text stringlengths 0 868k |
|---|
T - cell activation requires specific recognition of antigen presented as small fragments (peptides) bound to major histocompatibility complex (mhc) molecules . The recognition of a particular peptide - mhc occurs through a highly specific t - cell receptor (tcr), which is selected in the thymus . Following tcr triggering, costimulation and the presence of polarizing cytokines together determine the t - cell activation pattern and guide ultimate t - cell differentiation . Classically, cd4t - cells recognize antigens scavenged extracellularly by the antigen presenting cell (apc) that are presented in mhc class ii, whereas cd8 t - cells recognize endogenous antigens presented by mhc class i (mhc - i) [1, 2]. In spite of this widely held view, already decades ago it was shown that also antigens derived from intracellular pathogens such as viruses or intracellular bacteria can be presented in mhc - i . More recently, cross - presentation by dendritic cells and autophagy have been elucidated as important mechanisms in this context [2, 4]. Transplantation of hematopoietic cells as well as solid organs and detailed studies of viral infections provided the initial key information leading to the concept of genetic mhc restriction by autologous mhc molecules . However, numerous t - cell subsets have been identified that do not fulfil these criteria, including mhc class ib restricted t - cells, cd1 restricted t - cells, mr1 restricted mucosal associated invariant t - cells (mait), nkt - cells, and t - cells, subsets that are collectively called unconventional or donor - unrestricted t - cells (durt). Unconventional t - cells behave differently in terms of memory, kinetics, and ligands recognized compared to conventional t - cells as recently summarized . An intriguing group of durt family cells are the t - cells that are restricted by mhc class ib molecules . These cells may share several critical properties with conventional t - cells but most importantly recognize antigens typically in the context of nonpolymorphic mhc - i molecules . The human mhc class ib family, also called nonclassical hla class i, is comprised of hla - e, hla - f, and hla - g . The major difference with classical class ia molecules is their very low level of allelic variation . Whereas hla class ia families are composed of several hundred family members for hla - a, hla - b, and hla - c alleles, hla - e, hla - f, and hla - g comprise only 3, 4, and 10 family members, respectively, and not all of these are actually expressed as functional proteins . Immune cells express relatively high levels of hla - e protein, but also tissue cells can express the hla - e protein (http://www.proteinatlas.org/). Although hla - e was originally described to be broadly expressed by almost all cells that also express hla class ia molecules, other studies suggest hla - e expression is restricted to lymphoid and endothelial cells . Furthermore, pathogens can affect hla - e cell surface expression; for example, human cytomegalovirus (cmv) can upregulate its expression . Hla - e functions as ligand for cd94-nkg2 receptors and has a peptide - binding groove that is ideally suited for binding peptides derived from the leader sequences of other mhc - i molecules . In this regard, the loss of leader - peptide loaded hla - e expression is a marker for cells having lost expression of hla class ia molecules, which targets these cells for recognition and lysis by natural killer (nk) cells . In contrast to hla - e, hla - f expression appears to be more restricted and is detected mostly in liver and bladder . However, its expression is largely intracellular and in association with other mhc - i molecules, which has led to speculations that hla - f might be involved in the intracellular stabilization of hla class ia molecules . The third human mhc class ib family member, hla - g, has an even more narrow tissue distribution; its expression appears limited to trophoblasts in the placenta, and it has been associated with fetal - maternal tolerance . Hla - g may function during pregnancy to inhibit nk mediated lysis as trophoblasts lack hla - a and hla - b expression . Thus, given the intracellular expression of hla - f and the placental restriction of hla - g, limited information is available on t - cells interacting with these molecules, and their relevance to general immunity remains unclear . For this reason, the focus of this review will be on hla - e restricted t - cells . The role of hla - e in the innate immune response is to present signal sequence - derived peptides of other hla class i molecules to inhibit nk mediated lysis of cells via recognition by cd94/nkg2a . However, hla - e can also bind and present other peptide sequences, which can be self or pathogen derived and can be recognized by adaptive t - cells . Hla - e is thus considered to play a role in both innate and adaptive immunity, via interacting with both nk cells as well as presenting peptides to antigen specific cd8 t - cells (figure 1). Eleven alleles have been reported for hla - e, only 3 of which can be translated into proteins, 2 of them being highly dominant, the hla - e (e01:01) and the hla - e (e01:03) variants, which differ only in a single amino acid at position 107, being arginine (e01:01) or glycine (e01:03). Position 107 is located on the loop between the -strands outside of the 2 domain of the heavy chain, just outside the peptide - binding groove . The frequency of the hla - e and hla - e in the population is about equal, suggesting balanced selection in diverse populations [14, 15]. Whether hla - e and hla - e display functional differences has not been studied in detail [14, 16], but it has been demonstrated that hla - e homozygous cells express higher levels of hla - e and had higher peptide - binding affinity . More recently, peptide elution studies revealed a different peptide - binding repertoire eluted from hla - e versus hla - e molecules, indicating that the f - pocket of hla - e bound a smaller variety of peptides and had a stronger preference for a lysine at the p position [17, 18]. The structural basis of hla - e's ability to bind signal sequence - derived peptides from hla class ia (hla - i) molecules has been studied previously . Unlike hla class ia that typically contain 2 or 3 anchor residues, hla - e contains 5 anchor residues in the peptide - binding groove that highly constrains the sequence of the bound peptide [19, 20]. However, hla - e was additionally shown to bind peptides derived from viruses such as influenza m1 protein and ebv bzlf1 . Moreover, a sequence from cytomegalovirus (cmv) glycoprotein ul40, which is identical to the hla - c03 leader sequence, can bind to hla - e and is capable of preventing nk mediated lysis [9, 22]. The same was found for a hcv derived sequence, despite its sequence difference from signal peptides . Peptide identification and characterization using random peptide approaches also revealed that a leucine on p9 is a critical anchor residue for hla - e binding but did not identify methionine as critical p2 anchor for hla - e binding and folding . Identification of the motif within the hla class ia leader sequences critical for interaction with the cd94/nkg2 complex suggested anchor residues at positions 2, 6, 7, and 9, while solvent exposed residues at p5 and p8 were likely important for binding to cd94/nkg2 . Thus, while p2 and p9 are anchor residues for binding to hla - e and p5 and p8 are involved in the interaction with cd94/nkg2, p8 is also the critical residue distinguishing self (signal sequence) from nonself (cmv ul40) and allowing for tcr recognition of cmv ul40 . Recent peptide elution studies provided important insights in the types of peptides that are naturally presented by hla - e and identified a larger array of peptides eluted from hla - e than originally discovered [17, 18, 27]. Eluted peptides were generally short (8 - 9 - 10 mers), but occasionally also longer peptides were eluted including 1117 mers [17, 18, 27]. This is in line with earlier studies, where also peptides greater than 8 amino acids could bind hla - e . Furthermore, eluted peptides were different from signal sequences, possessing hydrophobic amino acids on p2 and p9, consistent with a binding motif that was very similar to that of hla - a2 . Recent studies in rhesus macaques immunized with siv - gag (simian immunodeficiency virus), in specific cmv vectors, revealed a series of peptides that were recognized by cd8 t - cells but only a minority contained the canonical mhc class i antigen e (mhc - e) binding motif . Structural analyses revealed that the peptide - binding cleft of hla - e is rigid but relatively open compared to that of hla class ia family members . Peptides that lack the canonical residues can adopt a backbone structure that is similar to canonical peptides, allowing them to bind the hla - e molecule . These unique binding properties of hla - e may explain the observed epitope diversity and breadth in siv - gag in the rhesus macaque vaccination studies . Furthermore, the authors suggested that the open structure of hla - e may allow peptide exchange; this may be in particular relevant for mycobacterium tuberculosis (mtb) as hla - e expression is enriched in the mtb phagosome . Intriguingly, we have identified a large series of mtb epitopes presented in hla - e and recognized by mycobacteria exposed human donors, many of which lack the canonical residues . Together, these data indicate that hla - e binds signal sequence - derived peptides not only from mhc class ia molecules but also from other self and even pathogen - derived sequences . Although many peptides contain canonical amino acids for binding hla - e, clear examples exist for peptides which lack canonical residues and can still bind hla - e . Presentation of nonself sequences, being absent during thymic selection, may elicit adaptive immune responses by cd8 t - cells . Specific recognition of pathogen - derived sequences presented by the unconventional presentation molecule hla - e by the cd8 tcr could lead to specific activation of adaptive immune responses, independent of classically hla restricted cd4 and cd8 t - cells . As viruses require the human host to survive and therefore reside within host cells, their proteins are presented by hla class i molecules, including hla class ib . Peptides from epstein barr virus (ebv) [3436], cytomegalovirus (cmv) [12, 3741], and hepatitis c virus (hcv) can be presented by hla - e and are recognized by virus specific t - cells (table 1). The peptide epitopes studied from cmv ul40 are highly similar to the hla class ia signal sequences, whereas the sequences from ebv bzlf1 and hcv appear more different . The functional and phenotypical description of these t - cells is rather limited, but they all express cd8 as expected for hla class i restricted cells . In many studies, hla - e restricted t - cells have been identified and enumerated using hla - e tetramers whereas functional analyses were limited to the demonstration of target cell lysis . Likewise, phenotypical characterizations were very limited in scope but when performed showed a cytolytic t - cell phenotype (perforin, granzyme a / b) and ifn production in some studies [38, 41]. . Initial studies on possible recognition of hla - e peptide complexes by t - cells in a tcr dependent manner were performed using signal sequences from hla class ia alleles [34, 35, 42] (table 1). It is a priori not clear why healthy human subjects would mount t - cell responses towards signal sequences of conserved class ia molecules . While some of these studies lack information on the hla - typing of the donors, others have suggested that these cells are mostly reactivity against nonself target peptides of signal sequences [34, 35, 42]. Similarly, cytotoxic cd8 t - cells recognizing hla - e binding sequences from tcr v chains were detected in peripheral blood . An alternative, nonexclusive, explanation may be that these t - cells are reactive with nonself virally derived antigens that share sequence homology with the mhc class ia derived signal sequences used in these studies . Nk - ctl due to their ability to lyse a broad range of allogeneic targets, it was subsequently found that these t - cells were specific for the cmv ul40-encoded peptide (vmaprtlil) bound to hla - e [35, 42]. The detected alloreactivity was due to target cells possessing hla - c alleles encoding the same sequence as the ul40 peptide (e.g., hla - c03). Ul40-specific t - cells can reach frequencies in the circulation similar to those restricted by classical hla - i, indicating their potential to play a significant role in cmv immunity . The tcr from an ul40-specific t - cell clone, kk50.4, was cloned, expressed, and analysed for its interaction with hla - e in complex with the ul40-epitope vmaprtlil (figure 2). Overall, the structural basis for recognition of hla - e largely overlaps that of tcr recognition of hla class ia . However, in order for ul40-specific t - cells to recognize the ul40 antigen or allogeneic hla - i peptides, the ul40-specific tcr need to distinguish between the ul40 epitope (vmaprtlil) and nearly identical self peptides which may differ by as little as a single methyl group (e.g., vmaprtlvl). Analysis of tcr sequences from ul40 specific t - cell clones suggested there were a limited number of tcrs capable of such discrimination, as all of the clones isolated utilized trbv14 (v16) and there was a characteristic arginine residue present in the cdr3 (figure 2). Structural analyses of the kk50.4 clone showed that the convergence of cdr1, cdr2, and cdr3 of the kk50.4 chain onto p8 ile determined self / nonself discrimination (figure 2). Notably, the highly selected arginine present in the cdr3 made multiple contacts with both hla - e and peptide . As the cmv ul40 peptide is highly homologous to hla class ia derived signal sequences, typically these t - cells are only observed in individuals where the ul40 epitope differs from that found in self - hla - c alleles (e.g., hla - c07 homozygotes). However, other pathogen - derived peptides that bind to hla - e are more different from the class ia signal sequences and may therefore depend less on the donors' hla class ia genotype . (2) hiv - nef proteins interact with the intracellular domain of hla - a and hla - b molecules, resulting in downregulation of hla class ia molecules from the cell surface . In contrast, hla - c and hla class ib molecules, particularly, hla - e and hla - g, lack these intracellular nef - interaction domains and thus remain expressed normally on the cell surface of hiv infected cells . In addition, it has been shown that a peptide from the hiv-1 capsid protein p24 (aisprtlna) may further enhance hla - e surface expression . However, recently it was shown that this peptide presented in hla - e is not recognized by cd94/nkg2a and that these cells thus were not protected against nk mediated t - cell lysis . This is most likely due to lack of homology between the hiv p24 peptide and hla leader peptides, which prevents ligation of cd94-nkg2a to the hla - e peptide complex . Inhibition of nk mediated lysis of hiv-1 infected t - cells rather appears to be the result of hla - c expression and recognition by nk cells that specifically express the nk cell receptors kir2dl1/2/3 . Interestingly, it has not yet been investigated whether the hiv-1 p24 peptide, presented in hla - e, may be recognized by the host adaptive immune system and thus may result in specific cd8 t - cells . Induction of such cd8 t - cell responses would be interesting from a therapeutic as well as vaccination point of view . In rhesus macaques, mhc - e (or mamu - e) is the homologue of human hla - e, which also showed upregulated expression in hiv / siv infected animals . Vaccination of rhesus macaques with a cmv - based vector, expressing hiv gag, revealed a very strong cd8 t - cell response (tcr) with a large variety of specific interactions, with an estimated induction of 4 distinct epitopes per 100 amino acids in all tested hiv / siv derived antigens . Although this massive mhc - e restricted response was due to the specific design of the viral vector, it clearly illustrates the abundance of potential hla - e epitopes in a large array of antigens . Detailed characterization of the peptide - binding domain revealed a relatively open structure, exposing many side chains for interaction with the tcr . Interestingly, next to inducing mhc - e restricted t - cells, these cmv recombinant vectors also induced a significant population of other unconventional cd8 t - cells, which were restricted by mhc class ii molecules . Bacteria like salmonella and mtb are intracellular pathogens that hijack host cells to promote their own survival . Intriguingly, the expression of hla - e is enriched on mtb phagosomes compared to classical hla class ia family members, thus presumably facilitating hla - e loading by mtb peptides in infected cells . In 1998, lewinsohn et al . Identified mtb specific cd8 t - cell clones that appeared to be restricted to mhc class ib, two of which were hla - e restricted unpublished recent data point to a peptide derived from the mtb glycoprotein mpt32 (david lewinsohn, personal communication, manuscript in preparation). In an independent effort, we have screened the mtb genome for the presence of peptides that could potentially be presented by hla - e and selected 69 peptides based on 3 different prediction algorithms . Many of these peptides were recognized by donors that had been previously sensitized by mycobacteria, suggesting in vivo priming and t - cell memory for several hla - e epitopes . We have shown that these peptides presented in hla - e elicit cd8 t - cell activation through the tcr, as measured by both zap70 phosphorylation (the first downstream effect in tcr signalling), as well as cd137 expression (a molecule exclusively expressed following specific antigen recognition on cd8 t - cells). Moreover, hla - e restricted t - cell lines specific for mtb had strongly reduced cytokine production in the presence of blocking antibodies against the tcr or hla - e . Altogether, these data support specific recognition of hla - e peptide complexes by mtb specific tcrs . Hla - e binding peptides from mtb were not capable of preventing nk mediated lysis in a cd94/nkg2a dependent manner, similar to hiv p24, indicating that only surface expression of peptide containing hla - e may not be sufficient . Detailed characterization of these t - cells revealed that they are cytolytic or suppressive, and that t - cells reactive against the same peptide can display different functional polarities, indicating that polarity is not determined by the peptide . Interestingly, t - cell clones with cytolytic activity were also capable of inhibiting intracellular outgrowth of mtb, suggesting that they are potent antimycobacterial effector cells . Many of the hla - e restricted mtb specific t - cells did not produce typical cytotoxic t - lymphocyte associated cytokines, nor did they produce classical th1 cytokines (ifn, tnf, and il2), but instead they produced an array of th2 cytokines including il-4, il-5, il-10, and il-13, as well as the th2 associated transcription factor gata-3 (table 2) [47, 48]. In patients with tb disease, hla - e tetramers identified mtb specific hla - e restricted cd8 t - cells, with the highest frequencies at tb diagnosis and waning of the response during successful treatment . Moreover, in line with the knowledge that hla - e is not susceptible to downregulation by hiv, we were able to detect hla - e specific t - cells in patients that concomitantly were infected with mtb and hiv . Salmonella peptides presented by hla - e are also recognized by hla - e restricted t - cells . Volunteers vaccinated with a s. typhi vaccine had a robust hla - e restricted t - cell response, as measured by the cytolytic capacities of these cells, such as granzyme b activity (table 1). Kinetic analysis of these responses in a similarly vaccinated cohort revealed that the hla - e restricted t - cells are long - lasting, up to 2 years after vaccination, again suggesting immune memory . Moreover, following challenge experiments with salmonella in unvaccinated, healthy volunteers, multifunctional hla - e restricted cd8 t - cells were detected and correlated with protection against typhoid disease development . Interestingly, t - cells reactive with self hsp60sp presented by hla - e have also been identified, both in healthy donors and in patients with type 1 diabetes . These cd8 t - cell lines were involved in discriminating self from nonself in the periphery, and defective discrimination between self and nonself was detected in the majority of patients with type 1 diabetes . While many viruses are known to interfere with antigen processing and presentation, resulting in peptide presentation in a tap - independent manner, this is also the case in many tumors . As a consequence, tumor unique antigens may be presented also in the context of hla - e [54, 55], which may subsequently be recognized by cytotoxic t - cells . In contrast to what was expected, in humans the presence of ctls was only beneficial in patients with lung carcinoma if hla - e was not expressed by the tumor, indicating that hla - e restricted ctls may not directly contribute to tumor elimination in these patients . Hla - e restricted t - cell responses have been studied only to a very limited extent in autoimmune diseases; however they could potentially play an important role . In patients with multiple sclerosis (ms), increased frequencies of ebv specific, hla - e restricted cd8 t - cells have been found to be associated mostly with the relapsing remitting form of the disease rather than the progressive form . Moreover, cd8 t - cells induced by glatiramer acetate vaccination appear to be restricted to hla - e and have immunomodulatory capacities, resulting in amelioration of ms [5759]. Hla - e restricted cd8 t - cells in patients with ms appeared phenotypically different from healthy controls; however these t - cells were selected based on the expression of nkg2c and thus may reflect only a small subset of hla - e restricted t - cells . In rheumatoid arthritis (ra), limited information is available, although hla - e polymorphisms may be associated with disease susceptibility and treatment responsiveness . Interestingly and similar to the studies in ms, ra like autoimmunity can be strongly inhibited by induction of (self hsp60) peptide specific qa-1 restricted suppressor t - cells in mice . Furthermore, there is a defect in cd8 t - cell recognition of hla - e / hsp60sp in patients with type i diabetes . Thus, mhc - e restricted cd8 t - cells with immunoregulatory properties may be critical in amelioration of autoimmune diseases and deserve further detailed characterization . Surprisingly, little information is available on the phenotype and function of human cd8t - cells recognizing peptides presented by hla - e . In many studies, hla - e restricted t - cells have only been enumerated using tetramer staining, or the presence of hla - e reactivity was demonstrated using cytolytic assays (table 2). Analyses of the tcr composition were only performed in a limited number of studies and, as mentioned above, found consistent selection of trav14 (v16) in cmv specific tcrs . Basic descriptive information of hla - e restricted t - cells, such as memory phenotype, is also largely lacking . The limited data that have been published do not suggest specific memory stages to be overrepresented among hla - e restricted cd8t - cell populations, since both cd45ra positive and negative populations were identified, as was also reported for ccr7 (table 2). Generally, the t - cells reported expressed cytolytic molecules, but in some cases these were weakly expressed or even undetectable (table 2). Specific target cell lysis was frequently used as read out to demonstrate hla - e restriction of cd8 t - cells . Recently, we demonstrated for the first time that hla - e restricted cd8 t - cell clones had antibacterial activity against mtb, considered to be an important property in immune control of intracellular pathogens (table 2). Other studies have not assessed or reported viral or bacterial inhibition following hla - e restricted cd8 t - cell activation or downstream target cell lysis . It will be of interest to identify the mechanism of control of intracellular outgrowth of mtb, as this could be a yet unknown component of the immune system that could be harnessed for preventive or therapeutic interventions . Cytokine production has been analysed in detail only in the most recent series of papers . Originally, studies focused on the production of classical th1 cytokines, such as ifn and tnf, and although sometimes detected in hla - e restricted t - cells, not all produced ifn in response to specific peptide stimulation (table 2). As mentioned above, we recently found mtb specific hla - e restricted cd8 t - cells to produce th2 rather than th1 cytokines and demonstrated that these cells utilize il-4 to activate b - cells (table 2). It would be interesting and relevant to investigate th2 cytokine production also in hla - e restricted cd8 t - cells in response to other ligands . Moreover, an analysis of transcription factor expression in hla - e restricted cd8 t - cells has been limited thus far to our description of mtb specific t - cells expressing gata-3 (table 2). One of the major differences between innate and adaptive immunity is the formation of immunological memory during adaptive immune responses . As hla - e restricted cd8 t - cells are activated through their tcr, in an antigen specific manner, it is likely that they also differentiate into memory cells . The formation of memory cells following hla - e mediated antigen presentation would be an important prerequisite for successful application of these peptides in future vaccination strategies . Phenotypically, effector memory and effector memory recently activated [38, 41] have been described as indicators of memory . Moreover, screening for recognition of hla - e restricted mtb peptides by human donors showed recognition only in donors that had been sensitized by mycobacteria (as measured by ppd recognition), suggesting that in vivo priming, and thus memory induction, was critical . Vaccination of healthy volunteers with a single dose of s. typhi strain ty21a resulted in antigen specific, hla - e restricted cd8 t - cells that were detectable up to 2 years after vaccination, suggesting that hla - e restricted memory t - cells had been induced . Also, individuals with latent tb and individuals successfully treated for tb disease still had circulating cd8 t - cells binding to hla - e tetramers (tm) loaded with mtb peptides (notwithstanding that the frequencies detected were highest in patients with active tb disease); the persistence of responses after microbiological cure thus also suggests immune memory . The murine homologue of human hla - e is qa-1, which also presents signal sequences from mhc class i proteins that are called qdm (qa-1 determinant modifier). However, also specific recognition of qa-1 peptide complexes by t - cells has been described . Interestingly, similar to hla - e, qa-1 restricted t - cells have been isolated that are able to detect differences in leader - sequenced derived peptides between mouse strains, although there is no indication they are involved in immunity to mouse cmv . Also, similar to hla - e, qa-1 restricted t - cells have been implicated in immunity to pathogens, including listeria monocytogenes and salmonella typhimurium . Qa-1 restricted s. typhimurium specific t - cells are curiously cross - reactive to self hsp-60 derived peptides and thus have been implicated in autoimmune conditions . Furthermore, there is a large and older body of research focusing on qa-1 restricted suppressor cd8 t - cells . These t - cells reportedly recognize qa-1 in a tcr dependent manner and act to suppress autoreactive cd4 t - cells, thereby attenuating the development of autoimmune encephalomyelitis (a mouse model of multiple sclerosis), very similar to the role of hla - e restricted cd8 t - cells evoked by vaccination in human ms [6769]. In this model, qa-1 deficient mice developed exaggerated secondary cd4 responses, as a result of the lack of a population of regulatory cd8 t - cells, demonstrating the in vivo significance of suppressor qa-1 restricted t - cells . Their role in infectious diseases and in particular in the elimination of pathogens has not been studied in great detail thus far . Moreover, a detailed description of the phenotype and function of these cells is lacking and warrants further investigation . Hla - e plays a dual role in the innate and adaptive immune system (figure 1). The low polymorphism in hla - e in conjunction with its relative insensitivity to downregulation by, for example, hiv, makes hla - e an interesting target for vaccination strategies against infectious diseases and tumors . Small sets of peptides should suffice to induce t - cells recognizing foreign antigens and mount effector responses . The quality of these t - cell responses needs further investigation, however, given the diversity in functions that have been described thus far, ranging from cytotoxicity and pathogen control to immune suppression . Various pathogen - derived antigens can bind and stabilize hla - e at the cell surface, for some of which this may be an essential mechanism to prevent nk mediated target cell lysis . However, many of these antigens can also be recognized in a tcr dependent manner by cd8 t - cells . These t - cells may suppress bystander t - cells or lyse (infected) target cells and inhibit intracellular bacteria, indicating an important functional contribution to the immune response . Nevertheless, the relative frequency of hla - e restricted t - cells and their in vivo relevance in many cases remains unknown and unstudied . Although these t - cells are donor - unrestricted, they in many aspects display similar functionalities to classical, conventional t - cells . Pathogen specific hla - e restricted cd8 t - cells are an interesting new player in the field of immunology . Future work should address their exact roles and relative contributions in the immune response against infectious diseases. |
Clonal proliferation of histiocytes was reported in langerhans cell histiocytosis (lch) by willman et al . In 1994 (1). Langerhans cells are a type of nonlymphoid mononuclear cells involved in inflammatory responses and also in neoplastic processes . They are immature dendritic cells which express lysosomal enzymes cd1a and s-100 protein and ultrastructurally contain racket shaped organelles of birbeck granules (2). The etiology is unknown; however, environmental agents and viruses, especially epstein - barr virus (ebv), or vaccination, have been proposed to play a role in the pathogenesis of lch (3, 4). The role of ebv as the etiologic agent of several malignancies is known and herpes viruses are shown to be responsible for persistent infection (5, 6). In addition, ebv and cytomegalovirus (cmv) are considered to be responsible for hemophagocytic syndromes in human with several inherited immunodeficiencies (7, 8). One study showed 30% positivity for cmv in lch (9); however, others have failed to show any association with adenovirus, cytomegalovirus, epstein - barr virus, herpes simplex virus, human herpes virus type 6, human immunodeficiency virus, human t - cell leukemia virus types i and ii, and parvovirus using pcr (10 - 12). In this study, we have investigated the presence of cmv in lch by qualitative pcr method . Formalin - fixed, paraffin - embedded (ffpe) tissue samples of 30 patients with pathologic diagnosis of lch were extracted from archive of pathology department of mofid children s hospital in tehran (one of the referral centers from all over the country) for a ten year period (2002 to 2012). The diagnosis of lch was made by a pediatric pathologist, using the histological criteria mentioned in the pathology textbooks, i.e. Granulomas composed of langerhans cells with typical grooved nuclei mixed with eosinophils and other inflammatory cells . The diagnoses were confirmed using immunohistochemical technique for cd1a, s-100 protein and cd68 when available . Thirty tissue samples with non lch diagnoses were also selected (between the years 2002 and 2012) as age and site - matched controls to lch cases . Paraffin was removed from the ffpe samples after undergoing xylene treatment, followed by two washes with pure ethanol . Total dna was extracted from the air - dried pellet tissues according to the rtp dna / rna virus mini kit procedure (stratec molecular, berlin, germany). The extracted nucleic acid was stored at -20c until it underwent pcr . To assess the quality of the extracted genome, as well as inhibition of pcr test, all extracted and stored nucleic acid underwent beta - globin pcr, using the pco3/pco4 primer set, as described previously with modifications in method (13). The beta - globin pcr was performed in syber green real - time pcr - melting curve format (figure 1). To detect cmv, real - time pcr was performed using envelope glycoprotein b (gpul55) gene primer sets amplifying 116 bp gene region of the virus genome (cmv - r; 5-aagtacccctatcgcgtgtg-3), cmv - f; 5-atgatgccctcrtccargtc -3, with an internal probe, cmv - p; 5-fam - tggcccagggtacggatcttattcg - bhq1 - 3) (14). Amplification of cmv gpul55 genes was performed in reaction volumes of 20 l under the following conditions: first the samples underwent denaturation at 94c for 10 minutes, followed by denaturation at 94c for 10 seconds, followed by annealing and extension at 60c for one minute, 50 cycles (figure 2). Real - time pcr system cfx-96 (bio - rad, usa) with hs prime taq premix taqman reagent (genetbio, korea) was used in real - time pcr assay . The limit detection of 5 genome copies of cmv per reaction was determined by the real - time assay, using the serial dilutions of amplirun cytomegalovirus dna control (vircell, spain). The graph shows that the melting temperature of beta - globin pcr product is around 82.5c . The achieved data were compared by chi - square (or fisher s exact test if appropriate). P value of less than 0.05 was considered to indicate statistical significance . In this study, no ethical issues were involved; only the pathology reports were reviewed retrospectively, and the patients were anonymous . Formalin - fixed, paraffin - embedded (ffpe) tissue samples of 30 patients with pathologic diagnosis of lch were extracted from archive of pathology department of mofid children s hospital in tehran (one of the referral centers from all over the country) for a ten year period (2002 to 2012). The diagnosis of lch was made by a pediatric pathologist, using the histological criteria mentioned in the pathology textbooks, i.e. Granulomas composed of langerhans cells with typical grooved nuclei mixed with eosinophils and other inflammatory cells . The diagnoses were confirmed using immunohistochemical technique for cd1a, s-100 protein and cd68 when available . Thirty tissue samples with non lch diagnoses were also selected (between the years 2002 and 2012) as age and site - matched controls to lch cases . Paraffin was removed from the ffpe samples after undergoing xylene treatment, followed by two washes with pure ethanol . Total dna was extracted from the air - dried pellet tissues according to the rtp dna / rna virus mini kit procedure (stratec molecular, berlin, germany). To assess the quality of the extracted genome, as well as inhibition of pcr test, all extracted and stored nucleic acid underwent beta - globin pcr, using the pco3/pco4 primer set, as described previously with modifications in method (13). The beta - globin pcr was performed in syber green real - time pcr - melting curve format (figure 1). To detect cmv, real - time pcr was performed using envelope glycoprotein b (gpul55) gene primer sets amplifying 116 bp gene region of the virus genome (cmv - r; 5-aagtacccctatcgcgtgtg-3), cmv - f; 5-atgatgccctcrtccargtc -3, with an internal probe, cmv - p; 5-fam - tggcccagggtacggatcttattcg - bhq1 - 3) (14). Amplification of cmv gpul55 genes was performed in reaction volumes of 20 l under the following conditions: first the samples underwent denaturation at 94c for 10 minutes, followed by denaturation at 94c for 10 seconds, followed by annealing and extension at 60c for one minute, 50 cycles (figure 2). Real - time pcr system cfx-96 (bio - rad, usa) with hs prime taq premix taqman reagent (genetbio, korea) was used in real - time pcr assay . The limit detection of 5 genome copies of cmv per reaction was determined by the real - time assay, using the serial dilutions of amplirun cytomegalovirus dna control (vircell, spain). The graph shows that the melting temperature of beta - globin pcr product is around 82.5c . The achieved data were compared by chi - square (or fisher s exact test if appropriate). P value of less than 0.05 was considered to indicate statistical significance . In this study, no ethical issues were involved; only the pathology reports were reviewed retrospectively, and the patients were anonymous . All patients were iranians (16 males and 14 females) and the age ranged 2 months to 10 years . Thirty tissue samples with non lch diagnoses were also selected as controls which were age and site - matched to lch cases . Cmv dna was detected in only 2 (6.66%) lch patients out of 30 cases (positive results in 6.66% and negative results in 93.34%). In control group, we detected cmv virus in 1(3.3%) sample out of a total of 30 cases (positive results in 3.3% and negative results in 96.7% of controls) with a p value of 1.00 (1.00> 0.05) and or: 2.07; 95% ci of or: 0.18 - 24.15 which shows no significant difference in cmv prevalence results between lch patients and controls . The lch patients with positive result for cmv expression were a 2 year old boy with frontal bone lesion and a 1 year old girl with chest skin lesion; the positive control was in a 6 year - old boy with skin biopsy diagnosed as pilonidal fistula . Lch is a rare disease involving clonal proliferation of bone marrow derived langerhans cells which mostly affects children, particularly children younger than 5 years with an incidence of about 5 per 1,000,000 (2). Clinically, there are three overlapping clinical syndromes including multifocal multisystemic lch (letterer - siwe syndrome), multifocal unisystemic lch (hand - schuller - christian syndrome) and unifocal lch (solitary eosinophilic granuloma) (2). Histologically, the findings are the same in various tissues, characterized by granulomas composed of a mixture of langerhans cells, macrophages, eosinophils, multinucleated giant cells and lymphocytes (15, 16). Most adult patients with lung involvement usually have an indolent course of regress, whereas children need to be treated (17 - 20). (9) detected cmv in lesional langerhans cells in 30% of 29 patients by immunochemistry, in situ hybridization, and pcr, indicating that release of cytokines stimulates langerhans cell growth and induction of lch . (10), however, did not support the hypothesis of the role of ebv, cmv, or hhv-6, in the pathogenesis of lch in their study . (11) also failed to find evidence of genomes for adenovirus, cmv, ebv, hsv, hhv-6, human immunodeficiency virus, human t - cell leukemia virus types i and ii, and parvovirus in 56 cases of lch employing in situ hybridization and pcr technique . We detected cmv dna in only 2 patients with lch (positive results in 6.66% and negative results in 93.34%). Only one in our control group had cmv virus (positive results in 3.3% and negative results in 96.7% of controls), which could be attributed to a coincidence . The p value of 1.00 (1.00> 0.05) and or: 2.07; 95% ci of or: 0.18 - 24.15 indicates no significant difference in cmv prevalence results between lch patients and controls . This is in keeping with some other results reported in the literature (10, 12). In previous studies (9 - 12) authors declared no limitations and the methods used included serology, immunochemistry, in situ hybridization, and pcr . However, immunochemistry and in situ hybridization for cmv were not available to be employed in our study and the patients were not checked for the evidence of cmv infection serologically (limitations in our study). Our study is the first study performed in iran on this subject and does not support the hypothesis of a role for cmv in the pathogenesis of lch, in concordance with some other studies in the literature (10 - 12). Our study is the first study performed in iran on this subject and does not support the hypothesis of a role for cmv in the pathogenesis of lch, in concordance with some other studies in the literature (10 - 12). |
Glucocorticoids (gcs) are among the most effective drugs used in the treatment of hematopoietic malignancies of the lymphoid lineage in virtue of their ability to induce apoptosis of these cancerous cells [13]. The main hematopoietic cancer types that respond well to gc therapy include t acute lymphoblastic leukemia (t - all), chronic b lymphocytic leukemia (cll), multiple myeloma (mm), hodgkin's lymphoma (hl), and non - hodgkin's lymphoma (nhl). Gcs appear, however, to have little value in the treatment of acute or chronic myeloid leukemia (aml / cml). A major drawback of gc therapy is the gradual development of resistance to gc during treatment that limits the clinical utility of this drug . Poor response to a 7-day monotherapy with the gc prednisone is one of the strongest predictors of adverse outcomes in the treatment of pediatric all [2, 4]. A great challenge today is to develop strategies that can overcome the drug resistant phenotype . For this purpose it is important to understand the underlying mechanisms of gc resistance and the signaling pathways regulating apoptosis induced by gcs . Besides inducing apoptosis of lymphoid cells, gcs gc treatment produces rapid symptomatic improvements, including relief of fever, sweats, lethargy, weakness, and other nonspecific effects of cancer.gcs decrease the severity of chemotherapy - induced emesis . Gcs are also used in the clinics for other medical conditions such as autoimmune diseases, asthma, ulcerative colitis, chronic obstructive pulmonary disease, kidney diseases, and rheumatologic disorders due to their strong anti - inflammatory and immunosuppressive properties . Gc therapy is hampered by a variety of metabolic and medical complications, including insulin resistance, diabetes, hypertension, glaucoma, osteoporosis, and osteonecrosis with increased risk of bone fractures [510]. Diabetes may develop by direct gc - mediated induction of apoptosis in insulin - producing beta cells of the langerhans islets [1113], and osteoporosis may develop due to apoptosis of osteoblasts [1416]. Gcs also suppress cell growth and proliferation processes in the brain [17, 18]. Besides being used as monotherapy at high dosages, gcs are frequently combined with other chemotherapeutic drugs to achieve rapid and more efficient therapeutic effects . For the treatment of t - all, gcs such as prednisone, methylprednisolone, and dexamethasone are usually used in combination with other chemotherapeutic drugs such as vincristine, daunorubicine, l - asparaginase, cytosine arabinoside, doxorubicin, and cyclophosphamide . This multidrug regimen prolongs remission, minimizes the long - term use of prednisone, and thus reduces the steroid - mediated adverse effects . Typical b - cell chronic lymphocytic leukemia (cll) in the early stage of progression responds well to combination chemotherapy including an alkylating agent (such as chlorambucil) plus or minus prednisolone.advanced stages of the disease often require the addition of an anthracycline and a vinca alkaloid for successful therapy . One commonly used combination is cyclophosphamide, doxorubicin, vincristine, and prednisolone, a drug combination termed chop . Rituximab, a chimeric monoclonal antibody directed against the b - cell specific antigen cd20, is often added to the therapy, which is here termed r - chop . Rituximab is also combined with fludarabine and cyclophosphamide in the treatment of cll [19, 20]. Another antibody proved to be efficient against cll in combination with methylprednisolone is alemtuzumab, which targets cd52 . The immunomodulatory drug lenalidomide shows also good activity in relapse / refractory or treatment - nave cll [23, 24]. Chop is also used for non - hodgkin's lymphomas and anaplastic large cell lymphoma (alcl)., prednisone has been used in combination with carmustine, vincristine (oncovin), procarbazine (mopp), and rituximab . Recently, brentuximab vedotin (adcetris), an antibody directed towards cd30 conjugated with the anti - tubulin chemotherapeutic agent monomethyl auristatin e, has been approved for the treatment of hodgkin's lymphoma and systemic anaplastic large cell lymphoma . Cd30 expression is restricted to only a relative small population of activated t and b cells, and therefore this treatment is expected to be more selective for cd30-positive tumor cells . Another monoclonal antibody entered the clinics is epratuzumab, which targets cd22 and is proved to be efficient in the treatment of adult non - hodgkin's lymphoma as a single agent or in combination with chemotherapy . A phase ii clinical trial showed that combining epratuzumab with rituximab and chop (er - chop) may have a favorable response on diffusing large b - cell non - hodgkin lymphoma (dlbcl). Multiple myeloma (mm) has frequently been treated with vincristine, doxorubicine (adriamycin), and dexamethasone (vad) or prednisone / melphalan . Bortezomib (velcade), lenalidomide, and to a lesser extend thalidomide have proven efficient in the treatment of mm in combination with dexamethasone . Lenalidomide is a 4-amino - glutamyl analogue of thalidomide that lacks the neurological side effects of thalidomide and has emerged as a drug with activity against various hematological malignancies [27, 28]. Bortezomib is a selective inhibitor of the 26s proteasome that stabilizes many cell cycle - regulatory proteins . The antitumor effects of bortezomib in lymphoid tumors have been attributed to nfb inhibition through stabilization of its inhibitor ib . Other tumors that have been treated with combination chemotherapy involving a gc include medulloblastoma, primitive neuroectodermal tumors, and ependymomas . One major obstacle in the therapy of lymphoid malignancies is the appearance of gc resistant cells . Drug resistance may occur at the level of the glucocorticoid receptor (gr) or through alterations in downstream regulatory pathways . In most gc - resistant all primary biopsy specimens, gr was found to be functional, suggesting that pharmacological intervention may restore drug sensitivity . Several strategies have been developed that aim to overcome drug resistance through specifically targeting anti - apoptotic pathways . Gc resistance may occur due to overexpression of anti - apoptotic proteins of the bcl-2 superfamily [30, 31]. Among these, small molecules that target the anti - apoptotic proteins of the bcl-2 family are attractive drugs that should be able to overcome gc resistance . One example is abt-737, a bh3 mimetic that inhibits the pro - survival function of bcl-2, bcl - xl, and bcl - w and induces apoptosis in a variety of cancer cell types including leukemias [3335]. Treatment of the lymphoma - prone e-myc transgenic mice with abt-737 prevented the development of myc - driven lymphomagenesis, understating the need for these anti - apoptotic proteins . Combined use of abt-737 and the dual specificity pi3k / mtor inhibitor pi-103 led to loss of c - myc expression and apoptosis of burkitt's lymphoma cells, whose tumorigenicity is driven by overexpression of the c - myc gene . The pro - apoptotic effect of abt-737 in cll depends on sufficient amount of bcl-2 that tonically sequesters the pro - apoptotic bim protein . Also, the sensitivity of lymphoma cell lines to bcl-2 antagonism is directly related to the amount of bcl-2 primed with bim . The sequestration of bim may explain the marked chemosensitivity of cll and follicular lymphoma (fl) that express abundant bcl-2 abt-737 potentiated the effect of vincristine, dexamethasone, and l - asparaginase (vxl) treatment on all cells and could potentiate the effect of the vxl combination in chemoresistant human primary all xenografts . This study also shows a synergistic effect between the three components of the vxl regimen . An additive effect was observed in primary mm cells when abt-737 was combined with dexamethasone [41, 42]. Abt-263 (navitoclax) is a second generation, orally bioavailable small molecule bcl-2 family protein inhibitor that has entered clinical trials with promising efficacy on cll [4346]. Abt-263 has been shown to have synergistic effects with r - chop treatment on mantle cell lymphoma . The pro - apoptotic bim that is displaced from bcl-2 by abt-737, becomes captured by either bfl-1 or mcl-1 . The resistance could be overcome by decreasing the mcl-1 level with the cyclin - dependent kinase (cdk) inhibitors flavopiridol and pha767491, or by inhibiting mtor complex 1 (mtorc1) or glycolysis [49, 50]. Another approach to overcome mcl-1-dependent resistance is to use the small molecule obatoclax (gx15 - 070) that has entered clinical trials in the combined treatment of various hematopoietic neoplasms [5153]. Obatoclax disrupts the interaction between mcl-1 and its pro - apoptotic counterparts including bak, bax, and noxa [54, 55]. Obatoclax and flavopiridol synergized in overcoming drug resistance in human myeloma cells through a mechanism involving bim and noxa . The multikinase inhibitor sorafenib could synergize with obatoclax in inducing apoptosis in acute myeloid leukemia (aml) through downregulating mcl-1 . Obatoclax could overcome gc resistance in all through induction of apoptosis and autophagy, an effect that depends on the pro - apoptotic bak and to a certain extent also on beclin-1 [58, 59], a mammalian orthologue of yeast atg6 that plays a central role in autophagy . Under certain conditions, cell death induced by obatoclax and gc may be executed in the absence of both bax and bak . Under these conditions, necroptosis ensues necroptosis ensues, a process mediated by rip-1 (receptor - interacting protein-1) kinase and the cylindromatosis deubiquitinase cyld . It may promote either cell death or cell survival dependent on its ubiquitinated state, which is regulated by cyld and a20, two nfb target genes . Altogether, there is a general consensus that obatoclax might be a favorable drug that ought to be combined with dexamethasone / prednisone and/or rapamycin to overcome gc resistance in all cells and other hematological lymphoid malignancies . 1.2.1.3 . Overcoming bcl-2-mediated resistance with small molecular inhibitors of xiap (x - linked inhibitor of apoptosis). Bcl-2-mediated resistance in cll may also be overcome by small molecular inhibitors of the anti - apoptotic xiap (x - linked inhibitor of apoptosis) when exposed to trail [62, 63]. Xiap and the cellular ciaps 1 and 2 are expressed at high levels in cll cells [62, 63]. Xiap inhibitors enhanced bcl-2 cleavage and induced a conformational change in bax . Similarly, xiap inhibitors sensitized all for cd95-induced apoptosis . In patients with t - all, xiap inhibition using the low - molecular - weight smac mimetic lbw242 resulted in increased prednisone - induced apoptosis in vitro . Another anti - apoptotic protein that negatively regulates gc - induced apoptosis is notch1 [6668]. Notch1 is indispensable for normal t - cell development [6971] and is an attractive target in the treatment of hematopoietic malignancies of the t lineage . Mice transplanted with bone marrow cells transduced with a constitutively active form of notch1 develop t - cell neoplasms, while mice transgenic for constitutively active form of notch3 develop thymic lymphomas . Acute lymphoblastic t - cell leukemia is frequently associated with increased notch signaling [7579], which may be caused by the chromosomal translocation t(7; 9)(q34; q34.3), gain - of - function mutations of notch1, and/or mutations in fbw7 (f - box and wd repeat domain - containing 7), a negative regulator of notch1 . One approach to avoid notch activation is to prevent its cleavage by the -secretase complex using -secretase inhibitors (gsi). Rather, gsi can enhance the pro - apoptotic effect of gcs and other chemotherapeutic agents including the mtor inhibitor rapamycin [84, 88]. Gsi does not overcome gc resistance in t - all deficient for pten [89, 90], supposedly due to elevated akt activity . The constitutive akt activation in the absence of pten leads to increased glucose metabolism and bypasses the requirement of notch signaling to sustain cell growth . In this context it should be noted that notch1 by itself may upregulate the p13k / akt pathway via its target gene hes1 . As pten is a target of several micrornas that are often expressed abnormally in cancer (see section 2.4.2.3), resistance to gsi may be far more prevalent . Nevertheless, gsi compounds, such as pf-03084014, have entered clinical trials for refractory t - all . Preclinical data do show a synergistic effect between gsi inhibition and gc in reducing xenografted t - all tumor burden . Another concern associated with the clinical use of gsis is severe toxicity to various organs at therapeutic doses, which may be explained by the broad action of notch1 as well as -secretase on various biological systems . The simultaneous use of gcs may prevent the gsi - induced gastrointestinal toxicity via inhibition of goblet cell metaplasia . A more specific inhibition of notch1 can be achieved by the sahm1 peptide that prevents notch - mediated transcription by interfering with the mastermind - notch interaction essential for notch - mediated transcription of target genes . The effect of this peptide on gc sensitivity awaits examination as well as its toxicity . Since notch signaling is intertwined with the pi3k / akt / mtor signaling axis [9496], the inhibition of the latter has proven to be more efficient in overcoming gc resistance (see section 1.2.3) and would be a better therapeutic choice . Accumulating data show that gc therapy can affect the activity of several protein kinases, and, vice versa, many protein kinases can affect gc - induced apoptosis [30, 31, 9799]. The mtor signaling pathway is frequently activated and found to be essential for cell growth and survival in lymphoid malignancies [100106]. Gc resistance frequently appears in malignant cells due to aberrant activation of various protein kinases that exert anti - apoptotic effects [30, 31, 67, 97, 107109]. One strategy to overcome gc resistance would be to prevent the activities of the pi3k / akt / mtor, mek1/erk1/2, and other activated protein kinase pathways . The mtor inhibitor rapamycin especially has proven efficient in sensitizing human gc - resistant t - all, b - all, mm, and npm - alk (nucleophosmin - anaplastic lymphoma kinase)-dlbcl to gc - induced apoptosis [110117]. The combinatory therapy of rapamycin with dexamethasone was proven to be effective also in pten - negative cells . A lower dose of dexamethasone was sufficient for reducing t - all burden in a xenograft model when used together with rapamycin . One major drawback with rapamycin therapy is its immunosuppressive function, which adds to the immunosuppressive function of gcs . The dual pi3k / mtor inhibitor nvp - bez235 synergistically enhanced cytotoxicity of dexamethasone, doxorubicine, and cytosine arabinoside (arac), even in gc - resistant all cells . The broad - acting protein kinase staurosporine was especially effective in overcoming gc resistance in mouse lymphomas that overexpressed notch-1, bcl-2, and/or bcl - xl . This sensitization was achieved through prevention of akt - mediated inhibition of gsk3 and induction of the pro - apoptotic nur77 . However, staurosporine was less effective on human t - all cell lines (unpublished data), which could rather be sensitized to gc by rapamycin . In order to choose the right kinase inhibitor for combinatory therapy, the cyclin - dependent kinase (cdk) inhibitors flavopiridol (alvocidib), bms-387032 (sns-032), sunitinib, and sorafenib are currently under clinical trials for relapsed / refractory cll . These include vandetanib (zd6474), bosutinib (ski-606), tki258 (chir-258), pazopanib (gw786034), and axitinib (ag013736). Chir-258, a potent inhibitor of flt3 (fms - like tyrosine kinase receptor-3), c - kit tyrosine kinase, and fibroblast growth factor receptor 3 (fgfr3), prevented cell growth of fgfr3-positive human multiple myeloma cell lines and augmented their sensitivity to gc - induced apoptosis . Importantly, neither interleukin-6 (il-6) nor stromal cells conferred resistance to chir-258 . Other protein kinase inhibitors with more cell - type specific effects have been developed, which are expected to have less adverse effects . The classical example for efficient use of a specific protein kinase inhibitor in the clinics is the bcr - abl kinase inhibitor sti-572 (imatinib) used for the treatment of chronic myelogenic leukemia (cml). A similar strong response of a single agent was observed in alk - anaplastic large cell lymphoma (alcl) patients treated with crizotinib, an inhibitor of the alk tyrosine kinase . Another promising target is the b - cell receptor (bcr) signaling, which is important during b - cell oncogenesis and is a key to the survival of malignant b cells, including cll and dlbcl [125, 126]. The survival of dlbcl may depend on the nonligand - dependent (tonic) signals from the bcr . The bcr signaling can be targeted with small molecular inhibitors directed against bruton's tyrosine kinase (btk), spleen tyrosine kinase (syk), or phosphoinositide 3-kinase (pi3k) isoform p110 (pi3k), all being efficient in the treatment of cll . Targeting btk with the inhibitor pci-32765 leads to disruption of bcr signaling and was effective in a preclinical model of b cell non - hodgin's lymphoma [127, 128]. Pci-32765 seems also to be promising for the treatment of cll [128131] and mm . Importantly, pci-32765 induced apoptosis in cll cells even in the presence of various exogenous stimuli, including cd40l, baff, il-6, and il-4 and when cultivated together with stromal cells . Two other btk inhibitors, ibrutinib and avl-263, are also under investigation for cll . The syk (spleen tyrosine kinase) inhibitor fostamatinib had clinical activity in non - hodgkin lymphoma and cll . Syk is a cytoplasmic tyrosine kinase that is important for immunoreceptor signaling in b cells . Syk has also been shown to be critical for the survival and maintenance of mature normal and malignant b cells [125, 134] and is frequently expressed at high levels in follicular lymphoma . The pi3k inhibitor gs-1101 (cal-101) had preclinical and clinical activity against cll, mantle cell lymphoma, and mm [121, 129, 136138]. While the pi3k and isoforms are ubiquitously expressed, pi3k expression is largely restricted to hematopoietic cells, where it plays a role in b - cell homeostasis and function . The effect of the btk, syk, and pi3k kinase inhibitors on the sensitivity to gcs warrants investigations . Accordi et al . Found aberrant activation of protein kinases in poor prognosis pediatric b - cell precursor - all patients . The p56 (lymphocyte cell - specific tyrosine kinase) activity was enhanced in patients with poor clinical response to prednisone with respect to those with good response . P56 is a nonreceptor tyrosine kinase of the src oncogene family mostly expressed in t cells where it plays an essential role in activation and development, and in some b cells . Its activity is negatively regulated by the membrane - bound tyrosine kinase csk (c - src tyrosine kinase). The p56 inhibitor dasatinib (bms-354825) was shown to enhance apoptosis induction by dexamethasone in otherwise gc - resistant cll cells . This finding concurs with the observation by sade et al . Showing that notch - mediated resistance of a mouse lymphoma cell line a synergistic effect was observed between the aurora a kinase inhibitor mnl8237 (alisertib) and dexamethasone . Ampk (amp activated protein kinase) activation has a dual effect on cell death and survival, which contextually depends on signaling alterations with related oncogenic pathways . However, in all and cll, activation of ampk by aicar (5-aminoimidazole-4-carboxamide riboside or acadesine), a cell - permeable nucleotide, induces growth inhibition and apoptosis [146148]. However, aicar prevented glucocorticoid - induced apoptosis and thus cannot be combined with steroids in the treatment of lymphoid malignancies . Of note, inhibition of either bcl-2 family members, notch1, or the akt / mtor survival pathways was independently sufficient for sensitizing resistant cells to gc, suggesting a tight crosstalk between these pathways, interruption of one of them being sufficient for abrogating the resistant phenotype . However, it is likely that using a combination of these three strategies together with gc should lead to a more efficient therapy, which may require lower dosages with reduced adverse effects . In order to develop strategies to overcome gc resistance, it is essential to understand the signaling network regulating gc - induced apoptosis . Main factors affecting the response to gc include the basal and inducible gr expression levels, the induction of and basal expression of genes involved in the intrinsic apoptotic pathway, the ability of gr to translocate to the mitochondria, the activity of gsk3 (glycogen synthase kinase 3), the general protein kinase activation profile of the cell prior to and following gc therapy, the expression profile of anti - apoptotic proteins, and the activities of pro - survival signaling pathways . The main traits will only be briefly described here as these have been extensively reviewed elsewhere [30, 31, 99, 150153], and the scope of this paper is to provide updated data with a specific focus on the microrna world that has emerged to comprise important regulators of most biological processes . Numerous factors have been shown to affect gc responsiveness by regulating glucocorticoid receptor (gr) activity and expression level . These include gr co - activators and corepressors [154, 155], gr splice variants [156159], gr isoforms [160, 161], and regulators of gc nucleocytoplasmic shuttle [162164]. The transcription of human gr is regulated by at least 11 different promoters (1a1, 1a2, 1a3, 1b, 1c, 1d, 1e, 1f, 1h, 1i, and 1j) [155, 165], seven of them being embedded in a highly enriched cpg island region subjected to methylation and harbor single nucleotide polymorphisms (snps) that affect their activity . Promoter 1a is involved in the upregulation of gr by gc in some kinds of t cells, while downregulated in other cell types [167169]. Gc resistance in primary pediatric t- and b - all could not be correlated with either basal or stimulated expression of the 1a-, 1b, or 1c transcripts . The gr expression level prior and following gc therapy affects drug responsiveness . The cellular response to gcs depends on sufficient gr expression [30, 171179], and resistance to gc therapy has been associated with downregulation and loss of gr expression in malignant plasma