of the ranked variants, of 37% (6/16) and 81% (13/16), respectively, of the art - active p450 catalysts in the pool, with the ten top - ranking p450s comprising those with the highest 6a - regioselectivity . Consistent with their divergent reactivity, the best variants for 7(s)-hydroxylation (iv - h4, v - h2), 7(r)-hydroxylation (ii - h10, iii - b1), and 6a - hydroxylation (x - e12, x - f11) show distinct fingerprints compared to each other, the parent fl#62, and the evolutionary intermediate ii - e2 (figure 6). These variants were further characterized to gain insights into the effect of the mutations on their catalytic and substrate binding properties . Interestingly, the selective 7(s)-hydroxylating variants were found to share a similar mutational pattern (table 1), both carrying three active site mutations with two identical substitutions at position 78 and 82 and a similar solution (val vs ile) at the neighboring site 81 (figure 2). In comparison, refinement of 7(r)- and c6a - selectivity required a more extensive remodeling of the enzyme active site as judged by the five to six mutations occurring in ii - h10, x - e12, and x - f11 (table 1). Overall, this trend well reflected the functional distance of these variants, in terms of site - selectivity, from the parent enzyme . Ii - h10 mutations were found to comprise a triad of phenylalanine substitutions within the heme pocket (s81f, a87f, l181f). Interestingly, iii - b1, the second best (r)7-hydroxylating variant found in this study, also carries a pair of phenylalanine mutations in proximity of the heme . These common features suggest a distinctive requirement for bulky substitutions at the level of the heme pocket to favor art hydroxylation at c7 with r stereoselectivity, when compared to iv - h4 and v - h2 . Another interesting observation emerged from comparing the mutations in the 6a - hydroxylating variants with those of ii - h10, which evidenced the importance of substitutions at positions 74 and 181 in steering the enzyme selectivity toward c6a . Probe activities correspond to mean values from triplicate experiments (se within 10%) after normalization to those of the reference enzyme p450bm3(f87a). Upon incubation with art, all the p450 variants were found to exhibit a 5 to 20% shift of the heme iron spin - state equilibrium (figure 7 and figure s4 in the supporting information), which is indicative of the ability of this substrate to displace the heme - bound water ligand upon complex formation . This property also enabled estimation of the binding affinity (kd) of these variants for art via titration experiments . For all the p450 variants (figure 7 and figure s5 in the supporting information), hyperbolic curves were observed, suggesting a noncooperative binding interaction . Interestingly, the 7(s)- and the 7(r)-selective variants showed kd values similar to that of fl#62 (3060 m; table 1), indicating that the acquired mutations had little impact on art binding affinity compared to the parent enzyme . 5- to 10-fold higher kd values were observed instead for variants x - e12 and x - f11 as well as for ii - e2, indicating that the mutations responsible for improving 6a - hydroxylation selectivity resulted in a somewhat weaker interaction with art . These equilibrium dissociation constants fall however in the range of that observed for wild - type p450bm3 and the fatty acid laurate (270 m). Artemisinin binding experiments with (a) variant iv - h4, (b) variant ii - h10, and (c) variant x - e12 . Left panel: overlay of the enzyme absorbance spectrum before (gray line) and after (red line) addition of artemisinin (1 mm), illustrating the substrate - induced shift of the heme spin state equilibrium . Right panel: representative plot of the artemisinin - induced heme spin shift versus artemisinin concentration . The dissociation constant (kd) for the enzyme artemisinin complex was calculated via nonlinear fitting of the experimental data (dots) to a noncooperative 1:1 binding model equation (solid line). Data relative to the other variants of table 1 are provided in the supporting information . Further experiments were carried out to analyze the impact of the mutations on the catalytic rates of the enzymes . These analyses revealed that all the selective 7(s)-, 7(r)-, and 6a - hydroxylating variants exhibited a 3- to 10-fold lower initial product formation rate compared to fl#62 and the less selective ii - e2 (table 1). This trade - off between oxidation rate and site - selectivity has been observed in other studies as well, and it can be rationalized here considering that the improved site - selectivity in the former enzymes must inherently involve a more specific enzyme substrate interaction and thus a restriction of the (productive) binding orientations available to art during oxidation . In the case of ii - h10 and v - h2, the observed reduction in product formation rate is likely to result also from a reduction in their coupling efficiency (= ratio of product formation rate / nadph oxidation rate) as compared to the parent enzyme . For all the other selective p450 variants (iv - h4, x - e12, x - f11), however, the improvement in regio / stereoselectivity came at no cost of the coupling efficiency, as evidenced by the values reported in table 1 . Notably, for both the 6a - hydroxylating variant x - f11 and the 7(s)-hydroxylating variant iv - h4 the coupling efficiency significantly improved compared to fl#62, exceeding values of 55% and 70%, respectively . The catalytic turnovers achieved in analytical - scale settings indicated that the evolved p450 variants could be valuable for synthetic purposes . Prior attempts toward enzymatic hydroxylation of art have involved the use of oxidizing strains . Besides requiring long reaction times (314 days), these transformations have however resulted in the unselective oxidation of the natural product and/or its degradation to the biologically inactive deoxoartemisinin via deoxygenation of the endoperoxide group . To assess the synthetic utility of the engineered p450 catalysts developed here, large - scale reactions involving up to 0.4 g of art were carried out for 12 h using iv - h4 (0.19 mol%), ii - h10 (0.25 mol%), and x - f11 (0.28 mol%) in buffer (50 mm kpi, ph 8.0) in the presence of a cost - effective nadph regeneration system consisting of a thermostable phosphite dehydrogenase and sodium phosphite as sacrificial reductant . From these reactions, 0.26 to 0.41 g of the three desired products (7(s)-, 7(r)-, and 6a - hydroxy - art, respectively) could be isolated in over 90% yields . Interestingly, both iv - h4 and ii - h10 were found to support higher total turnovers under these settings (485 and 350 ttn, respectively), likely due to more favorable oxygen transfer conditions . Importantly, access to preparative amounts of 3 and 4 could now allow for the direct modification of two metabolically labile sites in artemisinin and derivatives thereof via stereoconservative hydroxyl group functionalizations (e.g., alkylation or acylation). At the same time, the complementary stereoselectivity of iv - h4 for c7 hydroxylation can be leveraged upon to chemically protect, in a two - step sequence, the pro - r c h bond in c7 via deoxofluorination, a transformation that typically proceeds through inversion of configuration at secondary carbon centers . To illustrate this point, the enzymatically produced 7(s)-hydroxy - artemisinin 2 was reacted with dast to afford enantiopure 7(r)-fluoro - artemisinin 5 in 82% yield (scheme 1). 5 was then converted in two steps into 6 and 7, which correspond, respectively, to the clinical antimalarial drugs artemether and artesunate bearing a c h to c f substitution, with the ideal configuration, at the major site of metabolic attack of these drugs by human hepatic p450s . Altogether, these results demonstrated the viability of these p450 catalysts for oxyfunctionalization of art at preparative scales as well as their utility toward enabling relevant, late - stage elaborations of art scaffold via p450-mediated c h functionalization . In summary, we have demonstrated how a systematic approach based on first - sphere active site mutagenesis, high - throughput p450 fingerprinting, and fingerprint - based p450 reactivity predictions can provide an efficient solution to the problem of developing p450 catalysts with fine - tuned site - selectivity for the oxidative activation of multiple, isolated sp c h bonds in a complex molecule . By guiding and focusing our search for the desired catalysts across a large engineered p450 library, this method allowed us to accomplish our goal of refining the site - selectivity of a p450 enzyme in a time- and cost - effective manner . To our knowledge, the complete inversion in stereoselectivity achieved with ii - h10 (100% ee (r) from 78% ee (s) in fl#62), the absolute regioselectivity and stereocomplementarity obtained with the iv - h4/ii - h10 pair, and the regioselectivity shift achieved with x - e12 to afford the selective hydroxylation of a primary, nonallylic / nonbenzylic c h site (7% 94%) remain unprecedented in previous p450 engineering efforts . It is also worth noting that the overall process required the empirical testing of only 75 p450 variants via laborious hplc - based methods, thereby reducing by orders of magnitude the screening efforts currently associated with the search for selective p450 catalysts . From a methodological standpoint, another important aspect is that the tier-2 component of this approach is independent of the nature of the target substrate whereas the tier-3 method could be readily extended to any probe - unrelated compound of interest, making this strategy potentially very general in terms of substrate scope . From the characterization of the evolved artemisinin - hydroxylating variants, intriguing trends have emerged with respect to the active site positions and mutations responsible for steering the selectivity of these enzymes toward each one of the three, spatially close sp c h bonds in c7 and c6a of artemisinin (figure 1b). These findings call for future studies to explore in more detail the molecular mechanisms that permit such a subtle control on the c h oxidation reaction catalyzed by this group of related variants . Finally, the p450-based oxidation catalysts developed in this work disclose now the opportunity to selectively functionalize relevant aliphatic positions within the artemisinin scaffold that have so far remained inaccessible to chemical methods / catalysts . As demonstrated with the preparation of 7(r)-fluoroartemether and 7(r)-fluoroartesunate, the suitability of this set of engineered p450s for late - stage c h functionalization of artemisinin at practically useful scales is expected to render them of particularly high value toward the synthesis and investigation of new classes of c7- and c6a - modified artemisinin - based antimalarial agents . Multiple site - saturation (nnk) mutagenesis libraries were prepared using pcwori_fl#62 as template, primers bamhi_2_fwd (5-ggaaacaggatccatcgatgc-3) and saci_2_rev (5-aatatcgagctcgtagtttgtatgatc-3) as megaprimers, and the oligonucleotides of table s1 in the supporting information as mutagenizing primers . Construction of libraries 78/87, 78/81/87, 78/87/181, 78/87/184, 78/81/82/87, and 81/82/87/184 was described earlier . Additional libraries (78/81/82/87/181/184 and 74/81/82/87/181/184) were constructed in a similar manner by pcr overlap extension mutagenesis . The soe products (1.5 kbp) were digested with bamhi and saci restriction enzymes and ligated to bamhi / saci double - digested pcwori_fl#62 vector . The ligation mixtures were transformed in chemically competent dh5 cells and plated on lb agar plates containing ampicillin (100 mg l) followed by overnight incubation at 37 c . 96-deep - well plates containing 400 l of lb medium (100 mg of ampicillin l) per well were inoculated with single colonies from the p450 libraries and shaken overnight at 37 c and 200 rpm . A row (8 wells) in each plate was inoculated with dh cells expressing fl#62 (or ii - e2 in the case of ii - e2-based libraries) as a reference . After overnight growth, the lb plates were used to inoculate a second set of 96-deep - well plates containing 900 l of terrific broth (tb) medium (100 mg of ampicillin l). At od600 = 1.0, the tb cultures were induced with 0.25 mm -d-1-thiogalactopyranoside (iptg) and 0.3 mm -aminolevulinic acid (ala). After incubation at 30 c and 200 rpm for 18 h, the plates were centrifuged at 3500 rpm and the pellets were separated from the supernatant and frozen at 80 c . Cell lysates were prepared by adding 400 l of lysis solution (4 u of deoxyribonuclease i, 0.8 mg / ml lysozyme, 10 mm mgcl2, 50 mm phosphate buffer, ph 7.5) to each well . After incubation at 37 c for 70 min, clarified lysates for the screening were obtained by centrifuging the plates at 4,000 rpm . P450 demethylation activity on probe p1p5 (figure s2 in the supporting information) was measured in parallel reactions with the aid of a beckman coulter multimek 96 automated pipettor and a tecan infinity plate reader . Reactions were carried out by mixing 50 l of clarified cell lysate with 150 l of 50 mm phosphate buffer (ph 7.5) containing the probe (final concentration: 1 mm) and a phosphite dehydrogenase (ptdh)-based cofactor regeneration system (final concentrations: 1.8 m ptdh, 50 mm sodium phosphite, 150 m nadp). After incubation for 1 h at room temperature, to each well was added 50 l of 2 m naoh containing 150 mm purpald following by reading of the absorbance at 550 nm with the plate reader . The measured demethylation activity of each member of the library on the probes p1p5 was then normalized to the activity of the parent enzyme from the same plate . The p450 enzymes were expressed from pcwori - based vectors and purified by ion - exchange chromatography as described previously . P450 concentration was determined from co binding difference spectra (450500 = 91,000 m cm). The vector encoding for the thermostable phosphite dehydrogenase (ptdh) was kindly provided by the zhao group . Ptdh was expressed and purified via ni - affinity chromatography according to the published procedure . A 200 ml scale reaction was set up adding fl#62 (1 m) to a buffered solution (50 mm potassium phosphate, ph 8.0) containing 32 mg of artemisinin (0.53 mm), ptdh (2 m), nadp (150 m), and sodium phosphite (50 mm). The reaction mixture was stirred overnight at room temperature and then extracted with dichloromethane (3 30 ml). The collected organic layers were dried with na2so4, concentrated under reduced pressure, and purified by flash chromatography (dichloromethane / hexanes / ethyl acetate: 1/1/1) to afford 2 (18 mg), 3 (2 mg), 4 (1 mg), and recovered artemisinin (10 mg). H nmr (500 mhz, cdcl3): = 1.18 (3 h, d, j = 7.2 hz), 1.23 (1 h, m), 1.27 (3 h, d, j = 7.2 hz), 1.44 (1 h, m), 1.50 (3 h, s), 1.57 (2 h, m), 1.79 (oh, br), 1.95 (1 h, m), 2.022.20 (3 h, m), 2.48 (1 h, m), 3.32 (1 h, ddd, j = 10.6 hz, j = 10.6 hz, j = 4.5 hz), 3.42 (1 h, m), 5.98 (1 h, s). C nmr (100 mhz, cdcl3): = 12.6, 15.5, 24.8, 25.1, 32.1, 32.6, 35.8, 42.3, 44.5, 47.9, 73.5, 78.8, 93.5, 105.5, 171.6 . Ms (esi) calcd for c15h23o6 [m + h]m / z: 299.15, found 299.47 . The 7(s) configuration of 2 was confirmed based on the j coupling constant between the 7(h) proton and 6(h) and 8(h) protons and the known chair conformation of the cyclohexyl ring in artemisinin . The observed coupling constants (j = 10.6 hz; j = 10.6 hz; j = 4.5 hz) are consistent with 7(h) being in trans to 6(h) and thus with c7 atom having s configuration . H nmr (500 mhz, cdcl3): = 1.12 (3 h, d, j = 6.7 hz), 1.23 (3 h, d, j = 7.3 hz), 1.34 (1 h, dd, j = 13.7 hz, j = 2.1 hz), 1.461.51 (4 h, m), 1.56 (1 h, m), 1.81 (oh, br), 1.95 (2 h, m), 2.10 (2 h, m), 2.402.53 (2 h, m), 3.45 (1 h, m), 3 . 89 (1 h, ddd, j = 2.8 hz, j = 2.8 hz, j = 2.5 hz), 5.90 (1 h, s). C nmr (100 mhz, cdcl3): = 12.5, 15.8, 24.6, 25.2, 30.7, 32.4, 36.0, 37.6, 41.3, 43.4, 69.1, 79.3, 93.4, 105.5, 172.4 . Ms (esi) calcd for c15h23o6 [m + h]m / z: 299.15, found 299.41 . The 7(r) configuration of 3 was confirmed based on the j coupling constant between the 7(h) proton and 6(h) and 8(h) protons and the known chair conformation of the cyclohexyl ring in artemisinin . The observed coupling constants (j = 2.8 hz; j = 2.8 hz; j = 2.5 hz) are consistent with 7(h) being in cis to 6(h) and thus with c7 atom having r configuration . H nmr (500 mhz, cdcl3): = 1.15 (1 h, m), 1.26 (3 h, d, j = 6.6 hz), 1.361.49 (4 h, m), 1 . 1.541.61 (3 h, m), 1.65 (oh, br), 1.761.85 (2 h, m), 1.952.14 (3 h, m), 2.50 (1 h, ddd, j = 17.3 hz, j = 13.3 hz, j = 3.9 hz), 3.45 (1 h, m), 3 . 68 (1 h, dd, j = 10.6 hz, j = 5.6 hz), 3.79 (1 h, dd, j = 10.6 hz, j = 3.0 hz), 5.93 (1 h, s). C nmr (100 mhz, cdcl3): = 12.6, 23.0, 24.5, 25.2, 27.9, 32.9, 35.9, 44.2, 44.5, 44.8, 64.1, 79.5, 93.6, 105.4, 172.0 . Ms (esi) calcd for c15h23o6 [m + h]m / z: 299.15, found 299.39 . Analytical - scale reactions (1 ml) were carried using 0.51 m p450, 0.5 mm artemisinin, 2 m ptdh, 100 m nadp, and 50 mm sodium phosphite in potassium phosphate buffer (50 mm, ph 8.0). The p450 variants described in table 1 were characterized in purified form, while those described in tables s2s4 in the supporting information were characterized directly from cell lysates . The hydroxylation products were functionalized with benzoyl chloride followed by hplc analysis as described in more detail in the supporting information . Ttn values were calculated based on the total amount of hydroxylated products in the reactions as quantified based on the calibration curves generated using purified 24 . The enzyme regio- and stereoselectivity was determined based on the peak areas corresponding to the hydroxylation products 2, 3, and 4 . Mean and standard deviation values reported for p450 variants in table 1 were calculated from experiments performed at least in triplicate . Initial product formation rates were measured from 1 ml scale reactions containing 250 m artemisinin, 0.10.5 m purified p450, and 200 m nadph in potassium phosphate buffer (50 mm, ph 8.0) at room temperature . After 30 s, the samples were extracted with dichloromethane and subjected to benzoyl chloride derivatization followed by hplc analysis as described above . Cofactor oxidation rate in the presence of artemisinin was measured by monitoring nadph depletion at 340 nm (= 6.22 mm cm) using 0.1 m purified p450, 250 m artemisinin, and 200 m nadph . Coupling efficiency was calculated from the ratio between the initial product formation rate and the initial nadph oxidation rate . Reported mean and standard deviation values were calculated from experiments performed at least in triplicate . Binding experiments were performed using 3 m purified p450 in potassium phosphate buffer (50 mm, ph 8.0) by titrating increasing amounts of artemisinin (5 m to 1 mm) from an ethanol stock solution (50 mm). At each concentration, a difference spectrum from 350 to 500 nm was recorded and binding curves were generated by plotting the change in absorbance at 390 and 420 nm corresponding to the high - spin and low - spin state of the enzyme, respectively, against the artemisinin concentration . Kd values were calculated using sigma plot via nonlinear fitting of the experimental binding curves to an equation describing a standard 1:1 binding interaction . Reported mean and standard deviation values were calculated from experiments performed at least in triplicate . After high - throughput fingerprinting, p450 variants displaying a unique fingerprint were identified by selecting the parent - normalized fingerprints according to the following criteria: (a)> 10% of parent activity on at least one probe; and (b) larger than 20% variation in activity on at least one probe compared to the parent or any other member of the library . The p450 variants with a unique fingerprint were transferred from the library plates to new 96-well plates containing p450bm3(f87a) as reference enzyme . The p450 variants of this collection were then fingerprinted in triplicate using the probe activity of p450bm3(f87a) for fingerprint normalization . The standard error in the values of the fingerprints provided in figure 3b is within 10% . To generate the fingerprint - based model predictive of artemisinin reactivity, 19 randomly chosen p450 variants from the collection were characterized for artemisinin hydroxylation activity measuring their ttn values (table s2 in the supporting information). After normalization against the activity of the parent enzyme (ttn(p450 variant)/ttn(fl#62)), the normalized activities were then correlated with the corresponding fingerprints using multiple linear regression (mlr) analysis using the equation y = b0 + b1x1 + b2x2 + b4x4 + b4x4 + b5x5, where y corresponds to relative artemisinin reactivity, x1 to x5 correspond to the five fingerprint components (activity on probes 1 to 5, respectively), and b1 to b5 correspond to the regression coefficients for the five independent variables x1 to x5 . This process yielded the plot of calculated versus experimental artemisinin activity presented in figure 2a, with the calculated regression coefficients being b1 = 0.0109, b2 = 0.0016, b3 = 0.0551, b4 = 0.0338, and b5 = 0.01271 . The low rmsd value (0.0859) indicated an excellent fit between the calculated and experimental values . This model was then used to rank the p450 variants of the collection according to their predicted artemisinin reactivity . The same method was applied for generating a fingerprint - based predictive model for ranking the second - generation variants derived from ii - e2 . In this case, the training set used for calculations was expanded to include ii - e2 (training set b, table s2 in the supporting information) as this variant exhibited the highest selectivity toward 6a - hydroxylation . Mlr analysis of the correlation between fingerprints and artemisinin hydroxylation activities across this training data set yielded a best - fitting model with regression coefficients b1 = 0.0037, b2 = 0.0278, b3 = 0.0839, b4 = 0.1158, and b5 = 0.1202 and a rmsd of 0.1789 (figure s2 in the supporting information). Based on this model, the 50 ii - e2 derived variants were scored according to their predicted artemisinin reactivity (figure s3 in the supporting information) and subsequently prioritized according to their score . To prepare 2, purified p450 variant iv - h4 (final concentration: 1 m; 0.19 mol%) was dissolved in 1 l of 50 mm phosphate buffer (ph 8.0) in the presence of artemisinin (150 mg, final concentration: 0.53 mm), ptdh (2 m), nadp (150 m), and sodium phosphite (50 mm). The collected organic layers were dried with na2so4, concentrated, and purified by flash chromatography (dichloromethane / hexanes / ethyl acetate: 1/1/1.5) to afford 2 (138 mg, 92%). The same procedure was repeated two more times to yield a total of 410 mg of 2 . To prepare 3, purified p450 variant ii - h10 (final concentration 1 m; 0.25 mol%) was dissolved in 1 l of 50 mm phosphate buffer (ph 8.0) in the presence of artemisinin (110 mg, final concentration: 0.39 mm), ptdh (2 m), nadp (150 m), and sodium phosphite (50 mm). The collected organic layers were dried with na2so4, concentrated, and purified by flash chromatography (dichloromethane / hexanes / ethyl acetate: 1/1/1.5) to afford 2 (100 mg, 91%, ttn: 350). The same procedure was repeated two more times to yield a total of 305 mg of 2 . To prepare 4, purified p450 variant x - f11 (final concentration: 1 m; 0.28 mol%) was dissolved in 1 l of 50 mm phosphate buffer (ph 8.0) in the presence of artemisinin (100 mg, final concentration: 0.35 mm), ptdh (2 m), nadp (150 m), and sodium phosphite (50 mm). The collected organic layers were dried with na2so4, concentrated, and purified by flash chromatography (dichloromethane / hexanes / ethyl acetate: 1/1/2) to afford 4 (90 mg, 90%). The same procedure was repeated two more times to yield a total of 260 mg of 4 . To a solution of 3 (50 mg, 0.17 mmol) in anhydrous ch2cl2 (5 ml) was added (diethylamino)sulfur trifluoride (55 mg, 0.34 mmol) dropwise at 78 c . The reaction mixture was warmed up to 0 c and stirred until the starting material disappeared as determined by tlc . The reaction mixture was quenched with 60 l of triethylamine and extracted with ch2cl2 (2 5 ml). The collected organic layers were dried with na2so4 and concentrated, and the residue was purified by flash chromatography (hexanes / ethyl acetate: 3/1) to afford 5 (42 mg, 82%). H nmr (500 mhz, cdcl3): = 1.20 (3 h, d, j = 7.0 hz), 1.27 (3 h, d, j = 7.4 hz), 1.281.50 (6 h, m), 1.85 (1 h, m), 1.94 (1 h, m), 2.03 (1 h, m), 2.292.36 (2 h, m), 2.53 (1 h, m), 3.49 (1 h, m), 4.67 (1 h, m), 5.87 (1 h, s). C nmr (100 mhz, cdcl3): = 10.12, 12.4, 24.7, 25.2, 28.7 (d, j = 21.8 hz), 32.3, 35.9, 37.9, 40.7 (d, j = 20.6 hz), 43.9, 78.7, 90.6 (d, j = 166.0 hz), 93.0, 105.5, 171.9 . F nmr (376.5 mhz, cdcl3): = 133.9 . Ms (esi) calcd for c15h22fo5 [m + h]m / z: 301.15, found 301.42 . To a solution of 5 (20 mg, 0.07 mmol) in 2 ml of anhydrous methanol was added sodium borohydride (8 mg, 0.21 mmol) at 0 c . The reaction mixture was stirred at 0 c until the starting material disappeared as determined by tlc . The reaction mixture was quenched with 5 ml of ice - cold water, and methanol was removed by evaporation in vacuo . The aqueous layer was then extracted with ch2cl2 (3 5 ml), and the collected organic layers were dried with na2so4 and concentrated . The crude product was dissolved in 2 ml of anhydrous meoh followed by the addition of sulfuric acid (11 l, 0.21 mmol). The mixture was stirred overnight at room temperature and then quenched with 50 l of triethylamine . The mixture was concentrated under reduced pressure and purified by flash chromatography (hexanes / ethyl acetate: 3/1) to afford 6 (11 mg, 55%). H nmr (500 mhz, cdcl3): = 0.97 (3 h, d, j = 7.5 hz), 1.15 (3 h, d, j = 6.8 hz), 1.50 (5 h, m), 1.821.92 (2 h, m), 1.98 (1 h, m), 2.052.20 (3 h, m), 2.47 (1 h, m), 2.72 (1 h, m), 3.48 (3 h, s), 4.57 (1 h, d, j = 49.5 hz) 4.76 (1 h, d, j = 3.3 hz), 5.43 (1 h, s). C nmr (100 mhz, cdcl3): = 12.7, 16.1, 24.6, 26.1, 29.7 (d, j = 20.7 hz), 36.4, 37.3, 40.6 (d, j = 19.9 hz), 45.1, 56.1, 80.2, 86.9, 91.9 (d, j = 172.5 hz), 92.3, 103.6, 104.2 . Ms (esi) calcd for c16h25fnao5 [m + na]m / z: 339.16, found 339.25 . To a solution of 5 (20 mg, 0.07 mmol) in 2 ml of anhydrous methanol was added sodium borohydride (8 mg, 0.21 mmol) at 0 c . The reaction mixture was stirred until the starting material disappeared as determined by tlc, followed by quenching with 5 ml of ice - cold water . The mixture was evaporated in vacuo to remove methanol, and the remaining aqueous layer was extracted with ch2cl2 (3 5 ml). The crude product was dissolved in 2 ml of 1,4-dioxane followed by the addition of succinic anhydride (8 mg, 0.077 mmol) and triethylamine (50 l, 0.35 mmol). The mixture was then concentrated under reduced pressure and purified by flash chromatography (dichloromethane / methanol: 20/1) to afford 7 (24 mg, 90%). H nmr (500 mhz, cdcl3): = 0.90 (3 h, d, j = 7.1 hz), 1.051.11 (4 h, m),1.321.60 (6 h, m), 1.90 (2 h, m), 2.102.22 (3 h, m), 2.47 (1 h, m), 2.662.79 (4 h, m), 4.65 (1 h, d, j = 50.1 hz), 5.46 (1 h, s), 5.82 (1 h, d, j = 10.1 hz). C nmr (100 mhz, cdcl3): = 11.7, 15.9, 24.4, 25.9, 27.2 (d, j = 20.6 hz), 28.5, 28.7, 31.0, 36.1, 38.3, 40.1 (d, j = 19.2 hz), 44.3, 52.1, 79.2, 91.5 (d, j = 146.5 hz), 93.2, 104.6, 171.1, 172.6 . F nmr (376.5 mhz, cdcl3): = 135.2 . Ms (esi) calcd for c19h27fnao8 [m + na]m / z: 402.17, found 402.33.
The loss of teeth, very common in this population, is related to the reduction of bone tissue, receptors (proprioceptors and periodontal ligaments), and muscle atrophy . Consequently, orofacial functions are impaired in toothless individuals.1 in addition, prostheses are functionally less efficient when compared to individuals with natural dentition.1,2 the stability of the jaw occlusion of the posterior teeth or prostheses is important for the swallowing function.2 the dental condition and the use of poorly fitting prostheses may contribute to the difficulties arising from old age, and the oral diet and nutritional status of the elderly may be affected by changes related to aging3 and changes in skill and desire to feel, bite, chew4 and swallow food,3,5 significantly compromising and further aggravating the quality of life of these individuals.6 the literature has shown the influence of oral health condition on swallowing and nutrition, indirectly influencing the daily life activities of the elderly.7 furthermore, it is clear that maintenance of oral health is essential for the general health, quality of life, chewing ability8 and, mainly, the reduction of pneumonia risk in fragile elderly people,8,9 for it is already known that bacterial colonies in oropharyngeal tissues and in dental plaque are the greatest precursors for the development of aspiration respiratory infections.10 besides the influence of the loss of dentition, the functional impairments resulting from aging may be potentiated by neurological changes resulting in dysphagia in patients, an important cause of morbidity and mortality in this population.11 in the adult and elderly population, dysphagia is most commonly associated with stroke.12 more than half of patients who have suffered stroke present between six and ten types of disability, muscle weakness being the most prevalent one, followed by communication, speech, and swallowing disorders.13 specifically regarding swallowing, the stroke entails increased oropharyngeal transit time,14,15 changes in motor control of tongue,16 as well as the presence of laryngotracheal aspiration of food.16,17 once the physiological changes resulting from aging in swallowing may be aggravated by loss of teeth and the use of poorly fitting prostheses, the severity of dysphagia could be influenced by the oral health condition and use of dental prostheses in elderly patients with neurological diseases . However, according to the literature studied, no research has made the correlation between the findings of the swallowing performance with oral health in elderly patients after stroke . Therefore, the aim of this study was to relate the condition of oral health to the level of oral intake and the degree of swallowing dysfunction in elderly patients with stroke in chronic phase . Thirty poststroke individuals, aged 61 to 90 years, whose injury happened 6 months to 9 years previously to their participation in this prospective study . The inclusion criteria considered the following cases: affected by stroke as attested by a medical report, through clinical diagnosis and imaging, with a minimum time of 6 months; aged over 60 years, being in regular clinical neurological monitoring, not having undergone dysphagia rehabilitation; presenting general stable health that would enable the realization of the proposed tests . In order to achieve a greater delineation of the group, in addition to considering the group of 30 individuals (heterogeneous group [hg]), the total dentate, the total edentulous without dental prostheses, and individuals with more than one episode of stroke were excluded and the participants were divided into two groups, according to the affected body side: right hemiplegic group (rhg, n=8) and left hemiplegic group (lhg, n=11). A distribution and recruitment fluxogram the participants underwent assessment of various components of oral health through traditional health indicators, based on the presence or absence of disease . The data were collected from the clinical examination by a dentist as instructed by the who oral health surveys: basic methods,18 including the assessment of dental status by the number of decayed, missing, and filled teeth (dmft) and evaluation of dental prostheses . The prostheses were evaluated for retention, functional stability, smile aesthetics, degree of bone resorption, and quality of the mucosa.19 from the evaluation, the dental arches were classified as without prosthesis or with the presence of partial or complete dental prosthesis; later, the use or need for replacement of dental prostheses was indicated . The need for prostheses replacement was as follows: 0, no need to change; 1, partial dental prosthesis was necessary in one of the dental arches; 2, need for partial dental prosthesis in both dental arches; 3, need for complete dental prosthesis in one of the dental arches; 4, need for dental prosthesis in both dental arches . Research of oral ingestion was performed by reviewing the usual food consumption patterns referred to in the 24-hour dietary recall . From the data obtained by the research of oral ingestion, patients were classified according to the levels of the functional oral intake scale (fois),20 on a scale from i to vii, considering the diet characteristics based on the properties and texture of the food.21 the fiberoptic endoscopic evaluation of swallowing (fees) was performed by an otorhinolaryngologist physician collaboratively with the speech therapist . Subjects were asked to remain seated with their heads arranged in the direction of the body axis, without bending or rotation, and the examination was performed using a flexible endoscopic equipment of fiberoptic bronchoscopic type (model olympus clv - u20) and an olympus otv sc nasopharyngoscope (olympus corporation, tokyo, japan). Three consistent standardized foods were evaluated: liquid (10 ml of filtered water), thick pudding (10 ml of thickened dietary grape juice, reaching a final consistency similar to that of pudding), and solid (half a slice of bread, 1 cm thick). From the data obtained by the fees, the severity rating of the swallowing disorder was determined in accordance with the scale of functional impairment of swallowing of macedo filho,22,23 which subdivides the dysphagia severity levels (normal, mild, moderate, and severe). Spearman s test was used to verify the correlation between the oral health condition (dmft, number of teeth present, and the need for prostheses replacement) and the performance in the swallowing function (classification in the fois scale and dysphagia rating in each consistency). For this analysis to be performed, the fois scale and the degree of dysphagia were numerically classified from 1 to 7 and from 1 to 4, respectively . For comparison of fois results and dysphagia classification, among the different types of prostheses used in the upper and lower dental arches (complete dental prosthesis, partial dental prosthesis, denture or none), the kruskal thirty poststroke individuals, aged 61 to 90 years, whose injury happened 6 months to 9 years previously to their participation in this prospective study . The inclusion criteria considered the following cases: affected by stroke as attested by a medical report, through clinical diagnosis and imaging, with a minimum time of 6 months; aged over 60 years, being in regular clinical neurological monitoring, not having undergone dysphagia rehabilitation; presenting general stable health that would enable the realization of the proposed tests . In order to achieve a greater delineation of the group, in addition to considering the group of 30 individuals (heterogeneous group [hg]), the total dentate, the total edentulous without dental prostheses, and individuals with more than one episode of stroke were excluded and the participants were divided into two groups, according to the affected body side: right hemiplegic group (rhg, n=8) and left hemiplegic group (lhg, n=11). A distribution and recruitment fluxogram the participants underwent assessment of various components of oral health through traditional health indicators, based on the presence or absence of disease . The data were collected from the clinical examination by a dentist as instructed by the who oral health surveys: basic methods,18 including the assessment of dental status by the number of decayed, missing, and filled teeth (dmft) and evaluation of dental prostheses . The prostheses were evaluated for retention, functional stability, smile aesthetics, degree of bone resorption, and quality of the mucosa.19 from the evaluation, the dental arches were classified as without prosthesis or with the presence of partial or complete dental prosthesis; later, the use or need for replacement of dental prostheses was indicated . The need for prostheses replacement was as follows: 0, no need to change; 1, partial dental prosthesis was necessary in one of the dental arches; 2, need for partial dental prosthesis in both dental arches; 3, need for complete dental prosthesis in one of the dental arches; 4, need for dental prosthesis in both dental arches . Research of oral ingestion was performed by reviewing the usual food consumption patterns referred to in the 24-hour dietary recall . From the data obtained by the research of oral ingestion, patients were classified according to the levels of the functional oral intake scale (fois),20 on a scale from i to vii, considering the diet characteristics based on the properties and texture of the food.21 the fiberoptic endoscopic evaluation of swallowing (fees) was performed by an otorhinolaryngologist physician collaboratively with the speech therapist . Subjects were asked to remain seated with their heads arranged in the direction of the body axis, without bending or rotation, and the examination was performed using a flexible endoscopic equipment of fiberoptic bronchoscopic type (model olympus clv - u20) and an olympus otv sc nasopharyngoscope (olympus corporation, tokyo, japan). Three consistent standardized foods were evaluated: liquid (10 ml of filtered water), thick pudding (10 ml of thickened dietary grape juice, reaching a final consistency similar to that of pudding), and solid (half a slice of bread, 1 cm thick). From the data obtained by the fees, the severity rating of the swallowing disorder was determined in accordance with the scale of functional impairment of swallowing of macedo filho,22,23 which subdivides the dysphagia severity levels (normal, mild, moderate, and severe). Spearman s test was used to verify the correlation between the oral health condition (dmft, number of teeth present, and the need for prostheses replacement) and the performance in the swallowing function (classification in the fois scale and dysphagia rating in each consistency). For this analysis to be performed, the fois scale and the degree of dysphagia were numerically classified from 1 to 7 and from 1 to 4, respectively . For comparison of fois results and dysphagia classification, among the different types of prostheses used in the upper and lower dental arches (complete dental prosthesis, partial dental prosthesis, denture or none), the kruskal the participants underwent assessment of various components of oral health through traditional health indicators, based on the presence or absence of disease . The data were collected from the clinical examination by a dentist as instructed by the who oral health surveys: basic methods,18 including the assessment of dental status by the number of decayed, missing, and filled teeth (dmft) and evaluation of dental prostheses . The prostheses were evaluated for retention, functional stability, smile aesthetics, degree of bone resorption, and quality of the mucosa.19 from the evaluation, the dental arches were classified as without prosthesis or with the presence of partial or complete dental prosthesis; later, the use or need for replacement of dental prostheses was indicated . The need for prostheses replacement was as follows: 0, no need to change; 1, partial dental prosthesis was necessary in one of the dental arches; 2, need for partial dental prosthesis in both dental arches; 3, need for complete dental prosthesis in one of the dental arches; 4, need for dental prosthesis in both dental arches . Research of oral ingestion was performed by reviewing the usual food consumption patterns referred to in the 24-hour dietary recall . From the data obtained by the research of oral ingestion, patients were classified according to the levels of the functional oral intake scale (fois),20 on a scale from i to vii, considering the diet characteristics based on the properties and texture of the food.21 the fiberoptic endoscopic evaluation of swallowing (fees) was performed by an otorhinolaryngologist physician collaboratively with the speech therapist . Subjects were asked to remain seated with their heads arranged in the direction of the body axis, without bending or rotation, and the examination was performed using a flexible endoscopic equipment of fiberoptic bronchoscopic type (model olympus clv - u20) and an olympus otv sc nasopharyngoscope (olympus corporation, tokyo, japan). Three consistent standardized foods were evaluated: liquid (10 ml of filtered water), thick pudding (10 ml of thickened dietary grape juice, reaching a final consistency similar to that of pudding), and solid (half a slice of bread, 1 cm thick). From the data obtained by the fees, the severity rating of the swallowing disorder was determined in accordance with the scale of functional impairment of swallowing of macedo filho,22,23 which subdivides the dysphagia severity levels (normal, mild, moderate, and severe). Spearman s test was used to verify the correlation between the oral health condition (dmft, number of teeth present, and the need for prostheses replacement) and the performance in the swallowing function (classification in the fois scale and dysphagia rating in each consistency). For this analysis to be performed, the fois scale and the degree of dysphagia were numerically classified from 1 to 7 and from 1 to 4, respectively . For comparison of fois results and dysphagia classification, among the different types of prostheses used in the upper and lower dental arches (complete dental prosthesis, partial dental prosthesis, denture or none), the kruskal according to the evaluation of oral condition, the mean of dmft of elderly individuals affected by stroke in this study was 28.7, while the mean of remaining teeth was 5.6, showing that most individuals were edentulous . Table 2 shows the types of prostheses used by the elderly individuals affected by stroke in each dental arch and the need for prostheses replacement . According to the results of the functional oral intake scale, most individuals (53%) presented as level v on the fois, followed by level iv (34%) and level vii (13%). With the severity rating of the swallowing disorder, no occurrence of severe the distribution of the elderly affected by stroke according to severity rating of the swallowing disorder is shown in table 3, as well . According to the results of the statistical analysis, correlations between the oral health condition and the results of the fois scale in elderly individuals affected by stroke in this study were found . There was a statistically significant negative correlation between the need for replacement of prostheses and the rating scale, and also in the hg and in rhg, showing that the greater the need for replacement of the prosthesis, the worse the rating of the fois scale . There were differences in the classification of the fois scale, for the lhg, in the different types of prostheses used in the upper dental arch, whereas for the rhg the difference in the classification of fois occurred between groups of individuals with different types of prostheses used in the lower dental arch . After completion of the dunn s post - test, the difference was confirmed only in the lhg, demonstrating that individuals of this group with partial prostheses in the upper arch (ie, that still had natural elements and whose missed teeth had been rehabilitated) had better ratings in the fois scale compared to individuals with total prostheses . The results of the correlation between the fois scale and the oral health condition are shown in table 4 . In the statistical analysis between the degree of swallowing dysfunction and oral health condition, a significant negative correlation between the number of teeth and the swallowing performance of liquid in the lhg was found, demonstrating that the greater the number of teeth, the lower the degree of swallowing dysfunction . According to the kruskal wallis test, there was no difference in the performance of swallowing solid boluses depending on the type of prosthesis used in the lower dental arch; in the hg, however, when applying the post - dunn s test, this difference was not confirmed (p>0.05). The comparison of the fois scale between the types of dental prostheses is shown in table 5 . The results of the correlation between the degree of dysphagia and the oral health condition are shown in table 6, and the comparison of the degree of swallowing dysfunction between types of dental prostheses is described in table 7 . According to the literature, individuals affected by stroke often exhibit decreased level of consciousness, paralysis of the muscles involved in swallowing, sensory deficits of the pharynx and oral cavity, as well as loss of appetite.24 with these disorders related to swallowing, dysphagia becomes an important symptom in this population, and may be aggravated by teeth loss and the use of poorly fitting prosthesis, common during aging . Furthermore, the hypothesis that oropharyngeal colonization is primarily responsible for the subsequent respiratory infection, owing to aspiration, is strongly supported by the literature.10 no literature studies have made the correlation between the findings of the swallowing performance and the condition of the oral health in elderly patients after stroke . The results of this study showed some correlations between the oral condition and the data of the swallowing performance even when elderly individuals affected by stroke were part of the heterogeneous group . Besides the statistical analysis for the study group, in an attempt to reduce its heterogeneity, the subjects were divided according to the side of the motor impairment after stroke . Former studies have suggested that dysphagia maybe associated with diffuse lesions in one or both hemispheres, anterior fossa, or brainstem, as swallowing has a bilateral cortical representation . It has been well established that the protection of the airways during swallowing requires a precise coordination with accurate movements of the structures involved and adequate propulsion of the bolus to the oropharynx and esophagus;25 thus, the motor ability for swallowing seems to be essential for this protection . In the hg and rhg, it was found that the higher the need for replacement of the prosthesis, the worse the rating in the fois scale; ie, individuals with greater need for replacement of the prostheses had a greater perception in making more compensation and changes in their diet, which reflected the classification level of oral intake . The fois scale was developed to describe the functional level of the daily oral intake of food and liquid of a patient, considering the changes in diet and need for compensation during swallowing.20 these limitations and changes in oral intake result from patient perception and self - perception of swallowing ability that is impaired . Therefore, from the results, it can be inferred that when there was a greater need for replacement of the prosthesis, the patient s perception of doing more compensation and dietary modifications is reflected in the classification of the fois scale . Significant changes in oral condition can have a major effect on the functions of eating and drinking and on the nutritional status of elderly individuals and those with neurological diseases.26 thus, the selection of food is determined by the difficulty in chewing and swallowing of the individuals . Missing teeth and the use of prosthesis cause changes in the chewing ability of the elderly according to the type of food, and influences the swallowing function;27 thus, soft or mashed foods are preferentially ingested by the elderly, due to the difficulty in mastication,28 showing that there is an influence of oral health condition on the selection of foods . Besides the influence of the oral condition on swallowing, there was a difference between the types of prostheses and classification of the fois scale when the results of the evaluation of individuals with impaired right and left hemiplegia were analyzed separately . The difference between the types of prostheses could be confirmed by post - dunn s test in the lhg, and demonstrated that individuals with partial dentures had better ratings in the fois scale than individuals with complete prostheses . Thus, we can infer that when there was partial prosthesis rehabilitation along with the presence of some dental elements, subjects needed less compensation and changes in the oral diet . In this sense, studies show that the use of prostheses in the edentulous contributes to the maintenance of the physiological process of swallowing in the elderly,29 the fixation of the prosthesis in the mandible,30 and the presence of natural elements enables greater preservation of functional swallowing . When comparing the swallowing performance according to the type of prosthesis used, there was no difference between the types of prostheses fitted in the lower dental arch in swallowing solids in the hg . Studies in healthy elderly subjects demonstrate the importance of the oral condition in the performance of the oral phase of swallowing . Changes in masticatory function related to the oral condition, such as difficulties biting and chewing food27 demonstrated an influence on the pharyngeal phase of swallowing, such as premature escape of food, waste retention in the vallecula and pyriform sinuses, and the presence of coughing and gagging.27 moreover, the absence of dental prosthesis can result in a longer duration of swallowing,29 and the chewing and swallowing difficulties in healthy older adults decreased after the replacement of removable total prostheses by mandibular implant - supported prostheses.30 the literature has shown positive effects in the swallowing function with the use of prostheses and the differences in swallowing performance with prostheses in the upper or inferior arches.8 a study with healthy elderly individuals showed the differences between the total duration of swallowing, the latency period before pharynx elevation, duration of preparatory and oral phase, when using or not using the dental prostheses.29 finally, in the lhg, it was observed that the smaller the number of teeth present, the worse the rating of dysphagia for liquid . Although this study aimed at finding an influence of the presence and number of teeth on chewing and consequently on swallowing solids,1,27,28 it also demonstrates the influence of the oral condition on liquid swallowing for this population . According to tamura et al,2 especially for liquid food, which demands more coordination during swallowing, stability in the jaw is also required, so that there is greater stability of the hyolaryngeal complex . To start the pharyngeal phase, the rise of the hyoid bone by the suprahyoid muscles and laryngeal elevation should occur . To complement these events, the jaw must be stabilized by natural or rehabilitated teeth into the proper position, because when the elevation of the hyoid bone and larynx is insufficient, there is an increased risk of aspiration during swallowing . The findings of this study indicate that the oral health condition of elderly individuals after stroke in chronic phase showed an association with the level of oral intake and the degree of oropharyngeal dysphagia . The limitations of the study should be considered, one being the lack of access to the imaging examinations to characterize the individuals according to the type of stroke, damaged areas, and extent of injury, and heterogeneity of the time of brain involvement, in addition to the effects of medications and other comorbidities, which were not taken into account . Also, owing to the small sample, strong correlations could not be observed, and a cause / effect relationship cannot be determined . Despite the limitations of this study, and the fact that hemiplegia does not necessarily represent a direct relationship with the injured brain hemisphere contralaterally, since cerebellum lesions may cause ipsilateral motor damages,31 the findings indicated that the level of oral intake was influenced by the condition or type of dental prostheses, regardless of the side of the body affected . On the other hand, the number of teeth were demonstrated to be related to the level of dysphagia in individuals with right hemiplegia, which shows that the oral health condition differentially affects the physiological responses of swallowing, influenced by the brain damage . Considering the present sample, further research is necessary pertaining to the oral condition and the neurological involvement of individuals . In addition, these issues demonstrate the need for an interdisciplinary research team comprising dentists, physicians, speech pathologists, and other health professionals, so as to study and define the treatment and guidelines to patients and caretakers, in order to maintain the best oral health condition in the elderly presented with oropharyngeal dysphagia.
In recent years, video - assisted intubation devices have flooded theaters, and, to a lesser extent, are also being used in icus . But can such new technology really contribute to making tracheal intubation in the icu less life - threatening, or even more life - saving? Noppens and colleagues, in a study just published in critical care, evaluated the efficacy of the c - mac video laryngoscope for endotracheal intubation in an icu managed by anesthesiologists and compared the results to those obtained during a previous period when conventional direct laryngoscopy was used . In patients with at least one predictor for difficult intubation, poor glottic views (cormack and lehane grades iii and iv) were reduced from 38% to 19%, and intubation success on the first attempt increased from 56% with direct laryngoscopy to 79% when the c - mac video laryngoscope was used . Even in all patients, the incidence of at least two intubation attempts though this was not statistically significant, halving this incidence may have substantial clinical impact . Although the overall intubation success was 100% in either group, successful tube placement in the trachea on the first attempt is crucial in icu patients with poor tolerance to apnea . After implementation of a video laryngoscope, however, intubations were more often performed by less experienced physicians . Even if one reason may be that younger physicians are more open to the newer technique, it must be guaranteed that physicians' experience is not substituted solely by technical equipment . Similarly, the use of endoscopic intubation was reduced substantially in the intervention phase (4% versus 13%), so experience with such devices may decrease, causing problems if video laryngoscopy is not possible or is contraindicated . Video laryngoscopy for every patient? Sparing such devices for the really difficult cases? To answer these questions it needs to be emphasized that all video - assisted and optical intubation devices have different view angles, thus producing different images with particular distortions, and even experts in' old - fashioned' airway management need a substantial level of training with a certain device before using it safely and successfully in critical situations and patients . Video laryngoscopes, regardless of a particular brand or device, cannot be used intuitively - they require expert skills and routines to be tamed and turned into life - saving tools . Tube placement can turn out to be difficult and even impossible, despite the excellent glottic exposure video laryngoscopes most often provide . The reason is that the operator's eye is no longer in a straight - optical and anatomical - line with the larynx, but at the tip of the laryngoscope blade . Optical and anatomical axes divert, and tube placement is sometimes difficult or fails . Becoming alert to these potential problems associated with video laryngoscopy and constantly improving one's technical skills to overcome such pitfalls can only be achieved when such devices are used on a daily basis and in routine patients . Apart from the primary aim of the study - evaluating video laryngoscopy - it needs to be highlighted that noppens and colleagues routinely used capnography to verify correct tube placement after intubation . Capnography has become a mandatory requirement in any operating room, but its use in the icu seems still to be somewhat dowdy . As of 2010, only 25% of icus in the uk and the republic of ireland used capnography to confirm correct tube placement after intubation . Such refusal may produce catastrophic outcomes: data collected from all uk national health service hospitals over a period of one year in 2008/2009 revealed that 61% of adverse events during airway management in the icu resulted in death or permanent brain damage . In 74% of such fatal cases no capnography was used! Doubtless, video laryngoscopy is a helpful tool in the hands of experienced physicians, but should not be considered a bailout procedure for beginners in airway management . And as attractive and simple video laryngoscopy appears, we must always remind ourselves to maintain our skills in endoscopic intubation . Both authors receive continuous material support for clinical studies from karl storz gmbh & co. kg, the manufacturer of the c - mac video laryngoscope.
In gipuzkoa, 27 human listeriosis episodes were reported during january 2013february 2014 . All cases produced sepsis in the patients, except 1 case that produced diarrheal disease in a 34-year - old parturient woman who had undergone a splenectomy . Eleven episodes (40.7%) occurred in pregnant or parturient women, and 8 of the children of these patients were affected: 5 newborns (4 of them premature infants) became ill, 2 pregnancies ended in miscarriage, and 1 infant was stillborn . (for this study, a pregnancy - associated episode was counted only once, whether the causative strain was isolated from mother, child, or both .) Ten cases (37.0%) occurred among the elderly (> 70 years of age) and 6 (22.2%) in adults 4560 years of age . Of the 6 patients in the 45- to 60-year age group, a total of 29 human l. monocytogenes isolates were available for microbiological characterization: 22 from blood, 3 from placental membranes, 2 from cerebrospinal fluid, and 1 each from stool and dermal exudate . Serotypes were established by agglutination (listeria - o - antisera, difco; bd diagnostics, sparks, md, usa) and by multiplex - pcr (4). The predominant serotypes identified were 1/2b (n = 17, 58.6%) and 4b (n = 8, 27.6%); 4 isolates were serotype 1/2a (13.8%). Pulsed - field gel electrophoresis (pfge) was performed by using the restriction endonucleases smai and asci (5). The sts of l. monocytogenes isolates were determined by using the multilocus sequence typing (mlst) primers and conditions described by the pasteur institute (6). Mlst showed that 16 of 17 serotype 1/2b isolates we tested were st87; the remaining serotype 1/2b isolate was st3 . Only 2 human l. monocytogenes st87 serotype 1/2b isolates, both from japan, were listed in the pasteur institute mlst database (6). Further, pfge showed 2 large clusters within serotype 1/2b, and epidemiologic research detected 2 main outbreaks . All listeriosis episodes during the study period that were caused by isolate types other than serotype 1/2b and st87 were sporadic . In the first case cluster (first outbreak), 5 episodes were detected during august all isolates from 1 woman at 28 weeks gestation, 1 parturient woman and her newborn child, and 2 newborn twins (no samples from the mother were available) showed the same pfge pattern with the restriction enzyme asci (arbitrarily named as pattern a) and were st87 (figure). Another 2 l. monocytogenes isolates from cases apparently not related to this first outbreak, isolated in january 2012 and in april 2013 from a 53-year - old man with meningitis and an 84-year - old woman, respectively, showed the same pfge pattern . Pulsed - field gel electrophoresis patterns of 6 listeria monocytogenes serotype 1/2b isolates collected from listeriosis patients in gipuzkoa, northern spain, during january 2013february 2014 . Lanes 1 and 2, isolates from first outbreak (pattern a); lanes 3, 4, and 5, isolates from second outbreak (pattern b), including (lane 5) 1 isolate from a food product of foie gras; lane 6, l. monocytogenes sequence type 3 serotype 1/2b isolate, unrelated to outbreaks . For this first outbreak, epidemiologic interviews were conducted starting with the cases observed during september 2013 . Patients were asked about their alimentary habits, focusing on consumption of raw or semicooked animal or animal derivate products . Although no specific food was identified as the possible source of the outbreak, all but 1 of the patients remembered eating cooked ham bought in the butcher s department of a certain supermarket chain located in different villages of the province . Were investigated by pcr and culture after selective enrichment (24 listeria enrichment broth; oxoid, basingstoke, uk)). In the microbiological investigation (7), 1 of 6 brands of cooked ham studied grew l. monocytogenes at a low level, but the sample strain was not the serotype 1/2b identified in the outbreak . No listeria spp . Were identified in the remaining 5 brands of cooked ham studied . In the second outbreak, 10 episodes were reported during early november 2013 through late february 2014; patients were 5 elderly persons, 4 previously healthy parturient women, and 1 parturient women who had undergone a splenectomy . No isolates could be obtained from the mother of an infected newborn and from a miscarriage . The 10 isolates available for study (1 per episode) were of the same serotype and sequence type, 1/2b and st87, as isolates from the first outbreak, but these isolates differed in pfge asci pattern (this pattern arbitrarily named pattern b). Isolates from these 2 outbreaks had the same pfge pattern when the smai enzyme was used (figure). After the epidemiologic survey for this outbreak, we conducted microbiological analysis of several foods . A foie gras product kept by a patient in his refrigerator yielded a positive culture of l. monocytogenes that had the same phenotype and molecular profile as isolates from the second outbreak . The presence of the outbreak strain was confirmed in high amounts (5.2 10 cfu / g) by several other cultures from 3 unopened samples from the same brand of foie gras . After this food source was identified as the source of this second outbreak, all patients from the first outbreak were specifically interviewed again about the consumption of this product, but none remembered having eaten it . L. monocytogenes infection is serious and has high fatality rates . Among the 35 persons infected in this region of spain since 2013, a total of 6 deaths have occurred: 3 adults, 2 fetuses (miscarriages), and 1 child (stillbirth). Without rapid case detection and early treatment, l. monocytogenes infections mainly affect elderly persons, pregnant women, newborns, and immunocompromised adults (810). Humans are usually infected after eating contaminated food, although the source of the infection is infrequently detected in sporadic cases . For outbreaks, after the epidemiologic survey, a food is usually implicated as the source of infection, but it is not always possible to obtain microbiological confirmation (11). In this study, the strain (same phenotype and genotype) that caused the second outbreak was obtained from a recently consumed food in the home and in several unopened samples from the same batch of food . However, this source could not be identified as related to the first outbreak . Pregnant women were frequently infected during these outbreaks; epidemic clones infected 8 pregnant women and their offspring . However, during 2012 and 2013, serotype 4b isolates of different genotypes also infected 5 pregnant women, resulting in 1 miscarriage, 3 premature newborns, and 1 stillborn infant and 1 premature newborn in a twin pregnancy . In summary, we defined 2 epidemiologically unrelated outbreaks of listeriosis caused by a rare type of l. monocytogenes that occurred at the same time in a small region of spain . Management of this frequently fatal disease requires careful investigation of the source of infection to stop its spread and prompt treatment of infected persons to prevent severe illness and death.
Toothbrushes play an essential role in oral hygiene and are commonly found in both community and hospital settings . Toothbrushes may play a significant role in disease transmission and increase the risk of infection since they can serve as a reservoir for microorganisms in healthy, oral - diseased and medically ill adults . Contamination is the retention and survival of infectious organisms that occur on animate or inanimate objects . In healthy adults, contamination of toothbrushes occurs early after initial use and increases with repeated use [2, 3]. Toothbrushes can become contaminated from the oral cavity, environment, hands, aerosol contamination, and storage containers . Bacteria which attach to, accumulate, and survive on toothbrushes may be transmitted to the individual causing disease [4, 5]. In the hospital there is a need for standardized nursing guidelines to prevent toothbrush contamination, which may increase the risk of infections from potentially pathogenic microorganisms and is clinically relevant for assessing the risks and benefits of oral care and informing nursing practice . This review of peer - reviewed literature was conducted to evaluate the cumulative state of knowledge related to toothbrush contamination, its possible role in disease transmission, and in preparation for a research study related to toothbrush contamination in critically ill adults . Articles published from 1977 to 2011, on human subjects and using the english language were obtained . The review included studies that evaluated toothbrush contamination in healthy and oral - diseased adults, guidelines for toothbrush and oral care in both healthy and medically ill persons, hospitalized and nonhospitalized patients, and interventions for reducing contamination of toothbrushes . The following databases were searched: pub med (clinical inquiries and mesh), cinahl, cochrane library, national guidelines clearinghouse, web of science, and google scholar . Key search terms used in the review were toothbrush, tooth brushing, colonization, bacterial contamination, contamination, oral hygiene, oral health, nursing practice, microbial contamination, and adults . A total of three separate searches were conducted in a systematic fashion using the inclusion and exclusion criteria and search terms . The first search (search 1) identified articles in the selected databases and complete copies of articles that were considered to have met the inclusion criteria were obtained for further review (table 1). Articles were excluded if they did not meet the inclusion criteria listed above, were conducted on a pediatric population, were duplicates from other databases, or only explored antibacterial methods . The second search (search two) included articles identified through cited articles and were reviewed following the same criteria . There were a total of 23 new articles identified through the second search . A third search (search three) was conducted one year after the first search in order to capture any recently published articles . After a review of the abstracts for the articles obtained through the three searches, a total of 88 relevant articles were identified for further evaluation . After inclusion criteria were applied, 38 articles were selected; after exclusion criteria were applied, ten articles were retrieved to be read in their entirety and included in this review (figure 1). The selected studies are grouped by setting in vivo, in vitro, and studies that combined both types of settings . The sample sizes ranged from 3 to 103 with the majority of studies having a sample size under 30 . Overall, the studies evaluated several perspectives related to toothbrush contamination to include: contamination, methods for decontamination, storage, design, and environmental factors . All of the studies examined toothbrush contamination and found significant bacterial retention and survival on toothbrushes after use [6, 7]. Glass found that toothbrushes from both healthy patients and patients with oral disease contained potentially pathogenic bacteria and viruses such as staphylococcus aureus, e. coli, pseudomonas, and herpes simplex virus . Glass also found toothbrushes contaminated with herpes simplex virus 1 in numbers sufficient to cause an infection in the patient . Bunetel et al . Found that toothbrushes used by patients with existing oral disease quickly became contaminated . This study also found a significant relationship between repeated use and bacterial retention on toothbrushes and that the oral cavity can be inoculated from a contaminated toothbrush . Several of the studies found that toothbrushes were contaminated before use [5, 9]. Mehta et al . Found that 70% of the toothbrushes in their study became heavily contaminated with pathogenic microorganisms after use . Studies by both taji and rogers and glass found extensive toothbrush contamination after use except in cases where an oral antiseptic, such as mouthwash, was used immediately prior to brushing . Verran and leahy - gilmartin found that toothbrushes supported many different bacteria and the amount of growth was varied . Bunetel et al . Found that toothpaste, mouthwash, and oral antiseptics all decrease microbial load on toothbrushes . Their study found that the toothbrushes became heavily contaminated after use . Soaking the toothbrush in listerine for 20 minutes prior to and after brushing decreased the microbial load . The use of antimicrobial coated toothbrushes in adults with oral disease was explored by efstratiou et al . As a means to prevent toothbrush contamination . This study, however, found that coating the bristles with triclosan did not change bacterial growth but the use of toothpaste did . Glass and jensen explored ultraviolet light as a means of decontamination and found this method to be effective at reducing the bacterial load on toothbrushes . The use of coated tufts and toothpaste was investigated in adult patients with oral disease . Found that coated tuffs did not inhibit contamination but use of toothpaste did reduce contamination . Mehta et al . Found that an overnight immersion in chlorhexidine gluconate was highly effective in decreasing toothbrush contamination and chlorhexidine was more effective than listerine in reducing the microbial load of bacteria . Sato et al . Found that rinsing toothbrushes with tap water resulted in continued high levels of contamination and biofilm . . Found that the use of regular and triclosan - containing toothpaste resulted in lower toothbrush contamination than no toothpaste use . Toothbrushes can become contaminated through contact with the environment, and bacterial survival is affected by toothbrush storage containers . Found that toothbrushes placed in closed containers and exposure to contaminated surfaces yielded higher bacterial counts than those left open to air . Mehta et al . Found that the use of a cap for toothbrush storage increased bacteria survival . In addition, glass found that bacteria survived more than 24 hours when moisture is present . Toothbrush bristles range from soft to hard with different cluster patterns and plastic shapes while toothbrush handles included different plastic shapes and decorative moldings . Bunetel et al . Found that bacteria become trapped inside the bristles of the toothbrush and bacterial survival is dependent upon the bacteria (aerobic versus anaerobic) and toothbrush design . In addition, the researchers found that solid handles had less bacteria retention and that as the surface area increased, so did the microbial load . Toothbrushes with bristles that are frayed and arranged closely together trapped and retained more bacteria . This finding was also echoed in a study by glass that explored the level of bacterial retention based on toothbrush brand, color and bristle pattern . Contamination was the lowest in soft and round, clear, two bristle row toothbrushes . Mehta et al . Found that the retention of moisture and oral debris in the bristles increased bacterial survival . Due to the limited number of publications specifically related to toothbrush contamination, it was necessary to conduct a preliminary evaluation of the majority of identified articles for this review . For example, several of the articles combined an in vivo examination of bacterial survival on actual patient's toothbrushes and then conducted an in vitro autoinoculation experiment to examine decontamination methods on sterile toothbrushes in the laboratory . The selected studies all found that toothbrushes of healthy and oral diseased adults become contaminated with potentially pathogenic bacteria from the dental plaque, design, environment, or a combination of factors . The trend identified in the literature is to evaluate methods to reduce toothbrush contamination or toothbrush design rather than evaluating the process related to how the toothbrush initially becomes contaminated, is stored, or is disinfected . In a vulnerable population such as critically ill adults, pathogenic contamination may increase the risk of infection and mortality . Although some interventions such as chlorhexidine, toothpaste, mouthwash, and ultraviolet sanitizers reduce bacterial survival, oral hygiene practices in the hospital setting by nurses vary . Currently, there are no nursing guidelines related to toothbrush frequency of use, storage, and decontamination . In the hospital setting, the environment as a source of pathogenic bacteria is now a hot topic and the focus of many current infectious disease research studies . Surfaces in close contact with the patient such as bed frames, countertops, sinks, bedside tables, linens, and mattresses may act as fomites . Toothbrushes may come into contact with these surfaces prior to or after use thus increasing risk . While there is significant literature available on environmental contamination and risk for infection, no studies have specifically examined the toothbrush on more vulnerable hospital populations such as critically ill adults . Toothbrush storage is inconsistent in both community and hospital environments and may increase exposure to pathogenic organisms . The storage conditions of toothbrushes play an important role in bacterial survival: toothbrushes stored in aerated conditions had a lower number of bacteria than those stored in plastic and bacterial growth on the toothbrush increased 70% in a moist, covered environment . In clinical practice, the author has observed that there is no standardized nursing protocol for the storage or replacement of toothbrushes and that some commonly observed nursing practices include storing the toothbrush in the bath basin with other bathing / personal supplies and linens, in a paper towel, in a plastic wrapper, on the bedside table, next to the sink, and in an oral rinse cup at the bedside . These practices may impact the contamination of toothbrushes . In this review, the majority of studies identified had small sample sizes . Importantly, despite multiple studies supporting toothbrush contamination and the likely relationship between contamination and disease transmission, there are no studies that specifically examine toothbrush contamination and the role of environmental factors, toothbrush contamination and vulnerable populations in the hospital setting (e.g., critically ill adults), and toothbrush use in nursing clinical practice . Additional descriptive studies to evaluate these relationships would be beneficial and informative for future research . The relationship between environmental factors, toothbrush contamination, and patient oral colonization would inform development of nursing oral care guidelines for adults that minimize risks related to toothbrush contamination.
This article briefly reviews the need for emergency care in africa and barriers to its integration into health systems in the region . We describe an example of an emergency care initiative at muhimbili national hospital (mnh) in dar es salaam that has integrated a multi - cadre training program with development of a dedicated emergency department in the largest public hospital in tanzania . This article should be of interest to those concerned with prevention and treatment of acute illness in the sub - saharan region, and those with a particular interest in global emergency care and physician training initiatives in resource - limited settings . Low - income countries suffer the highest rates of every category of injury from road traffic to drowning; the highest rates of maternal death from acute complications of pregnancy; and the highest rates of acute complications of communicable diseases including tuberculosis, malaria, and hiv . The rapidly growing prevalence of cardiovascular and diabetic disease has only increased the burden of acute illness, as patients with chronic disease in low - income countries also have the highest rates of mortality from acute complications . The disease control priorities in developing countries project estimates that 45 per cent of deaths and 36 per cent of disability - adjusted life years (dalys) in low- and middle - income countries could be addressed by the implementation of emergency care systems . While definitive specialty care will never be available at all times in all places, several studies suggest that emergency care is an effective and cost - effective means of secondary prevention: prioritizing an integrated approach to early resuscitation and stabilization of acutely ill patients greatly reduces the morbidity and mortality associated with a range of medical, surgical, pediatric, and obstetric conditions . In addition, many acute conditions can be mitigated by primary prevention; disease surveillance at acute and emergency care facilities has been shown to increase preparedness and disease control capabilities . In general, analysis of acute disease patterns and the distribution of mortality across the acute care continuum is a crucial part of identifying the preventive and training initiatives most likely to improve outcomes . Facility - based and pre - facility emergency care are essential components of a continuum ranging from prevention, through primary and chronic care, to inpatient critical care and surgery, and with resolution 60.22 the world health assembly has called for all its member states to consider formal, integrated emergency care systems' . There are four foundational challenges to integrating emergency care into health systems in sub - saharan africa: the burden of acute disease in sub - saharan africa is severely under - documented . Some data exist on the distribution of inpatient diagnoses in the region, but the actual range of acute presentations to health facilities is largely unknown . Studies that compare police, hospital, and insurance records with other sources in low - income countries, for example, suggest that as few as 1 in 10 injuries may be documented in official counts . Health - care facilities often lack an integrated approach to triage, resuscitation, and stabilization of acutely ill patients . Even at a single small district hospital, acutely ill patients may be cared for by several different departments, depending on age, pregnancy status, and specific disease states . This vertical approach means that there is rarely a dedicated acute intake area staffed with nonrotating personnel who can be trained in resuscitation and stabilization.essential components of acute and emergency care have not been determined, and there is no consensus on how to define success . To date, there has been no systematic analysis of the acute care delivery systems most appropriate to these varied contexts . While there are scattered examples of successful interventions, little is known about what makes these programs effective or how others might replicate their success . Impact is often quantified by the number of providers trained, rather than by any measure that incorporates quality or performance assessment.there is no current advocacy plan for placing emergency care on the global health agenda . Despite the essential role of early resuscitation and stabilization in averting morbidity and mortality, emergency care is conspicuously absent from discussions of global health priority initiatives (such as the millennium development goals and un consensus statements) and large - scale global health funding strategies . The burden of acute disease in sub - saharan africa is severely under - documented . Some data exist on the distribution of inpatient diagnoses in the region, but the actual range of acute presentations to health facilities is largely unknown . Studies that compare police, hospital, and insurance records with other sources in low - income countries, for example, suggest that as few as 1 in 10 injuries may be documented in official counts . Health - care facilities often lack an integrated approach to triage, resuscitation, and stabilization of acutely ill patients . Even at a single small district hospital, acutely ill patients may be cared for by several different departments, depending on age, pregnancy status, and specific disease states . This vertical approach means that there is rarely a dedicated acute intake area staffed with nonrotating personnel who can be trained in resuscitation and stabilization . Essential components of acute and emergency care have not been determined, and there is no consensus on how to define success . To date, there has been no systematic analysis of the acute care delivery systems most appropriate to these varied contexts . While there are scattered examples of successful interventions, little is known about what makes these programs effective or how others might replicate their success . Impact is often quantified by the number of providers trained, rather than by any measure that incorporates quality or performance assessment . There is no current advocacy plan for placing emergency care on the global health agenda . Despite the essential role of early resuscitation and stabilization in averting morbidity and mortality, emergency care is conspicuously absent from discussions of global health priority initiatives (such as the millennium development goals and un consensus statements) and large - scale global health funding strategies . Despite these challenges, interest in emergency care training is rapidly expanding in africa, and there are planned or established emergency training programs for specialists in botswana, ethiopia, ghana, kenya, liberia, rwanda, south africa, sudan, tanzania, and uganda; and for other provider cadres in ghana, tanzania, south africa, and uganda . We review one such initiative at mnh in dar es salaam, with a focus on the development of the emergency medicine residency program . The united republic of tanzania is designated as a low - income country with an estimated population of 46 million, a per capita income of around us$500, and an average life expectancy of 51 . More than three quarters of the population lives in rural areas and a third lives below the poverty line . The infant mortality rate is around 51 per 1000 population, and there are approximately 3 doctors and 39 nurses and midwives per 100 000 population . In january 2010, mnh opened tanzania's first dedicated public emergency department via a public private partnership between tanzania's ministry of health and social welfare (mohsw), and abbott fund tanzania . The mnh emd is fully staffed with physicians (registrars have completed medical school and internship, whereas residents have worked as registrars and are now pursuing specialty training) and nurses 24 hours per day and currently sees 100130 patients daily, or approximately 40 000 patients per year . The department has full resuscitation capacity, and to add to the main hospital - operating suite a single - room operating theater dedicated to emergency cases has recently been opened within the emd . A business plan to ensure the department's financial sustainability has just been finalized through an agreement between the hospital, the ministry, and abbott fund tanzania . Nearly 40 per cent of mnh emd patients are female, 25 per cent are under 18 years of age, and 13 per cent are under 5 years of age (table 1). Approximately, one quarter of all patients and 20 per cent of pediatric patients present with injuries . In adults, intracranial injuries are very common, and road traffic is a very common cause of injury in adults and children . Other common diagnoses in adults and children include anemia and infections, particularly pneumonia in children . Mental illness is also a top diagnosis in adults, with the majority of these patients presenting with psychosis . While the muhimbili emd project began as an infrastructure - development initiative, the necessity for a coordinated professional development strategy emerged early at the time the emd opened, there were no emergency physicians in tanzania and no dedicated emergency care nurse training programs . Abbott fund tanzania initiated and supports an academic collaboration among united states (us), south african, and canadian institutions to provide clinical training for nurses and physicians, with the goal of ensuring long - term sustainability of the muhimbili emd and training leaders to promote, disseminate, and sustain emergency care throughout tanzania . Via this program, the emd providers are supported by international emergency nursing and emergency physician faculty year round . Visiting faculty serve minimum 1-month stints, and there is an emergency medicine residency program director from the university of california san francisco onsite for the majority of the year (author tr). The collaboration has developed site - specific training materials for a 10-module nursing curriculum, a 1-year registrar program, and a 3-year residency program . Ninety per cent of nursing staff have completed the program; 15 registrars have filed to complete the 1-year emergency care credentialing process; and the first class of eight residents and second class of six residents will be joined by a third class this fall . The first residency cohort will graduate in july 2013, and leadership of the program will transition to local faculty by the end of 2014 . The program at muhimbili is the nation's only emergency medicine residency and is fully integrated into the muhimbili university of health and allied sciences (muhas) master of medicine (mmed) track . The initial curriculum was developed and implemented in a collaboration between the mnh head of department and the us emergency medicine faculty serving as abbott fund tanzania consultants . The curriculum was subsequently revised as part of a university - wide initiative to introduce a competency - based format . At the time of the curriculum development, the international federation for emergency medicine model curriculum had not been released, but we have since conducted a curricular review to ensure that our curriculum meets its guidelines . Residents currently spend approximately half their time in the emd itself, and half on outside rotations in other clinical departments relevant to the practice of emergency medicine, such as surgery, obstetrics gynecology, cardiology, orthopedics, and pediatrics . The competency - based curriculum guides evaluation and allows resident performance to be appraised with reference to context - oriented proficiency, rather than traditional, discipline - based evaluation . This mode of targeted learning is particularly appropriate to the broad, setting specific practice of emergency medicine especially as a newly established field where the transmission of a culture of practice is as essential as the transmission of a body of scientific knowledge . The program is monitored by a combination of resident examinations and other provider performance metrics . Each semester residents undergo a multidimensional evaluation including a written multiple - choice exam, a written essay exam, an oral case - based exam, and an observed clinical exam (with case presentation) on volunteer hospitalized patients . Exams are proctored by local faculty and international outside examiners approved by the university academic senate . Performance gaps are recorded and addressed in subsequent review sessions, and any gaps shared by multiple residents trigger review of the relevant component of the didactic and off - service curriculum . In addition, all doctors, nurses, and health attendants undergo regular professional performance audits that evaluate on - time attendance, room - response times, and documentation quality . The emd operations team is currently specifying metrics to evaluate throughput times, triage performance, and resuscitation process . Emergency residents have also agreed to participate in a 10-year tracking study, which currently surveys their experiences on off - service rotations, and will continue to track their practice sites and the disease burden they encounter over the next decade . In general, medical trainees in tanzania face an extraordinary burden of disease and take on a degree of individual responsibility that rarely if ever falls on their us counterparts . The ratio of patients to providers is daunting, and the ratio of faculty to residents in most specialties is simply not adequate to the supervision and training needs . Whereas this latter condition is mitigated to some extent by the visiting faculty in the muhimbili emergency program, other challenges result from the acuity of the specialty and its nascent status . Managing dynamically evolving, unstable patients is new to most trainees as their previous clinical training was often in settings with limited resources for intervening with critically ill patients (who usually died). For now, emergency residents also face the challenge of being taught and supervised by faculty who have not been trained within the same system . Although they are guided by faculty in clinical decision making, ultimately the residents themselves are charged with developing the practice of regionally specific emergency care as they build their individual funds of knowledge . They frequently serve as advisors and teachers for each other, and are often in the position of researching a condition as they treat it in a patient . On rotations in other departments, besides mastering the clinical content of that respective specialty, the emergency residents must serve as ambassadors and educate others as to the nature of their own specialty and their learning goals . As the first and only emergency physicians in the country, they are called into institutional and political service to a degree that only a handful of their international colleagues will experience much later in their careers . Even in terms of the scientific advancement of the specialty, because the burden of acute disease is so poorly documented in the region, many of these dissertations will be the first, and for a time the definitive literature on the topic . Although the practice of emergency medicine has indeed evolved during the past 40 years into a coherent global discipline with a unique set of cognitive, technical, and administrative skills for managing acute illness or injuries,' there remain notable differences in the scope of practice required of providers in low - income countries . Simple translation of curricular content from other regions is unlikely to prepare trainees for what they will face during training and after graduation . Acute care facilities serve to fill many gaps in the health systems of low - income countries, and providers at facilities distant from referral centers may be required to perform tasks considered beyond the scope of emergency specialists in other countries, such as basic obstetric, abdominal, and orthopedic surgeries . In this context, off - service rotations serve a different role than they might in areas where consultants are expected to be accessible within minutes to hours . As much as possible, informed by interviews with local providers who have worked in district and sub - district facilities, we have adapted the content of our curriculum to accommodate this reality (either by emd - based or off - service training). In addition, to ensure that our curriculum is appropriate to the local disease burden, we are currently analyzing diagnostic and demographic data from the first 2 years of the mnh emd, and the 2013 curriculum will be adjusted based on these results and other emerging regional data . Eventually, we hope that the results of our physician tracking study will also serve to inform future emergency care curricula at muhimbili and elsewhere . In an effort to advocate for the dissemination of high - quality emergency care in tanzania, muhimbili providers formed the emergency medicine association of tanzania (emat), the first emergency medicine professional organization in the region . Emat was ratified by the ministry in may of 2011 with the mandate to: promote and improve emergency care through teaching, research, and education.advocate for and provide emergency care across tanzania.collaborate with other emergency care research and educational organizations, regardless of location, to the benefit of emergency care in tanzania . Advocate for and provide emergency care across tanzania . Collaborate with other emergency care research and educational organizations, regardless of location, to the benefit of emergency care in tanzania . With the approval of the mohsw, a research team including the authors (tr, hs, jm) and other emat members has just completed site visits to every district hospital in tanzania to assess emergency care capacity . The results will serve to guide future emergency care planning and development, as well as prevention initiatives . Other ongoing emat projects include expanding the registrar training program to accommodate visiting stints by district hospital providers; onsite training of district hospital providers in regionally appropriate basic and advanced resuscitation and trauma management skills; the development of a transport medicine skills course; and a series of needs analysis studies that will facilitate the development of coordinated pre - hospital emergency services . In addition, emat aims to expand collaboration with other emergency provider training efforts in arusha, bugando, moshi, and zanzibar and has begun an exchange of site visits and planned collaborative training projects . To amplify and support its national efforts, emat has affiliated with the african federation for emergency medicine and the international federation for emergency medicine, and plans are underway to establish an east african emergency medicine federation that will allow resource - sharing and coordination of research and training efforts . The first east african regional meeting on emergency care sub - saharan africa faces a disproportionate burden of acute disease and many challenges to meeting the call of world health assembly resolution 60.22 for formal integrated emergency care systems . The abbott fund tanzania - supported program at mnh in dar es salaam represents one effort to integrate a multi - cadre professional development strategy with the establishment of a high - volume emergency care facility . The muhas - based residency will soon enroll its third class and will produce its first graduates in 2013 . Their and others' future efforts will benefit from greater national and regional coordination to allow multi - site research and surveillance and sharing of educational resources . Emat has been formed to help expand regional and global advocacy efforts in collaboration with the african and international federations for emergency medicine.
The notion of peripheral immune regulation by t cells that shut off other immune cells has been around for many decades (gershon and kondo, 1971)., 1995; takahashi et al ., 1998) and a lineage - specific transcription factor (hori et al ., 2003; walker et al ., 2003) confirmed the existence of a distinct regulatory t cell (treg) population . Originally identified by their aptitude to hold off autoimmune reactions (sakaguchi et al ., 1995; takahashi et al ., 1998; treg own far - ranging suppressive activity affecting the function, maturation, and survival of all types of immune cells (thornton and shevach, 1998; jonuleit et al ., 2001; grossman et al ., 2004; kojima et al ., 2005) in response to self and non - self antigens, including pathogens (belkaid et al ., 2002; additionally, treg have been shown to confer regulatory properties upon suppressed t cells implementing a second layer of regulation (jonuleit et al ., 2002; stassen et al ., 2004; andersson et al ., 2008). Attempts to define the molecular basis of treg suppression have lead to the description of numerous putative pathways and molecules (tang and bluestone, 2008; shevach, 2009). A majority of studies agreed on cell contact - dependent suppression by treg in vitro (thornton and shevach, 1998; jonuleit et al ., 2001) and the observation of persistent contacts between treg and dendritic cells (dcs) during active suppression by intravital microscopy suggests that cell contact - dependent suppression might also play a role in vivo (tang et al ., 2006). Analyzing the molecular mechanism of contact - dependent treg suppression by comparison of gene expression in treg and non - regulatory t cells, we found that treg up - regulate camp in their cytosol upon activation and consign camp to conventional cd4 t cells and dcs (bopp et al . 2010) by gap junction intercellular communication (gjic; oviedo - orta et al ., 2000). Upon transfer camp inhibits the proliferation and differentiation of responder cells, most probably through the induction of inducible camp early repressor (icer) expression (foulkes et al ., 1991; bodor et al . Continuative work revealed that camp transmission is an essential component of treg - mediated suppression in vivo (bopp et al . Dc interaction (tang and bluestone, 2006), transfer of treg - derived camp into conventional t cells in vivo was inevitably dependent on the presence of antigen presenting cells (apc) and restricted to the draining lymph node (bopp et al ., 2007). Correspondingly, repression of camp accumulation in treg either by adenylyl cyclase inhibition, application of a camp - specific antagonist or phosphodiesterase (pde) overexpression abrogated treg suppression (bopp et al ., 2007; oberle et al ., 2007; becker et al ., 2009; klein et al ., 2012; martin et al ., inversely, blockade of camp degradation by pde inhibition improved treg - mediated suppression in a murine asthma model (bopp et al ., 2009). Regarding camp regulation in treg, foxp3 has been shown to repress pde3b expression (gavin et al ., 2006) thereby preventing camp degradation . (2009) showed that the high camp content in treg and their suppressive property depend on foxp3-mediated repression of the adenylyl cyclase 9 (ac9) regulating mirna 142 - 3p . In line with these observations, 2009) demonstrated that non - functional treg in foxp3 mutant scurfy mice harbor significantly reduced levels of cytosolic camp . Hence, the transcription factor foxp3 participates in camp buildup by concomitantly regulating the expression of camp - generating and degrading enzymes . It is noteworthy that the transmission of camp is actually involved both in the suppression of other t cells (bopp et al . Huang et al ., 2009; klein et al ., 2012) and in suppression of dcs (fassbender et al ., 2010). Together these findings classify camp as a key component of treg suppressive mechanism in vitro and in vivo and disclose camp - regulating enzymes as molecular targets for therapeutic intervention with treg activity in pathological processes like allergy and autoimmunity . Next to the transfer of camp through gap junctions, production of extracellular adenosine has been suggested as an alternative mechanism in camp - dependent suppression by treg (deaglio et al ., 2007). Extracellular nucleotides are anti - inflammatory mediators produced by a variety of cell types including treg (deaglio et al ., 2007; physiologically, extracellular nucleotide production represents a protective mechanism in response to tissue injury (fredholm, 2007). In treg suppression adenosine formation through the ectoenzymes cd39 and cd73, expressed by murine treg and a subpopulation of human treg (mandapathil et al ., 2009), has been assumed to induce camp production in conventional t cells or dcs upon binding to the a2a receptor (deaglio et al . However, the role of adenosine as a major suppressive mechanism employed specifically by treg is questionable . Blockade of camp production in responder t cells by inhibition of adenylyl cyclases does not alter their susceptibility to treg - mediated suppression (klein et al ., 2012). In addition, a2a receptor expression is detectable on t cells 4 days after stimulation (deaglio et al ., 2007) while t cells are susceptible to treg suppression exclusively within the first 24 h after stimulation (hagness et al ., 2012). Finally, blockage of ectonucleotidase activity only slightly abrogates suppression of human t cells by cd39 expressing treg (mandapathil et al ., 2010). Thus, while nucleotides certainly affect numerous cellular functions including de novo camp generation in treg their role in treg suppression is most likely of an indirect nature . Interestingly, camp up - regulation in treg coincides with another cell contact - dependent mechanism of suppression: treg constitutively express the two co - inhibitory membrane - bound molecules ctla-4 and tigit (read et al ., 2000; takahashi et al ., 2000) which are believed to provide inhibitory signals . In mice ctla-4 deficiency (bachmann et al ., 1999), ctla-4 blockade (takahashi et al ., 2000), and treg - specific ablation of ctla-4 (wing et al, ctla-4 deficient treg remain suppressive in vitro and in vivo (tang et al ., 2004; read et al ., 2006) suggesting additional mechanisms to be involved . Studies on human treg in vitro revealed only a minor role of ctla-4 in treg suppression (birebent et al ., 2004) or firmly excluded ctla-4 as a suppressive mechanism (baecher - allan et al ., 2001; however, discrepancies regarding the importance of ctla-4 in treg suppression might in part be due to the use of different target cells . While the role of ctla-4 in suppression of t cells remains uncertain, it is unequivocally required in the suppression of apc . Suppression of dcs by treg via ctla-4 has been shown to induce the downregulation of cd80 and cd86 (cederbom et al ., 2000) preventing effector t cell activation by the apc in vitro (oderup et al ., 2006) and in vivo (wing et al . Notably, elevated camp levels in t cells have been shown to increase ctla-4 expression (vendetti et al ., 2006) and camp and ctla-4 expression are simultaneously up - regulated in treg upon activation (becker et al ., 2009). While a majority of studies firmly excluded soluble factors in treg suppression in vitro, there is growing evidence that cytokines substantially add to the immune regulatory function of treg in vivo . In particular, transforming growth factor- (tgf-) and il-10 seem to be indispensable for sustained tolerance induction by treg . A role for tgf- in maintenance of peripheral tolerance was initially suggested by its importance in infectious tolerance (chen et al ., 2003) particularly its long - lasting production by cd4 t cells from tolerant mice in long - term acceptance of allografts (daley et al ., 2007). However, in order to exert its biological functions, tgf- needs to be converted from its latent (bound to latency associated peptide, lap) into its active conformation by proteolytic cleavage (khalil, 1999). Yet, there are multiple mechanisms of activating tgf- from its latency (lawrence, 2001; annes et al ., 2003) and it is unclear how tgf- is activated in vivo . Although repeatedly observed in disease models (nakamura et al ., 2001) a direct contribution of tgf- in treg suppression remained controversial because anti - tgf- antibodies and soluble tgf - rii failed to affect the suppressive function of treg (andersson et al ., 2008). Glycoprotein a repetitions predominant (garp) expressed on the surface of treg upon activation (wang et al . 2011) has been shown to act as a receptor for the tgf-/lap complex (stockis et al ., 2009). Stassen et al ., 2004) latent tgf- bound to garp on the surface of activated treg has been demonstrated to convert responder t cells into induced treg (andersson et al ., 2008). Thus, apart from acting as a soluble modulator of immune cells, tgf- supposedly helps treg to execute their contact - dependent suppressive activity by binding to garp (battaglia and roncarolo, 2009). Il-10 has been unequivocally shown to form another important mediator in treg suppression in vivo (kearley et al ., 2005; collison et al ., 2007) particularly in suppression of pathogenic th17 cells (chaudhry et al ., 2011; huber et al ., correspondingly, treg - specific ablation of il-10 leads to inflammation (rubtsov et al ., in contrast to general treg deficiency, however, treg - specific il-10 paucity leads to mucosal but not systemic autoimmunity, suggesting mucosal restriction of il-10-mediated treg tolerance induction . This view is supported by our previous observation that human treg expressing gut - homing 7 integrin preferentially induce il-10 production in converted secondary t helper suppressor cells (stassen et al ., 2004). Due to their far - ranging tolerizing capability treg have become key targets in the development of tolerance - inducing therapies (wing and sakaguchi, 2010). Like other t cells, attempts to exploit treg for therapeutic purposes therefore depend on treg activation, either by antigen or polyclonal stimulation (jordan et al ., 2001). Current efforts to increase the frequency and potency of treg in vivo include the use of cytokines (tawara et al ., 2010), antigen targeting to immature dc (mahnke et al ., 2003), and monoclonal antibodies (mab) against surface molecules (belghith et al ., are biased toward recognition of self - antigens (hsieh et al ., 2004), however, because antigenic specificities of treg in diseases have not been elucidated, potential clinical applications have mainly focused on polyclonal treg activation methods (horwitz et al ., t cell surface molecules that participate in t cell receptor - mediated stimulation have a significant influence on t cell function . Mab against coreceptors have been successfully shown to allow intentional tolerance induction in rodent and non - human primate models (krieger et al ., 1996). One particularly well - established regimen of tolerance induction is the administration of anti - cd4 mab (waldmann and cobbold, 1998). Although the mechanisms underlying tolerization by anti - cd4 mab are not yet fully understood, the activation of treg has been recognized as the entering wedge to successful tolerance induction (becker et al ., 2009; cd4, a 55-kda glycoprotein with four extracellular domains (littman, 1987), recruits the protein kinase p56 (rudd et al . 1988) to the tcr complex (holdorf et al ., 2002; kim et al ., 2003 2010) and strengthens the contact between t cells and apcs through its interaction with non - polymorphic regions of mhc class ii molecules (greenstein et al ., 1984; doyle and strominger, 1987; konig et al ., 1992, 1995). Cd4 molecules on t cell surface have been shown to preferentially form disulfide - linked dimers and tetramers (110 and 220 kda; li et al ., 1998; moldovan et al ., 2002) and mutations disabling dimerization cd4 expression on mature t cells is uniform with the exception of polarized t helper 2 cells (itoh et al ., 2005) and treg (bryl et al ., 2001) which both show decreased cd4 expression supposedly entailing altered proximal tcr signaling (hannier et al ., 2002; itoh et al ., 2005 through its interaction with tyrosine kinase p56, cd4 engagement alone can induce tcr - independent signaling events in t cells (zhou and konig, 2003). Selective engagement of the cd4 coreceptor by certain mab raises intracellular calcium and il-2 production (carrel et al ., 1991), whereas other anti - cd4 mab prime t helper cells to activation - dependent cell death triggered by subsequent tcr / cd3-mediated signals (newell et al . Colleagues suggested that the gene - activating and proapoptotic potential of different anti - cd4 mab may be associated with different epitopes (baldari et al ., 1995; di somma et al ., 1995; milia et al ., 1997) however, a similar range of divergent responses can be induced through a single cd4 epitope as demonstrated for the cd4-binding (lasky et al ., 1987) human immunodeficiency virus-1 (hiv-1) envelope protein gp120 (liegler and stites, 1994; westendorp et al . It is therefore tempting to speculate that the functional outcome of cd4-stimulation might mainly depend on the functional state of the t cell addressed rather than on a specific cd4 epitope . However, the functional state is believed to affect the formation of cd4 oligomers, which, in turn, regulate the activation of the cd4 cytoplasmic tail - associated tyrosine kinase p56, by trans - phosphorylation (veillette et al ., 1989). Even before the role of the cd4 molecule in t cell activation had been fully recognized, three groups reported that short courses of anti - cd4 mab application induce long - term tolerance to foreign proteins (benjamin and waldmann, 1986; benjamin et al . Subsequent studies revealed that anti - cd4-mediated tolerance induction was not based on t cell depletion but rather an activation of regulatory mechanisms (benjamin et al ., 1988; carteron et al ., 1988, 1989; qin et al ., 1990). Further, tolerance could not only be induced to foreign proteins but also to various transplanted allografts (shizuru et al ., 1987; qin et al ., 1989; davies et al ., 1996), demonstrating that the tolerizing potential of anti - cd4 mab is not restricted to a particular type of antigen . Immunoregulatory mechanisms initially suggested to operate in anti - cd4 induced tolerance include a predisposure of developing t cells to selective deletion, or anergy in the thymus (arima et al ., 1997); immune deviation (scully et al ., 1997); receptor blockade (fehervari et al ., 2002; harding et al ., 2002); modulation of cd4 expression (portoles et al ., 1999); and transmission of negative signals (chirmule et al ., 1999). However, none of these not mutually exclusive processes could reasonably explain the infectious tolerance rather than being submissive, anti - cd4 induced tolerance relied on dominant immune suppression by t cells activated in presence of the antibody . In regard to the dominant suppressive t cell type in charge several functionally and phenotypically different anti - cd4 mab - induced tolerogenic cd4 t cell populations have been proposed (bushell et al ., 2003; chen et al ., 2003; however, whether these had been directly or indirectly induced by anti - cd4 treatment remained undefined at first . The impressive capacity of treg and their ability to confer regulatory properties upon suppressed t cells (jonuleit et al ., 2002; stassen et al ., 2004; andersson et al ., 2008) in particular, strongly suggested a role of treg in anti - cd4-mediated infectious tolerance induction . In support of this assumption administration of non - depleting anti - cd4 mab into mice had been shown to result in pre - activation of treg in vivo (karim et al ., 2005; yang et al ., 2007) foxp3(hcd2) mice to ablate treg with an anti - hcd2 mab kendal et al . (2011) formally demonstrated that treg are crucial for infectious tolerance induced by non - ablative anti - t cell mab . Motivated by the description of activated treg in murine anti - cd4 tolerance models we previously analyzed the effect of cd4 binding agents on human treg . Comparing numerous anti - cd4 mab we found that certain anti - cd4 mab have the potential to induce the suppressive function of isolated human treg in a supposedly t cell receptor - independent manner (becker et al . In addition, we and others observed that the cd4-binding hiv-1 surface protein gp120 activates the suppressive function of treg (nilsson et al ., 2006; kinter et al ., 2007) in vitro and in two humanized mouse models in vivo (becker et al ., 2009; ji and cloyd, 2009) signifying that stimulation via the cd4 receptor represents an efficient treg activating pathway with potential to induce immunological tolerance in humans . Difference between anti - cd4 mab to trigger treg suppressive activity could not be related to a particular cd4 epitopes . However, comparing the treg activating potential of different anti - cd4 mab and cd4 binding virus envelopes we observed that one crucial event that separates treg activating and non - activating cd4 ligands consists in up - regulation of the second messenger camp (becker et al ., 2009 and unpublished results). Moreover, the binding affinity of cd4 ligands seems to play a role as suggested by the fact that weak cd4 binding viral envelopes from hiv-2 (gp105) and siv (gp130) did not activate human treg in vitro and in vivo . However, apart from these general observations the signaling events initiated by separate ligation of cd4 on treg so far remain unexplored . In particular, it is unclear whether cd4 stimulation of treg is truly independent of tcr signals, whether and how both pathways resemble or differ from another, and, most important, whether cd4-mediated signals are differently or similarly handled in treg and conventional cd4 t effector cells . The latter question is of particular interest since treg are believed to maintain an activated phenotype through constant stimulation by self antigens, yet, require additional stimulation to become suppressive . Future insights into how tcr and cd4 signaling pathways drive the suppressive activity of treg will undoubtedly help to understand treg biology and discover alternative intervention points for functional manipulation of treg suppressive activity . As summarized in figure 1 at least three different immune mechanisms can be distinguished that help to explain the tolerizing effect of cd4-specific agents: first, a general treg - independent mechanism that consist in interference with proper cd4 coreceptor function resulting in induction of t cell anergy or t cell depletion (figure 1a). This effect seems to depend either on cd4/mhc class ii binding blockade or additional tcr - independent signaling . Second, by modulating antigenic stimulation, individual cd4 mab induce differentiation of naive t cells into adaptive tregs (oliveira et al ., 2008), which are suggested to control pathogenic effectors through tgf- (oliveira et al ., 2011) or il-10 release (figure 1b) finally, and crucially important for tolerance induction, cd4-specific mab activate the suppressive function of treg (becker et al . 2011), which, upon activation, exert control on pathogenic t cells by direct and linked suppression (figure 1c). These different effects of cd4 stimulation are intrinsic functions of individual anti - cd4 mab . Potential modes of tolerance induction by cd4-specific monoclonal antibodies.a short - term treatment with non - depleting cd4-specific mab induces dominant tolerance to foreign proteins and transplanted allografts . This figure represents the different immune mechanisms that have been proposed to explain the tolerizing effect of cd4-specific mab . Three intervening points can be distinguished: (a) cd4 binding by non - depleting cd4-specific mab modulates antigenic stimulation through the t - cell receptor complex resulting in induction of t cell anergy . (b) by modulating antigenic stimulation, cd4-specific mab induce differentiation of naive t cells into adaptive regulatory t cells, which control pathogenic effectors through transforming growth factor- (tgf-) and il-10 release . (c) crucially important for tolerance induction, cd4-specific mab activate the (camp - dependent) suppressive function of treg, which, upon activation, exert control on pathogenic t cells by direct and linked suppression . Current immunosuppressive therapies are efficient in preventing acute transplant rejection and dampening inflammation in autoimmune diseases such as rheumatoid arthritis or lupus . Nevertheless, immune suppression remains inadequate, as it comprises significant side effects such as organ toxicity and hypersuppression disabling protective immune responses against pathogens and enhancing the risk of chronic infections . Hence, there is a clinical need for novel immunotherapeutic drugs with the ability to rebalance the immunologic tolerance network without persistently affecting immune function . In contrast to pharmacological immune suppression, re - induction of tolerance through the exploitation of evolutionarily established tolerance mechanisms is expected to offer a parentally operative cure . Among mechanisms operative in self - tolerance, the immune - suppressive activity of treg appears to be exceptionally well suited for therapeutic exploitation for several reasons: first, activated treg dampen the function of a wide range of immune cells including t cells (pandiyan et al ., 2007), b cells (lim et al ., 2005), dc (misra et al ., 2004; larmonier et al ., 2007), and monocytes (taams et al ., 2005) and affect a broad range of immune contexts including cardiovascular disease (ait - oufella et al ., 2006) and obesity - induced insulin resistance (feuerer et al ., 2009). Second, the activation of treg is antigen - specific defined by the selected t cell receptor repertoire in the thymus . However, once activated the suppressive mechanisms of treg operate in an antigen - non - specific manner, sidestepping the need to identify disease - specific antigens to affect a particular treg population . Prime examples of the treg immune dampening potential are experiments demonstrating that treg can be expanded and re - infused to limit immune responses (hoffmann et al ., 2002) preventing gvhd induction without causing toxicity . While persistent polyclonal treg activation would lead to general immune hyporesponsiveness, a short - term treg activation as established for tolerance induction with non - depleting anti - cd4 mab in mice is expected to induce (or re - induce) antigen - specific regulatory networks that maintain antigen - specific tolerance when treg activity has returned to normal levels . Based on the evidence for treg activation by cd4 ligands as outlined above, anti - cd4 mab seem to represent ideal compounds for treg - mediated tolerance induction . However, although animal studies have provided a compelling basis for clinical application of anti - cd4-mediated tolerance induction, this approach has been remarkably unsuccessful when transferred to the clinic . Although short interventions with particular mab have been shown to offer quick symptomatic relief, improvements supposedly caused by inactivation and depletion of cd4 t cells (kon et al ., 2001; choy et al ., failure to establish an anti - cd4-based tolerogenic therapy in humans is most likely due to difficulties in translating the timing and dosage used in animal models for human application . Importantly, in contrast to animal models, mab are administrated at late disease stages in clinical studies . Whereas the immature immune system seems to dependably allow tolerance induction with anti - cd4 mab, it seems more difficult to tolerize the experienced immune system in patients, in part due to the presence of effector and memory t cells resistant to the suppressive action of treg (yang et al ., 2007). In fact, treg - based therapies have been found to be generally less effective in models of autoimmune diseases . (2011) for example observed that functionally active treg failed to control hyperactivated t effector cells in rheumatoid arthritis patients with ongoing inflammation but prevented autoaggressive immune responses in non - inflammatory arthritis . Impaired treg suppression under inflammatory conditions has been mainly ascribed to the influence of tnf-, il-1, and il-6, which turn effector t cells resistant to treg - mediated suppression (walker, 2009; goodman et al ., 2011). Certainly, resistance to treg - mediated suppression can be overcome by blockade of il-6 (chen et al ., 2009) and supposedly, the beneficial effects of anti - tnf- treatment include a similar effect too (ehrenstein et al ., 2004; valencia et al ., 2006). Thus, provided treg can be sufficiently activated in the host, their suppressive efficiency might depend on the disease stage, which strongly argues for a combination of treg enhancing strategies with biologicals that reverse treg resistance in autoaggressive t effector cells . As exemplified with anti - cd3 mab already in the clinic evacuation of t effectors cells and concomitant enhancement of treg activity can form a very effective treatment (chatenoud and bluestone, 2007). With regard to anti - cd4-mediated tolerance induction in humans, it is important to emphasize again that anti - cd4 mab vary in their capacity to activate treg (becker et al ., 2007) and antibodies used in clinical trials so far have not been analyzed with regard to their treg activating potential . However, clinical trials with treg enhancing agents such as the anti - cd4 mab tregalizumab in rheumatoid arthritis have been initiated to investigate the efficacy of treg - based anti - cd4-mediated tolerance induction in patients with autoimmune diseases . In summary, polyclonal activation of treg through their surface molecules by biologicals that enhance their intracellular camp level are effective to induce the suppressive function of treg for re - induction of tolerance in small animal models and in humanized mice . It is therefore expected that polyclonal treg activation forms a rational for tolerance induction in humans . However, both the exact conditions, efficiency in different stages of disease and cooperation with additional treatment regiments to diminish t effector cells need to be thoroughly explored . Moreover differential signals in treg versus t effector cells are far from being clear . In addition to deepening our understanding of treg biology investigation of the latter holds the key to define alternative entry points for therapeutic manipulation of treg function . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Hepatitis c virus (hcv) infection is responsible for considerable morbidity and mortality worldwide . Moreover the hcv genotype has been shown to have an important role in clinical and histological features as well as the response to antiviral treatment . Most studies suggest that subtype 1b isolate possibly represent more aggressive variants of the virus and better responses to ifn are found in patients infected with either hcv genotypes 2 or 3 in comparison with those infected with genotypes 1 and 4 . Considering that approximately 1% of iran s population is infected, chronic hepatitis c remains a serious medical problem with considerable burden on iran s health care system . These observations have led us to determine hcv genotypes, particularly in the region of khuzestan province, southwest iran, which has no available data on hcv genotypes . Herein, we report the results of our cross - sectional analyses of hcv genotype distribution and its association with certain clinical features in patients with chronic hcv infection in khuzestan province conducted from september 2006 to september 2009 . During a three year period (between september 2006 and september 2009), we conducted a cross - sectional study on 223 consecutive hcv positive individuals who referred to the ahwaz jundishapour university hospitals (ajsuh) and hepatitis clinic . The presence of anti - hcv antibody was determined by an elisa test (ortho hcv 3.0 diagnostics, raritan, nj, usa). The presence of hcv rna in anti - hcv positive and indeterminate samples was detected by rt - pcr with the qualitative amplicor hcv test v.2.0 (roche molecular systems, branchburg, nj, usa). Hcv genotyping / sub - typing was performed by two rt - pcr assays, restriction length polymorphism analysis (rflp) of the 5noncoding region (5ncr) and nested pcr with type specific primers following primary rt - pcr with consensus primers designed for the core region of the hcv genome . Hcv genotyping by rflp was carried out using the restriction enzymes avaii and rsai on pcr - amplified from 5ncr as previously described . Type - specific pcr assay was accomplished by means of the nested pcr assay originally developed by okamoto et al . For sub typing genotypes 1 and 2, and sequences of the hcv core region were detected after synthesis of cdna and nested pcr with conserved primers covering positions 439 to 751 of the hcv genome . Rank - sum and kruskal - wallis tests compared continuous variables such as age between the groups . Fisher exact test assessed associations ., 1989 - 2002, chicago, il, usa) for windows in addition to univariate analysis and multivariate logistic regression . All 223 patients had documented positive anti - hcv antibodies for at least six months . There were 170 males (mean age: 34.6 years) and 53 females (mean age: 49.1 years) with an age range of 13 - 70 years . Samples comprised 42 patients with unknown risk factors and 179 with parenteral risk of infection [11 dialyzed, 10 hemophiliacs, 95 intravenous drug users (ivdu), with tattoos, 54 polytransfused, and needle sticks in 2 cases]. Possible routes of infection were recognized in 181 (81.2%) patients . Among these, patients with a history of ivdu, blood transfusion recipients, undergoing chronic hemodialysis, history of tattooing, accidental inoculation and non - marital sexual contact comprised 42.6%, 23.3%, 4.93%, 3.15%, 0.9% and 0.9% of samples, respectively (table 1). Rflp identified hcv genotypes in 181 of 223 samples, whereas 42 cases could not be sub - typed with this method . Patients ages were analyzed as a categorical variable (<40 and> 40 years). Genotypic distribution was as follows: 1a (41.7%); 1b (2.7%); 2 (4.1%); 3a (31.4%) and 4 (1.8%). There were 42 samples (18.84%) not classified into any of the known hcv subtypes . Univariate analysis demonstrated an independent association between ivdu and genotypes 1 (60.7% 1a) and 3a (30%). Statistical analysis did not show a difference in the frequency distribution of genotypes according to gender and age (p> 0.56). In this study, 64 (28.7%) of 223 patients received blood transfusions before 1995, whereas 5 (2.25%) of 64 patients were positive for hcv rna who received transfusions after 1995 . Hepatitis c infection is currently the most common cause of end - stage liver disease in many countries, however the whole population, prevalence is less than 1% in iran . A comparison of hcv genome sequences from various geographical regions of the world has shown substantial heterogeneity of nucleotide sequences within several regions of the viral genome . Based on these genomic differences, six major genotypes with several subtypes have been identified and a nomenclature for these was given following a consensus proposal . In the first report on iranian patients, zali et al . In tehran studied the prevalence of specific genotypes in 15 samples with the following results: type i /1a (7), type ii/1b (3), type v/3a (4) and type 4 (1). A recently published article by samimi - rad et al . In iranian patients with anti - hcv ab positive from tehran and five cities from different locations of iran showed a predominance of genotype 1a (47%), followed by 3a (36%), 1b (8%) and 4 (7%), respectively . The current study has shown that in khuzestan province, southwest iran, genotype 1a accounted for the majority of hcv infections (41.7%). This is the first study of the genotype distribution in this area which suggests a pattern similar to that reported in other parts of iran, where most cases studied thus far belonged to genotype 1 . However the results of our study differed from other middle - east countries such as the republic of yemen, kuwait, iraq and saudi arabia where genotype 4 has been identified as the most prevalent . A study of saudi patients detected hcv genotype 4 in 50% of cases and genotype 1b in nearly 40% . From other parts of the world, studies have revealed that genotype 3 is prevalent in south east asia whereas genotype 1 is common in the usa and western europe . Patients with risk factors for hcv infection enrolled in the present study were very few and therefore we were unable to reach any conclusion of genotype distribution within this group . The distribution of the two most common hcv viral types (1a and 3a,) were not statistically different in terms of mean age or gender . The relative influence of hcv genotype, risk factors for infection, duration of infection, and host factors on progression of liver disease seemed to be important . Our study indicated that ivdu and blood transfusions were the leading risk factors for hcv acquisition (71.3%), of which ivdu was the most frequent risk factor (42.6%,). All hcv infected ivdu patients were male, which was consistent with other reports . The route of hcv transmission mainly causes this epidemiological pattern in genotype distribution such that ivdu associated with genotype 1a and 3a is currently the primary risk factor of hcv infection . Screening for hcv is routine for all blood donors since 1995 in iran but 5 (2.25%) out of 64 patients who received transfusions after 1995 were positive for hcv rna . Therefore, more careful pre transfusion screening of blood for anti - hcv must be introduced in our blood banks . There were 42 cases (18.8%) unable to be classified for hcv genotype by rflp technique . This may be due to multiple infecting genotypes in these patients, difficulties in sample handling or unusual hcv genotypes in this patient group which could not be classified by this method . We can conclude that genotype 1, particularly the subtype 1a and genotype 3, subtype 3a are predominate in this geographic part of iran . Knowledge on the distribution of various genotypes in our area is essential for its prognostic implications in chronic hepatitis c infection . Further investigations with larger sample numbers are necessary to determine the major genotypes that cause hcv infection in various clinical conditions and potential associations with disease severity . This work was supported by the tropical and infection research center, ahwaz jundishapour university of medical sciences, ahwaz, iran . We are grateful to the research deputy of ahwaz jundishapour university of medical sciences for his encouragement and constructive advice during the preparation of the manuscript . We thank the subjects for their compliance in participating in this study, and danesh lab center for genetic studies, sequence alignment and immunoassays.
In the past few decades, there has been a tremendous growth in information and communication technology leading to easier access to any form of digital data including medical data . Medical data are those that are generated from medical information system (mis), hospital information system (his), radiology information system (ris), and electronic patient records (epr). Most of the medical diagnosis is based on images from ct scans, x - rays, mri scans, mammography, and other forms of image modalities . The time factor is very important to discover the abnormality issues in target images, especially in various cancer tumors such as the breast cancer . Researchers at the january 1997 consensus development conference presented data discussing the facts related to breast cancers detected by mammography . Their data showed that mammograms have more prognoses than cancers detected by other imaging modalities . Though the survival rate of a cancer patient is less, it makes a difference for a breast cancer patient . To increase the survival rate of breast cancer patients, mammography is used for earlier detection and treatment stages with reduced risk . Doctors' advice and treatment are based on the data the doctor analyses from the mammogram . Nowadays, most of the patients prefer a second / third opinion on the medical analyses received from their doctor . The second / third opinion may be from a doctor located at a different place through telemedicine . Telemedicine applications are those that provide for diagnostics, prescription, consulting, and sometimes conferences to telesurgery . Telemedicine plays an important role in today's world, where the patient's medical data is transmitted over the internet . The medical data considered may be medical images (mammogram) which has to be shared or transmitted over internet . This medical data is crucial data and is at the risk of unauthorized access or manipulation . Authenticating as well as protecting it is essential since critical judgment is done on medical images especially mammograms during breast cancer detection . Cryptography, steganography, and watermarking are such schemes that are used to protect digital data . Digital image watermarking is a technique of embedding a watermark (say logo) into the host image for dealing with security issues . Medical image watermarking deals with medical data authentication, ownership, security, source identification, and patient identification . When dealing with epr, it is mandatory to consider confidentiality to access the information, availability of the data to be used when required, and reliability of the data . These are maintained through security issues, namely, integrity, availability, authentication, and confidentiality nonrepudiation . Medical image watermarking provides for security at the origin reducing piracy of crucial medical data and also protects medical documents or images that can be illegally modified . Part of the medical information, the region of interest (roi), is crucial and must not be altered . Several watermarking schemes exist, and these schemes adopt both additive and multiplicative approaches in time domain . These schemes adopted ss (spread spectrum), dct (discrete cosine transform), dft (discrete fourier transform), dwt (discrete wavelet transform), svd (singular value decomposition), ridgelets, and contourlets in frequency domain . Proposed a watermarking scheme to verify the integrity and authenticity of ct scan images . Here have identified three different schemes to watermark a medical image: embedding the information within the non - region of interest (nroi): this method generally places the watermark in the gray portions of the image ., this method may seem too annoying to the physician.these schemes deal with reversible watermarking and were better suited for integrity control and data hiding .these methods normally minimize distortion . Have proposed a method where the physician selects the maximum power of the watermark under the level of interference with diagnosis . Wakatani proposed a scheme wherein the watermark was embedded in the nroi (non - region of interest) by adopting dwt . Medical image watermarking schemes must consider computational complexities which may lead to time delays for the physician and are still in the early stages of development . It is difficult to evaluate watermark interferences with diagnosis . Embedding the information within the non - region of interest (nroi): this method generally places the watermark in the gray portions of the image . During application of salt and pepper noise, this method may seem too annoying to the physician . These schemes deal with reversible watermarking and were better suited for integrity control and data hiding . This was achieved by replacing some of the image details . In this paper, a robust medical image watermarking scheme using fractional wavelets is proposed . The proposed scheme is divided into two stages, namely, the embedding stage and the extraction stage . Frft (fractional fourier transform) has good reconstruction capability compared to fft (fast fourier transform). When frft is combined with wpt (wave packet transform), it has the capability to retain the coefficients after attacks . Firstly, arnold transform is applied to the host image and the host image is scrambled . Secondly, the value of the transform order is used as the key . According to this key thirdly, the position of all frequency subbands is changed at each level using some secret rule known only to the user or creator . Quality of the extracted watermark to the original watermark is directly proportional to degradation of the image quality . Sections 2 and 3 describe fractional wave packet transform and arnold transform, respectively . We conclude the work presenting the future enhancements to obtain more robust medical image watermarking schemes . Based on the idea of fractional fourier transform (frft) and wave packet transform (wpt), fractional wave packet transform (frwpt) was introduced by huang and suter . Mathematically, for an input signal x(t) represented along the time axis and its fourier transform represented along the frequency axis, frft, f(t, u), of the input signal, x(t), is given by(1)ft, u=+ct, uxtdt, where c(t, u) is the fourier transformation kernel . The wave packet transform (wpt) is a combination of short time fourier transform (stft) and continuous wavelet transform (cwt). Wpt (w) of an input signal, x(t), is given by(2)w=12+expjuttxtdt.wpt can also be defined as the ft of a signal windowed by a wavelet, dilated by and translated by . Frwpt, w(u, a, b), for a given input signal x(t) can be defined as(3)wu, a, b=1a+ctbaxtdt.the frwpt is a function of time, frequency, and scale . The computation of frwpt corresponds to the following steps as explained by huang and suter: a product by a wavelet.a product by a chirp.a fourier transform.another product by a chirp.a product by a complex amplitude factor.for computational purposes, a simple implementation of frwpt is used as shown in figure 1 . A product by a wavelet . A product by a chirp . The computational algorithm can be described as follows:(1)the transform order of is used for the frwpt . If frwpt is applied to the original signal, and the transformed signal is reconstructed from inverse frwpt, then the transform order is that value which results in minimum mean square error between the original and the reconstructed signal . The process may sometimes be long and cumbersome due to its trial and error approach, but it is limited only to once per signal. (2)frft is performed on the input signal, with user defined transform order, followed by wavelet packet transform . This phase is the decomposition phase. (3)inverse wavelet packet transform and inverse frft are performed on the transformed signal with transform order . This phase is the reconstruction phase . If frwpt is applied to the original signal, and the transformed signal is reconstructed from inverse frwpt, then the transform order is that value which results in minimum mean square error between the original and the reconstructed signal . The process may sometimes be long and cumbersome due to its trial and error approach, but it is limited only to once per signal . Frft is performed on the input signal, with user defined transform order, followed by wavelet packet transform . Inverse wavelet packet transform and inverse frft are performed on the transformed signal with transform order . This phase is the reconstruction phase . To further improve the security and improve the proposed watermarking scheme, the host image is preprocessed (scrambled) by applying arnold transform . Consider an image of size n n; the arnold transform is defined by (4)xy=11121112xymodn, where x, y are the coordinates of the image and x, y are the coordinates after scrambling . The proposed scheme can be divided into two phases: the embedding phase and the extraction phase . In the embedding phase, the host image is converted to a reference image and the watermark is embedded on the reference image . During the extraction phase, the watermark is first extracted and then the host image is obtained from the reference image . The embedded watermark is smaller than the host image by a factor raised to the power of 2 along both the directions . The proposed embedding and extraction scheme is shown in figures 2 and 3, respectively . Assuming that i(x, y) represents the original image of size p q, w(x, y) represents the watermark of size p q; the embedding and the extraction phase can be detailed as follows . The proposed watermarking embedding process can be outlined as follows:(1)scramble the host image by applying arnold transform. (2)apply l - level fractional wave packet transform to the arnold transformed image . The subbands obtained are hh, hl, lh, and ll. (3)change the position of the subbands . The pattern to swap / change the image subband is defined by the creator. (4)apply l - level inverse fractional wavelet transform to obtain the reference image iref(x, y) and then divide the reference image into subblocks. (5)apply watermark to the subblocks to obtain the modified reference watermarked image . The modified subblocks are represented by(5)wref = irefx, y+wp, q, where denotes the strength of the watermark . Integrate the subblocks to obtain the reference watermarked image, wref(x, y). (6)perform l - level fractional wavelet transform. (7)change the position of subbands . Perform l - level inverse fractional wavelet transform. (8)apply arnold transform to scramble back the image to obtain the watermarked image, w(x, y). Apply l - level inverse fractional wavelet transform to obtain the reference image iref(x, y) and then divide the reference image into subblocks . The modified subblocks are represented by(5)wref = irefx, y+wp, q, where denotes the strength of the watermark . Apply arnold transform to scramble back the image to obtain the watermarked image, w(x, y). The watermark extraction process can be outlined as follows:(1)apply arnold transform on the watermarked image w(x, y). (2)perform l - level fractional wavelet transform on the arnold transformed image. (3)change the positions of all the subbands. (4)perform l - level inverse fractional wavelet transform to obtain the watermarked reference image, wref(x, y). (5)extract the watermark, w(x, y). (6)perform l - level fractional wavelet transform on the watermarked image, w(x, y). (7)change the positions of all the subbands. (8)perform l - level inverse fractional wavelet transform to obtain the host image, i(x, y). Perform l - level inverse fractional wavelet transform to obtain the watermarked reference image, wref(x, y). Perform l - level fractional wavelet transform on the watermarked image, w(x, y). The watermark used is the bmw logo (any grey scale image can be used); reference image is obtained using 2-level decomposition of frwpt . Since 2-level decomposition gives a block size of 64 64, the watermark is embedded 16 times into the modified reference image to get the watermarked reference image . Table 1 shows the values of psnr and ssim values of the watermarked image with reference to the original image without any attack . The watermarked image is subjected to common attacks to investigate the robustness of the proposed scheme . The attacks considered are average and median filtering, gaussian noise, salt and pepper noise, cropping, resizing, rotation, and sharpening attacks . The performance of the watermarking algorithm under these attacks is tabulated in tables 2 and 3 . The extracted watermark quality is also degraded . When the image is subjected to weiner filtering the image quality this is due to addition of noise which degrades the quality of the image and hence the watermark extracted is degraded . Similar effects are also seen when gaussian noise and salt and pepper noise are added . Cropping is done by deleting certain number of rows and columns . Since a large part of the image was cropped (200 200 pixels towards upper left corner of the image), most of the medical information was removed . But this can be further modified to crop only the non - region of interest, preserving important medical data . The image was rotated by an angle of 5 degrees towards the left and right . The proposed algorithm was also tested for sharpening and contrast adjustments and results show that the proposed scheme could withstand these results . Graphical analysis of the proposed scheme under various common attacks discussed above is depicted in figures 6 and 7 . The graph shows the relation between psnr and correlation coefficient for different values of, where denotes the strength of the watermark . It is observed that the proposed watermarking scheme is not image variant and maintains a linear relationship for most of the mammogram images used . In this work, a robust nonblind medical image watermarking scheme for mammograms was proposed applying frwpt . Experimental results show that the scheme is robust to common attacks like the compression attacks, interference attacks, and signal processing attacks . It is vital to adopt imperceptible watermarks to ensure security issues of integrity and authenticity.
Septic shock is consistently the most common causative factor identified for acute kidney injury (aki) in critical illness, and has been associated with nearly 50% of cases internationally . Despite advances in our understanding of the pathophysiology of septic aki, treatment aimed at reversing or preventing septic aki remains primarily based on supportive haemodynamic management . In the previous issue of critical care, legrand and colleagues examine the association between haemodynamic targets of resuscitation (cardiac output, mean or diastolic blood pressure, central venous pressure (cvp) and central venous oxygen saturation) and development or persistence of aki in a single centre study of patients with septic shock admitted to a surgical icu . The authors found that only higher cvp and low diastolic blood pressure were associated with increased risk of development of new aki, or persistence of renal dysfunction present at icu admission . In these patients importantly, the association between cvp and aki remained when potentially confounding effects of positive fluid balance and higher positive end - expiratory pressure were accounted for in a multivariable analysis . So, a 5 mmhg increase in cvp predicted 2.7-fold odds of new or persistent aki . Furthermore, when the association between different levels of mean cvp and aki was examined in a non - parametric logistic regression, there was a trend for higher cvp to be associated with worse renal outcome for all levels of cvp from 4 mmhg upward, so that a cvp of 15 mmhg was associated with an approximately 80% risk of new or persistent aki, compared to approximately 30% at a cvp of 6 mmhg . These findings are important because current surviving sepsis campaign guidelines recommend fluid resuscitation of patients with sepsis - induced tissue hypoperfusion to target a cvp of 8 to 12 mmhg (or 12 to 15 mmhg in mechanically ventilated patients) within 6 hours of presentation . In patients with sepsis - induced hypotension the rationale for cvp targeted fluid resuscitation is to ensure' adequate cardiac preload and hence maintain cardiac output and organ perfusion . However, absolute levels or changes in cvp poorly predict cardiovascular response as sepsis - induced hypotension is multi - factorial, related to changes in myocardial performance, vascular tone, regional blood flow distribution, venous reservoir capacity and capillary permeability . In contrast, elevated cvp will cause a direct and predictable increase of renal venous pressure that, experimentally, has been associated with elevated renal interstitial and intra - tubular pressure . Resultant renal venous congestion can reduce renal blood flow (lower trans - renal pressure gradient) and decrease the pressure gradient for ultrafiltration (higher intra - tubular pressure). In septic shock, . Aggressive fluid resuscitation beyond reversal of hypovolaemia to arbitrary cvp targets could result in increased venous congestion without substantial benefit to forward renal perfusion, thus predisposing to renal dysfunction . The association between elevated cvp and renal dysfunction has been made previously in the setting of chronic cardiac failure . Now legrand and colleagues have provided evidence that such an association is observed in septic shock and its treatment . Their findings are also in accord with secondary analysis of the vasopressin in septic shock trial, which reported that a more positive fluid balance and elevated cvp were associated with increased mortality in patients with septic shock even when accounting for differences in baseline illness severity and demographics . Although these observational findings are hypothesis - generating rather than confirmatory, they add weight to the literature suggesting the adverse effects of fluid overload in critical illness and aki in particular, effects that may be mediated in part by venous congestion causing impaired organ function . It is now important to determine whether uncritical pursuit of cvp targets such as those advocated by the surviving sepsis campaign might, in some patients, add insult to sepsis - induced organ injury . Prospective data are required to evaluate the true contribution of raised venous pressure to renal and other organ dysfunction and to determine better endpoints for fluid resuscitation in sepsis . Rajkumar rajendram bsc mbbs mrcp frca fficm, specialty registrar in anaesthesia, royal free hospital, london . John r prowle ma msc md mrcp fficm, consultant in renal medicine and intensive care, the royal london hospital, london.
In modern endodontic practice, the number of indications for endodontic periapical surgery is decreasing . Still periapical surgery accounts for 3% to 10% of typical endodontic practice . This case report has been presented to emphasize that all nonvital teeth with periapical lesion should be first treated conservatively, and the treatment mode is to be changed to surgical therapy only when conventional treatment proves ineffective . Oztan and kalaskar et al . Have confirmed that large periapical lesions can respond favorably to nonsurgical treatment using calcium hydroxide paste . Cohn proposed periapical surgery as a predictable option when root canal treatment is either not possible or fails . Thus surgical endodontic treatment is indicated in limited number of cases of persistent periradicular pathosis . Selection between alternative treatments should be based on assessment of individual case, as done in the present case report . A meticulous removal of periapical granulation tissue is an important aspect of surgical endodontic treatment . Removal of very large anterior cysts in maxilla may produce oro - nasal communication in cases wherein the cyst has destroyed the bony floor of the nasal cavity, with only soft tissue lining left in between . An innovative method of surgical removal of the periapical lesion to save teeth with periapical pathosis refractory to conventional treatment and to preserve the adjacent vital structures has been introduced . The large through and through periapical pathosis with both buccal and palatal bone loss is managed by periapical surgery adopting a novel method of separation of lesion after nonresponsiveness of the pathosis to intracanal medicament and of the smaller periapical pathosis to long - term intracanal medicament . To the best of our knowledge, a 19-year - old female patient was referred to the department of conservative dentistry and endodontics with the chief complaint of pain and recurrent swelling in the upper front teeth region since 10 to 12 weeks . Medical history and investigations did not reveal anything that could oppose or influence the proposed treatment plan . On clinical examination, labial and palatal swelling was seen in association with maxillary right central incisor (tooth no . Maxillary right and left central incisors (tooth no 11 and 21) were discolored and fractured . 11, 12, 13 and 21 gave a negative response with the electrical pulp tester (digitest, farmingdale, ny). The maxillary occlusal radiograph showed a large radiolucent periapical lesion in association with maxillary right anterior teeth and a relatively small radiolucent periapical lesion in association with maxillary left anterior tooth [figure 1]. Preoperative radiograph based on the history, clinical examination, sensitivity test and radiographic examination, a diagnosis of pulp necrosis with symptomatic periapical pathosis was made for the right maxillary central incisor, lateral incisor and canine . A decision of conventional root canal treatment with the placement of intracanal medicament was made after discussion with the patient . The operative field was isolated, and access preparation was done in 11, 12, 13 and 21 without local anesthesia . After the radiographic determination of the working length, biomechanical preparation following step back method was done using 2.6% sodium hypochlorite and normal saline as an irrigating agent . Iodine containing calcium hydroxide (vitapex, neo dental chemical products, tokyo, japan) was placed as intracanal medicament, and the root canal access was sealed with zinc oxide eugenol cement at the end of the first appointment . After 21 days, the patient reported with no relief from her symptoms . There was no resolution of the buccal - palatal swelling, and tenderness to percussion continued to be present in 11, 12 and 13; but tooth 21 became asymptomatic . Teeth 11, 12 and 13 were obturated with zinc oxide eugenol sealer and gutta - percha using the lateral condensation technique . Assessment of the surgical site showed adequate mouth opening, little attached gingiva and adequate depth of the vestibule . Local anesthesia of 2% lignocaine with 1:80,000 adrenaline was infiltrated in the alveolar buccal mucosa superficial to the periosteum at the level of root apices from 13 to 21 to get added advantage of less surgical bleeding . The buccal full - thickness triangular mucoperiosteal flap was elevated to expose the area of periapical lesion . Already existing pathological cortical bone window was expanded until underlying pathology was adequately exposed and sufficient space was available for thorough curettage . Sterilized gauze was placed between the pathological soft tissue mass and the lateral wall of the crypt, and lateral pressure was applied on the gauze with the concave surface of the curette facing the bone . This helped in separation of the periapical lesion from the surrounding bone and the nasal mucosal and palatal linings [figure 2]. The dental assistant supported the palatal lining from inside the oral cavity with his finger while the cystic lining was being separated from the palatal lining . The periodontal curette was used to remove the tissue firmly attached to the root surface [figure 3]. Caution was exercised in separating the lesion from the roof because no intervening bone was present between the nasal lining and the lesion . However, the lesion was curetted in toto, leaving the nasal and the palatal linings intact . Sterilized gauze placed between the soft tissue mass and the lateral wall of the crypt from the distal aspect with the curette after separation of the periapical lesion from the surrounding bone and the nasal and palatal linings but attached to the root surface the enucleated periapical lesion was stored in 10% buffered formalin solution and sent for histopathological examination . The root resection was not done to maintain maximum cemental covering on the root surface and to maintain the original root length to help tooth stability . The bone cavity was irrigated with sterile normal saline and gently dried with moist gauze . Careful clinical and radiographic inspection of the area was done to ensure no residual lesion tissue was left behind . The flap was repositioned and the flap margins were ensured to rest on sound bone . On the 4 postoperative day, healing of covering mucosa with primary intention was observed and the sutures were removed . The patient was free from all symptoms and signs with optimum tissue healing at the 6-month follow - up visit . Tooth 21 was obturated with zinc oxide eugenol sealer and gutta - percha using lateral condensation technique . A radiographic review at the 1-year follow - up showed good evidence of bone healing bilaterally [figure 4]. Conservative approach of treatment of any lesion is always preferable over surgery as most periapical lesions are the result of an inflammatory response to bacterial infection within the root canal, i.e., intracanal infection . Nonsurgical root canal treatment involves cleaning and disinfecting the root canal system, thereby reducing the bacterial load and creating an environment in which periapical healing can occur . This has limited periapical surgery in contemporary dental practice to very selective cases those in which the causative factors are located outside the root canal, such as microorganisms colonizing the periapical tissues, cysts and foreign body reactions . To prevent tooth loss, surgical solution for the inflammatory periapical lesions was considered in the present case as right maxillary anterior region did not respond favorably to conservative treatment . Nonsurgical root canal treatment using calcium hydroxide as intracanal medication was attempted on both sides, emphasizing conservative treatment, expecting that the long - term intracanal medicament will be effective in resolving the periapical lesions . Follow - up after 21 days revealed, left tooth was asymptomatic but the teeth in the right region were symptomatic . Treatment for the right side was changed to surgical intervention according to the clinical need . Intracanal medicaments are advocated to eliminate remaining bacteria after chemomechanical instrumentation, even in the inaccessible areas of the root canal system, reduces inflammation of the periapical tissues, dissolves remaining organic material and counteracts coronal microleakage . In the case presented here, calcium hydroxide intracanal medicament created a more favorable environment leading to healing of periapical lesion in the left central incisor . The periapical lesion on the right side, however, did not respond to the intracanal medicament because of the causative factor being located beyond the root canal system, viz . . Conventional method of removing soft tissue from the bony crypt consists of using curettes . Curettes are initially used with the concave surface facing the internal wall of the osseous crypt to separate the soft tissue lesion from the lateral borders of the crypt and subsequently used in a scraping manner to remove the remainder of the lesion from the osseous defects . Curette being sharp margined, there always remains a risk of penetration of the vital anatomic structures or pathological soft tissue mass, which will make the removal of the tissue mass difficult and time consuming . The surgical technique is a fundamental consideration, since it largely conditions the prognosis of periapical surgery . A novel method of separation of lesion was adopted in this case with large periapical lesion to prevent injury to other surrounding vital anatomic structures . Caution was required in separating the lesion from the roof because no intervening bone was present between the nasal lining and the lesion . Application of gentle lateral pressure on the sterilized gauze placed between the pathological soft tissue mass and the lateral wall of the crypt with the concave surface of the curette facing the bone to free the soft tissue in the present case helped in the removal of the entire tissue mass without injuring the nasal mucosa and palatal lining . The present method has the advantage of more predictable removal of the soft tissue lesion in toto because of the blunt technique used, compared to using sharp curettes with higher chances of penetration of the soft tissue lesion making the removal of the remaining tissue tags difficult and more time consuming . At the same time, the present method results in greater safety of the approximating vital and vulnerable anatomical tissues, resulting in better postoperative comfort and outcome for the patient . At the 6-month and 1-year postoperative recall examination, the teeth were asymptomatic and radiographically showed signs of healing of periapical lesions . Evaluating success of the periapical surgery based on clinical and radiographic criteria of von arx and kurt it can be concluded that endodontic treatment with calcium hydroxide as intracanal medicament might be a viable approach for promoting periapical healing and success in root canal treatment in nonvital teeth associated with periapical lesion . However, periapical surgery may be the only alternative when the tooth with periapical lesion fails to respond to calcium hydroxide as intracanal medicament . To prevent injury to other vital anatomic structures, a novel method of surgically treating large periapical lesions has also been introduced in the present case report.
It has been well established that patients with end - stage renal disease (esrd) undergoing hemodialysis (hd) had a higher association of peripheral arterial disease (pad), lower extremity amputation (lea), and foot ulcerations (fu) [13]. Such an association could be attributed to a common atherosclerotic cause . Moreover, diabetic patients with esrd had a 10-fold increased risk of lea in comparison to diabetes patients without renal insufficiency . Several studies have reported increased rates of lea among esrd patients, irrespective of the concomitant presence of diabetes mellitus (dm) [46]. The mechanism of fu development is multifactorial which depends upon various physiological, mechanical, and treatment factors . Reported significantly higher incidence of foot complications in patients with concomitant esrd and dm in comparison to those who had only dm suggesting a possible relationship between esrd and fu . In addition, lea and fu are well established complication of diabetic nephropathy [8, 9]. Margolis et al . Observed a strong correlation between progressions of chronic kidney disease (ckd) with the development of diabetic fu . Game et al . Also demonstrated a close association of fu and amputations in diabetic patients started to undergo dialysis . Performed a meta - analysis to look for the relationship of diabetic fu with cardiovascular disease (cvd) and all - cause mortality . The authors found an increased association of cvd and mortality in diabetic patients with fu in comparison to those without fu . Interestingly, a recent study advocated a higher incidence of risk factors (pad and peripheral neuropathy) for fu among hd patients . In qatar, an earlier report from our center identified a high incidence of pad in hd patients . However, there is a lack of information that describes the risk factors and prognostic implications of fu among hd patients in the arab middle east . We aim to evaluate this association and its impact on the outcomes over a 5-year period . We conducted a retrospective analysis of all hemodialysis patients enrolled at the hd unit at hamad general hospital (hgh), qatar, over five years (20072012) duration . Patients surviving for at least 3 months on the initial hd were included in the study . Hd patients were categorized into two groups according to whether they had foot ulcer (fu) or not (no - fu) based on physical examination . The attending physician in the hd unit collected the data regarding the demographics characteristics, clinical evaluation, medical history, and comorbidities . During the follow - up period over 5 years, hd - related procedures such as vascular access (arteriovenous fistula, arteriovenous grafting, and tunneled catheter), renal transplantation, and vascular complication were also reported . The need for 3 vascular accesses (due to mechanical obstruction, poor flow, or infection) had been analyzed . We speculated that hd patients with fu had poor outcomes compared to no - fu patients . The study end - points (major amputation, vascular complications, and mortality) were also subanalyzed according to the presence or absence of dm and pad . Fu was defined according to the clinical findings as a full thickness skin break below the level of malleoli . Patients were considered to have pad if they had one of the following criteria: abi <0.9, history of intermittent claudication, vascular bypass or endovascular intervention for occlusive vascular disease, or amputation due to occlusive vascular disease . Major amputations were defined as amputations proximal to the ankle joint, and minor amputations were defined as those through or distal to the ankle joint . Diabetic nephropathy was diagnosed during patient follow - up in the nephrology out - patient clinic according to the patient chart . It was defined as presence of macroalbuminuria that is a urinary albumin excretion of more than 300 mg in a 24-hour collection or macroalbuminuria and abnormal renal function as represented by an abnormality in serum creatinine, calculated creatinine clearance, or glomerular filtration rate . Analyses were conducted using the student's t - test for continuous variables and pearson chi - square () test for categorical variables . Multivariate logistic regression analysis was performed for predictors of development of fu and mortality . Adjusted odds ratios (or), 95% ci, and p values a significant difference was considered when the two - tailed p value was <0.05 . Data analysis was carried out using the statistical package for social sciences version 18 (spss inc ., the study has been approved by the medical research center, hamad medical corporation, qatar (irb #12007/12). A cohort of 252 hd patients was included in the study, of which 42 had fu (17%) and 210 were without fu . Demographic, clinical characteristics, and risk factors for hd patients with and without fu were shown in table 1 and figure 1 . Patients with fu were 6 years older and had higher incidence of retinopathy (67% versus 40.5%; p = 0.002), polyvascular disease (26.2% versus 6.7%; p = 0.001), angina (24% versus 11%; p = 0.02), pad (71% versus 32%; p = 0.001), and nephropathy (79% versus 42%; p = 0.001) compared to no - fu patients . Also, a high percent of patients needed tunneled catheters (88% versus 82%; p = 0.03) and aspirin (62% versus 45%; p = 0.04) in the fu group, whereas, history of renal transplant (14% versus 2.4%; p = 0.03) was observed more in no - fu group . Patients in fu group also had higher percentage of dm (83.3% versus 56%; p = 0.001), major amputation (26% versus 1%; p = 0.001), need for 3 vascular accesses (69% versus 47%; p = 0.01), and coronary artery disease the two groups were comparable regarding the mean baseline laboratory investigations (table 2). Similarly, the percentage of dyslipidemia, hypertension, smoking, and cerebral vascular accident (cva) was comparable between the two groups (table 1). The types of hd vascular accesses such as arteriovenous fistulas, graft, or catheter were comparable in the 2 groups . Overall mortality rate within 3 years was 24.2% among the study cohort and was comparable between the two groups . Development of pad (71% versus 32%; p = 0.001), new foot ulcers (47.6% versus 2.4%; p = 0.001), and need for major amputation (16.7% versus 1%; p = 0.001) were significantly higher among fu group as compared to no - fu group . In the following two years, significantly more number of patients in fu group developed new pad (22% versus 1.4%; p = 0.001), underwent major amputation (22% versus 0%; p = 0.001), and died (70.4% versus 17.5%; p = 0.001) in comparison to no - fu group (table 1). The frequency of renal transplant and angina was comparable among both the groups, while cerebral vascular accident (3.5%) was only observed in no - fu group . Figure 2 shows that dm patients had significantly higher incidence of fu (23% versus 7%; p = 0.001), need for major amputation (8.6% versus 0%; p = 0.003), and mortality (65% versus 23%; p = 0.001) than non - dm patients . In dm group, figure 3 demonstrates the outcomes in hd patients based on the presence / absence of dm and/or pad . Patients who had pad showed increased incidence of fu (41% versus 4%; p = 0.001), major amputation (14% versus 2%; p = 0.02), and mortality (80.5% versus 29%; p = 0.001) than non - pad . On the other hand, among non - dm patients of these patients, mortality rate was significantly higher among pad group (39% versus 13%; p = 0.007) in comparison to non - pad . Univariate analysis (figure 1) shows the mortality rate in patients with fu in both diabetic and nondiabetic patients . On multivariate analysis, after adjusting for dm, hba1c, age, and gender, the presence of pad was the major independent predictor of development of fu in hd patients with an adjusted odd ratio (aor) of 16.0 (95% confidence interval (ci): 4.4162.18, p = 0.001) followed by duration of hd with aor 1.14 (95% ci: 1.0051.299, p = 0.042). Furthermore, after adjusting for age, sex, and cad, predictors of mortality in hd patients were pad (aor 4.1; 95% ci: 1.948.59, p = 0.001), fu (aor 3.6; 95% ci: 1.2810.002, p = 0.01), and dm (aor 2.7, 95% ci: 1.235.89, p = 0.01) (figures 4 and 5). The present study highlights the frequency and implications of fu in patients undergoing maintenance hd over a 5-year duration . The mortality rates were higher in patients with fu in both diabetic and nondiabetic patients; however it was relatively higher in diabetic patients . Moreover, fu was associated with 4-fold increased risk of mortality after adjusting for age, sex, and cad . Presence of pad was associated with 16-fold increased risk of fu in hd after adjustment for age, sex, dm, and duration of hd . Patients in the fu group underwent higher number of repeated hd vascular accesses in comparison to non - fu group . Recent studies have identified an increased risk of fu and lea in ckd patients who did not receive renal replacement therapy [10, 17]. Other studies investigated patients of combined dm with esrd and found a higher risk of fu in patients undergoing hd [11, 15]. A swedish study demonstrated a 2.45 times increased risk of lea in esrd patients compared to those without esrd . Similarly, prompers et al . Found the risk of nonhealing of fu to be 2.3-fold higher in esrd than in non - esrd patients . The correlation between dialysis and foot complications among patients with dm and ckd has been initially described by mcgrath and curran . They observed 50% mortality rate at one - year follow - up after lea . In our study, the rate of major amputation was significantly higher in fu patients which corroborates with an earlier study showing increased rate of amputation in ckd patients undergoing dialysis (57%) as compared to those without dialysis (25%). The relevance of selecting fu in our report is that it is potentially preventable, and its progression generally leads to serious foot complications, major amputation, and mortality . In their long - term follow - up study (10 years), morbach and coworkers concluded that patients with diabetic foot had high mortality particularly in the presence of pad or renal failure . In comparison to that study, our 5-year study showed that fu patients had higher mortality (81% versus 70.4%) although our patients were 6 years younger and less likely to have dm (83% versus 100%) and pad (34% versus 55.5%). Moreover, the entire cohort of the present study was undergoing hd (100% versus 4%). The association of severe complications in hd patients might be attributed to the cardiovascular risk factors . Several contributing factors have been proposed for the development of fu in patients with esrd and dm . The important risk factors for the development of diabetic fu involve distal polyneuropathy, microangiopathy, and macroangiopathy . Also, cardiovascular autonomic neuropathy is another coexisting complication of dm . The authors found that pad is independently associated with esrd . According to one of our recent studies, pad patients had 4- to 5-fold increased incidence of fu and lea in comparison to non - pad patients . In our study, a higher incidence of retinopathy, polyvascular disease, angina, pad, and nephropathy was associated with fu . Studied the risk factors associated with prevalent fu in patients with dm and ckd (predialysis versus on - dialysis). The authors reported that dialysis therapy and previous fu were the only independent predictors of the development of new fu . Kaminski et al . Reported a high prevalence of risk factors for fu present in patients with esrd either with or without the coexistence of dm . The authors did not indicate the severity of esrf or whether the patients were on dialysis or not . . Found that dm, preexisting comorbidities, cvd, hd inadequacy, and lower serum albumin level are the major factors for lea . Consistent with our findings, a recent meta - analysis reported higher association of cvd, dm, and fu . Ischemic in comparison to neuropathic ulcers are associated with higher mortality rate . Moreover, the marked inflammatory response during the process of ulceration has a significant role in the initiation and worsening of the atherosclerosis . In our study, among hd patients without diabetes, only 7% developed fu, despite a high prevalence of pad and cad . Wolf et al . Reported that the presence of dm in esrf patients increases the risk of lea 10 times in comparison to those who are diabetic without esrf . Moreover, during hd, around 4% of patients require an amputation each year [17, 25]. Our subanalysis showed significantly higher incidence of fu, amputation, and mortality in diabetic patients than in non - dm patients . Also, patients with combined dm and pad revealed increased association of fu, amputation, and mortality . Our findings are supported by a large meta - analysis which showed that pad is independently associated with cvd and all - cause mortality . Further, the authors reported an increased risk of all - cause mortality in diabetic patients who developed fu than in diabetics without fu . It is not possible to specify the extent of infection, neuropathy, ischemia, depth, or extent of tissue loss grade of fu . Another limitation is the additive effect of diabetes on hd patients who developed foot ulcers . We did not know how many hd patients developed dm during the follow - up . In order to confirm our findings, large sample - sized studies are needed to establish the implications of fu in hd patients . Abi <9 was used as a part of the diagnosis of pad which may lead to underestimation of the disease . Previous data showed that as with low abi, high rates of mortality, vascular events, and amputation were reported in patients with high abi or noncompressible vessels . In a large study of patients with dm and cad, singh et al . Reported a high prevalence of arterial stiffness, similar to that seen in older individuals and dialysis patients . (2014) defined pad as an abi <0.9 or> 1.4, these high abi values were observed in patients with diabetes, particularly for those with concomitant ckd . In conclusion, hemodialysis is a significant risk factor for fu which needs special attention . Further, pad is significantly associated with fu, amputation, and mortality in diabetic hd patients . The increased risk of mortality could be explained by the greater burden of cvd in these patients . Therefore, hd patient needs intensive foot care to avoid complications of the lower limb and warrant progressive modification of cvd risk factors.