cells [180, 181]. However, most primary all cells showed upregulation of gr expression upon prednisolone treatment regardless of their phenotype or sensitivity to gc - induced apoptosis, suggesting that other factors are more dominant for conferring a gc - resistant phenotype in these cells [29, 170, 182184]. Many glucocorticoid - regulated genes (e.g., fkbp5 and socs1) were upregulated by dexamethasone in all primary all xenografts tested, suggesting for a functional gr in these leukemic cells . Also, beesley et al . Observed that receptor mutation is not a common mechanism of gc resistant in primary all . However, the minor c allele of rs10482605 (1c) has been associated with a higher complication rate in childhood all . A bcli polymorphism in the nr3c1 gene was associated with increased lymphocyte response to methylprednisolone . Also, initial good responder cells may develop resistance upon repeated gc dosages, a phenomenon that sometimes occurs due to downregulation of gr [156, 179, 188, 189]. Posttranslational modifications of gr are another way of regulating its target gene specificity and involve several cell - signaling cascades [30, 190, 191]. Gr can be phosphorylated at ser211 by cdks and p38 map kinase, and at ser226 by jnk . Phosphorylation of gr modulates its transcriptional activity, alters its protein stability and subcellular location [192195]. Gr phosphorylation appears to be cell - cycle dependent [196, 197] and may affect gc - sensitivity of t - all cells [98, 195]., gr is mostly located to the cytosol sequestered to heat - shock protein complexes [30, 162]. Following gc binding to gr, the receptor undergoes phosphorylation, dissociates from the heat - shock complexes, dimerizes, and translocates to the nucleus where it either promotes or represses a whole series of genes . Transcriptional activation is either directly mediated by binding of gr to glucocorticoid response elements (gres), or through interaction with other transcription factors such as forkhead transcription factors, thereby increasing their transcriptional activity on target genes . Gr may repress gene expression either through binding to negative gres (ngres) or through interaction with and inhibition of the transcription factors activating protein-1 (ap-1) and nfb . The o - glcnac transferase (ogt) was found to be involved in gc - mediated transrepression . Hundreds of genes are regulated by gcs [199203], and some genes are differentially regulated in gc - sensitive versus gc - resistant cells [29, 199, 204]. Of special importance is the induction of the pro - apoptotic bim (bh3-only b - cell lymphoma 2 (bcl-2) interacting mediator of cell death; or bcl2l11bcl-2-like apoptosis initiator-11) for achieving the propensity to undergo apoptosis in response to gc [29, 30, 67, 205208]. The central role of bim in gc - induced apoptosis is understated by the partial gc response of bim thymocytes, and gc resistance of lymphoma cells after knocking down bim [67, 207]. Bim is often expressed at high basal levels in lymphoid cells [30, 120, 209, 210], and in these cells there is no further need for upregulating bim in order to achieve an apoptotic response to gcs [30, 59]. However, in several t - all and b - all cells, an upregulation of bim in response to gcs is an absolute must, especially when the basal level is low . Bim was shown to be upregulated in gc - sensitive primary t - all samples, but not in resistant ones [29, 182]. Also, a comparison of established t - all cell lines, bim was upregulated in the sensitive ones only . When sufficient bim expression cannot be achieved, gc resistance pursued . A significantly lower bim expression was detected in high risk childhood all patients who exhibited slow early response to a standard 4-drug induction regimen compared with patients who responded rapidly . Homozygous deletion of bim has been seen in many mantle cell lymphomas and silencing of bim by promoter methylation and mutation is common in b - cell lymphomas . However, in pediatric all, no correlation between bim cpg methylation and gc resistance was found . Rather, gc resistance in primary pediatric all samples correlated with decreased histone h3 acetylation . The histone deacetylase inhibitor vorinostat relieved bim repression and exerted synergistic antileukemic efficacy with dexamethasone both in vitro and in vivo using a xenograft model . Bim has been shown to be a prognostic biomarker for early prednisolone response in pediatric all . Bim is a potent pro - apoptotic protein belonging to the bcl-2 protein family [215, 216]. Bim binds to the pro - survival proteins bcl-2, bcl - xl, and mcl-1, thereby allowing bax and bak to promote apoptosis . Bim may also directly bind to bax and bak, triggering a conformational change required for their subsequent oligomerization on the mitochondrial outer membrane . Bim appears in various alternative splice variants, which exhibit different intrinsic toxicities and modes of regulation . In gc - resistant primary cll, bim was upregulated by dexamethasone, but failed to activate bax and bak due to exclusive sequestration to bcl-2 . Bim may cooperate with the pro - apoptotic puma (p53 upregulated modulator of apoptosis) in mediating apoptosis induced by dexamethasone . In b - lymphoid cells, other pro - apoptotic members of the bcl-2 family that is not directly upregulated by gcs, but may contribute to the cell death response, include bid, bad, and noxa . Also the thioredoxin - interacting protein txnip (vdup1/tbp-2) has been shown to be upregulated by gc and could contribute to gc - induced apoptosis in one mouse lymphoma cell line . During gc monotherapy of childhood all, gc was found to repress the expression of the pro - apoptotic pmaip / noxa, which could be one mechanism leading to impaired gc sensitivity . Bam, is also induced by gcs in all cells, but its importance in gc - induced apoptosis is still not defined . Bim expression is tightly regulated both at the transcription and posttranscriptional levels [215, 218] (figure 1). Rather, gc - induced bim expression in lymphoid cells requires p38 activation and is mediated by the forkhead transcription factor foxo3a / fkhr - l1 . Foxo3a has also been shown to promote bim transcription in various other cellular systems [227229] and may cooperate with runx1 (runt - related transcription factor 1). Differential recruitment of foxo3a to the bim promoter was observed after dexamethasone treatment of gc - sensitive versus gc - resistant childhood all xenografts . Foxo3 was found to be an immediate early gr target, whose transcription is further enhanced by stimuli that activate the amp - activated protein kinase ampk . The activity of foxo transcription factors is tightly regulated, inhibited by akt and erk signaling, while promoted by p38 signaling [232236]. The ribosomal protein s6 kinase (rsk) activated downstream of erk1/2, phosphorylates bimel, providing a binding site for the f - box proteins beta - transducin repeat containing protein (trcp)1 and trcp2, which promote the polyubiquitination of bimel . The erk1/2-mediated phosphorylation of bimel at ser69 facilitates optimal phosphorylation by rsk at ser93, ser94, and ser98 and this motif serves as the binding sites for trcp1/2 . While erk1/2 lowers the affinity of bim for mcl-1 and bcl - xl and targets bim for degradation, phosphorylation of bim by jnk increases the pro - apoptotic activity of bim [240, 241]. Gcs may repress erk1/2 activity through upregulation of mitogen - activated protein kinase phosphatase 1 (mkp-1). Several drugs that inhibit the erk1/2 and pkb / akt pathways may facilitate upregulation of bim expression . Additional signals are required, such as simultaneous inhibition of the pkb / akt pathway or the downstream mammalian target of rapamycin (mtor) kinase . Apoptosis may be induced in a variety of all cells when cotreated with dexamethasone and a mek / erk inhibitor or an akt inhibitor [67, 108, 243]. Early studies by the thompson research group noticed that c - jun played a role in gc - induced apoptosis . An increase in c - jun was observed in gc - sensitive, but not gc - resistant t - all cell lines, while c - fos and jund were unaffected by the steroid . Chen et al . Reconfirmed that c - jun was upregulated by gcs in gc - sensitive, but not gc - resistant all cells . They further showed that c - jun is recruited to the ap-1 site of the bim promoter upon gc treatment . Another study showed that dexamethasone - induced bim expression was decreased in cells harboring a dominant - negative c - jun, suggesting a role for c - jun in the upregulation of bim . A p38 inhibitor prevented dexamethasone - induced expression of runx2, c - jun, and bim, suggesting that p38-mapk activation acts upstream to the induction of these three molecules . Another level of bim regulation is through micrornas . Bim transcription is repressed by the mir-17~92 microrna cluster, which, in turn, is repressed by gcs . Thus, one mechanism by which gcs upregulate bim is through repression of mir-17~92 . Of note, the mir-17~92 cluster is often overexpressed or amplified in human cancers [247252], thereby preventing the upregulation of bim required for an apoptotic response . Another microrna that suppresses bim expression is mir-26a, which is frequently upregulated in t - all patients . In gastric cancer, mir-106a~363 targets bim . The mir-106a~363 cluster located at chromosome xq26.2 is the paralogue of mir-17~92 and encodes for mir-363, mir-106a, and mir-20b . In hepatocellular carcinoma, mir-25 of the mir-106b~25 cluster targets bim . Also, the mir-106b~25 cluster, which includes mir-106b, mir-93 and mir-25, is a paralogue of the mir-17~92 cluster and located on chromosome 7 within the thirteenth intron of the protein - coding gene mcm7 . Also, the foxo transcription factors, important for bim upregulation, are regulated by micrornas (figure 2). Foxo1 and foxo3 transcripts might be targeted by mir-182 [258261], mir-1, mir-27a, mir-96, and mir-155 [263, 264]. Mir-155 plays a role in the activation and function of b and t lymphocytes [265, 266] (see section 3.1.6). Mir-182 expression was higher in gc - resistant cells in comparison to gc sensitive ones . Increased expression of mir-182 reduced total foxo3a expression in t - all cells with consequent lower bim expression . Foxo3a and bim increased upon downregulation of mir-182, suggesting that mir-182 is involved in conferring gc resistance . The expression of the mir-182~96~183 cluster was induced in splenocytes from mouse with experimental systemic lupus erythematosus (sle), suggesting a role of these micrornas in the breakdown of immunological tolerance and the manifestation of chronic autoimmune inflammation . This microrna cluster was also upregulated upon t - cell activation by an il-2-dependent manner . Prevention of the expression of the mir-182~96~183 cluster led to increased foxo1 expression and limited population expansion of activated t - helper cells, due to increased cell death . Vice versa, foxo3a was found to negatively regulate the oncomir mir-21, which may be one mechanism by which foxo3a regulates apoptosis . As mir-21 targets pten [269, 270], activation of foxo3 by gcs may be one mechanism responsible for the gc - induced reduction in akt activity . Besides function as a transcription factor in the nucleus, gr was found to translocate to the mitochondria in gc - sensitive, but not gc - resistant, lymphoma cell lines . Gr was also found to translocate to the mitochondria in gc - sensitive thymocytes [272, 273]. Although there is one paper describing an interaction between gr and bcl-2 in the mitochondria, gc - induced mitochondrial gr translocation in gc - sensitive thymocytes and lymphoma cells proceeded in the absence of bcl-2 . Exclusive overexpression of gr in the mitochondria was sufficient for inducing apoptosis, suggesting that mitochondrial gr may contribute to gc - induced apoptosis . Glucocorticoid treatment inhibited complex i and complex iii of the electron transport chain, and the mitochondria was found to be the primary source of h2o2 production required for gc - induced apoptosis of lymphoma cells [275, 276]. Gcs may interact with the mitochondrial thioredoxin trx2, a redox regulator, and directly modulate mitochondrial gene transcription . Several mitochondrial metabolite and protein transporters and two subunits of the atp synthase were downregulated in t - all and precursor b - all cells at the gene expression level by dexamethasone . These changes were observed in gc - sensitive, but not gc - resistant, cells . Corticosterone and other steroids were found to directly act on mitochondria to inhibit mitochondrial atp production by suppressing electron transfer from nadh to the electron transfer chain through complex i . The cellular protein kinase network (kinome) has critical influence on the gc sensitivity of lymphoid cells [30, 31, 97, 281]. Below, i will provide data supporting an involvement of gsk3 (glycogen synthase kinase 3) in gc - induced apoptosis, and the antagonism of its activity by protein kinases such as akt and mtor, which leads to gc resistance . The activity of gsk3 was found to be essential for gc - induced apoptosis [67, 282]. Gsk3 inhibitors prevented gc - induced apoptosis, and gc resistance frequently occurs through inhibition of gsk activity . Reactivating gsk3 by using inhibitors of the pi3k - akt or mtor pathways sensitized gc - resistant cells to gc - induced apoptosis [67, 108, 115, 116, 243, 283]. Gsk3 was found to interact with gr in the absence of ligand and released from gr following exposure to gc . Gsk3 also regulates gr transcriptional activity of bim, iap1 (inhibitor of apoptosis 1), and gilz (glucocorticoid - induced leucine zipper) [282, 284]. The pi3k / akt and mtor signaling pathways are frequently hyperactivated in gc - resistant t - all [104, 286, 287] and is associated with poor prognosis and chemotherapeutic resistance in pediatric b - precursor all . Mtor is a crucial regulator of cell metabolism, growth, and proliferation and mtor is positively regulated by pi3k / akt and notch1 [96, 289], while negatively regulated by the tuberous sclerosis tumor suppressor complex (tsc1/tsc2). Activation of mtor contributes to tumor cell survival in alk (anaplastic lymphoma kinase)-positive alcl (anaplastic large cell lymphoma), mantle cell lymphoma, childhood b - precursor all, t - all, and aml . Akt and mtor confer drug resistance by phosphorylating a series of targets [292, 293]. Phosphorylation and inactivation of gsk3 is a major cause for gc resistance that can be overcome by reactivating gsk3, for example, by akt inhibitors or mtor inhibitors . As mentioned in section 1.2.3, the mtor inhibitor rapamycin is efficient in overcoming gc resistance in various lymphoid malignancies . Gc resistance can also be overcome in akt - active lymphoma cells by inhibiting src members (e.g., by pp1), pi3k (e.g., wortmannin), or an akt inhibitor [67, 68]. Combination of gc with rapamycin or gc with obatoclax led to reduced akt phosphorylation at ser473, suggesting that mtor may also act upstream to akt . Gcs could also independent of other cytotoxic agents reduce mtor activity in lymphoid cells . Low - dose arsenic trioxide could sensitize gc - resistant all to dex through an akt - dependent pathway . Inhibition of mtor with rapamycin, which binds to fkbp12, leads to increased bim expression and overcomes ras - dependent survival signals . Synergy between mtor inhibitors (e.g., rapamycin (sirolimus) and cci-779 (temsirolimus)) and other chemotherapeutic agents has been observed in b- and t - lineage all cell lines and preclinical models [96, 298]. The akt activity is negatively regulated by pten (phosphatase and tensin homolog deleted on chromosome 10), a tumor suppressor gene that is suppressed, mutated, or deleted at high frequency in a large number of cancers . Pten mutations or deletions are frequent in t - all and pten deletions are associated with less favorable outcome in t - all [104, 300]. For instance, treatment of t - all with gamma secretase inhibitor (gsi) was only efficient if the cells expressed functional pten . One mechanism by which notch confers gc resistance is through pten inhibition leading to akt activation . Pten specifically catalyzes the dephosphorylation of 3-phosphate of the inositol ring in phosphatidylinositol (3,4,5)-triphosphate (pip3) resulting in the biphosphate product phosphatidyl (4,5)-biphosphate (pip2). Pip3 is a second messenger generated by pi3k that binds to the pleckstrin homology (ph) domain of akt, which allows its phosphorylation and activation by the 3-phosphoinositide - dependent protein kinase 1 (pdk1). Regulation of pten stability by phosphorylation and ubiquitination . Taken into account the important role of pten in determining drug sensitivity, pten expression has been attributed to epigenetic events such as promoter methylation [302, 303]. At the posttranslational level, phosphorylation and ubiquitination decrease pten protein levels, while oxidation and acetylation reduce pten activity . Rak phosphorylation of pten at tyr336 stabilizes the pten protein, while phosphorylation at thr366, ser370, ser380, thr382, and ser385 by casein kinase 2 (ck2) and gsk3 reduces its stability [305, 306]. Pten is regulated by the protooncogene ubiquitin ligase nedd4 - 1 (neural precursor cell expressed, developmentally downregulated 4) that promotes pten for proteasomal degradation . In multiple human cancer samples where the genetic background of pten was normal, but its protein level was low, nedd4 - 1 was highly expressed . Upon tcr / cd28 stimulation of t cells, pten undergoes inactivation by nedd4 - 1 . The association between pten and nedd4 could be impeded by the e3 ubiquitin ligase cbl - b (casitas - b - lineage lymphoma protein - b). Cbl - b t cells show elevated akt activity, which was abrogated by simultaneous deficiency in nedd4 . Pten is also negatively regulated by the anti - apoptotic xiap (x - linked inhibitor of apoptosis) that promotes pten for polyubiquitination and proteosomal degradation . Induction of apoptosis in b - cll by arsenic trioxide was shown to lead to activation of c - jun - nh2 terminal kinase (jnk), inactivation of akt and nfb, xiap downregulation, and pten upregulation . Two other e3 ligases downregulating pten include wwp2 (ww - domain containing protein-2 or aip-2, atrophin-1-interacting protein 2), and chip (chaperone - associated e3 ligase c terminus of hsc70-interacting protein). Pten expression can also be repressed by a range of micrornas including the mir-17~92 cluster [247, 248], mir-106b~25, mir-21, mir-26a [253, 315], mir-29b, mir-214 [317, 318], mir-216a and mir-217, mir-212, mir-221, and mir-222 (figure 3). Bcl-2 and bcl - xl are anti - apoptotic proteins residing in the mitochondrial outer membrane and in the endoplasmic reticulum . They prevent apoptosis of various chemotherapeutic drugs including gcs by capturing pro - apoptotic members of the bcl-2 superfamily, including bim, bax, and bak [215, 322, 323]. Bcl-2 may also regulate gene expression [324, 325], cell cycle [326328], activate erk1/2 [324, 329], and modulate the activities of transcription factors such as p53, e2f, nfb, and notch [332, 333]. This may be explained by the ability of bcl-2 to modulate p27 expression and promote g0 arrest [325, 327, 331, 335, 336]. Long - term exposure to gcs could overcome resistance caused by either bcl-2 or bcl - xl [30, 120, 337]. Overexpression of bcl-2 is common in leukemias and lymphomas [338341]. In follicular lymphoma (fl) and diffuse large b - cell lymphoma (dlbcl), bcl-2 upregulation is commonly due to the t(14,18)(q32; q21) translocation, which places the bcl-2 gene under the control of ig heavy chain enhancers [342344]. Overexpression of bcl-2 is common in cll due to the loss or downregulation of the human chromosome 13q14 locus, which harbors the mir-15a and mir-16 - 1 cluster . Overexpression of mir-15a and mir-16 - 1 in cll cells led to cleavage of procaspase-9 and parp (poly - adp - ribose polymerase) and activation of the intrinsic apoptosis pathway . These two micrornas could serve as natural antisense bcl-2 actors that have potential use in the therapy of bcl-2 overexpressing tumors . The tumor - suppressor mir-34a, a pivotal member of the p53 network, also downregulates bcl-2 [347, 348], which may be one mechanism by which p53 activation leads to downregulation of bcl-2 . It also targets mcl-1 and bcl - w, and indirectly bcl - xl by attenuating il-6/stat-3 (signal transducer and activator of transcription 3) signaling pathway [350, 352]. Mir-125b may function both as tumor suppressor and as an oncogene and has been widely considered as conferring drug resistance, among others by downregulating bak1 (bcl-2 antagonist killer 1) [353355] and bmf . Over - expression of mir-125b could induce leukemia in a mouse model . Mir-181a / b that shows altered expression in cll could also target bcl-2, besides acting on mcl-1 and xiap [358360]. Bcl - xl can be targeted by the tumor suppressor microrna let-7 and mir-491 . A predominant feature of the gene expression signature leading to gc resistance in all was found to be elevated expression of the anti - apoptotic mcl-1 (myeloid cell leukemia sequence 1) [364, 365]. Mcl-1 expression is especially high in mll - rearranged all, which represents an unfavorable type of leukemia that is often highly resistant to gcs . Mcl-1 is also frequently overexpressed in b - cell and mantle - cell lymphomas, cml, cll, and mm . Mcl-1 is an anti - apoptotic protein that sequesters the pro - apoptotic proteins tbid, bim, puma, noxa, and bak . Besides preventing gc - induced apoptosis, mcl-1 confers resistance to trail (tumor necrosis factor - related apoptosis inducing ligand)-induced cell death . Mcl-1 differs from bcl-2 and bcl - xl in having a short protein turnover regulated by the 26s proteasome and its expression is tightly regulated . Unlike bcl-2, rapamycin, a mtor inhibitor that sensitizes resistant all cells to gc, reduces the expression level of mcl-1 [113, 287]. The degradation of mcl-1 depends on gsk3-mediated phosphorylation of mcl-1 at ser159 [369, 370]. E3 ubiquitin ligases implicated in the regulation of mcl-1 include mule (mcl-1-ubiquitinase ligase e3), scf (skp1/cul1/f - box protein -transducin repeat - containing protein), and fbw7 (f - box and wd repeat domain - containing 7) which is part of the skp1-cullin1-f - box (scf) e3 ligase complex . The deubiquitinase usp9x (ubiquitin specific peptidase 9 x - linked) is an important regulator of mcl-1 stability . Silencing of usp9x resulted in loss of mcl-1 . High levels of mcl-1 correlated with elevated usp9x expression in follicular lymphoma, diffuse large b - cell lymphoma, and some other cancer samples . Increased expression of usp9x mrna was associated with poor prognosis of multiple myeloma . Overexpression of noxa triggered an increase in the mule / mcl-1 interaction in parallel to a decrease in mule / usp9x complex formation . In an akt - driven, e-myc lymphoma mouse model, translational regulation of mcl-1 by mtor has been implicated in promoting lymphomagenesis . As gc may activate gsk3 and gsk3 inhibits mtor through phosphorylation of tsc2 and promotes mcl-1 degradation [369, 370], mcl-1 expressing lymphoid cells may ultimately undergo apoptosis if the exposure time to gc is sufficiently long . This may explain why many mcl-1-positive all cells exhibit delayed response to gcs, and not complete resistance [67, 108]. Also, the anti - apoptotic function of mcl-1 appears to require simultaneous expression of other anti - apoptotic bcl-2 family members . Similarly, overexpression of mcl-1 in bcl-2- and bcl - xl - negative mouse double positive thymic lymphoma cells did not confer gc resistance upon these cells . Usually, mcl-1 is expressed together with other anti - apoptotic proteins in gc - resistant lymphoid malignancies . Mcl-1 is also regulated by micrornas (figure 2), including mir-29a, mir-29b [381383], mir-101, mir-125b, mir-181a / b [358, 385], mir-133b, mir-193b, and mir-512 . Alk - positive anaplastic large cell lymphomas (alcl) express low levels of mir-29a, whose downregulation requires an active npm - alk kinase, and may probably also be due to methylation repression . Enforced mir-29a expression reduced mcl-1 expression in alcl cells and reduced tumor growth in a xenografted model . Mir-29b is downregulated in primary mm and aml samples and forced overexpression of mir-29b - induced apoptosis in mm and aml cells [381, 383]. Mir-29b overexpression also downregulated the expression of the dna methyltransferase isoforms dnmt1, dnmt3a, and 3b . The global dna hypomethylation induced by mir-29b led to reexpression of tumor suppressor genes such as the cdk inhibitor p15 . Altogether, these data propose that targeting mcl-1 with micrornas such as mir-29 represents a potential tool to constrict tumor growth of mcl-1 positive lymphomas . Gcs release ca from the endoplasmic reticulum into the cytosol, which in turn increases the amount of mitochondrial ca . Elevated expression of calcium - binding proteins s100a8 and s100a9 and of the anti - apoptotic mcl-1 (myeloid cell leukemia-1) inhibits the free cytosolic ca and mitochondrial ca signals, respectively, thereby imposing gc resistance [287, 365, 389, 390]. Downregulation of s100a8 and s100a9 by the src kinase inhibitor pp2 sensitized mll - arranged all cells otherwise resistant to prednisolone - induced cell death . Bcl-2 inhibits apoptosis in part by decreasing the size of ca stores in the endoplasmic reticulum resulting in reduced ca transfer to the mitochondria [391393]. One mechanism is through interaction of bcl-2 with ip3r (inositol 1,4,5-triphosphate (insp3) receptor), which is the principle er ca release channel in most cell types . Also, bcl - xl and mcl-1 act in part by inhibiting ip3r [393, 395, 396]. An increase in hydrogen peroxide (h2o2) is a necessary signal for gc - induced apoptosis . The mitochondria is the source of this signal, gcs inhibit complex i and complex iii of the electron transport chain . Expression of anti - oxidant defense proteins such as manganese superoxide dismutase, thioredoxin, and catalase prevents gc - induced apoptosis [276, 398400]. The anti - apoptotic bcl-2 may regulate the mitochondrial redox state in cancer cells [323, 401]. Notch is frequently activated in t - all cells, which may be due to mutations in notch1 (gain - of - function) and/or in the e3 ligase fbw7 that targets notch1 for degradation [7678, 80, 81, 402405]. For example lnx1 (ligand of numb - protein x1) is a positive regulator of notch signaling through degradation of numb, a membrane - associated protein that inhibits the function of the notch receptor . Neuralized (neur) and mind bomb (mib) promote the monoubiquitination and endocytosis of delta [409, 410]. Itch binds to the n - terminal portion of the notch intracellular domain via its ww domains and promotes ubiquitination of icn - notch1 through its hect ubiquitin ligase domain . Recent studies showed that notch1 can be activated in leukemic cells through interaction with bone marrow stromal cells that express notch receptors and ligands [412, 413]. Interaction with bone marrow stroma is also a mechanism for notch activation in multiple myeloma . Cyclin e, which is targeted for degradation by fbw7 [415, 416], is expressed at higher levels in early relapsed pediatric b - cell precursor all patients, who usually show an unfavorable prognosis . Notch1 prevents gc - induced apoptosis, among others, through activation of p56, which activates the pi3k - akt axis, and through the transactivation of its target genes deltex and hes1 . Deltex is a ring - domain ubiquitin ligase that may affect notch activity, and its overexpression prevents gc - induced apoptosis . Activation of the pro - survival pi3k / akt / mtor pathway by notch has also been observed in other studies [95, 106, 419, 420] and may be responsible for notch - mediated inhibition of the p53 tumor suppressor gene . Another mechanism by which notch1 protects t - all cells from gc - induced apoptosis, is through the anti - apoptotic gimap5/ian5 (gtpase of the immunity - associated protein / immune - associated nucleotide - binding protein 5) [421, 422]. Giamp5/ian5 interacts with bcl-2 and bcl - xl and inhibits apoptosis during t - cell development and is highly expressed in human b - cell lymphoid malignancies . It is localized within the mitochondria and endoplasmic reticulum (er) and regulates mitochondrial integrity . Gimap has been linked to immunological diseases such as t - cell lymphopenia and autoimmune diseases . Notch also activates nfb signaling [74, 427] and induces c - myc expression [428430], both contributing to apoptotic resistance . This resistance can be overcome by the simultaneous exposure of the cells to src inhibitors, pi3k / akt inhibitors, or mtor inhibitors [67, 68], understating the importance of the protein kinase network in regulating the effects of notch1 on gc - induced apoptosis . A recent report showed that gc sensitivity of t - all is associated with gr - mediated inhibition of notch1 expression . The serum- and glucocorticoid - inducible kinase 1 (sgk1) was also shown to control notch1 signaling by downregulating its protein stability through fbw7 ubiquitin ligase . Sgk1 phosphorylates fbw7 at ser227, an effect inducing icn - notch1 ubiquitination and degradation . Despite gc resistance induced by notch, notch- and fbw7-mutated t - all shows in general a favorable response to gc therapy and in some studies, but not all, also exhibits a better prognosis [405, 433436]. This may be related to the fact that gcs may overcome notch - dependent drug resistance, and in these t - all cases the cell survival depends on notch signaling . Various micrornas negatively regulate fbw7 expression including mir-27a, mir-182, mir-363~92, and mir-223 [253, 438, 439] and may increase the expression of fbw7-regulated target genes including notch1, mcl-1, c - jun, c - myc, and cyclin e . Mir-451 and mir-709 suppressed oncogenesis in notch1-induced mouse t - all . Mir-150, which is upregulated upon thymocyte maturation, targets notch3 and thus regulates t - cell proliferation and survival . The p53-induced mir-34a also targets the notch1 receptor as well as its ligand dll1 (delta like-1) [443, 444]. Prevention of notch activation in cutaneous t - cell lymphoma (ctlc) by gsi (-secretase inhibitor) treatment led to alterations in the microrna profile of the cell . Among others, mir-27a, mir92b, mir-181a, mir-18a, mir-19b, mir-222, and mir-221 were downregulated, while mir-122 and mir-214 upregulated . Mir-27a targets fbw7/hcdc4 [253, 438, 439], the substrate recognition component of the scf (skp1-cullin - f - box) ubiquitin ligase complex that targets notch1 for degradation . The repressive effect of mir-27a on fbw7 mrna is especially pronounced at the g2/m and early g1 phases . Other targets of mir-27a includes zbtb10 (zinc finger and btb domain containing 10), which acts as a repressor of sp (specificity proteins) transcription factors and induces g1 arrest, and the myt-1 kinase, which inhibits the transition through g2-m by enhanced phosphorylation and inactivation of cdc2 (cdk1, cyclin - dependent kinase 1). Upregulation of mir-122 by gsi seems to be mediated by p53 and has an antagonistic effect on apoptosis through activation of akt . C - myc is, among others, a target of notch [428430] and has broad effects on tumorigenesis and modulates gc - induced apoptosis [99, 448]. Conditional overexpression of c - myc in hematopoietic cells in mice culminated in the formation of malignant t - cell lymphomas and acute myeloid leukemias . These authors demonstrated a role for the pi3k / akt axis in c - myc activation . Dysregulation of the c - myc gene is a common trait of burkitt's lymphoma due to chromosomal translocations, the most frequent one being t(8; 14)(q24:q32) involving c - myc and igh (immunoglobulin heavy locus) [451453]. Other hematopoietic malignancies characterized with c - myc overexpression include diffuse large b - cell lymphoma (dlbcl), follicular lymphoma, cll, b - cell lymphoma, and aml [454459]. Earlier studies have shown that dexamethasone - induced apoptosis of a t - all cell line was associated with c - myc suppression [460, 461]. The gc - mediated down - regulation of c - myc expression was initially thought to be one mechanism that contributes to apoptosis . Not all studies have confirmed this finding, which may be explained by the many signaling pathways induced by gcs . C - myc uses distinct mechanisms for activating and repressing gene expression . For transcriptional activation, c - myc dimerizes with max and transcriptional repression is achieved through protein - protein interactions, where it antagonizes the activity of positive regulators of transcriptions . The c - myc - mediated upregulation of mir-17 and mir-20a (belonging to the mir-17~92 cluster) negatively regulates e2f1 translation by targeting the 3-utr of e2f1 mrna and may therefore fine tune the direct myc - mediated transcriptional activation of e2f1, allowing a tightly regulated proliferative signal (figure 4). E2f1 - 3 also binds to the promoter of the mir-17~92 cluster and activates its transcription, thus generating an autoregulatory feedback loop . Another target of the mir-17~92 cluster is cyclin d1, which also induces the expression of mir-17 and mir-20a by binding to the promoter regulatory region of the mir-17~92 cluster . The gc - induced down - regulation of mir-17~92 should actually stimulate e2f1 expression, which under certain circumstances may exert pro - apoptotic effects . E2f1 may promote apoptosis through transcriptional activation of the pro - apoptotic mir-15a~16 cluster and by activating jnk . In a b - cell lymphoma model, c - myc down - regulated a series of micrornas, an action that may contribute to tumorigenesis . The c - myc mediated repression of the mir-30 cluster may affect autophagy, as beclin-1 expression is regulated by mir-30a . Some of the pro - autophagy activity of cancer therapy is mediated through down - regulation of mir-30a . Also the down - regulation of mir-15a and mir-16 by c - myc is of interest as these micrornas are deleted or downregulated in over two - thirds of individuals with cll, and they target the anti - apoptotic bcl-2 gene [345, 346]. A third mirna downregulated by c - myc is the tumor suppressor let-7 mirna cluster, which targets, among others, the ras oncogene, hmga2 (high mobility group a2) [477, 478], bcl - xl, cdc25a, cdk6 (cyclin - dependent kinase 6), and cyclin d2 . Other mirnas repressed by myc include mir-22, mir-23a / b, mir-26a / b, mir-29a / b / c, mir-34a, mir-146a, mir-150, and mir-195 [465, 473, 480]. Mir-26a levels were found to be reduced in various b - cell lymphomas, especially burkitt lymphoma as well as various solid tumors [481, 482]. B - cll, which does not have a prominent pathological role of c - myc, showed higher expression of mir-26a than myc - dependent burkitt lymphoma . Mir-26 restoration in burkitt lymphoma or nasopharyngeal carcinomas reduced proliferation and colony formation through g1 arrest and repression of the histone - lysine n - methyltransferase ezh2, a global regulator of gene expression [465, 481, 483]. The tumor - suppression function was only seen in myc - transformed cells, but not in v - abl transformed cells [465, 483]. However, in t - all, mir-26a was one of five micrornas that independently promoted tumorigenesis through inhibition of pten . In the background of activating mutations in notch1, mir-26a overexpression decreased the latency of t - all . Forced overexpression of mir-34a, mir-150, and mir-15a/16 - 1 attenuated in vivo tumor growth of myc - induced b - cell lymphoma . Mir-34a is a crucial component of the p53 tumor suppressor network with potential anti - proliferative and pro - apoptotic activity [484486]. C - myc transcriptionally induces lin28b, which is an rna - binding protein that suppresses the maturation of let-7 family microrna precursors [487, 488]. Lin28 is involved in stem cell maintenance [489491] and is a marker of cancer stem cells . The effect of autophagy on the cellular response to chemotherapy is dual . Under certain conditions, autophagy acts as a pro - survival mechanism to protect cancer cells from chemotherapy, whereas under other circumstances, autophagy mediates the therapeutic effects of the anticancer agents . Another important regulator of autophagy is the activity of mtor (mammalian target of rapamycin), which is a central element signaling cell growth and enhancing protein translation . When this kinase is inhibited, autophagy is promoted . It should be noted that beclin-1 may play a dual role in both regulating autophagy and apoptosis, thus being at the cross - road between these two physiological processes . Beclin-1 has recently been recognized as a bh3-only protein interacting with bcl-2, bcl - xl and mcl-1 [59, 60, 494496]. One report provides evidence that after initiating apoptosis, beclin-1 is cleaved by caspases and the n - terminal fragment of beclin can inhibit autophagy, while the c - terminal fragment can amplify mitochondrial - mediated apoptosis . Perturbation of beclin-1 cleavage by knockin mutation phenocopied the autophagy induction observed in apoptosis - defective cancer cells and rendered chemotherapy resistance both in vitro and in vivo . A role for beclin in regulating tumorigenesis has been demonstrated in mice with heterozygous disruption of beclin-1 . Dlbcl expressing high beclin-1 levels had a favorable clinical outcome with r - chop treatment than those with low beclin-1 expression . Gcs have been shown to promote autophagy in lymphocyte cell lines and primary t - all cells [501, 502]. One mechanism for induction of autophagy is through upregulation of the mtor - inhibitory stress protein dig2 (dexamethasone - induced gene 2), also known as rtp801 and redd1 (regulated in development and dna damage responses 1). Mtor inhibition by dexamethasone was demonstrated by reduced phosphorylation of s6k (70kd ribosomal protein s6 kinase 1), a member of the rsk family of serine / threonine kinases . Dig2 releases tsc2 from 14 - 3 - 3, thereby promoting the assembly of the tsc1/tsc2 complex, which inhibits mtor . Dig2 knockout thymocytes underwent more extensive dexamethasone - induced cell death, suggesting that autophagy promotes cell survival . However, rapamycin, an inhibitor of mtor and inducer of autophagy, strongly sensitizes resistant mm and t - all cells to gc - induced apoptosis [59, 111, 116, 117], suggesting that induction of autophagy does not always combat apoptosis . It could be that the higher degree of autophagy induced by rapamycin itself may be pro - apoptotic . Bonapace et al . Showed that rapamycin induces an autophagy - dependent necroptosis, which is required for childhood t - all to overcome gc resistance . Necroptosis is a form of programmed necrosis that occurs when apoptosis is abortive due to caspase inhibition . The gc - mediated necroptosis was mediated by rip-1 (receptor - interacting protein-1) and cyld (cylindromatosis). Mir-19, which is frequently overexpressed in t - all patients and cell lines, represses cyld expression . Obatoclax, a putative antagonist of bcl-2 family members, could also sensitize t - all cells to gc - induced apoptosis through induction of autophagy . This effect was associated with dissociation of the autophagy inducer beclin-1 from mcl-1 and decreased mtor activity . The apoptosis induced by gc in combination with obatoclax or rapamycin could be prevented by the autophagy inhibitors 3-methyladenine and bafilomycin . Cdkn2/p16, which acts as a g0/g1 cycle inhibitor, is frequently lost in t - all [507, 508] and predicts relapse in children with all [508510]. P16 sensitizes t - all cell lines to gc - induced apoptosis through induction of bbc3/puma and repression of mcl-1 and bcl-2 . Noxa was repressed in p16 transgenic cells, which could be a result of the simultaneous repression of e2f1 due to retinoblastoma protein and p130 activation . Diffuse large b - cell lymphoma with cdkn2a deletion had a poor prognosis under r - chop treatment . Also, myc gene arrangement in diffuse large b - cell lymphoma patients had a poor prognosis with r - chop chemotherapy . During the last decade, micrornas have become the focus of having a central role in the pathogenesis of cancer including lymphoid malignancies, besides their role in regulating gene expression during cell division, development, and differentiation [514523]. Micrornas are short noncoding rnas that induce posttranscriptional gene silencing through base pairing with the 3 untranslated region (utr) of their target mrnas, thereby inhibiting their translation, with subsequent reduced protein levels [524, 525]. Bases 27 or 28 of the microrna are primary contributors to target specificity and are referred to as the microrna seed region . The micrornas are usually transcribed by rna polymerase ii, and sometimes by rna polymerase iii, into long primary precursor transcripts referred to as pri - mirnas . Mirna are encoded by one arm of a stem loop structure embedded in introns or, less frequently, exons of protein - coding or noncoding transcripts . In the nucleus, the pri - mirnas stem loop is cleaved by the nuclear rnase iii enzyme drosha together with its cofactor dgcr8 (digeorge syndrome critical region 8)/pasha (the microprocessor complex) to generate ~70 nucleotides long precursors called pre - mirnas . In some cases, an entire intron consists of such a stem loop structure, which is released by the splicing machinery in a drosha - independent manner . Pre - mirnas are exported by rangtp / exportin-5 to the cytoplasm, where they are further processed by dicer, another rnase iii enzyme, to generate ~22 base pair microrna duplexes that enter effector complexes called mirisc (mirna - containing rna - induced silencing complex). Here, they are converted into single - stranded mature mirnas that target mrnas and thereby affect their translation and stability [516, 528, 529]. Cancer cells frequently display reduced levels of micrornas that act as tumor suppressors, while expressing elevated levels of oncogenic micrornas, called oncomirs that promote tumor development by negatively regulating tumor suppressor genes and/or genes that control cell differentiation and apoptosis . There are variations in the microrna expression pattern described between the various scientific reports, which can be explained by the use of different internal standards, different controls for comparison, and the use of sample materials of malignant cells at different developmental stage and at different ontogeny tumor grade . Virtually every step in hematopoiesis seems to be finely tuned by specific micrornas [514, 530533]. Conditional deletion of dicer expression in the t - cell compartment resulted in impaired t - cell development and diminished regulatory t - cell function [534536], and ablation of dicer in the b - cell compartment attenuates b - cell development and alters the antibody repertoire . It should be noted that there exists an alternative microrna processing pathway that is independent of dicer, but dependent on argonaute-2 . Microrna expression is dynamically regulated during thymocyte development, with different enriched micrornas expressed at each developmental stage (table 1). It should be emphasized that the cd4cd8 (double positive, dp) thymocytes are the most gc - sensitive thymocyte population [540542]. Dicer - deficient dp thymocytes expressed higher levels of cd69 and tcr (t - cell receptor), but lower levels of bcl-2 . The dicer - deficient thymocytes were more prone to apoptosis than control cells [539, 543], understating the role of micrornas in regulating cell survival . Some micrornas, such as mir-146a and mir-182, play a dominant role in the regulation of the innate and adaptive immune responses, respectively [544, 545]. According to neilson et al ., the pro - apoptotic mir-15b is almost not expressed at the immature dn1 (double negative 1) thymocyte stage but becomes gradually upregulated in dn3 and dn4, and further in dp cells . The pro - apoptotic mir-16 is also low in dp1 and reaches a maximum in dn4 cells, with a reduction upon transition to dp cells . The oncogenic mir-21 is expressed at the highest level in dn1 and becomes reduced upon transition to dn3 and is almost not expressed in dp cells . Mir-181a / b is expressed at the highest level in dp thymocytes, together with mir-92 and mir-350 . It should be noted that in this study the expression of each microrna was determined relative to the general microrna pool of each subpopulation . Since the amount of total microrna becomes strongly reduced upon transition from dn4 to dp (a drop from 32000 to 5200 copies / cell), the absolute microrna number in each cell population differs, which can be demonstrated by the mir-181a transcript . While mir-181a presents 15.6% of the microrna in dp cells and 6.7% and 5% in dn3 and dn4, respectively, the numbers of mir-181a copies in these three populations were estimated to be 810 in dp, 1400 in dn3, and 1600 in dn4 . . Showed that mir-181a is expressed at dn1 and becomes upregulated during dn2 and dn3 and then downregulated at dn4 . Mir-181 is still significantly expressed in dp cells, albeit at a slight lesser extent than in dn4 and becomes downregulated upon differentiation to the sp (single positive) stage . Performed an extensive microrna profiling to identify micrornas specifically expressed in b - cell subsets during peripheral b - cell differentiation . Notably, mir-18a, mir-28, mir-15a~16 - 1, and mir-181 are expressed at higher levels in centroblasts (germinal center b lymphocytes) compared with memory b cells, whereas mir-101c, mir-150, mir-29a, b, c, and mir-23a~24 are enriched in memory b cells . Mir-17~92, mir-363~106a, and mir25~106b are highly expressed in all b - cell subtypes . The high level of mir-15a~16 - 1 in germinal center b - cells corresponds with low bcl-2 expression in these cells . Mir-223 is highly expressed in nave and memory b cells, but not in centroblasts . Mir-181a represses the expression of bcl-2, cd69, and the t - cell receptor (tcr) -chain . Mir-181a augments the strength of tcr signaling and down - regulates several phosphatases including dusp5, dusp6, shp-2, and ptpn22 that regulate the sensitivity of t cells to antigens . The down - regulation of ptpn22 by mir-181a led to elevated phosphorylation of p56 at y394 and the down - regulation of dusp5/6 to increased erk activation . The normally high levels of mir-181a maintain t - cell tolerance to self - peptide / mhc molecules, with a reduction in this microrna increasing the number of self - reactive t cells . Also, dampening mir-181a expression using antagomir-181a impaired positive selection with about a 70% reduction of mature cd4 sp thymocytes . Thus, mir-181a plays a role in regulating tcr response during t - cell development . Recently, mir-181a-1/b-1, but notmir-181a-2b-2andmir-181-c / d, was found to control the development of normal thymic t cells and leukemia cells . Conditional deletion of mir-181ab1 allele resulted in 50%75% decrease in cellularity in the thymus and a significant reduction in the percentage of dp cells . Mir-181a expression decreased during the dn3a to dn3b transition during -selection, and loss ofmir-181ab1resulted in a reduction in the percentage of dn3 and dn4 cells that expressed intracellular tcr-, while pret expression in dn3 thymocytes was normal . Other alterations occurring upon tcr / cd28 co - stimulation includes the upregulation of the mir-466 family, mir-574, mir-346, mir-214, mir-155, and mir-709, and the down - regulation of the mir-29 family, mir-15a, mir-15b, mir-16, mir-146b, mir-142, mir-27a, mir-150, and let-7 family . Chen et al . Showed that mir-181 is expressed in the b - lymphoid cells of the mouse bone marrow, and its ectopic overexpression in hematopoietic stem / progenitor cells significantly increased b - cell production . Mir-181 also affects the development of nk cells through targeting the nemo - like kinase (nlk), an inhibitor of notch signaling . Mir-181 targets the rna - binding protein lin28, thereby disrupting the lin28-let-7 reciprocal regulatory loop, with concomitant upregulation of let-7 and differentiation of megakaryocytes . Mir-150 is highly expressed in mature and resting lymphocytes, but not in their progenitors [547, 553]. Overexpression of mir-150 led to a block in b - cell formation at the pro - b to pre - b - cell transition by downregulating c - myb, among other targets, suggesting for a role for this microrna in b - cell differentiation . Within the lymphoid lineage the choice between t and b cells the t - cell population level was unaffected by overexpression of mir-150 in hematopoietic progenitor cells, while the mature b - cell levels were strongly reduced . Mir-150 drives megakaryocyte - erythrocyte progenitor (mep) cells towards megakaryocytes at the expense of erythroid cells . Mir-150 also regulates the development of nk (natural killer) and inkt (invariant nk) cells . Mice with target deletion in mir-150 had a defect in their ability to generate mature nk cells, while overexpression of mir-150 resulted in a substantial reduction in inkt in the thymus and in the peripheral lymphoid organs, supposedly through targeting of c - myb by mir-150 . Mir-125b affects t - cell differentiation through regulation of ifn (interferon), il-2r, il-10r, and prdm1/blimp1 (b lymphocyte - induced maturation protein-1). Ectopic expression of mir-125b in nave lymphocytes inhibited differentiation to effector cells . During normal b - cell development, mir-125b is enriched in germinal center b cells and keeps the transcription factor irf4 and prdm1/blimp1 down, while mir-223 is enriched in memory b cells, where it targets the transcription factor lmo2, which is specifically expressed in germinal center b cells . Irf4 and prdm1/blimp1 expression are repressed in centroblasts, but is necessary for differentiation into memory and plasma cells [593, 594]. Overexpression of mir-125b alone in mice causes an aggressive, transplantable myeloid leukemia . Before leukemia, these mice did not display elevation of white blood cells in the spleen or bone marrow, rather the hematopoietic compartment showed lineage - skewing, with myeloid cell numbers dramatically increase and b - cell numbers severely diminished . Mir-125b targets lin28a, an induced pluripotent stem cell gene . Knockdown of lin28a led to hematopoietic lineage - skewing similar to ectopic mir-125b overexpression, with increased myeloid and decreased b - cell number . Mir-155 is also important for lymphopoiesis and for preserving normal immune system responses [266, 597599]. Mir-155 is processed within the second exon of the nonprotein - encoding gene bic (b - cell integration cluster). Mir-155 is upregulated upon tcr / cd28 costimulation in mouse t cells, and in macrophages by several tlr (toll - like receptor) pathways . B cells require mir-155 for normal production of isotype - switched, high - affinity antibodies and for a memory response . The transcription factor pu.1, which down - regulates igg1 levels, is a target gene of mir-155 in b cells . This may explain the reduced amount of circulating igg1 in mir-155 knockout mice . As with b cells, it seems that mir-155 is involved in t - cell differentiation [266, 597]. Nave t cells derived from mir-155 knockout mice showed increased propensity to differentiate into th2 rather than th1 cells, with the concomitant production of th2 cytokines such as il-4, il-5, and il-10 [266, 597]. One explanation for this biased development of th2 cells might be the mir-155 mediated targeting of c - maf (musculoaponeurotic fibrosarcoma), a transcription factor that transactivates the il-4 gene . With regard to the acute immune response, the t cells had an impaired response and showed attenuated il-2 and ifn release in response to antigens [266, 597]. Mir-155 is upregulated by the transcription factor foxp3 and critical for t regulatory cell function . Mice overexpressing mir-155 in the b - cell lineage results in preleukemic pre - b - cell proliferation in the spleen and bone marrow, followed later in life by b - cell malignancy . The mir-17~92 cluster located on chromosome 13 at locus q31.3 is essential for b - cell development . The expression of mir-17~92 peaked in pre - b cells, where it inhibited cell death . It is expressed at higher levels in normal germinal center b cells compared to nave and memory b cells . Knockout of mir-17~92 leads to increased bim expression and inhibits b - cell development at the pro - b to pre - b transition, a step also blocked by mir-150 . Mice overexpressing the mir-17~92 cluster in lymphocytes developed lymphoproliferative disease and autoimmunity and they died prematurely . These animals were found to have increased numbers of activated b cells, and a higher ratio of activated cd4 t cells versus cd8 t cells . The enhanced proliferation and survival of b and t cells may result from the down - regulation of bim and pten . Mir-17~92 expression is strongly induced after activation of cd8 t cells, which is critical for the rapid clonal expansion of these cells . However, following the clonal expansion, mir-17~92 is downregulated and further silenced during memory development . Malignant lymphomas arise from normal b- or t - cell counterparts at different ontogeny stages and commonly continue to express gene signatures inherited from their nontransformed cellular progenitors . Extensive mirna profiling studies have been performed on various lymphoid malignancies, including t - all, cutaneous t - cell lymphoma, cll [557, 563], pre - b - all [557, 605, 607], diffuse large b - cell lymphoma (dlbcl) [564, 580582, 608610], anaplastic large cell lymphoma (alcl), multiple myeloma (mm) [574, 611, 612], mantle cell lymphoma (mcl) [583, 591, 613], burkitt lymphoma (bl) [564, 614], and follicular lymphoma (fl) [135, 582, 615]. A comprehensive study aimed to integrate the many mirnas upregulated in t - all into a microrna - transcription factor coregulatory network was performed by ye et al . . A short description of some important micrornas in malignant lymphoid diseases is described below and summarized in tables 2 and 3 . In general, t - all is characterized by upregulation of the mir-17~92 cluster, mir-26a, mir-128a / b, mir-146a, mir-181a / b, mir-150, and mir-155, while let-7b and mir-223 are downregulated [253, 557561]. 