The neuronavigation had proven to be a great device for the surgical treatment of variable neurosurgical problems such as tumor resection or biopsy, the surgery for epilepsy, vascular neurosurgery, the localization of functional and eloquent area, spinal neurosurgery and the operation for hydrocephalus9,13,16,17). Because the device helps the identification of pathologic condition and intraoperative anatomy distorted by pathologic anatomic conditions, the application of this device makes the operations more exact, safe, fast and less invasive due to finding the way and avoiding collision16,17). The endoscopic surgery in pediatric patients can also be applied to the some operations such as shunt for the hydrocephalus, the fenestration for the cystic lesion and the biopsy or resection of intraventricular and periventricular lesions . But the pathologic condition distorts the normal anatomy, so the operator confuses normal anatomical structures in small endoscopic surgical view . For these difficulties the pinless electromagnetic (em) image - guided neuronavigation has expanded the application of neuronavigation in intracranial neurosurgery, because the other neuronavigation systems needed the rigid pinning cranial fixation, these techniques were not always suitable for very young patients13). In addition, some reported that this device has proven to be successful in pediatric patients17,18). In this study, the usefulness of em neuronavigation is described with the review for the neuroendoscopic surgery in 11 pediatric surgical cases in one institute . Between jan . 2007 and jul . 2011, nine pediatric patients (8 boys and 1 girl) were managed with endoscopic surgery using pinless em neuronavigation (axiem, medtronics, usa). The age of the patients ranged from 4 months to 12 years (mean age: 4.0 years old). A total of 11 neuroendoscopic procedures on 9 patients with cystic lesions (7 patients) and hydrocephalus (2 patients) were performed . The cystic lesions consisted of five arachnid cysts and two ependymal cysts . In two hydrocephalus, one patient had an obstructive hydrocephalus due to an aqueductal stenosis by a tectal glioma and the other had the multi - loculated hydrocephalus caused by ventriculitis and ventricular abscess . The clinical signs and symptoms were increased head circumference, headache or the prematurity (table 1). Then the registration with fiducial markers and em stylets was performed . With the guidance of neuronavigation the clinical outcome of the procedure was evaluated by improvements of symptoms and sign and the postoperative radiologic study . On classical optical neuronavigation with rigid pinning cranial fixation, preoperative 1a) which were attached on patient's head (scalp and/or face). In the operation room (or), the patient's head was fixed with rigid pinning fixation such as mayfield frame (fig . The preoperative navigation - image was transported to the navigation workstation in or and reconstructed to 3-dimensional image . And then the position of the infra - red camera was controlled to recognize the reference frame and navigation pointer . At the end of the registration, the fiducial markers on patient's scalp were removed and the surgery started . On pinless and frameless neuronavigation, adhesive tape replaces rigid pinning fixation as the fixation of head . The patient's head was put on the gelly head ring and electromagnetic coil was installed around head (fig . On classical optical neuronavigation with rigid pinning cranial fixation, preoperative mri or ct was performed with several fiducial markers (fig . 1a) which were attached on patient's head (scalp and/or face). In the operation room (or), the patient's head was fixed with rigid pinning fixation such as mayfield frame (fig . The preoperative navigation - image was transported to the navigation workstation in or and reconstructed to 3-dimensional image . And then the position of the infra - red camera was controlled to recognize the reference frame and navigation pointer . At the end of the registration, the fiducial markers on patient's scalp were removed and the surgery started . On pinless and frameless neuronavigation, adhesive tape replaces rigid pinning fixation as the fixation of head . The patient's head was put on the gelly head ring and electromagnetic coil was installed around head (fig . All procedures were performed with using of em neuronavigation and not interfered by any magnetic devices during navigation . The fenestration was performed for the cystic lesion and made on the cystic wall for communication to cistern and/or ventricle . The csf diversion was performed for the patients suffered with hydrocephalus and included shunt operation, third ventriculostomy and septostomy . The combined procedures were performed at the same time in some cases . In author's study, the fenestration was used in 8 cases and the csf diversion in 6 cases . In all cases, the goal of surgery was accomplished successfully at the time of surgery, as confirmed immediately by postoperative imaging with the check of multiple pneumocephalus as the evidence of communication between the lesion and other space such as cistern or ventricle . Surgery related intraoperative problems such as error of the surgical trajectory, the csf leakage, infection and the injury of neurovascular structures were not occurred in all patients . And one patient (case 6) had mild third nerve palsy due to manipulation intraoperatively and that was transient . The imaging study for postoperative status and follow - up showed the improvement and the stabilization of the lesion in 7 cases . In 2 cases, all patients have the improvement of preoperative symptom and normal development except one baby who was transferred to the other hospital during follow up on out - patient department . A 4-month - old male infant visited to the hospital due to incidentally detected intracranial cystic lesion . The baby was born with 2820 gram body weight at 38 weeks 5 days of gestation . The cystic lesion was detected on prenatal ultrasonography and the size enlarged on follow up examination . Brain mri demonstrated about 8 cm sized interhemispheric multiloculated cystic lesion without enhancement and associated hypogenesis of corpus callosum, right lateral ventricular dilatation (fig . The baby underwent endoscopic cystic wall fenestration at multiple sites and insertion external ventricular drainage (evd) catheter in the cyst . Postoperative brain ct showed decreased size of the cyst and subdural hygroma on bilateral frontoparietal region (fig . But the cyst was enlarged again with the aggravation of ventriculomegaly on postoperative imaging study of 3 months (fig . Therefore, the endoscopic cyst fenestration and ventriculoperitoneal shunt was performed because the function of csf circulation might be impaired . The size of cyst and ventricle decreased and the brain mantle has gotten thicker (fig . A 2-year - old boy visited with the complaint of prolonged headache after slipping down . On neurological examination, there was no specific finding . Brain ct showed about 6.5 cm sized cystic lesion on the right middle cranial fossa with midline shifting to the left side by 7 mm (fig . The neuroendoscopic cyst fenestration with the guidance of em neuronavigation and the insertion of evd catheter were performed . The boy discharged with the removal of evd catheter and mild ptosis and medial gaze limitation on right eye . On the follow - up on out - patient department, 4b). A 12-year - old boy visited to the hospital due to intermittent syncope and headache . There was no abnormal finding on neurological examination, on past history and on other examination such as electrocardiography . However, brain mri demonstrated about 8 cm sized cystic lesion on antrum of left lateral ventricle without hydrocephalus (fig . He underwent pinless em image - guided neuroendoscopic septostomy and ventriculo - cystostomy through a right postcoronal burr hole on prone position . Postoperative brain ct demonstrated pneumocephalus on frontal horn of both lateral ventricles without any acute hemorrhagic or ischemic lesion (fig . Postoperative neurologic examination was non - specific . On follow - up, the size of cyst had decreased (fig . A 4-month - old male infant visited to the hospital due to incidentally detected intracranial cystic lesion . The baby was born with 2820 gram body weight at 38 weeks 5 days of gestation . The cystic lesion was detected on prenatal ultrasonography and the size enlarged on follow up examination . Brain mri demonstrated about 8 cm sized interhemispheric multiloculated cystic lesion without enhancement and associated hypogenesis of corpus callosum, right lateral ventricular dilatation (fig . The baby underwent endoscopic cystic wall fenestration at multiple sites and insertion external ventricular drainage (evd) catheter in the cyst . Postoperative brain ct showed decreased size of the cyst and subdural hygroma on bilateral frontoparietal region (fig . But the cyst was enlarged again with the aggravation of ventriculomegaly on postoperative imaging study of 3 months (fig . Therefore, the endoscopic cyst fenestration and ventriculoperitoneal shunt was performed because the function of csf circulation might be impaired . The size of cyst and ventricle decreased and the brain mantle has gotten thicker (fig . A 2-year - old boy visited with the complaint of prolonged headache after slipping down . On neurological examination, there was no specific finding . Brain ct showed about 6.5 cm sized cystic lesion on the right middle cranial fossa with midline shifting to the left side by 7 mm (fig . The neuroendoscopic cyst fenestration with the guidance of em neuronavigation and the insertion of evd catheter were performed . The boy discharged with the removal of evd catheter and mild ptosis and medial gaze limitation on right eye . On the follow - up on out - patient department, the symptom improved and the size of the cyst decreased (fig . 4b). A 12-year - old boy visited to the hospital due to intermittent syncope and headache . There was no abnormal finding on neurological examination, on past history and on other examination such as electrocardiography . However, brain mri demonstrated about 8 cm sized cystic lesion on antrum of left lateral ventricle without hydrocephalus (fig . He underwent pinless em image - guided neuroendoscopic septostomy and ventriculo - cystostomy through a right postcoronal burr hole on prone position . Postoperative brain ct demonstrated pneumocephalus on frontal horn of both lateral ventricles without any acute hemorrhagic or ischemic lesion (fig . Postoperative neurologic examination was non - specific . On follow - up, the size of cyst had decreased (fig . A 4-month - old male infant visited to the hospital due to incidentally detected intracranial cystic lesion . The baby was born with 2820 gram body weight at 38 weeks 5 days of gestation . The cystic lesion was detected on prenatal ultrasonography and the size enlarged on follow up examination . Brain mri demonstrated about 8 cm sized interhemispheric multiloculated cystic lesion without enhancement and associated hypogenesis of corpus callosum, right lateral ventricular dilatation (fig . The baby underwent endoscopic cystic wall fenestration at multiple sites and insertion external ventricular drainage (evd) catheter in the cyst . Postoperative brain ct showed decreased size of the cyst and subdural hygroma on bilateral frontoparietal region (fig . But the cyst was enlarged again with the aggravation of ventriculomegaly on postoperative imaging study of 3 months (fig . Therefore, the endoscopic cyst fenestration and ventriculoperitoneal shunt was performed because the function of csf circulation might be impaired . The size of cyst and ventricle decreased and the brain mantle has gotten thicker (fig . A 2-year - old boy visited with the complaint of prolonged headache after slipping down . On neurological examination, there was no specific finding . Brain ct showed about 6.5 cm sized cystic lesion on the right middle cranial fossa with midline shifting to the left side by 7 mm (fig . The neuroendoscopic cyst fenestration with the guidance of em neuronavigation and the insertion of evd catheter were performed . The boy discharged with the removal of evd catheter and mild ptosis and medial gaze limitation on right eye . On the follow - up on out - patient department, a 12-year - old boy visited to the hospital due to intermittent syncope and headache . There was no abnormal finding on neurological examination, on past history and on other examination such as electrocardiography . However, brain mri demonstrated about 8 cm sized cystic lesion on antrum of left lateral ventricle without hydrocephalus (fig . He underwent pinless em image - guided neuroendoscopic septostomy and ventriculo - cystostomy through a right postcoronal burr hole on prone position . Postoperative brain ct demonstrated pneumocephalus on frontal horn of both lateral ventricles without any acute hemorrhagic or ischemic lesion (fig . Postoperative neurologic examination was non - specific . On follow - up, the size of cyst had decreased (fig . The neuroendoscopy has used since 1922 by dandy1) and the appliance of endoscopy are variable in neurosurgical area22): the biopsy or resection of intraventricular or periventricular lesion, third ventriculostomy, cyst fenestration for arachnoid or ependymal cyst, aqueductal stenosis, multilobulated hydrocephalus and the insertion of intraventricular catheter such as shunt proximal tip and ommaya reservoir etc . This procedure requires exact anatomic orientation for every step of the operation due to narrow surgical view . However, this procedure had relative high complication rate that reported up to 20%6,14,17,19,22): the neurovascular injury, csf leakage and infection, seizure and subdural fluid collection (table 2). And abtin et al.1) and navarro et al.14) reported the discontinuation of the procedure due to the lack of anatomical landmark with distorted intracranial anatomy in several cases . After the appliance of the neuronavigation makes the neurosurgical procedures more safe and easy, so it can help to reduce the complication and morbidity and improve outcome in neurosurgical procedures13,17) (table 2). And the appliance of the neuronavigator helps the operator understand the orientation of distorted anatomy and blind areas over the septum and the cystic wall20). But the classical optical neuronavigation with rigid cranial fixation has some limitations for the application . The fixation has a risk of scalp laceration, skull fracture, extradural hemorrhage and intracranial injury13,17). In addition, the pain involved in using the fixation cause the increased use of anesthetic agents and the increased operation time7). The rigid pinning makes that the appliance to children with thin and immature skull is especially difficult . Therefore, the advance of pinless neuronavigation can lead to an increase in its range of uses in several neurosurgical conditions including pediatrics17). But this system does not solve the limitation of the operator's motion and that of the head fixation with adhesive tape . Em neuronavigation leads to be non - invasive due to the use without rigid pinning cranial fixation and with free head motion on the operation . Due to non - invasiveness, the system can apply to very young pediatric patients who have very thin and immature skull . This advantage makes lower limitation of the application neuronavigation in age . As shown table 2, the age in which neuroendoscopic surgery was performed is lower in em neuronavigation than in classical neuronavigation . The system needs shorter time for set - up and registration compared with previous neuronavigation system . In addition, it allows head movement at any time after registration with no restriction on the freedom of movement of instruments within the surgical field and does not limit the operator motion due to no need of optical line between the pointer, reference frame, and the infrared camera . Also, the operation using neuronavigation can be performed under local anesthesia due to no fixation with pinning frame9,11,13,15 - 17,21). In an author's case, which was 5 months baby with congenital hydrocephalus, this device was very useful to decide the proper trajectory for proximal shunt tip with the change of head position after registration . Several operators reported the appilication of em neuronavigation on neuroendoscopic surgery in variable conditions3,7,9,13,17). Mcmillen et al.13) applied em neuronavigation in 13 months children who had obstructive hydrocephalus caused by cystic hypothalamic glioma . In the case, neuroendoscopic surgery for shunt and cyst fenestration was performed in two different surgical points with head reposition without accuracy changes . In this study, the patient (case 1) had post - infectious multiloculated hydrocephalus and needed multiple fenestrations for multiple cystic walls . The decision for the site to fenestrate was difficult, because the loculated walls were not defined exactly and not discriminated clearly from normal ventricular walls, in addition, normal anatomy was distorted . Em neuronavigation without rigid pinning fixation was able to been applied for endoscopic surgery usefully and successfully . Hayhurst et al.9) suggested some indications for appliance of em neuronavigation in neurosurgical procedures (table 3). Among them, the em neuronavigation had additional several usefulness in neuroendoscopy with the advantage of previous system as follows2,8,9,13,16,17,23): 1) the control of probe's depth due to the flexibility of the probe is feasible . 2) this system allows to be passed through the endoscope working channel for use in fenestration of both arachnoid and floor of the third ventricle on the tip of the endoscope . 4) the handling of endoscope containing em probe is not difficult due to a character of weightless stylet . 5) if the endoscope needed to be repositioned, the navigation stylets could easily be replaced in the endoscope's working channel to confirm the location of the tip of the instrument . 6) the additional procedure with head reposition can be performed without distortion of preoperative registration . The navigation devices such as probe and tracer were disposable and expensive, and some authors reported that the accuracy for application is lower than other system . In addition, it has the risk of loss of sterility and unsuspected injury in awaken procedures due to not rigidity fixation9,17,21). Some authors reported that the em neuronavigation in the insertion of the shunt proximal catheter insertion can be worthier than the cost of stylets because the costs for revision and/or complications which caused by not using em neuronavigation might be higher than the cost for usage of em neuronavigation7,9). In addition, rosenow and sootsman15) and mascott12) reported that application accuracy of em neuronavigation is not lower than optical navigation . The usefulness of em neuronavigation in neuroendoscopy has been reported and proven by several authors and cases . This technique in 9 pediatric patients who were younger than 12 year - old showed successful surgical management in this study, however, there were too small cases to prove usefulness of em neuronavigation compared with other authors . But this result of operations is similar with others and can be supports for usage of em neuronavigation and help prove usefulness of em neuronavigation in neuroendoscopic surgery . The appliance of the neuronavigation reduces the complication rate and enhances for the indication of the neuroendoscopic surgery . But the use of classical optical neuronavigation which needs rigid pinning fixations has been limited in several situations such as pediatrics with immature skull . Em neuronavigation, in this aspect, solved that problem without using rigid pinning fixation . In conclusion, it can be a useful device and alternative to a classical optical neuronavigation in the pediatric neuroendoscopic surgery.
One hundred forty - seven clinical isolates of m. tuberculosis were obtained from the molecular mycobacteriology laboratory, department of microbiology, faculty of medicine, siriraj hospital, mahidol university, thailand, and the t-2 project from 1997 to 2001 (table). These strains were isolated from 74 cerebrospinal fluid (csf) samples and 73 sputum samples from 147 different patients . Dna from these isolates was isolated by an enzymatic method and submitted for genotyping by performing the is6110 restriction fragment length polymorphism with the standard method (12) and for sequencing the pks15/1 region (8). * csf, cerebrospinal fluid . Using the genotyping results, we categorized m. tuberculosis isolates into beijing, single - banded, few - banded (25 bands), nonthaburi, and heterogeneous with> 5 bands (table and figure 1), as recently reported (13,14). All m. tuberculosis genotypes were sequenced around the junction of pks15 and pks1 (corresponding to the m. tuberculosis h37rv sequence) to determine whether they contained an intact pks15/1 or separated pks15 and pks1 . Unexpectedly, the results showed that the 7-bp insertion of pks15 that causes a frameshift mutation resulting in an intact pks15/1 was found in most strains of all genotypes, except the heterogeneous group with> 5 bands (table and figure 2). R indicates the m. tuberculosis mt 14323 strain used as the positive control for is6110 typing . Sequence alignment of region corresponding to the 3 portion of pks15 and 5 portion of pks1 in various mycobacterium tuberculosis genotypes . B) m. tuberculosis strains isolated from sputum . Letters in brackets refer to is6110 restriction fragment length polymorphism patterns: bj, beijing; sb, single banded; fb, 25 bands; nb, nonthaburi; h, heterogeneous . The 7-bp insertion is shown in boldface, and the start codon of the pks1 gene is underlined . The intact pks15/1 has been shown to be responsible for the production of phenolic glycolipids and is seemingly found in m. tuberculosis w - beijing family, but it was not found in m. tuberculosis cdc1551 and h37rv (8). Previous studies suggested that pgls produced by the m. tuberculosis w - beijing family were associated with the hypervirulent phenotype by inhibiting the innate immune response (6,7). The intact pks15/1 has also been shown to be nonpolymorphic in the w - beijing family; it was found in all 102 w - beijing strains tested (15). From this observation, we hypothesized that if the ability to produce pgls is among the factors that make this family more virulent than others, the intact pks15/1 should be absent in strains other than the w - beijing family . Our results showed that the 7-bp insertion of the pks15/1 was not only present in the w - beijing family but also in other m. tuberculosis genotypes . Although almost all beijing strains contain the intact pks15/1 (97%), 38.5%100% of strains of other genotypes also contain it . These strains could, therefore, produce pgls and cause both pulmonary and disseminated diseases as the w - beijing strains do . Our results showed no significant difference in the percentage of m. tuberculosis isolates with an intact pks15/1 gene between csf isolates (65 [87.8%] of 74) and sputum isolates (62 [84.9%] of 73). The hypothesis that the hypervirulence of the w - beijing family is solely attributable to pks15/1 is still inconclusive . This family may have only recently been transmitted globally and may have had more chances to cause infections and disease than other families . Although pgls are involved in the hypervirulence of the pgl - producing strains, they are not a unique characteristic of the w - beijing family . If w - beijing strains are more virulent than others, other virulence determinants besides pgls must be responsible for the hypervirulent phenotype.
Although, the incidence of multicentricglioma accounts nearly 2.5% of all gliomas, mostcases are glioblastoma or anaplastic gliomas . Oligodendroglioma cells are detectablein the cerebrospinal fluid in up to 14% of patients, and we recently treated a case of multiple anaplastic oligodendrogliomas, describe the case in detail and discuss the distinction between multicentric and dissemination via cerebrospinal pathways and the treatment . A 72-year - oldman revealed aphasia, abnormal behavior, and rapidly progressivedementia since october 13, 2009, and hospitalized in our department on oct . 17, 2009.magnetic resonance imaging (mri) enhanced by contrast media demonstrated multiplebrain tumors in left parietal lobe and left paraventricular region [figure 1a]. Computed tomography (ct) scan showed high density of microbleeding in the left paraventricularregion [figure 1b]. Biopsy for the tumor in the left parietal tumor was performed . In the permanent section, the hematoxylin and eosin - stained specimen showed that thetissue was composed of cells with clear cytoplasm and with round or irregular nucleushaving dense chromatin (so called honey comb appearance) that existed in between highly proliferative vasculature [figure 2]. The nuclei had pleomorphism and a variety ofsize, a lot of mitosis were observed . Microvascular proliferation and necrotic findingswere also seen . Occasionally, calcification deposit and microbleeding were observed.immunocy to chemical study showed positive for glial fibrillary acidic protein, stronglypositive for the olig-2 (oligodendrocyte lineage genes) stain . These findings were compatible for anaplastic oligodendroglioma, so geneticalevaluation was performed, showing loss of heterozygosity (co - deletions) in chromosome1p19q . Local brain for the left parietal regionradiotherapy was given to a total dose of 50gy, in34 fractions of 1.5gy daily on weekdays from november to december, 2009 . At the sametime, temozolomide of 120 mg daily was orally administrated for 42 days . Mri was performed just after these combined chemo- and radiotherapy showed lessening of themass effect in the left parietal tumor, but enlarging the size of the tumor in the left paraventricular region [figure 3]. We considered that enlargement of the paraventriculartumor was pseudoprogression, as consolidating therapy, temozolomide of 240 mg daily (150mg / m2/day) for 5 days was orally administered for 5 times from february to october 2010 at outpatient clinic . Despite of the high levels of promoterhypermethyltransferase (mgmt) activity, temozolomide is the first linechemotherapeutic agent against anaplastic oligodendroglioma, so we tried temozolomide . But during those period, cerebellar tumor appeared and graduallyenlarged and hydrocephalus was observed [figure 4]. In october 2010, one cycle of temozolomidevia intravenous administration was performed and lessening of the masseffect was seen, so the patient was transferred to rehabilitation hospital . In the end ofnovember 2010, the patient's consciousness deteriorated because of the enlargement ofthe 4th ventricle tumor, hydrocephalus and abnormality of serum electrolyte . Theconsciousness of the patient recovered for a while by correcting the electrolyte balance, but consciousness level worsened again, and respiration and clinical state wasdeteriorated, and died on january, 2011 . (a) magnetic resonance imaging (mri) enhanced by contrast media obtained atthe first hospitalization.multiple brain tumors in the left parietal and leftparaventricular region were observed . The tissue was composed ofcells with clear cytoplasm and with round or irregular nucleus having dense chromatin (so called honey comb appearance). Hematoxylin and eosinstained specimen, 400 mri after radiotherapy 50gy and temozolomide of 120 mg daily for 42 days . Although, lessening of the mass effect of left parietal tumor was observed, enlargementof the paraventricular tumor was seen, which seemed to be pseudoprogression mri performed about 1 year after initial hospitalization . Salvati m. et al.reported 25 cases with multicentricgliomas, 11 cases aremulticentricglioblastomas, 6 cases are multicentric anaplastic astrocytomas, and othercases are combinations of glioblastomas, anaplastic astrocytomas, and low gradegliomas, and no oligodendrogliomas were found . Solomon etal . Stated a clear distinction must be made, in cases of multiple tumors, amongdissemination via cerebrospinal pathways, direct extension across commissures, satellitosis, and true multicentrism . Multicentric tumors are widely separated, arisingin different lobes or hemispheres, which is not readily explained by one of the pathwaysmentioned above.in our case, the 4th ventricle tumor which arose about 1 year afterinitial treatment might have been a metastasis via cerebrospinal fluid, although one ofthe multiple sites cannot be dismissed entirely . However, left parietal tumor and lefttrigonal area tumor were found at the same time, and those two tumors were separated, arising in the distinct sites, and were not explained either by the dissemination viacerebrospinal pathways or direct extensions, so we considered those tumors weremulticentric.the pathogenesis of multicentricgliomas is unknown.the most quoted hypothesis is the two - step process reported by willis . In the firststage a large area of the brain undergoes neoplastic transformation, while in the secondstage one or more foci of tumor proliferation develop within the affected area, givingorigin to separate lesions . The pathogenesis of multicentricglioma include theembryonal rest theory and the two - stage theory, but zlch pointed out the metastasisvia an unknown pathway . Multicentricgliomas are characterized by rapid progression, which may be related tothe fact that they tend to exhibit malignant features on histology, this fact is also validfor the oligodendrogliomas . The course of our case from initial diagnosis to death was 1year and 3 months, despite of the combined chemoradiotherapy.in our case, the 4thventricle portion tumor which appeared about one year after the initial treatment andwas not detected in the mri taken at initial hospitalization, might be the metastasis viacerebrospinal fluid, as histological type of malignant oligodendroglioma is a risk factor of cerebrospinal fluid dissemination . Finally, the tumor in the left paraventricular region showed progression even just after the temozolomide treatment, and we presumed it was pseudoprogression, because in the first 6 months of post - chemoradiotherapy period, showed a high incidence of pathologically confirmed pseudoprogression associated with treatment - related necrosiswithout viable tumor cells . Various imaging techniques including mr spectroscopy havebeen studied but neither has been found to be powerful to identify pseudoprogression, and unfortunately, the diagnosis of pseudoprogression still depends on pathologicexamination.the disruption of blood - brain barrier with the resultant observation of an earlyradiologic increase in contrast enhancement at mri, which may falsely mimic trueprogression, and this fact made the treatment of this case more complicated.
Metformin is widely used to improve insulin resistance (ir), but the mechanism is not fully understood . Although liver is the primary target, metformin acts on a variety of tissues, including adipose tissue, skeletal muscles, endothelium, and ovary [1, 2]. Previous studies have demonstrated metformin exerts the metabolic actions, especially the glucoregulatory action, mainly through amp activated protein kinase (ampk) [3, 4]. In recent years, metformin has been reported to have an impact on the production of adipokines (e.g., adiponectin, leptin), which might be associated with the insulin - sensitizing effect of this agent [5, 6]. Pigment epithelium - derived factor (pedf), an adipokine discovered in recent years, plays an important role in obesity - induced ir . It is one of the most abundant proteins secreted by human adipocytes with the property to induce ir and inflammatory signaling in adipocytes and skeletal cells . Serum pedf levels elevate in obese mice and reduce upon weight loss; prolonged pedf administration stimulates adipose tissue lipolysis, results in ectopic lipid deposition, and reduces insulin sensitivity, whereas neutralizing pedf with pedf antibody in obese mice enhances insulin sensitivity [7, 9]. Clinical researches have revealed that serum pedf level is an independent determinant of ir in patients with essential hypertension . In our previous work, increased serum pedf levels, which are closely associated with ir and chronic inflammation, are observed in patients with polycystic ovary syndrome . Additionally, pedf is also found to be an important determinant of oxidative stress, inflammation, and angiogenesis [12, 13]. It is presently unclear whether metformin could influence pedf production in adipose tissue and liver . A study showed that the improvement of ir, following diet and/or surgery - induced weight loss, was associated with the magnitude of decrease in serum pedf levels and pedf expression of adipose tissue . In this context, the present study was undertaken to get insights into the effect of metformin on the expression and secretion of pedf in adipocyte and hepatocyte and whether this effect is associated with the ir - improving action of the agent, which may help to clarify pharmacological action of metformin . Our data showed metformin inhibits pedf production and release, and ampk plays a key role in this process, which is closely associated with the improvement of ir . Animal care and experimental procedures were performed with the approval from the animal care committees of chongqing medical university . After two weeks of adaptive feeding, the seven - week - old sd rats were randomly assigned to receive a normal chow diet (15% fat) (nc group, n = 6) or a high fat diet (45% fat) (n = 12) for 15 weeks; then the high - fat - diet rats were gavaged saline (hf group, n = 6) or metformin (glucophage, sanofi, france) 400 mg / kg / d (met group, n = 6) for 4 weeks . At the end of the 19th week, insulin sensitivity was assessed by the hyperinsulinemic - euglycemic clamp, and then the rats were culled with cervical dislocation . When sacrificed, blood and tissue samples were collected for further assessments . Mouse embryo fibroblast 3t3-l1 cells were obtained from american type culture collection (manassas, va) and grown in dulbecco's modified eagle's medium (dmem) containing 1% antibiotics (life technologies, maryland, us) as described previously . Human hepatoma cells (hepg2 cells) (obtained from american type culture collection) were grown in 1640 medium supplemented with 10% calf serum and 1% antibiotics . Hepg2 cells and differentiated 3t3-l1 cells seeded on 96-well plates were treated with 0, 0.05, 0.5, 5, and 50 nm insulin for 24 h, and the insulin (100 nm) mediated glucose uptake was examined to validate the establishment of the cell models . The ir cell models were treated with or without 0.1 mm metformin (sigma, us) for 24 h, and the 40 m compound c (sigma, us) was added 1 h before metformin addition . The tracer used to monitor glucose uptake in cells was 6-[n-(7-nitrobenz-2-oxa-1, 3-diazol-4-yl) amino]-6-deoxyglucose (2-nbdg; sigma, us), with the method described previously, with some modification [19, 20]. After treatment, the cell medium was removed, and the cells were washed twice with krebs'-ringer's - hepes (krh) buffer (136 mm nacl, 20 mm hepes, 4.7 mm kcl, 1.25 mm mgso4, and 1.25 mm cacl2, ph 7.4) and the plate was measured by a fluorescence microplate reader (spectramaxm2 multimode plate readers, molecular devices, usa) set at an excitation wavelength of 488 nm and an emission wavelength of 520 nm, and the results were expressed as fa . Treated with 2-nbdg (50 m) for 15 min and washed twice with krh buffer, the cells were measured by the fluorescence microplate reader again and the results were expressed as fb . Later on, treated with 2-nbdg combined with insulin (100 nm) for 15 min and washed twice with krh buffer, the cells were measured by the fluorescence microplate reader for the third time and the results were expressed as fc . Finally, the cell viability was measured by 4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide method and the results were expressed as od . Pedf concentration in the serum and the supernatants of 3t3-l1 and hepg2 cells was analyzed by the elisa kits (uscn life science inc, china) according to the manufacturer's instruction . Serum insulin was determined by the elisa kits (uscn life science inc, china). Serum lipids were measured as follows: total cholesterol (tc) using the cholesterol oxidase - hdaos method (wako, osaka, japan); triglycerides (tg) using the gpo - hdaos glycerol blanking method (wako); high - density lipoprotein cholesterol (hdl - c) using the immunoinhibition (direct) method (wako); and low - density lipoprotein cholesterol (ldl - c) using the selective protection enzymatic (direct) method (wako). Clamp was performed as described previously, with some modifications [21, 22]. In brief, after rats were anesthetized with 10% chloral hydrate (0.4 ml/100 g body weight), two polyethylene catheters were inserted into the right jugular vein and left carotid artery . Patency was maintained by 0.5% heparin (1 ml / kg body weight) administration, and the vein catheter was connected with two digital syringe pumps (medtronic, inc, usa) by a y connector . Blood samples of 600 l were obtained for the measurement of serum insulin, lipids, and pedf before the infusion of insulin . The infusion rate of insulin (humulin regular insulin, eli lilly, usa), mixed with a variable volume of 0.1% bsa, was set at (10 mu / kg / min), and when the plasma glucose was lower than 5.0 mmol / l) was maintained by a variable infusion rate that was adjusted according to the plasma glucose level at 5 min intervals . During the last 60 min of the clamp when the plasma glucose level became steady, the glucose infusion rate was calculated as the average results of the last thirteen times of plasma glucose levels . Total rna was extracted using the trizol reagent (life technologies, maryland, usa) according to the manufacturer's instruction . The rna purity was assessed by measuring od at 260 and 280 nm with the standard of a260/a280 1.8 . Rna was treated with 1 unit of dnase i (life technologies, maryland, usa) for 15 min at room temperature . Cdna synthesis was performed with 0.5 mg total rna treated with dnase i in a 10 l reaction system using the first strand synthesis for rt - pcr kit (takara). Real - time reverse transcription polymerase chain reaction (rt - pcr) was performed in the applied biosystems 7500 real - time pcr system, using sybr green dye (qiagen, german) according to the manufacturer's protocol . All the primers were designed by beacon designer software and synthesized by life technologies corporation . Proteins were extracted from tissues and cells using cell lysis buffer for western blotting (beyotime, jiangsu, china), and protein concentration was determined using the bca protein assay kit (beyotime). Sample proteins were separated by sodium dodecyl sulfate polyacrylamide gel electrophoresis in a bio - rad mini - protean apparatus . Membranes were blocked with blocking buffer and incubated with primary antibodies (goat polyclonal anti - pedf, rabbit polyclonal anti - pampk, rabbit polyclonal anti - beta actin, santa cruz biotechnology, usa) overnight at 4c, followed by horseradish peroxidase - labeled secondary antibodies (santa cruz biotechnology, usa) for one hour at room temperature . Immunoreactive proteins were visualized using enhanced chemiluminescence (ecl, beyotime, china), and the band intensities were quantified using quantity one software (bio - rad, usa). Data involving more than two groups were assessed by one - way anova (with games howell test for post hoc analysis). Compared with the nc group, rats in the hf group showed higher levels of body weight, fasting plasma glucose, fasting serum insulin, ldl - c, and a lower level of glucose infusion rate (table 2). In addition, the mrna expression levels of phosphoenolpyruvate carboxykinase (pepck) and glucose 6-phosphatase (g-6-pase), in the liver were also significantly upregulated in the high - fat diet induced obese rats (figure 1). With metformin treatment for 4 weeks, the ir of the high - fat diet induced obese rats was obviously improved, manifested as enhanced glucose infusion rate, reduced serum tg and serum insulin levels, and down - regulated mrna expression of pepck, g-6-pase (table 2, figure 1). The high - fat diet induced obese rats showed higher levels of serum pedf as compared with the nc group (2.16 0.09 versus 1.77 0.14 g / ml, p <0.05, figure 2(a)), and a negative association was found between the serum pedf concentration and glucose infusion rate (r = 0.67, p <0.05, figure 2(b)). The mrna and protein expression of pedf in the epididymal adipose tissue and liver were significantly up - regulated in the hf group as compared to the nc group . However, the metformin group exhibited decreased serum pedf levels (2.16 0.09 versus 1.69 0.24 g / ml, p <0.05, figure 2(a)) and down - regulated pedf expression when compared with the hf group (figures 2(c) and 2(d)). To be in accordance with the ir condition in vivo, ir models of adipocytes and hepatocytes were established by the hyperinsulinemic method [1618]. With a low or moderate concentration of insulin (0.05 nm5 nm) treatment for 24 h, the glucose uptake in the adipocytes and hepatocytes showed no significant changes; however, when the insulin concentration was as high as 50 nm, an obvious decreased glucose uptake was observed, indicating an ir status in the cell models (figure 3). Similar to the results in vivo, increased pedf expression and secretion were found in the ir adipocytes and hepatocytes . While with 0.1 mm metformin treatment, the pedf expression was down - regulated and the pedf secretion was lowered, accompanied with increased glucose uptake in the ir adipocytes and hepatocytes (figure 4). Since metformin exerts its metabolic action mainly through ampk [3, 4], the phosphorylation at threonine 172 of the subunit of ampk was examined, and the results showed metformin treatment stimulated ampk phosphorylation in adipose tissue and liver of the obese rats, which was accompanied with the profound reduction in pedf protein content (figure 2). In vitro, when the ir adipocytes and hepatocytes were treated with metformin combined with an ampk inhibitor compound c, the inhibitive effects of metformin on pedf expression or secretion were abrogated (figure 4). First identified in retinal pigment epithelium cells, pedf is expressed in various tissues throughout the body such as the eye, adipose tissue, liver, and muscle [79, 13]. It is reported as a multifunctional, pleiotropic protein with antiangiogenic, antioxidant, neurotrophic, and both pro- and anti - inflammatory properties [12, 13]. In the previous work, we found the serum pedf level is elevated in women with polycystic ovary syndrome and is associated with ir, indicating pedf may play a role in the pathogenesis of ir in patients with polycystic ovary syndrome . Metformin, a widely prescribed agent to improve ir, has been reported to have an impact on the production of adipokines (e.g, adiponectin, leptin), which might be associated with the ir - improving effect of the agent [5, 6]. While pedf has been reported to play an important role in the development of ir [79] for the first time, our study reports that metformin inhibits the expression and secretion of pedf in adipocyte and hepatocyte via stimulating ampk phosphorylation, and this effect is associated with the ir - improving action of metformin . To get insights into the effect of metformin on pedf when metformin exerts its ir - improving action, high - fat diet induced obese rats were used for the in vivo experiment and validated as being insulin resistant by the hyperinsulinemic - euglycemic clamp . In vitro, the ir models of 3t3-l1 and hepg2 cells were established by the hyperinsulinemic method and validated through glucose uptake test . It is generally accepted that ir is the most common cause of hyperinsulinemia; however, recent studies have revealed that ir might also be a result of prolonged exposure of high concentrations of insulin [2426]. Liu et al . Found that exposure of cultured hepatocytes to 10100 nm insulin for 24 h induces significant ir, which might be associated with disturbed insulin signal transduction and oxidative stress . Another study reported that exposure to 1 m insulin for 6 h, 3t3-l1 cell showed down - regulated mrna expression of glucose transporter 4 and lost their capacity for acute stimulation of glucose uptake by insulin . Similar to these studies, our data revealed that, incubated with 50 nm insulin for 24 h, the adipocytes and hepatocytes were markedly insensitive to insulin as shown by the decreased glucose uptake when stimulated by 100 nm insulin . It is noteworthy that although the high concentration of 50 nm insulin induced ir in vitro, this might not be duplicated in vivo since the serum insulin level as high as 50 nm has rarely been reported in human . Both in vivo and in vitro, increased pedf secretion as well as expression were found in tissues and cells with ir . Furthermore, we found the serum pedf levels were negatively correlated with the insulin sensitivity . In the study of crowe et al ., an elevated serum pedf and expression in adipose tissue were also observed in high - fat diet induced mice, which are in line with our in vivo findings . With metformin intervention for 4 weeks, high - fat diet induced obese rats exhibited obvious improvement of ir, manifested as enhanced glucose infusion rate, reduced serum tg and fasting serum insulin levels, and down - regulated mrna expression of key enzymes which promote gluconeogenesis and fatty acid synthesis . In addition, serum pedf levels as well as expression of pedf in the adipose tissue and liver decreased significantly during ir improvement caused by metformin . In accordance with the in vivo findings, insulin resistant adipocytes and hepatocytes also showed decreased secretion and expression of pedf with metformin treatment, accompanied with enhanced glucose uptake . To further investigate the role played by the target molecule of metformin, the phosphorylation at threonine 172 of the subunit of ampk was measured in the rats, and we found the impact of metformin on pedf expression in adipose tissue and liver was associated with stimulation of ampk phosphorylation . When combined with compound c, the suppressive effect of metformin on pedf those results suggest that metformin exerts the effect on pedf via stimulation of ampk phosphorylation . Additionally, our study indicates ampk might be a potential regulator of pedf production, on transcriptional or posttranscriptional level, although the detailed mechanism needs further study . The study conducted by akin et al . On 36 turkish type 2 diabetic patients showed that, after metformin treatment for 6 months, the serum pedf levels increased . The different subjects in akin's study (type 2 diabetic patients) and ours (high - fat diet induced obese rats) might partially explain the discrepancy in the results of the two studies . Besides, metformin exerts complex effect in vivo, whether the increase of serum pedf in type 2 diabetic patients is a direct effect of metformin is still unclear . Although different from metformin in mechanism, troglitazone was an insulin sensitizer which was once used to improve ir ., our study reveals that metformin inhibits expression and secretion of pedf in adipocytes and hepatocytes via the stimulation of ampk phosphorylation . In addition, our study indicates ampk might be a potential regulator of pedf . Although we found the effect of metformin on pedf is closely associated with the ir - improving action of the agent, whether the action is mainly mediated through an inhibition in pedf still needs further study.
Efforts in the field of biomarker research have pointed to the existence of circulating immune complexes as a novel class of tumor markers with diagnostic potential comparable with or greater than that of the corresponding free biomarker . They include biomarker - immunoglobulin m (igm) complexes, which have been found in several neoplastic diseases, such as colorectal, liver, and prostate cancer [13]. Although they are supposed to be a valuable adjunct in differential diagnostics, the biological meaning of this kind of complexes has not been elucidated; that is, it is not known whether they have any physiological role . In addition, from the biochemical point of view, there is no insight into their composition in terms of the structural properties of the molecules recognized by igm . Prostate - specific antigen (psa), a well - known tumor marker for prostate cancer (pca), has been found complexed with igm in both benign prostatic hyperplasia (bph) and cancer . In general, psa comprises heterogeneous molecules differing in primary structure and in glycan composition . Structural variability exists among psa forms in serum, seminal plasma, and hyperplastic or cancerous tissues [46]. Thus, using different experimental approaches, more than 30 immunoreactive glycoisoforms ranging in molecular mass from 6 to 35 kd have been separated from serum, seminal plasma, or prostate tissue [712]. Investigation of the structural heterogeneity of psa revealed that some distinct forms are more frequently associated with pca than with bph [1315]. For example, some isoforms of precursor or pro - psa are cancer specific, whereas other internally cleaved or nicked (multichain) psa isoforms are characteristic for bph [16, 17]. This study was aimed at complementing existing data on psa - igm by defining molecular species of psa in circulating immune complexes . Having in mind the oligoreactivity and multivalency of igm and its preference for carbohydrate antigens, there is the possibility that it can selectively recognize known psa glycoisoforms [18, 19]. Beyond the clinical relevance for cancer detection, this might be of basic importance, since tumor - associated antigens are known to be targets of immune surveillance [20, 21]. Circulating psa - igm complexes separated by gel filtration from subjects with bph and pca were subjected to on - chip immunoaffinity profiling using monoclonal anti - psa antibodies . The detected molecular species were subsequently analyzed for protein and glycan composition and compared to established psa forms . Monoclonal anti - free psa antibody, clone 8a6 (recognizing epitope i), was purchased from hy test (turku, finland). Monoclonal anti - psa antibody, clone 8311 (recognizing free and complexed psa forms), was from medix biochemica (kauniainen, finland). Alkaline phosphatase - conjugated anti - human igm and p - nitrophenyl phosphate (pnpp) were from institut virion\serion gmbh (wrzburg, germany). Broad range sds - page molecular mass standards and silver stain kit were purchased from bio - rad (hercules, ca, usa). Proteinchip: ps20 (preactivated surface), q10 (strong anion exchanger), cm10 (weak cation exchanger), sinapinic acid, and proteinchip all - in - one protein standards ii were from bio - rad (hercules, ca, usa). Microwell plates were from nunc (roskilde, denmark) and star - bottom tubes were from spektar (aak, serbia). Total psa (tpsa) and free psa (fpsa) were quantitated using the appropriate commercially available irma psa assays (inep, serbia) according to the manufacturer's instructions . Serum samples from subjects with benign prostatic hyperplasia (bph) and prostate cancer (pca) seen at inep, zemun, for psa determination as a part of followup, were obtained according to local ethical standards (document gsp/05 and pr030/09, approved by the institutional committee of inep). Diagnoses were confirmed using clinically established protocols based on psa level, physical examination, ultrasound, and biopsy . Individual serum samples from 18 patients with pca and bph were randomly used (to reflect intrinsic heterogeneity) to form three pools (each n = 6). Psa concentration ranges of the pca pools were 15.6776 g / l; 35.4987.2 g / l and 20.73063.3 g / l . Psa concentration ranges of the bph pools were 0.85.1 g / l; 0.42.5 g / l and 0.35.1 g serum samples (400 l) were applied to a sephacryl s-300 column (1.3 25 cm) equilibrated with 0.05 m pbs, ph 7.2, and eluted with the same buffer and 1 ml fractions were collected . Psa - igm or psa was detected in the expected fractions, using solid phase assays with immobilized monoclonal anti - psa antibody . Antibody - coated tubes (1.2 g per tube) were prepared by physical adsorption, overnight at 4c . After washing with 0.05 m pbs, ph 7.2, tubes were blocked with 0.5% casein for 3 h at 37c and rinsed again . (a) gel filtration fractions (fractions 120) were added (100 l) to coated tubes and incubated for 4 h at room temperature (rt). After washing thrice with 0.05 m pbs, ph 7.2, alkaline phosphatase - conjugated anti - human igm (100 l) was added and incubated for 2 h at rt . Unbound conjugate was washed, and 100 l of pnpp substrate solution was added . The reaction was quenched with 100 l 1 m naoh after 30 min . The absorption was measured at 405 nm using a wallac 1420 multilabel counter (perkin elmer, monza, italy). Fractions containing psa - igm were concentrated and used for further analysis . In parallel, the total igm was detected in void volume gel filtration fractions after direct immobilization on polystyrene microwell plates, using alkaline phosphatase - conjugated anti - human igm, as described above . (b) psa was probed by the addition of corresponding gel filtration fractions (100 l of fractions 130) to anti - psa coated tubes following simultaneous incubation with iodinated anti - psa antibody (300000 cpm / tube), overnight at rt . After washing steps, bound radioactivity was detected on a wallac wizard 1470 automatic -counter (perkin elmer, waltham, usa). Samples of igm or psa - igm preparations (10 l) were subjected to immunoelectrophoresis on 1% agar gel for 1.5 h at 4c . Purified sheep anti - human igm (inep, zemun, serbia) was used for detection . Psa fractions (psa - igm or fpsa) separated by gel filtration were profiled using on - chip immobilized monoclonal anti - psa antibodies, as described . The corresponding antibody (5 l) was applied to each spot of the preactivated surface protein chip array and incubated in a humid chamber overnight at 4c . The spots were washed thrice with 5 l of 0.05 m pbs, ph 7.2 for 1 min at rt and then blocked with 0.05 m tris - hcl, ph 8.0 buffer for 1 h in a humid chamber at rt . After washing three times using the same procedure, 5 l of examined sample was added to each spot and incubated for 2 h in a humid chamber at rt . The spots were rinsed again thrice with 0.05 m pbs, ph 7.2, and twice with deionized water . All procedures included shaking (150 rpm). After drying, 1 l of 50% sinapinic acid in acetonitrile / dh2o / trifluoroacetic acid (50%/49.9%/0.1%) was added to each spot, dried, and then reapplied . Nonspecific binding was monitored using igm (figure 1, fraction 10) as control sample . Protein chips were analyzed by surface - enhanced laser desorption / ionization time of flight mass spectrometry (seldi - tof / ms) using the proteinchip reader, series 4000, personal edition (bio - rad). All spectra were acquired in 25 kv positive ion acquisition mode, in mass range 2.5300 kda, and with 8815 laser shots per spot . All spectra were analyzed using ciphergen express software 3.0 (bio - rad, hercules, ca, usa). The spots with incorporated quaternized ammonium groups (q10, strong anion exchanger) or carboxymethyl groups (cm 10, weak cation exchanger) were prewetted twice with 5 l of 0.05 m tris - hcl, ph 8, for 5 min at rt . After removing the prewetting buffer, 5 l of the examined sample (bph fpsa or pca fpsa) was added to each spot and incubated for 1.5 h in a humid chamber at rt . The spots were rinsed thrice with 0.05 m tris - hcl, ph 8, and twice with deionized water . After drying, 1 l of 50% sinapinic acid in acetonitrile / dh2o / trifluoroacetic acid (50%/49.9%/0.1%) was added to each spot, dried, and then reapplied . A representative psa - immunogram, revealing typical differential elution positions of the main serum fractions, is shown in figure 1 . Psa - igm (b) is eluted at the trailing edge of the total igm peak (a). As deduced from its elution position and immunoelectrophoretic appearance (data not shown), psa - immunoreactivity of igm complexes seemed to be partly associated with low molecular mass igm . Gel filtration profiles of several individual runs of pooled pca and bph sera gave no striking difference in psa - igm peaks, but psa - act (c) and fpsa (d) peaks were considerably lower in bph, as expected . Psa - igm preparations from pooled pca and bph sera were further subjected to on - chip immunoaffinity chromatography, to determine psa forms in the immune complexes . Typical mass spectra of psa - igm preparations from bph and pca sera, profiled using anti - fpsa antibody, are shown in figure 2 and table 1 . The general pattern was similar, comprising dominant peaks at 17 kda and 28 kda . The main difference was the presence of a 26889.27 da species in pca psa - igm absent from bph psa - igm . This appeared as doubly charged ion, which might be related to its structural properties . In comparison to the species at 26.8 kda, the observation of minor peaks at 15.8 kda or at 16.0 kda which have close molecular masses was not considered as relevant difference . In addition to anti - fpsa antibody, anti - psa antibody, recognizing both free and complexed forms, was also used for on - chip chromatography . Comparable spectra were obtained but the intensity and frequency of particular peaks differed slightly . However, this did not additionally contribute to separation and individual characterization of psa (data not shown). Psa - immunoreactive forms complexed with igm, in both bph and pca, overlapped distinct molecular species observed in mass spectra of fpsa fraction (figure 3). Cluster at 28 kda was common for both pca psa - igm (figure 2(a)) and pca fpsa (figure 3(a)), whereas the 15.8 kda species was more abundant in pca fpsa compared to pca psa - igm . As for bph, fpsa fraction displayed a more restricted pattern with the main forms at 27595.81 da and 28244.95 da (figure 3(b)) in contrast to bph psa - igm (figure 2(b)). Taking the mass spectra of psa - igm preparations obtained from different pools of sera together, subtle differences (some peaks were occasionally present) were noticeable but they all revealed psa separation into several peaks; that is, they suggested the presence of different psa glycoisoforms in immune complexes with igm . Taking into account the theoretical mass of psa peptides and their carbohydrate moiety, the observed psa - igm species were matched to amino acid sequence and glycan composition of established psa isoforms (table 2). The deduced glycan masses of dominant peaks at 17 kda in bph psa - igm and pca psa - igm ranged between 1121 and 1259 da . The distinct pca psa species at 26889.27 is supposed to contain trimannosyl core / paucimannosidic structures (mm), based on the deduced glycans mass of 800.16 da . Psa species at 28 kda are assessed to contain fucosylated or nonfucosylated monosialylated biantennary chain with terminal n - acetylglucosamine (gnnaf / nagnf) or galactose (naa / ana; anaf / naaf). In addition, the modification through bisecting glucosaminylation (nagnfbi / gnnafbi) is also suggested . 28.9 kda peaks in both bph and pca have estimated glycan mass of 2817 da . This is higher than mass of complete psa glycan (2352 da), and it might be assigned to triantennary oligosaccharide chains . Due to the limited amounts of particular psa species for direct analysis, the predictions were validated using ion - exchange chromatography of uncomplexed psa as reference . Taking into account, known data on isoelectric point of psa glycoisoforms (pi 6.97.7), corresponding samples were separated on anion and cation exchangers at ph 8.0 . The results obtained indicated that incompletely glycosylated psa (17 kda) showed weak binding to both ionic exchangers in contrast to sialylated forms (28 kda) which bound strongly to anionic exchanger (figure 4). Thus, the observed charge heterogeneity of psa molecular species was in agreement with their predicted various degrees of glycosylation . According to the observed molecular masses, psa has been classified into two more or less heterogeneous groups of glycosylated (gp28, gp22, gp18, and gp12) or nonglycosylated (p26-full length nonglycosylated psa, p20, p16, p10, and p6) peptides . Lower molecular mass psa results from protein cleavage at several different sites, among which major forms comprise those cuts at either lys182/ser183 or lys145/ser146 or at both residues [4, 16]. Our results indicate that the major molecular species of pca psa and bph psa found complexed with igm corresponded to gp18, which is glycosylated psa amino acid residues 1145 . In addition, minor forms corresponding to the entire mature glycosylated psa species, that is, gp28, were also observed . Psa is defined as a 28.430 da glycoprotein containing 8% of carbohydrates mainly as a biantennary n - linked oligosaccharide of n - acetyllactosamine type with sialic acid group at the end of each of the two branches . However, available data indicate that there is pronounced heterogeneity under both normal and pathological conditions . Psa isoforms differ, generally, in sialic acid content as well as outer chain features [2325]. Besides biantennary chains, monoantennary sugar chains and peripheral structures composed only of n - acetylhexosamine residues also occur . The results obtained in this study indicated that psa species complexed with igm mostly contained incomplete glycan chain lacking sialic acid . Thus, the main psa species complexed with igm are assessed to have oligomannosidic structure in both bph and pca . In addition, alterations in psa glycosylation were reported in both bph and pca [2630]. Specifically, psa forms with reduced sialylation, fucosylation changes, and increased pi were found in pca . As for unusual mannosidic structures found in psa - igm, it represented a minor fraction, that is, only 0.6% of the total psa isoforms, and comprised four psa species ranging from 26808.9 to 27295.8 da . It seems that newly found igm - bound isoforms could have diagnostic potential to distinguish pca and bph, but with no advantage in comparison to other established parameters (total psa - igm or fpsa / psa). Due to intrinsic heterogeneity of total psa - igm and complexity of the method applied, their possible relevance should be confirmed by testing different types of samples, using different experimental designs suitable for clinical use . However, the finding of distinct igm - bound psa forms may be of interest in light of recent data indicating paucimannose as marker of human cancers [31, 32]. In contrast to these poorly glycosylated psa species found in complex with igm, the main fpsa species contained predominantly mono- or disialylated biantennary chains . The fpsa fraction was used as the reference, because it is supposed to comprise an abundant species that can be recognized by igm . Psa complexed with act was not considered relevant for this interaction, since it predominantly contains covalently bound enzymatically active psa . Psa glycosylation is very important for its biomarker potential and this was investigated in a number of studies under diverse physiological and pathological conditions . Generally, an examination of psa glycosylation, especially numerous psa species / glycoforms, is faced with the problem of small amounts, preventing isolation in sufficient quantity for glycan analysis . In addition, the limitation is related to the known influence of both glycan and peptide on psa behavior during electrophoretic and chromatographic separations . Using data on the psa standard preparation obtained by mass spectrometry, assessment of psa glycosylation by calculation of glycan mass has already been proved relevant . In this study, this was combined with on - chip immunoaffinity chromatography and ion - exchange chromatography, which enables simultaneous sensitive detection of various psa glycoforms . Thus, despite the differences in methods and detection systems used for this analysis and those reported in the reference literature, generalizations about the composition of psa isoforms, based on congruence in patterns of protein and glycan moieties, can be made . Differences between calculated and theoretical masses extended to 0.1 kda, which may be due to common ion adducts observed in mass spectrometry . However, for the psa species at 28.9 da, the difference was significant . Psa species having masses higher than 28.4 kda are also reported in seminal plasma and serum, but they are not characterized in detail [6, 8, 11, 12]. Their relation to psa forms containing multiantennary chains or to pro - psa, as suggested by some authors, cannot be confirmed or denied . It is known that the structural integrity of psa significantly influences its biological activity and ability to interact with different molecules . As the first line of defense, igm has a special position in the immune system and the discovery of psa - igm complexes opens an interesting point beyond its biomarker potential . Is the binding of modified carbohydrates, as in the case of psa, a general principle, not only of basic, but also of clinical interest, for instance, in relation to cancer immunotherapy? Different active and passive vaccines, including carbohydrate - based vaccines to aberrant glycostructures, are under clinical trials but have had limited success at proof of principle and efficacy stages . Characteristic psa glycoforms bound to igm, as emerged from this study, direct further investigations to structural comparison of different tumor markers found in immune complexes and their free forms and hold promise for advancement of their use as targets for cancer detection and therapy . The results obtained indicated distinct differences in immuno - complexed pca psa compared to bph psa, although both were predominantly composed of nonsialylated incompletely glycosylated molecular species . It poses the question of the possible role of glycosylation as a framework for immunoreactivity and immunoediting, representing a mechanism for early elimination or inactivation of aberrant cancer molecules and cells.
The design and baseline characteristics of the whi have been described in detail elsewhere (8). In brief, the whi enrolled postmenopausal women 5079 years of age who provided written informed consent and had an expected survival and local residency of 3 years . Exclusion criteria included current alcoholism, drug dependency, dementia, or other conditions that would limit full participation in the study . A total of 161,808 women (68,132 in clinical trials and 93,676 in an observational study) were enrolled in the whi between 1993 and 1998 . Data used in this report were obtained from women at baseline and then at periodic follow - up points over an average of 10.4 years . The protocol and consent forms were approved by the institutional review boards of all participating institutions . Prevalent diabetes was defined as a self - report at baseline of ever having received a physician diagnosis of diabetes when not pregnant . Incident diabetes was based on data collected at annual follow - up visits at which participants were asked, since the date given on the front of this form, has a doctor prescribed any of the following pills or treatments? Choices included cases of incident treated diabetes reported as of 31 august 2009 were included in the analysis . A study of the accuracy of self - reported diabetes conducted in a subset of whi participants indicated that self - reported disease status was a reasonably valid indicator of diagnosed diabetes when compared with medication and laboratory criteria (9). However, self - report fails to identify undiagnosed diabetes and tends to underestimate diabetes prevalence and incidence in our study group (9). At baseline, whi participants self - reported their race / ethnicity, choosing from non - hispanic white (referred to hereafter as white), non - hispanic black (referred to hereafter as black), hispanic, american indian / alaska native, asian (ancestry was chinese, indo - chinese, korean, japanese, pacific islander, or vietnamese), and other . We excluded 1,849 women who reported race / ethnicity as other and 413 women without race / ethnicity information . The sample size was limited among american indians (n = 714); therefore, analyses were restricted to whites, blacks, hispanics, and asians . Body weight, height, and waist circumference were measured at baseline and year 3 . Demographic and health history data were self - reported at baseline and included age, years of education, cigarette smoking status, family history of diabetes, and hormone therapy use . The baseline physical activity questionnaire asked about usual frequency and duration of several types of recreational and household activities using a standardized classification of physical activity intensity (10). Total energy expenditure was summarized in metabolic equivalent (met) hours per week (met - h / week), computed as the summed product of frequency, duration, and intensity for reported activities . Participants also completed a standardized food frequency questionnaire (ffq) developed for the whi to estimate average daily nutrient intake over the 3-month period prior to baseline visit (11). Dietary quality, assessed by the alternate healthy eating index (ahei) (12,13), was computed based on food items and nutrients derived from the ffq, including 1) fruit, 2) vegetables, 3) nuts and legumes, 4) ratio of white to red meat, 5) total dietary fiber, 6) trans - fat, 7) ratio of polyunsaturated fat to saturated fat, 8) alcohol, and 9) multivitamin use . The reliability and validity of physical activity measurements were assessed among a random sample of 536 participants by a second measure of physical activity 10 weeks after the first measure . The test - retest reliability (weighted) for the physical activity variables ranged from 0.53 to 0.72, and the intraclass correlation for the total physical activity variable was 0.77 (8). For the ffq, we assessed bias and precision of the ffq by comparing the intake of 30 nutrients estimated from the ffq with means from four 24-h dietary recalls and a 4-day food record from 113 women who participated in the whi (11). For most nutrients, means estimated by the ffq were within 10% of the records or recalls . Energy - adjusted correlation coefficients ranged from 0.2 (vitamin b12) to 0.7 (magnesium), with a mean of 0.5 . We concluded that the ffq produced nutrient estimates, which were similar to those obtained in other studies comparing short - term dietary recall and recording methods . We acknowledge that the reliability and validity are not perfect; however, they provided reasonable measures in a large clinical trial, as published by several of our authors in high - impact articles (1416). Racial / ethnic differences in the prevalence of diabetes were assessed using logistic regression and are expressed as odds ratios (ors) and associated 95% cis, with whites used as the reference group . We present four logistic regression models: 1) unadjusted, including only race / ethnicity as a covariate; 2) age - adjusted; 3) adjusted for multiple potential confounding factors, including study arm, baseline age, bmi, waist circumference, physical activity, dietary quality, and smoking status; and 4) adjusted for the same covariates as in model 3 plus educational attainment . Among women who were free of diabetes at baseline, incidence rate was calculated as the number of newly reported postbaseline diabetes cases divided by total follow - up time in person - years . The time to diabetes (i.e., time to event) was calculated as the interval between enrollment date and the earliest of the following: 1) date of annual medical history update when new diagnosis of diabetes and initiation of treatment for diabetes were ascertained (observed event); 2) date of last annual medical update during which participants were identified to be without diabetes (censored event); or 3) date of death from any cause (censored event). Cox proportional hazards models were used to estimate the hazard ratios (hrs) and associated 95% ci of incident diabetes, with whites used as the reference group . Four cox regression models that parallel those described for the analysis of diabetes prevalence are presented . To identify determinants of diabetes incidence that might vary by racial / ethnic group, the impact of several covariates was evaluated by assessing the extent to which the hr estimate for a specific race / ethnicity group changed when each covariate was added individually to the unadjusted model . The percentage change in hr between the model with and without the covariate was used to describe the contribution of each covariate, considered singly, to diabetes risk estimated by race / ethnic group . To identify the most parsimonious prediction model, a stepwise cox proportional hazards regression analysis was conducted (p values for entry = 0.25 and for retaining in the model = 0.05). Subgroup analyses also were conducted by race / ethnicity . Weight change from baseline to 3 years was evaluated in relation to risk of incident disease by race / ethnicity among women who reported being free of diabetes at the 3-year measurement point . A similar analysis was conducted for waist circumference . To assess how the combined role of healthy lifestyle habits in diabetes prevention may vary by race / ethnicity (6,7), categories of four modifiable lifestyle factors were defined as follows: physical activity (upper vs. lower two tertiles), dietary quality score (upper vs. lower two tertiles), smoking (nonsmokers vs. past and former smokers combined), and bmi (<25 vs. 25 kg / m). In subgroup analyses by race / ethnicity, hrs and 95% cis were calculated for diabetes incidence for each lifestyle risk factor individually and several lifestyle factors in aggregate, adjusting for age, family history of diabetes, hormone therapy use, study arm, and lifestyle risk factors not already included in the model . The design and baseline characteristics of the whi have been described in detail elsewhere (8). In brief, the whi enrolled postmenopausal women 5079 years of age who provided written informed consent and had an expected survival and local residency of 3 years . Exclusion criteria included current alcoholism, drug dependency, dementia, or other conditions that would limit full participation in the study . A total of 161,808 women (68,132 in clinical trials and 93,676 in an observational study) were enrolled in the whi between 1993 and 1998 . Data used in this report were obtained from women at baseline and then at periodic follow - up points over an average of 10.4 years . The protocol and consent forms were approved by the institutional review boards of all participating institutions . Prevalent diabetes was defined as a self - report at baseline of ever having received a physician diagnosis of diabetes when not pregnant . Incident diabetes was based on data collected at annual follow - up visits at which participants were asked, since the date given on the front of this form, has a doctor prescribed any of the following pills or treatments? Choices included cases of incident treated diabetes reported as of 31 august 2009 were included in the analysis . A study of the accuracy of self - reported diabetes conducted in a subset of whi participants indicated that self - reported disease status was a reasonably valid indicator of diagnosed diabetes when compared with medication and laboratory criteria (9). However, self - report fails to identify undiagnosed diabetes and tends to underestimate diabetes prevalence and incidence in our study group (9). At baseline, whi participants self - reported their race / ethnicity, choosing from non - hispanic white (referred to hereafter as white), non - hispanic black (referred to hereafter as black), hispanic, american indian / alaska native, asian (ancestry was chinese, indo - chinese, korean, japanese, pacific islander, or vietnamese), and other . We excluded 1,849 women who reported race / ethnicity as other and 413 women without race / ethnicity information . The sample size was limited among american indians (n = 714); therefore, analyses were restricted to whites, blacks, hispanics, and asians . Body weight, height, and waist circumference were measured at baseline and year 3 . Demographic and health history data were self - reported at baseline and included age, years of education, cigarette smoking status, family history of diabetes, and hormone therapy use . The baseline physical activity questionnaire asked about usual frequency and duration of several types of recreational and household activities using a standardized classification of physical activity intensity (10). Total energy expenditure was summarized in metabolic equivalent (met) hours per week (met - h / week), computed as the summed product of frequency, duration, and intensity for reported activities . Participants also completed a standardized food frequency questionnaire (ffq) developed for the whi to estimate average daily nutrient intake over the 3-month period prior to baseline visit (11). Dietary quality, assessed by the alternate healthy eating index (ahei) (12,13), was computed based on food items and nutrients derived from the ffq, including 1) fruit, 2) vegetables, 3) nuts and legumes, 4) ratio of white to red meat, 5) total dietary fiber, 6) trans - fat, 7) ratio of polyunsaturated fat to saturated fat, 8) alcohol, and 9) multivitamin use . The reliability and validity of physical activity measurements were assessed among a random sample of 536 participants by a second measure of physical activity 10 weeks after the first measure . The test - retest reliability (weighted) for the physical activity variables ranged from 0.53 to 0.72, and the intraclass correlation for the total physical activity variable was 0.77 (8). For the ffq, we assessed bias and precision of the ffq by comparing the intake of 30 nutrients estimated from the ffq with means from four 24-h dietary recalls and a 4-day food record from 113 women who participated in the whi (11). For most nutrients, means estimated by the ffq were within 10% of the records or recalls . Energy - adjusted correlation coefficients ranged from 0.2 (vitamin b12) to 0.7 (magnesium), with a mean of 0.5 . We concluded that the ffq produced nutrient estimates, which were similar to those obtained in other studies comparing short - term dietary recall and recording methods . We acknowledge that the reliability and validity are not perfect; however, they provided reasonable measures in a large clinical trial, as published by several of our authors in high - impact articles (1416). Racial / ethnic differences in the prevalence of diabetes were assessed using logistic regression and are expressed as odds ratios (ors) and associated 95% cis, with whites used as the reference group . We present four logistic regression models: 1) unadjusted, including only race / ethnicity as a covariate; 2) age - adjusted; 3) adjusted for multiple potential confounding factors, including study arm, baseline age, bmi, waist circumference, physical activity, dietary quality, and smoking status; and 4) adjusted for the same covariates as in model 3 plus educational attainment . Among women who were free of diabetes at baseline, incidence rate was calculated as the number of newly reported postbaseline diabetes cases divided by total follow - up time in person - years . The time to diabetes (i.e., time to event) was calculated as the interval between enrollment date and the earliest of the following: 1) date of annual medical history update when new diagnosis of diabetes and initiation of treatment for diabetes were ascertained (observed event); 2) date of last annual medical update during which participants were identified to be without diabetes (censored event); or 3) date of death from any cause (censored event). Cox proportional hazards models were used to estimate the hazard ratios (hrs) and associated 95% ci of incident diabetes, with whites used as the reference group . Four cox regression models that parallel those described for the analysis of diabetes prevalence are presented . To identify determinants of diabetes incidence that might vary by racial / ethnic group, the impact of several covariates was evaluated by assessing the extent to which the hr estimate for a specific race / ethnicity group changed when each covariate was added individually to the unadjusted model . The percentage change in hr between the model with and without the covariate was used to describe the contribution of each covariate, considered singly, to diabetes risk estimated by race / ethnic group . To identify the most parsimonious prediction model, a stepwise cox proportional hazards regression analysis was conducted (p values for entry = 0.25 and for retaining in the model = 0.05). Subgroup analyses also were conducted by race / ethnicity . Weight change from baseline to 3 years was evaluated in relation to risk of incident disease by race / ethnicity among women who reported being free of diabetes at the 3-year measurement point . A similar analysis was conducted for waist circumference . To assess how the combined role of healthy lifestyle habits in diabetes prevention may vary by race / ethnicity (6,7), categories of four modifiable lifestyle factors were defined as follows: physical activity (upper vs. lower two tertiles), dietary quality score (upper vs. lower two tertiles), smoking (nonsmokers vs. past and former smokers combined), and bmi (<25 vs. 25 kg / m). In subgroup analyses by race / ethnicity, hrs and 95% cis were calculated for diabetes incidence for each lifestyle risk factor individually and several lifestyle factors in aggregate, adjusting for age, family history of diabetes, hormone therapy use, study arm, and lifestyle risk factors not already included in the model . At baseline, the average age of the 158,833 women with evaluable data was 63 years . The racial / ethnic distribution was 84.1% white, 9.2% black, 4.1% hispanic, and 2.6% asian . Blacks and hispanics tended to have more risk factors, whereas asians tended to have fewer (table 1). Baseline characteristics of participants in the whi 19932009 (n = 158,833) at enrollment, diabetes prevalence was highest among blacks (12.2%), followed by hispanics (7.2%), asians (5.9%), and whites (3.3%) (table 2). Compared with the unadjusted ors, which were significantly higher in all three race / ethnic groups when compared with whites, the age - adjusted and multivariable - adjusted ors were attenuated for blacks and hispanics but strengthened for asians . Additional adjustment for educational attainment further attenuated the ors for blacks and hispanics; however, ors for all three racial / ethnic minority groups remained significantly higher than that of whites . Prevalence and incidence of diabetes in the whi 19932009 during an average of 10.4 years (sd = 3.2) of follow - up, 14,604 new cases of diabetes were reported (11,127 whites, 2,181 blacks, 879 hispanics, and 417 asians), with incidence being highest in blacks and lowest in whites . Compared with whites, unadjusted analyses showed a significantly higher diabetes incidence of 136% in blacks, 114% in hispanics, and 43% in asians . After adjusting for age, study arm, bmi, physical activity, smoking status, and educational attainment, 1), the highest cumulative incidence of diabetes was seen among women who had both high bmi and low levels of physical activity . The cumulative incidence of diabetes was 23.4% among black women who were both obese and in the lowest tertile of physical activity, but decreased to 8.8% in those who had a healthy weight and exercised . White women who were overweight (bmi = 2529.9 kg / m) and in the lowest tertile of physical activity had a cumulative incidence of 8.7%, whereas white women who were obese (bmi 30 kg / m) and in the lowest tertile of physical activity had a cumulative incidence of 18.6% . Across all racial / ethnic groups, women who were normal weight (bmi <25 kg / m) and in the highest tertile of physical activity had less than one - third to one - sixth the incidence of diabetes compared with women with bmi 30 kg / m and in the lowest tertile of physical activity . Cumulative incidence of diabetes by race / ethnicity, physical activity level, and bmi category . Analyses conducted to estimate the influence of individual factors that may account for the observed racial / ethnic variation in diabetes incidence by comparing hrs obtained from unadjusted versus fully adjusted models (results not shown) revealed that if asian women had the same waist circumference, bmi, and dietary quality intake as whites, their hr for diabetes would be increased by 44, 29, and 3.5%, respectively . Among blacks, if they had the same bmi, waist circumference, family history of diabetes, dietary quality intake, and physical activity levels as whites, their hr for diabetes would be decreased by 25, 19, 11, 7, and 6%, respectively . Among hispanics, if they had the same educational attainment, bmi, family history of diabetes, dietary quality intake, and physical activity levels as whites, their hr for diabetes would be decreased by 14, 10, 9, 7, and 6%, respectively . Results from the stepwise cox proportional hazards regression analysis conducted to identify the most parsimonious predictive model for diabetes incidence, fitting candidate predictors plus race / ethnicity, showed that race / ethnicity, age, bmi, waist circumference, education, smoking status, physical activity, family history of diabetes, and dietary quality score entered the model . Hrs of incident diabetes corresponding to single and specific combinations of lifestyle risk factors in race / ethnicity subgroups in the whi 19932009 subgroup analyses by race / ethnicity (results not shown) conducted to assess the effect of interval (i.e., baseline to 3 years) changes in factors found to be significant in the cox proportional hazards models revealed a significant effect of 5% increased risk of diabetes for each 5-cm increase in waist circumference (hr 1.05 [95% ci 1.041.07]). The observed effect was consistent across all race / ethnicity groups . An alternative model fit to assess if weight gain could explain some of the observed racial / ethnic variation in diabetes incidence revealed an 3% increase in subsequent risk for each 1-kg / m increment in bmi (1.03 [1.021.04]). Higher levels of physical activity, better diet, and having a healthy weight tended to be associated with a significantly lower risk of diabetes in each racial / ethnic group, with some exceptions . Whites, blacks, and hispanics with all factors in the low - risk category (4.0, 1.1, and 2.2%) had 60, 69, and 63% lower risk for incident diabetes (table 3). Healthy weight (bmi <25 kg / m) demonstrated the greatest role in reducing risk of diabetes in each racial / ethnic group: 66% in whites, 55% in blacks, 64% in hispanics, and 66% in asians . At baseline, the average age of the 158,833 women with evaluable data was 63 years . The racial / ethnic distribution was 84.1% white, 9.2% black, 4.1% hispanic, and 2.6% asian . Blacks and hispanics tended to have more risk factors, whereas asians tended to have fewer (table 1). At enrollment, diabetes prevalence was highest among blacks (12.2%), followed by hispanics (7.2%), asians (5.9%), and whites (3.3%) (table 2). Compared with the unadjusted ors, which were significantly higher in all three race / ethnic groups when compared with whites, the age - adjusted and multivariable - adjusted ors were attenuated for blacks and hispanics but strengthened for asians . Additional adjustment for educational attainment further attenuated the ors for blacks and hispanics; however, ors for all three racial / ethnic minority groups remained significantly higher than that of whites . Prevalence and incidence of diabetes in the whi 19932009 during an average of 10.4 years (sd = 3.2) of follow - up, 14,604 new cases of diabetes were reported (11,127 whites, 2,181 blacks, 879 hispanics, and 417 asians), with incidence being highest in blacks and lowest in whites . Compared with whites, unadjusted analyses showed a significantly higher diabetes incidence of 136% in blacks, 114% in hispanics, and 43% in asians . After adjusting for age, study arm, bmi, physical activity, smoking status, and educational attainment, 1), the highest cumulative incidence of diabetes was seen among women who had both high bmi and low levels of physical activity . The cumulative incidence of diabetes was 23.4% among black women who were both obese and in the lowest tertile of physical activity, but decreased to 8.8% in those who had a healthy weight and exercised . White women who were overweight (bmi = 2529.9 kg / m) and in the lowest tertile of physical activity had a cumulative incidence of 8.7%, whereas white women who were obese (bmi 30 kg / m) and in the lowest tertile of physical activity had a cumulative incidence of 18.6% . Across all racial / ethnic groups, women who were normal weight (bmi <25 kg / m) and in the highest tertile of physical activity had less than one - third to one - sixth the incidence of diabetes compared with women with bmi 30 kg / m and in the lowest tertile of physical activity . Cumulative incidence of diabetes by race / ethnicity, physical activity level, and bmi category . Analyses conducted to estimate the influence of individual factors that may account for the observed racial / ethnic variation in diabetes incidence by comparing hrs obtained from unadjusted versus fully adjusted models (results not shown) revealed that if asian women had the same waist circumference, bmi, and dietary quality intake as whites, their hr for diabetes would be increased by 44, 29, and 3.5%, respectively . Among blacks, if they had the same bmi, waist circumference, family history of diabetes, dietary quality intake, and physical activity levels as whites, their hr for diabetes would be decreased by 25, 19, 11, 7, and 6%, respectively . Among hispanics, if they had the same educational attainment, bmi, family history of diabetes, dietary quality intake, and physical activity levels as whites, their hr for diabetes would be decreased by 14, 10, 9, 7, and 6%, respectively . Results from the stepwise cox proportional hazards regression analysis conducted to identify the most parsimonious predictive model for diabetes incidence, fitting candidate predictors plus race / ethnicity, showed that race / ethnicity, age, bmi, waist circumference, education, smoking status, physical activity, family history of diabetes, and dietary quality score entered the model . Hrs of incident diabetes corresponding to single and specific combinations of lifestyle risk factors in race / ethnicity subgroups in the whi 19932009 subgroup analyses by race / ethnicity (results not shown) conducted to assess the effect of interval (i.e., baseline to 3 years) changes in factors found to be significant in the cox proportional hazards models revealed a significant effect of 5% increased risk of diabetes for each 5-cm increase in waist circumference (hr 1.05 [95% ci 1.041.07]). The observed effect was consistent across all race / ethnicity groups . An alternative model fit to assess if weight gain could explain some of the observed racial / ethnic variation in diabetes incidence revealed an 3% increase in subsequent risk for each 1-kg / m increment in bmi (1.03 [1.021.04]). Higher levels of physical activity, better diet, and having a healthy weight tended to be associated with a significantly lower risk of diabetes in each racial / ethnic group, with some exceptions . Whites, blacks, and hispanics with all factors in the low - risk category (4.0, 1.1, and 2.2%) had 60, 69, and 63% lower risk for incident diabetes (table 3). Kg / m) demonstrated the greatest role in reducing risk of diabetes in each racial / ethnic group: 66% in whites, 55% in blacks, 64% in hispanics, and 66% in asians . Previous reports, mainly focused on younger men and women, have indicated significant racial / ethnic disparities in diabetes in the u.s . (1,4,5). The 20072009 national health interview survey found that 7.1% of whites, 8.4% of asians, 11.8% of hispanics, and 12.6% of blacks reported having a diagnosis of diabetes (1). The whi allows a unique opportunity to deepen understanding of the patterns and determinants of diabetes in older women, including racial / ethnic minorities that represent growing segments of the u.s . We found that the prevalence and incidence of diabetes ranged from approximately two to three times higher in blacks and approximately two times higher in hispanics and in asians, compared with whites . Observed racial / ethnic differences in diabetes incidence were explained, in large part, by modifiable lifestyle factors that included diet quality, physical activity, and smoking status or factors resulting from lifestyle behaviors including bmi and waist circumference . Adjustment for differences in these variables indicates that asians have the highest inherent risk, though women of all four racial / ethnic groups would experience a large reduction in diabetes risk by maintaining a healthy body weight, healthy diet, and a physically active lifestyle . Maintaining a bmi <25 kg / m appears to be particularly important, and interval changes in both bmi and waist circumference predicted newly incident disease . In this study, both bmi and waist circumference were found to be related to prevalent diabetes, and interval changes were associated with risk of incident disease . Because waist circumference reflects centralized obesity, and the propensity toward large waist circumference varies according to race / ethnicity, its effect may differ from that of bmi (17,18). Although bmi and waist circumference among asian, postmenopausal women in the whi were relatively lower than whites, asians were at higher risk of diabetes at lower levels of bmi and with smaller waist circumferences (i.e., by 44 and 29%, respectively) compared with whites, a result consistent with that seen in the multi - ethnic study of atherosclerosis (19). Our results on asians suggest that additional risk factors, which might be biological, social, or a combination, drive the higher prevalence and incidence of diabetes in this population . Diabetes risk in blacks with the same bmi and waist circumference as whites was lower by 25 and 17%, respectively . Similarly, diabetes risk in hispanics with the same bmi and waist circumference as whites was lower by 10 and 2%, respectively . We noted that within each group, bmi was the most important determinant for diabetes incidence . Physical inactivity also was found to be associated with increased risk of diabetes in all groups . In a previous publication using whi data, we reported the association between physical inactivity and development of diabetes (20). Our present study showed that, compared with whites, given the same level of physical activity, the risk for diabetes for blacks and hispanics is 6% lower . Several studies have found differences in dietary intake by race / ethnicity (26,27). Although their diet quality was better than that of whites, we found, for example, if their overall dietary quality were to decrease to that of whites, their risk of diabetes would increase by 4% relative to whites . In fact, if blacks and hispanics improved their diet to a quality similar to that of whites, their risk of diabetes would be 7% lower . Although previous studies demonstrated that diabetes is preventable by relatively simple lifestyle modifications (6,7), our data suggest that some minority groups might obtain greater benefit from improving lifestyle factors (i.e., blacks and hispanics) than others (i.e., asians) due to differences in the amount of change possible or the vulnerability to these factors . The divergent findings in asian women are of interest, suggesting that additional approaches to prevention deserve attention . For example, asians may need to achieve even greater weight loss to have the same low risk of diabetes as nonoverweight whites, and the world health organization already uses a lower bmi cut point for asians . The fact that asians in the whi had much healthier body weights at baseline set the stage for much lower overall diabetes risk . However, further research with this population is warranted because our statistical models, with additional covariates, may be unstable and less reliable due to small numbers . We found that blacks and hispanics are more sensitive to lifestyle modifications and weight loss than whites, and this is corroborated by our previous lifestyle intervention study results from a hispanic population (28). Hispanic sensitivity to the development of an insulin - resistant state or diabetes with lower weight gain is well described (29). If confirmed in weight - loss studies, the sensitivity to modest weight loss that we observed in high - risk groups in the whi will have important clinical and public health implications . It will also be important to explore possible social and genetic underpinnings for such population sensitivity . Two recent studies indicate that social economic status (ses) may account for some of the observed race / ethnicity disparities in diabetes prevalence (30,31). Similarly, in our study, adjustment for educational attainment resulted in the largest decrease in diabetes incidence in hispanics; if hispanics had achieved the same education levels as whites, their risk of diabetes would be 14% lower . However, education is only one component of ses, and thus consideration of an adjustment for other ses parameters (e.g., income and occupation) would likely account for a greater proportion of the disparities observed in black and hispanic women . First, observed prevalence of diabetes in the whi was lower than expected, as relatively healthy postmenopausal women were enrolled in the study . Second, reported education level among black women in the whi was considerably higher than education level among black women in the u.s . The education differential for blacks and hispanics is much more extreme than that observed in whites, and this may underlie some of the other observations in the data (32,33). However, observed patterns are consistent with the population - based literature in terms of race / ethnic patterns of diabetes prevalence and incidence of diabetes . Third, asian women appear to have the greatest inherent risk in that their risk factor profile was in fact better than whites, and large increases in diabetes risk would occur if the risk factors deteriorate . (19), which showed that asians had a higher diabetes risk per unit increase in bmi and waist circumference . Recognizing that each of the racial / ethnic groups is heterogeneous due to differences by national origin and other relevant parameters fourth, it is encouraging to note the effect of interval changes in weight amounting to a 3% reduction in risk of diabetes for each unit decrease in bmi . Individual efforts to reduce weight and increase physical activity are difficult to sustain; however, current efforts are underway to tackle weight regulation through a variety of approaches that go beyond the individual . Lessons from the tobacco literature indicate that behavior change is influenced by our social and political structure; thus, multilevel approaches are likely needed . In the u.s ., the race / ethnicity categories used most often in medical and public health research are from self - report, the same as the u.s . Census categories . Genetic race / ethnicity information known as admixture data (i.e., ancestry - informative markers) from another study indicates great diversity within all four of the groups that we examined (34). Yet, few studies obtain such data due to issues concerning cost, feasibility, practicality, and comparability . Thus, the differences observed and reported here reflect any inherent biological differences across the groups studied as well as differences in life experiences (e.g., exposure to specific environments and stressors), which may also contribute to acquired physiological differences in reactivity, and in turn diabetes risk (35). The challenges for interpreting the results associated with studying self - reported racial / ethnic groups will likely increase in future studies, as more people identify themselves as belonging to multiple racial / ethnic groups . Although geographically diverse, racial / ethnic groups vary in their representation of the general population . Data for whites show that many characteristics of the whi participants are similar to white women participating in the national health and nutrition examination survey (11); however, ethnic groups are underrepresented in the whi . Women from parts of the country where we see large disparities in certain minorities (e.g., rural southern blacks) were not represented . Thus, both prevalence and racial differentials are smaller in the whi than what we might expect to see in the u.s . As a whole . Second, only self - reported prevalence of diabetes and treated incident diabetes were ascertained; thus, prevalence and incidence of diabetes may be underestimated . We acknowledge that this is a limitation, and we did not account for nontreated diabetes . However, self - reported diabetes in the whi was found to be reliable and sufficiently accurate to allow its use in epidemiologic studies (9). Third, there could be other factors for which we did not control that further contribute to racial / ethnic disparities, such as health care access (36). However,> 90% of the whi participants had insurance coverage, and diabetes prevalence and incidence were assessed at regular study visits . Fourth, although incident diabetes in older women is likely to be type 2 diabetes, the whi question did not specify type of diabetes . Other limitations include missing data; however, the rates of retention in the whi were> 95% during an average of 7 years of follow - up (37). Balancing the limitations, there are several major strengths . In addition, the whi collected detailed information on a comprehensive range of diabetes risk factors relevant to this investigation, with a 10-year follow - up for diabetes outcome . In conclusion, significant disparities exist between the major ethnic groups in diabetes prevalence and incidence in postmenopausal women; these differences withstand adjustment for a very comprehensive group of physiological and behavioral risk factors . Although these results highlight the potential benefits of tailored diabetes prevention strategies directed at those specific factors that are most likely to increase the risk of diabetes among each racial / ethnic group, it is prudent to recommend avoidance of weight gain, weight loss, a healthy diet, and adequate levels of physical activity to all postmenopausal women for the purpose of diabetes risk reduction.
Cholelithiasis presented as chronic right back pain in the case discussed in this report . According to the clinical practice guidelines, gallbladder lithiasis is a common condition . Around two - thirds of the cases are asymptomatic, with the most frequent clinical presentation being the presence of attacks of acute abdominal pain . However, chronic right back pain persisting for months as a main symptom is uncommon . This report presents a patient with right back and subscapular pain for 9 months, demonstrating both biliary lithiasis and chronic cholecystitis . It is important to take into account the atypical manifestations of a prevalent illness as well as the limitations of the diagnostic tests, since the presence of gallstones can easily be missed or misinterpreted and delay in diagnosis may lead to complications which could worsen the prognosis of the patient . A 47-year - old male presented with a history of chronic neck pain that had started 10 years back . He underwent a magnetic resonance (mr) which showed cervical canal stenosis of degenerative etiology and also had an episode to self - limited abdominal spasmodic pain that appeared 10 years ago, considered as being functional by the gastroenterologist . Abdominal ultrasonography was performed twice, and both times it was normal . One and a half years ago, the patient had right subscapular and paralumbar back pain at the t10l2 level for 9 months . He described it as a permanent pain, which persisted throughout the day, with very intense exacerbations, especially in the evening and at night . These exacerbations usually lasted for 4 - 6 h, worsening on inhalation and sometimes radiating to subcostal and right hemithorax . The only feature of note on physical examination was the palpation of painful spinal processes from t10 to l2 . Blood analysis showed the level of gamma - glutamyl traspeptidase to be 79 u / l, while all the other laboratory parameters were normal . Abdominal computed tomography (ct) showed an extensive hepatic steatosis and a moderately relaxed gallbladder, with no stones observed within thin walls [figure 1]. Abdominal ct: gallbladder without gallstones despite the regular use of analgesics and the rehabilitation treatment that followed, the patient presented a torpid evolution . Due to the pain in the right paralumbar area, an abdominal ultrasonography was performed, which showed moderate hepatic steatosis and a gallbladder with multiple inner calculi [figure 2]. On diagnosis of cholelithiasis, a cholecystectomy was carried out, which revealed a gallbladder with a large number of yellow lithiasic structures, thereby confirming an anatomopathological diagnosis of chronic cholecystitis [figure 3]. The previous pain completely disappeared after surgery and the patient remained asymptomatic 7 months later . Back pain affects 80% of adults at some point of their life and occurs at all ages . The first objective is to rule out a visceral disorder or a serious potentially life - threatening condition, which occurs in 2.7% of the cases . Back pain may be the manifestation of thoracic involvement as in esophageal disease, pleurisy, aortic aneurysm, or coronary heart disease, or an abdominal process, such as gastrointestinal ulcer, gastric cancer, pancreatic cancer, pancreatitis, or biliary pathology . Only one - third of the cases of gallstones are symptomatic and give an indication for surgery . The most frequent symptomatic manifestation is episodic upper abdominal pain called biliary colic, with complications such as cholecystitis, acute pancreatitis, cholangitis, or choledocholithiasis being less frequent . Characteristically, this pain is severe and located in the epigastrium and/or the right upper quadrant . The pain may radiate to the upper back or the right scapula in 60% of the cases and might be associated with nausea or vomiting, usually occurring in the late evening or at night, in 80% of the cases . One study carried out to characterize the presentation in cholelithiasis reported that all patients described pain in the right upper quadrant of the abdomen, including the epigastrium . The pain was located in the right subcostal area (20%) and epigastrium (14%), which radiated to the back in 63% . In fact, chronic cholecystitis is thought to be a result of a delay in diagnosis . The test of choice to diagnose cholelithiasis is transabdominal ultrasound, with a sensitivity and specificity greater than 95% for detecting gallstones larger than 4 mm . Abdominal ct scan has a very low sensitivity and gallstones may be visible due to most being isodense . Microlithiasis (stones <3 mm in diameter) is not detectable by transabdominal ultrasonography; however, it may cause complications such as acute pancreatitis . In some patients the diagnosis can be confirmed by the detection of biliary crystals by microscopic examination of bile collected from the duodenum . In patients with a clinical history of biliary colic with negative transabdominal ultrasonography, endoscopic ultrasonography is an important diagnostic tool, since it can detect microlithiasis in a proportion of patients ranging from 41 to 78% . Patients with pain and a negative abdominal ultrasound show an endoscopic ultrasound and/or a positive analysis of the bile . Most of these patients show positive results on cholecystectomy, with resolution of abdominal pain and improvement in their quality of life . Non - vertebral causes such as the presence of gallstones should be considered in patients with back pain . Physicians should be aware of atypical manifestations of common diseases, so as to avoid diagnostic delays . Gallbladder disorders should be taken into account in patients with dull, undefined right back pain, despite a normal physical examination . Abdominal ultrasound should be chosen as the first diagnostic procedure when considering gallstones, since ct scans have a very low sensitivity for their detection . In a patient with a typical clinical report of biliary colic and a negative abdominal ultrasound, this was the case of our patient in whom the abdominal ultrasonography was normal 5 years earlier, thereby making correct differential diagnosis crucial.
The process of odontogenesis is under the control of homeobox (hox) genes; a number of different mesenchymal regulatory molecules and their receptors . Hox genes are classified as muscle segment (msx1 and msx2), distal - less (dlx), orthodontical, goosecoid, paired box gene 9 (pax9) and sonic hedgehog (shh). Msx1 and msx2 genes are responsible for the developmental position and further development of tooth buds, respectively . Pax9 is a transcription factor required for tooth morphogenesis and plays a role in the establishment of the inductive capacity of the tooth mesenchyme as it is necessary for the mesenchymal expression of bone morphogenetic protein (bmp4), msx1 and lef1 genes . Tumor necrosis factor, fibroblast growth factor, bmp, shh and wnt pathways are involved in signaling pathways of organogenesis on the 9 to 11 embryonic days to initiate tooth epithelium . Any mutation in these genes and any disruption of regulatory molecules may result in the anomaly of dental characteristics . Hypodontia, oligodontia and anodontia are the terms used to describe the numerical values of tooth agenesis . Hypodontia is the absence of 1 - 6 teeth (excluding third molars), whereas oligodontia refers to the absence of more than 6 teeth (excluding third molars) and anodontia is the complete absence of teeth . Hypodontia is frequently accompanied with cleft - lip or palate, reduction in tooth size, short root anomaly, malformation of other teeth, impaction, maxillary canine and first premolar transposition, delayed formation or eruption of other teeth, microdontia, taurodontism, enamel hypoplasia and altered craniofacial growth . Sometimes, it is caused by environmental factors such as; infection, different kinds of trauma in the apical area of dentoalveolar process, chemical substances or drugs, radiation therapy or disturbances in the jaw innervations, but in the majority of cases, hypodontia is impacted by genetics . Autosomal dominant inheritance with incomplete penetrance and variable expressivity was first proposed by burzynski and escobar . For a genetic linkage study on hypodontia, arte et al ., evaluated 214 family members in three generations and concluded that incisor - premolar agenesis is transmitted by autosomal dominant genes with small upper incisors, ectopic canines, taurodontism and rotated premolars as accompanying anomalies . A familial autosomal dominant hypodontia was demonstrated to be caused by a point mutation in the msx1 gene . Vastardis et al ., using a linkage analysis in a family with second premolar and third molar agenesis, defined a locus on the chromosome 4p16 as the site of the msx1 . Sequence analysis revealed arg31-to - pro missense mutation in the msx1 homeodomain for all of the affected subjects . Arg31-to - pro mutation is known to influence the msx1 interactions, which are critical in the normal development of human teeth . This finding supported the result of an animal study, which showed a knockout mutation of msx1 gene leading to the inhibition of dental development; however, when the premolar agenesis was accompanied with a lateral incisor, the influence of msx1 and msx2 genes could not be proved . Another gene, causing tooth agenesis is pax9 in chromosome 14 (14q21-q13). In hypodontia cases, a frameshift mutation and a nonsense termination mutation of the same gene have been observed in oligodontia . According to das et al ., this situation suggests that hypodontia and oligodontia are not fundamentally different or at least can be caused by different mutations in the same gene . The frameshift mutation of pax9 gene located on chromosome 14 was identified as responsible for autosomal dominant oligodontia in a large family for four generations . In some of the affected members, maxillary and mandibular second premolars and mandibular central incisors were absent in addition to the lack of permanent molars; although, a normal primary dentition was present . In 2001, nieminen et al ., identified an a - to - t transversion of the pax9 gene in a family with autosomal dominant oligodontia . They reported that all the second and third permanent molars, maxillary lateral incisors and in some cases all of the first permanent molars and several second premolars were missing, in addition to deciduous second molar agenesis . A year later, frazier - bower et al . Concluded that the molar oligodontia is due to allelic heterogeneity in pax9, which is an important regulator of molar teeth development . In 2003, lamni showed a distinct phenotype with canine agenesis, which is quite rare, in a family segregating autosomal dominant oligodontia . In recent studies, different transition, insertion and transversion mutations in pax9 gene were reported, providing more comprehensive explanations for the pathogenic mechanisms of the interactions between mutations and tooth agenesis . In addition to pax9 and msx1 genes, contribution of a regulatory molecule in the mesenchyme, called transforming growth factor alpha, might play a role in isolated dental agenesis . Furthermore, axin2 is a negative regulator of canonical wnt signaling and mutations of this gene can cause tooth agenesis associated with colorectal cancer . Another mode of inheritance for hypodontia associated with other dental anomalies such as dental malformations, enamel hypoplasia and eruption failure is the autosomal recessive inheritance, with polygenic inheritance also suggested . Studies showed that tooth agenesis could be manifested as an isolated feature or as a part of a syndrome . Tooth agenesis was associated with a large number of syndromes, which indicating that the development of teeth and certain organs are under the control of the same molecular mechanisms . Hypodontia is a major component of ectodermal dysplasia, oral - facial digital syndromes with oral - facial clefting . Ectodermal dysplasia is characterized by small, misshapen and missing teeth, delayed eruption, prominent lip, maxillary hypoplasia, sparse hair and hypohidrotic skin . This disorder is inherited as an x - linked trait, though the autosomal recessive form has also been reported . Oral - facial digital syndrome type 1 has symptoms such as hypodontia of lower incisors, facial asymmetry, hypertelorism, micrognathia, supernumerary frenulum and thickened alveolar ridges . Oral - facial clefting is affected by chromosome 6p24, 2p13, 19q13 and 4q and the prevalence of hypodontia increases with cleft severity . The upper lateral incisor is the most frequently affected tooth in the cleft area both in primary and in permanent dentitions . In syndromic cleft lip and palate (clp) like pierre - robin sequence 50% hypodontia and van der woude syndrome 70% hypodontia prevalence is associated with other disorders . The genetic basis of hyperdontia has been extensively explained in the literature . In 1932, brook reported a greater occurrence of supernumerary teeth in the close relatives of effected individuals, compared with the general population . It was also reported that the supernumerary and impacted teeth occupied the same location in the identical twins and in their parents . Although there is no difference in the sex distribution for the primary dentition, supernumeraries occur more frequently in the permanent dentition of males . Supernumerary teeth may occur in isolation or as part of a syndrome, such as in clp, cleidocranial dysplasia and gardner's syndrome and less commonly in fabry anderson's syndrome, chondroectodermal dysplasia, ehlers - danlos syndrome and tricho - rhino - phalangeal syndrome . Supernumerary and impacted teeth, retarded eruption of primary and permanent dentition, aplasia or hypoplasia of clavicles and other skeletal anomalies are the features of this disorder exhibiting autosomal dominant inheritance . Hypodontia, oligodontia and anodontia are the terms used to describe the numerical values of tooth agenesis . Hypodontia is the absence of 1 - 6 teeth (excluding third molars), whereas oligodontia refers to the absence of more than 6 teeth (excluding third molars) and anodontia is the complete absence of teeth . Hypodontia is frequently accompanied with cleft - lip or palate, reduction in tooth size, short root anomaly, malformation of other teeth, impaction, maxillary canine and first premolar transposition, delayed formation or eruption of other teeth, microdontia, taurodontism, enamel hypoplasia and altered craniofacial growth . Sometimes, it is caused by environmental factors such as; infection, different kinds of trauma in the apical area of dentoalveolar process, chemical substances or drugs, radiation therapy or disturbances in the jaw innervations, but in the majority of cases, hypodontia is impacted by genetics . Autosomal dominant inheritance with incomplete penetrance and variable expressivity was first proposed by burzynski and escobar . For a genetic linkage study on hypodontia, arte et al ., evaluated 214 family members in three generations and concluded that incisor - premolar agenesis is transmitted by autosomal dominant genes with small upper incisors, ectopic canines, taurodontism and rotated premolars as accompanying anomalies . A familial autosomal dominant hypodontia was demonstrated to be caused by a point mutation in the msx1 gene . Vastardis et al ., using a linkage analysis in a family with second premolar and third molar agenesis, defined a locus on the chromosome 4p16 as the site of the msx1 . Sequence analysis revealed arg31-to - pro missense mutation in the msx1 homeodomain for all of the affected subjects . Arg31-to - pro mutation is known to influence the msx1 interactions, which are critical in the normal development of human teeth . This finding supported the result of an animal study, which showed a knockout mutation of msx1 gene leading to the inhibition of dental development; however, when the premolar agenesis was accompanied with a lateral incisor, the influence of msx1 and msx2 genes could not be proved . Another gene, causing tooth agenesis is pax9 in chromosome 14 (14q21-q13). In hypodontia cases, a frameshift mutation and a nonsense termination mutation of the same gene have been observed in oligodontia . According to das et al ., this situation suggests that hypodontia and oligodontia are not fundamentally different or at least can be caused by different mutations in the same gene . The frameshift mutation of pax9 gene located on chromosome 14 was identified as responsible for autosomal dominant oligodontia in a large family for four generations . In some of the affected members, maxillary and mandibular second premolars and mandibular central incisors were absent in addition to the lack of permanent molars; although, a normal primary dentition was present . In 2001, nieminen et al ., identified an a - to - t transversion of the pax9 gene in a family with autosomal dominant oligodontia . They reported that all the second and third permanent molars, maxillary lateral incisors and in some cases all of the first permanent molars and several second premolars were missing, in addition to deciduous second molar agenesis . A year later, frazier - bower et al . Concluded that the molar oligodontia is due to allelic heterogeneity in pax9, which is an important regulator of molar teeth development . In 2003, lamni showed a distinct phenotype with canine agenesis, which is quite rare, in a family segregating autosomal dominant oligodontia . In recent studies, different transition, insertion and transversion mutations in pax9 gene were reported, providing more comprehensive explanations for the pathogenic mechanisms of the interactions between mutations and tooth agenesis . In addition to pax9 and msx1 genes, contribution of a regulatory molecule in the mesenchyme, called transforming growth factor alpha, might play a role in isolated dental agenesis . Furthermore, axin2 is a negative regulator of canonical wnt signaling and mutations of this gene can cause tooth agenesis associated with colorectal cancer . Another mode of inheritance for hypodontia associated with other dental anomalies such as dental malformations, enamel hypoplasia and eruption failure is the autosomal recessive inheritance, with polygenic inheritance also suggested . Studies showed that tooth agenesis could be manifested as an isolated feature or as a part of a syndrome . Tooth agenesis was associated with a large number of syndromes, which indicating that the development of teeth and certain organs are under the control of the same molecular mechanisms . Hypodontia is a major component of ectodermal dysplasia, oral - facial digital syndromes with oral - facial clefting . Ectodermal dysplasia is characterized by small, misshapen and missing teeth, delayed eruption, prominent lip, maxillary hypoplasia, sparse hair and hypohidrotic skin . This disorder is inherited as an x - linked trait, though the autosomal recessive form has also been reported . Oral - facial digital syndrome type 1 has symptoms such as hypodontia of lower incisors, facial asymmetry, hypertelorism, micrognathia, supernumerary frenulum and thickened alveolar ridges . Oral - facial clefting is affected by chromosome 6p24, 2p13, 19q13 and 4q and the prevalence of hypodontia increases with cleft severity . The upper lateral incisor is the most frequently affected tooth in the cleft area both in primary and in permanent dentitions . In syndromic cleft lip and palate (clp) like pierre - robin sequence 50% hypodontia and van der woude syndrome 70% hypodontia prevalence is associated with other disorders . The genetic basis of hyperdontia has been extensively explained in the literature . In 1932, brook reported a greater occurrence of supernumerary teeth in the close relatives of effected individuals, compared with the general population . It was also reported that the supernumerary and impacted teeth occupied the same location in the identical twins and in their parents . Although there is no difference in the sex distribution for the primary dentition, supernumeraries occur more frequently in the permanent dentition of males . Supernumerary teeth may occur in isolation or as part of a syndrome, such as in clp, cleidocranial dysplasia and gardner's syndrome and less commonly in fabry anderson's syndrome, chondroectodermal dysplasia, ehlers - danlos syndrome and tricho - rhino - phalangeal syndrome . Supernumerary and impacted teeth, retarded eruption of primary and permanent dentition, aplasia or hypoplasia of clavicles and other skeletal anomalies are the features of this disorder exhibiting autosomal dominant inheritance . The structural anomalies of teeth are caused by the disturbances at the level of enamel and dentin during tooth development . Amelogenesis imperfecta as one of these disorders, is characterized by discolored teeth and anterior open bite and exhibits x - linked, autosomal dominant and recessive inheritance caused by mutation of five different genes; amelogenin amel, enamelin enam, matrix metalloproteinase- 20 mmp20, kallikrein - related peptidase 4 klk4 and family with sequence similarity 83, member h fam83h . There are three types of amelogenesis imperfecta; as hypoplastic; with thin, normally calcified enamel, hypocalcified; with less mineralized, but normal thickness enamel and hipomaturation with enamel structure that has the same radiodensity of dentin and which is easily dislodged from dentin . In a study of 50 patients with hypoplastic amelogenesis imperfecta, anterior openbite occurred in 24% of the cases and severe vertical discrepancy was observed in almost all of them . Furthermore, it was shown that this specific malocclusion with autosomal recessive inheritance was caused by the mutation in the enamelin gene, which is the largest protein in the enamel matrix of developing teeth . When hypoplastic teeth coexist with an anterior openbite, the orthodontists should investigate the genetic background for any existing condition . Type i is syndromic form of dgi which is inherited with osteogenesis imperfecta and the genes encoding collagen, type i, alpha 1, (col1a1) and col1a2 . Radiographically, the teeth have short, constricted roots and dentin hypertrophy leading to pulpal obliteration either before or just after eruption . Expressivity is variable even within an individual, with some teeth showing total pulpal obliteration while in others the dentin appears normal . The other two forms seem to result from mutations in the gene dentin sialophosphoprotein, encoding dentin phosphoprotein and dentin sialoprotein . Bulbous crown are typical features of dgi type ii, with hypotrophy in dentine structure . Dentin dysplasia (dd), which has radicular and coronal subtypes is another structural anomaly and has the same genetic disorder with dgi, except dd type i (radicular type). The importance of the genetic factors controlling tooth size and morphology has been shown by twin studies . Some authors reported that tooth crown dimensions, especially buccolingually and mesiodistally were genetically determined . It has been suggested that there is an association between oversized teeth and supernumerary teeth . Similarly, the existence of peg shaped or strongly mesiodistally reduced lateral incisors may be the result of a variation in the expression of hypodontia . The displacement of canines in a palatinal direction is a positional dental anomaly and can generally happen even if there is adequate place in the dental arch . There is an association between the malpositions of certain teeth, such as palatally displaced canines, mandibular lateral incisor - canine transposition and maxillary canine - first premolar transpositions and tooth agenesis . Similar for tooth agenesis, the positional anomalies of canines have been shown to affect some family members and thought to be under strong genetic control . Some authors suggested that the ectopic canines exhibit a multifactorial inheritance pattern with high phenotypic variance and low penetrance . Reported that palatally displaced and frequently impacted canines and mandibular lateral incisor - canine transposition were related to congenitally missing third molars in the posterior orofacial area . Similarly, an association between the maxillary canine - first premolar transposition and maxillary lateral incisor agenesis in the anterior orofacial area may exist . Furthermore, the agenesis of the lower second premolar, which is located in an intermediate zone is related to all the positional anomalies of canines . The anteroposterior morphogenetic field concept, proposed by butler in 1939, supports the current molecular investigations such as the determination of the interaction between a single gene and site specific orofacial expressivity . Hox genes, which play a role in oral and dental development are known to show site specific anteroposterior expression patterns . Msx1, regulator gene in the third molar and lower second premolar agenesis, may be responsible for posterior site development . In addition to the other posterior area genes, which are dlx-1, dlx-2 and barx-1, pax9 also control the development of all of the molars . Furthermore, neubser et al ., reported that there is an association between pax9 transcription factor and repositioning of tooth buds on the mesenchymal level . This theory might give a clue to researchers about the genetic mechanisms of dental positional anomalies such as palatally displaced canines or different kind of transpositions . It appears that tooth agenesis, tooth size and position anomalies, which are often seen together, are the components of a complex, genetically controlled dental condition . Dental malpositions such as rotations, eruption failures and ankylosis are among other anomalies complicating this dental condition . The etiology of dental anomalies is partly environmental and partly genetic . Because of the polygenic nature of dental characteristics, it is very challenging to identify one single defective gene responsible for a specific dental anomaly . Further studies are required and the rapid progress in the field of genetics may help the clinicians to more accurately discern the environmental and genetic factors contributing to the development of dental anomalies . Currently, the orthodontist, probably the first to diagnose hereditary dental anomalies and malocclusion of an individual, will remain responsible for the detection of any additional defects in the same patient in order to provide the best treatment . The clinician should always keep in mind that some of those dental anomalies can coexist with certain syndromes and other family members might also have been affected . Whenever it seems necessary, a genetic consultation should be added as part of the orthodontic treatment . Finally, this interdisciplinary approach may help to reveal any risk of recurrence in subsequent generations.
Homeopathy claims a curative reaction from a small dose of a drug of which high doses cause symptoms similar to those from which the patient is suffering . Homeopathy originated in 19 century, prior to the acceptance of the germ and gene bases of disease; it has never been based on scientific evidence . Results of randomized trials do not provide acceptable evidence that homeopathic treatments are more effective than placebo; although there are also contradicting statements . It is however possible that some empirical knowledge is successfully used in homeopathy unrelated to its axioms like can be cured with like, less is more or the memory of water . Hormesis has been defined as a biphasic dose - response relationship in which the response at low doses is opposite to the effect at high doses . According to this concept, however, claims that homeopathy is based on hormesis create an illusion that it employs a scientific method . The difference between hormesis and homeopathy is that hormesis can be observed at low but measurable concentrations; while homeopathy claims effects of infinite dilutions, whereas the concept of memory of water is used as an explanation . There is an opinion, shared by the author that the term hormesis should not be linked with homeopathy . If homeopaths have valuable empirical knowledge, it should be verified by the methods of evidence - based medicine . Potentially useful empirical knowledge gathered in homeopathy, alternative or complementary medicine, should be scientifically tested and discussed in the professional literature . Among the known hormetic agents are pro - oxidants, heavy metals, heat, exercise, food restriction, and different kinds of stress . Living organisms come in contact with all these factors in the natural environment, so that the hormetic effects can be explained from an evolutionary standpoint . The term hormetins has been used in the literature for hormesis - inducing compounds . For antibiotics, hormetic effects develop secondarily along with the adaptation of microorganisms and development of antibiotic resistance . Another example: thousands years adaptation of certain human populations to ethanol resulted in detectable hormesis also for this toxic agent: moderate alcohol consumption was reported to be associated with a reduced risk of coronary heart disease and other health benefits . There has been no plausible explanation of hormesis as a default principle in the pharmacological theory . Scientific foundations of some hormetic mechanisms were discussed within the framework of stress response pathways . However, different kinds of stress are an integral part of the environmental impact on living organisms, who have been accordingly adapted to it . Hormesis as a general principle is conceivable only for the agents that have induced adjustment of living organisms, so that a deviation in either direction from an optimum would be harmful . This is obviously the case for visible light, ultraviolet and ionizing radiation, atmospheric pressure, as well as for many chemical substances and microelements present in the environment . It is not surprising that potentially toxic heavy metals, which are present in the natural environment, act hermetically in plants . There are no general reasons to expect hormetic responses for the factors absent in the natural environment . Among explanations for the hormetic effects, discussed in the literature, are an excess of repair mechanisms in response to mild damage and a proposed existence of two receptor types (small quantity of high - affinity receptors and large numbers of low - affinity ones). Both hypotheses have not been sufficiently proven, in particular, as umbrella mechanisms for different types of agents . Moreover, some reported hormetic effects can be doubtful because of the difficulties of differentiation between low - level hormetic and placebo effects questionable reliability of some data, poor study designs, etc . It should be stressed that a response to an agent usually increases with increasing concentration; in contrast, a placebo effect does not depend on concentrations, while homeopathic remedies can be extremely diluted so that the agent can be absent in the solution . For research purposes, placebo effects can be excluded in animal experiments without conditioning and especially in plants, where hormetic effects can be studied . Hormesis phenomenon was discussed in the context of homeopathy; it was sometimes generalized and treated as a matter - of - course . For example, the question: is hormesis likely to occur for all types of drugs? Was answered: there are sufficient data to conclude that the hormetic dose response is common, reproducible, and a biological expectation in the vast majority of biological systems, end points measured, and chemical classes tested . The question may drugs be acting hormetically even though the experimental data appear inconsistent with this interpretation? Was responded: the hormesis concept establishes a biological context for some of the key hormetic - like biphasic dose responses may represent a general biological dose - response pattern or strategy have never been substantiated . Moreover, hormesis, usually, relates to a single response, while toxic impacts can have different responses . Some noxious stimuli can act synergistically with other factors, for example, on the cells with a limited or no capacity for cellular regeneration such as cardiomyocytes or neurons . It can be of particular importance in conditions when such cells are pre - damaged by ischemia so that even a mild additional damage would act according to a no - threshold dose - response pattern without hormesis . In conditions close to a functional decompensation of an organ, even minimal additional damage can be detrimental . In such conditions, which are not uncommon especially in elderly patients, the concept of hormesis can be dangerous if used in the clinical decision - making . For example, it would hardly be indicated to apply mild asphyxia in angina pectoris or small doses of ethanol in end - stage liver disease with a hope for a hormetic effect as a general biological dose - response pattern . Considering the above, the statement: the hormesis concept is a fundamental dose response, highly conserved, and set in an evolutionary framework is true a priori only for the factors that have induced evolutionary adjustment . If even hormesis was observed in studies of the substances that are absent in the environment such as antineoplastic, anxiolytic or anti - seizure drugs, or resveratrol (the latter was extensively discussed in the volume 29 of human and experimental toxicology, while relevance of the hormetic effects was questioned), there is still no reason to conclude that hormetic dose responses are broadly generalizable, being independent of biological model, endpoint measured, and stressor agent, and represent a basic feature of biological responsiveness to chemical and physical stressors . The publications containing generalizations of this kind can be cited in support of homeopathy and placebo, in gerontology and other fields of medicine, also to endorse official registration of drugs without specific effects or efficacy not exceeding that of placebo . It can pave the way for homeopathy and placebos instead of evidence - based treatments, as inexpensive substitutes, especially for elderly patients . There are many examples of marketed compounds without scientifically demonstrated efficacy, in russia often in the guise of evidence - based medications; while artificial theoretic concepts are created to promote them . Promotion of unproven health schemes can be harmful especially for elderly people . In the medical practice, deception is normally objectionable on the grounds that it limits autonomy and breaches trust; these grounds possibly do not apply to placebos when they are prescribed within appropriate ethical limits; although there is an opinion that clinical placebo interventions are unethical and unnecessary . If even placebo therapy with misinformation of a patient might be ethically acceptable in certain cases, it is still not a reason to publish biased information . Remarkably, it seems that some patients are influenced not only by medical advertizing, which is sometimes misleading in russia, but also directly or indirectly by professional publications . In conditions when commercial considerations tend to replace medical ethics, some patients try to come clear with their ailments with the help of professional literature, which is their right . Moreover, persistence and development of spurious theoretic concepts can sooner or later result in the application of invasive procedures with questionable clinical indications . For example, in the preceding article a series of studies was commented that has become internationally known in 1986 after a publication in the lancet with participation as coauthor of the health minister of that time . There followed numerous publications in russian and foreign journals continued until today [40 - 47] (more references are in). Cultures of smooth muscle cells or macrophages were used for testing of blood atherogenicity, anti- or pro - atherogenic action of various substances . In addition to the drugs, many natural substances were shown by the same researchers using the cell culture method to be effective against serum atherogenicity: black elder berries, calendula and violet flowers, grape seeds and stems etc . Extracts from 13 different mushrooms were shown to significantly lower serum atherogenicity . However, as discussed in, the relationship between serum atherogenicity in a cell culture and atherogenesis in vivo must be inverse rather than direct . For example, in familial hypercholesterolemia, caused by abnormality of lipoprotein receptors, ineffective clearance of low density lipoprotein (ldl)-cholesterol from serum causes hypercholesterolemia and predisposes to atherosclerosis . Up - regulation of ldl - receptors (and, correspondingly, of the ldl - cholesterol uptake by cells) is one of the paradigms to the atherosclerosis therapy . Accordingly, if an agent reduces cholesterol uptake by cells in - vitro, it can be expected to cause serum cholesterol elevation in - vivo . Nevertheless, following their concept, the same researchers started applying extracorporeal apheresis through a column with immobilized ldl aimed at the removal of non - lipid atherogenicity factor(s) twice monthly for the period of 7 - 9 months . The patients were men 46 - 59 years old with functional class ii - iii angina pectoris, an angiographically documented stenosis of 2 - 3 coronary arteries and a normal cholesterol level . During this trial, the patients were reported to feel better, endure higher physical loads, and have heightened sexual activity, which could have been caused by a placebo effect . It is reasonable to assume that invasive procedures are associated with a placebo effect, which might be stronger than that of non - invasive procedures . Blood apheresis is associated with certain risks, although severe side - effects such as shock or allergic reactions were reported to be very rare . Efficiency of the apheresis in the study cannot be excluded, although apheresis is usually aimed at removal of lipids and lipoproteins e.g., in patients with severe drug - resistant ldl - hypercholesterolemia or lipoprotein elevation and premature atherosclerosis . Considering the above, indications to apheresis in hormesis as a general principle has never been proven as an umbrella theoretic basis for factors that are absent in the environment . If an agent is present in the natural environment, existence of its optimal level can be assumed, which would correspond to the current environmental level or, considering that the natural selection is a slow process, to some average from the past . Low - dose impacts may be associated with a higher risk in a state of organ sub - compensation or failure especially in elderly patients . Accordingly, practical recommendations should be based neither on the hormesis as a default approach nor on the like cures like, less is more or other postulates of homeopathy . All clinically relevant effects, including hormetic ones, should be tested by the methods of evidence - based medicine.
Testicular adrenal rest tumors (tarts) are benign intratesticular masses that occur in male patients with congenital adrenal hyperplasia (cah), with more than 90% of cases caused by a deficiency of 21--hydroxylase . Tarts originate from aberrant adrenal cells in the testes and can impair both spermatogenesis and endocrine testicular function . Studies have indicated that tarts may be present in childhood, with an increasing prevalence after the onset of puberty . Therefore, the early detection of tarts is important to preserve testicular function, and scrotal baseline ultrasound (bus) screening is recommended beginning in early childhood . Although several reports of tart sonographic features have been described previously, the reports are limited by a small numbers of cases or the old age of the patients . This situation prompted us to investigate the sonographic features of tarts during puberty, evaluating patients no older than 18 years . From june 2009 to january 2015, 79 male patients had been diagnosed as cah and screened for testicular evaluation in our institute, and only 15 patients had tarts in this study . The prevalence of tarts in our patient population was 19% (15/79), which was all bilateral, without unilateral . Written informed consent was obtained from all patients, and the study was approved by the first affiliated hospital of sun yat - sen university institutional review board . The first machine was an high density interconnector 5000 us machine (phillips healthcare, tokyo, japan) equipped with a transducer with a frequency range of 7.0 to12.0 mhz . The other was an aplio xv machine (toshiba medical systems, tokyo, japan) equipped with a transducer with a frequency range of 7.5 to 10.0 mhz . All bus examinations were performed by 1 of 2 experienced radiologists who had more than 3 years of experience in diagnosing andrological diseases . The entire testicle was scanned thoroughly using bus, and the target lesions were identified . The location, size, shape, boundary, and echogenicity of the lesion, as well as the testicular size and the presence or absence of the testicular mediastinum were recorded . Afterwards, the transducer was maintained in a stable position and shifted to the color doppler imaging mode, and the blood supply of the lesions was recorded . From june 2009 to january 2015, 79 male patients had been diagnosed as cah and screened for testicular evaluation in our institute, and only 15 patients had tarts in this study . The prevalence of tarts in our patient population was 19% (15/79), which was all bilateral, without unilateral . Written informed consent was obtained from all patients, and the study was approved by the first affiliated hospital of sun yat - sen university institutional review board . The first machine was an high density interconnector 5000 us machine (phillips healthcare, tokyo, japan) equipped with a transducer with a frequency range of 7.0 to12.0 mhz . The other was an aplio xv machine (toshiba medical systems, tokyo, japan) equipped with a transducer with a frequency range of 7.5 to 10.0 mhz . All bus examinations were performed by 1 of 2 experienced radiologists who had more than 3 years of experience in diagnosing andrological diseases . The entire testicle was scanned thoroughly using bus, and the target lesions were identified . The location, size, shape, boundary, and echogenicity of the lesion, as well as the testicular size and the presence or absence of the testicular mediastinum were recorded . Afterwards, the transducer was maintained in a stable position and shifted to the color doppler imaging mode, and the blood supply of the lesions was recorded . Fifteen male patients involved in this study were aged 4 to 17 years (mean age, 8.8 3.8 years), height 104.6 to 172.5 cm (mean height, 138.7 22.5 years), and weighted 15 to 57 kg (mean weight, 36.5 14.0 kg). All of the patients had been diagnosed with cah for at least 1 year; the blood pressure and blood glucose of the cases were all at normal levels; 33.3% (5/15) of the cases exhibited normal bone age, and nearly 66.7% (10/15) of the cases exhibited advanced bone age; and the andrological evaluation of these cases were listed in table 1 . In addition, 80% (12/15) of the cases were confirmed by pathological examination using surgical specimens, and immunohistochemistry showed that cd56, inhibin, and vimentin were all positive, which were the pathological characteristics of adrenal gland (figure 1). The remaining 3 cases were clinically confirmed (diagnostic criteria: the testicular lesions near the mediastinum were gradually diminishing with an increasing amount of hormone therapy in patients who had been diagnosed with cah). The hormone levels of these 15 patients with tarts before and after operation and hormone therapy were showed in table 2 . Basic characteristics of pubescent patients with congenital adrenal hyperplasia and testicular adrenal rest tumors testicular adrenal rest tumor was growing into testis (a). And immunohistochemistry showed that cd56 (b), inhibin (c), and vimentin (d) were all positive, which was the pathological characteristics of adrenal gland . The basic hormone levels of pubescent patients with congenital adrenal hyperplasia and testicular adrenal rest tumors before and after operation and hormone therapy all 15 cases were bilateral, and there were 30 lesions in total . The lesions were 1.4 0.8 cm (range: 0.23.8 cm) in diameter on average . In 93.3% of the patients (14/15), the testicular mediastinum were clearly visualized, and only 1 mediastinum exhibited a fuzzy appearance . All of the lesions had clear boundaries and were located near the testicular mediastinum or the testicular hilum; 83.3% (25/30) of the lesions had an irregular shape, whereas 5 (5/30, 16.7%) lesions were round . Furthermore, 56.7% (17/30) of the tart lesions exhibited homogeneous hypoechogenicity (figure 2), 36.7% (11/30) of the tart lesions exhibited heterogeneous hypoechogenicity (figure 3), and 6.6% (2/30) of the tart lesions exhibited heterogeneous isoechogenicity (figure 4a). Color doppler revealed that 76.7% (23/30) of the lesions had a rich blood supply and that 23.3% (7/30) of the lesions had a scarce blood supply . Testicular adrenal rest tumor in a 4-year - old patient with congenital adrenal hyperplasia (patient 13). Sonographic examination of the left testis revealed a homogeneous hypoechoic lesion (arrow) with a round clear boundary, 4 mm in diameter, adjacent to the mediastinum of the testis (a, b). Testicular adrenal rest tumor in a 10-year - old patient with congenital adrenal hyperplasia (patient 5). (a) sonographic examination of the right testis revealed a clearly defined heterogeneous hypoechoic lesion (arrow), 14 mm in diameter, adjacent to the mediastinum of testis . (b) color doppler demonstrated marked vascularization compared with the normal testicular parenchyma (arrow). Testicular adrenal rest tumor in a 15-year - old patient with congenital adrenal hyperplasia (patient 4). (a) sonographic examination of the left testis revealed a heterogeneous isoechoic lesion with a lobulated boundary (arrow), 31 mm in diameter, adjacent to the mediastinum of testis . (b) sonographic examination of the left testis half a year later after operation revealed no tart lesion in the heterogeneous echoic testis caused by operation (arrow). Sonographic features of pubescent patients with congenital adrenal hyperplasia and testicular adrenal rest tumors the follow - up period was from 3 to 12 months, and the tart lesions were almost disappeared after operation and hormone therapy . The testis exhibited heterogeneous echogenicity, which might be caused by operation (figure 4b). Fifteen male patients involved in this study were aged 4 to 17 years (mean age, 8.8 3.8 years), height 104.6 to 172.5 cm (mean height, 138.7 22.5 years), and weighted 15 to 57 kg (mean weight, 36.5 14.0 kg). All of the patients had been diagnosed with cah for at least 1 year; the blood pressure and blood glucose of the cases were all at normal levels; 33.3% (5/15) of the cases exhibited normal bone age, and nearly 66.7% (10/15) of the cases exhibited advanced bone age; and the andrological evaluation of these cases were listed in table 1 . In addition, 80% (12/15) of the cases were confirmed by pathological examination using surgical specimens, and immunohistochemistry showed that cd56, inhibin, and vimentin were all positive, which were the pathological characteristics of adrenal gland (figure 1). The remaining 3 cases were clinically confirmed (diagnostic criteria: the testicular lesions near the mediastinum were gradually diminishing with an increasing amount of hormone therapy in patients who had been diagnosed with cah). The hormone levels of these 15 patients with tarts before and after operation and hormone therapy were showed in table 2 . Basic characteristics of pubescent patients with congenital adrenal hyperplasia and testicular adrenal rest tumors testicular adrenal rest tumor was growing into testis (a). And immunohistochemistry showed that cd56 (b), inhibin (c), and vimentin (d) were all positive, which was the pathological characteristics of adrenal gland . The basic hormone levels of pubescent patients with congenital adrenal hyperplasia and testicular adrenal rest tumors before and after operation and hormone therapy the lesions were 1.4 0.8 cm (range: 0.23.8 cm) in diameter on average . In 93.3% of the patients (14/15), the testicular mediastinum were clearly visualized, and only 1 mediastinum exhibited a fuzzy appearance . All of the lesions had clear boundaries and were located near the testicular mediastinum or the testicular hilum; 83.3% (25/30) of the lesions had an irregular shape, whereas 5 (5/30, 16.7%) lesions were round . Furthermore, 56.7% (17/30) of the tart lesions exhibited homogeneous hypoechogenicity (figure 2), 36.7% (11/30) of the tart lesions exhibited heterogeneous hypoechogenicity (figure 3), and 6.6% (2/30) of the tart lesions exhibited heterogeneous isoechogenicity (figure 4a). Color doppler revealed that 76.7% (23/30) of the lesions had a rich blood supply and that 23.3% (7/30) of the lesions had a scarce blood supply . Testicular adrenal rest tumor in a 4-year - old patient with congenital adrenal hyperplasia (patient 13). Sonographic examination of the left testis revealed a homogeneous hypoechoic lesion (arrow) with a round clear boundary, 4 mm in diameter, adjacent to the mediastinum of the testis (a, b). Testicular adrenal rest tumor in a 10-year - old patient with congenital adrenal hyperplasia (patient 5). (a) sonographic examination of the right testis revealed a clearly defined heterogeneous hypoechoic lesion (arrow), 14 mm in diameter, adjacent to the mediastinum of testis . (b) color doppler demonstrated marked vascularization compared with the normal testicular parenchyma (arrow). Testicular adrenal rest tumor in a 15-year - old patient with congenital adrenal hyperplasia (patient 4). (a) sonographic examination of the left testis revealed a heterogeneous isoechoic lesion with a lobulated boundary (arrow), 31 mm in diameter, adjacent to the mediastinum of testis . (b) sonographic examination of the left testis half a year later after operation revealed no tart lesion in the heterogeneous echoic testis caused by operation (arrow). Sonographic features of pubescent patients with congenital adrenal hyperplasia and testicular adrenal rest tumors the follow - up period was from 3 to 12 months, and the tart lesions were almost disappeared after operation and hormone therapy . The testis exhibited heterogeneous echogenicity, which might be caused by operation (figure 4b). In male patients with cah, tarts are relatively common, especially in adult males, with a prevalence of nearly 94% . In recent years, it has become evident that some of these lesions can be detected in childhood, with a prevalence ranging from 18.3% to 29% in studies performed on children . A similar prevalence of 19% (15/79) was found in our patient population . To the best of our knowledge, few reports have described the imaging characteristics of tarts in puberty and adolescent; the present study is the first to evaluate the sonographic features of tarts in a large pediatric cah population from 0 to 18 years of age . We retrospectively analyzed the imaging features of 30 tart lesions that had been pathologically or clinically confirmed within the past 5 years . Our results revealed that all 15 cases were bilateral in onset, similar to previous reports . Although the results of delfino et al indicated that 2 of 11 cases were unilateral, we believe that this result might be influenced by lesions too small to detect; in our series, the size of the smallest lesion was 2 mm in diameter, and it is sometimes difficult to detect lesions smaller than 2 mm . Ultrasonography revealed that all 30 lesions in our series were located adjacent to the testicular mediastinum and had clear boundaries . The location in the mediastinum has previously been described and is considered a typical feature of tarts in cah . The results of stikkelbroeck et al revealed blurring of the margins in 36% of lesions, but all of our lesions had clearly defined margins, which may be due to the advanced ultrasonic technology compared with that used a decade ago . In our study, 83.3% (25/30) of the lesions had an irregular, lobulated shape, and ranged from 0.7 to 3.8 cm in size . Five (5/30, 16.7%) lesions were round, ranging from 0.2 to 0.6 cm in size . We believe the tarts begin as small, distinct lesions that could grow and coalesce to form 1 large, lobulated lesion . The histopathological hypothesis of the development of these lesions was that they originated from aberrant adrenal rest cells; when stimulated by adrenocorticotropic hormone, these adrenal rest cells in the testicular tissue were activated and became hyperplastic, subsequently appearing as confluent lesions . The tarts in cah in our group exhibited hypoechogenicity compared with normal testicular tissue except in 6.6% (2/30) of the lesions, which exhibited isoechogenicity . By contrast, with respect to lesion size, stikkelbroeck et al reported that 17 of 20 lesions <2 cm were hypoechoic, whereas all lesions> 2 cm were hypoechoic with hyperechoic reflections . The significant difference in the echogenicity of tarts was likely due to the selection of patients, who were all adults in stikkelbroeck's report and might have had a longer disease course compared with the pubescent patients; furthermore, hyperechogenicity might indicate fibrotic changes or calcifications in the lesions . Color doppler revealed that 76.7% (23/30) of the lesions exhibited a rich blood supply, whereas 23.3% (7/30) of the lesions exhibited a scarce blood supply . In addition, the vessels coursing through the lesions did not deviate or change in caliber . The latter observation has also been made by avila et al and stikkelbroeck et al, who suggested that this appearance may be useful in distinguishing tarts because it has not been described with other testicular tumors . Therefore, tart screening by scrotal bus beginning from early childhood is important in male patients with cah to prevent the development of future complications, especially infertility . Notably, the high tart prevalence in adult patients is due to failure of detection during childhood . Our study still has a limitation, which is the uncertain relationship between tarts size and abnormal hormone levels . So, a well designed clinical study is needed to get the relationship between them . In conclusion, the sonographic characteristics of tarts are bilateral growth, location adjacency to the testicular mediastinum, hypoechogenicity, and a rich blood supply . We recommend that ultrasound be performed from the onset of puberty in all boys with classic cah to avoid the risk of infertility.
Hip fractures are a major problem for the elderly, and especially for those confined to long - term care, both nursing homes and residential homes . Those in institutions constitute about 6%-7% of the population of those over 65 years, but this population contributes almost one third of the hip fracture numbers [1, 2]. The residents of long - term care establishments are, however predominantly female and tend to be particularly old, both risk factors for hip fracture . They are also frailer, which is what usually necessitates their institutionalization and makes them more likely to fall . In addition, they may have fragile bones, though whether more fragile than their community - dwelling peers is not known . In a later report, however, zimmerman and colleagues demonstrated that the predictors of bone density in nursing home patients were the same as for those living in the community, namely, age, gender, race, and weight . We have compared hip fracture rate in long - term care (ltc) and community - dwelling men and women at different age strata . Subsequently we corrected for age and gender distribution in the ltc setting to see what proportion of the excess rate of hip fracturing the different age and gender balance of the ltc population might account for . Any remaining excess risk would point to an added risk factor, be it endogenous or exogenous to the patient, as important in increasing the hip fracture rate in these people . The study was conducted in london, ontario, canada, a city of approximately 350000 residents, using secondary deidentified data . Hospital discharge abstract databases (dads) are reported to the canadian institute for health information from all acute care hospitals in canada (except those in the province of quebec) to form a national database . Dads were obtained from the two local acute care hospitals which handle all hip fractures from the city . Data for 5 calendar years, 20022006 inclusive, were obtained . To distinguish between hip fractures occurring in institutionalized versus community - dwelling populations, a prefracture residence classification was created using information from the residential postal code, place of injury and institution from data fields contained in the dads . A hip fracture was classified as having occurred in an institution if one of the following three criteria was met: (i) the patient's residential postal code matched a specific postal code for an institution (most of the institutions are large enough to have their own specific postal code), (ii) the patient's residential postal code was consistent with, but not specific to, an institution, and the place of injury on the dad was coded for an institution, or (iii) the patient's residential postal code was consistent with but not specific to an institution, and the patient's institution from designation in the dad was unique to a known institution . Residents of both nursing homes and residential homes are included as we could not distinguish between them in the databases . All subjects aged 65 years or over, who were residents of london, were included in the data set . Patients with subcapital (s72.0-s72.091) or intertrochanteric (s72.1-s72.191) fractures were identified from the data field containing the most responsible diagnosis for the length of stay indicator . Patients coded as having a fracture of the femur other than at the subcapital or intertrochanteric sites, those with identified malignant neoplasms (c00-d09, n = 71) or motor vehicle accident - related fractures (v01-v99, n = 48) were excluded . Those with more than one admission within a calendar year for hip fracture were only counted once to exclude those with more than one admission for the same fracture or transfer between hospitals . A few (n = 12) with missing postal codes were excluded . The final number for analysis was 1209 (902 women and 307 men). The number of london residents for the city of london was obtained from statistics canada, census of canada data for the years 2001 and 2006 categorized according to census tract . Given that intercensal estimates are not generated at this level of aggregation, population estimates for each year this assumes a linear change in population numbers and distribution between the two census times . The population count for the middle of the study period (2004) was used in all analyses that amalgamated the study years . The number of institutionalized people (n = 3199) was available from the local agency responsible for admissions to ltc . The age and gender distribution was calculated by a sample survey of 6 ltc homes housing 1448 residents, representing a 45% sample of all ltc residents in the city . For the institutionalized population the numbers in three age strata 6574, 7584, and 85 years and over were calculated for each gender . From the statistics canada data the community dwelling population in each age stratum was derived and the rate of hip fracture for each age stratum calculated from this and the dads . Standard rate of fracture for each age stratum which was used to calculate the expected or theoretical rate of hip fracture for the institutionalized subjects that would be expected if they had the same rate as those of that age stratum and gender living in the community . A total for each of the actual fracture counts and the theoretical counts could then be summed to provide a comparison of the two counts for the total institutionalized population . Although this is similar to the methods used in other studies, for example, that employed by guilley et al ., there is a difference between the two populations that should be noted . Beds which are vacated, usually in the canadian system by the demise of the resident, are filled by a new admission which may or may not be of the same gender and in the same age stratum . It is likely, however, that overall, the population is reasonably stable regarding gender and age distribution, in the absence of any major extraneous influences . In the community, but once again, in the absence of major demographic trends, such as the arrival of the baby boomers, the population will remain reasonably stable in terms of age and gender distribution . There will be some immigration into and emigration from the region of interest somewhat similar to the discharge and admission processes of the institution and which cannot be accounted for . Furthermore in the method used whereby secondary data analysis of 5 consecutive years of administrative data are studied, the institution dwellers are not a true cohort as the turnover is higher, and the composition of the cohorts, in terms of the individual members of the study group year by year, will change more than the community dwellers . This turnover may actually be part of the cause of an excess rate of hip fractures as people newly admitted are known to be at higher risk of hip fracture . Accordingly the definition of the rate of fracture presents some difficulty but for simplicity sake we have chosen to call it the rate per person - year but bearing in mind the above provisos . Data analysis was performed using spss 18, and confidence intervals for ratios followed the method of altman et al . . Figures 1 and 2 compare the crude rates of fracture in community and institutional dwelling subjects for the three age strata and the two genders . In the community, the expected rapid rise with age is seen, with women higher than men for all age strata . For men in institutions the fracture rate increases with age and is much higher than that seen in the community men at all age strata . For women the pattern is somewhat different, with the rate tending to plateau and the rate in the oldest band being very similar for women living in the community and those in the institutions . The men in institutions at the two younger age bands have a fracture rate similar to those of women of the same ages whereas the oldest men in institutions actually have a higher rate than the oldest women in institutions (p <.05). Table 1 shows that the mean age of the patients in the various age bands was very similar for community and ltc dwelling patients . Table 2 shows the actual numbers of hip fractures for men, women, and both together for those living in institutions and the theoretical, or expected, number that would be seen if their rate was the same as those of similar age and same gender living in the community, that is, standardized to the community population . The theoretical number of fractures is calculated by multiplying the total institutional population of that age and gender by the rate of fracturing shown by the community dwellers of same age stratum and gender . For the total of all institutional subjects the rate of fracturing is 1.8 (95% ci 1.62.0) times higher than expected, but it is only 1.5 (95% ci 1.31.7) times higher for women while being 4.3 (95% ci 3.75.6) times higher for men (p <.05 for men versus women). Overall, 207 of the 373 institution - based hip fractures or 55% (+ / 2.6 se) can be explained by the age and gender distribution of the institutional population, but the corresponding percentages explained for the women and men are 66% (+ / 2.8) and 23% (+ / 4.5), respectively . Our study suggests that the excess number of hip fractures that are seen in the ltc population is only partly accounted for by the age and gender distribution in this population . Furthermore, a much lower proportion of the fractures in men appears to be attributable to the age distribution than is the case in women . Hip fractures are a complicated phenomenon produced in part by increasing fragility of the bones with age, an increasing tendency to fall, and a change in the manner of falling in older life, where the fall is more likely to be sideways or backwards [10, 11].the studies of zimmerman et al . And chen et al . Provided several predictors of hip fracture in the ltc population, namely, age, cognition, gender, race, and weight . The population studied here is almost exclusively of white caucasian origin and race is not an issue . We did not have access to weight, which may be an important factor as residents of ltc may lose weight . This has been well described in the context of private for - profit nursing homes in the united states, but evidence from a canadian context is less available [1214]. Undernutrition, as opposed to actual weight loss, is well described, especially in cognitively impaired residents and, indeed, low body weight is a risk factor for admission to an institution . Where the hip fracture phenomenon fits into this scenario clearly requires more study . Within certain populations cumming was able to explain the difference in hip fracture rate between institution and community on the basis of various potential confounders, such as weight, dementia, diet, activity, and so on, but whether the final common pathway was through thinning of the bones or risk of falling, was not explored . Dementia, for example, is associated with an increased rate of hip fracture, but it is associated especially with an increased rate of falling [17, 18]. . Demonstrated that for a given bone density there were more fractures with aging, suggesting other factors operate, the obvious one being a tendency to fall more often . Interestingly, none of these studies has corrected for the rate of falling nor may this be the whole answer, as the way of falling may be as important as the frequency . The possible consequence of the higher turnover in the ltc group needs to be considered . Our hip fracture rates, especially in the older women, are lower than some of the figures reported in the literature . For example, rapp et al . Found a markedly higher rate but their study was a prospective cohort following subjects from the time of admission . Thus this included the early stages of the admission to the home when risk of fracture is highest, due perhaps to disorientation and unfamiliarity with the surroundings, deconditioning from recent illness, and so on, but even allowing for that our rates are low . For example, chen et al . Found an overall rate of 40 per 1000 person years in a prospective study of subjects already residing in ltc . Whether the difference is due to patient factors such as different levels of mobility, or system characteristics, such as admission criteria or one might have predicted that the need to be admitted to long - term care would have had a leveling effect on the rate of fracturing as individuals need to have reached a threshold level of dysfunction, and perhaps frailty, in order to be admitted . To some degree this does happen as the relative increase in risk is much higher for the younger strata compared to those in the community (table 2). However, the observation that for the most part absolute risk is higher for those who are in an institution and are in the most advanced age category suggests that even in older patients, for whom institutionalization seems necessary, increasing frailty is seen with increasing age . The markedly higher hip fracture rate in institutionalized men of all ages and institutionalized women in the two younger age strata, compared to those in the community, is notable . The anomaly seems to be the similar rate of fracturing in the oldest women whether in the community or ltc . Possibly, the reasons the oldest women are admitted to ltc are not related to the risk of falling, this therefore remaining the same for both community and ltc dwellers from that stratum . It is known that falling in the ltc population is much more prevalent than in the community but whether this is correct for the oldest female group is unknown . As more very old men have surviving spouses than do old women, this may enable them to be cared for in the community until they are particularly frail and/or ill, and institutionalization is required . Thus the oldest men may be frailer than their female counterparts . However, this is speculative and the explanation is by no means clear . The situation in the men, who are presumably admitted to the ltc sector for reasons other than osteoporosis, suggests that the high rate in ltc is not just bone - related and, compared to the oldest men, the lower rate in the oldest institutionalized women, who might be expected to have the most osteoporosis, supports a different etiology . Our study has some obvious shortcomings, the main one being an absence of information regarding some of the risk factors, such as weight and cognitive status, in the subjects in the two settings . Our study does, however, include all hip fractures over a 5-year period so should it be free of selection biases . There is some urgency to sorting out the cause of the excess fracture rate in the ltc setting, where it may be easy to assume that the underlying problem is osteoporosis, leading to the use of osteoporosis medications in this setting despite absence of efficacy for this population . As van den kroonenberg et al . Have shown, a fall onto the greater trochanter will generate enough force to break most if not all hip bones, and the real problem of hip fractures in ltc may well be the much more difficult one of falling and the way of falling, with osteoporosis simply determining where the hip will break, with those with thin bones more likely to suffer an intertrochanteric fracture than a subcapital fracture.