3.2.1.1 . The mir-19, mir-20a, mir-92a, and mir-17 especially of the mir-17~92 cluster are upregulated in t - all . All six mirnas mir-17, mir-18a, mir-19a, mir-20a, mir-19b, and mir-92a, of the mir-17~92 cluster promoted leukemogenesis in notch1-induced t - all in vivo [253, 616]. Among them, the mir-19 family has been considered the key oncogenic component [248, 506, 617]. The mir-17~92 cluster is located within a fragile site that is frequently amplified in a range of hematopoietic malignancies . Mir-19 represses notch1, pten, hoxa9, cyld, runx1, e2f1, and bcl2l11 (bim) [506, 616, 620]. Posttranslational inactivation of pten by mir-19 promotes activation of the pi3k / akt pathway, and incontrollable proliferation of t cells [104, 105]. Increased akt signaling antagonizes gc - induced apoptosis by several mechanisms, including phosphorylation of foxo3a, thus preventing its nuclear translocation and transcriptional activation of bim, and through inactivation of gsk3, which is essential for gc - induced apoptosis [30, 67, 97]. Hoxa9 is a leukemogenic homeoprotein in t - all, and a target gene of the oncogenic mll - af4 fusion protein . High expression of mir-196b was found in pediatric all with aberrant activation of hoxa genes . Notch1 plays a vital role in t - cell development and transformation, and about 50% of primary t - all samples show abnormal notch1 expression . Downstream transcriptional targets of notch1 include hes1 and c - myc, the former affecting the pi3k / akt and nfb signaling pathways [624, 625]. C - myc is a potent and direct transcriptional activator of mir-17~92, leading to modulation of e2f1 expression . Gcs repress the expression of mir-17~92, which may be one means to overcome the tumorigenicity of t - all cells and to elevate bim expression . In contrast to mir-19, mir-451, and mir-709 are potent suppressors of oncogenesis in notch1-induced mouse t - all . Mir-451 represses c - myc, while mir-709 represses ras - grf-1 that acts upstream to ras and prevents akt activation . Both mir-451 and mir-709 are transcriptional targets of the bhlh e2a tumor suppressor, which is degraded upon notch1 induction in mouse t - all cells [626, 627]. Repression of tumor suppressor mir-451 is essential for notch1-induced oncogenesis in a murine model of t - all . Human t - alls with activating notch1 mutations have decreased mir-451 and increased c - myc levels compared with t - alls with wild - type notch1 . One mechanism of the tumor suppressive action of mir-451 could be through down - regulation of the pi3k / akt survival pathway . Primary t - all cells also express elevated levels of mir-26a that suppresses pten and bim . Mir-26a mir-26a was found to be repressed by c - myc in a mouse lymphoma model, leading to enhanced expression of the ezh2 oncogene, a component of the polycomb repressive complex 2 . Mir-146a, mir-181a / c, and mir-221 were associated with overall survival in all patients . However, overexpression studies of mir-146a in transplanted bone marrow cells suggest a tumor - suppressive role for this microrna . Mir-146a knockout mice developed massive myeloproliferation followed by hematopoietic tumors, including myeloid sarcomas and lymphomas [635, 636]. The myeloproliferative phenotype correlated with enhanced nfb signaling . Mir-146a suppresses the nfb activators irak1 (interleukin 1 receptor - associated kinase 1) and traf6 (tnf receptor - associated factor 6) [635, 637, 638]. A negative feedback loop exists between nfb and mir-146 . Whereas mir-146 represses nfb signaling, nfb signaling upregulates mir-146 . Mir-181a family members are highly expressed in t - all leukemia cells and downregulated during remission . Deletion ofmir-181a-1/b-1expression inhibits the development ofnotch1 oncogene - induced t - all in a mouse model . Mir-181a / bcontrols the strength and threshold of notch activity in tumorigenesis in part by dampening multiple negative feedback regulators downstream of notch and pre - t - cell receptor (tcr) signaling pathways . Mir-124a has been shown to be downregulated in more than 50% of all cases and associated with higher relapse rate and mortality rate . A comparison study of primary cll samples with normal unstimulated or cpg - stimulated b cells showed high similarities between cll and activated b cells, including upregulation of mir-34a, mir-155, and mir-342 and down - regulation of mir-103 and mir-181a / b . Activation of normal b cells led to reduced mir-23a, mir-23b, mir-24, mir-27b, mir-181a / b, and mir-223 and increased mir-155 with all activation agents used . Mir-150 was reduced during b - cell activation, whereas it was upregulated in most cll cases . The latter confirms the study of fulci et al ., but is opposed to wang et al ectopic mir-150 expression increased cell death in pro - b cells, while mir-150 deficiency led to b - cell expansion and an enhanced humoral immune response . Some differences in mir-150 are observed between the mutated versus unmutated igvh (immunoglobulin heavy chain variable - region genes) subgroups, where expression is higher at the average in the mutated igvh subgroup . Cll cases with unmutated igvh or with high expression levels of zap-70 (70kd zeta - associated protein) show an unfavorable course with rapid progression in comparison to patients with a mutated igvh . Two research groups [565, 566] observed decreased levels of mir-29c and mir-223 in cll with zap70 and igvh unmutated status . Calin et al . Observed that the unmutated igvh cll subgroup exhibited high levels of tcl-1 due to low expression of mir-29 and mir-181 that negatively regulate this oncogene . Mir-181 and mir-29 might therefore be considered to have tumor - suppressor functions . Tcl-1 functions as a coactivator of akt, and b - cell forced expression of tcl-1 in transgenic mice resulted in tumors that resembled cll . Cll with unmutated igvh and high expression of zap-70 showed also relative high expression of mir-15a, mir-16 - 1, mir-16 - 2, mir-195, mir-23b, mir-155, mir24 - 1, and mir-146, while low expression of mir-223, mir-29a-2, mir-29b-2, and mir-29c . In an aggressive subtype of cll with abnormalities in the tp53 gene, cll cases with good prognostic features are typically characterized by down - regulation of mir-15a and mir-16 - 1 [643, 708], located at the 13q14.3 locus . These mirnas map to a region between exon 2 and 5 of the leu2 gene . Deletion of 13q14.3 (del(13q)) is the most common cytogenetic abnormality in cll occurring in more than 50% of the cases and implies for a favorable prognosis . This deletion occurs also frequently in mm patients .deletion in mice of the 13q14-minimal deleted region, which encompasses the mir-15a~16 cluster, caused the development of indolent b - cell - autonomous, clonal lymphoproliferative disorders, recapitulating the spectrum of cll - associated phenotypes observed in humans . Repression of mir-15a and mir-16 - 1, as well as mir-29b, in cll may also be mediated by histone deacetylases (hdacs). Hdac inhibition triggered the accumulation of the transcriptionally activating chromatin modification h3k4me2 and restored the expression of mir-15a, mir-16 - 1, and mir-29b . Both mir-15a and mir-16 - 1 negatively regulate bcl-2, and mir-29 targets mcl-1 [381, 382]. The expression of bcl-2 in cll cases is inversely correlated with the expression of mir-15a and mir-16 - 1 [563, 711]. Other targets of mir-15/16 include chek1, cyclind1, cyclind2, and cdc25a [525, 645]. Overexpression of mir-15a and mir-16 - 1 induced cell cycle arrest at g1/g0 in an rb - dependent manner . A germ - line mutation in the primary precursor of mir-15a/16 - 1 that impairs their processing was observed in familial cll patients . Targeting deletion of mir-15a~16 in mice led to the development of a spectrum of diseases resembling cll - associated lymphoproliferation in humans, including cll, cd5 monoclonal b - cell lymphocytosis, and cd5 non - hodgkin's lymphomas . The new zealand black (nzb) mouse that harbor a point mutation in the 3-flanking region of mir-16 that leads to reduced mir-16 expression and develops symptoms similar to b - cll in humans, further confirming the tumor suppressor function of this locus . Underexpression of mir-181a / b was associated with shorter overall survival in cll, while higher levels of mir-181a were associated with a shorter time from diagnosis to initial therapy . During the course of cll progression, the mir-181a / b levels were decreased, which inversely correlated with increased levels of its target genes mcl-1 and bcl-2 . The study of marton et al . Showed consistent underexpression of mir-181a, as well as let-7a and mir-30d in all cll cases studied . However, increased expression of mir-181a / b was associated with favorable outcome in patients with cytogenetically normal acute myeloid leukemia (aml). Ectopic overexpression of mir-181a / b into primary cll increased fludarabine - sensitivity in p53 wild - type cells, but not in cll with attenuated p53 response . The importance of the mir-181 target mcl-1 in cll survival was demonstrated by rapid apoptosis of cll cells following sirna - mediated down - regulation of mcl-1, and by the mcl-1 transgenic mice, which developed b - cell lymphoma . Thus, low mir-181 and mir-29 expression in cll could confer drug resistance through upregulation of mcl-1 expression . The mir-29 family consisting of mir-29a and mir-29b seems to play a dual role in tumorigenesis . On the one hand, mir-29a and mir-29b are downregulated in mantle cell lymphoma, aggressive cll samples (high zap-70 with unmutated igvh) [659, 710, 716], alk - positive anaplastic large cell lymphomas (alcl), mm, and aml . On the other hand, mir-29a and b are expressed at higher degree in indolent cll (low zap-70/mutated igvh) than in normal cd19 cells [563, 569, 716]. Mir-29c together with mir-223 down - regulation is associated with higher tumor burden, disease aggressiveness, and poor prognosis in cll . Forced overexpression of mir-29b the tumor suppressor activity of mir-29 may be achieved through targeting cell cycle regulators and oncogenes such as cdk6, dna methyltransferase 3a (dnm3a) and 3b (dnmt3b), mcl-1, and tcl1a [382, 569, 583, 717]. Another tumor suppressor function of mir-29 is mediated through activation of p53, which is achieved by targeting p85 (the regulatory subunit of pi3k kinase) and cdc42 (a rho family gtpase). However, in another setting mir-29 acts as an oncogene . Mir29a overexpression in immature and mature b cells promoted cll development, and transplantation of mir-29-transduced hematopoietic stem and progenitor cells into irradiated mice resulted in myeloproliferative disease and aml . One mechanism for the oncogenic feature of mir-29 could be through repression of the tumor suppressor cell - adhesion molecule peroxidasin homologue (pxdn). Thus, depending on the cellular contexts, mir-29 can function as an oncogene or a tumor suppressor . Mir-221 and mir-222 are expressed at higher levels in cll with unmutated igvh and high expression of zap-70, the most aggressive cll subtype with poor prognosis . These micrornas may contribute to oncogenesis by targeting the cdk inhibitor p27 [695, 696, 718, 719], foxo3a [720, 721], apaf-1 [721, 722], p57, bmf, pten, and timp3 (tissue inhibitor of metalloproteinase 3). In other cll cases, the mir-222 was found to be lower than that of normal cd19 cells . The p53 target mir-34a is decreased in cll patients with 11q deletions, leading to increased zap-70 expression . Mir-34a also targets bcl-2 [348, 484], and the e2f1 and b - myb oncogenes in cll . Members of the mir-17~92 polycistron are upregulated in b - cell lymphoma, as well as mir-155 [469, 568, 685]. Adoptive transfer of hematopoietic stem cells bearing a truncated portion of the mir-17~92 polycistron in c - myc transgenic mice resulted in a more rapid onset of malignant b - cell lymphomas . Transgenic overexpression of the entire mir-17~92 in the murine hematopoietic compartment led to the development of lymphoproliferative disease and increased lethality . The negative regulation of bim by the mir-17~92 cluster seems to be a major mechanism by which b - cell lymphomas evade apoptosis . Silencing of mir-17 and mir-20a in mantle cell lymphoma led to upregulation of the cyclin - dependent kinase (cdk) inhibitor p21, suggesting that p21 is an essential target of the mir-17~92 cluster during b - cell lymphomagenesis . Overexpression of c - myc mrna together with mir-17 - 5p / mir-20a was associated with a more aggressive behavior in mantle cell lymphoma . Mir-17~92 confers chemoresistance in mantle cell lymphoma through activation of the pi3k / akt pathway . Mir-21 is commonly upregulated in cll as well as cml and many other cancer cell types . Forced overexpression of mir-21 under the control of the nestin promoter resulted in severe pre - b - cell lymphoma . Mir-21 overexpression potentiated lung tumorigenesis of a constitutively activated k - ras proto - oncogene . Mir-21 is an oncomir that promotes tumorigenesis by targeting a range of genes involved in regulating cell proliferation and/or survival, including pten, sprouty (spry2), pdcd4 (programmed cell death 4), tpm1 (tropomyosin 1), and human dna muts homolog 2 (hmsh2). In glioblastoma cells, mir-21 also targets a network of p53 pathways, tgf, and mitochondrial tumor suppressor genes . Pdcd4 inhibits ap-1-mediated transactivation and negatively regulates the pro - survival ral guanine - nucleotide dissociation stimulator (ralgds) signaling pathways [517, 729]. Pdcd4 is a tumor suppressor that is upregulated during apoptosis and downregulated in several cancer forms [737739]. Spouty, which is downregulated by mir-21, negatively regulates the c - raf pro - survival signaling pathway . Overexpression of mir-125b in cll - derived cell lines resulted in the repression of many transcripts encoding enzymes implicated in cell metabolism . These authors proposed that mir-125b acts as a regulator for the adaptation of cell metabolism to a transformed state . One microrna consistently downregulated in most b - lymphomas is mir-150, which is proposed to act as a tumor suppressor [523, 547, 589]. Mice lacking mir-150 have increased expression of its target transcription factor c - myb, which plays an important role in lymphocyte development and maturation . Premature expression of mir-150 blocked the transition from pro - b to the pre - b stage . Overexpression of mir-150 in nk / t lymphomas increased apoptosis and reduced cell proliferation, with concomitant reduction in dkc1 (dyskeratosis congenita 1) and akt2, reduced akt phosphorylation, and elevated levels of bim and p53 . Mir-155 is overexpressed in many b - cell lymphomas including cll, primary mediastinal b - cell lymphoma (pmbl), aggressive activated b - cell like (abc) subtype of dlbcl, hodgkin's lymphoma, and pediatric burkitt's lymphoma, but is almost absent in adult burkitt's lymphoma [515, 566, 568, 576, 583, 584, 587, 602, 685, 686]. C - myb (v - myb myeloblastosis viral oncogene homolog), which is overexpressed in a subset of cll patients, associates with the promoter of mir-155 host genes (mir155hg, also known as bic, b - cell integration cluster) and stimulates its transcription . Forced overexpression of mir-155 in b cells (e-mir-155 transgenic mice) led to initial preleukemic pre - b - cell proliferation followed by frank b - cell malignancy . The mir-155 orthologue mir - k12 - 11 in kaposi sarcoma - associated herpes virus (kshv) has been associated with b - cell tumors . Mir-155 is essential for immune function and is strongly induced in activated t and b cells . Mir-155 represses sh2-domain containing inositol-5-phosphatase-1 (ship-1), which is a critical phosphatase that negatively downmodulates akt pathway and is involved in normal b cell development . Thus, sustained overexpression of mir-155 in b cells unblocks akt activity, inducing b - cell development . C - maf in lymphocytes, and hgal and smad5 in diffuse large b - cell lymphoma (dlbcl) [741, 742]. Hgal, a germinal center (gc)-specific gene, inhibits lymphocyte and lymphoma cell motility by activating rhoa signaling cascade and by interacting with actin and myosin proteins . Smad5 is a bone morphogenetic protein (bmp)-responsive transcription factor and is activated by various cytokines . Dlbcl expressing high levels of mir-155 concomitant with low hgal expression showed high aggressiveness and cell dissemination . Thus, down - regulation of smad5 in diffuse large b - cell lymphoma defines a unique mechanism used by the cancerous cells to escape tgf growth inhibitory effects . In breast cancer, as foxo3a is a positive regulator of the pro - apoptotic bim essential for gc - induced apoptosis [227229], mir-155 overexpression may prevent bim upregulation . In one study, mir-93, mir-25, mir-92, mir-19a / b, mir-181a / b, and mir-32 were shown to be significantly overexpressed, while let7-b, let7-i, let7-c, mir-29a, and -29b significantly downregulated in mm . . Found decreased expression of mir-15a~16 and increased expression of mir-222, mir-221, mir-382, and mir-181a / b in their mm samples . Also, the 13q14.3 locus containing the mir-15a and mir-16 - 1 is sometimes deleted in mm [345, 746748]. The absence of mir-15a expression and overexpression of mir-181a / b correlated with worse prognosis of mm . Antagonists especially to mir-19a / b and mir-181a / b (antagomirs) suppressed tumor growth of human myeloma cells implanted into nude mice . Some differential mirna expression was observed between malignant mm and mgus (monoclonal gammopathy of undetermined significance), which is the precancerous state preceding mm . Mgus show already upregulation of mir-21, mir-106~25, mir-181a / b, mir-1, and mir-133a, while during the progression to malignant multiple myeloma mir-17~92, mir-32, mir-193b~365 are upregulated and mir-192~194~215 and mir-15a~16 are downregulated [574, 576, 577]. The upregulation of mir-17~92 could be related to the upregulation of c - myc observed during mm progression [750, 751]. Upregulation of mir-1 and mir-133a correlated with t(14; 16) translocation in mm cases, suggesting that deregulation of microrna expression could be associated with chromosomal abberations . Higher expression of dicer was associated with improved progression - free survival in symptomatic mm cases . The global increase in microrna expression in high - risk mm patients with poor prognosis was associated with increased expression of argonaute (ago2/elf2c2), a master regulator of mirna maturation and function [753, 754]. Adhesion of multiple myeloma to bone marrow stroma triggers cytokine production and enhances cell proliferation and resistance to chemotherapy through il-6-induced activation of nfb, pi3k / akt, and stat3 pathways . It should be noted that these pro - survival pathways antagonize gc - induced apoptosis in mm [756760]. Mir-19a and mir-19b that are part of the mir-17~92 cluster downregulate socs-1 (suppressor of cytokine signaling-1), a gene frequently silenced in mm that plays a critical role as inhibitor of il-6 growth signaling, thus enforcing the il-6-induced survival signals . The oncogenic mir-21 is upregulated in mm patient samples and cell lines [574, 579, 652]. In il-6-dependent ectopic mir-21 expression was sufficient to sustain growth of il-6-dependent cell lines in the absence of il-6 . Mir-21 is upregulated in a nfb - dependent manner in mm cells upon cell adhesion to bone marrow stromal cells . Combining mir-21 inhibition with dexamethasone the p300-cbp - associated factor (pcaf) was found to be a target of the combined action of the mir106b~25 cluster and mir-32 . Mir106b~25, mir-17, and mir-20a target the cdkn1a1/p21 cell cycle regulator, which prevents cell cycle progression in general and prevents the growth of mm cells [764, 765]. Mir-15a~16 is a pro - apoptotic microrna that targets bcl-2, cyclin d1, cyclin d2, and cdc25a [346, 748, 766768]. Overexpression of mir-15a~16 in mm led to inhibition of akt3, ribosomal protein s6, map kinases, and the nfb - activator map3kip3, ultimately resulting in an antiproliferative effect and apoptosis . The anti - mm effect of mir-15a~16 was observed even in the context of the bone marrow microenvironment . Mir-15a~16 reduced vegf secretion from mm cells, thereby reducing mm cell - induced pro - angiogenic activity on endothelial cells . Vegf represents one of the major pro - angiogenic cytokines responsible for the induction of neoangiogenesis in mm patients [769, 770]. A distinct microrna profile could distinguish between alk and alk subtypes of alcl, an aggressive form of non - hodgkin's lymphoma (nhl) belonging to the t - cell lineage . More than 80% of alk alcl harbor the t(2; 5)(p23; q35) translocation, resulting in the expression of the chimeric nucleophosmin (npm)-alk . The constitutive alk activity leads to the activation of many different growth - promoting and anti - apoptotic pathways including pi3k / akt / mtor, jak / stat, c - jun, junb, and c - myc . The prognosis of alk alcl is worse [772, 773]. Alk alcl has a high cure rate with chop treatment, in contrast to alk cells that are relative resistant . Five members of the mir-17~92 cluster were expressed higher in alk alcl, whereas mir-155 was expressed more than 10-fold higher in alk alcl . The upregulation of mir-17~92 cluster in alk alcl cells is in agreement with the observation that c - myc is expressed in alk alcl and absent from alk samples . Mir-101 targets mtor, mcl-1, and the histone methyltransferase ezh2 [778, 779]. Inhibition of mtor, which is targeted by mir-101, led to reduced tumor growth in engrafted alcl mouse models . Mir-29a and mir29b down - regulation in alk alcl confer apoptotic resistance due to mcl-1 upregulation [380, 587]. Another microrna that has been implicated in npm - alk - driven oncogenicity is mir-135b . Mir-135b inhibition reduced tumor angiogenesis and growth in vivo, suggesting that targeting this microrna has therapeutic potential . A 9-mirna signature (mir-146b-5p, mir-146a, mir-21, mir-155, mir-500, mir-222, mir-363, mir-574 - 3p, and mir-574 - 5p) could differentiate the diffuse large b - cell lymphoma (dlbcl), the most common subtype of non - hodgkin's lymphoma, into abc (activated b - cell) or gcb (germinal center b - cell) subtypes, with a general higher expression in the abc subtype . Another study found that mir-331, mir-151, mir-28, and mir-454 were upregulated in the gcb type, whereas mir-222, mir-144, mir-451, and mir-221 upregulated in the abc type . The microrna expression of both gcb - like and abc - like cells was more similar to germinal center lymphocytes than memory b - cells . The region encoding the mir-17~92 cluster was more commonly amplified in gcb - like than abc - like dlbcl . Lawrie et al . Identified 3 mirnas, mir-155, mir-21, and mir-221, more highly expressed in abc type than gcb type cells . Expression of mir-155 and mir-21 was also higher in nonmalignant abc than in gcb cells . Patients with gcb dlbcl have longer overall survival and event - free survival compared with patients with an abc phenotype when treated with r - chop [782, 783]. Increased expression of mir-18a in dlbcl was associated with a shorter os (overall survival) of patients receiving r - chop regimen . Increased expression of mir-181a was associated with longer pfs (progression - free survival), while increased expression of mir-222 was associated with shorter pfs . In dlbcl, mir-181a regulates foxp1 (forkhead box protein p1) and mgmt (o - methylguanine - dna methyltransferase) expression in dlbcl cells . Foxp1 is expressed in normal activated b cells, mantle zone b cells, and some germinal center b cells [784, 785]. Foxp1 is recurrently targeted by chromosomal translocations involving the immunoglobulin heavy chain locus in marginal zone lymphomas and dlbcl, suggesting a potential role for foxp1 in lymphomagenesis [786, 787]. Foxp1 has in some studies been shown to be associated with poor prognosis and survival [788, 789]. The ability of mir-181a to reduce mgmt protein expression may contribute to better cyclophosphamide chemosensitivity . Mir-222 is part of the mir-221/mir-222 cluster, which is highly expressed in abc - like dlbcl cell lines and abc - like dlbcl tumors . Mir-222 regulates the expression of the stem cell factor c - kit, and the cyclin - dependent kinase inhibitors p27 and p57 [695, 698]. High expression of mir-222 was associated with inferior overall survival and progression - free survival . Fl is characterized by high mir-9, mir-138, mir-20a / b, and mir-155 expression [135, 564, 582]. Mir-9 targets also the transcription factor prdm1/blimp1 in lymphoma and may contribute to the phenotype maintenance and pathogenesis of lymphoma cells by interfering with normal b - cell terminal differentiation [582, 608]. Brdm1/blimp1 and bcl6 are critical regulators of germinal center b - cell differentiation [594, 792, 793]. Brdm1/blimp1 and bcl6 are expressed in a mutual exclusive pattern and evidence suggests that they repress each other in germinal center b cells [792, 794]. A marked decrease of brdm1/blimp1 and an increase of bcl6 were observed in follicular lymphoma cells, which might be related to the increased mir-9 levels in these cells . Mutations in brdm1/blimp1 are frequently found in activated b cell (abc)-like dlbcl [790, 795]. The malignant hodgkin's lymphoma cells are usually derived from b cells, but have lost the expression of typical b - cell genes . Multiple signaling pathways are deregulated, including nfb, jak (janus kinase)/stat (signal transducer and activator of transcription), pi3k / akt, erk, notch1, and receptor tyrosine kinases . Patients with low mir-135a expression had a higher probability of relapse and a shorter disease - free survival . Mir-135a targets jak2, a cytoplasmic tyrosine kinase involved in a subset of cytokine receptor signaling pathways . Transfection of pre - mir-135a into classical hl (chl) caused apoptosis and decreased cell growth . The mir-135a - mediated jak2 down - regulation led to decreased bcl - xl expression, a downstream effector of jak2 . About 40%60% of hodgkin's lymphomas have ebv (epstein - barr virus) associated with the malignant cells . Since mir-155 is overexpressed in hodgkin's lymphoma and promotes b - cell lymphoma formation [602, 798, 799], ebv may be important in the pathogenesis of chl . Micrornas have been shown to modulate gr expression in neuronal tissue [649, 800, 801]. Mir-18 and mir-124a especially reduced gr - mediated events in addition to decreasing gr protein levels . Upregulation of the mir-17~92 has causally been related to small cell lung cancer [802, 803], where reduced gr levels have been associated with gc resistance . Activation of the gr - responsive glucocorticoid - induced leucine zipper (gilz) was impaired by mir-124a and -18 overexpression, while mirs-22, -328, and -524 did not have any effect . Of note, mir-124 regulates hes1 expression in p19 teratocarcinoma cells, a transcription factor that negatively regulate gr expression . While mir-130b, -181a, and -636 have putative complimentary binding sites in the 3-utr of gr, only mir-130b was found to down - regulate endogeneous gr protein expression in the multiple myeloma cell line mm.1 . The mir-130b, -181a, and -636 were differentially expressed between gc - sensitive and gc - resistant mm.1 cell lines . Overexpression of mir-130b in mm.1s cells resulted in decreased expression of endogeneous gr, decreased induction of the gr - target gene gilz, and induction of gc resistance . Expression of mir-130b was therefore suggested to be a potential biomarker for patients who could be refractory to gc therapy . In gastric cancers, mir-130b regulated the tumor suppressor gene runx3 . Mir-130b may also down - regulate p21, resulting in inhibition of cellular senescence [676, 806]. Another study showed that elevated mir-142 expression in human t - all cells confers gc resistance by reducing the gr expression level . Other mechanism for the oncogenic role of mir-142 might be explained by its targeting of adenylyl cyclase 9 mrna leading to reduced production of cyclic adenosine monophosphate (camp) production with concomitant inhibition of the protein kinase a (pka) signaling pathway . The reduction in camp levels and reduced pka activity caused by mir-142 relieve the inhibitory effect of pka on t - leukemic cell proliferation . T - all with poor prognosis expressed higher levels of mir-142 than those with good prognosis . Also, mir-142 was expressed at higher levels in relapsed t - all than newly diagnosed samples . Transfection of mir-142 inhibitor increased gr expression levels and sensitized t - all cells to gc - induced apoptosis . These findings are in accord with previous findings showing a synergistic effect of camp mimetics on gc - induced apoptosis [99, 460, 807]. Camp signaling can also be negatively regulated by phosphodiesterase 4b (pde4b) that is frequently overexpressed in diffuse large b - cell lymphoma (dlbcl). Pharmacological inhibition of pde4 in a xenograft model of human lymphoma unleashed camp effects, inhibited akt, and restored gc sensitivity . Pde4 inhibitors may thus improve the clinical outcome of patients with b - cell malignancies . Triptolide, a drug that overcomes dexamethasone - resistance in human multiple myeloma cells, was found to regulate gr expression in the mm1.s cell line by downregulating the expression of mir-142 and mir-181a . Mir-142 and mir-181a mimetics slightly attenuated, whereas mir-142 and mir-181a inhibitors enforced gc - induced apoptosis of mm1.s cells . Mir-181a / b can also increase gc - induced apoptosis in virtue of their ability to repress the expression of the anti - apoptotic bcl-2, mcl-1, and xiap proteins [385, 539, 810]. . Showed that broad microrna repression occurs during gc - induced apoptosis of rat thymocytes . This repression was associated with reduced expression of both nuclear (drosha and dgcr8/pasha) and cytoplasmic (dicer) microrna processing enzymes . Silencing of dicer in two human leukemic cell lines (cem - c7 and ectopic gr-overexpressed jurkat cells) led to enhanced sensitivity to gc - induced apoptosis . Global downregulation of microrna levels, especially the mir-17 family, by gcs was also observed in gc - sensitive all cell lines, with concomitant upregulation of bim . Later studies showed that gcs selectively upregulate and downmodulate specific mirnas that cannot be explained by altered dicer expression . One polycistron cluster repressed by gcs is mir-17~92 [648, 657], which regulates bim expression [246, 247]. This microrna cluster also represses pten, a negative regulator of the pi3k / akt signaling pathway . The gc - mediated downregulation of mir-17~92 might be one mechanism responsible for the gc - induced dephosphorylation of akt . Primary thymocytes derived from mice transgenic for the mir-17~92 polycistron members in the lymphocyte compartment exhibited diminished sensitivity to gc - induced apoptosis in lymphocytes, further supporting a role for gc - induced repression of mir-17~92 in promoting apoptosis . Observed that gcs reduced mir-17 family expression in 50% of primary gc - sensitive all, but not in any of the gc - resistant ones . Overexpression of mir-17~92 attenuated gc - induced cell death, while inhibition of mir-17~92 increased the sensitivity to gc . They also reported that in a pre - b all cell line, a 10-hour dexamethasone treatment led to a reduction in mir-142 and mir-27a, while mir-9 was induced . There is also some evidence that gcs can reduce mir-27a expression in mouse muscle cells . Rainer et al . Reported an induction of the myeloid - specific mir-223 and the apoptosis and cell - cycle arrest inducing mir-15~16 clusters by gc in a subset of b- and t - all cells, together with downregulation of the mir-17~92 complex . The mirnas of the mir-15~16 family are encoded in two clusters (15a~16 - 1 and 15b~16 - 2) embedded in the dleu2 (deleted in leukemia 2) and smc4 loci, respectively [766, 812]. They have been implicated in cell - cycle arrest and in cell death / survival decisions, the latter supposedly by targeting bcl-2 . Other micrornas affected by gcs in pediatric all include upregulation of mir-548d-1 and repression of mir-128b along with mir-106b~25~93, the paralogue of mir-17~92 . It is still not known whether the gc - induced upregulation of mir-223 affects gc - induced apoptosis . Increased expression of mir-223 is involved in the differentiation of myeloid precursors into granulocytes such as neutrophils [701, 814]. During granulopoiesis, mir-223 targets e2f1, which in turn represses mir-223 expression, creating an autoregulatory negative feedback loop . A negative feedback loop also exists between mir-223 and the transcription factor nfi - a . Mir-223 is positively regulated by c / ebp during differentiation to granulocytes and negatively regulated by aml1/eto in leukemia cells . Moreover, mir-223 targets the myeloid elf-1-like factor (mef)-2c and igfr (insulin - like growth factor receptor), which may account for some of its negative regulation of granulocyte proliferation . Through suppression of igf-1r, the downstream pi3k / akt / mtor / p70s6k pathway is suppressed, with consequent inhibition of cell proliferation . Mir-223 attenuates hematopoietic cell proliferation and positively regulates mir-142 through lmo2 isoforms and c / ebp . Mir-223 knockout mice showed increased numbers of granulocyte progenitors in the bone marrow and hypermature neutrophils in the circulation, suggesting that mir-223 is involved in the negative regulation of maturation rather than differentiation of granulocytes . Mir-223 may also target fbw7 [705, 816], a negative regulator of the anti - apoptotic mcl-1 . Dexamethasone treatment of thymocytes led to upregulation of mir-150 and mir-342, while mir-181a and mir-181d were downregulated . Lif is a member of the il-6 cytokine family expressed in thymic epithelial cells and t lymphocytes, which elevates gc levels following lps exposure and is responsible for thymic atropy induced by stress [817819]. A recent report showed that gcs could prevent lipopolysaccharide (lps)-mediated inflammatory responses in macrophages by downregulating mir-155 . Overexpression of mir-155 reversed the suppressive action of gcs, while inhibition of mir-155 exhibited an effect similar to that of gcs on lps - treated macrophages, suggesting that gc - induced repression of mir-155 is one mechanism for the immunosuppressive function of gc . Mir-155 is transcribed from b - cell integration cluster (bic) [584, 691] and targets among others socs1 (suppressor of cytokine signaling 1), which negatively regulates jak / stat signaling . Gcs also prevented the lps - mediated upregulation of mir-146, mir-147, mir-148, mir-32b, and mir-301 in macrophages . In the brain, gcs prevents bdnf (brain - derived neurotrophic factor)-regulated synaptic function through suppression of mir-132 expression . Mir-132 is increased by bdnf and is involved in promotion of neuronal outgrowth . In some carcinoma cell lines, dexamethasone was shown to down - regulate mir-27b, mir-148a, and mir-451 . From all we have learned above, any microrna that modulates any of the many factors regulating gc - induced apoptosis may affect the apoptotic response to gcs (figures 16). These include micrornas that affect gr expression (e.g., mir-18, mir-124a, mir-130b, mir-142, and mir-181a), those affecting bim expression (mir-26a, mir-93, mir-17~92, mir-106a~363, and mir-106b~25) or its transcription factor foxo3 (e.g., mir-1, mir-21, mir-27a, mir-96, mir-135b, mir-155, and mir-182), those affecting pten expression (mir-17~92, mir-106b~25, mir-21, mir-26a, mir-29b, mir-214, mir-216a, mir-217, mir-221, and mir-222) or mtor (e.g., mir-101), and those downregulating directly or indirectly the anti - apoptotic proteins bcl-2, bcl - xl, mcl-1, xiap, and cyld (e.g., mir-15a~16, mir-181a / b, mir-34a, mir-125b, mir-29a / b / c, mir-101, mir-133b, mir-193b, mir-512, let-7, and mir-491). The effect of some of these micrornas on gc - sensitivity has already been described above and will not be repeated here . Rather, i will present here some data from primary samples showing the influence of micrornas on clinical outcome . A study searching for differential mirnas expression in all relapse cells versus childhood all with complete remission showed significant associations for mir-708, mir-223, and mir-27a with individual relapse - free survival . For samples at relapse versus diagnosis, the most differentially expressed micrornas included mir-223, mir-23a, let-7 g, mir-181, mir-708, and mir-130b, while comparison of complete response with diagnostic samples showed differential expression pattern of mir-27a, mir-223, mir-23a, mir-181, and mir-128b . Among these micrornas, mir-223, mir-128b, mir-23a, and let-7 g were downregulated in the relapse samples compared with complete response samples, while mir-181 family members, mir-708, and mir-130b were upregulated in the relapse samples . It should be remained here that mir-130b targets gr, runx3, and p21, and mir-223 is upregulated by gcs and targets igfr and e2f1 . E2f1 has a dual role in cell - cycle control, as it affects several cell processes . It can either act as a tumor - suppressor or oncogene depending on the cellular context . Thus, the upregulation of mir-130b together with downregulation of mir-223 may contributes to gc resistance . Mir-708 was the most upregulated microrna in the relapse samples, whereas mir-223 was significantly downregulated, suggesting that these two micrornas may have important role in pediatric all relapse . Moreover, upregulation of mir-708 was found to be associated with the in vivo gc therapy response and with disease risk stratification in childhood all . Standard and middle risk stratification groups had a higher mir-708 expression at diagnosis than the high risk group . Interestingly, mir-708 was low in high relapse patients at diagnosis, while specimens of relapsed samples showed abundance of mir-708, suggesting for an upregulation of mir-708 during disease progression . Foxo3, that is critical for hematopoietic stem cell self - renewal and mediates the initial apoptotic response [825827], contains a conserved mir-708 response element in its 3-utr . Foxo3 can act as either an oncogene or a tumor suppressor in leukemia [828, 829]. Foxo3 transcriptional activity was found to prevent b - cll and cml proliferation [825, 828]. Foxo3a is also targeted by other micrornas, including mir-27a (see section 2.2.6). Moreover, mir-27a directly regulates the drug - resistant factor p - glycoprotein, and overexpression of mir-27a increased sensitivity of leukemia cells to doxorubicin . Mir-27a is relevant to treatment outcome in vivo and may be involved in relapse of both lymphocytic leukemia and myeloid leukemia . Low expression of mir-27a might promote all relapse [655, 658]. On the contrary, mir-27a exerts oncogenic effects by regulating zbtb10 [446, 830] and fbw7 [253, 438]. Mir-128b, which was higher in relapse all and at diagnosis compared to complete response, has been reported to confer drug resistance in many cancers including all [672, 673]. Both mir-27a and mir-128b might target bmi1, a transcription factor of the polycomb - group gene necessary for hematopoietic stem cell (hsc) and leukemia stem - cell self - renewal [831, 832]. Deletion of bmi1 inhibits self - renewal of tumor stem cells and prevents leukemia recurrence . A role for mir-128 and mir-221 in regulating gc sensitivity in cells from mll - af4 all patients has been proposed . Mir-128b and mir-221 are downregulated in mll - arranged all relative to other types of all . The mll gene is located at 11q23, a site frequently involved in chromosomal translocations in aggressive human lymphoid and myeloid leukemias . As a result of chromosomal translocations, a portion of mll becomes fused to one among more than 40 different partner proteins . Mll - af4 all, which results from the translocation between mll and af4, is associated with gc resistance and has a poor prognosis [834, 835]. Re - expression of mr-128 and mir-221 in cultured mll - af4 all cells sensitized them to gcs . Mir-128 targets mll, af4, and the mll - af4 pusion protein resulting in lower expression of hoxa9, whereas mir-221 downregulates cdkn1b (cyclin - dependent kinase inhibitor 1b, p27), another gene transcriptionally activated by mll - af4 as well as the wild - type mll protein . The targeting of different proteins may explain the cooperative effect of mir-128b and mir-221 on gc sensitization . It should be noted that mir-221 in other settings, for example, cll, has anti - apoptotic effects and functions as an oncogene . In light of the multiple effects of various micrornas on cell survival and apoptosis, modulating microrna expression in tumor cells is an attractive approach for sensitizing the tumor cells to chemotherapeutic drugs . Inhibition of specific micrornas is performed by using antisense sequences (termed antagomirs) targeting the microrna guide stand that blocks the interaction with the microrna recognition elements within the 3-utr of the target mrna genes . To increase their binding affinity and stability in biological fluids, the antagomirs are often modified with 2-o - methyl-, phosphorothioate, or locked nucleic acid substitutions . To overexpress micrornas, one potential use of micrornas is to repress the expression of mll - af4 fusion protein in all that is responsible for gc resistance . This fusion protein can be repressed through overexpression of mir-143, or mir-128 together with mir-221 . The latter combination was shown to sensitize the mll - af4-carrying all cells to gcs . Another promising approach is to target mir-155, an oncogenic microrna often correlated with poor prognosis . They showed that overexpression of mir-155 in lymphoid tissues resulted in disseminatedlymphomacharacterized by a clonal, transplantable pre - b - cell population of neoplastic lymphocytes . Systemic delivery of antisense peptide nucleic acids encapsulated in unique polymer nanoparticles inhibited mir-155 and slowed the growth of these pre - b - cell tumors in vivo . Glucocorticoid - induced apoptosis appears to be a complex process involving several signaling pathways (figure 6). These include (1) transactivation of pro - apoptotic genes (importantly bim); (2) alterations in microrna expression (upregulation of mir-15~16 that targets the pro - apoptotic bcl-2; mir-223 that targets igfr; mir-150 that targets akt and notch, while suppressing mir-17~92 that prevents bim and pten translation); (3) direct action of gr on the mitochondria (including mitochondrial gr translocation and production of reactive oxygen species within the mitochondria); (4) activation of the protein kinases gsk3 and p38; (5) activation of the foxo3a transcription factor that upregulates bim; (6) inhibition of the notch1, pi3/akt / mtor, and erk1/2 survival pathways . Altered microrna expression in malignant cells may modulate many of these processes thereby imposing apoptotic resistance (figures 16). Gc - resistant lymphoid cells might be divided into two major subgroups according to the underlying mechanism of resistance . The first group consists of cancer cells whose drug resistance can be overcome by exposing the cells to gcs in combination with drugs that target protein kinases such as akt, mtor, src, alk, and/or bcr, or drugs antagonizing bcl-2, bcl - xl, mcl-1, c - myc, or notch . These lymphoid malignancies show in general a more favorable response to combined gc therapy and in many cases may be explained by their growth dependency on these signaling molecules . The second group of gc - resistant cells exhibits an intrinsic defect in the gc - mediated apoptotic process and can thus not be turned sensitive to this drug . It is important to distinguish between these two subgroups prior to therapy initiation in order to choose the right drug combination . A diagnostic test needs to be developed that can distinguish between the different resistance backgrounds . Recently, burnsides et al . Have developed an ex vivo stimulation assay that determines the ability of leukocytes to upregulate anti - inflammatory genes such as gilz and fkbp51 following exposure to dexamethasone . It is reasonable that a similar test may be developed to gene profiling lymphoid malignancies prior to and following gc treatment, where upregulation of the pro - apoptotic bim gene would be a favorable predictor . Also, bim induction may be measured after combining gc with a protein kinase inhibitor . Simultaneous expression profiling of micrornas, notch1, and bcl-2 family proteins together with the activated protein kinase status in the malignant cell would provide valuable information for choosing the proper drug combination . A predictor for a good gc response would be to determine the ability of gcs to downregulate mir-17~92 and upregulate mir-15~16, mir-150, and mir-223 . A tentative therapeutic approach would be to modulate the microrna status of the cell using microrna mimics or antagomirs as described in section 4.4 . What we have learned from the studies described in this paper is that it seems that in general it would be favorable to augment the expression of mir-29, mir-27, mir-15a~16, mir-34a, mir-150, and let-7, while suppressing mir-155, mir-181, mir-182, mir-21, and mir-221/222 as well as mir-17~92 . Obviously, an initial microrna profiling should be performed, and the cancer - type classification should be considered . While down - regulation of mir-181 may suppress the growth of t - all and mm, augmented mir-181 expression prevents the growth of unmutated igvh cll cases . Also, mir-26a has a dual effect . Its overexpression prevents growth of c - myc - positive burkitt lymphoma, while it must be downregulated in notch - positive t - all to achieve growth inhibition . Mir-451 and mir-709 could prevent growth of notch - positive t - all . A reduction in mir-142, and maybe also of mir-708, which is highly expressed in relapsed childhood t - all, is anticipated to improve t - all therapy . For classical hl, mir-135a may cause apoptosis . In conclusion, in certain types of lymphoid malignancies, gc resistance may be overcome by relieving the inhibitory effects of protein kinases and bcl-2 family members . Both the activity of protein kinases and the expression of bcl-2 members are affected by the microrna network . Modulation of microrna expression might increase gc drug responsiveness and thus improve the therapy of lymphoid malignancies. |
Advances in cancer treatment have resulted in improved relative survival rates . However, many oncology patients are faced with treatment - related symptoms and conditions that lead to increased use of health services, including emergency departments (eds). Febrile neutropenia (fn) is such a condition and remains one of the most common causes of oncological patient presentation to the ed . Febrile neutropenia is a life - threatening treatment - related condition that requires urgent management in the ed . Although there have been many advances in the treatment of fn, such patients are known to be at risk of serious infections that are associated with 1242% mortality . The management of febrile neutropenic patients should be based on their clinical course and possible infection source . Early prediction of bacteremia with timely and tailored empiric antimicrobial therapy will improve the prognosis of patients with fn . Recent progress in the treatment of neutropenic fever has underscored the importance of risk stratification and indicated the need to evaluate predictive factors for outcomes in fn . Patient - specific risk factors, comorbid conditions, performance status, type of cancer and stage, age, number of previous febrile neutropenic episodes, and the severity and duration of neutropenia have been considered important predictors of outcomes . Based on the characteristics of fn patients, several predictive models have been developed to classify patients into low- or high - risk groups . (2000) developed an internationally validated scoring system called the multinational association of supportive care in cancer (mascc) risk index score . The mascc score also allows the selection of low - risk patients who can be safely treated with orally administered antibiotics . A mascc score 21 indicates that the patient is at low risk of complications and mortality (table 1). The clinical risk - prediction model proposed by the mascc is widely used in clinical practice to define low - risk febrile neutropenia . In the present study, we analyzed the clinical factors predictive of poor outcomes in patients with chemotherapy - induced fn at initial patient evaluation in the ed . All adult chemotherapy - induced fn patients who presented to the ed of the university of ankara hospital from january 1, 2011 to december 31, 2013 were included in this study . Approval to conduct the study was granted by the ethics committee of the university of ankara . Overall, 200 chemotherapy - induced fn patients over 18 years of age and with hematological and oncological malignancies were evaluated retrospectively . Fever was defined as body temperature greater than 38.3c at triage or a temperature of 38c for 1 h or longer during the first 24 h . A c - reactive protein (crp) cut - off value of 50 mg / dl was used, as proposed in a previous study . Clinical data were obtained from medical records in the electronic patient record system . Upon arrival in the ed, we collected information regarding clinical data (sex, age, vital signs, underlying systemic diseases), laboratory test results (assessment of complete blood count, blood chemistry with differential, liver and renal function tests, blood glucose, electrolytes, protein, estimated glomerular filtration rate [egfr], blood cultures, crp concentration), and radiological examinations (a chest radiograph of all febrile neutropenic patients). Egfr was calculated from serum creatinine using the modification of diet in renal disease (mdrd) study equation . The mascc risk index score was calculated for all patients with chemotherapy - induced neutropenic fever . Outcomes were categorized as good if the patient could be discharged without any serious complications and poor if there were serious complications during hospitalization or if death occurred . Serious complications included refractory hypotension (defined as systolic blood pressure less than 90 mmhg that required treatment with vasopressors agents), respiratory failure (defined as the need for mechanical ventilation), need for intensive care unit (icu) admission, renal failure, need for treatment with fluids or hemodialysis, severe bleeding and need for transfusion, fungal infection, altered mental status, arrhythmia requiring treatment, chronic heart failure, and allergic reactions to treatment . This list of serious medical complications was adapted and modified from klastersky et al . . The following data were collected: a) variables that were available at presentation, such as age, sex, laboratory variables (hemoglobin, neutrophil count, crp, egfr, protein, platelet count), chest x - ray, and comorbidities (e.g., diabetes mellitus, heart failure, copd, acute coronary syndromes); b) other variables that were determined at triage such as vital signs (respiratory and pulse rates, systolic blood pressure); and c) variables related to blood cultures and complications during hospitalization . Differences between the 2 groups were evaluated using the t - test for continuous variables . Categorical variables were assessed using the chi - square test, and odds ratios were calculated . To define the risk factors of the outcome variables (mortality and complications), the sensitivity, specificity, and positive and negative predicted values were calculated for diagnostic performance of the multiple logistic regression model . Differences between the 2 groups were evaluated using the t - test for continuous variables . Categorical variables were assessed using the chi - square test, and odds ratios were calculated . To define the risk factors of the outcome variables (mortality and complications), multiple logistic regression analysis was used, and adjusted odds ratios were calculated . The sensitivity, specificity, and positive and negative predicted values were calculated for diagnostic performance of the multiple logistic regression model . During the study period, there were 200 episodes of fn in 200 patients with cancer . The mean and median age of the study patients were 56.413.46 (mean standard deviation) and 57.5, respectively . Of the 200 febrile episodes, 72 (36%) had bacteremia and 128 (64%) were categorized as an unexplained fever (table 2). Serious medical complications were observed in 105 (52.5%) patients and 64 (32%) patients died during hospitalization (table 3). Univariate analyses of the clinical parameters available from the ed and mascc scoring system were performed (table 4). In the multiple logistic regression analysis, a platelet count <50 000 cells / mm (or 3.93, 95% ci 1.4210.92), serum crp> 50 mg / dl (or 3.80, 95% ci 1.688.61), hypoproteinemia (or 7.81, 95% ci 3.4317.78), egfr 90 ml / min/1.73 m (or 3.06, 95% ci 1.138.26), and mascc risk - index score <21 (or 3.45, 95% ci 1.537.79) were determined to be independent risk factors for the prediction of poor clinical outcomes of fn patients admitted to the ed (table 5). These risk factors were predictive of serious complications with sensitivity, specificity, positive predictive value (ppv), and negative predictive value (npv) of 81%, 78%, 81%, and 79%, respectively . As shown in table 6, the clinical parameters and mascc scores were evaluated with univariate analysis . In the multiple logistic regression analysis, a platelet count <50 000 cells / mm (or 3.90, 95% ci 1.629.43), pulmonary infiltration (or 3.45, 95% ci 1.488.07), hypoproteinemia <6g / dl (or 3.30, 95% ci 1.278.56), respiratory rate> 24/min (or 8.75, 95% ci 2.1835.13), and mascc risk - index score <21 (or 9.20, 95% ci 3.9821.26) were determined to be independent risk factors for death (table 7). These parameters were predictive of death with sensitivity, specificity, positive predictive value (ppv), and negative predictive value (npv) of 75%, 89%, 77%, and 88%, respectively . During the study period, there were 200 episodes of fn in 200 patients with cancer . The mean and median age of the study patients were 56.413.46 (mean standard deviation) and 57.5, respectively . Of the 200 febrile episodes, 72 (36%) had bacteremia and 128 (64%) were categorized as an unexplained fever (table 2). Serious medical complications were observed in 105 (52.5%) patients and 64 (32%) patients died during hospitalization (table 3). Univariate analyses of the clinical parameters available from the ed and mascc scoring system were performed (table 4). In the multiple logistic regression analysis, a platelet count <50 000 cells / mm (or 3.93, 95% ci 1.4210.92), serum crp> 50 mg / dl (or 3.80, 95% ci 1.688.61), hypoproteinemia (or 7.81, 95% ci 3.4317.78), egfr 90 ml / min/1.73 m (or 3.06, 95% ci 1.138.26), and mascc risk - index score <21 (or 3.45, 95% ci 1.537.79) were determined to be independent risk factors for the prediction of poor clinical outcomes of fn patients admitted to the ed (table 5). These risk factors were predictive of serious complications with sensitivity, specificity, positive predictive value (ppv), and negative predictive value (npv) of 81%, 78%, 81%, and 79%, respectively . As shown in table 6, the clinical parameters and mascc scores were evaluated with univariate analysis . In the multiple logistic regression analysis, a platelet count <50 000 cells / mm (or 3.90, 95% ci 1.629.43), pulmonary infiltration (or 3.45, 95% ci 1.488.07), hypoproteinemia <6g / dl (or 3.30, 95% ci 1.278.56), respiratory rate> 24/min (or 8.75, 95% ci 2.1835.13), and mascc risk - index score <21 (or 9.20, 95% ci 3.9821.26) were determined to be independent risk factors for death (table 7). These parameters were predictive of death with sensitivity, specificity, positive predictive value (ppv), and negative predictive value (npv) of 75%, 89%, 77%, and 88%, respectively . The development of multi - drug chemotherapy protocols in the treatment of hematological conditions and solid organ tumors, use of high - dose drugs, and improved supporting treatment options have improved the chances of survival for cancer patients in recent years . However, these treatment regimens also result in immunosuppression and neutropenia, conditions that make patients prone to developing severe infections . Currently, clinicians are aiming to prolong life with these new anti - cancer treatments while also reducing adverse effects such as fn . One of the most important subjects of recent research is the ability to predict the prognosis of these patients . Guidelines have been developed to categorize fn patients into low- or high - risk groups . This scoring system, which predicts prognosis, is believed to be more useful in low - risk patients . High fever in a neutropenic patient requires prompt treatment with broad - spectrum antibiotics until the culture results are obtained . This urgent approach requires emergency physicians to predict independent risk factors for fn apart from those indicated by the massc risk - scoring system . However, only a few studies have been conducted in the ed setting to identify independent factors associated with serious complications after the emergent diagnosis of fn . In this study, independent predictive factors for serious complications in patients diagnosed with fn were identified with a sensitivity of 81% and specificity of 78% . Previous studies that aimed to predict complicated fn in the ed found that laboratory parameters (e.g., platelet count, crp, and pulmonary infiltration as revealed by chest x - ray) identified patients likely to develop complications . Our results are in agreement with these studies; platelet counts of 50 000cells / mm and crp, an indicator of inflammation, were associated with serious complications . Platelets are unique blood cells with specialized molecular repertoires that have evolved to accomplish crucial functions in host integrity, defense, and repair . Growing evidence shows that platelets play an active role in fighting infection and innate immunity, and thrombocytopenia is frequently observed in systemic infections . Previous studies have found that the severity of thrombocytopenia is associated with increased mortality rates [1315]. In our study, the level of serum crp was also recognized as an independent factor . Because infections are the major cause of morbidity and mortality in neutropenic patients, considerable attention has focused on the value of acute - phase reactants in identification of high - risk patients . However, results from previous studies have been inconsistent, and their cut - off points are variable . We used a cut - off value of crp of 50 mg / dl, as proposed in a previous study . Several studies have reported that crp is a significant predictor of severe sepsis, while other studies have stated that crp was not useful in predicting infectious complications in neutropenic patients . However, in our study, we found crp (or 3.8, 95% ci 1.688.61) to be a significant predictor of serious complications . In our study, egfr <90 ml / min/1.73 m is associated with increased risk of serious complications . The observed increased risk of serious complications from neutropenic patients with reduced egfr is considerable, and we suggest that decreased kidney function itself is a predictor of poor outcomes . First, previous studies have shown that patients with chronic kidney diseases (ckd) are less likely to undergo cancer screening, and patients with ckd also have multiple comorbid conditions . There is little information regarding the optimal timing and necessary dose adjustment of cytotoxic agents for patients with reduced kidney function . In a previous study, iff et al . Stated that an egfr <60 ml / min/1.73 m is a risk factor for cancer deaths and is also a predictor of poor cancer outcomes in the older population . Except for their study, we were unable to find another study that evaluated the egfr threshold associated with an increased risk of cancer death . In another study, g / l) was found to be associated with severe sepsis in neutropenic patients . In our study, hypoproteinemia was another independent factor that could predict serious complications in febrile neutropenic patients . This finding can be explained by the fact that intensive chemotherapy can lead to energy consumption and high protein catabolism . These are common features in progressive advanced cancer and are responsible for increased severe hematological toxicity . Clinical malnutrition, which negatively affects patient response to therapy, increases the incidence of treatment - related adverse effects and can decrease survival . Numerous studies have shown that patients with a mascc risk index score of less than 21 should be considered at high risk for complications, as we did in our study . In this study, independent predictive factors for death in patients diagnosed with fn have been identified with a sensitivity of 75% and specificity of 89% . We found that hypoproteinemia, platelet counts of 50 000 cells / mm, and the mascc risk index score were independent predictive factors . Additionally, a respiratory rate> 24/min (or 8.75, 95% ci 2.1835.13) was the only component in vital signs that was predictive of exitus in multivariate analysis . In a recent study of patients with hematological malignancies, tachypnea was a predictor of septic shock and of poor prognosis of febrile neutropenic patients . In previous studies, infiltration or abnormality in the chest x - ray both aspects could be responsible for the mortality rate of up to 2550% (2426). In our study, pulmonary infiltration was significantly predictive for mortality (or 3.25, 95% ci 1.478.07). This was a retrospective analysis of a small population in a single - center study . Therefore, our results may not be representative of all other institutions and require validation . The results of our study may help emergency medicine physicians to prevent the development of serious complications and death in fn patients by the proper use of simple independent risk factors in addition to the mascc score . Early stratifications of patients into low- and high - risk groups with timely and tailored empiric antimicrobial therapy can improve the prognosis of patients with fn. |
Cotton is an economically important plant grown world - wide as a principal source of staple fiber and vegetable oil . A great deal of effort has been made to improve cotton cultivation and characteristics by genetic engineering, such as adapting advantageous varieties to new geographical areas, increasing protein and oil contents of seeds, recovering more fertile varieties, and developing disease and insect resistance . Although widely cultivated, transgenic plants have aroused wide concern among the public [46], including the transfer of the introduced genes to wild plants and nontransgenic plants, the indirect effects of the transgenic crops on the environment, modification of the biodiversity of wildlife, unpredicted harmful changes in food products, and so on . Therefore, there is an increasing demand for monitoring and verifying the presence and the amount of genetically modified organisms (gmos) in agricultural crops and in products derived [7, 8]. To perform a transgenic analysis, the currently used methods for transgenic product identification include protein - based methods, dna - based methods, microscopy, spectroscopy, and chromatography [1, 11]. The rationale behind nir transgenic analysis is the spectral absorbance of molecular bonds such as c h, c n, and c o that is related to the phenotypic changes (expression level) caused by genotypic changes . Then, chemometric methods are used to extract detailed information concerning sample genotypes . For transgenic identification, some advantages make nir spectroscopy a useful alternative tool to biological analytical methods: (1) no or less sample preparation, (2) reduced analysis time and cost, (3) simultaneous characterization of multiple components influenced by genotype, and (4) feasibility of online analysis . However, compared with biological analysis methods, nir - transgenic analysis also suffers some disadvantages . Firstly, due to the baseline, low signal - to - noise ratio (snr) and the natural weak absorbance of some components, the sensitivity of nir analysis is much lower . To increase the analytical sensitivity, proper data - preprocessing methods, such as smoothing, taking derivatives, and standard normal variate (snv), are required to remove background, improve snr, and enhance spectral resolution . Another practical problem is the existence of outliers which would degrade or spoil the classification models . Considering the multivariate nature and uncertainty of potential spectral outliers, it is important to detect and exclude the real outliers before any chemometric models are developed . The aim of this paper is to develop a rapid, accurate, and robust method for genotype analysis of cotton plants (parent, transgenic, and parent - transgenic hybrid) by near infrared (nir) spectroscopy and robust partial least squares discriminant analysis (plsda) methods . To tackle the problem of outliers, robust principal component analysis (rpca) the influence of different data - preprocessing methods on model prediction performance was also investigated . The cotton plants of three different genotypes including parent, transgenic, and parent - transgenic hybrid were collected from two plantations as shown in table 1 . The collected leaves were cleaned with water and dried at 60c for 24 hours before grinding . For seed collection, both leaves and seeds were then ground into powders and finally sifted through a 0.45 mm sieve . Nir spectra were collected using a tensor37 fourier transform nir spectrometer (bruker, ettlingen, germany) in the wavelength range of 400012000 cm . For each sample, 32 scans were performed with a resolution of 8 cm at 25c using opus6.5 software . The average of the 32 scans was used as a raw spectrum for further data analysis . Firstly, nir spectra are of multivariate nature; for example, a spectrum can have more than one thousand analytical channels, while the size of training set is usually less than 100 . Therefore, in the case of large p, small n problem, sufficient description of the multivariate sample distribution usually requires dimension reduction of the measured data by latent - variable methods, such as pca . Moreover, when performing outlier detection, the masking effects of multiple outliers need to be considered, so robust class models resistant to outliers are required . Robust principal component analysis (rpca) was based on robust estimators of principal components (pcs) and the resulted projection distances and residuals . Hubert et al . Proposed an improved version of rpca algorithm, which was numerically more stable for high - dimensional data and computationally effective . In rpca, score distance (sd) is defined as the sample distance from the data center in pc space and orthogonal distance (od) as a measure of the pc projection residual . An object can be classified into one of the following four groups in terms of od and sd: good pca - leverage points (with large sd and small od), orthogonal outliers (with small sd and large od), bad pca - leverage points (with large sd and large od), and regular objects (with small sd and small od). Since pls is a commonly used method in chemometrics, here only a brief introduction to multiclass plsda the training nir spectral set can be arranged in an n p matrix x containing the absorbance measurements at p wavelengths for n samples . For multiclass problems, n denotes the total size of all the b (in this paper, b = 3) different classes . A response matrix y (n b) is constructed containing the category variables of each sample in x, where each row vector in y indicates the class of a sample . If a sample belongs to class i(i = 1: b), then the ith element of its response variable is assigned a value of 1 and otherwise 0 . Then b pls models can be developed to fit each column of y using x. for prediction, an unknown object is classified into class j(j = 1: b) when the jth element of its predicted response vector is the nearest to 1 . For plsda, an important problem is to select the number of latent components or determine the model complexity . Including too many latent variables would lead to an unnecessarily complicated model that tends to overfitting, while selecting too few components would lose useful data information and fail to classify the samples sufficiently . Therefore, an improved cross - validation algorithm, monte carlo cross - validation (mccv), was used for this purpose . By multiple resampling and leaving out a higher percent of training samples for prediction, mccv has been proved to be a reliable method to estimate model complexity and can reduce the risk of overfitting effectively . The rmsemccv (root mean square errors of mccv) values with different model complexity were calculated and then tested with a well - established f - test procedure [19, 20]. To avoid selecting too many latent variables, this f - test procedure determines model complexity as obtaining an rmsemccv not significantly higher than the lowest rmsemccv with least model complexity . To evaluate the performance of discriminant models, sensitivity and specificity of prediction set for each genotype were calculated as follows: (1)sens.=tptp+fn, spec.=tntn+fp, where tp, fn, tn, and fp denote the numbers of true positives, false negatives, true negatives, and false positives, respectively . All the data analysis was performed on matlab 7.0.1 (mathworks, sherborn, ma). Some of the measured spectra of cotton seeds and leaves from three different genotypes are shown in figure 1 . The interval between 12000 cm and 10000 cm is contaminated with significant noise and was excluded from data analysis . Seen from figure 1, for both seeds and leaves, the spectra of three genotypes assume very similar absorbance bands and the data are characterized by low absorbance and baseline . Therefore, proper data preprocessing methods were required to reduce various undesirable factors in the raw data . Figures 2 and 3 show the preprocessed spectra obtained by smoothing and taking second - order derivative and snv transformation for leaves and seeds, respectively . Smoothed spectra seem to have an improved snr at the cost of losing some detailed information . Second derivative can effectively improve resolution but has a degraded snr . From figure 3, it is very obvious the detailed information around 7200 cm in second - order derivative spectra is very useful for classification . Outlier detection was performed based on rpca of the raw spectral data at a significance level of 0.05 . Because each genotype has a different sample distribution, rpca was performed on each of the genotype . To demonstrate the outlier diagnosis, 10 components account for 85.77% of the total variances and more components cannot decrease the robust cross - validation press (prediction sum of squares) value significantly; therefore, 10 components were selected . Seen from figure 4(b), sample 13 was detected as orthogonal outliers and samples 22 and 35 as good pca - leverage points . To select a representative set covering a wide range of samples, only bad pca - leverage points and orthogonal outliers were excluded and good pca - leverage samples were retained . The outlier diagnosis results for three genotypes of leaves and seeds are summarized in table 2 . To select representative training and test sets for model training and validation, k - s algorithm was used to split the samples into a training set and a test set . The k - s algorithm selects the set of training samples that covers the overall sample domain based on their distance (euclidean distance) from each other . Because the distributions of different genotypes were different, k - s algorithm was performed on each subclass and then the obtained samples were combined to form a training set and test set . Table 3 demonstrates the splitting of training and test sets with outliers waded . With different preprocessing methods the sampling time of mccv was 100 and the significance level of the f - test was set to be 0.25 as proposed . The prediction results of test set are summarized in table 4 . Seen from table 4, second derivative and snv spectra obtained improved prediction accuracy compared with raw and smoothed spectra . For cotton seeds, second - order spectra can correctly classify all the test samples and snv spectra had just one object wrongly predicted . For leave samples, the effects of second - order derivative spectra on classification can be also seen from figure 3(b), where the three genotypes can be clearly distinguished from the naked eye by some detailed high - frequency information . Compared with the raw data, smoothed spectra cannot improve classification accuracy, which might be attributed to the loss of high - frequency spectral information . Rapid and accurate discrimination of three different genotypes of cotton plants were developed by nir analysis of leaves and seeds . The best models obtained total classification accuracy of 100% and 97.6% for seeds and leaves, respectively . In order to tackle the problem of spectral outliers, robust pca models were applied to each subclass and were proved to be very effective . Snv and second - order derivative can significantly improve the classification accuracy by removing background and baseline and enhancing resolution . Spectral smoothing cannot improve prediction performance due to the possible loss of high - frequency information . The results also demonstrate the removal of background and baseline plays a more important role than enhancing signal snr for classification. |