Angiogenesis is a constant hallmark of multiple myeloma (mm) progression and has prognostic potential . We have previously isolated endothelial cells (ec) from bone marrow of patients with mm (mmec). They show intrinsic angiogenic ability, because they rapidly form a capillary network in vitro, and extrinsic ability, because they generate numerous new vessels in vivo in the chick embryo chorioallantoic membrane (cam). Moreover, mmec secrete angiogenic cytokines, such as fibroblast growth factor-2 (fgf-2) and vascular endothelial growth factor (vegf), as well as matrix metalloproteinase-2 and 9 (mmp-2 and mmp-9) and express adhesion molecules facilitating dissemination of these cells . Studies by rajkumar et al ., dominici et al ., and laroche et al . The bone marrow microenviromnent plays a crucial role in inducing the angiogenic response in mm [6, 7]. Reciprocal positive and negative interactions between plasma cells and bone marrow stromal cells, namely haematopoietic stem cells, fibroblasts, ostoblasts / osteoclasts, ec, ec progenitor cell, t lymphocytes, macrophages and mast cells are mediated by an array of cytokines, receptors and adhesion molecules . These cells secrete angiogenic factors, such as interleukin-6 (il-6), vegf, fgf-2, hepato - cyte growth factor / scatter factor (hgf / sf), transforming growth factor- (tgf-) and tumour necrosis factor (tnf-) [6, 7]. Here, we have attempted a fine characterization of the angiogenic response induced by mmec, as compared with monoclonal gammopathy of undetermined significance ec (mgusec) in the cam assay . We investigated the angiogenic response induced by gelatin sponges soaked with the cell suspensions and implantedonthecamsurfacefrom8today12ofincu - bation and we studied the effects of mmec and mgusec on the expression of endogenous levels in the cam of vegf, fgf-2, angiopoietin-1(ang-1), hypoxia - inducible factor-1 (hif-1) and endostatin by reverse transcriptase - polymerase chain reaction (rt - pcr). Mmec were obtained from 10 patients with mm and mgsuec were obtained from 10 patients with mgus, as previously described . Fertilized white leghorn chicken eggs were incubated at 37c at constant humidity . On day 3 of incubation a square window was opened in the egg shell after removal of 23 ml of albumen so as to detach the developing cam from the shell . The window was sealed with a glass and the eggs were returned to the incubator . Gelatin sponges (gelfoam, upjohn company, kalamazoo, mi, usa) were cut to a size of 1 mm3 and placed on top of a growing cam at day 8 incubation under sterile conditions . The sponges were then adsorbed with 2 l of cell suspension (18,000 cells per sponge) of mmec or mgusec or with rpmi-1640 medium alone or supplemented with fgf-2 (200 g / ml) (r & d systems, abington, uk), used as negative and positive control, respectively . The angiogenic response was evaluated 96 hrs after the implants by means of a stereomicroscope connected to an image analyser system (olympus italia, italy). Blood vessels entering the sponges within the focal plane of the cam were counted by two observers in a double blind fashion at a magnification of 50x . Means 1 standard deviation (sd) were evaluated for all the parameters and the statistical significance of the differences between the counts was determined by student's t - test for unpaired data . Total rna was extracted from 12 cam treated with ec obtained from six patients with mgus and six patients with mm and from six control cam using trizol reagent (invitrogen, carlsbad, ca, usa) according to the manufactures's protocol . The concentration and the purity of the isolated rna were determined using a spettrofotometric analysis and the integrity of the rna was verified by means of electroforesis in a formaldehyde agarose gel followed by ethidium bromide staining . The cdna was then synthetized with 5 g of total rna using m - mlv and oligo (dt)1820 as primer (invitrogen, carlsbad, ca, usa). Level of mrna expression of pro - angiogenic molecules vegf, fgf-2, ang-1, hif-1 and mrna expression of anti - angiogenic factor endostatin were evaluated by pcr using specific primers and the relative level of the each amplified transcripts were normalized to those of the housekeeping gene -actin . Pcr reactions were performed in a final volume of 25 l containing 2 l of rt products, 10 picomoles of each primer and 1x of red - taq polymerase mix (sigma - aldrich, milano, italy). Preliminary experiments were performed to determine the appropriate conditions (ta and specific number of cycles) for semi - quantitative rt - pcr and transcript were amplified using different cycle numbers:25 cycles for -actin, 30 cycles for vegf, fgf-2, ang-1 and for endostatin and 35 cycles for hif-1. Pcr products were subjected to electrophoresis in a 1.5% agarose gel and ethidium bromide stained, and then photographed under an ultraviolet transilluminator (amersham biosciences). Intensity of bands was quantified as arbitrary optical density units (od) using the scion image software (based on nih image). Six cam treated with ec obtained from three patients with mgus and three patients with mm and three control cam were homogenized in ice cold buffer containing 250 mm sucrose, 10 mm tris - hcl, ph 7.4 and protease inhibitors [1g / ml leupeptin, 1g / ml pepstatin and 1 mm phenyl - methylsulfonyl fluoride (pmsf)]. After homogenization in a potter apparatus and centrifugation at 1000 g for 10 min, the protein content of the supernatant was measured using a bradford assay (bio - rad laboratories, hercules, ca, usa). For sds - page, samples (60 g / lane) were solubilized in laemmli buffer, boiled at 90c for 10 min and runned on a 12% polyacrylamide . The proteins were blotted to a pvdf membrane (millipore corporate, billeira, ma, usa) and immunoblotting was performed using a monoclonal mouse primary antibody against endostatin (novus biologicals, littleton, co, usa) diluted 1:500 in tbst . Peroxidase activity was revealed by chemiluminescence (ecl kit, santa cruz biotechnology, santa cruz, ca, usa) and blot was immediately exposed to x - ray film . Control experiments were performed using a mouse - anti--actin (abcam, cambridge, ca, usa) to detect housekeeping protein -actin to normalize the protein load . Stained bands were scanned and intensity was quantified using the scion image system (based on nih image). Mmec were obtained from 10 patients with mm and mgsuec were obtained from 10 patients with mgus, as previously described . Fertilized white leghorn chicken eggs were incubated at 37c at constant humidity . On day 3 of incubation a square window was opened in the egg shell after removal of 23 ml of albumen so as to detach the developing cam from the shell . The window was sealed with a glass and the eggs were returned to the incubator . Gelatin sponges (gelfoam, upjohn company, kalamazoo, mi, usa) were cut to a size of 1 mm3 and placed on top of a growing cam at day 8 incubation under sterile conditions . The sponges were then adsorbed with 2 l of cell suspension (18,000 cells per sponge) of mmec or mgusec or with rpmi-1640 medium alone or supplemented with fgf-2 (200 g / ml) (r & d systems, abington, uk), used as negative and positive control, respectively . The angiogenic response was evaluated 96 hrs after the implants by means of a stereomicroscope connected to an image analyser system (olympus italia, italy). Blood vessels entering the sponges within the focal plane of the cam were counted by two observers in a double blind fashion at a magnification of 50x . Means 1 standard deviation (sd) were evaluated for all the parameters and the statistical significance of the differences between the counts was determined by student's t - test for unpaired data . Total rna was extracted from 12 cam treated with ec obtained from six patients with mgus and six patients with mm and from six control cam using trizol reagent (invitrogen, carlsbad, ca, usa) according to the manufactures's protocol . The concentration and the purity of the isolated rna were determined using a spettrofotometric analysis and the integrity of the rna was verified by means of electroforesis in a formaldehyde agarose gel followed by ethidium bromide staining . The cdna was then synthetized with 5 g of total rna using m - mlv and oligo (dt)1820 as primer (invitrogen, carlsbad, ca, usa). Level of mrna expression of pro - angiogenic molecules vegf, fgf-2, ang-1, hif-1 and mrna expression of anti - angiogenic factor endostatin were evaluated by pcr using specific primers and the relative level of the each amplified transcripts were normalized to those of the housekeeping gene -actin . Pcr reactions were performed in a final volume of 25 l containing 2 l of rt products, 10 picomoles of each primer and 1x of red - taq polymerase mix (sigma - aldrich, milano, italy). Preliminary experiments were performed to determine the appropriate conditions (ta and specific number of cycles) for semi - quantitative rt - pcr and transcript were amplified using different cycle numbers:25 cycles for -actin, 30 cycles for vegf, fgf-2, ang-1 and for endostatin and 35 cycles for hif-1. Pcr products were subjected to electrophoresis in a 1.5% agarose gel and ethidium bromide stained, and then photographed under an ultraviolet transilluminator (amersham biosciences). Intensity of bands was quantified as arbitrary optical density units (od) using the scion image software (based on nih image). Six cam treated with ec obtained from three patients with mgus and three patients with mm and three control cam were homogenized in ice cold buffer containing 250 mm sucrose, 10 mm tris - hcl, ph 7.4 and protease inhibitors [1g / ml leupeptin, 1g / ml pepstatin and 1 mm phenyl - methylsulfonyl fluoride (pmsf)]. After homogenization in a potter apparatus and centrifugation at 1000 g for 10 min, the protein content of the supernatant was measured using a bradford assay (bio - rad laboratories, hercules, ca, usa). For sds - page, samples (60 g / lane) were solubilized in laemmli buffer, boiled at 90c for 10 min and runned on a 12% polyacrylamide . The proteins were blotted to a pvdf membrane (millipore corporate, billeira, ma, usa) and immunoblotting was performed using a monoclonal mouse primary antibody against endostatin (novus biologicals, littleton, co, usa) diluted 1:500 in tbst . Peroxidase activity was revealed by chemiluminescence (ecl kit, santa cruz biotechnology, santa cruz, ca, usa) and blot was immediately exposed to x - ray film . Control experiments were performed using a mouse - anti--actin (abcam, cambridge, ca, usa) to detect housekeeping protein -actin to normalize the protein load . Stained bands were scanned and intensity was quantified using the scion image system (based on nih image). The ability of mmec and mgusec to induce an angiogenic response in vivo was assessed with the cam - gelatin sponge assay . 1). Cam implanted with the medium containing fgf-2 or mmec gave significantly higher vessel counts and numerous allantoic vessels converging like spokes toward the sponges were recognizable (table 1 and fig . When the sponges were loaded with the medium alone and with mgusec, physiologic angiogenesis was observed in the form of few allantoic vessels partly around and partly converging toward the sponge (table 1 and fig . Angiogenic response assessed by the chick embryo chorioallantoic membrane (cam)-gelatin sponge assay p<0.001 versus rpmi-1640 and mgusec angiogenic activity in the chorioallantoic membrane (cam) assay . Gelatin sponges loaded with fgf-2 (a), mmec (b), rpmi-1640 (c) and mgusec (d) were implanted on top of the cam on day 8 . Macroscopic view of the cam on day 12 shows numerous allantoic vessels converging like spokes toward the sponge in a and b, while few allantoic vessels are recognizable in c and d. original magnification: a d, x 50 . In order to evaluate the angiogenic effects of mmec and mgusec, mrna expression of pro - angiogenic factors including vegf, fgf2, ang-1, hif-1 and mrna expression of anti - angiogenic molecule endostatin the expression level of each transcript was compared to those detected in control cam . As shown in fig . 2, treatment of cam with mmec and mgusec did not produce significant difference in the expression of pro - angiogenic factors mrna in comparison with control cam treated with medium alone . Moreover, no statistical difference was found in vegf, fgf-2, ang-1, hif-1 and endostatin mrna content between mm and mgus treated cam (p<0.05). In contrast, the expression of endostatin mrna detected in both mgus and mm treated cam was significantly lower respect to control cam (mgus od:120.113 and mm od:48.319.6 versus ctrl od:205.84 19.6; p<0.05). Expression levels of mrna coding for vegf, fgf-2, ang-1, hif1 and endostatin evaluated by semi - quantitative rt - pcr . Transcript levels from the cam assay are referred to ec obtained from 6 mm and 6 mmgus patients and the error band represents the standard deviation of six experiments . Western blot analyses were also performed to study whether the expression of endostatin changes in mmec and mgusec treated cam respect to control . As shown in fig . 3, according to rt - pcr quantification, endostatin was significantly lower also at the protein level in both mgusec and mmec treated cam respect to control cam (mgus od: 97.1410 and mm od: 52.313.6 versus ctrl od: 158.715.52; p<0.05). Immunoblotting analysis and quantification after western blot analysis of endostatin expression in cam treated with ec obtained from 3 mm and 3 mgus patients . Mm plasma cells secrete vegf, whereas both vegfr-1 and vegfr-2 are markedly elevated in the bone marrow stromal cells, suggesting that a paracrine growth pathway mediated by vegf - activated stromal cells, secretion of il-6 on their part, and subsequent activation of plasma cells may occur . In active mm, we found secretion of the vegf - a isoform by plasma cells, overexpression of vegfr-2 by bone marrow microvessels and isolated ec and of vegfr-1 by the other stromal cells, secretion of vegf - c and vegf - d by stromal cells, and expression of their cognate receptor vegfr-3 by plasma cells, which suggests another paracrine loop of angiogenesis and tumour growth in mm . Parallel studies by kumar et al . Found secretion of vegf by several mm cell lines and fresh patients' bone marrow plasma cells, as well as expression of vegfr-1 and vegfr-2, which suggests multiple vegf - mediated autocrine pathways of tumour growth and paracrine stimulation of angiogenesis . When we studied the angiogenic potential of plasma cell suspension obtained from patients with active mm and implanted them onto the cam, we demonstrated a vasoproliferative response, significantly higher than that induced by cell suspension obtained from patients either with non - active mm or mgus . Hgf / sf is yet another angiogenic factor identified in the culture medium of both human mm cell lines and freshly isolated plasma cells . Still other factors may be responsible for bone marrow angiogenesis in mm: the plasma cell secretion products, such as tgf-, il-1, il-6 and il-8; granulocyte - colony stimulating factor (g - csf), granulocyte macrophage - colony stimulating factor (gm - csf) and tnf-, secreted by bone marrow microenvironment cells recruited and activated by plasma cells . Since human mm cell lines produce ang-1 that up - regulates the tie-2 cognate receptor in bone marrow ec, involvement of the ang-1/tie-2 loop in mm neovascularization has been demonstrated . Conversely, mmec secrete angiogenic cytokines, such as fgf-2, vegf and ang-1 as well as matrix metalloproteinase-2 and -9 (mmp-2 and mmp-9) and express adhesion molecules facilitating dissemination of these cells . Other studies, however, showed that the expression levels of vegf, fgf-2, and their receptors were similar among plasma cells from mgus and mm, suggesting that increasing angiogenesis from mgus to mm is, at least in part, explained by increased tumour burden rather than increased expression of vegf / vegfr-2 by plasma cells . Another possibility is that the inhibition of angio - genesis in mgus is lost with progression, hence that the switch from mgus to mm may involve a loss of an anti - angiogenic activity . Our data are in accord with this statement, because the expression of endostatin mrna detected in both mgus and mm treated cam was significantly lower respect to control cam . The phenotypic switch to angiogenesis in tumour growth involves more than simple up - regulation of angiogenic activity and is thought to be the result of a net balance of positive and negative regulators, and our study suggests that angiogenic switch in mm, investigated by using an in vivo experimental model such as the chick cam, may involve loss of an endoge - nous angiogenesis inhibitor, namely endostatin.
Preeclampsia, a pregnancy - complicated syndrome, is one of the leading causes of maternal and fetal morbidity and mortality . This potentially dangerous condition affects approximately 27% of all pregnancies in the western world, but the incidence in developing countries can be greater [1, 2]. Preeclampsia is a maternal systemic symptom of late second or third trimester of pregnancy, characterized by hypertension, proteinuria, fetal intrauterine growth restriction, and other maternal abnormity . In the worst cases now, except for induced delivery, there is no effective treatment to cure it . Risk factors involved in preeclampsia have been increasingly identified (table 1), and emergence of any risk factor may cause a woman to develop preeclampsia . However, exact pathogenesis of this disorder remains uncertain since numerous research into the etiology of preeclampsia did not progress significantly . Understanding the detailed mechanism underlying preeclampsia will help to develop novel prophylactic and therapeutic interventions for this condition . The current understanding about preeclampsia is that it appears to develop in a two - stage progress, with a preclinical initial stage which has an abnormal placenta, followed by a second stage during which release of soluble factors from hypoxic placenta leads to various observed maternal conditions, including hypertension, proteinuria, and generalized damage to the maternal organ . Preeclampsia is commonly considered to result from the presence of a poor placenta since the only effective cure of the clinical syndrome is delivery of the placenta . Placentation occurs from weeks 6 to 18 of gestation, during which extravillous cytotrophoblast invasion is required for extensive remodeling of maternal spiral arteries . In preeclampsia, placenta is extremely shallow because of inadequate trophoblast invasion and deficient remodeling of spiral arteries [5, 6]. Implantation failure of placenta predisposes it to hypoxia and oxidative stress, thus resulting in a maternal systemic inflammatory response characterized by enhanced expression of inflammatory mediators . It was found that dysfunctional placenta can release adverse factors into the maternal circulation, causing the clinical features of this condition . These factors include some hormones or chemical substances, such as sflt1 (soluble fms - like tyrosine kinase 1), at1-aa (angiotensin ii at1 receptor auto - antibody), and cardiac glycosides (marinobufagenin, mbg). Among these, sflt1 can cause endothelial dysfunction in the maternal blood vessels by binding vascular endothelial growth factors and placental growth factor; at1-aa can react with the at1 receptor in a stimulatory fashion similar to angiotensin ii signalling, which could contribute to maternal hypertension; mbg, involved in the pathogenesis of preeclampsia, has been demonstrated to cause hypertension, proteinuria, and intrauterine growth restriction in the rat model of preeclampsia . Augmented release of these factors secondary to the original poor placenta will eventually lead to damage of the endothelium, metabolism dysfunction, and inflammation as well as other typical symptoms . Then, what is the exact mechanism leading to deficient trophoblast invasion and further poor placenta? Immune responses and maternal endocrine system can be considered to be two main elements involved in the development of placenta . There is evidence suggesting that shallow placenta is thought to stem from the lack of immune tolerance to pater - derived fetal antigens . Initial maternal rejection to the fetoplacenta may be the main reason for inadequate spiral arteries remodeling in preeclampsia . During the normal pregnancy, maternal innate immune response th1/th2 activity balance is strongly shifted toward th2 activity to maintain the normal fetomaternal interaction . Many have found that maternal t cell cannot recognize fetal human lymphocyte antigens (hlas) rightly and decidua nk cell has an unusual phenotype in preeclampsia . Moreover, another important difference found between normal pregnancy and preeclampsia is the shift of th1/th2 balance toward th1 responses . In addition to immune maladaptation, it is also found that maternal endocrine system is perturbed in preeclampsia . In normal pregnancy, components of renin - angiotensin - aldosterone system, including renin, angiotensin, and aldosterone, are increased, while these hormones are suppressed in preeclampsia . A recent report found that activation of mineralocorticoid receptor in trophoblast by maternal aldosterone appears to be required for trophoblast proliferation and placenta development . Additionally, other pregnancy - related hormones also make great contribution to favourable pregnancy outcome . For example, progesterone plays a dominant role in maintaining uterine quiescence and modulating fetomaternal immune response locally, while estrogen appears also to be a potent immunomodulator in pregnancy - associated immune function . Aberration in these hormones level may disrupt homoeostasis of placenta development, thus causing the onset of preeclampsia eventually . Overall, abnormal change in immune responses and maternal endocrine system throughout pregnancy may be one explanation for preeclampsia (figure 1). Following extensive research into placentation, recent advances have identified emerging key players relevant to placenta establishment, including renin - angiotensin system (ras), 1, 25-dihydroxyvitamin d (1,25(oh)2d3), and lipoxin a4 . Evidence indicates that aberration in them may disrupt placenta development, contributing to adverse pregnancy outcome, such as preeclampsia (described subsequently). V - atpase, another key molecule in placentation, is closely associated with all of them . During normal pregnancy, ras, 1,25(oh)2d3, and lipoxin a4 may work independently, in parallel or jointly on the central molecule, v - atpase, while v - atpase also affects them at the same time . Therefore, the intriguing molecule v - atpase may represent a key link between various causes of preeclampsia . In the following the present review will focus on some new findings about interaction between v - atpase and ras, 1,25(oh)2d3 and lipoxin a4 in pregnancy, which will provide new insights into the molecular mechanisms underlying preeclampsia . The acidity regulation of intracellular and extracellular environment is crucial for a variety of biological processes, including acidity homeostasis, membrane trafficking, protein degradation, and sperm maturation . Central to this regulation is the vacuolar atpase (v - atpase), which is a large multisubunit complex functioning as an atp - driven proton pump . V - atpase is of significant importance in basic physiological processes, and it has been implicated in a number of human diseases, such as renal disease, tumour metastasis, and bone disease . V - atpase is composed of two large domains, v0 and v1 . The v0 domain is a 260 kda membrane - embedded complex that contains six different subunits (a, d, e, c, c, and c) and functions as a proton - translocation domain, whereas the v1 domain is a 650 kda cytoplasmic complex that contains eight different subunits (a, b, c, d, e, f, g, and h) and functions as an atp - hydrolytic domain . It is the structural complexity of v - atpase that makes it an important player in various physiological functions . Many of v - atpase subunits have multiple isoforms, and so specific v - atpase can be composed of different combinations of these subunit isoforms . V - atpase, mediating various physiological processes and cellular homeostasis, may be closely involved in different stages of reproduction . In fact, there are many reports demonstrating that v - atpase has an important role in all aspects of mammalian reproduction, such as spermatogenesis, fertilization, embryonic implantation, and embryo development . On one hand, the acidic microenvironment regulated by v - atpase is essential for embryonic development following embryonic implantation . On the other hand, different v - atpase has specific tissue distribution in reproduction system and exerts differential crucial function . Among all of the v - atpase subunits, subunit a is involved in acrosomal reaction of sperm and embryonic implantation, both of which provide vital foundation for successful pregnancy . Subunit a is a large membrane - spanning protein with a hydrophilic cytoplasmic n - terminal domain and a nine - transmembrane c - terminal domain, and it contains the information necessary to target the v - atpase to different cellular destinations and is responsible for proton transport into the lumen of intracellular vesicles or across membranes . (a1, a2, a3, and a4), which exhibit diverse tissue distribution and subcellular location . (atp6v0a2, referred to as a2v - atpase) can be detected in the epididymis, kidney, lung, thymus, spleen, and placenta . Recently, increasing evidence indicates the crucial role of a2v - atpase in placental immune modulation associated with pregnancy . In early pregnancy, many important cytokines secreted by placenta trophoblast cells and immune cells in decidua play a key role in embryonic implantation and fetomaternal immune tolerance . Interestingly, it is reported that a2v - atpase is important in controlling the expression of these essential cytokines . Thus, the normal expression and localization of a2v - atpase in fetoplacental unit is essential for pregnancy . Have reported that placental a2v - atpase expression is a link between multiple causes of spontaneous abortion in mice, and dysfunction of a2v - atpase in early pregnancy has been associated not only with spontaneous abortion but also with preeclampsia and fetal growth restriction . Another interesting study found that nox2/nadph oxidase regulates antigen crosspresentation in adaptive immunity through changing phagosome lumen ph, whereas the effect of nox2/nadph oxidase on phagosomal ph is antagonized by v - atpase, which may represent a novel mechanism responsible for the maintenance of immune tolerance . Taken together, these indicate the importance of v - atpase in maintaining reproduction process and placentation and modulating fetomaternal immune tolerance in pregnancy, whereas defective v - atpase may increase the risk of causing a poor placenta and inducing preeclampsia (figure 2). The circulating renin - angiotensin system (ras) is an endocrine hormone system that plays a key role in regulating blood pressure and systemic electrolyte balance . Apart from systemic circulating ras, local ras is present in many tissues or organs, such as brain, heart, ovary, and placenta, and one of the major extrarenal ras during pregnancy is the placental ras . In pregnancy, the circulating ras maintains maternal electrolyte balance and blood pressure homoeostasis, facilitating expanding blood supply for fetus, while the placental ras has indispensable role in the uteroplacental unit . Components of placental ras have been confirmed to be involved in many molecular events of placental establishment . A recent review reported that placental cytotrophoblast is rich in at1 receptor, and ang ii - at1 receptor signaling regulates multiple genes associated with normal trophoblast invasion, such as plasminogen activator inhibitor-1 (pai-1), such as soluble fms - like tyrosine receptor-1 (sflt-1) and soluble endoglin (s - eng). Additionally, ang ii signaling also activates nf - kappa b and stimulates the synthesis of reduced nicotinamide - adenine dinucleotide phosphate (nadph) oxidase by trophoblast . Moreover, it has been demonstrated by a recent study that activation of mineralocorticoid receptor in placental trophoblast by maternal aldosterone appears to be required for trophoblast growth and normal fetoplacental function . Therefore, in response to pregnancy, both systemic ras and placental ras need to be adapted to sustain a healthy pregnancy ., there is an increase in almost all the components of maternal ras, including renin, angiotensin, and aldosterone, but these hormones are suppressed in preeclampsia . However, the changes happening in the components of uteroplacental ras are different from those observed in circulating ras . Recent studies demonstrated that upregulation of the at1 receptor expression, increase in renin level, and enhancement of ang ii production occur in uteroplacental unit of preeclamptic women . So, the expression profile of both systemic ras and placental ras in preeclampsia differs greatly from that of healthy uncomplicated pregnancy . Additionally, there is a growing body of reports indicating the presence of the angiotensin ii type i receptor agonistic autoantibody (at1-aa) in preeclamptic women, and this autoantibody through at1 receptor signaling can result in dysregulation of the ras, then leading to clinical features of preeclampsia . All abnormalities in both systemic ras and placental ras can cause poor placentation and preeclampsia . There is accumulating evidence suggesting that components of ras are interrelated to v - atpase and are essential for regulating v - atpase activity . The (pro)renin receptor ((p)rr), encoded in atp6ap2, plays a key role in activation of the local ras, while a truncated form of (p)rr, termed m8.9, was found to be associated with the v - atpase assembly and function, implicating a novel role of (p)rr in v - atpase activity . Recently, another interesting report indicated that (p)rr functions as an adaptor between wnt receptor and v - atpase, which is required for mediating wnt signaling . It was found that angiotensin ii has profound effects on h transport and urinary acidification in kidney, mainly through its regulation on v - atpase activity, and it has also been confirmed to stimulate vacuolar h - atpase activity in renal acid - secretory intercalated cells from the outer medullary collecting duct . Not long before, a report showed that aldosterone may participate in the regulation of v - atpase activity in acid - secretory intercalated cells through rapid nongenomic stimulatory action and contribute to urinary acidification . Meanwhile, another study, prior to this review, described that aldosterone has both genomic and nongenomic stimulatory effects on v - atpase in proximal s3 segments . Considering the content described earlier, it is reasonable that uteroplacental v - atpase function is a key link between ras and placentation . Therefore, any aberration in interaction between ras and v - atpase may induce preeclampsia by interfering various processes in placent development . 1,25-dihydroxyvitamin d (1,25(oh)2d3), the active form of vitamin d, has long been considered to be a leading molecule in calcium and bone homeostasis . However, in the past years, it was found that vitamin d receptor (vdr) is present in most tissues and many tissues contain the 1,25(oh)2d3 synthase, 25(oh)d3 - 1-hydroxylase [31, 32], which makes us begin to be aware of multiple nonclassic actions of 1,25(oh)2d3 . In fact, advances have shown that 1,25(oh)2d3 deficiency may increase the risk of developing a wide range of chronic diseases, including cancer, autoimmune disease, infectious disease, and cardiovascular disease . Through binding to the vdr, 1,25(oh)2d3 can generate a wide array of favorable nonclassic biological responses that are different from its classic actions in maintaining bone and calcium homeostasis, whereas these nonclassic actions are mainly linked to its regulation of cell proliferation, cell differentiation, and immune responses . It is worth emphasizing that some of nonclassic biological effects of 1,25(oh)2d3 have been suggested to participate in modulation of embryo implantation, fetomaternal immune tolerance, and placental antimicrobial and anti - inflammatory responses . Therefore, 1,25(oh)2d3 deficiency in pregnancy may not only impair maternal and fetal bone health, but also cause various adverse pregnancy outcomes such as preterm birth, fetal intrauterine growth restriction, and preeclampsia . Al demonstrated that the level of 1,25(oh)2d3 in both maternal circulation and umbilical cord compartment is low in preeclampsia . Furthermore, expression and activity of 25-hydroxyvitamin d-1-hydroxylase has been confirmed to be significantly restricted in cultures of placental syncytiotrophoblast cells from preeclamptic pregnancy . Typical feature of preeclampsia is maternal systemic inflammatory response, characterized by upregulation of proinflammatory mediators in both uteroplacental unit and peripheral circulation . In fact, as described previously, the systemic inflammatory response in preeclampsia is thought to stem from initial disorder of fetomaternal immune tolerance . Vitamin d, particularly 1,25(oh)2d3, has received particular attention in recent years as it has been shown to have important effect on both innate and adaptive immune systems . Moreover, 1,25(oh)2d3 has been demonstrated to be essential for modulating tissue - specific immune responses and preventing chronic inflammation and autoimmunity . Increasingly, the immunomodulation of 1,25(oh)2d3 has been proposed as a key link between vitamin d and pregnancy . In addition to be mainly synthesized in the kidney, 1,25(oh)2d3 can also be locally produced by immune cells, such as macrophage, dendritic cell, activated t cell, and probably b cell . In autocrine or paracrine manner, the local produced 1,25(oh)2d3 can exert a marked inhibitory effect on adaptive immune responses, promoting humoral th2 responses whilst suppressing cellular th1 responses [33, 36]. For example, 1,25(oh)2d3 is able to inhibit the differentiation, maturation, and immunostimulatory capacity of dcs by decreasing the expression of mhc class ii molecule, cd40, cd80, and cd86 . A recent report by saito speculated that imbalance between regulatory t cell and th17 cell differentiation may explain pathogenesis of preeclampsia, which provides new light on pathophysiology of preeclampsia . Interestingly, 1,25(oh)2d3 has been confirmed to enhance tolerogenic immunity by inducing immunosuppressive treg, while proinflammatory th17 cell is suppressed by 1,25(oh)2d3 . In summary, maternal vitamin d level may influence pregnancy outcome through a variety of potential mechanisms, and impaired vitamin d status may lead to preeclampsia . Indeed, a recent study demonstrated that in the presence of vitamin d, human osteoclasts express elevated v - atpase levels . Meanwhile, this work also described that 1,25(oh)2d3 can upregulate the activity of v - atpase complex . Although the study did not study the case in pregnancy, it will imply us that 1,25(oh)2d3 may have an important effect on uteroplacental v - atpase activity . Moreover, the ability of 1,25(oh)2d3 to regulate secretion of pregnancy - related hormones may explain its role in mediating v - atpase activity . 1,25(oh)2d3 has been confirmed to be an important player in the upregulation of estrogen biosynthesis, and the previous description has also revealed that v - atpase expression is estrogen dependent, which makes it reasonable to speculate that 1,25(oh)2d3 can act on v - atpase indirectly by influencing hormones level . Recently, a significative review suggested that autophagy is a general basis for the multiple health - promoting effects of vitamin d . Autophagy, depending on lysosomal self - digestion machinery, is an evolutionarily conserved self - catabolism process that is essential for cell growth, development, and homeostasis . To a great extent, v - atpase is vital for autophagy since v - atpase is of great importance for lysosomal function . Thus, coupled with v - atpase, 1,25(oh)2d3 could induce and activate autophagy, protecting human against many diseases . Autophagy is induced by several forms of cell stress including hypoxia, infection, and starvation . If autophagy could not be initiated properly, disturbance in autophagy will result in a wide range of disorder . In the case of preeclampsia, abnormal placentation in early pregnancy predisposes placenta to ischemia, hypoxia, and oxidative stress, which accumulates large numbers of apoptotic trophoblast cells at uteroplacental interface . If not treated through cell autophagy, the apoptotic trophoblast cells may impair further placenta development seriously and induce onset of preeclampsia . Thus, maternal vitamin d deficiency may trigger preeclampsia through affecting v - atpase activity, which seems to represent a general and basic pathogenesis of preeclampsia . Lipoxin, the stop signal for inflammation, is the first mediator recognized to have dual anti - inflammatory and proresolution activities . In mammals, lipoxin a4, mainly depending on transcellular biosynthesis in the inflammation microenvironment, is derived from arachidonic acid by the sequential action of lipoxygenase (lox). This pattern of biosynthesis involves the initiation of arachidonic acid oxygenation by 5-lox in leukocytes, and then the intermediate leukotriene a4 is converted into lipoxin a4 by 12-lox in platelets . Interestingly, our previous results indicated that platelet - derived microparticles containing 12-lox can be transferred to leukotriene - producing mast cells, which represents a new pathway for lipoxin a4 biosynthesis in vivo . Lipoxin a4 can act on many cell types including blood cell, neural cell, and stromal cell . Lipoxin a4 displays selective regulation for leukocyte responses and trafficking in vivo through activating its specific receptor, alxr . For example, in neutrophils, lipoxin a4-alxr interaction blocks neutrophil migration and infiltration into sites of inflammation . By contrast, in monocytes, lxa4-alxr interaction stimulates monocyte recruitment and the phagocytosis of apoptotic neutrophils . Recently, we found that lipoxin a4 can suppress hepatocellular carcinoma via remodeling tumor microenvironment . Moreover, we found that alxr (also termed fpr2) has an appreciable pleiotropic regulator role in macrophage polarization, and lxa4-induced m2a+m2c - like macrophage phenotype showed antitumorigenesis activities . Taken together, all previous results show us the key role of lipoxin a4 as an essential modulator of immune response and homoeostasis . Inflammatory processes are central to a series of pregnancy events, while inflammation dysregulation is a typical feature of pregnant complications, such as preeclampsia and preterm . Normal pregnancy is characterised by a state of mild maternal systemic inflammation, which develops when pregnancy is progressing . Although preeclampsia is also associated with inflammatory response, it is an exaggerated maternal systemic inflammatory response . In fact, this disorder is an extreme condition of a range of uncontrolled inflammatory responses induced by abnormal pregnancy . Lipoxin a4, as an anti - inflammatory and proresolution mediator, will play an important role in human pregnancy . In fact, level of lipoxin a4 in nonpregnant women is significantly lower than that in pregnant women, and circulating level of lipoxin a4 in pregnant women displayed a modest but significant increase throughout pregnancy . Thus, it is tempting to speculate that inadequate production of lipoxin a4 can lead to abnormality of placental immunomicroenviroment, increasing the risk of preeclampsia . This has been confirmed by our results from clinical study that level of lipoxin a4 in preeclampsia is significantly lower than that in normal pregnancy . Additionally, our results from animal study demonstrated that lipoxin a4 could suppress the increased production of proinflammatory cytokines and alleviate the symptoms of preeclampsia in lps - induced rat model for human preeclampsia . Moreover, results from our previous study verified that lipoxin a4 can inhibit the enhanced il-1 production of monocytes from severe preeclampsia women . Recently, preliminary results from animal study indicated that lipoxin a4 may participate in the regulation of rat fetomaternal immune tolerance in early pregnancy . Therefore, lipoxin a4, an endogenous anti - inflammatory and proresolution mediator, is a key player in terminating exaggerated inflammatory responses and restoring maternal systemic homoeostasis in pregnancy . The recent findings by russell et al . Found that lipoxin a4 is a novel estrogen receptor modulator and exhibits estrogenic activity in vivo, revealing a previously unappreciated facet of various bioactions of this anti - inflammatory and pro - resolution mediator . Thus, lipoxin a4 may exert an important role in regulating the v - atpase expression, as v - atpase expression level is estrogen dependent, which has been mentioned earlier in this review . In addition, v - atpase may also participate in the modulation of lipoxin a4 bioactions . There is evidence implicating that v - atpase may get involved in the complex interaction between lipoxin a4 and its receptor in lipoxin a4-stimulated signal pathways . Reported that internalization and trafficking is critical for lxa4-stimulated phagocytosis in the resolution of inflammation . Transmembrane receptors internalization is of physiological importance, which is required for right signal transduction, proper dissociation of ligand from receptor, and receptor - mediated endocytosis . Although receptor internalization may occur in different ways, v - atpase - mediated intraendosomal pathway is the main endocytic trafficking machinery . Therefore, internalization and trafficking of lipoxin a4 receptor is likely to require the right assembly and activity of v - atpase in the endocytic complex of alxr internalization . If there is some defect in v - atpase, biological actions of lxa4 through alxr could be severely hindered . In summary, lipoxin a4 may play an important role in modulating v - atpase activity during pregnancy while the key role of lipoxin a4 in fetomaternal immunoregulation also depends on normal v - atpase activity extensively . Based on the previous novel findings, a model of how placental v - atpase function can be a key link between multiple causes of preeclampsia is proposed (figure 3). On one hand, v - atpase is an essential modulator in regulating bioaction of ras, 1,25(oh)2d3, and lipoxin a4 during pregnancy . On the other hand, key roles of ras, 1,25(oh)2d3, and lipoxin a4 can be integrated into the v - atpase function in pregnancy . Right cross - talk between v - atpase and ras, 1,25(oh)2d3, and lipoxin a4 can facilitate normal placentation and ensure successful pregnancy . Once disorder of v - atpase activity takes place at the fetomaternal interface, various bioactivity of ras, 1,25(oh)2d3, and lipoxin a4 will come into great trouble, and vice versa . Any abnormality occurring at the interaction between v - atpase and ras, 1,25(oh)2d3 and lipoxin a4 could cause a defective placenta, which will be eventually involved in the progression of preeclampsia . Overall, the previous proposal not only suggests the importance of v - atpase in modulating essential components of maternal endocrine system (ras) and key molecules of fetomaternal immune interaction (1,25(oh)2d3 and lipoxin a4), but also shows the key role of ras, 1,25(oh)2d3, and lipoxin a4 in regulating v - atpase function . Maternal endocrine system and immune responses have been long considered to be involved in normal placenta development . The renin - angiotensin system is a typical endocrine hormone system that plays a key role in regulating placentation as well as maintaining normal pregnancy . Recently, the immunomodulation of vitamin d in pregnancy has been proposed as a key aspect of placental homoeostasis . Additionally, lipoxin a4, as an anti - inflammatory and proresolution mediator, has been demonstrated to be vital in modulating fetomaternal immune tolerance during pregnancy . Nevertheless, the complexity of various molecular events that occur at the fetomaternal interface in placenta development is far from being completely elucidated . A series of molecular mechanisms needs to be coordinated for establishing a perfect placenta, while any deviation from this ordered course of molecular events may result in pregnancy complications, such as preeclampsia . V - atpase, a key molecule in placentation, is beginning to be appreciated . It is closely linked to renin - angiotensin system, 1,25(oh)2d3, and lipoxin a4 . Further studies regarding v - atpase - related molecular mechanisms necessary for placentation are required, since clinical intervention to these potential dysregulated molecular events may eventually improve pregnancy outcome . Clarify the potential role of placental v - atpase in preeclampsia.investigate the nature of interaction between v - atpase and ras, 1,25(oh)2d3, and lipoxin a4 in normal pregnancy.investigate the causes of abnormal interaction between v - atpase and ras, 1,25(oh)2d3, and lipoxin a4 in preeclampsia.understand the mechanisms of placental damage associated with defective v - atpase, ras, 1,25(oh)2d3 and lipoxin a4 in preeclampsia.study the effect of potential therapeutic agents on placental damage and maternal clinical signs of preeclampsia . Investigate the nature of interaction between v - atpase and ras, 1,25(oh)2d3, and lipoxin a4 in normal pregnancy . Investigate the causes of abnormal interaction between v - atpase and ras, 1,25(oh)2d3, and lipoxin a4 in preeclampsia . Understand the mechanisms of placental damage associated with defective v - atpase, ras, 1,25(oh)2d3 and lipoxin a4 in preeclampsia . Study the effect of potential therapeutic agents on placental damage and maternal clinical signs of preeclampsia.
Spending hours in plastic surgery opd in a government medical college and dealing with the kind of queries posed to us by patients and often having to see delayed and neglected patients made us question and wonder on various views that people have of plastic surgery . Most of the patients had no idea of the range of our services and had reached us after having visited a series of generalists and eventually being referred to us . Hence, we undertook this study with an aim to ascertain current awareness among the medical students and residents (the future practitioners) about the surgical procedures that a plastic surgeon performs . This study was conducted in four medical colleges chosen from four zones of india: king george medical college (kgmu), lucknow; all india institute of medical sciences (aiims), new delhi; king edward memorial (kem) hospital, mumbai; and stanley medical college (smc), chennai . The questionnaire had 35 surgical situations, whereby the respondents were to refer a patient to any department or departments where a particular problem can be managed . A total of 2000 questionnaires were distributed and 1552 responses were received . There were 440 respondents from kgmu, 312 from aiims, 418 from kem, and 382 from smc . The respondents were categorized into four groups: mbbs students, interns, junior residents, and senior residents . The y - axis reveals percentage of referral to plastic surgeons and x - axis shows the group studied . Facial fractures, craniofacial surgery, temporomandibular joint dysfunction cleft lip palate, burns liposuction, rhinoplasty, hair grafting wound cover, pressure ulcer, scalp avulsion peripheral nerve injury, hand anomalies and trauma it was observed [table 1] that there was a good deal of awareness (> 60%) regarding the role of plastic surgeons in dealing with burn injuries, rhinoplasty, liposuction, hair grafting and cleft lip and palate . There was a moderate degree of awareness (4060%) regarding wound management and pressure ulcer, being managed by plastic surgeons . Only 1530% respondents were aware that craniofacial anomalies, congenital hand anomalies, facial fractures, scalp avulsion, hand injuries and peripheral nerve injuries are reconstructed by us . There was a poor knowledge (<15%) about brachial plexus surgery and temporomandibular joint (tmj) ankylosis being managed by plastic surgeons . Table 1 is an ascending order depiction of the awareness regarding treatment of various conditions by plastic surgeons . The findings of our study are similar to those of previous studies on different population and socioeconomic groups which show the public to be poorly informed about plastic surgery . In his paper perception of plastic surgery in the society, the author concludes that indian public associates plastic surgeons with cosmetic and burn surgeries . The knowledge is also limited among medical students and nurses and the source of their knowledge is magazines and newspapers . In their study perception and reality a study of public and professional perceptions of plastic surgery conducted in the british public population, medical students and general practitioners, plastic surgery was associated with reconstruction for trauma and cancer and procedures with a strong aesthetic element by all the three groups and hand was associated with orthopaedic surgeons . In a study conducted in philadelphia in the usa, among consecutive patients visiting a primary care facility, medical students, and primary care physicians, the authors demonstrate that public perception of the plastic and reconstructive surgeon is limited and grossly underestimates this specialty . Although the plastic surgeons are associated with reconstructive surgery, they are not necessarily identified as primary surgeons for procedures fundamental to this specialty . Many people who do not come into contact with plastic surgery in their hospitals are under the popular misconception that plastic surgeons spend their time fixing noses and altering the size of breasts . It is not really surgery since it can be done in the office and is not covered by insurance . The media is also little informed about the versatility of plastic surgeons and ends up building false expectation in public and wrong images of plastic surgeons as scavengers for money . In their paper plastic surgery in the cinema, the authors concluded that films usually incorporate cosmetic surgery and burns in the screenplay . Also, plastic surgeons are depicted to be living in affluent localities, making a lot of money . Patients visiting plastic surgeons are also shown to be ultra rich. [710] this often deters many patients from primarily consulting us . Patients visiting the department late in the course of disease process have often revealed that they had feared to visit our department fearing the expenditure they would incur . Although the findings of this paper may not surprise practicing plastic surgeons, it does quantify a reality we all share that various works of our specialty are not easily identified by public and medical professionals . We have made an attempt to reason out the cause for the same in our country and suggest remedial measures . Also, the commonly followed textbook of general surgery in the undergraduate curriculum discusses mostly burns and cleft lip and palate under plastic surgery section . To add to these, the lectures devoted to plastic surgical topics are few and often delivered by general surgeons who are less equipped to spread awareness among medicos . Hence, plastic surgery department must be developed in all colleges, and medical students and surgical residents must be rotated for at least a week or two as part of their training programme . This is a long - term goal, and till it is in place, a few committed and reverent teachers in the society may come forward to deliver planned lectures to mbbs students in colleges where the department is lacking . This can be put forward by the association of plastic surgeons of india (apsi) as part of expansion of plastic surgery . We should also develop methods to educate the general practitioners because they are the people who reach out to public at large . Our primary aim then should be to educate and sensitise the media regarding the role of plastic surgeon even in day - to - day life of a common man . The contribution of prominent members of plastic surgery society will be more than sufficient to open the eyes of media regarding various subspecialities . Apsi may invite media personnel on an awareness trip to well - established centres to see a variety of procedures and the necessity of plastic surgeon in trauma centres, burn care, as reconstructive surgeons in trauma, congenital and oncological surgeries besides their role as an aesthetic surgeon . We should encourage media personnel to project a real picture to the general public and publicise the various conditions in which plastic surgeons play a role . At the village level, this may be done by plays and distributing pamphlets and posters showing preoperative and postoperative photos . Regular monitoring of progress in the endeavour to spread awareness can be conducted yearly, and necessary intervention may be added as and when required welcoming newer ideas for the same . Our study clearly shows that knowledge about the field of plastic surgery is highly lacking and lot needs to be done to spread awareness . The best way to describe plastic surgeons is that we are a problem solving specialty . The amazing developments made in our field must be made available and accessible to the mass and a collective part played by plastic surgeons can go a long way in making our specialty really known to even layman as to it being a necessity rather than a privilege.
This mixed - methods study (yin, 2003) seeks to more accurately identify perceptions of acceptance for various age-, race-, and sexual identity - based segments of the population within the gay and mainstream communities at a pivotal time in the evolution of both urban gay communities and mainstream societal attitudes . While the use of survey data aligns with extant studies that measure gay community attachment (barrett & pollack, 2005; frost & meyer, 2012), the addition of interviews with self - identified gay and bisexual men and service providers allows for the creation of new, grounded theory (strauss & corbin, 1990) about gay community inclusion and its relationship to the changing social contexts of north america . We employ the concept of perceived acceptance to gauge how the gay and mainstream communities as imagined by individuals are perceived to be oriented toward various groups (e.g., men of color, trans men), rather than measuring individuals levels of attachment to a pre - given gay community . First, measuring perceived acceptance is a more meaningful indicator of the inclusivity of gay and mainstream communities than simple attachment (i.e., participation). Second, asking respondents to identify levels of acceptance toward multiple groups (e.g., men of color) and not just the one being surveyed (i.e., gay and bisexual men) allows individuals to reflect on personal exclusion or discrimination that might be associated with their other intersecting identities (moghaddam & studer, 1997). Finally, our mixed - methods approach allowed for interview narratives to inform our survey design and, through triangulation, corroborate and explain the results it produced . This study is part of a larger project called health in middlesex men matters (himmm), which was initiated following a 2006 forum organized by the regional hiv / aids connection (rhac, formerly aids committee of london) to discuss health needs and challenges for london - middlesex s lgbt, two - spirit, and queer communities . The himmm project was formed to examine how the forum - identified themes of community, communication, and homophobia influence the lives and health of local gay and bisexual men, specifically . As a community - based collaborative research project, partners on himmm include rhac, the university of western ontario, middlesex - london health unit, options clinic for hiv testing at the london intercommunity health centre, st . Joseph s infectious diseases care program, and gay men s sexual health alliance of ontario . London - middlesex, ontario, the study site, is located halfway between toronto, ontario, and detroit, michigan . London is the seat of middlesex county and the eleventh largest city in canada, comprising approximately 366,000 residents and another 70,000 in the surrounding county (statistics canada, 2011). Statistics canada estimates that 34% of the canadian population lives in areas considered to be london - middlesex s peer group: mixed urban - rural areas with average numbers of both aboriginal residents and immigrants (statistics canada, 2009). As of 2006, 11.7% of the population of middlesex county was a visible minority, with the largest populations being black, latin american, and arab (about 2% of the population each) and chinese and south asian residents representing slightly smaller segments (statistics canada, 2006). The study sample, which generally mirrors these characteristics, therefore offers an opportunity to assess the dynamics of social acceptance outside of canada s largest cities . Himmm project data were collected in two phases: an initial phase of qualitative semistructured interviews and a second phase of quantitative information gathered using an online questionnaire . During 2009, semistructured interviews were conducted with 15 local gay and bisexual community members and five service providers . Gay and bisexual men, 16 years or older and residing in middlesex county, were sampled purposively based on age, ethnicity, hiv status, location, and sexual orientation . Service providers, which comprised a physician, an hiv testing provider, and counselors and coordinators from community organizations, were also sampled purposively based on their experiences working with local gay and bisexual men . Community members were asked about gay and bisexual community and identity; access to health and wellness services; and spiritual, emotional, and sexual health . Service providers were asked about their experiences serving gay and bisexual populations, including coming out counseling and working with other local organizations to meet service user needs . Since gay- and bi - identified trans men (female - to - male) are increasingly viewed as part of the gay community (bockting, benner, & coleman, 2009), and since some trans women (male - to - female) have histories or attachments within communities of gay and bisexual men, results relevant to these populations are also considered . No remuneration was offered for participation . After reviewing the transcripts, the himmm team designed the survey, which was pretested and pilot - tested by local gay and bisexual volunteers . Eligibility criteria allowing access to the online survey included age 18 +, having an address in middlesex county (though not necessarily a permanent address, as in the case of students), and identifying as gay, bisexual, or as a man who has had sexual experience with or strong, continual sexual attractions to another man . Questionnaire participants were recruited through online web sites, smartphone apps, and informal referrals between gay and bisexual men . Participants received a $10 gift card as a token gift for completing the survey, with chances to win additional prizes if they referred other gay and bisexual men who also completed the survey . Sociodemographic variables in the survey included age, ethno - racial identity, birth country, educational attainment, household income, employment status, area of residence, marital status, relationship status, and sexual orientation identity, adapted from the canadian community health survey (statistics canada, 2008) and other community surveys . The project team developed 10 questions assessing perceptions of acceptance of gay men, bisexual men, men of color (sexuality not specified), transgender men (sexuality not specified), and transgender women (sexuality not specified) from within the gay community and the broader middlesex - london community . Responses to each question asking how accepting the broader and (separately) gay communities were toward each group were expressed in likert scales ranging from 1 (not at all accepting) to 7 (completely accepting). Using nvivo 10, qualitative interview texts were open - coded and grouped into categories and themes based on team discussions of themes emerging from both the initial forum and the interview data . The team then used coded data reports to outline perceived processes of community development and evolution . First, frequencies for sociodemographic variables were calculated for both the interview and survey samples . Next, paired t - tests were used to test for differences (= 0.05) between respondents perception scores for acceptance of different sexual orientation, race, and gender identity groups within the gay community . Similarly, tests were used to compare acceptance for those same groups within the broader table 1 demographic attributes of survey respondents and interview participants from the health in middlesex men matters (himmm) study survey sample (n = 202) n (%) interview sample (n = 20)age group 182448 (23.8)3 253462 (30.7)7 354430 (14.9)2 455439 (19.3)6 55 + 23 (11.4)2ethno - racial group non - aboriginal white176 (87.1)16 non - aboriginal racialized19 (9.4)3 aboriginal7 (3.5)1ethnic or cultural identity indicated * white canadian / american / european180 (89.1)16 aboriginal7 (3.5)0 east / south / southeast asian7 (3.5)0 latin american5 (2.5)1 black canadian / american / african / caribbean4 (2.0)2 middle eastern3 (1.5)0 indo - caribbean3 (1.5)0education high school not completed12 (6.0)3 high school completed20 (10.0)5 some postsecondary57 (28.4)8 postsecondary graduate112 (55.7)4area of residence non - rural194 (97.0)18 rural6 (3.0)2marital status married or living common - law with a man55 (27.4)8 married or living common - law with a woman6 (3.0)0 separated / divorced / widowed / never married140 (69.7)12sexual orientation identity homosexual153 (89.5)13 bisexual17 (9.9)1 do nt know / would rather not say1 (0.6)1 heterosexual0 (0.0)5trans - identified yes5 (2.5)1 no195 (97.5)18country of birth canada185 (91.6)n / a other17 (8.4)n / ahousehold income per person <$15,00030 (15.6)3 $15,000$29,99963 (32.8)3 $30,000$49,99948 (25.0)3 $50,000$79,99928 (14.6)5 $80,000 + 23 (12.0)3employment status employed163 (81.2)11 non - employed38 (18.9)8student status not attending school146 (72.6)n / a attending school full - time39 (19.4)n / a attending school part - time16 (8.0)n / arelationship status single95 (47.3)n / a in a monogamous relationship71 (35.3)n / a in a non - monogamous or polyamorous relationship35 (17.4)n / a demographic attributes of survey respondents and interview participants from the health in middlesex men matters (himmm) study community . Paired t - tests were also used to assess whether participants viewed the gay community and the broader community as different in their acceptance of each group . Finally, linear regression was used to model the association between age and the perception of acceptance of each group by the gay community, and again separately by the broader community . Following these analyses, the team used an iterative process to triangulate and establish complementarity of information across qualitative and quantitative data sources (yin, 2003). Qualitative and quantitative phases of the himmm project were approved by the non - medical research ethics board at the university of western ontario . Within the broader community, survey respondents perceived distinct hierarchies of acceptance for men of various sexual orientation, genders, and racial identities, with men of color (sexuality not specified) being seen as most accepted and trans persons as least accepted (table 1). As shown in table 2, respondents reported significantly different levels of perceived broader community acceptance of each of the selected identity subgroups (p <0.01), excepting perceived broader community acceptance of gay versus bisexual men . Racialization thus appeared to be less of a perceived detriment to acceptance than sexual minority or transgender status . We questioned whether this may be the result of optimistic perceptions of racial tolerance within our majority - white sample, but as shown in table 3perceptions of broader community acceptance for all men of color did not differ significantly between aboriginal participants (4.71 on a scale of 17), non - aboriginal participants of color (4.68), and white participants (4.61). Since we queried perceived acceptance for single - characteristic groups, we cannot comment on acceptance for different intersections of sexual orientation, gender identity, and race . Table 2 differences in gay and bisexual men s mean perceived levels of broader community acceptance and gay community acceptance, comparisons of subgroups differencetpbroader community acceptance of gay men compared to bisexual men0.111.520.1305 gay men compared to trans men1.3113.51<0.0001 gay men compared to trans women1.1711.83<0.0001 gay men compared to men of color0.736.74<0.0001 bisexual men compared to trans men1.1913.22<0.0001 bisexual men compared to trans women1.0611.41<0.0001 bisexual men compared to men of color0.847.43<0.0001 trans men compared to trans women0.142.680.0081 trans men compared to men of color2.0417.95<0.0001 trans women compared to men of color1.9016.01<0.0001gay community acceptance of gay men compared to bisexual men0.919.630.1305 gay men compared to trans men1.4313.4<0.0001 gay men compared to trans women1.4413.18<0.0001 gay men compared to men of color0.171.710.088 bisexual men compared to trans men0.535.37<0.0001 bisexual men compared to trans women0.565.31<0.0001 bisexual men compared to men of color0.766.79<0.0001 trans men compared to trans women0.030.650.51 trans men compared to men of color1.2711.64<0.0001 trans women compared to men of color1.3111.76<0.0001 differences based on a 7-point likert scale measure . Paired t - test . As an example, gay / bi men perceived that gay men s acceptance within the broader london community was, on average, 0.11 points higher than bisexual men s acceptance, using a 7-point likert scale to measure acceptance . Table 3 differences in gay and bisexual men s mean perceived levels of broader community acceptance and gay community acceptance of men of color, comparisons between respondent ethno - racial groups differencetpbroader community acceptance of men of color aboriginal compared to white0.100.180.86 aboriginal compared to men of color0.030.040.96 white compared to men of color0.070.200.84gay community acceptance of men of color aboriginal compared to white0.300.530.60 aboriginal compared to men of color0.921.100.28 white compared to men of color0.611.690.09 differences based on a 7-point likert scale measure . As an example, gay / bi aboriginal men s perception of the broader community s acceptance of men of color was on average 0.10 points more than white gay / bi men s perception of the broader community s acceptance of men of color (p = 0.0.86). Differences in gay and bisexual men s mean perceived levels of broader community acceptance and gay community acceptance, comparisons of subgroups differences based on a 7-point likert scale measure . As an example, gay / bi men perceived that gay men s acceptance within the broader london community was, on average, 0.11 points higher than bisexual men s acceptance, using a 7-point likert scale to measure acceptance . Differences in gay and bisexual men s mean perceived levels of broader community acceptance and gay community acceptance of men of color, comparisons between respondent ethno - racial groups differences based on a 7-point likert scale measure . As an example, gay / bi aboriginal men s perception of the broader community s acceptance of men of color was on average 0.10 points more than white gay / bi men s perception of the broader community s acceptance of men of color (p = 0.0.86). The high levels of perceived acceptance for gay men in the broader mainstream community align with an emerging narrative of equal rights and greater social acceptance for gay identities in western countries (weeks, 2007; smith, 2008). One interview participant reflected on an adoption support group meeting where he saw widespread support for a middle - class gay couple: i went to these meetings by myself and there were maybe primarily five or six [male / female] couples but there was two men there they presented themselves as a couple awaiting an adoption and i was very pleased to see that the other couples interacted with these two men as they would all of the other couples like, you know, i hope you get a child soon and that kind of thing so that was very affirming . (peter, 51, gay - identified) i went to these meetings by myself and there were maybe primarily five or six [male / female] couples but there was two men there they presented themselves as a couple awaiting an adoption and i was very pleased to see that the other couples interacted with these two men as they would all of the other couples like, you know, i hope you get a child soon and that kind of thing so that was very affirming . (peter, 51, gay - identified) others felt that gay identities had become widely acceptable in the broader london community: um, i think [visibility is] a good thing and i m not one of those people who is really out there or i need to put myself out there . Um, if i m at an event so, the visibility for [my partner and me] has been very good and it hasnt been very negative because of our positions and our reputations in the [london] community . (mark, 31, gay - identified)a very mainstream, you know, social organization [united church of canada] linking themselves with gay pride, i mean that s a very positive thing . (peter, 51, gay - identified) um, i think [visibility is] a good thing and i m not one of those people who is really out there or i need to put myself out there . Um, if it comes up in conversation then we ll talk about it or if i m at an event so, the visibility for [my partner and me] has been very good and it hasnt been very negative because of our positions and our reputations in the [london] community . (mark, 31, gay - identified) a very mainstream, you know, social organization [united church of canada] linking themselves with gay pride, i mean that s a very positive thing . (peter, 51, gay - identified) at the same time, historical events in london suggest a more mixed attitude toward gay and bisexual men within the broader community . In 1993, two local men were arrested on child pornography charges following the discovery of bags of videotapes in a nearby river . Over the next two years, a widely publicized police investigation called project guardian linked the gay community with the possible existence of a large child pornography ring . While only the initial two men arrested were convicted on child pornography charges, at least 2,296 interviews were conducted by police, 64 men were charged for various offenses, some were arrested, and several were also outed (sas & hurley, 1997). During the same period, the london police arrested large numbers of men for cruising in bathrooms and parks (janoff, 2005, pp . In 1995, the year that project guardian concluded, former mayor diane haskett refused the homophile association of london ontario s (halo s) request for the city to issue a proclamation for the london gay pride celebration . Haskett insisted that she would not issue controversial proclamations, and the city council voted 135 against it . Halo filed a complaint with the human rights commission of ontario, which decided in 1997 that both haskett and the london city council had discriminated against halo . Haskett subsequently posted an ad in the london free press claiming the decision was incorrect and violated constitutional freedoms . In this historically hostile social environment, it is feasible that the overall high reported acceptance for gay and bisexual identities masks some variation in men s experiences based on their socioeconomic and professional positions . Those who do not fit easily into the mainstream or require services tend to suffer from the lack of visibility and resources in a smaller community where the closet may be bigger than people on the street mainstream public health services in london - middlesex, for example, have built only limited capacity to address lgbt health needs . [w]e live in a conservative government who does nt care about gay issues, msm issues, the health aspects of a small minute population and there are no services, one participant said . There is a variety of mental health services, um, but again, they re not directed to the gay population and oftentimes there you may have to go to through two or three counsellors before you find one that s appropriate (steve, 45, gay - identified). Another compared the availability of health information in london and toronto: in toronto, you know, you have a community that s so well connected and so well informed that information is just, you know, jumping off the trees really . But in london you really have to go searching for it to find it concerns about anonymity of services in a mid - sized city may discourage some from using the limited services available . One provider recounted, when i first started [at a satellite clinic] and i could nt draw blood very well, i would say you can come by tomorrow to our main site and they would say no, no i ca nt go down there because so and so works there . I do nt want them to know that i m getting blood work for hiv cause i m not out to her in the community . (jason, 53, service provider) when i first started [at a satellite clinic] and i could nt draw blood very well, i would say you can come by tomorrow to our main site and they would say no, no i ca nt go down there because so and so works there . I do nt want them to know that i m getting blood work for hiv cause i m not out to her in the community . (jason, 53, service provider) another participant reflected that the continued marginalization of gay and bisexual men in mainstream health care settings had made the local hiv clinic and counseling center an important support structure for local gay and bisexual men . There s a fundamental belief that even within the structured systems that [gay people are] not right, you know, and i m talking about the aids committee focusing on gay issues as a necessity rather than simply focusing on hiv issues even though all the psychologists and psychiatrists say, you know, this is natural . (steve, 45, gay - identified) there s a fundamental belief that even within the structured systems that [gay people are] not right, you know, and i m talking about the aids committee focusing on gay issues as a necessity rather than simply focusing on hiv issues even though all the psychologists and psychiatrists say, you know, this is natural . (steve, 45, gay - identified) in other institutions, such as schools and media outlets, the subtle, ongoing erasure of lgbt issues and identities persists despite official proclamations of equality, diversity, and inclusion (see young & meyer, 2005; bauer et al ., 2009). While the london region is associated increasingly with a creative cities discourse that equates certain local industries (e.g., education, biosciences) with cosmopolitanism and tolerance (bradford, 2010), other dominant sectors such as finance (e.g., london life insurance), manufacturing (general motors, toyota, mccormick foods), and military - industrial (general dynamics land systems tank manufacturing), have been associated with heteronormative and sometimes homophobic work cultures and environments (mcdowell, 2001; embrick, walther, & wickens, 2007). According to one participant, even the higher education sector in london - middlesex suppressed gay visibilities intermittently: at kings [college] there was a group of students last year who wanted to do something in the cafeteria in conjunction with pride activities on main campus at [university of] western [ontario] and they were initially refused to do that they could have a booth and they could educate about sexual orientation but not celebrate use words that were like too condoning . (peter, 51, gay - identified, white) at kings [college] there was a group of students last year who wanted to do something in the cafeteria in conjunction with pride activities on main campus at [university of] western [ontario] and they were initially refused to do that they could have a booth and they could educate about sexual orientation but not celebrate use words that were like too condoning . (peter, 51, gay - identified, white) in local high schools, suppression of gay identities has been often more overt: we have the safe schools project here and since that s been instigated, numerous teachers have been made to take down their safe space signage because of objections from parents, so it was a good idea but the follow through is lousy (steve, 45, gay - identified). Others felt that the inaccessibility of the local media limited the possibility of a more connected, supportive gay community . One participant said, small groups like [rhac] ca nt afford to take out full page ads each september or the high schools wo nt print them in their newsletters that there is a safe space to come talk about your issues or concerns so the problem is nt necessarily the resource being available, it s the awareness of the availability of the resources and either we do nt have the financial resource to make that happen or we live in a culture that does nt want it to happen . (steve, 45, gay - identified) small groups like [rhac] ca nt afford to take out full page ads each september or the high schools wo nt print them in their newsletters that there is a safe space to come talk about your issues or concerns so the problem is nt necessarily the resource being available, it s the awareness of the availability of the resources and either we do nt have the financial resource to make that happen or we live in a culture that does nt want it to happen . (steve, 45, gay - identified) he added that the london - middlesex mainstream media also seemed to ignore ongoing homophobia and hate crime in the region: i saw on [gay hook - up site] squirt today there that somebody was assaulted a couple days ago here and someone in kitchener got the crap beat out of them too so gay violence is on the rise again, but you know, you do nt ever hear it . Another agreed, in london although both national - level advances in rights and ongoing, more localized marginalization might be therefore described as issues affecting the canadian lgbt community at large, they have been experienced differently by the various subgroups of gay and bisexual men, potentially leading to the diverging perceptions of inclusion in both the gay community and broader society . Acceptance of gay and bisexual men in the mainstream community, then, may be reserved largely for middle - class community members (e.g., business owners) who, in turn, mask or minimize their sexual expression to continue being accepted . There s a number of high profile gay [-owned] businesses opened up and they really revitalized the core, but for the most part their sexuality has been downplayed [in the media]. They re young, exciting, interesting entrepreneurs bringing diversity to our core many of the senior gay businesses, the people who i knew were gay had visible, high traffic locations, had the resources to make an impact and change, they did nt want to be associated with gay pride or gay business, exclusively because the comment was 90% or more of their business comes from a heterosexual population who enjoy the sass, that classing up and london is an upper middle - class community and so they appreciate that sense of decadence not necessarily going to buy into it but they appreciate it . (steve, 45, white) there s a number of high profile gay [-owned] businesses opened up and they really revitalized the core, but for the most part their sexuality has been downplayed [in the media]. Many of the senior gay businesses, the people who i knew were gay had visible, high traffic locations, had the resources to make an impact and change, they did nt want to be associated with gay pride or gay business, exclusively because the comment was 90% or more of their business comes from a heterosexual population who enjoy the sass, that classing up and london is an upper middle - class community and so they appreciate that sense of decadence not necessarily going to buy into it but they appreciate it . (steve, 45, white) another added, there s more publications geared to a gay audience now than ever, but if you witness the way media is going over the last number of years it s not about developing a community, it s using the community to profit from (steve, 45, gay - identified). Middle - class participants also tended to deal with perceived exclusion or marginalization in the broader community by seeking services elsewhere or relocating altogether . One talked about his past unwillingness to disclose his sexual identity to local doctors and, eventually, the choice to have a doctor in toronto: i ve had doctors in the past where i havent disclosed my sexual orientation out of fear of being rejected and, you know, i m pretty sure that it would have happened before because not all doctors are as good as my gp [general practitioner] in toronto (dean, 27, gay - identified). Another found acceptance primarily in white - collar institutions he worked in: i think [acceptance in london is] pretty good to the extent that people feel comfortable sort of being out and you know public in their sexuality in a sense they do nt hide it people will support that and i d certainly in my experience here at the firm they ve been extremely supportive at the law school and in undergrad that s sort of when i was coming out . I mean, you do nt have to make an apology for it because, you know, you re fortunate where you work that it s just not an issue . (will, 29, gay - identified) i think [acceptance in london is] pretty good to the extent that people feel comfortable sort of being out and you know public in their sexuality in a sense they do nt hide it people will support that and i d certainly in my experience here at the firm they ve been extremely supportive at the law school and in undergrad that s sort of when i was coming out . I mean, you do nt have to make an apology for it because, you know, you re fortunate where you work that it s just not an issue . (will, 29, gay - identified) in contrast, he downplays persistent harassment among gay men in london s social spaces as part of the human condition: i mean, sure yeah, sometimes you ll see people in bars or something who are jerks, but that s just you know the human condition i think london is a fairly progressive - minded town and um, you know, it s got a fairly educated population between the university and the hospital system and the health system so you know it s really not a bad place to be gay . I mean, sure yeah, sometimes you ll see people in bars or something who are jerks, but that s just you know the human condition i think london is a fairly progressive - minded town and um, you know, it s got a fairly educated population between the university and the hospital system and the health system so you know it s really not a bad place to be gay . Respondents also perceived high acceptance for men of color (sexual orientation not specified) in the broader london - middlesex community, even more than for gay and bisexual men . As noted, the mean perceived acceptance for all men of color did not differ statistically for participants from different ethno - racial groups . However, research participants may be more likely to report discrimination toward the identity group that is the study s focus (gay and bisexual men, in this case) than they are to report personal discrimination, which may be connected to intersecting statuses such as race (moghaddam & studer, 1997). In contrast, participants observed sustained exclusion of transgender individuals in london - middlesex, mirroring research reporting profound transphobia in ontario s health care institutions and communities more generally (bauer et al ., i knew there was a large trans population but it s not a very visible one i mean those boys and girls they keep themselves well hidden i believe they just allowed gender reassignment surgeries to be covered by [universal public health insurance] again but for years that was taken out (steve, 45, gay - identified). Measuring perceived acceptance of various groups within the london gay community elicited responses markedly different from those regarding the broader london community (see table 2). Here, being a man of color or gay was perceived as most acceptable, with bisexuality less acceptable, and being a transgender man or woman even less so . As shown in table 2, perceived acceptance levels for each group differed significantly from one another at p <0.0001, excepting gay men versus men of color, and transgender men versus transgender women; neither of these comparisons were statistically significant (p> 0.05). Finally, as shown in table 4, the broader london community was perceived as being less accepting than the gay community for each group (p <.0001 for each comparison). Table 4 differences in gay and bisexual men s mean perceived levels of acceptance of subgroups, broader community compared to the gay community differencetpbroader community acceptance compared to gay community acceptance of gay men1.2111.43<0.0001bisexual men0.424.45<0.0001trans men1.0910.15<0.0001trans women0.928.68<0.0001men of color0.323.96<0.0001 differences based on a 7-point likert scale measure . Paired t - test . As an example, gay / bi men perceived that the level of acceptance for gay men within broader community was on average 1.21 points less than their acceptance within the gay community (p <0.0001). Differences in gay and bisexual men s mean perceived levels of acceptance of subgroups, broader community compared to the gay community differences based on a 7-point likert scale measure . As an example, gay / bi men perceived that the level of acceptance for gay men within broader community was on average 1.21 points less than their acceptance within the gay community (p <0.0001). The high perceived acceptance for gay men within the gay community is perhaps an unsurprising finding . Located within a rural, regional bible belt, london acts as a magnet for younger, rurally situated lgbt people moving from homophobic environments (bruce & harper, 2011). At the same time, because it is also located less than 200 miles from toronto, groups such as gay students and white - collar workers might travel to toronto for nightlife and services, or eventually move there (rowe & dowsett, 2008; lewis, 2012). The london - middlesex gay community is also a transient entity whose shifting dynamics affect the durability of community infrastructures . In 2005, halo, the city s central gay community nonprofit organization, bar, and referral center, closed permanently . Halo s closure left a large physical and psychological gap in the community, leaving a rotating circuit of 12 bars, a bathhouse, and the local aids service organization (aso) as the only visible community entry points . For gay men who might not fit easily into the remaining gay commercial scene [volunteering at rhac is] an activity that just makes me feel so good inside and you know, it s a reason to get out of bed in the morning . If it was nt for [rhac], you know, i would not want to see where i would be at just because, you know, coming to [rhac] and having that social interaction and knowing that i m not being judged for being gay, i m not being judged for being hiv positive it s really important that i come here (dean, 27, gay - identified) [volunteering at rhac is] an activity that just makes me feel so good inside and you know, it s a reason to get out of bed in the morning . If it was nt for [rhac], you know, i would not want to see where i would be at just because, you know, coming to [rhac] and having that social interaction and knowing that i m not being judged for being gay, i m not being judged for being hiv positive it s really important that i come here (dean, 27, gay - identified) some felt, however, that rhac was still perceived primarily as a place for the economically disadvantaged or hiv - positive despite its broadened service umbrella . [rhac] primarily supports more marginalized members of society, another added, [london s gay men s community is] either for people who like the bar scene or who are [hiv-] infected, but nothing nothing for anybody else . That s just my take on what i m hearing (jason, 53, service provider). As in the analysis of the broader community, the high reported perceived acceptance for men of color may mask important differences in how white men and men of color perceive the local gay community . One participant recounted: i saw one person of colour in the [pride london] parade and i do nt remember seeing any persons of color observing the parade people of colour, um, generally do nt advertise their lives but if i m one who was interested in [the parade] i m going to, you know, enthusiastically provide that information to other black people so they can be there too . (ronald, did not wish to share age or sexual identity) i saw one person of colour in the [pride london] parade and i do nt remember seeing any persons of color observing the parade people of colour, um, generally do nt advertise their lives but if i m one who was interested in [the parade] i m going to, you know, enthusiastically provide that information to other black people so they can be there too . (ronald, did not wish to share age or sexual identity) he explained further that gay and bisexual men of color may also feel marginalized where few health or social resources are geared to their specific needs and experiences: you wo nt get a black person or a person of colour coming into the group that has 30 white people, one indian and one chinese people and expecting them to share and be open but if they re in a group with people that are in the same health circumstances that they are in and they re all the same colour, then there s gonna be more openness if there were 10 support groups right now and none of them were multicultural i would nt go to none of them even if i felt that i needed them . You wo nt get a black person or a person of colour coming into the group that has 30 white people, one indian and one chinese people and expecting them to share and be open but if they re in a group with people that are in the same health circumstances that they are in and they re all the same colour, then there s gonna be more openness if there were 10 support groups right now and none of them were multicultural i would nt go to none of them even if i felt that i needed them . Ronald s narrative indicates that men of color may feel disconnected from the gay community unless providers make efforts to create communal experiences, avoid tokenization, and allay fears of being outed . Trans participants also delineated themselves as separate from a mainstream gay community that they equated with socializing and nightlife at gay venues . I would say the community that i have run into that s more of the mainstream community, you know, downtown at the clubs and things like that that is a community that i am uncomfortable around you know there is like the club - hopping community and the not - club hopping community i guess that is what i d call it this echoes browne and lim s (2010) study of brighton (england s gay capital), which found that trans residents connected more closely geographically and psychologically with a regional gender clinic than the local gay community defined by tourism and nightlife . Middle - aged respondents perceived the lowest levels of acceptance for the various identity subgroups in the broader london - middlesex community (see figure 1). When asked to evaluate acceptance for the same subgroups within the gay community, middle - aged respondents again reported lower levels of acceptance than younger or older respondents (see figure 2).we found a significant age effect (as indicated by a statistically significant quadratic term) on the assessment of acceptance of all groups other than bisexual men . Figure 1 regression results of gay and bisexual men s mean perceived levels of broader community acceptance of different subgroups, by respondent age figure 2 regression results of gay and bisexual men s mean perceived levels of gay community acceptance of different subgroups, by respondent age regression results of gay and bisexual men s mean perceived levels of broader community acceptance of different subgroups, by respondent age regression results of gay and bisexual men s mean perceived levels of gay community acceptance of different subgroups, by respondent age younger gay men, who have come of age in a milieu of greater social acceptance and gay rights (hammack & cohler, 2011), typically demonstrated the most optimism about the inclusion of sexual minorities within mainstream society: i have a lot of straight friends too that are fine with me being gay and one of my straight friends is really adamant about gay rights i think it s come a long way in both communities because people in the straight community are more accepting now and we are more willing to answer that acceptance and speak out for ourselves bisexuality was deemed equally acceptable as we observed no statistically significant difference in gay and bisexual men s perceived acceptance of bisexual versus gay men in the broader london community, though some suggested that the acceptance was due to perceptions of bisexuality as a stepping stone to being gay rather than a distinct identity . At the same time, the levels of perceived acceptance for gay men compared with other sexual / gender minority groups echoes recent work claiming that developments in gay rights have cultivated a group of inoffensive, normal gay male subjects that are acceptable to mainstream society, while other groups (e.g., trans people) are made marginal (duggan, 2002). Middle - aged men s more pessimistic perceptions of community acceptance appeared based, in part, on experiences from earlier in life (see also kertzner, 2001; hammack & cohler, 2011). One spoke about experiences of school - based, family - based, and sometimes internalized homophobia among middle - aged men who had grown up in the surrounding rural areas . We re a feeder community drawing from a lot of smaller communities i grew up in a place called [name withheld], when i came out with my father he said now why do you want to do that you know how much i hate fags . There s this instantaneous revulsion and yet when he sold his house they found a bag of porn and in there was two very, very hard - core gay porns . (steve, 45, gay - identified) we re a feeder community drawing from a lot of smaller communities i grew up in a place called [name withheld], when i came out with my father he said now why do you want to do that you know how much i hate fags . There s this instantaneous revulsion and yet when he sold his house they found a bag of porn and in there was two very, very hard - core gay porns . (steve, 45, gay - identified) he continued, our school system where you get the majority of this very few parents who would even consider that [their] child may be homosexual for the most part, no, and it s a sense of failure . Other middle - aged participants perceptions were influenced by religious upbringings in the london - middlesex region . One noted that experiences of self - devaluation relating to religion were common among his peers, but also among younger men: you know, so many guys . You re a gay man, well, the devil was punishing you and stuff like i m still hearing that, you know from young guys that come out and say i was abused like whoa there s still a lot of discrimination, there s still even from within internalized guilt and shame may therefore keep some men from coming out or participating in gay community until later in life: i havent heard a lot of people coming through saying that um, they ve been shunned, except you know, unless they ve been shunned by their family or by their community um, i think the lack of acceptance is often from within a lot of people who are reassessing their sexuality or 40 years into a marriage to a woman where the intimacy is long gone and everything is great except that they wind up down at the bathhouse and they re feeling terrible about it . (jason, 53, service provider) i havent heard a lot of people coming through saying that um, they ve been shunned, except you know, unless they ve been shunned by their family or by their community um, i think the lack of acceptance is often from within a lot of people who are reassessing their sexuality or 40 years into a marriage to a woman where the intimacy is long gone and everything is great except that they wind up down at the bathhouse and they re feeling terrible about it . (jason, 53, service provider) men in midlife also appeared most likely to carry forward trauma from events in the community s past: i ve heard like historically you know going back to days where, you know, the mayor would nt declare gay pride day and right - wing groups demonstrating at some pride activities and how much of that is still happening (peter, 51, gay - identified). Younger men, in contrast, were more likely to dismiss discrimination from the mainstream community as a thing of the past . It s something that sort of is like the, you know, diane haskett thing from years ago, but i mean, you d think surely after she gets trounced in the subsequent election [in 2006, despite being re - elected immediately after the legal decision in 1997] that people would say oh, maybe it s not so bad . (will, 29, gay - identified) i think people perceive london as being more conservative than it actually is it s something that sort of is like the, you know, diane haskett thing from years ago, but i mean, you d think surely after she gets trounced in the subsequent election [in 2006, despite being re - elected immediately after the legal decision in 1997] that people would say oh, maybe it s not so bad . (will, 29, gay - identified) mirroring their perceptions of low acceptance for gay and bisexual groups in london, men in or approaching midlife felt especially disenfranchised by a funny split like young people as in university students or college students and then everyone else (will, 29, gay - identified). While younger men tend to join university and college lgbt groups and continue to patronize the city s main commercial gay bar, men in midlife have been left with fewer social supports and opportunities to connect with other men their age . There s been inklings in attempts to have a support group for older adults, [young adult groups are] basically up to 25, so if you re coming out at 30 or in a married relationship and that falls apart because you really discover that you re not just bi, you re not just interested in sex with men there really is nt many supports out there . (steve, 45, gay - identified).like maybe it would be useful periodically to chat with some other middle - aged gay men about if there are some issues that come up sexual activity or sort of moving into middle age i realize that all of my close friends in london are heterosexual and i was thinking this is odd because anywhere else at least a number of my close friends were gay men . (peter, 51, gay - identified) there s been inklings in attempts to have a support group for older adults, [young adult groups are] basically up to 25, so if you re coming out at 30 or in a married relationship and that falls apart because you really discover that you re not just bi, you re not just interested in sex with men there really is nt many supports out there . Like maybe it would be useful periodically to chat with some other middle - aged gay men about if there are some issues that come up sexual activity or sort of moving into middle age i realize that all of my close friends in london are heterosexual and i was thinking this is odd because anywhere else at least a number of my close friends were gay men . (peter, 51, gay - identified) middle - aged participants also commented on the limited number of gay - associated activities and venues that they felt were age - appropriate or interesting . They re not all into bingo i m sure there s a lot of gay men that love to go boating maybe i m at an age where i do my own thing . (carl, 54, msm - identified)with the demise of halo a few years ago there is no social network or body as such, and typically i ll hear this at the bathhouse, the folks are there, and you know they re not especially sexual but, they do nt like the bar scene, they do nt like the music, they do nt like the atmosphere or what the bathhouse is, but they ll go but saying why is there nothing for folks for whom sex is not the be all and the end all? (jason, 53, service provider) not all gays / bisexual or men having sex with men are into drag they re not all into bingo i m sure there s a lot of gay men that love to go boating maybe i m at an age where i do my own thing . (carl, 54, msm - identified) with the demise of halo a few years ago there is no social network or body as such, and typically i ll hear this at the bathhouse, the folks are there, and you know they re not especially sexual but, they do nt like the bar scene, they do nt like the music, they do nt like the atmosphere or what the bathhouse is, but they ll go but saying why is there nothing for folks for whom sex is not the be all and the end all? (jason, 53, service provider) the comments indicate that while some gay community infrastructure exists in the london region, it is seen as supporting primarily a younger, often transient population . While there was insufficient qualitative evidence to examine why older men demonstrated less pessimism about acceptance than middle - aged men, it is possible that this generation sees the current state of the community as more positive because they have survived the aids epidemic, a long - term lack of human rights protections, and the pathologization and criminalization of sexuality . Within the broader community, survey respondents perceived distinct hierarchies of acceptance for men of various sexual orientation, genders, and racial identities, with men of color (sexuality not specified) being seen as most accepted and trans persons as least accepted (table 1). As shown in table 2, respondents reported significantly different levels of perceived broader community acceptance of each of the selected identity subgroups (p <0.01), excepting perceived broader community acceptance of gay versus bisexual men . Racialization thus appeared to be less of a perceived detriment to acceptance than sexual minority or transgender status . We questioned whether this may be the result of optimistic perceptions of racial tolerance within our majority - white sample, but as shown in table 3perceptions of broader community acceptance for all men of color did not differ significantly between aboriginal participants (4.71 on a scale of 17), non - aboriginal participants of color (4.68), and white participants (4.61). Since we queried perceived acceptance for single - characteristic groups, we cannot comment on acceptance for different intersections of sexual orientation, gender identity, and race . Table 2 differences in gay and bisexual men s mean perceived levels of broader community acceptance and gay community acceptance, comparisons of subgroups differencetpbroader community acceptance of gay men compared to bisexual men0.111.520.1305 gay men compared to trans men1.3113.51<0.0001 gay men compared to trans women1.1711.83<0.0001 gay men compared to men of color0.736.74<0.0001 bisexual men compared to trans men1.1913.22<0.0001 bisexual men compared to trans women1.0611.41<0.0001 bisexual men compared to men of color0.847.43<0.0001 trans men compared to trans women0.142.680.0081 trans men compared to men of color2.0417.95<0.0001 trans women compared to men of color1.9016.01<0.0001gay community acceptance of gay men compared to bisexual men0.919.630.1305 gay men compared to trans men1.4313.4<0.0001 gay men compared to trans women1.4413.18<0.0001 gay men compared to men of color0.171.710.088 bisexual men compared to trans men0.535.37<0.0001 bisexual men compared to trans women0.565.31<0.0001 bisexual men compared to men of color0.766.79<0.0001 trans men compared to trans women0.030.650.51 trans men compared to men of color1.2711.64<0.0001 trans women compared to men of color1.3111.76<0.0001 differences based on a 7-point likert scale measure . Paired t - test . As an example, gay / bi men perceived that gay men s acceptance within the broader london community was, on average, 0.11 points higher than bisexual men s acceptance, using a 7-point likert scale to measure acceptance . Table 3 differences in gay and bisexual men s mean perceived levels of broader community acceptance and gay community acceptance of men of color, comparisons between respondent ethno - racial groups differencetpbroader community acceptance of men of color aboriginal compared to white0.100.180.86 aboriginal compared to men of color0.030.040.96 white compared to men of color0.070.200.84gay community acceptance of men of color aboriginal compared to white0.300.530.60 aboriginal compared to men of color0.921.100.28 white compared to men of color0.611.690.09 differences based on a 7-point likert scale measure . As an example, gay / bi aboriginal men s perception of the broader community s acceptance of men of color was on average 0.10 points more than white gay / bi men s perception of the broader community s acceptance of men of color (p = 0.0.86). Differences in gay and bisexual men s mean perceived levels of broader community acceptance and gay community acceptance, comparisons of subgroups differences based on a 7-point likert scale measure . As an example, gay / bi men perceived that gay men s acceptance within the broader london community was, on average, 0.11 points higher than bisexual men s acceptance, using a 7-point likert scale to measure acceptance . Differences in gay and bisexual men s mean perceived levels of broader community acceptance and gay community acceptance of men of color, comparisons between respondent ethno - racial groups differences based on a 7-point likert scale measure . As an example, gay / bi aboriginal men s perception of the broader community s acceptance of men of color was on average 0.10 points more than white gay / bi men s perception of the broader community s acceptance of men of color (p = 0.0.86). The high levels of perceived acceptance for gay men in the broader mainstream community align with an emerging narrative of equal rights and greater social acceptance for gay identities in western countries (weeks, 2007; smith, 2008). One interview participant reflected on an adoption support group meeting where he saw widespread support for a middle - class gay couple: i went to these meetings by myself and there were maybe primarily five or six [male / female] couples but there was two men there they presented themselves as a couple awaiting an adoption and i was very pleased to see that the other couples interacted with these two men as they would all of the other couples like, you know, i hope you get a child soon and that kind of thing so that was very affirming . (peter, 51, gay - identified) i went to these meetings by myself and there were maybe primarily five or six [male / female] couples but there was two men there they presented themselves as a couple awaiting an adoption and i was very pleased to see that the other couples interacted with these two men as they would all of the other couples like, you know, i hope you get a child soon and that kind of thing so that was very affirming . (peter, 51, gay - identified) others felt that gay identities had become widely acceptable in the broader london community: um, i think [visibility is] a good thing and i m not one of those people who is really out there or i need to put myself out there . Um, if i m at an event so, the visibility for [my partner and me] has been very good and it hasnt been very negative because of our positions and our reputations in the [london] community . (mark, 31, gay - identified)a very mainstream, you know, social organization [united church of canada] linking themselves with gay pride, i mean that s a very positive thing . (peter, 51, gay - identified) um, i think [visibility is] a good thing and i m not one of those people who is really out there or i need to put myself out there . Um, if it comes up in conversation then we ll talk about it or if i m at an event so, the visibility for [my partner and me] has been very good and it hasnt been very negative because of our positions and our reputations in the [london] community . (mark, 31, gay - identified) a very mainstream, you know, social organization [united church of canada] linking themselves with gay pride, i mean that s a very positive thing . (peter, 51, gay - identified) at the same time, historical events in london suggest a more mixed attitude toward gay and bisexual men within the broader community . In 1993, two local men were arrested on child pornography charges following the discovery of bags of videotapes in a nearby river . Over the next two years, a widely publicized police investigation called project guardian linked the gay community with the possible existence of a large child pornography ring . While only the initial two men arrested were convicted on child pornography charges, at least 2,296 interviews were conducted by police, 64 men were charged for various offenses, some were arrested, and several were also outed (sas & hurley, 1997). During the same period, the london police arrested large numbers of men for cruising in bathrooms and parks (janoff, 2005, pp . In 1995, the year that project guardian concluded, former mayor diane haskett refused the homophile association of london ontario s (halo s) request for the city to issue a proclamation for the london gay pride celebration . Haskett insisted that she would not issue controversial proclamations, and the city council voted 135 against it . Halo filed a complaint with the human rights commission of ontario, which decided in 1997 that both haskett and the london city council had discriminated against halo . Haskett subsequently posted an ad in the london free press claiming the decision was incorrect and violated constitutional freedoms . In this historically hostile social environment, it is feasible that the overall high reported acceptance for gay and bisexual identities masks some variation in men s experiences based on their socioeconomic and professional positions . Those who do not fit easily into the mainstream or require services tend to suffer from the lack of visibility and resources in a smaller community where the closet may be bigger than people on the street mainstream public health services in london - middlesex, for example, have built only limited capacity to address lgbt health needs . [w]e live in a conservative government who does nt care about gay issues, msm issues, the health aspects of a small minute population and there are no services, one participant said . There is a variety of mental health services, um, but again, they re not directed to the gay population and oftentimes there you may have to go to through two or three counsellors before you find one that s appropriate (steve, 45, gay - identified). Another compared the availability of health information in london and toronto: in toronto, you know, you have a community that s so well connected and so well informed that information is just, you know, jumping off the trees really . But in london you really have to go searching for it to find it concerns about anonymity of services in a mid - sized city may discourage some from using the limited services available . One provider recounted, when i first started [at a satellite clinic] and i could nt draw blood very well, i would say you can come by tomorrow to our main site and they would say no, no i ca nt go down there because so and so works there . I do nt want them to know that i m getting blood work for hiv cause i m not out to her in the community . (jason, 53, service provider) when i first started [at a satellite clinic] and i could nt draw blood very well, i would say you can come by tomorrow to our main site and they would say no, no i ca nt go down there because so and so works there . I do nt want them to know that i m getting blood work for hiv cause i m not out to her in the community . (jason, 53, service provider) another participant reflected that the continued marginalization of gay and bisexual men in mainstream health care settings had made the local hiv clinic and counseling center an important support structure for local gay and bisexual men . There s a fundamental belief that even within the structured systems that [gay people are] not right, you know, and i m talking about the aids committee focusing on gay issues as a necessity rather than simply focusing on hiv issues even though all the psychologists and psychiatrists say, you know, this is natural . (steve, 45, gay - identified) there s a fundamental belief that even within the structured systems that [gay people are] not right, you know, and i m talking about the aids committee focusing on gay issues as a necessity rather than simply focusing on hiv issues even though all the psychologists and psychiatrists say, you know, this is natural . (steve, 45, gay - identified) in other institutions, such as schools and media outlets, the subtle, ongoing erasure of lgbt issues and identities persists despite official proclamations of equality, diversity, and inclusion (see young & meyer, 2005; bauer et al ., 2009). While the london region is associated increasingly with a creative cities discourse that equates certain local industries (e.g., education, biosciences) with cosmopolitanism and tolerance (bradford, 2010), other dominant sectors such as finance (e.g., london life insurance), manufacturing (general motors, toyota, mccormick foods), and military - industrial (general dynamics land systems tank manufacturing), have been associated with heteronormative and sometimes homophobic work cultures and environments (mcdowell, 2001; embrick, walther, & wickens, 2007). According to one participant, even the higher education sector in london - middlesex suppressed gay visibilities intermittently: at kings [college] there was a group of students last year who wanted to do something in the cafeteria in conjunction with pride activities on main campus at [university of] western [ontario] and they were initially refused to do that they could have a booth and they could educate about sexual orientation but not celebrate use words that were like too condoning . (peter, 51, gay - identified, white) at kings [college] there was a group of students last year who wanted to do something in the cafeteria in conjunction with pride activities on main campus at [university of] western [ontario] and they were initially refused to do that they could have a booth and they could educate about sexual orientation but not celebrate use words that were like too condoning . (peter, 51, gay - identified, white) in local high schools, suppression of gay identities has been often more overt: we have the safe schools project here and since that s been instigated, numerous teachers have been made to take down their safe space signage because of objections from parents, so it was a good idea but the follow through is lousy (steve, 45, gay - identified). Others felt that the inaccessibility of the local media limited the possibility of a more connected, supportive gay community . One participant said, small groups like [rhac] ca nt afford to take out full page ads each september or the high schools wo nt print them in their newsletters that there is a safe space to come talk about your issues or concerns so the problem is nt necessarily the resource being available, it s the awareness of the availability of the resources and either we do nt have the financial resource to make that happen or we live in a culture that does nt want it to happen . (steve, 45, gay - identified) small groups like [rhac] ca nt afford to take out full page ads each september or the high schools wo nt print them in their newsletters that there is a safe space to come talk about your issues or concerns so the problem is nt necessarily the resource being available, it s the awareness of the availability of the resources and either we do nt have the financial resource to make that happen or we live in a culture that does nt want it to happen . (steve, 45, gay - identified) he added that the london - middlesex mainstream media also seemed to ignore ongoing homophobia and hate crime in the region: i saw on [gay hook - up site] squirt today there that somebody was assaulted a couple days ago here and someone in kitchener got the crap beat out of them too so gay violence is on the rise again, but you know, you do nt ever hear it . Another agreed, in london although both national - level advances in rights and ongoing, more localized marginalization might be therefore described as issues affecting the canadian lgbt community at large, they have been experienced differently by the various subgroups of gay and bisexual men, potentially leading to the diverging perceptions of inclusion in both the gay community and broader society . Acceptance of gay and bisexual men in the mainstream community, then, may be reserved largely for middle - class community members (e.g., business owners) who, in turn, mask or minimize their sexual expression to continue being accepted . There s a number of high profile gay [-owned] businesses opened up and they really revitalized the core, but for the most part their sexuality has been downplayed [in the media]. They re young, exciting, interesting entrepreneurs bringing diversity to our core many of the senior gay businesses, the people who i knew were gay had visible, high traffic locations, had the resources to make an impact and change, they did nt want to be associated with gay pride or gay business, exclusively because the comment was 90% or more of their business comes from a heterosexual population who enjoy the sass, that classing up and london is an upper middle - class community and so they appreciate that sense of decadence not necessarily going to buy into it but they appreciate it . (steve, 45, white) there s a number of high profile gay [-owned] businesses opened up and they really revitalized the core, but for the most part their sexuality has been downplayed [in the media]. Many of the senior gay businesses, the people who i knew were gay had visible, high traffic locations, had the resources to make an impact and change, they did nt want to be associated with gay pride or gay business, exclusively because the comment was 90% or more of their business comes from a heterosexual population who enjoy the sass, that classing up and london is an upper middle - class community and so they appreciate that sense of decadence not necessarily going to buy into it but they appreciate it . (steve, 45, white) another added, there s more publications geared to a gay audience now than ever, but if you witness the way media is going over the last number of years it s not about developing a community, it s using the community to profit from (steve, 45, gay - identified). Middle - class participants also tended to deal with perceived exclusion or marginalization in the broader community by seeking services elsewhere or relocating altogether . One talked about his past unwillingness to disclose his sexual identity to local doctors and, eventually, the choice to have a doctor in toronto: i ve had doctors in the past where i havent disclosed my sexual orientation out of fear of being rejected and, you know, i m pretty sure that it would have happened before because not all doctors are as good as my gp [general practitioner] in toronto (dean, 27, gay - identified). Another found acceptance primarily in white - collar institutions he worked in: i think [acceptance in london is] pretty good to the extent that people feel comfortable sort of being out and you know public in their sexuality in a sense they do nt hide it people will support that and i d certainly in my experience here at the firm they ve been extremely supportive at the law school and in undergrad that s sort of when i was coming out . I mean, you do nt have to make an apology for it because, you know, you re fortunate where you work that it s just not an issue . (will, 29, gay - identified) i think [acceptance in london is] pretty good to the extent that people feel comfortable sort of being out and you know public in their sexuality in a sense they do nt hide it people will support that and i d certainly in my experience here at the firm they ve been extremely supportive at the law school and in undergrad that s sort of when i was coming out . I mean, you do nt have to make an apology for it because, you know, you re fortunate where you work that it s just not an issue . (will, 29, gay - identified) in contrast, he downplays persistent harassment among gay men in london s social spaces as part of the human condition: i mean, sure yeah, sometimes you ll see people in bars or something who are jerks, but that s just you know the human condition i think london is a fairly progressive - minded town and um, you know, it s got a fairly educated population between the university and the hospital system and the health system so you know it s really not a bad place to be gay . I mean, sure yeah, sometimes you ll see people in bars or something who are jerks, but that s just you know the human condition i think london is a fairly progressive - minded town and um, you know, it s got a fairly educated population between the university and the hospital system and the health system so you know it s really not a bad place to be gay . Respondents also perceived high acceptance for men of color (sexual orientation not specified) in the broader london - middlesex community, even more than for gay and bisexual men . As noted, the mean perceived acceptance for all men of color did not differ statistically for participants from different ethno - racial groups . However, research participants may be more likely to report discrimination toward the identity group that is the study s focus (gay and bisexual men, in this case) than they are to report personal discrimination, which may be connected to intersecting statuses such as race (moghaddam & studer, 1997). In contrast, participants observed sustained exclusion of transgender individuals in london - middlesex, mirroring research reporting profound transphobia in ontario s health care institutions and communities more generally (bauer et al ., i knew there was a large trans population but it s not a very visible one i mean those boys and girls they keep themselves well hidden i believe they just allowed gender reassignment surgeries to be covered by [universal public health insurance] again but for years that was taken out (steve, 45, gay - identified). Measuring perceived acceptance of various groups within the london gay community elicited responses markedly different from those regarding the broader london community (see table 2). Here, being a man of color or gay was perceived as most acceptable, with bisexuality less acceptable, and being a transgender man or woman even less so . As shown in table 2, perceived acceptance levels for each group differed significantly from one another at p <0.0001, excepting gay men versus men of color, and transgender men versus transgender women; neither of these comparisons were statistically significant (p> 0.05). Finally, as shown in table 4, the broader london community was perceived as being less accepting than the gay community for each group (p <.0001 for each comparison). Table 4 differences in gay and bisexual men s mean perceived levels of acceptance of subgroups, broader community compared to the gay community differencetpbroader community acceptance compared to gay community acceptance of gay men1.2111.43<0.0001bisexual men0.424.45<0.0001trans men1.0910.15<0.0001trans women0.928.68<0.0001men of color0.323.96<0.0001 differences based on a 7-point likert scale measure . Paired t - test . As an example, gay / bi men perceived that the level of acceptance for gay men within broader community was on average 1.21 points less than their acceptance within the gay community (p <0.0001). Differences in gay and bisexual men s mean perceived levels of acceptance of subgroups, broader community compared to the gay community differences based on a 7-point likert scale measure . As an example, gay / bi men perceived that the level of acceptance for gay men within broader community was on average 1.21 points less than their acceptance within the gay community (p <0.0001). The high perceived acceptance for gay men within the gay community is perhaps an unsurprising finding . Located within a rural, regional bible belt, london acts as a magnet for younger, rurally situated lgbt people moving from homophobic environments (bruce & harper, 2011). At the same time, because it is also located less than 200 miles from toronto, groups such as gay students and white - collar workers might travel to toronto for nightlife and services, or eventually move there (rowe & dowsett, 2008; lewis, 2012). The london - middlesex gay community is also a transient entity whose shifting dynamics affect the durability of community infrastructures . In 2005, halo, the city s central gay community nonprofit organization, bar, and referral center, closed permanently . Halo s closure left a large physical and psychological gap in the community, leaving a rotating circuit of 12 bars, a bathhouse, and the local aids service organization (aso) as the only visible community entry points . For gay men who might not fit easily into the remaining gay commercial scene [volunteering at rhac is] an activity that just makes me feel so good inside and you know, it s a reason to get out of bed in the morning . If it was nt for [rhac], you know, i would not want to see where i would be at just because, you know, coming to [rhac] and having that social interaction and knowing that i m not being judged for being gay, i m not being judged for being hiv positive it s really important that i come here (dean, 27, gay - identified) [volunteering at rhac is] an activity that just makes me feel so good inside and you know, it s a reason to get out of bed in the morning . If it was nt for [rhac], you know, i would not want to see where i would be at just because, you know, coming to [rhac] and having that social interaction and knowing that i m not being judged for being gay, i m not being judged for being hiv positive it s really important that i come here (dean, 27, gay - identified) some felt, however, that rhac was still perceived primarily as a place for the economically disadvantaged or hiv - positive despite its broadened service umbrella . Another added, [london s gay men s community is] either for people who like the bar scene or who are [hiv-] infected, but nothing nothing for anybody else . (jason, 53, service provider). As in the analysis of the broader community, the high reported perceived acceptance for men of color may mask important differences in how white men and men of color perceive the local gay community . One participant recounted: i saw one person of colour in the [pride london] parade and i do nt remember seeing any persons of color observing the parade people of colour, um, generally do nt advertise their lives but if i m one who was interested in [the parade] i m going to, you know, enthusiastically provide that information to other black people so they can be there too . I saw one person of colour in the [pride london] parade and i do nt remember seeing any persons of color observing the parade people of colour, um, generally do nt advertise their lives but if i m one who was interested in [the parade] i m going to, you know, enthusiastically provide that information to other black people so they can be there too . (ronald, did not wish to share age or sexual identity) he explained further that gay and bisexual men of color may also feel marginalized where few health or social resources are geared to their specific needs and experiences: you wo nt get a black person or a person of colour coming into the group that has 30 white people, one indian and one chinese people and expecting them to share and be open but if they re in a group with people that are in the same health circumstances that they are in and they re all the same colour, then there s gonna be more openness if there were 10 support groups right now and none of them were multicultural i would nt go to none of them even if i felt that i needed them . You wo nt get a black person or a person of colour coming into the group that has 30 white people, one indian and one chinese people and expecting them to share and be open but if they re in a group with people that are in the same health circumstances that they are in and they re all the same colour, then there s gonna be more openness if there were 10 support groups right now and none of them were multicultural i would nt go to none of them even if i felt that i needed them . Ronald s narrative indicates that men of color may feel disconnected from the gay community unless providers make efforts to create communal experiences, avoid tokenization, and allay fears of being outed . Trans participants also delineated themselves as separate from a mainstream gay community that they equated with socializing and nightlife at gay venues . I would say the community that i have run into that s more of the mainstream community, you know, downtown at the clubs and things like that that is a community that i am uncomfortable around you know there is like the club - hopping community and the not - club hopping community i guess that is what i d call it this echoes browne and lim s (2010) study of brighton (england s gay capital), which found that trans residents connected more closely geographically and psychologically with a regional gender clinic than the local gay community defined by tourism and nightlife . Middle - aged respondents perceived the lowest levels of acceptance for the various identity subgroups in the broader london - middlesex community (see figure 1). When asked to evaluate acceptance for the same subgroups within the gay community, middle - aged respondents again reported lower levels of acceptance than younger or older respondents (see figure 2).we found a significant age effect (as indicated by a statistically significant quadratic term) on the assessment of acceptance of all groups other than bisexual men . Figure 1 regression results of gay and bisexual men s mean perceived levels of broader community acceptance of different subgroups, by respondent age figure 2 regression results of gay and bisexual men s mean perceived levels of gay community acceptance of different subgroups, by respondent age regression results of gay and bisexual men s mean perceived levels of broader community acceptance of different subgroups, by respondent age regression results of gay and bisexual men s mean perceived levels of gay community acceptance of different subgroups, by respondent age younger gay men, who have come of age in a milieu of greater social acceptance and gay rights (hammack & cohler, 2011), typically demonstrated the most optimism about the inclusion of sexual minorities within mainstream society: i have a lot of straight friends too that are fine with me being gay and one of my straight friends is really adamant about gay rights i think it s come a long way in both communities because people in the straight community are more accepting now and we are more willing to answer that acceptance and speak out for ourselves bisexuality was deemed equally acceptable as we observed no statistically significant difference in gay and bisexual men s perceived acceptance of bisexual versus gay men in the broader london community, though some suggested that the acceptance was due to perceptions of bisexuality as a stepping stone to being gay rather than a distinct identity . At the same time, the levels of perceived acceptance for gay men compared with other sexual / gender minority groups echoes recent work claiming that developments in gay rights have cultivated a group of inoffensive, normal gay male subjects that are acceptable to mainstream society, while other groups (e.g., trans people) are made marginal (duggan, 2002). Middle - aged men s more pessimistic perceptions of community acceptance appeared based, in part, on experiences from earlier in life (see also kertzner, 2001; hammack & cohler, 2011). One spoke about experiences of school - based, family - based, and sometimes internalized homophobia among middle - aged men who had grown up in the surrounding rural areas . We re a feeder community drawing from a lot of smaller communities i grew up in a place called [name withheld], when i came out with my father he said now why do you want to do that you know how much i hate fags . There s this instantaneous revulsion and yet when he sold his house they found a bag of porn and in there was two very, very hard - core gay porns . (steve, 45, gay - identified) we re a feeder community drawing from a lot of smaller communities i grew up in a place called [name withheld], when i came out with my father he said now why do you want to do that you know how much i hate fags . There s this instantaneous revulsion and yet when he sold his house they found a bag of porn and in there was two very, very hard - core gay porns . (steve, 45, gay - identified) he continued, our school system where you get the majority of this very few parents who would even consider that [their] child may be homosexual for the most part, no, and it s a sense of failure . Other middle - aged participants perceptions were influenced by religious upbringings in the london - middlesex region . One noted that experiences of self - devaluation relating to religion were common among his peers, but also among younger men: you know, so many guys . You re a gay man, well, the devil was punishing you and stuff like i m still hearing that, you know from young guys that come out and say i was abused like whoa there s still a lot of discrimination, there s still even from within internalized guilt and shame may therefore keep some men from coming out or participating in gay community until later in life: i havent heard a lot of people coming through saying that um, they ve been shunned, except you know, unless they ve been shunned by their family or by their community um, i think the lack of acceptance is often from within a lot of people who are reassessing their sexuality or 40 years into a marriage to a woman where the intimacy is long gone and everything is great except that they wind up down at the bathhouse and they re feeling terrible about it . (jason, 53, service provider) i havent heard a lot of people coming through saying that um, they ve been shunned, except you know, unless they ve been shunned by their family or by their community um, i think the lack of acceptance is often from within a lot of people who are reassessing their sexuality or 40 years into a marriage to a woman where the intimacy is long gone and everything is great except that they wind up down at the bathhouse and they re feeling terrible about it . (jason, 53, service provider) men in midlife also appeared most likely to carry forward trauma from events in the community s past: i ve heard like historically you know going back to days where, you know, the mayor would nt declare gay pride day and right - wing groups demonstrating at some pride activities and how much of that is still happening (peter, 51, gay - identified). Younger men, in contrast, were more likely to dismiss discrimination from the mainstream community as a thing of the past . It s something that sort of is like the, you know, diane haskett thing from years ago, but i mean, you d think surely after she gets trounced in the subsequent election [in 2006, despite being re - elected immediately after the legal decision in 1997] that people would say oh, maybe it s not so bad . (will, 29, gay - identified) i think people perceive london as being more conservative than it actually is it s something that sort of is like the, you know, diane haskett thing from years ago, but i mean, you d think surely after she gets trounced in the subsequent election [in 2006, despite being re - elected immediately after the legal decision in 1997] that people would say oh, maybe it s not so bad . (will, 29, gay - identified) mirroring their perceptions of low acceptance for gay and bisexual groups in london, men in or approaching midlife felt especially disenfranchised by a funny split like young people as in university students or college students and then everyone else (will, 29, gay - identified). While younger men tend to join university and college lgbt groups and continue to patronize the city s main commercial gay bar, men in midlife have been left with fewer social supports and opportunities to connect with other men their age . There s been inklings in attempts to have a support group for older adults, [young adult groups are] basically up to 25, so if you re coming out at 30 or in a married relationship and that falls apart because you really discover that you re not just bi, you re not just interested in sex with men there really is nt many supports out there . (steve, 45, gay - identified).like maybe it would be useful periodically to chat with some other middle - aged gay men about if there are some issues that come up sexual activity or sort of moving into middle age i realize that all of my close friends in london are heterosexual and i was thinking this is odd because anywhere else at least a number of my close friends were gay men . (peter, 51, gay - identified) there s been inklings in attempts to have a support group for older adults, [young adult groups are] basically up to 25, so if you re coming out at 30 or in a married relationship and that falls apart because you really discover that you re not just bi, you re not just interested in sex with men there really is nt many supports out there . Like maybe it would be useful periodically to chat with some other middle - aged gay men about if there are some issues that come up sexual activity or sort of moving into middle age i realize that all of my close friends in london are heterosexual and i was thinking this is odd because anywhere else at least a number of my close friends were gay men . (peter, 51, gay - identified) middle - aged participants also commented on the limited number of gay - associated activities and venues that they felt were age - appropriate or interesting . They re not all into bingo i m sure there s a lot of gay men that love to go boating maybe i m at an age where i do my own thing . (carl, 54, msm - identified)with the demise of halo a few years ago there is no social network or body as such, and typically i ll hear this at the bathhouse, the folks are there, and you know they re not especially sexual but, they do nt like the bar scene, they do nt like the music, they do nt like the atmosphere or what the bathhouse is, but they ll go but saying why is there nothing for folks for whom sex is not the be all and the end all? (jason, 53, service provider) not all gays / bisexual or men having sex with men are into drag they re not all into bingo i m sure there s a lot of gay men that love to go boating maybe i m at an age where i do my own thing . (carl, 54, msm - identified) with the demise of halo a few years ago there is no social network or body as such, and typically i ll hear this at the bathhouse, the folks are there, and you know they re not especially sexual but, they do nt like the bar scene, they do nt like the music, they do nt like the atmosphere or what the bathhouse is, but they ll go but saying why is there nothing for folks for whom sex is not the be all and the end all? (jason, 53, service provider) the comments indicate that while some gay community infrastructure exists in the london region, it is seen as supporting primarily a younger, often transient population . While there was insufficient qualitative evidence to examine why older men demonstrated less pessimism about acceptance than middle - aged men, it is possible that this generation sees the current state of the community as more positive because they have survived the aids epidemic, a long - term lack of human rights protections, and the pathologization and criminalization of sexuality . With regard to both the broader london community and the local gay community, respondents perceived a hierarchy of acceptance, with men of color and gay men perceived as most accepted, bisexual men as somewhat less accepted, and trans men and women as least accepted . At the same time, notable variations emerged . Respondents perceived that in the broader community, men of color were more accepted than gay men and bisexual men (who were deemed to be roughly equally accepted). With regard to the gay community, it was men of color and gay men who were deemed equally accepted, while bisexual men were seen as less accepted . Respondents also perceived overall greater acceptance in the gay community than in the broader london - middlesex community . In addition, middle - aged respondents perceived less acceptance for all groups than did younger and older respondents . The high level of perceived acceptance for gay men may signify the growing normalization of gay identities and advances in gay rights . At the same time, comments suggested that acceptance might be directed specifically toward upwardly mobile, professional gay men, and that these segments of the community are also those most able to overcome the lack of social supports in a mid - sized city with a long history of intolerance . The figures for men of color suggested that respondents felt that racial diversity was as accepted as sexual diversity in the gay community, and even more accepted than sexual diversity within the broader community . Although the lack of differentiation for acceptance of gay men and men of color in the gay community could be due simply to higher perceived acceptance for gay men in the gay community (and not lower acceptance for men of color), the qualitative comments suggested that there was only limited integration of those with non - white identities into london s gay community . At the same time, the high perceived acceptance for men of color in the broader community might be inflated due to predominance of white respondents in the sample . The high overall perceived acceptance for all men of color in both gay and broader communities and limited quantifiable differences in perceptions of acceptance across race groups mirrors frost and meyer s (2012) finding that there are few differences in gay community attachment by race group . However, the qualitative comments regarding perceived invisibility of men of color in the gay community echo other recent qualitative work noting racial hierarchies within gay communities (e.g., han, 2007). While the difference in perceived acceptance for men of color and gay men in the gay community was diminished (compared with the broader community), the difference for bisexual men and gay men was amplified (though not significantly so). This might be due to the perception of bisexuality as a conflicted or incomplete sexual identity within the gay community, but as roughly analogous to homosexuality (in terms of acceptability) within the broader community . Trans persons were perceived as least accepted from both the mainstream community and the gay community . Trans persons have not necessarily enjoyed the greater mainstream social acceptance recently achieved for gay men and other sexual minorities, and they may also lack safe, inclusive spaces within urban gay communities characterized more by nightlife and social scenes dominated by gay men than by mutually supportive interaction between multiple sexual and gender minority groups . Finally, the age - based segmentation of perceived acceptance suggests differing experiences of the london region and its gay community among men of different generations . While younger men emphasized recent advances in rights and potential for the future, men at middle age frequently mentioned both individual traumas from growing up in homophobic environments as well as more recent traumas (e.g., project guardian, the pride controversy) affecting their perceived acceptance of sexual and gender diversity in broader london and its gay community . In addition, these feelings may be amplified among older, long - term residents of the region compared with a younger, transient population who fits more easily into the commercial gay scene and may be living in london only temporarily . These trends mirror barrett and pollack s (2005) study noting less gay community attachment among older and working - class men, as well as qualitative interventions that observe age, gender, and generational differences in broader experiences of gay community (browne & lim, 2010; zablotska, holt, & prestage, 2011; wilkinson, 2011; hammack & cohler, 2011). The differences also reflect social, political, and institutional changes that have occurred across canada but that affect different geographic regions and community subgroups differently . In canada, the advent of legal rights such as same - sex marriage, adoption, and pension benefits have been treated as roughly universal goods for gay communities (smith, 2008). Even so, their lived impacts across the sub - communities and sociodemographic groups within them may be more mixed . In the new milieu of rights - based activism, greater social inclusion in the form of same - sex marriage, pension, and adoption rights was pursued in the federal courts, while conservative - led regional governments (e.g., ontario s harris administration during the 1990s and early 2000s) and federal government (the harper administration since 2006) disinvested in health and social services infrastructure geared toward vulnerable and minority groups (hackworth, 2008; whiteside, 2009). Sustained, grassroots lgbt movements in large cities (e.g., toronto) have effectively resisted the trend of rollback neoliberal governance in canada, running services through critical masses of volunteers, in - kind donations, and petitions for public funding . However, smaller cities have not been able to rely on these types of infrastructures (smith, 2005). A lack of gay community connectedness among some groups in london - middlesex, then, may reflect declining infrastructures and services more than it does assimilation into mainstream society (weeks, 2007) or an individualist gravitation toward personal communities (holt, 2011). The qualitative evidence suggests that class also mediates the observed hierarchies of perceived acceptance among respondents . For younger gay and bisexual men who are also middle - class, optimistic perceptions of acceptance may stem from coming of age during the promotion of human rights protections for sexual orientation in canada, insulation within a university environment, ability to participate in the limited nightlife scene, or assuredness of their ability to move (e.g., to toronto). For middle - aged gay and bisexual respondents, class status in the form of white - collar jobs, dual incomes, or ability to engage in more normative practices (e.g., raising children) may to counteract the overall less optimistic perceptions of acceptance . Middle - class respondents also seem most able to dismiss, bypass, or circumvent the (under-) development of more inclusive, sustained community infrastructures by socializing in private and traveling elsewhere, while other groups (e.g., trans men) may remain marginalized . While our study did not compare the survey and interview responses with those from a big - city referent group (e.g., gay and bisexual men in toronto), our preliminary results suggests that recent advances in gay rights and mainstream social acceptance may have a mixed effect in smaller and mid - sized cities . As recent interventions have shown (knopp & brown, 2003; lewis, 2013), cultural hierarchies that position large metropolitan, commercial gay scenes as the birthplaces and anchors of gay community never truly applied to smaller cities such as london . In the 1980s and 1990s, a single venue, halo, fostered an active, self - sustaining gay community . It is only in the new milieu of advanced rights, reduced funding for health and social services, and the closure of organizations such as halo, that toronto a city with established lgbt services, networks, and neighborhoods emerges as the region s dominant urban gay community while smaller - city communities experience continued disinvestment and social fragmentation . Incidentally, the relative security of community identity and visibility in toronto has spawned both a post - mo media discourse that suggests a declining need for village - based gay venues and the emergence of alternative, non - bar queer spaces as well as trans and people of color spaces (nash, 2013). London - middlesex, in contrast, seems to have suffered many of the drawbacks of the new right - based milieu (e.g., homonormativity and gay community disinvestment) without seeing the supposed benefits, such as visibilities for more diverse gay and bisexual groups or the development of a rich array of alternative gay and queer spaces . London and other mid - size or small cities might therefore benefit from community centers that offer opportunities for volunteering and networking across identity - based groups . Such centers even in an online capacity would offer new health promotion opportunities amid persistent perceptions of asos as spaces solely for the hiv - infected (zablotska, holt, & prestage, 2011). Creating such spaces, however, may require public endorsements, funding mechanisms, or public meanwhile, groups who are perceived as most marginalized within the gay community (e.g., trans people, racialized immigrants) might be included through greater network - building with extant organizations such as student groups or the local newcomer settlement center, and through explicitly multicultural and gender - fluid events . Thus, for london and potentially other mid - sized cities, narrowing the social cleavages among gay and bisexual men may require reframing the form and function of gay community rather than merely celebrating ascendance to a . More work, therefore, needs to be done to assess whether gay communities are beginning to evolve differently in smaller cities than they are in large metropolitan areas . The conclusions drawn in this study, however, must also be considered in light of several limitations . First, as a small - scale, convenience - sample study, the results cannot easily be extrapolated to gay and bisexual men and communities more generally, though it may suggest possibilities for this larger group . Second, while the inferential statistics used in this study highlight gradients in perceived social acceptance among gay and bisexual men, they cannot be interpreted in the same way as in a larger, random - sample study . This is primarily a descriptive analysis, and the quantitative analysis does not provide information as to why differences in perceived acceptance exist . However, the study s mixed - methods design overcomes some of this limitation, in allowing more detailed explanation . Third, since we queried perceived acceptance for men of color without sexual identity being specified, we cannot comment on the acceptance of gay or bisexual men of color . Fourth, the higher perceived acceptance for all groups within the gay community may be due to positive bias stemming from surveying respondents who are members of the community they are being asked to describe . Despite these limitations, the study provides an important point of departure for monitoring and assessing emerging cleavages in both gay communities and gay equalities, particularly in mid - sized cities that do not follow dominant metropolitan narratives of gay advancement.
According to the international diabetes federation, metabolic syndrome (ms) is clinically characterized by central obesity (waist circumference 94 cm for men and 80 cm for women), and at least two of these risk factors: high triglyceride levels (150 mg / dl); low hdl cholesterol (40mg / dl); high blood pressure levels (systolic blood pressure 130 mmhg and/or diastolic blood pressure 85 mmhg); and fasting plasma glucose levels 100 mg / dl . This cluster of cardiovascular risk factors is intrinsically related to increased incidence of diabetes mellitus and cardiovascular mortality . Studies have demonstrated several ms - induced abnormalities of cardiac geometry and function . Both increased left ventricular mass and relative wall thicknesses, as well as rapid deceleration time, have been found in hypertensive subjects with ms when compared with a hypertensive cohort without the syndrome . On the other hand, patients with ms in addition, it is well known that insulin resistance plays a key role in ms and as such contributes to the development of premature cardiovascular atherosclerosis, independent of the association with diabetes and obesity [68]. It seems reasonable to assume that the association of several risk factors, as in the ms, favors an increased incidence of cardiovascular diseases and death risks in humans . Thus, a better understanding of the pathophysiological mechanisms of this syndrome becomes of paramount importance in clinical practice . Studies on animal models can be relevant as they mimic the aspects of the human disease as the development and maintenance of ms characteristics, particularly obesity, type 2 diabetes, dyslipidemia, and hypertension . Thus, the aim of this paper is to both describe and discuss the animal models used for the study of ms . A special focus was given to cardiovascular changes which can be seen in tables 1, 2, and 3 . The db / db mouse (bks.cgm+/+leprdb/j) is a genetic model widely used as ms animal model, as it presents a leptin receptor mutation which causes hyperglycemia and insulin resistance . However, the evaluation of these animals with 8 - 9 weeks of age did not lead to changes in blood pressure as compared to their wild controls . As the animals age (14 - 15 weeks), noradrenergic responsiveness of the heart is reduced and indications of sympathetic denervation are observed . The increase in blood pressure of these animals is associated with an increase in plasma angiotensin converting enzyme activity and angiotensin ii levels . Using spectral methods for autonomic function evaluation, no changes in heart rate variability, blood pressure variability, or baroreflex function are observed [11, 13]. In addition, db / db mice show impaired cardiac functional reserve capacity during maximal beta - adrenergic stimulation (with dobutamine), which is associated with unfavorable changes in cardiac energy metabolism . Kkay is a congenital strain established by the transduction of the yellow obese gene (ay) into the moderate hyperglycemic kk strain . Kkay mice are obese and have high blood pressure levels, increased urinary excretion of catecholamines, and exacerbated responses to sympathetic blockade, suggesting a sympathetic role in the genesis of their hypertension [16, 17]. The ob / ob mice have a mutation in the ob gene resulting in leptin deficiency . Short - term direct blood pressure measurements suggested that the ob / ob mice are hypotensive with low sympathetic nerve activity . However, when blood pressure is measured chronically, that is, data are collected for 5 s every 2 min and are averaged for the light cycle (7 am4 pm) and the dark cycle (7 pm5 am) with radiotelemetry (24 h full - time), ob / ob mice remain hypertensive during the light period . Interestingly, during the dark cycle, ob / ob mice show no difference in blood pressure . On examination of the data over 24 h (the dark and light cycles combined), ob / ob mice, blood pressure was measured 24 h / day, which obviously includes every activity performed by the animals . Thus, behavior and feeding may be especially relevant since the ob / ob animals have leptin deficiency and eat throughout the day and at night, leading to the hypertension observed during the day . Furthermore, these animals develop left ventricular hypertrophy with decreased cardiac function at 24 weeks of age and cardiac fibrosis after 20 weeks of age . Finally, the db / db (c57bl / ksj - db / db) mice have inherited an autosomal recessive mutation in the leptin receptor gene present on chromosome 4 . The metabolic alterations most frequently observed in this strain are hyperglycemia, hyperinsulinemia, hypertriglyceridemia, hypercholesterolemia, high levels of nonesterified fatty acids, and reduced hdl cholesterol . In addition to these changes, both infiltration with inflammatory cells and fibrosis were observed in the heart after 12 weeks of age . These mice also show vascular endothelial dysfunction, although no blood pressure changes are observed . We studied the cardiovascular and autonomic phenotype of male db / db mice and evaluated the role of angiotensin ii at(1) receptors . Radiotelemetry was used to monitor 24 h blood pressure in mice for 8 weeks . Although there were no changes in heart rate variability and spontaneous baroreflex sensitivity between control and db / db mice, the results indicate an age - related increase in mean arterial pressure in db / db mice, which can be reduced by the antagonism of angiotensin ii at(1) receptors . Wistar ottawa karlsburg w (wokw) rats were developed from a wistar rat outbred strain of the biobreeding laboratories . As observed in humans, the features of ms in this model in addition to obesity, this animal model shows other metabolic alterations, such as dyslipidemia, hyperinsulinemia, and impaired glucose tolerance . Specifically, insulin resistance in this animal model genomic scan studies have revealed a linkage of the ms and/or diabetes to a region on chromosome 3 (3q26 - 27), where the gene encoding adiponectin, apm1, is located . One important clinical characteristic displayed by these animals was the impaired coronary function, due to increased alpha(1)-adrenoceptor - mediated coronary constriction (at 3 and 10 months of age), and to a seriously blunted beta - adrenoceptor - mediated coronary relaxation (at 16 months of age). Zucker obese (zo) rat model develops ms characterized by obesity since they are polyphagic due to a mutation in the leptin receptor [30, 31], insulin resistance, hypertriglyceridemia, and hypertension . Obesity leads to an inflammatory state which is linked to reduced insulin sensitivity and expression of glut4 in adipose tissue, skeletal muscle, and heart [33, 34]. This is likely to be related to increased circulating free fatty acids which compete with glucose as energy substrate and also inhibit the translocation of glut4 to the cell membrane . Myocardial fatty acid uptake and utilization lend support to the hypothesis that myocardial insulin resistance is associated with cardiac dysfunction, characterized by increased left ventricle mass, reduction systolic function, and survival . Increasing fatty acid as fuel energy can lead to increased reactive oxygen species, thus contributing to structural and functional damage in the myocardium . Accordingly, these abnormalities occur prior to the onset of hypertension, which becomes elevated above control levels around 12 weeks of age . Furthermore, cardiovascular complications similar to human obesity also include higher resting sympathetic nerve activity and reduced heart rate variability [35, 36] which were observed in zo rats attenuated baroreflex - mediated changes in sympathetic nerve activity to vascular targets . These are due to impairments in sympathetic and parasympathetic control of the heart [37, 38]. Zucker diabetic fatty rats (zdf) phenotype originated from selective breeding of zucker rats with high glucose levels, which developed diabetes after 10 weeks of age . Zdf presents hyperphagia, as a result of a nonfunctioning leptin receptor, which in turn leads to obesity similar to the prediabetic state in humans . Furthermore, hyperglycemia in the zdf model is different from that observed in the zo; zdf rats do not have sufficient pancreatic -cell function . It has been observed that changes in left ventricular chamber morphology occurred in the untreated zdf animals as early as 16 weeks of age . (2009) found an increase in myocardial fatty acid oxidation, a reduction in insulin - mediated myocardial glucose utilization, associated with impairment of myocardial function in zdf rats with 14 weeks of age . In addition, vascular and neural dysfunction observed in zdf rats with 12 weeks of age has been improved with vasopeptidase inhibitors . In addition, this animal model shows an increase in plasma angiotensin converting enzyme activity and angiotensin ii levels that, associated with high glucose levels, can lead to advanced nephropathy . This may be the reason by which zdf rats started to die at 50 weeks of age (63 weeks for the control group), in association with an abrupt increase in blood urea nitrogen, suggesting that the cause of death was renal insufficiency . One of the most recently created ms models is the dahls.z - lepr / lepr rat (ds / obese). This ms model was established by crossing dahl salt rats and zucker rats with the missense mutation in the leptin receptor gene (lepr). The animals, once fed with a normal diet, developed obesity, as well as hypertension, dyslipidemia, insulin resistance, and type 2 diabetes . In addition, these animals developed cardiac hypertrophy, as well as renal and liver damage, which may account for their premature death . Hattori et al . (2011) showed that in an experimental period of 18 weeks, 13 (65%) of 20 ds / obese rats died (seven from renal failure, two from cerebrovascular events, and four from sudden cardiac death); there were no deaths in the control group . (2012) have recently demonstrated that body weight, as well as visceral and subcutaneous fat mass, was significantly increased in ds / obese female rats, which was associated with diastolic dysfunction and marked left ventricle hypertrophy and fibrosis . Myocardial oxidative stress and inflammation, serum insulin, and triglyceride were also increased in ds / obese rats compared with ds / lean rats . Otsuka long - evans tokushima fatty (oletf) rats are a cholecystokinin 1 receptor knockout model which become obese secondarily to hyperphagia . The increased food intake is characterized by a large increase in meal size with a decrease in meal frequency which is not sufficient to compensate for the meal size increase . As a result, these animals usually present hyperglycemia after 18 weeks of age, mild obesity, and diabetes mellitus, more frequently observed in males . However, insulin resistance in oletf rats emerges at 12 weeks of age, before the impairment of pancreatic -cell function . (2000) have previously demonstrated that oletf rats present diastolic dysfunction in their prediabetic state (15 weeks), observed by a prolongation in deceleration time and a decrease in amplitude of peak velocity of the early diastolic filling wave, without changes in the blood pressure and heart rate . In addition, the researchers observed extracellular fibrosis and abundant transforming growth factor-1 receptor ii in the left ventricle of these rats . While still in the prediabetic stage, oletf rats exhibited a lower coronary flow reserve and increased coronary vascular resistance during hyperemia, which was associated with increased wall - to - lumen ratio and perivascular fibrosis . In the late stage of diabetes (22 and 62 weeks of age), it was demonstrated that these animals displayed an impairment in diastolic function and changes in the geometry of conductance and resistance arteries . The goto - kakizaki (gk) model was created by selective breeding of an outbred colony of wistar rats, selected for high glucose levels in an oral glucose tolerance test . These animals develop hyperglycemia after 4 weeks of age and increased liver and plasma lipid concentration after 8 weeks of age . After 16 weeks of age, at prediabetic state, gk rats displayed left ventricle remodeling with marked hypertrophy of cardiomyocytes and increased extracellular matrix deposition, culminating in increased heart size . Despite the progressively worsening of glucose metabolism derangement, at 18 months of age the contractile function of the heart appears to be well preserved, as observed by maintenance of amplitude of shortening in electrically stimulated myocytes . In addition, untreated gk rats presented mild hypertension and a blunted vascular relaxation by acetylcholine and sodium nitroprusside when compared to control animals . We studied in our laboratory the cardiovascular autonomic function of obesity induced by monosodium glutamate (msg) in a normotensive model . Male wistar rats receiving msg neonatal treatment showed metabolic abnormalities, as well as increased body weight, lee index, epididymal white adipose tissue, and insulin resistance . In addition, these animals exhibited reduced glucose / insulin index (62.5%), and increased insulin secretion during glucose overload (39.3%), and hyperinsulinemia . These rats showed a slight increase in mean arterial pressure with no difference in the heart rate from their controls . However, they showed cardiovascular autonomic dysfunction, as shown by reduced baroreflex sensitivity and vagal and sympathetic effects when compared to their controls . We observed a reduced sympathetic effect which was not followed by changes in the basal heart rate or tachycardic responses to arterial pressure changes . Recently, we carried out studies on cardiovascular abnormalities of the spontaneously hypertensive rat (shr) [59, 60] treated with msg in the neonatal period . Although this animal model is not new [62, 63], no research, to our knowledge, has been undertaken using metabolic and cardiovascular parameters over time (3, 6, and 9 months of age). The use of msg in genetically hypertensive rats led these animals to progressively increase body adiposity and triglyceride levels . Besides developing and maintaining insulin resistance, they presented low hdl cholesterol and increased inflammation state (high c - reactive protein, interleukin 6, tumor necrosis factor- levels, and low adiponectin levels), which reached highest levels at 6 and 9 months of age . In ms, therefore, the use of a genetically hypertensive rats associated with msg treatment, which leads to metabolic changes including obesity, seems to work well as an ms model resembling the human disease . However, early studies showed that shr treated with msg did not maintain hypertension, but it should be noted that indirect tail - cuff methods were used . Thus, we evaluated blood pressure by direct method (analyzed on a beat - to - beat basis) at 3, 6, and 9 months in msg - treated shr compared to shr and normotensive rats . It was observed that mean blood pressure was similarly higher in shr and msg - treated shr at all ages, when compared to normotensive rats . Furthermore, there were no changes in blood pressure over time in the groups studied . The increased cardiovascular mortality which characterizes ms may be partially attributed to cardiac sympatho - vagal imbalance [64, 65]. Thus, we evaluated temporal cardiovascular autonomic dysfunction in this model by spectral analysis and observed that the changes in cardiovascular autonomic control evaluated up to 9 months are similar to those observed in hypertensive rats . At 9 months the animals maintained the hypertensive state, a feature of shr, and presented reduced heart rate variability, decreased spontaneous baroreflex sensibility, and increased cardiac sympathovagal balance . In addition to these changes, it was observed that shr and shr with msg - induced obesity showed increments of 6- to 8-fold of systolic arterial pressure variability at 6 and 9 months, as compared to normotensive rats . Interestingly, at 6 months, msg - induced shr had increased systolic arterial pressure variability when compared to only shr . Taken together, sympathetic activation plays an important role in the pathogenesis of insulin resistance [6668] and in the activation of the renin - angiotensin system, which are related to cardiovascular autonomic control dysfunction of ms . The injection of streptozotocin (stz) to mice, rats, and rabbits has been widely used as a model of type 1 diabetes . Streptozotocin destroys pancreatic cells, resulting in a diabetic syndrome in animals, characterized by hyperglycemia, hypoinsulinemia, glycosuria, and body weight loss [70, 71]. These rats have systolic and diastolic dysfunction at rest, as evaluated by left ventricular catheterization and echocardiography, as well as reduced capacity for cardiac adjustment to volume overload and maximal oxygen consumption [72, 73]. Furthermore, stz induces reduction in baroreflex - mediated bradycardia and tachycardia, as well as impairment in cardiac vagal tone in the face of unaltered sympathetic tone [71, 74, 75]. Although well accepted in the literature as a model for type 1 diabetes, the injection of stz alone does not allow it to mimic the characteristics of ms in humans, since these animals show hypoinsulinemia, loss or no change in body weight, and hypotension [71, 74, 75]. An alternative approach, previously used, is the administration of low doses of stz (25 mg / kg) associated with high fructose diet in rats . This combination induced mild hyperglycemia and hypertriglyceridemia associated with mild fasting hyperinsulinemia and whole body insulin resistance, without significant increase in body weight . In addition, the authors also observed decreased left ventricular contractile function and reduced myocardial metabolic efficiency . Since 1978 the mean daily intake of added fructose and total fructose has increased in both sexes and all age groups, having as the main sources of consumption soft drinks and other sweetened beverages [77, 78]. Fructose overload in drinking water or chow has been used to promote metabolic, hemodynamic, structural, and functional derangements in rodents . Fructose overload in experimental animals has been associated with high triglyceride levels, adiposity, insulin resistance, and glucose intolerance [7986]. These animals have been used by our group in order to understand the various aspects of obesity, dyslipidemia, and insulin resistance - associated cardiovascular changes [8188]. We observed that an increased sympathetic modulation to the vessels and heart preceded metabolic dysfunction in fructose - consuming mice, thus suggesting that changes in autonomic modulation may be a triggering mechanism underlying the cluster of symptoms associated with cardiometabolic disease [8386, 88]. Animal studies have shown strong associations between high fructose intake and the onset of arterial hypertension . According to farah et al ., mice which received a high fructose diet showed higher blood pressure and heart rate in the dark (active) period when compared with the light (resting) period . This augment in blood pressure was related to an increase in the blood pressure variability and, consequently, to increased vascular sympathetic modulation . This is a relevant finding since during the dark period the mice are active (grooming, eating, and drinking) and the sympathetic activity should be high . On the other hand, it was displayed that female fructose - fed rats presented reduced vagal tonus, unaltered sympathetic tonus, and intrinsic heart rate . However, this study also showed that although the sympathetic tonus remained unchanged, the autonomic balance (sympathetic / parasympathetic) was altered, leading to a sympathetic predominance . A positive correlation between reduced cardiac vagal tonus and insulin resistance was also found, thus reinforcing the relationship between autonomic and metabolic dysfunction . Since arterial baroreflex influences both sympathetic and parasympathetic outflow, disorders in autonomic neuronal pathways (efferent or afferent) may affect cardiovascular health and be related to high blood pressure . High fructose consumption induces an impairment of baroreflex sensitivity, as evaluated by heart rate responses associated with arterial pressure changes induced by vasoactive drugs [81, 86], as well as by linear regression and alpha - index . Furthermore, unpublished data from our laboratory demonstrated that impairment of baroreflex sensitivity was positively correlated with the number of elastic lamellae in the ascendant aorta . This data suggest that the possible loss of distensibility of the aorta may be associated with changes in baroreflex sensitivity, since the mechanical stress of the arterial wall cannot be effective to properly trigger the mechanoreceptors . Regarding the rennin - angiotensin system, it has been widely acknowledged that high - fructose diet induces increased angiotensin ii plasma levels, which contributes to hypertension, insulin resistance, and dyslipidemia, and may account for cardiac remodeling [80, 90] and vascular oxidative stress in this ms model . In fact, it appears that angiotensin ii promotes fibroblast proliferation due to activation of the angiotensin ii type 1 receptor, which results in increased collagen type iii expression and accumulation in the heart . Also, there is evidence that the insulin - resistant state is associated with angiotensin ii type 1 receptor upregulation and increased endothelial (aorta) superoxide anion levels, which is likely to be caused by an increase in nad(p)h oxidase expression in fructose - fed rats . Furthermore, it should be stressed that angiotensin 1a receptors are critical in mediating the response to a high - fructose diet and the resultant state of glucose intolerance, because in the absence of these receptors, a fructose diet decreases the blood pressure, as observed in angiotensin 1a knockout mice . As an important consequence of these metabolic, hemodynamic, autonomic, and structural changes displayed in this ms model, our group recently demonstrated that fructose overload promoted changes in left ventricular morphometry, diastolic dysfunction, and increased cardiac effort, as evidenced by the increase in the myocardial performance index . Other researchers have found similar results for wistar rats receiving a 10% fructose overload for 8 weeks . Sucrose is a disaccharide composed by one molecule of glucose linked to one molecule of fructose through an 14 glycoside bond . Similar to fructose, sucrose induces ms in animals, as increased plasma concentrations of insulin, leptin, triglycerides, glucose, and free fatty acids and impaired glucose tolerance were shown . Sucrose - treated rats (32% in drinking water) revealed early abnormalities in diastolic function (2.5 weeks of treatment) followed by late systolic dysfunction and concurrent alterations in myocardial structure (10 weeks of treatment). Furthermore, the authors demonstrated that after 10 weeks of sucrose treatment the animals presented reduced calcium uptake in sarcoplasmic reticulum of cardiomyocytes . In addition, animals treated with an 8% sucrose solution developed hypertension and tachycardia after 2 weeks of treatment, and this was not related to weight gain . The authors concluded that sucrose ingestion may stimulate the ventromedial hypothalamus to increase sympathetic activity and elevate blood pressure in rats . High fat diets have been used with fat fractions between 20% and 60% energy as fat, and the basic fat component varies between animal - derived fats and plant oils, for example, corn, coconut, or safflower oil . After 10 weeks of a high fat diet, rats displayed high fat mass, insulin resistance, and hyperleptinemia, typically associated with obesity . Rabbits receiving a high fat diet during 3 weeks presented an impairment in leptin sensibility, along with increased mean arterial pressure, heart rate, and plasma norepinephrine concentration . Renal sympathetic nerve activity was also higher in high fat diet rabbits when compared to control diet rabbits and was correlated to plasma leptin . 2012) have demonstrated that the baroreceptor dysfunction which controls renal sympathetic nerve activity is an initial change in the obesity - induced high fat - fed rats, which might be a predictor of sympathoexcitation and hypertension associated with obesity . The renin - angiotensin system has been involved in the hypertension genesis linked to obesity . (2004) observed that both angiotensinogen gene expressions in retroperitoneal fat mass and plasma angiotensinogen concentration were increased in rats receiving high fat diet, thus showing increased activity of the adipose and systemic rennin - angiotensin system in obesity - related hypertension . Proponents of chemically induced ms models have been challenged by researchers who argue for diet - induced models . The latter contend that these reflect more accurately the condition of human obesity when compared to chemically induced or genetic modifications . Thus, several diet - induced experimental models have been proposed, suggesting that there is an aggregation of factors in ms . The cafeteria diet model is a fine example of a diet - induced experimental model . In this model, animals are allowed free access to standard chow and water while concurrently given highly palatable, energy dense, unhealthy human foods ad libitum, which promotes voluntary hyperphagia . This diet results in weight gain, increased fat mass, glucose intolerance, and insulin resistance [106, 107]. Wistar rats fed a cafeteria diet showed, in addition to the classical metabolic disorder, cardiovascular alterations, such as increased heart rate and blood pressure . Cafeteria diet has been shown to lead to impairment of the endothelium - derived hyperpolarization mechanism, in particular, potassium channel signaling mechanisms . Thus, this finding may explain, at least in part, the link between cafeteria diet and increased blood pressure in rats; this link is further reinforced by understanding that vascular tone refers to the balance between constrictor and dilator actions and influences the control of blood flow and pressure, and this phenomenon is influenced by endothelium - derived hyperpolarization mechanism . Although normotensive rats fed a cafeteria diet showed an increase in blood pressure, this diet may have a better outcome if used in shr, since this animal model has cardiac disorders, for example, increased sympathetic activity, hypertension, and cardiac hypertrophy [59, 60] which may be potentiated by the cafeteria diet . Spontaneously hypertensive rats fed with cafeteria diet for 12 weeks showed metabolic changes similar to those of the ms, for example, high plasma levels of glycemia, insulin, triglyceride, leptin, and obesity . Many studies have dealt with the autonomic dysfunction of shr by spectral analysis [111, 112]. There is considerable evidence to support the hypothesis that the cluster of complications from metabolic syndrome status converges to a derangement of the cardiovascular system . In fact, cardiovascular diseases are the leading cause of morbidity and mortality in this condition . The use of different experimental models that mimic the metabolic derangements seen in this syndrome is extremely important in order to better understand the mechanisms involved in cardiovascular changes caused by metabolic syndrome . New approaches, such as genetically modified models, can provide mechanistic information on the genetic and environmental factors involved in the development of cardiovascular dysfunction in the metabolic syndrome.
The prostate is the site of two common diseases in aging men, benign prostatic hyperplasia and prostate cancer (pca). Epidemiological studies show that, in the united states, pca accounts for 28.7% of new non - skin cancers and 12.7% of cancer - related deaths.1 androgen deprivation therapy (adt) retards pca progression in 60%80% of patients but may cause cardiovascular complications and alterations in body composition, lipoprotein metabolism, and sexual function . In general, adt may result in a decreased quality of life . Furthermore, studies in men demonstrate that low serum testosterone (t) levels are associated with several cardiovascular risk factors,2,3 such as lower high density lipoprotein cholesterol, higher triglyceride concentrations, hyperinsulinemia, and increased abdominal adiposity . These factors are all characteristic of the metabolic insulin resistance syndrome . In addition, many patients treated with adt experience rapid bone loss that increases the risk of debilitating osteoporotic fractures.46 reports indicate that total and free levels of serum t decline in aging men and that abdominal visceral fat is inversely associated with t levels . Resting energy expenditure (ree), which accounts for 60%70% of total daily energy expenditure, decreases with age, physical inactivity, sympathetic nervous system and endocrine status.7,8 to our knowledge, the effects of adt on ree have not been fully explored in controlled trials . The goal of this prospective study was to determine the effects of adt on body composition and resting metabolic rate in patients with metastatic pca . Sixteen men, aged 63 to 96 years (mean age 71), with untreated metastatic pca were enrolled in this study . Prior to orchiectomy, all patients were evaluated clinically and by laboratory analysis to establish a baseline . After a careful medical history had been taken from each patient, we assessed several exclusion criteria, namely, cognitive alterations, depression and emotional liability . Laboratory examinations included tests of fsh - lh serum concentrations, and an evaluation of body mass index, fat / lean body mass, bone mineral density, carbohydrate / lipid oxidation, and resting energy expenditure . Following orchiectomy, the same evaluation was carried out monthly and after 12 months, the period chosen for final analysis . To evaluate body composition, all patients underwent densitometry testing (dual - energy x ray absorptiometry - dexa).9 the ree, fat and carbohydrate oxidation levels were measured using indirect calorimetry, with a delta - trac metabolic monitor.10 body composition analyses and indirect calorimetry were carried out at baseline and after 12 months following the orchiectomy procedure . Written consent was obtained from all patients, and this protocol was approved by the ethics committee at our institution . We used the non - parametric two - sided wilcoxon t - test, and p<0.05 was considered significant to appropriately compare time differences for each variable.11 we used the non - parametric two - sided wilcoxon t - test, and p<0.05 was considered significant to appropriately compare time differences for each variable.11 statistically significant differences in body composition pre and post orchiectomy were seen in terms of weight, body mass index (bmi) and lean body mass (lbm). Total fat body mass (fbm) exhibited a tendency to increase but failed to reach significance . No significant changes were observed in bone mineral density (bmd) and ree, but we identified a statistically significant change in terms of increased carbohydrate oxidation (choox) and a decrease in lipid oxidation (lipidox). Aging is associated with sarcopenia (loss of muscle mass), with an average 12 kg loss of lbm between the ages of 25 and 70 years and an increase in fbm of 18%36% during the same period.2 testosterone levels exhibit a positive correlation with lbm and a negative correlation with fbm . This has led to the hypothesis that adt may help mitigate age - related alterations in body composition . Our study reports two major findings: 1) adt was associated with decreased body weight and with decreased lbm; 2) adt led to increased choox and decreased lipidox . Androgens modulate body composition, including lipid and protein metabolism.12 smith et al,13 galvo et al,14 levy et al,15 and van londen et al16 observed significant changes in metabolic and body composition parameters after 6 months of induced hypogonadism in all patients . The researchers observed a significant increase in fbm (20.29.4 to 21.99.6 kg,13 13.82.3%,14 1.172.3%, 15 and 2167.15 g,16 respectively) and a significant decrease in lbm (63.28.0 to 62.35.4 kg,13 2.4 0.4%,14 1.152.20%;15 and 1785.81 g,16 respectively) with no significant changes in total body weight, lipid readings or glucose metabolism . They also reported a positive correlation between the changes in fbm and insulin concentrations (r=0.56; p=0.013). These results are in agreement with other studies that demonstrated a relationship between t and abnormalities in carbohydrate and lipid metabolism.17 in healthy male populations, low t concentrations are negatively correlated with the degree of central abdominal obesity . In hypogonadal males, there is a tendency toward increased visceral adiposity and reduced muscle mass that can be reversed by androgen replacement.18 the underlying mechanisms for these observations are not well defined, but androgen receptors are known to be present on visceral adipocytes . It is likely that t is directly involved in the mobilization of free fatty acids.19 we observed significant changes in metabolic and body composition in our patients after adt . We identified significant decreases in total body weight, bmi and lbm (2.5 kg, p = 0.01; 0.8 kg / cm, p = 0.02, 11.7 kg, p = 0.002, respectively). Fbm was found to increase (7.15 kg, p = 0.06) with no significant change in bone mineral density (bmg). There were no changes in ree, but we did identify a significant increase in choox and a decrease in lipidox (52.62%, 4.10% respectively). In one study, suppression of t levels after 10 weeks of gnrh agonist administration was found to reduce ree in young men . In this study, researchers were unable to determine whether the effect was directly mediated by a reduction in t levels or if it was due to a subsequent reduction in t aromatization to estrogen.20 we were unable to show alterations in ree in our study, possibly due to the size of our study sample . The altered concentrations of gonadotropins following orchiectomy may be linked with the effects of this procedure on the pituitary gland . It is important to consider that adt not only acts on pca but also affects metabolism, including hematogenesis, bone, fat, protein, and sarcho - metabolism . Despite pca being one of the leading causes of death, a substantial proportion of aging patients die of unrelated causes that are due to comorbidities, often in the context of metabolic syndrome . To our knowledge, this is the first prospective study to examine changes in body composition, resting energy expenditure, and consequences involving the oxidation of carbohydrates and lipids in the context of adt . A study on a larger group of patients would be of great interest once a limited number of patients included from only one centre may be considered a limitation in this study . After 12 months of androgen deprivation therapy, elderly males with metastatic prostate cancer exhibit declines in lean body mass and lipid oxidation, together with an increase in carbohydrate oxidation.