We tested a structured relaxation program on nine patients with a diagnosis of schizophrenia suffering from akathisia . All patients were rated on barnes akathisia scale (bas) before the relaxation program, immediately after and again one week later . The mean bas score was before the relaxation 3.3 which reduced to 1.4 immediately after to finally 1.0 a week later . A wilcoxon signed ranks test revealed a significant reduction in bas score from baseline to endpoint (p = 0.026; z = 2.232) and a highly significant reduction from baseline to follow - up (p = 0.008; z = 2.636). Although the study has a number of limitations the relaxation program appears to be a promising alternative to traditional treatment of akathisia . The patients appreciated the relaxation session but none of them managed to carry it out on their own without professional encouragement . Akathisia (inability to sit still) is a movement disorder characterized by objective movements and restlessness and/or distress, which is common among patients under - going treatment with psychotropic drugs . It is generally agreed that the syndrome of akathisia comprises both an objective and a subjective component.1 although one of the main motivating factors for the development of second generation antipsychotics was to reduce the incidence and severity of treatment - emergent akathisia and other extrapyramidal side effects, these remain problematic and not uncommon:2 furthermore, akathisia can also be associated with antidepressant treatment.3 although often extremely upsetting, the widely held view of an association between akathisia and suicidal behavior has not been proven in larger methodologically sound studies,4 and is mainly based on case reports . It is nevertheless a distressing problem that can reduce quality of life and may impede treatment compliance in some patients undergoing pharmacological treatment . In an attempt to make sense of the condition some patients develop a dysfunctional interpretation of the stressful symptoms.5 there is no general agreement on how to diagnose akathisia, and this has hampered both research and clinical practice.6 if akathisia is recognized, current treatment options include reducing the daily dosage or withdrawal of the implicated medication, or the addition of other medications . The most widely used pharmacological interventions include anticholinergic drugs, beta - blockers, and benzodiazepines, but the evidence base to support these interventions is limited and treatment may entail risks such as development of hypotension, tolerance, and dependence.7 in fact the only small, randomized controlled trial on biperiden showed no difference compared to saline water in the treatment of akathisia.8 some of the most important differential diagnoses of akathisia are the presence of agitation and anxiety symptoms, and these can be helped significantly with structured relaxation programs.9 however to our knowledge a relaxation approach has not been examined in patients experiencing akathisia associated with antipsychotic drugs, therefore the aim of this short report is to investigate whether a relaxation approach would reduce akathisia in patients suffering from this syndrome . Nine patients with a primary diagnosis of schizophrenia and currently experiencing distressing akathisia (measured on the barnes akathisia scale [bas]) were invited to participate in a structured relaxation program, lasting 12 minutes and consisting of breathing (four exercises) and tension - relaxation (six exercises). The patients were selected specifically because they suffered from akathisia all participants were receiving, or had recently received, pharmacological interventions for akathisia such as benzodiazepines, beta blockers, or procyclidine (see table 1) leading to an unsatisfactorily response . However, the responsible clinicians had been reluctant to lower the dose of antipsychotic medication due to fears of deterioration of psychotic symptoms . One patient (number 9) underwent a repeat of the relaxation program with tl during the week before the final follow - up assessment . All patients were rated (by lkh) using the bas,10 before the intervention (baseline, bas median, 3), after the relaxation session (endpoint, bas median 2), and again one week later (follow - up bas median, 2). The short follow - up period was decided on to minimize the risk of changes to the medication regime that could have made the patients unsuitable for the study . All patients were given a written version of the program following the sessions, but according to self - reports, none managed to undertake the program on their own in the week before follow - up . There were no changes to medication regimes in any patient, during the study period . A wilcoxon signed rank test showed a significant reduction in bas score from baseline to endpoint (p = 0.026, z = 2.232) and a highly significant reduction from baseline to follow - up (p = 0.008; z = 2.636). No significant difference was however found between endpoint and follow - up (p = 0.257; z = 1.134). These findings are promising, although it is possible that the benefits were at least partly due to factors such as increased attention and greater contact with other patients and staff . Other limitations in this report include the small sample size, preliminary pilot nature of the data, use of a potentially biased (lkh) rater, and the uneven completion of the relaxation program in some patients . Although the number of patients was limited, all but one patient appeared to have benefited from the relaxation program . The approach was received enthusiastically by the participating patients, but no patient managed to perform the program on their own without professional intervention . The structured relaxation program appeared to be well accepted and to be associated with a notable reduction in the severity of symptoms of akathisia in this group of patients with chronic schizophrenia, treated with antipsychotic drugs . The pathophysiology underlying akathisia is not fully understood, and current treatment approaches are less than ideal . It is important to develop evidence - based alternatives to current interventions that are feasible in routine clinical practice . The mechanism underlying the reduction in symptoms of akathisia with the structured relaxation program is uncertain but biofeedback methods may be at least partly responsible for the beneficial effect . Biofeedback is a process that enables a person to change physiological activity (eg, heart rate, muscle activity). It is conceivable that the relaxation program improved the patients ability to minimize the restlessness characteristic of akathisia . The sustained effect at 1-week follow - up is intriguing and warrants further study, possibly comparing structured relaxation with current pharmacological treatment options, such as use of beta - blockers or benzodiazepines in an open label clinical trial. |
Viruses are divided into two similar - sized groups depending on whether the virus particle contains dna or rna, and, as causes of human fatality, rna viruses are by far the more important (1). New viral diseases continue to appear as a result of several changes in human activity: travel, population growth, interaction with wild habitats etc . Well - known novel, or emergent, rna diseases include severe acute respiratory syndrome (sars) (2), human immunodeficiency virus 1 (hiv-1) (3), and may come to include avian influenza h5n1 virus (4). These emergent diseases are an important factor behind the increase in the number of genome sequences that ncbi treats as representing new species (figure 1). In 2005, more than 200 new virus species were submitted to genbank (more recent dates are less reliable because there is typically a delay between submission and public availability). As more emergent viruses appear, it is important to have a site that allows their genomes to be compared to those of known viruses . The origin of most major infectious diseases is unknown because of our ignorance of the diversity of pathogens in wild animals . This restricts our ability to both predict risks and develop treatments (5). Dates are the earliest given in the accession (either of submission or publication). Submissions after 2006 are excluded because accessions are made public typically only following publication and thus the frequency of submissions is more recent time periods is underestimated . Dates are the earliest given in the accession (either of submission or publication). Submissions after 2006 are excluded because accessions are made public typically only following publication and thus the frequency of submissions is more recent time periods is underestimated . Despite some advances (6,7), the evolutionary history of rna viruses is in general poorly known, especially the deep phylogenetic relationships between virus families (8,9). We believe that one of the reasons for this is a lack of easily available translated genes and genomes for all species, and the lack of aligned genome sequences representing different isolates of the same species . In addition to the need to facilitate greater comparative analysis of rna viruses is the need to link together the existing virus web sites and their underlying databases . There are many web sites that provide genomic data, tools for genetic analysis and/or biological information for some viruses (see links on our site home page). The rna virus database is intended to complement these other sites by providing basic genomic information and tools for all rna viruses and linking the user to more specialist sites, where they exist, e.g. For hiv-1 and hepatitis c virus (hcv), we provide links to sites such as the los alamos laboratory on the main page for each of these viruses (find by typing hiv-1 or hcv into the search window in the top toolbar). For such viruses, we do not duplicate the work of other groups by attempting to display the available diversity of genomes . We intend that the rna virus database should develop further as a hub for other sites and we therefore encourage other workers to contact us with details of their sites that they wish linked to ours . Also, we encourage workers to adopt a virus and improve and/or expand the information that we provide for individual species . This can be done by emailing us or getting involved directly in developing the database, which is an open source project available at our googlecode site (http://code.google.com/p/rnavirusdb). Some of the data and tools on the rna virus database can be found elsewhere, but not all of them can, e.g. Ncbi's genome site provides genomic overviews of virus species and pairwise alignments of other isolates to the reference sequence, but it does not provide multiple alignments or complete translated genomes as we do . Similarly, its general entrez site provides pair - wise alignments of the query sequence and similar sequences in the database, plus a phylogenetic tree calculated from those distances; however, no multiple alignment is built . We also corrected the (few) errors in the genbank entries, and our database records features such as rna editing (10) that make genome translation problematic . We have, therefore, created the rna virus database as a user - friendly site devoted to rna viruses, providing essential genomic data and tools (discussed in more detail below) and links to the other virus web sites . Provide multiple whole - genome alignments, gene and whole - genome translations for all rna virus speciesidentification and taxonomic searching facilityguidance to other web resources . Provide multiple whole - genome alignments, gene and whole - genome translations for all rna virus species identification and taxonomic searching facility guidance to other web resources . We provide multiple alignments of whole genomes (as nucleotides) for all species where genbank contains multiple representatives . Our database, thus, currently has multiple alignments for approximately half the species (available from the main page of any virus species under these alignments were made by downloading from genbank all complete (or near - complete) genomes using the bioperl genbank modules (11). Accidental mismatches were excluded by performing a preliminary alignment using blastalign (12), which is designed to cope with non- or poorly homologous sequences and reports such matches . The sequences that showed clear homology to the ncbi reference sequences (we used a cutoff of a maximum of 40% of positions being represented by gaps in the blastalign alignment), up to a maximum of 50, were then aligned using clustalw (default parameter values) (13). For species for which we have at least three sequences, a neighbor - joining tree was then constructed using paup (with hky - adjusted genetic distances) (14), and this tree is displayed both as a pdf [via the treegraph program (15)] and using figtree, which is a new java - based tree - drawing application created by one of us (rambaut, a ., unpublished data). Our site allows virus nucleotide or amino acid sequences submitted by the user to be identified or, if the query is a new species, its closest relative to be found . In addition, the genomic location of any matched region of the library sequences is shown . For this we use ncbi's suite of blast programs (16) (go to the blast link on the toolbar of the home page). Once the most closely related reference species has been located, the query sequence can then be placed into a whole - genome multiple alignment for that species (where such an alignment is present) in order to show the query's phylogenetic relationships to the genomes in our database (go to (i) a blast of the query to the reference species sequence provides coordinates from the resulting pair - wise alignment . These coordinates are then used to select homologous regions from the reference multiple alignment, and a new multiple alignment is then built using clustalw along with a phylogenetic tree using paup as described above . (ii) blastalign (described above) is used to generate a new multiple alignment using the query sequence plus the sequences from the reference multiple alignment . Figure 2.screenshots illustrating use of the rna virus database to investigate a submitted virus nucleotide sequence . Screenshots illustrating use of the rna virus database to investigate a submitted virus nucleotide sequence . Isolates, includes the biological data of the isolates used in the whole - genome multiple alignments [except for hiv-1, hcv and hepatitis b virus (hbv), where we used manually built multiple alignments; for these three species, accession numbers for the isolates are given in the supplementary data as accessionhivhcvhbv.xls]. We provide amino acid sequences for all virus genes (or, more strictly, for all open reading frames) plus complete translated genomes for each virus species (go to the translated genomes are intended to facilitate phylogenetic analysis of more distantly related viruses (9). One feature that makes annotation of rna viruses difficult is that most species have some gene overlap (17), i.e. Where the same nucleotides code for two different genes by being read in two different frames . We, therefore, allow the user to select from three possible options for dealing with this feature: (i) have overlapped regions excised from the translated genome, (ii) have one only of any overlapped amino acid sequences represented or (iii) have all the amino acids sequences present, with overlapped sequences placed sequentially (and thus the nucleotides represented twice). Using a key word search of the genbank entries, and a standard reference work (18) where this did not reveal a match, the rna virus database is a php web application on top of a mysql database . Php is available at http://www.php.net, but should come pre - installed on unix machines . All data have been taken from the ncbi's genome and nucleotide sites at the following two urls . Table names are in large bold font and interlinking column names are in small regular font . Relationships of tables in the underlying mysql database . Table names are in large bold font and interlinking column names are in small regular font . Species names, nucleotide sequences and accession numbers were downloaded directly from genbank using bioperl modules, while further details of the virus gene coordinates, taxonomic affinities etc.were subsequently extracted from the flatfile of all genbank entries that can be downloaded from the ncbi genome site (19). Our approach was to treat all entries in the ncbi virus genome sites as species and to follow their taxonomic classification, although we only give virus type (e.g. Single - stranded positive - sense, retrotranscribing), family and genus at our site . We, therefore, follow ncbi's inclusion of hepadnaviruses, which include hbv, and caulimoviruses among the rna viruses despite their mature virion containing dna rather than rna (their possession of reverse transcriptase clearly places them biologically and evolutionarily among the reverse - transcribing group of rna viruses). The php scripts can be accessed using subversion (http://subversion.tigris.org/) from our googlecode site at http://code.google.com/p/rnavirusdb . The mysql database (a gzipped 16 mb dump) may also be downloaded from the same site for installation on the user's computer if required . If required, the database can subsequently be updated by other users following instructions and perl scripts given in the supplementary material (perl_scripts.tar). This updating involves a series of short intervening manual steps (we find that complete automation of such processes is inefficient). We intend to update the database on at least a 6-monthly basis in order to include newly discovered viruses, and are currently working to incorporate biological and epidemiological data . As discussed in introduction, we are keen to collaborate with other groups over further developments of our database . Wellcome trust (to r.b . ); eu marie curie fellowship scheme (to t.d.o . ); the royal society (to a.r.) |
Cryptogenic organizing pneumonia (cop), also known as bronchiolitis obliterans organizing pneumonia (boop), is a relatively rare disorder with distinctive clinical, imaging and pathological features . The pathological findings are characterized by plugs of granulation tissue lying within small airways, alveolar ducts and alveoli and by chronic inflammatory cell infiltration in the alveolar walls . Cop is defined as idiopathic and any cause for the development of pneumonia such as infection or underlying tissue disease is excluded . Patients with cop manifest rapid clinical and imaging improvement with corticosteroid therapy, but suffer from frequent relapses . Through histopathological examination and clinical observation, uveitis is usually classified into two categories, granulomatous and nongranulomatous . Hypopyon is the accumulation of white blood cells in the anterior chamber and is often observed in nongranulomatous uveitis . Nongranulomatous presentations are mostly idiopathic or due to hla - b27 antigen involvement [2, 3, 4]. It is well known that systemic diseases that can be associated with nongranulomatous uveitis include behet's disease, ankylosing spondylitis, inflammatory bowel disease and psoriasis . Although the cause is not fully disclosed, certain ocular and systemic conditions might be the underlying association with nongranulomatous uveitis . In this report, we describe two cases of cop who developed bilateral anterior uveitis with hypopyon unresponsive to topical corticosteroid therapy but responsive to systemic corticosteroid therapy . In addition, the clinical condition of their cop was concomitant to that of their intraocular inflammation . A 65-year - old woman was referred for evaluation of bilateral decreased vision and glaucoma . She had undergone a series of treatment for breast cancer with surgery, radiation and chemotherapy 14 years earlier . Concerning her ocular history, she had been diagnosed as having an epiretinal macular membrane on her right eye and received a vitrectomy and phacoemulsification 3 years prior . The intraocular inflammation was resistant to topical betamethasone administration but decreased spontaneously in 1 year . Despite the uveitis being mostly controlled, the intraocular pressure in both eyes had gradually increased and she was referred to our hospital . The initial ophthalmic examination disclosed a best - corrected visual acuity (bcva) of 20/50 in the right eye and 20/80 in the left eye . The intraocular pressure was 25 mm hg in the right and 40 mm hg in the left eye . Slit - lamp examination demonstrated no sign of uveitis or retinal disease besides pseudophakia in the right eye and a cataract in the left eye . The results of the laboratory investigations of serum including angiotensin - converting enzyme, antinuclear antibodies, rheumatoid factor and antineutrophil cytoplasmic antibodies were unremarkable despite for the presence of elevated c - reactive protein . Serological analyses indicated that there was no active infection of syphilis, human t - cell lymphoma virus 1, herpes simplex virus or varicella zoster virus . The results of human leukocyte antigen type b testing were positive for b-60 and b-61 . After admission, the patient underwent phacoemulsification surgery with intraocular lens implantation and a viscocanalostomy in the left eye for her cataract and glaucoma . Her bcva improved to 20/40 in the right eye and 20/32 in the left eye, and both the intraocular inflammation and intraocular pressure were controlled . Five months later, the cellular infiltration with hypopyon in the anterior chamber was seen in both eyes (fig . Then, the patient received systemic prednisolone (psl) 40 mg / day administered orally to treat the aggravated cop, and both lung symptoms and intraocular inflammation diminished . When psl dosage was reduced to 5 mg / day during tapering, cellular infiltration in the anterior chamber and hypopyon relapsed and bcva of her eyes, particularly of her left eye, declined despite administration of topical dexamethasone . An optical coherence tomography (oct) examination showed a macular edema in her left eye (fig . Although a subconjunctival triamcinolone injection was given when her left bcva reached 20/200, there was little improvement . Then, oral psl was increased to 30 mg / day, and the intraocular inflammation subsequently decreased and her bcva gradually recovered (fig ., yttrium - aluminum - argon (yag) laser treatment was performed to treat posterior capsule opacification in her left eye . During the clinical course, there was temporal intraocular pressure elevation, which could be maintained by topical antiglaucoma medication . At the middle of the relapse period, cytological examination of infiltrated cells in the anterior chamber showed neutrophils and a few lymphocytes, but no atypical cell . The genomic dna in aqueous humor was analyzed to screen infectious pathogens including bacteria, parasites, and viruses by comprehensive polymerase chain reaction ., there were no physical findings of skin disease, oral aphtha, pudendal ulcers, joint inflammation, spondylitis or digestive symptoms . A 69-year - old woman presented with blurred vision in both eyes . Her ocular history expressed age - related macular degeneration in both eyes 6 years prior . Subsequently, she was referred to our hospital . The initial ophthalmic examination disclosed a bcva of 20/25 in the right eye and 20/20 in the left eye . Slit - lamp examination demonstrated bilateral fine keratic precipitates, hypopyon and intensive cell infiltration in the anterior chamber . There was a mild cataract but no sign of posterior uveitis or diabetic change in the retina . 3 . The results of the laboratory investigations of serum including angiotensin - converting enzyme, antinuclear antibodies, rheumatoid factor, and antineutrophil cytoplasmic antibodies were unremarkable despite for the presence of elevated c - reactive protein and hba1c (7.1%). Serological analyses showed no active infection of syphilis, human t - cell lymphoma virus 1, herpes simplex virus or varicella zoster virus . The results of human leukocyte antigens type b testing were positive for b-51 and b-61 . One month later, she was administered systemic psl 40 mg / day orally to treat cop . The intraocular cell infiltration and hypopyon diminished in 1 month . During psl an oct examination showed an epiretinal membrane and macular edema in both eyes (fig . The psl administration was reduced gradually and then halted, with no recurrence of uveitis . Therefore, the cytological examination of infiltrated cells in the anterior chamber or the genomic dna analysis of infectious pathogens was not performed . During observation, there were no physical findings of skin disease, oral aphtha, pudendal ulcers, joint inflammation, spondylitis or digestive symptoms . A 65-year - old woman was referred for evaluation of bilateral decreased vision and glaucoma . She had undergone a series of treatment for breast cancer with surgery, radiation and chemotherapy 14 years earlier . Concerning her ocular history, she had been diagnosed as having an epiretinal macular membrane on her right eye and received a vitrectomy and phacoemulsification 3 years prior . The intraocular inflammation was resistant to topical betamethasone administration but decreased spontaneously in 1 year . Despite the uveitis being mostly controlled, the intraocular pressure in both eyes had gradually increased and she was referred to our hospital . The initial ophthalmic examination disclosed a best - corrected visual acuity (bcva) of 20/50 in the right eye and 20/80 in the left eye . The intraocular pressure was 25 mm hg in the right and 40 mm hg in the left eye . Slit - lamp examination demonstrated no sign of uveitis or retinal disease besides pseudophakia in the right eye and a cataract in the left eye . The results of the laboratory investigations of serum including angiotensin - converting enzyme, antinuclear antibodies, rheumatoid factor and antineutrophil cytoplasmic antibodies were unremarkable despite for the presence of elevated c - reactive protein . Serological analyses indicated that there was no active infection of syphilis, human t - cell lymphoma virus 1, herpes simplex virus or varicella zoster virus . The results of human leukocyte antigen type b testing were positive for b-60 and b-61 . After admission, the patient underwent phacoemulsification surgery with intraocular lens implantation and a viscocanalostomy in the left eye for her cataract and glaucoma . Her bcva improved to 20/40 in the right eye and 20/32 in the left eye, and both the intraocular inflammation and intraocular pressure were controlled . Five months later, the cellular infiltration with hypopyon in the anterior chamber was seen in both eyes (fig . Then, the patient received systemic prednisolone (psl) 40 mg / day administered orally to treat the aggravated cop, and both lung symptoms and intraocular inflammation diminished . When psl dosage was reduced to 5 mg / day during tapering, cellular infiltration in the anterior chamber and hypopyon relapsed and bcva of her eyes, particularly of her left eye, declined despite administration of topical dexamethasone . An optical coherence tomography (oct) examination showed a macular edema in her left eye (fig . Although a subconjunctival triamcinolone injection was given when her left bcva reached 20/200, there was little improvement . Then, oral psl was increased to 30 mg / day, and the intraocular inflammation subsequently decreased and her bcva gradually recovered (fig ., yttrium - aluminum - argon (yag) laser treatment was performed to treat posterior capsule opacification in her left eye . During the clinical course, there was temporal intraocular pressure elevation, which could be maintained by topical antiglaucoma medication . At the middle of the relapse period, cytological examination of infiltrated cells in the anterior chamber showed neutrophils and a few lymphocytes, but no atypical cell . The genomic dna in aqueous humor was analyzed to screen infectious pathogens including bacteria, parasites, and viruses by comprehensive polymerase chain reaction ., there were no physical findings of skin disease, oral aphtha, pudendal ulcers, joint inflammation, spondylitis or digestive symptoms . She had undergone treatment for ovarian cancer with surgery 8 years earlier . In addition, she had been regularly examined and treated for cop and nephrolithiasis . Her ocular history expressed age - related macular degeneration in both eyes 6 years prior . The initial ophthalmic examination disclosed a bcva of 20/25 in the right eye and 20/20 in the left eye . Slit - lamp examination demonstrated bilateral fine keratic precipitates, hypopyon and intensive cell infiltration in the anterior chamber . There was a mild cataract but no sign of posterior uveitis or diabetic change in the retina . 3 . The results of the laboratory investigations of serum including angiotensin - converting enzyme, antinuclear antibodies, rheumatoid factor, and antineutrophil cytoplasmic antibodies were unremarkable despite for the presence of elevated c - reactive protein and hba1c (7.1%). Serological analyses showed no active infection of syphilis, human t - cell lymphoma virus 1, herpes simplex virus or varicella zoster virus . The results of human leukocyte antigens type b testing were positive for b-51 and b-61 . One month later, she was administered systemic psl 40 mg / day orally to treat cop . The intraocular cell infiltration and hypopyon diminished in 1 month . During psl an oct examination showed an epiretinal membrane and macular edema in both eyes (fig . The psl administration was reduced gradually and then halted, with no recurrence of uveitis . Therefore, the cytological examination of infiltrated cells in the anterior chamber or the genomic dna analysis of infectious pathogens was not performed . During observation, there were no physical findings of skin disease, oral aphtha, pudendal ulcers, joint inflammation, spondylitis or digestive symptoms . In the present study, we described two cases that had common points in their phenotype . First, both cases showed bilateral anterior uveitis with hypopyon . Their intraocular inflammation was unresponsive to the administration of topical corticosteroids but showed a greater response to systemic corticosteroid administration (sca). Furthermore, both patients were receiving treatments for cop, and had medical histories of malignant tumors . However, neither was identified with any systemic disease that could be associated with uveitis . Nongranulomatous uveitis is characterized by fine keratic precipitates, and in severe cases, fibrinous clotting or hypopyon in the anterior chamber . The most common form of nongranulomatous anterior uveitis is acute anterior uveitis, which is associated with the hla - b27 allele [2, 3, 5]. The ocular feature of hla - b27-associated acute anterior uveitis is acute onset of unilateral inflammation, and is common in males between the ages of 2040 years . In this series, both cases were hla - b27 negative, and the uveitis was bilateral . Other diseases that could be associated with uveitis were screened . By the absence of systemic symptoms such as skin lesion, genital ulcer, oral aphtha and digestive symptoms, the laboratory investigations also eliminated the involvement of ankylosing spondylitis, arthritis, inflammatory bowel disease, sarcoidosis and infection . In addition, several drugs including cidofovir and rifabutin are reported to induce uveitis . In the present study, neither patient had taken those medicines during the period in which they contracted uveitis . It is also known that the malignant neoplasm can introduce hypopyon that resembles intraocular inflammation [7, 8, 9]. Since they had not shown any recurrence for several years, it was assumed that their malignancies were controlled . Additionally, the cytological analysis of aqueous humor with cell infiltration in case 1 showed a moderate inflammation pattern without neoplastic cell . Through the follow - up period of ovarian cancer without anticancer therapy in case 2, there was no sign of recurrent cancer or metastasis . From these facts, it is unlikely that their malignancy is associated with uveitis in their eyes . Cop is diagnosed by its typical pathological findings of organizing pneumonia and the absence of any identified cause . The organizing pneumonia occurs in cases of autoimmune diseases such as rheumatoid arthritis and sjgren's syndrome . Several reports have described how cop accompanies uveitis as a part of behet's disease [12, 13]. In those cases, although the uveitis in our report developed concomitant to cop, there was no clinical indication to suggest a diagnosis of behet's disease . Additionally, the anterior uveitis in our patients was resistant to topical corticosteroid drops, which rarely occurs during anterior uveitis care . This suggests that anterior uveitis in our cases was associated with cop . At present, there is one report that describes the complications of cop and uveitis without any cause . In this case, bilateral nongranulomatous uveitis was unresponsive to topical corticosteroid treatment, but systemic corticosteroid treatment had a more positive effect . The present findings suggest the possibility that there is a novel cause of uveitis that shares the same etiology with cop . Further investigation with increased numbers of case studies and statistical analysis may result in the discovery of new symptoms for uveitis and cop. |
Since 2006, surveillance physicians have listed and collected blood from those patients encephalitis, defined as fever or history of fever with axillary temperature> 38.5c (101.3f) and altered mental status, new onset of seizures, or new neurologic deficit in patients admitted to 3 nipah surveillance hospitals: rajshahi, rangpur, and faridpur medical college hospitals . The institute for epidemiology disease control and research and us centers for disease control and prevention tested serum with an igm - capture enzyme immunoassay to detect niv igm, and we defined laboratory - confirmed niv encephalitis as niv igm in serum . During december 2012march 2013, surveillance physicians interviewed accompanying caregivers of all hospitalized patients whose illness met the encephalitis case definition on admission in the inpatient ward . Study physicians asked about patients consumption of raw or fermented date palm sap and contact with other persons with fever and altered mental status in the month before illness onset; if caregivers were unaware of the patient s exposures, study physicians asked them phone the patient s friends and colleagues about exposures . Hospital physicians used personal protection equipment and provided it to caregivers of each patient with encephalitis and a history of these exposures . As part of subsequent epidemiologic studies, we also conducted detailed case investigations at each niv encephalitis case - patient s household . We interviewed surviving patients directly, or appropriate proxies among family, friends and relatives for patients who died, about their exposures to encephalitis patients or to fresh or fermented date palm sap before illness . We calculated the sensitivity, specificity, positive predictive value (ppv), and negative predictive value (npv) of the screening questions asked on admissions to hospitals by comparing with the niv igm results . We repeated the calculations for patients hospitalized during january and february, when the prevalence of niv encephalitis is highest . We compared the answers provided by caregivers during patient hospitalization with those provided during interviews in the community as part of our epidemiologic studies . Icddr, b s ethical review committee reviewed and approved the protocol for niv surveillance and case investigation . They collected and tested blood samples from 328 (91%) patients for niv igm . Seventeen (5%) had niv igm (table 1), of whom 15 (88%) niv encephalitis case - patients were identified during january and february 2013 . Of the 17 confirmed case - patients, family caregivers of 14 reported either a history of drinking raw or fermented date palm sap or contact with other persons with fever and altered mental status in the month before illness onset . Therefore, the sensitivity of the screening questions was 82%, specificity was 86%, ppv was 24% and npv was 99% (table 2). The sensitivity during january february was 93%, specificity was 82%, ppv was 37%, and npv was 99% . * drinking raw or fermented date palm sap or having contact with encephalitis patients in month before illness onset . At admission, 3 (18%) niv encephalitis case - patients had no reported history of drinking raw or fermented date palm sap or of contact with persons who had encephalitis (table 1). However, during the epidemiologic investigations in the community, family members of 2 case - patients reported that the patients drank fermented date palm sap in the month before illness onset . Of the 14 niv encephalitis case - patients who, at admission, had reported 1 of the risk exposures, results were consistent with exposures reported during the epidemiologic investigation . Screening patients with possible encephalitis at the time they seek hospital care regarding recent exposure to date palm sap and to other patients with encephalitis demonstrated high sensitivity and specificity for detecting niv encephalitis, particularly during peak months of niv encephalitis incidence . The high npv of the screening questions suggests that focusing infection control efforts toward patients with these exposures is an efficient use of scarce resources to prevent transmission . Although three fourths of encephalitis patients had reported histories of exposure, they possibly could have had other infections, including other bat - borne viruses, that were transmitted through similar routes or could have lacked niv igm, despite having niv infection (13). Alternatively, recent consumption of date palm sap by these patients might have been purely coincidental because this practice is common in bangladesh during this season, but nipah infection is rare . For 2 niv encephalitis case - patients, caregivers did not report a history of drinking fermented date palm sap during hospital interview, but this behavior was reported in later community investigations . Because 90% of bangladeshis are muslim, and consumption of alcohol is prohibited by islam (14) and illegal in bangladesh, patients might be reluctant to report drinking traditional liquor made of fermented date palm sap . Therefore, caregivers should be asked about socially stigmatized behaviors privately and confidentially to increase the odds that these stigmatized behaviors are reported . Exposure - based screening can detect patients at high risk for niv encephalitis in low - income, resource - constrained settings, such as bangladesh . We deployed screening questions on admission to inpatient wards but screening earlier, at triage in emergency wards, could further reduce risk . Surveillance for other diseases with well - described exposures that put healthcare workers at risk, such as ebola virus infection, and where laboratory diagnosis is limited or delayed could also deploy this approach. |
Since chitosan is insoluble in water, the use of chitosan in basic environment is limited and hence delivery of drugs to the intestine is not possible . A derivative of chitosan, that is cmc, is soluble in water [1, 2]. Amphoteric polyelectrolyte hydrogels possessing both positive and negative charges, and many researchers are using amphoteric polyelectrolyte hydrogels to develop controlled delivery systems such as an insulin pump for diabetics, matrices for molecular recognition or separation, and so forth . A lot of research is going on the stimuli - sensitive polymer hydrogels . Among stimuli - sensitive systems, ph or temperature - responsive hydrogels have been extensively studied in the biomedical field, because these two factors can be easily controlled and are applicable both in vitro and in vivo conditions [3, 4]. Cmc is amphoteric polyelectrolyte and has various applications due to its unique chemical, physical, and biological properties, especially its excellent biocompatibility . It is used to prepare wound dressings, artificial bone, and skin, is used as a bacteriostatic agent and blood anticoagulant also . It has also demonstrated good ph and ion sensitivity in aqueous solutions due to abundant cooh and nh2 groups . Recent studies have shown that cmc has been used in preparation of nanoparticles for treatment of cancer [6, 7]. The use of cmc has also been explored for delivery of antimicrobial agents and proteins . Extended release matrix tablets they found that hydrogels show minimal swelling in acidic ph . Considering this behavior of hydrogels carbopol 934 is a polymer which is sensitive to ph and was used in the present study along with chitosan . To combine the advantage of synthetic and natural polymers and at the same time maintain the property of natural polymers such as biodegradation and bioactivity, amphoteric polyelectrolyte hydrogels with ph sensitivity were synthesized with cmc and carbopol 934 in this work . The release behavior of theophylline was investigated, when it was loaded into the ph - sensitive hydrogels . Theophylline is a antiasthmatic drug and the dosing of theophylline is complicated because it shows extensive variation in bioavailability among patients . About 75% of people with asthma have symptoms that disrupt both the length and depth of their nighttime sleep at least once a week . The number of inflammatory cells in the airways is highest in the early morning, with a peak at 4 am . In one study, patients with nocturnal asthma were found to have a 20% decrease in lung function overnight compared with 4% in nonasthmatics . Hencem changing the timing or dosage of the medications may improve symptoms one experiences at night . Theophylline comes in both short - acting and slow - release formulations, once or twice a day . It comes as a pill or in granules which should be swallowed whole, so as not to release too much medication at one time . The main drawback of this type of dosage form is that when blood levels are too high, unpleasant side effects may occur, such as nausea, vomiting, abdominal pain, jitteriness, insomnia, rapid or irregular heartbeat . Theophylline, if delivered to the intestine can be useful in treatment of nocturnal asthma and a single dose of a slow release or extended release theophylline preparation given at night, may provide effective control of nocturnal asthma symptoms . In the present paper, an attempt was made to formulate a ph - sensitive hydrogel from cmc containing theophylline which has not been attempted so far and evaluate it in vitro and in vivo . The polymer exhibits ph dependent swelling that is, they swell and release the drug depending on ph range, hence sustained or extended drug delivery is possible in the basic environment of gastrointestinal tract . Cmc since soluble in water, undergoes extensive swelling in basic ph compared to acidic ph and drug release is maximum in intestine, thus it can be highly helpful in controlling symptoms of nocturnal asthma . 80% deacetylated) was purchased from sigma aldrich, usa . Carbopol 934 was purchased from loba chemie pvt . Ltd ., there is no conflict of interests for any financial gain, as the chemicals were purchased from the companies . Chitosan solution was prepared in acetic acid and methanol, and acetic anhydride was added under stirring at room temperature . The prepared gel was agitated with 0.5 m naoh in ethanol at room temperature overnight . The product was transferred to 2-propanol and chloroacetic acid was added in portions under stirring . After stirring at room temperature for 2 hr, the reaction mixture was heated to 60c for another 2 hr . Dialysis was carried out against deionized water for 3 days; the product obtained was dried in dessicator . Cmc solution was prepared in distilled water under stirring at 5000 rpm for 30 min . Theophylline was added to cmc solution and the solution was stirred for 15 min . Carbopol 934 dissolved in 1.75 m acetic acid was added to cmc solution gradually under stirring . The turbid dispersion obtained was immediately poured into petri dish and kept overnight for cross linking at room temp . The hydrogel obtained was cut into 1 cm 1 cm pieces and dried for 24 hr under vacuum . The prepared hydrogel was subjected to ftir analysis by kbr pellet method using fourier transform infrared (ftir) spectrophotometer (perkin elmer, spectrum-100, japan). Sem studies were carried out on hydrogel samples after coating with gold palladium on a scanning electron microscope, joel sem analysis instrument, japan . Differential scanning calorimetry was performed on a pure sample of theophylline and its formulation, using shimadzu dsc-50 apparatus . Differential scanning calorimetric thermograms of 2 to 3 mg samples were recorded at a heating rate of 5c / min in an open aluminium pan over the range of 25c300c . Nuclear magnetic resonance studies were carried out on cmc to determine whether the conversion of chitosan has occurred to cmc using c nmr and using an nmr spectrometer (dsx-300, bruker, india). The solid state (without solvent) nmr was done at 75 mhz . Here an amount of hydrogels containing 20 mg of theophylline was placed in 7.4 ph phosphate buffer solution, for 24 hours . In the 7.4 ph phosphate buffer solution the hydrogels swell and the drug is released . At the end of 24 hours, amount of theophylline present in 7.4 ph phosphate buffer is determined spectrophotometrically at 272 nm . The method obeyed beer's law in the concentration range 214 g / ml . The ph - dependent swelling property of hydrogel was studied by immersing the dry hydrogels in aqueous solutions of the ph 1.2 hcl buffer for 2 hr and then in ph 7.4 phosphate buffer for another 8 hr . After regular intervals of time, hydrogels were removed from the aqueous solution, excess surface water was removed with filter paper, weighed, and returned to the same container until equilibrium was observed [13, 15]. The degree of swelling (wt) was calculated at different times by means of following equation: (1)s=(weight of swollen hydrogelweight of dry hydrogel)100weight of swollen hydrogel . In vitro drug release from the hydrogels was carried out in triplicate at 37 0.1c in usp xxii dissolution apparatus type ii (six basket dissolution tester - usp xxii, tdt-08l, electrolab, mumbai, india) at a rotation speed of 50 rpm . A sample of hydrogel equivalent to 300 mg of theophylline was used in each test . Drug release from the hydrogel was studied in 900 ml of dissolution medium (2 hr in ph 1.2 hcl buffer and 10 hr in ph 7.4 phosphate buffer). Sample of dissolution fluid was withdrawn through a filter (0.45) m at every hour and was assayed at 272 nm for theophylline content using a shimadzu uv-1700 double beam spectrophotometer . The release data obtained were fitted into korsmeyer - peppas equation, log% r = logk + nlogt, where r is the amount of drug released in given time t, k is the release rate constant, and n is the time exponent . The intercept on y - axis gave the value of k, the release rate constant and the slope the value of n, the time exponent . About 50 hydrogel particles were taken for the study and spread over the sheep's intestinal mucosa (2 2 cm) taken as a biological substrate for studying mucoadhesive nature of the hydrogels . The prepared hydrogel was passed through sieve number 20; the particles which were retained on the sieve were coarser and were counted and taken for the study . The instrument designed was, disintegration apparatus usp, the 6 tubes were removed and the mocosa was fixed to the base of the apparatus . The medium chosen was 7.4 ph phosphate buffer, every 5 min interval hydrogel particles adhering to the mucosa were counted . The animals were divided into two groups of 6 rabbits each as a standard and the other as test . A written approval was obtained from the institutional ethical committee of jss medical college and hospital and jss college of pharmacy, mysore, india . Detailed verbal and written information on the study was provided to the veterinary surgeon, central animal facility, jss medical college and hospital and permission was obtained . The animals were fasted for 12 hours before the capsules were introduced into the oesophagus and washed using 5 ml of distilled water in order to avoid the possible damage caused by chewing . Blood samples were collected from ear vein at 1, 2, 4, 8, 16, 24 hr after the oral administration . The blood samples were centrifuged and plasma was stored at 20c for further analytical determination . To the above samples, isopropyl alcohol was added and vortexed for 30 sec . The drug was extracted with 2 ml of chloroform and vortexed at high speed for 1 min . After centrifugation at 1000 rpm for 5 min, the organic layer was evaporated and the residue was reconstituted with 100 ml of the mobile phase . Acetonitrile (7.5%) in 0.2% acetic acid solution was used as the mobile phase . The in vivo studies were conducted on prepared optimized hydrogel formulation (test) and on marketed sustained release formulation theobid sr tablet from cipla (standard). Stability studies were conducted on optimized formulation of cmc hydrogels to assess their stability with respect to their physical appearance, drug content, swelling, and drug release characteristics after storing them at 25c/(rh) 60%, and 30c/(rh) 65% as per ich q1a (r2) regulations for 6 months . When chitosan is changed into o - carboxymethyl chitosan (o cmc) by introducing ch2cooh groups onto oh along chitosan molecular chain, an amphoteric polyelectrolyte containing both cationic and anionic fixed charges was prepared . By varying degree of deacetylation and carboxymethyl group substitution of the chitosan carboxymethyl substituents were observed on amino and hydroxyl sites on the surface of modified chitosan . First, n - acetyl chitosan was prepared using acetic anhydride, then carboxymethylation was done to get cmc . As given in literature at 50% concentration naoh gives better degree of substitution, hence, 50% concentration was used . The prepared cmc is white - colored free - flowing powder and shows good solubility in both water and organic solvents, which extends its range of applications . This property and water solubility was used in preparing ph - sensitive hydrogels in the present work . Cmc is amphoteric in nature and contains positively charged groups, they interact with negatively charged carboxylic groups of carbopol and form interpolyelectrolyte complexes (ipecs) which were stabilized by cooperative ionic bonds . Moreover, interpolymer interactions were possible between countercharged groups in the own macromolecule and of course between copolymer chains of different macromolecules . Due to its good solubility in wide range of ph values, the cmc solution could be readily blended with polyacrylic acid solution and homogenous hydrogels were obtained . Different formulations were prepared by varying the concentration of cmc by keeping the concentration of polyacrylic acid constant from f1f5 . For the formulation f1 to f5 the concentration of carboxymethylchitosan was increased gradually from 1%, 1.25%, 1.5%, 1.75%, and 2%, respectively . Ftir studies were carried out for carboxymethylchitosan and chitosan, and the spectra are given in figure 1 . Spectra showed signals of nonmodified chitosan at 1,653 and 1,560 cm for the c o stretching (amide) and n other characteristic peaks of chitosan o h stretch, c h stretch, and c o stretch were present at 3,4003,600, 2,8002,900 and 1,0201,180 cm, respectively . The spectra of carboxymethylchitosan are similar to that of the original chitosan with a new peak appearing at 1,703 cm, which is assigned to the carbonyl groups . Carboxymethylchitosan showed the disappearance of the nh2 associated band at 1595 cm, which can be ascribed to characteristic vibration deformation of the primary amine n h and the appearance of some new intensive peaks at 29222852, 1466, and 721 cm which can be attributed to the methyl groups and the long carbon segment of the quaternary ammonium salt . Characteristic peaks of the hydroxyl and second hydroxyl groups between 1152 and 1030 cm did not change . Theophylline (pure drug) and hydrogel formulation were subjected for ftir spectroscopic to ascertain whether there is any interaction between the drugs and polymers used . The characteristic peaks of the pure drug were compared with the peaks obtained for their formulation . It was observed that similar characteristic peaks appear with minor differences, at 1654 cm (c = o stretching amide), 1596 cm (c = c stretching aromatic), 1307 cm (c o stretching) for theophylline and for the formulation as shown in figure 2 . Hence, it can be concluded that the drug is in free state and there is no interaction between drug and polymer used . The c nmr of chitosan was studied as given in literature and compared with the spectra of cmc . Chitosan spectra show peaks at 177.9 ppm and at 25 ppm, which are assigned to the carbonyl carbon of coch3 and the methyl carbon (ch3), respectively . The signal at 101.3 ppm is assigned to the hydrogen bonded to carbon of chitosan and the signals in 59.6 ppm, 73.1 ppm, 81.1 ppm, 78.6 ppm, and 64 ppm are assigned to carbons of glucopyranose . Spectra show the signal shifted from 101.3 ppm to 105.9 ppm because of the electron - withdrawing effect of the carboxymethyl substituents . Since various different units occur in the structure of carboxymethylchitosan, many of the signals in the spectrum of chitosan appear split in the spectrum of carboxymethylchitosan . Thus, the signals at 60.1 ppm, 73.8 ppm, 73.2 ppm, 82.2 ppm 78.2 ppm, and 63.9 ppm are split and shifted in relation to those detected in the spectrum of the parent chitosan . The signal observed at 180.7 ppm is assigned to the carbonyl carbons of carboxymethyl groups while the one detected at 177.9 ppm corresponds to the carbonyl carbon of coch3 of the parent chitosan . The methylene groups (ch2), carbons give rise to the signals at 53 and 57.4 ppm, respectively . However, no signal was detected at 53 ppm in the spectrum of carboxymethylchitosan figure 3 and the weak signal at 58.4 ppm can be probably assigned to the methylene (ch2) bonded to the amino group (nh). These features are taken as evidence that the carboxymethylation occurred at the hydroxyl as well as in the amino groups of chitosan which is also supported by ftir studies . Scanning electron microscopy was carried out in order to study surface morphology, texture, and porosity of hydrogels . Dsc studies of pure drug and f1 were studied to determine the possible interaction between the drug and the hydrogel . Thermogram of theophylline has shown a sharp endothermic peak at 272.41c, which corresponds to its melting point . The evaluation of thermograms obtained from dsc revealed no interaction between the drug and polymers used, as there was no significant change in the melting point of theophylline . The test for drug content was carried out to ascertain that the amount of drug in the formulation . From the results obtained, it can be inferred that there is proper distribution of theophylline in the hydrogels . The drug content analysis showed that the drug is uniformly distributed in the range of 74.588.6% of the total amount of the drug added in different formulations . Swelling studies were conducted for 12 hrs but swelling did not show significant change after 10 hrs until 12 hrs hence data for 10 hrs is presented . The swelling in water mainly depends on the osmotic pressure difference between inside the gel and the surroundings caused by redistribution of mobile ions . The swelling was observed to be more at basic ph due to increase in the number of mobile ions inside the gel and large osmotic pressure leads to swelling . The results indicate that with an increase in ph from 1.2 to 7.4, a considerable increase in swelling was observed for all the hydrogel formulations, which may be due to the dissociation of the cooh groups of cmc, thereby increasing the osmotic pressure inside the hydrogels resulting in increased swelling . Swelling increased when ratio of cmc was changed till 1.5: 1 with polyacrylic acid, that is, formulation f1f3 but further increase in ratio, that is, 1.75: 1 and 2.0: 1 (f4 and f5) swelling decreased . This shows that cmc and polyacrylic acid have synergistic effect till certain ratio as a result of which swelling increases but further increase in cmc amount resulted in reduced water uptake which may be attributed to the antagonistic effect resulting in decrease swelling . Swelling strongly depends on the extent of cross - linking . At lower cross - linking, the network is loose with a greater hydrodynamic free volume, so that the chains can accommodate more of the solvent molecules resulting in higher swelling . In this study it was found that the swelling was increased when the ph was changed from acidic to basic, and it conforms that the prepared hydrogel was sensitive to ph . The in vitro release studies were carried out for all the formulations in both acidic and basic media . The release studies were carried in the ph 1.2 hcl buffer for the first two hours, to mimic the acidic conditions prevailing in the stomach . For the next 10 hours, the release studies were carried out in ph 7.4 ph phosphate buffer, to mimic the alkaline conditions of the intestine . For the initial 2 hours that is, in the ph 1.2 hcl buffer, the percentage drug release was found to be low in all the cases; this can be attributed to the fact that the hydrogel swells less in the acidic medium . When the dissolution medium was changed to ph 7.4 ph phosphate buffer, the release was found to increase, with time . The effect observed is based on swelling, as swelling increases the drug release decreases and again when swelling decreases drug release increases as shown in figure 6 . On the basis of above studies conducted f1 was chosen as optimized formulation as it showed desired sustained - release profile along with other drug content and swelling studies results . It may be attributed to diffusion of the drug caused by rapid gel swelling and also the release of drug adsorbed towards the surface of the gel matrix . The% drug release was found in range of 37.2198.47 at the end of 12 hrs . The value of n determined from korsmeyer peppas equation was in the range of 0.50.7, which indicates the drug release from the hydrogels followed non - fickian or anomalous mechanism (relaxation controlled). The mucoadhesive study showed that all the hydrogel particles get detached from the mucosa within 20 min . This study shows that carboxymethylchitosan does not have a good mucoadhesion property when compared to well - known mucoadhesive strength of parent chitosan . This can be attributed to the better solubility of cmc in water and organic solvents . In vivo studies were carried out for theobid sr tablet from cipla (product a) and theophylline loaded hydrogels of cmc both containing 300 mg of theophylline on albino rabbits . Blood samples were withdrawn at different time intervals and plasma concentrations of theophylline were estimated, the profile is presented in figure 7 . Statistical comparison of the mean values of pharmacokinetic parameters derived for both products a and b are given in table 4 . From the data obtained, it may be observed that after oral administration, peak plasma concentration cmax of 12.34 2.42 g / ml was observed for product a and 09.69 4.12 g / ml for product b. from the comparison of mean values of plasma concentrations of product a and b, it was observed that product b has lower plasma concentrations . It was observed that the plasma concentration of theophylline in all animals after 24 hrs of oral administration was below 20 g / ml for both products . It was also observed from the studies that the therapeutic concentration range of theophylline maintained for about 24 hrs following a single oral dose administration for both products . From the data obtained, it may be observed that the time taken to reach peak plasma concentration tmax was 5.0 0.81 hrs for product a and 6.0 0.75 hrs for product b. mean elimination rate constant kel was found to be 0.08410 h for product a and 0.07813 h for product b. similarly mean elimination half life t1/2 for product a was 8.24 4.7 hrs and for product b 8.87 5.74 hrs . The mean auc0 - 24 values for product a was 101.73 16.5 ghr / ml and for product b 123.17 21.5 ghr / ml . The lower cmax, prolonged tmax, of theophylline in rabbits indicated that the drug release from the product b is slow, thereby providing a prolonged and controlled in vivo delivery of the drug . These in vivo absorption characteristics are in confirmation with the observed in vitro drug release rate of the drug from the hydrogel . Stability studies were conducted for different formulations for a period of 6 months . At specific time intervals, the drug content in samples was tested at 2 different conditions along with 95% confidence limits, using sigma plot software 10.0 as shown in figures 8 and 9 . Stability studies results obtained at various intervals showed that the hydrogel prepared from cmc did not show significant difference in physical appearance at the end of 6 months except in change of colour from light brown to brown .% drug release,% swelling, and mucoadhesion did not change significantly at the end of stability studies . From the data from the results obtained, it may be concluded that the prepared hydrogels were ph - sensitive and the degree of swelling of hydrogel depends on the concentration of cross - linking agent as well as on the ph of the environment . As the theophylline is released highly in basic ph the peak theophylline concentration will be achieved at early morning which will be highly beneficial to the patients suffering from nocturnal asthma . The in vitro and in vivo studies showed that the drug release is slowed down and prolonged which is better than commercial available formulation and hence better . Thus, the hydrogel prepared using cmc can be used to deliver theophylline in sustained manner and can be used effectively against nocturnal asthma; cmc can also be useful for the delivery of drugs which are unstable in acidic ph. |