5xfad tg mouse model (b6sjl - tg(appswfllon, psen1m146ll286v)6799vas) (jackson laboratories) is bred on a non - transgenic background (b6sjlf1). Hela is a human cervical cancer cell line; nih/3t3s is a mouse embryonic fibroblast line; hepg3 is from hepatocellular carcinoma; raw264.7 is a mouse leukemic monocyte macrophage cell line . 16 nm magnetite nanoparticles were synthesized by decomposition of iron - oleate at 320c as described in an earlier report . 10.8 g of iron (iii) chloride hexahydrate and 36.5 g sodium oleate were dissolved in a mixture of 60 ml distilled water, 80 ml ethanol and 140 ml hexane and heated at 60c for 4 hr . The organic layer of the biphasic mixture becomes dark, indicating phase transfer of iron (iii) ions and formation of iron oleate complex . 18 g of iron oleate complex and 2.58 g of oleic acid were dissolved in 100 g of octadecene at room temperature and heated to 320c at a rate of 3.3c per minute . Resulting nanoparticles are separated from the solution by addition of ethanol and ethyl acetate followed by centrifugation . To make the organic phase synthesized mns suitable for biological application we stabilized the mns using carboxylate terminated ligand with ndopa as an anchor . Synthesis of carboxylate terminated ndopa ligand and functionalization of the mns was carried out according to the following protocol . Tetraethylene diacide, n - hydroxysuccinimide (nhs), n, n-dicyclohexylcarbodiimide (dcc), ndopa hydrochloride and anhydrous sodium bicarbonate was dissolved in chloroform under argon atmosphere and stirred for 4 hr . Hexane stabilized mns were added and stirred for another 24 hr . The precipitate formed was separated by magnet, dispersed in water and purified by dialysis . The conjugation of buffer stabilized mns with antibody was done using a conventional carboxyl - amine crosslinking method . We first activated the carboxyl terminated mns by sulfo - n - hydroxy succinimide (snhs) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (edc) followed by incubation with corresponding antibody (nu4 or igg1, with or without fluorescent label) overnight . Conjugated mns were separated by magnet to remove excess reagent and antibody then re - dispersed in working media . Conjugation efficiency was estimated using uv spectroscopy (absorbance at 280 nm) of the magnetically separated supernatant . Of note, because both fluorophore and mns conjugation use carboxyl - amine crosslinking, fluorescent nu4 that has more than 2.5 mol fluorophore / mol antibody does not conjugate well to the mns . Optimal concentration of fluorophore / nu4 is ~1.02.5 mol fluorophore / mol antibody for fluorescent - nu4mns preparation . Mice were anesthetized with isoflurane and then placed on their backs with their heads positioned to maximize the residency time for the delivered material to remain on the olfactory surface . Each naris was administered with 568-nu4, nu4mns or non - immune iggmns (5 l / naris), using a sterile micropipette, slowly over a period of 1 min, keeping the opposite naris and mouth closed to allow complete aspiration of delivered material . A falcon tube containing the mns treated tissue samples was placed in a bruker pharmascan 7 t animal mri scanner . Sample were imaged using a t2 * -weighted gradient echo (gre) flash pulse sequence 3-dimensional acquisition . The image resolution was 0.07 mm isotropic, with field - of - view (fov) 4.62cm/2.52cm/0.65 cm and image matrix (mtx) 700 pixels/385 pixels/100 pixels . The number of averages (nex) was 20 to improve the signal - to - noise ratio . Following intranasal inoculation, the probe was allowed to distribute for 4 hours before mr imaging was performed according to imaging methodology described in mundt et al . T1, t2, and t2 * weighted mr images were acquired on a bruker biospec 7 t magnet, using a 25 mm rf quadrature coil . T1- and t2-weighted images provide anatomical guidance as well as some localization of the nu4mns and were acquired with a fat suppressed spin echo sequence (rapid acquisition with relaxation enhancement, rare) with the following parameters for t1-weighted (tr=1000 ms, teeff=13.2 ms, rare factor 2, number of excitations, nex=4) and for t2-weighted (tr=3500 ms, teeff=58.5 ms, rare factor 4, nex=4). T2 * -weighted imaging provides more of the localization of the nu4mns as the iron causes local changes in magnetic susceptibility which t2 * weighted images can be sensitive to . A gradient echo sequence was used with the following parameters (gradient echo fast imaging, gefi; tr=1200 ms, te=5.6 ms, flip angle 35 and nex=4). 5xfad tg mouse model (b6sjl - tg(appswfllon, psen1m146ll286v)6799vas) (jackson laboratories) is bred on a non - transgenic background (b6sjlf1). Hela is a human cervical cancer cell line; nih/3t3s is a mouse embryonic fibroblast line; hepg3 is from hepatocellular carcinoma; raw264.7 is a mouse leukemic monocyte macrophage cell line . 16 nm magnetite nanoparticles were synthesized by decomposition of iron - oleate at 320c as described in an earlier report . 10.8 g of iron (iii) chloride hexahydrate and 36.5 g sodium oleate were dissolved in a mixture of 60 ml distilled water, 80 ml ethanol and 140 ml hexane and heated at 60c for 4 hr . The organic layer of the biphasic mixture becomes dark, indicating phase transfer of iron (iii) ions and formation of iron oleate complex . 18 g of iron oleate complex and 2.58 g of oleic acid were dissolved in 100 g of octadecene at room temperature and heated to 320c at a rate of 3.3c per minute . Resulting nanoparticles are separated from the solution by addition of ethanol and ethyl acetate followed by centrifugation . 10.8 g of iron (iii) chloride hexahydrate and 36.5 g sodium oleate were dissolved in a mixture of 60 ml distilled water, 80 ml ethanol and 140 ml hexane and heated at 60c for 4 hr . The organic layer of the biphasic mixture becomes dark, indicating phase transfer of iron (iii) ions and formation of iron oleate complex . 18 g of iron oleate complex and 2.58 g of oleic acid were dissolved in 100 g of octadecene at room temperature and heated to 320c at a rate of 3.3c per minute . Resulting nanoparticles are separated from the solution by addition of ethanol and ethyl acetate followed by centrifugation . To make the organic phase synthesized mns suitable for biological application we stabilized the mns using carboxylate terminated ligand with ndopa as an anchor . Synthesis of carboxylate terminated ndopa ligand and functionalization of the mns was carried out according to the following protocol . Tetraethylene diacide, n - hydroxysuccinimide (nhs), n, n-dicyclohexylcarbodiimide (dcc), ndopa hydrochloride and anhydrous sodium bicarbonate was dissolved in chloroform under argon atmosphere and stirred for 4 hr . Hexane stabilized mns were added and stirred for another 24 hr . The precipitate formed was separated by magnet, dispersed in water and purified by dialysis . The conjugation of buffer stabilized mns with antibody was done using a conventional carboxyl - amine crosslinking method . We first activated the carboxyl terminated mns by sulfo - n - hydroxy succinimide (snhs) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide (edc) followed by incubation with corresponding antibody (nu4 or igg1, with or without fluorescent label) overnight . Conjugated mns were separated by magnet to remove excess reagent and antibody then re - dispersed in working media . Conjugation efficiency was estimated using uv spectroscopy (absorbance at 280 nm) of the magnetically separated supernatant . Of note, because both fluorophore and mns conjugation use carboxyl - amine crosslinking, fluorescent nu4 that has more than 2.5 mol fluorophore / mol antibody does not conjugate well to the mns . Optimal concentration of fluorophore / nu4 is ~1.02.5 mol fluorophore / mol antibody for fluorescent - nu4mns preparation . Mice were anesthetized with isoflurane and then placed on their backs with their heads positioned to maximize the residency time for the delivered material to remain on the olfactory surface . Each naris was administered with 568-nu4, nu4mns or non - immune iggmns (5 l / naris), using a sterile micropipette, slowly over a period of 1 min, keeping the opposite naris and mouth closed to allow complete aspiration of delivered material . A falcon tube containing the mns treated tissue samples was placed in a bruker pharmascan 7 t animal mri scanner . Sample were imaged using a t2 * -weighted gradient echo (gre) flash pulse sequence 3-dimensional acquisition . The image resolution was 0.07 mm isotropic, with field - of - view (fov) 4.62cm/2.52cm/0.65 cm and image matrix (mtx) 700 pixels/385 pixels/100 pixels . The number of averages (nex) was 20 to improve the signal - to - noise ratio . Following intranasal inoculation, the probe was allowed to distribute for 4 hours before mr imaging was performed according to imaging methodology described in mundt et al . T1, t2, and t2 * weighted mr images were acquired on a bruker biospec 7 t magnet, using a 25 mm rf quadrature coil . T1- and t2-weighted images provide anatomical guidance as well as some localization of the nu4mns and were acquired with a fat suppressed spin echo sequence (rapid acquisition with relaxation enhancement, rare) with the following parameters for t1-weighted (tr=1000 ms, teeff=13.2 ms, rare factor 2, number of excitations, nex=4) and for t2-weighted (tr=3500 ms, teeff=58.5 ms, rare factor 4, nex=4). T2 * -weighted imaging provides more of the localization of the nu4mns as the iron causes local changes in magnetic susceptibility which t2 * weighted images can be sensitive to . A gradient echo sequence was used with the following parameters (gradient echo fast imaging, gefi; tr=1200 ms, te=5.6 ms, flip angle 35 and nex=4).
Cataract extraction requires analgesia, ocular akinesia, and is performed in the outpatient surgery . Topical anesthesia is indicated in procedures involving the anterior part of the eye, lasting less than two hours . Sedation is performed so that the patients remain quiet and do not interfere with the procedure . Clonidine is one of the drugs used in this context because it causes sedation without inducing hypnosis and reduces the blood pressure (bp) and heart rate (hr) [3, 4]. The reduction of the intraocular pressure (iop) represents an additional advantage of clonidine because it makes the eye surgery easier and reduces the frequency of complications, such as expulsion of the vitreous humor when the lens posterior capsule is broken during phacoemulsification . Following the development of phacoemulsification, topical anesthesia became a well - accepted minimally invasive technique, although it does not provide an analgesia that is as efficacious as blocks . This led us to conduct the study with the aim of assessing the effect of clonidine on the intraoperative analgesia, sedation, and intraocular pressure in patients subjected to cataract extraction under topical anesthesia . The secondary outcomes were better sedation and a reduction of the intraocular pressure (iop) and arrhythmia . The study was prospective, randomized, and double - blind and registered at clinicaltrials.gov under code nct01677351 . Before the onset of anesthesia, a nurse or anesthetist who was not involved in the participant's later follow - up opened the envelope and prepared the syringes with clonidine or 0.9% saline solution as indicated . No other investigator who participated in the study or data collection was aware of the group to which each participant was allocated . Following the approval by the research ethics committee of federal university of so paulo (number 0609/01) and signature on the informed consent form, 40 patients who were 40 to 80 years of age, of both genders, with an asa (american society of anesthesia) i, ii, or iii physical status, and subjected to cataract extraction by means of phacoemulsification under topical anesthesia at a tertiary university hospital were assessed . The following were excluded: patients with coronary heart disease, heart arrhythmias, or chronic pain; patients using analgesics 2 weeks before surgery; patients with tremors or cough; patients who had previous surgery; patients with claustrophobia, glaucoma, psychiatric disorders, or difficulty in communicating; and pregnant patients . Monitoring included the following: electrocardiogram using a holter device, arterial pressure (ap), heart rate (hr), oxygen saturation, and placement of a venous catheter followed by pupil dilation using 10% phenylephrine (two drops) and 1% tropicamide (two to eight drops). Thirty minutes later, the patients in clonidine group were given a clonidine solution (4 mcgkg), while the patients in placebo group were given 0.9% saline solution . Twenty minutes later, topical anesthesia was performed with 2% lidocaine gel that was placed on the inferior conjunctival sac, and the patient was released for surgery . Whenever it was needed, anesthesia was supplemented by instillation of 2% lidocaine (three to five drops) or an intracameral injection of 2% lidocaine (0.5 ml). Intraoperative analgesia was assessed on a numerical scale ranging from 0 to 10, before injection of the solution, after 5 and 15 minutes, blepharostat placement, incision of the cornea, capsulorhexis, phacoemulsification, irrigation and aspiration, and lens implantation, and at the end of surgery . Sedation was assessed by means of the ramsay sedation scale ((1) patient is anxious; (2) patient is calm and awake; (3) patient is sleepy but opens eyes on command; (4) patient is sleeping and only responds to vigorous verbal stimuli; (5) patient is sleeping and responds to pain stimulation by glabellar tap; (6) patient does not respond to pain stimuli). The iop was measured before and 15 minutes after administration of the solutions to both eyes and after the surgical procedure in only the eye not subjected to the surgery . The continuous electrocardiogram, holter series 8500, was applied after the pupil dilation and was discontinued immediately at the end of surgery . The instat graph statistical software was used for the sample calculations and analysis of the results . A difference of 30% in pain intensity according to a numerical scale was considered clinically significant for 80% power and a 95% confidence interval (95% ci). Based on a preliminary evaluation, a standard deviation (sd) of 2.2 was estimated for the pain intensity score within the group of patients; the calculated sample size was 20 patients per group . The statistical tests used were as follows: student's t - test for age, body weight, height, iop, hr, ap, and length of surgery and the mann - whitney test for hr, ap, pain intensity, sedation, iop, and arrhythmia . Measures of central tendency, mean, and dispersion (standard deviation) were used . There was no difference between the groups regarding the demographic data (table 1). The physical status was class asa i for six patients in clonidine and eight patients in placebo group, and it was asa ii for eight patients in clonidine and 12 patients in placebo, without a significant difference between the groups (p = 0.7411; mann - whitney test). The surgery lasted 22 9.9 min for clonidine and 24 12 min for placebo (p = 0.05692; student's t - test). The intensity of pain exhibited a significant difference between the groups at the assessed time points (table 2). Sedation was greater in g1 at almost all the assessed time points (p <0.05; mann - whitney test) (table 3). Sedation increased in g1 between the onset (2.0 0.0) and end (2.5 0.6) of the surgery, which did not occur in g2 (2.0 0.0 and 2.0 0.0, respectively; kruskal - wallis analysis of variance (anova test)). The greatest hr measured was 69.4 8.6 in g1 and 76.0 18.5 in g2, while the lowest hr was 63.2 11.1 in g1 and 69.3 17.9 in g2 . At some time points, the systolic arterial pressure (sap) was lower when clonidine was used (p <0.05; mann - whitney test). At some time points, the iop of the nonmydriatic eye exhibited a significant difference between the groups 15 minutes after injection of the solution (clonidine = 12.9 3.1 and placebo = 15.5 3.2; p = 0.0135; mann - whitney test) and at the end of surgery (clonidine = 12.5 3.4 and placebo = 15.3 2.7; p = 0.0065; mann - whitney test). The incidence of arrhythmia was higher in placebo only at the end of surgery, and there was no difference in the incidence of myocardial ischemia (table 4). It also promoted sedation and was associated with reductions in the bp, hr, and iop . The intensity of pain decreased during the surgical steps that are considered to be uncomfortable . Although supplementary analgesia was not required in either group, the intensity of pain was lower when clonidine was used, thus showing that this drug is appropriate for the intended procedure . In spite of its disadvantages, many patients prefer a topical anesthesia to a block due to the greater discomfort caused by the use of needles . The analgesic effect is not as good as after blocks but there are fewer complications . Complementary analgesia might be achieved with intracameral 1% lidocaine, which is effective as a supplement to topical anesthesia in cataract surgery via phacoemulsification . In the present study, the sedative and anxiolytic effects of clonidine, which are mediated through its binding to alpha-2 receptors, might avoid complications related to sympathetic stimulation . In this study, no patients required supplementary sedation . In spite of the sedation induced by clonidine, the patients who received it were as awake at the end of surgery as the ones who were given a placebo, although the length of the procedure was shorter . Reduced iop during cataract extraction facilitates the surgery performance and reduces the risk of complications . In the present study, the iop of the patients given clonidine decreased at the end of the surgery (approximately 30 min), which was similar to another study . Clonidine might reduce the hr and bp mediated by a decreased release of peripheral norepinephrine and a central sympatholytic effect . In the present study, the hr was lower when clonidine was used; however, it remained within the normal range . There are no reports on significant alterations of the ap or hr when these mydriatics are used at their usual doses . The bp was lower when clonidine was used, but neither hyper- nor hypotension occurred with the dose used in the present study . Clonidine might also reduce the incidence of myocardial ischemia in patients with coronary heart disease [1113]. In the present study, the incidence of arrhythmia exhibited a difference only at the end of surgery, which suggests the antiarrhythmic action of clonidine . Arrhythmia before anesthesia might be related to the use of mydriatics and to anxiety . By inhibiting the sympathetic activity, clonidine might act as an anxiolytic and antiarrhythmogenic agent [14, 15]. The results of the present study suggest that clonidine at a dose of 4 /kg via an intravenous route promotes an analgesic effect and sedation appropriate for cataract extraction by means of phacoemulsification under topical anesthesia without altering the heart rate or the systemic arterial pressure . The results of the recent study further suggest that the use of clonidine reduces the incidence of arrhythmia . Although no cardiovascular adverse effects were observed, the sample size of this study is too small to make any clinically relevant conclusions . In fact, the cataract population is usually old, has several comorbidities, and thus is at a very high risk of cardiovascular complications.
The prevalence of childhood obesity has been increasing at unsettling rates across the globe . In addition to striking the developed world, this pattern has also been noted in developing countries undergoing rapid epidemiological transitions, including those in east africa . In sudan, a study of children in secondary school in the capital khartoum found that rates of overweight and obesity were 28.5% and 5.6%, respectively . Rates of obesity for younger schoolchildren in east africa remain unclear, though obesity at younger ages may carry greater importance because younger children possess improved potential for early intervention . Hypertension, a notable sequela of obesity, was already common in sub - saharan africa but has been reported to be worsening in prevalence in recent years . Hypertension often goes underdiagnosed in children, in part because its accurate diagnosis requires the use of standardized growth charts specific for age, gender, and height, with hypertension defined as a systolic and/or diastolic blood pressure> 95th percentile and pre - hypertension defined as systolic and/or diastolic blood pressure 9095th percentile . Underdiagnosis of hypertension may be even more common in developing countries, where medical care is limited to symptomatic diseases, and childhood hypertension has been overlooked in lieu of more urgent disease . Given the importance of childhood hypertension and pre - hypertension in determining adult cardiovascular disease outcomes, our goal was to determine the prevalence of hypertension and pre - hypertension among urban school children in sudan and to determine whether hypertension was associated with obesity in this population . These data serve to alert providers in developing and developed countries to the extent of the current obesity epidemic . Sudan is in east africa, bordering egypt on the north, ethiopia on the east, kenya, uganda, and congo on the south, and central african republic, chad, and libya on the west . Sudan has 2.5 million square kilometers and 37 million inhabitants, of whom 57 million live in the capital of khartoum . Traditionally an impoverished country, sudan has experienced an economy that has expanded rapidly with oil exportation over the past 10 years, with khartoum being the epicenter of economic activity . This was a cross - sectional study using a sample of 304 children aging six through twelve years from two schools randomly selected in khartoum, the capital of sudan . All students were given a questionnaire to be filled out by their parents, which asked for signed consent for their child to participate in the study, in addition to other demographic and health information . Ethics approval was obtained from the university of medical sciences and technology (khartoum, sudan) research ethics board . Questionnaires sent to parents inquired regarding the child's age, gender, and health conditions, both previous and current . The questionnaire also asked whether there was a medical diagnosis of hypertension, diabetes, or heart disease among blood - related family members and which family members were affected . The child was classified as having a positive family history only if disease was present in a first - degree relative . Body weight was measured to the nearest tenth of a kilogram on a calibrated digital scale, with the child's shoes removed . Height was measured with the child standing with shoes removed, measured in centimeters to the nearest millimeter . Blood pressure was measured twice, once manually and once digitally, using an appropriate cuff size, based on arm circumference, and the mean was taken and used for analysis . Body mass index (bmi), defined as body weight in kilograms divided by the square of height in meters (kg / m), was used as the measure of obesity in this study . Bmi is an accepted measure of obesity in clinical practice, and its use in children has been supported internationally by the international obesity task force (iotf), which agreed that it provides a reasonable index of adiposity and in that it is a simple and inexpensive measure . It provides reliable estimations, with the exceptions of extremes of age, height, and musculature . Bmi was categorized according to the centers for disease control and prevention (cdc) age- and sex - specific growth charts . The following categories were used: underweight <5th percentile; normal weight, 5th to 85th percentile; overweight, 85th to 95th percentile; obese,> 95th percentile . Blood pressure was categorized according to bp tables from the fourth report on the diagnosis, evaluation, and treatment of high blood pressure in children and adolescents, using age and height percentiles, with normotension defined as a bp under the 90th percentile, prehypertension 90th to 95th percentile, and hypertension greater than 95th percentile or an absolute systolic bp (sbp) of 120 mm hg or diastolic bp (dbp) of 80 mm hg . Children were also classified as hypertensive if they were taking antihypertensive medication or had been diagnosed with hypertension previously . Descriptive statistics were calculated for gender, family history, and bmi and bp categories . Analyses were performed using the chi - squared test for association, and multinomial logistic regression to investigate the odds of systolic and diastolic prehypertension and hypertension with overweight or obesity, controlling for family history of hypertension . Analyses were conducted using stata 10.0 (2008 statacorp lp, college station, tx). Complete data on height, weight, bp, and family history were available for the entire sample (n = 304). The average age of participants was 7.8 years, with a median age of 9 years (range 612 years). All were of sudanese nationality, and the gender distribution was 236 female (77.6%) and 68 male (22.4%). The number of children who were overweight was 45 (14.8%), and 32 were obese (10.5%). Females had a nonsignificant trend toward higher rates than males of overweight (14.0% versus 11.8%) and obesity (11.0% versus 5.9%, p>.05). Prehypertension was detected in 15 (4.9%) participants and additional 15 (4.9%) had hypertension, all on the basis of bp measurement, as none were taking antihypertensives or had a previous diagnosis of hypertension . The rate of elevated bp (prehypertension and hypertension combined) in males and females was 13.2% versus 8.9% . A family history of hypertension was reported for 64 (21.1%) of the participants overall, including 20.1% of children with a normal blood pressure, 20.0% of those with pre - hypertension, and 40.0% of hypertensive children (table 2). Though there is a higher rate of family history with hypertension compared to normal bp or prehypertension, this difference was not significant by chi - square test (p>.05). Regarding the association between bmi and bp, 31.2% of obese children had hypertension, versus 17.8% of overweight children and 5.3% of normal bmi children . These results were found to be highly statistically significant by pearson chi - squared test (p <.001). Further classification of prehypertension and hypertension into systolic and diastolic is stratified by bp category in table 3 for descriptive purposes . The results are given as the relative risk of being in a certain bp category by weight category compared to children with a normal bmi, adjusting for gender and family history . After adjustment for these factors, sudanese children who were obese had a relative risk of systolic hypertension of 14.7 compared to their normal - weight counterparts (p <.01). We found a high rate of overweight and obesity among 612-year - old primary schoolchildren in urban sudan, with 14.8% of the children overweight and 10.5% obese . Despite moderate rates of hypertension reported previously among children in sub - saharan africa up to 11% in rural children, suggesting an underlying genetic predisposition we found that obesity and not family history was the factor most strongly associated with hypertension in our sample . Obese children carried a relative risk of 14.7 for systolic hypertension after adjustment for family history, while family history of hypertension was not significantly associated . That obesity was so highly correlated with hypertension in a part of the world more commonly linked to undernutrition underscores the pervasiveness of the obesity epidemic and its sequelae throughout the world . Rates of hypertension in sub - saharan africa have been noted to be increasing among adults [5, 6, 13] concurrent with rising rates of obesity in urban areas . Prior studies to demonstrate these effects among children in east africa have been lacking, however . The appearance of early cardiovascular sequelae of obesity at these young ages suggests that urban areas in the developing world may begin to face increasing health concerns in children related to the obesity epidemic . As in other sub - saharan african nations, these high rates of obesity in sudan are felt to be due to the epidemiological transition that has come with westernization . While food availability has improved, dietary habits have shifted away from traditional agricultural choices to an increase in processed foods as seen in western countries . The appearance of obesity - associated hypertension in children may signal that developing countries are likely to face similar difficulties as developed countries in overcoming lifestyle choices . Similar reports of obesity have been reported from other less - developed nations outside of africa . A study of schoolchildren in beijing, china, reported that approximately 20% of children were overweight or obese . In karachi, pakistan, an almost identical prevalence of 25% of children had a high bmi, with 6% of children overweight and 19% obese . In iran, rates of hypertension in other populations are less clear, although increasing bmi has been consistently associated with increased blood pressure throughout childhood [1719]. The total number of children involved was relatively small (304 subjects), particularly with respect to boys (68 subjects). In contrast to many studies of blood pressure in african children that did not determine rates of hypertension based on normal ranges for height, age, and gender, we determined blood pressure status for each of our participants, dividing children into normotensive, pre - hypertensive, and hypertensive categories . In common with other studies [20, 21], we used the average of blood pressure measurements at a single time point for each subject, acknowledging that measuring blood pressure on separate occasions is necessary for the diagnosis of hypertension on a clinical basis . It is possible that the prevalence of hypertension in our sample would be lower were three measurements used to determine hypertension . Other measurements estimating adiposity (waist circumference, bioelectrical impedance, and mri) are more specific to the amount of fat mass . Nevertheless, for population - based studies bmi correlates well with these other measures and remains widely used as a definition of obesity in hypertension research [2325]. In conclusion, primary schoolchildren in urban sudan exhibited a high degree of overweight and obesity, and hypertension among these children was more closely linked to obesity than to family history . That obesity - associated cardiovascular sequelae exist in the developing world at such young ages is a harbinger of worsened cardiovascular outcomes in sub - saharan africa in the future . To overcome these trends, children in urban settings in africa are likely to require similar dietary and activity lifestyle adjustments as needed by their counterparts in developed nations
Incisional hernia is a common long - term complication of abdominal surgery and is estimated to occur in 3% to 13% of laparotomy incisions . However, its incidence is greater than 23% in patients who have developed an infection in the laparotomy wound . Approximately 50% of incisional hernias develop within the first 2 years after the primary operation, and 74% develop after 3 years . Approximately more than 100,000 men, women, and children in the usa undergo surgery for ventral hernia repair each year . The recurrence rate of incisional hernia, after primary closure is high, ranging between 10% and 50%, and has been reduced to 3% to 18% after the introduction of prosthetic materials (meshes) in hernia repair . Nevertheless, open hernia repair can be a major operation with considerable morbidity due to mesh - related infections . An increasing interest in laparoscopic surgery and the availability of new materials have encouraged the adoption of laparoscopic techniques in ventral hernia repair . Laparoscopic ventral hernia repair (lvhr) was introduced into surgical practice by leblanc and booth in 1991 . It is based on the same physical and surgical principles as the open underlay procedure described by stoppa, rives, and wantz . Surgeons and patients have rapidly accepted laparoscopic repair for incisional and primary ventral hernia over the past decade . Lvhr is now being used with increasing frequency even for the management of patients with complex incisional hernias . With the use of the laparoscopic approach, large incisions and drain placement can be avoided, which leads to a reduction in postoperative wound - related problems . Recent reports on this topic have supported minimal postoperative morbidity, a shorter convalescence period, and an acceptable recurrence rate . Limiting factors in most studies include technical variations, limited sample size, and restricted follow - up . To date, more than 100 studies on lvhr have been published, although most of them are case series lacking control groups . Recently, several studies based on large numbers of patients have been accumulated due to increasing experience . Herein, we analyze the existing literature on lvhr, in an effort to examine the optimal surgical technique, complications, and long - term results in comparison with the open ventral hernia repair (ovhr). Early postoperative development of incisional hernia implies an important role of perioperative factors, such as type of incision, suture technique, wound infection, or wound dehiscence . It is hypothesized that incisional hernias are caused by acute subclinical fascial separations in the early postoperative period . Several studies have compared different suture material, and it has been recommended that an absorbable suture be used for fascial closure, as it decreases the likelihood of infection and eventually dissolves, preventing a saw - like effect on the fascia, which may predispose to fascial disruption . However, more recently, 2 meta - analyses identified more incisional hernias after closure with absorbable sutures than with nonabsorbable sutures . Another meta - analysis performed by van't riet et al found no difference in incisional hernia development between slowly absorbable materials, such as pds, and nonabsorbable sutures, such as nylon . In addition, nonabsorbable sutures were found to be associated with an increased incidence of prolonged wound pain and suture sinus formation; therefore, the use of slowly absorbable sutures should be considered in abdominal wound closure . Late development of an incisional hernia implicates other mechanisms, such as advanced age, diabetes, malignancy, and connective tissue disorders . However, there is evidence that the abdominal wound can weaken over the course of years and give rise to an incisional hernia . Wound healing depends on a variety of cellular and molecular factors capable of inducing hemostasis, angiogenesis, inflammation, fibroplasias, and wound remodeling . One of the major extracellular proteins involved in wound healing is collagen, with 2 main types: type i and type iii collagen . Type i collagen is found in fascia, bone, and skin, and has a high tensile strength . Type iii collagen has a lower tensile strength but increased flexibility and is found in blood vessels, smooth muscle, and organ parenchyma . Early aponeurotic wound healing is based mainly on type iii collagen, which provides the wound with little tensile strength . Therefore in the early phase, closure and healing of the aponeurosis depends largely on technical closure . However, fascial strength increases later as type i collagen increases and forms tight intermolecular links . It is believed that abnormalities in collagen synthesis may predispose to weak healing of the aponeurosis and progression to development of an incisional hernia . In an experimental study by dubay et al,, a fibrablast growth factor (bfgf)-releasing rod was placed into the fascial wound and as a result a significant increase in type i collagen staining around the bfgf treated fascia was noted . This contributed to a considerable increase in the fascia - breaking strength, and as a consequence a significant reduction in primary and recurrent incisional hernia formation rate was observed . Advances in analyzing the cellular and molecular mechanisms of the pathogenesis of incisional hernia will help in applying therapeutic agents to strengthen wound healing and prevent incisional hernia formation . Traditional primary open repair is based on suture approximation of aponeurosis on each side of the hernia defect . However, recurrence rates after this procedure range from 41% to 52% in the long term . The introduction of prosthetic meshes in hernia repair has substantially helped in the reduction of recurrence rates . Indeed, luijendijk et al demonstrated a significant reduction in recurrence rates between primary suture repair compared with mesh repair, 43% to 24%, respectively, for first - time incisional hernia repairs . However, the mesh repairs still require wide dissection of soft tissue, which contributes to an increased incidence of wound - related complications (more than 12%). Among the open repairs, this technique is easy, convenient, but it has a considerable morbidity rate and recurrence rate (8% to 27%). Another repair option is the inlay technique, such that the mesh is sutured to the aponeurotic edges . This technique has been used to cover large aponeurotic gaps, and it carries extremely high recurrence rates . In the extra - peritoneal underlay technique, widely known as the rives - stoppa repair, the mesh is placed retromuscularly and anterior to the posterior rectus sheath, followed by primary closure of the anterior fascia . This technique requires limited soft tissue dissection; therefore, it carries acceptable morbidity and recurrence rates . Because there is no direct contact of mesh with the abdominal viscera, moreover, problems resulting from placement of the prosthesis in the subcutaneous space, such as seroma formation and wound infection, are also avoided . The intraperitoneal underlay technique was first described by mccarthy et al in 1981 . At the beginning, they used polypropylene mesh, which was sutured to the peritoneal edge of the hernia sac . Polypropylene was gradually abandoned for intraperitoneal mesh fixation due to its trend to cause adhesions to bowel loops and was replaced by the polytetraflouoroethylene (eptfe) mesh or bilayer polytetrafluoroethylene and polypropylene mesh in the more recent series . A recent study by millikan et al with this technique using full - thickness transfascial sutures in 102 patients showed a 0% recurrence rate in a median follow - up of 28 months . Nevertheless, in the majority of studies analyzing the intraperitoneal underlay technique, the recurrence rate did not surpass 10% . Although the onlay technique seems to be the most popular due to its simplicity, it carries a higher morbidity rate than the other 3 techniques . In addition, rudmik et al performed an extensive review of the articles referring to the main techniques used in open ventral hernia repair and calculated an overall 4.5%, 8%, 14%, and 48% recurrence rate for the intraperitoneal underlay repair, the extraperitoneal underlay repair, onlay repair, and inlay repair, respectively . The relatively high morbidity and recurrence rates of the open repair techniques prompted the development of the laparoscopic approach in an effort to improve the clinical outcome . Since the introduction of the laparoscopic approach in ventral hernia repair by leblanc and booth, the laparoscopic technique has gradually become increasingly popular worldwide, as it offers early recovery, decreased hospital stay, minimal morbidity, and low recurrence rates . The laparoscopic technique has numerous variations of the methodology used by surgeons, although several common steps are followed by all . The procedure starts with entering the peritoneal cavity by using a veress needle, an open hasson method, or an optical trocar allowing view of the abdominal wall layers during penetration . Three trocars are used, one 10-mm trocar and two 5-mm, which are placed as laterally as possible on the abdominal wall, so they are at an adequate distance from the hernia orifice (figure 1). Perforation of the intestine is the most serious injury associated with laparoscopic ventral hernia repair . Schematic presentation of a midline hernia defect, trocar sites, suture fixation of the mesh, and tack application points . After adhesiolysis, the sac contents are gently reduced into the peritoneal cavity, while the peritoneal sac is left in situ . Closure of large hernia defects is recommended by franklin et al with nonabsorbable sutures, even if only a limited closure is possible . The periphery of the hernia defect is evaluated by direct vision and palpation and is marked on the abdominal wall skin with a marker . The carbon dioxide should be released prior to measurement, revealing the true size of the hernia defect . The craniocaudal and lateral measurements are taken to define the size of the prosthetic mesh . The surgeon should add 6 cm to these measurements in both directions, which provides a 3-cm overlap of the aponeurotic edges of the hernia by the mesh . Some surgeons suggest a 4-cm to 5-cm overlap, especially if the patient is morbidly obese, or if the hernia is recurrent or of large size . The size of mesh that most closely approaches this measurement is selected for the repair . Four main types of mesh have been used: polypropylene (prolene, ethicon, sommerville, nj, usa), expanded polytetrafluoroethylene (dual mesh, gore - tex, gore medical, flagstaff, az, usa), composite polypropylene+polytetrafluoroethylene (composix, cr bard, cranston, nj, usa), or composite polypropylene+collagen (parietene, sofradim, trevoux, france). Polypropylene prosthesis has been abandoned in the laparoscopic approach, because it may create adhesions with bowel loops . It has been replaced by proceed (ethicon), which is composed of polypropylene covered with oxidized regenerated cellulose (orc) (table 1). The most popular prosthetic biomaterials available for incisional hernia repair eptfe = expanded polytetrafluoroethylene, ppm = polypropylene, pol = polyester, ha = hyalouronic acid, pds = polydioxanone, orc = oxidized regenerated cellulose, cmc = carboxymethyl cellulose . Gore - tex (eptfe) mesh has been widely used worldwide, but composix has become more popular in the last few years . All collagen meshes have been treated to eliminate all cells and proteins other than collagen, which may evoke adverse reactions to the host . The most popular of these meshes is surgisis (surgisis gold, cook surgical, bloomington, il, usa), made of porcine small intestinal mucosa . These meshes are mainly used to reconstruct the abdominal wall in an infected field, but they are of limited use in laparoscopic ventral hernia repair . After selection of the appropriate - sized mesh, 4 to 6 sutures are placed on the edges of the prosthetic mesh . The suture sites are numbered with a marker to allow easier orientation of the prosthetic mesh in the abdominal cavity . The tailored prosthetic mesh is rolled tightly and inserted in the peritoneal cavity through the 10-mm to 11-mm trocar . Two - mm skin incisions are made in the marked points on the abdominal wall . With the help of a berci fascial closure instrument (karl storz gmbh & co. kg, tuttlingen, germany) or the endoclose (autosuture) inserted through each skin incision into the peritoneal cavity, the 2 ends of each suture are grasped and drawn outside through the skin incisions by separate passages and at different angles . The mesh is further secured with 5-mm titanium tacks using protack (autosuture, norwalk, ct, usa), the ems stapler (ethicon), or the reusable salute (cr bard). Lvhr achieves adequate closure of the hernia defect by using intraperitoneal mesh fixation with minimal soft - tissue dissection . The technique has all the advantages of the laparoscopic approach, such as less postoperative pain, earlier recovery, and a shorter convalescence period than the ovhr . Moreover, the patients feel more comfortable and tolerate oral intake earlier than after the open procedure . For patients undergoing laparoscopic repair of a primary ventral hernia however, for patients undergoing laparoscopic repair of an incisional hernia, the benefit in terms of body image is limited . Lvhr also has significant technical advantages . With this approach, minimal fascial defects, known as swiss cheese defects, which may be missed during the open repair, can be identified and closed with one mesh . In addition, by placing the mesh intraperitoneally, the intraabdominal pressure pushes upwards and holds the mesh into position . The major debate for this type of repair is which mesh fixation technique should be used, tacks plus transfascial sutures or tacks alone . A variety of reports are available on this type of mesh fixation, which represents the traditional technique in lvhr . Heniford et al, in a large series of 850 consecutive hernias, used an eptfe mesh that was fixed on the abdominal wall with tacks and tranfascial eptfe stitches in 97% of cases . Tacks alone were used to secure the mesh in several cases at the beginning of the study, but later this practice was discontinued . During a mean follow - up of 20.2 months, leblanc et al have also suggested the importance of suture anchorage at 4-cm to 5-cm anchorage intervals around the perimeter of the mesh to minimize the risk for mesh migration . In another study, leblanc's group retrospectively compared 2 patient groups, one early and one late lvhr group, of 100 patients each . In a median follow - up of 36 months, the recurrence rate droped from 9% to 4%, which was attributed to the use of transfascial sutures and the increased mesh overlap in the more recent group . Franklin et al published their 11-year experience in 384 patients who underwent lvhr using transfascial sutures . In a median follow - up of 47.1 months, perrone et al recently reported their results in a group of 116 patients who had lvhr . In a median follow - up of 22 months, the majority of cases were performed with transfascial sutures; however, 35% of cases were performed with tacks alone . The 2 groups, ie, the transfascial suture group and the tack alone group, had similar recurrence rates, 9.2% and 8.5%, respectively . In a recent large review in lvhr by cobb et al, a 3.8% overall recurrence rate was found, when transfascial sutures and tacks were used, compared with a 5.6% recurrence rate, when tacks only were used . Frantzides et al followed up 208 patients for a median period of 24 months and reported a very low 1.4% recurrence rate . Bageacu et al studied a similar group of 159 patients for a median follow - up of 49 months . The recurrence rate was very high, 15.7%, and this was attributed by the authors to the learning curve effect: their recurrence rate decreased from 20% to 10% between the early (1993 to 1995) and the late period (1996 to 1998) of the study . The largest study was performed by carbajo et al who followed up 270 patients for a median period of 44 months . In this study, et al review of the related literature, the calculated recurrence rates after the suture and tack fixation technique and the tack fixation technique were approximately equal, 4.5% and 4.4% . Therefore, it seems that the fixation technique does not really affect the final outcome in lvhr, and that the laparoscopic repair yields very low recurrence rates . However, there is a general idea that tacks do not have the same holding strength as full - thickness abdominal sutures, and this is further supported by experimental evidence . Up to the present, no randomized prospective trial has compared the 2 fixation techniques, and therefore we cannot draw any safe conclusion in this matter . The laparoscopic approach in ventral hernia repair carries the risk of intestinal or bladder injury intraoperatively . Adhesions to the abdominal scar represent a significant problem during lvhr, with the risk of bowel injury around the neck of the hernia during dissection . Rudmik et al, in their review, calculated an overall risk of enterotomy of 2.1% . Injury of a hollow organ is a very serious event and should be recognized and treated immediately . This should be managed with endoscopic suturing if it is limited, whereas the procedure should be converted to open in case a more extensive laceration occurs of the small bowel or the colon, or if spillage of bowel contents occurs in the abdominal cavity . In the latter case, if the enterotomy remains unnoticed, it may result in an acute abdominal condition and sepsis within a few hours after surgery . The main disadvantage of the laparoscopic approach is that the hernia sac is usually retained in place, which predisposes to postoperative seroma formation . The latter is a fluid collection inside the hernia sac, which develops in most cases . Actually, in a series, systematic ultrasound examinations detected seromas in 93% of patients postoperatively . Many of these cases are not noticed by the patient, and the majority resolve without intervention . However, some seromas persist for more than 8 weeks or cause symptoms requiring intervention, which is usually a sterile aspiration . The incidence of symptomatic seromas according to various reports ranges from 1% to 24% . According to the carolina medical center's experience, only 2.6% of a large group of 860 patients with lvhr had seromas that persisted for more than 8 weeks or caused symptoms requiring intervention . Long - term complications, such as infection, do not usually develop from these fluid collections, regardless of whether they are aspirated early or allowed to persist for 8 weeks or longer . Seroma formation is a common problem after lvhr; however, its incidence is similar to that after ovhr . Despite the fact that no specific measures are available to prevent this complication, leblanc et al showed that applying a postoperative compressive bandage or wearing an abdominal binder for a couple of months after surgery may decrease clinically significant seroma formation . In lvhr, the mesh comes into minimal contact with the patient's dermal flora while it is introduced intraperitone - ally . Minimal tissue dissection in the laparoscopic approach further reduces the risk of infection . Despite the potential benefit of a reduction in infectious complications from lvhr, still a percentage of patients, ranging from 0.7% to 5% in different series, may acquire infection related to the hernia repair . The overall calculated incidence of mesh infection is 0.6%, whereas the incidence of fistula formation is 0.1% . Any associated abscesses should be drained percutaneously under computed tomography guidance, and the patient should receive systemic antimicrobial therapy . Prophylactic measures to reduce the risk of infection include efforts to minimize skin contamination at surgery, elimination of any potential sources of infection before surgery, limit the contact of mesh with the skin, and the use of antibiotic prophylaxis perioperatively . Protracted pain (more than 12 weeks) at the sites of the transfixing sutures on the abdominal wall is not uncommon (1.3% to 3.3%). Patients with prolonged pain are initially treated with anti - iflammatory medications, or injections of local anesthetics . In case of persisitent pain, removal of the anchoring suture however, there may be neuroma formation, which does not resolve after suture removal . Prolonged ileus may develop in a minority of patients (3%) and should be treated expectantly, in - hospital, until patients can tolerate oral intake . In some patients, adhesions may form between the omentum or the intestines and the mesh at the tack sites, and this may predispose to intestinal obstruction . Exacerbation of chronic obstructive pulmonary disease may occur after the laparoscopic procedure, as a result of pneumoperitoneum . Cardiac complications may also occur in patients with preexisting cardiac disease, such as congestive cardiac failure, coronary artery disease, and other such things . Heniford et al found significant associations between recurrence and larger hernias, longer operative times, previous hernia repairs, morbid obesity, and higher complication rates . Sains et al performed an excellent meta - analysis of recent high - quality studies comparing lvhr with ovhr and they noted a trend towards lower hernia recurrence rates following the laparoscopic approach, though not achieving statistical significance . Pierce et al have presented a pooled data analysis of 45 published series in lvhr, representing 5340 patients (4582 lvhr, 758 ovhr). They demonstrated a significantly lower recurrence rate with lvhr for both the pooled (4.3%) and the paired (3.1%) study cohorts (studies comparing patients who had undergone lvhr or ovhr within a given institution), compared with ovhr series (12.1%, p<0.0001). Although recurrence still remains an important problem after lvhr, it does not surpass 5% to 10% in most series . The laparoscopic technique has numerous variations of the methodology used by surgeons, although several common steps are followed by all . The procedure starts with entering the peritoneal cavity by using a veress needle, an open hasson method, or an optical trocar allowing view of the abdominal wall layers during penetration . Three trocars are used, one 10-mm trocar and two 5-mm, which are placed as laterally as possible on the abdominal wall, so they are at an adequate distance from the hernia orifice (figure 1). Perforation of the intestine is the most serious injury associated with laparoscopic ventral hernia repair . Schematic presentation of a midline hernia defect, trocar sites, suture fixation of the mesh, and tack application points . After adhesiolysis, the sac contents are gently reduced into the peritoneal cavity, while the peritoneal sac is left in situ . Closure of large hernia defects is recommended by franklin et al with nonabsorbable sutures, even if only a limited closure is possible . The periphery of the hernia defect is evaluated by direct vision and palpation and is marked on the abdominal wall skin with a marker . The carbon dioxide should be released prior to measurement, revealing the true size of the hernia defect . The craniocaudal and lateral measurements are taken to define the size of the prosthetic mesh . The surgeon should add 6 cm to these measurements in both directions, which provides a 3-cm overlap of the aponeurotic edges of the hernia by the mesh . Some surgeons suggest a 4-cm to 5-cm overlap, especially if the patient is morbidly obese, or if the hernia is recurrent or of large size . The size of mesh that most closely approaches this measurement is selected for the repair . Four main types of mesh have been used: polypropylene (prolene, ethicon, sommerville, nj, usa), expanded polytetrafluoroethylene (dual mesh, gore - tex, gore medical, flagstaff, az, usa), composite polypropylene+polytetrafluoroethylene (composix, cr bard, cranston, nj, usa), or composite polypropylene+collagen (parietene, sofradim, trevoux, france). Polypropylene prosthesis has been abandoned in the laparoscopic approach, because it may create adhesions with bowel loops . It has been replaced by proceed (ethicon), which is composed of polypropylene covered with oxidized regenerated cellulose (orc) (table 1). The most popular prosthetic biomaterials available for incisional hernia repair eptfe = expanded polytetrafluoroethylene, ppm = polypropylene, pol = polyester, ha = hyalouronic acid, pds = polydioxanone, orc = oxidized regenerated cellulose, cmc = carboxymethyl cellulose . The clinical experience with all these types of mesh varies from country to country . Gore - tex (eptfe) mesh has been widely used worldwide, but composix has become more popular in the last few years . All collagen meshes have been treated to eliminate all cells and proteins other than collagen, which may evoke adverse reactions to the host . The most popular of these meshes is surgisis (surgisis gold, cook surgical, bloomington, il, usa), made of porcine small intestinal mucosa . These meshes are mainly used to reconstruct the abdominal wall in an infected field, but they are of limited use in laparoscopic ventral hernia repair . After selection of the appropriate - sized mesh, 4 to 6 sutures are placed on the edges of the prosthetic mesh . The suture sites are numbered with a marker to allow easier orientation of the prosthetic mesh in the abdominal cavity . The tailored prosthetic mesh is rolled tightly and inserted in the peritoneal cavity through the 10-mm to 11-mm trocar . Two - mm skin incisions are made in the marked points on the abdominal wall . With the help of a berci fascial closure instrument (karl storz gmbh & co. kg, tuttlingen, germany) or the endoclose (autosuture) inserted through each skin incision into the peritoneal cavity, the 2 ends of each suture are grasped and drawn outside through the skin incisions by separate passages and at different angles . The mesh is further secured with 5-mm titanium tacks using protack (autosuture, norwalk, ct, usa), the ems stapler (ethicon), or the reusable salute (cr bard). Lvhr achieves adequate closure of the hernia defect by using intraperitoneal mesh fixation with minimal soft - tissue dissection . The technique has all the advantages of the laparoscopic approach, such as less postoperative pain, earlier recovery, and a shorter convalescence period than the ovhr . Moreover, the patients feel more comfortable and tolerate oral intake earlier than after the open procedure . For patients undergoing laparoscopic repair of a primary ventral hernia however, for patients undergoing laparoscopic repair of an incisional hernia, the benefit in terms of body image is limited . Lvhr also has significant technical advantages . With this approach, minimal fascial defects, known as defects, which may be missed during the open repair, can be identified and closed with one mesh . In addition, by placing the mesh intraperitoneally, the intraabdominal pressure pushes upwards and holds the mesh into position . The major debate for this type of repair is which mesh fixation technique should be used, tacks plus transfascial sutures or tacks alone . A variety of reports are available on this type of mesh fixation, which represents the traditional technique in lvhr . Heniford et al, in a large series of 850 consecutive hernias, used an eptfe mesh that was fixed on the abdominal wall with tacks and tranfascial eptfe stitches in 97% of cases . Tacks alone were used to secure the mesh in several cases at the beginning of the study, but later this practice was discontinued . During a mean follow - up of 20.2 months, leblanc et al have also suggested the importance of suture anchorage at 4-cm to 5-cm anchorage intervals around the perimeter of the mesh to minimize the risk for mesh migration . In another study, leblanc's group retrospectively compared 2 patient groups, one early and one late lvhr group, of 100 patients each . In a median follow - up of 36 months, the recurrence rate droped from 9% to 4%, which was attributed to the use of transfascial sutures and the increased mesh overlap in the more recent group . Franklin et al published their 11-year experience in 384 patients who underwent lvhr using transfascial sutures . In a median follow - up of 47.1 months, perrone et al recently reported their results in a group of 116 patients who had lvhr . In a median follow - up of 22 months, the recurrence rate was 9.3% . The majority of cases were performed with transfascial sutures; however, 35% of cases were performed with tacks alone . The 2 groups, ie, the transfascial suture group and the tack alone group, had similar recurrence rates, 9.2% and 8.5%, respectively . In a recent large review in lvhr by cobb et al, a 3.8% overall recurrence rate was found, when transfascial sutures and tacks were used, compared with a 5.6% recurrence rate, when tacks only were used . Frantzides et al followed up 208 patients for a median period of 24 months and reported a very low 1.4% recurrence rate . Bageacu et al studied a similar group of 159 patients for a median follow - up of 49 months . The recurrence rate was very high, 15.7%, and this was attributed by the authors to the learning curve effect: their recurrence rate decreased from 20% to 10% between the early (1993 to 1995) and the late period (1996 to 1998) of the study . The largest study was performed by carbajo et al who followed up 270 patients for a median period of 44 months . In this study, et al review of the related literature, the calculated recurrence rates after the suture and tack fixation technique and the tack fixation technique were approximately equal, 4.5% and 4.4% . Therefore, it seems that the fixation technique does not really affect the final outcome in lvhr, and that the laparoscopic repair yields very low recurrence rates . However, there is a general idea that tacks do not have the same holding strength as full - thickness abdominal sutures, and this is further supported by experimental evidence . Up to the present, no randomized prospective trial has compared the 2 fixation techniques, and therefore we cannot draw any safe conclusion in this matter . The laparoscopic approach in ventral hernia repair carries the risk of intestinal or bladder injury intraoperatively . Adhesions to the abdominal scar represent a significant problem during lvhr, with the risk of bowel injury around the neck of the hernia during dissection . Rudmik et al, in their review, calculated an overall risk of enterotomy of 2.1% . Injury of a hollow organ is a very serious event and should be recognized and treated immediately . This should be managed with endoscopic suturing if it is limited, whereas the procedure should be converted to open in case a more extensive laceration occurs of the small bowel or the colon, or if spillage of bowel contents occurs in the abdominal cavity . In the latter case, mesh repair of the ventral hernia should be postponed for a second stage . If the enterotomy remains unnoticed, it may result in an acute abdominal condition and sepsis within a few hours after surgery . The main disadvantage of the laparoscopic approach is that the hernia sac is usually retained in place, which predisposes to postoperative seroma formation . The latter is a fluid collection inside the hernia sac, which develops in most cases . Actually, in a series, systematic ultrasound examinations detected seromas in 93% of patients postoperatively . Many of these cases are not noticed by the patient, and the majority resolve without intervention . However, some seromas persist for more than 8 weeks or cause symptoms requiring intervention, which is usually a sterile aspiration . The incidence of symptomatic seromas according to various reports ranges from 1% to 24% . According to the carolina medical center's experience, only 2.6% of a large group of 860 patients with lvhr had seromas that persisted for more than 8 weeks or caused symptoms requiring intervention . Long - term complications, such as infection, do not usually develop from these fluid collections, regardless of whether they are aspirated early or allowed to persist for 8 weeks or longer . Seroma formation is a common problem after lvhr; however, its incidence is similar to that after ovhr . Despite the fact that no specific measures are available to prevent this complication, leblanc et al showed that applying a postoperative compressive bandage or wearing an abdominal binder for a couple of months after surgery may decrease clinically significant seroma formation . In lvhr, the mesh comes into minimal contact with the patient's dermal flora while it is introduced intraperitone - ally . Minimal tissue dissection in the laparoscopic approach further reduces the risk of infection . Despite the potential benefit of a reduction in infectious complications from lvhr, still a percentage of patients, ranging from 0.7% to 5% in different series, may acquire infection related to the hernia repair . The overall calculated incidence of mesh infection is 0.6%, whereas the incidence of fistula formation is 0.1% . Any associated abscesses should be drained percutaneously under computed tomography guidance, and the patient should receive systemic antimicrobial therapy . Prophylactic measures to reduce the risk of infection include efforts to minimize skin contamination at surgery, elimination of any potential sources of infection before surgery, limit the contact of mesh with the skin, and the use of antibiotic prophylaxis perioperatively . Protracted pain (more than 12 weeks) at the sites of the transfixing sutures on the abdominal wall is not uncommon (1.3% to 3.3%). Patients with prolonged pain are initially treated with anti - iflammatory medications, or injections of local anesthetics . In case of persisitent pain, removal of the anchoring suture, however, there may be neuroma formation, which does not resolve after suture removal . Prolonged ileus may develop in a minority of patients (3%) and should be treated expectantly, in - hospital, until patients can tolerate oral intake . In some patients, adhesions may form between the omentum or the intestines and the mesh at the tack sites, and this may predispose to intestinal obstruction . Exacerbation of chronic obstructive pulmonary disease may occur after the laparoscopic procedure, as a result of pneumoperitoneum . Cardiac complications may also occur in patients with preexisting cardiac disease, such as congestive cardiac failure, coronary artery disease, and other such things . Heniford et al found significant associations between recurrence and larger hernias, longer operative times, previous hernia repairs, morbid obesity, and higher complication rates . Sains et al performed an excellent meta - analysis of recent high - quality studies comparing lvhr with ovhr and they noted a trend towards lower hernia recurrence rates following the laparoscopic approach, though not achieving statistical significance . Pierce et al have presented a pooled data analysis of 45 published series in lvhr, representing 5340 patients (4582 lvhr, 758 ovhr). They demonstrated a significantly lower recurrence rate with lvhr for both the pooled (4.3%) and the paired (3.1%) study cohorts (studies comparing patients who had undergone lvhr or ovhr within a given institution), compared with ovhr series (12.1%, p<0.0001). Although recurrence still remains an important problem after lvhr, it does not surpass 5% to 10% in most series . Our review indicates that lvhr is a safe and effective approach to abdominal wall hernias . The technique offers the advantages of the laparoscopic approach, ie, a short hospital stay, less postoperative pain, and early convalescence . The procedure carries an acceptable risk of complications, a low risk of recurrence, and an excellent cosmetic result . However, larger, long - term multicenter studies comparing the laparoscopic with the open technique are needed to establish its efficacy . For the time being, it is considered a good alternative to its open counterpart, at least in experienced hands.
5-fluoruracil (5-fu), pyrimidine antimetabolite, is a chemotherapeutic agent widely used for various tumors . Neurotoxicites of 5-fu with manifestations of somnolence, upper motor neuronal signs, cerebellar ataxia and a cluster of symptoms and signs of organic brain syndrome have rarely been reported . We report a case of serious neurotoxicity following 5-fu infusion for malignant gastrointestinal stromal tumor (gist) and also briefly review 5-fu related neurotoxicity . A 44-year - old male patient received his first cycle of palliative 5-day chemotherapy containing 5-fu (800 mg / m), adriamycin (40 mg / m) and mitomycin- c (8 mg / m) for a recurrent, massive, malignant gastrointestinal stromal tumor (gist) which developed at 3 years after surgery . His tumor was about 20 cm in diameter and invaded the urinary bladder and sigmoid colon (figure 1). About 1 week after the completion of his first cycle of chemotherapy, he displayed slurred speech and inappropriate behavior for 35 days at home . Such abnormal symptoms improved spontaneously . On the beginning of the second cycle of chemotherapy, he appeared well and no remarkable abnormality was found on physical examination and laboratory test . He received the second cycle of chemotherapy with the same regimen as the first and was discharged without any complaint . On the 7 day after the completion of his second chemotherapy, his mental status deteriorated with slurred speech, inappropriate language, hyperventilation, insomnia, disorientation and incontinence of stool and urine . The er, his vital signs were as follows: blood pressure 120/70 mmhg, pulse rate 92/minute, respiration rate 24 /minute and body temperature 36.8c . On physical examination neurological examination revealed confused mental status, bizarre behavior, lethargy, slurred speech and somnolence . Light reflex was prompt with symmetric, isocoric pupils . Orientation to time, person and place however, he showed neither focal neurological sign nor pathological reflex . On the laboratory findings, white blood cell count was 3,020/ul, bun and creatinine were 24.0 mg / dl and 1.4 mg / dl, respectively, serum natrium 135.0 meq / l, serum pottasium 4.3 meq / l, ionized calcium 4.25 mg / dl and serum albumin 2.9 g / dl . On arterial blood gas analysis (abga), respiratory alkalosis pattern was found with ph 7.546, pco2 19.3 mmhg, po2 133.3 mmhg, bicarbonate 16.8 meq / l and o2 saturation 99.4% at room air . His serum ammonia level was at 326 ug / dl, higher than the upper limit of normal range (0150 ug / dl). Chest x - ray was normal, abdominal simple x - ray showed mild paralytic ileus pattern . Brain computed tomography at the er was normal without evidence of metastasis or cerebral vascular accident . After a few sessions of lactulose enema, his mental status recovered somewhat with intact orientation to persons . During the admission period for 15 days, his mental status and general condition gradually recovered . He complained of intermittent abdominal pain and gastric distension due to partial obstruction of the proximal small bowel by the mass . Cerebellar function tests, such as finger to nose, rapid alternative test, heel to shin test and romberg test, were all negative . Brain magnetic resonance imaging revealed no abnormal lesion in brain parenchyma . His mental status and general condition recovered, so that we changed the chemotheapeutic regimen to adriamycin (60 mg / m) and cisplatin (60 mg / m) for 1 day, omitting 5-fu . On the 5 day of postchemotherapy, he was in stuporous mentality and lethargic condition . At er, he was found to have neutropenic fever and sepsis syndrome with pancytopenia, respiratory alkalosis and hypokalemia . Cerebrospinal fluid (csf) study was normal in pressure, cell count and chemistry . On blood culture, after treatment with intravenous fluids and broad - spectrum antibiotics, his mental status and general condition rapidly improved for 23 days . On the 17 day after the 3 chemotherapy, he was discharged since he completely recovered from sepsis syndrome . After discharge, he intermittently experienced altered mentality which developed after constipation and abdominal distention . His neurological symptoms were relieved after repeated lactulose enema at a local hospital . On the last visit after 2 months of 5-fu administration, he still displayed slightly slurred speech and slowly progressive cachexia . Brain magnetic resonance imaging revealed newly developed hyperintense lesions in the bilateral cerebellar hemisphere, thalami and midbrain on t2wi without mass effect . On t1wi, hypertensive lesion was developed in bilateral basal ganglia (figure 3). There are many reports on serious neurotoxicity of 5-fu in patients with dihydropyrimidine dehydrogenase (dpd) deficiency . Dpd is the rate - limiting enzyme of 5-fu catabolism and is encoded by the human dihydropyrimidine dehydrogenase gene (dpyd). So far, about 20 different mutations of dpyd have been reported in dpd deficient subjects . G to a point mutation within the 5-splicing site (gt to at), also known as dpyd2a (intron 14 g1a), is one of the common mechanisms for dpd deficiency171 . Therefore we examined the presence of dpyd2a (intron 14 g1a) by polymerase chain reaction - restriction fragment length polymorphism (pcr - rflp). When a pcr - rflp based genotyping was performed, fragments of 278 and 131 bp were produced by the restriction endonuclease mae ii in the wild type allele . However, the mutant allele had no restriction site and remained undigested (409 bp). Therefore, as shown in figure 4, this patient had a wild - type pattern . Although both acute and delayed forms have been reported, fluorouracil - induced neurotoxicity is rare . The acute form consists of cerebellar syndrome and encephalopathy, whereas the delayed variety takes the form of subacute multifocal ieukoencephalopathy . About 5% (0.67%) of the patients who received 5-fu have been reported to experience neurotoxic symptoms . The clinical manifestations of acute cerebellar syndrome, such as ataxia, slurred speech and nystagmus, were first described by riehl and brown in 1964 . Encephalopathy or organic brain syndrome following 5-fu treatment is a less commonly observed neurotoxicity with confusion, disorientation and other cognitive disorders . Subacute multifocal leukoencephalopathy with typical brain magnetic resonance imaging findings of multifocal, enhancing white matter lesions and biopsy findings of demyelination has been reported as a 5-fu sequela . We reported a case of delayed form of 5-fu neurotoxicity characterized by subacute multifocal leukoencephalopathy . Our case initially showed moderate diffuse cerebral dysfunction on electroencephalography (figure 2) without abnormality in brain magnetic resonance imaging . During the 2 months after the last administration of 5-fu, the neurological symptoms waxed and waned depending on the partial obstruction of the bowel and did not fully recover . However, we could not find any relevant papers on the neurotoxicities of adriamycin and mitomycin . 5-fu is a pyrimidine antimetabolite which has to be metabolically activated within the cells and incorporated into both dna and rna, which results in dna strand breakage and abnormal processing and function of rna . 5-fu itself seems to be relatively nontoxic to the nervous system in laboratory animals when administered intrathecally . Koenig et al . Proposed that fluorocitrate, the major catabolite of 5-fu, inhibited krebs cycle and a blockade of krebs cycle impaired the activity of the urea cycle . Reported that, in animal experiments, direct toxic effect on myelin with splitting of the intraperiodline and vacuole formation was not due to 5-fu itself, but to monofluoroacetic acid and -fluoro--alanine (the major catabolites of 5-fu). The other explanations for 5-fu neurotoxicity, such as induction of thiamine deficiency and inherited deficiency of the enzyme dihydropyrimidine dehydrogenase (dpd), have also been presented . The frequency of low and deficient dpd activity in the general population is estimated to be 35% and 0.1%, respectively . Recent efforts to explain the relationship between genotype and phenotype in patients with dpd deficiency have brought much progress . Dpd protein is encoded by dpyd, which is a large gene (> 950 kb) containing 23 exons with approximately 3 kb of coding region . To date, about 20 variant dpyd alleles, containing single amino acid substitutions, nucleotide deletions or a donor splice site mutation resulting in exon skipping, have been described . Among them, g to a point mutation within the 5-splicing site (intron 14 g1a) is the most common (2.2% out of 90 alleles in finnish and 2.7% out of 72 alleles in taiwanese general population) and analytical methods for this mutation are well established . Although this mutant allele was not found in our case, a possibility of decreased dpd activity by other dpyp mutations could not be excluded . As a chemotherapeutic agent, 5-fu is active against a wide variety of solid tumor, including cancers of gastrointestinal tract, ovary and breast ., there are many possible differential diagnoses, such as brain metastasis, infection of brain or meninges, sepsis syndrome, metabolic abnormality . Based on our present case, we emphasize that 5-fu - induced neurotoxicity should also be an important category of differential diagnosis in these patients . The treatment of 5-fu neurotoxicity is recommended as supportive care . In the literature, several treatments, such as thiamine infusion, glucocorticosteroid, uridine infusion, charcoal hemoperfusion or hemodialysis, were recommended . However, their efficiency has not been proven . To understand the mechanism of neurological manifestation of 5-fu,
Most patients are asymptomatic or suffer from mild symptoms only, (1) and many present with extraintestinal manifestations such as neurologic disorders (2). The anti - tissue transglutaminase antibody (ttga) test is a sensitive and specific tool in disclosing celiac disease with overt villous atrophy (3) with a specificity of approximately 95%, false positive tests are uncommon, and ttga may appear in serum at an early stage in the disease, in other words before the clinical manifestations and even before the development of villous atrophy (4). Psychiatric disorders are also common in untreated celiac disease, especially depressive symptoms (58). Hallert & derefeldt reported that nine out of 42 studied subjects had attended a psychiatric clinic because of neurotic problems and most of them are involved with depressive disorders (7). Celiac disease was considered relatively uncommon in iran, until recently an estimated population prevalence of 1:166 was reported (9). Greater awareness of its varying presentation and the availability of new serologic tests have shown celiac disease to be relatively common (10). These observations prompted us now to assess the association between celiac disease and severe chronic depression and schizophrenia . This cross - sectional study was carried out in 2006 - 2007 . By random sampling, 200 inpatient men comprising 100 with chronic depression and 100 with schizophrenia (mean age 37 years, range 18 - 68 years) were enrolled in razi hospital, tabriz, iran . Chronic depression was defined according to dsm - iv criteria, (11) diagnosed and treated by semi - structural clinical interview by two psychiatric experts . The duration of the diseases was more than two years, and the diseases were unbearable without antipsychotic drugs . Patients with schizophrenia suffered from different types of the disease such as paranoid, phrenetic or undistinguished . Two hundred healthy males were selected as controls, matched for age and birthplace (mean age 32, range 4 - 77 years). A written informed consent was obtained from patients (or from next of kin if necessary) and the study was approved by the institutional ethics committees of the research center for gastroenterology and liver disease, tabriz medical university . Iga class ttga antibody was measured by enzyme - linked immunosorbent assay using a commercially available kit (eu - ttg iga, eurospital, trieste, italy). A titer of> 7 u / ml was considered positive as recommended by the manufacturer . A frequency of 0.6% celiac disease has been reported in iran (9). Assuming this frequency in 200 controls and a tenfold frequency in psychiatric patients (6%, as has been reported in many autoimmune conditions) the statistical power of 0.80 at a significance level of 0.05 percentages were compared by rates and proportion; 95% confidence intervals (ci) were reported . A frequency of 0.6% celiac disease has been reported in iran (9). Assuming this frequency in 200 controls and a tenfold frequency in psychiatric patients (6%, as has been reported in many autoimmune conditions) the statistical power of 0.80 at a significance level of 0.05 percentages were compared by rates and proportion; 95% confidence intervals (ci) were reported . None of the 200 patients had a history of chronic diarrhea and all were taking antipsychiatric drugs (antipsychotic such as risperidone, haloperidol or perphenazine and anticholinegic for schizophrenic patients, and fluoxetine and tricyclic antidepressants for depressive patients). Three patients with chronic psychiatric disorders were ttga positive, in which one (age 52 years) with schizophrenia and two (both 30 years of age) with chronic depression . Of these three patients, two refused duodenal biopsy and one died during the study period . In the control group, one (age 25 years) out of 200 individuals was positive, but duodenal histology proved normal . The prevalence of positive celiac disease serology in patients with chronic psychiatric disorders was thus slightly but not significantly higher than in controls; 1.5%, (95% ci: 0.38 - 4.03) and 0.5% (95% ci: 0.00025 - 2.44), respectively (p = 0.06). Clinical features and laboratory findings among the patients with schizophrenia and depression are shown in table 1 . Five in the study group and none in the control group had selective iga deficiency . Clinical and laboratory features of male patients with schizophrenia and depression ttga iga - class anti - tissue transglutaminase antibody; meanstandard deviation in our reports, the frequency of positive celiac disease serology in iranian inpatients suffering from depression or schizophrenia was 1.5% . By comparison, pynnnen et al . Have shown the prevalence of celiac disease in patients with depression to be 0.7% (5). The same authors have reported that in adolescent celiac disease patients the frequency of depression and disruptive behavioral disorders was higher than in controls, 31% and 7%, respectively (6). The present observations support earlier findings that celiac disease is not increased in patients with schizophrenia . (12) studied 7754 schizophrenia patients in denmark and found a frequency of untreated celiac disease of 0.05% . In uk, west et al . Showed that in subjects with celiac disease the prevalence of schizophrenia was 0.25%, the adjusted odds ratios showing no association between the two conditions (celiac disease vs. controls 0.76, 95% ci: 0.41 - 1.4) (13). By contrast, a study in the uk revealed that patients with celiac disease developed schizophrenia 3 times more frequently than non - celiac controls (14). Some studies have suggested that schizophrenia and celiac disease may be associated with similar or adjacent genes (15, 16). It has indeed been reported that genetic susceptibility in schizophrenia lies in human leukocyte antigen (hla) dq, similarly to autoimmune disorders such as celiac disease (17). By contrast, a recent study showed no such hla association in schizophrenia (18). In a case report, the symptoms of schizophrenia were improved in a celiac patient aged 33 years after the introduction of gluten free diet (19). Here we had no opportunity to investigate the effect of gluten - free diet, since two patients refused and one died during the study . In this present study, the frequency of positive celiac disease serology in patients with chronic depressive (2%) and schizophrenia (1%) was in fact similar to that found in healthy blood donors in iran (0.6%) (9). In the latter study, the frequency of celiac disease in males (1.8%) was higher than in females (0.5%), although usually 60%-70% of celiac disease patients are female . We could not investigate females with psychiatric disorders, which may be considered as a limitation to the current study . On the other hand, all our patients were inpatients, indicating that they suffered from severe manifestations of chronic psychiatric disorders . Patients with selective iga deficiency remain negative by ttga iga class screening, and we had no opportunity to test our 5 such subjects by igg class ttga . In blood donors there may thus be additional celiac case in our study group, but we consider that this would not change our conclusions . To conclude, mass screening for celiac disease in patients with depression or schizophrenia is not advocated . Despite this, alertness to celiac disease should be high, since early diagnosis and treatment by gluten - free diet may ameliorate the symptoms and quality of life of these patients.
We carried out a retrospective study by testing blood and serum samples on 1,740 patients who consulted the emergency department of cayenne hospital seeking treatment for fever compatible with malaria and/or dengue during a 1-year period, july 2004june 2005 (figure). Diagnosis of malaria has always been quick; dengue diagnosis was initially conducted only in malaria - negative patients . In our study, dengue investigations were conducted retrospectively at the pasteur institute of french guiana for 99% of patients (1,723/1,740) by using serum samples obtained at admission and frozen at 80c . Comparison of confirmed cases of dengue fever and of symptomatic malaria in patients examined at the emergency department of cayenne hospital, cayenne, french guiana, january 2004march 2006 . The black frame corresponds to the period of the retrospective study (july 2004june 2005). * cases confirmed by positive test results from reverse transcription pcr or virus isolation (pasteur institute, cayenne). Cases diagnosed based on recorded fever or history of fever in the previous 24 h associated with microscopic detection of asexual forms of plasmodium spp . By blood smear . Malaria diagnosis was based on the identification of hematozoa on a thin blood film and/or on a thick blood film stained with giemsa . The asexual parasite load (pl) was quantified in percent parasitized erythrocytes for values> 0.1% . For lower values, classes were created using thick smears: class 1, <0.00125% but positive; class 2,> 0.00125% but <0.0125%; and class 3,> 0.0125% but <0.125% . Carriage was considered for classes 1 and 2 (in the absence of prior antimalarial treatment and for case - patients residing> 1 year in an area of malaria transmission). Virus isolation or reverse transcription (8) was performed on all serum samples obtained during the acute phase of infection, between day 0 and day 4 (n = 264). For malaria - positive samples, virus isolation was conducted on all samples without a date of onset of disease (n = 163). Serologic immunoglobulin (ig) m testing was performed on all serum samples (n = 1,723). Dengue was detected in 238 case - patients (13.8%); among these, 73% (174/238) were confirmed by positive virologic diagnosis (isolation or rt - pcr), whereas 27% were probable dengue cases (positive igm serology only). The first group was named early dengue cases (edc) and the second group late dengue cases (ldc). Of the 1,723 patients, 393 (22.8%) had smear - positive malaria; of those, 251 (63.9%) were p. vivax, 133 (33.8%) were p. falciparum, 2 were p. malariae, and 7 were mixed p. vivax and p. falciparum . Most malaria - positive case - patients had a parasite count above class 2 (371/393 [94.4%]), indicating acute malaria . Concurrent dengue (edc and ldc) and malaria were confirmed in 17 of the 1,723 patients (1%), corresponding to 7.1% (17/238) of dengue cases and 4.1% (16/393) of malaria cases, respectively (table). When considering acute malaria associated with edc, the percentages of confirmed associations were 3.4% for dengue (6/174, 95% confidence interval [ci] 0.76.2) and 1.6% for malaria (6/371, 95% ci 0.32.9). All 17 associations were considered clinically as malaria, including the 2 case - patients with low parasite counts . Antimalarial drugs were administered promptly in every case . Dengue serology and virology reports were available after the initial episode; however, these results did not influence patient management . Among the 6 acute concurrent infections, three patients were hospitalized, all in the igm - seropositive group, i.e., ldc; only 1 was severely ill . This patient, who had p. vivax malaria infection, was hospitalized for interstitial pneumonia with severe anemia . Intubation, blood transfusion, and antimicrobial drugs were required, but he was discharged from the intensive care unit after 11 days . The second patient was hospitalized for diabetes, the third because treatment with riamet (arthemether + lumefantrine) was only available to inpatients . * igm, immunoglobulin m; rt - pcr, reverse transcription pcr; iso, isolate; pv, plasmodium vivax;, negative; + positive; den, dengue; nd, not done; pf, p. falciparum; tp, thrombocytopenia++ (<100,000 platelets/l); hb, hemoglobin (reference range <10 g / l); bp, arterial blood pressure (systolic / diastolic); sat, blood oxygen saturation; hr, heart rate; bpm, beats per minute . For diabetes requiring insulin . For treatment with riamet (arthemether + lumefantrine). Malaria and dengue must be suspected in febrile patients living in or returning from areas endemic for these infections . Although the usual places of contamination by malaria and dengue viruses are quite different in french guiana, considering that the incubation phase is longer for malaria than for dengue and that the population s mobility is high, a simultaneous clinical expression of the 2 diseases is plausible . Moreover, in french guiana, dengue viruses have spread to malaria - endemic rural areas (9). The confirmation of malaria is rapid, and after malaria is confirmed, dengue is usually ruled out without screening for it . Two methods can confirm dengue: dengue - specific igm seroconversion or detection of dengue virus particles during the acute phase (day 0 to day 4 after onset of fever) by rt - pcr, which is faster and more specific . In published case reports (17), the diagnosis of dengue infection is usually made based on positive dengue igm; however, this cannot confirm recent dengue, because igm can persist for months and cross - react with other arboviruses (10). If rt - pcr requires a specific laboratory and cannot be performed on site, a new test, the platelia, is now easily included in any laboratory and is indicated particularly for early - acute phase samples (11). To investigate the frequency of dengue and malaria co - infection, the platelia test should be used in all cases of dengue - like or malaria - like syndrome, even when malaria diagnosis was positive, in regions where both infections may overlap . Of the 1,723 patients investigated in this study, 17 had concurrent dengue and malaria . In 10 of these patients, recent acute dengue fever could not be confirmed (ldc). Two patients, 1 of whom was part of the edc group, could have been asymptomatic carriers of plasmodium spp . (1 patient with p. falciparum and 1 with p. vivax) because of low parasitemia (12). A true acute concurrent infection (strictly defined diagnosis) concurrent acute malaria and recent dengue fever had a lower frequency than predicted by the multiplication of both prevalences, but such reasoning implies the same overlapping contamination areas for malaria and dengue, which it is not the situation in french guiana . The greater prevalence of ldc than edc associated with acute malaria infection illustrates the prolonged persistence of specific igm or igm cross - reaction, which increases the probability of a malaria case when comparing the short 45 day period corresponding to edc . Virologic investigations using isolation or rt - pcr techniques were not performed on samples taken after the 4th day because of the usual disappearance of viremia . Additional associations where fever was initially caused by malaria and followed by dengue after the 4th day of malaria fever could have been undiagnosed . Edc were diagnosed on average after 4 days of fever, never 5 . Thus, delayed complications of dengue or malaria may not be detected using this definition . One of these patients had pneumonia, which has recently been described as a complication of p. vivax (13). Although acute concurrent infections were benign in our study, special attention should be given to the possibility of co - infection with malaria and dengue, especially when p. falciparum is implicated . The distinction between severe dengue and severe malaria must be made in an emergency department or hospital setting because in both situations, early diagnosis is essential for patient care.
To date, kaposi sarcoma has not been mentioned among the adverse effects of triptolide / tripdiolide, ethyl acetate extracts or polyglycosides of the chinese herbal remedy tripterygium wilfordii hook f. she underwent treatment with corticosteroids, methotrexate and gold sodium thiosulfate, and was chronically taking ketoprofen . At the age of 59 years she started to take a powder (2 g / day) from a chinese physician for treatment of rheumatoid arthritis . This powder was supplied to her regularly for 10 years . At the age of 69 years, multiple soft, violaceous to dark - red patches, plaques, nodules and blisters of varying sizes appeared on a background of severely edematous skin on her legs, and later on her arms . Triptolide (235 g/1 g) and tripdiolide were found in the chinese powder by the use of liquid chromatography electrospray ionization mass spectrometry . This case indicates a possible association between triptolide / tripdiolide chronic intake and development of human herpesvirus 8-associated kaposi sarcoma . Triptolide / tripdiolide could contribute to development of kaposi sarcoma by reactivation of latent human herpesvirus 8, permitted by immunosuppression induced by triptolide . Our aim is to show a case of disseminated cutaneous kaposi sarcoma (ks), occurring during a long - term usage of a powder containing triptolide / tripdiolide, for treatment of rheumatoid arthritis (ra). Triptolide and tripdiolide, compounds originally purified from tripterygium wilfordii hook f and used for centuries in traditional chinese medicine to treat ra [24], could contribute to development of ks by reactivation of latent human herpes virus 8 (hhv8), permitted by triptolide - induced immunosuppression . To date, ks has not been mentioned among adverse effects of triptolide, ethyl acetate extracts or polyglycosides of the chinese herbal remedy tripterygium wilfordii hook f[4,69], although dermal reactions including different kinds of rush with the tendency to develop erosion and scarring were described with incidence of 55.5% during 12 weeks of treatment with polyglycosides of tripterygium wilfordii hook f. a patient was diagnosed to have ra when she was 29 years old . Since 55 year of age the patient was regularly controlled by a nephrologist due to infections of the urinary tract resulting in chronic tubulo - interstitial nephritis, and due to possible ra influence on kidneys . Echocardiography was normal, proteinuria was not present, and glomerular filtration rate was over 60 ml / min/1.73 m body surface area . A cyst (diameter 20 mm) was shown in the left kidney, not confirmed in further evaluations . High sensitivity c - reactive protein (hscrp) was 4.2 mg / l (normal value <5 mg / l). Medication with chloroquine diphosphate was added to ketoprofen (table 1), but did not influence ankle edema and joint pain . Serum perinuclear antineutrophil cytoplasmic antibodies were negative . Since 69 years of age, leg edema was worse and she stopped working in her profession (a pharmacist). Doppler ultrasonography of leg vessels again did not reveal abnormalities, proteinuria was not present, and renal function was normal . Six months later, multiple soft, violaceous to dark - red patches, plaques, nodules and blisters of varying sizes started to appear on a background of edematous skin on her legs . Ambulatory laboratory data of the blood revealed hemoglobin level of 5.87 mmol / l (normal range 7.449.92 g / l for women), total protein of 55.2 g / l (normal range 3550 g / l) and creatinine of 144 mol / l . Proteinuria was not present . Although there was no infection of the urinary tract and renal function was deteriorated no more then before appearance of skin changes, she was admitted to the nephrologic ward to determine her health problem . At the admission, severe skin lesions on the edematous background were present on the patient s legs (figure 1) and incipient skin changes on her arms . Rheumatoid factor (rf) was 2,310 iu / ml (normal range <14 iu / ml), but decreased to 566 iu after introduction of treatment with corticosteroids . Functional class iii / iv of ra was classified according to steinbrocker et al . . G / l) and lymphocytes constituted 22% of all leukocytes (normal range 2044%). Lymphocyte subset percentage was abnormal: cd3 84.0% (normal range 6776%), cd3+dr+ 43.0% (normal range 815%), cd4 32% (normal range 3846%), cd8 52% (normal range 3140%), cd19 2% (normal range 1116%), nk 6% (normal range 1019%). The histological examination of 2 biopsy specimens of the leg lesions showed a mixed proliferation of irregular slit - like vascular channels associated with pleomorphic spindle cells, a low - grade lymphocytic inflammatory infiltrate and extravasated erythrocytes consistent with a diagnosis of ks (figure 2). Immunophenotypic analysis showed cell markers f viii+, ck ae1/ae3, cd34 + and cd31 + (figure 3), demonstrating the endothelial nature of the proliferating tumor cells . Expression of the proliferative antigen ki-67 was shown in 20% (specimen 1) and in 30% (specimen 2) of cell nuclei; p53 immunoreactivity was found in less than 5% of cell nuclei . Hh8 latent nuclear antigen protein was detected in biopsy specimens by immunohistochemistry (figure 4). Knowing the diagnosis of hh8 ks, a patient s spouse confessed that at the age of 59 years she started to take a chinese powder of unknown composition and continued it until the current hospitalization . She evaluated this powder as a good pain reliever and was convinced that it would help her to avoid severe ra signs and symptoms . According to the patient s spouse, she used to take 1 dose of powder a day, and sporadically took 2 doses per day . For brief intervals she would stop taking the powder . He calculated that his wife had taken approximately 300 doses per year . During hospitalization in the nephrologic ward, administration of the powder the patient was transferred to the oncological ward and treatments with paclitaxel (sindaxel, sindan, romania) were initiated according to earlier promising reports . Sixteen weeks after withdrawal of the chinese powder and after 12 weeks of paclitaxel administration (6 doses of paclitaxel were given) the patient s condition improved and the skin lesions diminished significantly, presenting postinflammatory hyperpigmentation and crust (figure 5). At the 10 month of treatment with paclitaxel, she died at the age of 71.3 years due to sepsis complicating perforation of the sigmoid diverticulum . We obtained a sample of the powder from the patient s spouse and performed an analysis . Qualitative examination was done using liquid chromatography electrospray ionization mass spectrometry (lc / esi - ms) system . The presence of triptolide m / z=359 (m - h) and tripdiolide m / z=375 (m - h), 2 major active components of trypterigium wilfordii hook f, was confirmed . The content of triptolide in 1 g of the analyzed sample, determined by hplc quantitative analysis, was 235 g . We obtained a sample of the powder from the patient s spouse and performed an analysis . Qualitative examination was done using liquid chromatography electrospray ionization mass spectrometry (lc / esi - ms) system . The presence of triptolide m / z=359 (m - h) and tripdiolide m / z=375 (m - h), 2 major active components of trypterigium wilfordii hook f, was confirmed . The content of triptolide in 1 g of the analyzed sample, determined by hplc quantitative analysis, was 235 g . A question arises how triptolide / tripdiolide, taken in the high daily dose for years, could influence the patient s health status . Triptolide is a small molecule known to act as an anti - inflammatory and anti - cancer compound . Aa amyloidosis, present in 4.44% of early ra patients, was shown to be inhibited in mice by experimental treatment with triptolide . Thus, progression of ra seemed to be slower than usually observed, independently of triptolide / tripdiolide administration . However, only while receiving triptolide / tripdiolide was she almost free from joint pain . The most important point to determine is the possible association of ks with triptolide / tripdiolide medication . Ks is a multifocal angioproliferative neoplasm of the skin (mainly affecting the skin of the limbs) and mucosa, frequently seen in immunosuppressed patients, also due to ra . Regardless of their source or clinical subtype, have been found to be infected with hhv8 . Hhv8 latent transcripts, such as latency - associated nuclear antigen, viral cyclin, viral flip and viral - encoded micrornas, drive cell proliferation and prevent apoptosis, whereas hhv8 lytic proteins such as viral g protein - coupled receptor, k1 and virally encoded cytokines (viral interleukin-6 and viral chemokines) contribute to the angioproliferative and inflammatory ks lesions through a mechanism called paracrine neoplasia . In patients infected with hiv, expression of the proliferative antigen ki-67, shown in our patient in 2030% of cell nuclei, does not correlate with skin and organ lesions or early- and late - stage ks lesions, but is valuable in ks diagnosis . Decreasing cd4 cells, triptolide could contribute to development of ks by reactivation of latent hhv8, permitted by triptolide - induced immunosuppression . On the other hand, triptolide is an anti - cancer compound and ks is not mentioned among the adverse effects of triptolide, ethyl acetate extracts or polyglycosides of the chinese herbal remedy tripterygium wilfordii hook f[4,69]. Moreover, ks lesions are attributed to the release of angiogenic molecules, most notably vascular endothelial growth factor (vegf) and angiopoietin - like 4 . It was recently found that the antitumor action of triptolide is partly via inhibition of tumor angiogenesis by blocking 2 endothelial receptor - mediated signalling pathways, and triptolide can be a promising antiangiogenic agent . Thus, triptolide as an immunosuppressant could contribute to development of ks, but also could potentially be helpful by vegf inhibition although we cannot definitively answer the question of whether triptolide/ tripdiolide contributed to development of ks in our patient, we also cannot exclude such a possibility . The case of our patient indicates an association between triptolide / tripdiolide chronic intake and development of hhv8 ks . Triptolide/ tripdiolide could contribute to development of ks by reactivation of latent hhv8, permitted by immunosuppression induced by triptolide . We believe that this case will help other physicians to be vigilant for a possible association between ks and medication with chinese remedies containing triptolide.
. One of the most common cardiac diseases is congestive heart failure, with the highest incidence, mortality, and hospitalization . This is the only cardiac disease with a progressive incidence and mortality, in which almost 10% of the individuals over 75 years of age are involved . The reported statistics reveal an increase in its mortality by six times in the last 40 years, indicating that about 300,000 people expired yearly directly or indirectly due to heart failure . On the other hand, this disease is so disabling and costly that over 70% of the patients are readmitted in a hospital 3 months after their initial discharge, imposing a high financial burden to health care systems . One of the important strategies to promote clinical outcomes in these patients is promotion of self - care behaviors . Self - care in heart failure contributes to issues such as medical and food diet, limitation of intake of sodium and fluids, daily weighing, level of permitted activities, and a decision for appropriate therapeutic interventions when the disease gets worse . Various researches show that self - care behavior can significantly diminish the number of hospitalizations, mortality, and care cost burdens . In patients with heart failure, administration of self - care is difficult as a result of the complicated medical diet, the chronic nature of the disease, as well as the complications in various systems of the body which result in lower self - care . Therefore, provision of an efficient support for self - care is essential and important . Family as the most important source of social support is tightly related with self - care activities . Since most of the patients with heart failure live with other family members at their home, participation and support of family members can play a key role in self - care behaviors and efficiency of disease control . Therefore, family can influence a patient's success and stability of their behavior change in self - care programs . Several studies revealed the association between family support and heart failure patients self - care . Earlier studies showed that the patients with more support had better compliance of self - care health behaviors . Showed the self - care behaviors such as restricting fluid intake, regular medication, sports, and referring to physicians in case of observed overweight among the patients who had received more support . Sayers et al . Showed that the level of family support was directly associated with medical and food diets and other dimensions of self - care in heart failure patients . Meanwhile, most of the families, especially the caregivers, have low knowledge about the disease and its signs and treatment, and do not know what is beneficial for the patients or how they can support and encourage the patients to follow self - care behaviors . Nurses, with their unique position in family members, can play a key role in support, education, counseling, and taking care of heart failure patients and their caregivers . They can familiarize the family members, especially caregivers, with these behaviors, which act as a knowledgeable and capable source of family - focused nursing interventions to give a better support to these patients . Despite evidences proving the important role of family support in heart failure patients self - care, family - focused supportive interventions with goal of their clinical outcomes promotion have been less conducted among these patients . On the other hand, the researcher, despite searching thoroughly, did not find any studies on family - focused supportive care in heart failure patients in iran . Therefore, the present study aimed to define the effect of family supportive intervention on heart failure self - care behaviors . The present study was a pre- and post - test case and control clinical trial conducted in the selective university hospitals in isfahan, iran, in 2012 . It aimed to study the effect of family support intervention on self - care behavior in heart failure patients . Inclusion criteria were: confirmation of heart failure diagnosis by a cardiologist, being in grade ii, iii, or iv of heart failure based on american heart association classification, having history of at least one time hospitalization due to cardiac failure, at least 1 year of experience of heart failure, being over 21 years of age, complete consciousness, no history of myocardial infarction (mi) or heart surgery in the past 6 months, no history of other chronic or disabling diseases except cardiovascular risk factors (diabetes, hypertension, and hyperlipidemia), having a family, not living alone and the caregiver being from the family members, being over 18 years of age, and being literate . The sample size was calculated to be 36 heart failure patients in each group of study and control . A total of 62 patients with heart failure were initially selected by convenient sampling, and then randomly assigned to experimental and control groups equally . The data collection tool was a two - section questionnaire . The first section of the questionnaire contained demographic characteristics, the existing data in patients medical profile (ejection fraction, disease grade, and consumed drugs), as well as some information about patients caregiver (age, sex, relation to the patient, length of care, and education level). This questionnaire was designed by shoji fard et al ., and its face and content validity and reliability were confirmed by experts panel, and cronbach's alpha was 0.8 . In this tool, 15 self - care activities were listed and investigated using a likert's 5-point scale (from zero = never to 4 = always). Based on this scale, the obtained score can vary from 0 to 60 . Scores of 0 - 20 were assigned to poor, 21 - 40 to moderate, and 41 - 60 to good . After obtaining an informed written consent from the subjects and filling the self - care behaviors questionnaire, the subjects were assigned to study and control groups, and then family support intervention was conducted in the study group . As the subjects in the study group were from three medical centers, the patients caregivers in each center were considered as a control group and three sessions with 8 - 12 attendees were held for each group . These sessions were held weekly for 1 - 1.5 h in an appropriate classroom in the same medical educational center . In the first session, the caregivers were familiarized with the definition and heart failure disease process, its etiology and treatment, importance and manner of self - care behaviors, and related skills such as reading food labels and taking strategies to lower food salt intake . At the end of the first session, a booklet of heart failure self - care guidelines was distributed among the caregivers, not only to read but also to discuss the points with the other family members in order to be able to answer the questions related to the disease and administration of self - care indicated at the end of the booklet, with the cooperation of the patients . They were also asked to write down their possible questions and deliver them to the researcher in the following session . In the second session, patients and caregivers responses to the questions in the booklet were collected and their learning and practical administration of the learned issues were evaluated, and the required guides were given to the caregivers . Then, the importance and role of family in disease control and patients care was explained . The caregivers held group discussions about living with heart failure patients and the way of supporting them . In order to increase emotional and affective support toward these patients, efficient communication skills case scenario, role play of suggested strategies, and supportive discussion were adopted to empower and practice learned skills . At the end of the second session, the caregivers were given a booklet about the importance and manner of patients practical and emotional support, and they were asked to pass it among the other family members . In the third session, caregivers gave examples of the patient supportive strategies taken, and communication as well as prohibiting and facilitating factors they faced during the latest week . Then, some indications about the manner of self - care as well as other related points were explained to finalize the subject and get a conclusion during the sessions . At the end of the third session, a contact number was given to the caregivers in order to get answers for their disease - related and self - care - related questions . Phone call follow - ups were carried out for 2 weeks to guide the subjects and answer their questions . One month after the group sessions and 1 month after the introductory test in control group, self - care behavior questionnaire was again filled up for the subjects in both the groups . The data were analyzed by descriptive and analytical statistics through spss version 12 . In analytical statistical tests, p <0.05 was considered significant . In the present study, letter of introduction issued by isfahan nursing and midwifery school the subjects were also assured that their personal information would be kept confidential by the researcher, and the subjects were free to leave the research any time they wanted to . In the present study, 81 heart failure patients entered and filled the initial questionnaire . Before the subjects random allocation, nine subjects were excluded from the study (three patients died and six were not interested to attend). During the study, four subjects dropped out of control group (two died and two were not available). In the study group, four subjects dropped out (two did not participate in all stages of the research and two died). Research findings showed that the subjects were identical in both groups concerning age; sex; marital status; education level; grade of disease; hospitalization history; sex, age, and education level of caregivers; relationship of the caregiver with the patient; and length of care . Most of the subjects in both groups were males (54.6%), married (87.15%), illiterate (51.55%), and in grade iii of the disease (59.35%). Most of the caregivers were females (81.2%), had education level of high school and lower (81.2%), and were the children of the patients (46.9%). Demographic characteristics of the subjects in each group are presented and compared in table 1 . Demographic characteristics of patients and caregivers in table 2, it is observed that the highest mean scores of each self - care behavior before intervention in both the study and control groups were for not smoking, drug consumption based on doctor's prescription, time of preparation of the medications, regular visits to a physician, and avoiding canned foods, respectively . Meanwhile, the lowest self - care behavior mean scores were for visiting a physician due to an observed overweight, daily weighing, and fluid restriction compliance and intake of low - salt food . The comparison between each self - care behavior's mean score of the subjects in the intervention and control groups before and after the intervention in table 3, it is seen that there was no significant difference between self - care behavior mean scores in the two groups of study and control before intervention (p = 0.79), but there was a significant difference between self - care behavior mean scores in the two groups of study and control after intervention (p <0.001). The comparison between self - care behavior mean scores of the subjects in the intervention and control groups before and after the intervention the results of the present study show that administration of supportive intervention and promotion of family support led to promotion of self - care behavior in heart failure patients . The results show that subjects had a moderate level of self - care behavior before intervention . Shoja fard et al . And gallager et al . Reported subjects self - care behavior mean scores in the range of the present study, which is consistent with our findings . The results obtained show that not smoking, taking the medications based on physician's prescription, preparation of the medications in time, regular visits to physicians, and avoiding canned foods were among the self - care behaviors, and were in a moderate level . Meanwhile, subjects function in the other behaviors such as daily weighing, intake of less salt, referring to a physician when observing the signs, and fluid restriction compliance were found to be poor . Also reported that medication intake based on physician's prescription was the most frequent self - care behavior practiced by the subjects, while daily weighing was the least . In sayers et al . Reported that lack of daily weighing in heart failure patients was as a result of the following factors: either the subjects did not find it helpful or they did not have an appropriate tool for weighing or they could not interpret the results . In the present study, the subjects mentioned being illiterate, not having scales available for daily weighing, and consideration of low importance as the reasons for lack of daily weighing . The results of the present study showed that self - care behaviors in heart failure patients were promoted after supportive intervention and promotion of family support toward the patients . Showed that supportive intervention and conducting group sessions with heart failure patients caregivers and counseling regarding the manner of positive and supportive communication of the family with the patients led to better compliance concerning following a low - salt diet . Piette et al . Showed that supportive strategies promoted self - care behaviors in the subjects . The results of other researches also showed an association between social support from family side and self - care, as well as a positive association between family support and self - care, which is consistent with the present study . Argue that this finding may be due to the long time of follow - up and the inadequate interventions administered, and recommend further studies in this regard . In the present study, the process of skills administration and use of supportive strategies was followed up, evaluated, and checked through phone calls and filling checklists in sessions intervals . On other hand, lofvemark et al . Showed that administration of a mere educational program for heart failure patients concerning care does not affect their level of re - hospitalization despite promotion of their caring knowledge . Lack of an educational effect on clinical outcomes and self - care behaviors in the aforementioned study can show that knowledge alone is not adequate for a behavior change and promotion of self - care . In addition, clark et al . Reported a poor relationship between heart failure knowledge and self - care . In the present study, the goal was not just promotion of caregivers knowledge, but their familiarization with strategies and supportive communication in the direction of patients emotional support promotion . The researchers believe the observed patients self - care promotion may be as a result of caregivers participation in efficient communication skills education sessions, accompanied with the patients, and application of supportive communication and strategies by them leading to promotion of patients motivation toward conducting self - care . In the present study, the highest promotion of self - care behavior was observed after administration of family supportive intervention in dimensions such as compliance to a low salt - diet, fluid restriction, and referring to a physician after observing the signs of disease . Heart failure patient's family plays a vital role in the control of signs and symptoms, and can help the patients to diagnose the symptoms of the disease getting worse earlier, encourage their compliance to a medical food diet, and support them through changes in their lifestyle . Showed that the patients who received more support by their spouses had better compliance to fluid restriction and referring to a physician . Dunbar et al . Also observed a significant reduction in daily sodium intake after family supportive interventions . One of the most important challenges in heart failure patients self - care is compliance to a low - salt diet . Since the self - care concerning compliance to a diet often occurs at home, family members can play a specific role in compliance to diet restrictions . Therefore, making the family members familiar with the need for compliance to this behavior and patients encouragement to do it is of great importance . The findings of the present study reveal the major and important role of family members support in self - care among congestive heart failure patients . Nurses, as the professionals in the field of health and with regard to their important role in support, education, and care of these patients and their caregivers, can support, educate, and guide these patients through family members education and designing appropriate care programs in order to take steps toward promotion of self - care . Designing, administration, and application of these supportive educational programs by family's participation can reveal the role of nurses in promotion of patients and community health behavior and self - care . Based on the findings of the present study, it is suggested to design and conduct more family - focused interventions and studies for promotion of self - care in other chronic diseases.
Vaccinations are an effective prevention tool for maintaining the health of the individual and society as a whole and have significantly increased life expectancy and quality [1, 2]. Smallpox was officially declared eradicated by the world health organization (who) in 1980, all industrialized countries are considered " poliofree ", while other important infectious diseases such as diphtheria, tetanus and hepatitis b reached a significant reduction [3 - 5], with important benefits for childhood, by the planning of vaccination campaigns and development of national pediatric immunization schedules in many european countries [6, 7]. Strategies adopted by european union countries to achieve and maintain high immunization rates in target population include compulsory and recommended vaccinations, free of charge and co - payment offer . Some countries have preferred mandatory vaccinations such as france, greece, portugal and italy (for some pediatric vaccines); others, such as the united kingdom, voluntary decision supported by appropriate service offer, incentive for caregivers and health education . Others, like usa, canada and germany, opted for a middle way (no sanctions for non - vaccination, but need for a certificate of admission to school) [8 - 10]. According to latest edition of national immunization schedule, italian children are mandatory vaccinated against polio, diphtheria, tetanus and hepatitis b, while vaccinations against pertussis, measles, mumps, rubella, pneumococcus, meningococcus and invasive forms of h. influenzae type b are recommended . This difference is merely theoretical since no coercion is actually performed for parents who express their dissent to compulsory vaccinations . Accomplishment of mandatory vaccinations and successful extensive immunization programs permitted prevention of many infectious diseases which resulted in lower concern about them while, nowadays, worsening attention to side effects and availability of new vaccines has progressively increased burden of commitment within vaccination policy . Current scenario is also complicated by strongly varied regional framework in immunization schedules (determined by modification of title v of constitution), by inadequate information on low risk in terms of safety and significant benefits concerning protection that facilitate activity of antivaccinal groups . All italian national vaccine plans (nvp), from 2005 to present, notice the opportunity to begin a cultural and social awareness growth to overcome difference between compulsory and recommended vaccinations, inviting to same active offer for both vaccine groups, in favor of a modern approach, based on health education, health promotion and patient self - determination . Regions which possess following characteristics are encouraged to move towards abolition of mandatory vaccinations: an effective information system with well organized vaccines register; adequate immunization coverage; a sensitive and specific surveillance system of communicable diseases, are able to mix corporate / regional data flows; a good system of monitoring vaccine adverse events, are able to ensure appropriate follow up of cases . Piedmont, for example, introduced in 2006 a method of simplification of immunization offer, defining priority vaccines (proposed free and in active manner) and all other vaccines (available in health care organizations at cost) obtaining very satisfactory results in terms of agreement . Tuscany, instead, eliminated distinction between mandatory and recommended vaccinations in 2007 and 2010 through tuscan vaccine schedules [13, 14]. Only recently autonomous province of trento started a step - by - step overcoming of compulsory vaccination in children, depending on achievement of provincial immunization coverage percentage not less than that expected by the nvp and in absence of conflicting epidemiological evaluations . With regional law 7/2007 " suspension of mandatory vaccination for children and adolescents ", veneto region has suspended obligation of compulsory immunizations for all infants born from 1 january 2008, confirming that they still are included in essential level of assistance and therefore free and actively offered by the local health units (ulss) and part of immunization schedule, periodically reviewed and approved by the regional council in accordance with nvp guidelines . A monitoring plan of vaccination system, shared with ministry of health and superior institute of health, must ensure vaccination coverage achieves at least 95% of newborns, otherwise obligation suspension is stopped . President of regional council may also come back to previous system, if significant epidemiological events occur or if the content of the document drafted by the technical scientific committee, expressly created, signals an alarm situation with regard to immunization coverage rates . This paper aims to analyze whether innovations introduced by veneto regional law 7/2007 have modified immunization coverage rates and parents participation in vaccination acceptance . Levels of vaccination coverage achieved in local health unit of rovigo (ulss18) at 24 months in children born in 2002 - 2008 regarding immunizations for which obligation is suspended (including an estimate of non - vaccination against polio percentage and reasons for non - vaccination) and immunization rates for some recommended vaccinations (pertussis, h. influenzae b, measles, mumps and rubella) are considered . For birth cohorts 2006 - 2011, we assessed percentage of children who have received, within the first year of life, full or partial cycle of vaccination against diphtheria, tetanus, pertussis, hepatitis b to detect possible differences between before and after the appliance of regional law 7/2007 . Similarly we considered noncompulsory vaccinations against pneumococcus (partial and complete cycle), meningococcal c, measlesmumps- rubella (mmr) and chickenpox (one dose) to examine whether high levels of adhesion to recommended vaccinations were confirmed even after suspension of compulsory vaccination . Records were obtained from two regional forms adopted for monitoring vaccination activities: model 19 for coverage rates and enclosure c for immunization acceptance . In both cases adjusted rates were calculated by dividing number of administered doses by number of children born in investigated cohort excluding unreachable (e.g. Domiciled abroad and untraceable). Data on immunization coverage were collected from annual survey form (so called model 19) that each ulss annually transmit to veneto region in order to assess coverage rates . Years from 2004 to 2010 were considered, therefore, vaccination coverage refers to birth cohorts 2002 - 2008 (2008 birth cohort is the first affected by the suspension of immunization compulsoriness). According to regional directives, we examined immunization coverage at 24 months as the number of completed vaccinations in children born two years before the year of reference . Coverage rates at 24 months were assessed as well as for previously mandatory vaccines (polio, diphtheria, tetanus and hepatitis b) as for those against pertussis, h. influenzae b (hib), measles, rubella and mumps . Trends in immunization offer acceptance were calculated from regional form, called enclosure c, that each ulss send to department prevention services - promotion and development of hygiene and public health of veneto region twice a year (march 31 and september 30) in order to strictly monitor vaccination compliance . Number of doses administered to newborns divided in cohorts, according to three previous semesters are recorded, e.g. The detection of 30 september 2011 considered separately children born in the first half of 2010, those born in the second half of 2010 and those born in the first half of 2011 in order to assess vaccines received within 6, 12 and 18 months from birth respectively . Presented data relate to three doses of hexavalent and anti - pneumococcal vaccines and first dose of measles, chickenpox, rubella, mumps and meningococcal c vaccines in the period september 2007- september 2011 . Data on immunization coverage were collected from annual survey form (so called model 19) that each ulss annually transmit to veneto region in order to assess coverage rates . Years from 2004 to 2010 were considered, therefore, vaccination coverage refers to birth cohorts 2002 - 2008 (2008 birth cohort is the first affected by the suspension of immunization compulsoriness). According to regional directives, we examined immunization coverage at 24 months as the number of completed vaccinations in children born two years before the year of reference . Coverage rates at 24 months were assessed as well as for previously mandatory vaccines (polio, diphtheria, tetanus and hepatitis b) as for those against pertussis, h. influenzae b (hib), measles, rubella and mumps . Trends in immunization offer acceptance were calculated from regional form, called enclosure c, that each ulss send to department prevention services - promotion and development of hygiene and public health of veneto region twice a year (march 31 and september 30) in order to strictly monitor vaccination compliance . Number of doses administered to newborns divided in cohorts, according to three previous semesters are recorded, e.g. The detection of 30 september 2011 considered separately children born in the first half of 2010, those born in the second half of 2010 and those born in the first half of 2011 in order to assess vaccines received within 6, 12 and 18 months from birth respectively . Presented data relate to three doses of hexavalent and anti - pneumococcal vaccines and first dose of measles, chickenpox, rubella, mumps and meningococcal c vaccines in the period september 2007- september 2011 . Coverage percentages at 24 months for the vaccines for which suspension of compulsory immunization was introduced are shown in figure 1 . For each vaccination and for each birth cohort considered, 95% coverage, set by region as goal, was always exceeded . For birth cohort 2008 percentage of vaccinated children, that under mandatory tended to decrease, showed an increase compared to previous birth cohort, reaching 98.5% for polio and hepatitis b and 99% for diphtheria - tetanus . Rovigo ulss18 coverage rate at 24 months for formerly mandatory vaccinations (birth cohorts 2002 - 2008). The percentage of children vaccinated against pertussis and hib at 24 months after birth was always fully satisfactory and, in the first cohort affected by the suspension of obligation, amounted to 96.7% . Measles, mumps and rubella vaccinations, that in cohort 2002 recorded a coverage of 96%, has shown, over the years, a marked reduction, however, in recent years percentage of vaccinated children has increased to 94.9% for measles and 94.5% for mumps and rubella . Rovigo ulss18 coverage rate at 24 months for formerly recommended vaccinations (birth cohorts 2002 - 2008). The motivations of non - vaccination against polio at 24 months after birth are indicated in figure 3 . The leading cause was the inability to contact parents and deliver invitation to vaccination because they moved abroad, do not have a fixed address or are untraceable . Percentage of children at 24 months not vaccinated against polio according to motivation that led to non - vaccination (birth cohorts 2002 - 2008). Since 2007, standard definitions to define several types of vaccination postponement have been broadened considering also vaccination delay . Proportion of children actually defaulting vaccination (having expressed an informed dissent) was a minority, but the percentage showed an increasing trend from 0.2% in 2002 cohort to 0.9% in 2008 cohort . Data collected every six months, before and after suspension of compulsory vaccination, are reported in table i. the monitoring do not have the purpose of determine vaccine coverage, that can be estimated on consolidated data at 24 months of life, but to evaluate performance of immunization activities on cohorts of newborns to make a comparison over time and between ulss (benchmarking), therefore it should not concern the detection of percentages slightly lower than 95% even for previously mandatory vaccinations . Proportion of children receiving hexavalent vaccine has always been elevated and a steady increase, more pronounced for the third dose, has been recorded . In all measurements, the percentage of vaccinated children has reached levels ranging from acceptable (90 - 94%) and desirable (95%). Vaccination against pneumococcal presented a comparable situation, with a more marked rise for third dose passing from 33% in september 2007 to 64% in september 2011 . Percentage of children vaccinated against meningococcal (offered from the thirteenth month) was stable around 90% . Measles - mumps - rubella and chickenpox vaccinations starting from very lower rates of acceptance (respectively 72.3 and 67.3%) showed an increase, reaching levels fairly above 80%, always remaining within a not satisfactory range . Hexavalent vaccine contains poliomyelitis, diphtheria, tetanus, pertussis, hepatitis b, h. influenzae b vaccines . Regional autonomy has allowed, in healthcare sector, the undertaking of an important initiative of public health such as that started by veneto region with the promulgation of regional law 7/2007 that, overcoming the dichotomy between mandatory and recommended vaccinations, meets the growing demand of citizens for self - determination in choices regarding their health by introducing a legislative action with a european outlook . The debate on recommended or mandatory vaccinations has also collected conflicting opinions because it raises several ethical issues . The possibility for regions to independently determine vaccination schedule and introduce new vaccines and methods of promotion has created a national framework strongly non homogeneous which could have a negative impact on immunization programs and, apparently, does not ensure equal access to immunization . Furthermore, at first sight, the comparison between countries that only recommend certain vaccinations and countries that force them does not seem to show remarkable differences [17, 18]. The experience of rovigo ulss18 showed that, in a context of already high levels of coverage for recommended vaccinations, rates for ex - mandatory immunizations remain unchanged . Results obtained in the 2008 birth cohort, the first involved in the suspension of the obligation, showed that no loss of coverage occurred for previously mandatory vaccines, in fact coverage rates moved from values ranging from 95 - 97% in previous birth cohorts to 98.5 for poliomyelitis and hepatitis b and to 99 for diphtheria and tetanus in 2008 birth cohort . Obviously available data on a single birth cohort are too limited to express a judgment of full validity of the regional law, therefore it will be necessary to continue to monitor levels of vaccination coverage and offer compliance in order to highlight situations of deviation from expected value before warning situation occurs . Opponents of this law consider that liberalization in the field of immunization poses a threat to consolidated practices of public health with the risk of decreasing vaccine coverage and increase the number of cases of infectious diseases easily preventable . However, first monitoring data are fully encouraging and demonstrate that there were no changes with regard to coverage, while acceptance of immunization offer remained constant for ex - mandatory and was even growing for exrecommended vaccinations . In that regard, it should be noted that the legislative measure adopted by veneto provides for a constant monitoring of vaccination coverage and compliance to invitation, a rigorous epidemiological surveillance of infectious diseases for which the requirement of vaccination is suspended, and immediate suspension of the regional law 7/2007 when coverage levels fall below the established threshold or in case of significant epidemiological events related to the disease for which the vaccination requirement is suspended . The developed delivery system of vaccinations appears able to allow the suspension of mandatory vaccinations without risk to coverage, continuing to ensure a strong adhesion to all available vaccinations, as it is characterized by some essential elements: a strong degree of integration of vaccination services with pediatricians and family physicians; active and free offer of all vaccinations recognized as safe and effective; computerized immunization database that allows rapid recovery of non - adhesion to first call; the remarkable cultural maturity reached by population that is constantly affected by actions of counseling and health education . These observations support the conclusion that similar legislative measures can be adopted with comparable success, as advocated by nvp 2012 - 14, also in other italian regions, provided that they possess specific starting conditions: high levels of immunization coverage, ability to ensure an effective vaccination offer system, continuous monitoring of membership, a rapid recovery of any non - compliance based on dialogue and information . The introduction of compulsory vaccination suspension law in veneto region has allowed experiencing a public health setting established on self - guided individual choice in making decisions regarding health, creating a modern and efficient vaccine service . Further research and reports are required to careful value whether the choice between compulsory and voluntary vaccination takes effect on coverage rates . In conclusion a healthcare system should promote and actively offer all vaccinations approved as safe, effective and with a positive public health impact . However decision about proposal for vaccine strategies should be elaborated in agreement with organizational features of vaccination services combined with traditional and cultural habits . Trust on health authorities will lead to more compliance with recommendations producing not only benefits for health of citizen but also enhancing their awareness on this issue and support the overall effectiveness of vaccination programs through the herd immunity effect.
One of the leading causes of death are non - communicable diseases (ncds), killing more people each year than all other causes combined . It has been reported that nearly 80% of ncd deaths occur in low- and middle- income countries . It has been estimated that about one fourth of global ncd - related deaths take place before the age of 60(1 - 4). It has been indicated that the prevalence of non - communicable diseases such as hypertension and diabetes including obesity has increased over the past few years in iran(1, 4). The prevalence of hypertension, diabetes, obesity and overweight in big cities in iran was 14%, 13%, 27% and 20% respectively(1). Hypertension is a risk factor for life threatening diseases such as cerebrovascular accidents (cva), coronary artery diseases (cvd), congestive heart failure (chf) and chronic renal failure (crf) (3 - 13). Based on national health and nutrition examination survey (nhanes) database in united states, the prevalence of hypertension was 24.5% and 28.4% in 1988 - 1994 and 1999 - 2000 respectively (11, 12). The prevalence of hypertension in the capital city of big provinces of iran was 11%. (1) also, in zabol city in south east of iran, the prevalence of hypertension was 13.9% among adults (4). In semnan province, the prevalence of hypertension was 24.1% and 24.8% in urban and rural area respectively. (5) in tehran, the prevalence of hypertension among taxi drivers was 35.4% (7). Based on phase 1 of isfahan healthy heart study, the prevalence of hypertension in female and male were 15.6% and 18.8% respectively . The prevalence of hypertension was higher in women than in men, except in under 25-year age group . Overall 26.7% of hypertensive male and 47.7% of hypertensive female were on anti - hypertensive pharmacological treatment among which bp was under control in 6.4% of the male and 13.8% of the female (8). Ncd risk factors can be categorized as " modifiable " and " non - modifiable " . Modifiable parameters include factors that can be altered such as individual and community influences, living and working conditions and socio - cultural factors . Non - modifiable parameters include those factors that are beyond the control of the individual, such as age, sex and genetic factors (1, 4). Diabetes mellitus, cardiovascular diseases, cancer, and chronic obstructive pulmonary diseases are linked by common preventable risk factors related to lifestyle (unhealthy diet, physical inactivity, obesity and overweight, and tobacco use) (1). Also, four behavioral risk factors that are pervasive aspects of economic transition, rapid urbanization and 21st - century lifestyles are tobacco use, unhealthy diet, insufficient physical activity and the harmful use of alcohol . These risk factors affect low- and middle- income countries, and on poorer people within all countries, mirroring the underlying socioeconomic determinants . There is a fact that poverty exposes people to behavioral risk factors for ncds and, in turn, the resulting ncds may become an important driver to the downward spiral that leads families towards poverty (1). It has been shown that a major reduction in the burden of ncds will come from population - wide interventions, which are cost effective and may even be revenue - generating . However, it has been reported effective interventions, such as tobacco control measures and salt reduction, are not implemented on a wide scale because of inadequate political commitment, insufficient engagement of non - health sectors, lack of resources, vested interests of critical constituencies, and limited engagement of key stakeholders (1). According to global status report on non - communicable diseases 2010 smoking is estimated to cause about 71% of lung cancer, 42% of chronic respiratory disease and nearly 10% of cardiovascular disease . It has been demonstrated that adequate consumption of fruit and vegetables reduces the risk for cardiovascular diseases, stomach cancer and colorectal cancer . Moreover, most populations consume much higher levels of salt than recommended by world health organization (who) for disease prevention; high salt consumption is an important determinant of high blood pressure and cardiovascular risk . High consumption of saturated fats and trans - fatty acids is linked to heart disease . In addition, it has been indicated that raised blood pressure is estimated to cause 7.5 million deaths, about 12.8% of all deaths . The prevalence of raised blood pressure is similar across all income groups, though it is generally lowest in high - income populations (1). It has been illustrated that at least 2.8 million people die each year as a result of being overweight or obese . Also, it is estimated that raised blood pressure cause about 7.5 million deaths, about 12.8% of all deaths. (2, 6) risks of heart disease, strokes and diabetes increase steadily with increasing body mass index (bmi). Prevalence of overweight is over 50% in the who european region, the eastern mediterranean region and the region of the americas (1). Physical inactivity is a risk factor of ncds that causes 3.2 million people die each year . It has been reported that people who are insufficiently physically active have a 20% to 30% increased risk of all - cause mortality . Moreover, regular physical activity reduces the risk of cardiovascular disease including high blood pressure and diabetes (1). According to the alma ata declaration, it is obvious that in effective management of diseases, three aspects should be considered . The second aspect was preventive intervention which includes personal and behavioral actions and education to encourage behavioral modification . The third aspect was curative and rehabilitative intervention that includes services focusing on individuals who are already diagnosed, to prevent complications (1). The first step of planning and policy making for intervention and modification of cardiovascular diseases in a defined population is to assess the prevalence of their risk factors . Therefore, this study performed to assess personnel blood pressure and its risk factors in one of the medical universities of tehran in te health day of 2013 . This cross - sectional study was performed from may 19, 2013 to may 24, 2013 (i.r . Of iran s health weak) in one of the medical universities of tehran . Participants were personnel of the university that completed a researcher - made questionnaire voluntarily; the questionnaire composed of demographic variables such as sex, age and variables about risk factors and preventive factors of cardiovascular diseases such as smoking, history of diabetes, history of hypertension, physical exercise status and so on . Systolic and diastolic pressures were measured after the participants had rested in a quiet area for 5 minutes . Participants were advised to avoid exercise for at least 30 minutes before their blood pressure measurement . The korotkoff phase i (appearance) and phase v (disappearance) were recorded for the systolic blood pressure (sbp) and diastolic blood pressure (dbp) respectively (least of 3 readings taken on 1 occasion). One - sample kolmogorov - smirnov test used to check normal distribution of quantitative variables . Binary logistic regression used to analyze relationship between hypertension status and its risk factors . One - sample kolmogorov - smirnov test used to check normal distribution of quantitative variables . Binary logistic regression used to analyze relationship between hypertension status and its risk factors . Of 195 persons participated in this study, 180 persons (92.3%) were male . Table 1 shows age, duration of employment, weight, height, body mass index (bmi) and systolic and blood pressure . Only 8 persons (5.6%) were cigarette smokers and 26 persons (14.9%) were hookah smokers . Table 3 shows the history of some diseases in participants and first - degree relatives . Among hypertensive cases (18 persons), most of the patients (87.0%) used 1 - 2 cups of tea per day . Among participants, only 29 persons (15.8%) attended healthy life style classes . Of participants, only 75 persons (40.5%) had normal bmi (table 4). Figure 1 shows classification of blood pressure based on the seventh report of the joint national committee on prevention, detection, evaluation, and treatment of high blood pressure (jnc 7 category) (14). Hypertension status based on jnc7 table 5 shows relationship between demographic and other factors among normal, pre - hypertensive and hypertensive groups based on jnc7 categories . According to binary logistic regression analysis, (enter model), there was a significant relationship between pre - hypertension or hypertension status with first relatives cardiovascular history (p= 0.029). However, forward conditional model showed no significant relationship between pre - hypertension or hypertension status and its risk factors . The result of our study showed that only 40.5% of samples had a normal bmi . Although overweight and obesity are risk factors of hypertension, diabetes and other ncd, it could be modified by life style intervention such as physical activity promotion . Yarahmadi and his colleagues study showed that the prevalence of overweight and obesity was 27.0% and 20.0% respectively (1). Based on global status report on non - communicable diseases 2010, the age - adjusted prevalence of overweight in bahrain and egypt was 70.3% and 69.8% respectively . In addition, the age - adjusted prevalence of obesity in bahrain and egypt was 32.6% and 34.6% respectively (2). Godarzi and his colleagues study showed that the prevalence of obesity in male and female was 64% and 70% in male and female respectively (4). Demirchi and mehrabani s study showed that the prevalence of overweight and obesity was 26.6% and 40.6% respectively (7). Sadeqi and her colleagues study showed that the prevalence of bmi> 25 in male and female was 41.9% and 59.0% respectively. (8) ahmadi and his colleagues study showed that the prevalence of obesity in hypertensive and control group was 21.7% and 14.2% respectively (10). Ong and his / her colleagues study showed that the mean of bmi (se) was 27.81 (0.22), 27.87 (0.16) and 27.99 (0.13) in 1999 - 2000, 2001 - 2002 and 2003 - 2004 respectively based on nhnes database (11). In 2001, the prevalence of obesity (bmi>= 30) was 20.9% versus 19.8% in 2000 . Saeedi study showed that the prevalence of obesity was 56.5% and 25.0% in diabetic female and male respectively (16). Mcniece and his / her colleagues' study showed that the prevalence of overweight was 18.1% in adolescent (17). Tazi and his colleagues' study indicated that the prevalence of obesity in non - hypertensive and hypertensive adult was 11.1% and 23.6% respectively . Also, the prevalence of overweight in non - hypertensive and hypertensive adult was 24.7% and 32.8% respectively (18). Fukuda and his / her colleagues' study showed that the mean bmi (sd) of male and female employees was 22.6 (2.4) and 21.2 (2.9) respectively (19). Based on a report from a community - based cohort study in taiwan, mean bmi in normotensive, pre - hypertensive, stage 1 hypertensive and stage 2 hypertensive group were 22, 23.2, 24 and 24.3 respectively. (20) (20) steyn and his / her colleagues' study showed that the prevalence of obesity in male and female adult was 11.1% and 23.6% respectively (21). Singh and his / her colleagues' study indicated that the prevalence of overweight and obesity (bmi>23 kg / m2) in normotensive, pre - hypertensive and hypertensive female and male was 14.3%, 82.3%, 83.2%, 16.4%, 70.7% and 71.3% respectively. (22) ishikawa and his / her colleagues' study showed that the mean bmi (sd) of normotensive, prehypertensive and hypertensive male and female was 22.0 (2.5), 23.0 (2.8), 23.8 (3.0), 22.1 (2.7), 23.3 (3.1) and 24.3 (3.4) respectively (23). Egan and his / her colleagues' study showed that the prevalence of obesity was 21.8%, 29.5%, 29.6%, 31.4%, 33.4% and 33.2% in 1988 - 1994, 1999 - 2000, 2001 - 2002, 2003 - 2004, 2005 - 2006 and 2007 - 2008 based on nhnes database respectively (24). A prevalence study in iranian military personnel showed that about 20% of participants were overweight (25). Our results showed that the prevalence of norm tension, prehypertension and hypertension was 47.9%, 40.4% and 11.7% respectively . Also, there was a significant difference between cardiovascular diseases and diabetes history and hypertension status based on jnc7 categories . Yarahmadi and his colleagues study showed that the prevalence of hypertension was 14.0% in the capital city of 6 big provinces of iran (1). Based on global status report on non - communicable diseases 2010, the age - adjusted prevalence of hypertension in bahrain and egypt was 43.7% and 38.1% respectively (2). Godarzi and his colleagues study showed that the prevalence of hypertension was 13.9% among zabol city adults (4). Another study showed that the prevalence of hypertension was 24.1% and 24.8% in urban and rural area respectively (5). A study on taxi drivers blood pressure showed that the prevalence of hypertension was 35.4% . This study concluded that hypertension prevalence are correlated positively with age increase, physical activity decrease, cardiovascular diseases history, obesity, low level of education, income increase and family member increase (7). Sadeqi and her colleagues showed that the prevalence of hypertension was 15.6% and 18.8% in male and female respectively . Moreover, the prevalence of hypertension was higher in female than in men, except in under 25-year age group (8). Gu and his colleagues indicated that the prevalence of hypertension was 27.2% in chinese adult population (13). In addition, tazi and his colleagues study showed that the prevalence of hypertension was 37.2% and 41.3% in male and female respectively . Also, the prevalence of hypertension was 30.6%, 46.5% and 58.1 in normal, overweight and obese samples respectively . (18) singh and his / her colleagues study indicated that the prevalence of female and male prehypertension and hypertension in five indian cities was 27.2%, 27.2%, 30.0 and 30.6% respectively (22). Ishikawa and his / her colleagues study showed that the prevalence of the prevalence of normotension, prehypertension and hypertension was 32.7%, 33.0% (34.8% in males and 31.8% in females), 34.3% (36.8% in males and 32.7% in females) respectively (23). A prevalence study in iranian military personnel showed that 58% and 49.4% of participants had systolic and diastolic pre hypertension respectively . Additionally, the prevalence of systolic and diastolic hypertension was 9.4% and 22.2% respectively (25). Based on mustafavi and zare study the prevalence of hypertension was 66.4% and 10.1% in elderly and young population respectively (26). Angell et al showed that the prevalence of hypertension among nyc adults was 25.6% (95% ci 23.4% to 27.8%) and was similar for men and women (men: 25.5 (22.528.7), female: 26.0 (23.528.8)) (27). Kearney and his / her colleagues study indicated that 26.4% of the adult population in 2000 had hypertension (26.6% of men and 26.1% of women), and 29.2% were projected to have this condition by 2025 (29.0% of men and 29.5% of women) (28) based on nhanes database in united states, the prevalence of hypertension was 24.5% and 28.4% in 1988 - 1994 and 1999 - 2000 respectively. (11, 13, 24, 29, 30) also, the prevalence of hypertension was 26.0% and 29.3% in 2001 - 2002 and 2003 - 2004 respectively (11, 24, 29). Based on jaipur heart watch in india, the prevalence of hypertension in jhw - r, jhw-1, jhw-2, jhw-3 and jhw-4 studies in men was 21.6%, 29.1%, 29.6%, 42.5% and 45.1% and in women 15.7%, 21.7%, 25.5%, 35.2% and 38.2% respectively (31). A survey by wolf - maier and colleagues showed that the age- and sex - adjusted prevalence of hypertension was 28.0% in north american countries and 44.0% in the european countries based on jnc7 categories (32). Based on global status report on non - communicable diseases 2010, the age - adjusted prevalence of current daily cigarette smoking in bahrain and egypt was 14.3% and 16.5% respectively (2). Godarzi and his colleagues showed that the prevalence of tobacco and cigarette smoking in male and female was 36.0% and 15.0% respectively (4). Sadeqi and her colleagues study showed that the prevalence of current daily cigarette smoking in male and female was 29.0% and 1.6% respectively (8). Based on ahmadi and his colleagues study, the prevalence of current daily cigarette smoking in hypertensive and normal population was 9.4% and 14.2% respectively (10). Tazi and his colleagues showed that the prevalence of current smoking in non - hypertensive and hypertensive samples was 16.4% and 9.1% respectively (18). Based on a report from a community - based cohort study in taiwan, the prevalence of smoking in normal blood pressure, pre - hypertensive, stage 1 hypertensive and stage 2 hypertensive men was 72.1%, 69.9%, 70.1% and 75.4% respectively . These percentages in women were 5.3%, 3.8%, 7.0% and 6.5% respectively (20) based on singh and his colleagues study, the prevalence of tobacco use in normotension, prehypertension and hypertension group of men and women was 35.7%, 30.5%, 30.8%, 9.2%, 10.2% and 10.7% respectively (22). Based on the jichi medical school cohort study, the prevalence of current smoking in normotension, prehypertension and hypertension group was 57.2%, 51.1% and 44.4% respectively (23). Based on jaipur heart watch in india, the prevalence of smoking in jhw - r, jhw-1, jhw-2, jhw-3 and jhw-4 studies in men were 50.0%, 38.7%, 35.7%, 27.1% and 59.9% respectively (31). Despite the low prevalence of hypertension in our samples, the high prevalence of prehypertension and overweight needs great attention . Interventions like lifestyle education, life style modification such as increasing time of physical activity programs per week, dietary modification and low caloric diet and avoiding junk and fast foods could be effective.
Lysosomes are cellular organelles that play a pivotal role in the cell homeostasis through their involvement in degradation and recycling processes of extracellular material that has been internalized by endocytosis and intracellular components that have been sequestered by autophagy (1). Lysosomes may also fuse with the plasma membrane, emptying their contents outside the cell . This is important for processes such as cellular immune response and plasma membrane repair, both in normal and pathological conditions (2, 3). Mutations that cause lysosomal enzyme deficiencies result in different syndromes, known as lysosomal storage disorders (lsds) (4). In addition, they are characterized by intracellular deposition and protein aggregation, events also found in age - related neurodegenerative disorders, such as alzheimer s and parkinsons s diseases (57). These studies underline the importance of the lysosome as a central player in cell metabolism . Hence, the characterization of genes participating in lysosomal biogenesis and function is a critical step toward the understanding of basic processes in cell biology and pathogenic mechanisms in many human diseases . Recently, it was found that most lysosomal genes exhibit coordinated transcriptional behavior and are regulated by the transcription factor eb (tfeb), which also links autophagy to lysosome biogenesis (8, 9). Gene expression at the post - transcriptional level can be regulated by micrornas (mirnas). Mirnas play important roles in diverse biological processes, including development, cell differentiation, proliferation and apoptosis, in which the lysosomal system also plays an important role . Notably, mirnas have been recently identified as involved in the regulation of autophagy (10, 11). The human lysosome gene database (hlgdb) is the first searchable database focused on the census of genes belonging to the lysosomal system and on their regulation by mirnas . No database resources entirely dedicated to the regulation of lysosomal genes by mirnas or other regulators are currently available . Several lists of lysosomal genes were collected from public gene databases, published proteomics articles and reviews edited by biochemists and cell biologists working in the lysosome field . We paid special attention on balancing predictions, which were as follows: (i) more suitable to look for confirmatory evidence (targetscans) (15); (ii) more suitable to identify any possible target for a particular mirna, to form the basis for in vitro or in vivo experiments (pictar four - way and five - way) (16); (iii) more suitable to find in silico evidence for the interaction between a mirna and a gene of a certain family or function (pita, miranda) (17). To increase mirna - target mrna information, experimentally verified mirna targets from mirtarbase were also reported . Hlgdb aims to providing a useful resource to anyone studying the lysosomes and a tool for identifying common regulatory features of lysosomal genes . Hlgdb provides a user - friendly interface through which information can be easily retrieved, including the union and intersection of different gene lists, searches for mirna predictions and visualization on the gene transcript sequence of the mirna target predictions . The data reported in the current version 1.1, derived from ncbi pubmed searches for review articles regarding human (8, 1825) and murine (22, 2629) proteome of the lysosome and from lists of lysosomal genes present in the gene ontology (30), kegg (31), reactome (32) and uniprot databases (33) [uniprot: lysosome (kw-0458) and organism: homo sapiens (human) (9606); kegg: lysosome (ko04142); go: go:0005764 data stamp from the source 20120303]. The references listed within each review article (34, 35) were examined and lists of genes were extracted from either the full text or the supplementary information following a manual curation . There are 16 sources of information divided in four main categories: proteomic studies, databases, reviews and system biology approaches . Each gene has been associated to its official hgnc gene symbol (36) and to its entrez gene i d (mappings were based on data provided by entrez with a date stamp from the source of 7 march 2012). The gene transcripts associated to each gene are annotated accordingly to ncbi refseq or genbank (release 57). Mirna target predictions were extracted from the tables downloaded from the websites of the different algorithms used to predict the binding between mirna and gene transcripts . Coordinated lysosomal expression and regulation (clear) is a nucleotide motif (gtcacgtgac) found to be highly enriched in the promoter set of lysosomal genes (8). We mapped this motif on both strands on the human genome (hg19) by means of fuzznuc utility of the emboss package allowing one single mismatch (37). The binding sites of the tfeb come from a chip - seq experiment carried out on hela cell lines (38). Hlgdb is a mysql 5.0.95 database (constructed in the fourth normal form, some redundancy being kept to increase retrieval performance), and the interface is built in php . Search for gene lists: hlgdb can be used to retrieve and combine lists of lysosomal genes from different sources . The any and all options allow the user to either merge or intersect lists . Search for a gene using the gene symbol is also allowed (figure 1). Search for mirna targets: once the user has selected or created a gene list, he / she can find mirna (or families of mirna) targets choosing different combinations of prediction softwares . Results are returned in a table showing information about the gene (gene symbol and gene name) and the mirna (identifier and number of softwares predicting each binding). Gene symbols are hyperlinked to gene - centered page where additional gene information is provided (figure2a). On each gene transcript associated to the selected gene, search for tfeb binding sites / clear motifs: once the user has selected or created a list, he / she can choose the filter and find the lists of genes with tfeb binding sites or clear motifs within a range around the transcription start site (tss). Results are provided in the table showing gene - centered information, as the hit count and distance from tss of tfeb binding sites / clear motifs . All data in hlgdb are freely available for download as tab - delimited text files without password protection for any user . Concerning other organisms, currently the database provides a parallel orthology annotation for mouse: the user can select the species of interest using the upper right botton . It collects information about these genes and their transcriptional regulation such as tfeb binding sites and mirnas . Hlgdb was designed to become a lysosomal gene census . When new lysosomal genes will be discovered lysosomal genes include lysosomal hydrolases, lysosomal membrane proteins, lysosomal proteins involved in acidification and non - lysosomal proteins fundamental for this organelle biogenesis . In addition, there is increasing evidence that lysosome genes play a role in the pathogenesis of common neurodegenerative diseases such as alzheimer s, parkinson s and huntington s . Researchers may benefit from hlgdb because they have in a single reference to the broadest compendium of lysosomal gene lists . Results of mirna targets may be directly compared with other transcriptional regulation elements such as the distance from the tss of tfeb binding site or the distance to a clear sequence to identify common features of regulation . Hlgdb has been designed to integrate additional layers of biological information, such as experimental data and comparative genomics . Currently the database present information for human and mouse species; in the next versions, additional species, such as rat, will be integrated . Finally, hlgdb provides a powerful resource to system biology approaches and network analysis to dissect the map of interactions taking place in the lysosomal system.
A malignant peripheral nerve sheath tumor (mpnst) is a sarcoma that arises from peripheral nerves or cells of the associated nerve sheath (schwann cells, perineural cells, fibroblasts). The term " mpnst " has substituted previously used terms such as malignant schwannoma, neurofibrosarcoma, and neurogenic sarcoma1,2). The mpnsts comprise approximately 5% to 10% of all soft tissue tumors and have an incidence of 0.001% in the general population and the etiology is unknown . However, more than half of mpnst cases develop in patients with neurofibromatosis type-1 (nf-1) and there is a higher incidence in patients that have undergone prior radiotherapy1,2,5,8,13). Mpnsts are most likely to metastasize to the lungs, followed by the bone and finally the pleura, but, spinal cord and brain metastasis is very rare in non - nf-1 mpnst3,7). The authors report a very rare case of spinal cord and brain metastasis of mpnst in the lumbar spine that occurred in a 18-year - old man without nf . An 18-year - old man presented initially with a 6-month history of low back pain that worsened over time . One month prior to admission, the patient developed radiating pain to his anterior thigh . Neither caf au lait spots nor neurofibromas were seen and his family history was absent of nf-1 . The neurologic examination showed normal motor power in his lower extremities . Magnetic resonance imaging (mri) showed a paraspinal mass that extended from the central space of l2 to the right psoas muscle through right l2 - 3 foraminal space . It was an asymmetrical dumbbell shaped mass and the thecal sac was displaced left by the mass . The mass showed iso - signal intensity on t1-weighted images and mixed signal intensity on t2-weighted images . A paramedian incision was made from the l1 to l4 and we exposed the right l2 and l3 lamina with transverse process . Right l2 hemilaminectomy was performed using a high speed drill and kerrison rongeur to expose the thecal sac . The margin of mass was relatively distinct from neural tissue, thus gross total resection was possible under microscopic view . To remove the mass extended to the psoas muscle, the right transverse process of l2 and l3 was resected and the mass was visible . After the operation, his symptom had improved . However, a few days later, his confirmed pathologic report was presented as mpnst (fig . The contrast - enhanced mri was followed at 1 month after the operation and revealed a total removal of tumor (fig . However, the patient declined the external beam radiation due to the fear of potential radiation risk . Spine and brain mri showed that the tumor recurrence with leptomeningeal, multiple spinal cord and brain metastases (fig . 4). Complete surgical clearance of the tumor was not technically feasible, owing to the multiple metastases . Therefore, the patient was referred for adjuvant chemotherapy . In addition, intrathecal chemotherapy was performed . After 4 months of chemotherapy, he was referred to the hospice hospital and died within a month . An 18-year - old man presented initially with a 6-month history of low back pain that worsened over time . One month prior to admission, the patient developed radiating pain to his anterior thigh . Neither caf au lait spots nor neurofibromas were seen and his family history was absent of nf-1 . The neurologic examination showed normal motor power in his lower extremities . Magnetic resonance imaging (mri) showed a paraspinal mass that extended from the central space of l2 to the right psoas muscle through right l2 - 3 foraminal space . It was an asymmetrical dumbbell shaped mass and the thecal sac was displaced left by the mass . The mass showed iso - signal intensity on t1-weighted images and mixed signal intensity on t2-weighted images . A paramedian incision was made from the l1 to l4 and we exposed the right l2 and l3 lamina with transverse process . Right l2 hemilaminectomy was performed using a high speed drill and kerrison rongeur to expose the thecal sac . For removal of intradural portion the margin of mass was relatively distinct from neural tissue, thus gross total resection was possible under microscopic view . To remove the mass extended to the psoas muscle, the right transverse process of l2 and l3 was resected and the mass was visible . After the operation, his symptom had improved . However, a few days later, his confirmed pathologic report was presented as mpnst (fig . The contrast - enhanced mri was followed at 1 month after the operation and revealed a total removal of tumor (fig . However, the patient declined the external beam radiation due to the fear of potential radiation risk . Spine and brain mri showed that the tumor recurrence with leptomeningeal, multiple spinal cord and brain metastases (fig . 4). Complete surgical clearance of the tumor was not technically feasible, owing to the multiple metastases . In addition, intrathecal chemotherapy was performed . However, no significant effect was observed and the patient's condition deteriorated gradually . After 4 months of chemotherapy, he was referred to the hospice hospital and died within a month . Non - nf-1 mpnsts are very rare and the occurrence of mpnsts occurring in adolescents is very rare . Mpnsts generally occur in adulthood typically between the ages of 20 and 50 years of age . Approximately 10 - 20% of cases have been reported to occur in the first 2 decades of life, with occasional cases involving infants as young as 11 months of age5,6). Hruban et al . Described 43 patients with mpnst and of these patients, 28 (65%) had distant metastasis3). Sites of metastasis included the lungs (22 cases), bone (9 cases), pleura (6 cases), retroperitoneum (4 cases), diaphragm (3 cases), inguinal lymph nodes (2 cases), liver (2 cases), chest wall (2 cases), soft tissue (2 cases), pulmonary hilum, pericardium, thyroid gland, and adrenal gland (1 case each). Described 11 distant metastasises in 54 patients with mpnst that included metastases to lymph nodes, pleura, lung, liver, adrenal gland, leptomeninges and brain7). William et al.4) reported a non - nf-1 mpnst case of metastasis to the spinal cord4). Our case showed that leptomeningeal, spinal cord and brain metastasis of non - nf-1 mpnst for relatively short period after tumor removal in young male patient, reflecting aggressive nature of this malignancy . The outcome with respect to both local recurrence and distant metastasis largely depends on grade of surgical excision . Radiation therapy combined with wide surgical excision offers statistical significant reduction in the rates of local disease recurrence . However, it has not had a meaningful reduction in either rate of distant metastasis or overall survival15). Benefit of chemotherapy is unproven and its application is limited to high grade metastatic disease3). The italian and german soft tissue sarcoma cooperative group reported an overall pediatric response rate of 45%, with the highest response noted within the ifosfamide group9,11,12). The recurrence rate for mpnsts has been reported to range from 40 - 68%7,10,14). The 5-year survival rate has been reported at 16 - 52% and a favorable prognosis has been related with complete surgical excision of the tumors that are sized less than 5 cm7,10). Historically, mpnsts have been difficult tumors to treat due to their inherently aggressive nature and dismal prognosis . Our patient underwent complete surgical excision, but the patient was not treated with radiotherapy . Follow - up images revealed multiple spinal cord and brain metastases . The patient was managed with chemotherapy, but expired several months later . Despite complete surgical excision, we reported a case of mpnst that had metastasized to the brain and spinal cord . Because the mpnst showed both rapid and aggressive progression, patients should be followed carefully to identify local recurrence or metastasis and be mandatory an adjuvant radiotherapy.