Dental caries in primary teeth has been widely studied in many countries worldwide since it is known to be one of the most common oral diseases of childhood . However, figures to quantify the prevalence of such disease in palestine are almost inexistent . It is extremely important to study the prevalence of dental caries in preschool children in palestine to be able to provide a clear picture about the situation of oral and dental health in such population so as to help the local authorities to make future plans to reduce as much as possible the incidence of dental caries . Many countries have developed different strategies to reduce or even eradicate dental caries from preschool children following dental caries surveys . Some have already obtained excellent results using water and salt fluoridation, dental health education, school oral health program, and so forth . In palestine, dental caries surveys are rare and are unable to draw the attention of the local health authorities to take any reaction in fighting such common disease . The aim of this study is to give an idea about the actual situation of dental caries among preschool children in palestine . The results found here would probably be helpful in making future plans concerning the best methods to lower the level of such oral disease and make necessary improvements in the palestinian health system especially in the field of oral and dental health problems . The prevalence of dental caries in primary teeth is commonly evaluated using the dmft index . The number of decayed, missing, and filled primary teeth is calculated in each child to obtain a sum that is known to be the mean dmft score in such child . Children of both sexes aged between 4 years and 5 years (n = 1376) who were accompanied by their parents to the dental centre of the arab american university of jenin during the first 10 months of 2013 were examined clinically by one of the three calibrated examiners in the clinics of pediatric dentistry department after gaining the permission of the parents . As the families come from different geographic areas of northern palestine, the examined population was subdivided as shown in table 1 . Medical and dental histories were taken for each child by the help of one of the parents before starting the clinical examination . The parent was asked about the mother's level of education (elementary school, secondary school, college graduated, or postgraduate studies). Children who had previous history of receiving any specific organized preventive treatment were excluded from the study . Clinical examination intraorally was achieved using sterile dental mirror and sterile dental explorer under dental unit's light . The presence of cavitation has been considered to be indicative of carious lesion in accordance with the criteria recommended by the who in 1997 [24]. Teeth which were missing due to trauma or congenitally absent teeth were excluded from the data processing; therefore, they did not contribute to the final score . The number of dental restorations has also been registered for each child which contributed to the f component in the dmft score . The dmft scores of the clinically examined children were registered as shown in table 2 . It was found that only 330 children (24%) were caries - free (dmft = 0) at the age of 4 - 5 years while the other 1046 children have already experienced dental caries at this age . As for the (d) component, it was found that 932 children have had at least dental decay or caries in one or more primary teeth at the cavitation stage by the age of 4 - 5 years as shown in figure 1 . However, the number of decayed teeth in the whole population studied here was 2895 . The mean dt would be 2.10 while the number of children who had at least one missing primary tooth due to dental caries was only 98 representing 7.1% of the overall sample . The figure below shows the prevalence of missing teeth (mt) in the studied population (figure 2). The number of missing teeth in the whole studied population was 163 . When looking to the number of filled teeth representing the (f) component here, it was found that the number of children who had at least one restored primary tooth (filled tooth) was 154 representing 11.2% of the whole sample as shown in figure 3, while the total number of restored teeth was 325 . When asked about their level of education, mothers of examined children were divided into 4 groups as shown in table 3 . As mentioned above, the number of children who had at least one restored (filled) tooth was 154 . Mothers of such children have been found to have a high level of education in comparison to mothers of children who have decayed (cavitated) teeth or missing teeth (table 4). Correlation between mother's level of education and the presence of fillings in her child's mouth has been found to be statistically significant (p value <0.05). The overall caries prevalence in the study population was 76% with an overall mean dmft score of 2.46 of which decayed component is 2.10, missing component 0.12, and filled component 0.24 . Difference between males and females in caries prevalence at the age of 4 - 5 years has not been found to be significant as demonstrated by table 5 . As seen above, caries prevalence in primary teeth of 4- to 5-year - old girls is 74.6% which is very close to that of boys at the same age (77.2%). The table below shows the mean dmft scores for both sexes (table 6). The prevalence of dental caries in primary dentition in 4- to 5-year - old children in northern palestine would be about 76% which means that almost 3 children out of 4 have already experienced dental caries by the age of 5 years in northern palestine . Figures found here seem to be far from the who / fdi goals for 2000; that is, 50% of 5- to 6-year - old children should be caries - free . When compared to other developing countries, recent studies in pakistan and india revealed that caries prevalence in preschool children in different regions of both countries is about 5060% which is considered much better than what we found in our study here [69]. On the other hand, caries prevalence in preschool children in some arab countries like saudi arabia has been found to be high (approaching the 75%) [1012]. In the united arab emirates, a high prevalence of caries among preschool children has been registered as well (7080%) [13, 14]. Kuwaiti kindergarten schoolchildren who are caries - free at the age of 4 - 5 years do not represent more than 2432% of such population according to a national epidemiologic survey done in kuwait in 2010 . These findings are almost similar to what we found here in northern palestine, although they are still far from the figures published by many developed countries as we could find in the united kingdom (4060% caries prevalence in 5-year - old children) or in sweden (69% of 3-year - old preschool children are caries - free in 2003) as well as in brisbane, australia (66% of 4- to 6-year - old children are caries - free in 2002) [1618]. A probable explanation for such discrepancy can be the following: inequality in economic conditions and resources, effective fluoridation policy, efficiency of healthcare system, availability and consumption of refined sugars, standard of oral health awareness among public, dietary and oral hygiene lifestyles, and motivation status of parents and children . As expected, highly educated mothers tend to take their children to the dentist early in their lives so as to make regular check - ups and treat dental caries as soon as it appears, which best explains the high f component (ft) in case of children of college - graduated mothers . The mean dmft scores as well as caries prevalence in primary teeth of 4- to 5-year - old palestinian children reflect a considerable defect in the oral health care at home and at school, showing a real need to establish school oral health programs in the different regions of northern palestine [1, 7]. Such programs are possible to implement in cooperation with the ministry of health so as to be able to finance them properly . It is always possible to prevent dental caries in primary dentition and lower the caries prevalence in young children in northern palestine starting with good dental health education of the parents and teaching them how to take care of their children's teeth as soon as they start to erupt . Emphasis on babies feeding habits as well as the use of kids toothpastes is also important [1, 20]. Parents should be encouraged to take their children to the public dental clinics directed by the ministry of health or to their private dentist before the age of 1 year . They would be able to have an idea about dental health education programs and topical fluoride application campaigns . Preventive measures campaigns including topical fluoride application, fissure sealants, and healthy diet promotion would be a lot of help to improve the situation of the oral and dental health in young children who go to nurseries and kindergartens . It is always possible to find volunteer dentists locally or to employ freshly graduated dentists to provide preventive measures to children in nurseries and kindergartens in different northern palestinian districts including fluoride varnish application to all primary teeth as early as possible, educating the teachers as well as the parents about the best hygiene methods and toothpastes to be used by preschool children, making regular dental check - ups to the children, and giving them advices about healthy nutrition. |
Stroke, after myocardial infarction (mi), is the second leading reason for mortality in iran as with many countries worldwide . The epidemiology of stroke has already been investigated in the american, european, african, and asian countries . No comprehensive study has yet investigated the epidemiology of stroke, particularly in mi patients, in iran, one of the largest countries in southwest asia . Stroke and mi share many risk factors, most prevalent of which are smoking, dyslipidemia, type 2 diabetes, and hypertension . The risk factors for stroke and mi, especially smoking, hypertension, and dyslipidemia are highly prevalent in iran, as well . According to projections urbanism, increased life expectancy, reduction in childbirth, aging and elderly population, epidemiological changes, socioeconomic status, geographical conditions, and lifestyles such as poor diet, stress, and low mobility are the main causes of the burden of noncommunicable diseases, particularly stroke . Because the determinants of stroke in different communities are various, we require knowledge about the risk factors and determinants of mortality in a community for effective planning and selection of appropriate strategies for the prevention and management of stroke and heart attack as the most important causes of death . Since no comprehensive study has yet been investigated the status and mortality determinants of stroke in mi patients in iran, this study is conducted to determine and compare the determinants of mortality due to stroke in mi patients . In this retrospective cohort study, the data obtained from the mi registry of iran's cardiovascular diseases surveillance system were analyzed . Around 20,750 hospitalized patients with mi with a new presentation (hospitalized in 540 hospitals) between april, 2012 and march, 2013 were enrolled . The study was approved by the management center of noncommunicable diseases and the department of cardiovascular diseases prevention of iran's ministry of health and medical education (approval no . The research followed the principles of the declaration of helsinki; the researchers did not conduct any interventions on the patients, and an institutional review board approved this research . The study protocol was approved by an independent scientific review committee (at shahid beheshti university medical of sciences) (no . Inclusion criteria were determined according to the world health organization (who) and world heart federation definition of mi diagnosis per the international classification of diseases-10 codes i21 and i22 . Patients with mi history or no definite diagnosis by a cardiologist were excluded from the study . The data on age, gender, education, ischemic heart disease symptoms, hospital stay duration, smoking, dyslipidemia, hypertension, type 2 diabetes, heart failure, and family history of cardiovascular diseases were gathered . Stroke history was defined based on the who s definition rapidly developing signs of focal (or global) disturbance of cerebral function lasting> 24 h (unless interrupted by surgery or death), with no apparent nonvascular cause . Therefore, patients with transient cerebral ischemia or stroke events were excluded if they had blood disease or brain tumors . Moreover, patients with secondary strokes caused by trauma, acute hemorrhagic stroke, or transient ischemic attack were excluded . After a definite diagnosis of mi by a cardiologist, the data on the left bundle branch block, right bundle branch block, atrial fibrillation, ventricular and atrial tachycardia, type and site of mi, and use of therapeutic regimens such as coronary artery bypass grafting, percutaneous coronary intervention, and thrombolytic therapy were recorded . The cohort of patients was defined by the date at mi diagnosis, hospital stay, and follow - up till discharge or death (outcome). Odds ratio (or) of mortality for clinical and demographic risk factors were calculated by logistic regression . Or of mortality was calculated as the crude and adjusted ratio for patients with and without stroke by simple and multiple logistic regression models . First, univariate analysis was conducted . To control confounders, we entered the significant or approximately significant variables into a multiple regression model . For data analysis, chi - square, t - test, and regression model in stata software (stata corp . 2011, stata statistical software: release 14, college station, tx: stata corp lp, usa) were used and p <0.05 was considered the level of significance . The cohort of patients was defined by the date at mi diagnosis, hospital stay, and follow - up till discharge or death (outcome). Odds ratio (or) of mortality for clinical and demographic risk factors were calculated by logistic regression . Or of mortality was calculated as the crude and adjusted ratio for patients with and without stroke by simple and multiple logistic regression models . First, univariate analysis was conducted . To control confounders, we entered the significant or approximately significant variables into a multiple regression model . For data analysis, chi - square, t - test, and regression model in stata software (stata corp . 2011, stata statistical software: release 14, college station, tx: stata corp lp, usa) were used and p <0.05 was considered the level of significance . The prevalence of stroke in the studied population was derived 20.96% (confidence interval ci 95%: 20.1321.24). Mean standard deviation age at mi incidence was 64.38 (12.9) years in patients with stroke history and 60.37 (13.3) years in patients without, with a significant difference (p <0.001). About 64.8% of these patients were male, 52.8% of them were illiterate, and only 4.9% had an academic education . The prevalence of diabetes, hypertension, hypercholesterolemia, and heart failure was obtained 30%, 56.5%, 27.3%, and 8.1% in patients with stroke history and 20.1%, 30%, 15.4%, and 8% in patients without stroke history, respectively . The ratio of cardiovascular surgery, percutaneous coronary intervention, and thrombolytic therapy was obtained 6.4%, 5.8%, and 41.1% in the former group and 1.6%, 7.1%, and 45.3% in the latter, respectively . The demographic characteristics and individual risk factors in patients with and without stroke demographic and medical history of myocardial infarction patients with and without stroke within 1 year of study, 18.8% of the stroke patients deceased . The mortality ratio in all patients was derived 12.1% . Of the 4293 patients with stroke, 2537 (59.1%) had st - elevation mi (stemi). Mortality ratio was obtained 18.8% in patients stroke history and 10.3% in the without . The clinical characteristics and risk factors in the patients according to the type of hospital diagnosis and therapeutic measures the ratio of cardiovascular surgery, percutaneous coronary intervention, and thrombolytic therapy was obtained, respectively, 6.4%, 5.8%, and 41.1% . By logistic regression, the mortality - associated factors were different in the mi patients with and without stroke history . The adjusted or of mortality in patients with stroke history was derived 7.02 (95% ci: 5.429) for chest pain resistant to treatment, 2.39 (95% ci: 1.972.9) for stemi, 3.02 (95% ci: 2.53.64) for lack of thrombolytic therapy, 2.2 (95% ci: 1.662.91) for heart failure, and 2.17 (95% ci: 1.62.9) for ventricular tachycardia . Considering other potential covariates and the confounders of hospital mortality in patients with stroke, we obtained the highest adjusted or of hospital mortality in patients with stroke for chest pain resistant to treatment followed by lack of thrombolytic therapy and stemi . Prevalence of clinical risk factors in myocardial infarction patients with and without stroke risk factors for hospital mortality in myocardial infarction patients with and without stroke in this study, the risk factors in the mi patients with and without stroke history were investigated and compared for the first time in iran . In reliable, electronic databases such as pubmed and scopus, we found no study to model and compare the characteristics of the two groups of patients as with our study . Our study indicated that the pattern of determinants of hospital mi mortality with and without a stroke is various . The mean age at incidence in our study is similar to a study in singapore comparing the risk factors for stroke in chinese, indian, and malaysian ethnic populations . The study in singapore reported the mean age of stroke patients to be 64.1 years . In the study of singapore the prevalence of hypertension was obtained 83.2%, 85%, and 84.1% in chinese, malaysian, and indian ethnics, respectively, which is twice higher than the prevalence of hypertension in the patients in iran . Moreover, the prevalence of smoking was obtained 11.8%, 20%, and 15.9% in chinese, malaysian, and indian ethnics in singapore, respectively . The prevalence of smoking was obtained approximately 24% in our study, which is higher than that reported by the study of singapore . In the study of singapore, the prevalence of diabetes was reported to be 67.5% in malaysian ethnics and 39.8% in chinese ethnics while it was 27.9% in the patients of our study . Within 1 year of study, hospital mortality was obtained 9.1%, 3.4%, and 2.5% in indian, chinese, and malaysian ethnics, respectively . This inconsistency can be explained by the difference in lifestyles, life expectancy, and the incidence of stroke risk factors . Another explanation can be related to access to therapeutic and hospital services to prevent mortality due to stroke . However, it is noteworthy that the sample size in the study of singapore seems unsatisfactorily small, which might be another reason for the inconsistency of the findings . A review article reported that the age at stroke incidence was 68.6 years in men and 72.9 years in women, and the incidence and prevalence of stroke were higher in men than women . Although the age of incidence in our study is younger than the age reported in this review article, the gender differences in our study and this review article are consistent . A nationwide multicenter cooperative cohort study of japanese patients with mi and stroke reported stroke history (14.7%) to be more frequent than mi history (2.6%) in patients with stroke, whereas stroke history (6.6%) was less frequent than mi history (7.6%) in patients with mi . The mean age at mi incidence in our study is lower than a study in australia that reported the mean age of patients with stroke was 78.6 years . The difference in lifestyle, life expectancy, and patterns of risk factors for noncommunicable diseases as well as the larger elderly population of australia can be some reasons for the discrepancy in the mean age at the incidence of stroke . In a study in nigeria, the prevalence of hypertension and dyslipidemia the difference in the population and environment of the study may be the main reasons for the inconsistency of the findings . In a study in australia and europe (finland, norway, belgium, france, germany, the netherlands, switzerland, italy, greece, and hungary), 3944 patients with stroke were studied, and smoking, dyslipidemia, and hypertension were reported to be the most prevalent (48.7%, 45.8%, and 35.9%, respectively) risk factors for stroke, which are, except hypertension, higher than our study . The prevalence of diabetes and heart failure in the study in europe was obtained 6.511.1% and 3.84.2%, respectively, which is lower than the corresponding figures in our study . The study in europe has recommended that adoption of a primary strategy to avoid a stroke in young adolescents and the intervention aimed to change and/or decrease the highly prevalent risk factors that can be mitigated is an important principle of the stroke control . In brazil, the risk factors for stroke were studied, and the prevalence of hypertension, diabetes, and stroke history was reported to be 29.9%, 9.1%, and 2.1%, respectively, which are lower than the present study . In a study in japan, the mean age at incidence was 73.3 years in men and 76.8 years in women . Moreover, the prevalence of hypertension, diabetes, dyslipidemia, smoking, and heart attack was 55%, 19.3%, 17.9%, 25.9%, and 6.9%, respectively . In another study in japan, the fatality rate due to stroke was obtained 14.9% and 15.7% in men and women, respectively . Since life expectancy is much higher in japan than iran and the mean age at stroke incidence is expected to be younger in iran than japan, the determinants of hospital mortality in our study are similar to a study reporting that mi history, diabetes, gender, and age are the most common determinants of outcome in intracerebral hemorrhage patients . Interestingly, the prevalence of risk factors in the mi patients without stroke in iran and japan is similar . The prevalence of manageable risk factors is being controlled in patients with stroke and mi and was obtained lower compared to other studies . In a review article, the fatality rate of stroke within a month after the onset of the disease was reported to be 17% in japan, 33% in italy, and 22.9% overall . The difference may be explained by the access to better therapeutic services in hospitals and health - care facilities in italy compared with iran . In a study in iran, losing the golden time to start thrombolytic therapy, lack of beds in the intensive care units, and failure to afford the facilities and services were some of the obstacles to initiating the treatment in stroke and mi patients . In iran, our study is the first report in iran and indicated that the pattern of determinants of hospital mi mortality with and without a stroke is various . Therefore, adopting an appropriate strategy for the treatment and prevention of death in the two groups of the patients requires close attention to the characteristics of each group of the patients . In addition, our study demonstrated that the risk factors including hypertension, diabetes, smoking, dyslipidemia, and heart failure were more prevalent in mi patients with stroke history than those without . Therefore, it is recommended to give greater priority to the mi patients with the previous stroke over those without in iran for training, healthcare, and control of the risk factors such as hypertension, diabetes, and smoking to enhance the cost - effectiveness of the interventions for prevention and treatment and to prevent avoidable mortalities . As no similar study was found to make a closer comparison between our and others findings, similar studies in other countries hence, the findings can be generalized only to hospitalized patients . In addition, tissue plasminogen activator thrombolytic therapy was not considered in mi patients with the previous stroke . Because no similar study, to the best of our knowledge, was found to compare our and others findings more closely, similar studies in other countries should be conducted to give more definite explanations . Hence, the findings can be generalized only to hospitalized patients . In addition, tissue plasminogen activator thrombolytic therapy was not considered in mi patients with the previous stroke . We did not gather any treatment information about these patients before mi . Because no similar study, to the best of our knowledge, was found to compare our and others findings more closely our study demonstrated that the risk factors including hypertension, diabetes, smoking, dyslipidemia, and heart failure were more prevalent in the mi patients with a stroke history than those without . In fact, the mi patients without stroke history appear to control and mitigate the risk factors themselves . Chest pain resistant to treatment gave the highest adjusted or of hospital mortality in patients with stroke followed by no thrombolytic therapy and stemi . It is recommended to give greater priority to the mi patients with the previous stroke over those without in iran for training, healthcare, and control of the risk factors as well as to enhance the cost - effectiveness of the interventions for prevention and treatment . Aa, ak and ke contributed to the design of the research protocol and supervised its implementation . Aa and ke analysed the data and aa, ak and ke drafted the article . All of the authors approved the final version of of the manuscript before publishing and agreed to be accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved . All of the authors reviewed drafts of the article and contributed to the conceptual framework. |
Angiogenesis, the formation of new blood vessels, is essential for tumor growth and metastasis and inhibition of angiogenesis is an important new approach for therapy of many cancers [1, 2]. A principal regulator of angiogenesis is vascular endothelial growth factor (vegf). The vegf family is comprised of at least five genes (vegf a through e), of which the most potent activators of angiogenesis are vegf - a and vegf - b . Analysis of the vegf - a (termed vegf here and elsewhere in the text) gene promoter region has revealed numerous potential transcriptional activator sites . One of the best studied stimuli for vegf synthesis and secretion is hypoxia, which acts by upregulating hypoxia inducible factor-1 (hif-1). Inhibition of hif-1 may therefore decrease angiogenesis by reducing vegf levels and potentially other proangiogenic factors, such as angiopoeitin-1 and -2 (ang-1 and ang-2) [68], basic fibroblast growth factor (bfgf), and platelet derived growth factor (pdgf), all well known regulators of angiogenesis . T - oligos, telomere homolog oligonucleotides, activate p53 and e2f1, resulting in apoptosis . However, in p53 null cells like malignant melanoma an cells (mm - an), apoptosis is induced by the p53 homolog p73, presumably acting coordinately with e2f1 . Moreover, e2f1 has also been reported to inhibit angiogenesis [9, 12]. While e2f1 decreases vegf production in fibroblasts through p53 activation, its effect on angiogenesis in cells that lack functional p53, such as mm - an cells has not been studied [11, 13]. Several lines of evidence suggest that normal cells have an integrated program of genome - protective responses, functionally analogous to the bacterial sos response, that is based in the telomeres and appears to be abrogated in malignancy . Telomeres, the ends of chromosomes, are maintained in a loop configuration by insertion of the single - stranded 3 overhang into the proximal telomere duplex . Disruption of this loop structure by removal of the principal binding protein trf2 (telomere repeat binding factor 2) leads to exposure and digestion of the overhang and activation of atm (ataxia telangiectasia mutated) and its effector protein p53, followed by apoptosis or senescence, depending on cell type . Knockdown of another telomere - associated protein, the protection of telomeres-1 (pot-1), also expected to expose the ttaggg telomere repeat sequence, activates atr (ataxia telangiectasia and rad3-related), leading to similar downstream effects [16, 17]. Moreover, treatment of malignant cells with rnai to knockdown the expression of ter, the rna subunit of telomerase, rapidly alters the expression of many genes in a pattern predicted to reduce cancer cell proliferation and invasiveness, then leads to apoptosis in a time course far too rapid to be attributable to the expected loss of telomerase activity and consequent telomere shortening, suggesting that other telomere - based effects are responsible . Our laboratory has described several anticancer properties of oligonucleotides homologous to the telomere repeat sequence ttaggg (t - oligos) [10, 11, 13, 15, 1928]. T - oligos provided to cultured cells rapidly accumulate in the nucleus and mediate dna damage responses without digestion of the telomere overhang or other detectable effects on genomic dna [10, 13, 15, 19, 23, 25, 26, 29]. T - oligos activate the atm kinase [21, 27], upregulate and activate p53 [30, 31], as well as upregulate and/or activate its homolog p73, e2f1, p16, p33, p27, and p95/nbs1, and phosphorylate the histone variant protein h2ax [11, 13, 21, 22, 24, 25]. In addition, t - oligos promote differentiation of melanoma cells and downregulate the inhibitor of apoptosis protein iap / livin in these cells . T - oligo effects require wrn, the protein mutated in the progeroid cancer - prone werner syndrome, and are associated with formation of classic dna damage foci at telomeres . In combination, these signaling cascades result in induction of apoptosis, autophagy, and/or senescence selectively in cancer cells [13, 19, 27, 28]; while in normal cells they lead to transient cell cycle arrest, increased dna repair capacity and adaptive differentiation [19, 21, 23, 2527, 30]. Complementary, unrelated, or scrambled oligonucleotides comparably accumulate in the nucleus, but do not cause dna damage - like signaling or affect growth, differentiation or survival of malignant cells [11, 13, 15, 19, 21, 24, 27, 28]. Because the t - oligo - induced transcription factors p53, p73, and e2f1 are known to affect endothelial cell (ec) survival, differentiation, and proliferation during tumor angiogenesis [12, 33, 34] and because blocking angiogenesis would be an additional anticancer mechanism of action for t - oligos, we asked whether t - oligo treatment inhibits tumor angiogenesis . We now report that t - oligo inhibits angiogenesis in the aggressive human melanoma cell line mm - an, derived from a metastatic melanoma, by decreasing production and secretion of proangiogenic factors in both tumor cells and ecs . As well, t - oligo treatment decreases the number of total and functional (perfused) vessels in flank tumors of mm - an cells in scid mice after two systemic injections . Human microvascular endothelial cells (hmvecs) and human umbilical vein endothelial cells (huvecs) were obtained at passage 2 and used by passage 46 . Cells were maintained in egm-2 medium with 2% fbs plus growth factors (bullet kit) (cambrex bio sciences, walkersville, md). Human melanoma mm - an and ep cells were cultured in modified eagle's medium (mem) (mediatech, inc ., herndon, va) supplemented with fetal bovine serum (fbs 2%), calf serum (cs 8%), and antibiotic - antimicotic . Human breast adenocarcinoma (mcf-7) and ovarian adenocarcinoma (ovcar3) cells were cultured and maintained according to atcc recommendations . The oligonucleotide was synthesized by midland certified reagent (midland, tx) and then diluted from a 2 mm stock in medium to obtain a final concentration of 40 m . Mm - an, ep, mcf-7, and ovcar3 cells were grown in their corresponding media and treated once with diluent or 40 m t - oligo . For qrt - pcr the sequences used were as follows: e2f1 forward: cggtgtcgtcgacctgaact, e2f1 reverse: aggacgttggtgatgtcatagatg, e2f1 probe: tgccgaggtgctgaaggtgcag; ang-1 forward: cagaaaacagtgggagaagatataacc, ang-1 reverse: tgccatcgtgttctggaaga, ang-1 probe: caacatgggcaatgtgcctacactttc; ang-2 forward: ggctgggcaatgagtttgtc, ang-2 reverse: cccagtccttcagctggatct; ang-2 probe: accggtcagcaccgctacgtgc . Cells were treated with diluent or 40 m t - oligo and harvested 0, 1, 16, and 32 hours after treatment . Emsas were carried out as described using a total of 5 g of nuclear protein per lane . The assay was performed using consensus sequences of e2f1 and hif-1 transcription factors (santa cruz biotechnology, ca). The specificity of the bands was confirmed by using either 25 or 50 excess of cold probe as competitor and mutant oligos as control . As an additional negative control, nuclear extracts were incubated with a specific competing e2f1 antibody before adding the radioactive (p - labelled) consensus oligonucleotides . Cells were treated with t - oligos, harvested at various times, snap - frozen, and stored at 70c . Total cellular protein was isolated and 50 g of total protein was processed for western blot analysis as described . Antibody reactions were performed with the following antibodies: anti - e2f1 (neomarkers, inc ., fremont, ca), anti - vegf - a (sc-507, santa cruz biotechnology, inc, santa cruz, ca) that recognizes all vegf - a isoforms, and anti - vegf - r2 (a kind gift from dr . Nader rahimi, departments of ophthalmology and biochemistry, boston university school of medicine). The human vegf immunoassay kit (quantikine, r&d systems, minneapolis, mn) was used to compare the release of vegf into the medium by ecs and mm - an cells each cell type was cultured in its appropriate medium and treated with either diluent or t - oligo (40 m). The conditioned medium was collected at 24, 48, and 72 hours after treatment and frozen at 70c until it processed for elisa . The plate was read using the tecan spectra model 96 well microplate reader (mtx lab systems, vienna, va). 200 l of matrigel basement membrane matrix (phenol - red free) (bd biosciences, bedford, ma) was added per 4-well chamber slide and allowed to solidify for 1 hour at 37c . Huvecs (50,000 cells) were then added to each chamber in 500 l of medium as described . Cells were treated at the time of plating with diluent, 40 m, 80 m, or 120 m of t - oligo . Some of the cells treated with 40 m of t - oligo were retreated a second time at 2 hours postplating, at the time tube - formation some cells that were treated twice with 40 m of t - oligo received a third treatment 6 hours after plating . Tube - formation was observed and photographed at numerous time points starting from 2 hours and up to 24 hours after treatment . Of note, after tubular structures formed in control wells, they stayed intact up to 72 hours (data not shown). Image - tool (the university of texas health science center in san antonio, san antonio, tx) software was used to quantify the length of tubular structures . The biocoat matrigel invasion chamber (bd biosciences, bedford, mm - an cells were treated with diluent or 40 m t - oligo and media were collected after 72 hours, based on elisa data (mm - an conditioned media). Conditioned mm - an medium was then used as the chemoattractant for the assay . Ecs and mm - an cells were grown on the inserts (upper chambers) and allowed to invade through the matrigel and attach to the membrane as described in the manufacturer's protocol . Invasion was assessed after 22 hours by staining with diff - quick (fisher, atlanta, ga) bisected membranes from the bottom of the chambers (containing the invading cells) as described in the manufacturer's protocol . Of note, we believe that any effect on ecs or mm - an invasion cannot be attributed to residual active t - oligos in the conditioned medium, diffusing into the upper chamber and killing mm - an cells, because t - oligos are rapidly degraded in serum - containing medium . With a measured half - life for a 12-base telomere homolog of 46 hours, the 16-base t - oligo would thus have been present in the medium after 72 hours of conditioning at an estimated (1/2) or 10-fold less than the initial therapeutic concentration . 2 10 mm - an cells were injected subcutaneously into the flank of 6 week old scid mice (fox - chase cancer center, philadelphia, pa). Mice (5 - 6 per treatment group) were injected via tail vein with t - oligo or diluent alone when tumors were first palpable (2 - 3 mm diameter). Tumor sizes were recorded every 2 - 3 days throughout the experiment using electronic callipers and all animals were sacrificed 4 weeks after tumor inoculation . The diagnosis of melanoma was confirmed histologically on sections of each nodule cut through the center of the clinical tumor . 2 10 mm - an cells were injected subcutaneously into the flank of 6 week old scid mice (fox - chase cancer center, philadelphia, pa). Then mice (5 - 6 per treatment group) were injected via the tail vein with t - oligo or diluent alone (60 nmoles / injection, 15 mg / kg) when tumors were first palpable (2 - 3 mm diameter). Microvascular density (mvd) in bisected tumors were assessed 24 hours after two systemic injections of t - oligos by using two ec - specific markers cd31 (pecam-1) and bandeurea simplicifolia (bs)-1 lectin conjugated to rhodamine (vector laboratories, burlingame, ca). To measure functional mvd in the tumor tissue, 30 minutes before sacrifice a set of mice (5 per treatment group) were anesthetized and were perfused with 0.5 mg (in 100 l of isotonic solution) of rhodamine - conjugated bs-1 lectin as described [40, 41]. To measure total mvd, 6 m cross - sections of bisected tumor tissue (of the same mice perfused with bs-1 lectin) were stained with cd31 primary antibody followed by fitc - labelled secondary antibody as described . Samples were photographed using a multicolour fluorescence microscope (nikon, nikon instruments inc, melville, ny), and analyzed using a digital image analysis system (nikon). Anova with post hoc analysis by scheffe and bonferroni - dunn and unpaired t - test were performed using statview (sas institute, inc ., mm - an cells were treated once with t - oligo or diluent alone, provided in fresh medium, and processed for western blot analysis . Compared to diluent, t - oligo decreased vegf protein level at 24 hours (p <.01) by ~41% and at 48 hours (p = ns) by ~32% (figures 1(a) and 1(b)). In addition, after 48 hours t - oligo treatment reduced ang-1 mrna (p <.01) by ~60% (figure 1(c)) and ang-2 mrna (p <.04) by ~45% (figure 1(d)). Similar decreases in vegf (supplemental figures 1(a)1(c) and ang-1 (supplemental figures 2(a)2(c)) mrna were seen in a second human melanoma line ep, as well as in other malignant cell types . Paired dishes of mm - an and ecs were treated with 40 m t - oligo or diluent alone once . Medium was collected after 24, 48 and 72 hours and vegf level in the medium was measured by elisa . In ecs (hmvec and huvec), there was a ~50%75% variable and statistically insignificant decrease in vegf release into the medium over time in both diluent- and t - oligo - treated cells (data not shown). In contrast, total vegf release from mm - an cells in diluent - treated dishes rose progressively over 72 hours to ~600% (of 24-hours vegf levels), while vegf release in t - oligo - treated dishes was decreased (p <.0008) by ~30% over the 72-hours experiment after a single dosing at time 0 (figure 1(e)). Thus, t - oligo not only decreased vegf protein expression in tumor cells but also the release of this potent angiogenic factor into the surrounding culture medium . E2f1 mrna expression was increased at 24 hours (p <.0001) by ~41% and at 48 hours (p <.0001) by ~100% in t - oligo - treated mm - an cells compared to control (figure 2(a)). Similar increases in e2f1 mrna were seen in a second human melanoma line ep, as well as in other malignant cell types (supplemental figures 3(a)3(c)). T - oligo treatment also increased e2f1 protein level at 24 hours to ~218% and at 48 hours to ~286% (p <.02) of control values (figures 2(b) and 2(c)). In addition, there was a doubling in e2f1 dna binding activity 32 hours after treatment compared to diluent - treated cells (figures 2(d) and 2(e), compare lane 3 versus 4). Mm - an cells were treated once with t - oligo or diluent alone and nuclear proteins were harvested up to 32 hours after treatment to evaluate dna binding activities of the angiogenic transcription factor hif-1. There was ~80%95% decrease in hif-1 dna binding activity at 1 and 16 hours after treatments (figures 2(f) and 2(g), lanes 3 versus 4, and 5 versus 6, respectively). These data suggest that t - oligo - mediated inhibition in dna binding activity of hif-1 transcription factor contributes to decreased expression of the angiogenic factors, vegf and ang-1, whose promoters contain binding sites for hif-1 . We used mm - an medium collected 72 hours after addition of t - oligo or diluent alone (mm - an conditioned media: t - oligo cm or diluent cm) as the chemoattractant for an in vitro invasion assay . Mm - an and hmvecs were both evaluated for invasion through matrigel to determine if t - oligo treatment reduces the chemoattractant properties of mm - an cells . As recommended by the manufacturer of the matrigel invasion kit, after 22 hours of incubation the invading cells were fixed, stained and counted for each membrane . Mm - an cells plated above t - oligo cm had a ~96% decrease in invasion (p <.03) through matrigel (figures 3(a) and 3(b)). Hmvecs plated on inserts coated with matrigel and exposed to t - oligo cm had a ~40% reduction in matrigel invasion compared to controls, but this did not reach statistical significance (p <.08) (figures 3(c) and 3(d)). These findings demonstrate that t - oligos reduce the migration / invasion of mm - an cells towards chemoattractant stimuli and, possibly, to a lesser degree affect hmvecs . This is consistent with the observation that mm - an cells elaborate factors that promote migration and invasion of tumor cells, like vegf and ang-1, and that these factor(s) are reduced as a result of t - oligo treatment . Because vegf signaling through vegfr-2 is principally responsible for ec survival, proliferation, migration, and angiogenesis [4447], we examined the effect of t - oligo treatment on these proteins . Hmvecs and huvecs were grown and treated with 40 m t - oligo or diluent alone . Compared to diluent - treated control cells there was a decrease (p <.004) of ~86% in vegf expression at 24 hours and an insignificant decrease of ~50% at 48 hours in t - oligo - treated samples (figures 4(a)4(c)). In addition, in t - oligo - treated hmvecs and huvecs there were ~29% (p = ns) and ~59% (p <.04) reduction in the protein level of vegfr-2 at 24 and 48 hours, respectively (figures 4(d)4(f)). Thus, t - oligo - mediated antiangiogenic effects on ecs may be, in part, due to inhibition of vegf - vegr2 axis . Hmvecs were plated on matrigel in 4-well chamber slides in serum - containing medium and treated with diluent alone or increasing concentrations of t - oligo . Tube - like structure formation was maximal in controls at 22 hours and formal comparisons were made after 222 hours, as customary for this assay . By 22 hours, in cells treated once with either 40 m or 80 m t - oligo there was a ~19% reduction in average tube length compared to cells treated with diluent alone (p = ns) (figures 5(a) and 5(b)). Cells treated with two separate doses of 40 m t - oligo at plating and 2 hours after plating showed a ~35% reduction in average tube length (p <.03). Cells treated once at plating with 120 m t - oligo showed a ~58% reduction in average tube length compared to the diluent - treated cells (p <.001). A reduction of ~83% (p <.0001) in tube length was observed in cells treated with 3 separate doses of 40 m t - oligo (40 m 3) added to the medium at the time of plating and then at 2 and 6 hours (figures 5(a) and 5(b)). These results indicate that t - oligo inhibits ec function in a manner dependent on the dose and frequency of administration, with the caveat that the very large amount of oligos administered, rather that specific telomere - based t - oligo initiated signalling may have contributed to the effect observed . In our future experiments, we plan to examine the effect of large and/or fractioned t - oligo doses on survival of ecs . In melanoma tumors inoculated into scid mice, we determined the effect of systemic t - oligo injection on melanoma angiogenesis by evaluating functional and total vessel density in tumor tissue (5 mice per group). When tumors became palpable (2 - 3 mm in diameter, day 5 to 14 after inoculation) we injected t - oligo (60 nmoles / injection, 15 mg / kg) via the tail vein (iv) and injected again after 6 hours, then harvested tumors 24 hours after the second t - oligo injections . Representative images of tumor cross - sections were immunostained to identify all vessels as well as functional (patent) vessels 24 hours after t - oligo injection (figure 6(a)). Compared to control - injected mice .002) in functional vessels in t - oligo - injected mice (figure 6(b)). There was also more than ~60% decrease (p <.004) in total vessels in t - oligo - injected mice (figure 6(c)). These data corroborate our in vitro findings (figures 4 and 5) and demonstrate that two systemic administrations of t - oligo reduce tumor angiogenesis and vessel patency in vivo (figures 6(a)6(c)). To determine the effect of systemic t - oligo treatment on melanoma growth, in scid xenograft model mm - an cells were injected subcutaneously in the flank . When tumors became palpable (2 - 3 mm in diameter, day 5 to 14), the mice received daily systemic injections of t - oligo (60 nmoles / injection, 15 mg / kg bid) or vehicle for 5 days only . In control animals, tumors increased in volume from 6.96 2.9 mm on day 6 to 88.04 19.72 mm on day 27 (figure 6(d), blue line). In contrast, in t - oligo treated animals, whose tumors were the same size as in controls on day 6 (6.48 2.57) there was very little tumor growth through day 15 (6.48 2.57 versus 9.92 3.8 mm) and thereafter a slower and statistically insignificant increase in volume to 29.65 10.47 mm by day 27 (figure 6(d), pink line). Thereby, in t - oligo - treated mice tumor growth was inhibited (p <.003) by ~53% after ~4 weeks, when the experiment was terminated . These data demonstrate that systemic administration of t - oligo for only 5 days has a persistent inhibitory effect on melanoma growth . We have also evaluated t - oligos toxicity in several internal organs of scid mice 24 hours after the last iv injections (15 mg / kg bid for 5 days). No systemic toxicity was observed in bone marrow, liver, intestines, brain, lungs and kidneys of t - oligo - injected mice (figures 7(a)7(f)). Tumor angiogenesis is essential for tumor growth and metastasis . Without active angiogenesis tumor diameter angiogenesis is mediated through release of angiogenic factors by tumor cells and cells in the tumor stroma and microenvironment including, but not limited to, endothelial cells . We now report that telomere homolog oligonucleotides (t - oligos) decrease the synthesis and release of angiogenic factors by ecs and melanoma cells, inhibit ec tubulogenesis and impede melanoma cells and ecs from invading matrix (matrigel). Ec proliferation, in vitro tubulogenesis, and survival are all known to be stimulated in large part by vegf . Decreased vegf levels or inhibition of receptor activation in ecs often correlate with decrease in tumor size and metastatic potential . Vegf binds to the extracellular domain of the vegfr-1 (flt-1) and vegfr-2 (flk-1), inducing receptor dimerization and activation of tyrosine kinases by autophosphorylation, leading to angiogenesis, increased vascular permeability, and ec proliferation and survival . We found that t - oligo decreases the expression of vegfr-2 by hmvec and huvec (figures 4(c) and 4(f)). Other investigators reported that receptor tyrosine kinase inhibitors (tkis) such as sunitinib and dasatinib reduce signaling through the raf / mek / erk pathway that is activated by ligand binding to angiogenic receptors like vegfr-2, pdgfr-, fh-3 and c - kit, indirectly inhibiting tumor growth by affecting tumor angiogenesis . By reducing vegf - r2 level, vegf also induces leakage within tumor vessels, allowing tumor cells to infiltrate blood vessels and migrate into the blood stream . Hence, changes in angiogenic factors even early in tumor formation can affect metastasis and spread and inhibiting vegf production by t - oligos would be expected to reduce the metastatic potential of tumor cells . Additionally, increased blood vessel permeability within the tumor may interfere with adequate delivery and retention of chemotherapeutic agents [54, 55]. Indeed, certain antiangiogenic agents that prevent tumor vessel leakage (a phenomenon called vessel normalization) were shown to enhance the delivery of chemotherapeutic agents into tumors . Thus, combination treatment with antiangiogenic factors together with conventional chemo - therapeutic agents may be superior to using the latter alone . Furthermore, because vegf is likely required for migration and recruitment of ecs, t - oligo - me diated vegf reduction would also likely decrease the number of blood vessels in the tumor [1, 6]. Our present findings suggest that t - oligos may induce potent antiangiogenic effects, enhancing their attractiveness as a therapeutic option for cancer . In addition to vegf and its receptors, angiopoietin 1 and 2 (ang-1 and ang-2) and their tyrosine kinase receptor tie-2 have been identified as major players in the processes of growth and remodelling of tumor vasculature [57, 58]. Although under certain conditions ang-2 may inhibit ang-1 effect, in an in vivo mouse model for melanoma and in glioma cells increased expression of ang-2 is thought to stimulate angiogenesis . Another angiogenic factor, hif-1, a transcription factor that is activated by hypoxia, exerts its effect by upregulating vegf levels . We found that t - oligo treatment inhibits hif-1 activity and ang-1 and ang-2 expression in melanoma cell line and decreases vegf synthesis secretion in these cells, strongly suggesting that t - oligo - mediated effects on tumor angiogenesis are transcriptional and ultimately affect several angiogenic molecules . Our laboratory has previously shown that t - oligo increases p73 level in the p53 null mm - an cells and that blocking p73 expression by rnai decreases t - oligo - induced apoptosis in these cells . Like p53, p73 is known to inhibit angiogenesis, primarily through vegf down - regulation . Therefore, we assume that in mm - an cells t - oligo decreases vegf production, in addition to its effect on hif-1, by activating p73 through induction of e2f1 . However, in cells with functional p53, we assume that t - oligo - induced p53 and p73 would cooperate to inhibit angiogenesis . Furthermore, e2f1 is known to induce apoptosis in part by its effect on p73 . Thus, induction of e2f1 by t - oligos also contributes to tumor cell apoptosis . We have previously shown that t - oligo treatment activates (phosphorylates) atm [21, 27]. We therefore suggest that t - oligo regulates e2f1 first via atm - mediated phosphorylation of e2f1 and that e2f1 then further transcriptionally upregulates e2f1 by binding to its own promoter . Indeed, we show that t - oligo increases e2f1 mrna and protein levels as well as its dna binding activity in human mm - an melanoma cells, further confirming our previous finding that e2f1contributes to t - oligo effects . The t - oligos used in the present experiments have physiologic readily hydrolysable phosphodiester linkage, unlike for example antisense dna in which phosphorothioate or other nonhydrolyzable linkage is employed to increase the molecule's half - life (t 1/2). Hydrolyzable linkage is required for initiation of t - oligo signalling and, despite the known short t 1/2, approximately 46 hours in serum - containing medium for a 12-base 100% telomere homolog, nevertheless this allows for the cellular responses observed in the present and previous experiments to evolve over 35 days [11, 13, 19, 21, 22, 2428]. This may reflect the fact that at least in vitro t - oligos rapidly enter the nucleus [11, 22, 24, 27] and that, once in the nucleus, such oligos have a far longer t 1/2 . The efficacy of these presumptively short - lived t - oligos may also reflect the likelihood that, after interaction of the oligos with the werner protein and formation of dna damage - like foci at telomeres, signalling through the dna damage response pathways may continue even if the t - oligos have been hydrolyzed, at least through 48 hours at which time the dna damage foci can still be observed by immunohistochemistry . In earlier studies, we have shown that t - oligos inhibit tumor growth in scid mouse models by inducing cell cycle arrest, differentiation, apoptosis, and senescence [13, 15, 27]. Angiogenesis inhibition encompassing both ecs and melanoma cells, in combination with other t - oligo - mediated anti - tumor effects [11, 13, 22, 25, 27], likely combine to significantly decrease melanoma burden in established scid mouse models, as reported in our earlier publications [13, 27]. These multiple diverse responses are all mediated through activation and/or upregulation of dna damage response proteins . They are thus reminiscent of the less complex but very well characterized bacterial sos response, a genome - protective mechanism that enhances survival of prokaryotic organisms in the face of dna damage . The telomere - based dna damage - like signalling initiated by t - oligos may be viewed as an evolutionarily perfected parallel mechanism in mammalian cells that addresses the threat to genomic integrity posed by malignant transformation . In summary, the present paper indicates that t - oligos exert multiple antiangiogenic effects . These data reinforce prior evidence that t - oligo therapy may offer a powerful new approach to treatment of human primary melanoma and possibly other human malignancies, with several conceptual advantages over the currently lionized targeted therapy approach. |