Osteoid osteoma is a benign bone tumor consisting of an osteoid nidus in a highly vascular connective tissue stroma . These tumors are exquisitely painful, and demonstrate characteristic findings on clinical and radiographic examinations . The major drawback of this traditional approach is prolonged surgery and hospital stay, weakening of the bone requiring a prophylactic fixation, and its subsequent removal and additional time off school due to open surgery . To overcome this drawback, different minimally invasive techniques have been described as alternative therapeutic options (radiofrequency ablation, laser photocoagulation, and percutaneous resection). Computed tomography (ct) guidance has become a very useful and easy method for the percutaneous treatment of these lesions . We started using ct guided radiofrequency ablation for osteiod osteoma 5 years ago and immediately noted many beneficial effects in terms of duration of hospital stay, morbidity, and overall patient comfort prompting us to do this study . We report our experience with ct - guided percutaneous radiofrequency ablation (rfa) of osteoid osteoma in common and technically challenging locations in 30 pediatric patients and evaluate technical and clinical results . This is a retrospective observational study of 30 pediatric and adolescent patients who underwent ct - guided percutaneous rfa of osteoid osteoma between june 2009 to may 2014 . All patients reported severe pain that usually increased at night and required nonsterioidal anti - inflammatory drugs for pain relief . The osteoid osteoma was diagnosed from clinical and imaging findings (radiography, ct, and/or magnetic resonance imaging (mri) scan), demonstrating a nidus and other findings that are typical of osteoid osteoma . Patients and their legal guardians were fully informed of the procedure as well as of the surgical and medical alternatives, and informed consent was obtained . All procedures were performed under general anesthesia in the ct room on six slice ct scanner (philips brilliance, massachusetts, usa). A guidewire (k - wire) was drilled into the center of the nidus using either a hand drill (aesculap inc . B braun, center valley, pa) or a battery operated drill (stryker corp ., kalamazoo, mi) with a cannulated drill bit (2.54.5 mm) (zimmer, warsaw, in) along the planned tract by the pediatric orthopedist; keeping the cannulated drill bit in nidus of osteoid osteoma, k - wire was exchanged for the stiff end of the amplatz wire; a 5f sheath which was cut near hub and a linear cut along its entire length was made to allow it to expand and peel off when rfa probe was inserted through; subsequently, a 4 mm cannulated bone drill was exchanged for a 5f sheath over an amplatz wire . (17 gauge 2 cm diameter, 12 cm long, three tines) angiodynamics, inc ., ga, usa] was inserted into the nidus of osteoid osteoma through the sheath . Sheath was withdrawn approximately 2 cm back, and the tines were opened and confirmed to be within the lesion with check ct sections . Using the radiofrequency waves from rf generator (model 1500x; angiodynamics, inc ., ga, usa), the tines were heated to a target temperature of 90c and power of 60100 w and the peak temperature was maintained for 6 min . After 6 min, the tines were withdrawn into the probe and then the rf probe was removed . The treatment success was evaluated in terms of pain relief before and after procedure (1 day, 1 month, and 3 months). Patients were also contacted by telephone at 6 months for follow - up regarding complications or recurrence of pain . Technical success was defined as the ability to localize the radiolucent nidus and placement of an electrode under ct guidance with ablation performed for the desired period . Clinical success was defined as complete relief of pain without the use of oral pain medication within 1 month of the procedure . From june 2009 to may 2014, 30 pediatric patients underwent ct - guided rfa of osteoid osteoma . There were 25 boys and 5 girls, with a male - to - female ratio of 5:1 . Their age ranged between 4 years to 20 years with a mean age of 13.16 years . Lesions were grouped into common and challenging location . Among the common location (n = 25), lesions were located in the femur (n = 21) [figure 1] and tibia (n = 4). Among the challenging locations (n = 5), four were near articular surface (one each at glenoid fossa of right scapula, head of right radius, talocalcalcaneal joint of right calcaneum [figure 2] and left femoral head) and one was in the left sacrum . Radiography (a) and ct scan bone window axial image (b) show a radiolucent nidus and surrounding reactive sclerosis . (d) ct scan post procedure shows rf ablation tract a 17-year - old boy with a right calcaneal osteoid osteoma near the talocalcaneal joint margin . (a) magnetic resonance imaging (stir) sagittal image shows central nidus surrounded by hypointense reactive sclerosis . Rest of the surrounding calcaneum appear hyperintense due to reactive edema due to osteoid osteoma . (b) ct scan shows rfa probe in situ in nidus technical success was achieved in all patients (100%). Primary clinical success was 96.66% (29 of total 30 patients), despite pediatric population and challenging location . One patient with an osteoid osteoma in the shaft of right femur had persistent pain after 1 month and was treated successfully with a second procedure (secondary success rate 100%). One patient from the challenging location group with osteoid osteoma at right radial head had immediate post - procedure weakness of wrist and finger extension because the lesion was very close to posterior interosseous nerve, which slowly recovered with physiotherapy . Since the promising results of rosenthal et al ., in the management of osteoid osteoma with rfa, a large number of studies evaluating rfa of osteoid osteoma have been reported in the literature . Most of these studies found very high technical success rates (100%) and good primary success rates with a single session of ablation ranging from 76% to 100% . Hence, this minimally invasive technique has become the method of choice for treatment of osteoid osteomas, provided that the diagnosis is based on a typical clinical, scintigraphy, and ct presentation . To our knowledge, there are few reports in the literature regarding the role of percutaneous rfa in treating osteoid osteomas in children at atypical locations . Our technical success rate was 100%, which is similar to most of the other studies (100%). In our study in the pediatric population, the primary and secondary clinical success ratings were 96.66% and 100%, respectively, which are comparable to success rates in most other studies among adults, where primary success and secondary success ranged from 76% to 100% and 87% to 100%, respectively . In a study done by donkol et al . On the efficacy of rfa of osteiod osteoma in children showed that the technical success, primary clinical success, and secondary clinical success rates were 91.3%, 78.2%, and 82.6% respectively . And vanderschueren et al ., in their studies, showed that lower age can be a risk factor for lower clinical success rate . This can be explained by the greater technical difficulty during ablation of osteoid osteoma in children due to the small body mass, difficulty in positioning and fixation of the needle, and shorter ablation time (range: 26 min in their study) for each procedure . Our study showed that if technical success is 100% and if strict desired temperature (90c) can be maintained for desired time (6 min) using controlled power (wattage) delivery (60100 w) then high clinical success can be achieved even in pediatric population similar to adult population . In our study, this happened in a child with radial head (technically challenging position) osteoid osteoma who had developed an immediate post procedure weakness of wrist and finger extension as the lesion was very close to posterior interosseous nerve . There are few case reports of likely articular cartilage damage in weight bearing joints such as acetabulum following ct - guided percutaneous rfa of juxta - articular osteoid osteoma, however, it was not confirmed whether the articular cartilage was damaged only by head due to rfa or if it had also been weakened before by the osteiod osteoma . On rfa of intra - articular osteoid osteoma of the hip showed that there is good ossification and bone regeneration following rfa and that it is a safe and effective treatment even for intra - articular lesions . No delayed complications were observed in our study . In comparison to percutaneous ct - guided curettage of osteiod osteoma, during rfa there is lack of confirmation of histological diagnosis . However, there are other disadvantages of curettage technique that it is little more traumatic with complications of neuropraxia, skin abrasions, damage to blood vessels especially in femur leading to avascular necrosis, and frequently incomplete curettage . We suggest that when the clinical and radiological features are not typical, the technique should be supplemented with a core biopsy from the nidus area . This is specially indicated when the differential diagnosis is infection as management will be required . Limitations of our study are that it is an observational study, lack of confirmation of histological diagnosis, and lack of imaging follow - up . Percutaneous ct - guided rf ablation is a relatively safe, highly effective, and minimally invasive procedure for the treatment of osteoid osteoma in pediatric population despite atypical location.
Mouse dis3l2 was expressed in sf9 cells as an n - terminal strep - sumo - tev fusion protein from the pfl vector of the multibac baculovirus expression system . Sf9 cells were infected with baculovirus in hyclone ccm3 media (thermo scientific) at 27c . Following 60 hours of expression the cells were centrifuged at 1200 rpm and resuspended in wash buffer (50 mm tris ph 8, 100 mm nacl, and 5 mm dtt), flash frozen in liquid nitrogen and stored at 80c . Frozen cells were thawed, nacl concentration increased to 500 mm, and then lysed by sonication . The lysate was treated with 0.2% poly - ethylene imine (pei) to precipitate nucleic acids prior to ultracentrifugation at 35,000 rpm at 4c for 1 hour . The soluble fraction was incubated with 1 ml of strep - tactin superflow resin (iba biotagnology) per 10 ml of lysate for 1 hour on a rolling shaker . The resin was applied to a gravity flow column and washed extensively with wash buffer . The cleaved protein was diluted with an equal volume of heparin buffer a (25 mm hepes ph 7.5, 5 mm dtt) to a final nacl concentration of 50 mm . Dis3l2 was loaded onto a hitrap heparin hp column (ge life science) equilibrated with 25 mm hepes ph 7.5, 50 mm nacl and 5 mm dtt . A linear gradient between 0.05 m and 1 m nacl was used to elute dis3l2 at 0.25 m nacl . Fractions that contained dis3l2 were analyzed by sds - page, pooled and concentrated to 2 ml and loaded onto a hiload 16/60 superdex 200 gel filtration column equilibrated with 10 mm tris ph 8, 100 mm nacl, 2 mm mgcl2 and 5 mm dtt . Fractions containing dis3l2 were pooled and concentrated to 25 mg / ml, flash frozen in liquid nitrogen and stored at 80c . Mutants of dis3l2 were constructed by sequence and ligation - independent cloning (slic) using mutant primers . We expressed and purified a d389n active site mutant lacking the protease - sensitive loop within csd1 (residues 148169 and 194221), and both the n (136) and c (857870) termini (extended data figure 2). The truncated dis3l2 was incubated with a 1.2 molar excess of u13 rna for 30 minutes at 20c . Crystallization was carried out by the hanging drop vapor diffusion method by mixing the dis3l2-u13 complex at 15 mg / ml with an equal volume of 100 mm tri - ammonium citrate ph 5.5, 100200 mm ammonium chloride and 2022% peg 3350 . Crystals appeared in 12 days at 18c and were placed directly in a freshly prepared solution composed of the crystallization condition supplemented with 20% glycerol and flash frozen in liquid n2 . X - ray diffraction data were collected to 2.95- resolution at the x25 beamline at the national synchrotron light source (nsls) at brookhaven national laboratory (bnl) (extended data table 1). We generated a molecular replacement (mr) search model by pruning yeast rrp44 (pdb 2vnu) with the sculptor utility . The pruned model was separated into its individual csd1, csd2, rnb and s1 domains . Phasing was determined by mr with phaser, using each of the domains of yeast rrp44 as individual search models . Phaser found solutions for csd2, rnb and s1 domains, but failed to find a unique solution for csd1 . The initial mr phases were input into the autobuild routine in phenix, where the resolve and buccaneer option for density modification and model building, respectively, was critical for phase improvement and interpretation of initial electron density maps . The csd1 of yrrp44 was placed manually into the initial map and the autobuild routine repeated . The resulting phases were of sufficient quality to manually build protein and rna in coot . Although a u13 homo - oligonucleotide was used in crystallization, interpretable electron density accounted for 14 nucleotides . This is readily explained by slipping of the homo - oligou into two conformations along the rna binding cleft . One conformation is fully threaded into the active site (at the 0 position), and a second conformation occupies the 1 position . Crystallographically, these two states are indistinguishable, and thus is best accounted for by modeling 14 nucleotides . The final model includes two copies of truncated dis3l2 with the exception of disordered residues (3748, 119228 and 252258), two u14 molecules, two mg ions and 6 water molecules . The structure was refined using automatically determined ncs restraints, tls and isotropic b - factor refinement as implemented in phenix to an r / rfree of 21/25% . The final model was validated with molprobity, where 96.8% of residues reside in the favored and 3.13% in the allowed regions of the ramachandran plot (extended data table 1). The copy represented by chain a (dis3l2) and chain c (u14) had appreciably better electron density and was used for all structural analysis described in this manuscript . Weak electron density, presumably due to disorder in the region surrounding u5, precluded accurate modeling of the position of this nucleotide, so we carefully avoided over interpretation of the interactions observed in this region, though we are confident of its presence and general location . All structural figures were generated with the pymol molecular graphics system, version 1.6 schrdinger, llc . All exonuclease assays were conducted under multiple turnover conditions, where we measured the linear initial rate of rna degradation and calculated the specific activity (nt degraded minute molecule of enzyme). The indicated amount of dis3l2 was incubated at 30c with 100 nm 5' radiolabeled rna substrate in reaction buffer (20 mm hepes ph 7.5, 50 mm nacl, 1 mm dtt and 100 um mgcl2). A 50 l reaction was initiated and 5 l was removed and quenched at 0, 0.5, 1, 2, 4, 8 and 16 minute time points in formamide loading buffer (0.025% sds, 95% formamide, 0.025% bromophenol blue, 0.025% xylene cyanol and 18 mm edta). Quenched samples were heated to 95c for 2 minutes and resolved by denaturing urea page . The amount of substrate degraded (fmol) was plotted vs. time and linear regression was used to determine the initial rate (slope) of the linear portion of the curve with graphpad prism 6 . The initial rate was converted specific activity (nt / min / molecule of enzyme) by dividing the initial rate (fmol substrate processed / min) by the fmol of enzyme used in each assay and multiplying by n-3 (where n is the number of nucleotides of the substrate and 3 is the length of the end - product). Briefly, the rna coding sequence was flanked by a 5' hammerhead ribozyme and 3' hepatitis delta virus ribozyme (hdv) to ensure homogeneous ends . Constructs were cloned into a prsf vector containing a t7 promoter and the rna produced by run - off transcription . The pre - let-7 sequence used in this study is pre - let7a1: ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuuc transcribed rna was gel purified with denaturing page and resuspended in depc - treated water . A range of dis3l2 concentrations; 05 nm for oligou, pre - let-7-u15, deoxyu15 and pre - let-7 substrates and 0150 nm for a15 and c15 were incubated with 1 pm 5' radiolabeled rna for 1 hour in binding buffer (20 mm hepes ph 7.5, 50 mm nacl, 1 mm dtt, 50 g / ml bsa and 100 m edta). We determined that wild - type dis3l2 is inactive in the presence of edta and no magnesium, but binds to rna with the same affinity as the inactive d389n mutant . A slot blot filtration system was used (biorad) to capture dis3l2/rna complexes on the top nitrocellulose membrane and unbound rna on the bottom nylon membrane . The membranes were washed with 100 l of binding buffer, prior to applying 100 l of the binding reaction, followed by 100 l of binding buffer . The nitrocellulose and nylon membranes were dried and analyzed by phosphor imaging . All binding assays were conducted in triplicate, were quantified and fraction bound plotted vs. free protein concentration . Mouse dis3l2 was expressed in sf9 cells as an n - terminal strep - sumo - tev fusion protein from the pfl vector of the multibac baculovirus expression system . Sf9 cells were infected with baculovirus in hyclone ccm3 media (thermo scientific) at 27c . Following 60 hours of expression the cells were centrifuged at 1200 rpm and resuspended in wash buffer (50 mm tris ph 8, 100 mm nacl, and 5 mm dtt), flash frozen in liquid nitrogen and stored at 80c . Frozen cells were thawed, nacl concentration increased to 500 mm, and then lysed by sonication . The lysate was treated with 0.2% poly - ethylene imine (pei) to precipitate nucleic acids prior to ultracentrifugation at 35,000 rpm at 4c for 1 hour . The soluble fraction was incubated with 1 ml of strep - tactin superflow resin (iba biotagnology) per 10 ml of lysate for 1 hour on a rolling shaker . The resin was applied to a gravity flow column and washed extensively with wash buffer . The cleaved protein was diluted with an equal volume of heparin buffer a (25 mm hepes ph 7.5, 5 mm dtt) to a final nacl concentration of 50 mm . Dis3l2 was loaded onto a hitrap heparin hp column (ge life science) equilibrated with 25 mm hepes ph 7.5, 50 mm nacl and 5 mm dtt . A linear gradient between 0.05 m and 1 m nacl was used to elute dis3l2 at 0.25 m nacl . Fractions that contained dis3l2 were analyzed by sds - page, pooled and concentrated to 2 ml and loaded onto a hiload 16/60 superdex 200 gel filtration column equilibrated with 10 mm tris ph 8, 100 mm nacl, 2 mm mgcl2 and 5 mm dtt . Fractions containing dis3l2 were pooled and concentrated to 25 mg / ml, flash frozen in liquid nitrogen and stored at 80c . Mutants of dis3l2 were constructed by sequence and ligation - independent cloning (slic) using mutant primers . We expressed and purified a d389n active site mutant lacking the protease - sensitive loop within csd1 (residues 148169 and 194221), and both the n (136) and c (857870) termini (extended data figure 2). The truncated dis3l2 was incubated with a 1.2 molar excess of u13 rna for 30 minutes at 20c . Crystallization was carried out by the hanging drop vapor diffusion method by mixing the dis3l2-u13 complex at 15 mg / ml with an equal volume of 100 mm tri - ammonium citrate ph 5.5, 100200 mm ammonium chloride and 2022% peg 3350 . Crystals appeared in 12 days at 18c and were placed directly in a freshly prepared solution composed of the crystallization condition supplemented with 20% glycerol and flash frozen in liquid n2 . X - ray diffraction data were collected to 2.95- resolution at the x25 beamline at the national synchrotron light source (nsls) at brookhaven national laboratory (bnl) (extended data table 1). We generated a molecular replacement (mr) search model by pruning yeast rrp44 (pdb 2vnu) with the sculptor utility . The pruned model was separated into its individual csd1, csd2, rnb and s1 domains . Phasing was determined by mr with phaser, using each of the domains of yeast rrp44 as individual search models . Phaser found solutions for csd2, rnb and s1 domains, but failed to find a unique solution for csd1 . The initial mr phases were input into the autobuild routine in phenix, where the resolve and buccaneer option for density modification and model building, respectively, was critical for phase improvement and interpretation of initial electron density maps . The csd1 of yrrp44 was placed manually into the initial map and the autobuild routine repeated . The resulting phases were of sufficient quality to manually build protein and rna in coot . Although a u13 homo - oligonucleotide was used in crystallization, interpretable electron density accounted for 14 nucleotides . This is readily explained by slipping of the homo - oligou into two conformations along the rna binding cleft . One conformation is fully threaded into the active site (at the 0 position), and a second conformation occupies the 1 position . Crystallographically, these two states are indistinguishable, and thus is best accounted for by modeling 14 nucleotides . The final model includes two copies of truncated dis3l2 with the exception of disordered residues (3748, 119228 and 252258), two u14 molecules, two mg ions and 6 water molecules . The structure was refined using automatically determined ncs restraints, tls and isotropic b - factor refinement as implemented in phenix to an r / rfree of 21/25% . The final model was validated with molprobity, where 96.8% of residues reside in the favored and 3.13% in the allowed regions of the ramachandran plot (extended data table 1). The copy represented by chain a (dis3l2) and chain c (u14) had appreciably better electron density and was used for all structural analysis described in this manuscript . Weak electron density, presumably due to disorder in the region surrounding u5, precluded accurate modeling of the position of this nucleotide, so we carefully avoided over interpretation of the interactions observed in this region, though we are confident of its presence and general location . All structural figures were generated with the pymol molecular graphics system, version 1.6 schrdinger, llc . All exonuclease assays were conducted under multiple turnover conditions, where we measured the linear initial rate of rna degradation and calculated the specific activity (nt degraded minute molecule of enzyme). The indicated amount of dis3l2 was incubated at 30c with 100 nm 5' radiolabeled rna substrate in reaction buffer (20 mm hepes ph 7.5, 50 mm nacl, 1 mm dtt and 100 um mgcl2). A 50 l reaction was initiated and 5 l was removed and quenched at 0, 0.5, 1, 2, 4, 8 and 16 minute time points in formamide loading buffer (0.025% sds, 95% formamide, 0.025% bromophenol blue, 0.025% xylene cyanol and 18 mm edta). Quenched samples were heated to 95c for 2 minutes and resolved by denaturing urea page . The amount of substrate degraded (fmol) was plotted vs. time and linear regression was used to determine the initial rate (slope) of the linear portion of the curve with graphpad prism 6 . The initial rate was converted specific activity (nt / min / molecule of enzyme) by dividing the initial rate (fmol substrate processed / min) by the fmol of enzyme used in each assay and multiplying by n-3 (where n is the number of nucleotides of the substrate and 3 is the length of the end - product). Briefly, the rna coding sequence was flanked by a 5' hammerhead ribozyme and 3' hepatitis delta virus ribozyme (hdv) to ensure homogeneous ends . Constructs were cloned into a prsf vector containing a t7 promoter and the rna produced by run - off transcription . The pre - let-7 sequence used in this study is pre - let7a1: ugagguaguagguuguauaguuuuagggucacacccaccacugggagauaacuauacaaucuacugucuuuc transcribed rna was gel purified with denaturing page and resuspended in depc - treated water . A range of dis3l2 concentrations; 05 nm for oligou, pre - let-7-u15, deoxyu15 and pre - let-7 substrates and 0150 nm for a15 and c15 were incubated with 1 pm 5' radiolabeled rna for 1 hour in binding buffer (20 mm hepes ph 7.5, 50 mm nacl, 1 mm dtt, 50 g / ml bsa and 100 m edta). We determined that wild - type dis3l2 is inactive in the presence of edta and no magnesium, but binds to rna with the same affinity as the inactive d389n mutant . A slot blot filtration system was used (biorad) to capture dis3l2/rna complexes on the top nitrocellulose membrane and unbound rna on the bottom nylon membrane . The membranes were washed with 100 l of binding buffer, prior to applying 100 l of the binding reaction, followed by 100 l of binding buffer . The nitrocellulose and nylon membranes were dried and analyzed by phosphor imaging . All binding assays were conducted in triplicate, were quantified and fraction bound plotted vs. free protein concentration . A, dis3l2 exonuclease assays were conducted with 5' radio - labeled rna substrates at 30c over a 16 minute time course and products resolved by denaturing urea page . Two representative gels, one from an exonuclease assay with u15 that was used to quantify dis3l2 enzymatic activity and another for deoxyu15, showing no detectable activity under the initial rate conditions tested . B, the initial rate plots for each substrate used to calculate specific activity as shown in fig . The concentration of enzyme used to measure the initial rate is indicated on each plot . The amount of substrate degraded (fmol) was plotted vs. time and the initial rate (slope) was determined with linear regression using graphpad prism 6 . Dis3l2-rna complexes were captured on the top nitrocellulose membrane and unbound rna to the bottom nylon membrane . 1b, was determined by plotting the fraction rna bound vs. the concentration of free dis3l2 and fit by non - linear regression with graph pad prism 6 . Extended data figure 2 \| sequence alignment of mouse and human dis3l2, yeast rrp44 and human dis3 . Dis3l2 is composed of two cold shock domains (csd1, residues 49240, 1, 15 and csd2, residues 241324, 610, 2) at its n - terminus followed by a catalytic rnb domain (residues 325765, 317, 1121) and flanked by an s1 domain (residues 766856, 2229). The secondary structure elements deduced from the structure of mouse dis3l2 are shown on top of the sequences, color - coded by domain as in fig . The segments of mouse dis3l2 that were truncated to facilitate crystallization are outlined in a black box . Blue diamonds indicate residues interacting with the backbone of u14 rna and red diamonds denote conserved active site residues . Extended data figure 3 \| substrate specificity of truncated dis3l2 and electron density map for u14 rna . A, comparison of specific activity (nt min molecule) of truncated dis3l2 construct resembling the one used in crystallization, but without the d389n mutation with the same set of substrates analyzed for wild - type dis3l2 . Truncated dis3l2 had comparable levels of activity and displayed the same substrate preference as wild - type dis3l2 . The specific activity was calculated from the initial rate plots, in the same way as described in fig.1a and extended data fig . Initial molecular replacement phases were improved by density modification with resolve and automated model building with buccaneer, as implemented by the autobuild wizard in phenix . The unbiased density modified electron density map prior to inclusion of rna is shown contoured at 1. despite the crystallization of dis3l2 in complex with u13, unambiguous density allowed modeling of u14 (details are discussed in the methods). Clear electron density accounted for all 14 nucleotides, except some disorder contributed to weak electron density surrounding u5, precluding its accurate placement in density . Extended data figure 4 \| dis3l2 domain interface analysis . A, analysis of the csd1-rnb interface . The conformation of csd1 is stabilized by two protein - protein interactions with the rnb (k240 with d739 and d91 with t613), and an rna mediated interaction with the rnb through u6-u7 and 11 . Csd2 is intimately associated with csd1, but also interfaces with the rnb through 3 (s242 with e337 and k319 with e332). S1 is part of a large hydrophobic interface with rnb (11, 13, 17 and 18, 19). The s1 domain also interfaces with the rnb through interactions with u8 (also see fig . 3d) d, csd1 is further stabilized through an rna mediated interaction with s1 . A, specific activity (nt min molecule) of dis3l2 with increasing length oligou (u9, u11, u13 and u15). B, the initial rate plots for each substrate used to calculate specific activity in panel a. the amount of substrate degraded (fmol) was plotted vs. time and the initial rate (slope) was determined with linear regression using graphpad prism 6 . C, equilibrium dissociation constants (kd) for increasing oligou length . The kd s.d . Determined from d, the equilibrium dissociation constant (kd) for each substrate in panel c was determined by plotting the fraction rna bound vs. the concentration of free dis3l2 and fit by non - linear regression with graph pad prism 6 . Extended data figure 6 \| dis3l2 has a conserved active site and an rna path that resembles rnase ii . Conserved active site residues are shown as green sticks and u13 and u14 are shown as orange sticks . A single mg ion (purple sphere) as proposed for rnase ii, dis3l2 may utilize a two mg ion mechanism during catalysis . Dis3l2 side chains and the mg ion are colored the same as in panel a, and yrrp44 residues are shown as grey sticks . A wide - open funnel created by the csd lobe and s1 allows rna to access the top of the rnb . The path of rna in rnase ii more closely resembles that in dis3l2, compared to yrrp44, though narrow along its length, underscoring its ability to accommodate only single - stranded rna substrates . E, perpendicular side and top views of the electrostatic surface potential of dis3l2 (contoured at 5 kt / e, white = neutral, blue = positive and red = negative). A much wider positively charged funnel on the top of the rnb supports the ability of dis3l2 to degrade structured rna substrates . F, electrostatic surface potential of the single - strand specific rnase ii, in the same configuration as panel c. a narrow rna binding channel can only accommodate single - stranded rna . Extended data figure 7 \| dis3l2 discriminates u over a and c. a, dis3l2 selects oligou - tailed substrates by way of an extensive u - specific interaction network along most of its binding path . In u - zone 1 hydrogen bond pairs are shown as dashed lines and disrupted hydrogen bonds are shown as curved red lines . B, u - zone 2, with the same layout as panel a. c, u - zone 3 . Extended data figure 8 \| initial rate plots of dis3l2 u - zone mutants . A, initial rate plots for assays were conducted under the same conditions as described for u15 in extended data fig . 1 ., where reactions contained 0.5 nm enzyme and 100 nm 5' radio - labeled u15 . B, initial rate plots for u - zone 2, conducted as described for panel a. c, initial rate plots for u - zone 3, conducted as described for panel a. extended data figure 9 \| binding affinity of dis3l2 u - zone mutants a, slot blot filter - binding assay was used to measure the binding affinity of selected dis3l2 mutants with u15 . The equilibrium dissociation constant (kd) for u - zone 1 mutants as shown in fig . 3 g, was determined by plotting the fraction rna bound vs. the concentration of free protein and fit by non - linear regression with graph pad prism 6 . B, the equilibrium dissociation constant (kd) for u - zone 2 mutants as shown in fig . 3 g, and measured as described for panel a. c, the equilibrium dissociation constant (kd) for u - zone 3 as shown in fig.
The knowledge about the role of cytokines in psoriasis has developed in the last several years . Initially, only th1 cells and cytokines secreted by these cells, like tnf-, ifn-, and il-2, have been associated with the development and maintenance of chronic inflammatory diseases, such as psoriasis . Th1 cells differentiate from naive cd4 + cells in the presence of il-12, il-18, and ifn and . It is well known that th1 cytokines have strong inflammatory effects in activating macrophage, neutrophil, and cd8 + cytotoxic t cells . In the 1990s, th17 cells were described as a new t - cell population that produces il-17, il-6, il-21, il-22, and tnf . Transforming growth factor (tgf)-1, il-6, il-23, and il-15 stimulated initial th17 differentiation from naive t cells . Tgf-1 is secreted by activated t cells and it initiates t cell and fibroblast activation, as well as angiogenesis and neovascularization [37]. Il-6, secreted by macrophages, endothelial cells, and epithelial cells, is responsible for augmentation of keratinocyte hyperplasia and invasion of macrophages and t cells [3, 8]. Il-15, produced by monocytes, macrophages, dcs, and t cells, can appear to induce angiogenesis, immune cell recruitment, and activation of keratinocytes [4, 9, 10]. Cytokines produced by th17 cells were found to initiate acanthosis, hyperkeratosis, and parakeratosis . Th17 cells demonstrated involvement in neutrophil and monocyte chemotaxis, t - cell migration and activation, and neovascularization . Th22 cells have been recently described as inflammatory cd4 + t cells that produce cytokines such as il-22, il-26, and il-13 of which il-22 is the most important functional cytokine . Recent studies indicate that il-6 and tnf-, along with the help of plasmacytoid dendritic cells, can promote the th22 phenotype [14, 16]. The differentiation of main three t cell subsets involved in the pathogenesis of psoriasis, as well as th1, th17, and th22 cytokine production are illustrated in figure 1 . The aim of the study was to assess the serum levels of some cytokines involved in the th17 and th22 responses in psoriatic patients . The study comprised 60 psoriatic patients, 50 males (83.33%) and 10 females (16.67%), as well as 30 healthy controls . The studied patients' age was between 18 and 69 years, 45.6 13.2 years on average . The history of the disease was from 1 to 45 years, 18.7 11.5 years on average . Thirty - four of the studied patients (40%) reported two psoriasis exacerbations a year, whereas 9 persons (15%) observed as many as 4 exacerbations a year . The skin lesions severity was assessed with the use of psoriasis area and severity index (pasi), body surface area (bsa), and physician global assessment (pga) scores . The pasi value in the studied group was from 4.8 to 64.2 and 15.7 9.7 on average . The bsa value was in the range of 9.096.9% and 31.4 18.2 on average . The pga score was 3 in 24 individuals (40%), 4 in another 24 individuals (40%), and 5 in 12 individuals (20%). Blood samples were collected from psoriatic patients and controls and were centrifuged for 15 minutes at 1000 g . Then, serum samples were subdivided into small aliquots to be stored at 80c until tested for cytokine levels . Elisa kits were used to determine il-6, il-12, il-17, il-20, il-22, and il-23 (r&d systems, minneapolis, mn, usa) serum levels, according to the manufacturer's instructions . Continuous variables were presented as mean standard deviation, while categorical variables were presented as absolute and relative frequencies . Mann - whitney's u test was used to compare continuous data between the studied and control groups . The statistical analyses of the conducted study results revealed significantly higher serum levels of il-6, il-20, and il-23 in psoriatic patients comparing to healthy controls (table 1 and figure 2). Significant correlations between il-20, il-22, il-17, and psoriasis severity were observed . No significant correlations were found between the concentrations of the studied cytokines and the sex, age, or psoriasis duration in the studied patients (p> 0.05). Significantly higher il-6 values were found in the psoriatic patients in comparison to the control group (p <0.001). Il-6 contributes to the th17 cell line's involvement in numerous processes of inflammation and autoimmunity by preventing the proliferation of t regulatory cells . Il-17 can induce fibroblasts to produce il-6 potentially activating a positive feedback loop that strengthens th17 inflammation . Analyzed 78 studies comparing the serum inflammatory markers, including il-6, in psoriasis with healthy controls . The study showed that the standardized mean differences were higher in psoriatic patients compared to healthy controls for il-6 . Elevated serum il-6 appears to be associated with greater psoriasis severity [18, 21, 24]. It was shown that il-6 might be the biomarker differentiating psoriasis arthritis from psoriasis without joint involvement [19, 22]. Significantly higher il-20 values were found in the psoriatic patients in comparison to the control group (p <0.001). A significant positive correlation between the il-20 concentrations and psoriasis severity measured by the pasi was detected (p <0.001; r = 0.698). Il-20 is produced by keratinocytes in the presence of il-22, tnf-, and il-17 but not ifn- or il-20 itself [15, 25]. Il-20 can play an important role in the later effector phase of psoriasis pathogenesis, in which it inhibits the terminal differentiation, increases antimicrobial competence, and production of chemokines for neutrophils in keratinocytes [25, 29]. There are not many studies concerning il-20 serum level, but increased levels of il-20 were noted in lesional skin as well as in the blood in psoriatic patients . As in our study, il-20 serum levels correlated with pasi scores . A significantly higher increase in il-22 was observed in psoriatic patients in comparison with the healthy controls (p <0.001). A significant positive correlation was found between the il-22 concentration and psoriasis severity measured by both the pasi and bsa score; that is, p <0.001; r = 0.557 and p <0.001; r = 0.559, respectively . Il-22 is a member of the il-10 cytokines family and is mainly produced by th17, th22, and mucosal nk cells [3032]. Il-22 upregulates keratinocyte proliferation and migration, inhibits keratinocyte differentiation by downregulating a variety of genes as filaggrin and involucrin genes [33, 34], and augments the expression of inflammatory molecules by keratinocytes, which leads to an increase in skin thickness in vitro and in vivo [3537]. Il-22 increased the expression of the hbd-2 and hbd-3 in human keratinocytes and mmp1 and mmp3 in the skin [3840]. In psoriasis, il-22 is overexpressed most probably as a result of upregulated il-23 and il-6 levels [12, 41, 42]. The treatment with tnf inhibitor (etanercept) reduced serum levels of il-17 and il-22 . No significant differences were found in the il-12 and il-23 concentrations between the psoriatic patients and control group (p> 0.05). Il-23 together with il-12 belongs to the il-12 family and are both structurally related; il-12 is formed by the p40 and p35 subunits; il-23 consists of p40 and p19 subunits [44, 45]. Although both il-12 and il-23 are present in psoriasis, studies support that il-23, rather than il-12, is crucial during the pathogenesis of psoriasis . Il-23 is overexpressed in psoriasis lesional skin, as shown for example, by increased p40 and p19 mrna levels but not always p35 [4654]. Il-23 is overproduced by dermal dendritic cells [48, 53] and keratinocytes in lesional psoriatic skin . Most recent reports show no increased expression of the il-12 in psoriasis [3, 49, 52, 53]. Statistically significant differences in serum il-12 level have been found in psoriatic patients comparing to healthy controls [20, 56]. However, there are no significant studies comparing the serum levels of il-23 in psoriatic patients and controls . No significant differences were found in the serum il-17 concentrations between the psoriatic patients and control group (p> 0.05). A significant positive correlation between the il-17 concentrations and psoriasis severity measured by the pasi was detected (p <0.05; r = 0.277). Il-17 (il-17a) is a member of a newly identified cytokine family comprising il-17a, il-17b, il-17c, il-17d, il-17e (il-25), and il-17f . Il-17 and il-17f have a proinflammatory activity inducing the expression of proinflammatory cytokines, colony - stimulating factors, and chemokines from dendritic cells, neutrophils, t cells, monocyte / macrophages, and epithelial cells [11, 44]. Il-17a and il-17f can mobilize, recruit, and activate neutrophils [44, 57]. Il-17 is undetectable in normal skin, and biological therapy that inhibits th17 pathways results in reduced expression of il-17 and il-23 and improved disease outcomes [11, 24, 39]. Th17 cells and the cytokines produced by these cells are found in increased levels within skin affected by psoriasis [31, 4749, 5860]. Statistically significant differences in serum il-17a level have been found in psoriatic patients comparing to healthy controls . Il-17 serum levels correlated with the psoriasis area and severity index (pasi). In addition, an analysis of mutual correlations between the concentrations of selected cytokines in the psoriatic patients was conducted . A significant positive correlation between the il-23 and il-17 values was found (p <0.05; r = 0.271). An increase in the il-23 concentration was accompanied by an increase in the il-17 concentration . In previous studies, it was found that interaction of il-23 with its receptor on th17 cells stimulates the production of il-17 and other related proinflammatory cytokines activates nk cells and regulates antibody production [1, 3, 44]. We believe that the results of our study confirm involvement of th17 and th22 cytokines in psoriasis pathogenesis . Elevated il-22 level without increase of il-17 level may suggest that th22 role is more significant in the inflammatory process of psoriasis . Very high concentrations of il-22 in the patients' serum can be connected with intensive il-6 stimulation . Il-22 and il-20 itself induce production of il-20, which is elevated in our study . It seems that il-6, which initiates th17 and th22 pathways in psoriasis, may be helpful in the clinical practice as a soluble biomarker of the disease activity and its prognosis . The development of new therapeutical strategies targeting the initial step of cytokine network activation, for example, il-6, may reduce the next events of inflammatory reactions and prevent the psoriasis exacerbation and systemic complications . Furthermore, serum levels of il-20, il-22, and il-17, which correlated with the clinical severity and activity of psoriasis, may be objective parameters of successful treatment and may be used in the followup.
Chlamydia genital infection is the most common bacterial infection sexually transmitted in the world (1). The highest age - specific rate was reported in females aged 15 - 35 years . The majority of the females are asymptomatic (2), thus, providing a continuous reservoir for the infection (3). It is estimated that 5 - 12% of sexually active adults in the age group of 16 - 34 years in the united kingdom are infected with chlamydia trachomatis (4). According to the world health organization (who), 101.5 million people with chlamydia infection are detected globally each year (5). The infection risk factors include being young or adolescent, having new or frequent sexual contacts, inconsistent use of barrier contraception, history of prior sexual transmitted infection, and low educational and socioeconomic levels (6). Thus, the prevalence of c. trachomatis may differ among racial groups because of differences in sexual risk behavior and cultural backgrounds (7). Untreated chlamydial infections may lead to pelvic inflammatory disease (pid), ectopic pregnancy, premature delivery, spontaneous abortion, low birth weight, tubal infertility and subsequent scarring of the fallopian tubes (8). During pregnancy, chlamydial infection can cause miscarriage, premature rupture of membranes, preterm labor, low birth weight, infant mortality, neonatal chlamydial infection, and postpartum endometritis (9). Screening, early diagnosis and treatment is considered the main policy to prevent complications and further transmission of the infection (10). Conventional laboratory diagnosis of c. trachomatis infection is done by cell culture or antigen detection . Commercially available naats using methods such as polymerase chain reaction (pcr), and ligase chain reaction (lcr), are now the gold standard tests for genital chlamydia infection (11). Pcr has good sensitivity (100%) and specificity (99.3%) for endocervical samples compared with urethral culture . It is the preferred test and the most commonly used method of diagnosis, which amplifies c. trachomatis dna sequences (12). There are no accurate data regarding the prevalence of c. trachomatis infection in kashan and few studies from iran examined the prevalence of genital chlamydia infection based on age . The current study aimed to assess the prevalence of endocervical c. trachomatis infection in a population of females aged 17 - 35 years in kashan, iran . Endocervical swab samples were collected by the gynecologists from 255 married females aged 17 - 35 years, with or without symptoms, referring to the obstetrics and gynecology clinics of kashan, iran, from december 2012 to july 2013 . The study was approved by the regional research ethics committee of kashan university of medical sciences (p 2331), and all participants signed informed consent forms prior to enrolment in the study . Demographics, sexual behavior, method of contraception, previous history of sexually transmitted infections (stis) and symptoms were assessed by a questionnaire routinely used in the clinic . Cervical samples were collected from the endocervical region after inserting a sterile speculum into the vagina . Mucus was cleaned with a sterile cotton swab without causing any bleeding or using antiseptics . Dacron swabs were used to collect endocervical specimens . The specimen placed into sterile collection tubes containing 2 ml of transport buffer (nah2po4 20 mm, na2hpo4 20 mm, sucrose 20 mm, glutamin 5 mm, gentamycin 50 g / ml, vancomycin 100 g / ml, amphotericin b 25 g / ml supplemented with 10% of inactivated fetal calf serum) and transported to the laboratory for further processing . Pcr was set up using positive control dna from c. trachomatis serovar l2 type strain 434/bu (atcc vr-902b). For the negative control, the dna was isolated using a kiaspin pcr template purification kit, (kiagen, iran) according to the manufacturer s instructions . Briefly, samples were vortexed and centrifuged for 30 minutes at 14000 g. then, dna purification was performed, 200 l of each specimen was transferred and mixed with 300 l of buffer lb and 2 l of dna / rna carrier and 5 l of proteinase k in a 1.5 ml microcentrifuge tube and incubated at 65c for 10 minutes . After incubation, 100 l of isopropanol was added to the tubes, mixed and centrifuged for 2 minutes at 5000 g. the supernatant was applied to the spin column and centrifuged at 12000 g for 1 minute, after which the filtrate was discarded and 500 l of buffers irb and 600 l of wb were added to each spin column and centrifuged again at 12000 g for 1 minute . Chlamydia trachomatis was detected by a pcr designed in the laboratory to amplify a sequence in the cryptic plasmid generating a fragment of about 512 base pair . Primers were hl1 forward, 5-tagagataggaaaccaactc-3and hl2 reverse, 5ctcgggttaatgttgcatga-3 (13) (cinnagen, tehran, iran). Amplification reactions were performed in a final volume of 25 l containing 5 l of sample, 12.5 l of the master mix pcr solution (cinnagen, tehran, iran), and 1 l of each reverse and forward primers . The reaction mixture was incubated for 5 minutes at 94c, followed by 40 cycles of 1 minute at 94c, 1 minute at 45c, and 1 minute at 72c, and a final elongation step of 7 minutes at 72c . The pcr products were analyzed by electrophoresis in the 1% tbe buffer through 1.5% agarose gel, stained with ethidium bromide 0.5 g / ml and dna bands were visualized using a uv transilluminator (figure 1). Lane m: marker; lane 1: negative control; lane 2: positive control; lane 3 - 6: positive samples; 7: negative sample . Data were analyzed using spss version 16 and the outcome variables including prevalence rates and their 95% confidence intervals (cis) were calculated . The chi - square or fisher s exact test was used to analyze the categorical data . Endocervical swab samples were collected by the gynecologists from 255 married females aged 17 - 35 years, with or without symptoms, referring to the obstetrics and gynecology clinics of kashan, iran, from december 2012 to july 2013 . The study was approved by the regional research ethics committee of kashan university of medical sciences (p 2331), and all participants signed informed consent forms prior to enrolment in the study . Demographics, sexual behavior, method of contraception, previous history of sexually transmitted infections (stis) and symptoms were assessed by a questionnaire routinely used in the clinic . Cervical samples were collected from the endocervical region after inserting a sterile speculum into the vagina . Mucus was cleaned with a sterile cotton swab without causing any bleeding or using antiseptics . Dacron swabs were used to collect endocervical specimens . The specimen placed into sterile collection tubes containing 2 ml of transport buffer (nah2po4 20 mm, na2hpo4 20 mm, sucrose 20 mm, glutamin 5 mm, gentamycin 50 g / ml, vancomycin 100 g / ml, amphotericin b 25 g / ml supplemented with 10% of inactivated fetal calf serum) and transported to the laboratory for further processing . Pcr was set up using positive control dna from c. trachomatis serovar l2 type strain 434/bu (atcc vr-902b). For the negative control, sterile deionized water was used as the pcr template instead of nucleic acid . The dna was isolated using a kiaspin pcr template purification kit, (kiagen, iran) according to the manufacturer s instructions . Briefly, samples were vortexed and centrifuged for 30 minutes at 14000 g. then, dna purification was performed, 200 l of each specimen was transferred and mixed with 300 l of buffer lb and 2 l of dna / rna carrier and 5 l of proteinase k in a 1.5 ml microcentrifuge tube and incubated at 65c for 10 minutes . After incubation, 100 l of isopropanol was added to the tubes, mixed and centrifuged for 2 minutes at 5000 g. the supernatant was applied to the spin column and centrifuged at 12000 g for 1 minute, after which the filtrate was discarded and 500 l of buffers irb and 600 l of wb were added to each spin column and centrifuged again at 12000 g for 1 minute . Chlamydia trachomatis was detected by a pcr designed in the laboratory to amplify a sequence in the cryptic plasmid generating a fragment of about 512 base pair . Primers were hl1 forward, 5-tagagataggaaaccaactc-3and hl2 reverse, 5ctcgggttaatgttgcatga-3 (13) (cinnagen, tehran, iran). Amplification reactions were performed in a final volume of 25 l containing 5 l of sample, 12.5 l of the master mix pcr solution (cinnagen, tehran, iran), and 1 l of each reverse and forward primers . The reaction mixture was incubated for 5 minutes at 94c, followed by 40 cycles of 1 minute at 94c, 1 minute at 45c, and 1 minute at 72c, and a final elongation step of 7 minutes at 72c . The pcr products were analyzed by electrophoresis in the 1% tbe buffer through 1.5% agarose gel, stained with ethidium bromide 0.5 g / ml and dna bands were visualized using a uv transilluminator (figure 1). Lane m: marker; lane 1: negative control; lane 2: positive control; lane 3 - 6: positive samples; 7: negative sample . Data were analyzed using spss version 16 and the outcome variables including prevalence rates and their 95% confidence intervals (cis) were calculated . The chi - square or fisher s exact test was used to analyze the categorical data the age of the 255 subjects ranged 17 - 35 years with a mean of 27.3 4.37 years . The majority of them were married or living with a partner (98%), had high school education or higher (74%). The prevalence of c. trachomatis was 2.4% (95% confidence interval [ci] 0.54 - 4.26%) with a mean of 25.8 6.17 years; 50% (3/6) of the subjects with a positive chlamydia test result were under the age of 25 . Of the 92 subjects in the 25-year - old group, 3 (3.3%) were positive for c. trachomatis compared to three out of 163 (1.8%) in the> 25-year - group; 83.3% (5/6) of the subjects with a positive chlamydia test result were older than 16 at first sexual encounter and all of the infected subjects lived in the city . The most general symptoms among c. trachomatis infected young subjects were vaginal discharge (66.6%) and lumbar pain (50%). No significant relationships were found between c. trachomatis infection and the risk factors, probably reflecting the small number of those who were positive in the test . The prevalence of c. trachomatis genital infections among young females in kashan, iran was 2.4% . The previous published reports from iran showed various prevalence of 2% to 11% (14). The study by chamani - tabriz et al . On the prevalence of chlamydia infection in females aged 15 - 42 attending obstetrics and gynecology clinics in tehran, from may 2003 to october 2003 showed that 12.6% were positive for chlamydia by pcr (15). In another study on the females <45 years attending gynecology clinics in babol, iran, european centre for disease prevention and control (ecdc) described the prevalence ranging from 1.4% to 3.0% among females aged 15 - 40 years (17). The prevalence of c. trachomatis infection and the risk factors in individuals <35 years old attending sexual health clinics in barcelona province, spain, in 2006 was 3.8% and the prevalence was significantly higher in those under 25 years (5.8%) compared with the ones aged 25 - 35 (1.6%) (18). Another study in melbourne, australia, showed that the chlamydia prevalence was 3.7% among sexually active females aged 18 - 24 years compared with 0.2% among 25 - 35-year - old ones (19). A study among the brazilian females referred to sexually transmitted diseases (std) clinic showed that 68% of the infected ones aged 15 - 25 year (13). In the current study, the c. trachomatis prevalence in females 25 years (3.2%) was similar to those of reported in australia 4.9% (20), spain 4% (21), france 3.6% (22) and the united kingdom 3% (23). The current cdc guidelines recommend annual screening for chlamydia in sexually active females 25 years and the ones> 25 years old who are at increased risk (24). Screening is especially important in pregnant females who are at risk of transmission of their infection to the fetus (25). Chlamydia trachomatis infection is the main causative agent of abortion (26). In the current study, abortions were reported by 16.7% of females with positive test results . Early detection and appropriate treatment of c. trachomatis can prevent the development of the disease after abortion (27). Prevalence of c. trachomatis was found to be low among females in kashan, iran . The reason for c. trachomatis infection low prevalence in the population under study was the scarcity of pre - marriage sexual intercourse frequency in females, having stable sexual intercourse only after marriage . To date it was the first study in kashan to determine the prevalence of endocervical c. trachomatis infection in young females . There were several limitations to the study, which should be considered in the interpretation of the results . Data on sexual behavior was not specifically collected for the current study . Knowing a patient s number of sexual partners, sexual activity before and after sti diagnosis, and frequency of condom use may help identify the patients who are at increased infection risk . Chlamydia prevalence was low in young sexually - active females, but there is a significant difference regarding chlamydia infection in females younger than 25 years . The new information provides evidence for the need to implement active opportunity to screen young sexually active females and the patients in all socioeconomic groups . All sexually active females should be offered a c. trachomatis test when attending a physician.
Rabies diagnosis is based on fluorescent antibody testing (fat) in brain smears and inoculation of brain suspension either in mouse neuroblastoma cell cultures or intracerebrally in mice as confirmatory assays with high sensitivity and specificity for postmortem diagnosis [13]. These techniques are well suited for rapid and reliable routine diagnosis, if brain material is available . For other diagnostic specimens sampled intra vitam in case of clinical suspicion, for example, saliva, cerebrospinal fluid, or skin biopsies, more suited molecular techniques with excellent sensitivity have been developed and validated, mostly targeting the conserved nucleoprotein gene of the lyssavirus genome, for example, [410]. Among these, there are protocols both for classical rt - pcr and for real - time rt - pcr, which adds speed, efficiency, contamination safety, and reliability to the technique combined with the potential to quantify the viral load [11, 12]. A major advantage offered by these molecular techniques is the characterisation of viral isolates by sequencing the given amplification products followed by phylogenetic or phylogeographic analysis [1315]. The greatest challenge for these powerful novel techniques is the ever growing spectrum of known lyssavirus species / genotypes (gt), probably all of which having the potential to cause animal and human rabies fatalities [16, 17]. So far, 12 lyssavirus species and three as yet unclassified species have been identified . The development of classical simple or (hemi)nested rt - pcr methods with particular emphasis on the diagnosis of a broad spectrum of lyssaviruses species has been published in a number of studies [1823]. Also several real - time rt - pcr protocols suited for the broad detection or differentiation of several genotypes have been developed [9, 2428]. Is of particular interest for the rabies epidemiology in europe concerning the european bat lyssaviruses types 1 and 2 [2932] apart from classical rabies [33, 34]. This assay uses genotype (gt) specific probes and fluorophore signals for direct differentiation of gt1, gt5, and gt6 in a single - tube reaction . The goal of this work was, based on a comprehensive review of the rich literature on the theme and adapting thereof, to develop, establish, and validate classical and real - time rt - pcr protocols for (intravitam) diagnosis of rabies and molecular - epidemiological characterisation of viral strains with the main emphasis on the growing number of known species / genotypes . All operations with potentially infectious material apart from centrifugation in closed tubes were performed in a class ii biological safety cabinet . Frozen cell culture supernatants of rabies virus strains propagated previously on bhk-21 cells (baby hamster kidney cells, atcc, manassas, usa) were thawed, centrifuged at 2,000 g for 10 min at 4c, and filtrated using the millex - ha 450 nm filter (millipore, cork, ireland). Approximately 1 g of cerebellum, medulla oblongata, and hippocampus from unfixed, freshly obtained brain material was homogenized to a 20% brain suspension using a mortar and pestle, after addition of approximately 1 g of quartz sand (merck kgaa, darmstadt, germany) and 5 ml of modified eagle medium with earle's salts with 2.2 g / l nahco3 (bioswisstec ag, schaffhausen, switzerland) supplemented with 5% penicillin 10,000 iu / ml (bioswisstec ag, schaffhausen, switzerland) and 20% foetal calf serum (fcs; paa laboratories gmbh, pasching, austria). The suspension was then decanted into a 5 ml tube (5 ml polystyrene round - bottom tube; bd biosciences, erembodegem, belgium) to let it sediment for 1 hour at 4c and subsequently centrifuged at 1,400 g for 10 min and filtrated as above . Frozen brain suspensions from former mouse inoculation tests were handled like frozen cell culture supernatant . 500 l of rna storage solution (ambion, foster city, usa) was added to 100200 l of fresh or previously frozen saliva samples or swabs, which were subsequently vortexed (vortex genie 2, tewis laborbedarf ag, berne, switzerland) for 1 min and centrifuged in a biofuge pico (heraeus holding gmbh, hanau, germany) at 5,000 rpm for 10 min . Cerebrospinal fluid (csf) samples were diluted 1: 2 to 1: 4 with rna storage solution (ambion, foster city, usa). Skin biopsies were shaved, cut into small pieces with a sterile pair of scissors, and further processed as described for brain suspension . A panel of 31 lyssaviruses (including 4 species) was used to test the diagnostic performance of our pcr (table 1). Stocks of viral strains were produced in neuroblastoma cells (mna 42/13) as described for the rabies tissue culture infection test (rtcit, described below). The maintenance medium used for the first passage was dulbecco's mem supplemented with 0.5% neomycin 50 iu / ml (bioswisstec ag, schaffhausen, switzerland), 5% tryptose phosphate (bioconcept ltd . Amimed, allschwil, switzerland), 1% nonessential amino acids (bioswisstec ag, schaffhausen, switzerland), 3% foetal calf serum, and 1% l - glutamine 200 mm (bioswisstec ag, schaffhausen, switzerland) to which 1% diethylaminoethyl - dextran (deae - dextran; sigma - aldrich corporation, st . Dulbecco's mem with 10% foetal calf serum was used for the 3 consecutive passages . Staining of the cells was performed after each passage using rabies dfa reagent (millipore, livingston, uk) as a conjugate . The standard fluorescent antibody test (fat) was performed with brain tissue samples as previously described . Rabies tissue culture infection test (rtcit) using four consecutive passages on murine neuroblastoma cells [4143] was applied to clinical specimens like brain specimens, liquor, saliva, or skin biopsies . Primers, probes, and synthetic dna were obtained from microsynth (microsynth gmbh, balgach, switzerland). The location of suitable n - directed primers and probes for heminested rt - pcr and real - time rt - pcr, respectively, was chosen and evaluated based on published work [8, 18, 22, 25]. Using multiple sequence alignment (clustalx 2.0.3 program [4446]) of the n gene region of the available lyssavirus species rabv (33 sequences), lbv (4 sequences), mokv (5 sequences), duvv (4 sequences), eblv-1 (17 sequences), eblv-2 (14 sequences), ablv, aravan, khujand, irkut, and west caucasian bat (each one) from genbank (national center for biotechnology information and national library of medicine, rockville pike, usa), variable positions of primers and probes were adjusted with wobble positions for a potentially broader match . Several probes for real - time rt - pcr for broadening the spectrum of detectable species were designed in this work (table 2). As internal control for conventional rt - pcr, amplification of gapdh (glyceraldehyde 3-phosphate dehydrogenase) was used . As internal inhibition control for real - time rt - pcr, primers and probes for the amplification of sendai virus (atcc, manassas, usa), which was added to the samples before rna isolation, were used (table 2). Synthetic dna with a length of 125 bases encompassing positions 48172 according to the pasteur virus genome (x03673) of the following lyssavirus species were obtained from microsynth: aravan virus (arav) ef614259, khujand virus (khuv) ef614261, bokeloh bat lyssavirus (bblv) jf311903, australian bat lyssavirus (ablv) af418014, irkut virus (irkv) ef614260, lagos bat virus (lbv) eu293110, mokola virus (mokv) 293117, shimoni bat virus (shiv) gu170201, and west caucasian bat virus (wcbv) ef614258 . Rna was isolated from 140 l of sample supernatant using the qiaamp viral rna mini kit (qiagen, germantown, usa) according to the manufacturer's instructions, except the usage of rna storage solution (ambion, foster city, usa) for elution . Heminested rt - pcr was performed as previously described using the onestep rt - pcr kit . Briefly, for the first round 3 l of extracted rna was amplified in the rt - pcr mix prepared according to manufacturer's instructions, supplemented with 0.6 m of each primer (jw12-f, jw6as1-r1, and jw6as2-r1; table 2) and 5 u rnase inhibitor (rnasin plus, 40 u/l; promega, madison, usa), with the following cycling conditions: 50c for 30 min and 95 for 15 min for reverse transcription and subsequent activation of the polymerase, followed by 10 cycles of 95c for 20 s, 60c for 30 s (1c decrease / cycle), followed by 72c for 30 s and 35 cycles of 95c for 20 s, 52c for 30 s, followed by 72c for 30 s. for the second round, the taq dna polymerase kit (qiagen, germantown, usa) was used with 2 l of the first round product, 2.5 l 10x pcr buffer, 1.2 mm final dntp concentration (invitrogen, foster city, usa), 0.4 m of heminested primers (jw12-f, jw10as1-r2, and jw10as2-r2; table 2), 0.5 u of taq dna polymerase, and 19.35 l nuclease free water (ambion, foster city, usa). Cycling conditions were as follows: 95c for 5 min followed by 35 cycles of 94c for 20 s, 52c for 20 s, followed by 72c for 30 s. amplifications were performed in a 2720 thermal cycler . Internal controls using gapdh primers, as described in the one - round pcr, were run in parallel in the first round . Gel electrophoresis was performed using a 1.5% tae agarose gel (agarose le, analytical grade; promega, madison, usa) stained with ethidium bromide (eurobio, courtaboeuf, france). For sequencing, the desired band was excised under uv light . Real - time rt - pcr (ndwd) adapted from nadin - davis et al . And wakeley et al . [8, 25] was performed using the quantitect probe rt - pcr kit (qiagen, germantown, usa). The 25 l reaction volume consisted of 9.5 l rnase - free water, or 9 l in the multiplex mix, 12.5 l 2x quantitect rt - pcr master mix, 0.25 l of the rabvd1 forward and reverse primer (0.4 m final concentration each), 0.25 l of the probes rabvd1, lysgt5, and lysgt6 together in the multiplex mix or 0.25 l of the probes ivvwcbv - p, ivvmok - p, ivvablv2n - p, ivvlbv - p, ivvkhujand - p, and ivvsblv2-p (table 2) alone in a mix (all 0.2 m final concentration), 0.25 l of quantitect rt mix, and 2 l of sample rna . Additionally, for the internal sendai virus control, 5 l of sample rna was added to a mix containing 6.625 l of rnase - free water, 12.5 l 2x quantitect rt - pcr master mix, 0.625 l of sendai forward primer, reverse primer, and probe mix (sendai - f, sendai - r, and sendai - p, 8 m; table 2), and 0.25 l of quantitect rt mix . The reactions were carried out in microamp fast optical 96-well reaction plates with barcode 0.1 ml (applied biosystems, foster city, usa) in a 7500 fast real - time pcr system v1.3.1 (applied biosystems, foster city, usa) using the following cycling conditions: 1 cycle of 50c for 30 min and 95c for 15 min followed by 45 cycles of 95c for 15 sec and 50c for 1 min . Amplification curve analysis was performed using the 7500 software v2.0.6 (applied biosystems, foster city, usa). For cloning, a segment of viral genome covering a part of the n gene (positions 1933 according to the pasteur virus genome accession number x03673) of cvs-11 was generated using primers designed for this purpose (twclon - f and twclon - r, table 2). Amplification was performed using the onestep rt - pcr kit with the master mix consisting of 29.25 l of rnase - free water, 10 l 5x qiagen onestep rt - pcr buffer, 0.4 mm of each dntp, 0.6 m of the cloning primers, 10 u rnasin (40 u/l), and 2 l of qiagen onestep rt - pcr enzyme mixed with 5 l of extracted rna to a total volume of 50 l . Amplifications were performed in a veriti 96-well thermal cycler (applied biosystems, foster city, usa) using the following cycling conditions: 30 min at 50c, followed by 15 min at 95c and 40 repetitive cycles of 1 min at 94c, 1 min with a temperature gradient from 56c to 46c in steps of 2c, and 1 min at 72c . After gel electrophoresis excised pcr fragments with a length of 933 bp were eluted with the qiaquick gel extraction kit (qiagen, germantown, usa) and cloned into the pcr - ii - topo vector using the topo ta cloning kit (invitrogen, foster city, usa) according to the manufacturer's instructions . Sequencing reactions were performed by microsynth ag, balgach, switzerland . For this purpose, reaction mixtures containing 22.5 ng dna per 100 bp, 30 pmol of each primer used for the amplification (table 2), and depc treated water (ambion, foster city, usa) to a final volume of 15 l were prepared . Sequences were edited using the seqman ii v5.01 software (dnastar, madison, usa) and subsequently evaluated using the clone manager 9 software (scientific & educational software, cary, usa). The 543 bp nucleotide sequences of the nucleoprotein gene obtained from the heminested pcr reaction, together with additional sequences retrieved from genbank, were saved in fasta file format . The sequences were then aligned using the clustalx 2.0.3 software and the genedoc software v2.5.0 . Thirty - one lyssaviruses (19x rabv, 7x eblv-1, 4x eblv-2, and 1x duvv) were analysed in rtcit . All isolates were viable in murine neuroblastoma cells and could be visualized using rabies dfa reagent as a conjugate . For the comparison with infectious titres, rna of the classical rabies virus strain cvs-11 was extracted from cell culture supernatants (bhk-21 cells or neuroblastoma cells mna 42/13) and serially diluted from 10 to 10 . The infectious titre was determined according to the spearman - karber formula [49, 50] in fluorescent focus forming doses 50% (ffd50). In the heminested rt - pcr (hnrt - pcr), the amplification product of 582 bp was visible up to a dilution of 10 corresponding to a detection limit of 0.4 ffd50 (10 ffd50; figure 1). In the real - time rt - pcr (ndwd) the limit of detection was defined as the last dilution at which at least 2 out of 3 replicates were positive . Using this definition, cvs-11 was detectable up to a dilution of 10 (once at a dilution of 10). The amplification plot showed regular intervals of the curves with ct - values from 18.1 (dilution 10) to 40.0 (dilution 10). Relating to infectious titre real - time rt - pcr reached a detection limit of 0.003 ffd50 (10) for cvs-11 . The efficiency of the real - time rt - pcr (ndwd) was determined using linear regression of the ct - values and the titres of the samples (figure 2). On the basis of the slope coefficient the limit of detection in terms of dna copy numbers was determined using 10-fold serial dilutions of a cloned 933 bp segment of n of cvs-11 containing 10 to 10 dna copies / pcr reaction . In the hnpcr, the limit of detection was 100 dna copies/3 l of starting material of the cvs-11 plasmid . In the real - time pcr (ndwd), the 10-fold serial dilution of the cvs - plasmid was tested in triplicate . The limit of detection was 10 dna copies/2 l of the cvs-11 plasmid with ct - values between 38.6 and 47.5 . The efficiency was at 82.8% with a slope coefficient of 3.82 (not shown). The intra - assay repeatability of the real - time pcr (ndwd) proved to be excellent with very low coefficients of variation up to 10 dna copies (0.181.37%) with and outlier at 10 copies (12.05%; table 3). A total of 31 lyssaviruses (19 identified as classical rabv, 7 as eblv-1, 4 as eblv-2, and 1 as duvv) were used to test the diagnostic performance of the pcr (table 1). All viruses used were detected with the expected band size in the hnrt - pcr technique (table 4). The specificity of the amplified product was confirmed as rabv, eblv-1, eblv-2, or duvv by sequencing in each case . Host gapdh (glyceraldehyde 3-phosphate dehydrogenase) was detected in all of the cell culture supernatants and mouse brain suspensions as internal control, indicating that sample material was present and rna isolation, reverse transcription, and amplification were not inhibited . All samples were also tested positive by the real - time rt - pcr assay (table 4). Sendai virus as internal control for inhibition was run in parallel using the same cycling conditions . In the real - time rt - pcr (ndwd) with an annealing temperature of 50c, some samples were detected with more than one probe . With the exception of the sample derived from a raccoon dog from poland, the probe for the homologous genotype always yielded the lowest ct - value . In this exceptional case, the probe for the detection of genotype 6 was slightly lower than the one for genotype 1 (15.0 versus 16.1; table 4). Comparison of these two probes with the sequence of the rabies variant in question showed 1 and 2 mismatches with the rabvd1-p and lysgt6-p probe, respectively (figure 3). Duvenhage virus, also designated as genotype 4, was detectable with the probe adapted for genotype 6 in spite of 3 mismatches (lysgt6-p). The probe lysgt6-p was able to detect synthetic dna fragments of bblv, arav, and irkv, although containing one or two mismatches, respectively . The synthetic dna fragments of khuv, ablv, lbv, mokv, shibv, and wcbv, which exhibited from four (ablv / khuv) up to ten (wcbv) mismatches to the best fitting probe for gt1, gt6, or gt5, respectively, were all detected with the corresponding species - specific new probe (table 2). 10 copies of the synthetic dna were detected at ct - values of 27.933.5 for ablv, mokv, shibv, and wcbv (not shown). The efficiency of detection of khuv, which showed an atypical amplification plot at the highest number of 10 copies of the synthetic dna, and that of lbv was lower with ct - values of 40.0 and 40.5 at a copy number of 10, respectively (not shown). Multiplexing of combinations of these probes (ivvlbv - p (fam: 6-carboxyfluorescein), ivvkhujand - p (yy: yakima yellow), and ivvsblv2-p (cy5: cyanine 5), as well as ivvwcbv - p (fam), ivvmok - p (yy), and ivvablv2n - p (cy5)) as for the species 1, 5, and 6 was not successful . The 543 bp amplification products of the nucleoprotein gene obtained in the heminested pcr reactions were sequenced (table 1) and analysed phylogenetically with additional sequences retrieved from genbank representing all known lyssaviruses . The similarity of the 543 bp nucleotide sequences of the nucleoprotein gene (positions 74616 according to the pasteur virus genome) among the lyssaviruses included ranged from 64.6% to 90.1% (hamming distance). The resulting phylogenetic tree obtained by the neighbor - joining method implemented in the mega5 software is presented in figure 4 . Clinical specimens like brain suspensions (1x human, 12x mouse), skin biopsies from the nape of the neck (3x human, 1x mouse), saliva (4x human), and cerebrospinal fluids (6x human) were used for the establishment of the assays . Both hnrt - pcr and real - time rt - pcr (ndwd) were shown to work properly on all these samples without significant inhibition using gapdh as internal control for conventional rt - pcr and sendai virus for real - time rt - pcr (ndwd), which was mixed to the samples before rna isolation . Skin biopsies taken from the neck and lip of a mouse (white swiss mouse at an age of 3 weeks) euthanized 2 weeks after intracerebral infection with sad bern virus 20 years ago were positive with the hnrt - pcr and real - time pcr (ndwd). Skin biopsies taken from other locations on the head were positive with the real - time pcr (ndwd) and weakly positive in hnrt - pcr whereas samples taken around the vibrissae were weakly positive in real - time pcr (ndwd) only . Sequencing of amplification products excluded a contamination with the positive cvs-11 control (not shown). Brain suspension from an imported human rabies case in 2012 was already strongly positive after one round of the hnrt - pcr . Phylogenetic analysis of the 543 bp nucleotide fragment revealed its close relationship to the classical rabies virus strains circulating in the insectivorous mexican free - tailed bat, tadarida brasiliensis, a species common in the southern united states and mexico . This allowed identification of the origin of the patient's infection, who had travelled extensively and did not report any previous biting incident [51, 52]. Based on a large amount of published work, we were able to establish and quantitatively characterise rt - pcr protocols for the detection of lyssaviruses in clinical samples . Well suited real - time protocols [8, 25] for the detection of classical rabies virus and the genotypes 5 and 6 (eblv-1 and eblv-2) were adapted and extended for the detection of at least 13 lyssavirus species . To this goal, 6 species - specific probes (khuv, ablv, lbv, mokv, shibv, and wcbv) were designed and verified on synthetic dna fragments encompassing the targeted sequence of the lyssaviral nucleoprotein gene . Multiplexing the probes in a single - tube reaction as described for the genotypes 1, 5, and 6 was not possible with the newly designed probes, probably due to false priming and/or interference within the mix of reagents and synthetic target sequence . As far as evaluated with the multiplexed probes for the genotypes 1, 5, and 6 using 31 viral isolates, which were all detectable with high sensitivity, direct differentiation of targeted genotypes on the base of the quantitative reaction (ct - values) was mostly possible . Furthermore, a single probe for genotype 6 (species eblv-2) was able to detect up to 7 genotypes / species . We consider this type of cross hybridization as an advantage of the technique using degenerate primers and probes in terms of a broad detectability of lyssavirus rather than a lack of accuracy of discrimination . In an approach using sybr green qpcr with similarly degenerate primers spanning the same part of n as in this work, the detection of all lyssavirus species known at that time was achieved . Using several genotype - specific probes in a taqman real - time protocol, we were able to add more intrinsic confidence to the specificity of the analysis . Quantitative characterisation of the assay using the probe for genotypes 1, 5, and 6 on cvs-11 showed excellent sensitivity and repeatability with a detection limit of as low as an infectious dose of 0.003 ffd50 combined with an analytical sensitivity of 10 dna copies at efficiencies of 94.5% and 82.8%, respectively . Considering the amount of degeneration in both primers and probes, the efficiencies determined must be considered satisfactory . As far as the absolute detection limit in terms of target copies is concerned, the usage of plasmid dna rather than rna must be kept in mind . Since reverse transcription cannot be assumed as 100% efficient and reproducible, the limit for rna might be somewhat lower . For further characterisation of samples with a positive reaction in real - time rt - pcr, excellent simple and (hemi)nested rt - pcr protocols are available . With the protocol used for this work, all 31 viral strains used could be amplified and sequenced, confirming the diagnostic broadness of the assay . Phylogenetic analysis of these partial nucleotide sequences belonging to genotypes 1, 4, 5, and 6 along with known sequences confirmed the suitability of this relatively conserved genomic region for molecular - epidemiological characterisation of lyssaviruses circulating worldwide [5658]. This was also confirmed in the context of a human rabies case imported to switzerland in 2012, which could be attributed unequivocally to an exposure to a bat of the species tadarida brasiliensis in california, usa . In this work we could show and validate the suitability of an adapted and further developed real - time rt - pcr protocol for the rapid, efficient, and highly sensitive intravitam diagnosis of a wide spectrum of lyssavirus species followed by rapid molecular - epidemiological characterisation of viral isolates respective to origin of the virus and source of exposure, using heminested rt - pcr . This new tool is also particularly promising for active surveillance of european bat lyssaviruses using oral swabs in live - captured bats.
Poly implant prothse (pip) company is known to manufacture breast implants using unapproved industrial grade silicone and their products have been banned after numerous studies reporting an increased risk of complications such as implant rupture and gel leakage. [14] over 400,000 pip implants have been utilized for breast augmentation worldwide, and approximately 10,000 have been sold in ukraine . Overall, various complications have been reported in patients with ruptured breast implants or after free biomaterial injections, which also include, but not limited to neoplasms as breast carcinoma, mesenchymal tumors, and anaplastic large cell lymphoma (alcl). [510] however, little is known about possible biological effect of industrial grade silicone in individuals with ruptured pip implants . Xanthoma is a benign lesion that is frequently diagnosed in skin, kidney or gallbladder, but rare in breast . Xanthoma is rarely diagnosed in patients with breast implants and is mainly described in case reports . We report a clinical case of a patient previously operated on for breast augmentation, who opted for implant replacement and was diagnosed with a unilateral breast xanthoma associated with pip implant rupture . A 30-year - old female was seen by the senior plastic surgeon (vk) in january 2015 after bilateral aesthetic breast augmentation in 2007 . The patient was concerned about her pip breast implants and knowing possible risks of the devices opted for their removal and replacement with other authorized breast implants . Preoperative clinical assessment revealed subglandular breast implants with no signs of capsular contracture or other implant - related concerns . The woman was otherwise healthy; non - obese (body mass index 20 kg / m) and non - smoker . We started with the right side where no noteworthy changes have been seen, i.e. No paraprosthetic fluid, implant was intact with no irregularities, and the capsule looked normal . During the removal of the left implant, further, some visible air bubbles within the implant and small fatty smears on the gloves were discovered, indicating possible subtle ruptures of the implant s shell . To test this hypothesis, this maneuver resulted in rupture of the left implant, whereas the right one remained intact (figure 1). (a) a yellow implant without signs of rupture and with visible air bubbles inside indicating possible microruptures of the implant shell . (b) ruptured pip device with leakage of the silicone gel after manual compression further revision of the left implant pocket revealed a yellowish well - delimited mass 4 5 cm in the central lower part of the breast over the fascia of the pectoral major muscle . A malignant neoplasm was suspected and an excisional biopsy with histopathological and immunohistochemical (ihc) analyses were performed . We did not proceed with concurrent breast implantation and prioritized rapid tumor verification, evaluation and treatment . The histopathology of the specimen revealed xanthoma with no evidence of malignant neoplasm (figure 2). Ihc was performed to discriminate the case from soft tissue sarcomas by using antibodies against proteins cd68 (clone kp1) and s100 (clone 4c4.9); proliferation was evaluated by analyses of ki-67 (clone mib-1) expression . Analyses of ihc for histiocytic marker cd68 revealed a strong positive expression in 100% of xanthoma cells, a weak staining of s100 in <10% of xanthoma cells (considered as negative). Several positively stained cells with mib-1 indicated the absence of sarcoma and low proliferation, which supported the histopathological diagnosis of benign lesion, i.e. Xanthoma (figure 2). (a) histopathological features of h&e stained xanthoma tissue showing foamy histiocytes with multinucleate giant cells (magnification 200). (b) negative expression of protein s100 by ihc in xanthoma (magnification 400). (c) illustration of several xanthoma cells with positive nuclear expression of mib-1 indicating low proliferation (magnification 400). (d) strong cytoplasmatic expression of cd68 in xanthoma (magnification 400) both breasts were evaluated by ultrasonography, showing some signs of remaining xanthoma tissue but no evidence of other pathological findings postoperatively (figure 3). Considering the clinical findings, and to perform a secondary reconstruction with the new breast implants creating new submuscular pockets (figure 4). The remnant xanthoma tissue is visualized as 1 mm hypoechogenic mass (marked by white crosses) surgical findings . (a) remnant xanthoma tissue was identified as 2 2 cm yellowish neoplasm in the lower part of the left breast . Blood biochemistry was performed to evaluate the post - operative status of certain compounds relating to lipid methabolism . The analyses of clinical biochemistry revealed that majority of studied parameters were within the normal ranges: triglycerides 0.74 mmol / l (normal range: <1.7), cholesterol 4.24 mmol / l (normal range: <5), high - density lipoprotein cholesterol 2.04 mmol / l (normal range:> 1.2), low - density lipoprotein cholesterol 1.9 mmol / l (normal range: <3), very low - density lipoprotein cholesterol 0.34 mmol / l (normal range: 0.261.04), apolipoprotein a1 1.33 g / l (normal range: 0.762.1), apolipoprotein b 0.58 g / l (normal range: 0.461.42), lipoprotein (a) 9.59 mg / dl (normal range: <30). Considering the findings and patient s desire to reconstruct the breast, we proceeded with the excision of the remained xanthoma tissue and the delayed secondary breast augmentation was scheduled (figure 4). Thus, a total capsulectomy was performed and new implants (450 ml, round shaped, polytech health & aesthetics, germany) were placed in the submuscular position . The 6-months follow up revealed good results with no post - operative complications clinically or on ultrasound . As part of the routine assessment, health - related quality of life (hrqol) was evaluated before surgery, after implant removal and 6 months after secondary breast augmentation . An eq-5d-5l instrument with a visual analogue scale (vas) was used to assess self - rated overall health status (http://www.euroqol.org/euroqol group, netherlands) according to the previously published protocol . The patient reported no problems related to physical activity, but a problem in the anxiety / depression domain was detected after implants removal; this returned to normal after the breast implantation . Self - rated overall health status revealed a decrease from 50 vas units preoperatively to 30 units after implants removal . However, 90 vas units were reported 6 months after the placement of the new implants . In this study, we reported an unusual case of a ruptured pip implant associated with breast xanthoma . This neoplasm is a rare lesion of the breast and an uncommon complication of pip implant rupture . To the best of our knowledge, xanthoma is not included in the list of clinical findings in the current opinion of the scientific committee on emerging and newly identified health risks of european commission (scenihr, february, 2014). According to scenihr and other studies, commonly reported signs of the pip implant rupture include breast pain, breast and axillary lymphadenopathy, and palpable breast mass associating with migration of silicone gel . In the current case, we did not observe any of these signs, which might indicate a different clinical course for patients with xanthoma and micro ruptured pip, also supported by the findings from other studies . Another differential diagnosis to consider in patients with a breast mass following breast augmentation is anaplastic large cell lymphoma (alcl). Although alcl is a rare breast malignancy, it is reported as an implant - associated malignant neoplasm developing due to a chronic periprosthetic inflammation. [(7] however, no clear association between pip implants and alcl has been yet confirmed according to scenihr or other investigations . It is also worth to mention, that before the surgery we were unaware of any seroma in the breast and did not perform any fluid aspiration and cytological evaluation . However, an excisional biopsy of the tumor with histhopatological assessment had been performed with following immunohistochemistry, which was considered sufficient to describe the morphological patterns of the tumor and rule out alcl . Apart from alcl, various mesenchymal tumors (i.e. Fibromatosis, lipomatous tumors or sarcomas) are known to be associated with breast silicone implants . These neoplasms are infrequent and differential diagnosis could be established using histopathological analyses along with ihc staining for s100 protein . Although malignant mesenchymal tumors were not reported among patients with ruptured pip implants, we performed ihc analyses of s100 expression in our patient, which is in agreement with other studies . Previously, xanthogranulomatous inflammatory processes in breast were demonstrated in patients with implant rupture, breast cancer patient, or individuals without history of breast lesions . Similarly to hernanz et al . We did not observe any specific symptoms of xanthoma, unlike hussain et al . Who reported an abnormal mass in a breast cancer patient, possibly indicating different mechanisms of xanthoma pathogenesis . An association between xanthoma and foreign body reaction is a rare observation and was previously demonstrated in several case reports . According to the data from these studies xanthoma was associated with: oophoritis as a reaction to talcum powder, with cystitis secondary to sutures, as well as with cholecystitis as a reaction to gallstones . Literature search revealed no evidence of association between breast xanthoma and foreign body reaction . In our study, the microrupture of the pip device was suspected only after removal of the left implant . The risk of rupture is known and it was previously shown in a study on elastomeric properties of pip implants that detected a random reduction of thickness and defects of microscopical structures of the shell . Moreover, the hypothesis of microscopical structural defects is supported by the presence of the yellow color of the ruptured implant in our case . This may arise due to absorption of the fat - soluble compounds due to a high permeability of the pip shell . Similarly to other studies we observed some fluid effusion during implant removal as a result of synovial metaplasia associating with implant rupture . Finally, we also identified a negative impact of implants removal and neoplasm identification on hrqol; levels of anxiety and depression increased postoperatively, but improved 6 months after the secondary breast augmentation and tumor related reassurance . To summarize, we report a case of breast xanthoma following breast augmentation associated with an asymptomatic microrupture of the pip implant . Current study supports findings of other papers investigating larger cohorts of patients with pip implants; it also raises awareness of possible risks among individuals without clinical symptoms of implant rupture and leakage of the silicone gel . In asymptomatic patients who would like to keep their pip implants we recommend more intensive clinical surveillance with the breast ultrasound screening.
Invasive meningococcal disease (imd) is due to infection with the gram - negative bacterium neisseria meningitidis (n. meningitidis). Although fulminant septicemia is less common, it is highly fatal, even if treated . Approximately 500 000 cases occur worldwide annually, resulting in approximately 50 000 deaths and severe long - term complications in up to 20% of survivors . Deafness, intellectual and learning impairment, epilepsy, and other neurological deficits are frequent sequelae that lead to long - term reduction in quality of life . According to the world health organisation (who) estimates, the overall notification rate of imd in europe ranges from 0.214 cases per 100 000 in the general population . Although the rates of imd can be low in european and other industrialized countries, the disease is potentially devastating, with a case mortality rate that has remained at about 510% despite treatment . In europe, the highest numbers of confirmed imd cases are reported in children younger than 5 y of age (7.37 per 100 000), followed by children aged 1524 y (1.44 per 100 000). Most of these cases of imd occur sporadically, although small local outbreaks are not uncommon . While the majority of imd infections are caused by n. meningitidis serogroups a, b, c, x, w-135, or y, their relative prevalence has varied considerably over time and by geographical location, making trends in disease epidemiology unpredictable . In europe, the majority of imd cases (85%) are caused by serogroups b and c, while serogroup y is the third most frequently reported cause (3% in 2008, and 4% in 2009). Overall, the number of cases of imd attributable to serogroup y increased by 42% across european countries between 2007 and 2009 . However, the incidence of n. meningitidis infection due to serogroup c has declined since the introduction of the meningococcal group c conjugate vaccine (mcc) in some european countries while the incidence of imd across europe has also changed . Active surveillance is crucial to assess the epidemiology and burden of imd, as well as the impact of vaccination . In european countries, in which adequate surveillance systems have been in place for> 10 y, long - term surveillance has detected large reductions in meningococcal serogroup c disease following the introduction of the mcc . However, the scarcity of comprehensive country - specific data on the current burden of meningococcal disease in turkey arises from the lack of homogenous surveillance system, making it difficult to understand and to predict the dynamic changes in serogroup - specific epidemiology . Meningococcal conjugate acwy vaccine is used for both individual protection (e.g., target groups such as hajj pilgrims, military recruits, or teenagers in the united states) and mass campaign vaccinations . It is established that mcv has a great impact in reducing meningitis if used at large scale, such as the use of menc conjugated vaccine in the uk . While commonly used meningococcal vaccines in europe cover serogroups a, c, y, and w-135, an effective vaccine against serogroup b has not been available until recently . A quadrivalent protein - based serogroup b vaccine developed by novartis vaccines and diagnostics has been licensed in the eu for infant vaccination . Although its use has not been implemented in large - scale vaccination programmes, phase iii studies have demonstrated that the vaccine has the potential to protect against 78% of all imd - causative serogroup b strains . Lack of systemic surveillance data on serogroup - specific meningococcal epidemiology complicates the decision to be made by health authorities with regard to implementation and choice of available meningococcal vaccines . The purpose of this review is to provide up - to - date information on the epidemiological situation regarding the burden of imd in turkey . In turkey, data available on the burden of imd at the national level are based on records collected by the turkish statistical institute (tsi) and by the ministry of health . According to ministry of health data, between 1989 and 1999, the incidence of imd varied between 1 and 35 cases per 100 000 and the mortality rate varied between 0.71 and 2.62 per million cases . The tsi reports that meningococcal infections were responsible for 10.2% (1336) of all deaths in children under 5 y of age in year 2008 . Tsi reports 21, 14, and 15 deaths from meningococcal infections in all age groups in 2010, 2011, and 2012, respectively based on icd-10 coding system . These contradictory data might be due to either the notification procedure (report of death due to imd or report of newly identified imd cases) or the identification of causes . The current situation on meningococcal epidemiology may be better reflected by the prospective multicenter sentinel surveillance for childhood bacterial meningitis conducted by 2 groups since year 2005 . One of the investigator - initiated sentinel surveillance studies was conducted by ceyhan et al . Between february 16, 2005, through february 15, 2006, for acute bacterial meningitis among children admitted to 12 participating hospitals from 7 geographic areas and 12 health centers in 9 cities . This study reports that n. meningitidis was the leading cause of bacterial meningitis in children aged <1 y (56.5%) followed by those aged 14 y. among the samples that were positive for n. meningitidis following pcr analysis, serogroup w-135 was the cause of most infections59 (42.7%) cases were due to serogroup w-135, 43 (31.1%) were due to serogroup b, 3 (2.2%) were due to serogroup y, and 1 (0.7%) was due to serogroup a. there were no cases with a positive result for serogroup c. in this study, serogroup w-135 was also more common in children aged 416 y, while serogroup b was slightly more common in children aged <3 y. n. meningitidis serogroup w-135 was more prominent than the other meningococcal serogroups in the southeast anatolia while n. meningitidis serogroup b was much more common in the marmara (northwestern turkey) and the central region . During ongoing surveillance by ceyhan et al . Between 20072009, while the overall imd incidence was stable, the prevalence of imd due to serogroup b was reported to increase to 35% and the prevalence of serogroup w-135 decreased . Interestingly, the same group states that during the first 9 mo of 2011, serogroup w135 was the predominant serogroup, followed by serogroup a, and serogroup b was observed in only 2.5% of cases . Another nationwide prospective rt - pcr - based surveillance for childhood bacterial meningitis was conducted between july 2006 and january 2009 and the turkish ministry of health with participation of 37 referral hospitals located in 23 cities in 7 geographic regions of the country . Rt - pcr detected bacterial dna in 246 (29%) of 841 csf specimens from children with suspected bacterial meningitis, of which 131 (53%) were due to streptococcus pneumoniae, 47 (19%) were due to neisseria meningitidis, and 40 (16%) were due to hemophilus influenzae type b. in this study, 29 (62%) of 47 n. meningitidis isolates were determined as serogroup b, 2 (4%) serogroup c, 1 (2%) serogroup x, 1 (2%) serogroup a, 1 (2%) serogroup w135, and 13 (28%) other serogroups (undetermined). Sixteen (32%) of n. meningitidis were detected from the marmara (north - western turkey) region and only 5 (11%) from the southeast anatolia . To prevent imd among young infants, protection needs to be achieved early in life . Since the introduction of the first meningococcal conjugate vaccines in 1999, remarkable progress has been made in reducing the morbidity and mortality caused by meningococcal disease . Studies have demonstrated that meningococcal c conjugate (mcc) vaccination confers protection in infancy (012 mo) from the first dose but this protection is short - term . However, administration of a booster dose early in the second year of life results in longer protection . The burden of imd is the highest among infants aged <1 y (2.6 cases per 100 000 persons) in the us . Among infants younger than 1 y of age, more than 50% of cases it was recently reported that bacterial meningitis was most frequently observed in the first 7 mo of life, regardless of the etiologic agent . All meningococcal meningitis cases occurred in those <6 mo of age and mostly in those <3 mo of age . All cases in the youngest infants were due to meningococcal serogroup b and w135 in turkey . If meningococcal vaccines against men b and serogroups a, c, w135, y with early infant indications may also be registered, we would have an opportunity to protect young infants starting from 2 mo of age in turkey . The growing - complexity of national immunization programme (nip) in turkey has resulted in as many as 4 required injections during a single healthy baby visit . The number of injections in a well - baby visit in the us is up to 7 . Protecting against vaccine preventable meningococcal serogroups will result in an increase in the number of injections up to 6 in turkey, but this is acceptable when we compare with developed countries (table 1) current nip schedule . Contrasting data obtained from different surveillance studies may be related to regional differences in the weight of subjects enrolled from different regions of the country or methods used . Argues that higher rates of serogroup w-135 since 2005 in their earlier study is due to 100 000 turkish hajj pilgrims traveling to saudi arabia every year, which was also seen in malaysia and singapore . The results reported by bakir et al . Showing the predominance of serogroup b may be explained by the millions of the turkish diaspora living in europe, where serogroup b is predominant, who travel back and forth to the country many times annually . This is a more likely explanation of the existing sero - epidemiology because other explanations of the sharp decrease of serogroup b imd from 35% down to 2.5% in only a few years in the absence of serogroup - specific vaccination are unlikely . This variation may also reflect the introduction and implementation of detection techniques such as the pcr . Sero - epidemiology data on imd in 2 different surveillance studies in turkey at the same time periods had different results . This complicates the decision to be made by health authorities on the implementation and the type of meningococcal vaccine to be chosen . In the light of available surveillance data in turkey, a vaccine effective against meningococcus serogroup b as well as serogroup systematic continuous surveillance is warranted to measure the urgency of need and effectiveness of a vaccination program for imd . The who recommends the introduction of appropriate large - scale meningococcal vaccination programmes in countries with high (> 10 cases/100 000 population / year) or intermediate (210 cases/100 000 population / year) imd incidence rates, and in countries with frequent epidemics . In countries with lower imd incidence rates (<2 cases/100 000 population / year), vaccination is recommended for defined risk groups, including children and young adults residing in close communities, laboratory workers at risk of exposure, travelers to high - endemic areas and immunodeficient individuals . Overall, each country should choose the appropriate vaccination program depending on the locally prevalent serogroup of n. meningitidis . Conjugate vaccines are preferred over polysaccharide vaccines due to their potential for herd protection, immunologic memory and their increased immunogenicity, particularly in children <2 y of age.
Correct estimation of protein concentration in aqueous biological samples is an essential step in biochemical research and the pharmaceutical industry impacting downstream applications ranging from biomarker studies to quality control in the production of biotherapeutics . Determination of protein concentration in most popular assays is accomplished via comparison to a sequence - based extinction coefficient (uv measurements) or in relation to a standard (traditional dye - based absorbance assays such as bca, lowry, and bradford) [13]. However, most recent reviews point out the fact that, due to assay - specific limitations, there is no single method dominating protein quantification [1, 3]. While uv based quantification is reliant upon absorbance of tryptophan, tyrosine, and cysteine at 280 nm [4, 5], a protein's extinction coefficient can vary widely with sequence . In fact, a greater than two - fold difference is observed between extinction coefficients calculated for albumin and immunoglobulin g. also, mixtures of unknown composition (most notably, biologically relevant samples) cannot be confidently quantified based on absorption at 280 nm . Moreover, amino acid analysis (aaa) is capable of delivering possibly the most accurate protein quantitation, but the method is expensive with lengthy turnaround times if samples are sent to a third party for analysis . Performed in - house, aaa requires time - consuming sample manipulation and specialized equipment . Infrared (ir) spectroscopy is a powerful and growing analytical tool for the detection and analysis of biomedically relevant compounds such as proteins, lipids, carbohydrates, and nucleic acids [69]. Midinfrared (mir) spectroscopy is based on the absorption of radiation in the approximate range 4000400 cm and is currently considered among the most promising spectroscopic techniques for application in biomedical research and diagnostics [1012]. Also, mir spectroscopy has been recognized as a viable method for lipid analysis [1316] and is one of the oldest and well established experimental techniques for the analysis of protein and carbohydrate structure [1721]. Attenuated total reflection (atr) spectroscopy and transmission flow - through cells used in combination with complex chemometric data analysis have recently enabled fast quantitative protein analysis directly from aqueous samples [2229]. However, while flow - through cells for protein quantification allow for automated sample analysis, these devices have a propensity for clogging, requiring frequent, time - consuming cleaning procedures . While atr cells are more robust, the required sample volumes (1025 l) may be considered significant, particularly in situations where biological samples, limited by both volume and repeat access, are to be analyzed . However, due to enhanced sensitivity, the multivariate approach (e.g., partial least - squares analysis (pls)) is usually applied to data analysis [14, 2229] reducing attractiveness of the method for routine application in biological laboratories that usually lack the time and expertise required for method development and validation . To our knowledge, an easy, fast, and robust method utilizing atr and univariate data analysis for accurate and reproducible protein quantitation from complex biological samples in a dried format has not yet been reported . Several amide bands have been identified in mir spectroscopy allowing for characterization and quantification of proteins . Among these, amide i (16001690 cm) and amide ii (14801575 cm) are recognized as the most representative of all vibration modes [17, 18]. The amide i absorption consists predominantly of c = o stretching vibration (about 80%) with a minor contribution from the c n stretching vibration (20%), while the amide ii band is more equally split between n h bending (60%) and c until recently, analysis of the amide i and ii absorption regions has been severely hampered in aqueous samples due to spectral interference of a strong water absorption band at 15001700 cm . While the advent of atr and flow - through cells has circumvented the water interference issues, their utility is limited due to practical drawbacks which include instrumentation cost, expertise, and time required for method development and accurate data analysis . A simple univariate (beer - lambert) analysis, applied in the method reported here, relies on the integration of amide i band and uses directly searchable absorptions on the spectrum curve . Reported protein quantification by mir, while still based on a curve - fitting technique, presents substantial advantages over other current methodologies like uv absorbance or colorimetric assays . First, unlike uv absorbance at 280 nm, mir - based protein quantitation is much less dependent upon amino acid composition . Also, amide bond quantitation by mir is not subject to signal interference from many common biological buffer components such as detergents, reducing agents, and chelators, demonstrating superiority over standard colorimetric assays . Moreover, the mir - based method enables fast and accurate peptide quantitation providing researchers with a robust substitute for time - consuming amino acid analysis . However, when compared to uv spectroscopy, ir instruments are more costly and require technical expertise as well as time - consuming method development preventing widespread applicability of mir for general protein quantification . Thus, an instrument or method, allowing for simple and more cost - effective analysis of samples, while at the same time combining the advantages of atr and flow - through based systems, would be of unique value . Additionally, in contrast to uv or any other known protein quantitation method, simple, mir - based analysis can also be employed for simultaneous analysis of lipids or detergents [14, 3036]. Due to their complex and varied chemical composition, characteristic lipid bands, such as the aliphatic group stretching (30002800 cm), ester c = o stretching (around 1740 cm), or phosphate stretching (around 1235 cm) permit qualitative and quantitative analysis of lipid content [14, 31, 32]. Due to similarities in composition, detergents possess mir absorption spectra that closely resemble lipids present in the cell membrane and can be analyzed along with lipids . This commonality offers researchers a means for monitoring the efficiency of residual detergent removal from lysate - derived samples prior to downstream application . The method reported in this paper uses a hydrophilic polytetrafluoroethylene (ptfe) membrane engineered for sample application and retention . The membrane is transparent in the mir regions used for protein and lipid / detergent analysis . The size of the sample application spot was further designed to be slightly smaller than the ir beam, ensuring probing of the entire sample . This constraining feature is important in enabling simple, univariate, quantitative measurements . In comparison to currently available techniques and instruments (e.g., hts - xt system by bruker optics), the method described here is technically less complex; thus, it is more cost - effective and especially well suited for routine analysis of small sample numbers . Also, given the minimal volume (2 l) required for measurement, this method can be successfully applied for the analysis of precious material available in limited quantities . The presented paper provides a detailed description of method development along with a comparison to other protein quantification techniques routinely used in biological laboratories, with respect to the required sample volume, time - consumption, labor - intensity, accuracy, and robustness . In addition to general protein quantification, the ability for simultaneous lipid analysis was also investigated . Well characterized solutions of several purified proteins, protein mixtures, and examples of lipids and detergents were used to assess quantification limits, dynamic range, linearity, accuracy, precision, and robustness of the reported method . Further applicability of the method for the analysis of biological samples was demonstrated using cell lysates and tissue homogenates . In order to avoid cleaning steps in between series of successive measurements, a disposable device for sample application was designed . From several investigated options, a membrane - based system emerged as the most cost - efficient and the easiest to use, predominantly because it allowed rapid water removal and drying of the sample . Various membranes were tested (data not shown); ultimately a hydrophilic ptfe - based membrane was selected due to its transparency within the relevant mir regions, allowing for the quantification of proteins and lipids . As shown in figure 1(a), the membrane spectrum contains a strong signal between 1100 and 1300 cm but is transparent in the mir region above 1300 cm used for the analysis of biological samples reported here . The hydrophilic ptfe membrane (30 m thick) is mounted on cardboard frame to allow easier handling and provide a place to record sample names, while also assuring consistent presentation for interrogation by the mir beam . The card configuration contains four analysis areas designed for easy application and containment of the entire sample within the focused ir beam . The hydrophilic spot for sample application (4.5 mm diameter; see figure 1(b) and supplementary figure s1a, the supplementary material will be available online at http://dx.doi.org/10.1155/2014/657079 .) Is surrounded by a hydrophobic ring generated by mechanical removal of hydrophilic surface; the ring prevents analyte dispersal promoting precise presentation of the entire sample to the mir beam (diameter 6.5 mm) [37, 38]. The reported method permits two ways of drying aqueous sample spotted onto ptfe membrane . On average, 2 l of sample placed on the membrane spot requires around 10 to 15 minutes to dry completely at room temperature . The sample can also be dried within around 30 seconds, on average, by the heater and fan located in the sample carrier chamber of the dedicated ftir spectrometer . 4-spot card was selected for the final configuration to allow rapid analysis of an individual sample in triplicate or three separate samples in comparison to an appropriate background buffer spot . Measurements were performed using the direct detect spectrometer (emd millipore), a fourier transform (ft)-ir system analyzing the spectral range 5006000 cm . A classical univariate quantification method, based on the fact that mir spectroscopy of nonscattering samples obeys beer's law, was applied to data analysis . For each protein and lipid / detergent measurement, a buffer subtraction step was performed only on regions of the spectra used for amide i and/or aliphatic symmetric stretching signal analysis . Proteins are quantified using the amide i region (17021602 cm) only; thus, all other regions of the mir spectrum are not critical for the analysis . Consequently, for accurate protein quantification, it was sufficient to subtract buffer in the region (18501350 cm) surrounding amide i area . The same procedure was applied to aliphatic stretching region used for lipid / detergent analysis . Buffer subtraction is performed between 3100 and 2600 cm; the rest of mir spectra is not being utilized . Amide i band integration is performed by anchoring the baseline at fixed points between 1702 and 1602 cm and determining the amide i signal value at the highest point between these wavenumbers . Two additional integration methods (not discussed here) accounting for possible buffer interference have also been developed . Aliphatic symmetric stretching band integration is performed by anchoring the baseline between 2990 and 2810 cm and determining the signal strength at the highest point between 2868 and 2838 cm . To compare the theoretical variability of various quantitation methods, a protein database was examined . For example, the theoretical extinction coefficient at 280 nm is based on the number of tryptophan, tyrosine, and cysteine residues in the protein . The mir - based analysis is dependent on the number of amide bonds, which not only link the amino acids together but are also present in the side chains of asparagine and glutamine . To automate the examination of the database, a visual basic for applications (vba) program was written for excel (microsoft) to check all 20233 proteins in the human protein database (uniprot release 2012_10,) for (1) total count of amino acids, (2) number of glutamines, (3) number of asparagines, (4) number of tryptophans, (5) total molecular weight, and (6) theoretical molar extinction coefficient at 280 nm . The theoretical molar extinction coefficient was estimated by summing the number of tryptophans in the protein multiplied by 5690, the number of tyrosines by 1280, and the number of cysteines by 120 . This molar extinction coefficient was converted to a mass coefficient by dividing by the molecular weight of the protein to derive an extinction coefficient with units of au ml mg cm . The average mass per residue was estimated by dividing the molecular weight by the number of amino acids in the protein . The number of amides was determined by adding the number of asparagines and glutamines to the total number of amino acids and subtracting one . The average mass per amide was determined by dividing the molecular weight by the number of amides . Sample protein concentrations were determined with reference to a calibration curve; the method requires prior generation of a reusable standard curve derived from serial dilution of a reference protein . For all reported experiments, the system was calibrated using bovine serum albumin (bsa) from the national institute of standards and technology (nist) diluted in phosphate - buffered saline (pbs). A series of ten concentration points (0.1255 mg / ml) was used to generate the protein calibration curve . All reported measurements were performed in triplicate using 2 l of sample solution per membrane position . From pilot experiments (not discussed here), 2 l was chosen as a trade - off between minimum sample volume required and acceptable quantitation results . Although smaller quantities could be applied to the membrane, human error in the pipetting of such low volumes would introduce additional variability and thus was not considered further . Performance of the method, within the standard curve - defined dynamic range, was assessed using pure protein solutions as well as protein mixtures . Pure protein solutions were prepared with lysozyme solubilized in milli - q water and protein a in pbs . Protein mixtures consisted of bsa, cytochrome c, alcohol dehydrogenase, human transferrin, concanavalin a, lysozyme, -globulins from rabbit, and protein a in pbs, used at two distinct concentrations . For reference purposes, the concentration of all examined protein solutions was determined by amino acid analysis (aaa). To obtain a 1 mg / ml solution analyzed by mir - based quantitation, a lysozyme sample (aaa determination at 68 mg / ml) was diluted with pbs at 1/68 ratio . Protein a (aaa determination at 52 mg / ml) was diluted, also with pbs, 1/13 to obtain 4 mg / ml sample . The protein mixture (aaa determination at 1.98 mg / ml) was used at the aaa estimated concentration as well as a 1/8 dilution . Potential interference from detergents and reducing agents, which are known to impact bradford and lowry protein determination assays, was investigated using known concentrations of bsa in pbs (from 0.25 to 2 mg / ml) spiked with increasing amount of investigated additive . Influence of tween 20 and triton x-100 on protein quantitation was tested in the range of 0.15% detergent . -mercaptoethanol (bme) and dl - dithiothreitol (dtt) were analyzed at up to 150 mm and 50 mm, respectively . Possible obstruction of protein quantification due to the presence of sodium dodecyl sulfate (sds) was analyzed using buffers containing up to 1% of the detergent . While all investigated detergents and reducing agents produced mir spectra, none was absorbing within the region used for protein quantification (17001600 cm). Empirical sample concentration values were determined by interpolation from calibration curves developed for each lipid or detergent analyzed . The reported method relied on strength of bands produced by vibrations of aliphatic groups (30002800 cm). For the experiments reported here, the system was calibrated using tetracosanoic acid in chloroform and 3-[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate (chaps) in pbs . A series of seven concentrations (0.251.75 mg / ml) was used to generate a calibration curve for tetracosanoic acid . For chaps, the calibration curve was also derived from seven concentration points (0.254%). To investigate whether protein and lipid can be quantified simultaneously in complex biological samples, tissue lysates, originating from breast cancer tissues, were analyzed . Surgical frozen tissue, derived from a human breast ductal carcinoma, was obtained from analytical biological services inc . And divided into 2 equal samples (115 mg each). Tissue was covered with 2 ml 1x ripa buffer (emd millipore; final composition: 50 mm tris - hcl ph 7.4, 150 mm nacl, 0.25% deoxycholic acid, 1% np-40, and 1 mm edta) or cytobuster protein extraction reagent (emd millipore; composition not available), both supplemented with an inhibitor cocktail and disrupted with a glass tissue homogenizer . Liquid fractions from homogenized and lysed tissue were transferred to separate tubes (fraction 1, supplementary figure s2) while the remaining pieces of tissue were covered with fresh volume of corresponding lysis buffer and homogenized again (fraction 2, supplementary figure s2). Protein containing fractions (bottom of the supernatant layers (p1a and p2a)) were separated and analyzed, using mir - based method, for protein and lipid content . The top layers were saved for future lipid analysis . To remove substantial amounts of lipids detected in both protein fractions, an additional centrifugation step (15,000 g for 10 minutes) resulting layers, top lipid fraction (l1b and l2b), and bottom protein fractions (p1b and p2b) were analyzed, using mir - based method, for protein and lipid content . Lysates were prepared from mcf-7 (atcc htb-22) breast cancer cells (1.4 10 cells per sample) in 1 ml of either 1x ripa buffer or cytobuster protein extraction reagent, both supplemented with protease inhibitor cocktail, by homogenization for few seconds with a handheld homogenizer followed by centrifugation at 15,000 g for 10 minutes . The mir - based method was used to measure both protein and lipid content of the supernatant . Mir - based protein data was compared to the results obtained using bca protein assay kit (thermo scientific). Mir - based analysis of biological samples was achieved by the application of 2 l aqueous samples onto hydrophilic ptfe membrane and the presentation of dried sample to the mir beam . While znse and calcium fluoride are commonly used in mir spectroscopy, they are cost - prohibitive for single - use applications . Also, the intention of the presented method was to avoid cleaning of the deposition window after each use and ptfe - based single - use card permitted such application . The ptfe membrane displays strong signal between 1100 and 1300 cm (figure 1(a)); however, it is relatively inert in the remaining mir spectrum, including the amide i region used for protein quantitation and the aliphatic group stretching region used for lipid and detergent measurement . During development, it became clear that precise overlap between the site of sample application and the mir beam is critical for quantitative accuracy . In order to achieve highly reproducible sample presentation to the mir beam, a hydrophobic ring was introduced through mechanical membrane crushing and removal of the hydrophilic surface . Introduction of this ring allowed for precise confinement of applied sample within the designated spot . Spot was surrounded by a hydrophobic embossment (figure 1(b)) preventing dispersion of the aqueous sample during application and drying . Design significantly improved the overlap between the mir beam intensity profile, being the strongest in the center of the spotting area, and the dried sample area, thereby promoting higher assay accuracy . Because the comparative measurements are performed on dried samples, and therefore volume - dependent, reproducible and precise deposition of the employed 2 l onto the membrane is critical . All results reported here were obtained using manual pipette (rainin, pipet - plus r2) with a latch trigger mechanism and aspiration rate controller, features that improve precision from sample to sample and from operator to operator . In order to enable a fast, cost - effective, and simple analysis method, although multivariate quantification procedures can provide better sensitivity when applied to the analysis of complex samples, they require ir expertise . As the method described here is intended for general protein quantification that is rapid and straightforward to non - ir specialists, the simpler univariate approach was pursued . The influence of protein secondary structure on amide i extinction coefficient (exact location of amide i band) has been well documented [17, 18, 40]. Different spectral regions within the amide i area were analyzed and the best results for general protein quantification were obtained for the region between 1702 and 1602 cm . Additionally, to account for possible buffer interference, a buffer signal (e.g., originating from buffer salts deposited and dried on the membrane) was subtracted from the protein signal . Investigation of various spectral regions considered for buffer signal subtraction delivered the most promising results for the region between 1850 and 1350 cm . Following subtraction, the strength of the remaining amide i signal was used to interpolate the estimated protein concentration from a known standard curve . Under standard conditions, aqueous samples spotted on hydrophilic materials, including ptfe membrane, dry forming a coffee ring effect where the majority of sample is preferentially deposited around the edges of a spot . Distribution of the coffee ring is strongly influenced by the nature of the sample buffer . Effect is displayed in water (supplementary figure s1b) while use of buffers, such as pbs, reduces water tension allowing more uniform sample distribution across the membrane surface (supplementary figure s1c). In the presence of detergent, the buffer - dependent differences in dried sample distribution are highly reproducible but require generation of a reusable calibration curve and confirmation of linearity for each matrix to ensure the most accurate results . One major limitation of uv / vis - based protein quantitation is its strict dependence on amino acid composition, in particular the presence of tryptophan and tyrosine . Comparative analysis between amide i - derived signal and uv / vis absorbance at 280 nm was performed for a range of concentrations of bsa, rabbit igg, and protein a (figure 2). Unlike uv / vis, mir - based analysis was unaffected by the proteins' vast differences in amino acid composition or size . In reviewing the human protein database (table 1), it is clear that many protein properties, such as protein length and mass, the number of specific amino acids, and even the predicted extinction coefficients at 280 nm, vary widely from protein to protein . However, the average mass per residue tends to be surprisingly consistent considering that individual residue contributions can range from 57 da for glycine to 186 da for tryptophan . Further, since the number of amide bonds in a protein or peptide is only one less than the number of residues, plus the number of asparagines and glutamines, the mass per amide bond is also very consistent, even for short proteins and peptides . One could therefore postulate that mir absorbance (on a mass basis, not a molar basis) would be very consistent and that a single protein could serve as a reliable reference for just about any other protein or peptide, assuming that its average residue mass did not deviate significantly from the typical 110 da per residue (e.g., polyglycine or polytryptophan would be expected to deviate). In order to test the mir - based protein quantitation method, a series of ten dilutions (in triplicate), spanning the range 0.1255 mg / ml, was used to prepare a calibration curve . Amide i signal strength delivered by each concentration point was fitted to a regression line that was ultimately used to determine protein concentration in the analyzed samples (figure 3). Accuracy of mir - based concentration estimation was determined using single - protein solutions as well as a protein mixture . Concentration values were derived by interpolation from a bsa reference curve and compared to amino acid analysis (aaa), a method recognized currently as the gold standard for estimating protein concentration . First, a 1 mg / ml lysozyme sample in pbs, prepared by 1/68 dilution of a 68 mg / ml sample (concentration determined by aaa) was found by the mir method to be 0.922 0.061 mg / ml . Next, protein a (52 mg / ml by aaa) was diluted 1/13 with pbs to obtain a 4 mg / ml solution . When analyzed by mir, a concentration of 4.047 0.184 mg / ml was determined . Lastly, a mixture of proteins (1.98 mg / ml by aaa) was quantified at 1.944 0.028 mg / ml; a 1/8 dilution of the same sample (expected 0.25 mg / ml) delivered a concentration of 0.273 0.028 mg / ml when analyzed by the mir - based method . Overall, the method showed very good accuracy and linearity in response to samples between 0.25 mg / ml and 5 mg / ml . Measurement accuracy for samples below 0.25 mg / ml decreased significantly; thus, a limit of 0.25 mg / ml was selected for this method . In regard to the upper detection limits, a small set of samples up to 100 mg / ml was successfully measured (data not shown). However, as the intended application of this method was for the analysis of precious samples, such high sample concentrations were not analyzed within the context of this paper . Sample cards prepared using protein mixtures, at 0.25 and 1.98 mg / ml (each in triplicate; total of 9 spots per sample), were analyzed multiple times to determine measurement reproducibility . Each card (3 protein spots + 1 control spot) was measured four times and the concentrations obtained for each position as well as for an entire card were compared . Assuring correct and complete deposition of the samples onto the membrane, the average concentrations were 0.277 mg / ml (4.9% cv) and 1.942 mg / ml (1.5% cv), respectively . The precision at each individual card position was measured, with cvs of 1.3 and 0.3%, respectively, at position 2 . Position 3 delivered data with cvs of 1.2 and 0.1%, while cvs at position 4 were at 2.3 and 0.1%, respectively . Protein quantitation method reported here relies on mir - based evaluation of biological samples (from original buffers) spotted and dried onto a membrane . Therefore, measurements in the presence of buffer salts containing amide bonds, such as urea, can potentially affect the accuracy of the results . In the majority of cases, interference from buffer salts is accounted for in the buffer subtraction step; however, since the method relies on a simple univariate approach, high concentrations of interfering components can still overwhelm the protein signal and preclude proper measurement . Reducing agents and detergents are known to interfere with colorimetric protein quantitation methods . To elucidate whether these agents would also interfere with mir - based measurements, the results reveal that accurate mir - based protein quantitation can be achieved in the presence of up to 50 mm dithiothreitol (dtt) (figure 4(a)) and up to 150 mm of -mercaptoethanol (spectra not shown). In addition, the infrared absorption pattern of sodium dodecyl sulfate (sds; analyzed up to 1%) did not overlap with the protein region allowing unbiased protein quantification in the presence of this detergent (figure 4(b)). Method performance was also unaltered by the presence of up to 5% tween 20 (data not shown) or triton x-100 (figure 4(c)). At the same time, the presence of amide containing detergent, like, for example, chaps, might interfere with or prevent accurate protein quantitation . Also, since detergents are known to bind to proteins with varying affinities, subtracting the buffer contribution might not always be sufficient for accurate analysis . For example, in cases when analyzed proteins bind a significant amount of the detergent, the bound detergent will most likely not be accounted for by the blank influencing the accuracy of concentration determination . By virtue of its ability to detect the spectral absorbance bands for many structural entities, the mir - based method is not limited to the analysis of protein species . Given the large number of lipid - associated absorption bands, application of the described method for the quantification of lipid biomolecules h stretching region (28502870 cm) provides an ideal candidate for the analysis of lipids and detergents . While a single - protein standard can be used to quantify a wide range of protein and peptide samples, due to the vast complexity and variability among lipids and detergents, it was speculated that each quantitation would require the generation of a standard curve using the specific species in question . Experiments using various lipids, including fatty acids (supplementary figure s3a), phospholipids, triglycerides, liposaccharides, and many detergents, demonstrated a high degree of variability in the detection limits and slope of the employed calibration curves, thus confirming requirement for individualized calibrations for each of the analyzed lipids and detergents . In order to validate the compatibility of mir - based quantitation method for lipid and detergent analysis, the ftir spectrometer was initially calibrated using either tetracosanoic acid (in chloroform) or chaps (in pbs). Two concentration ranges (performed in triplicate), spanning 0.251.75 mg / ml (tetracosanoic acid) and 0.254% (chaps), were used to derive lipid and detergent calibration curves (supplementary figure s3b). The strength of symmetric c h vibration for each concentration was fitted to a regression line . The accuracy of concentration estimation within the established dynamic ranges for tetracosanoic acid and chaps was assessed using 0.8 mg / ml tetracosanoic acid and 1.8% chaps . The results showed that, for a well defined calibration range, the method was capable of estimating lipid and detergent concentration with low error . Assuring precise pipetting when applying the samples, mir - based quantitation of the tetracosanoic acid sample returned 0.853 0.14 mg / ml (2.4% cv) and chaps sample was quantified as 1.8 0.004% (2.3% cv). The experiments using several formulations of lysis buffers, like ripa and cytobuster protein extraction reagent, spiked with known concentration of bsa and measured alone, as well as in the presence of phospholipids (data not shown), demonstrated that the reported method allows accurate protein quantification from lysis buffers . To determine if the reported method can be further applied to more complex biological samples, protein content in variously prepared breast cancer cell line (mcf-7) lysates was measured and compared to values derived from a bca protein assay . Total protein content in the sample obtained using cytobuster protein extraction reagent was estimated at 2.4 mg / ml (bca assay) or 2.7 mg / ml (mir - based method). Protein concentration in samples lysed with ripa buffer was estimated at 3.4 mg / ml (bca assay) or 4.6 mg / ml (mir - based method). The results obtained using bca assay were consistently lower (10% and 26%, resp .) Than the mir - based method . For the two methods, the differences in estimated protein concentration were most likely caused by a combination of the following factors: presence of various detergents (documented to influence the accuracy of bca assay) in lysis buffers, documented inaccuracy of bca in the analysis of native proteins, an error associated with use of bsa as a standard in colorimetric assays, and the fact that accurate quantification of peptides by the bca assay could not be achieved without additional sample manipulations that are incompatible with biological material . The possibility that mir - based quantification is inflated by signal from nucleic acids present in cell lysates was excluded because the amount of nucleic acids generally present in such mixtures is significantly below the detection level of the reported method . The findings reported here are consistent with a previous report where the mir - based method was used to quantify protein content in crude human skin carcinoma cell lysates or to adjust protein concentration prior to mass spectrometry and nmr analysis [47, 48]. The method described here was able to detect and examine protein and lipid content of all analyzed samples simultaneously and selectively (figure 5(a)), in contrast with conventional analysis techniques such as uv spectroscopy . This dual functionality could enable the monitoring of changes in total lipid content and protein liberation yield, thereby simplifying and improving the analytical process . The efficacy of mir - based analysis for use in downstream sample qualification was evaluated during a short study of breast cancer cell lysate fractionation and biomarker detection . Breast tissue was chosen because it is documented to have a high fat content (69.9 22.9%). In the reported study, breast tissue lysates were prepared using ripa buffer and cytobuster protein extraction reagent . Following tissue homogenization, the efficiency of fat removal and total protein liberation during centrifugal extractions was monitored using the mir - based method (see supplementary figure s2 for separation flow chart). The collected spectral data were used to determine protein recovery across the centrifugal fractions (figure 5(b)) and to examine the efficiency of gradual fat removal from these samples (figure 5(c)). Information delivered by mir - based analysis was utilized in further sample manipulations facilitating faster and more consistent immunodetection of the investigated breast cancer biomarkers (study in progress). Fast and accurate quantification of proteins from complex aqueous biological samples such as plasma, cerebrospinal fluid, or cell / tissue lysates remains a challenge . Critical understanding of results from downstream applications is often dependent on proper preparation and accurate qualification of the applied samples . Classical methods for protein quantification, like uv and colorimetric assays, permit precise estimation of purified protein concentration but are less reliable when applied to the analysis of complex mixtures . While mir is a promising technique allowing accurate quantification in complex samples, existing techniques for mir - based protein quantification require regular time - consuming cleaning procedures (flow - through cells), larger sample volume (atr cells), or expertise in method development (atr of dried samples), thus precluding their suitability for fast analysis in a typical research laboratory . Although high - throughput mir sampling and analysis techniques are already available on the market, they are more suited for larger pharmaceutical laboratories that require recurring analysis of repetitive sample sets and possess the requisite analytical skills for effective chemometrics - based method development . Currently available instrumentation is often too costly or requires certain ir expertise to be easily adapted for general protein quantification by non - ir savvy personnel in small - scale laboratories or academia . The method developed and described herein relies on a simple, cost - effective approach permitting accurate quantification results based on a univariate sample analysis technique that does not require advanced ir expertise . The system relies on a membrane, transparent in most of the mir region, which permits robust analysis of aqueous samples in a dried format . The reported method is also compatible with organic solvents commonly used in peptide and lipid research . To achieve accurate quantitative results, strict adherence to a consistent loading volume between samples and controls is required . While a general calibration curve can be employed, the method is more accurate when a specific calibration curve is prepared for each buffer to be utilized . Based on the experimental data, a general lower quantification range was set to 0.25 mg / ml; for some samples, a detection limit as low as 0.1 mg / ml can be achieved . Because the developed method focuses solely on small volumes and biologically relevant samples, the upper detection limit was not investigated thoroughly . However, from the narrow set of experimental results, such limits can exceed 100 mg / ml . Although some buffer salts might not be compatible with the reported technique, in pbs, the method allows development of a general linear calibration between 0.25 mg / ml and 5 mg / ml . Accuracy and precision of the reported method, within the linear range, are comparable with results obtained by amino acid analysis, providing researchers with a fast and cost - effective alternative to other protein quantitation tools available today . Due to chemical and structural variation observed within lipids and detergents, mir signal strengths display considerable variability; for this reason, a universal standard for all lipids and detergents could not be identified . Therefore, quantitation of lipids and detergents requires development of separate standard curves for each of the analyzed compounds . In addition, qualitative analysis of mixtures or unknown compounds can be performed using a relative absorbance mode where the method delivers information about strength of mir signal without any comparison to a known standard . In summary, the mir - based method reported here enables simultaneous measurement of total protein recovery and monitoring of fat removal from lysed samples . This technique was also successfully applied to complex sample analysis during a small - scale investigation of surgical breast tissue processing and fractionation . Mir - based analysis facilitates more in - depth sample characterization and offers higher quality control over the sample preparation process . Given its unbiased biomolecular detection capabilities and amenability to liquid samples, many more applications are easily envisioned for this method.
The northern house mosquito, culex pipiens l. (diptera: culicidae), is a member of a species complex that includes vectors of lymphatic filariasis and several arboviral diseases, such as st . Louis encephalitis (sle), rift valley fever (rfv), and west nile virus (wnv). In the northeastern quadrant of the united states, c. pipiens recently has become important because of its role in the transmission of wnv . The virus was introduced into new york city in 1999 and is currently the most widespread arboviral disease in the u.s . (cdc, 2010). The blood - feeding pattern of c. pipiens (shifting from avian to human feeding within the transmission season) (edman and taylor, 1968; kilpatrick et al ., 2006), coupled with its high vector competence (turell et al ., 2005) and ability to carry wnv through the winter, has allowed the virus to spread from its point of origin and maintain transmission throughout the mosquito s range . Thus, c. pipiens is one of the major targets for mosquito vector control and surveillance in the u.s . Current methods of monitoring by abatement districts and health departments include centers for disease control (cdc) light traps and co2-baited traps, which mainly trap blood - seeking females, along with gravid traps, which target gravid females . Plant - derived attractants have the potential to act as surveillance - trap lures and, when combined with poison - laced sugar solutions (mller et al ., mosquitoes are attracted to various plant species, from which they obtain nectar and other juices . Sugar feeding by mosquitoes has a significant influence on dispersal (hocking, 1953; magnarelli, 1977) and vectorial capacity (gary and foster, 2001; gu et al ., 2011), and, contrary to long - held conjecture, is required by both males and females throughout the adult stage (downes, 1958; yuval, 1992; foster, 1995). Both sexes typically first visit plants soon after emergence . Males then require sugar at frequent intervals to maintain their energy reserves in order to join nightly mating swarms (yuval et al ., 1992). Females take sugar between blood meals, when they are digesting blood, or when they are gravid (clements, 1999; foster, 2008). Furthermore, females of most temperate - climate culex and anopheles species enter reproductive diapause in late summer, after which they no longer are attracted to blood hosts, but engage heavily in plant - sugar feeding (bowen, 1992a). The potential for plant volatiles to lure mosquitoes has been demonstrated in several laboratory behavioral assays that have used stimuli such as natural plant extracts (vargo and foster, 1982; jepson and healy, 1988; mauer and rowley, 1999) or single floral compounds (jhumur et al ., 2006). In field studies, bates (1949) reported the successful trapping of anopheline mosquitoes with plant and fruit baits; fruit also proved to be an effective attractant in cdc traps for c. tarsalis (reisen et al ., 1986). Sandholm and price (1962) observed that mosquitoes in the field were attracted to light - colored flowers with distinct fragrances; odor appears to be primarily responsible for long - range attraction, with visual cues playing a role at shorter range (thorsteinson and brust, 1962; healy and jepson, 1988; jepson and healy, 1988). Orientation to commercially obtained floral extracts and honey has been demonstrated for various mosquito species (thorsteinson and brust, 1962; hancock and foster, 1997; foster and takken, 2004). Schlein and mller (2008) and mller et al . (2008, 2010) reported dramatic population reductions of c. pipiens and other mosquito species by spraying a fruit - based sugar bait containing insecticide on vegetation surrounding larval habitats . Light - less cdc traps baited with the blossoms of tamarix jordanis were highly effective in trapping c. pipiens, and populations were reduced where these blossoms were treated with spinosad insecticide (schlein and mller, 2008). Flower species that elicit the highest attraction probably vary by region . During mid - summer in the u.s ., mosquitoes have been observed probing blossoms of common milkweed, asclepias syriaca, at rates disproportionate to their abundance relative to other flowering plants, with one study reporting 54 species occurring in the study area that did not serve as nectar sources (grimstad and defoliart, 1974). Another study collected 25 aedes vexans from one milkweed cluster in just 15 min (sandholm and price, 1962). The observed preference of insects for milkweed flowers, both day and night, possibly is due to its strong and distinctive fragrance, lighter - colored flowers, and greater nectar production (sandholm and price, 1962). Common milkweed is indigenous to eastern and midwestern north america, where its principal native pollinators are mainly large hymenoptera and lepidoptera (e.g., jennersten and morse, 1991). Mosquitoes are incapable of transferring milkweed pollinia and therefore function as nectar thieves, appearing to co - opt the attractive properties used by the pollinators to locate the flowers (foster, 1995). Solvent extracts of common milkweed flowers also are attractive to mosquitoes (vargo and foster, 1982; mauer and rowley, 1999), confirming that volatile chemicals are at least partly responsible for that attraction . Mauer and rowley (1999) determined the headspace profile of common milkweed flower to be predominantly 2-phenylethanol and benzyl alcohol; however, they found that a synthetic blend of these two compounds was not attractive to c. pipiens . Due to the multiple demonstrations of c. pipiens attraction to milkweed, both in the laboratory and the field, we used a solvent extract of the flower as a potential model for synthetic mosquito lures . Experiments were conducted with c. pipiens from a colony established in 2009 from larvae collected near columbus, oh, usa . Larvae were identified at l4 by siphonal hair tufts (vinogradova, 2000). Adults were maintained in 41-l clear acrylic cages on a diet of 10% sucrose, water, and weekly blood meals from the legs of a rooster (ilacuc permit no . Oviposition water was prepared by soaking grass clippings in aged tap water and allowing fermentation over a 3-d period . Three days after each blood meal, oviposition cups were placed with caged adults, and eggs were collected the following day . Two hundred first - instar larvae were placed into 22.8 33.0 cm aluminum pans with 450 ml of aged tap water . The larvae were provided finely ground tetramin flakes, increasing the quantity daily from 50 mg for first instars to 500 mg for final instars until pupae appeared on the 8th and 9th day post - hatching . Pupae then were counted and transferred to plastic cups and placed in a 41-l cage supplied with water wicks . Emerging adults were given ad libitum access to water, but were deprived of sugar . The mosquito rearing and maintenance conditions were 27 1 c, 85 5% rh, and 16:8 (l: d), with 30-min gradual crepuscular transitions between photophase and scotophase . Phenylacetaldehyde (> 90%), benzaldehyde (99.5%, purified by redistillation), nonanal (95%), (e)-2-nonenal (97%), and an alkane - standards mixture (c8 - c20) were purchased from sigma - aldrich (st . Louis, mo, usa). (phillipsburg, nj, usa), and -ocimene [(75% (e)--ocimene)] was synthesized by chemos gmbh (regenstauf, germany). Synthetics were diluted with hplc - grade n - pentane (fisher scientific, pittsburgh, pa, usa). Flowers of common milkweed, a. syriaca, were collected in early summer from the ohio state university campus in columbus (400018.95 " n, 830247.11 " w), placed in an ice cooler, and transported 10-min to the laboratory . Single florets were plucked from the main milkweed umbel and separated from the calyx and other green parts of the flower, weighed, and placed into a 500 ml narrow - mouth glass erlenmeyer flask . Milkweed florets were submerged in hplc - grade n - pentane (fisher scientific) in a 1:8 ratio (w / v) for a total solvent volume of 480 ml and held for 24 h at room temperature, at which time the extract was decanted into 21-ml borosilicate glass vials, capped with teflon - lined screw caps and stored at -20 c . The volatile profile of milkweed flower was characterized by placing a single floret into a 21-ml borosilicate glass vial with a teflon - lined rubber septum . Volatiles were allowed to equilibrate in the vial headspace at 30 c for 10 min before collections were made . Volatiles were collected by using a divinylbenzene / carboxen / polydimethylsiloxane (dvb / car / pdms) (50/30 m) solid phase micro - extraction (spme) fiber (supelco, bellefonte, pa, usa). This mixed - chemistry fiber provides affinity for chemicals with a far broader range of polarity and volatility than pdms alone . The fiber was introduced to the vial through the septum and exposed for 30 min . The collected volatiles were analyzed immediately by using an agilent technologies 6890 series gas chromatograph interfaced to an agilent technologies 5973 quadrupole mass selective detector (gc - ms). The spme fiber was desorbed at 275 c for 3 min with a splitless injection onto a zebron zb-1 ms column (30 m 0.25 mm, 0.25 m film thickness) (phenomenex, torrance, ca, usa). The oven temperature was held at 25 c for 3 min, then ramped at 15 c / min to 250 c, where it was held for 2 min . The carrier gas was helium at a flow rate of 1 ml / min . The mass selective detector was operated in ei mode at 70 ev, scanning 19 - 350 m / z with a quadrupole temperature of 180 c and source temperature of 240 c . To guide the construction of a synthetic floral blend, pentane extracts of milkweed florets were analyzed by gc - ms on a zebron zb-50 column (15 m 0.25 mm, 0.25 m film thickness) (phenomenex), with a 1-l splitless injection at 210 c . The temperature program began at 25 c for 3 min and increased at 13 c / min to 200 c, followed by a 25 c / min increase to 280 c to remove high - boiling lipids . Peak identities were validated by re - injection on a finnegan trace gc / ms (thermo fisher scientific inc ., waltham, ma, usa), with a 1:10 split at 180 c and a rtx-5ms column (30 m 0.25 mm, 0.25 m film thickness) (restek, bellefonte, pa, usa). The helium flow was 1 ml / min, and temperature program was 40 c for 1 min, ramped at 15 c / min to 275 c, with a 2-min final hold time . Retention indices (ri) of compounds were determined on both columns relative to n - alkanes (c8c20). Components of floral headspace and extract were identified by matching their mass spectra to nist / epa / nih mass spectral library 2005 and comparison of retention indices to published values (adams, 1995). Identity of major components was confirmed by comparison of spectra and retention times to authentic standards . Peak purity was determined by using amdis deconvolution software (nist, gaithersburg, md, usa) to assure the absence of any co - eluting components . A synthetic mimic of the extract was constructed by blending authentic standards of the major components identified in the extract . Quantities of each component were individually adjusted until the overall concentration and component proportions closely approximated those of the floral extract (fig . 1total ion chromatograms (a) of florets of milkweed, asclepias syriaca, pentane extract (broken line), and a synthetic blend (solid line) used to assay upwind attraction of culex pipiens (peak #1 . Phenylethanol; column = zebron zb-50) and total ion chromatogram (b) of the headspace profile of a single a. syraica floret captured on a divinylbenzene / carboxen / polydimethylsiloxane spme fiber (peak #1 . (e, e)-alloocimene; column = zebron zb-1) total ion chromatograms (a) of florets of milkweed, asclepias syriaca, pentane extract (broken line), and a synthetic blend (solid line) used to assay upwind attraction of culex pipiens (peak #1 . Phenylethanol; column = zebron zb-50) and total ion chromatogram (b) of the headspace profile of a single a. syraica floret captured on a divinylbenzene / carboxen / polydimethylsiloxane spme fiber (peak #1 . (e, e)-alloocimene; column = zebron zb-1) all behavioral assays were conducted in a clear acrylic dual - port flight olfactometer, modified from hancock and foster (1993), with three main parts: an introduction / release chamber, flight chamber, and trapping ports . The introduction / release chamber was located at the downwind end, measuring 30 40 cm wide and 30 cm long . A sliding gate separated the release chamber from the main flight chamber (30 40 cm wide, 90 cm long), which had two cylindrical glass jar trapping ports (15 cm long by 7 cm diameter) on its upwind end . Ports were fitted with borosilicate glass funnels, with the wide end opening into the flight chamber and the narrower (3 mm diam) end pointing into a glass jar . Thus, mosquitoes entering the wide end of the funnel from the flight chamber were channeled into the jar, where they were retained . Trapping ports were located 11 cm above the flight chamber floor and were separated by 21 cm . The funnel and glass jar were held together by parafilm sealing film (pechiney plastic company, menasha, wi, usa), which was replaced between treatments . We recognized the pitfalls associated with the use of parafilm in solvent - based behavioral assays (millar and haynes, 1998), and we ensured that this sealant would not come in contact with any chemicals in the olfactometer . A 7.5-mm diam hole in the upwind end of each jar allowed the introduction of purified / humidified air after it had passed from an oil - free air pump through an activated carbon canister, and then through a water column . Air flow was maintained at 50 ml / s into each port, providing a velocity of 72 mm / s in the center of the flight chamber . A black cotton cloth, covering a dampened layer of cotton wool, covered the entire floor of the flight chamber, to maintain a level of humidity similar to that within the choice ports . Data loggers (hobo, onset computer corporation, bourne, ma, usa) recorded temperature and humidity in the olfactometer, which was 25.0 - 27.5 c and 75 - 95% rh . An exhaust duct, connected at the downwind end of the release chamber, directed the effluent air out of the building through an exhaust hood . To test for positional bias of the ports, mosquitoes were released into the chamber after either baiting both ports with honey or leaving both empty . Mosquitoes were divided equally between left and right ports when baited with honey and were found rarely in ports when both were empty . Response to whole milkweed flowers was determined in the flight olfactometer with 2 g of florets placed in an aluminum weighing boat in one of the trapping jars, and compared with an empty control jar . Extracts and synthetic chemicals were applied to 15-cm long cotton wicks (tidi products, neenah, wi, usa) and compared to a pentane control . The positions of the treatment and control ports were alternated between bioassays as a further safeguard against positional bias . The olfactometer parts were cleaned with 70% ethanol followed by water after each experiment; gloves were used at all times to avoid contamination with human - related kairomones . The 16:8 (l: d) light cycle used for mosquito rearing was maintained in the bioassay room . At 2 h prior to scotophase, approximately 200 - 300 mosquitoes of both sexes in similar numbers were released through a sleeve connection, directly from an acrylic plastic cage (30 30 30 cm) into the holding / release chamber, where they were held for 15 min to acclimatize before the release gate was opened . After 12 h, the numbers of mosquitoes in the treatment port, the control port, and remaining in the flight chamber were recorded . Use of a 12-h period captured the bimodal nocturnal - crepuscular sugar - feeding rhythm of c. pipiens, which includes some sugar feeding throughout the night (yee and foster, 1992). Subtractive bioassays were conducted on the synthetic blend to determine the relative activity of the identified components . The full six - component blend was presented in one of the paired olfactometer ports alongside a reducted five - compound blend, in which one of the components was removed . After establishing the significance of each chemical on mosquito attraction, we compared the minimal attractive blend against the full six - component blend . This was followed by a dose response study of the minimal blend to determine the optimal concentration for response . Doses were presented in a randomized block design (n = 5), with percentage response calculated as the number in the synthetic blend port minus the number in the control port and expressed relative to the number of mosquitoes released . Mosquito flight behavior was recorded by using three infrared rca closed - circuit video cameras (lancaster, pa, usa) onto which was mounted a tc1824b wide - angle es 25 mm 1:1.4 lens for flight - chamber recordings or a tc1874c es 75 mm 1:1.8 lens for each of the choice ports . (lancaster, pa, usa) eight - channel switcher, with video output to two rca tc1109 video monitors . Video output was recorded with an emerson ewv404 vcr (parsippany, nj, usa) onto vhs tape in time - lapse mode, 20 s each min . Mosquito response in the flight olfactometer was analyzed by comparing numbers caught in the two ports by a goodness - of - fit chi - squared test with spss v. 17 (spss inc, chicago, il, usa). Response experiment, a regression model of mosquito response to log - transformed blend dose was determined by using the fitted line plot module of minitab v. 16 (minitab inc . Six compounds comprised> 90% of the relative abundance of the milkweed floret components in the pentane extract: (e)--ocimene, benzaldehyde, nonanal, benzyl alcohol, phenylacetaldehyde, and (e)-2-nonenal (fig . 1a, table 1). The volatile profile collected by dvb / car / pdms spme directly from fresh florets was dominated by three of these compounds: (e)--ocimene, benzaldehyde, and phenylacetaldehyde (> 75% of the total), but there were also substantial differences compared to the pentane extract (fig . Most notably, (e, z)- and (e, e)-alloocimene were collected from the flower headspace, but were almost completely absent from the extract, whereas nonanal, a major constituent of floret extract, was missing in the headspace sample . These disparities can be explained partly by variation in volatility among the components, but also likely reflect differences between the chemical composition in flower tissue and what is released . The extract also contained higher - boiling hydrocarbons and fatty acids, but due to their low volatility, they were not included in behavioral studies . Based on the quantities of synthetic standards used to mimic the extract gc profile (table 1), the total floral concentration of the six major volatiles was estimated at 32 g / g floret fresh weight.table 1major volatile constituents of a pentane extract of the common milkweed, asclepias syriaca, as determined by gas chromatography mass spectrometry, and quantities used in a synthetic mimiccompoundrelative retention indexdiagnostic ei - ms fragment ions (% intensity)synthetic blend (g / ml)(e)--ocimene112477(36), 79(42), 91(53), 93(100)6.14benzaldehyde115551(54), 77(100), 105(88), 106(88)3.27nonanal122029(66), 41(100), 56(61), 57(94)4.14benzyl alcohol123677(85), 79(100), 107(59), 108(75)4.58phenylacetaldehyde125765(22), 91(100), 92(24), 120(16)11.25(e)-2-nonenal130429(56), 41(100), 55(80), 70(58)2.12identity established by comparison to authentic standard of each compoundgc retention times relative to n - alkane standards on a phenomenex zb-50 column phasesynthetic -ocimene contained a 3:1 (e: z) isomer mixture major volatile constituents of a pentane extract of the common milkweed, asclepias syriaca, as determined by gas chromatography mass spectrometry, and quantities used in a synthetic mimic identity established by comparison to authentic standard of each compound gc retention times relative to n - alkane standards on a phenomenex zb-50 column phase synthetic -ocimene contained a 3:1 (e: z) isomer mixture infrared video recordings showed c. pipiens in the flight chamber engaged in a zigzagging flight that was directed upwind towards ports baited with florets, extracts, or synthetic blends . The angle of the turns progressively decreased as the mosquitoes approached the target . In most cases, mosquitoes flew into the ports, but in a few cases they landed on the entrance of the port and walked in . There was no observed oriented flight towards the control port . In the first behavioral assay, mosquitoes showed a significant response to whole milkweed florets, where 67% of released mosquitoes were captured in the floret - baited port, compared to only 6% in the control port (fig . 2a; = 515.02 df = 1, p <0.001). Despite the chemical differences measured between the headspace and extract profiles of milkweed florets, mosquitoes showed a similarly strong response to a pentane extract of milkweed florets (52%) compared to pentane alone (11%) (fig . 2b; = 61.44, df = 1, p <0.001). Moreover, mosquitoes were observed in video recordings to probe the extract - treated cotton wick during the early scotophase and early photophase, suggesting that the extract also stimulated a feeding response . 2percentage of culex pipiens flying upwind in a dual - port flight olfactometer to: a whole milkweed, asclepias syriaca, florets; b pentane extract of a. syriaca florets; and (c) synthetic a. syriaca floret blend compared against a water a or solvent (b, c) control . * * * p <0.001 by chi - squared test percentage of culex pipiens flying upwind in a dual - port flight olfactometer to: a whole milkweed, asclepias syriaca, florets; b pentane extract of a. syriaca florets; and (c) synthetic a. syriaca floret blend compared against a water a or solvent (b, c) control . * * * p <0.001 by chi - squared test based on the positive response to the milkweed floret extract, a six - component synthetic blend was formulated to simulate the concentrations and relative proportions of major constituents of the pentane extract (fig . One discrepancy in the gc profiles was caused by the presence of the (z)-isomer in synthetic (e)--ocimene, resulting in a synthetic blend that exceeded the levels of this isomer in the floret extract . In the olfactometer, the synthetic floret blend performed similarly to the natural extract, with 48% of released mosquitoes trapped, compared to 16% for the control (fig . 2c; = 120.6, df = 1, p <0.001). Again, video - recordings showed a directed upwind flight response to ports containing the synthetic blend, accompanied by vigorous probing of the treated wicks, but not to the controls . Males and females responded to milkweed floret odors in similar numbers in all three experiments as the sex ratio of mosquitoes captured in either the treatment or control ports did not deviate significantly from 1:1 . The subtractive bioassay of the synthetic blend indicated a significant role for three compounds in c. pipiens response to milkweed: benzaldehyde (= 13.22, df = 1, p <0.001), phenylacetaldehyde (= 8.25, df = 1, p = 0.004), and (e)-2-nonenal (= 3.62, df = 1, p = 0.05) (fig . 3). When any of these compounds was removed, mosquitoes showed a significant preference for the full blend over the reducted blend . A nearly significant preference was seen for blends missing either -ocimene (p = 0.078) or benzyl alcohol (p = 0.082) compared to the full blend . The activity of benzaldehyde, phenylacetaldehyde, and (e)-2-nonenal was confirmed when the three were combined: the three - component blend captured 31% of mosquitoes compared to only 7% for the control (fig . 4a; = 196.56, df = 1, p <0.001) and was as active as the full blend (fig . 4b, 4; = 3.02, df = 1, p = 0.082).fig . 3choice response of culex pipiens in a dual - port flight olfactometer to a six - component (full) synthetic blend of milkweed, asclepias syriaca, floret volatiles compared to blends in which each component has been removed individually (reducted). Total response indicates the percentage of c. pipiens released that were captured by one of the blends (no significant differences by 1-way anova). Relative response shows the proportional response to the reducted (gray bars) and full (black bars) blends . Numbers in bars indicate the mean number of c. pipiens responding (n = 46). Asterisks denote significant differences in mean response to reducted versus full blend by chi - squared test (* p <0.05, * * p <0.005)fig . 4a percentage of culex pipiens flying upwind in a dual - choice flight olfactometer in response to a three - component blend, consisting of benzaldehyde, (e)-2-nonenal, and phenylacetaldehyde; * * * p <0.001 by chi - squared test . B percentage of c. pipiens flying upwind in response to the full (six - component) and minimal (three - component) synthetic blends of a. syriaca floral odor . Ns = no significant difference choice response of culex pipiens in a dual - port flight olfactometer to a six - component (full) synthetic blend of milkweed, asclepias syriaca, floret volatiles compared to blends in which each component has been removed individually (reducted). Total response indicates the percentage of c. pipiens released that were captured by one of the blends (no significant differences by 1-way anova). Relative response shows the proportional response to the reducted (gray bars) and full (black bars) blends . Numbers in bars indicate the mean number of c. pipiens responding (n = 46). Asterisks denote significant differences in mean response to reducted versus full blend by chi - squared test (* p <0.05, * * p <0.005) a percentage of culex pipiens flying upwind in a dual - choice flight olfactometer in response to a three - component blend, consisting of benzaldehyde, (e)-2-nonenal, and phenylacetaldehyde; * * * p <0.001 by chi - squared test . B percentage of c. pipiens flying upwind in response to the full (six - component) and minimal (three - component) synthetic blends of a. syriaca floral odor . Ns = no significant difference because quantity as well as quality can determine the intensity of chemically mediated behavior, c. pipiens response was measured in the flight olfactometer to different doses of the three - component blend compared to a solvent control . There was a significant positive quadratic response [log(dose) (y = 20.527x + 73.476x43.709; r = 57.6%], with a response maximum predicted at 62 g (fig . 5). The response flattened out at both the lowest and highest doses; removal of the two most extreme doses produced a stronger - fitting regression model (r = 93.3%), but with a similar predicted optimal dose of 65 g.fig . 5percentage of culex pipiens flying upwind in a dual - choice flight olfactometer in response to different concentrations of a three - component kairomone blend (benzaldehyde, (e)-2-nonenal, and phenylacetaldehyde) after subtracting the response to a paired solvent (pentane) control percentage of culex pipiens flying upwind in a dual - choice flight olfactometer in response to different concentrations of a three - component kairomone blend (benzaldehyde, (e)-2-nonenal, and phenylacetaldehyde) after subtracting the response to a paired solvent (pentane) control a positive upwind orientation by c. pipiens to floret volatiles of a. syriaca was demonstrated in this study, suggesting a new potential source of attractants for use in the field as lures . Males and females showed significant response to milkweed florets, a pentane extract, and a synthetic blend of the extract s six major constituents: benzaldehyde, (e)--ocimene, benzyl alcohol, phenylacetaldehyde, nonanal, and (e)-2-nonenal . The first three of these compounds are among the most common floral odor constituents in plants (knudsen et al ., 2006). Subsequent subtractive bioassays of the synthetic blend demonstrated that only three of its components contributed to attraction: benzaldehyde, phenylacetaldehyde, and (e)-2-nonenal . The attraction of mosquitoes to plant odors has been demonstrated in numerous field and laboratory studies, but few studies have shown significant attraction to synthetics . Mauer and rowley (1999) observed orientation of c. pipiens to a methylene chloride extract of a. syriaca in a dual port olfactometer . However, a synthetic blend of the two dominant compounds in the extract headspace, benzyl alcohol and 2-phenylethanol, failed to attract the mosquitoes . We did not test 2-phenylethanol, but benzyl alcohol was not active in our flight olfactometer bioassays . (2007) also found benzyl alcohol to not be very attractive to c. pipiens var . Flowers of tanacetum vulgare also attract culex species in the field (andersson and jaenson, 1987), and bowen (1992b) discovered a high proportion of both broadly- and narrowly - tuned antennal receptor neurons of c. pipiens sensitive to thujone, the primary constituent of t. vulgare fragrance . However, thujone only elicited a close - range dose - dependent probing response in c. pipiens; it did not stimulate upwind flight in a wind - tunnel olfactometer (bowen, 1992b). The only previous flower - based synthetic blend causing mosquito orientation was developed from silene otites, whose flowers attract mosquitoes in the field (brantjes and leemans, 1976). The synthetic blend mimic consisted of phenylacetaldehyde, veratrole, and 2-methoxyphenol, the first of which elicited the strongest attraction in c. pipiens var . Phenylacetaldehyde also was a prominent component of our a. syriaca headspace and solvent extract, and it was essential for maximum attraction to the synthetic blend . Although nonanal was a major component of a. syriaca floret extract, we saw no evidence that it played a role in attraction in our bioassays . In contrast, from single - cell recordings, syed and leal (2009) determined that ca . 40% of all antennal olfactory receptors of c. quinquefasciatus were acutely sensitive to nonanal, and it produced a synergistic effect on trap catch when presented with co2 . Nonanal is a major skin odorant of birds and mammals, including humans, resulting from the oxidation of sebaceous fatty acids (haze et al ., 2001) this fact, along with the significant behavioral interaction with co2, suggests that nonanal may play an important role in mediating culex host - finding, but does not attract sugar - seeking mosquitoes . We found notable differences between profiles of the pentane extract and the spme - collected headspace of a. syriaca florets . Pentane extracts were dominated by phenylacetaldehyde, (e)--ocimene, and nonanal, whereas the headspace profile contained primarily benzaldehyde, ocimene isomers, and phenylacetaldehyde . Disparities between extracts and chemicals collected in the headspace might be explained by differences in the physico - chemical properties of the constituents, deep penetration by solvents to extract compounds that are not normally released by the tissue, and/or selective trapping of chemicals by spme . In this study, benzaldehyde, -ocimene, and alloocimene have the highest vapor pressures of all the chemicals identified from milkweed, and they make up most of the volatile profile . The vapor pressure of benzaldehyde is almost twice that of nonanal, almost four times that of (e)-2-nonenal, and more than six times that of benzyl alcohol . The latter three compounds were either absent or found in very low levels in the headspace analysis . Phenylacetaldehyde is intermediate in its volatility, but was also the component found in the highest levels in the pentane extract . Volatile collection analyses can produce misleading results, as they may not accurately reflect the actual proportionality of constituents in the headspace . We do not believe that this was a major factor for explaining the differences in the headspace and extract profiles of milkweed due to our choice of spme phase . Although pdms has been the most widely used spme phase, it is actually a poor choice for characterizing plant volatile profiles that contain constituents with a range of volatilities and functional groups . In preliminary studies (not shown), we found a broader array of volatile compounds was trapped from various flowers by dvb / car / pdms compared to pdms alone . This mixed - bed fiber not only employs a broader range of phase polarity, but also incorporates both adsorption and partitioning as mechanisms of collection (koziel and novak, 2002). A number of recent studies have demonstrated the higher recovery efficiency and linearity by dvb / car / pdms compared to other spme phases for all of the compound classes that we identified from milkweed (cui et al ., 2009; ferreira et al ., 2009; zhang et al ., 2009). 2009) found that volatile profiles of longan fruit extracted by a 50/30 m dvb / car / pdms fiber were 3x higher in terpenes, 5x higher in alcohols, and 14x higher in esters than those produced by a 100 m pdms fiber, and revealed volatile carbonyls and acids, which were completely absent from pdms profiles . This study points to floral odors as a potential new model for chemical lures useful for mosquito sampling or control . If similar attraction can be demonstrated at the field level, as has already been demonstrated with human kairomone blends (mukabana et al ., 2012), synthetic floral blends could potentially be used in trapping devices to sample adult populations . Relative to animal - derived odors (mukabana et al ., 2012), floral odors have the advantage of attracting both sexes of mosquitoes in proportional numbers, and females in all gonotrophic states and in reproductive diapause . Given that c. pipiens visits a variety of flowers for nectar - feeding, the three compounds identified here are likely not the only floral components attractive to them, and more effective blends may remain to be discovered . Future research should seek additional attractants and determine optimal blend release rates, delivery systems, and trap designs for maximizing capture in the field.
Two male patients with type 2 diabetes (t2d) and coronary heart disease had plasma levels of brain natriuretic peptide (bnp) and n - terminal probrain natriuretic peptide (nt - probnp) measured as part of routine evaluation . Their glomerular filtration rate was normal (> 75 ml / min per 1.73 m), hba1c was <7% with metformin, and c - reactive protein (crp) was <1 mg / dl in both . Patient a was 71 years old and had suffered an anterior myocardial infarction three years ago with st - segment elevation, which was initially treated with fibrinolytics and 24 h later using percutaneous coronary intervention with a drug eluting stent on the anterior coronary descending artery . He presented with a> 70% stenosis on a diagonal artery, which was not treated and showed no significant stenosis in the remaining coronary arteries . His bmi was 34.8 kg / m, waist circumference 116 cm and was stable without chest pain in nyha class i. the echocardiogram showed apical and lateral hypokinesia with left ventricular ejection fraction (lvef) of 58% . Plasma bnp and nt - probnp were 72 and 100 pg / ml, respectively (reference values for age and sex: bnp median 28 pg / ml (percentile 2575th, 1058 pg / ml); nt - probnp median 45 pg / ml (percentile 595th, 14140 pg / ml)). Patient b, 58 years of age, had suffered a non - st - elevation myocardial infarction two years earlier, and had received standard treatment . His bmi was 44.3 kg / m and his waist circumference 137 cm . The echocardiogram showed mild hypokinesia of the basal segment of the inferior wall and mild dilation of left ventricle with eccentric hypertrophy . Lvef was 66% and plasma bnp and nt - probnp were 10 and <20 pg / ml, respectively (reference values for age and sex: bnp median 31 pg / ml, percentile 2575th, 14 - -49 pg / ml; nt - probnp median 25 pg / ml, percentile 595th, 588 pg / ml). These findings posed the question as to why it is that in some patients the plasma levels of cardiac natriuretic peptides (cnp) are unexpectedly low, and what is their value in the prognosis for these patients? The cnp act as a basic functional link between cardiovascular system homeostasis, inflammation and certain metabolic functions (fig . 1). Increased secretion of cnp is a result of both mechanical and neurohumoral stimuli (1, 2). The main mechanical stimulus for the secretion of cnp is the increased pressure in the cardiac chambers leading to stretching of the myocardial fibers . Neurohumoral stimuli include endothelin-1, angiotensin ii, adrenergic agonists and various cytokines (4). Increased left ventricular end - diastolic wall stress and left ventricular end - systolic wall stress correlate with an increase in plasma cnp in heart failure (5, 6). However, studies on cardiac transplant patients have shown that plasma cnp levels remain high even after intra - cardiac pressures normalize following transplantation (7). During an acute cardiac allograft rejection episode, bnp but not atrial natriuretic peptide (anp) plasma levels increase significantly above pre - rejection values independently of the surgical technique used (8). Plasma bnp levels during acute rejection episodes do not correlate with hemodynamic variables but correlate with the levels of regulated on activation, normal t expressed and secreted, insulin growth factor binding protein-1 and neutrophil activating protein-2 (4). In non - rejecting transplanted patients, despite the normalization of endothelin-1 plasma levels and diastolic and systolic functions, bnp remains high by comparison with control subjects (9). Measuring cnp is useful as a diagnostic and prognostic tool (10, 11, 12). High plasma levels of cnp (e.g. Bnp> 63pg / ml or nt - probnp> 206 pg / ml) can quite precisely predict which patients are at risk for events such as hospitalization due to systolic heart failure or cardiovascular death (13, 14, 15, 16, 17, 18). Obese patients may have strikingly low levels of plasma cnp (19, 20, 21, 22) due to multiple mechanisms that might include increased neprilysin - neutral endopeptidase activity resulting in increased degradation of circulating cnp and increased adipose tissue expression of the np clearance receptor c (nprc). It has been proposed that suppression of probnp1 - 108 prohormone processing due to o - glycosylation at its cleavage site where furine or corin convertases act, prevents the formation of bnp77 - 108 (functionally active) and nt - probnp1 - 76 (inactive) fragments, an event that is purportedly more frequent in diabetics and in insulin - resistant states (23, 24, 25). In heart failure patients, the precursor pro - hormone probnp1 - 108 is found circulating at lower than normal levels (26, 27). Recently, the paradigm - hf trial showed that angiotensin receptor - neprilysin inhibition using the compound lcz-696, 200 mg twice daily, compared with enalapril at 10 mg twice daily significantly reduced the risk of cardiovascular death and hospitalization in patients with heart failure with an lvef 40% . However, death rates from cardiovascular causes were similar among diabetics compared with non - diabetics (28). Although this interesting finding could be an accidental one, other heart failure trials found that the benefit of this therapy in diabetics seems to be less than that in non - diabetics (29, 30, 31). This finding merits further research, since diabetics comprise 2535% of the subjects in most studies (29, 30, 31, 32). The obese are differentiated from the metabolically healthy obese by an unhealthy metabolic profile (33). The latter is defined by increased waist circumference (> 94 cm in men and> 80 cm in women) or bmi 30 kg / m accompanied by two or more of the following: hypertriglyceridemia (1.7 mmol / l), low hdl cholesterol (<1.03 mmol / l in men and <1.29 mmol / l in women), hyperglycemia (> 11.1 mmol / l or a diagnosis of diabetes), hypertension (130/85 mmhg) or medication for high blood pressure (34, 35). In a 12-year follow - up of 61 299 subjects free from cardiovascular disease at baseline mrkedal et al . (36) observed that systolic heart failure development was similar among metabolically healthy compared to non - metabolically healthy obese subjects, meaning that obesity per se creates a higher risk for developing systolic heart failure, especially if it is long - lasting and severe (bmi> 40 kg / m). Recently, it was reported that subjects with high plasma levels of nt - probnp are at a greater risk of developing systolic heart failure whether they are obese or non - obese . However, unlike the non - obese who show a direct linear relationship between levels of nt - probnp and systolic heart failure, the obese show a u - shaped relationship; i.e. Those who have the lowest plasma levels are at just as much risk of developing systolic heart failure as those with the highest plasma levels (37). In contrast, the pathological weight loss caused by anorexia nervosa seems to be related to high plasma levels of anp (38). In severe obesity, bariatric surgery reduces the bmi and improves control of diabetes but it is not yet known if it reduces the risk of cardiovascular events (39, 40, 41, 42, 43, 44, 45, 46). In patients with severe obesity (bmi> 40 kg / m) before gastric bypass surgery, the median level of nt - probnp was 54 pg / ml increasing by 125% after 1 year with no apparent relation to weight loss or glucometabolic parameters . It was speculated that an improvement in secretory cardiac function following surgery was responsible for the increase in circulating nt - probnp (46). Myocardial ischemia and cardiomyocyte stretch trigger the immediate release of cnp (47, 48) even when the lvef is normal (49, 50). In a 9.2 year follow - up study of diabetic (about 7% of the cohort) and non - diabetic patients with chronic stable myocardial ischemia, high plasma levels of nt - probnp were significantly associated with mortality regardless of left ventricular function (51). Recently, it was shown that in patients with stable coronary heart disease bnp and nt - probnp were strong predictors of long - term (6.53.3 years) cardiovascular events and notably, when nt - probnp was added to the clinical predictors, it performed better than bnp in risk classification for adverse cardiovascular events (52). Serial measurement data for nt - probnp in patients with chronic stable angina have shown a wide intra - individual variation . An increase by> 42% or a decrease by> 30% relative to baseline values is required to indicate a significant change (53, 54). In patients presenting with acute chest pain, cnp plasma levels help the diagnosis and prognosis when used together with a non - diagnostic ecg and a negative troponin . Cnp measured in these patients at rest predict future cardiac events at 30 and 180 days and at 1 year (55, 56, 57, 58). If myocardial ischemia is evident during the stress test, an elevation of the plasma levels of nt - probnp detects ischemia and predicts cardiovascular events (59). Likewise, in non - st - elevation acute coronary syndromes, cnp add prognostic information to the clinical indicators (60, 61, 62, 63) (table 1). In a recent investigation (62), bnp was shown to be an independent predictor of mortality on entering the study . At 1 year of follow - up bnp plasma levels provided added value over the timi and grace scores . Cnp are stronger predictors of mortality than troponin in patients that will eventually develop myocardial infarction . In st - segment - elevation acute coronary syndromes cnp plasma levels also add prognostic information independently of the lvef (50, 64, 65) and in addition, predict which patients with primary percutaneous coronary intervention (pci) may be discharged earlier thus saving health resources (66). It has been shown experimentally that anp is associated with salt - sensitive high blood pressure (67). In humans alleles associated with the highest levels of np were also associated with a lower risk of high blood pressure (68, 69). In keeping with these findings, another study showed a relative deficiency of cnp at all the different stages of high blood pressure in humans consisting of low levels of probnp1 - 108 and anp99 - 126 . Low plasma levels of bnp76 - 108 and nt - probnp1 - 76 were observed in the first hypertensive stages together with a reduction of nt - anp1 - 98 in stage i (70). A possible therapeutic modality to supplement cnp in those cases in which circulating cnp are deemed deficient (like in hypertension or heart failure) is suggested by the development of a recombinant human serum albumin - atrial natriuretic factor (anf) (71) molecule . This compound, when injected into mice increased circulating cgmp and decreased blood pressure demonstrated a half - life of> 80 min, which is considerably longer than the 510 min half - life for native anf (71, 72, 73). From the preceding, it may be surmised that elevated cnp levels are strong markers of future cardiovascular events, especially cardiovascular death . On the other hand, cnp plasma levels lower than expected in obese and diabetic patients the two patients discussed above had similar metabolic profiles, lvef> 50% but a different bmi and cnp profile . Patient a was not severely obese and had slight residual myocardial ischemia with bnp and nt - probnp within low to moderate values expected for systolic heart failure and cardiovascular mortality on follow - up . Patient b suffered from severe obesity, with very low plasma levels of cnp with a prognosis related to his bmi of> 40 kg / m and probably also to a deficit of cnp, placing him in the high - risk category for developing systolic heart failure and eventual cardiovascular death . Our patient a has markedly higher bnp and nt - probnp levels compared to patient b. this can largely be explained by the better ejection fraction of patient b, but there might also be other contributing factors . For example, recent studies suggest an inverse relationship between circulating cnp levels and bodyweight as well as with insulin resistance and t2d (19, 74, 75, 76, 77, 78) (table 1). This correlation can also be observed in patients with congestive heart failure, despite increased cnp levels, due to cardiac wall stress (79). Cnp are cleared and degraded by neutral endopeptidase neprilysin and natriuretic peptide receptor c (nprc) (80, 81). Natriuretic peptide receptor a (npra) and nprc have been identified in human adipose tissue in abundance, implying that adipose tissue sustains a regulatory function on the np system (82, 83, 84). Interestingly, compared to non - obese and normotensive individuals, nprc is increased in adipose tissue of obese hypertensive patients (85). Insulin has been observed to induce nprc expression in human adipocytes (84) and monocytes (83), and might, hence, link conditions associated with hyperinsulinemia (e.g. Obesity and insulin resistance), to a relative np deficit . Additionally, neprilysin, the np degrading endopeptidase, is expressed at increased levels in obesity (86). These data argue for obesity and insulin resistance being conditions in which cnp are degraded at an accelerated pace . Second, very recent experimental data also suggest that myocardial bnp expression is markedly decreased in mice fed a high fat diet (87), an observation that warrants clinical confirmation . A cnp deficit in patients with components of the metabolic syndrome might be of clinical relevance . Obese individuals have a higher prevalence of arterial hypertension compared to lean subjects (88). Although obesity - related arterial hypertension has been intensively studied, not all mechanisms are well understood (89, 90). By reduced vasodilatory and sodium - excretion activity, as well as aldosterone - system (raas), a cnp deficit might contribute to obesity related hypertension . Interestingly, in lean subjects, application of a sodium load induces myocardial cnp secretion and stimulates natriuresis (91, 92, 93, 94), a response which is blunted in patients with obesity (95). Together, these data argue that obesity promotes hypertension partly through reduced vascular and renal np responses as well as through impaired np - mediated raas inhibition . Second, cnp also have beneficial actions on cardiac remodelling in essential hypertension, reducing left ventricular hypertrophy (96). Conversely, conditions with a cnp deficit are associated with cardiac hypertrophy in hypertensive patients . In this regard, hypertensive patients with the metabolic syndrome present with lower anp and nt - probnp levels and increased left ventricular mass compared to hypertensive patients without the metabolic syndrome and insulin resistance (97). Finally, the cnp deficit in patients with the metabolic syndrome might be part of a vicious circle which maintains metabolic disease . For instance, cnp exert lipolytic properties mediated by a cgmp - dependent protein kinase g activating pathway . Cgmp - activated protein kinase g (gk - i) activates perilipin a and hormone sensitive lipase mediated triglyceride hydrolysis (98, 99, 100, 101). Interestingly, these effects seem not to interact with the lipolytic effects of catecholamines (99, 102) and the effect seems to be independent of the regulation of insulin (103). Besides a direct activating effect on lipolysis and lipid oxidation, cnp also control secretion of the insulin sensitizing adipokine adiponectin . In humans, anp acutely increases systemic levels of total and high molecular weight adiponectin (104). These findings are in line with some observational studies showing positive associations between systemic cnp and adiponectin concentrations, as for example in heart failure patients (105, 106). This finding might also explain the adiponectin paradox in patients with congestive heart failure . Cnp also exert other relevant metabolic actions on adipose tissue . Treating a human derived adipose cell line with anp results in the uncoupling of cellular respiration (107) as well as the response seems to be mediated by p38 map kinase, which increases uncoupling protein 1 (ucp1) transcription (107). Upon cold exposure, systemic np concentrations increase and nprc expression in similarly, forced pkg expression in primary adipocytes leads to an increase in ucp1 expression and activates a thermogenic program . Administration of anp acutely increases lipid oxidation (102, 109) and postprandial energy expenditure in healthy individuals (110). Circulating -hydroxybutyrate increases, indicating enhanced hepatic lipid oxidation . Apart from acute effects on lipid oxidation (110), anp and bnp induce skeletal muscle mitochondrial biogenesis, respiration and lipid oxidation in human cells and in rodents, in vitro and in vivo (111, 112). Chronic overexpression of bnp and gk - i each led to increased muscle mitochondrial content, oxidative capacity and lipid oxidation in rodents (111). Enhanced oxidative metabolism is associated with protection from diet induced obesity and insulin resistance (113). Heterozygous npra knockout mice are prone to gaining weight and become insulin resistant (111). The mechanism linking np signalling to mitochondrial biogenesis and lipid oxidation in skeletal muscle includes activation of the co - transcriptional activator peroxisome proliferator activated receptor coactivator (pgc)-1 and peroxisome proliferator activated receptor-, both of which are important factors of mitochondrial biogenesis in skeletal muscle (111). In human myotubes, we observed that cnp stimulate pgc-1, maximal mitochondrial respiratory capacity and lipid oxidation (112). Moreover, npra expression positively correlates with pgc-1 expression in the skeletal muscle of individuals after a chronic physical training program . Similarly, cell culture studies show that cgmp restores glucose and insulin induced mitochondrial dysfunction in cultured c2c12 myotubes (114), nitric oxide signalling via cgmp mediates activation of pgc-1, and mitochondrial biogenesis in various murine tissues (115). Hepatic and skeletal muscle lipid content has been associated with insulin resistance (113). In liver and skeletal muscle, insulin resistance develops when bioactive lipid species accumulate, such as intracellular diacylglycerol (113). In obesity and the metabolic syndrome, this lipid accumulation is primarily due to excessive caloric intake that exceeds the capacity of hepatocytes and myocytes to metabolize or export fatty acids, while refining mitochondrial respiration and enhancing lipid oxidation have been proved to improve lipid utilization and insulin sensitivity (116, 117, 118). So far, there is no evidence that cnp directly interact with the insulin signalling cascade (109, 119). It is tempting to speculate that cnp could ameliorate lipid - induced insulin resistance through improvements in hepatic (110) and muscular (112) lipid oxidation . In line with this notion, cnp preserves mitochondrial function and insulin sensitivity in high fat diet mice (111). Cross sectional studies support the hypothesis that cnp protect from the development of obesity and t2d in patients (78, 120, 121,122). Conversely, data from the framingham heart study and the malm diet and cancer study show that reduced cnp concentrations correlate with a higher probability of insulin resistance in lean and obese individuals (76). Moreover, in the latter study low cnp concentrations are predictive of new - onset diabetes (123). Together, these data suggest that a cnp deficit, as observed in obese patients with the metabolic syndrome, contributes and aggravates metabolic vascular disease, and thus, prognosis . Life style interventions as well as pharmacological approaches might be of benefit in this regard (28, 124). While physical activity increases cnp levels acutely and augments npra expression in skeletal muscle cells (112), physical activity coupled with a low calorie diet seems to increase cnp levels chronically (125); an observation that seems to depend on the amount of weight loss (126, 127). Experimental data further suggests that the incretin glucagon like peptide 1 (glp1) might be of relevance in the regulation of np secretion . The glp1 receptor agonist liraglutide, which is widely used for the treatment of t2d, has been shown to induce cardiac anp release in mice, leading to enhanced natriuresis and vasodilatation (128) without inducing congestive heart failure . So far 25 clinical studies failed to demonstrate a similar effect of liraglutide when administered acutely (129) or sub - chronically to patients (130). Chronic liraglutide treatment, accompanied by weight loss, however, seems to increase circulating anp as well as bnp concentrations in diabetic patients (131). Clearly, future studies need to address the important question how a cnp deficit in obesity and t2d can be reversed most efficiently (132). The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of this review . This work was supported by a grant from the secretara de ciencia y tecnologa de la universidad nacional de crdoba (grant number 69/08) to h r ramos, a grant from the german research foundation (grant number bi1292/4 - 2) to a l birkenfeld and by funds from the university of ottawa to a j de bold.
Isovaleric acidemia (iva) is an inherited autosomal recessive metabolic disease caused by a defect in the metabolism of amino acid leucine . The disease may present as metabolically severe form in the initial 2 weeks of life with acute onset vomiting and lethargy, progressing to coma . The other manifestation may be a metabolically mild form of failure to thrive and/or delayed development / mental retardation . These patients as well as those who survive acute illness may develop acute intercurrent episodes of decompensation with stressors like infection, immunization, or fasting . Diagnosis is made by identifying elevated levels of isovaleric acid and its derivatives and their glycine and carnitine conjugates in plasma and urine of patients . Free isovaleric acid may increase several hundredfold in blood during acute decompensation, but is not readily seen in blood and urine as it is conjugated rapidly . Elevated levels of isovalerylcarnitine in blood and isovalerylglycine in urine are the hallmarks of this disease regardless of the metabolic condition . Other methods of diagnosis based on isovaleryl coa dehydrogenase (ivd) enzyme activity in the body cells and identifying dna changes in the gene encoding ivd can confirm the disease . We report the magnetic resonance imaging (mri) findings in a case of iva seen as hyperintense signal intensity in basal ganglia on t1- and t2-weighted images . A breastfed 4-month - old female presented to our emergency room with decreased feeding, a generalized clonic seizure, lethargy, and acidotic breathing for 3 h. a product of third - degree consanguinity, she was born by term normal delivery with no significant perinatal event ., she had a vacant stare with a glasgow coma score (gcs) of 7 . Her heart rate was 120/min, respiratory rate 66/min, capillary refill time 2 s, and temperature 97.8f . On anthropometric assessment, she was found to have failure to thrive with a weight of 3.8 kg, length 59 cm, upper segment / lower segment ratio 1.7:1, and head circumference 40 cm . Arterial blood gases were consistent with high anion gap severe metabolic acidosis (ph = 6.8, hco3 = 3 meq / l, pco2 = 16 mmhg, anion gap = 26). Serum chemistry showed a calcium level of 8.5 meq / l, phosphorus 3.2 mg / dl, sodium 137 mmol / l, and potassium level of 4.5 mmol / l . Patient was dilantinised and started on maintenance intravenous fluids containing dextrose 10% and antibiotics pending cultures which turned out to be sterile . Examination of cns showed rigidity of all limbs with decreased movement of lower limbs, which improved over a period of time in the hospital . Mri of head was performed with 1.5 t (siemens, erlangen germany) mr imager using inversion recovery (ir) t1-weighted (t1w) and t2-weighted (t2-w) sequences in various orthogonal planes . Diffusion - weighted imaging (dwi), susceptibility - weighted imaging (swi), and magnetic resonance spectroscopy (mrs) were also performed . Mri brain revealed altered signal intensity in bilateral basal ganglia involving lentiform nuclei symmetrically with predominant involvement of putamen than globus pallidus . On t1w images, bilateral putamen and globus pallidi appeared to be involved with a peripheral hyperintense signal intensity rim and central low heterogeneous signal compared to white matter [figure 1a and b]. Corresponding lentiform lesions showed predominant hyperintense signal intensity on t2w images with small, slightly hypointense signal in the center [figure 2a and b] which was more clearly seen in axial images . Dwi showed hyperintense signal intensity in bilateral lentiform nuclei on high diffusion - weighted (b value of 1000 s / mm) images [figure 3a] and hypointense signal on apparent diffusion coefficient adc [figure 3b] compatible with restricted diffusion . Adc maps revealed low adc value in the lentiform nuclei (0.9 10 mm / s) than thalami (1.110 mm / s). Restricted diffusivity area was slightly larger than the corresponding t2w - hyperintense signal intensity lesion and was distinctly more extensive than the hyperintense ring seen on t1w images in the bilateral lentiform nuclei . No convincing blooming was noticed on swi (t2 * ) images in the lentiform nuclei in the corresponding t1w- and t2w - hyperintense signal intensity lesions [figure 4]. Mrs (at te = 135 ms) of the lentiform lesions revealed a non - specific appearance of reduced n - acetylaspartate naa peak and elevated choline peak with slightly elevated lactate peak [figure 5]. There was no other significant abnormality of cerebellum, brainstem, or cerebral cortex on mri brain . T1w inversion recovery images at the basal ganglia level in axial (a) and sagittal (b) planes showing peripheral hyperintense signal intensity ring (downward arrow) in bilateral lentiform nuclei around heterogeneous low signal center (upward / backward arrow) t2w images at the level of basal ganglia in axial (a) and coronal (b) planes showing symmetric hyperintense signal intensity in bilateral lentiform nuclei (upward arrow) with small hypointense signal area toward the center (downward arrow) axial diffusion - weighted mri at b value of 1000 s / mm (a) at the level of basal ganglia shows hyperintense signal intensity in bilateral lentiform nuclei (arrow). Adc map (b) at the same level shows reduced adc value in bilateral lentiform nuclei seen as hypointense signal (arrow) susceptibility - weighted axial mri (t2 *) at the level of basal ganglia shows indistinct loss of signal / blooming (arrow) in the region of lentiform nuclei which is seen as hyperintense on t1w and t2w images mrs at te 135 ms of lentiform lesion showing elevated choline peak, reduced n - acetyl aspartate peak, and slight raised lactate level biochemical analysis of urine was done for possible inborn error of metabolism quantitative measurement of urinary organic acids by gas chromatography mass spectrometry revealed 3-hydroxyisovaleric acid = 5.95, isovaleroglycine = 96.10, isovalerylglycine-(2) = 0.40 (all in the units of relative peak area to internal standard) with elevation factors of 7.44, 961, and 0.40 respectively . A diagnosis of iva was made on the basis of biochemical analysis and clinical presentation of the child . Patient was put on low - protein, high - calorie diet after initial stabilization and is being followed for physical and mental development milestones . The enzyme catalyzes an early reaction in the metabolism of branched chain amino acid, namely leucine . Consequent to ivd deficiency, isovaleric acid and its other derivatives accumulate in the body . These metabolites may impart a peculiar sweaty feet smell to the body, which may aid in the diagnosis . Iva may present acutely in neonates with poor feeding, vomiting, decreased level of consciousness, and seizures . Characteristic smell of dirty socks may be noticed in the body sweat or cerumen from ear during an acute crisis . Intermittent iva patients beyond newborn period, also called catabolic episodes, may be triggered by infection or other stress and may be mistaken as diabetic ketoacidosis . Although genetic mutations and biochemical changes with gas chromatography and mass / tandem spectrometry have been extensively described in iva, imaging with computed tomography (ct) and mri of brain is rarely reported . We came across a single report describing ct and mri findings in a case of iva which documented altered signal intensity on mri in globus pallidus and brainstem . Changes in globus pallidi have been described as t1 and t2 relaxation time prolongation seen as symmetric t1w - hypointense and t2w - hyperintense signal intensity in the bilateral globus pallidus . We report signal intensity changes on mri in the bilateral putamen and globus pallidi in a case of chronic mri brain revealed t1w - hyperintense signal (t1 shortening) and t2w- hyperintense signal (t2 prolongation) in bilateral lentiform nuclei, with indistinct blooming / signal loss on swi and concomitant evidence of restricted diffusion . Involvement of putamen besides globus pallidus and t1w - hyperintense ring - shaped signal change in the lentiform nuclei differentiated basal ganglia lesions in our case from the one described in literature . The underlying cause of mri signal alteration in basal ganglia can be presumed to be the metabolites accumulating due to ivd deficiency . Putamen and globus pallidus are highly vulnerable to generalized metabolic abnormalities due to their richness of mitochondria, blood supply, and neurotransmitters and their increased utilization of glucose and oxygen . Oxidative stress and reduced na+ k+-atpase activity could be caused by metabolites accumulating in iva, including isovaleric acid, which can result in t2 prolongation and restricted diffusion due to cytotoxic edema . Acute hyperammonemia also is known to cause t2 prolongation and restricted diffusion in basal ganglia . We postulate oxidative stress due to accumulated metabolites to be responsible for reduced diffusivity seen in lentiform nuclei in our case . Oxidative stress and energy depletion could be substantiated by the presence of lactate in the mrs of lentiform lesion . T1 relaxation time shortening of basal ganglia seen as hyperintense signal intensity on t1w mri has been proposed to result from deposition of proteins, myelin breakdown products, blood, calcium or other minerals . We hypothesize that t1w shortening of lentiform nuclei in our case may possibly be related to protein and/or myelin breakdown product deposition resulting due to passage of isovaleric acid across the blood brain barrier in acute crisis, as calcium, iron, and hemosiderin deposition was excluded by susceptibility - weighted mri . Protein hydration layer within the cytoplasm of reactive astrocytes may result in t1 relaxation time shortening and consequent t1w - hyperintense signal in the basal ganglia . Reactive astrocytes (gemistocytes) have been described to accumulate after acute insult and result in t1w - hyperintense signal in the basal ganglia . Differential diagnoses of t1w - hyperintense signal intensity in bilateral basal ganglia include manganese deposition in acute hepatic decompensation of chronic liver disease, other causes of hyperammonemia like inborn errors of metabolism, manganese toxicity, and total parenteral nutrition . Hypoxic ischemic injury may involve basal ganglia and result in t1 relaxation time shortening in children . Neurofibromatosis 1 (the most common phakomatosis) may manifest as t1w- and t2w - hyperintense signal intensity lesions in bilateral globus pallidus . Relevant medical history and laboratory investigations (wide anion gap metabolic acidosis, raised glycine and carnitine conjugates of isovaleryl coa) can help in making the correct diagnosis of iva in a case of bilateral t1w - hyperintense signal intensity lesions involving lentiform nuclei . Early diagnosis is the key to treatment in the form of restricted protein (specifically leucine) intake, high - calorie diet, and glycine and carnitine supplementation.
Dr . Coyne - beasley receives research funding from merck & co. none of these funds were used in the conduction or completion of the research contained in this manuscript . This article was supported by grants from the national institutes of health 1r01ai113305 - 01 (cates pi), and by the north carolina translational and clinical sciences institute, through support from the national center for advancing translational sciences (ncats), national institutes of health, grant award number 1ul1tr001111 . The content is solely the responsibility of the authors and does not necessarily represent the official views of the nih.
In 1994, waldinger et al . Introduced the intravaginal ejaculation latency time (ielt) as a measure for the ejaculation time of heterosexual intercourse . The ielt is defined as the time from the moment of vaginal penetration until the moment of intravaginal ejaculation . In case of ejaculation outside the vagina the most accurate way to measure the ielt is the use of a stopwatch handled by the female partner . In a stopwatch study in a cohort of dutch men with lifelong premature ejaculation, it was shown that the ielt had a skewed distribution and that 85% of men ejaculated within 1 minute after penetration . In addition, in a meta - analysis of all drug treatment studies of premature ejaculation from 1943 to 2003, it was shown that prospective real - time stopwatch measurement of the ielt during selective serotonin reuptake inhibitors (ssri) treatment led to a smaller, and therefore more valid, confidence interval of the ielt compared to retrospective questionnaire studies of the ielt . In 2005, a prospective stopwatch study of 491 men of the general male population in 5 countries (the netherlands, united kingdom, spain, turkey, and the united states) also showed a skewed distribution to the right with a median ielt of 5.4 minutes (range, 0.5544.1 minutes). Using a blinded timer device, a second study was performed in 2009 in a new group of 474 men of the general population in the same countries . This study also showed a remarkable similar skewed distribution to the right, with a median ielt of 6.0 minutes (range, 0.152.7 minutes). The precise and similar method of ielt measurement by a stopwatch on various intercourse events in the 3 aforementioned studies facilitates comparison of their ielt distributions . However, a prerequisite for further research of the ejaculation time, is a better knowledge of the type of distribution that is formed by the ielt in different populations of men . The purpose of the current study, was to investigate which type of well - known mathematical distribution fitted to the ielt distribution of men with lifelong pe and of men in the general male population . By application of the statistical program easy fit professional ver . 5.6 (mathwave technologies inc . ), we analysed the ielt data of 2 previous stopwatch studies of the ielt in the general male population (fig . 1a, b) and of the ielt data of a previous stopwatch study in a clinical cohort of men with lifelong premature ejaculation (fig . In addition, we investigated which of the wellknown mathematical probability distributions, fitted most accurately to the curves of the aforementioned ielt distributions . This fitness of the distribution is expressed by the goodness of fit (gof), which is calculated by the kolmogorov - smirnov test (ks test) the gof therefore is a measure for the accuracy of the fitness . The ks test is a non parametric statistical test of the equality of continuous, one - dimensional probability distributions . In the current study it was used to compare the ielt distributions with various well - known theoretical reference probability distributions (one - sample ks test). The difference between the actual measured ielt data (as previously published in the three stopwatch studies) and the theoretical mathematical distribution models is measured with the kolmogorov smirnov test . In other words, the ks test measures the gof . The smaller the difference between the theoretical distribution and the ielt distribution, the more accurate is the fitness of the theoretical distributions on the ielt distributions . Gof, measured by the ks test showed that the ielt distributions in the 2 studies of the ielt in the general male population (the 2005 study and the 2009 study) and in the ielt distribution of dutch caucasian men with lifelong pe were a gamma - distribution, which is characterized by (1) a boundary on the left at zero, and therefore excluding negative ielt values, (2) a positively skewed shape, including high ielt values, and (3) a significant flexibility in the shape, allowing the gamma distribution any number of ielts, with reasonable accuracy . Of the multiple operationalized gamma - distributions, the lognormal distribution fitted most well on the gamma - ielt distribution in the general male population . The combined lognormal distribution of men in the general male population (combination of ielt study 2005 and 2009) is shown in fig . The form of this lognormal distribution is mirrored by the mathematical formula, shown in fig . 3 . In contrast, the gumbel max distribution fitted most well on the gamma - distribution of the ielt in the cohort of men with lifelong premature ejaculation (fig . The form of this gumbel max distribution is mirrored by the mathematical formula, shown in fig . According to kolmogorov smirnov the gof of the lognormal distribution for the 2005 study was 0.11708, and for the 2009 study the gof was 0.06284 . The gof of the combined lognormal distribution of both the 2005 and 2009 study was 0.057 . According to kolmogorov smirnov the gof of the gumbel max distribution of the ielt distribution in the 1998 study of men with lifelong pe was 0.179 . By using the lognormal distribution, the various ielt values of all men in the general male population of the 2005 study, the 2009 study and their combination were calculated (table 1). By using the gumbel max distribution, the various ielt values of all men in the 1998 study of dutch caucasian men with lifelong pe were calculated (table 2). Table 3 shows that in the general male population 1.08% of men ejaculates within 0 to 60 seconds after vaginal penetration (in 2005 study, 1.23%; in 2009 study, 0.99%; in combined study, 1.08%). In contrast, in the 1998 study of men with lifelong pe, 85.4% ejaculates within 1 minute, and 55.1% ejaculates within 30 seconds . Notably, in the general male population 7.1% of men ejaculates between 1 and 2 minutes . In contrast in men with lifelong pe, 14% of men ejaculates within 1 and 2 minutes . 2 and 4 show that the ielt distribution of the cohort of men with lifelong pe is not represented in the ielt distribution of the men in the general male population . This is also shown by the ielt data, as represented in table 3, which shows that 85.4% of men ejaculates within 1 minute in men with lpe, whereas only 1.08% of men in the general male population ejaculates within 1 minute . By investigating which theoretical mathematical distribution fitted most accurately on the ielt distributions of 3 previously published ielt distributions, it appeared that the 3 ielt distributions were gamma distributions, but that the type of gamma distribution of men in the general male population does not fit in the gamma distribution of men with lifelong pe . Therefore this study showed that men with lifelong pe not only differ from men in the general population in their ielt values, e.g., men with lifelong pe have ielts of less than 1 minute, but also in the mathematical type, e.g., curve of their ielt distribution . In order to investigate the ielt distributions, we investigated which of the well - known mathematically described distributions fitted most accurately to the ielt distribution of men in the general male population and of men with lifelong pe . For that purpose we summarized the data of 2 prospective real - time stopwatch studies of caucasian men in the general population, performed in the same five countries (the netherlands, united kingdom, spain, turkey, and the united states), to one set of ielt data, including 965 males, and compared this ielt distribution with the ielt distribution of a cohort of 117 dutch caucasian men with lifelong pe . In the current study, it was found by application of the ks test on various mathematical distributions that the ielt distribution of the males in the general male population most accurately fitted the lognormal distribution, which belongs to the family of gamma distributions . However, the ielt distribution of males with lifelong pe did not fit to the lognormal distribution . Importantly, the ielt distribution of the males with lifelong pe most accurately fitted to the gumbel max distribution, which, on its turn, inaccurately fits to the ielt distribution of men in the general male population . For example, whereas only a neglectable minority of men in the general male population ejaculates within 1 minute (e.g., 1.08%) and within 30 seconds after vaginal penetration (e.g., 0.08%), the current study shows that the opposite occurs in men with lifelong pe . In these men, the majority ejaculates within 30 seconds (e.g., 55.1%) and within 30 to 60 seconds (e.g., 30.3%). In other words, there are significantly more men with lifelong pe who ejaculate within 30 seconds than can be extrapolated from the probability density curve of the ielt distribution of men in the general population . An advantage of the formula for the lognormal distribution, is that it enables the calculation of the number and percentage of men in a specific population with a specific ielt value . Similarly, based on the gumbel max distribution, the number and percentage of men with a specific ielt value can be calculated in a cohort of men with lifelong pe . Our calculations by means of the formula of the lognormal distribution (table 1) showed a striking similarity of the percentages of males with a specific ielt value in the 2 separate studies of men in the general population, supporting the reliability and validity of stopwatch measurement of the ielt in an epidemiological study of the ielt . Notably, as the 2 general population ielt stopwatch studies, e.g., the 2005 and 2009 studies, have been conducted in caucasian men, a limitation of the current study is that the formula may only be valid for caucasian men in western countries, whereas for african, middle east, and far east asian countries our formula remains to be investigated on the condition that similar ielt stopwatch studies in random samples of their general populations have been conducted . One may argue that another limitation of the current study is the number of men with lifelong pe . However, a simple calculation shows that in order to discover the gumbel max ielt distribution of men with lifelong pe in the lognormal ielt distribution in the general male population, one has to multiply the number of men with lifelong pe by 100 . 1c could be extracted out of a general male population of 11.000 men (1% = 1/100 of the population). As it is impossible to perform a stopwatch study of the ielt in 11.000 males still, with a few hundreds of men with lifelong pe who have measured their ielt prospectively with a stopwatch it is argued that the current formula of the gumbel max ielt distribution can be become more accurate for application in a cohort of men with lifelong pe . Interestingly, based on the formula of the lognormal distribution that most accurately describes the ielt data of men in the general male population, it is possible to answer certain questions regarding the ielt of men in the general male population without the necessity of conducting realtime stopwatch measurements in very large samples of men . For example, according to the statistics netherlands (centraal bureau voor de statistiek or cbs), the netherlands currently has 16.982.433 inhibitants and 8.372.858 of them are males . Of these males, 5.912.984 are aged between 18 and 70 years . Application of our lognormal formula shows that in the netherlands there are 70.305 men (1.19%) who ejaculate within 1 minute, and 48.546 (0.82%) men who ejaculate within 30 seconds . In addition, using this formula, 502.012 (8.5%) men ejaculate between 0 and 2 minutes, 2.419.002 men (40.9%) who ejaculate between 1 and 5 minutes, and 1.971.330 (33.3%) men who ejaculate between 5 and 10 minutes . In addition, there are 1.112.291 men (18.8%) who ejaculate between 10 and 20 minutes . Notably, after 20 minutes, the number and percentages decrease: 233.208 men (3.9%) ejaculate between 20 and 30 minutes and 66.225 men (1.12%) ejaculate between 30 and 40 minutes . A minority of 40.633 (0.687%) ejaculates with an ielt of more than 40 minutes . The application of the formula, which describes the probability density of the ielt, shows that it may provide answers to questions that cannot be measured by a stopwatch, due to the extremely large number of men that otherwise ought to be included in an epidemiological study, or just cannot be measured as the ielt duration is too long and potentially painful for the female partner of a subject participating in a scientific study . Notably, it is questioned why the ielt distribution of the men with lifelong pe is so completely different from the ielt distribution of men in the general male population . Further research into this question is warranted and is presumably associated with genetic and epi - genetic factors . According to the recent classification by waldinger and schweitzer, there are 4 pe subtypes, e.g., lifelong pe, acquired pe, subjective pe, and variable pe . Their prevalence in the general population differs significantly, as has been shown by serefoglu et al . And gao et al ., with the lowest prevalence of lifelong pe . Notably, lifelong pe is characterized by a hypertonic state, consisting of premature ejaculation (ejaculatio praecox), a facilitated erection (erectio praecox) and a facilitated penile detumescence (detumescentia praecox), when the male is becoming involved in an erotic situation . The current study shows that lifelong pe not only differs from the 3 other pe subtypes with regard to this triad of symptoms, but that lifelong pe has a different ielt and a different ielt distribution than males in the general population, of which men with variable and subjective pe are part of . The separate state of lifelong pe among the 3 other pe subtypes with regard to the ielt and its ielt distribution has consequences for the methodology and design of drug treatment studies . As has recently been argued by waldinger, the method and design for drug treatment studies of men with lifelong pe who ejaculate within seconds, are not required for drug treatment studies of men with variable and subjective pe with normal ielt values . The ielt distribution of men in the general population is most accurately fitted by the lognormal distribution, whereas the ielt distribution of men with lifelong pe is most accurately fitted by the gumbel max distribution . As there are significantly more men with lifelong pe who ejaculate within 30 and 60 seconds than can be extrapolated from the probability density curve of the ielt distribution of men in the general population it is concluded that men with lifelong pe have a distinct ielt distribution that can only be retrieved from the general male population ielt distribution when thousands of men would participate in a stopwatch study of the ielt . The cause of the difference in ielt distribution should be further investigated and may be due to genetic and epigenetic factors . Application of the mathematical formula of the lognormal ielt distribution is useful for epidemiological research of the ielt in large populations of men.
Opces is a bioequivalent, randomized, double blind, multi - centric clinical trial enrolling six centers in five cities of iran . From march 2007 to november 2009, 442 patients were included in this study . Those centers that have the facility and requirements for stenting and also the tendency for research collaboration patients were randomized at least 12 hours before planned pci to receive a 300 mg loading dose of plavix or osvix (1:1) and followed by 75 mg / day for 30 days in bms and 6 months in des groups . All patients received daily aspirin therapy before pci and were continued until one and six months in bms and des groups, respectively . The study was approved by the ethical committee of the isfahan cardiovascular research center, a who collaborating center and was registered in the iranian registration clinical trial (irct138712111723n1). Patients were eligible for enrollment if they were 18 years of age, had chronic stable angina and selected for stenting in a coronary artery with diameter 2.5 mm . Exclusion criteria included previous treatment with a clopidogrel or warfarin for any reason, history of allergy or any contraindication to clopidogrel, high - risk patients (e.g., severe left ventricular dysfunction with ejection fraction less than 30%, stenting of saphenous vein grafts or internal mammary artery), total vessel occlusion without myocardial viability in des and large thrombus in angiography before pci . Baseline and demo graphic information including sex, age, indications for stenting, morphology, length, and diameter of stent, previous cardiac interventions, and left ventricular ejection fraction based on echocardiography reports were recorded according to the patients medical charts . History of smoking, hypercholesterolemia, hypertriglyceridemia, high blood pressure, diabetes mellitus and family history of premature coronary heart disease (cad) in first relatives were also recorded . Blood samples were drawn from each patient before the intervention to measure the platelet and neutrophil counts as well as liver enzymes . Patients who were selected for stenting were randomly assigned to receive a 300 mg loading dose of plavix (n = 221) or osvix (n = 221) (1:1 randomization ratio) 12 hours before the procedure followed by 75 mg / day for 30 days in bms and 6 months in des groups . All patients received daily aspirin therapy three days before pci and were continued until one and six months in bms and des groups, respectively . The laboratory assessment was performed for all patients before the study, then one month after pci for patients with bms and one and six months after pci for patients with des . Blood samples were taken in one month and six months in bms and des groups to measure platelets, neutrophils, alanine ami - notransferase (alt), and aspartate ami - notransferase (ast). Pci was considered successful when a residual diameter stenosis was less than 20% with thrombolysis in myocardial infarction (timi) flow less than iii . Timi iii means contrast material flows briskly into and clears rapidly from the distal segment or good distal runoff.13 timi grade 3 flows were obtained . Type a included lesions with the following characteristics: discrete (<10 mm length), concentric, readily accessible, non - angulated segment, smooth contour, little or no calcium, less than totally occlusive, not ostial in location, no major side branch involvement, and absence of thrombus . Type b included lesions of tubular (10 - 20 mm length), eccentric, moderate tortuosity of proximal segment 45, irregular contour, moderate to heavy circulation, total occlusion, ostial location, bifurcation lesion requiring double guide wire, and some thrombus present . Type c involved diffuse (> 20 mm length), excessive tortuosity of proximal segment, extremely angu - lated segments (90), with total occlusion> 3 months old, inability to protect major side braches, and degenerated side branches with friable lesions . Mace which is the primary endpoint of this study included death, q wave and non - q wave mi, stroke, target lesion revascularization (tlr), target vascular revascularization (tvr), in - stent thrombosis . Cardiovascular death was considered as any death with a cardiovascular cause and included those deaths following a cardiovascular procedure (for example, pci), cardiac arrest, mi, pulmonary embolus, stroke, hemorrhage or death due to unknown cause . Non- cardiovascular death was defined as death due to a clearly documented non - cardiovascular cause (e.g., trauma, infection, malignancy). Mi was defined by symptoms suggestive of infarction, electrocardiographic changes, and positive cardiac enzymes . In - stent thrombosis was classified in three groups; definite: the presence of an acute coronary syndrome with angiographic or autopsy evidence of thrombus or occlusion; probable: unexplained deaths within 30 days after procedure or acute myocardial infarction involving the target - vessel territory without angiographic confirmation; possible: all unexplained deaths occurring at least 30 days after the procedure . Stroke defined as a new focal neurological deficit thought to be vascular in origin with signs and symptoms lasting more than 24 hours . Secondary endpoints included changes of platelet or neutrophil number or liver enzymes, hospitalization for angina, and major bleeding . All primary and secondary end points were assessed during hospitalization and after 30 days in bms and six months in des group . The academic research consortium definitions were used for stent thrombosis.14 results were reported as mean standard deviation (sd) for the quantitative variables and percentages for the categorical variables . The groups were compared using the chi - square test (or fisher's exact test if required) for categorical variables and the t - test or mannwhitney u test for the continuous variables . All the statistical analyses were performed using spss version 16.0 (spss inc ., chicago, il, usa) for windows . Opces is a bioequivalent, randomized, double blind, multi - centric clinical trial enrolling six centers in five cities of iran . From march 2007 to november 2009, 442 patients were included in this study . Those centers that have the facility and requirements for stenting and also the tendency for research collaboration patients were randomized at least 12 hours before planned pci to receive a 300 mg loading dose of plavix or osvix (1:1) and followed by 75 mg / day for 30 days in bms and 6 months in des groups . All patients received daily aspirin therapy before pci and were continued until one and six months in bms and des groups, respectively . The study was approved by the ethical committee of the isfahan cardiovascular research center, a who collaborating center and was registered in the iranian registration clinical trial (irct138712111723n1). Patients were eligible for enrollment if they were 18 years of age, had chronic stable angina and selected for stenting in a coronary artery with diameter 2.5 mm . Exclusion criteria included previous treatment with a clopidogrel or warfarin for any reason, history of allergy or any contraindication to clopidogrel, high - risk patients (e.g., severe left ventricular dysfunction with ejection fraction less than 30%, stenting of saphenous vein grafts or internal mammary artery), total vessel occlusion without myocardial viability in des and large thrombus in angiography before pci . Baseline and demo graphic information including sex, age, indications for stenting, morphology, length, and diameter of stent, previous cardiac interventions, and left ventricular ejection fraction based on echocardiography reports were recorded according to the patients medical charts . History of smoking, hypercholesterolemia, hypertriglyceridemia, high blood pressure, diabetes mellitus and family history of premature coronary heart disease (cad) in first relatives were also recorded . Blood samples were drawn from each patient before the intervention to measure the platelet and neutrophil counts as well as liver enzymes . Patients who were selected for stenting were randomly assigned to receive a 300 mg loading dose of plavix (n = 221) or osvix (n = 221) (1:1 randomization ratio) 12 hours before the procedure followed by 75 mg / day for 30 days in bms and 6 months in des groups . All patients received daily aspirin therapy three days before pci and were continued until one and six months in bms and des groups, respectively . The laboratory assessment was performed for all patients before the study, then one month after pci for patients with bms and one and six months after pci for patients with des . Blood samples were taken in one month and six months in bms and des groups to measure platelets, neutrophils, alanine ami - notransferase (alt), and aspartate ami - notransferase (ast). Pci was considered successful when a residual diameter stenosis was less than 20% with thrombolysis in myocardial infarction (timi) flow less than iii . Timi iii means contrast material flows briskly into and clears rapidly from the distal segment or good distal runoff.13 timi grade 3 flows were obtained . Type a included lesions with the following characteristics: discrete (<10 mm length), concentric, readily accessible, non - angulated segment, smooth contour, little or no calcium, less than totally occlusive, not ostial in location, no major side branch involvement, and absence of thrombus . Type b included lesions of tubular (10 - 20 mm length), eccentric, moderate tortuosity of proximal segment 45, irregular contour, moderate to heavy circulation, total occlusion, ostial location, bifurcation lesion requiring double guide wire, and some thrombus present . Type c involved diffuse (> 20 mm length), excessive tortuosity of proximal segment, extremely angu - lated segments (90), with total occlusion> 3 months old, inability to protect major side braches, and degenerated side branches with friable lesions . Mace which is the primary endpoint of this study included death, q wave and non - q wave mi, stroke, target lesion revascularization (tlr), target vascular revascularization (tvr), in - stent thrombosis . Cardiovascular death was considered as any death with a cardiovascular cause and included those deaths following a cardiovascular procedure (for example, pci), cardiac arrest, mi, pulmonary embolus, stroke, hemorrhage or death due to unknown cause . Non- cardiovascular death was defined as death due to a clearly documented non - cardiovascular cause (e.g., trauma, infection, malignancy). Mi was defined by symptoms suggestive of infarction, electrocardiographic changes, and positive cardiac enzymes . In - stent thrombosis was classified in three groups; definite: the presence of an acute coronary syndrome with angiographic or autopsy evidence of thrombus or occlusion; probable: unexplained deaths within 30 days after procedure or acute myocardial infarction involving the target - vessel territory without angiographic confirmation; possible: all unexplained deaths occurring at least 30 days after the procedure . Stroke defined as a new focal neurological deficit thought to be vascular in origin with signs and symptoms lasting more than 24 hours . Secondary endpoints included changes of platelet or neutrophil number or liver enzymes, hospitalization for angina, and major bleeding . All primary and secondary end points were assessed during hospitalization and after 30 days in bms and six months in des group . The academic research consortium definitions were used for stent thrombosis.14 results were reported as mean standard deviation (sd) for the quantitative variables and percentages for the categorical variables . The groups were compared using the chi - square test (or fisher's exact test if required) for categorical variables and the t - test or mannwhitney u test for the continuous variables . All the statistical analyses were performed using spss version 16.0 (spss inc ., chicago, il, usa) for windows . Opces is a bioequivalent, randomized, double blind, multi - centric clinical trial enrolling six centers in five cities of iran . From march 2007 to november 2009, 442 patients were included in this study . Those centers that have the facility and requirements for stenting and also the tendency for research collaboration patients were randomized at least 12 hours before planned pci to receive a 300 mg loading dose of plavix or osvix (1:1) and followed by 75 mg / day for 30 days in bms and 6 months in des groups . All patients received daily aspirin therapy before pci and were continued until one and six months in bms and des groups, respectively . The study was approved by the ethical committee of the isfahan cardiovascular research center, a who collaborating center and was registered in the iranian registration clinical trial (irct138712111723n1). Patients were eligible for enrollment if they were 18 years of age, had chronic stable angina and selected for stenting in a coronary artery with diameter 2.5 mm . Exclusion criteria included previous treatment with a clopidogrel or warfarin for any reason, history of allergy or any contraindication to clopidogrel, high - risk patients (e.g., severe left ventricular dysfunction with ejection fraction less than 30%, stenting of saphenous vein grafts or internal mammary artery), total vessel occlusion without myocardial viability in des and large thrombus in angiography before pci . All the patients underwent complete history and physical examination . Baseline and demo graphic information including sex, age, indications for stenting, morphology, length, and diameter of stent, previous cardiac interventions, and left ventricular ejection fraction based on echocardiography reports were recorded according to the patients medical charts . History of smoking, hypercholesterolemia, hypertriglyceridemia, high blood pressure, diabetes mellitus and family history of premature coronary heart disease (cad) in first relatives were also recorded . Blood samples were drawn from each patient before the intervention to measure the platelet and neutrophil counts as well as liver enzymes . Patients who were selected for stenting were randomly assigned to receive a 300 mg loading dose of plavix (n = 221) or osvix (n = 221) (1:1 randomization ratio) 12 hours before the procedure followed by 75 mg / day for 30 days in bms and 6 months in des groups . All patients received daily aspirin therapy three days before pci and were continued until one and six months in bms and des groups, respectively . The laboratory assessment was performed for all patients before the study, then one month after pci for patients with bms and one and six months after pci for patients with des . Blood samples were taken in one month and six months in bms and des groups to measure platelets, neutrophils, alanine ami - notransferase (alt), and aspartate ami - notransferase (ast). Pci was considered successful when a residual diameter stenosis was less than 20% with thrombolysis in myocardial infarction (timi) flow less than iii . Timi iii means contrast material flows briskly into and clears rapidly from the distal segment or good distal runoff.13 timi grade 3 flows were obtained . Type a included lesions with the following characteristics: discrete (<10 mm length), concentric, readily accessible, non - angulated segment, smooth contour, little or no calcium, less than totally occlusive, not ostial in location, no major side branch involvement, and absence of thrombus . Type b included lesions of tubular (10 - 20 mm length), eccentric, moderate tortuosity of proximal segment 45, irregular contour, moderate to heavy circulation, total occlusion, ostial location, bifurcation lesion requiring double guide wire, and some thrombus present . Type c involved diffuse (> 20 mm length), excessive tortuosity of proximal segment, extremely angu - lated segments (90), with total occlusion> 3 months old, inability to protect major side braches, and degenerated side branches with friable lesions . Mace which is the primary endpoint of this study included death, q wave and non - q wave mi, stroke, target lesion revascularization (tlr), target vascular revascularization (tvr), in - stent thrombosis . Cardiovascular death was considered as any death with a cardiovascular cause and included those deaths following a cardiovascular procedure (for example, pci), cardiac arrest, mi, pulmonary embolus, stroke, hemorrhage or death due to unknown cause . Non- cardiovascular death was defined as death due to a clearly documented non - cardiovascular cause (e.g., trauma, infection, malignancy). Mi was defined by symptoms suggestive of infarction, electrocardiographic changes, and positive cardiac enzymes . In - stent thrombosis was classified in three groups; definite: the presence of an acute coronary syndrome with angiographic or autopsy evidence of thrombus or occlusion; probable: unexplained deaths within 30 days after procedure or acute myocardial infarction involving the target - vessel territory without angiographic confirmation; possible: all unexplained deaths occurring at least 30 days after the procedure . Stroke defined as a new focal neurological deficit thought to be vascular in origin with signs and symptoms lasting more than 24 hours . Secondary endpoints included changes of platelet or neutrophil number or liver enzymes, hospitalization for angina, and major bleeding . All primary and secondary end points were assessed during hospitalization and after 30 days in bms and six months in des group . Results were reported as mean standard deviation (sd) for the quantitative variables and percentages for the categorical variables . The groups were compared using the chi - square test (or fisher's exact test if required) for categorical variables and the t - test or mannwhitney u test for the continuous variables . All the statistical analyses were performed using spss version 16.0 (spss inc ., chicago, il, usa) for windows . The total study population represents a group of 442 patients (mean age 59 9.5 years) with stable angina pectoris in whom pci was performed . Among them, 225 participants implanted bms and the rest implanted des . A total of 224 patients treated with osvix (110 patients in bms and 114 patients in des) and 218 subjects were treated with plavix (115 patients in bms and 103 patients in des). Except male to female ratio that was higher in the osvix than the plavix group, the two drug groups were comparable with respect to baseline characteristics, clinical data especially left ventricular ejection fraction, and medical history . There were significantly more frequent hypertensive patients in the osvix than in the plavix group (p <0.01), but no other significant differences were seen in patient characteristics between the two groups table 2 . Besides, in both groups with des and bms, there was no significant difference in the type of coronary lesion, direct stenting, stent length and stent diameter (table 3). Baseline characteristics and clinical data of all participants based on plavix or osvix use recorded characteristics and clinical data of all patients based on their stent type . Coronary angiography and stent characteristics of patients and drug type used figure 1 shows the frequency and 95% confidence intervals of events such as death, instant thrombosis, mace rate, and mi following osvix or plavix placement in bare - metal or drug eluting stents patients . Frequency and 95% confidence intervals of events following osvix or plavix placement in bare - metal or drug eluting stents patients there was no significant difference regarding mace rate in patients treated with osvix compared with plavix (figure 1). The study groups had the same frequency of mi, thrombosis, stroke and tvr (figure 1). Regarding changes in laboratory variable, no significant changes were found concerning liver enzymes, platelet and neutrophil counts between the two drug regimens in both des and bms groups (figures 2 and 3). Changes of serum platelet and neutrophil counts following osvix and plavix regimens in patients who underwent bare - metal or drug eluting stenting changes of serum aspartate aminotransferase and alanine aminotransferase levels following osvix and plavix regimens in patients who underwent bare - metal or drug eluting stenting opcess is the first randomized trial to compare the effect of a generic form of clopidogrel on mace after coronary stenting in iran . Increased platelet activity has been shown to increase cardiovascular complications in acute coronary syndrome (acs), and subsequent to pci.15 various studies have demonstrated that administration of antiplatelet drugs such as aspirin, ticlopidine and clopidogrel reduce short and long - term cardiovascular events in patients suffering acs or undergoing pci.16 we studied the short and long - term cardiovascular complications, including death, myocardial infarction, stroke, tlr and tvr in patients treated with osvix (300 mg bolus, and 75 mg / daily maintenance) or plavix (300 mg bolus, and 75 mg / daily maintenance). Assessment of secondary end - points such as angina, heart failure (hf), major hemorrhagic episodes, and reduction of platelet or neutrophil counts and liver enzyme changes revealed no significant difference between the two treated groups . Reduced systolic performance and ageing are among important factors underlying mace in these patients . However, the frequency distribution of age, sex and left ventricular systolic function were similar in osvix and plavix groups . Tavazzi showed that concomitant disease and cvd risk factors can increase mace.17 whereas these risk factors were evenly distributed in the two groups in this randomized clinical trial; a higher frequency of hypertension in the osvix group was seen (p = 0.001) (table 2). Kang and colleagues demonstrated that hypertension does not affect short and long - term cardiovascular complications of pci.18 patients in osvix group showed nonsignificant lower mace rate than the plavix group (p <0.05). Thus, it can be concluded that osvix has at least similar cvd complications as plavix . Ali - doosti and colleagues showed that the type of vessel selected for pci did not affect the short and long term complications of the procedure.19 in our study, the frequency distribution according to the vessel elected for angioplasty was the same in both groups . Various studies have demonstrated an increase in short and long term post - angioplasty complications in patients with complex lesions: the worse the anatomy and morphology of the lesion, the more difficult the procedure and the poorer the outcomes.2021 in our study, the frequency distribution of the type of coronary lesion elected for angioplasty was not significantly different in the osvix and plavix groups . In separate studies, singh and pompa showed that the length and diameter of stents are directly, and inversely proportional to tlr.2223 in our study, the stent length and diameter, as well as angioplasty technique had similar distribution in both groups, although the rate of tvr was low in our study as shown by results . This may have been due to the short follow - up period (one month for non - pharmacological stents and six months for pharmacological stents). Tvr was seen in two of our patients who underwent cabg a day after unsuccessful angioplasty . Based on comparison of frequency distribution of patients according to mace in the preceding one and six months for bms and des stents, respectively, the incidence of mace including death was similar in the osvix and plavix groups . The incidence of mi was 0.4% in the osvix and 1.4% in the pla - vix groups with no significant difference . No significant difference was observed between the two groups in regard to episodes of angina, hf and bleeding which suggest no inferiority of osvix compared to plavix . Although the occurrence of events was not significantly different in the two groups, the distribution of findings revealed an up - sloping trend in complications in the plavix group . Thus, it may be concluded that osvix was not associated with more complications than plavix in patients who underwent pci . Safety of antiplatelet drugs is of great importance and must be assessed against possible side - effects . Gurbel demonstrated that including clopidogrel in the therapy of unstable angina patients, significantly reduced mortality from mace . Although clopidogrel may significantly increase the risk of bleeding, its benefits have been shown to outweigh the risks.24 yusuf and colleagues showed that adding clopidogrel to aspirin reduced mace but increased the risk of bleeding . However, in our study, the rate of major bleeding in osvix and plavix groups who were treated with aspirin too, were not significant . During our follow - up period, mean platelet counts did not change significantly in either groups (plavix, p = 0.80 and osvix, p = 0.99) or between them (p = 0.87). However, neutrophil counts were reduced significantly in the two groups (p <0.001), but the trend of change in counts was not significantly different between the two groups . The above findings showed that adverse hematological effects (thrombopenia or neutropenia) did not increase in the osvix group as compared to the plavix group . We noted some limitations to our study, the most important of which was the small study population . However, the power of the study was enough to achieve the main and secondary objectives of the study . The other important limitation was that the angiographies were performed by different cardiologists in different centers . Thus, interobserver variability was inevitable . In conclusion, our data demonstrated the safety of osvix in improving clinical outcome compared to plavix after coronary stenting in bms or des using patients . The frequency of mace, non - cardiac events or adverse hematological changes did not increase with osvix compared to plavix patients which suggest it's safety . However, due to more cost advantages of osvix regimen over plavix, administration of osvix among iranian patients is preferable . Akh designed the study and drafted this manuscript, mp designed the study, mo, gkm, mn, akh, mh, fr, shs, and jk carried the study, mgh drafted the manuscript and tables, hz helped in designing the study and carried the study, aat helped in designing the study, bs data analysis and drafted the tables, mgh helped in designing the study, mrkh and fn helped in statistical analysis, ekh and mj helped in data gathering, and ns helped in designing the study, revising the manuscript procedures, and drafting the manuscript.
Animals and treatment: all procedures in this experiment were conducted following protocols approved by the iwate university laboratory animal care and use committee . Four primiparous non - lactating, rumen - cannulated healthy holstein cattle, weighing 645 62 (mean sd) kg, were housed in a stanchion barn at the cattle research center of iwate university . During the experimental period, the cattle were fed a sara - inducing diet 2 weeks before and 1 week after first administration of bp . The sara - inducing diet was composed of a mix of orchard grass and timothy hay with an equivalent amount of flaked barley and corn . The ratio of roughage - to - concentrate was 3:7, and the percentages of total digestible nutrients, crude protein, neutral detergent fiber, non - fiber carbohydrates and starch in the dry matter were adjusted to 75.1, 12.2, 37.7, 42.4 and 37.0%, respectively . Cattle were fed daily at 9:00 and 17:00 and allowed free access to fresh water . Cattle were assigned randomly to a 4 4 latin square experimental design containing three treatments and a control ., tokyo, japan) included l. plantarum strain 220 (9 10 colony - forming units (cfu)/g), e. faecium strain 26 (9 10 cfu / g) and c. butyricum strain miyari (9 10 cfu / g) was administered as a daily single dose of 20, 50 or 100 g per head for 7 consecutive days . Cows fed the sara - inducing diet without bp served as a control . Based on the effects of the treatment, the experimental design consisted of 2 weeks of an adaptation period to the respective bp treatment during which cattle were fed only hay . The bp was stored at 4c, and each dose was mixed with their diet during the morning feeding . Ruminal ph measurements: ruminal ph was measured with a radio transmission ph measurement system (ycow - s; dkk - toa yamagata, yamagata, japan). The ph sensor was calibrated with ph 4 and 7 buffer solutions at the start of each experiment and was placed in the ventral sac of the rumen via the rumen cannula, as the ventral sac of the rumen has more stable ph values than the other ruminal site . Ruminal fluid sampling and vfa, lactic acid and nh3-n assays: ruminal fluids were collected from the same location as the ph sensor through the rumen cannula at 8:00, 11:00, 14:00, 17:00 and 20:00 on 7 days before (day 7) and 7 days after (day 7) the first bp administration (day 0). These sampling times (8:0020:00) samples for the vfa, lactic acid and nh3-n measurements were filtered immediately through two layers of cheesecloth . For the vfa analysis, 10 ml of ruminal fluid was added to 2 ml of 25% metaphosphoric acid in 3 n sulfuric acid . Total vfas and three individual vfas (acetic acid, propionic acid and butyric acid) were separated and quantified with gas chromatography (model 135, hitachi, tokyo, japan) using a packed glass column (3% thermon-3000) on a shimalite tpa 6080 support (shinwa chemical industries ltd ., the ruminal fluid was centrifuged immediately at 2,000 g for 15 min, and concentrations in the supernatant were determined using a commercially available kit (f - kit; d - lactate / l - lactate, j. k. international co., tokyo, japan). To measure nh3-n concentrations, ruminal fluid was analyzed using the steam distillation method with an nh3-n analyzer (kjeltec auto sampler system 1035 analyzer, tecator, sweden). Blood sampling and plasma metabolite profiles: blood samples were collected from the jugular vein into 10-ml evacuated serum - separating tubes and tubes containing sodium fluoride (bd vacutainer, franklin lakes, nj, u.s.a . ). Blood samples were collected at the same time as the ruminal fluid samples (days 7 and 7), centrifuged (1,500 g, 15 min, 4c) immediately to separate the serum and plasma, and preserved at 80c until the analysis . Glucose (glu), non - esterified fatty acids (nefa) and -hydroxybutyrate acid (bhba) in plasma, as well as total cholesterol (t - chol), triglycerides (tg) and blood urea nitrogen (bun) in sera were analyzed using an automated biochemistry analyzer (accute, toshiba ltd ., tokyo, japan). Statistical analysis: quantitative data are expressed as means standard errors (ses). The main effects included the sara challenge and bp treatment, day of the experiment, and hours after administration and feeding . Diurnal measurements of the ruminal ph were analyzed as the 24-hr mean ph from day 7 to day 7 . The ph data collected in 10-min intervals were summarized as a 1-hr mean from 9:00 to 8:00 of the following day to assess circadian changes . The minimum and maximum ph in one day was determined for days 7, 0 and 7 . 5.01 (la jolla, ca, u.s.a .) Was used for the statistical calculations, and two - way repeated - measures analysis of variance (anova) followed by the bonferroni post hoc test was used to evaluate the differences between the treatment and control groups . Ruminal ph: sara was successfully induced in cattle fed the sara - inducing diet . According to representative ph data on 3 days after beginning the diet, the 1-hr mean ruminal ph decreased rapidly and slowly after the morning and evening feedings, which was indicative of sara (fig . 1.circadian changes in the 1-hr mean ruminal ph at control day (n=4;) and 3 days after beginning the sara - inducing diet (n=4;). The 1-hr mean ph in cattle fed sara - inducing diet decreased after the morning and evening feedings, which was indicative of successfully induced sara . Data are means se . * significant difference compared with a control on the same day (p<0.05). Considerable disparities in the ruminal ph among the treatment and control groups were observed and continued throughout the treatment period (fig . 2.changes in the 24-hr mean ruminal ph in cattle administered 20 g (n=4;), 50 g (n=4;) or 100 g (n=4;) of a bacterial probiotic for 7 consecutive days . Data are means se . * significant difference compared with a control on the same day (p<0.05). The 24-hr mean ruminal ph in the control was generally lower, whereas that in the bp groups receiving 20 or 50 g was significantly higher from days 2 to 7 compared with the control . The 24-hr mean ph in the 100 g group was also significantly higher from days 2 to 4 compared with the control; however, it decreased on days 5 to 7 . Among the treatment groups, the 20 g bp group maintained a constant ph (6.46.5) from days 3 to 7 . Circadian changes in the 1-hr mean ruminal ph were almost identical among the treatment groups on days 0 and 7 . However, the 1-hr mean phs in the treatment groups were slightly higher than those in the control group on day 7 (fig . 3fig . 3.circadian changes in the 1-hr mean ruminal ph on days 0 and 7 in cattle administered 20 g (n=4;), 50 g (n=4;) or 100 g (n=4;) of a bacterial probiotic for 7 consecutive days . Additionally, the mean minimum ph in the control on day 7 was <5.0, which was significantly lower than in the treatment groups (fig . 4.box plots of the maximum and minimum ruminal ph on days 7, 0 and 7 in the treatment groups administered 20 g (n=4; light gray boxes), 50 g (n=4; gray boxes) and 100 g (n=4; dark boxes) of a bacterial probiotic for 7 consecutive days . Cattle not administered the probiotic served as a control (n=4; white boxes). The median and quartiles the upper and lower bars represent the maximum and minimum values, respectively . * significant difference compared with a control on the same day (p<0.05). Significant difference compared with the same group on day 7 (p<0.05).). The mean maximum ph approached> 6.8 in the treatment groups, which did not differ from that in the control . Circadian changes in the 1-hr mean ruminal ph at control day (n=4;) and 3 days after beginning the sara - inducing diet (n=4;). The 1-hr mean ph in cattle fed sara - inducing diet decreased after the morning and evening feedings, which was indicative of successfully induced sara . Data are means se . * significant difference compared with a control on the same day (p<0.05). Changes in the 24-hr mean ruminal ph in cattle administered 20 g (n=4;), 50 g (n=4;) or 100 g (n=4;) of a bacterial probiotic for 7 consecutive days . * significant difference compared with a control on the same day (p<0.05). Circadian changes in the 1-hr mean ruminal ph on days 0 and 7 in cattle administered 20 g (n=4;), 50 g (n=4;) or 100 g (n=4;) of a bacterial probiotic for 7 consecutive days . Box plots of the maximum and minimum ruminal ph on days 7, 0 and 7 in the treatment groups administered 20 g (n=4; light gray boxes), 50 g (n=4; gray boxes) and 100 g (n=4; dark boxes) of a bacterial probiotic for 7 consecutive days . Cattle not administered the probiotic served as a control (n=4; white boxes). The median and quartiles the upper and lower bars represent the maximum and minimum values, respectively . * significant difference compared with a control on the same day (p<0.05). Significant difference compared with the same group on day 7 (p<0.05). Ruminal vfa, lactic acid and nh3-n concentrations: total vfa increased from 8:00 to 20:00 in the treatment and control groups on days 0 and 7 (fig . 5fig . 5.circadian changes in the ruminal vfa, a: p ratio, lactic acid and nh3-n concentrations on days 0 and 7 in cattle administered 20 g (n=4;), 50 g (n=4;) or 100 g (n=4;) of a bacterial probiotic for 7 consecutive days . * significant difference compared with a control on the same day (p<0.05).). However, no difference was observed in the total or individual vfa concentrations between the treatment and control groups . The acetic acid - to - propionic acid ratio (a: p) was almost identical among the treatment groups . Lactic acid concentrations remained stable in the treatment groups, and the concentrations at 20:00 on day 7 were significantly lower than that in the control . No difference was observed in nh3-n concentrations among the treatment groups, although the nh3-n concentrations in the 50 g and 100 g groups at 8:00 on day 7 were significantly higher than that in the control . Circadian changes in the ruminal vfa, a: p ratio, lactic acid and nh3-n concentrations on days 0 and 7 in cattle administered 20 g (n=4;), 50 g (n=4;) or 100 g (n=4;) of a bacterial probiotic for 7 consecutive days . Data are means se . * significant difference compared with a control on the same day (p<0.05). Blood metabolite profiles: glu concentrations decreased from 8:00 to 20:00, but were almost the same among the treatment and control groups (fig . 6.circadian changes in the blood glu, nefa, bhba and bun concentrations on days 0 and 7 in cattle administered 20 g (n=4;), 50 g (n=4;) or 100 g (n=4;) of a bacterial probiotic for 7 consecutive days . Data are means se . * significant difference compared with a control on the same day (p<0.05).). Nefa levels were affected by feeding time and were significantly lower at 20:00 compared with at 8:00 in the treatment groups on days 0 and 7 . Furthermore, nefa level in the 50 g group at 20:00 on day 7 was significantly lower than that in the control . In contrast, bhba and bun concentrations were higher and lower, respectively, in all groups from 8:00 to 20:00 . Bhba concentrations in the 20 g and 50 g at 17:00 and 20:00, and bun concentrations in the treatment groups at 8:00 were significantly higher than that in the controls, respectively . Circadian changes in the blood glu, nefa, bhba and bun concentrations on days 0 and 7 in cattle administered 20 g (n=4;), 50 g (n=4;) or 100 g (n=4;) of a bacterial probiotic for 7 consecutive days . Data are means se . * significant difference compared with a control on the same day (p<0.05). Sara occurs when the ruminal ph decreases due to a combination of overproduction of vfa and lactic acid and a decrease in vfa absorption in the rumen [1, 22]. Sara is diagnosed when the ph in the ruminal fluid is <5.6 for at least 3 hr per day [5, 17, 21]. In this study, the ruminal ph measured continuously indicated that sara was successfully induced during the experimental period, especially during the first week of the experiment, by feeding a sara - inducing diet . Studies have shown that the main ruminal bacteria affecting the ruminal fermentative capacity are classified as lactic acid - producers and consumers [4, 15], and both of these bacterial groups have been used as bps . (2002) reported that a bp containing both lactate - consuming (propionibacterium) and lactate - producing (enterococcus) bacteria activated ruminal fermentation and reduced the risk of acidosis in cattle . In another study, a bp consisting of l. plantarum and e. faecium induced changes in the ruminal ph of cows fed a high - grain diet . However, the mechanism of the effects of bp on ruminal fermentation is unclear, and the effects of bp on sara in cattle are unknown . In this study, the 24-hr mean ruminal ph was higher in the bp - treated groups compared with in the control group during sara challenge . This was indicative of increased ruminal fermentation in the cows, as reported previously [12, 27, 28]. (2012) examined the effects of administering bp in sara - challenged cows and found no effects on ruminal ph when bp was administered as a single strain; however, ruminal ph increased compared over that in the control group when using a combination of e. faecium and yeast . We used the same bp in a previous study on weaned calves fed a high - concentrate diet, and the mean ruminal ph was significantly higher in the treatment group compared with in the control group . In this study, different doses of a multi - strain bp were administered to sara - challenged cows, and the 24-hr mean ruminal ph was notably higher on days 3 to 7, whereas the minimum ph increased on day 7 in the treatment groups . Bp appears to increase the ability of ruminal bacteria to metabolize lactic acid and regulate ruminal ph [20, 21]. It has been hypothesized that the functionality and efficacy of bps can be determined based on their effects on the predominant rumen microbiota [7, 12]. In this study, cattle receiving lower bp doses (20 g per head) had a constant mean ph of 6.46.6 . In contrast, cattle receiving higher bp doses (100 g per head) had higher mean ph on days 2 and 3, which decreased on days 5 to 7 . Previous reports have indicated that changes in rumen bacterial composition and diversity, increased activities of lactate - consuming bacteria and greater lactate absorption affect ruminal ph [13, 15]. The higher bp dose might increase lab numbers in the rumen, which could be related to increased ruminal fermentation capacity, higher carbohydrate fermentation and increased ruminal ph . Therefore, ruminal lab might have been overly increased due to the higher bp dose, causing the ruminal fermentation and ph to decrease on day 5 . These results are consistent with previous reports that lower bp doses improve gastrointestinal tract microbiota in calves . Furthermore, weaned calves administered lower bp doses showed a higher mean ruminal ph compared with controls . Based on our results, administration of an extremely high dose (100 g per head) of lab could cause decreased ruminal fermentation and ruminal ph . Decreases in ruminal ph are related to vfa production and lactic acid accumulation after feeding a high - grain diet [1, 18]. In this study, although ruminal vfa concentrations were not affected by bp treatment, they were affected by feeding time . This is in agreement with previous reports in which ruminal vfas were not affected by probiotics including lab [6, 20]. Administration of lab probiotics is thought to help rumen microbiota adapt to the presence of lactic acid and prevent lactate accumulation in the rumen . (1992) reported that lactate - consuming bacteria increased only when lactic acid accumulated and ruminal ph decreased . Based on these results, lab probiotics might affect ruminal ph by increasing the activity of lactate - consuming bacteria . In our previous study, significantly lower lactic acid concentrations were observed in the ruminal fluid of weaned calves receiving bp compared with the control . In this study, lactic acid concentrations were stable in the treatment groups; however, lactic acid was higher and correlated with a lower mean ruminal ph in the control group . Gradually increasing ruminal ph might be due to time after feeding and the absorption capacity of the rumen . Bps may prevent a decline in ruminal ph by increasing the lactic acid consumption by some microbes [3, 6]. A combination of certain probiotic bacteria that synthesize lactic acid may sustain a tonic level of lactic acid in the rumen, stimulating rumen microbial communities that consume lactic acid and reducing acidity, causing the ruminal ph to remain constant and stable . Conversely, the nh3-n concentrations in the ruminal fluid of the bp groups remained stable in this study, although significant difference was observed at 8:00 on day 7 between the bp - treated and control groups . Bp has no effect on the nh3-n concentrations in the rumen [7, 12]. Decreases in nh3-n levels after morning feeding in this study were in agreement with the previous study, which found that nh3-n concentrations decreased with decreasing ruminal ph [7, 13]. It has been reported that nefa levels are lower in steers with sara compared with in the control; therefore, the decrease in nefa levels indicates a more efficient use of dietary energy and greater dry matter intake in the bp - treated groups . In conclusion, repeated administration of a bp comprised of l. plantarum, e. faecium and c. butyricum improved the 24-hr mean ruminal ph in cattle with experimentally induced sara at doses of 20 or 50 g per head . Diurnal patterns of the 1-hr mean ruminal ph were identical among the treatment and control groups . Ruminal vfa was not affected by bp treatment; however, lactic acid was lower in the treatment groups than in the control group . Based on these results, bp might affect ruminal ph by increasing lactate consumption and decreasing lactic acid concentrations, resulting in a consistently higher ruminal ph in sara cattle . These results suggest that repeated administration of a multi - strain bp might reduce the risk of sara in cattle and that consecutive treatment with 20 or 50 g of a bp containing lab during high - concentrate feeding might reduce the incidence of sara in dairy cattle.
The importance of early and intensive control of blood glucose levels in improving outcomes for people with type 2 diabetes mellitus (t2 dm) was established in the uk prospective diabetes study (ukpds). Despite differences in glucose levels between the intensive and standard treatment groups disappearing soon after completion of the active study intervention, the benefits of earlier intensive glycaemic control in reducing diabetic complications were found to persist in long - term (10-year) follow - up . Combined with evidence that even short periods (i.e. Weeks) of hyperglycaemia increase the risk for developing diabetic complications, this highlights the importance of trying to establish good glycaemic control as early as possible . Subsequent large - scale intervention studies have confirmed the benefit of intensive glycaemic control in reducing microvascular risk, but the findings regarding cardiovascular disease and overall mortality have been less conclusive . Of note, what constitutes intensive therapy has evolved over the two decades since the ukpds as new antihyperglycaemic agents have become available . The newer agents, particularly those associated with a low risk of hypoglycaemia compared with sulphonylureas and insulin, offer new options for combination therapy aimed at achieving better glycaemic control . The global partnership for effective diabetes management was an early advocate for adoption of tailored targets and treatment in t2 dm, and subsequent guidelines have evolved to reflect the evidence, with universal glycaemic targets and treatment algorithms replaced with recommendations to individualize targets and treatment . While it seems clear that individualized targets are needed to optimize care, it is critical that good glycaemic control, as defined by individualized hba1c targets, is pursued without delay and with commitment . However, it is widely recognized that glucose levels are not well controlled in many people with t2 dm . Through a review of recently published data, we aimed to summarize current standards of glycaemic control globally . We also sought to identify the factors that may contribute to poor rates of glycaemic control . Searches were performed, last updated in july 2015, in the us national library of medicine / national institutes of health pubmed database . Abstracts of the publications identified by the searches were reviewed manually and included in the review if they reported (1) original data related to proportions of people with t2 dm achieving glycaemic control or (2) obstacles or barriers contributing to suboptimal glycaemic control . Publications were excluded from the review if they were (1) published before 2011 or (2) published in a language other than english . Manuscripts written originally in a language other than english but where an english translation is available were included . The search of the pubmed database was complemented by a manual search of online abstracts from recent (20132015) diabetes conferences including those from the european association for the study of diabetes and the american diabetes association annual meetings . Terms used in the pubmed search were also entered into the google search engine, and the results were reviewed manually to identify any additional relevant data from credible sources that might inform the analysis and review . A meta - analysis was not performed owing to the diverse nature of the data collected . A total of 45 relevant publications were identified by the search strategy and included in the literature review and analysis . The results of the literature review suggest that suboptimal glycaemic control is a common and widespread problem . The proportion of patients not achieving hba1c targets in 12 studies published between 2011 and 2015 inclusive is summarized in table 1 . Even in the study reporting the best rate of control, one in every three patients was above the hba1c target . A multi - centre, cross - sectional study of ~5800 people with t2 dm from nine european countries found that hba1c exceeded the target of 7.0% (53 mmol / mol) in 37% of cases, with rates for individual countries ranging from 26% in the netherlands up to 52% in turkey . Tidm: type 1 diabetes mellitus; t2 dm: type 2 diabetes mellitus . Target hba1c 7.0% (53 mmol / mol), other than for the study of laiteerapong et al . Which used individualized targets of hba1c <6.5%, <7.0% or <8.0% (<48 mmol / mol, <53 mmol / mol or <64 mmol / mol) based on patient characteristics . Nine european countries: belgium, france, germany, greece, italy, the netherlands, spain, turkey and the united kingdom . Other publications show that hba1c levels are markedly above target in a large proportion of people with t2 dm . In a registry - based study of> 10,000 people undergoing care for t2 dm in specialist clinics in canada, 62% were not at target [hba1c 7.0% (53 mmol / mol)] and 15% had an hba1c level of 9.0% (75 mmol / mol) or above . A puerto rican study of 600 adults with type 1 or type 2 diabetes reported that just 37% were at the recommended hba1c target . A survey of> 200,000 people with diabetes in taiwan found hba1c> 9.0% (75 mmol / mol) in nearly one in every four people and 30% of outpatients with t2 dm attending a medical college in rural india had hba1c 9.5% (80 mmol / mol). There was some evidence to suggest that suboptimal control occurred more frequently in low- and middle - income countries compared with wealthier countries, with the highest rate of 87% for non - achievement of hba1c target reported in rural india . However, high proportions of people in high - income, resource - rich settings also had inadequate control of hyperglycaemia . Suboptimal glycaemic control is often accompanied by poor control of other cardiometabolic risk factors . In a prospective cohort study of more than 3000 people with t2 dm in canada, the proportion of people with hba1c, blood pressure and low - density lipoprotein (ldl) cholesterol at target on study entry was 47%, 46% and 36%, respectively . All three risk factors were controlled to target in just 19% of people, and only 7% maintained good control of glycaemia, blood pressure and ldl cholesterol throughout the 12-month study . A canadian study of more than 5000 people with t2 dm seen by 479 primary care physicians found that the proportions achieving targets were 50% for hba1c, 36% for blood pressure and 57% for ldl cholesterol, with only 13% reaching all three targets . Similar results were found in more than 25,000 outpatients with t2 dm in china, with the proportions of patients achieving targets for hba1c, blood pressure and lipids of 48%, 28% and 36%, respectively . Importantly, nearly all of the studies reviewed assessed the quality of glycaemic control against a single target of hba1c 7.0% (53 mmol / mol). Within the context of individualized targets now recommended in guidelines, a somewhat higher target [e.g. Hba1c 7.5% (59 mmol / mol)] may have represented optimal management based on factors such as age, presence of cardiovascular comorbidities and duration of diabetes . This is unlikely to account for the large proportion of patients not controlled to hba1c 7.0% (53 mmol / mol) and certainly should not justify the sizeable proportion of people with hba1c levels exceeding 9.0% (75 mmol / mol). However, it highlights that a single target is unlikely to represent optimal management for all people . The review provides strong evidence that in all regions of the world, many people with t2 dm are not achieving good glycaemic control . Although there is considerable heterogeneity in the studies and the data generated, rates of uncontrolled glycaemia are typically in the range of 40%60% . Consequently, many people are left at increased risk of diabetic complications and the associated burden of illness and mortality, as well as consequent economic costs . Recent studies examining barriers to the achievement of good glycaemic control are summarized in table 2 . Tidm: type 1 diabetes mellitus; t2 dm: type 2 diabetes mellitus; hcps: healthcare professionals . Prescribers often identify poor patient motivation and self - management as leading barriers to achieving glycaemic targets . The second diabetes, attitudes, wishes and needs (dawn2) study, included an online survey of 4785 healthcare professionals (hcps) (~40% primary care clinicians, 30% diabetes specialists, 20% nurses and 10% dieticians) from 17 countries across four continents . The majority of the respondents (60%) indicated a need for improvements in self - management by people with diabetes, particularly in the area of diet and exercise . Resistance to lifestyle measures was also identified as a leading barrier by 252 primary care physicians, nurse practitioners and physician assistants in the united states, with 52% of hcps indicating that it was often or almost always a factor contributing to chronic lack of glycaemic control . Other leading patient - related barriers identified by the hcps included psychosocial issues (34%), reluctance to use insulin (31%) and non - compliance (30%). A study in the united kingdom examining the reasons for very poor glycaemic control [hba1c 10% (86 mmol / mol)] in 128 people with t2 dm attending three primary care centres found poor adherence to lifestyle measures to be most frequently involved . Other factors included infrequent clinic attendance (16%), side effects (16%), poor compliance with pharmacotherapy (14%), lack of knowledge of diabetes (14%), lack of titration of insulin (13%) and insulin refusal (12%). Poor patient motivation and adherence were also identified as barriers to good glycaemic control in qualitative studies with hcps . Interviews with a small number (n = 9) of hcps in the united arab emirates revealed a tendency to view patient attitudes and behaviours as the origin of poor glycaemic control and to believe that if patients were more knowledgeable about diabetes, cooperated with hcps and were adherent with treatment, then they could achieve their glycaemic targets . The studies reviewed also revealed that a number of healthcare system - level factors are often seen as important barriers to good glycaemic control . The dawn2 study, for example, found that only 30% of the hcps surveyed believed that healthcare was well organized for the management of chronic conditions . Participants from western european countries and china were more likely to feel that healthcare was well organized than those from north or south america, eastern europe, india or japan (figure 1). Approximately half of the participants considered the healthcare remuneration system to be a barrier and most (~60%) indicated a need for better access to qualified nurse educators / specialist diabetes nurses and psychologists / psychiatrists . Proportion of healthcare professionals reporting that healthcare in their country is well organized for the management of chronic conditions, including debates . A survey of 47 european countries found that while all had guidelines in place for managing diabetes, only 7 (15%) had protocols for monitoring their implementation . The majority (83%) of countries had or were developing national plans for diabetes, but these were often not comprehensive . There was substantial variability in the provision of multidisciplinary care . While 80% reported that nurses play an important role in providing education for self - management, diabetes specialist nursing was recognized as a speciality in only 19 countries (40%). Despite the widespread belief that patients need to be more engaged and effective in self - management, only 25% of the countries recommended continuous education for all people with diabetes . Lack of effective self - management education was also identified as a barrier in a qualitative study involving focus group discussions with 25 primary care clinicians in the united states, along with a persistent focus on acute care, poor integration of diabetes care, lack of clinical information and inadequate public health support . Lack of coordination in care and limited access to secondary resources were also identified as important barriers by studies in the netherlands and ireland . Limitations on the time available to manage patients are often identified as an obstacle to good glycaemic control . In the survey of 252 us primary care physicians, lack of time for treating complex patients was reported as often or always a factor in failure to achieve good glycaemic control by 41% of the physicians . Treatment costs were much less frequently seen as a barrier, with 25% of the hcps indicating that it made no contribution and most (58%) saying that it was a factor in only a minority (20%40%) of cases of poor glycaemic control . Other studies have also suggested that hcps in primary care often feel that they lack the time or other resources needed to manage diabetes effectively . This raises particular concerns, given that health policy in some countries involves shifting more of the responsibility for diabetes management onto primary care . Compared with patient- and system - related barriers to effective glycaemic control, there is limited information available regarding physician - related barriers . However, there is evidence to suggest that a lack of diabetes - focused education may be contributing to failure to achieve therapeutic targets . For example, one in five of the hcps surveyed in the dawn2 study indicated that they had received no formal postgraduate diabetes training, and in a uk survey, only 35% of 2149 trainee doctors felt that their postgraduate training had prepared them adequately to optimize treatment of diabetes and only 41% reported that they would take the initiative to optimize glycaemic control . A survey of 209 primary care clinicians in australia identified gaps in knowledge relating to the medical management of t2 dm, with 46% self - reporting a need for education on pharmacological management . It appears that prescribers often lack confidence in the use of insulin, particularly with more complex regimens . People with diabetes often continue in poor glycaemic control for extended periods of time without appropriate action being taken . A retrospective cohort study of> 80,000 people with t2 dm in the united kingdom revealed substantial delays in intensifying treatment when glycaemic control was suboptimal . For people who were inadequately controlled on one oral glucose lowering agent, the median time from hba1c being above a threshold of 7.0% (53 mmol / mol) to treatment intensification with an additional oral agent was nearly 3 years, and even when hba1c was 8.0% (64 mmol / mol), intensification was delayed by a median of 1.6 years . There were even longer delays (median of ~67 years) in intensifying treatment with the addition of a third oral agent or the initiation of insulin . Mean hba1c at intensification ranged from 8.7%9.7% (7283 mmol / mol). In a study of nearly 20,000 people with t2 dm initiated on basal insulin at hospitals across china, a study of primary care records of> 17,000 patients with t2 dm being treated with oral glucose lowering agents in france found that> 3000 of the patients were not at glycaemic target and required treatment intensification . However, treatment was actually intensified in only 39% of the patients requiring it and the majority (~60%) of changes were delayed by 6 months or more and a substantial proportion (~40%) by more than a year . The diattitude study (table 3) also looked at therapeutic inertia in the care of> 2000 people with t2 dm by 236 primary care physicians and found that among patients with uncontrolled glycaemia, representing 41% of all the patients studied, only 7% had their treatment intensified . The most common (60%) reason given for not intensifying treatment was that the patient s hba1c was satisfactory . Other leading reasons given included that lifestyle advice was more of a priority than changing medication (20%), the decision was postponed until the next clinic visit (11%) and that hba1c had decreased since the previous clinic visit (7%), although in the majority (58%) of these cases, an hba1c reduction was not confirmed by the available records . The problem appears to be common and widespread, with further studies in bahrain, croatia, spain, taiwan and the united states reporting high rates (typically 30%60%) of clinical inertia when managing elevated glucose levels in people with diabetes . Summary of studies reporting rates of and factors contributing to therapeutic inertia in the management of type 2 diabetes . Ldl: low - density lipoprotein; t2 dm: type 2 diabetes mellitus; hcps: healthcare professionals . A number of studies have attempted to explore the factors that may act as obstacles to action in addressing inadequate glycaemic control . In an online survey completed by 508 primary care physicians who provided data on 770 elderly patients (> 65 years), the leading reason for not initiating glucose - lowering medication, given as the first - ranked reason for 58% of the patients and a contributory factor in nearly all patients, was that they were treated with diet and exercise, and presumably, this was believed to be adequate management (figure 2). However, 33% of the patients were not at target hba1c, suggesting substantial clinical inertia in this population . Other reasons given for not starting drug treatment included that hyperglycaemia was mild (84%), patient concerns (61%), physician concerns about glucose - lowering agents (49%) and presence of comorbidities and polypharmacy (37%). When asked to identify a threshold for initiating treatment with glucose - lowering agents in the elderly population, the mean hba1c threshold value stated was 7.1% (54 mmol / mol). In approximately 20% of the cases, the physicians indicated that they were planning to initiate glucose - lowering therapy within the next month, but more than half (54%) of these patients already had an hba1c level above the physician - stated threshold . Results from an online survey of 508 us primary care physicians providing clinical date for 770 patients . A qualitative study of 20 hcps in the united kingdom found a pattern of seeking to lessen their own sense of accountability for clinical inertia by emphasizing patient - level barriers such as comorbidities, motivation and self - management capabilities as well as health system level barriers, especially time constraints . There was also a tendency for the hcps to overestimate the achievement of targets in their primary care centres . Factors contributing to therapeutic inertia in the initiation of insulin treatment for t2 dm were investigated in the translating research into action for diabetes (triad) project using structured interviews with primary care hcps in the united states . The majority of the 83 clinicians interviewed supported guideline recommendations on glycaemic targets, with 69% choosing an hba1c <7% (<53 mmol / mol) as the ideal target for good glycaemic control . At the same time, the most frequently cited reasons for setting higher individualized hba1c targets included advanced age or short life expectancy (54%), poor self - management capacity due to poor cognitive abilities (35%), presence of comorbidities (34%), low educational level or poor health literacy (34%) and patients unwillingness to self - manage their diabetes (33%). The most frequent reasons cited by the clinicians for not initiating insulin treatment were patient refusal or resistance (64%) and lack of patient self - management skills (43%). Factors determining initiation of insulin were also investigated using data for 1933 people with t2 dm from the french national health and wellness survey, an annual internet - based survey among french adults . Early initiation of insulin therapy was almost 10 times more likely to be prescribed by an endocrinologist or diabetologist than by a primary care physician . Early versus late insulin initiation was also more likely in patients who were younger, had diabetes - related complications or smoked . Insulin - treated patients were more likely to be adherent, and there was no apparent deterioration in quality of life associated with insulin use . In focus group discussions with 114 primary care physicians in belgium, many of the physicians found the concept of clinical inertia interesting, but some also found it insulting and felt it implied that they were passive in their work . They also noted that it was important to differentiate between cases where there was a conscious decision to not pursue lower targets based on a consideration of the individual patient factors and those where there was genuine inertia . It was acknowledged that genuine clinical inertia was a real risk in primary care, but there was a tendency to ascribe this risk to patient- and system - level barriers rather than physician - level behaviours and practices . In summary, recent studies suggest that clinical inertia is a common and widespread problem, typically affecting the care of 30%50% of people with t2 dm . The causes are diverse and complex, but surveys of hcps tend to emphasize patient - level barriers to treatment intensification, such as patient reluctance to start insulin therapy, or system - level barriers, such as disconnects between what is recommended in guidelines and what is reimbursed in practice . However, it also appears that hcps sometimes delay taking necessary action and may be willing to tolerate periods of it also appears that many hcps, while recognizing the importance of good glycaemic control, have low expectations for their patients . The issue of clinical inertia needs to be better understood if it is to be addressed effectively, particularly regarding the patient-, hcp- and system - level factors that underlie it . This is challenging as clinical inertia as defined in studies typically captures a range of behaviours, some of which may not reflect suboptimal care . However, studies of clinical inertia often apply a single glycaemic threshold [typically hba1c = 7% (53 mmol / mol)] across a broad range of patients . Guidelines for management of t2 dm have traditionally advocated a stepwise approach to management, in which treatment is started with diet and exercise, followed by the addition of oral antihyperglycaemic monotherapy, then combination therapy and eventually insulin . However, when applied systematically without considering individual factors such as the patient s current hba1c level, it can lead to treatment futility with people receiving therapy that has little chance of lowering glucose levels sufficiently to achieve their glycaemic target . Several recent publications have indicated potential benefits of early, intensive intervention with pharmacotherapy, including combinations of oral glucose lowering agents and/or insulin . The treatment options for type 2 diabetes in adolescents and youth (today) study compared metformin alone, metformin plus a thiazolidinedione and metformin plus intensive lifestyle intervention as initial therapy for new - onset t2 dm in people aged 1017 years and with obesity . The proportion of people who maintained glycaemic control over 5 years was significantly higher with the combination pharmacotherapy than either metformin alone or metformin plus intensive lifestyle measures . The combination pharmacotherapy was also associated with greater improvements in insulin sensitivity and -cell function compared with the other two approaches . The results lend support to early, intensive intervention with combination therapy, at least in this population of young people with new - onset t2 dm . Early intensive therapy was also studied in older (mean age = 45 years) people with newly diagnosed t2 dm who started treatment for 3 months with metformin plus insulin and were then randomized to either continuing metformin plus insulin therapy or triple oral glucose lowering therapy with metformin, glyburide and pioglitazone . Good glycaemic control was maintained for over 6 years with no significant difference between the groups (end of study hba1c = 7.3% for metformin plus insulin and 6.4 for triple oral combination; p = 0.4). A review of the health records for nearly 3000 people with t2 dm in the united states found that early initiation of metformin (within 6 months of diagnosis) significantly reduced hba1c (0.36%; p <0.001) and bmi (0.46 kg / m; p <the likelihood of achieving hba1c 7% was doubled and the likelihood of requiring therapy intensification was reduced by 28% with early versus delayed initiation of metformin . Another study in the united states looking at medical records for 5870 people with t2 dm found a similar pattern for early introduction of combination oral glucose early intensification was defined as addition of a second oral drug to metformin therapy within 3 months of treatment failure (hba1c 7.5%) and late intensification as the introduction of combination therapy 1015 months after loss of glycaemic control . People who received early intensification were 38% more likely to achieve good glycaemic control at 1.52 years than those with late intensification . In the advance trial of 11,140 patients with t2 dm, therapeutic intensification with addition of an oral glucose lowering agent doubled the chance of achieving good glycaemic control, and with intensification with insulin, the odds were increased 2.5-fold . A total of 45 relevant publications were identified by the search strategy and included in the literature review and analysis . The results of the literature review suggest that suboptimal glycaemic control is a common and widespread problem . The proportion of patients not achieving hba1c targets in 12 studies published between 2011 and 2015 inclusive is summarized in table 1 . Even in the study reporting the best rate of control, one in every three patients was above the hba1c target . A multi - centre, cross - sectional study of ~5800 people with t2 dm from nine european countries found that hba1c exceeded the target of 7.0% (53 mmol / mol) in 37% of cases, with rates for individual countries ranging from 26% in the netherlands up to 52% in turkey . Target hba1c 7.0% (53 mmol / mol), other than for the study of laiteerapong et al . Which used individualized targets of hba1c <6.5%, <7.0% or <8.0% (<48 mmol / mol, <53 mmol / mol or <64 mmol / mol) based on patient characteristics . Nine european countries: belgium, france, germany, greece, italy, the netherlands, spain, turkey and the united kingdom . Other publications show that hba1c levels are markedly above target in a large proportion of people with t2 dm . In a registry - based study of> 10,000 people undergoing care for t2 dm in specialist clinics in canada, 62% were not at target [hba1c 7.0% (53 mmol / mol)] and 15% had an hba1c level of 9.0% (75 mmol / mol) or above . A puerto rican study of 600 adults with type 1 or type 2 diabetes reported that just 37% were at the recommended hba1c target . A survey of> 200,000 people with diabetes in taiwan found hba1c> 9.0% (75 mmol / mol) in nearly one in every four people and 30% of outpatients with t2 dm attending a medical college in rural india had hba1c 9.5% (80 mmol / mol). There was some evidence to suggest that suboptimal control occurred more frequently in low- and middle - income countries compared with wealthier countries, with the highest rate of 87% for non - achievement of hba1c target reported in rural india . However, high proportions of people in high - income, resource - rich settings also had inadequate control of hyperglycaemia . Suboptimal glycaemic control is often accompanied by poor control of other cardiometabolic risk factors . In a prospective cohort study of more than 3000 people with t2 dm in canada, the proportion of people with hba1c, blood pressure and low - density lipoprotein (ldl) cholesterol at target on study entry was 47%, 46% and 36%, respectively . All three risk factors were controlled to target in just 19% of people, and only 7% maintained good control of glycaemia, blood pressure and ldl cholesterol throughout the 12-month study . A canadian study of more than 5000 people with t2 dm seen by 479 primary care physicians found that the proportions achieving targets were 50% for hba1c, 36% for blood pressure and 57% for ldl cholesterol, with only 13% reaching all three targets . Similar results were found in more than 25,000 outpatients with t2 dm in china, with the proportions of patients achieving targets for hba1c, blood pressure and lipids of 48%, 28% and 36%, respectively . Importantly, nearly all of the studies reviewed assessed the quality of glycaemic control against a single target of hba1c 7.0% (53 mmol / mol). Within the context of individualized targets now recommended in guidelines, a somewhat higher target [e.g. Hba1c 7.5% (59 mmol / mol)] may have represented optimal management based on factors such as age, presence of cardiovascular comorbidities and duration of diabetes . This is unlikely to account for the large proportion of patients not controlled to hba1c 7.0% (53 mmol / mol) and certainly should not justify the sizeable proportion of people with hba1c levels exceeding 9.0% (75 mmol / mol). However, it highlights that a single target is unlikely to represent optimal management for all people . The review provides strong evidence that in all regions of the world, many people with t2 dm are not achieving good glycaemic control . Although there is considerable heterogeneity in the studies and the data generated, rates of uncontrolled glycaemia are typically in the range of 40%60% . Consequently, many people are left at increased risk of diabetic complications and the associated burden of illness and mortality, as well as consequent economic costs . Recent studies examining barriers to the achievement of good glycaemic control are summarized in table 2 . Tidm: type 1 diabetes mellitus; t2 dm: type 2 diabetes mellitus; hcps: healthcare professionals . Prescribers often identify poor patient motivation and self - management as leading barriers to achieving glycaemic targets . The second diabetes, attitudes, wishes and needs (dawn2) study, included an online survey of 4785 healthcare professionals (hcps) (~40% primary care clinicians, 30% diabetes specialists, 20% nurses and 10% dieticians) from 17 countries across four continents . The majority of the respondents (60%) indicated a need for improvements in self - management by people with diabetes, particularly in the area of diet and exercise . Resistance to lifestyle measures was also identified as a leading barrier by 252 primary care physicians, nurse practitioners and physician assistants in the united states, with 52% of hcps indicating that it was often or almost always a factor contributing to chronic lack of glycaemic control . Other leading patient - related barriers identified by the hcps included psychosocial issues (34%), reluctance to use insulin (31%) and non - compliance (30%). A study in the united kingdom examining the reasons for very poor glycaemic control [hba1c 10% (86 mmol / mol)] in 128 people with t2 dm attending three primary care centres found poor adherence to lifestyle measures to be most frequently involved . Other factors included infrequent clinic attendance (16%), side effects (16%), poor compliance with pharmacotherapy (14%), lack of knowledge of diabetes (14%), lack of titration of insulin (13%) and insulin refusal (12%). Poor patient motivation and adherence were also identified as barriers to good glycaemic control in qualitative studies with hcps . Interviews with a small number (n = 9) of hcps in the united arab emirates revealed a tendency to view patient attitudes and behaviours as the origin of poor glycaemic control and to believe that if patients were more knowledgeable about diabetes, cooperated with hcps and were adherent with treatment, then they could achieve their glycaemic targets . The studies reviewed also revealed that a number of healthcare system - level factors are often seen as important barriers to good glycaemic control . The dawn2 study, for example, found that only 30% of the hcps surveyed believed that healthcare was well organized for the management of chronic conditions . Participants from western european countries and china were more likely to feel that healthcare was well organized than those from north or south america, eastern europe, india or japan (figure 1). Approximately half of the participants considered the healthcare remuneration system to be a barrier and most (~60%) indicated a need for better access to qualified nurse educators / specialist diabetes nurses and psychologists / psychiatrists . Proportion of healthcare professionals reporting that healthcare in their country is well organized for the management of chronic conditions, including debates . A survey of 47 european countries found that while all had guidelines in place for managing diabetes, only 7 (15%) had protocols for monitoring their implementation . The majority (83%) of countries had or were developing national plans for diabetes, but these were often not comprehensive there was substantial variability in the provision of multidisciplinary care . While 80% reported that nurses play an important role in providing education for self - management, diabetes specialist nursing was recognized as a speciality in only 19 countries (40%). Despite the widespread belief that patients need to be more engaged and effective in self - management, only 25% of the countries recommended continuous education for all people with diabetes . Lack of effective self - management education was also identified as a barrier in a qualitative study involving focus group discussions with 25 primary care clinicians in the united states, along with a persistent focus on acute care, poor integration of diabetes care, lack of clinical information and inadequate public health support . Lack of coordination in care and limited access to secondary resources were also identified as important barriers by studies in the netherlands and ireland . Limitations on the time available to manage patients are often identified as an obstacle to good glycaemic control . In the survey of 252 us primary care physicians, lack of time for treating complex patients was reported as often or always a factor in failure to achieve good glycaemic control by 41% of the physicians . Treatment costs were much less frequently seen as a barrier, with 25% of the hcps indicating that it made no contribution and most (58%) saying that it was a factor in only a minority (20%40%) of cases of poor glycaemic control . Other studies have also suggested that hcps in primary care often feel that they lack the time or other resources needed to manage diabetes effectively . This raises particular concerns, given that health policy in some countries involves shifting more of the responsibility for diabetes management onto primary care . Compared with patient- and system - related barriers to effective glycaemic control, there is limited information available regarding physician - related barriers . However, there is evidence to suggest that a lack of diabetes - focused education may be contributing to failure to achieve therapeutic targets . For example, one in five of the hcps surveyed in the dawn2 study indicated that they had received no formal postgraduate diabetes training, and in a uk survey, only 35% of 2149 trainee doctors felt that their postgraduate training had prepared them adequately to optimize treatment of diabetes and only 41% reported that they would take the initiative to optimize glycaemic control . A survey of 209 primary care clinicians in australia identified gaps in knowledge relating to the medical management of t2 dm, with 46% self - reporting a need for education on pharmacological management . It appears that prescribers often lack confidence in the use of insulin, particularly with more complex regimens . Prescribers often identify poor patient motivation and self - management as leading barriers to achieving glycaemic targets . The second diabetes, attitudes, wishes and needs (dawn2) study, included an online survey of 4785 healthcare professionals (hcps) (~40% primary care clinicians, 30% diabetes specialists, 20% nurses and 10% dieticians) from 17 countries across four continents . The majority of the respondents (60%) indicated a need for improvements in self - management by people with diabetes, particularly in the area of diet and exercise . Resistance to lifestyle measures was also identified as a leading barrier by 252 primary care physicians, nurse practitioners and physician assistants in the united states, with 52% of hcps indicating that it was often or almost always a factor contributing to chronic lack of glycaemic control . Other leading patient - related barriers identified by the hcps included psychosocial issues (34%), reluctance to use insulin (31%) and non - compliance (30%). A study in the united kingdom examining the reasons for very poor glycaemic control [hba1c 10% (86 mmol / mol)] in 128 people with t2 dm attending three primary care centres found poor adherence to lifestyle measures to be most frequently involved . Other factors included infrequent clinic attendance (16%), side effects (16%), poor compliance with pharmacotherapy (14%), lack of knowledge of diabetes (14%), lack of titration of insulin (13%) and insulin refusal (12%). Poor patient motivation and adherence were also identified as barriers to good glycaemic control in qualitative studies with hcps . Interviews with a small number (n = 9) of hcps in the united arab emirates revealed a tendency to view patient attitudes and behaviours as the origin of poor glycaemic control and to believe that if patients were more knowledgeable about diabetes, cooperated with hcps and were adherent with treatment, then they could achieve their glycaemic targets . The studies reviewed also revealed that a number of healthcare system - level factors are often seen as important barriers to good glycaemic control . The dawn2 study, for example, found that only 30% of the hcps surveyed believed that healthcare was well organized for the management of chronic conditions . Participants from western european countries and china were more likely to feel that healthcare was well organized than those from north or south america, eastern europe, india or japan (figure 1). Approximately half of the participants considered the healthcare remuneration system to be a barrier and most (~60%) indicated a need for better access to qualified nurse educators / specialist diabetes nurses and psychologists / psychiatrists . Proportion of healthcare professionals reporting that healthcare in their country is well organized for the management of chronic conditions, including debates . A survey of 47 european countries found that while all had guidelines in place for managing diabetes, only 7 (15%) had protocols for monitoring their implementation . The majority (83%) of countries had or were developing national plans for diabetes, but these were often not comprehensive . There was substantial variability in the provision of multidisciplinary care . While 80% reported that nurses play an important role in providing education for self - management, diabetes specialist nursing was recognized as a speciality in only 19 countries (40%). Despite the widespread belief that patients need to be more engaged and effective in self - management, only 25% of the countries recommended continuous education for all people with diabetes . Lack of effective self - management education was also identified as a barrier in a qualitative study involving focus group discussions with 25 primary care clinicians in the united states, along with a persistent focus on acute care, poor integration of diabetes care, lack of clinical information and inadequate public health support . Lack of coordination in care and limited access to secondary resources were also identified as important barriers by studies in the netherlands and ireland . Limitations on the time available to manage patients are often identified as an obstacle to good glycaemic control . In the survey of 252 us primary care physicians, lack of time for treating complex patients was reported as often or always a factor in failure to achieve good glycaemic control by 41% of the physicians . Treatment costs were much less frequently seen as a barrier, with 25% of the hcps indicating that it made no contribution and most (58%) saying that it was a factor in only a minority (20%40%) of cases of poor glycaemic control . Other studies have also suggested that hcps in primary care often feel that they lack the time or other resources needed to manage diabetes effectively . This raises particular concerns, given that health policy in some countries involves shifting more of the responsibility for diabetes management onto primary care . Compared with patient- and system - related barriers to effective glycaemic control, there is limited information available regarding physician - related barriers . However, there is evidence to suggest that a lack of diabetes - focused education may be contributing to failure to achieve therapeutic targets . For example, one in five of the hcps surveyed in the dawn2 study indicated that they had received no formal postgraduate diabetes training, and in a uk survey, only 35% of 2149 trainee doctors felt that their postgraduate training had prepared them adequately to optimize treatment of diabetes and only 41% reported that they would take the initiative to optimize glycaemic control . A survey of 209 primary care clinicians in australia identified gaps in knowledge relating to the medical management of t2 dm, with 46% self - reporting a need for education on pharmacological management . It appears that prescribers often lack confidence in the use of insulin, particularly with more complex regimens . People with diabetes often continue in poor glycaemic control for extended periods of time without appropriate action being taken . A retrospective cohort study of> 80,000 people with t2 dm in the united kingdom revealed substantial delays in intensifying treatment when glycaemic control was suboptimal . For people who were inadequately controlled on one oral glucose lowering agent, the median time from hba1c being above a threshold of 7.0% (53 mmol / mol) to treatment intensification with an additional oral agent was nearly 3 years, and even when hba1c was 8.0% (64 mmol / mol), intensification was delayed by a median of 1.6 years . There were even longer delays (median of ~67 years) in intensifying treatment with the addition of a third oral agent or the initiation of insulin . Mean hba1c at intensification ranged from 8.7%9.7% (7283 mmol / mol). In a study of nearly 20,000 people with t2 dm initiated on basal insulin at hospitals across china, mean hba1c at the time of insulin initiation was 9.6% . A study of primary care records of> 17,000 patients with t2 dm being treated with oral glucose lowering agents in france found that> 3000 of the patients were not at glycaemic target and required treatment intensification . However, treatment was actually intensified in only 39% of the patients requiring it and the majority (~60%) of changes were delayed by 6 months or more and a substantial proportion (~40%) by more than a year . The diattitude study (table 3) also looked at therapeutic inertia in the care of> 2000 people with t2 dm by 236 primary care physicians and found that among patients with uncontrolled glycaemia, representing 41% of all the patients studied, only 7% had their treatment intensified . The most common (60%) reason given for not intensifying treatment was that the patient s hba1c was satisfactory . Other leading reasons given included that lifestyle advice was more of a priority than changing medication (20%), the decision was postponed until the next clinic visit (11%) and that hba1c had decreased since the previous clinic visit (7%), although in the majority (58%) of these cases, an hba1c reduction was not confirmed by the available records . The problem appears to be common and widespread, with further studies in bahrain, croatia, spain, taiwan and the united states reporting high rates (typically 30%60%) of clinical inertia when managing elevated glucose levels in people with diabetes . Summary of studies reporting rates of and factors contributing to therapeutic inertia in the management of type 2 diabetes . Ldl: low - density lipoprotein; t2 dm: type 2 diabetes mellitus; hcps: healthcare professionals . A number of studies have attempted to explore the factors that may act as obstacles to action in addressing inadequate glycaemic control . In an online survey completed by 508 primary care physicians who provided data on 770 elderly patients (> 65 years), the leading reason for not initiating glucose - lowering medication, given as the first - ranked reason for 58% of the patients and a contributory factor in nearly all patients, was that they were treated with diet and exercise, and presumably, this was believed to be adequate management (figure 2). However, 33% of the patients were not at target hba1c, suggesting substantial clinical inertia in this population . Other reasons given for not starting drug treatment included that hyperglycaemia was mild (84%), patient concerns (61%), physician concerns about glucose - lowering agents (49%) and presence of comorbidities and polypharmacy (37%). When asked to identify a threshold for initiating treatment with glucose - lowering agents in the elderly population, the mean hba1c threshold value stated was 7.1% (54 mmol / mol). In approximately 20% of the cases, the physicians indicated that they were planning to initiate glucose - lowering therapy within the next month, but more than half (54%) of these patients already had an hba1c level above the physician - stated threshold . Results from an online survey of 508 us primary care physicians providing clinical date for 770 patients . A qualitative study of 20 hcps in the united kingdom found a pattern of seeking to lessen their own sense of accountability for clinical inertia by emphasizing patient - level barriers such as comorbidities, motivation and self - management capabilities as well as health system level barriers, especially time constraints . There was also a tendency for the hcps to overestimate the achievement of targets in their primary care centres . Factors contributing to therapeutic inertia in the initiation of insulin treatment for t2 dm were investigated in the translating research into action for diabetes (triad) project using structured interviews with primary care hcps in the united states . The majority of the 83 clinicians interviewed supported guideline recommendations on glycaemic targets, with 69% choosing an hba1c <7% (<53 mmol / mol) as the ideal target for good glycaemic control . At the same time, the most frequently cited reasons for setting higher individualized hba1c targets included advanced age or short life expectancy (54%), poor self - management capacity due to poor cognitive abilities (35%), presence of comorbidities (34%), low educational level or poor health literacy (34%) and patients unwillingness to self - manage their diabetes (33%). The most frequent reasons cited by the clinicians for not initiating insulin treatment were patient refusal or resistance (64%) and lack of patient self - management skills (43%). Factors determining initiation of insulin were also investigated using data for 1933 people with t2 dm from the french national health and wellness survey, an annual internet - based survey among french adults . Early initiation of insulin therapy was almost 10 times more likely to be prescribed by an endocrinologist or diabetologist than by a primary care physician . Early versus late insulin initiation was also more likely in patients who were younger, had diabetes - related complications or smoked . Insulin - treated patients were more likely to be adherent, and there was no apparent deterioration in quality of life associated with insulin use . In focus group discussions with 114 primary care physicians in belgium, many of the physicians found the concept of clinical inertia interesting, but some also found it insulting and felt it implied that they were passive in their work . They also noted that it was important to differentiate between cases where there was a conscious decision to not pursue lower targets based on a consideration of the individual patient factors and those where there was genuine inertia . It was acknowledged that genuine clinical inertia was a real risk in primary care, but there was a tendency to ascribe this risk to patient- and system - level barriers rather than physician - level behaviours and practices . In summary, recent studies suggest that clinical inertia is a common and widespread problem, typically affecting the care of 30%50% of people with t2 dm . The causes are diverse and complex, but surveys of hcps tend to emphasize patient - level barriers to treatment intensification, such as patient reluctance to start insulin therapy, or system - level barriers, such as disconnects between what is recommended in guidelines and what is reimbursed in practice . However, it also appears that hcps sometimes delay taking necessary action and may be willing to tolerate periods of it also appears that many hcps, while recognizing the importance of good glycaemic control, have low expectations for their patients . The issue of clinical inertia needs to be better understood if it is to be addressed effectively, particularly regarding the patient-, hcp- and system - level factors that underlie it . This is challenging as clinical inertia as defined in studies typically captures a range of behaviours, some of which may not reflect suboptimal care . However, studies of clinical inertia often apply a single glycaemic threshold [typically hba1c = 7% (53 mmol / mol)] across a broad range of patients . Guidelines for management of t2 dm have traditionally advocated a stepwise approach to management, in which treatment is started with diet and exercise, followed by the addition of oral antihyperglycaemic monotherapy, then combination therapy and eventually insulin . However, when applied systematically without considering individual factors such as the patient s current hba1c level, it can lead to treatment futility with people receiving therapy that has little chance of lowering glucose levels sufficiently to achieve their glycaemic target . Several recent publications have indicated potential benefits of early, intensive intervention with pharmacotherapy, including combinations of oral glucose lowering agents and/or insulin . The treatment options for type 2 diabetes in adolescents and youth (today) study compared metformin alone, metformin plus a thiazolidinedione and metformin plus intensive lifestyle intervention as initial therapy for new - onset t2 dm in people aged 1017 years and with obesity . The proportion of people who maintained glycaemic control over 5 years was significantly higher with the combination pharmacotherapy than either metformin alone or metformin plus intensive lifestyle measures . The combination pharmacotherapy was also associated with greater improvements in insulin sensitivity and -cell function compared with the other two approaches . The results lend support to early, intensive intervention with combination therapy, at least in this population of young people with new - onset t2 dm . Early intensive therapy was also studied in older (mean age = 45 years) people with newly diagnosed t2 dm who started treatment for 3 months with metformin plus insulin and were then randomized to either continuing metformin plus insulin therapy or triple oral glucose good glycaemic control was maintained for over 6 years with no significant difference between the groups (end of study hba1c = 7.3% for metformin plus insulin and 6.4 for triple oral combination; p = 0.4). A review of the health records for nearly 3000 people with t2 dm in the united states found that early initiation of metformin (within 6 months of diagnosis) significantly reduced hba1c (0.36%; p <0.001) and bmi (0.46 kg / m; p <0.001) compared with when introduction of pharmacotherapy with metformin was delayed . The likelihood of achieving hba1c 7% was doubled and the likelihood of requiring therapy intensification was reduced by 28% with early versus delayed initiation of metformin . Another study in the united states looking at medical records for 5870 people with t2 dm found a similar pattern for early introduction of combination oral glucose early intensification was defined as addition of a second oral drug to metformin therapy within 3 months of treatment failure (hba1c 7.5%) and late intensification as the introduction of combination therapy 1015 months after loss of glycaemic control . People who received early intensification were 38% more likely to achieve good glycaemic control at 1.52 years than those with late intensification . In the advance trial of 11,140 patients with t2 dm, therapeutic intensification with addition of an oral glucose lowering agent doubled the chance of achieving good glycaemic control, and with intensification with insulin, the odds were increased 2.5-fold . Recently published evidence highlights that many people with t2 dm do not achieve good control of blood glucose leaving them at increased and avoidable risk of serious complications . A tendency to focus on patient - related obstacles may fail to consider issues arising from the attitudes, perceptions and behaviours of healthcare providers . In particular, there are often delays in the implementation of appropriate interventions to achieve glycaemic targets due to a complex range of negative factors that exacerbate the situation . An improved understanding of these factors would better inform strategies to assist hcps in more timely treatment of inadequately controlled glycaemia . Despite a wide range of therapeutic options available, insufficient numbers of people with type 2 diabetes are reaching their glycaemic targets and large numbers are exposed to prolonged periods of hyperglycaemia . A number of obstacles exist globally that must be addressed and overcome if we are to improve the outcomes for patients . Despite a wide range of therapeutic options available, insufficient numbers of people with type 2 diabetes are reaching their glycaemic targets and large numbers are exposed to prolonged periods of hyperglycaemia . A number of obstacles exist globally that must be addressed and overcome if we are to improve the outcomes for patients.
Calcium channels have not been identified previously in c. albicans, but high - affinity and low - affinity calcium - uptake systems (hacs and lacs) have been described and partially characterized in s. cerevisiae [8, 9]. We identified and deleted in c albicans, homologs of components of these systems the voltage - gated cch1p channel and the stretch - activated channel mid1p . Together, these two channels are thought to form a complex that defines the hacs . Cacch1 encodes a putative 2254 amino acid protein with 38.4% identity to its s. cerevisiae homolog . The 24 predicted transmembrane (tm) regions in cacch1p are arranged in four repeated units (i to iv) of six tm domains, as they are in mammalian calcium channels where they tetramerize to form the core 1-subunit of l - type ca channels . The tm regions include segments responsible for voltage - dependency, channel - specificity, and association with organic calcium - channel blockers . The c. albicans cch1p and the human voltage - gated calcium channel cav1.2 are 62.9% similar and 37.7% identical over a 20 amino acid region in the four ca selective, pore - forming p domains . In the voltage - sensitive s4 domains, 13 of the 23 basic residues in cav1.2 the camid1 gene sequence had 36.9% and 34.4% identity to scmid1 and schizosaccharomyces pombe yam8(+), respectively . The 559 amino acid protein it encodes contains four putative tm regions (h1 - 4), potential n - glycosylation sites, a helix - loop - helix domain and 10 conserved cysteines that, in s. cerevisiae, form the c1/c2 domains that are essential for activity and localization [11, 16]. Unlike in s. cerevisiae, the c1/c2 regions in c. albicans are located between h3 and the c - terminal h4 . Cafig1p shares 48.5% identity with scfig1p, a putative homolog of mammalian pmp-22/emp / mp20/claudins, which are involved in the trafficking and assembly of membrane - associated proteins . Consistent with emp homology, cafig1p has four predicted n - glycosylation sites in the first of its four tm domains . The role of scfig1p in s. cerevisiae is not well - defined, but it localizes predominantly to the plasma membrane and is required for low - affinity calcium transport and for the calcium - dependent fusion of mating projections . Control strains were created by the generation of conditional mutants expressing a single remaining wild - type gene from the mrp1 maltose - regulatable promoter (cch1 or mid1) or by reintegration of the gene at a high - expression locus (fig1 or mid1) (see the experimental procedures in the supplemental data available with this article online). In s. cerevisiae, hacs is activated by low ca conditions and is regulated by calcineurin, which controls calcium homeostasis and specific stress responses [811, 18]. Scfig1p (lacs) activity was only revealed under conditions when hacs was inhibited by rich media . In contrast to hacs, lacs is insensitive to calcineurin and its affinity for ca is 16-fold lower . However, both systems are activated on exposure of cells to -pheromone, which stimulates the formation of the polarized mating projection [8, 19]. Localization of scmid1p and scfig1p to the mating projection is dependent on scspa2 and scbni1 [19, 8]. In c. albicans, caspa2p and cabni1p are components of the hyphal polarisome and spitzenkrper, respectively, and are required for polarized hyphal extension . Mid1p and fig1p may therefore be involved in polarized cell growth in both organisms . In c. albicans, mrna encoding hacs and lacs component proteins was detected in both yeast and hyphal growth conditions and in c. albicans - infected rabbit kidney (data not shown). Also, both hacs and lacs mutants were affected in the thigmotropic response (see below). Therefore, both hacs and lacs are expressed in c. albicans during the normal in vitro and in vivo growth of this fungus . After prolonged incubation on ca - depleted solid minimal medium (> 14 days), wild - type c. albicans colonies produced aberrant lobed margins that could be alleviated by the addition of 10 mm ca to the medium . Emerging colonies of the cacch1 and camid1 mutants produced lobed colonies at 2 days (see supplemental data). The aberrant morphologies of the colonies of cafig1, cacna1, and cacnb1 mutants were partially alleviated on supplementation with exogenous ca, supporting the view that these genes are involved in calcium signaling in c. albicans . The growth rates of the cacch1, camid1, and cacch1-mid1 mutants were reduced by 19%, 23%, and 25%, respectively, when they were grown in the yeast form, compared to the control strain (p = <0.037), but the extension rates of hyphae were not affected by the mutations (data not shown). Consistent with the putative roles of camid1p and cch1p as ca channels, ca accumulation in the camid1 and cacch1 mutants was significantly reduced after 2 hr culture in ca - depleted medium supplemented with ca (p = <0.001; supplemental data). The double cacch1-mid1 mutant had similar ca accumulation and yeast growth rates to the single mutants, consistent with the model that these proteins operate within the same pathway . This is consistent with reports that, in s. cerevisiae, cch1-mid1p are involved in ca homeostasis under low - ca conditions, where fig1p activity is not detectable . Tropic growth responses to applied external electric fields (galvanotropism) have been observed in migratory and tip - growing cells . Growing c. albicans hyphae orient toward the cathode in such fields . To characterize hyphal orientation, we measured the angle at which germ tubes emerged from the mother cell (emergence angle) and the angle of the hyphal tip after 6 hr growth (final angle) relative to the cathode . To investigate the role of calcium ions and channels in galvanotropism, we measured the emergence and final angles of hyphae exposed to electrical fields in media of varying extracellular [ca] or in the presence of pharmacological agents that block the activity of l - type voltage - gated cation channels . In c. albicans, site selection of germ tubes is not strictly controlled by the bud proteins that regulate bud - site selection during axial and bipolar budding of s. cerevisiae . We observed that, in electric fields, germ tubes were formed almost exclusively on the cathode - facing pole of cells, suggesting that imposed electrical fields can override cortical bud evagination markers . The percentage cathodal germ - tube emergence was positively correlated with extracellular [ca]. Cathodal orientation of wild - type cells was attenuated in ca - depleted medium (figures 1a and 1b) and was further significantly reduced in the presence of calcium - channel blockers (p = <0.05) (figure 2a). Therefore, ca influx is important for cathodal evagination of the germ tube in c. albicans . Localized ca uptake correlates with sites of germination of other cell types, such as the zygotes of the brown alga silvetia compressa . Even in low ca medium, extending hyphae grew toward the cathode and reoriented their direction of growth when the field polarity was reversed (figure 1c). Deletion of cacch1 resulted in a significant reduction in the cathodal orientation of germ - tube emergence (p = <0.001) (figure 2b). Cathodal orientation was restored in the conditional cacch1 strain when cacch1 expression was induced by growth on maltose but not when camid1 was induced in the cch1/mid1/mrp1-mid1 strain . We hypothesize that the voltage - gated cacch1p ca channel is activated by membrane depolarization at the cathodal face of yeast cells and that this results in localized ca uptake and subsequent induction of localized polarized growth . The effects of extracellular [ca] deprivation and cacch1 deletion primarily affected the site of germ - tube emergence . In low [ca], in the cacch1 mutant and in the presence of l - type ca - channel blockers, cathodal germ - tube emergence was approximately half that of the control strain, but after 6 hr exposure to an electric field, this effect was almost lost (figure 2a). Even hyphae that had emerged from the anodal face of the cacch1 mother cell eventually responded to the electric field . This suggested that differences exist between the mechanism that establishes cathodal growth and that which maintains it . Only the former appears to depend on calcium influx and cch1p . The ability of fungal hyphae to exhibit tropic growth responses in relation to changes in substratum topography is well - known in plant pathogens and has been demonstrated previously for c. albicans and certain dermatophytes [24, 25]. Some plant pathogenic fungi also use topographical features to trigger formation of the appressorium infection structure (thigmodifferentiation). We tested whether treatments and mutations that attenuated galvanotropism also influenced thigmotropic orientation in c. albicans hyphae . In wild - type cells, 60% of hyphae that contacted a 0.79 m ridge responded by reorienting their growth axis (figures 3a and 3b). This is consistent with previous observations that thigmotropism was attenuated by inhibitors of stretch - activated ca channels and supports a model whereby changes in the underlying topography induce stresses in the membrane that are sensed by mid1p (figure 4b). Reorientation of the cacch1 strain was also significantly reduced (p = <0.001) compared to the control strain (figure 3). Thigmotropism was attenuated in the regulatable cacch1/mrp1-cch1 under repressing conditions and restored to normal under mrp1p - inducing conditions . Expression of camid1 in the cacch1/camid1/mrp1-mid1 conditional mutant did not restore the reorientation response, confirming that cacch1p is required for thigmotropism . We propose that stretch activation of camid1p, and subsequent opening of the cacch1p channel, results in localized ca influx that exerts an influence on the molecular machinery involved in polarized growth of the hyphal tip . This influence overrides or repositions, or both, the molecular markers that defined the original axis of growth . However, because hyphal reorientation was observed in almost 30% of ridge interactions in the camid1 mutant, either cacch1p is activated independently of camid1p or other sensing elements also contribute to the regulation of thigmotropism . The function of fig1p in c. albicans is not known, but in s. cerevisiae its deletion resulted in defective cell - cell fusion during mating, suggesting it could be involved in the delivery of components to the fusion site . Because its deletion in c. albicans reduces hyphal reorientation during contact - sensing, cafig1p may again be involved in targeted delivery of secretory vesicles to the cell surface . No instances of tip bifurcation were observed when a hyphal tip contacted a ridge, even when the angle of approach was 90 (figure 3c), suggesting that orientation - determining factors are a nondivisible entity or discrete protein complex . Calcium - dependent gene transcription in eukaryotes involves activation of a transcription factor by the phosphatase, calcineurin . Calcineurin regulates fungal morphogenesis, calcium flux, and homeostasis . In c. albicans, calcineurin acts on the transcription factor, the deletion of cacrz1 affected both cathodal germ - tube emergence (figure 2b) and thigmotropism (figure 3), whereas the inhibition of calcineurin with fk506 or deletion of genes encoding either the catalytic cacna1 or regulatory cacnb1 calcineurin subunits only affected cathodal emergence (p = 0.006). Our results suggest that calcineurin is required for the establishment of cathodal cell polarity in an electric field but not for the reorientation of already - polarized hyphal tips during contact - sensing . Although cacrz1p influences cacch1 expression, it does not appear to be essential for basal expression or activation of camid1p or cacch1p because the morphology of cacrz1 mutant colonies was the same as the wild - type strain, whereas the camid1 and cacch1 mutants formed aberrant colonies (see supplemental data). Other targets of cacrz1p have been identified in c. albicans and are required for resistance to membrane damage and alkaline stress . It is not known whether cacrz1p - mediated gene expression regulates events that are upstream or downstream of calcium - influx induced tropisms . The ability of external cues to influence the orientation of hyphal growth of the human pathogenic fungus, candida albicans, may be relevant to their capacity to infiltrate between human cells during tissue invasion . We have found that reorientation of c. albicans hyphae in relation to electrical fields and topographical signals is ca dependent and is mediated by ca channels and a ca - dependent transcription factor, cacrz1p . Calcineurin, the primary regulator of cacrz1p, was required for galvanotropism but not thigmotropism . We observed that the hyphae of mutants lacking the stretch - activated camid1p or voltage - activated cacch1p proteins grew normally but were attenuated in orientation responses resulting from physical contact or imposed electric fields, respectively . We propose a model whereby localized ca - channel activation, caused by localized changes in membrane potential or membrane stretch, results in calcium influx that directs polarized growth (figure 4). Stretch - activated ion channel activity has been described in patch - clamp analysis of c. albicans membranes, but the ion selectivity of these channels is not known . In plant cells, mechanosensory ca channels produce high cytosolic ca and initiation of localized cell - wall expansion at sites of shear stress . Similarly, in mammalian synapses, localized channel activation produces intracellular ca microdomains where the spatial boundary of the domain correlates with the capacity for efficient vesicle exocytosis . Localized ca influx may result in an asymmetry in the tip - high ca gradient in hyphae of c. albicans and other fungi . This alters the axis of growth by increasing the rate of vesicle fusion within a local ca - high microdomain or by affecting the activity of calcium - binding proteins that are involved in polarized cell extension . Ca influx may therefore override existing polarity determinants at the cortex of evaginating mother cells and growing hyphae . Thus, both thigmotropic and galvanotropic responses of c. albicans hyphae are dependent on a single ca - regulated orientation mechanism . For strains used in this study, mutant - strain construction, growth conditions, and determination of ca accumulation, see the supplemental experimental procedures . Yeast cells were adhered to poly - l - lysine - coated microscope slides and placed on the flat bed of a biorad midi - sub cell electrophoresis tank and cultured in modified soll's medium at 37c 1c for 6 hr at 10 v / cm and a current of 33 2 ma . This field strength could be applied without affecting germ - tube formation or hyphal extension rate, yet it is sufficient for inducing cytoplasmic [ca] increases in other cell systems [3, 4]. Hyphal orientation at the site of germ - tube emergence and at the germ - tube tip relative to the cathode were measured with improvision openlab 2.0 software . The percentage cathodal orientation (p) was calculated with p = (sin /n) 100, for n measurements . A minimum of 100 cells was measured in each of three independent experiments for each treatment . Yeast cells were adhered to poly - l - lysine - coated quartz slides featuring ridges of 0.79 m 40 nm and a pitch of 25 m (kelvin nanotechnology, glasgow, uk). This ridge height caused maximal hypha reorientation in a preliminary trial of five heights (data not shown). Slides were placed in 20 ml prewarmed 20% (v / v) newborn - calf serum and 2% (w / v) glucose at 37c for 6 hr for inducing hyphae . The number of hyphae reorienting on contact with a ridge was expressed as a percentage of the total observed interactions . A minimum of 100 interactions was observed per strain in each experiment, and results were reported as the mean value from three independent experiments sd.
Periodontitis causes loss of tooth supporting bone . The bone loss may be vertical, horizontal, or combined . Regenerative periodontal therapy aims to predictably restore the structure and function of these lost tissues . For this purpose, these grafting materials are available in different forms . Among the graft materials, autogenous bone grafts have been considered the gold standard and can be harvested in either particulate or in the form of bone blocks . With the advancement in techniques and materials used for regeneration, sources of bone include bone from healing extraction wounds, bone from edentulous ridges, bone trephined from within the jaw, exostoses, and bone removed during osteoplasty and ostectomy . Bone removed from the donor site during osteoplasty has the advantage of eliminating the need for additional donor site while accomplishing the objective of obtaining desirable bone contour in the surgical site . The obvious advantage of this technique is the ease of obtaining bone from already exposed surgical sites, but the disadvantages are its relatively low predictability and inability to procure adequate material for large defects . In this case report, bone from ledges present on the mandibular posterior area was removed with the simple technique of scrapping with a sharp sickle scaler and the resulting graft was used to fill a two wall defect distal to first molar . A 37-year - old male patient reported to the department of periodontology government dental college, calicut with a chief complaint of bleeding from gums and bad breath of 3 months duration . On clinical examination, generalized moderate to deep periodontal pockets and bleeding on probing was noticed . Based on the history, clinical and radiographic findings, the patient was diagnosed with chronic generalized periodontitis . Six weeks after performing thorough scaling and root planning and following a strict plaque control regime, the case was reevaluated . Since the pocket depth was 7 mm distal to 36, it was decided to proceed with flap surgery [figure 1]. After giving block anesthesia in the left mandibular posterior area, meticulous defect debridement and root planing was done to remove subgingival plaque, calculus, and inflammatory granulation tissue . A deep two wall defect was observed distal to first molar, heavy ledges were noticed extending bucally from second premolar to the second molar area [figure 2]. First it was decided to remove the ledges as a part of osteoplasty procedure and then utilize the removed bone to fill the two wall defect . For this purpose, a sharp sickle scaler (pdt cruise scaler u15 - 33 r113, pdt inc ., us) [figure 3] was used in a scrapping motion with sufficient force such that the bone was essentially shaved off [figure 4]. The harvested bone was carefully collected in a dappen dish and then transferred to the defect with a periosteal elevator [figures 5 and 6]. The flap was repositioned, single interrupted sutures were placed and periodontal dressing was given [figures 7 and 8]. The patient was reviewed after 1-week, the healing was found to be uneventful . The patient was put on the maintenance phase with oral prophylaxis performed every 3 months . Clinically, there was a reduction in probing pocket depth from 7 mm to 3 mm [figure 9]. Radiographs revealed radio opacity in the site distal to first molar, suggestive of bone fill in the defect [figure 10]. Defect exposed, ledges seen (a and b) pdt cruise scaler u15 - 33 r113 used to remove ledge autograft obtained from ledge removal with sickle scaler autogenous graft placed in the defect distal to first molar postoperative view after 1-year (a) preoperative radiograph, (b) postoperative radiograph after 1-year there is ample evidence that autogenous bone grafts shore up the formation of new attachment . Autogenous bone, long considered the gold standard of grafting materials, is currently the only osteogenic graft available to clinical practitioners . Grafted autogenous bone heals into growing bone through the processes of osteogenesis, osteoinduction, and osteoconduction . Moreover, auto - grafts are bioabsorbable, nonallergenic, easy to handle, and not costly . Rapid revascularization occurs around autogenous bone graft particles, and the graft can release growth and differentiation factors . Although iliac crest is one of the most preferred site, it is not always recommended due to its associated problems, such as postoperative infection; exfoliation and sequestration; varying rates of healing; root resorption and rapid recurrence of the defect, in addition to increased patient expense and patient morbidity . Intramembranous (craniofacial origin) bones have been found to have more survival potential than endo - chondral (long bones) origin . Insulin - like growth factor - ii and transforming growth factor- have been found to be in a greater concentration in calvarial bone than in bone from the iliac crest or vertebral body . This increase in concentration of growth factors leads to a greater capacity for bone repair and graft retention . The use of intraoral graft material is, however, limited by the restricted donor sites in the oral cavity for extensive grafting . The use of bone removed from ledges as a part of osteoplasty procedure offers the added advantage of eliminating the nonphysiologic bony architecture . The goal of osseous respective therapy is to reshape the marginal bone to resemble that of the alveolar process undamaged by periodontal disease . The reshaping process is an attempt to gradualize the bone sufficiently to allow soft tissue structures to follow the contour of the bone . In this case, radicular blending was done using the sharp blade of scaler to gradualize the bone over the entire radicular surface providing a smooth, blended surface for good flap adaptation . Many techniques and devices are available to harvest intraoral autogenous bone grafts, such as: bone scraper, rotary instruments, bone chisels, rongeur pliers and piezoelectric devices . Particulate graft material is easy to procure and is best suited for two, three, or more walled defect, as they usually provide adequate space for placing and retaining the bone graft material for a sufficient period . The commonly used technique to procure particulate grafts is the use of carbide bur at speeds between 5000 and 30,000 rpm . The inability to procure adequate material for large defects is a major disadvantage of using rotary instruments . Conventional osteotomy or milling procedures has some limitations like overheating of the bone when water cooling is insufficient, which leads to possible structural bone changes on living cells . A simple technique for removal of bone using a sharp sickle was done, in this case, which turned out to be effective means for harvesting sufficient amounts of bone graft . Although specialized bone scrapers have been used for obtaining grafts from intraoral sites before . To the best of our knowledge, there are no previous reports of bone harvesting done with scaler alone . Reported higher percentages of cultured osteoblast cells for both rotary drill and the piezoelectric device, 88.9% and 87.9%, respectively . They concluded that the harvesting methods are not different concerning the detrimental effect on the viability . Another study by bacci et al . Showed contradictory results, their histological findings revealed that smaller particle size bone chips, obtained with a piezoelectric device, had less vital bone (64.83%) compared with the small particle size bone chips harvested with a bone scraper (75.34%). In this case, sufficient amounts of autogenous particulate bone were obtained during the ledge removal process to fill the two wall defect distal to first molar . Instead the sharp blade of the sickle scaler was utilized, which was also less time consuming . Autogenous grafts have long remained and will continue to remain as the first preference for bone grafting procedures because of its superior biologic properties . Ledges are frequently found in posterior regions and if properly managed can act as a source of autogenous graft . Routinely used scaling instruments may be utilized in certain situations instead of using specialized bone scrapping instrument.