Muscle dysfunction of the leg is very common in children with spastic diplegia cerebral palsy (cp)1 . Spasticity causes muscle stiffness and weakness, and decreases daily functional activities including standing and walking2 . Passive muscle stretching is a common physical therapy for decreasing the spasticity of children and adults with cp spasticity . It has been reported that prolonged passive muscle stretching improves the range of movements and reduces spasticity3 . Prolonged passive muscle stretching while standing on a tilt - table decreases the resistance to passive ankle joint movements in children with cp4 . Therefore, it has been suggested as a treatment technique for children and adults with cp . Whole body vibration has also been proposed as a treatment for children and adults with spastic cp . Some studies have shown that whole body vibration decreases the spasticity of patients with stroke, spinal cord injury and multiple sclerosis5,6,7 . A whole body vibration intervention decreases spasticity and improves walking speed, muscle strength and gross motor function without any side effects in adults with cp7 . Because both muscle stretching and vibration have underlying treatment efficacy in the alleviation of spasticity, and promote muscle function in adults with cp, a therapeutic program combining passive muscle stretching and whole body vibration may show better treatment effects in children and adolescents with spastic cp . However, no study has yet combined passive muscle stretching with whole body vibration for children and adolescents with spastic cp . Therefore, the aim of this study was to investigate the effect of combining passive muscle stretching and whole body vibration on the spasticity, functional strength and balance of children and adolescents with spastic cp . Twelve children and adolescents with spastic cp aged 618 years (age, 10.58 2.35 years; height, 127.25 9.72 cm; body mass, 26.48 7.95 kg; mean sd) were recruited from khon kaen special school . Subjects were classified for gross motor function at levels i, ii and iii according to the gross motor function classification system (gmfcs), and were included in the study when their modified ashworth scale (mas) scores were greater than or equal to 1 . Exclusion criteria for this study: were receiving pms more than 3 times / week; medical treatment for spasticity such as a drugs, botulinum toxin injection, or orthopedic surgery during the last six months; medical problems such as arthritis, congenital abnormality, cardiovascular or pulmonary diseases, or neuromuscular diseases; musculoskeletal disorders; or infectious disease . This study was approved by the local ethics committee for human research of khon kaen university . Parents of the children and the children read and signed an informed consent form before the start of the study . The study was designed as a two - period cross - over trial in which all subjects received both, passive muscle stretching alone as a control group (cg), and a combination of passive muscle stretching and whole body vibration as an experimental group (eg), as shown in fig . Cg: control group; eg: experimental group; pms: passive muscle stretching; wbv: whole body vibration . Both treatment groups were evaluated for immediate effect (one treatment) and for short - term effect (6 weeks treatment). The sample size was calculated based on a primary modified ashworth scale (mas) outcome which was determined as the predicted value (the post - test value of mas decreased 20%). Sampling randomization was stratified according to the gmfcs from levels i to iii, and ages of children (6 to <10 years), and adolescents (1019 years). After the baseline assessment of all subjects, 12 children were randomly assigned to either eg - cg or cg - eg . In eg - cg, the number of subjects with gmfcs levels i, ii and iii was 1, 1 and 4, respectively, and 3 of the 6 subjects were under the age of 10 while in cg - eg, the number of subjects with gmfcs levels i, ii and iii was 1, 2 and 3, respectively and 2 of the 6 subjects were under the age of 10 . The gmfcs levels and ages were similar in both groups and each group was crossed over at the end of each phase was so that each group received the same treatment . In phase 1, subjects were evaluated for outcome variables before and immediately after a one - time treatment and in phase 2, the procedure was repeated after group crossover . All subjects rested for 2 days for a washout between phases 1 and 2 . After phase 2 had finished, subjects rested for the 2-day washout period, and in phase 3, all individuals continuously received treatment for 6 weeks . After phase 3, a washout period of 2 weeks was conducted before group crossover for phase 4 . Pre - and post - treatment measurements were conducted in phases 3 and 4 . Cg: control group; eg: experimental group; pms: passive muscle stretching; wbv: whole body vibration for cg, passive muscle stretching was performed while the subjects stood on a tilt table for 40 minutes per session . The table was tilted to 7080 degrees relative to the horizontal plane, and two straps around the chest and knees helped to support the body . For eg, a combination of passive muscle stretching and whole body vibration was conducted . Whole body vibration was applied at 20 hz on the oscillation platform (aiko vibrator, etf-001cg, thailand). After passive muscle stretching for 30 minutes, a total of 10 minutes of one - minute vibration with one minute rest was performed while the subjects stood with equal weight - bearing on both feet . Subjects stood in a standardized foot position on the platform as recommended by the manufacturer with center of the platform located between the legs placed shoulder - width apart . The amplitude of vibration becomes larger when the feet are placed further from the center line . For safety reasons, some subjects held a handle - bar during the vibration . Both the cg and eg interventions were conducted for a total of 40 minutes treatment / day, 5 days / week for 6 weeks, in addition to the regular physiotherapy program at school of 1 session / week . Before and after the single treatments and the 6-week treatments, subjects were evaluated using the modified ashworth scale (mas), the five times sit - to - stand test (ftsst) and the pediatric balance scale (pbs). Mas is known as an essential clinical measure of muscle spasticity in people with neurological conditions8 . The topographic distribution of impairment was determined as the leg with lower or higher spasticity which represented the weaker or stronger side, respectively . Mas scores were assigned numerical values for the evaluated mas scores (0, 1, 2, 3, 4 and 5). A value of 0 indicates no increase in muscle tone; 1 (1 point) is a slight increase in muscle tone, manifested by a catch and release or by minimal resistance at the end of the range of motion when the affected part is moved in flexion or extension; 1 + (2 points) is a slight increase in muscle tone, manifested by a catch, followed by minimal resistance throughout the remainder (less than half) of the rom (range of movement); 2 (3 points) is a more marked increase in muscle tone through most of the rom, but the affected part is easily moved; 3 (4 points) is a considerable increase in muscle tone passivity, with movement difficult; 4 (5 points) is an affected part rigid in flexion or extension . Mas was assessed by the same evaluator throughout the experiment, and outcomes were tested for the intra - tester reliability . The five times sit - to - stand test (ftsst) is a reliable tool for evaluating lower limb muscle strength and balance ability9 . Subjects sat on a chair with their arms crossed over the chest, and they were asked to stand up and sit down again as quickly as possible five times without using arm support . The test began with the word go and stopped when subjects sat after the fifth performance; the time was recorded . The pediatric balance scale (pbs) is a modification of the berg balance scale, which was developed for the evaluation of the balance ability of school - age children with mild to moderate motor impairments . Pbs has been demonstrated to have good test - retest and inter - rater reliabilities10 . There are 14 items and each item is scored on a five point ordinal scale from zero to four with a maximum score of 56 points . In order to demonstrate each task and give instruction, each child was allowed to practice each item once . If the child was unable to complete the task based on their inability to understand the directions, a second practice trial was allowed, and the best score was recorded11 . Pbs took approximately 15 minutes to conduct, and if some children needed more time or felt fatigued during the test they were allowed to rest for a few minutes . The distribution of the data was examined using the shapiro - wilk s test to examine the assumption of normality . The differences of variables within and between the groups were assessed with the wilcoxon signed - ranks test and the mann - whitney u - test, respectively . Tables 1table 1.pre-and post - intervention evaluation items of the control and experimental groupsimmediate effectshort - term effectcontrol groupexperimental groupcontrol groupexperimental groupbeforeafterbeforeafterbeforeafterbeforeaftermas scorestrongerhip adductors 2 (1:3.75)2 (1:2)2 (1:3)1 (1:2.75)2 (1:3)2 (1:2.8)2 (1:3)1 (1:1)quadriceps 2.5 (2:3)1 (1:2)2.5 (2:3)2 (1.25:2)3 (1.3:3)2 (1.3:2.8)3 (1.3:3)1 (1:2)hamstrings2 (1:3)1 (1:2)2 (1:3)1 (1:1)2.5 (2:3)2 (1.3:2.8)3 (2:3)1 (1:1.8)soleus2 (1.25:4.75)1.5 (1:3)2 (1.25:4.75)1 (1:2)3 (1.3:5)2 (1:4)3 (2:5)1.5 (1:2.8)weakerhip adductors 2 (1:3.75)1 (1:3)2 (1:3.75)1 (1:3)1.5 (1:2.8)1.5 (1:2.0)1.5 (1:2.8)1 (1:1)quadriceps 2 (1:2.75)2 (1:2)2 (1:2.75)1 (1:2)2 (1:2)2 (1:2)2 (1:2)1 (1:1.8)hamstrings 1.5 (1:2.75)1 (1:2)1.5 (1:2.75)1 (1:1)1.5 (1:2)2 (1:2.8)1.5 (1:2)1 (1:1)soleus2 (2:3.75)1.5 (1:3.75)2 (2:3.75)1 (1:2.5)2.5 (1:4)2 (1:3)2 (1:3.8)1 (1:2.8)ftsst (s)16.59 (13.0:23.1)17.28 (10.6:22.7)16.93 (12.3:16.9)11.96 (10.9:19.9)13.34 (10.7:20.6)10.14 (9.6:12.7)13.55 (11.8:21.9)11.36 (8.1:13.4)pbs (score)26.00 (7:42)25.00 (7.5:42.25)24.00 (8.5:42.25)26.50 (10:42.25)26.0 (7.3:45.8)27.5 (8.5:42.0)24.5 (8.5:42.0)31.0 (10.0:44.3)data are presented as median (quartile1:quartile3) for all outcomes . P <0.05, p <0.01 and 2table 2.comparison of the median differences between the control and experimental groupsimmediate effectshort - term effectcontrol groupexperimental groupcontrol groupexperimental groupmas scorestrongerhip adductors 0 (1.0: 0)0 (1.0: 0) 0 (1: 0.75)0.5 (1: 0)quadriceps 1.0 (1.75: 0)1.0 (1: 0) 0 (1: 0)1.0 (1: 1)hamstrings 0.5 (1.0: 0)1.0 (2.0: 0)0.5 (1: 0)1.0 (2: 1)soleus 0 (1.0: 0)1.0 (2.0: 0)0 (1: 0)1.0 (1.75: 0.25)weakerhip adductors 0 (0.75: 0)0 (1.0: 0)0 (0: 0)0 (1: 0)quadriceps 0 (0.75: 0)0 (1.75 to 0)0 (0: 0)0.5 (1: 0)hamstrings 0 (1.0: 0)0 (1.75: 0)0 (0: 0.75)0.5 (1: 0)soleus 0 (1.0: 0)1.0 (1.75: 0.25)0 (1: 0)1.0 (1: 0)ftsst (s)1.18 (3.0: 1.6)2.61 (5.3: 1.1)3.28 (6.70: 0.51)4.46 (8.09: 2.41)pbs (score)0 (0: 1)0 (0: 1)0 (2: 2.75)2.5 (0: 4)data are presented as the median difference (quartile 1: quartile 3) for all outcomes . P <0.05 summarize the pre - and post - intervention measurement values of cg and eg . In the immediate effect of eg, mas scores significantly decreased in all muscles of the stronger side and the soleus of the weaker side . In the immediate effect of cg, mas scores significantly decreased in the quadriceps, hamstrings and soleus muscles of the stronger side . In the comparison of the groups, only the mas score of the soleus of the weaker side was significantly improved by eg . After the 6-week treatment, all the evaluated items significantly improved in eg, and the mas scores of the hamstrings and soleus of the stronger side and ftsst improved in cg . In the comparison of the groups, the mas scores of the quadriceps and hamstrings of both sides, and soleus of the stronger side were more significantly decreased by eg than by cg . No significant differences between the groups were found for ftsst, pbs and mas of the hip adductors . P <0.05, p <0.01 data are presented as the median difference (quartile 1: quartile 3) for all outcomes . The results show the combined treatment of pms and wbv had better effects than pms alone on the spasticity of children and adolescents with cp . Immediately after one treatment, the combined treatment showed better improvement in the scores of the mas than pms alone . After the 6-week intervention, the combined treatment significantly decreased the scores of the mas when compared to pms alone . Both treatments significantly reduced the children s performance times in the five times sit - to - stand test, while the combined treatment significantly increased the scores of the pediatric balance scale . Thus, the results suggest that a 6-week intervention of a combination of prolonged pms and wbv may elicit beneficial effects for the spasticity and balance of patients with cerebral palsy . Sustained passive muscle stretching for a long duration improves the range of movements, and reduces the spasticity of muscles11, 12 . Passive muscle stretching activates golgi tendon organs and inhibits the excitability of alpha motor neurons . Current evidence supports the effectiveness of passive stretching of children with spastic cp, although the reduction in spasticity may not be linked with functional activities such as walking3 . A combination of exercise, massage therapy and therapeutic supports is an effective treatment for the release of muscle stiffness, decrease of pain, and improvement of physical functions14,15,16 . Therefore, different therapeutic methods should be used to normalize muscle tone, maintain or increase soft - tissue extensibility, reduce contracture pain, and improve motor function18 . Oscillation of the ankle joints with a vibrator helps to induce release of a stiff ankle joint . During vibration, standing in a neutral ankle position with body weight bearing also stimulates the stretching of calf muscles . Whole body vibration decreases the spasticity of muscles and increases the gross motor function of subjects with cp7, 19 . Whole body vibration improved muscle strength and power movement similar to conventional resistance training in older women20 and in adults with cp7 . The muscle spindle senses a very small change in muscle length when a skeletal muscle perceives vibration . This information is transmitted to the fibers of group ia or ii, eventually reaching the spinal cord . In the spinal cord, the information serves as presynaptic inhibition through an interstitial cell and suppresses the alpha motor neurons21, 22 . The activation of these sensory receptors results in reflexive activation of motor units similar to the tonic vibration reflex23 . Whole body vibration improved the performance of multiple sclerosis patients in the timed up & go test26 . This improvement in physical balance after whole body vibration may be associated with improvement of leg muscle strength27 . The activation of proprioreceptive spinal circuits can be induced by upright standing on a vibration platform . Because reflexes are related to the time - differential activation of spindles in muscles and tendons28, the improvement in balance might be positively related to muscle strength and proprioception after vibration training . Whole body vibration may allow children and adolescents with cp to walk effectively with an improvement of balance . Similar to our results, previous research has shown that whole body vibration improves the muscle tone, strength, balance and mobility of children with cp29,30,31; however, those studies used a vibration frequency with stepwise increment up to 18 hz compared to the constant vibration frequency of 20 hz used in the present study . A limitation of this study was the small number of subjects and the absence of double - blinding of subjects and physiotherapists . With regard to adherence to treatment, all subjects enjoyed whole body vibration therapy and engaged in regular interaction with the physiotherapists . Therefore, whole body vibration should be added to the physiotherapy program . Although improvements in outcomes were found in this study, the optimal dose - response vibration was not clear . Thus, further studies should focus on the training protocol or whole body vibration that can provide the best results for children and adolescents with cp . In conclusion, this present study showed that 6 weeks of combined passive muscle stretching and whole body vibration could decrease the spasticity and increase the muscle strength and balance of children and adolescents with cp . Whole body vibration could be an alternative additional treatment to passive muscle stretching for both clinical and home therapy programs for children and adolescents with cp. |
Chirality is a hallmark of biological systems: proteins are composed of l - amino acids and dna and rna are composed of -d - nucleotides . It has, therefore, been widely accepted that enzymes that must correctly bind ligands and catalyze chemistry on their respective substrates, will invariably show high chiral selectivity . Quite unexpectedly, however, it was demonstrated that it is the l - component of the racemic mixture ()-bch-189 [()--2,3-dideoxy-3-thiacytidine], which possesses significantly better anti - human immunodeficiency virus (hiv) properties than its d - enantiomeric counterpart (1,2). Since this discovery, two non - physiologic l - nucleoside analogs [()--2,3-dideoxy-3-thiacytidine (3tc), the l - enantiomer of bch-189, and its 5-fluorinated analog ftc] have been approved for treatment of human acquired immune deficiency syndrome (aids). An additional six d - nucleoside analogs have been approved as aids therapeutics, and it is customary for patients to receive both l- and d - enantiomer anti - hiv agents simultaneously . The pharmacological potential of l - nucleoside analogs has been recently reviewed (35). The dioxolane analog of 3tc, troxacitabine [tro, ()-l--2,3-dideoxy-3-oxacytidine; figure 1a] is currently in a phase ii / iii clinical trial for third - line treatment of acute myelogenous leukemia (aml), a blood cancer . The l - nucleoside analogs 3tc and ftc are preferred as anti - virals over their d - analogs [(+) -bch-189 and (+) -ftc, respectively], primarily because these hiv reverse transcriptase inhibitors do not affect cellular dna polymerases (4), resulting in minimal toxicity . In contrast, tro, the first l - nucleoside analog to be used as a cytotoxic anti - cancer agent (6), which differs from 3tc by only one atom (s versus o in the five membered ring, figure 1a), has potent anti - viral activity yet displays substantial cellular toxicity due to inhibition of dna polymerases, and (7). Unlike the d - nucleoside analog anti - cancer agent cytarabine (arac), tro is not a substrate for the drug - modifying enzyme cytidine deaminase (6) that confers cytarabine resistance in aml (8). (a) schematic of the d- and l - nucleosides (all in -form): 3tc, ()-l-2,3-dideoxy-3-thiacytidine (lamivudine, epivir); tro, ()-l-2,3-dideoxy-3-oxacytidine (troxacitabine, troxatyl); d - dc, d-2-deoxycytidine, and l - dc, l-2-deoxycytidine . Experimental electron density map for the l - nucleoside analogs: (b) the difference map (|fobs| |fcalc|) is contoured at 3 (light blue) and 8 (orange). Note the strong signal given by the sulfur atom in 3tc even at the high sigma cut - off . Figures were generated using bobscript (26) and molscript (27), and rendered with raster3d (28). Metabolic conversion of 3tc and tro to pharmacologically active drugs requires serial phosphorylation to their triphosphorylated forms . The essential first step in this process is catalyzed by deoxycytidine kinase (dck) (6,911), which together with the two mitochondrial enzymes thymidine kinase (tk2) and deoxyguanosine kinase (dgk), constitute a family of three closely related non - enantioselective enzymes responsible for nucleoside phosphorylation (12,13). Tk2 phosphorylates both dc and deoxythymidine (dt), and dgk phosphorylates both da and dg . The overlapping substrate specificity of these nucleoside kinases reflects their differing sub - cellular localization: dck is cytosolic, whereas tk2 and dgk are mitochondrial . All three enzymes are capable of phosphorylating both l- and d - enantiomers (1416). The question that we set out to answer is what structural features endow certain enzymes, such as dck, the ability to accept substrates with non - physiological chirality? Answering this question is significant not only for our understanding of enzyme specificity, but also has medicinal ramifications as more l - nucleoside analogs enter clinical trials . To address this issue, we solved the crystal structures of human dck in complex with the two clinically relevant l - nucleoside analogs, 3tc and tro . This is the first report of an enzyme in complex with an l - nucleoside . Initial attempts to crystallize wild - type dck with 3tc and tro were hampered by reproducibility . Modification of all four surface - exposed cysteine residues yielded a significantly better behaved crystallization candidate, thereby making this study feasible . The dck variant containing the c9s / c45s / c59s / c146s mutations, designated c4s - dck, was created from the wild - type dck gene, using quickchange (stratagene, inc . ). The protein was produced in escherichia coli and purified to homogeneity (e. sabini, s. hazra, m. konrad and a. lavie, manuscript in preparation) in short, e.coli bl21(de3) harboring the pet14b expression plasmids were grown in 2yt media at 37c, induced with 0.1 mm isopropyl--d - thiogalactopyranoside (iptg), and harvested by centrifugation after 4 h. after lysis by sonication and ultracentrifugation, the supernatant was loaded onto a histrap hp ni sepharose column (ge healthcare) and washed with buffer containing 50 mm hepes (ph 7.5), 500 mm nacl and 20 mm imidazole . The enzyme was eluted by the same washing buffer containing 200 mm imidazole . After protein concentration by centrifugation, the protein was injected onto a s-200 gel filtration column (ge healthcare) equilibrated with 20 mm hepes (ph 7.5), 200 mm sodium citrate and 2 mm edta . The fractions containing the enzyme were concentrated to 20 mg / ml and stored at 80c . Ternary complexes were formed by mixing each nucleoside analog (3tc, obtained from the nih aids research and reference reagent program, division of aids; tro, provided by sgx pharmaceuticals, inc .) With adenosine diphosphate (adp) (final concentrations 5 mm each) and enzyme (1020 mg / ml) in 5 mm mgcl2 . Crystals were obtained under identical conditions as for wild - type dck (17) via hanging drop vapor diffusion against a reservoir containing 0.951.5 m sodium citrate and 100 mm hepes (ph 7.5). X - ray data were obtained under standard cryogenic conditions at the advanced photon source using sercat beamline bm-22 . Diffraction data were indexed, scaled and merged using xds and xscale (18) (see table 1 for data collection statistics). Data collection and refinement statistics ternary complex structures were determined via molecular replacement [molrep (19)] using the structure of wild - type dck - d - dc / adp (17) [pdb code: 1p60 (20)] as the search model . Refinement was carried out using refmac (21) and simulated annealing maps were calculated using cns (22) (see table 1 for refinement statistics). A spectroscopic enzyme - coupled assay was used to determine enzyme activity as described previously (23). This assay couples the production of adp or udp by dck to the phosphorylation of phosphoenolpyruvate (pep) by pyruvate kinase, followed by oxidation of nadh by lactate dehydrogenase . The decrease in nadh absorption is proportional to the adp / udp produced by dck . The extinction coefficient of nadh limits the precise measurement of km values below 3 m . For this reason, substrates displaying a km value below 3 m are reported in table 2 to this higher limit . Experiments were conducted at 37c in a kinetic buffer containing 50 mm tris hcl (ph 7.5), 100 mm kcl and 5 mm mgcl2 with dck: 0.35 m, adenosine triphosphate (atp)-mg: 1 mm and uridine triphosphate (utp)-mg: 1 mm . Steady state kinetic data of wt and c4s - dck values shown are the averages of at least two experiments and sds are shown . To verify that the cysser mutations in c4s - dck did not perturb the structure, ternary complex crystals of the c4s variant were obtained in the presence of d - dc / adp (pdb i d 2no1) and gemcitabine / adp (pdb i d 2no0) and compared to structures previously determined with wild - type enzyme (17). These control complexes crystallized in the same space group as the l - nucleoside complexes, and diffracted to 1.9 (d - dc / adp complex) and 1.8 (gemcitabine / adp) resolution (e. sabini, s. hazra, m. konrad and a. lavie, unpublished data). No significant structural differences were noted between corresponding polypeptide chain structures [root mean square deviation (r.m.s.d .) Between 241 carbon atomic positions: wild - type dck - d - dc / adp versus c4s - dck - d - dc / adp = 0.16; dck - gemcitabine / adp versus c4s - dck - gemcitabine / adp = 0.60] or substrate positions . Finally, no significant differences in catalytic efficiency were observed between wild - type and c4s - dck for two distinct phosphate donors and multiple acceptors (table 2). Together, these control experiments validate the use of the c4s mutant for structure determination . When referring to structures of dck herein, we make no distinction between wild type and the c4s mutant, unless otherwise stated . Initial attempts to crystallize wild - type dck with 3tc and tro were hampered by reproducibility . Modification of all four surface - exposed cysteine residues yielded a significantly better behaved crystallization candidate, thereby making this study feasible . The dck variant containing the c9s / c45s / c59s / c146s mutations, designated c4s - dck, was created from the wild - type dck gene, using quickchange (stratagene, inc . ). The protein was produced in escherichia coli and purified to homogeneity (e. sabini, s. hazra, m. konrad and a. lavie, manuscript in preparation) in short, e.coli bl21(de3) harboring the pet14b expression plasmids were grown in 2yt media at 37c, induced with 0.1 mm isopropyl--d - thiogalactopyranoside (iptg), and harvested by centrifugation after 4 h. after lysis by sonication and ultracentrifugation, the supernatant was loaded onto a histrap hp ni sepharose column (ge healthcare) and washed with buffer containing 50 mm hepes (ph 7.5), 500 mm nacl and 20 mm imidazole . The enzyme was eluted by the same washing buffer containing 200 mm imidazole . After protein concentration by centrifugation, the protein was injected onto a s-200 gel filtration column (ge healthcare) equilibrated with 20 mm hepes (ph 7.5), 200 mm sodium citrate and 2 mm edta . The fractions containing the enzyme were concentrated to 20 mg / ml and stored at 80c . Ternary complexes were formed by mixing each nucleoside analog (3tc, obtained from the nih aids research and reference reagent program, division of aids; tro, provided by sgx pharmaceuticals, inc .) With adenosine diphosphate (adp) (final concentrations 5 mm each) and enzyme (1020 mg / ml) in 5 mm mgcl2 . Crystals were obtained under identical conditions as for wild - type dck (17) via hanging drop vapor diffusion against a reservoir containing 0.951.5 m sodium citrate and 100 mm hepes (ph 7.5). X - ray data were obtained under standard cryogenic conditions at the advanced photon source using sercat beamline bm-22 . Diffraction data were indexed, scaled and merged using xds and xscale (18) (see table 1 for data collection statistics). Ternary complex structures were determined via molecular replacement [molrep (19)] using the structure of wild - type dck - d - dc / adp (17) [pdb code: 1p60 (20)] as the search model . Refinement was carried out using refmac (21) and simulated annealing maps were calculated using cns (22) (see table 1 for refinement statistics). A spectroscopic enzyme - coupled assay was used to determine enzyme activity as described previously (23). This assay couples the production of adp or udp by dck to the phosphorylation of phosphoenolpyruvate (pep) by pyruvate kinase, followed by oxidation of nadh by lactate dehydrogenase . The decrease in nadh absorption is proportional to the adp / udp produced by dck . The extinction coefficient of nadh limits the precise measurement of km values below 3 m . For this reason, substrates displaying a km value below 3 m are reported in table 2 to this higher limit . Experiments were conducted at 37c in a kinetic buffer containing 50 mm tris hcl (ph 7.5), 100 mm kcl and 5 mm mgcl2 with dck: 0.35 m, adenosine triphosphate (atp)-mg: 1 mm and uridine triphosphate (utp)-mg: 1 mm . Steady state kinetic data of wt and c4s - dck values shown are the averages of at least two experiments and sds are shown . To verify that the cysser mutations in c4s - dck did not perturb the structure, ternary complex crystals of the c4s variant were obtained in the presence of d - dc / adp (pdb i d 2no1) and gemcitabine / adp (pdb i d 2no0) and compared to structures previously determined with wild - type enzyme (17). These control complexes crystallized in the same space group as the l - nucleoside complexes, and diffracted to 1.9 (d - dc / adp complex) and 1.8 (gemcitabine / adp) resolution (e. sabini, s. hazra, m. konrad and a. lavie, unpublished data). No significant structural differences were noted between corresponding polypeptide chain structures [root mean square deviation (r.m.s.d .) Between 241 carbon atomic positions: wild - type dck - d - dc / adp versus c4s - dck - d - dc / adp = 0.16; dck - gemcitabine / adp versus c4s - dck - gemcitabine / adp = 0.60] or substrate positions . Finally, no significant differences in catalytic efficiency were observed between wild - type and c4s - dck for two distinct phosphate donors and multiple acceptors (table 2). Together, these control experiments validate the use of the c4s mutant for structure determination . When referring to structures of dck herein, we make no distinction between wild type and the c4s mutant, unless otherwise stated . The ternary complex structures of dck-3tc / adp and dck - tro / adp were determined at 1.8 and 2.15 resolution, respectively . Excellent difference electron density maps were observed for the l - nucleoside analogs (figure 1b and c). After several rounds of model building and refinement, in which the nucleotide adp and the respective l - nucleoside analogs were modeled into the density, and addition of water molecules, the final crystallographic r - factors (rfrees) converged to 19.2% (23.3%) and 19.5% (25.5%) for the 3tc and tro complexes, respectively (table 1). When compared to the ternary complex structures of dck - d - dc / adp and dck - l - dc / adp (e. sabini, s. hazra, m. konrad and a. lavie, unpublished data), binding of these l - nucleoside analogs does not affect the structure of the polypeptide chain r.m.s.d . For 239 common -carbon atoms among pairs of ternary complex structures = 0.180.30] nor the positions of the adp molecules (figure 2a). In contrast, the mode of l - nucleoside / l - nucleoside analog binding differs from that of d - nucleosides (figure 2b and c). (a) shown are four superimposed structures of human dck: the c4s variant in complex with 3tc / adp (yellow), tro / adp (magenta) and d - dc / adp (blue); the wt in complex with d - dc / adp (gray; pdb i d 1p5z). The structures in complex with d - dc / adp of the dck c4s variant and the wt dck are basically identical, apart from one loop involved in crystal contact . Non - carbon atom color coding: oxygen - red, nitrogen - blue, phosphorous - green and sulfur - orange . The n- and c - terminal residues visible in the experimental electron density map are labeled n20 and c260, respectively . (b) stereo representation of the active site showing hydrogen bonding interactions (some water molecules omitted, for clarity). (c) stereo representation of the active site in an orientation rotated 90 relative to (b) depicting the cytosine base in the aromatic slot with leu82 and ile30 sandwiching the sugar . Structures have been deposited in the pdb with accession i d 2noa for c4s-3tc / adp, 2no9 for c4s - tro / adp and 2no1 for c4s - d - dc / adp . The active site environment surrounding each l - nucleoside analog is shown in figure 3a, accompanied by similar views for dck - d - dc / adp and dck - l - dc / adp (figure 3b). D - dc is the mirror image of l - dc (chirality being determined by the location of the ch2oh group at the c4 chiral centre or ribose 4 position, figures 1a and 3b). 3tc and tro closely resemble one another, and only differ from l - dc at the 3 position (figure 1a). Detailed comparison of the protein ligand interactions, presented schematically in figure 4, reveals the structural basis for non - enantioselective phosphorylation by dck . For both 3tc and tro, the enzyme satisfies the same requirements for substrate recognition / catalysis that govern phosphorylation of its primary physiologic substrate, d - dc . First, hydrogen bonding interactions between the protein and the ligand permit the protein to detect the presence of a hydrogen bond donor (nh2) and two hydrogen bond acceptors (n; o) characteristic of the cytosine base (figure 2b). Second, the five - membered ring resembling the ribose is positioned so as to place the site of phosphorylation (5-oh) in the appropriate location for phosphoryl transfer from atp . (a) stereoview depicting the interactions made by the 5-oh groups of 3tc (yellow) and tro (magenta). (b) stereoview depicting the analogous interactions for d - dc (blue) and l - dc (cyan). Schematic representation of the (a) polar and (b) weakly polar and hydrophobic interactions made by 3tc and tro with the residues in the dck active site . Distances () are color - coded in (a) with 3tc - yellow and tro - magenta, while in (b) they are in black and correspond to the average closest contacts for both structures . Water molecules are represented as cyan balls . Despite the difference in chirality between the physiologic substrate d - dc and the l - nucleoside analogs 3tc / tro, the location of the cytosine base and its interactions with the enzyme are comparable . In all three ternary complex structures depicted in figure 2b, asp133 forms hydrogen bonds with the cytosine amino group . However, it is gln97 that serves as the primary cytosine recognition element contributing two hydrogen bonds between its side chain and the components of the base that normally engage in watson crick type hydrogen bonding with guanosine (gln97 onh2; gln97 nh2n; figures 2b and 4a). The fourth hydrogen bonding interaction between the protein and the base appears as a water bridge (tyr204/tyr86h2oo; figures 2b and 4a). Analogous interactions with comparable hydrogen bond geometries occur between dck and the cytosine bases of d - dc and l - dc (data not shown). The base itself sits deep in an aromatic slot, which is lined by the side chains of phe137, phe96 and trp58 (all conserved among dck, dgk and tk2). Phe137 engages in stacking against the cytosine base (interplanar distance 3.5). On the opposite face, phe96 and trp58 both engage in edge - to - face interactions that place electropositive aromatic hydrogen atoms close to the electronegative -electron cloud of the cytosine base (figures 2c and 4b). Quadrupole interactions characteristic of aromatic amino acid side chains in proteins as also seen in crystalline benzene (24). The important systematic difference in the position of the cytosine bases of 3tc and tro versus that of d - dc is a 10 tilt (figure 2c). We believe that this difference is a general feature of l - enantiomers, as the same base tilt is reproduced in the structure of l - dc bound to dck (e. sabini, s. hazra, m. konrad and a. lavie, unpublished data). In contrast to the numerous interactions between the cytosine base and the aromatic slot, the five membered rings of 3tc and tro make only limited enzyme contacts (figures 3a and 4). Critical for catalysis is correct positioning of the 5-oh, which receives the transferred phosphate group from atp . In the l - nucleoside analog structures depicted in figure 3a, the 5-oh group is hydrogen bonded to the side chain of arg128 . Consequently in each case, the o5-hydroxyl is close to a side chain oxygen atom of glu53 (3.13.6), the general base that activates 5-oh group attack of the -phosphate of atp (see figures 2b and 3). To achieve this critical interaction, concomitant with base tilting, the five - membered rings of 3tc and tro rotate 30 around the glycosidic bond (, marked with an arrow in figure 2b) relative to the dck - bound conformation of d - dc . A comparable rotation observed in the l - dc structure (e. sabini, s. hazra, m. konrad and a. lavie, unpublished data) provides additional evidence that our structural findings represent the way in which l - nucleosides and l - nucleoside analogs bind to dck . The four structures depicted in figure 3 document that positioning of the 5-oh group in the active site of dck is independent of chirality . This remarkable property derives from the internal symmetry and conformational flexibility (i.e. Rotation about the glycosidic torsion angle) of nucleosides and nucleoside analogs . Once the cytosine base is docked into the aromatic slot, the paucity of protein ligand interactions involving the five - membered ring and the conformational properties of the nucleoside permit appropriate positioning of the 5-oh group . Within the aromatic slot, possible glycosidic bond torsion angles are limited by the hydrophobic residues ile30 and leu82 (figures 2c and 4). An additional degree of freedom dictating the precise location of the hydroxyl is the pucker of the five - membered ring . For 3tc and tro, the ring pucker is equivalent to c3 endo, whereas for l - dc and d - dc the sugar pucker is c3 exo . This difference can be attributed in part to the absence of a 3-oh group on 3tc and on tro, both of which can act as dna chain terminators . Finally, a torsion angle rotation about the c4 and c5 bond, from gauche in the d - dc structure to trans in the complex structures of 3tc, tro and l - dc, direct the 5-oh group towards glu53 . Although these features of 3tc and tro conformational flexibility bring the 5-oh group near to glu53 (3.13.6; figure 3a), they do not stabilize the very close, so - called catalytic, interactions seen with l - dc and d - dc (2.42.5; figure 3b). However, the fact that dck shows similar catalytic efficiency towards 3tc / tro and l - dc (table 2) suggests that the slightly sub - optimal position observed for the 5-oh group in the 3tc / tro structures does not impede catalysis . In conclusion, the structures reported herein document that dck phosphorylation of l - nucleosides and l - nucleoside analogs is due to both the nature of the enzyme active site and the nature of the substrates . We suggest that lack of enantiomeric selectivity may reflect the central role dck plays in nucleotide salvage, i.e. Phosphorylating both the pyrimidine dc and the purines da and dg within the cytosolic compartment . Similar arguments can be invoked to explain why the related enzymes dgk, which phosphorylates da and dg, and tk2, which phosphorylates dt and dc, are not enantioselective . In contrast, human tk1, which is restricted to d - dt phosphorylation, is exquisitely enantioselective (25). We suggest that enzymes that evolved to catalyze more than one chemically distinct nucleoside substrate acquired less restrictive active sites, which in turn endowed such enzymes with hitherto unexpected catalytic activities for substrates with non - physiologic chirality. |
Parasitic infections are increasing worldwide due to rapid urbanization of cities, global warming, and international traveling . The diagnosis of parasitic diseases of the respiratory system is challenging because clinical manifestation and radiological findings are not specific . The larvae can cause airway inflammation, whereas migration of the mature adult worm may cause mechanical obstruction . We present a case of interstitial pneumonitis caused by parasitic infestation, which was diagnosed on transbronchial lung biopsy (tblb). A 54-year - old female presented with a history of exertional breathlessness and dry cough for two months . She was afebrile with spo2 of 91% on room air and bilateral crepitations on respiratory examination . L (46.4%), fvc of 1.45 l (45.2%), and fev1/fvc 83% with reduction in dlco 1.46 mmol / min / kpa (18%) and corrected value with alveolar volume 0.49 mmol / min / kpa (30%). High - resolution computed tomography (hrct) of chest showed multiple ill - defined nodular opacities in both lung fields showing centrilobular distribution associated with ground glass opacities bilaterally . Fine reticular densities were seen at places with segments of traction bronchiectasis [figure 1]. Total serum ige was 145 iu / ml and specific ige for pigeon droppings (<0.10 tblb showed thickened alveolar septa with mild lymphoplasmacytic inflammatory infiltrate in the interstitium with cross - sections of calcified parasitic larvae with foreign body giant cell reaction around it [figure 2]. Travel history revealed frequent travels in the himalayan belts yearly for 20 years during which she had frequent episodes of diarrhea . She was given albendazole 400 mg for three days and oral corticosteroids for 12 weeks . Bronchoalveolar lavage (bal) for tuberculosis culture at 6 weeks was negative . At 6 weeks high - resolution computed tomography chest showing multiple ill - defined centrilobular opacities with ground glass opacities bilaterally before treatment histopathology image of transbronchial lung biopsy showing calcified larva with thickened alveolar septa with mild lymphoplasmacytic inflammatory infiltrate in the interstitium high - resolution computed tomography chest showing remarkable improvement after treatment diffuse lung diseases can be further divided into transient pulmonary infiltrates and alveolar or interstitial lung diseases . Ascariasis, anchylostomiasis, and toxocariasis usually cause transient pulmonary infiltrates, whereas schistosomiasis, strongyloidiasis, and tropical pulmonary eosinophilia can cause diffuse interstitial changes, as in the current case . Strongyloidiasis causes reticulonodular opacities because of secondary infection, hemorrhage, inflammatory pneumonitis, and bacterial abscess formation . Schistosomiasis eggs that are not passed into bladder or intestinal lumen are the main cause of chronic lung diseases causing granulomatous reaction and fibrosis . Tropical pulmonary eosinophilia typically results from a hypersensitivity reaction to wuchereria bancrofti and brugia malayi . Tropical pulmonary eosinophilia is an immunological response to microfilariae rather than acute infection, which usually present as reticulonodular opacities . The diagnosis of parasitic infections is difficult on chest radiography or hrct of chest because of nonspecific presentations . Bronchoscopy may be helpful for diagnosis of parasitic infestation by variety of ways like direct visualization, bal, brushing, and tblb . Parasitic lung diseases can also show microscopic pulmonary calcification on lung biopsy . In the current report, transbronchial lung biopsy revealed showed thickened alveolar septa with mild lymphoplasmacytic inflammatory infiltrate in the interstitium with cross - sections of calcified parasitic larvae . Tblb is performed for obtaining tissue specimen from peripheral lung masses and focal or diffuse lung infiltrates . The technique is useful in patients with suspected lung cancer, fungal and mycobacterial lung infections, unexplained infiltrates in immunocompromised hosts and in patients with suspected pulmonary sarcoidosis, lymphangitic carcinomatosis, and in selected cases of pulmonary langerhan's cell histiocytosis, lymphangioleiomyomatosis, and cryptogenic organizing pneumonia . With increasing travels and worldwide migration, parasitic infections should be considered in differential diagnosis of interstitial lung diseases particularly in the evaluation of diffuse lung infiltrates . Bronchoscopy and transbronchial lung biopsy can be useful in the diagnosis of diffuse lung infiltrates. |
Muscle strength and power have been considered strong exogenous stimuli that are able to improve sports performance and promote therapeutic effects in several pathological conditions characterized by muscle wasting, such as cancer, disuse, sepsis, and sarcopenia [1, 2]. In this context, resistance exercise (re) has demonstrated significant effects regarding neural, metabolic, and functional adaptations in skeletal muscle . For this reason, recent studies in humans and rodents have focused on the mechanisms behind such responses promoted by re, especially molecular and phenotypic characterization [69]. Although human studies provide strong evidence for practical application (i.e., greater external validity), it is not always possible to control the variables that may influence a biological response . Furthermore, collection of muscle tissue samples in order to provide a significant body of cellular evidence [10, 11] may limit mechanistic human studies . Therefore, experimental research has been used to provide primary results that may support subsequent studies in humans . Since the study of klitgaard, literature has described some experimental models of re for rodents that have presented interesting results concerning skeletal muscle adaptations [1316]. These studies have demonstrated that rodents are able to perform long- and short - term re with different re protocols and that their hindlimb muscle adapts similar to human muscles in terms of size, fiber type profile, and functionality . Furthermore, molecular characterization of re effects have provided some insight in terms of cell signaling pathways (transcription and translation) involved in the control of skeletal muscle growth (hypertrophy, atrophy, and inflammation) and functionality (strength capacity). However, these experimental models present limitations that may compromise the extrapolation of data to humans . There are many factors that can limit experimental models of re in comparison to those performed in humans and, among these, we can cite as the main one, the stimulus that is needed to encourage the animal to execute the exercise . Indeed, environmental stress is required, but many models use fasting and electric shock as reward and punishment stimulus, respectively, which is beyond the physiological context observed in humans, and could be considered a limiting factor in experimental models characterized by appetite suppression and energy restriction . Free in a given area and remain tied in the training apparatus during exercise session . Regarding the exercise physiology context, these experimental models do not provide appropriate control of re variables: volume (series and repetitions), intensity, and rest interval between repetitions and sets . This lead us to question whether the stimuli is quantitatively enough or not for muscle tissue in terms of volume and overload . Thus, the aim of the present report is to propose an experimental model of re for rodents that could mimic (considering the limitation of the species) the training carried out in humans . We developed an re model that does not use fasting nor electric shock as stimuli for exercise execution, allows operant conditioning so that the animal does not stay tied to the training apparatus, and promotes the control of re variables to perform specific muscle function tests . With this model it is possible to minimize environmental stress, to approach the animal in a physiological context, to study skeletal muscle adaptations in response to re in several experimental conditions, and to compare the responsiveness of rodents' and humans' muscles to different re protocols . The experiments were conducted in accordance with the national research council's guidelines for the care and use of laboratory animals . Six wistar male rats (400450 g) were housed under controlled environmental conditions (temperature, 22c; 12-h dark period starting at 18: 00 h). They were given free access to commercial laboratory chow and water before the experiments were performed . During periods of energy restriction, the whole equipment consists of an re apparatus and an interface of control (hardware) on the rear panel of the equipment and was based on squat - type studies of klitgaard and wirth et al . . The re apparatus has its external structure built in acrylic, preferably dark, which holds all devices of the equipment and keeps the main tool of the experiment: the weight lifting cylinder . Thus, its composition can be divided to the acrylic structure, rear panel, drawer, copper bars, cylinder lid, weight lifting cylinder, sensors, and actuators . Acrylic structure (figure 1, item 1): the acrylic structure is bicompartmentalized, that is, it has two divisions: the lower box, to house devices of communication, sensors, actuators, and electronic boards, and the higher box, to place the animal and the weight lifting cylinder . Each compartment has distinct lids which have a slot for passage of sensor wires . Rear panel (figure 1, item 2): in the rear panel the connectors responsible for power supply and the hardware are allocated . Drawer (figure 1, item 8; figure 2, item 9): it is an aluminum tray that lines the bottom of the higher box during the experiments, facilitating the removal of animal wasting . It can be washed with water and is usually covered with paper for easy cleaning . Copper bars (figure 1, item 7; figure 2, item 8): responsible for supporting the weight lifting cylinder and can be exchanged for another metal material . Cylinder lid: this device is attached on the top of the weight lifting cylinder to provide better fixation of the cylinder to the acrylic structure, avoiding fluctuations during the experiment due to the rise and fall of weights . The weight lifting cylinder is located inside the re apparatus and is composed by the following . Acrylic cylinder (figure 2, item 1): it is a holder that allows the animal to lift the weight as squat - type exercise . In this cylinder are coupled: weight plates, lifting ring, lifting bar, and the measurement axis . Lifting ring (figure 2, item 6): it is an acrylic piece which is located inside the acrylic cylinder, with one side attached to the measurement axis and the other to a vertical rail found in the body of the acrylic cylinder . The height of this device can be adjusted according to the size and species of the animal . Lifting bar (figure 2, item 10): it is a steel piece responsible for supporting weight plates for the lifting movement . Weight plates must be placed at the predetermined distances relative to the rail found in the acrylic cylinder . Weight plates: 50 g cylinders that should be placed in the lifting bar and fixed with the aid of elastics (i.e., orthodontic elastics). More than one weight plate can be placed in the lifting bar at a time, but they should stay together side by side . The point at which they are placed on the lifting bar must be considered as the midpoint of the set of weight plates on rail of the acrylic cylinder . Axis measurement (figure 2, item 5): it consists of a potentiometer and an acrylic base . This axis should enable the establishment of the lifting ring trough a cross - bolt to the measurement axis . It enables the measurement of angular displacement of the lifting bar through the angle sensor . Support base (figure 2, item 7): it is responsible for acrylic cylinder fixation to the copper bars . The support base consists of two symmetrical parts and must be put side by side below the acrylic cylinder . U shape on both sides of the support base allows its attachment to the copper bars . Angle sensor: it is the sensor responsible for measuring the angle of the lifting bar . The angle sensor is attached to the weight lifting cylinder acting as the axis of the rotation of the lifting bar, allowing the software to calculate the angular displacement of the lifting bar when it is rotated . From this and other data, the software can also calculate the concentric and eccentric strength exerted by the animal as well as the length of each movement . Nose poke (figure 1, item 5; figure 2, item 12): it is through this device that the system receives each nose poking signal of the animal . It has a circular hole in which the animal introduces the nose cutting an infrared light and triggering the device . At the bottom of the hole there is as light - emitting diode (led) that emits yellow light, in order to stimulate the animal when it is operating . The actuators, located inside the apparatus, are responsible for performing specific actions on the re apparatus . Automatic feeder (figure 1, item 6; figure 2, item 2): it is installed inside the apparatus . A pellet at a time is released, requiring replacement of a new pellet into the feeder after the previous release . The release of pellets occurs through a door controlled by a motor servo which is controlled by the hardware in the rear panel of the equipment . Light device (figure 2, item 11): it is placed inside the apparatus in order to illuminate most of the distribution of acrylic structure through a lamp, preferably red and with low power . During the re session sound device (figure 2, item 4): it is placed inside the apparatus and generates noise through a speaker that is also located inside the equipment and protected by a grid . During the exercise session, the sound is activated as a conditioning tool (encourage / disturb the animal). Fan (figure 2, item 3): it is installed into the upper compartment of the equipment and remains ventilating while the apparatus is on trial . It keeps the air circulation inside the equipment, produces a very low noise, and is not within the reach of the animal . The present equipment has all the sensors and devices described highly integrated into its structure and is highly resistant, supporting all actions and movements of the animal . Moreover, it is not necessary to perform the assembly of each component individually prior to use and it is easy to operate and to clean . The phases of operant conditioning adopted in the present equipment are the same described by wirth et al . . However, we modified the logistics of such phases in order to optimize the exercise execution by the animal . As previously mentioned, we did not use fasting as a reward stimulus to execute the exercise, but for conditioning the animal . Therefore, the environment where the experiment was conducted was extremely well - controlled: dark (illuminated by a low - power red light), silent, and devoid of atypical odors . Briefly, the phases of operant conditioning were separated by 48 h and carried out as follows . Magazine: in this phase we only placed the animal inside the apparatus to adapt to the environment . After 12 h of energy restriction the animal remained inside the equipment for 1 hour . During this period, pellets of ~3040 mg were released (a total of 30 pellets) at regular intervals for the animal to identify the automatic feeder . Nose - poke 1: as shown in figure 2, nose - poke is installed besides the automatic feeder . Again, the animal was placed inside the equipment after 12 h of energy restriction . The automatic feeder was triggered each time the animal introduced its nose into the nose - poke . A total of 30 cycles was established for each experiment . Based on our experience with the apparatus, some food smell in the nose - poke was necessary to encourage the animal to introduce its nose inside it . Nose - poke 2: in the second phase of nose - poke, the sound device was integrated to the conditioning process . A constant noise was emitted and when the animal introduced its nose into the nose - poke, the automatic feeder was triggered and the noise stopped . The sound device was used to disturb the animal so that when the task (poking) was performed correctly, the animal was food - rewarded and the noise stopped disturbing . This phase introduced a new variable in order to replace the food reward as the only way to encourage the animal to perform the task proposed . A total of 30 interleaved cycles of pellets (15 with and without food) release were performed . Standing 1: the nose - poke device was removed from the wall and placed inside the weight lifting cylinder, above the lifting ring, and a lid was placed in the nose - poke hole on the wall . This phase was conducted to encourage the animal to enter into the weight lifting cylinder, but without lifting the ring, and was performed twice . Standing 2: in the second phase of standing, food reward was completely removed and the animal had the constant sound as the only stimulus to perform the task . Two sessions were required . Lifting: in the last phase, the nose - poke device remained within the weight lifting cylinder, however, at an unreachable height to the animal . Using the software, a minimum lifting height was set depending on the species and size of the animal . We observed that a height of 4 cm was necessary for an animal of ~400 g to complete the movement (full concentric contraction). During the lifting task, animals performed concentric muscle contractions being plantaris and soleus the main muscles involved in contraction . Of note, the access of the lifting ring allowed the animal to pass only the head through the ring hole and its height was adjusted according to the animal's characteristics . The sound was turned on and once the animal raised the lifting bar to the pre - determined height, the noise stopped . It was necessary to carry out one session without load and one session with light load . It is important to emphasize that the animal did not stay tied in the training apparatus . Once conditioned, the animal underwent a muscle function test: maximal voluntary strength capacity (mvsc) as previously described by our group using the same apparatus and procedures described by klitgaard . The advantages of the present equipment are that the rest intervals between each repetition in the mvsc were optimized because of the sound stimulus, it was possible to calculate concentric and eccentric strengths of the animal during each muscular contraction and relativize the training intensity with better precision (percent of mvsc, percent of body weight). Additionally, the mvsc test can be performed during and at the end of the experimental protocol to assess the progression of muscle function . To configure the training protocol in the software it was necessary to enter the following data: training volume (sets and repetitions), rest intervals between sets and repetitions, desired height of the lifting bar, and weight plate position in the lifting bar . The experiment could be interrupted at any time and all data were stored in a report file by the software . Differences between nose - poke - phases and body weight values were tested by paired t - test . The level of significance was set at p <0.05 . Statistical analysis was performed using sas 8.2 (sas institute inc ., cary, nc, usa). As previously described, to condition the animal to the experimental model it was necessary to carry out periods of energy restriction on the previous day of nose - poke 1 and 2 and standing 1 phases . However, as shown in figure 3, energy restriction did not promote significant changes in body weight at the end of the conditioning process (414.1 4.8 g in pre versus 410.8 4.2 g in post period; p> 0.05). Magazine phase is not described because it was carried out only to adapt the animal to the exercise environment . To complete the 30 cycles proposed in the nose - poke 1 phase interestingly, when the sound device was integrated to the conditioning (nose - poke 2 phase), animals took 58.9% less time to complete the cycles (768.4 109.1 seconds; p = 0.03). It is important to emphasize that, although the animals were more conditioned to the poking task in nose - poke 2 phase, this factor did not contribute to reduce the time spent to complete the cycles . We repeated the nose - poke 1 phase (without sound) and observed reduction of time (data not shown). Standing phases time were not statistically different (1274 92.4 seconds in standing 1 versus 1234 113.3 seconds in standing 2 phases; p> 0.05). Animals took 960.8 254.2 seconds to complete the lifting phases and lifted the bar to 4.1 0.1 cm . Height displacements during repetitions were quite similar to lifting phase and the result of the mvsc during the concentric phase of muscle contraction was 2.3 0.1 n (figure 5). We did not describe the eccentric strength performed because this experimental model is totally based on concentric muscle actions, since during the eccentric phase the animal does not counteract the external load . The rest interval between each repetition to perform a repetition (contraction) was 7.2 0.8 seconds (figure 5). Thus, each time the sound stimulus was released, animals took approximately 7 seconds to perform the next repetition . The aim of the present report was to propose an experimental model of re for rodents with better conditioning (no fasting and shocking) and control of exercise variables (volume, intensity and rest intervals). As previously described, animals were able to perform the conditioning phases within the logistics proposed . Second, integrating the sound device into the conditioning process optimized the performance of the exercise learning . Regarding exercise physiology, it was possible to optimize the encouragement of the animal to perform muscle contractions controlling repetitions and rest interval between repetitions . Therefore, it was possible to control and optimize the variable of re rest interval . Importantly, although this experimental model uses energy restriction as the first stimulus to condition the animal to the exercise, it did not promote significant changes in body weight and, consequently, in muscle mass . This can be explained by the fact that the energy restriction was imposed only at the beginning and gradually abolished during the conditioning process . The applicability of such factor is quite important since models of skeletal muscle atrophy (i.e., glucocorticoids, fasting, cancer, and sepsis) are usually characterized by reduction in food intake . Furthermore, this experimental model demonstrates that it is not necessary to punish the animal (shocking) to encourage exercising . In this context, sound device proved to be a good disturbing recently, we conducted an experiment to evaluate the effectiveness of this experimental model in counteracting dexamethasone - induced skeletal muscle atrophy, an experimental model characterized by severe muscle wasting and appetite suppression . Even with loss of appetite, animals performed, during 7 days, 3 sessions of re composed by 3 sets of 10 repetitions separated by 48 hours . We demonstrated that, although re did not attenuate the atrophic response, it promoted significant phenotypic adaptations in plantaris muscles that in the long term may reflect structural remodeling . Furthermore, re - trained animals presented higher concentric mvsc when compared with nontrained animals at the end of the experimental protocol . Therefore, the experimental mode is effective in conditioning the animal to re and, according to the exercise protocol, to promote phenotypic, structural, and functional responses in skeletal muscle at least in dexamethasone - treated animals . Although the present equipment promotes good control of re variables, the main limitation concerns the strength data . Concentric and eccentric measurements are calculated by estimative, that is, not directly measured by a strength platform as proposed by wirth et al . . Furthermore, it proposes a more specific control of other re variables, especially rest interval between sets and repetitions . Furthermore, it encourages the animal to exercise through short - term energy restriction and disturbing stimuli that do not promote alterations in body weight . Therefore, we believe that this re apparatus is closer to the physiological context observed in humans . Future studies should evaluate the molecular characterization of distinct re protocols in order to understand the biological response of skeletal muscle and optimize the development of training methods . Experimental models characterized by skeletal muscle wasting should also be investigated in order to propose re as a nonpharmacological tool for humans . Additionally, this experimental model allows investigations regarding other stimulus associated with re, that is, nutritional, pharmacological, and so forth. |
This study was approved by king fahad medical city (kfmc) institutional review board (irb) in riyadh, kingdom of saudi arabia . All patients had a baseline brain mri, video - eeg recording, and a pre - surgical neuropsychological assessment composed of addenbrooke s cognitive examination - revised (ace - r),5 handedness questionnaire,6 stanford - binet intelligence scale,7 hospital anxiety and depression scale (hads),8 and daily memory questionnaire (currently being tested in another study). These questionnaires were in arabic, given the language barrier, and were tested before being part of the standard neuropsychological evaluation of all patients admitted to the epilepsy monitoring unit (emu) in kfmc, especially if they were candidates for epilepsy surgery . Potentially included patients are those who were diagnosed with tle and were candidates for temporal lobectomy / lobotomy . Age range of the selected population for the procedure was between 18 and 65 years . Patients were excluded if they had history of coagulopathy, carotid dissection, allergy to the contrast or anesthetic agent, elevated serum creatinine, were not fit for surgery (for example, cardiopulmonary risk, major medical problems), or were unable to communicate efficiently during the procedure (for example, deafness). Patients were also excluded from the procedure if their ace - r score were less than 67 or if they were mentally retarded as per stanford - binet intelligence scale . Patient selection was according to the helsinki declaration.9 all patients consented and received a detailed explanation on the nature, risks, and benefits of the procedure . Since sa was not available, pf was chosen as an alternative, based on efficacy, safety profile, feasibility, potential side - effects, and several studies in the literature pertaining to the usage of pf in wada.10 - 17 the manufacturer of pf is astrazeneca, london, england, united kingdom . The procedure was carried out by a team that included an interventional neurologist, epileptologist, and a neuropsychologist . In each patient, 10 mg bolus of pf was injected into the internal carotid artery (ica) via a catheter inserted through the right femoral artery, except for one patient who received 15 mg bilaterally . Neither continuous infusion nor maintenance doses were given . We began by injecting the right ica first, evaluated the left hemisphere, and then injected the left ica with a 30-minute interval between . Prior to pf injection, the patient was asked to raise the contralateral arm to observe for weakness clinically, and count from one to 10 in numerical order to observe for speech arrest . In addition, patients were under continuous eeg monitoring to observe for any electrographic changes . The eeg demonstrated high amplitude theta and delta slowing of the ipsilateral hemisphere 5 - 18 seconds after the injection of propofol (figure 1). We assessed both hemispheres in the same session with 30-minutes interval between, during which baseline motor, speech, and electrographic activity were restored (figure 2). Electroencephalogram paper speed 30 seconds per epoch, high amplitude theta and delta slowing starts on right hemispheric channels, seen 5 - 18 seconds after injection of propofol . Electroencephalogram (eeg) paper speed 30 seconds per epoch, eeg starts to normalize, see reduction in amplitude of the slowing . The main elements of memory assessed were both recall (verbal and non - verbal) and recognition . The patient was shown 5 familiar objects and was asked if he / she recognizes them or not . During the test, the patient was shown 5 objects and 3 words and was asked to memorize them . The patient was asked to recall these objects and words as soon as the effect of pf wore - off . This study was approved by king fahad medical city (kfmc) institutional review board (irb) in riyadh, kingdom of saudi arabia . All patients had a baseline brain mri, video - eeg recording, and a pre - surgical neuropsychological assessment composed of addenbrooke s cognitive examination - revised (ace - r),5 handedness questionnaire,6 stanford - binet intelligence scale,7 hospital anxiety and depression scale (hads),8 and daily memory questionnaire (currently being tested in another study). These questionnaires were in arabic, given the language barrier, and were tested before being part of the standard neuropsychological evaluation of all patients admitted to the epilepsy monitoring unit (emu) in kfmc, especially if they were candidates for epilepsy surgery . Potentially included patients are those who were diagnosed with tle and were candidates for temporal lobectomy / lobotomy . Age range of the selected population for the procedure was between 18 and 65 years . Patients were excluded if they had history of coagulopathy, carotid dissection, allergy to the contrast or anesthetic agent, elevated serum creatinine, were not fit for surgery (for example, cardiopulmonary risk, major medical problems), or were unable to communicate efficiently during the procedure (for example, deafness). Patients were also excluded from the procedure if their ace - r score were less than 67 or if they were mentally retarded as per stanford - binet intelligence scale . Patient selection was according to the helsinki declaration.9 all patients consented and received a detailed explanation on the nature, risks, and benefits of the procedure . Since sa was not available, pf was chosen as an alternative, based on efficacy, safety profile, feasibility, potential side - effects, and several studies in the literature pertaining to the usage of pf in wada.10 - 17 the manufacturer of pf is astrazeneca, london, england, united kingdom . The procedure was carried out by a team that included an interventional neurologist, epileptologist, and a neuropsychologist . In each patient, 10 mg bolus of pf was injected into the internal carotid artery (ica) via a catheter inserted through the right femoral artery, except for one patient who received 15 mg bilaterally . Neither continuous infusion nor maintenance doses were given . We began by injecting the right ica first, evaluated the left hemisphere, and then injected the left ica with a 30-minute interval between . Prior to pf injection, the patient was asked to raise the contralateral arm to observe for weakness clinically, and count from one to 10 in numerical order to observe for speech arrest . In addition, patients were under continuous eeg monitoring to observe for any electrographic changes . The eeg demonstrated high amplitude theta and delta slowing of the ipsilateral hemisphere 5 - 18 seconds after the injection of propofol (figure 1). We assessed both hemispheres in the same session with 30-minutes interval between, during which baseline motor, speech, and electrographic activity were restored (figure 2). Electroencephalogram paper speed 30 seconds per epoch, high amplitude theta and delta slowing starts on right hemispheric channels, seen 5 - 18 seconds after injection of propofol . Electroencephalogram (eeg) paper speed 30 seconds per epoch, eeg starts to normalize, see reduction in amplitude of the slowing . The main elements of memory assessed were both recall (verbal and non - verbal) and recognition . The patient was shown 5 familiar objects and was asked if he / she recognizes them or not . During the test, the patient was shown 5 objects and 3 words and was asked to memorize them . The patient was asked to recall these objects and words as soon as the effect of pf wore - off . Once pf was injected, we noticed weakness of the contralateral side and aphasia if the involved hemisphere were the dominant one in which the patient stopped counting, could not obey commands, communicate with the neuropsychology team, recognize or memorize objects and words . Both motor and electrographic changes reverted back to baseline within 10 - 12 minutes . Out of 9 patients, with mean (+ sd) age 26 (+ 5.8) years six of the right - handed patients had left tle, and 2 had right tle . All patients had mri findings: 3 patients were found to have left mesial temporal sclerosis (mts), 2 had right mts, and 4 had altered hippocampal morphology . Only one patient was documented to have abnormal cognitive functions (addenbrooke s cognitive examination - revised 77/100) (table 1). We were able to lateralize speech in 8 patients, and memory in 6 patients . All right - handed patients had a left - sided representation of language . However, 2 out of 6 right - handed patients had bilateral representation of memory, while the rest had left - sided representation of memory . From the 3 patients who had right tle, 2 had left - sided representation of language while one had bilateral representation (table 1). In addition, 2 subjects experienced shivering during the procedure, and one subject complained of eye pain and facial pain ipsilateral to the site of the ica injection . The latter developed transient segmental spasm of the ica . This same patient required an additional 10 mg pf due to lack of effect with the first dose . The average blood pressure measured for all patients immediately after the procedure was 116/66 mm hg . All subjects were able to complete the procedure, testing both hemispheres in the same session . Aside from the mentioned adverse events, in addition, 2 subjects experienced shivering during the procedure, and one subject complained of eye pain and facial pain ipsilateral to the site of the ica injection . The latter developed transient segmental spasm of the ica . This same patient required an additional 10 mg pf due to lack of effect with the first dose . The average blood pressure measured for all patients immediately after the procedure was 116/66 mm hg . All subjects were able to complete the procedure, testing both hemispheres in the same session . Aside from the mentioned adverse events, propofol, an alkylphenol, is a lipid soluble anesthetic agent with rapid onset of action (30 seconds), and rapid rate of distribution (2 - 4 minutes).18,19 it is metabolized in the liver and excreted mainly through urine.18,19 propofol was first tried, by bazin et al20 in 1998, and by silva et al21 in 2000 . Both tried it on a single patient and recorded successful results . In terms of side - effects, the former reported perception of intense blue light, while the latter reported a hot sensation in the head . Thereafter, several studies assessed the efficacy and adverse events of pf . With respect to adverse events, we encountered: shivering, facial pain, and eye pain . Mikuni et al12 performed a case - series of 58 patients in which they studied the side - effects of pf in wada test . They classified the side - effects into 3 categories: grade 1 symptoms included pain, shivering, face contortion, lacrimation, laughing, and apathy . Grade 3 symptoms included seizure - like activity described as increased muscle tone with twitching and rhythmic movements or tonic posturing . Grade 1 and 2 symptoms were also seen with sa.12 some of these adverse events were also reported by takayama et al,13 mikati et al,11 and magee et al.22 it has been suggested that post - anesthetic shivering associated with pf, although not fully understood, is due to a thermoregulatory phenomenon associated with hypothermia.23,24 as for facial pain and eye pain, it has been proposed that they occur due to peripheral anastomosis and cross - filling between the internal carotid and external carotid arteries.12 a study10 showed that selective middle cerebral artery (mca) injection of pf was associated with a lower incidence of such side - effects; thus, supporting the anastomosis hypothesis . Although we did not encounter any of the grade 3 symptoms in our study, it has been reported that the frequency of grade 3 symptoms increased in patients older than 55 years, after a second injection of pf greater than 10 mg, and/or a total dose of pf greater than 20 mg.12 one of our subjects failed to elicit a response and developed transient segmental ica spasm . Thereafter, we bypassed the segment of spasm and gave an additional 10 mg of pf, which was successful without any side - effects . Thus, it is probable that vasospasm was secondary to the guide - wire or the catheter (namely, iatrogenic). Mechanically induced vasospasm has been reported in the literature as a complication of angiography, and is mostly self - limited.25,26 interestingly, a patient developed transient euphoria characterized by talkativeness, curiosity, and was asking many questions . However, there was an element of confusion to this picture and he was speaking incoherently rather than combativeness as reported in previous studies.11 - 13,22 it has been reported that iv pf might be associated with euphoria, and it might have an addictive effect.27,28 a possible explanation might be an increase in dopamine concentration in the nucleus accumbens, as seen in drug abusers, promoting drug seeking behavior.18,19 in terms of efficacy, it was not possible to compare pf to sa since it was not available . However, we were able to lateralize speech dominance in 8 patients, and memory dominance in 6 patients (table 1). We also found that the recovery time (both clinically and electrophysiologically) ranged between 10 - 12 minutes . Takayama et al13 were able to lateralize language and memory in 12 and 9 out of 12 patients, as opposed to 52 and 41 out of 55 patients with sa . They also noticed that the recovery time of muscle power, after the injection, was shorter with pf, while time to verbal and non - verbal response was shorter with amobarbital . Thus, they concluded that pf is a useful alternative to amobarbital in wada test . They noticed that the time to verbal and non - verbal responses and time to motor power 3/5 were not significantly different between the 2 groups . Magee et al22 retrospectively reviewed the records of 129 patients who underwent wada test over an interval of 5 years . Interestingly, they did not find a significant difference between pf and amobarbital in regards to length of time to end of hemiplegia, correlated with memory scores, pass / fail rates, and frequency and type of side - effects . It has been reported that left - handedness and left - hemispheric lesions increase the likelihood of bilateral representation of language.29 this patient was indeed left - handed and had bilateral mts . Secobarbital has been shown to be effective and relatively safe in wada test.14 reported side - effects include visual changes and epileptic episodes.14 moreover, there have been some concerns regarding its availability.3 methohexital, a rapid - acting barbiturate, has proven to be a successful alternative to amobarbital in wada test.15 however, methohexital may have potential epileptogenic properties.15 a retrospective chart review study of 760 patients who underwent wada test by either amobarbital or methohexital concluded that patients with a previous history of epilepsy may be at higher risks of developing seizures after methohexital injection.5 pentabarbital, a short acting barbiturate, has shown to be equivalent to amobarbital for language and memory lateralization in wada test . Unfortunately, a patient experienced transient respiratory depression after hyperventilating for 3 minutes.16 etomidate - a rapid - acting, non - barbiturate, hypnotic agent - showed similar efficacy to amobarbital . Its rapid duration of action necessitates an infusion pump, and maintenance doses.3 moreover, it has been reported to cause interictal epileptiform activity.17 in addition, it puts patients at risk of adrenal suppression especially if critically ill.30,31 propofol is a reasonable alternative for sa . Its relatively short duration of action allows us to assess both hemispheres in one session without the need of maintenance doses . Selective mca seems to decrease the incidence of adverse events, but requires a highly skilled neurointerventionalist . Precautions should be taken since propofol may induce seizure - like activity, although not encountered in our study . Transient ica spasm is probably secondary to guide - wire or catheter rather than being caused by pf . But if persistent, wada should be aborted to avoid cerebrovascular compromise . Blood pressure should also be monitored . Precautions should be exercised in patients with a documented history of bipolar disorder or are predisposed to experience such symptoms . Interestingly, left - handedness and left - sided lesions increase the chance of bilateral representation of language, which carries a prognostic value, in terms of outcome of tle surgery . The limitations of our study are small sample size, the fact that it is an observational study, and the lack of a control group . A randomized controlled trial with larger sample size is needed to better assess the efficacy and adverse effects of propofol in comparison to sa . In summary the relatively short duration of action allowed us to examine both hemispheres in the same session . Selective mca may decrease the incidence of these side - effects, but requires a skillful neurointerventionalist . In addition, we noticed 2 additional side - effects that were not mentioned in the previous studies;10 - 13,20 - 22 euphoria and transient ica spasm . Transient ica spasm may be reversible, but if persistent, and severe, wada should be aborted . Loring dw, meador kj, westerveld m. the wada test in the evaluation for epilepsy surgery. |
Ventriculoperitoneal shunt (vps) is a well - established cerebrospinal fluid (csf) diversion procedure in cases of hydrocephalus . There are a lot of complications associated with this procedure and shunt extrusion via different natural orifices is one of them . Transanal and per abdomen shunt extrusion are well documented in literature while shunt extrusion via urinary bladder, vagina, uterus, gall bladder, urethra, and scrotum are sporadically reported in the literature . The distal end of shunt erodes through the wall of hollow viscera, approaches their lumen, and protrudes outside through natural orifices . The distal end of shunt protrusion depends on stiffness of shunt tip, thickness of the wall of hollow viscera, condition of the visceral wall, underlying infection, fixity of viscera, and the operative hand of the surgeon . The incidence of perforation is inversely related to the mobility of gut, and colon is the most frequently perforated viscus due to its immobility . A 10-month - old male child presented with protrusion of shunt tubing from the anus, incidentally noticed by his parents . The patient had a history of excessive cry along with extrusion of shunt tube through anal orifice [figure 1a]. The abdomen was soft, nontender, and bowel sounds were audible on abdominal auscultation . His developmental milestones were delayed, and rests of the neurological examinations were within normal limit . X - ray abdomen erect imaging showed no pneumoperitoneum [figure 1b]. Computed tomography head showed dilated lateral and third ventricles . The patient was taken up for the removal of previous shunt assembly and placement of new one . At the time of distal end removal, lower end of shunt had retracted back into rectum; hence, we planned to remove that via incision at abdominal insertion point . Two incisions were given, one at the cranial end of shunt tubing, and another one at the abdominal insertion site . The shunt was divided at the abdominal insertion point, and cranial part was pulled out from cranial incision while abdominal part was pulled through the abdominal incision . The shunt tube had perforated the appendix and entering through the perforation [figure 2a and b]. An urgent gastrosurgery opinion was taken and urgent laparotomy via extension of same incision was performed by the gastrosurgeon . Postoperative period was uneventful, and patient discharged from hospital after removal of stitches and is under follow - up . (a) protrusion of the lower end of the shunt through anus, (b) a radiograph of a patient showing the course of the lower end of the shunt through a large intestine (a) an intraoperative photograph showing the appendix coming out of the abdominal incision while pulling the lower end of the shunt which was perforating the appendix at the tip (black arrow), (b) the perforated appendix during appendicectomy vps is most commonly used and universally accepted surgical procedure for the management of hydrocephalus in children . A number of complications associated with this procedure are mentioned in literature with abdominal complications accounting for 1030% of all . Bowel perforation by the tip of the catheter and extrusion of the shunt through external orifices is one of them . Although this is a rare complication and have incidence rate of 0.10.7% only . The first case of anal extrusion of distal vps was reported by wilson and bertan in 1966 . The duration between shunt surgery and bowel perforation was found to be minimum in infants and was related with the age of the patient . The interval between shunt insertion to the protrusion of catheter from anus ranges from 2 to 20 months with an average of 6.1 months . In our case, this period was 6 months . Nonenteric visceral perforation has also been sporadically reported in the literature and that includes urinary bladder, urethra, scrotum, vagina, gall bladder, and uterus . Factors associated with perforation of gut are foreign body reaction, stiff tip of shunt, thin bowel wall in pediatric patients, abdominal infections, silicon allergy, use of trocar for insertion of peritoneal end, previous abdominal surgery, and chronic wear and tear produced by tip of the shunt . Many patients do not present with significant abdominal symptoms because the fibrous tract formed at the perforated site usually seals the perforation and prevents spillage of fecal matter into the peritoneum, which would otherwise lead to peritonitis . Hence, the correct diagnosis may be delayed until a very later stage at which gram - negative or anaerobic meningitis, encephalitis or ventriculitis has been fully established, leading to significant morbidity and/or mortality to the patients . Mechanism of shunt extrusion is not well - established but most accepted hypothesis is that after bowel perforation shunt tubing propels outside with sequential peristaltic movement of the gut . In the cases of shunt extrusion through anal opening, most common site of bowel perforation is colon (70%) while in cases of oral extrusion most common site is the stomach . Early diagnosis, adequate clinical, radiological and biochemical evaluation, and prompt treatment are the key to successful treatment . The standard method of treatment is the removal of the extruded shunt system, control of infection, improvement of general condition followed by csf diversion procedure . The different available alternatives are laparotomy with the revision of the peritoneal end of shunt, conventional exploratory laparotomy and repair of bowel perforation, endoscopic localization of enterotomy site and removal of shunt, shunt removal, external diversion of csf and use of antibiotics, and later on replacement of vps when no infection are seen . In uncomplicated cases of shunt extrusion, shunt tubing can be removed via extruding orifice and bowel perforation can be managed conservatively while in complicated cases shunt removal is advised via a laparotomy . Appendicitis after ventriculoperitoneal shunting is a known complication but to best of our knowledge shunt extrusion via appendicular perforation is not documented in literature yet . In such cases, shunt removal via extruding orifice may be quite difficult . Theoretically, there are high possibilities of associated appendicitis which can result in the development of frank peritonitis or appendicular abscess after shunt removal through extruding orifice . So in our opinion, such type of cases whether complicated or not should be placed in special category and shunt removal should be done via laparotomy and followed by prophylactic appendectomy . . Such type of case should be consider in special category in which shunt removal without proper surgical exploration and added appendicectomy may be quite difficult and hazardous for the patient . Optimal management plan in such type of cases either uncomplicated or complicated is laparotomy and removal of the shunt with added appendicectomy. |
Recently, new oral anticoagulants have been approved as alternatives to warfarin for patients with atrial fibrillation . Rivaroxaban is one of the novel anticoagulants, which is an oxazolidinone derivative and inhibits both free factor xa and factor xa bound with the prothrombinase complex . It is a highly selective direct factor xa inhibitor with oral bioavailability and rapid onset of action . There are some advantages of the new agents compared with warfarin including rapid anticoagulation after an oral dose and lack of dietary or drug - drug interaction . However, there are no specific antidotes for the anticoagulant effect of rivaroxaban in the event of a major bleeding, unlike warfarin . We present a case of spontaneous rectus sheath hematoma (rsh) during rivaroxaban therapy for atrial fibrillation in an elderly female patient . A 75-year - old woman presented to the emergency department with the complaints of fatigue and abdominal pain after coughing . The patient had been started on new oral anticoagulant agent rivaroxaban therapy for nonvalvular atrial fibrillation for 3 days . The dose of 20 mg / day rivaroxaban was started because the creatinin clearance of the patient was above 50 ml / min . She had a blood pressure of 70/40 mmhg and an irregular heart rate of 115 beats / min on admission . The patient had no history of any trauma or surgery; she reported that the symptoms started after vigorous coughing . Blood analyses revealed leukocytosis (26.5 k / ul) accompanied by severe anemia (5.4 g / dl). Platelet counts were within normal ranges and her international normalized ratio (inr) was 1.48 . Her abdominal x - ray was normal and the stool occult blood test was negative . After the first treatment, the patient was transferred to the intensive care unit (icu). Repeated abdominal examination in the icu revealed increased tenderness and a palpable mass on the left side of the umbilicus . Noncontrast abdominal computerized tomography scan showed a left - sided rsh, 102 45 mm in size [figure 1]. A specific antidote for rivaroxaban is not available then the patient was treated with fluid resuscitation and packed red blood cells . Computed tomography scan of the abdomen shows a left - sided rectus sheath hematoma (arrow) rivaroxaban is an oral anticoagulant agent that directly inhibits factor xa and interrupts both the intrinsic and extrinsic pathway of the coagulation cascade . Rivaroxaban is currently indicated for use in patients for atrial fibrillation and prophylaxis of deep venous thrombosis . It does not require inr monitoring like warfarin . With the increasing use of the new anticoagulant agents like rivaroxaban in atrial fibrillation, bleeding complications due to these agents there are no specific antidotes for the anticoagulant effect of rivaroxaban and other new oral anticogulants unlike warfarin, thus the management of the bleeding complications include support and observation . Currently, no available specific antidote exists for the management of rivaroxaban - associated bleeding events, but supporting therapy is useful which are likely to be effective for the majority of patients because of the short half - lives of these agents . Recent studies showed that rivaroxaban was noninferior to warfarin for the primary endpoint of stroke and systemic embolism . There was no reduction in rates of mortality or ischemic stroke, but a significant reduction in hemorrhagic stroke and intracranial hemorrhage . The primary safety endpoint was the composite of major and clinically relevant nonmajor bleeding, which was not significantly different between rivaroxaban and warfarin but, with rivaroxaban, there was a significant reduction in fatal bleeding, as well as an increase in gastrointestinal bleeds and bleeds requiring transfusion . The main causes of the rsh include anticoagulant therapy, hematological disorders, trauma, excessive physical exercise, coughing, sneezing, and pregnancy . Especially in elderly patients the risk of rsh may be increased due to the impaired functional status and weakened rectus muscle . Early recognition, rapid assessment and treatment are important to reduce the complications such as hemodynamic instability, abdominal compartment syndrome, multiorgan dysfunction and even death . The treatment of such a hematoma includes transfusion with packed red blood cells and supporting therapy based on regularly monitoring of hemoglobin levels . Rivaroxaban has a mean terminal half - life of 7 - 11 h so in bleeding events supporting therapies are likely to be effective for the majority of patients . Several studies have shown that prothrombin complex concentrate may be useful in reversing the effects of rivaroxaban . Other possible measures include the use of recombinant factor viia to reduce bleeding or the use of activated charcoal to reduce absorption in cases of overdose . Several factors are reported which increase the risk of patients developing hemorrhage while receiving rivaroxaban, these include advanced age, hypertension, history of hepatic / renal disease, previous stroke, coagulopathy, concomitant use of antiplatelet agents and alcohol consumption . Jaeger et al . Have reported a 61-year - old female patient who developed a spontaneous spinal epidural hematoma after being treated by rivaroxaban . Boland et al . Also reported acute onset severe gastrointestinal tract hemorrhage in a postoperative patient taking rivaroxaban after total hip arthroplasty . In our patient, there was no other medication except rivaroxaban that could cause the hematoma . Based on naranjo's scale, a score of 7 showed that the rivaroxaban was the probable cause of the rsh . Several case reports of muscle hematoma due to the antiplatelet and anticoagulant agents have been reported previously, but this is the first reported case of spontaneous rsh due to the rivaroxaban. |
All pcos patients met all three criteria of the revised 2003 rotterdam european society of human reproduction and embryology (eshre)/american society of reproductive medicine (asrm) pcos consensus workshop group diagnostic criteria . The three criteria are 1) oligo- and/or anovulation, 2) clinical and/or biochemical signs of hyperandrogenism, and 3) polycystic ovaries (20). Furthermore, all subjects in the control arm had normal findings on pelvic ultrasound scan, regular periods, and no hirsutism / acne . Exclusion criteria for the study included age> 40 years, known cardiovascular disease, thyroid disease, neoplasms, current smoking, diabetes, hypertension (blood pressure> 140/90 mmhg), and renal impairment (serum creatinine> 120 mol / l). None of these women were on any medications for at least 6 months prior to the study, including oral contraceptives, glucocorticoids, ovulation induction agents, antidiabetic and antiobesity drugs, and estrogenic, antiandrogenic, or antihypertensive medication . Blood pressure was measured in a sitting position within a quiet and calm environment after a rest of at least 5 min . Subjects were outpatients of the department of reproductive medicine and gynaecological endocrinology of magdeburg university and the department of obstetrics and gynaecology of martin - luther - university halle . The metabolic study was performed in the outpatient department of endocrinology and metabolism of magdeburg university . Blood samples were collected between 0800 and 0900 h, after a 3-day normal carbohydrate diet and an overnight fast . Blood samples were drawn into serum separator tubes that contain no additives or anticoagulants, allowed to clot, centrifuged (3,000 rpm for 10 min) to separate sera, and stored at 80c . A treatment with metformin in an off - label use was offered to all pcos women independently from the results of insulin sensitivity testing . In those pcos women that agreed, therapy was initiated after basal assessment, and the dose of metformin was increased to a maintenance dose of 850 mg twice daily . Carotid intima media thickness (imt) was measured in pcos subjects, before and after metformin (see below). A total of 83 women of caucasian origin with pcos were recruited, 49 of which did not participate in the metformin arm of the study . The baseline characteristics of the 49 pcos women were comparable to the 34 pcos women who participated in the metformin arm of the study . Furthermore, the 21 women who completed the metformin arm of the study were comparable to the 13 pcos women who did not complete the metformin arm of the study . For the purposes of elucidating the effects of metformin in pcos women, the study design was approved by the local research ethics committee of the university of magdeburg, and written informed consent was obtained from all participants, in accordance with the guidelines in the declaration of helsinki 2000 . Measurement of carotid imt is a widely accepted tool to provide information about preclinical vascular disease . B - mode sonography of the proximal part of the carotid bulb was conducted on both sides, and the segments of the common carotid arteries 1.0 cm proximal were scanned longitudinally with hitachi eub-5000 plus - g (hitachi ltd ., all women were investigated in a supine position with the head slightly hyperextended and turned away from the side being scanned . The image was focused on the posterior wall, and the resolution function was used to magnify the arterial far wall . When an optimal image was obtained, it was frozen, and the distance from the junction of the lumen and intima and the junction of the media and adventitia was measured by electronic calipers in end - diastolic phase, to minimize variability during the cardiac cycle . Five measurements were conducted on each side, and the mean imt was calculated as the average of these measurements . All measurements were performed by an experienced ultrasound sonographer (intra - observer coefficient of variation was 6.8%) who was blinded to the diagnosis of subjects . Assays for glucose, insulin, cholesterol, triglycerides, luteinizing hormone, follicular stimulating hormone, testosterone, and rostenedione, dehydroepiandrosterone - sulfate, and sex hormone binding globulin were performed using an automated analyzer (abbott architect, abbott laboratories, abbott park, usa). The estimate of insulin resistance by homeostasis model assessment (homa - ir) score was calculated as previously described (21). High - sensitivity c - reactive protein (hs - crp) was determined immunoturbidimetrically using a modular system random - access analyzer (roche diagnostics). Omentin-1 levels in sera were measured using a commercially available elisa kit (axxora, nottingham, u.k . ), according to manufacturer's protocol, with an intra - assay coefficient of variation of <6% . Immunodepletion of serum omentin-1 and crp were performed using the immunoprecipitation protocol provided by dr . One ml of human serum was incubated with mouse - anti - human omentin-1 igg - protein g - sepharose conjugate (12 g/100500 g of total protein) or control mouse igg - protein g - sepharose conjugate; goat - anti - human crp iga - protein a - sepharose conjugate (10 g/100500 g of total protein) or control goat iga - protein a - sepharose conjugate, mixed overnight at 4c and centrifuged to sediment the conjugated sepharose beads . Supernatants and sera were subjected to immunoblotting for omentin-1 as previously described (13). Immunoblotting confirmed that these protocols decreased serum omentin-1 and crp by 80% (data not shown), respectively . Human microvascular endothelial cells (hmec-1) were obtained from the center for disease control, atlanta, usa hmec-1 cells were cultured in mcdb medium (sigma - aldrich, gillingham, u.k .) Supplemented with 10% fetal calf serum (sigma - aldrich, gillingham, u.k . ), 100 iu / ml penicillin (sigma - aldrich, gillingham, u.k . ), 100 g / ml streptomycin (sigma - aldrich), 5 ml of 200 mmol / l l - glutamine/500 ml of media, hydrocortisone 2 mol / l, and epidermal growth factor 2 ng / ml (invitrogen, paisley, u.k .) At 37c in 5% co2/95% air . Prior to each experiment, cells were fed with mcdb with addition of 1% fetal calf serum for 16 h. for endothelial cell signaling experiments, hmecs were preincubated with or without omentin-1 (kamiya biomedical company, seattle, usa) for 30 min followed by treatment with or without 1% of human serum from normal (n = 39; individually tested) and pcos women [before (n = 21; individually tested) and after (n = 21; individually tested) 6 months of metformin treatment] at different time points (0, 2, 5, 10, 20, 30, and 60 min). Dose- and time - dependent experiments were performed to determine the optimum concentration and time point . Angiogenesis was assessed by studying the formation of capillary tubelike structures by culturing hmec-1 cells on growth factor reduced matrigel (bd biosciences, san jose, usa). Hmec-1 cells were preincubated with or without omentin-1 (kamiya biomedical company, seattle, usa) and/or with or without pi3k / akt inhibitor (ly294002) (calbiochem, san diego, usa) for 30 min and 1 h, respectively, followed by treatment with or without 1% of human serum from normal (n = 39; individually tested) and pcos women [before (n = 21; individually tested) and after (n = 21; individually tested) 6 months of metformin treatment] or crp or omentin-1 [pcos after metformin (n = 21; individually tested)] and crp [pcos before metformin (n = 21; individually tested)] immunodepleted sera . Trypsinized hmec-1 cells were then seeded onto the matrigel - coated plates at a density of 45 10/well in fresh media and incubated at 37c . Dose- and time - dependent experiments were performed to determine the optimum concentration and time point . Capillary tube formation images were captured with a digital microscope camera system (olympus, tokyo, japan). Image pro plus software was used to quantify tube length formation; the lengths of tubes in 34 randomly selected fields in each of the wells were measured (2326). Endothelial cell migration assay was performed in a modified boyden chamber using a protocol obtained from bd biocoat angiogenesis system (bd biosciences, san jose, usa). Endothelial cells were trypsinized; a cell suspension of 4 10 cells / ml was prepared, 250 l of which was added to each of the trans - well inserts . Starvation media (750 l) was added to the lower chamber and incubated overnight . After this, the cells were labeled by incubating with hank's balanced salt solution medium (sigma - aldrich, gillingham, u.k .) Containing 4 g / ml calcein - am (bd biosciences, san jose, usa) for 90 min . The cells were preincubated with or without omentin-1 (kamiya biomedical company, seattle, usa) and/or with or without pi3k / akt inhibitor (ly294002) (calbiochem, san diego, usa) for 30 min and 1 h, respectively, followed by treatment with or without 1% of human serum from normal (n = 39; individually tested) and pcos women [before (n = 21; individually tested) and after (n = 21; individually tested) 6 months of metformin treatment] or crp or omentin-1 [pcos after metformin (n = 21; individually tested)] and crp [pcos before metformin (n = 21; individually tested)] immunodepleted sera . Dose- and time - dependent experiments were performed to determine the optimum concentration and time point . Fluorescence of migrated cells was read in a fluorescence plate reader with bottom reading capabilities at excitation / emission wavelengths of 494/517 nm . Only those labeled cells that have migrated through the pores of the membrane will be detected (2326). We studied nf-b activation by stably transfecting hmec-1 cells with a cis - reporter plasmid containing luciferase reporter gene linked to five repeats of nf-b binding sites (pnf-b - luc; stratagene, la jolla, usa). Hmec-1 cells were preincubated with or without omentin-1 (kamiya biomedical company, seattle, usa) for 30 min followed by treatment with or without 1% of human serum from normal (n = 39; individually tested) and pcos women [before (n = 21; individually tested) and after (n = 21; individually tested) 6 months of metformin treatment] or crp or omentin-1 [pcos after metformin (n = 21; individually tested)] and crp [pcos before metformin (n = 21; individually tested)] immunodepleted sera for 2 h. cells were lysed, and luciferase activities were measured . Experiments were also performed with tk plasmid (promega, southampton, u.k .) As negative control and tumor necrosis factor (tnf-) as positive control . Dose- and time - dependent experiments were performed to determine the optimum concentration and time point . Endothelial cells were lysed with sds sample buffer (5 mol / l urea, 0.17 mol / l sds, 0.4 mol / l dithiothreitol, and 50 mmol / l tris - hcl, ph 8.0), mixed, sonicated, boiled, centrifuged (5,000 rpm for 2 min), and then stored at 80c until use . Eighty g of each sample, supernatants, and sera were subjected to sds - page (8% resolving gel) and transferred to polyvinylidene fluoride (pvdf) membranes . Pvdf membranes were blocked in tris - buffered saline containing 0.1% tween-20 and 5% bsa for 2 h. the pvdf membranes were then incubated with polyclonal primary rabbit - anti - human antibody for phospho - erk1/2 (cell signaling technology inc ., beverly, usa) (1:1,000 dilution) or polyclonal primary rabbit - anti - human antibody for phospho - akt (ser473) (cell signaling technology inc ., beverly, usa) (1:1,000 dilution) or monoclonal primary goat - anti - human antibody for crp (sigma - aldrich, gillingham, u.k .) (1:1,000 dilution) overnight at 4c . The membranes were washed thoroughly for 60 min with tris - buffered saline0.1% tween before incubation with the secondary anti - rabbit horseradish peroxidase - conjugated immunoglobulin (dako, ely, u.k .) (1:2,000) or secondary anti - goat horseradish peroxidase - conjugated immunoglobulin (dako, ely, u.k .) (1:2,000) for 1 h at room temperature . Antibody complexes were visualized using chemiluminescence (ecl+; ge healthcare, little chalfont, u.k . ). For standardization, the same membranes were stripped and reprobed using polyclonal primary rabbit - anti - human antibodies for total erk1/2 (cell signaling technology inc . The densities were measured using a scanning densitometer coupled to scanning software scion image (scion corporation, frederick, usa). Standard curves were generated to ensure linearity of signal intensity over the range of protein amounts loaded into gel lanes . Comparisons of densitometric signal intensities for phospho - erk1/2, phospho - akt, total erk1/2, and total akt were made only within this linearity range . Whitney u test or kruskal wallis anova (post hoc analysis: dunn's test) according to the number of groups compared . If individual bivariate correlations achieved statistical significance, multiple regression analysis with omentin-1 as dependent variable was performed to test the joint effect of these parameters on omentin-1 . Measurement of carotid imt is a widely accepted tool to provide information about preclinical vascular disease . B - mode sonography of the proximal part of the carotid bulb was conducted on both sides, and the segments of the common carotid arteries 1.0 cm proximal were scanned longitudinally with hitachi eub-5000 plus - g (hitachi ltd ., all women were investigated in a supine position with the head slightly hyperextended and turned away from the side being scanned . The image was focused on the posterior wall, and the resolution function was used to magnify the arterial far wall . When an optimal image was obtained, it was frozen, and the distance from the junction of the lumen and intima and the junction of the media and adventitia was measured by electronic calipers in end - diastolic phase, to minimize variability during the cardiac cycle . Five measurements were conducted on each side, and the mean imt was calculated as the average of these measurements . All measurements were performed by an experienced ultrasound sonographer (intra - observer coefficient of variation was 6.8%) who was blinded to the diagnosis of subjects . Assays for glucose, insulin, cholesterol, triglycerides, luteinizing hormone, follicular stimulating hormone, testosterone, and rostenedione, dehydroepiandrosterone - sulfate, and sex hormone binding globulin were performed using an automated analyzer (abbott architect, abbott laboratories, abbott park, usa). The estimate of insulin resistance by homeostasis model assessment (homa - ir) score was calculated as previously described (21). High - sensitivity c - reactive protein (hs - crp) was determined immunoturbidimetrically using a modular system random - access analyzer (roche diagnostics). Omentin-1 levels in sera were measured using a commercially available elisa kit (axxora, nottingham, u.k . ), according to manufacturer's protocol, with an intra - assay coefficient of variation of <6% . Immunodepletion of serum omentin-1 and crp were performed using the immunoprecipitation protocol provided by dr . One ml of human serum was incubated with mouse - anti - human omentin-1 igg - protein g - sepharose conjugate (12 g/100500 g of total protein) or control mouse igg - protein g - sepharose conjugate; goat - anti - human crp iga - protein a - sepharose conjugate (10 g/100500 g of total protein) or control goat iga - protein a - sepharose conjugate, mixed overnight at 4c and centrifuged to sediment the conjugated sepharose beads . Supernatants and sera were subjected to immunoblotting for omentin-1 as previously described (13). Immunoblotting confirmed that these protocols decreased serum omentin-1 and crp by 80% (data not shown), respectively . Human microvascular endothelial cells (hmec-1) were obtained from the center for disease control, atlanta, usa hmec-1 cells were cultured in mcdb medium (sigma - aldrich, gillingham, u.k .) Supplemented with 10% fetal calf serum (sigma - aldrich, gillingham, u.k . ), 100 iu / ml penicillin (sigma - aldrich, gillingham, u.k . ), 100 g / ml streptomycin (sigma - aldrich), 5 ml of 200 mmol / l l - glutamine/500 ml of media, hydrocortisone 2 mol / l, and epidermal growth factor 2 ng / ml (invitrogen, paisley, u.k .) At 37c in 5% co2/95% air . Prior to each experiment, cells were fed with mcdb with addition of 1% fetal calf serum for 16 h. for endothelial cell signaling experiments, hmecs were preincubated with or without omentin-1 (kamiya biomedical company, seattle, usa) for 30 min followed by treatment with or without 1% of human serum from normal (n = 39; individually tested) and pcos women [before (n = 21; individually tested) and after (n = 21; individually tested) 6 months of metformin treatment] at different time points (0, 2, 5, 10, 20, 30, and 60 min). Dose- and time - dependent experiments were performed to determine the optimum concentration and time point . Angiogenesis was assessed by studying the formation of capillary tubelike structures by culturing hmec-1 cells on growth factor reduced matrigel (bd biosciences, san jose, usa). Hmec-1 cells were preincubated with or without omentin-1 (kamiya biomedical company, seattle, usa) and/or with or without pi3k / akt inhibitor (ly294002) (calbiochem, san diego, usa) for 30 min and 1 h, respectively, followed by treatment with or without 1% of human serum from normal (n = 39; individually tested) and pcos women [before (n = 21; individually tested) and after (n = 21; individually tested) 6 months of metformin treatment] or crp or omentin-1 [pcos after metformin (n = 21; individually tested)] and crp [pcos before metformin (n = 21; individually tested)] immunodepleted sera . Vascular endothelial growth factor (vegf) served as positive control . Trypsinized hmec-1 cells were then seeded onto the matrigel - coated plates at a density of 45 10/well in fresh media and incubated at 37c . Dose- and time - dependent experiments were performed to determine the optimum concentration and time point . Capillary tube formation images were captured with a digital microscope camera system (olympus, tokyo, japan). Image pro plus software was used to quantify tube length formation; the lengths of tubes in 34 randomly selected fields in each of the wells were measured (2326). Endothelial cell migration assay was performed in a modified boyden chamber using a protocol obtained from bd biocoat angiogenesis system (bd biosciences, san jose, usa). Endothelial cells were trypsinized; a cell suspension of 4 10 cells / ml was prepared, 250 l of which was added to each of the trans - well inserts . Starvation media (750 l) after this, the cells were labeled by incubating with hank's balanced salt solution medium (sigma - aldrich, gillingham, u.k .) Containing 4 g / ml calcein - am (bd biosciences, san jose, usa) for 90 min . The cells were preincubated with or without omentin-1 (kamiya biomedical company, seattle, usa) and/or with or without pi3k / akt inhibitor (ly294002) (calbiochem, san diego, usa) for 30 min and 1 h, respectively, followed by treatment with or without 1% of human serum from normal (n = 39; individually tested) and pcos women [before (n = 21; individually tested) and after (n = 21; individually tested) 6 months of metformin treatment] or crp or omentin-1 [pcos after metformin (n = 21; individually tested)] and crp [pcos before metformin (n = 21; individually tested)] immunodepleted sera . Dose- and time - dependent experiments were performed to determine the optimum concentration and time point . Fluorescence of migrated cells was read in a fluorescence plate reader with bottom reading capabilities at excitation / emission wavelengths of 494/517 nm . Only those labeled cells that have migrated through the pores of the membrane will be detected (2326). We studied nf-b activation by stably transfecting hmec-1 cells with a cis - reporter plasmid containing luciferase reporter gene linked to five repeats of nf-b binding sites (pnf-b - luc; stratagene, la jolla, usa). Hmec-1 cells were preincubated with or without omentin-1 (kamiya biomedical company, seattle, usa) for 30 min followed by treatment with or without 1% of human serum from normal (n = 39; individually tested) and pcos women [before (n = 21; individually tested) and after (n = 21; individually tested) 6 months of metformin treatment] or crp or omentin-1 [pcos after metformin (n = 21; individually tested)] and crp [pcos before metformin (n = 21; individually tested)] immunodepleted sera for 2 h. cells were lysed, and luciferase activities were measured . Experiments were also performed with tk plasmid (promega, southampton, u.k .) As negative control and tumor necrosis factor (tnf-) as positive control . Dose- and time - dependent experiments were performed to determine the optimum concentration and time point . Endothelial cells were lysed with sds sample buffer (5 mol / l urea, 0.17 mol / l sds, 0.4 mol / l dithiothreitol, and 50 mmol / l tris - hcl, ph 8.0), mixed, sonicated, boiled, centrifuged (5,000 rpm for 2 min), and then stored at 80c until use . Eighty g of each sample, supernatants, and sera were subjected to sds - page (8% resolving gel) and transferred to polyvinylidene fluoride (pvdf) membranes . Pvdf membranes were blocked in tris - buffered saline containing 0.1% tween-20 and 5% bsa for 2 h. the pvdf membranes were then incubated with polyclonal primary rabbit - anti - human antibody for phospho - erk1/2 (cell signaling technology inc ., beverly, usa) (1:1,000 dilution) or polyclonal primary rabbit - anti - human antibody for phospho - akt (ser473) (cell signaling technology inc ., beverly, usa) (1:1,000 dilution) or monoclonal primary goat - anti - human antibody for crp (sigma - aldrich, gillingham, u.k .) (1:1,000 dilution) overnight at 4c . The membranes were washed thoroughly for 60 min with tris - buffered saline0.1% tween before incubation with the secondary anti - rabbit horseradish peroxidase - conjugated immunoglobulin (dako, ely, u.k .) (1:2,000) or secondary anti - goat horseradish peroxidase - conjugated immunoglobulin (dako, ely, u.k .) (1:2,000) for 1 h at room temperature . Antibody complexes were visualized using chemiluminescence (ecl+; ge healthcare, little chalfont, u.k . ). For standardization, the same membranes were stripped and reprobed using polyclonal primary rabbit - anti - human antibodies for total erk1/2 (cell signaling technology inc . The densities were measured using a scanning densitometer coupled to scanning software scion image (scion corporation, frederick, usa). Standard curves were generated to ensure linearity of signal intensity over the range of protein amounts loaded into gel lanes . Comparisons of densitometric signal intensities for phospho - erk1/2, phospho - akt, total erk1/2, and total akt were made only within this linearity range . Whitney u test or kruskal wallis anova (post hoc analysis: dunn's test) according to the number of groups compared . If individual bivariate correlations achieved statistical significance, multiple regression analysis with omentin-1 as dependent variable was performed to test the joint effect of these parameters on omentin-1 . Insulin, homa - ir, cholesterol, triglycerides, luteinizing hormone, testosterone, free androgen index, systolic blood pressure, diastolic blood pressure, imt, and hs - crp were significantly higher whereas dehydroepiandrosterone - sulfate and sex hormone binding globulin were significantly lower in pcos women . Clinical, hormonal, and metabolic features of women with pcos and control subjects data are median (interquartile range). Free androgen index (fai) = t (nmol / l)/shbg (nmol / l) 100 . Ns = not significant; lh, luteinizing hormone; fsh, follicular stimulating hormone; dhea - s, dehydroepiandrosterone - sulfate; shbg, sex hormone binding globulin; sbp, systolic blood pressure; dbp, diastolic blood pressure . Serum omentin-1 levels were significantly lower in pcos subjects compared with control subjects [23.7 (20.027.9) versus 27.6 (25.629.4) ng / ml; p <0.05: table 1]. Only 21 women completed the study and were investigated after 6 months of metformin treatment . Reasons for subjects not completing study 2 were nausea and gastrointestinal side effects (n = 4), pregnancies (n = 5), incompliance (n = 2), and loss of contact (n = 2). Clinical, hormonal, and metabolic features of women with pcos (n = 21) before and after metformin treatment data are median (interquartile range). Free androgen index (fai) = t (nmol / l)/shbg (nmol / l) 100 . Ns = not significant; dhea - s, dehydroepiandrosterone - sulfate; shbg, sex hormone binding globulin; sbp, systolic blood pressure; dbp, diastolic blood pressure . After 6 months of metformin treatment, there was a significant increase in serum omentin-1 [23.7 (20.027.9) versus 59.2 (52.160.6) ng / ml; p <0.01: table 2]. Also, there were significant decreases in waist - to - hip ratio (whr), testosterone, glucose, homa - ir, and imt . Spearman rank analyses demonstrated that serum omentin-1 levels were significantly negatively correlated with bmi, whr, glucose, homa - ir, and hs - crp (p <0.05). However, when subjected to multiple regression analysis, none of these variables were significantly negatively correlated with serum omentin-1 levels (p> 0.05). Furthermore, we analyzed the correlation between the change in serum omentin-1 levels before and after metformin therapy (omentin-1) and the changes () in other covariates (table 3). We found that omentin-1 was significantly negatively associated with whr, glucose, homa - ir, and hs - crp . When subjected to multiple regression analysis, only hs - crp was significantly negatively correlated with omentin-1 (= 0.526; p = 0.036). Linear regression analysis of variables associated with changes in serum omentin-1 levels (before and after metformin treatment), omentin-1, in pcos subjects (n = 21) spearman rank correlation was used for calculation of associations between variables . If individual bivariate correlations achieved statistical significance, multiple regression analysis with omentin-1 as dependent variable was performed to test the joint effect of these parameters on omentin-1 . Multiple regression analysis contained whr, glucose, homa - ir, and hs - crp . Dhea - s, dehydroepiandrosterone - sulfate; shbg, sex hormone binding globulin; fai, free androgen index; sbp, systolic blood pressure; dbp, diastolic blood pressure . Given the above, we studied the effects of omentin-1 on in vitro migration and angiogenesis . Capillary tube formation was optimal at 24 h, after which capillary tubes begin to disintegrate . In vitro migration and angiogenesis at 24 h was significantly increased when comparing sera of pcos women to normal control subjects (figs . 1 and 2; p <0.01). Also, in vitro migration and angiogenesis were significantly decreased in pcos women after 6 months of metformin treatment (figs . 1 and 2; * * p <0.01) and when omentin-1 (200 ng / ml) or the pi3k / akt inhibitor (ly294002; 10 mol / l) were added to sera (figs . 1 and 2; * p <0.05, * * p <0.01). Furthermore, crp (1ug / ml) and vegf (10 ng / ml) induced in vitro migration, and angiogenesis was significantly decreased by omentin-1 (figs . 1 and 2; * p <0.05). In vitro tube formation by human serum at 24 h from normal control subjects (n = 39) with or without omentin-1 (200 ng / ml), pcos women (n = 21) with or without omentin-1 (200 ng / ml) or pi3k / akt inhibitor (ly294002; 10 mol / l) or crp immunodepletion (crp_ip), pcos women after 6 months of metformin treatment (n = 21) with or without omentin-1 immunodepletion (omentin-1_ip), crp (1ug / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), and vegf (10 ng / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), respectively . Data are expressed as% difference of median of normal control subjects [medians (interquartile range)]. Wallis anova (post hoc analysis: dunn's test) and mann whitney u test, respectively . P <0.05, p <0.01; * p <0.05, * * p <0.01 . Endothelial cell migration by human serum at 24 h from normal control subjects (n = 39) with or without omentin-1 (200 ng / ml), pcos women (n = 21) with or without omentin-1 (200 ng / ml) or pi3k / akt inhibitor (ly294002; 10 mol / l) or crp immunodepletion (crp_ip), pcos women after 6 months of metformin treatment (n = 21) with or without omentin-1 immunodepletion (omentin-1_ip), crp (1ug / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), and vegf (10 ng / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), respectively . Data are expressed as% difference of median of normal control subjects [medians (interquartile range)]. Wallis anova (post hoc analysis: dunn's test) and mann - whitney u test, respectively . P <0.05, p <0.01; * p <0.05, * * p <0.01 . Moreover, in vitro migration and angiogenesis were significantly decreased in crp (pcos before metformin) but not significantly altered by omentin-1 (pcos after metformin) immunodepleted sera (figs . 1 and 2; nf-b was significantly activated by sera from normal and pcos women compared with control subjects (fig . Nf-b was significantly activated by sera from pcos women compared with normal women (fig . 3; * * also, nf-b activation was significantly decreased in pcos women after 6 months of metformin treatment (fig . 3; * * p <0.01) and when omentin-1 (200 ng / ml) was added to sera (fig . 3; furthermore, crp (1 ug / ml) and tnf- (10 ng / ml) induced nf-b activation was significantly decreased by omentin-1 (fig . * p <0.05). Effects of serum from normal control subjects (n = 39) with or without omentin-1 (200 ng / ml), pcos women (n = 21) with or without omentin-1 (200 ng / ml) or crp immunodepletion (crp_ip), pcos women after 6 months of metformin treatment (n = 21) with or without omentin-1 immunodepletion (omentin-1_ip), crp (1ug / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), and tnf- (10 ng / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), respectively, on nf-b activation in hmec-1 cells stably transfected with pnf-b - luciferase at 2 h. cells were lysed, and luciferase activities (rlu) were measured . Data are expressed as% difference of median of basal [medians (interquartile range)]. Wallis anova (post hoc analysis: dunn's test) and mann whitney u test, respectively . P <0.05, p <0.01; * p <0.05, * * p <0.01 . Moreover, nf-b activation was significantly decreased in crp (pcos before metformin) but not significantly altered by omentin-1 (pcos after metformin) immunodepleted sera (fig . 3; p> 0.05, * p <0.05). In hmec-1 cells, erk1/2 and akt pathways were significantly activated by sera from normal and pcos women compared with control subjects (fig . Erk1/2 and akt phosphorylation were significantly increased by sera from pcos women compared with normal women (fig . Also, erk1/2 and akt activation were significantly decreased in pcos women after 6 months of metformin treatment (fig . 4a and b; * p <0.05, * * p <0.01). Furthermore, akt activation was significantly decreased when omentin-1 (200 ng / ml) was added to sera from pcos women before metformin treatment (fig . 4a). The detected proteins for phosphorylated erk1/2, total erk1/2, phosphorylated akt, and total akthad apparent molecular weights of 44/42, 44/42, 60, and 60 kda, effects of serum from normal control subjects (n = 39), pcos women (n = 21), and pcos women after 6 months of metformin treatment with or without addition of omentin-1 (200 ng / ml) (n = 21) on erk1/2 and akt phosphorylation in hmec-1 cells at 2 and 5 min, respectively . Data are expressed as% difference of median of basal [medians (interquartile range)]. Wallis anova (post hoc analysis: dunn's test) and mann whitney u test, respectively . P <0.05, p <0.01; * p <0.05, * * p <0.01 . Spearman rank analyses demonstrated that serum omentin-1 levels were significantly negatively correlated with bmi, whr, glucose, homa - ir, and hs - crp (p <0.05). However, when subjected to multiple regression analysis, none of these variables were significantly negatively correlated with serum omentin-1 levels (p> 0.05). Furthermore, we analyzed the correlation between the change in serum omentin-1 levels before and after metformin therapy (omentin-1) and the changes () in other covariates (table 3). We found that omentin-1 was significantly negatively associated with whr, glucose, homa - ir, and hs - crp . When subjected to multiple regression analysis, only hs - crp was significantly negatively correlated with omentin-1 (= 0.526; p = 0.036). Linear regression analysis of variables associated with changes in serum omentin-1 levels (before and after metformin treatment), omentin-1, in pcos subjects (n = 21) spearman rank correlation was used for calculation of associations between variables . If individual bivariate correlations achieved statistical significance, multiple regression analysis with omentin-1 as dependent variable was performed to test the joint effect of these parameters on omentin-1 . Multiple regression analysis contained whr, glucose, homa - ir, and hs - crp . Dhea - s, dehydroepiandrosterone - sulfate; shbg, sex hormone binding globulin; fai, free androgen index; sbp, systolic blood pressure; dbp, diastolic blood pressure . Given the above, we studied the effects of omentin-1 on in vitro migration and angiogenesis . Capillary tube formation was optimal at 24 h, after which capillary tubes begin to disintegrate . In vitro migration and angiogenesis at 24 h was significantly increased when comparing sera of pcos women to normal control subjects (figs . 1 and 2; p <0.01). Also, in vitro migration and angiogenesis were significantly decreased in pcos women after 6 months of metformin treatment (figs . 1 and 2; * * p <0.01) and when omentin-1 (200 ng / ml) or the pi3k / akt inhibitor (ly294002; 10 mol / l) were added to sera (figs . 1 and 2; * p <0.05, * * p <0.01). Furthermore, crp (1ug / ml) and vegf (10 ng / ml) induced in vitro migration, and angiogenesis was significantly decreased by omentin-1 (figs . 1 and 2; * p <0.05). In vitro tube formation by human serum at 24 h from normal control subjects (n = 39) with or without omentin-1 (200 ng / ml), pcos women (n = 21) with or without omentin-1 (200 ng / ml) or pi3k / akt inhibitor (ly294002; 10 mol / l) or crp immunodepletion (crp_ip), pcos women after 6 months of metformin treatment (n = 21) with or without omentin-1 immunodepletion (omentin-1_ip), crp (1ug / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), and vegf (10 ng / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), respectively . Data are expressed as% difference of median of normal control subjects [medians (interquartile range)]. Wallis anova (post hoc analysis: dunn's test) and mann whitney u test, respectively . P <0.05, p <0.01; * p <0.05, * * p <0.01 . Endothelial cell migration by human serum at 24 h from normal control subjects (n = 39) with or without omentin-1 (200 ng / ml), pcos women (n = 21) with or without omentin-1 (200 ng / ml) or pi3k / akt inhibitor (ly294002; 10 mol / l) or crp immunodepletion (crp_ip), pcos women after 6 months of metformin treatment (n = 21) with or without omentin-1 immunodepletion (omentin-1_ip), crp (1ug / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), and vegf (10 ng / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), respectively . Data are expressed as% difference of median of normal control subjects [medians (interquartile range)]. Wallis anova (post hoc analysis: dunn's test) and mann - whitney u test, respectively . P <0.05, p <0.01; * p <0.05, * * p <0.01 . Moreover, in vitro migration and angiogenesis were significantly decreased in crp (pcos before metformin) but not significantly altered by omentin-1 (pcos after metformin) immunodepleted sera (figs . 1 and 2; p> 0.05, * p <0.05). In hmec-1 cells, nf-b was significantly activated by sera from normal and pcos women compared with control subjects (fig . Nf-b was significantly activated by sera from pcos women compared with normal women (fig . 3; * * also, nf-b activation was significantly decreased in pcos women after 6 months of metformin treatment (fig . 3; * * p <0.01) and when omentin-1 (200 ng / ml) was added to sera (fig . 3; * p <0.05). Furthermore, crp (1 ug / ml) and tnf- (10 ng / ml) induced nf-b activation was significantly decreased by omentin-1 (fig effects of serum from normal control subjects (n = 39) with or without omentin-1 (200 ng / ml), pcos women (n = 21) with or without omentin-1 (200 ng / ml) or crp immunodepletion (crp_ip), pcos women after 6 months of metformin treatment (n = 21) with or without omentin-1 immunodepletion (omentin-1_ip), crp (1ug / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), and tnf- (10 ng / ml) with or without addition of omentin-1 (200 ng / ml) (n = 6), respectively, on nf-b activation in hmec-1 cells stably transfected with pnf-b - luciferase at 2 h. cells were lysed, and luciferase activities (rlu) were measured . Data are expressed as% difference of median of basal [medians (interquartile range)]. Wallis anova (post hoc analysis: dunn's test) and mann whitney u test, respectively . P <0.05, p <0.01; * p <0.05, * * p <0.01 . Moreover, nf-b activation was significantly decreased in crp (pcos before metformin) but not significantly altered by omentin-1 (pcos after metformin) immunodepleted sera (fig . In hmec-1 cells, erk1/2 and akt pathways were significantly activated by sera from normal and pcos women compared with control subjects (fig . Erk1/2 and akt phosphorylation were significantly increased by sera from pcos women compared with normal women (fig . Also, erk1/2 and akt activation were significantly decreased in pcos women after 6 months of metformin treatment (fig . 4a and b; * p <0.05, * * p <0.01). Furthermore, akt activation was significantly decreased when omentin-1 (200 ng / ml) was added to sera from pcos women before metformin treatment (fig . 4a). The detected proteins for phosphorylated erk1/2, total erk1/2, phosphorylated akt, and total akthad apparent molecular weights of 44/42, 44/42, 60, and 60 kda, effects of serum from normal control subjects (n = 39), pcos women (n = 21), and pcos women after 6 months of metformin treatment with or without addition of omentin-1 (200 ng / ml) (n = 21) on erk1/2 and akt phosphorylation in hmec-1 cells at 2 and 5 min, respectively . Data are expressed as% difference of median of basal [medians (interquartile range)]. Wallis anova (post hoc analysis: dunn's test) and mann whitney u test, respectively . P <0.05, p <0.01; * p <0.05, * * p <0.01 . Also, serum omentin-1 levels were significantly negatively correlated with bmi, whr, glucose, homa - ir, and hs - crp . We report that metformin (6 months treatment; 850 mg twice daily) significantly increases serum omentin-1 levels with concomitant decreases in insulin resistance and carotid imt in pcos subjects . Although the change in serum omentin-1 levels were significantly negatively associated with changes in whr, glucose, homa - ir, and hs - crp, only the change of hs - crp was significantly negatively correlated with the change of serum omentin-1 levels when subjected to multiple regression analysis . The possible implication is that changes in omentin-1 levels associated with metformin treatment observed in our pcos subjects are more robustly linked to changes in inflammatory rather than metabolic parameters . Of relevance, there is evidence that inflammatory markers other than crp are elevated in pcos subjects (35); also, studies have indicated metformin's potential anti - inflammatory effects via modulation of tnf-, il-6, il-18, and il-1- levels (2729). In pcos women, metformin corrects the associated endocrine and metabolic abnormalities (30); metformin counters ir by inhibiting hepatic glucose production (3133). Therefore, glucose may regulate circulating omentin-1 levels; however, it is possible that the effect of metformin on omentin-1 levels could be via modulation of other circulating factors . We, like others (34), observed a significant decrease in testosterone levels after metformin treatment . However, treatments of omental adipose tissue explants with gonadal and adrenal steroids revealed no meaningful effects on omentin-1 levels (13). It is therefore unlikely that the effects of metformin on serum omentin-1 levels observed in this study are attributable to altered gonadal and adrenal steroids . Furthermore, functional assays revealed that in vitro migration and angiogenesis were significantly increased by sera from both normal and pcos women; in pcos women, in vitro migration and angiogenesis was attenuated after 6 months of metformin treatment . Addition of omentin-1 to sera from pcos women before metformin treatment significantly decreased in vitro migration and angiogenesis . Omentin-1 also decreased the effects of crp and vegf induced in vitro migration and angiogenesis . However, in vitro migration and angiogenesis were significantly decreased in crp but not significantly altered by omentin-1 immunodepleted sera . It is important to consider that omentin-1 levels in tissues are unknown; the levels are likely to be significantly higher than in sera as sequestration of omentin-1 in vascular tissue, in particular, within stromal - vascular cells, has been shown (10,35). All of these effects appear to be associated with nf-b and akt signaling pathways, both well - established mediators of angiogenesis (3638). Taken together, increases in omentin-1 levels may play a role but are not sufficient to explain the decreased inflammatory and angiogenic effects of sera from metformin - treated pcos women . It is important to bear in mind that metformin may also modulate angiogenesis via the vegf system . Of relevance the link between angiogenesis and the pathogenesis of atherosclerosis has been well described (17). Given our data of an increase in circulating omentin-1 levels with concomitant decrease in imt, omentin-1 may have a potential role in the pathogenesis of atherosclerosis . Omentin-1, by promoting activation of the akt signaling pathway and in turn modulating the endothelial nitric oxide synthase in endothelial cells, may impact upon endothelial dysfunction, a step that is crucial in the pathogenesis of atherosclerosis (40,41). Our novel data of omentin-1 on angiogenesis in relation to the akt signaling pathway thus clarifies omentin-1's potentially important role in the pathogenesis of cardiovascular disorders . A limitation of our study may relate to the lack of a lean pcos comparator group . Only 3 of the 21 pcos subjects and 6 of the 39 control subjects had bmi <25 kg / m; thus, no meaningful result could be obtained . Furthermore, given ethical constraints, that is, blood samples could and were only obtained at baseline and after 6 months of metformin treatment, it is therefore difficult to be certain as to whether changes in serum omentin-1 levels precede or follow changes in clinical and hormonal indexes as a consequence of metformin treatment . Also, as diet and lifestyle modifications were only subjectively assessed, the changes in serum omentin-1 levels may be partially attributable to diet and lifestyle modifications . Further studies are needed to elucidate this point . Additionally, like others (42), we used whr, a universally accepted, simple, and cost - effective measure of adiposity as a surrogate marker for central fat mass . However, cascella et al . Has reported that whr does not distinguish between visceral and subcutaneous fat mass in pcos women (43). Therefore, more accurate and equally cost - effective methods of assessing central obesity are needed . Finally, given that pcos is a proinflammatory state associated with clustering of cardiovascular risk factors, it would be of importance to study the effect of metformin therapy in the context of omentin-1 biology on reactive oxygen species in pcos women, as reactive oxygen species not only induces tissue damage and inflammation but also is increased in dysmetabolic states including pcos (44). In conclusion, we provide evidence that increases in omentin-1 levels may play a role but are not sufficient to explain the decreased inflammatory and angiogenic effects of sera from metformin - treated pcos women . Our findings provide novel insights into the relationship between obesity, insulin resistance, and metformin therapy with dysregulated angiogenesis in pcos women in the context of omentin-1 biology. |