Tuberculosis remains a frequent and important infectious disease worldwide, it occurs with, in approximately 30% of all cases, extrapulmonary involvement in the form of tuberculous pleurisy (tp). And tp increases the morbidity and mortality associated with tuberculosis, and it is a major economic and health burden all over the world . The differential diagnosis of tp reliably is challenging although many conventional diagnostic methods are used, including microscopic analysis of pleural fluid or sputum smears, culturing for mycobacteria and even performing a pleural biopsy . Each of these methods has significant limitations: microscopic analysis of pleural fluid is rarely positive (<5%), culture of pleural fluid shows poor sensitivity (24 - 58%), culturing for mycobacterium tuberculosis requires several weeks, and pleural biopsy, which is considered the best method for confirming tp diagnosis, is invasive and technically difficult . Even more invasive procedures such as thoracoscopy or thoracotomy have been used for differential diagnosis of tp, but these complex procedures can cause complications and even increase morbidity . These led investigators to explore several biomarkers as possible diagnostic indicators . Its release by mesothelial cells in pleura contributes to the occurrence and development of tp through three mechanisms: it acts as a proinflammatory cytokine to attract neutrophils to kill mycobacteria directly as part of an innate immune response; it acts synergistically with interferon (ifn-) to activate macrophages as part of an adaptive immune response; and it recruits nave t cells to the granuloma . Tumor necrosis factor- (tnf-) levels in the pleural fluid are significantly higher in patients with tuberculosis than in patients with pulmonary malignancy . Some studies have reported that levels of tnf- in pleural fluid provide high diagnostic sensitivity (96.0%) and specificity (93.0%). Other studies, however, have reported much lower corresponding values of 70% and 66% . However, the comprehensive picture of the diagnostic usefulness of tnf- levels in pleural fluid is not obvious . Therefore in this article we will product a meta - analysis to explore the diagnostic accuracy of pleural fluid tnf- in tp . We conducted this meta - analysis according to the guidelines of the prisma and the quality assessment of diagnostic accuracy studies (quadas) checklist . The following search terms were used: tuberculosis or tb disease or active tuberculosis or tnf - alpha or cytokines and sensitivity and specificity and diagnosis . Reference lists of articles identified in these searches were also searched manually . To be included in our study, studies had to evaluate the sensitivity and/or specificity of pleural fluid tnf- for diagnosis of tp using.a case - control design involving.case and control groups classified using clear diagnostic criteria and.the same method to assay tnf-.apply an adequate experimental method . Evaluate the sensitivity and/or specificity of pleural fluid tnf- for diagnosis of tp using . A case - control design involving . Case and control groups classified using clear diagnostic criteria and . The same method to assay tnf-. Apply an adequate experimental method . Unpublished data, abstracts, review articles, and letters to the editor were excluded . Two reviewers (z.l . And w.q .) Independently assembled a final set of eligible studies, and a third author (x.c .) The same procedure was followed to extract data from the included studies using a standardized form . Extracted data included first author, publication year, country of the study, number and characteristics of participants, tnf- assay method, cut - off value for tnf- detection, sensitivity and specificity, and numbers of true positives, false positives, true negatives and false negatives . We assessed the methodological quality of the studies using the quadas-2 checklist, with a maximum score of 11 . Analyses were performed using stata and meta - disc (xi cochrane colloquium, barcelona, spain). The following measures of test accuracy were computed for each study: sensitivity, specificity, positive likelihood ratio (plr), negative likelihood ratio (nlr) and diagnostic odds ratio (dor). These curves were plotted for each study using the sensitivity and specificity based on the single - test threshold identified within the same study . Then we performed a meta - regression analysis to assess the effect of the baseline in each study on the relative dor of pleural fluid tnf- in tp diagnosis . We used a random - effect model to meta - analyze sensitivity, specificity, and other diagnostic measures across multiple studies . To assess statistically significant variability (heterogeneity) across studies, we used chi - squared and fisher's exact tests . The following search terms were used: tuberculosis or tb disease or active tuberculosis or tnf - alpha or cytokines and sensitivity and specificity and diagnosis . Only english - language articles were considered . Reference lists of articles identified in these searches were also searched manually . To be included in our study, studies had to evaluate the sensitivity and/or specificity of pleural fluid tnf- for diagnosis of tp using.a case - control design involving.case and control groups classified using clear diagnostic criteria and.the same method to assay tnf-.apply an adequate experimental method . Evaluate the sensitivity and/or specificity of pleural fluid tnf- for diagnosis of tp using . A case - control design involving . Case and control groups classified using clear diagnostic criteria and . The same method to assay tnf-. Apply an adequate experimental method . Unpublished data, abstracts, review articles, and letters to the editor were excluded . Two reviewers (z.l . And w.q .) Independently assembled a final set of eligible studies, and a third author (x.c .) The same procedure was followed to extract data from the included studies using a standardized form . Extracted data included first author, publication year, country of the study, number and characteristics of participants, tnf- assay method, cut - off value for tnf- detection, sensitivity and specificity, and numbers of true positives, false positives, true negatives and false negatives . We assessed the methodological quality of the studies using the quadas-2 checklist, with a maximum score of 11 . Analyses were performed using stata and meta - disc (xi cochrane colloquium, barcelona, spain). The following measures of test accuracy were computed for each study: sensitivity, specificity, positive likelihood ratio (plr), negative likelihood ratio (nlr) and diagnostic odds ratio (dor). These curves were plotted for each study using the sensitivity and specificity based on the single - test threshold identified within the same study . Then we performed a meta - regression analysis to assess the effect of the baseline in each study on the relative dor of pleural fluid tnf- in tp diagnosis . We used a random - effect model to meta - analyze sensitivity, specificity, and other diagnostic measures across multiple studies . To assess statistically significant variability (heterogeneity) across studies, we used chi - squared and fisher's exact tests . Literature searches turned up 96 potentially eligible studies, and 86 were excluded based on review of titles and abstracts . The remaining 10 articles were read in full, and 4 were excluded because they did not apply an adequate experimental method . In the end, six publications assessing the diagnostic performance of pleural fluid tnf- assay in tp were included in our analysis . One study involved two control groups, and sufficient data were reported for both that we were able to treat the groups as two independent studies in the meta - analysis [figure 1]. Flow diagram of included and excluded studies characteristics of studies included in the meta - analysis the seven studies involved 159 patients with tp and 338 without it . Average sample size in the seven studies was 71 (range: 50 - 97). Tnf- levels in all studies were assayed by enzyme - linked immunosorbent assay (elisa). Sensitivity for pleural fluid tnf- in tp diagnosis ranged from 0.71 to 0.96 in the seven studies, and meta - analysis of sensitivity and specificity indicated a pooled sensitivity of 0.89 (95% confidence interval [ci]: 0.83 - 0.93) [figure 2]. Specificity ranged from 0.71 to 0.93, and meta - analysis showed a pooled specificity of 0.82 (95% ci: 0.78 - 0.86) [figure 2]. Plr was 4.78 (95% ci: 3.32 - 6.89) and nlr was 0.16 (95% ci: 0.1 - 0.27) [figure 3]. Dor was 32.43 (95% ci: 14.48 - 72.6) [figure 4]. Significant heterogeneity (i> 50%) was present among the seven studies with respect to plr data but not data for other diagnostic measures: i was 0% for sensitivity, 47.5% for specificity, 53.8% for plr, 25% for nlr, and 46.9% for dor . Forest plot of estimates of sensitivity / specificity for pleural fluid tnf- in the diagnosis of tuberculous pleurisy . Point estimates of sensitivity and specificity from each study are shown as solid circles, the size of which reflects the total number of cases and controls . Numbers indicate the reference numbers of the studies forest plot of estimates of positive and negative likelihood ratios (plr and nlr) for pleural fluid tnf- in the diagnosis of tuberculous pleurisy . Point estimates of plr and nlr from each study are shown as solid circles, the size of which reflects the total number of cases and controls . Numbers indicate the reference numbers of studies (a) forest plot of estimates of diagnostic odds ratios for pleural fluid tumor necrosis factor- (tnf-) in the diagnosis of tuberculous pleurisy . Point estimates of diagnostic odds ratios from each study are shown as solid circles, the size of which reflects the total number of cases and controls . (b) summary receiver operating characteristic curves for pleural fluid tnf-. Each study is depicted as a solid circle, the size of which reflects the total number of cases and controls summary receiver operating characteristic curves were generated by plotting sensitivity against (1-specificity) for individual studies [figure 4]. The curves did not lie near the desired upper left corner, and the maximum joint sensitivity and specificity was 0.89, with an area under the curve (auc) of 0.8556 (standard error of mean 0.0559). On the other hand, dor was 32.43, suggesting relatively high overall accuracy . Across the seven studies, tnf- cut - off values in the elisa and different diseases in the control group were different significantly [table 1]. Weighted meta - regression of the effects of diseases in control groups and cut - off values on diagnostic accuracy of pleural fluid tnf- funnel plots showed some asymmetry [figure 5], presumably reflecting the small number of studies included in our meta - analysis . Nevertheless, deeks test gave a p = 0.11, suggesting that our analysis did not carry significant risk of publication bias . Funnel plot for evaluating publication bias among the six articles (seven studies) included in the meta - analysis . The log of the diagnostic odds ratio (dor) is plotted against the standard error of log dor; the latter serves as an indicator of sample size . Average sample size in the seven studies was 71 (range: 50 - 97). Tnf- levels in all studies were assayed by enzyme - linked immunosorbent assay (elisa). Sensitivity for pleural fluid tnf- in tp diagnosis ranged from 0.71 to 0.96 in the seven studies, and meta - analysis of sensitivity and specificity indicated a pooled sensitivity of 0.89 (95% confidence interval [ci]: 0.83 - 0.93) [figure 2]. Specificity ranged from 0.71 to 0.93, and meta - analysis showed a pooled specificity of 0.82 (95% ci: 0.78 - 0.86) [figure 2]. Plr was 4.78 (95% ci: 3.32 - 6.89) and nlr was 0.16 (95% ci: 0.1 - 0.27) [figure 3]. Dor was 32.43 (95% ci: 14.48 - 72.6) [figure 4]. Significant heterogeneity (i> 50%) was present among the seven studies with respect to plr data but not data for other diagnostic measures: i was 0% for sensitivity, 47.5% for specificity, 53.8% for plr, 25% for nlr, and 46.9% for dor . Forest plot of estimates of sensitivity / specificity for pleural fluid tnf- in the diagnosis of tuberculous pleurisy . Point estimates of sensitivity and specificity from each study are shown as solid circles, the size of which reflects the total number of cases and controls . Numbers indicate the reference numbers of the studies forest plot of estimates of positive and negative likelihood ratios (plr and nlr) for pleural fluid tnf- in the diagnosis of tuberculous pleurisy . Point estimates of plr and nlr from each study are shown as solid circles, the size of which reflects the total number of cases and controls . Numbers indicate the reference numbers of studies (a) forest plot of estimates of diagnostic odds ratios for pleural fluid tumor necrosis factor- (tnf-) in the diagnosis of tuberculous pleurisy . Point estimates of diagnostic odds ratios from each study are shown as solid circles, the size of which reflects the total number of cases and controls . (b) summary receiver operating characteristic curves for pleural fluid tnf-. Each study is depicted as a solid circle, the size of which reflects the total number of cases and controls summary receiver operating characteristic curves were generated by plotting sensitivity against (1-specificity) for individual studies [figure 4]. The curves did not lie near the desired upper left corner, and the maximum joint sensitivity and specificity was 0.89, with an area under the curve (auc) of 0.8556 (standard error of mean 0.0559). On the other hand across the seven studies, tnf- cut - off values in the elisa and different diseases in the control group were different significantly [table 1]. Weighted meta - regression of the effects of diseases in control groups and cut - off values on diagnostic accuracy of pleural fluid tnf- funnel plots showed some asymmetry [figure 5], presumably reflecting the small number of studies included in our meta - analysis . Nevertheless, deeks test gave a p = 0.11, suggesting that our analysis did not carry significant risk of publication bias . Funnel plot for evaluating publication bias among the six articles (seven studies) included in the meta - analysis . The log of the diagnostic odds ratio (dor) is plotted against the standard error of log dor; the latter serves as an indicator of sample size . Given the numerous limitations associated with current methods for diagnosing tp, researchers have explored whether pleural fluid biomarkers such as tnf- can serve as diagnostic markers . These studies have given conflicting results about the diagnostic performance of pleural fluid tnf-, so here we meta - analyzed the available evidence . Our analysis suggests that pleural fluid tnf- measurements by themselves are not sufficiently sensitivity (0.89) and specificity (0.82) to diagnose tp, but they can provide complementary diagnostic information when used in combination with assays of other pleural fluid biomarkers and conventional tests such as bacteriological examination or pleural biopsy . A meta - analysis of the seven included studies indicated a pooled dor of 32.4 for the pleural fluid tnf- assay, indicating a relatively high accuracy . Dor, which combines sensitivity and specificity data that serves as an aggregate indicator of test accuracy, is the ratio of the odds of positive test results in individuals with disease relative to the odds of positive test results in individuals without disease . The sroc curve and its auc present an overall summary of test performance and display the trade - off between sensitivity and specificity . In the present meta - analysis, we found the sensitivity of the pleural fluid tnf- assay to be 0.89; specificity, 0.82; maximum joint sensitivity and specificity, 0.89; and auc, 0.8556 . Diagnostic odds ratio and sroc curve analysis are not easy to interpret and use in clinical practice, and likelihood ratios are considered more clinically meaningful . Therefore, we meta - analyzed the data to determine pooled plr and nlr as measures of diagnostic accuracy . The plr value of 4.78 suggested that the probability of being positive for pleural fluid tnf- was nearly 5-fold higher for patients with tp than for patients without it . Although this is insufficient to serve as the sole basis for diagnosing tp, it is likely to be sufficient to allow a clinician to decide whether to initiate or continue anti - tuberculosis treatment of tp in individuals who do not present evidence of malignancy or inflammation . At the same time, nlr was 0.16 in our meta - analysis, indicating that patients negative for pleural fluid tnf- still have a 16% chance of having tp . This provides further evidence that such an assay is inadequate, on its own, for ruling out tp . Thus, a negative pleural fluid tnf- assay is not sufficient cause to deny or discontinue anti - tuberculosis therapy . The reliability of meta - analyses depends on heterogeneity among the included studies, and we found significant heterogeneity in the data for plr . Since the causes of heterogeneity can reveal systematic factors affecting the accuracy and reliability of meta - analyses, we examined the seven studies more carefully . In all studies, tp was diagnosed based on bacteriology, histology or both; tnf- was determined using an elisa kit according to the manufacturer's guidelines (oxfordimmunotec ltd ., abingdon, uk); and the quadus-2 score in each study was relatively high . In addition, inter - study variation in tnf- cut - off values and baseline tnf- levels in the control groups did not substantially affect diagnostic accuracy . Therefore, the basis for the heterogeneity in plr data in our meta - analysis is unclear, and in any case, further large studies are needed to verify our findings, especially since we excluded possibly relevant studies that were not published in english or that were published only as conference abstracts or letters to the editor . Analyses of other pleural fluid biomarkers suggest that they, like tnf-, cannot be used alone as diagnostic indicators . A meta - analysis of the diagnostic accuracy of ifn - g in tp reported a sensitivity of 0.75, specificity of 0.82, plr of 3.49, nlr of 0.24, and dor of 19.04 . Diagnostic performance was better in meta - analysis of adenosine deaminase, which reported a sensitivity of 0.86, specificity of 0.88, plr of 6.32, nlr of 0.15, and dor of 45.25 . These results suggest none of the biomarkers is sufficient on its own . Assaying for multiple biomarkers may improve the accuracy of tp diagnosis, and such combined approaches should include tnf- because the peptide plays such an important role in tuberculosis pathogenesis, especially in patients with auto - immune diseases who are taking tnf- antagonists . The available evidence suggests that the pleural fluid tnf- assay should not be used on its own to diagnose tp or guide treatment decisions, but it can be used to complement other tests including microscopic smear examination, culture for m. tuberculosis, pleural tissue histology and response to anti - tuberculosis therapy . The diagnostic performance of tnf- may improve by changing the detection platform from the current elisa to more advanced flow cytometry, elispot and luminex methods . Lz searched the literature and assessed articles, extracted data, performed meta - analyses, and wrote the draft . Cx contributed in the conception of the work, revised the draft, approval of the final version of the manuscript, and agreed for all aspects of the work.
Specific learning disabilities (slds) are a generic term that refers to a heterogeneous group of neurobehavioral disorders manifested by significant unexpected, specific, and persistent difficulties in the acquisition and use of efficient reading (dyslexia), writing (dysgraphia), or mathematical (dyscalculia) abilities despite conventional instruction, intact senses, normal intelligence, proper motivation, and adequate sociocultural opportunity . International classification of diseases-10 describes them as specific developmental disorders of scholastic skills and diagnostic and statistical manual 4 edition - text revision (dsm - iv) as learning disorders and dsm-5 as specific learning disorders . Dyslexia (reading disorder) is the most common among the learning disorders, affecting 80% of all those identified as learning - disabled . The incidence of dyslexia in primary school children in india has been reported to be 218%, dysgraphia 14%, and dyscalculia 5.5% . They are found most commonly associated with other cortical - based disorders such as other learning disorders, language disorders, motor disorders, and organization and executive function disability . The most common comorbidities include attention deficit hyperactivity disorder (adhd), conduct disorder, oppositional defiant disorder, anxiety disorder, and depression . Keeping the paucity of literature regarding slds in india, this study aims to document the sociodemographic profile and psychiatric comorbidities in school children . To study the number of children having slds and comorbidities in school settingto study the comorbidities in children with slds who are identified and on remedial educationto study the comorbidities in children who do not have sldsto study the difference in sociodemographic variables as well as a comorbidity in the three groups . To study the number of children having slds and comorbidities in school setting to study the comorbidities in children with slds who are identified and on remedial education to study the comorbidities in children who do not have slds to study the difference in sociodemographic variables as well as a comorbidity in the three groups keeping the paucity of literature regarding slds in india, this study aims to document the sociodemographic profile and psychiatric comorbidities in school children . To study the number of children having slds and comorbidities in school settingto study the comorbidities in children with slds who are identified and on remedial educationto study the comorbidities in children who do not have sldsto study the difference in sociodemographic variables as well as a comorbidity in the three groups . To study the number of children having slds and comorbidities in school setting to study the comorbidities in children with slds who are identified and on remedial education to study the comorbidities in children who do not have slds to study the difference in sociodemographic variables as well as a comorbidity in the three groups the data are collected from a group of sld children in remedial schools (dyslexia association of andhra pradesh, hyderabad). The other in two urban and two semi - urban schools all of them are nongovernment, private organized english medium schools . They were divided into three groups: group 1 consists of thirty children who are already diagnosed as having an sld by a psychiatrist and are on remedial education . After taking written informed consent from the parents, the details as per the intake pro forma are taken and parent is interviewed according to the developmental psychopathology checklist (dpcl). Subsequently, the child is administered colored progressive matrices (cpm)/standard progressive matrices (spm), malin's intelligence scale for indian children (misic) and nimhans sld index . Group 2 consists of 32 children diagnosed for the first time at schools during the study . After taking permission from the school management, following the screening, children were administered spm / cpm and those who scored more than the 50 percentile were shortlisted . After taking written informed consent from the parents and using the inclusion and exclusion criteria and information obtained from parents interview and intake pro forma and dpcl, the children were then administered misic and nimhans sld index . Group 3 constituted of 34 children who were not included in the list after administering the checklist; they were administered spm / cpm . The parents of those children who scored more than the 50 percentile were interviewed and information was collected in intake pro forma and dpcl after taking consent . Means and standard deviation, chi - square test, and anova were used for analysis . Semi - structured intake pro formaintelligence tests: raven's progressive matrices standard progressive matrices: the booklet comprises five sets (a to e) of 12 items each. (children: 1112 years)colored progressive matrices: the booklet comprises three sets (a, ab, b) of 12 items each (children up to 11 years). Progressive matrices are used as a screening instrument to rule out children with low iq misic the misic is an indian adaptation of wechsler intelligence scale for children the nimhans index for slds is a battery of tests used for confirming the diagnosis of sld . It consists of two levels: level 1: (57 years of age); level 2: (812 years)checklist to identify learning disabilitiesdpcl for children . Semi - structured intake pro forma raven's progressive matrices standard progressive matrices: the booklet comprises five sets (a to e) of 12 items each. (children: 1112 years)colored progressive matrices: the booklet comprises three sets (a, ab, b) of 12 items each (children up to 11 years). Progressive matrices are used as a screening instrument to rule out children with low iq misic the misic is an indian adaptation of wechsler intelligence scale for children raven's progressive matrices standard progressive matrices: the booklet comprises five sets (a to e) of 12 items each. (children: 1112 years)colored progressive matrices: the booklet comprises three sets (a, ab, b) of 12 items each (children up to 11 years). Progressive matrices are used as a screening instrument to rule out children with low iq standard progressive matrices: the booklet comprises five sets (a to e) of 12 items each. (children: 1112 years) colored progressive matrices: the booklet comprises three sets (a, ab, b) of 12 items each (children up to 11 years). Progressive matrices are used as a screening instrument to rule out children with low iq the misic is an indian adaptation of wechsler intelligence scale for children the misic is an indian adaptation of wechsler intelligence scale for children the nimhans index for slds is a battery of tests used for confirming the diagnosis of sld . It consists of two levels: level 1: (57 years of age); level 2: (812 years) checklist to identify learning disabilities dpcl for children . Means and standard deviation, chi - square test, and anova were used for analysis . Semi - structured intake pro formaintelligence tests: raven's progressive matrices standard progressive matrices: the booklet comprises five sets (a to e) of 12 items each. (children: 1112 years)colored progressive matrices: the booklet comprises three sets (a, ab, b) of 12 items each (children up to 11 years). Progressive matrices are used as a screening instrument to rule out children with low iq misic the misic is an indian adaptation of wechsler intelligence scale for children the nimhans index for slds is a battery of tests used for confirming the diagnosis of sld . It consists of two levels: level 1: (57 years of age); level 2: (812 years)checklist to identify learning disabilitiesdpcl for children . Semi - structured intake pro forma raven's progressive matrices standard progressive matrices: the booklet comprises five sets (a to e) of 12 items each. (children: 1112 years)colored progressive matrices: the booklet comprises three sets (a, ab, b) of 12 items each (children up to 11 years). Progressive matrices are used as a screening instrument to rule out children with low iq misic the misic is an indian adaptation of wechsler intelligence scale for children raven's progressive matrices standard progressive matrices: the booklet comprises five sets (a to e) of 12 items each. (children: 1112 years)colored progressive matrices: the booklet comprises three sets (a, ab, b) of 12 items each (children up to 11 years). Progressive matrices are used as a screening instrument to rule out children with low iq standard progressive matrices: the booklet comprises five sets (a to e) of 12 items each. (children: 1112 years) colored progressive matrices: the booklet comprises three sets (a, ab, b) of 12 items each (children up to 11 years). Progressive matrices are used as a screening instrument to rule out children with low iq the misic is an indian adaptation of wechsler intelligence scale for children the misic is an indian adaptation of wechsler intelligence scale for children the nimhans index for slds is a battery of tests used for confirming the diagnosis of sld . It consists of two levels: level 1: (57 years of age); level 2: (812 years) checklist to identify learning disabilities dpcl for children . They comprised 40 males (m) and 22 females (f) with the gender distribution ratio (m / f) of 1.8:1 [table 1]. Sociodemographic and personal data prematurity (sld special education group 6 (20%) and sld schools group 1 (3.1%) (p = 0.006) and cesarean section (sld special education group 63.4% and sld schools group (31.3%) (p = 0.02) are found to be related to sld in children . Sld children have delayed milestones particularly problems with speech, which is predominant in sld special education group (36.7%) (p = 0.02). Sld children have significant school problems in the form of school refusal, poor school performance, reading, writing, spelling, and arithmetic when compared to normal children . In sld children, the problems with reading were found to be about 56 (90.3%), with comprehension 55 (88.7%), with arithmetic 17 (27.4%), with spelling 47 (75.8%), and with writing 28 (45.2%) [table 2]. Break up of learning disabilities (nimhans specific learning disabilities index) table 3 shows various presentations of learning disabilities, pure reading disability is found in 22 (35.48%), writing disability in 1 (1.61%), dyscalculia in 3 (4.83%) whereas combined learning disability in 36 (58.06%), which is found to be the most common type of learning disability . Mathematic disability is found to occur less frequently in sld special education group (16.7%) than in sld schools group (34.4%). Presentation of learning disabilities overall, the prevalence of sld cases in schools is found to be 6.6% . Among the subtypes of learning disability, the prevalence of dyslexia is 4.58%, dysgraphia 0.2%, dyscalculia 0.63%, and combined learning disability in 7.5% respectively in school children . Children with sld committed significant errors on bender gestalt test (bgt) (p = 0.001) as well as number cancellation test (p = 0.001). No statistical difference was found (p = 0.37) on scores on recall of bgt designs (memory) among three groups indicating that there is no statistical difference in memory in the three groups . Pre-, peri-, and post - natal problems in mother, epilepsy, head injury or infections in infancy, poor vision, speech and language delay during childhood were found to be significant in children with sld in both groups . Developmental psychopathology checklist - developmental history table 5 shows various developmental problems . Only speech and articulation problems were found to be of highly statistically significant (p = 0.001) in children with sld . Developmental psychopathology checklist - developmental problems adhd [table 6] is found to be the most common comorbidity associated with sld amounting to 26 (41.9%) with trends toward inattentive subtype . Attention deficit hyperactivity disorder conduct disorder is found to be about 1 (3%) in sld schools group with trends toward symptoms of disobedience . Emotional disorders are found to be about 2 (6.3%) in sld schools group and 4 (13.3%) in sld special education group . None of the children in both sld groups met the criteria for somatic problems, psychosis, or obsessive - compulsive disorder . The family history of alcoholism was found to be significantly higher (p = 0.001) in normal children (50%) [table 7]. The family history of learning problems has been found to be occurring more frequently in both sld groups, which is found to be statistically significant (p = 0.02). Developmental psychopathology checklist - family history stressors such as over expectation (26.7%) (p = 0.04) and over - involvement (36.7%) p = 0.001) by parents are found in children with sld special education group . The prevalence of sld in schools is found to be 6.6% with combined learning disability being most common 7.5% . The male: female ratio in children with sld if 1.8:1, indicating male preponderance . The similar findings were found by karande et al . In his study with a gender distribution ratio of 2.1:1 . A higher representation of middle socioeconomic strata in sld schools group (84.4%) and high socioeconomic strata in sld special education group (66.7%) is observed . The higher representation of middle class is because the study sample is taken from urban and semi - urban areas, with english as the medium of instruction . It was being done due to the lack of standardized assessment tools for sld in vernacular languages . Study which states that sld is higher (82%) in middle socioeconomic strata . The higher representation of high socioeconomic strata in sld special education could be because the remedial or special education which was received by the students was from special educators / special education centers which charge a particular amount per month . Hence, most of the children who are receiving the special education are the ones whose parents could afford to pay them, apart from regular school fees . The findings are not in continuation of the previous study by murnane who stated that sld are more common in a minority group and those belonging to low socioeconomic status . The parents of children with sld special education group belong to high education group (mothers 73.3% and fathers 46.7%) and most of them are professionals (mothers 23.3% and fathers 46.7%) while those parents of children with sld schools group are educated up to secondary education (mothers 46.9% and fathers 25%). The previous study conducted by kohli et al . Has noticed that parents of sld children had 1215 years of education . Mean age of children with sld in schools group is 9.88 years while the mean age of children with sld in special education group is 9.43 years, respectively . The mean age of children with sld as observed by karande et al . Was 11.4 years . Children with sld in special education group are joined in schools at an early age (i.e., 3.02 years) when compared to that of children with sld schools group (3.81 years). The difference is statistically significant (p = 0.001), indicating that children in sld with special education group are being joined in the school at an earlier age than others and due to the high socioeconomic status of these parents of these children who keep them in special education schools for remedial methods . It is to be noted that none of the previous studies compared the age of the child at the time of joining school . Prematurity (sld special education group 20% and sld schools group 3.1%) and cesarean section (sld special education group 63.4% and sld schools group 31.3%) are found to be related to sld in children . The findings go with the result of previous study by wood et al ., where prematurity is found to be a risk factor with sld . Furthermore, cesarean section also appears to be a risk factor . However, there are no such reports from the previous studies . Sld children have delayed milestones particularly problems with speech, which is predominant in sld special education group (36.7%) indicates that sld special education group has developmental immaturity . Significant pre-, peri-, post - natal problems (40%) were found in mothers of children with sld in special education group along with epilepsy, head injury or infections in infancy, poor vision, speech and language delay during childhood are found to be significant in both groups of sld, clearly indicating that sld is a developmental problem . Sld children have significant school problems in the form of school refusal, poor school performance, reading, writing, spelling, and arithmetic when compared to normal children . In sld children, the problems with reading were found to be about 90.3%, with comprehension 88.7%, with arithmetic 27.4%, with spelling 75.8%, and with writing 45.2% . Pure reading disability is found in 35.48%, writing disability in 1.61%, dyscalculia in 4.83% while combined learning disability in 58.06%, which is found to be the most common type of learning disability . Mathematic disability is found to occur less frequently in sld special education group (16.7%) than in sld schools group (34.4%). These findings are similar to the findings of karande et al . Where combined subtype was represented more . However, compared to the study by ramaa where mathematic disability is found to be 5.98%, mathematic disabilities have found to occur less frequently in special education group; this could be probably due to the reason that most of the children brought to the special educators are having problems with reading and writing . In this study, most common type of learning disability was found to be combined (reading + writing) 35.48% which was similar to a finding by karande et al ., 2007 . But as compared to the previous indian studies, mathematic disabilities have found to occur less frequently in special education group, this could be probably due to the reason that most of the children brought to the special educators are having problems with reading, spelling, and writing . Children with sld committed statistically significant errors on bgt (p = 0.001) denoting perceptual and visuomotor integration problems in children with sld . This amounts to the high amount of inattentiveness seen in sld and also the influence of other comorbid conditions like adhd . Adhd is found to be the most common comorbidity associated with sld amounting to 41.9% with trends toward inattentive subtype . Analysis of the characteristics of the 26 (41.9%) children with adhd in sld group, it is found that there are 3 (11.5%) females and 23 (88.5%) males . On subtyping, the number of sld children with adhd inattentive type is found to be 11 (42.3%), adhd hyperactive type 7 (26.9%), and combined type of adhd in 8 (30.8%). The comorbidity of adhd was about 35% . In the present study, trends are toward inattentive type, whereas in other studies on indian and pakistani data found that combined subtype was more common . Conduct disorder is found to be about 3% in sld schools group with trends toward symptoms of disobedience . Emotional disorders are found to be about 6.3% in sld schools group and 13.3% in sld special education group . None of the children in both sld groups met the criteria for somatic problems, psychosis or obsessive compulsive disorder . On the whole, the comorbidities as assessed by dpcl showed significance on adhd, conduct and emotional disorders which was not found in the study by karande et al . Except for adhd . Significant family history of learning disabilities is found in children with both groups of sld . Learning disorders in family history is found to be significant as also observed by snowling et al . Stressors like over expectation and over involvement by parents are found in children with sld special education group . The study was not conducted in government schools as the assessment of sld in vernacular languages was not available . The study was not conducted in government schools as the assessment of sld in vernacular languages was not available . There was a significant association with prematurity, cesarean section, delayed speech and family history of sld . Among comorbidities of sld,
Hypoxaemia in critical illness may be caused by hypo - ventilation, ventilation / perfusion mismatch, right - to - left shunting or limitation of diffusion across the alveolar capillary membrane . Hypoxaemia my also occur as a result of breathing a low fractional inspired oxygen tension; for example, at high altitude . Tissue hypoxia (reduced cellular or mitochondrial oxygen availability) may arise as a consequence of hypoxaemia or as a result of reduced oxygen delivery due to decreased cardiac output or decreased red - cell concentration (anaemia). This may be due to decreased tissue oxygen delivery associated with microcirculatory dysfunction, or may occur via alterations in cellular energy pathways and mitochondrial function, resulting in a decreased ability to utilise the available oxygen a phenomenon termed cellular dysoxia . Hypoxic epithelial cell activation releases tumour necrosis factor alpha and il-8, resulting in pathological increases in vascular permeability and in the release of il-6, the main cytokine of the acute - phase response . Hypoxia - mediated cell death will generate an inflammatory response, further perpetuating the cascade of critical illness . Furthermore, myocardial tissue hypoxia may impair contractile function, thus reducing the total blood flow and further exacerbating global tissue hypoxia . For example, in monge's disease (chronic mountain sickness) occurring in natives or long - life residents living above 2,500 metres, excessive erythrocytosis coupled with hypoxic pulmonary vaso - constriction may result in high pulmonary artery pressures and cor pulmonale, leading to congestive heart failure . Time may, however, also allow beneficial adaptive processes that permit an individual to survive severe tissue hypoxia at levels that, encountered more acutely, might prove fatal . Critically ill patients form a heterogeneous group; preadmission patient characteristics (for example, age, fitness, comorbidities) and precipitating illnesses (for example, trauma, infection, ischaemic event) vary considerably . In addition, many pathological and physiological processes occur concurrently, and separating the cause and effect of just one feature of the disease (tissue hypoxia) can prove extremely difficult . Hypoxic adaptive processes are likely to be common to tissue hypoxia whatever the cause, however, and studying healthy individuals progressively exposed to hypoxia through ascent to high altitude may inform of the nature of the hypoxic adaptive processes occurring in critically ill patients . It might be possible, in other words, to take knowledge' from mountainside to bedside' . This approach offers the advantages of a relatively homogeneous study population and environmental challenge, in contrast to those observed on critical care units, as well as the availability of' premorbid' information and levels of function . Finally, the approach also offers an ethical alternative to hypoxia experimentation in patients; all individuals involved are willing participants in climbing or trekking ventures, as a consequence of which they expose themselves to a hypoxic environment . The troposphere is the lowest portion of the atmosphere and envelopes the earth's entire surface . Within the troposphere the concentration of oxygen in air remains constant so, as the barometric pressure decreases, the partial pressure of oxygen decreases proportionately . The partial pressure of oxygen at the altitude of everest base camp (5,300 metres altitude) is about one - half of the sealevel value . The summit of mount everest is the highest point above sea level on the earth's surface, at 8,850 metres altitude, and has a partial pressure of oxygen about one - third of the sea - level value . High - altitude physiology may be divided into the study of short - term changes that occur with exposure to hypobaric hypoxia (the acute response to hypoxia) and studies of longer - term acclimatisation and adaptation . Acute exposure to the ambient atmosphere at extreme altitude (for example, above 8,000 metres) is rapidly fatal . Acclimatisation is the set of beneficial processes whereby lowland humans respond to a reduced inspired partial pressure of oxygen . These changes tend to reduce the gradient of oxygen partial pressure from ambient air to tissues (classical oxygen cascade) and are distinct from the pathological changes that lead to altitude illness . Adaptation to high altitude describes changes that have occurred over a number of generations as a result of natural selection in a hypobaric hypoxic environment, and this can be observed in some groups of high - altitude residents . High - altitude illness may be divided into the acute syndromes that affect lowland or highland residents ascending to altitudes greater than those to which they are accustomed and the chronic conditions that affect individuals resident at high altitude for long periods . The acute adult syndromes of high altitude are acute mountain sickness, high - altitude pulmonary oedema (hape) and high - altitude cerebral oedema . Hypoxia fulfils criteria as a causative agent for the acute high - altitude illnesses . The incidence and severity of acute mountain sickness, hape and high - altitude cerebral oedema are related to the speed of ascent and the maximum height gained, suggesting a dose response type of relationship in susceptible individuals . A number of studies also suggest, however, that inflammation may be contributory in the pathogenesis of altitude illness [8 - 16]. Several studies have failed to convincingly demonstrate any association between an acute inflammatory response and the development of acute mountain sickness . On the other hand, a number of studies have shown that individuals with pre - existing inflammatory conditions (for example, diarrhoeal illness, upper respiratory tract infection) have an increased predisposition to acute high - altitude illnesses (that is, acute high - altitude illnesses occur at lower altitudes or with slower ascents). This pattern is consistent with moore and moore's' two hit model' of critical illness initiation, whereby a single insult primes the body for a much more severe response to a secondary insult (for example, major trauma followed by hypoxia and hypovolaemia). The initial pathogenesis in hape is thought to be nonuniform hypoxic pulmonary vasoconstriction leading to pulmonary capillary stress failure and a high - permeability type of oedema in the face of a normal left atrial pressure . Although alveolar fluid in early hape does not demonstrate inflammatory activation, bronchoalveolar lavage fluid from individuals with established hape has high levels of inflammatory cells and mediators . When broncho - alveolar lavage was performed in the field, in patients suffering from hape for 24 hours or less, there was a marked increase in total cells, with macrophages being predominant, along with elevated levels of cytokines including il-6, il-8 and tumour necrosis factor alpha . In hospitalised patients later in the course of hape, the proportion of neutrophils increases and the observation is an inflammatory process similar in magnitude and pattern to acute respiratory distress syndrome in the critical care unit . The development of an inflammatory component may modify the natural history of hape; anecdotally, the recovery time for hape (and high - altitude cerebral oedema) seems to be related to the duration of illness . This might be explained by postulating that in early hape, where mechanical capillary stress failure leads to accumulation of intra - alveolar fluid, relief of hypoxia will reduce pulmonary hypertension and the oedema will rapidly resolve . In more established hape, where significant inflammation has developed, resolution requires reversal of the inflammatory state, and takes more time . A similar pattern of injury may occur with critical illness: patients who remain poorly resuscitated on the wards for prolonged periods prior to their admission to critical care commonly have a much more prolonged recovery duration than those who are rapidly resuscitated following an initial insult . The study of the interaction between hypoxia and inflammation as mechanisms of injury occurring in healthy individuals in a hypoxic environment has the potential to increase our understanding of these interactions in the critically ill . Parallels exist between the pattern of responses seen following acute, in comparison with subacute, hypobaric hypoxia and those responses that occur during different phases of critical illness . The physiological response to acute hypobaric hypoxia serves to increase oxygen delivery to the tissues: ventilation, cardiac output and haemoglobin concentrations increase (haemoglobin concentration increases initially by the haemo - concentration and later as a result of increased erythro - poiesis). Similarly, the textbook paradigm of acclimatisation to hypobaric hypoxia emphasises the development of mechanisms to increase oxygen flux (increase in ventilation, cardiac output, oxygen carriage, and capillarity). These observations, however, do not adequately explain the observed differences between individuals in their tolerance of hypobaric hypoxic environments . Neither the baseline cardiorespiratory performance (maximal oxygen consumption) nor changes in the response to chronic hypoxia account for differences between individuals in acclimatisation to prolonged hypoxia or performance at altitude . Maximal oxygen consumption, maximal heart rate and stroke volume are all reduced after acclimatisation despite normalisation of the blood oxygen content to sea - level values (by an increase in haemoglobin concentration). Furthermore, pure oxygen breathing by acclimatised individuals (which results in an oxygen content greater than that at sea level) does not return maximal oxygen consumption to sealevel values . These surprising findings suggest that oxygen carriage is not a limiting factor for maximal oxygen consumption at altitude . This could be consistent with central nervous system limitation of the maximal exercise capacity, with limitation of oxygen flux within the tissues, or with a downregulation of cellular metabolism . An alternative model supported by empirical evidence suggests that mechanisms not related to oxygen delivery may play an even greater role: this alternative model proposes that acclimatisation is achieved not solely by increasing the oxygen flux, but also by decreasing utilisation . Acclimatisation may therefore be mediated in part by alterations in oxygen delivery, but also by reductions in cellular oxygen demand, perhaps through hibernation / stunning or preconditioning pathways, or through improvements in efficiency of use of metabolic substrates . Indeed, hypoxia - tolerant systems rarely activate the anaerobic metabolism but tend to favour a reduced energy turnover state and reduce costly cellular activities such as ion - pumping and protein turnover . In this regard, it is interesting to note that other hypoxia - tolerant species tend to adapt to hypoxia by reducing demand (hibernation, reduced metabolic rate) rather than increasing supply . The available empirical data suggest that this might be so . Early in critical illness (for example, severe sepsis, the immediate perioperative setting or major trauma), when the mitochondrial and metabolic activity is high, increasing oxygen delivery (or maintaining normal oxygen delivery in the face of evidence that the level is reduced) decreases subsequent mortality [29 - 35]. Conversely, in established critical illness, increasing oxygen delivery is at best of no benefit and may even increase mortality [34 - 37]. In established critical illness, mitochondrial activity and oxidative phosphorylation are reduced; just as such effects may be beneficial in acclimatisation to hypobaric hypoxia, singer and colleagues have proposed that such' reduced metabolic demand' may offer protection against the cellular hypoxia of critical illness . In both critical illness and during exposure to hypoxia at altitude the acute response seems to be to overcome tissue hypoxia by compensating with increased oxygen delivery (consistent with a fight or flight response) whereas the longer term response seems focused on reducing utilisation, perhaps through hibernation / stunning, through' preconditioning' phenomena or through enhanced efficiency of oxygen utilisation . Exploring these differences by studying humans exposed to the hypoxia of high altitude has the potential to identify mechanisms important in established critical illness and perhaps to alter our therapeutic focus towards increasing the efficiency of oxygen utilisation rather than improving delivery . Consistent with this model there is a suggestion that improved performance at altitude associated with genotype ii of the angiotensin - converting enzyme (ace) polymorphism (see below) may be related to alterations in the efficiency of oxygen utilisation . Just as in the outcome from critical illness, there is wide variation between individuals regarding performance at high altitude and susceptibility to high - altitude illness . This phenotypic variation occurs as a result of genetic variation, and the selection of' advantageous genetic variants' may underpin fundamental differences in the physiology of long - term highland dwellers when compared with lowland populations . Native tibetan populations have been resident at high altitude for hundreds of generations, whereas the han chinese residents of tibet have migrated from lowland regions during the past 60 years . When compared with the han chinese, native tibetans have greater maximal oxygen uptakes and vital capacities, a reduced alveolar arterial oxygen gradient, a higher arterial oxygen saturation at birth and during the first 4 months of life, and an increased uterine artery blood flow leading to a reduction in the incidence of intrauterine growth rate and of low - birth - weight babies . Some of these changes have also been noted in south american andean natives when compared with lowland residents . Among lowlanders ascending to high altitude, genetic differences individuals homozygous for the insertion variant of the human ace gene, which is associated with reduced ace levels, seem to perform better at altitude . The association of ace polymorphisms with acute and chronic high - altitude illnesses is more complex . In a japanese (lowland resident) population there was no difference in the insertion / deletion allele distribution between hape - resistant and hape - susceptible groups, although pulmonary vascular resistance was higher in those individuals with the d allele when they developed hape . This contrasts with studies in kyrghyz (highland resident) populations suggesting that high - altitude pulmonary hypertension is associated with the ace gene insertion (i) allele . There are also data suggesting that variants of the endothelial nitric oxide synthase gene could be involved in adaptation to altitude . Nitric oxide is synthesised in the lungs and is involved in the regulation of pulmonary blood flow . Exhaled nitric oxide levels are higher in native populations resident at high altitude . In japanese subjects, polymorphisms of the endothelial nitric oxide synthase gene resulting in decreased nitric oxide synthesis were associated with an increased susceptibility to hape . In caucasians, however, no difference in nitric oxide synthase genotype frequencies was found when comparing hape - susceptible and hape - resistant individuals, and there was also no association between pulmonary artery systolic pressure in acute hypoxia and the nitric oxide synthase genotype . The nitric oxide synthase gene polymorphisms associated with lower nitric oxide activity were found to have an increased frequency in nepalese sherpas when compared with nonsherpa lowland residents . Interactions with other gene systems will probably be responsible for the contrasting effect of the ace gene insertion allele and nitric oxide synthase gene alleles observed in different groups . If the paradigm proposed at the outset of the present review has validity, then it would be expected that genes conferring benefit for high - altitude performance might be related to improved outcomes in critical illness . In keeping with this hypothesis, the ace gene insertion allele is associated not only with improved performance at high altitude, but with a lower mortality from acute respiratory distress syndrome, improved outcomes in childhood meningococcal septicaemia and improved cardiorespiratory response to premature birth . Studying human responses to hypobaric hypoxia may offer important insights into the pathophysiology of critical illness . Ace = angiotensin - converting enzyme; hape = high - altitude pulmonary oedema; il = interleukin.
Increasing prevalence of morbid obesity has augmented the demand for bariatric surgery, which is so far the most effective and durable therapy for the treatment of morbidly obese patients . Deep vein thrombosis (dvt) and pulmonary embolism (pe) are the major risk factors of mortality after bariatric surgery [24]; venous thrombosis of mesenteric vessels may also contribute to significant morbidity . Although the risk of postoperative dvt following bariatric surgery does not exceed 2% in most studies, there are currently no strategies to identify individuals who have the highest risk for dvt . Diagnosis of dvt in morbidly obese patients is a challenging clinical task because a considerable proportion of cases remains asymptomatic . To date, there are different prophylactic strategies available for prevention of dvt; however, optimal personalized prophylactic regimes in individual patients are yet not defined . Anticoagulation with low molecular weight heparin, anti - factor xa inhibitors, and unfractionated heparin are widely used in bariatric surgery for prevention of dvt and pe, but appropriate dosing of anticoagulation is still controversial . Furthermore, the risk of dvt among morbidly obese patients undergoing bariatric surgery appears to persist despite the use of aggressive prophylactic anticoagulation therapy . Identification of individuals with increased risk for dvt is also crucial for the balance between dvt prevention and the risk of bleeding, which is another major complication of bariatric surgery . Recently, many different and complex changes in plasma coagulation factors have been described in patients with obesity . Obesity is linked to elevated expression of the prothrombotic molecules plasminogen activator inhibitor-1 and tissue factor (tf) and increased platelet activation . A significant increase in median levels of circulating microparticles was observed in obese patients compared to controls, including annexin v - mp, endothelial - derived, leukocyte - derived, and tissue factor bearing mp compared to controls . The same study also showed that obese patients had a significantly higher median peak thrombin and increased median endogenous thrombin potential compared to controls . The same group of researchers has shown that after sleeve gastrectomy, the decrease of bmi in morbidly obese subjects was matched with a decrease of circulating microparticles of endothelial, platelet, and leukocyte origin . Thromboelastography (teg) is used to monitor viscoelastic properties of blood clots, from formation to lysis . Over the last decade, teg has gained significant importance in the management of high - risk bleeding populations, liver transplantation, and certain other clinical conditions . Although teg is mostly used to monitor hypocoagulability states, recent evidence shows the importance of teg in evaluation of hypercoagulability in the perioperative setting . Thromboelastography has recently gained wide scientific attention in obesity and hypercoagulation trends observed in these individuals . A clear relationship between hypercoagulability detected by whole - blood thromboelastometry and aggregometry and several studies addressed the role of hypercoagulability monitoring in the perioperative period of bariatric surgery . A recent systematic review about hypercoagulable state and teg indicated that further studies are needed to determine the ultimate role of this method for prediction of hypercoagulable states and postoperative thrombosis . The aim of this study was to determine hypercoagulability states in obese patients undergoing bariatric surgery and to assess the alterations of coagulation parameters in the perioperative setting using teg . We selected the cutoff values of teg parameters for defining hypercoagulability based on the studies discussed above . We also evaluated the potential of clinical and standard laboratory tests to predict hypercoagulable states in patients referred to bariatric surgery . Sixty consecutive patients undergoing laparoscopic bariatric surgery (gastric bypass or gastric plication) were recruited at the department of surgery, lithuanian university of health sciences hospital from october 2014 to june 2015 . All the patients underwent general anesthesia in normothermal conditions and were given standardized thromboembolic prophylaxis with 500 ml 6% dextran 70 (fresenius, poland) after induction of anesthesia and fraxiparine 0.3 ml sc (glaxosmithkline, poland) starting in the morning of pod1 until discharge from the hospital . We excluded patients on anticoagulation therapy, as well as those with chronic kidney / liver failure, coagulation disorders (liver cirrhosis, known hematological, or hereditary coagulation disorder), previous history of dvt, or using oral contraception . The patients were followed for clinically evident thrombotic complications for 1 year after the study by arranging clinical appointments 1 month and 1 year after the surgery . The study was approved by the regional kaunas ethics committee (be-2 - 10). Thromboelastography was performed using the teg 5000 thromboelastograph hemostasis analyzer system (braintree, usa). Thromboelastographic alterations were assessed at 4 time points: at baseline prior to induction of anesthesia, immediately after the end of the surgery, and on the morning of postoperative days 1 (pod1) and 2 (pod2). The following parameters of thromboelastography were assessed: r - time (reaction time, min . ; normal range [nr]: 510); k - time (clotting time, min; nr: 13); -angle (degrees; nr: 5372); ma parameter (maximum amplitude, millimeters; nr: 5070); and g (clot strength, dynes per square centimeter; nr: 4.610.9). Briefly, mixing 1 ml of citrated blood with kaolin by an inversion technique was performed by the physician conducting teg . Then, 20 l of 0.2 m calcium chloride was added to the plain teg cup, followed by 340 l of the blood / kaolin mix . Data (age, bmi, coagulation parameters, and teg values) are presented as mean values and standard deviation (sd). Qualitative variables were compared using the chi - square or fisher s exact test, as appropriate . Spearman correlation analysis was performed to determine the correlation between clinical or standard laboratory test values (crp, esr, d - dimers, and fibrinogen) and teg parameters . Receiver operating characteristic (roc) curve analysis was performed to determine optimal fibrinogen levels for prediction of hypercoagulable states g 11 dynes / cm and ma 68 mm . Statistical analysis was performed using the spss 20.0 software package (chicago, il). Sixty consecutive patients undergoing laparoscopic bariatric surgery (gastric bypass or gastric plication) were recruited at the department of surgery, lithuanian university of health sciences hospital from october 2014 to june 2015 . All the patients underwent general anesthesia in normothermal conditions and were given standardized thromboembolic prophylaxis with 500 ml 6% dextran 70 (fresenius, poland) after induction of anesthesia and fraxiparine 0.3 ml sc (glaxosmithkline, poland) starting in the morning of pod1 until discharge from the hospital . We excluded patients on anticoagulation therapy, as well as those with chronic kidney / liver failure, coagulation disorders (liver cirrhosis, known hematological, or hereditary coagulation disorder), previous history of dvt, or using oral contraception . The patients were followed for clinically evident thrombotic complications for 1 year after the study by arranging clinical appointments 1 month and 1 year after the surgery . The study was approved by the regional kaunas ethics committee (be-2 - 10). Thromboelastography was performed using the teg 5000 thromboelastograph hemostasis analyzer system (braintree, usa). Thromboelastographic alterations were assessed at 4 time points: at baseline prior to induction of anesthesia, immediately after the end of the surgery, and on the morning of postoperative days 1 (pod1) and 2 (pod2). The following parameters of thromboelastography were assessed: r - time (reaction time, min . ; normal range [nr]: 510); k - time (clotting time, min; nr: 13); -angle (degrees; nr: 5372); ma parameter (maximum amplitude, millimeters; nr: 5070); and g (clot strength, dynes per square centimeter; nr: 4.610.9). Briefly, mixing 1 ml of citrated blood with kaolin by an inversion technique was performed by the physician conducting teg . Then, 20 l of 0.2 m calcium chloride was added to the plain teg cup, followed by 340 l of the blood / kaolin mix . Data normality was assessed using kolmogorov - smirnov test . Data (age, bmi, coagulation parameters, and teg values) qualitative variables were compared using the chi - square or fisher s exact test, as appropriate . Spearman correlation analysis was performed to determine the correlation between clinical or standard laboratory test values (crp, esr, d - dimers, and fibrinogen) and teg parameters . Receiver operating characteristic (roc) curve analysis was performed to determine optimal fibrinogen levels for prediction of hypercoagulable states g 11 dynes / cm and ma 68 mm . Statistical analysis was performed using the spss 20.0 software package (chicago, il). The study included 60 consecutive patients (18 males and 42 females) referred to bariatric surgery, with a mean age of 39.111.9 years (age range 1862) and a mean bmi of 47.58.5 years (bmi range 34.384.9). Gastric bypass surgery was performed in 38 (63.3%) patients and gastric plication in 22 (36.7%) patients . Twenty - one patients (35%) were active smokers at the time of the surgery, and 39 patients (65%) had previous diagnosis of arterial hypertension . We followed all our patients for clinically evident thrombotic complications for 1 year after the study and none of them had thrombotic events during the follow - up period (data not shown). Forty - six patients (76.7%) had g parameter <11 and 14 patients (23.3%) exhibited hypercoagulability prior to surgery, as defined by g value 11 (table 1). Comparison of clinical parameters and standard laboratory tests between the 2 groups (g <11 vs. g 11) did not reveal significant differences in bmi and crp levels (table 1). The age of patients in the g <11 group was lower (37.8) than in the g 11 group (43.6), but the difference was not significant (p=0.117). The only parameter that was significantly higher in the g 11 group compared to the g <11 group was fibrinogen levels, which were 4.23 and 3.8 g / l, respectively (p=0.021; table 1). Among all study participants, 17 patients (28.3%) had ma 68 mm and 43 patients (71.7%) had ma <68 mm . Patients with ma 68 were significantly older (44.2 years) than in the group of patients with ma <68 mm (37.1 years; p=0.046; table 1). Fibrinogen levels were also higher in the hypercoagulable group (ma 68 mm) than in the remaining subjects with ma <68 mm (table 1, p=0.025) mean values of teg parameters in the perioperative period of study participants are summarized in table 2 . There was an increase in r - time from preoperative levels (6.74 s) to pod1 (6.96 s), but it reached significance only at pod2 (7.43 s, p=0.022; table 2). K - time and a - angle remained at levels similar to the initial teg results recorded on pod1 and pod2 (table 2). There was a trend towards hypercoagulability and higher values of ma and g compared with initial teg values and results obtained on pod2; however, the differences were not significant (table 2). Dynamics of fibrinogen and d - dimer during the perioperative period are also presented in table 2 . There was a significant increase in d - dimer levels in the postoperative period after bariatric surgery . Average fibrinogen levels also increased significantly from basal values prior to surgery, from 3.90 to 4.16 we also aimed to assess the changes in hypercoagulability status from baseline to pod2 . At baseline, 46 patients (76.7%) had g parameter <11 (table 3), but on pod2 13.0% of this group had g 11 . Out 14 patients (23.3%) showing hypercoagulability prior to surgery, as defined by g value 11, 12 patients remained hypercoagulable on pod2 (table 3). Prior to surgery, 17 patients (28.3%) had ma 68 mm and 14 of them remained hypercoagulable on pod2 (table 3). Forty - three patients (71.7%) had ma <68 mm at baseline, but 7 of them became hypercoagulable by pod2 . To assess the relationship between clinical variables and standard laboratory parameters with baseline teg values, we performed correlation analysis (table 4). Similarly, markers of inflammation, crp, and erythrocyte sedimentation rate (esr) also did not correlate with coagulation parameters recorded by teg (table 4). Preoperative fibrinogen levels were associated with k - time (r=0.313, p=0.018), -angle (r=0.333, p=0.011), ma (r=0.431, p=0.001), and g (r=0.387, p=0.003; table 4). Interestingly, we also observed a weak but significant correlation between age and r - time (r=0.280, p=0.03), k - time (r=0.259, p=0.046), and -angle (r=0.260, p=0.045, table 4). To evaluate the potential of plasma fibrinogen levels to predict hypercoagulability measured by teg, we performed roc curve analysis . Figure 1 shows that plasma fibrinogen level could predict clot strength (g) 11 dynes / cm with area under the curve (auc)=0.680 (95% confidence interval (ci): 0.530.80, p=0.044). Roc curve analysis of plasma fibrinogen levels to predict ma 68 mm produced an auc of 0.679 (95% ci: 0.530.83, p=0.041, figure 2). G / l, with sensitivity of 80.0% and specificity of 64.3% (figure 2). The study included 60 consecutive patients (18 males and 42 females) referred to bariatric surgery, with a mean age of 39.111.9 years (age range 1862) and a mean bmi of 47.58.5 years (bmi range 34.384.9). Gastric bypass surgery was performed in 38 (63.3%) patients and gastric plication in 22 (36.7%) patients . Twenty - one patients (35%) were active smokers at the time of the surgery, and 39 patients (65%) had previous diagnosis of arterial hypertension . We followed all our patients for clinically evident thrombotic complications for 1 year after the study and none of them had thrombotic events during the follow - up period (data not shown). Forty - six patients (76.7%) had g parameter <11 and 14 patients (23.3%) exhibited hypercoagulability prior to surgery, as defined by g value 11 (table 1). Comparison of clinical parameters and standard laboratory tests between the 2 groups (g <11 vs. g 11) did not reveal significant differences in bmi and crp levels (table 1). The age of patients in the g <11 group was lower (37.8) than in the g 11 group (43.6), but the difference was not significant (p=0.117). The only parameter that was significantly higher in the g 11 group compared to the g <11 group was fibrinogen levels, which were 4.23 and 3.8 g / l, respectively (p=0.021; table 1). Among all study participants, 17 patients (28.3%) had ma 68 mm and 43 patients (71.7%) had ma <68 mm . Patients with ma 68 were significantly older (44.2 years) than in the group of patients with ma <68 mm (37.1 years; p=0.046; table 1). Fibrinogen levels were also higher in the hypercoagulable group (ma 68 mm) than in the remaining subjects with ma <68 mm (table 1, p=0.025) mean values of teg parameters in the perioperative period of study participants are summarized in table 2 . There was an increase in r - time from preoperative levels (6.74 s) to pod1 (6.96 s), but it reached significance only at pod2 (7.43 s, p=0.022; table 2). K - time and a - angle remained at levels similar to the initial teg results recorded on pod1 and pod2 (table 2). There was a trend towards hypercoagulability and higher values of ma and g compared with initial teg values and results obtained on pod2; however, the differences were not significant (table 2). Dynamics of fibrinogen and d - dimer during the perioperative period are also presented in table 2 . There was a significant increase in d - dimer levels in the postoperative period after bariatric surgery . Average fibrinogen levels also increased significantly from basal values prior to surgery, from 3.90 to 4.16 we also aimed to assess the changes in hypercoagulability status from baseline to pod2 . At baseline, 46 patients (76.7%) had g parameter <11 (table 3), but on pod2 13.0% of this group had g 11 . Out 14 patients (23.3%) showing hypercoagulability prior to surgery, as defined by g value 11, 12 patients remained hypercoagulable on pod2 (table 3). Prior to surgery, 17 patients (28.3%) had ma 68 mm and 14 of them remained hypercoagulable on pod2 (table 3). Forty - three patients (71.7%) had ma <68 mm at baseline, but 7 of them became hypercoagulable by pod2 . To assess the relationship between clinical variables and standard laboratory parameters with baseline teg values, we performed correlation analysis (table 4). Similarly, markers of inflammation, crp, and erythrocyte sedimentation rate (esr) also did not correlate with coagulation parameters recorded by teg (table 4). Preoperative fibrinogen levels were associated with k - time (r=0.313, p=0.018), -angle (r=0.333, p=0.011), ma (r=0.431, p=0.001), and g (r=0.387, p=0.003; table 4). Interestingly, we also observed a weak but significant correlation between age and r - time (r=0.280, p=0.03), k - time (r=0.259, p=0.046), and -angle (r=0.260, p=0.045, table 4). To evaluate the potential of plasma fibrinogen levels to predict hypercoagulability measured by teg, we performed roc curve analysis . Figure 1 shows that plasma fibrinogen level could predict clot strength (g) 11 dynes / cm with area under the curve (auc)=0.680 (95% confidence interval (ci): 0.530.80, p=0.044). The best cutoff point for fibrinogen to predict g 11 was 3.97 roc curve analysis of plasma fibrinogen levels to predict ma 68 mm produced an auc of 0.679 (95% ci: 0.530.83, p=0.041, figure 2). G / l, with sensitivity of 80.0% and specificity of 64.3% (figure 2). Much research has been targeted at establishment of optimal prophylactic anticoagulation regimens in bariatric surgery; however, a consensus over this strategy has not been achieved . Although the incidence of thromboembolic complications in patients undergoing bariatric surgery is not very high, the mortality rates associated with pe in this subgroup of patients is striking . Routine coagulation tests, including aptt, inr, and platelet count, are not able to predict hypercoagulative status in the perioperative period . Therefore, alternative testing and monitoring of coagulation status for identification of individuals at increased risk of vte is needed . In the present study we aimed to evaluate coagulation status in patients undergoing bariatric surgery and to assess dynamics of coagulation parameters in the perioperative setting using teg . The major finding of our study is that many patients referred to bariatric surgery show a trend towards hypercoagulability on teg . We used teg cutoff values of g 11 dynes / cm and ma 68 mm to define hypercoagulability based on previous studies that have shown these thresholds to be linked with thrombotic events . Our results also show that fibrinogen level is the only indicator of hypercoagulative state among the routinely used laboratory parameters; however, used alone, it is not able accurately predict hypercoagulative status . We believe that the results of our study add new insights into the monitoring of coagulation status in bariatric surgery . An increasing number of studies show the importance of teg for monitoring of coagulation status in the perioperative period . The major finding of the present study is that many patients referred to bariatric surgery show hypercoagulability as determined by teg in the perioperative setting . Based on results of previous studies, we used g 11 dynes / cm to define a hypercoagulable state found that strongest predictor of vte in surgical patients was elevated g value; for every 1 dyne / cm increase in g, the odds of a vte increased by 25% . A significant proportion (23%) of our patients were in hypercoagulable state prior to surgery, which supports previous data obtained by rotem analysis . It is important to point out that 18 patients (30%) also had g 11 at pod2 . We routinely stop low molecular weight heparins (lmwh) on discharge and this group of patients might benefit from extended antithrombotic prophylaxis, but this remains to be assessed in further studies . Interestingly, we followed all our patients for clinically evident thrombotic complications for 1 year after the study and none of them had thrombotic events during the follow - up period . The other teg parameter that may be used to identify hypercoagulable states and to predict dvt in the postoperative period is ma . Recent studies have also shown that ma parameter 68 mm is linked with increased risk of thrombotic complications and postoperative myocardial infarction . It is worth pointing out that in our study 17 out 60 patients had ma 68 mm prior to surgery, but this proportion did not increase dramatically at pod2 (28.3% and 35.0%, respectively); however, forfori et al . Showed a substantial (from 20% to 50%) increase in the percentage of patients with ma 68 mm by pod3 . A potential reason why we did not observe a significant increase in the proportion of patients with ma 68 on pod2 could be the shorter overall surgery time (91.420.0 min) as compared to the forfori et al . Another reason might be related to the different regimens used for thrombosis prophylaxis . In our study, patients received dextran solution during induction of anesthesia . Dextran is known for its anti - platelet activity realized through reduction of platelet adhesion to von willebrand factor and impairment of platelet activation by thrombin . We also observed a significant increase in r - time from preoperative levels to pod2 . These results indicate that a prophylactic regimen of 0.3 ml fraxiparine qd started on pod1 seems to reduce activation of the coagulation system in the postoperative period, similar to the prophylaxis regimen based solely on fraxiparine . Were the first to show that morbidly obese patients have accelerated fibrin formation and higher ma values than lean patients referred to elective surgery, as determined by teg . In our study, the patients with clot strength g 11 dynes / cm had higher average plasma fibrinogen concentration than patients in the g <11 group, and these findings support previously published results . We observed significant correlations between fibrinogen concentration and k - time, -angle, ma, and g values as determined by teg . To evaluate the potential of plasma fibrinogen levels to predict hypercoagulability measured by teg plasma fibrinogen level predicted clot strength (g) 11 dynes / cm with an auc=0.680 and the optimal cutoff point for fibrinogen to predict g 11 was 3.97 similarly, roc curve analysis of plasma fibrinogen levels to predict ma 68 mm resulted in auc of 0.679 with an optimal cutoff point for fibrinogen at 3.85 similar cutoff values of fibrinogen for prediction of hypercoagulability were observed in a spanish study . Our results show that fibrinogen level is the only indicator of hypercoagulative state among routinely used laboratory parameters; however, moderate auc values obtained in the study should be reassessed in larger studies . It is worth pointing out that some studies have shown that hyperfibrinogenemia is a potential factor in heparin resistance, and these patients might need enhanced vte prophylaxis regimens . Obese patients have a higher prevalence of inherited and acquired thrombophilias compared to the general population . Diabetes, which is closely linked to obesity, is also related to increased incidence of recurrent dvt . A recent study has reported that the inflammation biomarker crp was associated with hypercoagulable states evaluated by rotem in a group of patients referred to bariatric surgery . In the present study we did not observe a significant correlation between teg parameters and crp or esr levels . Several previous studies have shown that bmi increases the risk of vte . In the present study, bmi did not correlate with teg values, which was also observed previously by a research group . A recent study showed that central obesity, but now overall weight, is linked with increased thrombin generation and is a better predictor of complications . Firstly, it was not aimed at determining the optimal anticoagulation regimes for bariatric surgery, and that remains a challenging task in further studies . We have selected the teg cutoff values based on some previous studies that have shown these thresholds to be linked with the risk of thrombotic events and used them in earlier studies: g 11 dynes / cm and ma parameter ma 68 mm; however, we agree that the prediction of prothrombotic states based on teg results only is difficult and further research in the field is required . We also did not use doppler ultrasound to monitor subclinical vein thrombosis; therefore, we might have missed some cases of obscure vein thrombosis in the follow - up . To date, it is not clear whether patients showing hypercoagulation parameters on teg should be managed differently, and the optimal strategies for dvt prevention in this group have yet to be established in well - designed randomized clinical trials . Interestingly, some studies have suggested the need for extended anticoagulation regimens after bariatric surgery because some dvt occurs later after surgery . We speculate that patients showing hypercoagulability on pod2 by teg might benefit from receiving a prolonged prophylactic anticoagulation, but this needs to be assessed in further studies . Potentially, a combination of teg results and other coagulation markers could provide more accurate prediction models, and this needs to be established in the future . Bariatric surgery is clearly associated with significant weight loss and will retain a major role in treatment of morbid obesity . Furthermore, the balance between the risk of bleeding and risk of thrombotic complications remains very important, posing further challenges in the field . A considerable proportion of patients referred to bariatric surgery show a trend towards hypercoagulability as determined by teg . This study shows the potential of hypercoagulation monitoring by teg in the perioperative setting of bariatric surgery.
Urinary tract infections (utis) affect millions of women each year, with an annual societal cost of billions of dollars . Importantly, more than one quarter of women with a uti will have a recurrent infection within six months . There are few established options for prevention of uti other than the use of prophylactic antibiotics . However, resistance to commonly used antibiotics is increasing among bacterial cystitis isolates . A growing body of evidence suggests that vaginal h202-producing lactobacilli may have a protective effect against urogenital infections, including uti [511]. It is hypothesized that lactobacilli prevent uropathogen colonization of the vagina, a necessary step in ascending infection of the bladder . Several clinical trials have demonstrated that certain lactobacillus species, mainly l. rhamnosus and l. fermentum, can be given orally or vaginally with resulting colonization of the vagina, reduction in vaginal coliform counts, and even reduction in uti recurrence [1218]. Specific strains were chosen for their abilities to produce h202, adhere to uroepithelial cells, interfere with uropathogen attachment and growth, and persist in the vagina [18, 19]. The most frequently existing vaginal lactobacillus species, l. crispatus [20, 21], also produces h202 and possesses the adherence and inhibitory qualities essential for a good probiotic candidate [22, 23]. L. crispatus strain ctv-05 has been developed as a vaginal suppository (lactin - v) for the prevention of recurrent uti in women . L. crispatus ctv-05 is highly adherent to vaginal epithelial cells, and when given as a suppository can colonize the vagina . Furthermore, l. crispatus ctv-05 has been reported to have a specific dna fingerprint that distinguishes it from endogenous vaginal lactobacilli . To further evaluate the safety of this new formulation of l. crispatus ctv-05 and its effect on the vaginal microbial flora, we conducted a phase i, randomized, double - blind, placebo - controlled trial of vaginal l. crispatus ctv-05 in premenopausal women with a history of recurrent uti . We recruited premenopausal women aged 1835 years with a history of three or more uncomplicated utis diagnosed in the past year, or two uncomplicated utis diagnosed in the past six months, from (student health center, university of washington, wash, usa .) Additional eligibility requirements included regular menstrual cycles or amenorrhea for at least six months secondary to use of a hormonal contraceptive, a normal pap smear documented in the last year or at the baseline clinic visit, abstinence from sexual activity or participation in a mutually monogamous sexual relationship, use of birth control, agreement not to use other intravaginal products, agreement not to have sexual intercourse or use tampons between the baseline and first follow - up visit, and capability to understand english and provide informed consent . Exclusion criteria included history of urologic abnormality, recent urologic surgery or urinary catheterization, history of complicated pyelonephritis or renal calculi, hysterectomy, recent sexually transmitted infection (sti) or bacterial vaginosis, risk factors for sti and hiv, history of recurrent genital herpes, menses anticipated within ten days, pregnancy, lactation, recent antibiotic or antifungal use, diabetes or other immunocompromised state, drug or alcohol abuse, use of the (nuvaring), prior use of the study drug or allergy to any of its components, and abnormal initial pelvic examination . The study was approved by (institutional review board (irb), university of washington, wash, usa .) Subjects were randomized in a double - blinded fashion to l. crispatus ctv-05 at a dose of 5 10 colony forming units (cfu) or placebo vaginal suppository to be inserted daily for five days . L. crispatus ctv-05 and placebo suppositories were similar in appearance and consisted of a preservation matrix and maltodextran ., palo alto, calif, usa) according to a randomization schedule and supplied to the study site sequentially labeled with a subject number . Subjects were seen at three clinic visits over a period of one month . At the first (baseline) visit, eligible subjects provided informed consent before undergoing a structured medical and gynecologic history and physical examination . Subjects inserted the first dose of study drug in the clinic and were instructed to record any symptoms occurring during the first week of study on a prepared diary card . Subjects were seen in follow - up 68 days (1-week) visit and 2634 days (4-week) visit after enrollment . During these visits, new symptoms, new urogenital infections, and any changes in clinical history were recorded . Finally, subjects were contacted by telephone six months after enrollment to assess symptoms, pregnancy, new diagnoses, or major medical events . Laboratory testing included urine dipstick testing, urinalysis, urine culture, vaginal fluid wet preparation slides, gram stains, and culture for facultative isolates and lactobacillus species at all visits . Repetitive element sequence - based polymerase chain reaction (rep - pcr) for l. crispatus ctv-05 was performed on three lactobacillus colonies from culture at each visit . Testing for neisseria gonorrhoeae and chlamydia trachomatis by dna amplification was done at the baseline visit . A sample size of 30 was chosen to evaluate the primary outcome of safety as assessed through self - reported symptoms, physical exam findings, and laboratory studies . Secondary outcomes included shifts in the vaginal flora assessed by vaginal culture and vaginal colonization with l. crispatus ctv-05 assessed by rep - pcr . Two women randomized to l. crispatus ctv-05 completed treatment over six days, and one woman randomized to placebo used six suppositories over six days . All women remained on study through the 4-week visit (figure 1). Baseline characteristics of subjects were similar in the two treatment groups (table 1). The majority of women were young, white, healthy, university students in their 20s . Mild to moderate adverse events were relatively common, however . Of those felt by the investigators to be related to study drug use, abnormal vaginal discharge was the most frequently occurring, followed by external genital irritation and vaginal candidiasis (table 2). These adverse events occurred with similar or greater frequency in women randomized to placebo as compared to women randomized to l. crispatus ctv-05 . Three women reporting vaginal candidiasis also reported multiple prior episodes in the preceding 12 months . Two women randomized to l. crispatus ctv-05 reported episodes of cystitis during the study . All subjects completed a diary card of symptoms that occurred during the period of study drug insertion . Recorded symptoms generally confirmed the reported adverse events and were similar to symptoms reported at the 1-week clinic visit (below). Abnormal vaginal discharge was the symptom most frequently reported by subjects at clinic visits following study drug use (figure 2). While no women reported abnormal vaginal discharge at baseline, six randomized to l. crispatus ctv-05 and five randomized to placebo reported abnormal vaginal discharge at the 1-week visit . External genital or vaginal irritation was also reported by six women in each treatment arm at follow - up visits . Vaginal odor was reported at the 1-week visit by one woman randomized to l. crispatus ctv-05, and at the 4-week visit by two women randomized to placebo . Dysuria was reported by one woman randomized to l. crispatus ctv-05 at the 1-week visit and by one woman randomized to placebo at the 1- and 4-week visits . Headache, abdominal or pelvic cramps / abdominal pain, and low back pain were frequently reported at baseline as well as at follow - up visits . There were no significant differences in reported symptoms at any visit between women in the two treatment arms . External genital erythema was found at the 1- and 4-week visits in more women randomized to l. crispatus ctv-05 than in women randomized to placebo (4 versus 1, p=.33). Moderate - to - profuse vaginal discharge was frequently found in women from both treatment arms during follow - up examinations (12 versus 8, p = 1.00), though this finding was also often apparent at the baseline visit (6 women in each arm). Seven (47%) women randomized to l. crispatus ctv-05 had nine episodes of pyuria with a urine white blood cell count 8 per mm (range 8203) during a follow - up clinic visit (table 3). In contrast, none of the women randomized to placebo had pyuria at 1 or 4 weeks (p = .01). Pyuria was positively correlated with urine leukocyte - esterase test results (spearman r = 0.57, p<.01). There were no significant associations with vaginal or urinary symptoms or exam findings . Microbes isolated from the urine of women in the l. crispatus ctv-05 arm with pyuria included mixed gram - positive organisms (6), lactobacillus (3), e. coli (1), enterococcus (1), group b streptococcus (1), and yeast (1). One subject had a negative urine culture, and none had symptomatic infection . Lactobacillus and mixed gram - positive rods were isolated at 10 - 10 cfu / ml from more women with pyuria (50% and 75%) than without (19% and 46%, resp .) At the 1-week visit (p=.22 for lactobacillus, p=.60 for mixed gram - positive rods) but not at the 4-week visit . None of the other isolated organisms was found at a significantly increased frequency in women randomized to l. crispatus ctv-05 versus placebo or in women with pyuria compared to those without pyuria at any visit . Two women randomized to l. crispatus ctv-05 and one randomized to placebo had hematuria at the 4-week visit (30 red blood cells per mm). Nine women in the l. crispatus ctv-05 arm and ten in the placebo arm completed the six - month follow - up telephone call . Four women in the l. crispatus ctv-05 arm and one in the placebo arm reported one or more episodes of cystitis . 28 of 30 women had vaginal colonization with h202-producing lactobacilli at baseline and all follow - up visits (table 4). Two women randomized to placebo had no vaginal h202-producing lactobacilli detected at any clinic visit . One of these women had large quantities of gardnerella and bacteroides species morphotypes on gram stain . Cultures from women with h202-producing lactobacilli yielded heavy (4 +) growth . Vaginal cultures from five women in each treatment arm yielded e. coli from one or more clinic visits . E. coli was isolated from vaginal cultures taken at the 1- and 4-week visits from 4 women randomized to l. crispatus ctv-05 and from one women randomized to placebo (p=.33). No inverse association between vaginal colonization with h202-producing lactobacilli and vaginal colonization with e. coli was detected . Vaginal cultures frequently yielded candida at baseline as well as follow - up visits . Using rep - pcr, l. crispatus ctv-05 was detected in the vaginas of four women randomized to l. crispatus ctv-05 (three women at each clinic visit). Three women had a positive assay for l. crispatus ctv-05 detected at the baseline visit before administration of the study drug . No women randomized to placebo had a positive assay at any visit (p = .22 each visit). We compared our rep - pcr results (figure 3) to previously published rep - pcr patterns in order to identify the bacterial species . At baseline, 80% of subjects had l. crispatus, 37% had l. jensenii, 17% had l. gasseri, and 27% had other lactobacillus species detected in vaginal culture . The following combinations of lactobacillus species were found: l. crispatus (27%), l. crispatus and l. jensenii (20%), l. crispatus and l. gasseri (7%), l. crispatus and other lactobacillus species (13%), l. crispatus, l. jensenii, and l. gasseri (3%), l. crispatus, l. jensenii, and other lactobacillus species (7%), l. crispatus, l. gasseri, and other lactobacillus species (3%), l. jensenii (7%), l. gasseri (3%), other lactobacillus species (3%), and no lactobacillus (7%). The prevalences of individual species were relatively stable over time (figure 4). There were no significant differences in lactobacillus species prevalence between subjects in the two treatment arms with the exception of l. gasseri at the 1-week visit (p = .02). In phase i, placebo - controlled trial, use of a l. crispatus ctv-05 vaginal suppository, for the prevention of recurrent uti was well tolerated with minimal side effects . There were no serious adverse events, and despite the occurrence of abnormal vaginal discharge and external genital or vaginal irritation in several women, compliance was high . These mild to moderate symptoms appear to be secondary to the act of suppository use or a reaction to the preservation matrix rather than a consequence of l. crispatus ctv-05 as they occurred with similar frequency among women in each treatment arm . However, given the frequency of recurrent vaginal candidiasis experienced by subjects prior to enrollment and the prevalence of candida in baseline vaginal cultures, the relationship of this condition to study drug use is not compelling . L. crispatus ctv-05 use was associated with pyuria (detected by microscopy and urine leukocyte - esterase) in seven women at either the 1- or 4-week visits (p = .04 at 4 weeks). Pyuria was not associated with urogenital symptoms, exam findings, or symptomatic uti . While lactobacillus was not isolated from the urine during every episode of pyuria, it is possible that some lactobacilli were misclassified as mixed gram - positive rods, as both were more frequently found in women with pyuria than in women without . Our data suggest that vaginal instillation of l. crispatus ctv-05 induces a mild inflammatory response in the bladder or vaginal mucosa of some subjects without causing prolonged urogenital infection . The importance of this phenomenon with respect to safety or potential efficacy is unclear . It is possible that induction of an asymptomatic inflammatory response by lactobacilli protects against uropathogen colonization of the vagina or infection in the bladder . Limited existing data from prior studies suggest that l. crispatus therapy is safe . Women surveyed after participation in a clinical trial of a vaginal capsule formulation of l. crispatus ctv-05 for treatment of bacterial vaginosis rarely reported adverse effects, and those reported were largely related to a perceived difference in vaginal discharge . Satisfaction with the vaginal capsule was high . No adverse effects were reported in a pilot study of l. crispatus ctv-05 given intravaginally to a small group of healthy women . Nine women with a history of recurrent uti reported no adverse effects when given l. crispatus strain ga198332 as a vaginal suppository every other day for one year . Studies of other probiotic strains of lactobacillus have indicated that they can be given to women safely with minimal or no side effects [1218]. To our knowledge, pyuria resulting from vaginal instillation of lactobacillus has not been previously reported, and should be evaluated further in future studies . We did not see an effect of l. crispatus ctv-05 use on vaginal lactobacillus growth . However, most study participants had heavy vaginal growth of h2o2-producing lactobacilli at baseline, making detection of subsequent changes difficult . Data from a pilot study indicated that l. crispatus ctv-05 did not displace other endogenous vaginal lactobacilli . Vaginal colonization was most successful in women lacking vaginal h2o2-producing lactobacilli at the outset, suggesting that a lactobacillus probiotic may be most effective at establishing vaginal colonization in women with abnormal flora, such as those with bacterial vaginosis or recurrent uti . To our knowledge, our study represents the first attempt to use rep - pcr to identify the genetic fingerprint of the probiotic strain l. crispatus ctv-05 in a larger - scale clinical study . Although none of the placebo recipients were colonized with lactobacillus strains having the characteristic rep - pcr pattern of l. crispatus ctv-05 at any time, three women randomized to l. crispatus ctv-05 had at least one isolate in their vaginal culture at baseline that bore the characteristic fingerprint . . As there are no large - scale surveys of the prevalence and distribution of lactobacilli bearing this fingerprint, we do not know whether the rep - pcr technique failed to distinguish l. crispatus ctv-05 from other genetically closely related strains of l. crispatus naturally colonizing the vagina at baseline, or whether the identical strain was prevalent in our study population . Of note, subjects in our study had a much higher prevalence of vaginal h2o2-producing lactobacilli in baseline vaginal cultures than found in previous studies . By comparing our rep - pcr results to previous published rep - pcr patterns, we characterized lactobacillus isolates at the species level and found l. crispatus, l. jensenii, and l. gasseri to be the most prevalent species, with relatively stable prevalences over time . Our prevalence data are consistent with what has been previously documented [20, 21]. Additional tests are under way to compare quantitative pcr results for l. crispatus in women before and after the introduction of active suppositories or placebo . Our study was not designed nor statistically powered to evaluate the effect of l. crispatus ctv-05 on the rate of uti recurrence . Therefore, it is difficult to interpret the report of cystitis in two women randomized to l. crispatus ctv-05 . Other small studies have suggested that use of vaginally administered l. crispatus may be associated with a lower rate of uti recurrence [16, 29]. The major strengths of our study include the placebo - controlled, randomized study design, excellent compliance, and extensive and complete followup . Use of a study diary provided finer details of our subjects experiences that confirmed adverse events and symptoms reported from memory at clinic visits . Weaknesses that should be mentioned include the inability to accurately document vaginal colonization with the probiotic strain, and the inherent lack of statistical power due to the small sample size typical of phase i studies . We are currently conducting a phase ii trial that will have more power to clarify some of the issues raised in this study . In conclusion, l. crispatus ctv-05 is well tolerated when given as a vaginal suppository to healthy women with a history of recurrent uti . Mild to moderate side effects related to suppository use occur but do not affect compliance . Timing of administration and efficacy in preventing recurrent cystitis should be evaluated further in larger studies.
Retinoblastoma is the most frequent childhood intraocular tumour with an approximately incidence of one in 15,00020,000 births in the world . In africa management of retinoblastoma has been changing during years with a survival rate of more than 95% in developed countries [5, 6]. However, in developing countries these cures are less than 50%, primarily because of advanced disease at time of diagnosis [79]. Previous studies had reported epidemiological and clinical characteristics of the disease [1012]. In the democratic republic of congo (drc) in other previous study, retinoblastoma was the most common histologic form representing 31.7% of all malignant of the eye . However, there is still a paucity of information on clinical findings and on the outcomes of children with retinoblastoma . The last paper on presenting signs of retinoblastoma in congolese patients gave a five - year ophthalmology view . At the other side, it is necessary for health plan to have the main characteristics of all children with retinoblastoma followed in democratic republic of congo . This information will give the whole view of patients and may serve to rule out general public health and in - hospital cancer politics in poor resources settings . The aim of this study is to present data over two decades about clinical presentation and outcome of children with retinoblastoma treated at the university hospital of kinshasa, which is a referral and tertiary care center in west of democratic republic of congo and to compare the results with those reported in the literature . The medical records of all patients with a diagnosis of retinoblastoma seen in the pediatrics oncology unit at the university teaching hospital of kinshasa, between january 1985 and december 2005 were reviewed retrospectively . We used hospital - based data from the records because there is no population - based cancer registry in democratic republic of congo . The diagnosis of retinoblastoma was based upon history, clinical examination at university hospital of kinshasa . Clinical examination with complete ocular examination including dilated ophthalmoscopy under general anaesthesia and physical examination by a paediatrician ancillary studies consisted of ocular ultrasonography and computed tomography when affordable, which showed the presence of solid intraocular tumor with calcium deposits . The data collected included demographics features, reference, order among siblings, the initial sign noticed by the family, age at first symptom, clinical findings, age at diagnosis, laterality, different time lag, treatment modalities, treatment adherence, and outcome . Age at first sign means the age of the child when families noticed for the first time the abnormality (alarming sign). The clinical presentation report to what the physician had seen when examining the patient at our institution . Different lag times include four latency periods: (1) the time from the first sign to a referral service, (2) the time from the reference to the pediatrics oncology unit, (3) the time from pediatrics consultation to the initiation of treatment, and (4) the observational time from treatment (followup). We divided the study period in two parts considering the year 1998 as the limitation . Chemoreduction regimen consisted in vincristine, adriamycin, cyclophosphamide for a maximum of six cycles given every 3 weeks before and after enucleation) following the international conference on paediatric oncology in morocco in 1998 (http://www.smhop.org.ma/). Statistical analysis was performed using the statistics software spss for windows (15.0 spss, chicago). Data are represented as meanssd when the distribution was normal and median with range when the distribution was not normal . Nine of them were excluded because of insufficient information, and data of 40 patients, including 28 males (70%) and 12 females (30%) were reviewed . Our patients were referred from the ophthalmology unit of the hospital (33 cases 82.5%) and other centres (7 cases 17.5%). Their median order among siblings was 4 (range 1 to 10). During the study period, 31 cases (77.5%) had unilateral disease [16 cases (40%) left and 15 cases (37.5%) right] and 9 cases (22.5%) had bilateral disease, resulting in 49 affected eyes . In unilateral retinoblastoma, there were 20 boys and 11 girls with sex ratio 2: 1 . In bilateral disease, there were 8 boys and 1 girl with sex ratio 8: 1 . The median age at the first sign noticed by families was 1.9 years (range one month to six years) for unilateral disease and 1.4 year (range one month to three years and half) for bilateral disease while the median age of the diagnosis in our institution was 2.8 years (range six months to six years) for unilateral disease and 2.4 years (range nine months to four years) for bilateral disease . Leukokoria (n = 27) and proptosis (n = 6) were the most frequent initial signs noticed by families (table 1). At diagnosis in our institution (table 2), the most frequent clinical findings were proptosis (n = 22) and leukokoria (n = 10). A median 9 months (range, 1 to 79 months) passed from detection of the first sign to referral (lag time), 1 month (range, 0 to 23 months) from referral to paediatric oncology unit, 9.5 months (range, 0 months to 3.3 years) from paediatric consultation to treatment, and 2.3 months (range, 0 to 18 moths) from treatment initiation to last followup . An average of 15 months passed between the detection of the first sign and the beginning of therapy if applied . At diagnosis, 36 (90%) patients had stage 4 of the reese - ellsworth classification . Four patients had localized disease, twenty six had locoregional disease, and ten had metastatic disease . The sites of metastatic disease were brain (n = 4), lymph nodes (n = 3), bone (n = 2), and bone marrow (n = 1). From 1985 to 1998, 23 patients (57.5%) have been treated and 17 (42.5%) from 1998 to the 2005 . The table 3 shows chemotherapy protocols to be used and those effectively applied to patients . The outcomes of our patients were as follows: 30 (75%) children were lost from followup, 7 (17.5%) died among which 5 had proptosis with an orbital extension, 2 had protruded mass development after enucleation (characteristics presented in table 4), one was referred abroad for treatment, and two were alive at the time of final data entry . Assuming that cases lost to followup worsened and died, our study is the first to look at the outcome and the limitations to management of retinoblastoma in democratic republic of congo . The study spanned 20 years and 49 cases of retinoblastoma were identified during that time . From mid 1998 to 2005, 17 patients were identified . The calculation based on incidence of retinoblastoma in africa, data from index mundi available for 2005 (http://www.indexmundi.com/g/g.aspx?c=cg&v=25/), and estimate population in 1999, we can give an estimate o incidence of retinoblastoma in democratic republic of congo approximately of 9761098 cases and the the total number of children in this study indicates that only a tiny fraction of congolese children with retinoblastoma benefited from treatment in our tertiary referral center . It is common for some children with retinoblastoma to be taken to herbalist or prayer houses instead of hospital . This situation is due to cultural beliefs, stigma, and ignorance [17, 18]. Many authors reported similar observations [14, 16, 19, 20], but in others the occurrence of retinoblastoma is almost the same in both sexes [11, 21, 22]. The fact of sex ratio in the present study had been reported to be related to environmental factors or to bias referral . The main referral to paediatric oncology was the ophthalmology unit of our institution with 82.5% of patients . In a previous study from the ophthalmology unit of the university hospital of kinshasa, this may be explained by some obstacles outside university hospital of kinshasa as lack of paediatrician and ophthalmologist . In - hospital reference from ophthalmologist to paediatrician could help in the early management because it was reported in argentina that the paediatrician underestimated the complaints in half patients while the diagnosis was suspected by the ophthalmologist on the first visit . This frequency varies from 10 to 50% in different studies [1, 19, 2426]. It might be that some bilateral cases are lost to followup before second eye involvement appears, leading to misclassification as unilateral in our context . The age at diagnosis of retinoblastoma in developing countries varies from 24 months to 3 years [16, 24, 27, 28]. In this study, the age of our patients ranged from 6 months to 6.6 years and averaged 32 months . The mean age when first sign had noticed by parents was 20, 4 months, meaning a year average lost of time before reaching a hospital due to lake of information, education, or poor socioeconomic level . Different studies reported similar observations in developing countries [12, 20, 24, 28]. Leukokoria (67.5%) had been the first sign noticed by parents . In medical consultation, proptosis and leukokoria were the most common clinical presentation, similar to that from other developing countries [4, 20, 23, 26, 28, 29]. Computer tomography is generally avoided in bilateral retinoblastoma because radiation may increase risk of second cancers . Similar observations were reported in other studies in developing countries [20, 23, 26, 30]. The predominance of proptosis is due to the delay in consultation and the development of the tumour because there is a link between the lag time and the expansion of the tumour . However, in other settings leukokoria still remains the presenting sign at the hospital [32, 33]. Another explanation rises as been reported from the use of self - treatments or traditional healers' treatments before reaching a hospital or during the period between a health centre and the pediatrics oncology unit [34, 35]. So, retinoblastoma is diagnosed late with extraocular dissemination, and there is tremendous scope for improvement in its managements as performed in developed countries . This should lead to set up an informational program for careful screening and referral of white pupil for early diagnosis and treatment as proposed elsewhere [36, 37]. The chemotherapy of retinoblastoma in kinshasa evolved from one drug to a 3 drugs combination therapy every 3 weeks during the study period . The chemotherapy regimen (vincristine; adriamycine cyclophosphamide) had been systematically applied since 1998 . Most of the parents of our patients are poor and because a free health care facility is not available in most developing countries, these drugs are not affordable to many of the patients . An additional factor is the unavailability and high cost of some drugs in democratic republic of congo . This situation contributes to lack of treatment adherence and patients being lost to followup . In our series, this high treatment abandonment may be the result of late presentation as well as poor compliance with chemotherapy regimen . Treatment abandonment as well as loss to followup has also been reported from other developing countries [20, 24, 30]. We think that it derives from complex factors such as ignorance, poverty without health insurance system, financial constraint regarding investigations and procurement of drugs, lack infrastructure resources, poor communication between medical teams and patients, and deep lack of financial and infrastructure resources . In our study, limited management for above reasons and lack of an accurate tracing system are factors predicting a worse prognosis . During these 2 decades, retinoblastoma remains a life - threatening disease in democratic republic of congo characterized by advanced intraocular disease, late referral to a specialized unit, delay in treatment, important lost to followup, and affordability of chemotherapy . Early educational detection program, prompt referral to specialized centers, use of current methods treatment, and an implementation of a health insurance system particularly for cancers will improve outcomes for children with retinoblastoma in our settings.
Temporary external ventricular drainage for refractory thoracolumbar cerebrospinal fluid (csf) leak is not reported in the literature . We present a young man who had multiple complex spinal surgeries for resection of innumerable metastatic ependymoma lesions . As a last resort, we decided to place an external ventricular catheter for proximal controlled csf drainage with great success . The 32-year - old man had a history of spinal myxopapillary ependymoma world health organization (who) grade i with local metastatic spinal disease . The patient first presented in 2005 with a 1-year history of severe low back pain . He was found to have an intradural lesion, and subsequently had a t12l3 laminectomy for resection of the tumor . Small amounts of the tumor adherent to the nerve roots were purposefully left behind . Each time an attempt was made to remove these residual small pieces of the tumor, significant amounts of neuromonitoring activity was noted . Hence, the residual tumor was left behind so as to not cause a neurologic deficit . Approximately 10 days after surgery, the patient fell at home and noticed significant amounts of a clear fluid consistent with csf leaking from his incision . He was taken to the operating room at that time and a dural defect was identified and closed primarily, then covered with gelfoam (baxter healthcare, deerfield, il, united states) and tisseel (baxter healthcare). The patient again noted another csf leak from a different area of his incision 5 days later, and he was taken back to the operating room for another primary closure, as well as placement of a fat graft and more tisseel . Adjuvant radiation treatment was undertaken after he recovered from the initial surgeries . In 2008, he was found to have a dorsally located intradural lesion at the t8t9 region, which was resected via a t7t10 laminectomy . In 2010, he was found to have growing intradural lesions at l4 and l5 . At that time one year later, our patient presented yet again with multiple thoracolumbar intradural lesions (fig . He underwent redo decompressive laminectomies from t8s1 with a total of 13 intradural tumors being excised (fig . 2). The dural closure proved to be quite complex, as there were several areas that were macerated and very difficult to reapproximate . Fat grafts, duraform (depuy synthes, west chester, pa, united states), and tisseel were all used on top of the attempted primary dural closure . Preoperative sagittal t2-weighted magnetic resonance imaging (mri) (a) of the thoracic spine revealing multiple intradural tumors as well as an axial t2-weighted mri (b) revealing significant compression of the spinal cord . Postoperative t2-weighted sagittal (a) and axial (b) magnetic resonance imaging revealing gross total resection of multiple intradural tumors . Radiographic evidence of a refractory thoracolumbar cerebrospinal fluid leak was not readily evident on the immediate postoperative films . During his hospital course, the patient developed a spontaneous csf leak from his wound . It was initially treated by oversewing the skin, but the leak persisted over the next day . We decided to bring the patient back to the operating room for an exploration and an attempt at repairing the dural defects . Multiple dural defects were noted . As a result of the significant dural maceration, another primary closure was not attempted . We placed more pieces of duraform, fat graft, and tisseel over the areas of csf leakage, and we again performed a tight multilayer closure of the muscle, fascia, fat, and subcutaneous tissue . Despite our best efforts to stop the csf leak, the leak continued through the incisions from multiple areas . As a last resort, we decided to place a right frontal external ventricular drain (evd; integra life sciences, plainsboro, nj, united states) after obtaining a preprocedure computed tomography scan of the head, to ensure the ventricular size could accommodate the catheter (fig . He was placed on antibiotics for both the pneumonia as well as the csf leak and subsequent meningitis . On the day 8 of the evd in place, we continued to see cessation of the csf leak and decided to perform a 3-day clamping trial . No further csf leak was noted from the incision during the clamping trial . The evd was removed, and the patient was eventually discharged home without further complications . Preprocedure computed tomography scan of the head to ensure the ventricular size could accommodate an external ventricular drain (a). Postprocedure scan showing successful placement of a right frontal external ventricular drain (b). A watertight dural closure is essential in reducing the risk of csf leakage in spinal surgery . Eismont et al recommended the meticulous closure of the dura at the time of surgery and reoperation and repair of dural tears upon the discovery of a persistent csf leak.1 conservative management may be initially attempted with bed rest for 3 days with subsequent slow advancement to ambulation . Eighty - six of eighty - eight patients with dural tears studied by wang et al had resolution of csf leaks with primary dural closure at the time of surgery followed by bed rest.2 others have confirmed the efficacy of treating such leaks via csf diversion in the lumbar region.3 a review of the literature revealed scarce reports of csf leakage in more complex patients such as the patient in this case . This complexity arose from the multiple surgeries that were performed due to the recurrence of this intradural disease . They are benign, slow - growing, who grade i tumors that are amenable to surgical resection with optimal outcomes when gross total resection is achieved . Although pathologically they may be low grade, they can be metastatic locally within the spine via the csf route . Recurrence of the disease is usually in the same region and is substantiated by subtotal or piecemeal resection.4 spine surgeons occasionally encounter lumbar csf leak . Routine iatrogenic csf leaks can usually be repaired primarily by suturing the dural defect, with the subsequent placement of a liquefied dural sealant such as tisseel . Our patient's dura was manipulated on multiple occasions over the span of half a decade . With each surgery to remove more metastatic lesions, the dura became more macerated . This damaged dura created multiple avenues for csf to leak, which was essentially refractory to all of our attempts at a repair . A case report by yeager demonstrated the use of an evd with subsequent conversion to a shunt for a persistent cervical csf leak after a schwannoma resection.5 however, temporary external ventricular drainage for refractory lumbar spinal fluid leaks is not reported in the literature . Lumbar drains have been utilized in the case of persistent cervical csf leaks.6 we feel that a lumbar drain in our particular case would not have been best suited for the patient we presented . We placed an evd in this situation as opposed to a lumbar drain because maximal csf diversion from the macerated dura would take place with a proximal avenue for controlled csf drainage, which would essentially decrease the pressure gradient of csf in an attempt to traverse the dural defects more distally . Although the placement of external ventricular drains comes with associated risks, if they are placed safely after a preprocedure computed tomography scan is done, their usage can be a viable option for temporary proximal csf diversion for refractory thoracolumbar csf leaks.
Ankylosing spondylitis (as) is a chronic inflammatory rheumatic disease that affects the axial skeleton, causing characteristics inflammatory back pain, which can lead to structural and functional impairments . Asymmetric peripheral arthritis is present in about 2040% of patients with as . In europe, estimates of prevalence of ankylosing spondylitis vary by tenfold from 0.08% to 0.86% [24]. The direct costs of as are substantial . In europe, the annual total direct costs per patient have been estimated at 1,800 to 2,800 . The introduction of antitumour necrosis factor alpha (anti - tnf) agents has increased the direct cost of as . The first - line treatment of as is nonsteroidal anti - inflammatory drugs (nsaids) [79]. The nonselective nsaids (nsnsaids) have been associated with an increased risk of gastrointestinal (gi) adverse events such as ulcers and gi bleeding because of their inhibition of the gastroprotective cox-1 isoform . Etoricoxib and celecoxib have been demonstrated to have a superior upper gastrointestinal (gi) safety profile [1114]. The medal (multinational etoricoxib and diclofenac arthritis long term) program demonstrated the risk of cardiovascular (cv) events with etoricoxib (60 mg / d and 90 mg / d) comparable to diclofenac (75 mg bid and 50 mg tid). On the efficacy side, etoricoxib has been shown, at doses of 90 mg and 120 mg, to be superior compared to naproxen 1000 mg in the treatment of as . Celecoxib (200 mg and 400 mg) showed comparable efficacy to diclofenac (150 mg). Given the economic burden of as, a cost - effectiveness analysis of interventions for as is warranted . The objective of this study was to evaluate the cost - effectiveness of etoricoxib (90 mg) compared to celecoxib (200 and 400 mg), diclofenac (150 mg), and naproxen (1000 mg) in the treatment of patients with as in norway . In the present economic evaluation, a comprehensive decision bayesian modelling approach was used which integrates evidence synthesis and parameter estimation for efficacy and safety with cost - effectiveness modeling in a single unified framework . A previously published markov - state transition model was used to estimate the cost - effectiveness of etoricoxib versus celecoxib and nsnsaids in the treatment of as patients requiring daily nsaid treatment . The model consisted of eight health states reflecting treatment received: (1) initial nsaid (etoricoxib, celecoxib, or nsnsaids, depending on intervention arm of the model), (2) initial nsaid with proton - pump inhibitor (ppi), (3) alternative nsnsaids with ppi, (4) alternative nsnsaid with ppi and aspirin, (5) alternative nsnsaid, (6) anti - tnf treatment, (7) discontinued anti - tnf treatment, and (8) death . Transitions from state to state were determined by lack of treatment efficacy, and the different types of events as presented in table 1 . Figure 1 presents the different types of cost generating gi, cv, and other events relevant to each markov cycle . For each health state, utilities were assigned based on the bath ankylosing spondylitis functional index (basfi) and the bath ankylosing spondylitis disease activity index (basdai). Over time, basfi will worsen thereby decreasing utilities . Drug acquisition costs, and cost due to adverse events were taken into account . The model followed individuals for a maximum of 30 cycles (30 years) as by this time the majority of individuals had reached the absorbing state (i.e., death). The efficacy of etoricoxib, celecoxib, diclofenac, or naproxen in as regarding basfi, basdai, and discontinuation was obtained from a previously performed systematic review and bayesian mixed treatment comparison (mtc) of randomized controlled trials using noninformative prior distributions [19, 21, 22]. In table 2 the results of the mtc as used in the cost - effectiveness analysis are presented . For the model analysis, the expected change from baseline (cfb) estimates for basfi and basdai by treatment were subtracted from background basfi and basdai values which develop over time . Over time, an increase in basfi of 0.5 (scale 0100) per annum was assumed [6, 20]. It was assumed that background basdai scores remained stable over time [16, 23, 24]. For patients who continue responding to treatment, it is assumed that their treatment effect regarding basfi and basdai (i.e., the cfb scores) remain constant over time . Patients who switched to another nsnsaids were assumed to have the average treatment effect of diclofenac and naproxen as obtained from the mtc . For patients that switched to anti - tnf, a treatment effect of 23 points and 19 points was used for basfi and basdai, respectively . It was assumed that 10% withdraw from anti - tnf each year [20, 25]. For patients who withdraw from anti - tnf treatment basdai, and basfi measurements revert back to baseline values as reported by ara et al . . Incidence rates of an upper gi perforation, ulcer, or bleeding (pub) for etoricoxib, celecoxib, and the nsnsaids were estimated with an indirect comparison of the relative incidence rates versus placebo as reported by ramey et al . Incidence rates for suspected pubs were calculated by subtracting the pubs from all - investigator - reported pubs by ramey et al . . Rates of minor gi symptoms were based on discontinuations due to clinical gi events in the medal programme . Except for pubs, the rates for other upper gi events with etoricoxib were also used for the celecoxib arm of the model . The probabilities of treatment of gi events were based on moore et al . . The incidence of a thrombotic cv event with etoricoxib, diclofenac, and naproxen were obtained by performing an indirect comparison of the results from the medal programme by cannon et al . And the relative incidence rate of etoricoxib versus naproxen from a meta - analysis of thrombotic cv events in 12 phase ii - iv clinical trials [15, 19, 30]. The occurrence of edema, hypertension, coronary heart failure, hepatic adverse events, and renal events were obtained from the medal programme as well . For anti - tnf treatment, and treatment after anti - tnf, no adverse events were taken into consideration . The adverse event rate for second - line nsnsaid therapy was assumed to be equal to the average of those obtained for diclofenac and naproxen, with the exception of the incidence of an upper gi event in a patient receiving nsnsaid plus ppi therapy, which was assumed to be reduced by 40% . The gi and cv risk for a patient who switched to nsnsaid plus aspirin and ppi was assumed to be comparable to that for nsnsaid alone . The case - fatality of a ugi pub or lgi bleed was 3.6% [29, 31]. A 13% case - fatality for a cv event was used for etoricoxib and celecoxib, and 12.8% case - fatality for nsnsaids . For patients not experiencing gi or cv adverse events, a norwegian annual age - dependent mortality was used, as obtained from the life tables for norway . For the evaluation, an as population with an average age of 45 was assumed (base - case scenario). Utilities reflect the preference for a certain health state and are measured on 0 - 1 scale . A value of 1 reflects perfect health and 0 represents death . By summarizing the utility value over time, life years were transformed into qalys using a relation between utility (eq-5d) and basfi and basdai as derived by ara et al . Utility loss associated with adverse events was obtained from the literature [29, 3336]. Annual drug acquisition costs were calculated based on the most commonly prescribed drug within a drug class and obtained from the norwegian medicines agency (noma september 2007). For anti - tnf treatment, annual costs of etanercept were used . For each type of gi event, numbers of units of health care resource use were assigned and respective unit costs applied to all healthcare resources to calculate the cost per event . The key cost items for gi events included costs of treatment (drugs and dispensing), gp consultations, investigations, inpatient days, and surgery . Cost for the other adverse events (i.e., edema, hypertension, hepatic, and renal) were not taken into consideration . Drug costs related to adverse events were obtained from noma (september 2007); costs related to gp visits were obtained from the norwegian medical association (july 2007), and inpatient costs related to events were obtained from the drg price list . All costs were expressed in 2007 norwegian kroner (nok). Given the markov state - transition model structure, the source data were combined and translated into the following outcomes: quality adjusted life years, drug acquisition costs, costs of adverse events, total costs, and net monetary benefit (nmb) calculated as qalys multiplied with a willingness - to pay ratio (wtp) minus costs . Wtp is the amount that decision makers are willing - to pay per additional qaly gained . Since the model was fully probabilistic, outcomes were estimated with mcmc simulation using winbugs v 1.4 . For each iteration of the model, new parameter values were sampled from the estimated (posterior) or defined distributions for efficacy, safety, and costs (see table 3). The model was evaluated by averaging output values over many iterations (i.e., 10.000), allowing uncertainty in model parameters to be accounted for . For each iteration, the qalys and cost accrued for each cycle were calculated for each of the treatments according to sonnenberg and beck . At the end of each iteration, the cumulative qalys and costs over the cycles were obtained by summing the results over all cycles . Next, the incremental cost, incremental qalys, and incremental cost - effectiveness ratio (icer = incremental costs / incremental qalys) of etoricoxib versus the other interventions were evaluated . The probability of cost - effectiveness was expressed with cost - effectiveness acceptability curves, calculated as the number of iterations out of the total number of iterations for which the nmb was greatest for a given treatment out of all 4 treatments . Furthermore, analysis were performed to identify the impact of uncertainty in the source data on the uncertainty in the qalys, costs, and nmb estimates . In the base - case scenario, etoricoxib (90 mg) was compared with celecoxib (200 mg & 400 mg), diclofenac (150 mg), and naproxen (1000 mg). In alternative analyses, the following scenarios were evaluated: (1) celecoxib 200 mg was used instead of celecoxib 200 mg/400 mg, (2) only gi events, (3) only cv events, (4) no adverse events, (5) no discounting on costs and effects, (6) 8% discounting on costs and effects, (7) stable basfi over time, and (8) assuming an age of 20 years, and (9) anti - tnf costs excluded . For each scenario uncertainty in input parameters in table 4, the results of the base - case scenario are presented for 1 year, 5 years, and 30 years of follow - up . There was more than 98% probability that etoricoxib resulted in higher expected qalys than the other interventions of interest . Drug costs are expected to be the highest with celecoxib (200 & 400 mg) followed by etoricoxib (90 mg). After 5 years, however, the lowest drug costs can be expected for the patients for whom treatment was initiated with etoricoxib due to the higher probability of staying on initial therapy and not switching to the far more expensive anti - tnf treatment . Relative to a patient starting with nsnsaids, the costs due to gi events were lower for a patient starting with etoricoxib or celecoxib as a result of a reduced risk of treatment - requiring gi events . After 30 years, the gi - related costs with etoricoxib were higher than with celecoxib because this latter group of patients switched quicker to anti - tnf, which is not associated with gi events . Until 5 years, costs related to thrombotic cv events were similar with etoricoxib, celecoxib, and diclofenac, and slightly higher than with naproxen . For the same reason as the gi - related costs, the cv - related costs with etoricoxib were higher than with celecoxib and diclofenac at 30 years of followup . Overall, naproxen resulted in the lowest cost at 1 year; however, at 5 years and beyond, etoricoxib resulted in the lowest direct costs of the four alternatives; at 5 year, there is a> 96% probability that the lowest costs are obtained with etoricoxib . The difference in costs and qalys of etoricoxib relative to the other interventions is presented . Given the more favourable outcomes regarding costs and qalys with etoricoxib after 5 years of followup, etoricoxib is considered an economically dominant intervention . At 1 year, etoricoxib is economically dominant over celecoxib . The incremental cost - utility ratio (icer) of etoricoxib relative to diclofenac and naproxen at 1 year was 59,221 nok and 107,256 nok, respectively . In figure 2, the probability of cost - effectiveness for the different interventions at different willingness - to - pay (wtp) ratios are presented . For a wtp 200,000 nok per qaly there is an 85% probability that etoricoxib is the most cost - effective intervention at 1 year . This increased to more than 96% for wtp of 500,000 nok and higher . At 5 and 30 years, there is a more than 99% probability that etoricoxib is the most cost - effective intervention . Figure 3 provides an overview which of the parameters have the greatest impact on (uncertainty) in model outcomes . When celecoxib 200 mg was used as a comparator instead of celecoxib 200 mg & 400 mg combined, etoricoxib was no longer economically dominant at 1 year . Given the qaly gain of 0.07, this translates into a cost per qaly of 17,882 nok, a cost - effective result . Scenarios where (1) only gi events were included as adverse events, (2) only cv events were included as adverse events, (3) no adverse events were included, (4) no discounting was applied, (5) 8% discounting was applied, (6) basfi was assumed to be stable over time, and (7) assuming an average age of 20 years provided comparable cost - effectiveness results as the base - case analysis . Only for the scenario where anti - tnf costs were set to zero, etoricoxib was no longer dominant . However, etoricoxib can still be considered cost - effective, independent of the time horizon (see table 6). The economic evaluation demonstrated that etoricoxib (90 mg) is an economically superior treatment of as to celecoxib (200 & 400 mg), diclofenac (150 mg), and naproxen (1000 mg) for both qaly gains and cost savings for a time horizon longer than 5 years . For a 1-year time horizon, etoricoxib is associated with greater costs than diclofenac (150 mg) and naproxen (1000 mg), but can still be considered cost effective . In addition to drug acquisition costs for the nsaids, also costs for anti - tnf treatment after failure on nsaids were taken into consideration . Given the model structure we opted for, the average duration on any nsaid was estimated to be 11.2 years (95% cri 9.013.2) for the patients starting with etoricoxib, 7.8 (6.89.0) years with celecoxib, 8.3 (6.810.1) years with diclofenac, and 8.4 (6.910.2) years with naproxen . These differences explain the savings regarding drug acquisition observed when initiating treatment with etoricoxib over the other treatment strategies observed at the 5,- and 30-year time horizon . However, when the anti - tnf acquisition costs are taken out of the picture, etoricoxib is still economically more favorable than celecoxib, diclofenac, or naproxen (see table 6). For the current economic evaluation, an indirect comparison of efficacy and safety estimates were integrated with cost - effectiveness analysis in a single framework . The advantage of this approach is that no assumptions were made regarding the uncertainty distributions used for sensitivity analysis; the bayesian posterior uncertainty distributions of the treatment effect and gi and cv events as obtained from the mtc were directly propagated through the markov model . The most important factor in the cost - effectiveness analysis was the probability of discontinuation as estimated with the mtc (see figure 3) the etoricoxib gi safety data as used in the analysis were obtained from clinical trials in oa, ra, as, and chronic low back pain patients; the celecoxib gi safety data were obtained from the class study . These data were assumed applicable for as . It could be argued that as patients are likely younger than the average patient in the gi meta - analysis and, therefore, have a lower gi risk . However, as patients often receive higher nsnsaid doses than patients with other arthritic conditions, thereby increasing their risk for gi events . Risk estimates of cv events were based on the medal programme comparing etoricoxib with diclofenac among oa and ra patients and a meta - analysis of 12 phase ii - iv clinical trials comparing etoricoxib with naproxen, among oa, ra, as, and chronic low back pain patients [15, 30]. As as patients are on average younger than patients in the medal programme and the meta - analysis, it can be argued that the risk for cv events might have been overestimated in the model . In the model, the risk for a second cv event was set to be the same as before the cv event, assuming that the increased cv risk due to the history of a cv event was counterbalanced by adding aspirin to the nsaid . However, the history of a cv event might have a bigger impact than the protective effect by aspirin, which would imply an underestimation of the risk of cv events in the model, and, therefore, an underestimation of the costs due to cv events . The effect on the difference in costs, however, would be limited because the underestimation applies to both treatment initiated with etoricoxib and nsnsaids . Costs associated with severity of as (i.e., gp visits, specialist visits, paramedical visits, hospitalization, technical examinations, adaptations and aids) were not included in the analysis . For the uk, botteman et al . Showed that each incremental change in one unit of basdai (0100 scale) was estimated to be associated with a direct medical cost increase according to cost = 708.45 + 75.00*basdai . As a result, the cost savings of treatment of as have probably been underestimated, especially for etoricoxib . This evaluation was performed for the norwegian local situation . In general, it is difficult to transfer cost - effectiveness estimates obtained for one country to another, due to differences in treatment practices, resource use, and unit cost data, among other . Although the cost - effectiveness findings in this study were primarily driven by differences in efficacy of the compared interventions, the cost - effectiveness of the different nsaids for the management of ankylosing spondylitis in other countries needs to be confirmed with country - specific analysis . In conclusion, given the underlying assumptions and current evidence available, this economic evaluation demonstrated that etoricoxib is a cost - saving and qaly gaining therapy for as in norway from a health care perspective.
An unprecedented outbreak of ebola virus disease (evd) is occurring in west africa . In addition to the morbidity and mortality effects on the population at large, there is a significant impact on healthcare providers in the region . Although many healthcare worker exposures may occur prior to evd being suspected and appropriate isolation implemented, exposures can occur in spite of isolation procedures and ppe use . Although there is anecdotal evidence regarding the efficacy of ppe, a review of literature reveals few controlled studies of ppe ensembles relevant to evd . Field studies of ppe in the setting of evd are difficult because of ethical and safety concerns . It is thought a high level of training is required to safely don, use, and doff ppe . Introducing a new ppe ensemble into the field could increase exposure risk of participants who are already well - trained on a current ppe ensemble . There may be some hesitancy among participants to try an unproven ppe set . Finally, in a high disease prevalence area, with a relatively small number of events, a very large study population would be required to account for the possibility of evd acquisition from non - work exposures or activities (i.e. Non - medical contacts within the community). The possibility that exposures can occur in spite of ppe utilization is evident from recent disease acquisition by two healthcare workers in the united states . These regulatory standards are material standards so that testing of individual components (gloves, gown, etc .) Result in a rating for the tested component . Some ppe ensemble testing has been performed, so called man - in - suit - testing (mist)) but this has primarily focused on radiation, thermal or chemical exposures where exposure risk is dose - dependent, or in aerosol scenarios . Zamora et al . Compared two personal protective systems (ensembles) for biological exposures in 2006 and found significant differences in contamination rates . In 2010 the institute of medicine released a report regarding certification of personal protective technologies, noting that additional testing of ppe ensembles should be performed . Given the large number and variations of individual ppe components, it would not be feasible to test all potential combinations of ppe commercially available . Additionally, the recent surge in ppe purchasing in response to evd has caused significant shortages of some ppe components and manufacturers with a history of field use . Some healthcare facilities have had to develop ppe protocols based on the best use of locally available components (author, personal communication). Ideally, a ppe ensemble would be evaluated at the local level by the staff anticipated to wear the equipment . Doffing or removal of ppe after a patient encounter may be a particularly high risk activity . Appropriate testing of ppe ensembles should include mist type testing to confirm product efficacy in real world scenarios . Fluorescent agents have been used in training for hand - washing, and environmental decontamination, as well as ppe ensembles, . Non - toxic and mixed with an appropriate carrier, these agents can potentially mimic the natural contamination which occurs with an infectious agent spread by contact route . The purpose of our study was to compare two ppe ensembles used by volunteers with minimal prior training, and to evaluate the feasibility of fluorescent markers as an assessment tool for ppe effectiveness . Eight healthcare providers (six registered nurses and two physicians) volunteered for this preliminary study . The study protocol was approved by the texas tech university health science center institutional review board . The participants were randomized to one of two ppe ensembles that meet current (as of 10/20/14) cdc recommendations for ppe . One ppe ensemble (standard) utilized commercial components that meet current cdc recommendations . The other ppe ensemble (alternate) was composed of components already available at local hospitals or retail stores . 1) included a neck - to - ankle coverall with overlying water impermeable surgical gown, knee - length impermeable leggings, and stryker hood (stryker, kalamazoo, mi, usa). 2) ensemble included two plastic gowns (worn over the front and back of the torso), rain - suit pants, a rain - suit hood cut from a rain jacket, ankle length shoe covers, and a plastic spark - shield commonly used for metal working to cover the face . Both ppe ensembles utilized double gloving, with the outermost glove a forearm length surgical glove and n-95 masks . When complete, both ppe ensembles met the cdc recommendations for ppe and no skin was exposed in either group . Subjects were then randomized to standard or high volume exposures (hve) to simulate fluid splash . Subjects randomized to standard exposure came into contact with a training mannequin contaminated with fluorescent agents to simulate bodily fluids . Subjects randomized to hve had standard exposure, but then also had an additional 100 ml of fluorescent agent splashed onto the front torso of their garment . The fluorescent agents used included fluorescent powder (glogerm glogerm co, moab, ut, usa), liquid clothes detergent with bleach alternative (tide proctor & gamble inc ., providence, ri, usa), and dissolvable fluorescent tablets (bright dyes orange dye kingscote chemicals, miamisburg, oh, usa). A base mixture of 500 ml of liquid detergent, 500 ml of water and three fluorescent tablets was used to create body fluids . The base mixture was combined with oatmeal, chocolate powder and crushed cereal to simulate different bodily fluids . The testing area was divided into four areas, a ppe donning area (staging area), patient encounter room, ppe doffing area, and a separate dark room for black light photography ., participants worked in pairs to perform a series of clinical tasks to care for the evd patient . Participants were asked to clean the contaminated mannequin, change the mannequin gown, place an automated bp cuff, and check and record the temperature . After completing the tasks, finally, the de - gowned participants were examined under black light for fluorescence indicative of possible contamination . An led black light panel, (chauvet led shadow, model dmx-512 led uv, chauvet lighting, sunrise, florida) was used to illuminate . One participant in each ppe ensemble arm had evidence of contamination under black light examination (fig . The participant contaminated in the standard arm felt the exposure occurred because of a splash under her hood during hve . The trainer felt she may have inadvertently touched a contaminated portion of her leggings and subsequently touched her neck during ppe removal . The participant contaminated in the alternate group likely had a gap appear between her front and back gowns while placing a blood pressure cuff . This event was not noted at occurrence, but was noticed under black light examination . The contamination in the alternate ppe ensemble arm likely could have been prevented if a larger range of gown sizes was available . It may be helpful to consider the body habitus of evd responder when selecting ppe . Clinical activities as part of the assessment process, as the contamination likely would not have occurred without the provider manipulating the mannequin to place the blood pressure cuff . It could be helpful to videotape exercises such as this to better identify the timing of contamination such as that which occurred in the standard arm . Pin - pointing the conditions of contamination may allow the development of new mechanisms for prevention . In preparation for this exercise, we found it notable that taping gloves circumferentially is routinely shown in the lay press, but current guidelines do not make this recommendation . In our study, circumferential taping did not result in contamination, but greatly impaired the ease of ppe removal . On the other hand, a single strip of taped placed longitudinally along the sleeve and glove allowed the glove to be removed with the garment as a seamless piece . Current recommendations do not comment on hair or jewelry, perhaps making the assumption that these will be taken care of as a matter of course . For our study, we did not specifically ask participants to pull back their hair . Although we did not note any contamination specific to this, long hair, rings and watches adversely affected the ease of ppe placement and removal and may be an additional risk factor for exposure . It may be useful for future recommendations to include stipulations about such accouterments . In this very small study, ppe ensembles made from readily available components (approximately $36 per outfit) performed as well as the commercial ppe ensemble . Additionally, it must be borne in mind that increased complexity of ppe may be self - defeating, as the complexity of ppe removal may offset gains made by complexity of ppe . It is difficult to assess the actual effectiveness of fluorescents as a proxy for ev exposure in this study . It is possible that small volume contamination occurred that was unable to be visualized, and the clinical relevance of such a small exposure is unknown . How an exposure on intact skin correlates with risk of subsequent evd development remains to be determined . The florescent mixtures used in this study were intended to mimic the mechanical effects of bodily fluids during a patient interaction . In spite of widespread use, it is unknown how these mixtures compare with actual bodily fluids considering the unique chemical and biochemical attributes of blood . The limitations of this type of testing prevent any assumptions of risk of evd development for a healthcare worker in the field . This type of testing could, however, allow comparison of different ppe ensembles and protocols under the assumption that more fluorescent exposures equates to higher risk of evd development . Another use of this system could be to identify ppe ensembles with lower expense and equivalent testing attributes . Finally, fluorescent markers can be used for training and proficiency testing of ppe ensembles for evd preparedness and even determine minimal standards of training repetition to achieve proficiency . As fluorescent agents and black lights are readily available for purchase in retail stores and over the internet, it is feasible for testing and training to be performed at a local level with ppe ensembles available at hand . Beyond the current evd outbreak, this concept is applicable to training for other infectious diseases, such as methicillin - resistant staphylococcus aureus or multidrug resistant gram - negative bacteria, spread primarily by direct contact . The concept could also be used for some pathogens with a significant respiratory mode of transmission, such as pandemic influenza and novel pathogenic corona viruses, which have a recommended contact component of ppe.
Restoration of structure and function using autologous free fat grafts has always been a challenge . The advent and refinement of liposuction and lipoinjection techniques, abundant donor - tissue availability, and relative ease of harvesting have made autologous fat an attractive material for use as soft - tissue filler . Fat is harvested using either (1) syringe aspiration or (2) liposuction aspiration,(1) performed with a liposuction pump (byron medical, tucson, ariz . ). A standard coleman aspirator cannula (byron medical) with a curettage tip (500 mm mercury). (2) syringe aspiration is tedious if the amount of fat required is substantial . When the liposuction aspiration using a liposuction pump is performed the whole suction system, and the container needs to be kept sterile . (figure 1) we have devised a novel method of lipoaspiration to overcome these problems . The above picture helps us to compare the three modalities of lipoaspiration and also helps us to note the advantage of our technique materials required 20 - 50 cc disposable syringe, a piece of 2 2 cm polypropylene mesh, lipoaspiration suction pump (figure 2a). (a) materials required for the procedure, (b) connected syringe mesh system, (c) close - up view of the mesh in liposuction aspiration, a suction pump is used . In our technique, a piece of polypropylene mesh is kept at one end of the lipoaspiration syringe, which is then connected to the suction pump . (figure 2b & 2c) as one syringe fills, it is replaced by another one until the required amount of fat is obtained . These syringes are then centrifuged and the emulsified fat thus obtained is used for grafting (video 1). By using a polypropylene mesh in our technique, we are able to separate the transfusate from the harvested fat during harvesting itself in our experience, the fat graft obtained by this method is found to be concentrated and has fewer contaminants . This method also has the added advantage of having a short processing time, from harvesting to grafting . Fat grafting remains unpredictable, and various anecdotal harvesting and preparation techniques have been advocated . Our method is a more economical and an easier way to extract sterile emulsified fat . As it is a simple method, it can be practiced even in day care centers . Hence, we recommend our technique as a reliable and routine method for extracting sterile emulsified fat in an economical way.
Turner syndrome (ts) is caused by partial or complete monosomy of the x chromosome . Only a few cases of ts with ischemic stroke have been reported [2, 3, 4, 5]. In previously reported cases, various arteriopathies affecting the cerebral arteries such as fibromuscular dysplasia, hypoplasia, moyamoya syndrome, and, we report a case of ts with multiple embolic infarcts caused by a cryptogenic embolism . A 28-year - old woman with ts was referred to our hospital because of abnormal findings on brain magnetic resonance imaging (mri). She was diagnosed with ts [karyotype: 45, x/46, x, + mar] at the age of 16 years due to amenorrhea . She denied alcohol, tobacco, or drug use and had no family history of neurologic disorders . The patient was afebrile with a blood pressure of 180/130 mm hg and a heart rate of 89 beats / min . She was obese with a body mass index of 27.3 kg / m (160 cm height, 70 kg weight). She visited hospital due to sudden - onset severe headache with high blood pressure (240/140 mm hg). She underwent brain computed tomography and mri at the referring hospital for differential diagnosis of thunderclap headache including hypertensive intracranial hemorrhage, subarachnoid hemorrhage, arterial dissection, or reversible cerebral vasoconstriction syndrome . Brain computed tomography was unremarkable, but diffusion - weighted imaging showed restricted diffusion in multiple lesions involving multiple vascular territories (fig 1a). Cerebral magnetic resonance angiography (mra) (fig 1b) and carotid sonography demonstrated no extracranial or intracranial arterial stenosis . Laboratory tests revealed diabetes mellitus (fasting plasma glucose 219 mg / dl, hemoglobin a1c 11.0%) and hyperlipidemia (low - density lipoprotein 189 mg / dl). Transthoracic echocardiography revealed normal valvular structure and function with a normal left ventricular ejection fraction . Patent foramen ovale, atrial septal aneurysm, or any aortic pathologies including aortic atheroma were not detected in transesophageal echocardiography . The results of the hypercoagulability panel, vasculitis panel, and cerebrospinal fluid examination were all negative . Aspirin was administered, and medications for hypertension, hyperlipidemia, and diabetes were also started . Within few hours after blood pressure control, the patient was discharged from the hospital without any symptoms of stroke, and recurrence was not observed in the 2 years after discharge . Cerebrovascular arteriopathies such as fibromuscular dysplasia, congenital hypoplasia, moyamoya syndrome, and premature atherosclerosis have been shown to be causes of ischemic stroke in previous case reports . In this case furthermore, our patient showed multiple lesions in different vascular territories that were strongly suggestive of embolic stroke . Atrial fibrillation (af) could also be considered a potential source of embolic stroke in ts, as p - wave dispersion, a potential substrate for af, is increased in ts . The classical risk factors for developing af include hypertension, diabetes mellitus, and valvular disease, and these are more common in ts than in the general population . However, we could not completely exclude the possibility of paroxysmal af, as holter monitoring has a low yield for af detection (35%). Other possible cardio - aortic sources of embolism include intracardiac shunts, thrombi, calcifications / vegetations in the mitral valve, or aortic atheroma plaque . We sought to identify possible cardio - aortic sources on transthoracic echocardiography, transesophageal echocardiography, and transcranial doppler shunt test; however, all tests were negative . Some case reports have described deep venous thrombosis and portal vein thrombosis in ts [11, 12]. These factors include fibrinogen, d - dimer, factor viii, von willebrand factor, and proteins c and s . We also considered the possibility of hypercoagulability as a cause of stroke in this case; however, levels of d - dimer, fibrinogen, protein c and s were normal . The embolic source of stroke in our patient remains unclear; however, this is the first report of a ts patient with an embolic stroke pattern . Our case suggests another possible mechanism of stroke in ts that is different from previous case reports . Ischemic stroke in ts could be due to embolism as well as various cerebral arteriopathies . Further investigation is needed to more fully understand the various mechanisms of ischemic stroke in ts . Ischemic stroke in ts could be due to embolism as well as various cerebral arteriopathies, as documented in previous reports . Further studies are needed to determine the extent of the underlying mechanisms of ischemic stroke in ts . This case report has been approved by the institutional review board of the inha university hospital.
Mating is random when two individuals in a population are just as likely as any other two individuals to mate . Nonrandom mating results when individuals tend to choose mates with a specific phenotype and the associated genotype(s) among compatible mates . Dynamics of nonrandom mating have been studied in sexually dimorphic species in which size, sound, and color often describe the most preferred phenotype . Among the microbial eukaryotes, mate - preference has been demonstrated in the yeast saccharomyces cerevisiae, in which the highest amount of pheromone produced defines the most preferred phenotype for the cells of either sex . It is largely unclear how mates are chosen in other unicellular organisms . Often, unicellular species have more than two sexes, raising an obvious yet previously unanswered question: do more sexes mean more choice, thereby making evolution of mate preference among the sexes inevitable? In other words, is selective mating observed when there is an opportunity to choose between many compatible sexes? For instance, the multiple sexes of a species could form a hierarchy from the best phenotype (the most preferred sex) to the least preferred one . Alternatively, the multiple sexes could be grouped such that sexes within a group mate more frequently with each other than those between groups, resulting in pronounced mating preferences between groups . The ciliate tetrahymena thermophila has seven, self - incompatible mating types (sexes). Pair formation between cells of any two sexes initiates mating (conjugation) and subsequent genetic exchange . Although each of the seven sexes identified in t. thermophila readily forms pairs with the other six sexes the frequency of pair formation between sexes, that is, the degree of selective mating, has not been quantified when more than two compatible sexes are simultaneously present in a population offering a choice of mate . In t. thermophila, cells of different sexes engage in physical interactions (costimulation), which last for up to 2 hours prior to pair formation . Also, the extent of costimulation by one compatible sex does not affect the efficiency (total amount and the speed) of pairing with another compatible sex . Although this shows that costimulation is not sex - specific, the exact molecular interactions that occur during costimulation are still a mystery . Also, molecular differences between the seven sexes are unknown . Current speculation is that a unique glycoprotein ligand - receptor pair may characterize each sex and that the interaction between a sex - specific ligand carried by one partner with its receptor displayed on the surface of the other partner may lead to mating pair formation in t. thermophila [68]. Under this model, affinity between the ligand and receptor may determine how likely a sex is chosen as a mate, that is, pairs would more often be formed with the sex whose ligand shares the strongest affinity for the receptor . Another way in which the molecular affinities may affect the pairing frequencies is through mating kinetics, which affect the rate of pair formation . A sex whose ligand and receptor share the strongest affinity may begin pairing with the other sexes early, resulting in nonrandom mating if limited time is available to find a partner; however, given enough time, the initial differences in pairing frequencies may disappear . Mating kinetics has been previously documented to contribute to nonrandom mating in yeast [10, 11]. Here, we tested the null hypothesis that the sexes of t. thermophila mate randomly with respect to sex of a partner . Our experimental design allowed individuals a limited amount of time to choose between two compatible sexes (or not to mate at all), and we recorded the number of times each compatible sex was chosen as a partner . Under the conditions tested, we found that this species mates randomly with respect to sex . We obtained the strains cu427.4, cu428.2, and cu438.1 (table 1) from the tetrahymena stock center (cornell university). These strains have a sensitive phenotype in all drugs because their somatic nuclei contain the drug sensitive allele (table 1). All strains have the mat-2 allele at the sex determination locus [12, 14, 15]. We performed a genomic exclusion (ge) cross of each strain (following the methods in [13, 16]) with the strain a*iii, which does not contribute its genome to the progeny . We obtained 4 progeny, with mating types ii, iv, v, and vii, from each parental strain (figure 1(a), table 1). Each progeny inherits the mat-2 allele and expresses one of the seven sexes according to the sex determination pattern of mat-2 . The progeny of a strain carry the same drug resistance marker as their parent strain, but in contrast to the parental strain, the progeny express the drug resistant phenotype . Stocks of all strains were maintained frozen under liquid nitrogen for the entire duration of the study . Frozen stocks were thawed, and cells were grown to log phase for 48 hours prior, to use in the experiments . We used 2% w / v proteose peptone (pp) to grow cells asexually . This medium, unlike 2% pp, buffers the pairs against osmotic shock, allowing completion of mating and subsequent asexual growth . To induce mating, all strains an overnight culture of klebsiella pneumoniae grown in 2% pp was diluted 1: 50 with sterile water . In this medium, ciliates grow asexually by feeding on the bacteria and starve upon exhausting the bacteria in about 48 hours . We used 2% bp, instead of conventional starvation media (e.g., 10 mm tris), to mimic starvation in the natural environment . Also, 2%bp is the least likely to modify the molecular interactions and influence mating propensities between different sexes . Mating type (mt) tests are used to identify mating type (sex) of a new progeny cell produced as a result of a cross . Self - incompatibility, which is the inability of cells to form pairs with other cells of the same sex, is a key property used in mt tests . When mixed separately with a culture of each of the seven sexes, a clonal culture forms pairs with all but one of the seven mating type tester strains . Absence of pairing is interpreted as evidence that the progeny culture has the same sex as the tester strain . We used this protocol to determine the sex of each progeny strain generated by genomic exclusion (table 1). Pmr is a dominant structural mutation in the coding region of small subunit of the rdna, and it confers resistance to paromomycin (30 ng/l). Chx is a dominant mutation, which causes structural modification of large subunit of rdna, and confers resistance to cyclohexamide (15 ng/l) [18, 19]. The dominant mutant allele mpr is mapped to chromosome 2r, and confers resistance against 6-methylpurine(25 ng/l), which is a structural analog of adenine, and disrupts dna synthesis in sensitive cells . Since all drugs are lethal at the respective concentrations, the sensitive phenotype manifests as the presence of dead cells . A resistant phenotype is indicated by the presence of log - phase cells after 72 hours of exposure to a single drug or 48 hours of exposure to two drugs applied simultaneously (this study). We verified the stability of drug resistance markers in the parental as well as the progeny strains listed in table 1 . Parental strains obtained from the stock center carry resistance alleles in their germline nucleus, but sensitive alleles in the somatic nucleus . Because alleles in the somatic nucleus determine phenotypes, each parental strain is expected to show sensitivity to all drugs, including the one for which they carry resistance alleles in the germline . Each progeny strain is expected to be resistant to only one drug, characteristic of the resistance allele in the germline nucleus of its parental strain . From a clonal culture of each strain (parental or progeny), we isolated 48 single cells and grew them asexually for 48 hours . Each of the 48 cultures was exposed separately to the three drugs, and scored for resistant phenotype . This allowed us to determine the frequency with which cells spontaneously acquired or lost resistance to one or more of the drugs . Efficiency of a resistance marker is calculated as the frequency of observing a resistant phenotype when expected . We performed all pairwise crosses between the 12 progeny strains (table 1) to construct strains heterozygous for every pairwise combination of the markers . We picked 48 pairs from each cross, let their cultures grow asexually for 72 hours, and identified which cultures are sexually immature . Immaturity confirms that the pair mated successfully and exchanged the resistance markers (see below). The extent of association between confirmed immaturity and the presence of dual drug resistance provides the efficiency of drug resistance markers in the presence of each other . We used mate choice assays to quantify pairing frequency between the sexes ii, iv, v, and vii . Every assay was performed between three sexes, each sex carrying a different drug - resistant genotype (figure 1(b)). To create such a triplet of sexes, we used one progeny strain of each parent (table 1, figure 1). Thus, drug resistance allowed identification of morphologically indistinguishable sexes and quantification of the number of pairs formed between each of the three sexes ., we starved three sexes (i.e., the respective progeny strains) separately and adjusted the density of each to 2 10 cells / ml . We mixed about equal numbers of the three sexes (6.6 10 cells per sex) to a total density of 2 10 cells in 1 ml (0.33 ml per sex). A pair takes between 10 and 12 hours to complete mating and then separates . Before separation, the two sexes involved in a pair reciprocally exchange haploid genomes, including the drug - resistance markers . After separation, the partners (now called progeny) have dual drug - resistance, characteristic of the sexes involved in the pair . After 24 hours (t24), mostly single cells are observed, indicating separation of all pairs . For every triplet, the mate choice assay was performed under a strict competition regime by providing limited time for choosing a mate . We put each pair in an individual drop of 1% pp medium, and grew them asexually for 48 hours . We replicated each drop - culture into 2% pp medium containing each drug separately and into the pairwise combinations of the three drugs . If the pair mated successfully, its culture will have dual drug resistance characteristic of the two sexes in the pair and is expected to grow in the respective drug combination . If mating was unsuccessful, its culture will grow in the presence of two of the individual drugs, but not in any pairwise combination of drugs . For every triplet, we also repeated the mate choice assay giving the cells unlimited time to choose a mating partner by testing the dual - drug resistance of single cells isolated at t24 (data not shown). In addition to the drug resistance markers, we used immaturity tests to verify whether the isolated pairs successfully completed mating . Mating partners in a pair separate after about 10 to 12 hours . If genetic exchange was successful, the separated partners are now progeny cells, which are sexually immature and show no pairing with any of the seven mating types until they reach sexual maturity (~100 asexual divisions). In an unsuccessful mating, the separated partners retain their sexual maturity . Hence, soon after separation, they are able to form pairs with a compatible mating type . We tested cultures of each pair for immaturity by mating tests with the parental strains within 5 days after picking mating pairs . Significant differences in viability of mating pairs between the progeny strains would skew our estimates of pairing frequencies . Thus, we conducted a separate experiment to test how frequently mating pairs between progeny strains died before scoring for dual resistance . We made every pairwise cross (total 36 crosses) between the 12 progeny strains (table 1), and isolated 46 pairs at 6.5 hours after mixing the two progeny strains . We scored the survivorship as the proportion of viable pairs in 1% pp at 48 hours after - isolation . We used these viability data to correct the estimates of the pairing frequencies in mate choice trials . We divided the number of pairs observed between two sexes in a mate choice trial by the viability estimate for the corresponding pair of progeny strains (table s1 available online at doi:10.1155/2012/201921). We then normalized the corrected numbers to 96: the total number of pairs isolated in each mate choice trial . This gave us an estimate of the actual number of pairs that likely formed between the two sexes . We used these normalized estimates of pairing frequencies in the analyses of mating biases . In every trial conducted on a triplet of sexes, three types of pairs can be formed between the three sexes (figure 1(b)). Under random mating, we expect 1/3 of total pairs to be of each type . We used goodness - of - fit tests to determine if mating was random within a trial . Also, we used mixed - effect anova to analyze if mating was random in a triplet (i.e., pooling the data for all trials conducted for a given triplet). The experimental design (figure 1(b)) contained one fixed factor (sex) and one random factor (drug resistant genotype). Our aim was to investigate whether preferential mating occurs among sexes, when more than two sexes are present in a population . Hence, we quantified biases in pair formation between four (of seven) sexes of t. thermophila . We created experimental populations containing three sexes each and used drug resistance markers to identify how often the various sexes formed mating pairs . We determined the reliability of the drug resistance alleles as genetic markers and found that they are stable against spontaneous mutations . The frequency of mutations conferring a loss or gain of resistance was below the limit of detection for all strains listed in table 1 (data not shown), that is, we found no such spontaneous mutations . We also found the efficiency of the markers in conferring resistance to be 100% (data not shown) because only those strains that were immature showed dual drug resistance . Thus, the three resistance alleles are reliable genetic markers in the genetic backgrounds used in our experiments . While we did not explicitly test the neutrality of these markers towards fitness (growth rate) of the strains, at no step in our mate choice assays was there an opportunity for fertility selection . We did not, however, observe any obvious differences between growth rates of the progeny strains with different markers . We measured viability of mating pairs as the proportion of total pairs that survived and grew 48 hours after isolation in growth medium . We found that some mating pairs did die more frequently than others (one - way anova, p <2.2e 16). This indicates that viability of the pairs is contingent upon the progeny strains forming the pairs (table s1). We could not associate the observed mortality with the presence of any particular resistance marker, but rather conclude that viability is a property of the specific genetic backgrounds of the strains . Each experimental trial (figure 1(b)) contained three sexes in equal proportion, which ensures equal mating opportunity for each sex . Thus, under random mating, the three types of pairs that could be formed among the three sexes should be represented at an equal frequency of ~0.33 . We tested this null hypothesis for every trial using a goodness - of - fit g - test and found evidence of nonrandom mating (p <0.05) in many trials but without a strong bias towards any particular sex (data not shown). Hence, the apparent deviations from random mating may not represent mating preference with respect to sex of an individual but instead reflect an effect of genetic backgrounds on pairing frequencies in a trial . The genetic backgrounds used in our experiments represent a randomly chosen subset of the available drug resistant backgrounds; therefore, any effect of the genetic background on pairing frequencies may be specific to the strains we used, and must be isolated from the effect of the sexes . For every triplet of sexes, we had conducted three trials in which the drug resistant, genetic backgrounds alternated among the three sexes (figure 1(b)). If sex of an individual was driving biases in pairing frequencies observed within a trial, we would expect a consistent bias towards a particular pair of sexes across the three trials irrespective of the associated genetic backgrounds . On the other hand, if the sexes exhibit no preferences, the pairing frequencies across the three trials will reflect random mating with respect to sex . To investigate any consistent effects of sex (with alternating genetic backgrounds) on pairing, we analyzed mating biases by pooling across the three trials conducted for a given triplet of sexes . A mixed effect anova indicated no significant effect of the sex on the dynamics of pairing in each triplet of the sexes (table 2, figure 2). This suggests that mating was indeed random with respect to sex of an individual, and that the biases apparent in pairing frequencies in individual trials likely represent an effect of the genetic background rather than preferences among the sexes . Nonpreferential mating, that is, random mating with respect to sex, was verified in assays conducted at t24 (data not shown). Nonrandom mating is pervasive in nature, occurring in various ways, and resulting in differing evolutionary consequences . In contrast, our results suggest that t. thermophila mate randomly among each other with respect to sex . This lack of mate preference was apparent even under strict competition for mates imposed by limited time to find a mating partner, and subsequently when time restriction was removed . Sexes of t. thermophila are self - incompatible, that is, cells of the same sex never form mating pairs, but each of the seven sexes can pair with all the other (i.e., six) sexes . Thus, even though all sexes look morphologically alike, they are somehow able to distinguish self from nonself . Our analysis suggests that beyond this basic distinction, most sexes of t. thermophila are unable to differentiate the various nonself sexes . Thus, the choice in this multisex system is binary, that is, it is about whether or not to form a mating pair rather than which of the available sexes to form the pair with . Our results are consistent with the previous finding that the sexes functionally substitute each other during costimulation the stage immediately prior to mating pair formation . Although it used a similar experimental design, the previous study did not allow quantification of mating preference of the four sexes . Our experimental design allowed us to verify that none of the sexes ii, iv, v, and vii show bias for mating among each other when presented simultaneously with a choice between two compatible sexes . This could be possible if the ligands characterizing various sexes diverged to be sex - specific but still share a common receptor, enabling the sexes to replace each other functionally . Alternatively, random mating found in our study may reflect presence of a unique receptor for each sex - specific ligand and thus lack of competition between the sexes . Neither the molecular differences between the sexes nor the molecular interactions responsible for pairing are known in t. thermophila . Interaction between a sex - specific ligand on the surface of one sex and the receptor on the surface of the other sex is hypothesized to be the underlying mechanism of pairing between sexes, but awaits empirical support . If pairing indeed results from such molecular interactions, then we suggest that affinities between the sex - specific ligands and receptor(s) may be of equal strength, leading to random mating between the sexes . It is generally observed in other unicellular species that the affinities between sex - specific molecules rarely determine the intraspecific mating propensities . For instance, the unique pheromones secreted by the two mating types in the yeast saccharomyces cerevisiae bind to specific receptors displayed by the opposite mating type . Variation in the amount of pheromone produced, but not in the affinity to the receptor was found to be the basis of nonrandom mating . In the ciliate euplotes raikovi, sex - specific pheromones and receptors characterize the multiple sexes, which show variable mating interactions among each other beyond self-/non - self - distinction . Biased mating among the multiple sexes is a function of amount of pheromone produced such that higher secretion translates into higher mating success for any given sex . Thus, factors other than molecular affinities largely determine mating propensities among sexes in a population of this species . Also, affinities between sex - specific molecules play a minimal role in interspecific mating interactions . For instance, although recognition of opposite mating type occurs and interspecific hybrids sometimes form between the two closely related yeasts s. cerevisiae and s. paradoxus, mating takes place preferentially with conspecifics and is more efficient and frequent [10, 23]. The overall genetic background rather than species - specific pheromone - receptor affinities are largely responsible for mating selectively within species . Thus, unlike in anisogamous plants and animals, prezygotic reproductive barriers may rarely occur at the pheromone / receptor level in isogamous unicellular eukaryotes, allowing extensive diversification of mating types within species . For example, pairing with the strain 5c always resulted in low viability (table s1) for reasons that are yet unclear and may involve genetic incompatibilities, which could be investigated in future studies . Although mating is random with respect to sex, the effect of genetic background on viability implies that some sexes may contribute to the gene pool more than the others, contingent upon the genetic background they are associated with . The effect of a sex and its genetic background on mating propensities could be explored in future studies using a full factorial design involving six (instead of three) trials for every triplet of sexes (figure 1(b)). Natural populations of t. thermophila are likely patchy, thus due to self - incompatibility and the inability to switch sexes, finding a compatible mate may be difficult ([2426], p. doerder, pers . . Random mating with respect to sex creates the highest possible opportunity for mating, contingent upon the sex ratio, the relative frequencies of multiple sexes, in the population . High frequency of sex has been documented in natural populations of t. thermophila [2527]. Thus, when searching for mates is costly, random mating with respect to sex is likely to be advantageous by avoiding further delays in initiating mating . It is unclear, however, why self - incompatibility would be maintained under such a scenario, though it is possible that high levels of inbreeding depression select for the maintenance of self - incompatibility . Transitions to self - compatibility in arabidopsis have been linked to mate - limiting conditions . Mating between cells of the same sex and other selfing strategies, including autogamy, are also observed in many species of ciliates and may reflect ways to avoid the cost of finding a mate [7, 29]. Alternatively, presence of multiple sexes may compensate, at least partially, for the cost of self - incompatibility . Very few data exist to test the correlation between the number of sexes and the capacity to transition to self - compatibility in ciliates . The demonstration of random mating with respect to sex verifies a key assumption of our model on sex ratio evolution in t. thermophila . Although violating the assumption of random mating would not change the equilibria predicted in this model, it would change the approach (time and the trajectory) of the populations to those equilibria . We studied mating preferences of the four sexes specified by a single sex determining allele (mat-2). The analysis presented here does not rule out the possibility of finding nonrandom mating between sexes specified by different mat alleles, which may lead to assortative mating with respect to the genotypes at the mat locus in t. thermophila . Discovery of mating bias among sexes in t. thermophila could have delivered insights into affinities between sexes at the molecular level and facilitated predictions about the structural differences between the sex - specific molecules, which are currently unknown . Our results emphasize the need to decipher the molecular machinery that enables random mating among multiple sexes.
Stroke, with a high prevalence and long - term disabilities, is a major health problem in the world1, 2, and it was reported that about two million people suffer from stroke each year3 . Impairments including loss of strength, sensation, and coordination abilities, which result in walking difficulties, balance disorders, and limb function disturbance, occur in 7080% of stroke patients4 . This affects the life quality of patients adversely and leads to a heavy economic burden on society . Subsequently, effective rehabilitation interventions to optimize recovery in stroke patients have received high attention . In the treatment of balance and gait dysfunction, exercise therapy is regarded as one of the commonly used methods that bring greater benefits in physical function for stroke patients5 . The effect of exercises on balance and gait dysfunction in stroke patients has been confirmed by many clinical studies3, 6, 7 . In addition, core stability exercises have been widely carried out in many fields, including medical rehabilitation, sports training, and medical care . Core stability exercises were shown to improve dynamic standing balance, functional autonomy, static balance, flexibility, and stability8 . In recent years, core stability exercises have been reported to improve the rehabilitation effect in stroke patients . In a study of 20 stroke patients, the control group underwent standard exercise therapy, while the experiment group underwent both the core stability - enhancing exercise and standard exercise therapy simultaneously . After 4 weeks, yu found that the mean trunk impairment scale score and muscle activity of the lower trunk increased in the experiment group significantly9 . In study by cabanas - valdes, 80 patients were randomly assigned to an experimental group and a control group, both groups underwent conventional therapy including exercises, and the experimental group performed core stability exercises . The results showed that core stability exercises improve the efficacy of conventional exercises10 . Although these studies confirmed the effect of core stability exercises in the rehabilitation of stroke patients, few comparative studies have been carried out to compare the effect of core stability exercises and conventional exercises . Which is better in improving the stability and balance of stroke patients, core stability or conventional exercises? Therefore, a prospective study including 40 participants was carried out in the department of neurology of yidu central hospital of weifang between january 2014 and february 2015 . The objective of the study was to determine which is better in the rehabilitation of stroke patients, core stability exercises or conventional exercises . Participants with stroke - induced hemiplegia were recruited from the department of neurology of yidu central hospital of weifang between january 2014 and february 2015 . The diagnosis and lesion side of these participants were confirmed by history evaluation, physical examination, brain imaging, and examination of their medical records . The inclusion criteria9 were ability to walk more than 32 feet, duration of disorder> 6 months, no musculoskeletal problems, absence of any cardiac disorders, complete understanding of this research, and ability to communicate . The included participants were randomly divided into either an experimental or control group by a random computer - generated sequence . The randomization was managed by a physician who was not involved in the study . All the included patients signed an informed consent form, and the study was approved by the ethics committee of our hospital . The patients in the control group performed conventional exercises including limb stretching, passive mobilization of joints, walking between parallel bars, and occupational therapy11 . The patients in the experiment group performed core stability exercises including the plank, side plank, bridge, straight leg raise, and modified push - up12 . Before the beginning of the study, the patients were given individual instruction by the researchers . During the exercises, physicians provide necessary assistance to help the patients in executing the exercises . The exercises in both groups were performed for one hour per day, six times a week for six weeks . The modified barthel index (mbi)13 and berg balance scale (bbs)13 were used to assess the clinical outcomes of the two groups . The mbi, which demonstrates the ability of patients to deal with daily activities, consists of ten items including personal hygiene, taking a bath alone, eating, using the bathroom, ascending stairs, dressing, defecating, controlling urine, walking or using a wheelchair, and moving to a chair or bed . Each item is rated on a scale of 5 ranging from independent conduct to impossible to conduct . The bbs, which can evaluate static and dynamic balance abilities of patients, consists of 14 items covering functional tasks in three domains, sitting, standing, and changing posture, that are scored on a scale of 04 . Ibm spss statistics 21.0 (ibm corp ., armonk, ny, usa) was used for statistical analysis, and p <0.05 was considered significant . The differences in the baseline data including age, gender, and disease course were compared using the t test or test . In the current study, 40 patients with stroke - induced hemiplegia were included and divided randomly into experimental and control groups, with 20 participants in each group at the beginning of the study . The baseline clinical data including age, gender, disease course, bbs, and mbi were recorded . There was no significant difference in baseline data between the two groups (p>0.05). The patients in the control group performed conventional exercises for six weeks and those in the experimental group carried out core stability exercises for six weeks . Three patients in the experimental group and two in the control group withdrew from the study two weeks after treatment, and in total thirty - five patients completed the training . The final results showed that, compared with the baseline, the mean mbi scores of the experimental and control groups increased significantly from 53.5 and 55.1 to 66.8 and 61.2 (p<0.05), respectively, and that the mean bbs scores increased significantly from 30.2 and 31.9 to 38.6 and 35.7 (p<0.05), respectively . In addition, mbi scores were significantly lower (p<0.05) in the control group than in the experimental group . The bbs scores in the control group were relatively lower than those in the experimental group, but there was no significant difference between the two groups (p>0.05). A prospective study was carried out to compare the effect of core stability exercises and conventional exercises on patients with stroke - induced hemiplegia . To the best of our knowledge the core, described as a box in the trunk with the abdominals, paraspinals, and gluteals; diaphragm and pelvic floor; and hip girdle musculature serving as the front wall, back wall, roof, and bottom, respectively, makes up the largest part of the body and plays an important role in stabilizing the body and controlling movement of daily activities9 . Core stability is regarded as a prerequisite for maintaining proper posture of the lumbar and pelvic regions during sports activities9 . As a result, core stability exercises have many advantages in the field of rehabilitation and can improve the activation and cooperative contractions of abdominal and multifidus muscles, facilitating the function and movement of the limbs9, 12 . In the current study, the mbi and bbs scores after treatment were significantly increased in both the experimental and control groups when compared with those before treatment . This indicates that both core stability exercises and conventional exercises can improve the abilities of patients to deal with daily activities and control body balance, which confirms the viewpoints of many published studies9, 10 . In addition, after treatment, the mbi scores were significantly lower in the control group than those in the experimental group, and the bbs scores in the control group were also lower than those in the experimental group . The outcomes demonstrate that compared with conventional exercises, core stability exercises can result in better effectiveness in patients with stroke - induced hemiplegia . However, in terms of comparison of the bbs scores at the end of treatment, although the mean bbs score in the experimental group was larger than that in the control group, there was no significant difference between the two groups . Such a condition may be attributed to the relatively small sample size, and in a larger - scale study, the difference between the two groups may be significant . Consequently, the outcomes in the present study can demonstrate that core stability exercises present with better effectiveness than conventional exercises . First, the sample size was small, and a large - scale clinical study may be better in a comparative study . Second, the exercises results were evaluated using self - reported measures of function instead of an objective measurement, and this may have had some adverse influence on the final outcomes . Third, there was a lack of long - term follow - up in the study, and it is unclear whether the effectiveness of core stability exercises will decrease in patients with hemiplegia with time.
A 3-year - old male, neutered, domestic shorthair cat with a history of chronic regurgitation since being obtained as a kitten was presented for weight loss and regurgitation of all ingested food . The cat was in poor body condition and had a firm swelling in the ventral neck at the time of presentation . Thoracic radiographs showed severe dilation of the entire cervical and cranial intrathoracic esophagus to the level of the heart base . Computed tomographic angiography (cta) showed a persistent right aortic arch with an aberrant left subclavian artery and severe dilation of the cervical and intrathoracic esophagus cranial to the heart base . Cta also showed a bicarotid trunk and kommerell s diverticulum to be present, which are rare vascular structures in the cat . Removal of the obstructing trichobezoars resulted in resolution of clinical signs, and the cat was able to drink water and eat a canned food slurry without regurgitation . Vascular ring anomaly (vra) should be considered in all cats with a history of regurgitation, regardless of their age at the time of presentation . Cta is a valuable diagnostic imaging procedure that allows differentiation of a vra from other causes of esophageal obstruction and provides information about the vra that can be used to determine amenability to surgical correction . A 3 year - old male, neutered, domestic shorthair cat was presented with a 2 week history of severe regurgitation of all ingested food . The cat had a history of a voracious appetite and regurgitation of solid food since being acquired as a kitten, but was able to consume liquid meals without regurgitating until 2 weeks prior to presentation . The physical examination revealed a poor body condition score (bcs 2/9) and a 4 cm firm tubular structure in the ventral neck, believed to be within or associated with the esophagus . As a result of the cat s fractious nature, it was necessary to induce general anesthesia for further evaluation . Thoracic radiographs showed severe distention of the entire cervical and intrathoracic esophagus to the level of the heart base with heterogeneous soft tissue opaque material surrounded by a thin gas rim (figure 1). Differentials for the radiographic findings were constriction due to a vascular ring anomaly (vra), most commonly a persistent right aortic arch, a mural defect or benign esophageal stricture . The cervical and thoracic esophagus (dashed lines) is severely distended cranial to the carina, displacing the trachea (dotted lines) ventrally and to the right . Note the marked leftward deviation of the trachea at the level of the heart base computed tomographic angiogram . Structures of note include the persistent right aortic arch (praa), bicarotid trunk (bct), right subclavian artery (rsa), aberrant left subclavian artery (alsa), descending aorta (dao), esophagus (es), cranial vena cava (crvc), pulmonary trunk (pt) and right auricle (rau) computed tomographic angiography (cta) was performed in order to confirm and classify the suspected vra and to determine if surgical correction would be possible . The esophagus cranial to the heart base was almost entirely filled with heterogeneous soft tissue, gas and mineral opaque material . At the level of the heart base, the esophagus was focally and concentrically narrowed by the trachea and aorta on the right and the main pulmonary artery on the left . The site of constriction was apparent at the anatomic level of the ligamentum arteriosum; however, the ligamentum arteriosum could not be specifically identified on cta . The aortic arch and proximal descending aorta were located just to the right of midline, with the distal descending aorta positioned immediately ventral to the thoracic spine . A bicarotid trunk and right subclavian artery were present, and branched from the aortic arch in close succession . Additionally, the origin of the aberrant left subclavian artery from the aorta was markedly dilated and then abruptly narrowed distally to a normal diameter; this finding is known as kommerell s diverticulum . Although the aberrant left subclavian artery created a dorsal indentation in the intrathoracic esophagus, it did not appear to be the primary cause of the constriction . The esophagus remained dilated cranial to the level of the constriction and pulsation of the major vessels against the wall of the esophagus was observed at the level of the luminal narrowing (see video in the supplementary material). Evidence of mild - to - moderate esophagitis, presumably due to stagnation of trichobezoars and putrefaction of food, was observed cranial to the constriction . It was possible to advance the endoscope past the constriction and no gross abnormalities were noted in the stomach . Following recovery from anesthesia, the cat was able to drink water and eat a canned food slurry without complication or regurgitation . Surgical ligation and transection of the vascular ring anomaly with concurrent endoscopic balloon dilatation of the esophageal stricture was recommended as the treatment of choice . The cat was discharged with instructions to continue feeding a canned food slurry in an upright position . The owner was contacted prior to submission and reported that the cat was doing well with multiple small feedings of canned food and had not regurgitated since discharge . Although vras are common in dogs, with several reports of diagnosis in adult dogs, they are uncommon in cats and infrequently diagnosed in adult cats . The most common feline vra is persistent right aortic arch (praa) with a left ligamentum arteriosum; however, other described abnormalities include praa with coarctation of the aorta at the level of the left ligamentum arteriosum, double aortic arch, left aortic arch with right ligamentum arteriosum and praa with concurrent left cranial vena cava . Recently, cta has become more widely available as a diagnostic modality and has increased the frequency and accuracy of diagnosis . Cta proved valuable in this adult cat as it could confirm a congenital defect was present as the cause of the esophageal constriction and allow a surgical procedure to be planned . The vascular abnormality known as kommerell s diverticulum this vascular structure is classically defined as a dilation of the aorta at the insertion of either the left or right subclavian artery that is 1.5 times greater than the diameter of the distal subclavian artery . The presence of a bicarotid trunk branching directly from the aortic arch in this cat is also an unusual finding . The treatment of choice for vras in companion animals is surgical ligation and transection of the anomalous vessel(s). If possible, periesophageal fibrosis should be reduced, and the stricture site should be dilated intraluminally with a balloon dilatation catheter . This procedure has traditionally been performed via a thoracotomy, but thoracoscopy has also been used, and offers a less invasive treatment option . Ligation and transection of the aberrant left subclavian artery can also be performed if the vessel contributes to the esophageal constriction . In an effort to decrease the severity of esophageal dilation and dysfunction, although surgical correction is the treatment of choice, clinical signs may persist even after a successful procedure . Esophageal dilation may cause irreversible myenteric nerve degeneration and esophageal hypomotility; however, a 90% or greater recovery rate has been reported in dogs . Nutritional management is critical in the postoperative period but is rarely successful as a primary treatment for vra . Many of these patients require lifetime management with elevated feedings of canned or pured food in small meals, but it is possible to transition those with less severe obstructions to a more solid diet . In cases of severe esophageal dysfunction or malnutrition, a gastrostomy tube may be necessary to achieve adequate nutritional supplementation . Congenital causes of esophageal obstruction should be considered in cats presented with a history of regurgitation, regardless of age at the time of presentation . Cta confirmed the presence of an extraluminal constriction and provided valuable information about the vascular anomaly in the event that surgical correction would have been pursued . Surgical removal of the extraluminal constriction with balloon dilatation of the esophageal stricture was recommended and is considered the treatment of choice . However, considering the guarded prognosis for return of normal esophageal function in an adult cat with chronic esophageal dilation, medical management provided a viable alternative for this cat.
We wish to report some corrections to our study, none of which alters the interpretation of the data or the conclusions drawn . After publication, we noticed that one of the micro - array hybridizations (on sample nb11) was performed on the same patient's material as another hybridization (sample nb4; see table 1; a corrected version of table 5). As this error leads to an incorrect subclassification of the patients into the' favourable' and' unfavourable' neuroblastoma subgroups, we would like to exclude this data point from the differential expression analysis of favorable versus unfavorable neuroblastoma given under the heading' differential expression analysis of favorable and unfavorable neuroblastoma' in the results section of . Careful reanalysis after exclusion of nb11 did not lead to important changes in the generated gene lists and conclusions; the changes are given in the corrected paragraph and table 2 (a corrected version of table 4), and the additional data files 1 and 2 (corrected versions of additional data files 2 and 3) available online with this article . We also noticed that sample nb1 is stage 1 instead of stage 4s and that sample nb2 was not localized to the adrenals (see table 1). So far, most published microarray studies on neuroblastomas mainly compared favorable with unfavorable neuroblastomas in order to identify prognostic markers or pathways that are involved in these clearly different neuroblastoma tumor types . In order to add value to such an analysis, we contrasted similar differentially expressed gene lists with the normal neuroblast expression profile (additional data file 1). In a first step, we compared the differentially expressed genes between these two tumor types with published prognostic gene lists . We found that 23 of the 193 genes on our list were previously reported, including the well established markers mycn, ntrk1, and cd44 (see nbgs analysis in additional data file 2). Subsequently, we looked for the corresponding gene expression levels of the differentially expressed genes in the normal counterpart cells, aiming to select neuroblastoma candidate genes . Of the 100 genes that are more highly expressed in favorable tumors (compared to unfavorable) 41 also have a significant differential expression (either higher or lower) compared to neuroblasts, whereas 43 of the 93 genes that are more highly expressed in unfavorable tumors exhibit differential expression compared to the neuroblasts (table 2). From this analysis, a few putative positional tumor suppressor candidates emerge: cdc42 on 1p36, cacna2d3 on 3p21 and dlk1 on 14q . The latter two genes are of particular interest because they are highly expressed in neuroblasts and favorable neuroblastomas and their expression is significantly lower in unfavorable neuroblastomas . Among the genes that are more highly expressed in unfavorable neurob - lastomas than in favorable ones and neuroblasts, the proven oncogenic transcription factor mycn emerges (and putative downstream genes kifap3, ophn1, rgs7, ascl1, odc1, twist1 and tyms, according to nbgs), as well as several other genes that have been identified or studied in the context of neuroblastoma such as alk and prame, and positional candidates on 17q including birc5 and rnu2 . So far, most published microarray studies on neuroblastomas mainly compared favorable with unfavorable neuroblastomas in order to identify prognostic markers or pathways that are involved in these clearly different neuroblastoma tumor types . In order to add value to such an analysis, we contrasted similar differentially expressed gene lists with the normal neuroblast expression profile (additional data file 1). In a first step, we compared the differentially expressed genes between these two tumor types with published prognostic gene lists . We found that 23 of the 193 genes on our list were previously reported, including the well established markers mycn, ntrk1, and cd44 (see nbgs analysis in additional data file 2). Subsequently, we looked for the corresponding gene expression levels of the differentially expressed genes in the normal counterpart cells, aiming to select neuroblastoma candidate genes . Of the 100 genes that are more highly expressed in favorable tumors (compared to unfavorable) 41 also have a significant differential expression (either higher or lower) compared to neuroblasts, whereas 43 of the 93 genes that are more highly expressed in unfavorable tumors exhibit differential expression compared to the neuroblasts (table 2). From this analysis, a few putative positional tumor suppressor candidates emerge: cdc42 on 1p36, cacna2d3 on 3p21 and dlk1 on 14q . The latter two genes are of particular interest because they are highly expressed in neuroblasts and favorable neuroblastomas and their expression is significantly lower in unfavorable neuroblastomas . Among the genes that are more highly expressed in unfavorable neurob - lastomas than in favorable ones and neuroblasts, the proven oncogenic transcription factor mycn emerges (and putative downstream genes kifap3, ophn1, rgs7, ascl1, odc1, twist1 and tyms, according to nbgs), as well as several other genes that have been identified or studied in the context of neuroblastoma such as alk and prame, and positional candidates on 17q including birc5 and rnu2 . Additional data files 1 and 2 containing the corrected data available online with this article . Corrected version of additional data file 2 . Corrected version of additional data file 3 . Clinical and genetic data of carefully selected neuroblastoma samples that were included in this study samples were subdivided into favorable or unfavorable type based on mycn amplification, ploidy and age at diagnosis . Nd, not determined or unknown . Genes that are differentially expressed in favorable vs unfavorable neuroblastoma genes that are differentially expressed compared with neuroblasts among the differentially expressed genes in favorable neuroblastoma (nb) vs unfavorable nb, with an indication of the number of neuroblastoma microarray studies in which these genes were found through nbgs analysis.
The ultrasound (us) appearance of testicular microlithiasis (tm) was first described by doherty et al . In 1987 . The prevalence of tm in symptomatic korean men was found to be 6.0% with significant co - occurrence of tm, testicular cancer, and infertility by yee et al . Although the cause - and - effect relationships are unclear, tm has been seen in patients with cryptorchidism, varicoceles, infertility, testicular torsion, klinefelter syndrome, pulmonary alveolar microlithiasis, neurofibromatosis, acquired immunodeficiency syndrome, intratubular germ cell neoplasia, and most importantly, primary testicular neoplasms . Reported that 74% of testes with tumors had associated ipsilateral tm on radiological inspection; whereas, only 8% of testicular specimens with benign conditions had microcalcifications . Although chen et al . Reported that there was a significant difference in the rate of malignancy in males with tm compared with those without tm, the question remains whether tm independently increases the risk of testicular malignancy in taiwanese men ., after reporting an association between tm and testicular tumor specimens, suggested in 1982 that radiographic studies be incorporated into diagnosing tm because of the perceived risk for testicular cancer in testicles with microlithiasis performed us follow - up in 9 of 22 patients with tm for a mean of 32 months without any newly developing tumors being diagnosed . Reported similar results; therefore, a regular scrotal us is controversial in asymptomatic tm patients . The current recommendations, including those of the european association of urology, are that the presence of microlithiasis alone is not an indication for a regular scrotal us in the absence of other risk factors (size<12 ml or atrophy, inhomogeneous parenchyma). However, there have been no reports describing the changes in calcification over time in pediatric patients with tm . The study protocol was approved by the institutional review board of the asan medical center . The medical records from july 1997 to august 2014 of the asan medical center, a tertiary referral center, were retrospectively screened for patients diagnosed with tm by scrotal us . Twenty - three tm patients were included who had undergone scrotal us at least twice . We analyzed the patient characteristics, clinical manifestations, specific pathological features, and clinical outcomes . We measured the calcified area in maximum cross - sectional area, and we compared the calcific density in the initial diagnostic us and the final follow - up us . We defined the testis and the calcified area in terms of their maximal cross - sectional area and calculated those areas using image j software (national institutes of health, bethesda, md, usa) (fig . Patients that showed microlithiasis in three or more sections were defined as diffuse type, and patients with microlithiasis in less than three sections were defined as focal type (fig . We classified the patients into three groups according to the change of microlithiasis: an increased group, 20% increase in microlithiasis; a decreased group, 20% decrease in microlithiasis; and a no change group, <20% increase or decrease . Differences were analyzed by a paired t - test, and crosstabs were used to assess dependent samples . In this study p - values <0.05 were considered statistically significant . The mean age at presentation was 11.34.6 years, and the follow - up period (interval of fist us and last us) was 79.138.8 months (range, 25.4 - 152.9 months). The mean age at last follow - up was 17.85.8 years (range, 6.4 - 26.9 months). Follow - up occurred for 19 of 23 patients over puberty (defined as> 13 years old). Of the 23 patients 20 had bilateral tm, 2 patients had unilateral tm, and 1 patient had an atrophic testis . Less frequent comorbid conditions included testicular torsion (3 patients, 13.0%), epididymitis (3 patients, 13.0%), varicocele (2 patients, 8.7%), hydrocele (2 patients, 8.7%), and epididymal cyst (2 patients, 8.7%). Calcific density was increased at the last follow - up us compared with the initial us; however, this finding was not statistically different (3.74%6.0% vs. 3.06%4.38%, respectively, p=0.147). We divided the subjects into two groups (focal vs. diffuse) based on the distribution of tm . We classified 23 testes as having focal tm and 20 testes as having diffuse tm . In focal tm calcific density decreased but not significantly (0.72%0.55% vs. 0.66%1.03%, p=0.813). On the other hand, the calcific density of diffuse tm show a trend toward increase (5.8%5.2% vs. 7.3%7.4%, p=0.457) (table 2) (fig . 3). To clarify the tendency of tm calcification toward increase vs. decrease we divided the subjects into three groups based on the calcific density change of tm (increase: increased> 20%; decrease: decreased> 20%; no change: <20% increase or decrease). We categorized 14 testes as increased, 18 testes as decreased, and 11 testes as no change . Half of the patients with diffuse tm were assigned to the increased group, a proportion significantly higher than focal tm (10/20 [50%] in diffuse tm, 4/23 [17.4%] in focal tm, p=0.049) (table 3). In addition, 5 of 8 testes with cryptorchidism (including 2 with bilateral cryptorchidism) were categorized into the increased group . Previous tm studies have focused only on the relationship between tm and testicular cancer, and not on the natural course of this disease progression . In our current study, we report the natural course of calcific density changes in pediatric tm during pubertal development . The mean age at presentation was 11.3 years and the mean follow - up period of approximately 5 years allowed follow - up of 23 patients over pubertal development . Despite a follow - up interval that allowed potential pubertal changes to the testis, none of our patients developed testicular cancer or new abnormal symptoms . By contrast, there are some reported cases of patients with a known tm on us exam that eventually developed a primary testicular cancer . Reported a yolk sac tumor developing in a 17-year - old boy being followed for bilateral tm that was originally detected because of an initial sonographic evaluation of unequal sized testes . Reported the case of a man with tm seen on a sonograph performed due to bilateral testicular pain who presented three years later with a metastatic germ cell tumor of the left testicle . Although, an association between tm and subsequent testicular tumors appears likely, whether there is a true cause - and - effect relationship remains unknown . (7 patients, 45 months)-used us to follow patients with tm and, similarly to our present results, did not detect the appearance of new testicular tumors . Compared with these prior studies, our current study incorporates more patients and a longer - term follow - up extending through puberty . An additional strength of our study over previous studies is in our investigation of changes in calcified density of the tm . One earlier study has reported nonquantitative changes in the prominence of tm on yearly us follow - up . The tm was less prominent in one patient, unchanged in four, and two patients were lost to follow - up . To our knowledge, our present study is the first report to provide a quantitative analysis of calcific density in tm . Calcific density on us showed a nonstatistically significant trend toward increase over time in our study subjects . Reported a relationship between the number of microliths and testicular cancer after subgrouping subjects into four ranges based on the number of microliths . In our present study, we divided tm into two nearly equal groups based on the distribution pattern of calcification (focal type [23 testes] vs. diffuse type [20 testes]) that appear to differ in terms of calcification trends . Calcific density shows a trend toward a decrease in focal tm but toward an increase in 50% of the testes with diffuse tm . Notably, the majority of testes (5/8) in our study series with cryptorchidism, including those with bilateral cryptorchidism, were categorized as being in the increased calcification group . During the follow - up through puberty of the microlithiasis in the 23 boys in our present study, we observed no significant changes in the density of their microliths and no development of testicular cancer; however, we found that diffuse tm and cryptorchidism tend to increase calcific density . Hence, close observation is recommended in cases of tm combined with cryptorchidism and diffuse microlithiasis.
Bluetongue viruses, pathogenic only to domestic cattle and wild ruminants (barratt - boyes and maclachlan, 1995; tsuboi and imada, 1997), are non - pathogenic to humans (xiao et al ., 2004; hu et al ., 2008) and thus, humans do not have pre - existing antibodies to btvs (jeggo et al ., 1983; barratt - boyes and maclachlan, 1995; dong et al ., 1998) not only can btv be grown easily in vitro (jameson and grossberg, 1981; du, 1985; samal et al ., 1985; sundin and mecham, 1989; dong et al ., 1998; wechsler and mcholland, 1998; chen et al ., 1999; prasad et al ., 1999; xue, 2001; lei et al ., 2004; xiao et al ., 2004; liang et al ., 2006; hu et al ., 2008), it has powerful oncolytic activity against many different in vitro cultured cancer cell lines (chen et al . 2008), such as a498 human kidney cells (atcc: htb-4), hep - g2 human liver cells (atcc: hb-8065), a549 human lung epithelial cells (atcc: ccl-185), baby hamster kidney cells (bhk-21), monkey kidney (vero) cells (ramig et al ., 1989), mouse fibroblast cells (nih 3t3), spc - a-1 cells (lei et al ., 2004), ma 782 cells (liang et al ., 2006), and in mouse models . No normal human cells such as the primary human embryo lung fibroblast (hel) and primary murine embryos fibroblast (mef) have ever been successfully infected by btv (dong et al ., 1998; chen et al ., 1999;, 2004; liang et al ., 2006; hu et al ., 2008) and thus, humans are normally sero - negative . Madin darby canine kidney (mdck) which is sensitive to reovirus apoptosis also proved resistant to btv infection except in high moi (unpublished data). Btvs can also infect cultured insect cells (king and alders, 1985; samal et al ., 1987; guirakhoo et al ., 1995; mullens et al ., 1995; mertens et al ., 1996; xu et al ., 1997; tan et al ., 2001). In the last decade, our lab and collaborators have used both cell culture systems (dong et al ., 1998; xiao et al ., 2004; liang et al ., 2006; hu et al ., 2008) and mice (manuscript in preparation) to investigate and determine the oncolytic activities and capacities of btvs and their selective degradation of human cancer cells as potential treatment of human cancers . Human cancer cell lines such as hep-3b and hep - g2, a549, a498, spc - a-1, and ma 782 cells infected with btv 10, 11, 13, 17, and hbc3 at various mois exhibited the following easily detected characteristics 36 h post - infection (pi) but not in hel and mef cells in multiple determinations (xiao et al ., 2004; hu et al ., 2008). Briefly: between 70 and 90% cytopathic effects (cpe) were readily observed and detected along with cellular apoptosis and necrosis in many human cancer cell lines . Various degrees of morphological and cellular damage could be visualized by either light, confocal, or electron microscopy (em). Cellular dilated endoplasmic reticulum, nuclear chromatin condensation, and cytoplasmic shrinking were readily detected and easily observed in em . Btv viral genomic ds - rna fragments and viral mrnas could be found in btv-10, 13, 17, and hbc3 infected human cancer cells, but not in normal hel or mef cells by gel electrophoresis, elisa, rip, western blots, pcr, and qrt - pcr (tiwari et al ., 2000). The survival rate of several human cancer cell lines was low if high moi was used . Primary hel and mef cells survived very well for 69 days independent of the moi used for testing . Human cancer cells infected with btvs had more efficient viral replication and provided higher viral progeny yields . Selective cell cycle arrest at sub - g1 peak in several human cancer cells infected with btv-10 (hu et al ., 2008) and hbc3 similar to the reovirus - induced g2/m cell cycle arrest (poggioli et al ., 2000 after tumor cells were grown in culture and then injected as xenografts into mice (eight mice / sample), tumors developed and all these mice died in less than 8 days (preliminary data). When 0.1 ml of btvs with different mois in sterile phosphate - buffered saline (pbs) was injected at three different sites of each xenograft, the sizes of tumors in mice were reduced 6085% . Most mice with the reduced tumors survived more than 35 days before they were sacrificed for tissue and organ samples (kidney, lung, liver, heart . Etc . Thus, btvs selective cytotoxic effects to human tumor cells in vitro and partially in vivo have been clearly indicated and demonstrated . Further in vivo research and clinical studies are now in progress to document and investigate this unique oncolyitc potential of btvs which will provide us better and safer application in humans either in monotherapy or combination therapy in the near future . Bluetongue viruses administration has been shown to cause cell death and apoptosis in several cell lines as well as in several human tumor cell lines (wechsler and mcholland, 1998; xiao et al ., 2004; liang et al ., 2006; hu et al ., 2008). However, in experiments with cultured human cancer cells, the cells detached and died progressively throughout btv infection . All btv genes are transcribed and btv proteins are expressed during infection . In the analysis of secreted analyte expression, cytokine and chemokine levels from mock- and btv-17 infected cells were determined using multiplex immunoassay kits and reagents supplied from quansys biosciences (logan, ut, usa), according to the supplier's protocol . Twenty - five analytes were tested and these included il-1a, il-1b, il-2, il-4, il-5, il-6, il-8, il-10, il-12p40, il-12p70, il-13, ifn, tnf, tnf, tgf - b1, mcp-1, rantes, ang2, hgf, timp, tpo, vegf, pdgf, fgf - basic, and crp (manuscript in preparation). Of the 25 analytes tested for during infection, only seven were found to be expressed from five cell lines: a498 human kidney cells, hep - g2 human liver cells, a549 human lung epithelial cells (atcc: htb-4, hb-8065, ccl-185, respectively), bhk-21 cells, or vero cells . Of these seven analytes, five were found to be consistently elevated upon btv infection, with the expression pattern consistent among cell lines . These are il-6, il-8, mcp-1, rantes, and fgf. The levels of vegf and timp were similar in control and btv - infected cells . However, a498 kidney cells responded to infection with the greatest secretion of cytokines, followed by a549 lung cells while hep - g2 liver cells secreted the least amount of cytokines . Polyinosine: polycytosine (poly i: c) is a synthetic ds - rna that has been used to assess the role of ds - rna segments of many ds - rna viruses in vitro since it can induce differential interferon and cytokine production (der et al ., 1998;, 2003; chiang et al ., 2006). However, poly i: c alone did not cause cell death or have a significant impact on cytokine or chemokine expression in btv - infected human cancer cell lines . Only il-6 and il-8 were found to be significantly elevated during poly i: c treatment . Increases in il-6 and il-8 were observed only in kidney cells (a498 and vero) and were most prevalent in samples treated with 1 g / ml the other cytokines mcp-1, rantes, and fgf were all at expression levels comparable to the placebo treated cells . With the identification of some of the antigenic epitopes of various btv proteins (wang et al . Gould et al ., 1988a, 1994; grieder and schultz, 1989; geysen, 1990; li and yang, 1990, 1992; marshall and roy, 1990; mecham and jochim, 1990; eaton et al ., 1991; rossitto and maclachlan, 1992; du plessis et al ., 1994, 1995;, 1997; nagesha et al ., 2001), btv immunity has only been studied partially in the last two decades because of lack of supporting funding and reliable immune assays (jeggo and wardley, 1982a, b; gibbs et al ., 1983; jeggo et al ., 1983; campbell and grubman, 1985; stott et al ., 1985; fukusho et al ., 1987a; marshall and roy, 1990; martyn et al ., 1991;; lin and zhou, 1996; wade - evans et al ., 1996; odeon et al ., 1999; prasad and minakshi, 1999; demaula et al ., 2000; roy, 2003). With the recent development of more reliable immune assays and microarrays, we have found that btv can induce inflammatory cytokine expression in immortalized human kidney, lung, and liver cells and subsequently kill the infected cell with cell line - dependent severity . Analysis of results from the cytokine profiles and expression levels in these five cell lines indicated that human tumor cells and tumor reduction might be a result of the combined effects of direct viral induced cell death and recruitment of t - lymphocytes (jeggo and wardley, 1982a, b; jones et al ., 1996, 1997) to the tumor through elevated cytokine / chemokine production (shmulevitz et al ., 2005, 2010). Very high levels of pro - inflammatory cytokines were secreted from btv - infected cells and cytokine levels secreted from each of the seven cell types were directly proportional to the measured death of infected cells . Thus, we hypothesize that the cell death and cytokine expression are related and may be caused by shared signaling pathways or events . If these same events occurred in human tumors, btv would be expected to reduce tumor size in infected patients by directly causing infected human cancer cell death and by inducing cytokine expression from the tumor that would lead to lymphocyte recruitment to the site of the tumor . Thus, btv has the therapeutic potential in cancer because of its selective ability to cause preferential apoptosis of various human cancer cell lines and tumors . Ideal oncolytic viruses should have essential survival data, systemic effect, resist immune system clearance, targeted delivery, and distribution, be highly mobile for intravenous spread, travel to and kill distant metastases, have a high rate of replication to stay ahead of immune system clearance, tolerable toxicity, and side effects, etc . Systemic delivery makes sense in cancer where primary tumors and metastases are dispersed . However, systemic approach in cancer is a big problem because we do not have a good target specific delivery device that would facilitate uptake specifically for certain cells . If this can be achieved, then it would be better than the current and conventional therapies . However, it is very difficult to get enough control patients in clinical trials and to get biopsies from different tissues, organs and tumors after the oncolytic virus treatments to determine the efficacy or survival of most oncolytic viruses . Oncovirologists consider oncolytic virus as a dark horse treatment but not a dead one since they know that many anti - cancer agents appear to be actively effective in lab cultures and animal models but failed in human trials . Many oncolytic viruses (norman and lee, 2005; alain et al ., 2006, 2007; kim et al ., 2006; shen and nemunaitis, 2006; burroughs et al ., 2007; qi et al ., 2007, 2009; ou and yen, 2010) that are currently in phase i / ii / iii human clinical trial status include adenovirus, vaccinia virus, coxsackie virus, reovirus, newcastle disease virus, herpes simplex virus 1, measles virus, and seneca valley virus (burroughs et al ., 2007). In 2007, the only oncolytic virus approved for phase iii clinical trials in china was the adenovirus (h101) with e1b deletion produced jointly by the sunway biotech of china and onyx pharmaceuticals of emeryville, ca, usa (privilege communication). Since mid-2005 to the end of 2010, several other oncolytic viruses have also been approved for phase iii clinical trials primarily outside us as briefly described below . Thus, cancer therapy with oncolytic viruses has survived and revived, and this unique approach is poised for a comeback (aghi and martuza, 2005; norman and lee, 2005; alain et al . The results of the last 1015 years of investigation generated by researchers have increased interest in oncolytic viruses . Investigators have generated and obtained some genetically modified viruses with greater oncolytic potentials (aghi and martuza, 2005; norman and lee, 2005; alain et al . A significant effort is underway to understand the genetic and mechanistic basis of cancers, selective degradation of cancer cells by these oncolytic viruses, and their effects on downstream cellular events and pathways (strong et al . Vorburger et al ., 2004; aghi and martuza, 2005; norman and lee, 2005; shmulevitz et al ., 2005, 2010; alain et al ., 2006; liu, 2006; kim et al ., 2007; liu et al ., 2007; 2009; hill and lee, 2010; ou and yen, 2010; thirukkumaran et al ., 2010). Increasing attention is being paid to protein families like proteases, caspases, and kinases which play critical roles in cancer . Current therapeutic approaches for human cancer include the regimen of selective surgery, high dose but cytotoxic chemotherapy with two to three drugs and radiation . These approaches are not very effective to combat the increasing numbers of human cancers . Using oncolytic viruses generates a paradigm shift from current cancer treatment using chemotherapy and radiation which typically destroy both normal and cancer tumor cells . As we learn more about cancer biology and oncolytic viruses, new strategies for treating cancers are rapidly evolving . Uses of oncolytic virus alone or with synergistic anti - cancer drugs or irradiation in human clinical trials are currently under consideration or in progress . Reovirus leads the field of oncolytic viruses and positive clinical trials are very encouraging (strong et al ., 1998; norman et al ., 2004; norman and lee, 2005; shmulevitz et al ., 2005, 2010; alain et al ., 2006; kim et al . 2009; hill and lee, 2010; thirukkumaran et al ., 2010). Other companies and institutes are not far behind . In mid - may 2010, researchers of the university of helsinki and oncos therapeutics have treated 200 patients with their modified gmcsf armed oncolytic adenovirus which exhibited anti - tumor immunity that recruited natural killer cells and induced tumor - specific cytotoxic t - cells with strong efficacy and safety . The media report indicated that its clinical benefit is about 45% according to the recist criteria with no grade four to five side effects detected . This represents an extension of their initial investigation in 2008 . With these successful applications and those from other oncolytic viruses, we can now add the simple but oncolytic btv as a key component to the armamentarium of oncologists to combat and destroy the insidious cancer cells since btvs have similar characteristics and additional subtle advantages over reovirus and other oncolytic viruses . Bluetongue viruses and reovirus are more advantageous than the genetically modified oncolytic dna viruses since the integration of viral ds - rna genome into the host cell genome have not been shown or reported . Since humans are sero - negative to btvs, potential future use of btv to degrade human cancer by direct intratumoral injection to degrade the injected tumors will not be inhibited by pre - existing immune components within human cancer cells . . The current mechanisms of oncolytic reovirus toward human cancer cells have recently been summarized (strong et al ., 1998; norman et al ., 2004; norman and lee, 2005; shmulevitz et al ., 2005, 2010; alain et al ., 2006; kim et al ., 2009; hill and lee, 2010; thirukkumaran et al ., 2010). Genetically modified reovirus serotype 3, but not types 1 and 2, is a proprietary product called reolysin produced by reolytics biotech, inc . Data for cancer treatment with this agent from the last decade in animal models and lately in phase i / ii human clinical trials have shown encouraging indications of its potential oncolytic activities in cancer cells bearing an activated ras pathway . Phase iii human clinical trials have been approved and initiated in 2009 . However, the pre - existing anti - reovirus sera in humans worldwide can trigger greater immune responses against this virus, reducing its efficacy and effectively shutting down its potential oncolytic treatment . Uses of oncolytic btv have greater advantages over reovirus since no anti - btv serum is detected in most people globally . Even though btv injected into tumors can activate dendritic cells for early detection of viral infection, it will take 1014 days before adaptive immune responses can be generated against btvs which can eradicate xenografted tumor cells in mice in less than 10 days (preliminary data). Oncolytics biotech at calgary, ab, canada showed the uses of reovirus (reolysin) plus cisplatin, a standard chemotherapy agent in both cultured melanoma cells and a mouse model . The combined uses of reolysin and cisplatin were much better than either of these two agents alone since they appeared to work synergistically (abstract of the 4th international symposium on the treatment of cancers with oncolytic viruses at scottsdale, arizona march 1517, 2007). Furthermore, they had also showed that simultaneous and combined uses of reolysin and gemcitabine could completely eradicate the transplanted colon cancer in four of the five mice (abstract of the american association for cancer research (aacr) annual meeting in april 2007). Since mid - april, 2007, oncolytics biotech has demonstrated some success in multiple phase ii trials with several medical centers in the uk and us, administering intravenous reolysin to patients with sarcomas that have metastasized to the lung . Multiple clinical trials for other tumors with the us national cancer institute (nci) were conducted in late 2007 . This will help to determine whether reolysin can migrate systemically to metastasized tumor sites and exhibit its oncolytic activity . Oncolytics biotech has expended more than 65 million dollars and a decade of genetic modifications of reolysin before human clinical trials were approved . Similar and greater expenditures have also been made by other companies and institutes in the last 1215 years to develop different oncolytic viruses with tremendous personnel efforts before some clinical trials are approved and conducted . We strongly believe that btv is the front runner of the next generation oncolytic viruses since it needs no genetic modifications and attenuation, and carries no payloads . It can grow fast and spread easily within many human cancer cells . Since there is no pre - existing neutralizing antibody against btv in humans, they should be undetected nor immunologically inhibited in the initial injection alone or with anti - cancer agents . In addition to the comparison of the oncolysis of human cancer cells by reovirus and btv as shown in table 2, btv has additional advantages . Briefly: since btv does not infect normal human cells, we do not have to suppress the immune system before use btv is very stable since it can be stored at ph 8.28.4 at 4c for over 20 years with only 510% loss of infectivity (unpublished data). Thus, it can be shipped by air - mail globally without significant loss of its infectivity and oncolytic activities (unpublished data). 2-d gel electrophoresis and the 3-d assay (lam et al ., 2007) for the measurement of btv - induced oncolysis are currently under optimization and further development and adaptation . Btv infection of many cultured human tumor cells has led to the production of many inflammatory cytokines such as tnf - alpha and il-6 which strongly activate the kinase activity of p38 mapk and erk1/2 . These cytokines also assist the subsequent activation of p38-dependent mapk and pkr pathways which can bring about the necrosis and apoptosis of cancer cells . This strongly suggests that btv can prime and direct the immune system of cancer patients against certain solid tumors such as breast and prostate cancer . Repeat screening of over 500 human cytokines using biotin label - based cytokine antibody array is currently in progress and data are under comparative analysis . Construction and rescue of recombinant infectious btv (boyce and roy, 2007) expressing the enhanced green fluorescent protein (egfp), using a protocol similar to one recently published by our lab for human parainfluenza virus type 3 (roth et al . Comparison of oncolytic reovirus and bluetongue virus . * reovirus references: strong et al . An activated ras / ralgef / p38 pathway is potentially involved with the permissiveness of host cells to reovirus infection (norman et al ., 2004; shmulevitz et al ., 2005; alain et al ., 2007; kim et al ., 2007; marcato et al ., 2007). It has been shown that the c - k - ras gene inside the lung carcinoma cell line a549 we used has mutation at codon 12 (valenzuela and groffen, 1986). Since the ras / ralgef / p38 signal pathway inside the a549 cell has been activated, this might allow btv to degrade human tumor cells efficiently similar to reovirus (stott et al ., 1985; shmulevitz et al ., 2005, 2010; kim et al ., 2007; marcato et al ., 2007 we have further hypothesized that the genetic alterations / mutations of different human cancer cells, such as signals within a ras - activated pathway, play a key role in the susceptibility of different oncolytic viruses in addition to specific viral receptors which might be present in human cancer cells but not in normal human cells . Identification of btv receptor(s) on the surface of human cancer cells is also currently in progress . Comparison of oncolytic potentials between reovirus and btv is summarized in table 2 . With regard to the potential cytotoxic effect mechanisms of btvs, the gp5 protein of btv identified by our lab (li and yang, 1992; yang and li, 1992, 1993; yang et al ., 1992a) has recently been shown to induce or trigger apoptosis in mammalian cells (mortola et al ., 2004). Furthermore, the non - structural btv protein, ns-3, has been shown to be a viroporin, the polymerization of which forms pores on the surface of btv - infected cells, leading to severe cellular leakage, and potential cell death (han and harty, 2004). We hypothesize that these two btv proteins and other(s) are involved with the cytotoxic effect of human cancer cells after btv infection . Individual btv gene silencing with rnai to determine the contribution of each of the btv gene products to onclysis of human cancer cells are also in progress . The protein toll (means weird in german) was discovered in the fruit fly drosophila melanogaster in 1980s . However, if mutations in toll occurred in the fruit fly, the infection by aspergillus fumigates (a fungus) is lethal . Toll - related molecules involved with human innate immunity and coined as toll - like receptors (tlrs) were then discovered in mid-1990s by ruslan medzhitov and charles janeway (medzhitov and janeway, 2002; norman et al ., 2004). Tlrs are molecular pattern recognition receptors and can recognize molecules that are broadly shared by many pathogens . Thus, tlrs pathways play a key role in both innate immunity and normal immune physiology that can sense different pathogens and cancer cells . To determine whether mutated tlrs are involved with the recognition of btvs, we have initiated the silencing of each 1 of the 10 known human tlrs tlr- 110 using rnai . Human cancer cell lines, a498 and hek 239, are transfected with dna plasmids containing sirna sequences against human tlrs (invivogen, ca, usa). Preliminary data indicated that endosome - located tlr-3 which specifically recognizes ds - rna is potentially involved since cells transfected with this tlr-3 rnai plasmid produced substantially less btv 17 and 10 progeny . Cells transfected with tlr-2, 4, 7, 8, and 9 rnai plasmids produced slightly less viral progeny in these two human cancer cell lines . Experiments are now underway to determine what types of mutation are in the tlr-3 in these four human cancer cell lines and this might provide a potential explanation of why normal human cells are not infected by btv because the regular tlr-3 has not been modified nor mutated . Several signal pathways related to tlrs are currently under screening using pathway screen arrays (qiagen / sabiosciences). The protein toll (means weird in german) was discovered in the fruit fly drosophila melanogaster in 1980s . However, if mutations in toll occurred in the fruit fly, the infection by aspergillus fumigates (a fungus) is lethal . Toll - related molecules involved with human innate immunity and coined as toll - like receptors (tlrs) were then discovered in mid-1990s by ruslan medzhitov and charles janeway (medzhitov and janeway, 2002; norman et al ., 2004). Tlrs are molecular pattern recognition receptors and can recognize molecules that are broadly shared by many pathogens . Thus, tlrs pathways play a key role in both innate immunity and normal immune physiology that can sense different pathogens and cancer cells . To determine whether mutated tlrs are involved with the recognition of btvs, we have initiated the silencing of each 1 of the 10 known human tlrs tlr- 110 using rnai . Human cancer cell lines, a498 and hek 239, are transfected with dna plasmids containing sirna sequences against human tlrs (invivogen, ca, usa). Preliminary data indicated that endosome - located tlr-3 which specifically recognizes ds - rna is potentially involved since cells transfected with this tlr-3 rnai plasmid produced substantially less btv 17 and 10 progeny . Cells transfected with tlr-2, 4, 7, 8, and 9 rnai plasmids produced slightly less viral progeny in these two human cancer cell lines . Experiments are now underway to determine what types of mutation are in the tlr-3 in these four human cancer cell lines and this might provide a potential explanation of why normal human cells are not infected by btv because the regular tlr-3 has not been modified nor mutated . Several signal pathways related to tlrs are currently under screening using pathway screen arrays (qiagen / sabiosciences). Human cancers can be divided into two major types, 90 and 10% of which are solid (carcinoma and sarcoma) or liquid (leukemia) tumors, respectively . Recent data and epidemiological analysis of many tumors reveal that most fda - approved cancer therapeutic drugs can only provide small incremental improvement and survival to cancer patients . Companies that make many unrealistic claims for human cancer cures in scientific tabloid media do so strictly for financial reasons since these expensive cancer drugs can generate great revenues via physicians who make drug recommendation and to whom drug companies provide substantial and financial however, the 90% of deaths of cancer patients are primarily caused by those cancer stem cells that have metastasized to other regions to form metastatic tumors . Humans are sero - negative toward btvs since btvs do not infect normal human cells . Infection and selective degradation of several human cancer cell lines, but not normal cells, in vitro by five us btv serotypes have been investigated by our lab for the last few years when btv oncolytic potential was discovered . We have also recently found that direct single injection of oncolytic btv into the human tumor xenografts in mice, have led to cytotoxic destruction and preferential lysis of cancer cells within the xenograft but not in normal healthy human or mouse cells (preliminary data). Thus, oncolytic btvs are safer and more effective than most current cancer treatments . However, we believe that oncolytic btv is not a stand - alone therapeutic and that simultaneous combination of btv with either radiation or chemotherapy can obliterate the tumors more rapidly and extensively . Cancer patients should have fewer side effects since small dosage radiation and anti - cancer drugs are used for this combined treatment . Related to the oncolytic btvs, the following questions have been frequently asked: is widely curing cancer by oncolytic viruses possible or just hype? Big is the gap between in vitro / in vivo studies and human application? Is oncolytic btv a vital alternative for cancer therapy? What are the pathways btv used to carry out this task? Overall, we believe that the oncolytic ability of btv represents a significant potential to selectively degrade human cancer cells alone and would even be greater when combined with simultaneous anti - cancer drug and radiation treatment . Our group and collaborators are currently engaged in several types of investigations with these goals: (1) study the mechanistic basis of lung, kidney, and liver cancer destruction by btvs, (2) examine and determine biological profiles of three types of solid tumors after btv infection, (3) correlate the responses of these human cancer cells to changes at the cellular dna, rna and protein level, and (4) construction and rescue of an infectious recombinant btv 17 expressing the enhanced egfp using the method that we have developed for the human parainfluenza virus type 3 (roth et al ., 2010) with btv ds - rna fragments (kowalik et al ., 1990b; boyce and roy, 2007), the success of which can further reveal the oncolytic pathways used by btvs . Taking the next step in the investigation of btv oncolysis is very challenging since no one can individually excel in all the technical, scientific, and clinical avenues involved in this endeavor . Our ongoing in vitro work with different human cancer cell lines will assist us in elucidating the potential mechanisms of the btv oncolytic activities . No cpe was detected nor viral progeny obtained when several primary human cell lines were infected by btv . When xenografts implanted in mice were injected directly with btv, no pathological damages were detected in any tissue or organs 721 days post - infection (preliminary data). Thus, the potential risks of btv oncotherapy is substantially lower than risks associated with other oncolytic viruses . However, this author sincerely hopes that expert advice and suggestions will be forthcoming from different champions after they have read this brief review . The author declares that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
In the last few years, improvements in the endourological armamentarium together with the downsizing of flexible ureteroscopes, the advent of digital technology, and the increasing number of requests for minimally invasive procedures have made the use of flexible ureteroscopy (furs) for renal calculi increasingly attractive, even for stones larger than 2 cm in diameter including the most difficult clinical scenarios . Recently, roboflex avicenna, a new robotic system, has been introduced for assisting furs, showing good outcomes in terms of stone free rate (sfr) and safety, with significant improvements in ergonomics . To date, no information exists about the learning curve of roboflex avicenna compared to furs without the robotic device . It has been demonstrated that surgeons can become familiar with a specific surgical procedure and improve their skills through simulators by repetitive training in a stress - free environment . Recently, it has been showed that a new simulator for ureteroscopy, the kidney - box (k - box, porgs - coloplast), represents a valid training model for initiate medical students to flexible ureteroscopy . The aim of this study was to evaluate the acquisition of basic ureteroscopy skills with and without roboflex avicenna by subjects with no prior surgical training, using the k - box simulator . Ten 5-year medical students were voluntarily recruited from pierre and marie curie university of paris . Subjects were randomized in block fashion to include 5 medical students in each group; group 1 was trained with avicenna roboflex and group 2 with a standard flexible ureteroscope . The flexible ureteroscope used in both groups was urf - v2 (olympus) and the simulator for training the students was the k - box (porgs - coloplast). All the exercises were assessed with the boxes closed (non - transparent simulators). Under supervision of a trained endourological instructor, all students received didactic teaching for 10 lessons in 10 days, at 10 minutes for each session . The instructor was responsible for correcting students mistakes, answering and explaining the participants questions and doubts . All participants were evaluated by an experienced surgeon (ot), blinded to the randomization table, through two different exercises in the k - box (figures 1, 2), both aimed to discover the small spheres present in the simulator . While the exercise was done with real time endoscopic vision transmission, the evaluation was performed simultaneously in a separate room in order not to be influenced by the device used . Study s flow diagram . Using an objective structured assessment of technical skills (osats) according to previous evaluations in a simulator model performed by hu et al . And chou et al . All participants were scored on their global ability to perform, or not, the exercises recording their times analyzing the knowledge of the procedure, the instrument handling and the trainees competence . In addition, the participants were evaluated on the quality of their performance, using a 5-point likert rating scale from 1 (poor) to 5 (excellent) exclusively made for endoscopic evaluations . The scale contains the following parameters: respect of the surrounding environment, flow of the operation, orientation, centered vision and stability (table 1). Time to complete the exercise was measured; the students had a 2 minute timeframe to perform each exercise . The rating scale used to assess the quality of students performance statistical analysis was performed with spss version 20.0 (statistical package for the social sciences, spss inc, chicago, il) for mac os x. data extracted from our database was automatically converted into spss . Normality testing (dagostino and pearson test) was performed to determine whether data were sampled from a gaussian distribution . Chi - square and fisher s exact test were used to analyze proportions, as appropriate . Student s t test and the mann - whitney u - test were performed to compare continuous parametric and non - parametric variables, respectively . All the tests were 2-sided and statistically significant difference was considered for p <0.05 . All ten students completed the training . According to the osats evaluation, the global quality of performance was correct in all students . The first exercise was completed only by three out of five of students in group 1 (robotic training) and by four out of five students in group 2 (furs alone). Stability with the scope was significantly more accurate in the first group compared with the second, 4.6 + /- 0.7 (p = 0.02) respectively . There were no differences in timing, flow or orientation between groups . Although not significant, a tendency of respecting the surrounding tissue and maintaining centered vision was observed more in the first group . As for the second exercise, there were no differences between groups in regard of orientation, flow, respecting the surrounding tissue, stability or the ability of maintaining centered vision . Although not significant, the second group had a tendency of performing the exercise faster . Nowadays, the technological advances combined with healthcare and ethic law standards have made urologists explore the use of surgical simulators to overtake the first steps in the learning curve of certain procedures [10, 11]. It is known that untrained medical students, residents and skilled surgeons (even tutors) can become familiar with a specific surgical procedure and efficiently improve their skills through simulation technology by repetitive training in a stress - free environment . Endourology simulators such as virtual reality, cadaveric, artificial models and animal models [11, 12] are being widely and effectively used to master the learning curve of an evolving technology such as furs . It has been published and estimated that a surgeon must perform at least 50 furs to achieve surgical competence . Simulators can actively improve surgeons skills and may possibly accelerate this path . When comparing simulation vs non - simulation furs training, hu et al . Showed in a cohort of 36 medical students, that those participants with previous training experience in transparent and non - transparent models performed objectively better than those without it . The analysis also showed an even better performance in the group with transparent simulators, with all differences being statistically significant . A comparison between virtual reality and animal models reported that after a two month training period, all of their 36 participants evaluated by an objective qualitative scale, acquired adequate skills to perform a basic furs independently of the simulator used . In this study we used the k - box simulator (porgs - coloplast) which is an artificial model made of four different boxes that reproduces all anatomic variability of the upper urinary tract . This is a non - transparent model that permits the trainee to handle the actual ureteroscope while looking at a monitor with real time vision transmission . The k - box has proven to be a valid simulator to learn furs in a prospectively randomized study that compared a non - trained control group with trainees that underwent a ten day practice experience (five days to learn the flexible ureteroscope handling and five more days to practice how to catch and release stones with a nitinol basket). The comparison between groups made by an experienced endourologist with the objective endoscopic skill scale used in this paper (table 1), revealed that all scores obtained by trained students were significantly higher compared to non - trained students . Also, trained students performed the exercises significantly faster than the control group . As for the recent introduction of robotic furs, there is no evidence in the literature about the learning curve of this technique . Also there is no evidence about simulation of neither the newly robotic furs nor comparisons between skills gained comparing robotic and standard furs simulations . We conducted the first prospective randomized trial in the literature comparing the simulation between robotic and standard furs . In our study, ten medical students after ten training sessions were able to acquire good ureteroscopic skills in a simulator model both in robotic and standard furs . The skills were evaluated according the validation tool: objective structured assessment of technical skills for surgical residents (osats) that analyzes the knowledge of the procedure, the instrument handling and the trainees competence . The results demonstrate the rapid acquisition of ureteroscopic skills for trainees with no prior surgical training, and therefore the efficacy of training models in furs . Moreover, no major significant differences were seen between the groups, except for the stability item that was better in the robotic group for the first exercise, although it took the same group longer time to perform the second exercise . These data potentially suggest similar learning curves for robotic and standard furs in a training model that may later maximize the surgeons skills and support the trainers proficiency and excellence . Nevertheless, these results should be considered with caution because our study certainly presents some limitations due to low numbers of students in each group and, consequently, a lack of adequate statistical power; but to our best knowledge, this is the first study that compares the acquisition of endourological skills with and without roboflex avicenna in a simulator model . Further investigation with a wider cohort of participants is needed to establish the real lack of statistical differences in the acquisition of basic ureteroscopic skills with and without robotic furs . According to these preliminary results, the acquisition of basic ureteroscopic skills with and without robotic furs in the k - box simulator, by subjects with no prior surgical training, is similar . Traxer o: consultant for coloplast, rocamed, olympus, lumenis, boston scientific, biohealth, ems . Giusti g: consultant for coloplast, rocamed, olympus, lumenis, boston scientific, karl storz, cook medical.
A 35-year - old male farm - worker presented to the emergency room with alleged history of horse bite to the right forearm about 2 hours prior to presentation while feeding the horse . There was deformity of the forearm with multiple puncture wounds, deep abrasions and small lacerations on the distal - third of the forearm . Copious irrigation with normal saline was done and he was administered anti - tetanus and postexposure rabies prophylaxis . He underwent emergency wound debridement, and the ulna was stabilised with an intra - medullary square nail . He had an uneventful recovery and at three - month follow - up, the fractures had healed radiographically in anatomic alignment . At two - year follow - up, he is doing well, is pain free and has a normal range of motion compared to the contralateral side . Horse bites behave as compound fractures however rabies prophylaxis will be needed and careful observation is needed . Early radical debridement, preliminary skeletal stabilisation, re - debridement and conversion osteosynthesis to plate, and antibiotic prophylaxis were the key to the successful management of our patient . Falls and kicks are common mechanism of injuries in people handling horses [1 - 3]. We present a case of forearm open fracture due to horse bite and its management . A 35-year - old male farm - worker presented to the emergency room with alleged history of horse bite to the right forearm about 2 hours prior to presenting to us . He had recently bought the horse for renting it for marriages and other social and religious functions . On examination, there was deformity of the forearm with multiple puncture wounds, deep abrasions and small lacerations on the distal - third of the forearm . 1(a) and (b)) front and dorsal view of the forearm on presentation showing the bite wounds . He was given 0.5 ml tetanus toxoid and 500 iu tetglob (human tetanus immunoglobulin bp), and received post - exposure rabies prophylaxis with vaxirab (purified duck embryo vaccine for rabies ip). Radiographs revealed fracture of radius and ulna in the mid - shaft region (fig . He was taken to the operating room (or) where careful debridement of the wounds was done under loupe - magnification . The ulna was stabilised with an intra - medullary talwalkar square nail (inor, mumbai, india). Seventy - two hours later, he was taken to the or for re - debridement . The nail in ulna was removed and conversion osteosynthesis using dynamic compression plate and screws for radius and ulna was done (fig . He was changed to oral cephalexin and ciprofloxacin on day 6 which were given till suture removal . He had an uneventful recovery and was discharged from the hospital on the 10th day from injury . The patient, however, sold the horse as he was too scared to keep it . At three - months three - month follow - up radiographs showing fracture healing in anatomic alignment . At two - year follow - up, he is doing well, is pain free and has a normal range of motion compared to the contralateral side . He is able to use his hand for all routine work and has returned to his work in the farm . In horse - related accidents, the majority of injuries occur when the person falls from a horse [1 - 3]. Blow by a horse, getting struck by an object while riding a horse, being kicked by a horse, the horse falling on the patient, being entangled by reins, and being bitten by a horse are other less common horse - related accidents . Most people bitten by horses do not seek medical advice as most bite injuries are minor and self - treated or do not require admission to hospital . Thomas et al in their study estimated that 102,900 people are treated yearly in emergency rooms in the us due to nonfatal horse related injuries, and about 1800 patients are treated each year after horse bites . Our patient was too frightened to keep the horse and risk another bite, and hence, sold it not caring for the implications of financial loss . Domestic animals at home differ between societies, and therefore, local traditions affect the epidemiology of animal - related injuries . Comparing animal bite wounds, cat bites result in punctured deep wounds, dog bites cause rather superficial abrasion and laceration type wounds; because of the great deal of force exerted by an equine in closing its jaws, in horse and donkey bites, the severity of injuries may range from mild superficial pressure trauma, cutaneous breaks of the skin, deep lacerations with loss of tissue, to amputations of digits and even the nose . Peel et al reported a case of fracture of the forearm bones following horse bite that was treated with open reduction and internal fixation primarily . He sustained repeated infections with purulent wound discharge from which mixed cultures of bacteria, including staphylococcus aureus, prevotella melaninogenica, escherichia coli, and pasteurella multocida were isolated . More than 3 months after the initial attack by the horse actinobacillus suis was isolated by bone biopsy specimen . Though the acute trauma is readily apparent from a biting event, there is also the risk of exposure to various microbes in the oral secretions of equines . Transmission of such agents with zoonotic potential can also occur from the non - bite exposures to the oral and respiratory secretions . Because of the large number of bacteria in the mouth, animal bite wounds are generally contaminated and their treatment is difficult, particularly in extensive lesions . The occurrence of bacterial infection after animal bites depends on several factors, such as species of animal aggressors (humans would be associated with a higher infection risk), type and site of the injuries (wounds located in hands have a higher infection risk), care given to the wound, inherent factors in the individual (greater risk in elderly, those with diabetes mellitus, vascular disease, etc). In relation to wound type, puncture wounds have been reported to have a higher infection rate after animal bites, possibly due to the deposition of bacteria deep in the skin . There is evidence that the use of antibiotic prophylactic after bites of the hand reduces infection . Horse bites most commonly lead to infections with burkholderia, streptococcus, staphylococcus, rhodococcus, actinobacillus, yersinia, and pasteurella, escherichia, neisseria, prevotella, pseudomonas, listeria, hendra virus, vesicular stomatitis virus species . Bites, kicks or strikes, animal contact and cutting or scratching were the most frequent mechanisms of injury reported . Nearly 20% of reported horse - related injuries, 14% of cattle and cats and 11% of dog - related injuries resulted in admission . Brouwer et al reported a case of streptococcus equi meningitis complicated by brain abscesses, as a result of a horse bite . Kse et al performed a retrospective evaluation of 24 patients presenting with animal bites (19 horse and 5 donkey bites). The head and neck were the most frequent bite sites (14 cases), followed by the extremities (eight cases) and the trunk (two cases). Our primary aim was damage - control to aggressively debride and at the same time give stability to the limb for wound dressings . Preliminary stabilisation of the forearm by an intramedullary talwalkar square nail (inor, mumbai, india) in the ulna was done following debridement of the wounds and excision of devitalised tissues . Fixing the ulna with a nail also helped in maintaining forearm length . Re - debridement at 72 hours, showed no features of infection and decision of internal fixation with plate and screws was taken . We also wish to highlight to the journal reader community that putting in implants when there is any doubt of contamination is risking long term bone infection and other associated complications of delay - in - union and non - union with compromised hand function . Intra - medullary nail was preferred over external fixator in this case, though in fractures with severe soft tissue damage the use of external fixator is indicated . The problems of using external fixation in the forearm include: pin - track - infection, nerve damage due to insufficient anatomical exposure and a relatively high rate of non - union . Conversion osteosynthesis to internal fixation after primary external fixation is associated with high rates of osteomyelitis . Plating is established as the standard method in the operative treatment of forearm fractures in adults . We successfully converted the fixation from intra - medullary nail to plating with no incidence of infection or delay - in - union . Therefore, it makes sense to debride wounds which have necrotic tissue early rather than later . Considering the most common complication of zoonotic infection related to animal bite injuries, our successful surgical treatment without complication appears to have definite clinical relevance . The systematic treatment protocol of early radical debridement, preliminary skeletal stabilisation, re - debridement and conversion osteosynthesis to plate, and antibiotic prophylaxis were the key to the successful management of our patient . Horse or other animal bites are uncommon injuries . The management of these cases should be staged with the principles of damage control and infection control taking precedence . Through this publication we wish to highlight these rare injuries in the orthopaedic community and the journal readers.
Other exclusion criteria were history or clinical evidence of coronary or valvular heart disease, congestive heart failure, hyperlipidemia, peripheral vascular disease, chronic gastrointestinal diseases associated with malabsorption, chronic pancreatitis, history of any malignant disease, history of alcohol or drug abuse, liver or kidney failure, and treatments able to modify glucose metabolism . After 12-h fasting, a 75-g ogtt was performed with 0-, 30-, 60-, 90-, and 120-min sampling for plasma glucose and insulin . Glucose tolerance status was defined on the basis of ogtt using the world health organization (who) criteria . Insulin sensitivity was evaluated using the matsuda index (insulin sensitivity index [isi]), calculated as follows: 10,000/square root of [fasting glucose (millimoles per liter) fasting insulin (milliunits per liter)] [mean glucose mean insulin during ogtt]. The matsuda index is strongly related to euglycemic - hyperinsulinemic clamp, which represents the gold standard test for measuring insulin sensitivity (13). The ethics committee approved the protocol, and informed written consent was obtained from all participants . All of the investigations were performed in accordance with the principles of the declaration of helsinki . Readings of clinic blood pressure were obtained in the left arm of the supine patients, after 5 min of quiet rest, with a mercury sphygmomanometer . A minimum of three blood pressure readings were taken on three separate occasions at least 2 weeks apart . Systolic blood pressure (sbp) and diastolic blood pressure (dbp) were recorded at the first appearance (phase i) and the disappearance (phase v) of korotkoff sounds . Baseline blood pressure values were the average of the last two of the three consecutive measurements obtained at intervals of 3 min . Patients with a clinic sbp> 140 mmhg and/or dbp> 90 mmhg were defined as hypertensive . Plasma glucose was measured by the glucose oxidation method (beckman glucose analyzer ii; beckman instruments, milan, italy). Triglyceride and total, ldl, and hdl cholesterol concentrations were measured by enzymatic methods (roche diagnostics, mannheim, germany). Plasma insulin concentration was determined by a chemiluminescence - based assay (roche diagnostics). Tracings were taken with the patient in a partial left decubitus position, using a vivid 7 pro ultrasound machine (ge technologies, milwaukee, wi) with an annular phased array 2.5-mhz transducer . Echocardiographic readings were made in random order by the investigator, who had no knowledge of patients blood pressure or other clinical data . The mean values from at least five measurements of each parameter for each patient were computed . Having the same experienced sonographer perform all studies in a dimly lit and quiet room optimized the reproducibility of measurements . Subjects with a left ventricular ejection fraction <50% were excluded from this study . In our laboratory, the intraobserver coefficients of variation were 3.85% for posterior wall thickness, 3.7% for interventricular septal thickness, 1.5% for left ventricular internal diameter, and 5.1% for left ventricular mass (lvm). Tracings were recorded under two - dimensional guidance, and m - mode measurements were taken at the tip of the mitral valve or just below . Measurements of interventricular septal thickness, posterior wall thickness, and left ventricular internal diameter were made at end diastole and end systole, as recommended by the american society of echocardiography (14). Lvm was calculated using the devereux formula and normalized by body surface area (lvmi). Left ventricular diastolic function was evaluated according to diagnostic criteria proposed by the american society of echocardiography (15). Evaluation of left atrium volume was obtained using the apical four - chamber and two - chamber views . Pulsed doppler transmitral flow velocity profile was obtained from the apical four - chamber view, and the sample volume was positioned at the tip of the mitral valve leaflets . The following parameters were evaluated for diastolic function: peak transvalvular flow velocity in early diastole (e wave), peak transvalvular flow velocity in late diastole (a wave), e - to - a ratio, deceleration time (dt) (time measured between peak e velocity and the point where the deceleration slope of the e velocity crosses the zero baseline), and isovolumic relaxation time (ivrt) (time elapsed between aortic valve closure and mitral valve opening). Pulsed wave tissue doppler imaging (tdi) was performed at the junction of the septal and lateral mitral annulus . Early diastolic (septal e and lateral e) and late diastolic (septal a and lateral a) velocities were recorded; ratio of e - to - e (average) was also calculated . The intraobserver coefficients of variation for measurement of diastolic parameters ranged from 1.8 to 4.1% . Anova for clinical and biological data was performed to test the differences among groups, and the bonferroni post hoc test for multiple comparisons was further performed . Linear regression analysis was performed to relate parameters of diastolic function with the following covariates: age, bmi, sbp, dbp, fasting and 1- and 2-h postload plasma glucose levels, fasting and 1- and 2-h postload insulin, matsuda index, and lvmi . Subsequently, variables reaching statistical significance and sex, as dichotomic value, were inserted in a stepwise multivariate linear regression model to determine the independent predictors of diastolic dysfunction . Correlational analysis was performed for the whole study population and according to different groups of glucose tolerance . All comparisons were performed using the statistical package spss 16.0 for windows (spss, chicago, il). Readings of clinic blood pressure were obtained in the left arm of the supine patients, after 5 min of quiet rest, with a mercury sphygmomanometer . A minimum of three blood pressure readings were taken on three separate occasions at least 2 weeks apart . Systolic blood pressure (sbp) and diastolic blood pressure (dbp) were recorded at the first appearance (phase i) and the disappearance (phase v) of korotkoff sounds . Baseline blood pressure values were the average of the last two of the three consecutive measurements obtained at intervals of 3 min . Patients with a clinic sbp> 140 mmhg and/or dbp> 90 mmhg were defined as hypertensive . Plasma glucose was measured by the glucose oxidation method (beckman glucose analyzer ii; beckman instruments, milan, italy). Triglyceride and total, ldl, and hdl cholesterol concentrations were measured by enzymatic methods (roche diagnostics, mannheim, germany). Plasma insulin concentration was determined by a chemiluminescence - based assay (roche diagnostics). Tracings were taken with the patient in a partial left decubitus position, using a vivid 7 pro ultrasound machine (ge technologies, milwaukee, wi) with an annular phased array 2.5-mhz transducer . Echocardiographic readings were made in random order by the investigator, who had no knowledge of patients blood pressure or other clinical data . The mean values from at least five measurements of each parameter for each patient were computed . Having the same experienced sonographer perform all studies in a dimly lit and quiet room optimized the reproducibility of measurements . Subjects with a left ventricular ejection fraction <50% were excluded from this study . In our laboratory, the intraobserver coefficients of variation were 3.85% for posterior wall thickness, 3.7% for interventricular septal thickness, 1.5% for left ventricular internal diameter, and 5.1% for left ventricular mass (lvm). Tracings were recorded under two - dimensional guidance, and m - mode measurements were taken at the tip of the mitral valve or just below . Measurements of interventricular septal thickness, posterior wall thickness, and left ventricular internal diameter were made at end diastole and end systole, as recommended by the american society of echocardiography (14). Lvm was calculated using the devereux formula and normalized by body surface area (lvmi). Left ventricular diastolic function was evaluated according to diagnostic criteria proposed by the american society of echocardiography (15). Evaluation of left atrium volume was obtained using the apical four - chamber and two - chamber views . Pulsed doppler transmitral flow velocity profile was obtained from the apical four - chamber view, and the sample volume was positioned at the tip of the mitral valve leaflets . The following parameters were evaluated for diastolic function: peak transvalvular flow velocity in early diastole (e wave), peak transvalvular flow velocity in late diastole (a wave), e - to - a ratio, deceleration time (dt) (time measured between peak e velocity and the point where the deceleration slope of the e velocity crosses the zero baseline), and isovolumic relaxation time (ivrt) (time elapsed between aortic valve closure and mitral valve opening). Pulsed wave tissue doppler imaging (tdi) was performed at the junction of the septal and lateral mitral annulus . Early diastolic (septal e and lateral e) and late diastolic (septal a and lateral a) velocities were recorded; ratio of e - to - e (average) was also calculated . The intraobserver coefficients of variation for measurement of diastolic parameters ranged from 1.8 to 4.1% . Tracings were recorded under two - dimensional guidance, and m - mode measurements were taken at the tip of the mitral valve or just below . Measurements of interventricular septal thickness, posterior wall thickness, and left ventricular internal diameter were made at end diastole and end systole, as recommended by the american society of echocardiography (14). Lvm was calculated using the devereux formula and normalized by body surface area (lvmi). Left ventricular diastolic function was evaluated according to diagnostic criteria proposed by the american society of echocardiography (15). Evaluation of left atrium volume was obtained using the apical four - chamber and two - chamber views . Pulsed doppler transmitral flow velocity profile was obtained from the apical four - chamber view, and the sample volume was positioned at the tip of the mitral valve leaflets . The following parameters were evaluated for diastolic function: peak transvalvular flow velocity in early diastole (e wave), peak transvalvular flow velocity in late diastole (a wave), e - to - a ratio, deceleration time (dt) (time measured between peak e velocity and the point where the deceleration slope of the e velocity crosses the zero baseline), and isovolumic relaxation time (ivrt) (time elapsed between aortic valve closure and mitral valve opening). E - to - a ratio between 1 and 2 was defined as normal . Pulsed wave tissue doppler imaging (tdi) was performed at the junction of the septal and lateral mitral annulus . Early diastolic (septal e and lateral e) and late diastolic (septal a and lateral a) velocities were recorded; ratio of e - to - e (average) was also calculated . The intraobserver coefficients of variation for measurement of diastolic parameters ranged from 1.8 to 4.1% . Anova for clinical and biological data was performed to test the differences among groups, and the bonferroni post hoc test for multiple comparisons was further performed . Linear regression analysis was performed to relate parameters of diastolic function with the following covariates: age, bmi, sbp, dbp, fasting and 1- and 2-h postload plasma glucose levels, fasting and 1- and 2-h postload insulin, matsuda index, and lvmi . Subsequently, variables reaching statistical significance and sex, as dichotomic value, were inserted in a stepwise multivariate linear regression model to determine the independent predictors of diastolic dysfunction . Correlational analysis was performed for the whole study population and according to different groups of glucose tolerance . All comparisons were performed using the statistical package spss 16.0 for windows (spss, chicago, il). Of 161 patients examined by ogtt, 120 had normal glucose tolerance (ngt), 26 had igt, and 15 had newly diagnosed t2d . A 1-h postload plasma glucose cutoff point of 155 mg / dl during ogtt was used to stratify ngt subjects into two groups: 90 patients with 1-h postload plasma glucose <155 mg / dl (ngt <155) and 30 individuals with 1-h postload plasma glucose 155 mg / dl (ngt 155). Table 1 shows the demographic, clinical, and biochemical characteristics of the four study groups . Anthropometric, hemodynamic, and biochemical characteristics of the study population according to glucose tolerance data are means sd unless otherwise indicated . There were no significant differences among groups for sex, age, bmi, sbp, dbp, and total cholesterol . From the first to the fourth group, there was a significant increase of triglyceride (p = 0.002) and a significant reduction of hdl cholesterol (p = 0.034). Obviously, a progressive increase of fasting and 1-h and 2-h postload glucose parallels the worsening of glucose tolerance (p <0.0001). Fasting and postload insulin values were higher in the ngt 155 group and igt subjects in comparison with those in the ngt<155 group and diabetic patients, respectively . Echocardiographic parameters for the study population, according to glucose tolerance groups, are reported in table 2 . T2d patients had the highest lvmi value (p = 0.020), and clinically relevant, ngt 155 subjects showed an lvmi value not significantly different from igt patients (p = 0.691) but significantly higher than ngt <155 subjects (p = 0.042). Lvmi and echocardiographic parameters of left ventricular diastolic function according to glucose tolerance data are means sd unless otherwise indicated . It is interesting to note that the left atrium volume and ivrt values significantly increased from the first to the fourth group (p <0.0001) and that ngt 155 subjects showed both parameters significantly higher than ngt <155 subjects (p <0.0001 for left atrium and p = 0.037 for ivrt). Moreover, left atrium dimensions in ngt 155 subjects were similar to those of the igt group and t2d patients; ngt 155 subjects showed an ivrt value similar to that of igt subjects (p = 0.614) and t2d patients (p = 0.120). By contrast, e - to - a ratio significantly decreased from the first to the fourth group (p <0.0001), and it was significantly lower in ngt 155 than in ngt<155 subjects . No significant differences among groups were observed for the dt duration (p = 0.391). E - to - e ratio significantly increased from the first to the fourth group (p <0.044) and in ngt 155 subjects was significantly higher than in ngt <155 subjects (p <0.036) and similar to that of diabetic patients . All remaining tissue doppler parameters were significantly decreased from the first to the fourth group, confirming the progressive impairment of left ventricular diastolic dysfunction from the first to the fourth group of glucose tolerance . It is important to remark that ngt 155 subjects had the same characteristics observed in igt and t2d patients . A linear regression analysis was performed to test the correlation between echocardiographic parameters and different covariates (table 3). One - hour postload glucose was linearly correlated with ivrt (r = 0.426; p <0.0001) and left atrium volume (r = 0.366; p = 0.0001) and inversely correlated with septal e-to - a ratio (r = 0.502; p <0.0001), lateral e (r = 0.427; p <0.0001), septal e (r = 0.389; p <0.0001), lateral e-to - a ratio (r = 0.384; p <0.0001), e - to - e ratio (r = 0.161; p = 0.020), and e - to - a ratio (r = 0.238; p = 0.001). Linear regression analysis (r / p) between diastolic function parameters and different covariates bsa, body surface area; dt, deceleration time . Thus, variables reaching statistical significance and sex, as dichotomic value, were inserted in a stepwise multivariate linear regression model to determine the independent predictors of left ventricular diastolic function parameters (table 4). In the study population, 1-h postload glucose was the first predictor of left atrium volume, ivrt, and dt, explaining 25.6 (p <0.0001), 18.2 (p <0.0001), and 2.9% (p = 0.031) of its variation, respectively . Age, sex, and dbp added another 5.6 (p = 0.001), 3.1 (p = 0.013), and 2.8% (p = 0.032) to explaining left atrium volume, ivrt, and dt, respectively . As for the tissue doppler parameters, we observed that 1-h postload glucose was retained as the first correlated of septal e, septal e-to - aratio, lateral e, and lateral e-to - a ratio, explaining 15.2, 25.2, 18.3, and 14.8% of their variations, respectively . Age and sbp were retained as the independent predictors of e - to - e ratio, explaining 8.3% of its variation . Stepwise multiple regression analysis on diastolic function parameters as dependent variables in the whole study population bsa, body surface area . Echocardiographic parameters for the study population, according to glucose tolerance groups, are reported in table 2 . T2d patients had the highest lvmi value (p = 0.020), and clinically relevant, ngt 155 subjects showed an lvmi value not significantly different from igt patients (p = 0.691) but significantly higher than ngt <155 subjects (p = 0.042). Lvmi and echocardiographic parameters of left ventricular diastolic function according to glucose tolerance data are means sd unless otherwise indicated . It is interesting to note that the left atrium volume and ivrt values significantly increased from the first to the fourth group (p <0.0001) and that ngt 155 subjects showed both parameters significantly higher than ngt <155 subjects (p <0.0001 for left atrium and p = 0.037 for ivrt). Moreover, left atrium dimensions in ngt 155 subjects were similar to those of the igt group and t2d patients; ngt 155 subjects showed an ivrt value similar to that of igt subjects (p = 0.614) and t2d patients (p = 0.120). By contrast, e - to - a ratio significantly decreased from the first to the fourth group (p <0.0001), and it was significantly lower in ngt 155 than in ngt<155 subjects . No significant differences among groups were observed for the dt duration (p = 0.391). E - to - e ratio significantly increased from the first to the fourth group (p <0.044) and in ngt 155 subjects was significantly higher than in ngt <155 subjects (p <0.036) and similar to that of diabetic patients . All remaining tissue doppler parameters were significantly decreased from the first to the fourth group, confirming the progressive impairment of left ventricular diastolic dysfunction from the first to the fourth group of glucose tolerance . It is important to remark that ngt 155 subjects had the same characteristics observed in igt and t2d patients . A linear regression analysis was performed to test the correlation between echocardiographic parameters and different covariates (table 3). One - hour postload glucose was linearly correlated with ivrt (r = 0.426; p <0.0001) and left atrium volume (r = 0.366; p = 0.0001) and inversely correlated with septal e-to - a ratio (r = 0.502; p <0.0001), lateral e (r = 0.427; p <0.0001), septal e (r = 0.389; p <0.0001), lateral e-to - a ratio (r = 0.384; p <0.0001), e - to - e ratio (r = 0.161; p = 0.020), and e - to - a ratio (r = 0.238; p = 0.001). Linear regression analysis (r / p) between diastolic function parameters and different covariates bsa, body surface area; dt, deceleration time . Thus, variables reaching statistical significance and sex, as dichotomic value, were inserted in a stepwise multivariate linear regression model to determine the independent predictors of left ventricular diastolic function parameters (table 4). In the study population, 1-h postload glucose was the first predictor of left atrium volume, ivrt, and dt, explaining 25.6 (p <0.0001), 18.2 (p <0.0001), and 2.9% (p = 0.031) of its variation, respectively . Age, sex, and dbp added another 5.6 (p = 0.001), 3.1 (p = 0.013), and 2.8% (p = 0.032) to explaining left atrium volume, ivrt, and dt, respectively . As for the tissue doppler parameters, we observed that 1-h postload glucose was retained as the first correlated of septal e, septal e-to - aratio, lateral e, and lateral e-to - a ratio, explaining 15.2, 25.2, 18.3, and 14.8% of their variations, respectively . Age and sbp were retained as the independent predictors of e - to - e ratio, explaining 8.3% of its variation . Stepwise multiple regression analysis on diastolic function parameters as dependent variables in the whole study population bsa, body surface area . This study, conducted in a cohort of never - treated and well - characterized hypertensive patients, showed that the worsening of glucose tolerance was associated with an impairment of left ventricular diastolic function . The main finding of this study is that 1-h postload plasma glucose in ngt subjects is associated with left ventricular diastolic dysfunction . This result persists after adjustment for all significant covariates reported in table 3 . Of interest and clinically relevant, ngt 155 subjects had significantly worse diastolic function compared with ngt<155 subjects and similar compared with igt and t2d patients . To our knowledge, this is the first study that demonstrates this association, confirming the usefulness of early diagnosis in the stratification of overall cardiovascular risk; in addition, it highlights the links between early alterations of glucose tolerance and early alterations in cardiac function . There is a consistent body of evidences demonstrating the association between t2d or insulin resistance and diastolic dysfunction, which is recognized as the first stage of diabetic cardiomyopathy that may lead to chronic heart failure, independent of other cardiovascular heart diseases such as hypertension or atherosclerotic ischemic coronary disease (16,17). The development of diabetic cardiomyopathy is likely multifactorial involving several mechanisms including metabolic disturbances, endothelial dysfunction, coronary microvascular impairment, modification in the extracellular matrix, and sympathetic hyperactivity (16,17). All of these factors contribute to the increase of ventricular stiffness, promoting cardiac structure abnormalities such as left ventricular remodeling or hypertrophy . Cardiac fibrosis causes an imbalance between extracellular matrix deposition and degradation within the heart resulting in excessive fibroblast proliferation . In addition, ventricular fibrosis causes progressive stiffening of the ventricular wall resulting in ventricular dysfunction, increase in end diastolic pressure, and atrial dilatation . Some of these effects could be related to chronic hyperglycemia that induces, in diabetic patients, nonenzymatic glycation of circulating and cellular membrane proteins, leading to the formation of advanced glycation end products (ages) and, through protein kinase c activation, to reactive oxygen species production with increased oxidative stress (18). Ages accumulation, in the myocardium and arterial wall, makes irreversible and stable links with collagen polymers, leading to fibrosis development with reduction of ventricular compliance and increase of lvm, as observed in animal models of igt (19). Moreover, under chronic hyperglycemia condition, there is an increased turnover of free fatty acids, with a shift of myocardial metabolism toward the oxidation of the latter, with intracellular accumulation of intermediate products that lead, via increased oxidative stress, to deleterious effects (20). In keeping with this, our results, obtained in ngt 155 subjects, clearly indicate that these modifications begin early, at a clinically silent phase, and support reconsideration of the notion that ngt subjects are a homogeneous group with a low cardiovascular risk profile . The activation of both the renin - angiotensin - aldosterone system and sympathetic nervous system is another important mechanism potentially involved in activation of cardiac fibroblasts and collagen production (21), leading to fibrosis and likely subsequent to the development of diastolic dysfunction . Finally, we should not ignore the role of coronary microcirculation abnormalities that may lead to myocardial cell injury and reactive fibrosis / hypertrophy . Of interest, the impairment of coronary microcirculation, occurring without obstructive atherosclerotic lesions on epicardial coronary arteries, induces a reduction of coronary flow reserve, as demonstrated in type 1 diabetic patients (22) and hypertensive subjects (23). The reduction of coronary flow reserve seems to be a direct consequence of elevated glycemia (24). (25) showing that postprandial hyperglycemia induces myocardial perfusion defects in t2d patients, secondary to deterioration in microvascular function causing a decrease in myocardial blood flow . The most clinically relevant information from this study, is that there is a statistically significant and direct correlation between 1-h postload plasma glucose and diastolic dysfunction in ngt hypertensive patients . Our data have allowed us to identify a new early predictor of subclinical organ damage and emphasize the importance of performing an ogtt in all subjects affected by essential hypertension, paying attention not only to 2- h but also to 1-h postload plasma glucose values, which are more strongly associated with diastolic dysfunction, in order to better stratify the global cardiovascular risk in hypertensive patients.
Malignant salivary gland neoplasms account for <0.5% of all malignancies and approximately 35% of all head and neck cancers . Progress in understanding the cell biology of salivary gland carcinomas (sgcs) and detecting vulnerable molecular pathways may lead to the development of new targeted therapy options in these rare cancers with poor prognosis . Anti - egfr agents include (i) monoclonal antibodies (cetuximab or erbitux, panitumumab) which block the binding of natural egfr ligands like egf or tgf- resulting in inhibition of downstream signal - transduction pathways and (ii) small molecule tyrosine kinase inhibitors (tkis) which act by binding the atp pocket within the kinase domain of the egfr and impairing its catalytic activity (gefitinib, erlotinib, lapatinib). Downstream signaling pathways triggered by egfr include the ras - raf - extracellular signal - regulated kinase / mitogen activated protein kinase (mek / mapk) pathway, which is mainly correlated to cell proliferation, and the p13k - pten - akt axis . Recently, we were able to demonstrate that frequent egfr overexpression and the absence of drug - resistance egfr mutations in sgc plead in favor of further therapeutic trials with egfr - targeting monoclonal antibodies . One of the signaling effectors downstream of egfr, kras, was shown by us to be rarely mutated in sgc [2, 3]. Wildtype kras is one of the clinically proven prerequisites for a successful anti - egfr therapy and therefore anti - egfr monoclonal antibodies are approved only for metastatic colorectal cancer patients whose tumors display wildtype kras . In the absence of kras mutations, resistance to anti - egfr treatments could be caused by alterations of other members of the ras - raf - mapk pathway . Braf (v - raf murine sarcoma viral oncogene homolog b1), a serine / threonine kinase, is the downstream effector of kras in the ras - raf - mapk signaling pathway . A somatic mutation (v600e) in exon 15 of braf has been identified in multiple human cancers with a mutation rate of 66% in malignant melanomas and at lower frequency in other human carcinomas . Recently, it was demonstrated that wildtype braf is required for the response of patients with metastatic colorectal cancer to cetuximab and panitumumab . The aim of this study was to determine the braf v600e mutation frequency in a large cohort of sgcs of the main histopathological types and to design an allele - specific pcr as an effective screening method . Surgically removed, formalin - fixed tumor samples were obtained from 65 patients (35 males and 30 females with a median age at diagnosis of 55 years) treated with the histopathological diagnosis of an sgc according to the who classification . Egfr - targeted therapy was not applied . The study cohort consisted of adenoid cystic carcinoma (n = 25) mucoepidermoid carcinoma (n = 10), myoepithelial carcinoma (n = 8), acinic cell carcinoma (n = 12) and adenocarcinoma ex pleomorphic adenoma (n = 10). Genomic dna was extracted and pooled from oral mucosa samples of five healthy individuals . This pooled dna was used as a normal dna control for the development of the pcr assay . Heterozygous mutant control dna was extracted from cells of the colorectal cancer cell line ht 29 which contains the heterozygous braf v600e mutation . The basis for discrimination using allele - specific pcr is that a pcr primer mismatched at its 3 end with the dna template will react less efficiently than one that is entirely complementary . Our allele - specific multiplex pcr was designed with one common forward (bf) and two separate reverse primers (br and bmu): bf: 5-ctcttcataatgcttgctctgatagg-3, br: 5-agttgagaccttcaatgactttctagt-3, bmu: 5-cccactccatcgagatttct-3. The forward primer bf and the reverse primer br amplify a 273 bp fragment of both mutant and wildtype alleles and thus serve as amplification control . The second reverse primer (bmu) is specific for the mutated allele at the 3 end . This primer together with bf generates an 143 bp product only in the presence of the v600e (gtg> gag) mutation (figure 1(a)). A series of annealing temperatures (52c60c), primer concentrations (0.10.4 mol / l), and mg concentrations (1.53.5 reactions consisted of: 80100 ng genomic dna; 200 mol / l dntp; 0.1 mol / l of primers; 1.5 mmol / l mgcl2; 0.5 u taq polymerase (roche diagnostics, penzberg, germany). Final cycling conditions were as follows: 5 minutes of denaturing at 94c and 30 cycles of 94c for 30 seconds, annealing 55c for 45 seconds and 72c for 60 seconds . A volume of 10 l of the pcr products was electrophoresed on a standard 2.5% agarose gel stained with sybr - green i for visualization under uv light . The allele - specific pcr for the detection of the braf v600e mutation demonstrated high specificity (i.e., detection of only the normal or only the mutant allele), high sensitivity (i.e., no spurious pcr fragments), and acceptable yield . All 65 sgc in this cohort (100%) presented the braf wildtype (95% exact confidence limit 00.07). The 273 bp pcr fragment was always amplified confirming the integrity of the isolated dna from clinical tissue samples (figure 1(a)). To test the sensitivity of the mutation - specific pcr, we made a serial dilution of ht 29 dna (which contains the heterozygous braf v600e mutation), in control dna with wildtype braf . No braf v600e mutation was detected in additionally screened dna samples from microdissected normal tissue adjacent to the tumor cells (5 cases). The activation of the egfr - ras - raf signaling cascade is an important pathway in cancer development and is considered a key pathway for therapeutic molecules . Egfr transmits signals to the nuclei instructing cancer cells to proliferate and metastasize, and kras and braf are those downstream signaling molecules . Anti - egfr therapies interrupt the cancer - triggering signaling cascade, however, if the kras or the braf gene is mutated, their proteins are locked into an active conformation, regardless of whether the egfr is therapeutically blocked . Cetuximab (erbitux) has already been tested in two phase ii studies in patients with recurrent and/or metastatic sgc including mainly acc, a cancer with generally poor outcome . In 50% of patients, clinical benefit (i.e., response or stable disease for 6 month) gefitinib was associated with a 53% stable disease rate (10/19) in acc, but had no effects on patients with salivary duct tumors and mucoepidermoid cancer . Lapatinib, inhibiting erbb1 and erbb2 tyrosine kinases, was studied in a phase ii trial and stabilized disease for greater than 6 months in 47% of acc patients . Key molecules of the egfr - ras - raf signaling cascade and predictive markers of treatment outcome under anti - egfr therapies have not been comprehensively examined in sgc . Investigations of the mutation status of proteins in the cascade downstream of egfr identified markers for egfr - targeted therapy in colorectal cancer . In recent studies, wildtype braf as well as wildtype kras and intact pten pik3ca were found to be required for the response of colorectal cancer patients treated with cetuximab or panitumumab [5, 10, 11]. We were able to demonstrate in this and in a former study that kras and braf mutations seem to be extremely rare in sgc . These findings imply that salivary gland carcinomas which rarely acquire mutations that result in constitutive activation of the signaling cascade downstream of egfr may be good candidates for anti - egfr therapies . Molecular analyses of alternative members of the egfr signaling cascade, such as akt-1 and mek-1, may further contribute to elucidating predictive markers of treatment outcome under anti - egfr therapies in sgc . Because of its universal availability as a standard methodology in molecular medicine, we designed a braf mutation screening assay based on pcr . Allele - specific pcr, also known as amplification refractory mutation system (arms), is a well - established method for discriminating between different alleles at specific loci resulting from single base mutations [12, 13]. We used the methodology to establish an assay with three pcr primers which allows the discrimination of allele - specific pcr fragments by agarose gel electrophoresis without the need of capillary electrophoresis devices . With our assay interpretation of the results can be made by simple visual inspection of the stained gel to determine whether or not a specific primer pair amplified a fragment with the template dna . Because microdissected tumor areas were used for the allele - specific pcr, and a control amplification was incorporated into the pcr reaction to ensure dna integrity, we can exclude false negative results . So far, genomic screening for braf mutations has been based mainly on direct sequencing . Our protocol provides an alternative rapid, sensitive, and cost - effective braf screening method.
Wiskott aldrich syndrome (was) is a monogenic x - linked primary immunodeficiency characterized by the classic triad of microthrombocytopenia, eczema and recurrent infections . Multiple autoimmune manifestations and tumors are serious complications and the life expectancy of was patients is severely reduced, unless they are successfully cured by hematopoietic stem cell transplantation . Was is caused by mutations in the was gene impairing the expression and/or function of the was protein (wasp), a hematopoietic - specific regulator of cytoskeletal reorganization also involved in signal transduction of cells . The absence or reduction of wasp compromises multiple processes of different immune cell types involved in innate and adaptive responses, resulting in a variable and progressive immunodeficiency . Susceptibility of was patients to develop autoimmune diseases has been mainly attributed to the breakdown of self tolerance sustained by dysfunction of both natural t regulatory and effector t cells (reviewed in ref . ). However, b - cell intrinsic defects have been demonstrated to critically contribute to was - associated autoimmunity in was mouse model . In humans, the contribution of b - cell defects in the pathogenesis of was has been partially investigated . B cells from patients exhibit lower motility, migratory and adhesive capacities, likely due to defective f - actin nucleation . In contrast, despite the role of wasp in b - cell receptor (bcr) signaling, abnormalities in b - cell activation still remain controversial . A skewed distribution of serum immunoglobulin (ig) classes and the inability to mount a proper antibody response, particularly to t - cell independent (ti) antigens, suggest defects in b - cell effector function . Previous findings in was patients show phenotypical b - cell perturbations in the periphery . In order to evaluate whether an abnormal b - cell development might generate a b - cell repertoire unable to unsure full protection against pathogens and tolerance against self - antigens, to this end, we have combined a detailed phenotypical analysis of b - cell maturation stages, from the bone marrow (bm) to the periphery, with a molecular study of ig repertoire and in vivo b - cell maturation processes in a large cohort of was pediatric patients . Our data show that wasp - deficiency affects critical stages of central and peripheral b - cell differentiation contributing to abnormalities in humoral immunity and b - cell tolerance in humans . The diagnoses were clinically defined and confirmed by genetic analysis . A description of all patients is reported in supplementary table 1 . Human samples were obtained according to the code of ethics of the world medical association (declaration of helsinki) with the approval of the local medical ethical committees of the erasmus mc and the san raffaele scientific institute internal review board (tiget02). All results obtained from samples of was patients were compared to age and sex matched healthy donors (hds). The composition of the precursor b - cell compartment was analyzed by flow cytometric immunophenotyping as described in the supplementary material . For the analysis of replication history and somatic hypermutation, four b - cell subsets were isolated from thawed peripheral blood mononuclear cells (pbmcs) using a facs diva cell sorter (bd biosciences). Gating on cd19 cells, transitional (cd27cd24cd38), mature nave (cd27igdcd24cd38), natural effector (cd27igd) and memory (cd27igd) b - cell subsets were sorted with a purity of> 95% for all fractions . For intracytoplasmic detection of human wasp, cells were fixed and permeabilized using a cytofix / cytoperm kit (bd pharmingen, oregon, usa). The anti - wasp antibody 503 (a kind gift from prof h. d. ochs, seattle, wa, and l. d. notarangelo, boston, ma) was used, followed by detection with pacific blue - labeled anti - rabbit igg secondary antibody (invitrogen, san diego, usa). Cd20 positive cells were purified from pbmcs of pediatric was patients and age - matched hds by immunomagnetic beads (miltenyi biotec, germany) or facs sorting . The purity of the isolated cells were analyzed by facs and ranged from 84% to 98% . After isolation, cells were left overnight at 37 c in culture medium composed of rpmi-1640, 10% fbs, 2 mm glutamine, 100 iu / ml penicillin and 100 g / ml streptomycin (lonza, basel, switzerland). In vitro chemotaxis assay was performed using 5 m pore - size transwell inserts (costar corporation, corning, ny, us) in 24-well plates . Filters were prewet 30 min at 37 c in presence of 600 l of medium supplemented with 250 ng / ml of recombinant human stromal cell - derived factor (sdf)-1 (cxcl12; peprotech, rocky hill, us). Fifty thousand cd20 positive or negative cells were resuspended in 100 l of culture medium, seeded in the upper chamber and incubated at 37 c for 3 h. transmigrated cells, collected in the lower chamber, were counted for viable cells and stained with anti - cd19, anti - cd24, anti - cd38, anti - cd27 and anti - cd3 (bd biosciences) for the phenotypical analysis by facs . Migration frequency was estimated as the [(cell n at the lower chamber / the initial b cell input in the upper chamber) 100]. Levels of b - cell activating factor (baff) were measured in duplicate in plasma samples of was patients and hds using a quantikine human baff / blys / tnfsf13b immunoassay kit (r&d systems, minneapolis, usa). The assay was performed according to manufacturer's instructions and the od was determined using a microplate reader set to 450 nm . Ig and igh gene rearrangements were amplified and analyzed as described in the supplementary material . Dna was extracted from sorted b - cell subsets with the genelute mammalian total dna miniprep kit (sigma aldrich) and used to perform the ig-deleting recombination excision circles (krec) assay . The amounts of coding and signal joints of the ig-deleting rearrangement were measured by real - time quantitative pcr on an abi prism 7000 sequence detection system (applied biosystems). Ig restriction enzyme - based hot - spot mutation assay (igrehma) was performed on genomic dna isolated from sorted b - cell subsets . Briefly, v3 - 20-j rearrangements were pcr - amplified and the pcr products (500 bp) were first digested using the restriction enzyme fnu4hi and then kpni . The unmutated gene products can be visualized as 244 or 247 bp hex - coupled fragments and the mutated as 262 bp hex - coupled fragment . Comparisons between proportions were calculated by using the chi - square test (test) (with continuity correction). Until now, the composition of the b - cell compartment in the bm of was patients has not been reported . To evaluate the effect of wasp - deficiency on b - cell development in the bm, we characterized five stages of b - cell differentiation in three was patients . We observed a decreased frequency of immature b lymphocytes in was patients (fig . This observation was further assessed in four additional patients, focusing on late stages of b - cell differentiation based on the expression of cd10 and cd20 (gating strategy is shown in suppl . We confirmed a significant decrease in the frequency of immature b cells compared with age - matched hds (fig . In addition, at the earliest differentiation stages, we observed a significant increase of small pre - b - ii cells in was patients; while no statistical difference was detected in large pre - b - ii cell frequency (fig . These findings might reflect a partial block in the bm b - cell differentiation between the small pre - b - ii and immature b - cell stages in was, or an early egress of immature b cells into the periphery . Next we examined the distribution of b - cell subsets in the peripheral blood of was patients and age - matched hds . When available, we evaluated the absolute count of total b cells, which was found significantly reduced in patients less than three years old (<3y), while no differences were observed in the older was group (fig . Four b - cell subsets were identified according to the expression of cd24, cd38, igd and cd27: transitional, mature nave, memory and plasmablasts (fig . Transitional b cells (cd24cd38) are the most immature peripheral b - cell population that were significantly increased in both was age groups as frequency (fig . 2c) and absolute number (suppl . The next maturation stage, represented by mature nave b cells (cd27igdcd24cd38), was significantly decreased only in was patients less than 3 years old both in frequency (fig . Finally, the frequency of plasmablasts (cd24cd38) was significantly increased in the older group of patients (fig . 2c), while the absolute number of both memory b cells (cd27igdcd24cd38) and plasmablasts were significantly decreased in the younger group of was patients (suppl . Altogether, these findings demonstrate that was patients have a perturbed peripheral b - cell distribution . The overrepresentation of transitional b cells in the blood of was patients led us to hypothesize that an early egress of immature b cells from bm could occur . Cxcr4, the chemokine receptor for sdf-1, has an important role in retaining b - cell precursors within the bm in order to prevent premature migration to the periphery [2224]. We tested the chemotactic response to sdf-1 of b lymphocytes of was patients and hds by transwell migration assay . As shown in fig . 3, both transitional and mature peripheral b cells were less responsive to sdf-1 in the absence of wasp (fig . This defect was specific for b lymphocytes since cd3 positive cells of was patients showed a normal migratory capacity to sdf-1 (suppl . Thus, we hypothesize that a diminished retention signal mediated by cxcr4/sdf-1 could explain the premature egress of immature b cells from the bm leading to an increase of transitional b cells in periphery . To further characterize the peripheral b - cell distribution, we focused our analysis on b - cell subsets found expanded in autoimmune diseases and potentially autoreactive [2528]. We found a significant increase of cd19cd21cd35 subset in both was age groups (fig . 4a), confirming data previously reported by park and colleagues . We also analyzed the frequency of cd19cd21cd38 cells (referred to as cd21) described to be expanded in autoimmune diseases and immunodeficiencies . Interestingly, we observed that the frequency of this unusual population was markedly increased in was patients, both in the younger and older groups (fig . In addition, higher levels of soluble baff were found in the plasma of was patients as compared to pediatric hds (fig . This finding was also associated with a decreased expression of its receptor, baffr, in transitional b cells of was patients (fig . Because of the role of baff in b - cell homeostasis and peripheral b - cell tolerance, high baff levels may affect the stringency of peripheral b - cell selection thus favoring the survival of b - cell subsets containing potentially autoreactive clones . In order to evaluate the effect of wasp - deficiency in an antigen dependent context, we analyzed in detail the memory b - cell compartment of was patients . We identified six distinct memory b - cell subsets (gating strategy is shown in suppl . Igm - only) and cd27igg deriving from primary germinal center (gc) responses; igg cd27 and iga cd27 switched memory b cells originating from secondary gc responses; cd27igd (named natural effector) and cd27iga generated in a ti manner in the gastrointestinal tract or in the splenic marginal zone area, respectively . We did not observe differences in memory b - cell populations deriving from both primary and secondary gc responses between was patients and hds (fig . A marked reduction in natural effector b cells was found in both age groups of was patients both as frequency (fig . The frequency of cd27iga b cells was decreased in 312 years old patients compared with hds (fig ., the absence of wasp mainly affects ti responses of b cells, whereas only mildly impairs the generation of early memory b cells in gc without influencing the class - switched memory b - cell compartment . We determined the in vivo b - cell proliferation history by krec assay and in parallel shm by igrehma in sorted transitional, mature nave, natural effector and memory b cells . As expected, transitional b lymphocytes did not undergo cell divisions and mature nave b cells had a limited number of cell divisions in hds (fig . Both b - cell subsets were characterized by the absence of shm (fig . 6b) and we did not find differences in transitional and mature nave b cells of was subjects (fig . In contrast, the memory compartment showed less proliferation in was memory b cells in association with a reduced shm level (fig . Interestingly, the defect in maturation was even more pronounced in natural effector was b lymphocytes . To study shm also in the ig heavy chain (igh), we analyzed the frequency of mutated nucleotides in rearranged variable region of igh (ighv) genes by cloning and sequencing the most frequent ighv subgroups, the ighv3 and ighv4 gene families, of both - and -chain of constant regions (c and c). The mutational frequency of was b cells was significantly lower for both c and c transcripts in all domains of v region (fig . Thus, the decreased in vivo proliferation and shm levels of was memory b cells could be responsible of a lower protection against infections and persistence of pathogens that finally lead to autoimmunity . Was b cells showed an increased frequency of ighv3 - 30 in both ig classes (fig . 7a) and the absence of ighv3 - 48 genes in c sequences (suppl . 7a). In ighv4 transcripts, we noticed a dominant usage of the ighv4 - 34 genes in was c (fig . Moreover, the antibody repertoire of was b cells was devoid of ighv4 - 59, a gene commonly used in b cells from hds . The distribution of d families was only slightly altered in was patients (suppl . Finally, we evaluated the csr process in total b cells by analyzing the frequency of ig subclasses in sequenced igh transcripts . A preferential usage of -chain c region 3 (c3) and c1, igh - proximal genes (the igh locus is schematized in fig . 7d), accompanied by a reduction in the expression of distal c2 and c4, were detected in was patients (fig . The analysis of iga transcripts showed no significant difference in the subclass usage (fig . 7e). In conclusion was patients show a skewed ig gene usage suggesting an altered selection of the antibody repertoire during b - cell development . We reported herein that wasp - deficiency affects many aspects of b - cell development, first in the bm and then in the periphery . Indeed, precursor b - cell as well as memory b - cell development and selection appear affected by the absence of functional wasp . In the bm we have observed a decreased frequency of immature b cells, while in the periphery an overrepresentation of transitional b cells likely due to a reduced retention in the bm and/or a decreased migration to peripheral lymphoid tissues . The interaction of the chemokine receptor cxcr4 with its ligand sdf-1 is required for the retention of developing b cells in the bm . Wasp is actively involved in cxcr4 signaling [3739] and was murine b cells show defective migratory response to sdf-1 . Consistently, here we demonstrate in was patients that b cells migrate less to sdf-1. Thus, was immature b cells could be unable to properly sense retention signals derived from cxcr4 in the bm leading to a premature release in the periphery . The increase of transitional b cells could also reflect an altered migration to the peripheral lymphoid organs resulting in a prolonged persistence in the circulation . Consistently, our data allow us to exclude that the expansion of transitional b cells is due to homeostatic proliferation since we demonstrated the absence of replication history in this subset . Transitional b cells are found expanded in immunodeficient conditions or autoimmune diseases and represent a reservoir of autoreactive b cells . The cohort of patients analyzed here did not show any overt sign of autoimmunity, probably due to their young age . However, the analysis of serum autoantibodies performed in four patients showed positivity for anti - nuclear antibodies in three patients . One of them also showed the presence of anti - platelet antibodies (data not shown). These cells are enriched in anergic autoreactive clones and expanded in systemic lupus erythematosus (sle), rheumatoid arthritis and in common variable immunodeficiency groupia patients developing autoimmune syndromes . Baff levels and signals through baffr coordinate the maintenance of the primary b - cell pool and the fate of self - reactive b cells . Herein, we report for the first time increased baff levels and decreased baffr expression in was patients . Elevated baff serum levels are often present in immunodeficiencies, autoimmune diseases and viral infections and may lower the thresholds for the survival of autoreactive b cell clones . The enrichment of cd21 b cells and the alterations in baff levels and expression of its receptor suggest that the mechanisms of b - cell selection could be altered in was patients . Our data also suggest the presence of a defective selection of was b cells producing high - affinity antibodies . Indeed, we noticed a restricted or null presence of ighv3 - 48 and ighv4 - 59 gene families and a preferential usage of ighv3 - 30 and ighv4 - 34 . In particular, ighv3 - 48 gene is selectively used against polysaccharide antigens and its decrease in was could account for an inefficient antibody response . In contrast, ighv3 - 30 is highly represented among anti - platelet autoantibodies from patients with idiopathic thrombocytopenic purpura and in sle patients . Additionally, ighv4 - 34 encoded antibodies are intrinsically autoreactive when unmutated, as observed in our patients . This peculiar antibody repertoire reflects an altered selection of both protective and autoreactive ig gene families . The perturbation of b - cell homeostasis present in was patients supports the administration of anti - cd20 mab in the conditioning regimen of gene therapy to deplete b cells . In the memory b - cell compartment, the frequency of isotype - switched igg b cells we observed a normal frequency of memory b cells and of switched cd27igg and cd27iga b cells in our cohort of was patients . This suggests that t - cell dependent antigen response is induced normally in was patients . In contrast, the frequency and the shm level of ti memory b - cell subsets were reduced, likely due to their reduced in vivo proliferation . The marked reduction in the natural effector b - cell subset, resembling marginal zone b cells in the spleen, mirrors the decreased number of splenic marginal zone b cells and the histological defects in the marginal zone area of the spleen already described in was mice and patients . In addition, both the reduction in natural effector and igacd27 b cells, which are generated during ti responses, provide evidence of a defect in b - cell function independent from the cross - talk with t lymphocytes . The mutational status of both heavy and light ig chains is reduced in was in presence of a diminished rate of proliferation in the total memory b - cell pool . In addition, the analysis of ig gene selection showed a preferential use of igh - proximal genes (ighg1 and ighg3) accompanied by reduced shm suggesting that was b cells have undergone less gc reactions . Reduced igg2 switching in was patients could account for the poor response to ti antigens which is typical of the syndrome . The cytokine profile of was patients shows an impairment in the production of th1 cytokines that could explain their reduced switching to igg2 subclass . Moreover, the isotype - switching outcome is also influenced by two additional factors: cell division and antibody affinity to antigens . The defective proliferation of memory and natural effector b cells and the reduced affinity maturation found in was might contribute to these alterations in class switching . Our results in was patients show an early egress of immature b cells from bm leading to an overrepresentation of transitional b cells in the periphery . The memory compartment is characterized by a reduced maturation status that could affect the b - cell effector functions contributing to a lower clearance of pathogens and leading to chronic inflammation that can break tolerance . In conclusion, our results add novel immunological features of was b - cell phenotype that can complement the evaluation of the efficacy of various treatment approaches.
The direct nucleophilic substitution of alcohols is of high interest as it provides access to a wide variety of derivatives, with the formation of water as the only by - product . Indeed, the acs green chemistry institute pharmaceutical roundtable identified oh activation for nucleophilic substitutions as a priority area currently used in the preparation of pharmaceutical intermediates that would greatly benefit from the development of better methods.1 unarguably, propargylic substitutions have progressed substantially since the pioneering work of nicholas on octacarbonyldicobalt - stabilised propargylic cations.2 the versatility of the propargylic moiety as a synthon in organic chemistry as well as its occurrence in natural products and synthetic pharmaceuticals have been the main driving forces for these advances . Furthermore, propargylic alcohols are easily prepared from the corresponding aldehydes or ketones by addition of an alkynyl anion . Diverse transition metals,3 such as ruthenium, palladium, gold or silver,4 have been successfully used in this context . However, the cost of the catalyst, together with its selectivity (metal allenylidene vs. metal propargylic intermediates) remain important issues to solve . The direct displacement of activated alcohols such as benzylic, allylic, and propargylic alcohols can also be achieved using brnsted or lewis acids by simple sn1 reactions.5 important advantages of brnsted acids over lewis acids often include lower catalytic loadings and easier handling as they are generally more stable towards oxygen and water . Sulfonic acids are the most commonly used brnsted acids for the nucleophilic substitution of propargylic alcohols as described in extensive work by sanz and co - workers with p - toluenesulfonic acid.6,7 inorganic acids, such as phosphomolybdic acid on silica, have also been studied with c-, n- and o - nucleophiles.8 depending on the substrates, the reactions required either 10 mol-% of acid at room temperature, or 1 mol-% in refluxing toluene . An additional asset of these inorganic acids is their straightforward separation from the organic products through a simple basic workup . A common feature for all these catalytic systems is their compatibility with air and reagent - grade solvents, although they are mostly undesirable ones (toxic, costly to dispose of, such as meno2). Hbf4 is a common acid in academic and industrial laboratories that has found diverse applications in synthesis, either as a reagent (nucleophilic fluorination,9 synthesis of vinylidene metal complexes10), or catalyst (amidation of olefins,11 biginelli reaction,12 acylation of aldehydes13). Crafts alkylation of benzylic alcohols in the presence of an excess of hbf4oet2 solution at 78 c has been reported.14 even though high diastereoselectivities could be achieved with this methodology, the excess of acid and low reaction temperatures represent important drawbacks . Herein, we report the use of hbf4 as a highly efficient catalyst for sn1 reactions of propargylic alcohols with different nucleophiles under mild, simple reaction conditions . In a first step, the effect of different solvents was tested on the reaction of propargylic alcohol 1a with meoh to give 2a with 1 mol-% of hbf4 (table1). Of meoh and a commercially available 48 wt.-% solution of hbf4 in water as catalyst . No attempts were made to optimise the reaction times . Whereas sluggish reactions were observed in thf or in water (table1, entries 1 and 2), high conversions were obtained in dcm, acetonitrile, and acetone (table1, entries 46). Overall, acetone was chosen as our preferred solvent because of its greener profile.15 it is important to note that all tested solvents were technical grade, and in particular, the acetone employed in these reactions was standard laboratory washing acetone . Schuster rearrangement16 was not observed either in the model reaction or during the study of the scope of the reaction . The use of different o - nucleophiles was first explored (scheme 1). Propargylic alcohol 1a was treated with different primary and secondary alcohols to form the expected ethers 2a h in high yields under our standard conditions . When chiral alcohols were used, the corresponding ethers 2 g and 2h were formed as a mixture of inseparable diastereoisomers . A tertiary alcohol, tbuoh, only led to low yields of the ether 2i, and the major product of that reaction (51% conversion) formed from dimerisation of the starting propargylic alcohol (3a; vide infra for further details). On the other hand, an ortho - disubstituted aryl group was not detrimental to the reactivity of the propargylic alcohol, as exemplified with the formation of 2k . Also, unlike most transition - metal - based methodologies,3 the reaction is not limited to terminal alkynes, and alkyl (2j, 2k), aryl (2l) or silyl groups (2 m, 2n) at the acetylenic position did not have any major effect on the outcome of the reaction (scheme 1). Also, several functional groups (ketone, halogen or sulfone) were shown to be compatible with the reaction conditions . In the absence of any other nucleophile, the starting propargylic alcohol dimerised to form the symmetrical ether as a mixture of diastereoisomers (scheme 2). Dr = diastereoisomeric ratio . [a] isolated yields; h nmr conversions are provided in parentheses when lower than 95% . [b] 51% h nmr conversion into dimer 3a . [a] isolated yields; h nmr conversions are provided in parentheses when lower than 95% . On the other hand, when r on the starting propargylic alcohol was not an electron - rich aryl group, no reaction was observed at room temperature . In most cases, however, the formation of the desired ethers was possible by increasing the reaction temperature and/or the acid loading (table2). Good yields could be then obtained, except for a nitro - substituted substrate (table2, entry 4). It is important to note that, since no decomposition or undesired reactions were observed at room temperature, this difference in reactivity could be used to selectively functionalise a more complex molecule with two electronically dissimilar propargylic alcohols (vide infra). Isolated yields; h nmr conversions are provided in parentheses when lower than 95%; n.r . = the inherent basicity of most amines is an obvious potential limitation of any brnsted acid catalysed reaction as they might simply neutralise the catalyst . Our conditions, however, could be successfully applied to different carbamates and sulfonamides, as well as weakly basic anilines (scheme 3), and the expected products 4 were prepared in good yields at room temperature, with the exception of 4e . [a] isolated yields, h nmr conversions are provided in parentheses when lower than 95% . [b] reaction carried out with 5 mol-% of hbf4 at 60 c . Carbon nucleophiles were also investigated, and diketones as well as electron - rich arenes reacted to form the expected products 5 in good to excellent yields (scheme 4). Very similar results were obtained with pentane-2,4-dione and a variety of substituted propargylic alcohols . For the formation of 5d, with an electron - neutral aryl group at the propargylic position, a higher catalyst loading and an elevated temperature were required in order to obtain high conversions . Phenol also reacted efficiently in a friedel crafts - type reaction,17 to give para - substituted derivatives 5e g exclusively . When using 2-phenylphenol as the nucleophile, the hydroxy group had a stronger directing power than the arene, as expected (scheme 4, compound 5h). We then tested a phenol with a second strongly activating group at the para position (4-methoxyphenol, for the formation of 5i). In this case, only the product derived from reaction at the ortho position to the phenol was isolated . A] isolated yields; h nmr conversions are provided in parentheses when lower than 95% . [b] reaction carried out with 5 mol-% of hbf4 in mecn at 80 c . Surprisingly, allyltrimethylsilane proved to be a very poor reaction partner for the substitution of propargylic alcohols with hbf4 as the catalyst . Low conversions were obtained in either acetone or hot toluene, even when higher catalyst or nucleophile loadings were used (table3). Overall, the best results were obtained in mecn at 80 c, and still product 5j could only be isolated in 50% yield . It is important to note that alcohol 1a was stable under the studied conditions, and besides the expected product 5j, only 1a and ether 3a were evidenced in the h nmr spectra . Hence, no amide formation, which could potentially take place by a ritter reaction,18,19 was observed under these conditions . When furan was used as nucleophile, the h nmr spectrum of the crude reaction mixture showed the formation of a complex mixture of products . Prompt purification allowed the isolation of 5k in moderate yield, but it is important to note that 5k still decomposed rapidly after purification . These observations were perhaps not surprising as many furan derivatives are well - known to be acid - sensitive . This is also the case for some indoles, but as it can be seen in table4, better yields were obtained with this important family of heterocyclic nucleophiles.20 hbf4-catalysed propargylation reactions of heterocycles . Isolated yields; h nmr conversions are provided in parentheses when lower than 95% . Reaction carried out with 5 mol-% of hbf4 in toluene at 80 c . In order to investigate the influence of substitution on the nucleophile, different indole derivatives were treated with the same propargylic alcohol 1a . 1-methyl- and 1h - indoles reacted regioselectively at c-3, as expected, leading to the formation of 5l and 5 m, respectively, in good yields . This might be due to a higher instability under acidic conditions or its low solubility either in acetone or dcm . Even under more forcing conditions (5 mol-% of acid at 80 c), no evidence for reaction of the hydroxy group could be detected . Gratifyingly, products 5o q, derived from a friedel crafts reaction at c-2 could be prepared under very simple reaction conditions . To the best of our knowledge, this is the first example of the synthesis of 2,3-disubstituted indoles by brnsted acid catalysed propargylation reactions.21 some of the reactions in table4 were carried out in dcm, instead of acetone, to avoid the formation of undesired by - products . It has previously been reported that indoles can react with ketones or aldehydes as electrophiles under acidic conditions.22 indeed, when 1-methylindole was treated with propargylic alcohol 1a under our standard conditions in acetone, the expected product 5l was formed preferentially, but it was contaminated with bis(indole) 6 (scheme 5a). The high yield obtained of 5l indicates that the indole reacts preferentially with the propargylic cation formed from 1a and that the reaction between the excess of indole and acetone is quite sluggish . The formation of 6 remains undesirable, and hence acetone was avoided as a solvent for these reactions . More problematic was the reaction of 1a with tryptophol as nucleophile (scheme 5b). In this case the expected product could only be isolated in 40% yield because of a competitive oxa - pictet spengler acid - catalysed cyclocondensation of tryptophol with the solvent,23 which consumed 70% of the available nucleophile . Next, two competition experiments were performed to exploit the particular activity of hbf4 in propargylation reactions (scheme 6). Firstly, relatively electron - rich alcohol 1a reacted selectively in the presence of 1 g, bearing a chloro substituent at the para position of the phenyl ring (scheme 6a). Also, the unexpected diminished reactivity of allylsilanes as nucleophiles was exploited when 1a was treated with 2 equiv . Of benzyl alcohol and 2 equiv . Only 2b, derived from the reaction with benzyl alcohol, was formed under these conditions . Importantly, these chemoselectivities are not possible when using other brnsted acids reported for this transformation, such as p - toluenesulfonic acid,6a or phosphomolybdic acid.8a competition experiments with hbf4 . Finally, a gram - scale reaction was performed to further demonstrate the applicability of this reaction, and compound 5r was isolated in high yield when using our optimised conditions (scheme 7). The scope and limitations of hbf4 as a practical catalyst for propargylation reactions have been explored . In general, good to excellent yields for the formation of c o, c n and c c bonds were obtained under exceptionally simple reaction conditions . Challenging substrates such as electron - poor propargylic alcohols, or acid - sensitive indoles could be used with this methodology, even if slightly more forcing conditions were sometimes required . All reactions were carried out in air and in technical solvents, and the acid used was a commercially available aqueous solution . All the reactions were also completely regioselective, and no allene products were observed in any case . Furthermore, many of the reactions were extremely clean, and the desired products could be isolated analytically pure without the need for further purification after a simple aqueous workup (i.e., 2a, 2j, 2l o, 5b c). Overall, this is a convenient and powerful methodology that does not employ a costly metal catalyst . For instance, we were pleased to see that an allylic alcohol also reacted with meoh at room temperature in very high yields (scheme 8). General procedure for the nucleophilic substitution of propargylic alcohols: in a vial fitted with a screw cap and a stirring bar, the propargylic alcohol 1 (1 mmol), nucleophile (2 mmol) and technical acetone (2 ml) were introduced . An aqueous solution of hbf4 (48 wt.-%, 1.2 l,1 mol-%) was then added, and the reaction mixture was stirred at room temperature for 18 h. the reaction was quenched with a saturated aqueous solution of nahco3 and the mixture extracted with ethyl acetate . The combined organic extracts were washed with brine, dried with anhydrous mgso4, filtered, and concentrated under reduced pressure to give the title compound . As a service to our authors and readers, this journal provides supporting information supplied by the authors . Such materials are peer reviewed and may be re - organized for online delivery, but are not copy - edited or typeset . Technical support issues arising from supporting information (other than missing files) should be addressed to the authors
Notch proteins are evolutionarily conserved cell - surface receptors for transmembrane ligands of the dsl family (named after the delta and serrate ligands of drosophila). Signaling by notch regulates a broad range of cell - fate decisions during development and various human diseases, including cancers, the extracellular part of notch contains 36 epidermal growth factor - like (egf) repeats carrying the ligand - binding region and three lin12/notch repeats (lnrs) that limit proteolytic cleavage of the receptor at the s2 site, and hence limit its activation . The egf repeats are modified by two types of o - linked glycosylation, o - glucosylation and o - fucosylation (figure 1a); both are important for notch activity [3 - 6] (figure 1a). (a) schematic representation of the drosophila notch receptor . The extracellular domain (necd) is composed of three lin12/notch repeats (lnrs) (black) and 36 egf - like repeats; the egf repeats are predicted to be either o - glucosylated (cyan), o - fucosylated (yellow) or doubly modified (green) adapted from . The s2 cleavage site is indicated by an arrow . The intracellular domain (nicd) contains various elements involved in transcriptional activation: a ram domain, seven ankyrin repeats (ank), a transactivation domain (tad) and a pest domain (p). (b, c) two models for the roles of ofut1 in notch trafficking . Each model is illustrated in a schematic cell that is shown as wild type on the left and ofut1 mutant on the right, gray - shaded side . (b) model 1: in the er, newly synthesized, unfolded notch (with the necd in red and the nicd in white) becomes properly folded (necd in green) and is o - fucosylated by ofut1 (yellow diamond). It is then transported to the plasma membrane and adherens junctions (ajs, cyan) through the golgi . In the absence of ofut1, notch remains unfolded and is retained in the er . (c) model 2: o - fucosylated notch is first transported via the golgi to the apical membrane and then transported to ajs by a transcytosis mechanism . In ofut1 mutant cells, notch goes to the membrane, is internalized and accumulates in an uncharacterized endocytic compartment . O - fucosylation of notch is catalyzed by an o - fucosyltransferase (pofut1 in mammals and ofut1 in drosophila) that uses gdp - fucose as a substrate . The o - fucose residue added by this o - fucosyltransferase can be further elongated by the addition of an n - acetylglucosamine by fringe, an egf - o - fucose 1,3 n - acetylglucosamyltransferase . In drosophila, the activity of fringe is required for notch signaling events involved in boundary formation, in which it reduces the affinity of notch for serrate while enhancing that for delta . Given that ofut1 is thought to be the sole enzyme that o - fucosylates notch, the activity of fringe is predicted to require the o - fucosylation activity of ofut1 . However, ofut1 has additional functions, and other catalytic and non - catalytic activities have been proposed [8,11 - 16]. These include roles in the folding of notch in the endoplasmic reticulum (er), in notch - ligand binding and in endocytic trafficking of notch . There are several observations that support each of these models, and there has been controversy about which one is correct . A recent paper in bmc biology by kenneth irvine and colleagues (okajima et al .) The first model proposes that ofut1 acts in the er, where it performs two separable functions: to o - fucosylate notch, thereby modulating notch - ligand interaction, and to promote the correct folding of the extracellular domain of notch (a non - catalytic function). It partially co - localizes with er markers and acts, at least in part, in the er: the carboxy - terminal extremity of ofut1 contains a lys - asp - glu - leu (kdel)-like motif that is dispensable for its catalytic activity but is required for both er retention and function . The notch protein accumulates in intracellular compartments marked by er markers, and knockdown of ofut1 using double - stranded rna in cultured cells inhibits the secretion of a soluble version of the notch extracellular domain (necd). This activity of ofut1 does not require its o - fucosylation activity because expression of a mutant version of ofut1 demonstrated to be catalytically dead (ofut1) mostly rescues the notch localization defects . In addition, ofut1 and ofut1both bind the necd, and expression of ofut1 in cultured cells can increase both the amount and the ligand - binding activity of secreted necd . Consistent with this proposed o - fucosylation - independent activity, notch localizes at the cell cortex in gdp - mannose 4,6-dehydratase (gmd) mutants, which contain no gdp - fucose, indicating that non - o - fucosylated notch exits the er . Together, these results led to a simple model (model 1, figure 1b) in which ofut1 acts as an er chaperone to promote the proper folding of the egf repeats of notch, thereby ensuring its correct cell - surface localization and ligand - binding activity . The second model proposes that ofut1 acts at two post - exocytosis steps in the trafficking of notch: it regulates both the endocytosis of notch and its transcytosis from the apical plasma membrane to the adherens junctions (ajs). First, ofut1 is required for the proper distribution of notch at ajs . In ofut1 mutant cells, notch does not accumulate at ajs but instead accumulates into intracellular' dots' that co - localize with er markers only poorly . In addition, surface - staining experiments indicate that a low level of notch is also present at the surface of ofut1 mutant cells . These data were interpreted to suggest that ofut1 is not required for the er exit and cell - surface delivery of notch . Second, ofut1 is required to regulate the endocytic trafficking of notch, as monitored by antibody uptake . Anti - notch antibodies are internalized in ofut1 mutant cells, albeit at a lower level than in wild - type cells, but fail to accumulate in endosomes . It is therefore proposed that notch accumulates in an uncharacterized endocytic compartment in ofut1 mutant cells . Finally, the second model is supported by the observation that a lower level of intracellular notch is detected in gmd mutant cells than in ofut1 single - mutant or ofut1, gmd double - mutant cells . This suggests that the endocytic activity of ofut1 does not depend on its catalytic activity . In addition, the failure of notch to localize at ajs in gmd mutant cells is interpreted in the light of a speculative model of the transcytosis of notch to suggest that ofut1 acts in a catalysis - dependent manner to regulate the transcytosis of notch . We feel that this transcytosis model needs further experimental validation, so we will not detail the possible role of ofut1 in this process further . We note, however, that this proposed role of ofut1 in the transcytosis of notch suggests that the o - fucosylation activity of ofut1 is required for fringe - independent signaling events . Together, these observations suggest a model (model 2, figure 1c) in which ofut1 regulates the endocytic trafficking of notch at a post - internalization step so that notch accumulates in an undefined endocytic compartment in the absence of ofut1 activity . Thus, these two models offer two different interpretations of the cellular basis of the ofut1 mutant phenotype: in model 1, the reason notch does not signal is because it is trapped in the er, whereas in model 2, it is because notch accumulates in an undefined endocytic compartment with a low level of (inactive) notch at the surface . One implication of model 2 is that a fraction of ofut1 must escape er retention and act in the endocytic pathway . Consistent with this possibility, experiments using cultured cells indicate that a fraction of ofut1 is secreted, interacts with the extracellular part of notch at the cell surface, and is internalized in a notch - dependent manner . In addition, the notch localization defects seen in cells treated with ofut1 double - stranded rna can be rescued by adding ofut1-containing conditioned medium . Whether this happens in vivo is not clear . Indeed, ofut1 acts in a cell - autonomous manner to regulate the localization of notch, arguing that secretion is not important in this regulation . Moreover, the observed rescue of the ofut1 knockdown phenotype by extracellular ofut1 could also be consistent with model 1, given that endocytosed ofut1 may be transported back into the er . So, how can we distinguish between the two models? Clearly, answering the following questions would help . Does notch reach the cell surface in the absence of ofut1 activity? Where does notch accumulate in ofut1 mutant cells? Is the o - fucosylation activity of ofut1 required for proper notch localization and activity? Or is it only required for fringe - dependent signaling? Okajima et al . Have addressed these issues and provide compelling evidence in favor of model 1 . Okajima et al . Have shown that the o - fucosylation activity of ofut1 is required for fringe - dependent but not for fringe - independent signaling events . They found that embryos lacking both maternal and zygotic contributions of gmd develop into larvae, as fringe mutant embryos do . The complete loss of ofut1 activity results in a strong phenotype mimicking a loss of notch activity that is rescued to larval viability by the expression of ofut1 . These data show that the o - fucosylation activity of ofut1 is dispensable for notch signaling in the embryo . This conclusion is entirely consistent with the observation that the activity of fringe is dispensable in the embryo . It is therefore clear that non - fucosylated notch can reach the cell surface and can signal . The role of the o - fucosylation activity of ofut1 during wing imaginal disc development led to identical conclusions . Although the loss of ofut1 activity in clones leads to phenotypes mimicking a loss of notch activity, expression of ofut1rescued notch receptor activity in these ofut1 mutant cells and led to phenotypes mimicking a loss of fringe activity . This confirms that non - fucosylated notch can signal, and further indicates that the fucosylation activity of ofut1 is required only for fringe - dependent signaling events . This therefore implies that the transcytosis step of model 2, which was proposed to be dependent on ofut1 catalytic activity, is not essential for notch signaling . Because the controversy over the exact role of ofut1 is in part due to methodological differences between the various studies and also to technical limitations in subcellular localization analysis, okajima et al . Also re - examined the localization of notch in ofut1 mutant cells using a detergent - free cell - surface staining protocol . A striking difference in surface staining was observed between wild - type and ofut1 mutant cells . This convincingly shows that notch is not present at detectable levels at the surface of mutant cells . This contradicts the results obtained by sasaki et al ., who used a different protocol to assay the presence of notch at the cell surface of ofut1 mutant cells . Whether the difference in protocols accounts for these opposite conclusions remains to be addressed experimentally . The second piece of evidence in support of a cell surface accumulation of notch in ofut1 mutant cells comes from antibody uptake experiments showing that anti - notch antibodies can be internalized by ofut1 mutant cells . However, as discussed by okijama et al ., the low level of antibody uptake can probably be accounted for by the fluid - phase uptake of anti - notch antibodies by live ofut1 mutant cells, followed by the specific retention of internalized antibodies by notch accumulating intracellularly . Together, the published data are best interpreted as concluding that notch does not reach the cell surface in ofut1 mutant cells . Notch was shown to partially co - localize with four different er markers that, in fact, show only partial co - localization among themselves . Thus, the only partially overlapping distribution of er markers may explain the poor co - localization of notch with the two er markers seen by sasamura et al . . Therefore propose that notch accumulates in ofut1 mutant cells in the er, which is a heterogeneous organelle . Accordingly, notch should co - localize better with the sum of the signals of the different er markers . It is clear that the o - fucosylation of notch is primarily required for fringe - dependent signaling events and that ofut1 acts non - catalytically to regulate the exit of notch from the er . Thus, ofut1 probably acts as a chaperone in the er to promote the proper folding of the extracellular domain of notch, as described in model 1 . Although the catalytic and non - catalytic activities of ofut1 can be experimentally uncoupled, it is attractive to speculate that the o - fucosylation activity of ofut1 participates in the quality - control mechanism that ensures that only properly folded notch exits the er . Further analysis of the trafficking of non - fucosylated notch, produced for instance by gmd mutant cells, would help address this issue.
Choriocarcinoma is one of the malignant tumors arising from trophoblastic cells characterized by the secretion of human chorionic gonadotrophin (hcg). The tumor consisted of two basic cell types: cytotrophoblast and hcg - positive syncytiotrophoblast, the typical histologic features of choriocarcinoma (1 - 5). The serum hcg level is typically elevated, with resultant isosexual pseudoprecocity in children, and menstrual abnormalities, breast enlargement, androgenic changes, or combinations thereof, in adults (1, 2). It usually arises from fetal trophoblasts and rarely arises from germ cells in the testis or ovary or derives from dedifferentiation of other carcinomas (2, 3). The most common sites of systemic metastatic disease are lungs, liver and brain via hematogenous spread (1). Skin is a rare site for metastatic choriocarcinoma, and even more rare as the initial presenting site for the disease (3 - 5). To the best of our knowledge, we describe a case of 52-yr - old korean female patient with cutaneous metastasis of choriocarcinoma, diagnosed from a skin biopsy that provided important diagnostic clues to the primary lesion . A 52-yr - old korean female presented with dyspnea of 2 months duration and cutaneous nodules of 1 month duration on the left side of the neck and the right side of the upper back . Her past medical history was significant for behet's disease, which had been treated with colchicine for the past 4 yr . Routine blood tests showed leukocytosis with a wbc of 17,780/l, anemia with a hemoglobin of 9.4 g / dl and slightly elevated hepatic enzyme levels of got / gpt at 45/51 iu / l . Chest radiography, chest and abdomen - pelvis ct revealed pleural effusion, innumerable variable sized pulmonary metastatic nodules on both lungs and multiple metastatic lesions on the liver, left adrenal gland and left kidney . A skin biopsy was performed on the nodule at the right side of upper back . At low magnification, there were several hemorrhagic foci and multiple cellular infiltrations throughout the dermis (fig . 2a). At high magnification, the infiltrated tumor cells consisted of two cell types, and a biphasic pattern, in close proximity . One element had polygonal shaped, clear cytoplasm and large, irregular shaped, vesicular nuclei with prominent nucleoli, which were identified as cytotrophoblasts . The other cell population showed eosinophilic cytoplasm with cytoplasmic vacuoles and many dark nuclei, which were identified as syncytiotrophoblasts (fig . The immunohistochemical staining for hcg antigen (1:600, polyclonal rabbit, dakocytomation, denmark) in the cytoplasm of syncytiotrophoblasts (fig . Magnetic resonance (mr) images of the abdomen - pelvis detected diffuse enlargement of the uterus body and a protruding mass in the uterine cavity, which was the primary origin of the tumor (fig . Her serum hcg level was 700,000 miu / ml (upper normal limit: 10 miu / ml). She was referred to the gynecological oncology department, where combination chemotherapy was commenced . During combination chemotherapy, the serum hcg level has fallen off under 2.0 miu / ml and her skin lesions have almost disappeared . However, 3 months after 17 cycles, total abdominal hysterectomy and bilateral salpingo - oophorectomy were performed due to elevated serum hcg level (4,447.7 miu / ml), and she is scheduled to receive post - operative adjuvant chemotherapy . Compared to other organs, skin is an uncommon site of metastatic cancer in the body as it is usually associated with a disseminated disease and grave outcome . Occasionally, however, as in our case, cutaneous metastasis may be the first harbinger of a visceral malignancy of unknown origin and gives an important diagnostic clue (3, 4, 6 - 8). Cutaneous metastasis of a visceral malignancy has been estimated to be in the wide range of 1.4% to 10.4% according to the type of study undertaken and the site of primary tumor studied (6 - 11). Involvement of the skin is likely to be near the area of the primary tumor and in proportion to the incidence of internal malignancy . The chest, abdomen, and scalp are common anatomic sites to which metastasis localize with the back and extremities being relatively uncommon areas . Breast cancer in women and lung cancer in men are the most common causes of chest metastatic lesion (6 - 8). Occasionally, a cutaneous metastatic lesion may show typical histologic features which give a decisive diagnostic clue to the primary origin . Such cases include mucin - containing cells in colon cancer, bile - containing glandular structure in hepatoma, clear cells in renal cell carcinoma and, like our case, cytotrophoblasts and syncytiotrophoblasts in choriocarcinoma (6). Choriocarcinoma, in women, is often preceded by a gravid state, which is most often hydatidiform mole (50%), less frequently abortion (25%), and normal term pregnancy (15%)., it commonly arises from germ cells in the testis (1 - 5). The gross appearance of choriocarcinoma is often dark red or purple colored and resembles that of a friable segment of placenta (1). Microscopically, it is characterized by multiple foci of hemorrhage and necrosis around the neoplastic cells, by large sheets of cytotrophoblastic and syncytiotrophoblastic cells, biphasic pattern, and by the absence of hydropic villi . The cytotrophoblasts have cuboidal shaped, pale cytoplasm and large, irregular shaped, vesicular nuclei with prominent nucleoli . The syncytiotrophoblasts show eosinophilic cytoplasm with cytoplasmic vacuoles, many hyperchromatic and pleomorphic nuclei with indistinct border, looking like multinucleated giant cells, and may form syncytial knots . The immunohistochemical staining for hcg antigen is positive in the cytoplasm of syncytiotrophoblasts but not in cytotrophoblasts (1 - 5). Other germ cell tumors such as polyembryoma, embryonal carcinoma, dysgerminoma and mixed germ cell tumor can also show hcg positive syncytiotrophoblastic cells but these tumors do not demonstrate a biphasic pattern consisting of cytotrophoblasts and syncytiotrophoblasts, as in choriocarcinoma (1). The most common metastatic sites are, in a descending order of frequency, lung (60 - 95%), vagina (40 - 50%), vulva (10 - 15%), brain, liver (10%), kidney and spleen (<5%). Although choriocarcinomas respond relatively well to chemotherapy, cutaneous metastasis is an extremely uncommon presentation and a poor prognostic sign as it is associated only with disseminated disease (1 - 5). Reported a case of cutaneous metastatic testicular choriocarcinoma where the patient died 10 days after the initiation of chemotherapy (4). Shimizu et al . Also reported a case of metastatic disease to the upper back of testicular choriocarcinoma, where the patient died 3 months after the appearance of a cutaneous metastatic lesion . In their literature review, of 7 patients with metastatic choriocarcinoma to the skin, 5 patients died within 3 months after the appearance of skin metastasis (3). Reported another case of choriocarcinoma with metastasis to the chest wall, which responded well to 12 cycles of combination chemotherapy (5). We described an extremely rare patient with metastatic choriocarcinoma presenting initially as a cutaneous lesion . The diagnosis was made from the typical histological findings of a cutaneous metastatic lesion, which was confirmed by immunohistochemical staining for hcg and from the abdomen pelvis mr images . This case highlights the importance of a histological examination of skin metastatic lesion, which can provide conclusive evidences to the diagnosis.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.