The term neuroendocrine reflects the origin of endocrine cells from the embryonic neural crest . Neuroendocrine cells are characterized by their ability to produce and secrete different peptides and neuroamines . They aggregate in classical endocrine glands (e.g. Hypothalamus and the pituitary gland) or in the diffuse neuroendocrine system distributed throughout the body, such as the gastrointestinal tract and lungs . Gastroenteropancreatic neuroendocrine neoplasms (gep - nens) are a heterogeneous group of neoplasms defined as malignant transformation of neuroendocrine cells in the diffuse neuroendocrine system that regulates secretion, absorption and motility of the gastrointestinal tract . The incidence of gep - nens continues to exhibit a persistent increase; the most recent epidemiological study from the us surveillance shows that the overall incidence of gep - nens increased from 1 to 3.65 cases per 100,000 . A genetic etiology of gep - nens has been well documented in around 5 - 10% of cases as part of hereditary syndromes such as multiple endocrine neoplasia type 1, von hippel - lindau syndrome, neurofibromatosis 1 or tuberous sclerosis syndrome . These tumors commonly present with a wide spectrum of clinical manifestations according to site of origin and biological behavior . They can present with abdominal pain, weight loss, obstructive jaundice and intestinal obstruction . Moreover, the symptoms related to hormone secretion include flushing, diarrhea, wheezing, hypoglycemia, cardiovascular and peptic ulcers disease . The diagnosis is based on histological features, including tumor differentiation and grade, in addition to immunohistochemical stains for general endocrine markers, including chromogranins, synaptophysin and neuron - specific enolase . Tumor markers such as chromogranin a, pancreatic polypeptide, serum neuron - specific enolase and subunit of glycoprotein hormones have been used . It is useful for staging, prognosis and follow - up, since the serum concentration correlates with the tumor mass . In the presence of symptoms or syndrome suspicious of functional nens, biochemical testing for peptide hypersecretion should be ordered, e.g. Gastrin level for patients with zollinger - ellison syndrome or insulin for hypoglycemic syndromes . Imaging studies are an important tool in nen workup; abdominal ultrasound, computed tomography and magnetic resonance imaging have a high sensitivity and specificity in detecting many types of primary nens . Functional imaging such as in - pentetreotide (octreoscan) or i - metaiodobenzylguanidine (mibg) plays a critical role in the diagnosis and in establishing the eligibility for therapy . Combining functional imaging with computed tomography or magnetic resonance imaging is superior for staging and detection of primary tumors of undetermined location . Gep - nens can be classified according to the site of embryologic origin (foregut, midgut and hindgut), grade, differentiation or the hormones produced . The grade refers to the biological aggressiveness of the neoplasm which is defined by the number of mitoses per 10 high - power microscopic fields or per 2 mm (mitotic rate), or as the percentage of tumor cells that immunolabel for the ki-67 antigen (ki-67 index). While the differentiation refers to the extent to which the neoplastic cells resemble their non - neoplastic counterparts, in 2010, the world health organization proposed the most widely accepted classification: (1) neuroendocrine tumor grade 1 (g1), (2) neuroendocrine tumor grade 2 (g2), (3) neuroendocrine carcinoma (nec), grade 3 (g3), and (4) mixed adenoneuroendocrine carcinoma . Also, nens are divided into well - differentiated and poorly differentiated (table 1). In general, gep - nens are staged according to the primary tumor (t), lymph node involvement (n) and distant metastases (m) tnm system, similar to other types of carcinomas . Medical therapy of inoperable or metastasized nens includes multimodality options such as long - acting somatostatin analogs, -interferon, systemic chemotherapy and ablation therapy . There is no established regimen due to heterogeneity of the studies, including various grades, sites and inconsistent response criteria . Novel therapies like mammalian target of rapamycin (mtor), tyrosine kinase and angiogenesis inhibitors have showing promising results in clinical trials . We herein report a case of esophageal large - cell necs and review the published literature on this rare disease . A 66-year - old saudi female housewife with a background of diabetes, hypertension and hypothyroidism was seen initially by a gastroenterologist . She was suffering from progressive difficulty in swallowing, mainly of solid food, with a feeling of food stuck in the middle of her chest for more than 6 months . She denied any painful swallowing, oral thrush, chocking attacks, food impaction or nasal regurgitation . She denied any abdominal pain, distension, rectal bleeding or change in bowel habits . She had lost about 3 kg from a baseline weight of 68 kg despite normal appetite . Her history was unremarkable for esophageal disease, tuberculosis contact, neck swelling or radiation exposure . The patient underwent esophagogastroduodenoscopy (egd) which revealed a small esophageal nodule in an otherwise normal esophagus (fig . 1a), and nodule biopsy was consistent with papilloma . Despite of the prescription of a proton pump inhibitor (esomeprazole), her symptoms worsen so that she was referred to our institution in december 2014 for further evaluation and endoscopic ultrasound . Upon evaluation she was well, not pale or jaundiced, her weight was 64.8 kg and her body mass index was 26.6 . The abdomen was soft and non - tender, and no mass or lymph node was observed . Her complete blood count showed white blood cell 16.9 10/l, hemoglobin 11.8 g / dl and platelets 306 10/l . C - reactive protein was <3.5 mg / l and chest x - ray was normal . Repeat egd and endoscopic ultrasound examination revealed an ulcerated esophageal mass 4 cm in diameter 23 - 27 cm from the incisor line (fig . It was shown as a hypoechoic mass at the level of the third submucosal layer with no local lymph node or vascular infiltration (fig . A computed tomography scan showed an eccentric 3.2 2.0 cm mass in the lower esophagus, inseparable from the esophageal wall . Positron emission tomography / computed tomography revealed a hypermetabolic esophageal tumor with left cervical lymph node and midsacrum and right acetabulum metastasis (fig . Histopathological examination of the deep biopsies concluded that the mass was a nec of the large - cell type in view of irregular strands of large polygonal cells with an intermediate amount of pale oncophilic cytoplasm . The nuclei had occasional molding of salt and paper chromatin and visible nucleoli with extensive nuclear crushing artifact and immunohistochemical evidence of neuroendocrine differentiation . The patient was therefore staged as metastatic high - grade large - cell neuroendocrine tumor of the esophagus . Chemotherapy was initiated by the oncologist and she received three cycles of cisplatin 90 mg / m in divided doses over 3 days and etoposide 100 mg / m per day on days 1 - 3 of each treatment cycle . Large - cell nec of the esophagus is exceedingly rare; few cases have been reported in the literature . The incidence of esophageal nens ranges between 0.05 and 2.4% in most of the recent studies . The literature clearly shows that nens in this anatomical location occur more frequently in males in the sixth and seventh decades of life, with a male: female ratio of 4:1 . Similar to other esophageal tumors, patients usually present with vague symptoms, including constitutional symptoms, weight loss, chest pain or pressure and odynophagia . By far dysphagia is the most common presenting symptom and carcinoid symptoms are rare . From endoscopic findings, esophageal nens this is because neuroendocrine cells are mainly distributed in mucosal glands of the distal esophagus . Among the categories of nens, nec is a poorly differentiated, high - grade malignant neoplasm composed of small or large cells, sometimes with organoid features resembling well - differentiated neuroendocrine tumors, diffusely expressing the general markers of neuroendocrine differentiation (diffuse expression of synaptophysin, faint or focal staining for chromogranin a), with marked nuclear atypia, multifocal necrosis and a high number of mitoses (> 20 per 10 high - power fields); high grade (g3) is defined according to proliferation fraction and histology (table 1). Large - cell tumors all consist of cells with solid nests or acinar structures, a low nuclear / cytoplasm ratio, often abundant cytoplasm, many mitoses, focal areas of necrosis, vesicular chromatin and visible nucleoli . For practical purposes, esophageal necs can be staged according to the tnm / staging classification for esophageal carcinomas . In contrast to other gastrointestinal sites, there is no proposed tnm / staging classification for necs of the esophagus . However, proliferative activity, assessed by mitotic count or ki-67 immunostaining, was described as a significant prognostic factor in a previous study . There have been a few randomized, prospective and controlled therapeutic trials published thus far . Unfortunately, in those trials several tumor entities (e.g. Tumors arising from the stomach, pancreas and colon) were all included . Moreover, there are not specific recommendations, given that doses and schedules were different in the various studies . High - grade necs of the esophagus are rare tumors exhibiting an overall aggressive behavior, and their prognosis is dismal . The majority are locally advanced or metastatic at presentation and are rarely associated with secretory hormonal syndromes . Treatment regimens are extrapolated from more robust data published on pulmonary high - grade necs. |
Toxoplasma gondii is an obligate intracellular parasite that infects a variety of mammals and birds, causing toxoplasmosis . T. gondii is an important foodborne parasite that is primarily transmitted from animals to humans through the consumption of infected meat . In some countries, pork is the most common meat consumed, and several ethnic groups consume raw pork . Toxoplasmosis is a source of significant economic loss for swine farmers because of gross lesions in infected animals, which result in the carcass being condemned at the time of slaughter, the expense associated with treatment, and weight loss associated with clinical toxoplasmosis . The development of effective diagnostic reagents or vaccines is very important for worldwide public health and economic repercussions of t. gondii infection . The life cycle of t. gondii is relatively complex, and its antigenic component can change in specificity or makeup during different development stages; therefore, the newly synthesized multiepitope antigen is one of the most promising antigens for the development of effective diagnostic reagents or vaccines [4 - 9]. However, the study of epitope - based vaccines and diagnostic reagents is highly dependent on the accurate identification of b - cell epitopes and t - cell epitopes . Therefore, the identification of protein epitopes will be very important for diagnostic purposes and for the development of peptide vaccines [10 - 12]. Among dense granule antigens (gras), gra6 was also demonstrated to be useful for designing novel and alternative diagnostic methods for toxoplasmosis or vaccines [13 - 17]. The gra6 gene does not contain any introns and is a single copy in the genome of t. gondii . Gra6 localized in the dense granules and in the parasitophorous vacuole closely associated to the network . A total of 51 t. gondii - positive sera samples previously collected from pigs (n=32) experimentally infected with the gansu jingtai strain (isolated from a pig with acute toxoplasmosis) in our laboratory were evaluated in this study . The experimental protocol was approved by the ethical committee of the lanzhou veterinary research institute, chinese academy of agricultural sciences, china . Twelve pig serum samples were collected at the time of presentation of clinical symptoms (g1), 18 follow - up samples were collected on days 14 to 35 after the onset of symptoms (g2), and 21 samples were collected on days 60 to 120 after the onset of symptoms (g3). The presence of toxoplasma igm and igg antibodies was determined by t. gondii lysate antigen - elisa . T. gondii dna was obtained from gansu jingtai strain tachyzoites using the universal genomic dna extraction kit (takara biotechnology co., ltd, dalian, china), and the gra6 sequence was amplified using the primers 5-gcgaattcatggcacacggtggcatct-3 and 5-atgcggccgcttaaaaatcaaactcattc-3 . The pcr amplification was performed using the takara taqtm kit according to the manufacturer s instructions . The sample was subjected to an initial denaturation (94c for 5 min), 35 cycles of denaturation (94c for 1 min), annealing (60c for 30 sec) and elongation (72c for 1 min), and a final extension at 72c for 10 min . The pcr - generated fragment was purified and cloned into the pmd-18 t vector (takara biotechnology). The recombinant plasmid was used to transform escherichia coli jm 109 competent cells, and the recombinant cells were selected on lb plates with ampicillin (100 mg / l), x - gal (5-bromo-4-chloro-3-indolyl--d - galactopyranoside; 70 mg / l), and iptg (isopropyl -d - thiogalactopyranoside; 80 m) at 37c for 24 hr (ampicillin, x - gal and iptg were from takara biotechnology). Positive colonies were inoculated into lb liquid medium containing ampicillin (100 mg / l) and incubated at 37c for 16 hr . The positive colonies identified by pcr were sequenced by takara biotechnology . To analyze the gra6 b cell epitopes, the deduced amino acid sequence of gra6 was analyzed using the protean subroutine in the dnastar software package . This subroutine uses the garnier - robson and chou - fasman algorithms for predicting the alpha, beta, and turn regions, the garnier - robson algorithm for predicting the coil regions, the kyte - doolittle algorithm for predicting hydrophilicity, the karplus - schultz algorithm for predicting flexibility, the emini algorithm for predicting surface probability, and the jameson - wolf algorithm for predicting antigenicity . Based on this analysis, the peptides with good hydrophilicity, high accessibility, high flexibility, and strong antigenicity were selected as the antigen epitopes . Enzyme - linked immunoassays specific for each peptide were performed as described by cardona et al . With minor modifications . The microplates were coated with 100 l (10 g / ml) of each peptide diluted in carbonate buffer, ph 9.6 (na2co3: 0.159 g/100 ml; nahco3: 0.293 g/100 ml). The plates were incubated for 1 hr at 37c, then for 48 hr at 4c, and 1 hr at 37c . Non - specific ligand sites were blocked with 100 l 2% casein phosphate buffer for 1 hr at 37c . The plates were washed and incubated with 100 l serum diluted to 1:100 in 5% casein phosphate buffer for 1 hr at 40c . After washing, 100 l rabbit anti - pig peroxidase - conjugated igg (sigma) diluted to 1:4,000 in 6% casein phosphate buffer was added for 20 min at 37c . After the washes, the horseradish peroxidase activity was detected using tmb for 30 min at 37c and stopped with a 5% h2so4 solution . A positive cut - off point was determined by estimating the mean average absorbance of 10 negative controls plus 2 sds . To determine the specificity of the anti - peptide antibody, elisa using irrelevant peptides from the bl21 of the orf virus previously synthesized by our laboratory (sequence: vdvqskdkdadelre) was also performed as described above . As controls, elisa using excretory / secretory antigen (esa) and recombinant gra6 from the rh strain of t. gondii previously expressed by our laboratory briefly, non - specific ligand sites were blocked with 100 l 5% bsa phosphate buffer . The rabbit anti - pig peroxidase - conjugated igg diluted 1:8,000 in pbs was used as the secondary antibody . A total of 51 t. gondii - positive sera samples previously collected from pigs (n=32) experimentally infected with the gansu jingtai strain (isolated from a pig with acute toxoplasmosis) in our laboratory were evaluated in this study . The experimental protocol was approved by the ethical committee of the lanzhou veterinary research institute, chinese academy of agricultural sciences, china . Twelve pig serum samples were collected at the time of presentation of clinical symptoms (g1), 18 follow - up samples were collected on days 14 to 35 after the onset of symptoms (g2), and 21 samples were collected on days 60 to 120 after the onset of symptoms (g3). The presence of toxoplasma igm and igg antibodies was determined by t. gondii lysate antigen - elisa . T. gondii dna was obtained from gansu jingtai strain tachyzoites using the universal genomic dna extraction kit (takara biotechnology co., ltd, dalian, china), and the gra6 sequence was amplified using the primers 5-gcgaattcatggcacacggtggcatct-3 and 5-atgcggccgcttaaaaatcaaactcattc-3 . The pcr amplification was performed using the takara taqtm kit according to the manufacturer s instructions . The sample was subjected to an initial denaturation (94c for 5 min), 35 cycles of denaturation (94c for 1 min), annealing (60c for 30 sec) and elongation (72c for 1 min), and a final extension at 72c for 10 min . The pcr - generated fragment was purified and cloned into the pmd-18 t vector (takara biotechnology). The recombinant plasmid was used to transform escherichia coli jm 109 competent cells, and the recombinant cells were selected on lb plates with ampicillin (100 mg / l), x - gal (5-bromo-4-chloro-3-indolyl--d - galactopyranoside; 70 mg / l), and iptg (isopropyl -d - thiogalactopyranoside; 80 m) at 37c for 24 hr (ampicillin, x - gal and iptg were from takara biotechnology). Positive colonies were inoculated into lb liquid medium containing ampicillin (100 mg / l) and incubated at 37c for 16 hr . To analyze the gra6 b cell epitopes, the deduced amino acid sequence of gra6 was analyzed using the protean subroutine in the dnastar software package . This subroutine uses the garnier - robson and chou - fasman algorithms for predicting the alpha, beta, and turn regions, the garnier - robson algorithm for predicting the coil regions, the kyte - doolittle algorithm for predicting hydrophilicity, the karplus - schultz algorithm for predicting flexibility, the emini algorithm for predicting surface probability, and the jameson - wolf algorithm for predicting antigenicity . Based on this analysis, the peptides with good hydrophilicity, high accessibility, high flexibility, and strong antigenicity were selected as the antigen epitopes . Enzyme - linked immunoassays specific for each peptide were performed as described by cardona et al . With minor modifications . The microplates were coated with 100 l (10 g / ml) of each peptide diluted in carbonate buffer, ph 9.6 (na2co3: 0.159 g/100 ml; nahco3: 0.293 g/100 ml). The plates were incubated for 1 hr at 37c, then for 48 hr at 4c, and 1 hr at 37c . Non - specific ligand sites were blocked with 100 l 2% casein phosphate buffer for 1 hr at 37c . The plates were washed and incubated with 100 l serum diluted to 1:100 in 5% casein phosphate buffer for 1 hr at 40c . After washing, 100 l rabbit anti - pig peroxidase - conjugated igg (sigma) diluted to 1:4,000 in 6% casein phosphate buffer was added for 20 min at 37c . After the washes, the horseradish peroxidase activity was detected using tmb for 30 min at 37c and stopped with a 5% h2so4 solution . A positive cut - off point was determined by estimating the mean average absorbance of 10 negative controls plus 2 sds . To determine the specificity of the anti - peptide antibody, elisa using irrelevant peptides from the bl21 of the orf virus previously synthesized by our laboratory (sequence: vdvqskdkdadelre) was also performed as described above . As controls, elisa using excretory / secretory antigen (esa) and recombinant gra6 from the rh strain of t. gondii previously expressed by our laboratory briefly, non - specific ligand sites were blocked with 100 l 5% bsa phosphate buffer . The rabbit anti - pig peroxidase - conjugated igg diluted 1:8,000 in pbs was used as the secondary antibody . The secondary structure of gra6 was predicted by the garnier - robson and chou - fasman algorithms based on the sequence of the gra6 gene . A flexibility plot, hydrophilicity plot, surface probability plot, and antigenic index for gra6 were obtained using the karplus - schulz, kyte - doolittle, emini, and jameson - wolf algorithms, respectively (fig . 1). Based on the results obtained with these methods, potential b cell epitopes on gra6 were predicted, including 1 - 20 aa, 44 - 63 aa, 54 - 73 aa, 64 - 83 aa, 74 - 93 aa, 84 - 103 aa, 172 - 191 aa, 182 - 201 aa, 192 - 211 aa, and 202 - 221 aa . All of the 10 predicted epitope peptides were evaluated by elisa using pig sera from various time points after infection . The results of elisa for 3 peptides, p2, p10, and p11, are shown in fig . No significant differences were found between the mean absorbances of the 3 groups (g1, g2, and g3) as determined by anova . Furthermore, no significant differences were found between the mean absorbances of the 3 peptides, p2, p7, and p9 . The other 7 peptides were recognized by selection of sera from various time points after infection (fig . The number of positive samples / tested for each peptide was as follows: p1:8/51, p3:25/51, p4:18/51, p5:9/51, p6:27/51, p8:20/51, and p10:31/51 . To determine the specificity of the anti - peptide antibody, elisa using an irrelevant peptide 4a). To compare the serological reactivity of the peptides with esa and recombinant gra6, elisa using esa and recombinant gra6 the adoption of immunoinformatics methods for the prediction of antigenic epitopes has become an indispensable tool for epitope localization . In addition, such techniques are economical and effective and can substantially reduce experimental costs . Bioinformatics has been widely used in the analysis of protein epitopes [10 - 12]. In the present study, the secondary structure of gra6 was predicted by the garnier - robson and chou - fasman algorithms based on the sequence of the gra6 gene . A flexibility plot, hydrophilicity plot, surface probability plot, and antigenic index for gra6 were obtained using the karplus - schulz, kyte - doolittle, emini, and jameson - wolf algorithms, respectively . The existence of flexible regions, such as coil and turn region, provides powerful evidence for epitope identification . In the past, several experimental techniques were developed for mapping antibody interacting residues on an antigen, including the identification of interacting residues from the structure of antibody - antigen complexes . Many researchers have applied this technique to study epitopes [6,10 - 12,26,29]. Using this technique and bioinformatics tools, we found that many regions of gra6, particularly the regions represented by peptides p2, p7, and p9, are involved in the pig antibody response, and strong reactivity with the t. gondii - infected pig sera was observed . The reactivity of these epitopes does not seem to be dependent upon the time of infection . The identification of b cell epitopes is important for understanding antigenic structure and parasite - antibody interactions at the molecular level and may assist in the design of vaccines and diagnostic reagents . Conformational epitope selection relies on the determination of the tertiary structure of an antigen to identify residues that interact with antibodies . The experimental techniques required to determine the tertiary structure of the antigen, such as crystallography, are expensive and time - consuming, and the mapping of conformational epitopes has been severely hampered . The majority of methods and databases have focused on the identification of linear epitopes . In the present study, linear epitopes were analyzed using synthetic peptide techniques and bioinformatics tools, and 3 of the 10 predicted epitope peptides were confirmed by synthetic peptide techniques . The use of a molecular biology method in combination with a bioinformatics method is a useful method to screen for linear epitopes . We have precisely located the epitopes of t. gondii gra6 using pig sera collected at different time points after infection . The identification of specific epitopes targeted by the host antibody response is important both for understanding the natural response to infection and for the development of epitope - based vaccines and diagnostic methods . There are more linear and conformational b cell epitopes than previously predicted; therefore, the number of identified epitopes should also increase with further studies. |
Spontaneous splenic rupture occurs usually secondary to abdominal trauma, most often in a spleen affected by infection or haematological malignancy . Spontaneous splenic rupture is extremely rare, especially presenting in a patient subsequently diagnosed with splenic marginal cell lymphoma (smzl), which itself is rare and as a result only one case has been described in the literature so far . We report a case of a 71-year - old woman with a past medical history of inflammatory myelitis, osteoporosis, asthma, coeliac disease and chronic back pain who was admitted as an emergency with new onset and severe back and abdominal pain . She described a 5-day history of persistent bilateral back pain radiating to the shoulder tips and groin worse when lying flat . She attended the emergency department 3 days before with a similar complaint but discharged home the same day . The inflammatory markers were following: crp 88 and white cell count 12.3; biochemistry and clotting screen was normal . Laparotomy was performed and a large splenic haematoma with 1 l of blood in the abdomen and a splenectomy was performed . The postoperative period was complicated by a lower respiratory tract infection and some difficulty with mobilization but the patient made good recovery otherwise . During the post - operative period she developed a hypoglossal nerve palsy, which was assessed by the neurologist . Figure 1ct chest / abdomen demonstrating a large splenic haematoma with hyper- and hypo - dense areas . Ct chest / abdomen demonstrating a large splenic haematoma with hyper- and hypo - dense areas . High attenuation fluid is present within the pelvis consistent with blood . The excised spleen weighed 560 g with blood clots and was macroscopically normal . Microscopically (figs 24), the histology and immunohistochemistry was consistent with a diagnosis of smzl . Subsequently, a bone marrow biopsy and staging ct were performed and no distant spread of disease was demonstrated . Cd79a highlights the presence of marginal expansion of the white pulp lymphoid mantle with satellitosis (nodular infiltrates) in the red pulp . The monomorphic population of medium - sized lymphoid cells also stained positive for cd20, bcl2, igm and igg consistent with smzl . Figure 4marginal expansion of the white pulp lymphoid mantle with satellitosis in the red pulp . Cd79a highlights the presence of marginal expansion of the white pulp lymphoid mantle with satellitosis (nodular infiltrates) in the red pulp . The monomorphic population of medium - sized lymphoid cells also stained positive for cd20, bcl2, igm and igg consistent with smzl . The term spontaneous rupture is poorly defined in the literature and distinguished from pathological rupture of the spleen . Dating back to 1958 peskin and orloff described true spontaneous rupture in cases where there is no trauma pre- or intraoperativly, the spleen is not affected by any disease, no perisplenic adhesions present indicating previous splenic trauma and on gross and histological examination of the spleen must be normal . However, in the current literature, spontaneous splenic rupture describes a splenic rupture occurring without trauma whether the spleen is involved in pathology or not . First, in haematological malignancies, the splenic parenchyma gets congested with blast cells causing increased intrasplenic tension, which exceeds the capacity of the non - distensible splenic capsule and eventually results in rupture . Secondly, vascular occlusion secondary to reticular endothelial hyperplasia results in thrombosis and infarction, which may distort the splenic architecture making it weaker and thirdly deranged coagulation, which may be part of a systemic disease or caused by thrombocytopenia secondary to massive splenomegaly . Splenic rupture is a life - threatening event and a differential diagnosis in a patient presenting with acute abdomen, although not all cases present with abdominal pain . Haemodynamic instability and kehr's sign, defined as left hypochondriac pain radiating to the left shoulder, occurs in 20% of cases although neither signs are sensitive nor specific . Ultrasound scanning, which is usually readily available in emergency departments, is often a choice of initial imaging and is 7278% sensitive and 91100% specific . Treatment of splenic rupture depends on the site and size of rupture, whether the patient is haemodynamically stable and the underlying pathology causing the rupture . In haemodynamically stable patients it is becoming more common to treat patients by splenic artery embolization, whilst unstable patients require surgical management [5, 6]. Splenic marginal zone lymphoma is classified under the non - hodgkin's lymphomas (nhl) and account for <1% of these . Marginal cell lymphomas are indolent small b - cell lymphomas, which originate from the marginal zone of the lymphoid follicle, which consists of a germinal centre surrounded by a corona that is divided into the marginal zone and the mantle zone . The world health organization classifies the marginal zone - derived lymphomas into splenic (smzl), lymph node (nodal marginal zone lymphoma) and extra - nodal mucosa - associated lymphoid tissue (malt lymphoma) despite having a common origin in the marginal zone of the b - follicle as they have distinct clinical and molecular characteristics [2, 7]. Smzl usually presents as massive splenomegaly and/or with abnormalities in the full blood count, especially anaemia and thrombocytopaenia usually secondary to splenic sequestration rather than bone marrow infiltration [5, 7]. Retrospective analysis of blood results dating back a number of years, revealed no abnormalities in the full blood count; therefore, it appears that splenic rupture was the first presentation in this case and she is in remission at present after undergoing splenectomy as no distant disease was found . The treatment of smzl is not standardized and there are no reported prospective studies comparing outcome with immunotherapy, chemotherapy or splenectomy . In the past splenectomy was regarded as a choice of treatment until rituximab was introduced, which has shown responses of up to 100% . This trial concludes that splenectomy should not be regarded as first - line treatment but considered in patients who do not respond to immunotherapy or chemtotherapy . Patients with splenomegaly may suffer abdominal discomfort, early satiety and cytopaenias where splenectomy is indicated for palliative purposes [7, 8]. As this lady presented with spontaneous splenic rupture, it raises the question that when and if splenectomy should be performed prophylactically if picked up on a scan or whether surveillance is indicated but at present the literature does not address this question but ultimately comes down to assessing each individual case taking into account their overall health and stage of disease. |
Self - esteem is an important state of mind which allows individuals to accept themselves as they are and be self - confident . Rosenberg (1965) considered self - esteem as the positive or negative attitude of an individual toward himself . If an individual has a positive attitude in self - assessment, his self - esteem would be high; if he has a negative attitude, then his self - esteem would be low . Self - esteem is a psychological phenomenon that has a definite effect on the emotional and cognitive dimensions of an individual . The individuals with a high self - esteem tend to perceive themselves worth being respected and approved, important and beneficial . On the other hand, the individuals who have a negative idea about themselves or who have low self - esteem tend to perceive themselves as not very important, lacking lovability, and with no comfort in themselves and their capabilities . High self - esteem is considered important because it is associated with higher levels of psychological health and functioning and low level of self - esteem is undesirable because it is associated with lower levels of psychological health and functioning . One of the major reasons for researchers interest on self - esteem is its effects on health . Damaged self - esteem makes it impossible to endure the harsh conditions of everyday life and produces adverse physical and psychological outcomes . Therefore, there is always the risk of appearance of mental disease in the postpartum period . The postpartum depression is a disorder of non - psychosis depression according to the study of hendrick et al . As per the american psychiatric association [diagnostic and statistical manual of mental disorder - iv (dsm - iv)], brown et al . Reported that about 50% of women are affected by depression at the first 3 months after delivery, whereas one - third of them are affected by depression after 3 months of delivery . Although several factors influence depression, the psychosocial factors play a strong role in prediction of this disorder . Self - esteem is one of the variables that affects deleteriously on the pregnancy outcomes and postpartum period . 's study showed that self - esteem may be a useful predictor of disorders such as anxiety and depression . Depression and self - esteem tend to be highly correlated with each other . It has been accepted that depressed people think in a negative manner and report lower self - esteem than non - depressed people . The robustness of the effect also strengthens the potential importance of self - esteem interventions, said sowislo . She believes that treatments aimed at reducing depression by way of improving self - esteem could provide not only short - term gains for clients but also long - term protection from depression for those most at risk . It was found that individuals who have effective and positive social problem - solving approach have a high self - esteem . The individuals with high self - esteem generally have more confidence in their initial approaches to the problems and, therefore, they seek less information before offering solutions and making decisions . Problem - solving approach is a cognitive behavioral process . By means of problem - solving skills, people can identify and recommend the effective strategies to face stressful situations in everyday life . Social problem solving can be viewed as an important conformity mechanism that serves to increase behavioral competence and it leads to decrease in psychological distress . Dzurilla suggested that self - esteem may play an important role in the relationship between self - appraised social problem - solving ability and psychological adjustment . Also, mccabe et al . Found that social problem solving was predicted by self - esteem and depressive symptoms . In aylward's study, self - esteem emerged as the most important predictor of social problem - solving model . Some evidence was found to link the relationship between self - esteem and problem - solving skills . In the study of mahmoudi rad entitled the role of social problem solving and communication skills training on enhancing self - esteem level and its relationship to mental functioning and academic achievement of students, it was found that self - esteem scores of the two groups showed significant difference before and after intervention . The researchers stated that the findings suggest a direct effect and positive role of training of communication skills and social problem - solving abilities when a person faces social and personal problems . The study of abuhamzeh entitled the effect of problem solving training on increasing the self - esteem of students in school showed that training of problem solving significantly increases overall, academic, social, and family self - esteem in the intervention group than in the control group . This effect remains for up to 2months after the education . In the study of sharifi, it was found that problem - solving training positively affected the self - esteem of students with behavior problems . Based on studies, we can conclude that with higher problem - solving skills and social problem solving, we can increase a person's self - esteem and decrease the depressive symptoms . Several studies showed that low self - esteem is associated with increased anxiety and depression . Rees conducted an exploratory study of the effectiveness of guided imagery protocol with relaxation on reducing anxiety and depression and increasing self - esteem in primiparas during the first postpartum month . Not only relaxation and imagery decrease stress, pain, and anxiety, but also they generate a more positive understanding and a more strong feeling about well - being . With relaxation, the person can attach importance to herself and she can perceive everything that she needs . This develops self - appraised process which is the first important step toward self - esteem . Although there is little evidence about the effect of relaxation on self - esteem, its positive effect is somewhat proved . The relaxation training is simple technique and easy to practice at home; it can increase the self - esteem and decrease psychological problems . Relaxation and problem - solving training are behavioural cognitive interventions that help to decrease depressive symptoms and increase self - esteem; also, the self - esteem of depressed women is low during postpartum period . Hence, a study should be performed for determining the more effective and simpler technique . This study was done with the aim of comparing the effects of problem - solving skills training and relaxation on the self - esteem of women in postpartum period . This was a clinical trial with a control group in 39 weeks in postpartum period and was conducted after getting permission from the ethics committee of mashhad university of medical science . All women on days 1520 after delivery who referred to mashhad health centers from december 2009 to june 2010 participated in the study after completing the consent form . The inclusion criteria were: literate women, 1835 years old, with the term neonate, singleton, healthy infant, the history of lack of chronic medical illness, without history of previous depression, and no smoking . At first, edinburgh postnatal depression scale (epds) was completed by the subjects . Women whose get score 10 or above, completed beck depression inventory (bdi). Those who obtained a score of 1428 and confirmed to be depressed by a clinical interview conducted by a psychologist (based on dsm - iv criteria) in the health centers were divided into three groups randomly: problem - solving training (n = 26), relaxation (n = 26), and control group (n = 28) [figure 1]. Eysenck self - esteem scale which has seven items and a score of 140 was completed by the women at the onset of research . Interventions in the two groups of problem solving and relaxation were performed by a researcher (midwife). The researcher had been taught by a clinical psychologist and after gaining the skills, she received a certificate of performance of relaxation and problem solving skills . A pilot study had been done on depressed women in ebne - sina hospital in mashhad before conducting the main study . Chart of sampling process intervention was performed in the problem - solving group, which consisted of six sessions weekly in the healthy centers . The researcher notified the appointment by telephone to the research units before the intervention . In the problem - solving group, at the first session which lasted 1 h, the participants were trained in five skills of problem solving (general orientation, problem definition and formulation, generation of alternatives, decision making, and verification). In the next sessions which lasted 4550 min, depressive symptoms of women were studied according to the beck inventory; different solutions were presented by women and the best solution was selected for performing until the next session . The recording checklist of problem - solving sessions was completed by the researcher in each session . In the relaxation group, the first two sessions of relaxation were performed in the health center, and each session lasted about half an hour; the other sessions took 1020 min . In the first session of relaxation training, the causes of postpartum depression and the ways of controlling it were discussed and the relaxation purposes were explained . Also, women were trained about how to contract and relax their 16 groups of muscles similar to jacobson's method, and the practice was demonstrated by the researcher . Then the practice was repeated once in the presence of a researcher by a training mother . In the second session, progressive muscle relaxation technique was performed once again by a mother in the presence of the researcher and after correction and ensuring the accuracy of the technique, the cd of progressive muscle relaxation was given to the women to perform the exercise daily at home . In the next four sessions, in addition to the exercises of relaxation performed at home, the imagery techniques (forest visualization, beach, pilgrimage sits, and green space with good climate) were performed by the researcher . The relaxation exercise was performed by the women at home for about 20 min daily . The form of recording the exercises performed at home was given to women and it was emphasized to bring it along with them in each session . At the beginning of each session, the positive and negative experiences of women were considered and they asked about how they could perform relaxation techniques . The control group recoursed to health center weekly and they bring the recording checklistof postpartum depressive symptoms with themselves and routine care after delivery is performed for them according to the booklet of safe mother . Nine weeks after delivery, each of the three groups completed the eysenck self - esteem scale again as a post - test . In this research, the instruments of data collection included the edinburgh depression scale, beck depression inventory - ii, eysenck self - esteem scale, the socio - demographic questionnaire, recorded checklist of depressive symptoms, and recorded checklist of problem - solving sessions . The edinburgh scale is a standard instrument for screening depressive women in the postpartum period . This instrument assesses the feeling of women in the past 7 days and it has 10 items and each item has a score of 03 . It assesses the feeling of women in the past 1 week and its answers are scored between 0 and 3 . Eysenck self - esteem scale has 7 items and each item has a score of 020 . The first two sections included 20 questions about personal characteristics, pregnancy, and recent childbirth, which were completed before implementing interventions and its two questions were completed on referring to patients files . The third section included four questions that collected information on the availability of someone to help at home, sleeplessness difficulties, and breastfeeding, and it was completed 9 weeks after delivery . The validity of beck depression test was confirmed by mohammad khani in tehran, and in this study, the alpha coefficient was 0.827 . The data obtained in this study were analyzed using descriptive statistics, analysis of one - way variance, chi - square test, and spearman correlation coefficient by spss software . Intervention was performed in the problem - solving group, which consisted of six sessions weekly in the healthy centers . The researcher notified the appointment by telephone to the research units before the intervention . In the problem - solving group, at the first session which lasted 1 h, the participants were trained in five skills of problem solving (general orientation, problem definition and formulation, generation of alternatives, decision making, and verification). In the next sessions which lasted 4550 min, depressive symptoms of women were studied according to the beck inventory; different solutions were presented by women and the best solution was selected for performing until the next session . The recording checklist of problem - solving sessions was completed by the researcher in each session . In the relaxation group, the first two sessions of relaxation were performed in the health center, and each session lasted about half an hour; the other sessions took 1020 min . In the first session of relaxation training, the causes of postpartum depression and the ways of controlling it were discussed and the relaxation purposes were explained . Also, women were trained about how to contract and relax their 16 groups of muscles similar to jacobson's method, and the practice was demonstrated by the researcher . Then the practice was repeated once in the presence of a researcher by a training mother . In the second session, progressive muscle relaxation technique was performed once again by a mother in the presence of the researcher and after correction and ensuring the accuracy of the technique, the cd of progressive muscle relaxation was given to the women to perform the exercise daily at home . In the next four sessions, in addition to the exercises of relaxation performed at home, the imagery techniques (forest visualization, beach, pilgrimage sits, and green space with good climate) were performed by the researcher . The relaxation exercise was performed by the women at home for about 20 min daily . The form of recording the exercises performed at home was given to women and it was emphasized to bring it along with them in each session . At the beginning of each session, the positive and negative experiences of women were considered and they asked about how they could perform relaxation techniques . The control group recoursed to health center weekly and they bring the recording checklistof postpartum depressive symptoms with themselves and routine care after delivery is performed for them according to the booklet of safe mother . Nine weeks after delivery, each of the three groups completed the eysenck self - esteem scale again as a post - test . In this research, the instruments of data collection included the edinburgh depression scale, beck depression inventory - ii, eysenck self - esteem scale, the socio - demographic questionnaire, recorded checklist of depressive symptoms, and recorded checklist of problem - solving sessions . The edinburgh scale is a standard instrument for screening depressive women in the postpartum period . This instrument assesses the feeling of women in the past 7 days and it has 10 items and each item has a score of 03 . It assesses the feeling of women in the past 1 week and its answers are scored between 0 and 3 . Eysenck self - esteem scale has 7 items and each item has a score of 020 . The first two sections included 20 questions about personal characteristics, pregnancy, and recent childbirth, which were completed before implementing interventions and its two questions were completed on referring to patients files . The third section included four questions that collected information on the availability of someone to help at home, sleeplessness difficulties, and breastfeeding, and it was completed 9 weeks after delivery . The validity of beck depression test was confirmed by mohammad khani in tehran, and in this study, the alpha coefficient was 0.827 . The data obtained in this study were analyzed using descriptive statistics, analysis of one - way variance, chi - square test, and spearman correlation coefficient by spss software . Each of the three groups showed no significant statistical differences regarding their age (p = 0.680), husband support (p = 1.000), satisfaction in marital life (question by likert scale) (p = 0.506), unwanted pregnancy (p = 0.392), neonate sex (p = 0.253), social support (cassidy social support scale) (p = 0.078), self - esteem (p = 0.145), and the score of edinburgh depression scale (p = 0.258) [table 1]. In this study, 53.8% women had high, 42.5% had moderate, and 3.8% had low self - esteem . Descriptive characteristics of problem - solving training, relaxation, and control groups before intervention the mean of self - esteem score was 103.7 21.6 before intervention in the problem - solving group that increased to 117.9 9.7 after the intervention . Also, in the relaxation group, the mean of self - esteem score was 112.1 16.7 before the intervention, which increased to 117.0 11.8 after the intervention . In the control group, the mean of self - esteem score was 111.8 13.1 in the beginning of the study and it changed to 113.5 10.4 at the end of the study . By means of self - esteem scale, the self - esteem levels in each group were obtained . In our study, the self - esteem of relaxation group was moderate (42.3%) and high (57.7%) before the intervention and reached a moderate level in 23.1% and a high level in 76.9% of the cases after the intervention . Results showed relaxation can increase moderate self - esteem to high self - esteem . In the present study, the self - esteem score was low in 11.5%, moderate in 34.6%, and high in 53.8% of the problem - solving group before the intervention, which became moderate in 15.4% and high in 84.6% of the cases after the intervention . In the ninth week after delivery at which the intervention of relaxation and problem - solving training groups was completed, the statistical results of one - way variance analysis showed that the three groups had no significant differences at the end of study (p = 0.288). But according to the mean difference of self - esteem score before and after the intervention (by one - way anova test), it was found that there was significant difference among the three groups [table 2]. The tukey test showed that the two groups of relaxation and problem solving had significant difference (p = 0.018). Also, the intervention groups had significant difference compared to the control group (p = 0.000) [table 3]. Comparison of mean difference of self - esteem scores in three groups before and after intervention comparison of three groups based on tukey test generally, the three groups showed a significant difference regarding the mean difference of self - esteem score . In this study, both the interventions of relaxation and problem solving could increase the self - esteem score, while the control group showed no increase in self - esteem score . These findings indicate that both types of training (problem solving and relaxation) can produce a positive change in the overall self - esteem and improve the behavioral problems of women later in the postpartum period . Findings and the methods used in the study of ress are similar to those of our study . Unfortunately, no other study has been found that examined the effect of relaxation on self - esteem . Aylward et al . Found that self - esteem is the most important predictor of social problem - solving model and high self - esteem plays a major role in the relationship between problem - solving ability and psychological balance . The study of abuhamzeh showed that training of problem solving significantly increases the overall self - esteem in the intervention group than in the control group . Although abuhamzeh worked on healthy students, the method of performing problem - solving skills is similar to our study . Also, sharifi showed that problem - solving training could increase the self - esteem in students with behavioral problems . The present study showed similar results, but sharifi performed problem solving in 9 weeks, each session lasting 90 min, and we performed six sessions of 4560 min duration each . In addition, although the type of instrument used to evaluate self - esteem and the sex (male and female) and number of individuals were different in this study compared to our study, the results of both studies showed the effectiveness of this type of training in increasing the self - esteem score . We observed that the training of problem - solving skills increases the self - esteem score of depressed women more than relaxation training in the postpartum period . Although problem solving had more effect on self - esteem, the relaxation method is simple and easily practiced at home . Relaxation is accepted by most people and no need to haunt or many facilities . While in problem - solving method, an average of 214 min per patient visit with a psychiatrist or a general practitioner is required, and thus is time consuming . However, no study is found that compared the effect of relaxation and problem solving on self - esteem . Although relaxation technique is simpler than the procedure of problem solving, the constitution of the classes and meetings for women can increase the self - esteem of subjects because women reach better understanding of the problem and solve it, while the relaxation technique was performed at home in a shorter time (20 min vs. 45 min sessions). In addition to the above studies, the study of stephens in southern connecticut state university shows problem - solving training can boost the self - esteem of the participants . In this study, self - esteem scores were measured by a scale rating 21 questions before and 3 months after intervention . The average of self - esteem score increased after the intervention (from 1.76 before intervention to 3.53 after intervention). The results of study showed that this type of training can increase the self - esteem scores in men, as well as in special occasions such as domestic violence and mental health problems such as postpartum depression . Overall, the findings of the present study confirm that relaxation training and problem solving are successful as they can have an effect on a person's self - concept and increase his / her self - esteem . Also, women with postpartum depression often use dysfunctional problem - solving styles in stressful situations . The styles and techniques of treatment that are representative of the style of problem solving including cognitive behavioral therapy are fit and advantageous for the treatment of psychiatric and behavioral problems and can help women suffering from postpartum depression . Because of the importance of self - esteem during pregnancy and postpartum period, it is recommended that these two types of training programs are performed in pregnancy and the postpartum period with longer follow - up period . Since the midwife as a primary carer in the postpartum period could play a role in the prevention and promotion of self - esteem in women with depression, it is recommended to consider and apply both types of training programs in health centers by trained midwives . One of the study limitations was the time limit for performing this research in the pregnancy period . Also, this study was not practical as a double - blind method; the researcher herself was responsible for training the women . In addition, the relaxation technique was performed at home on a daily basis and so careful control by the researcher was not possible . So, we attempted to ensure that these techniques were performed on a daily basis only with repeated phone calls and by encouraging women, as well as by providing educational cds . Also, it was not possible to use from clinical interview by psychiatrist due to high costs during two stages (before and after the intervention); therefore, such as similar studies, only depression was measured using a standard questionnaire . The strengths of this study is performance in three groups randomly and at various health centers . Due to the lack of bias in the results consideration of postpartum depression using two questionnaires in the first step and confirmation by the clinical psychologist in the next phase of the study is another strong point . Based on the results of this study and the relationship of self - esteem with depression and the major role of problem - solving skills in improving the self - esteem score, we suggest that this simple technique is performed in the health centers by midwives for increasing the self - esteem and decreasing the depressive symptoms, and thus improving the mental health . Also, relaxation was effective in increasing self - esteem . Therefore, relaxation is proposed as an auxiliary or replacement method along with other methods in increasing the self - esteem. |
Neuromyelitis optica (nmo) or devic's disease is a rare inflammatory, demyelinating disease of the central nervous system (cns) that predominantly targets the optic nerves and spinal cord 1 . The disease was first described in 1870 by albutt and 24 years later, devic described the clinical characteristics of nmo the discovery of a specific nmo immunoglobulin (nmoigg) opened a new era in the classification and understanding of the pathogenesis of nmo 3 . Nmoigg binds to aquaporin4, which is the main channel that regulates water homeostasis in the cns . Diagnostic criteria for nmo with aquaporin4 antibodies (aqp4ab) requires at least one core clinical characteristic, a positive test for aqp4ab using best available detection method (cellbased assay recommended) and exclusion of alternative diagnoses 1 . The core clinical characteristics are, for example, optic neuritis, acute myelitis, acute brainstem syndrome, symptomatic narcolepsy, or symptomatic cerebral syndrome with typical nmo brain lesions 1 . Neuromyelitis optica must be distinguished from other demyelinating diseases, for example, multiple sclerosis . The presence of aqp4ab differentiates nmo from multiple sclerosis (ms) with high specificity 4 . In contrast to typical ms, the clinical events in nmo are usually more severe 5, 6 . Cerebrospinal fluid (csf) findings in nmo are also known to differ significantly from those in classical ms . Csfrestricted oligoclonal igg bands are absent in most nmo patients . However, pleocytosis is usually mild, and frequently includes neutrophils, eosinophils, activated lymphocytes, and/or plasma cells 6, 7 . Studies carried out in europe, south east and southern asia, the caribbean and cuba suggest that the incidence and prevalence of nmo ranges from 0.050.4 to 0.524.4 per 100,000, respectively 9 . The disease is mainly sporadic, although a few familial cases have been reported 10 . We describe a case of an unusual and severe course of nmo affecting almost the entire spinal cord and brain . Examination on the day of admission revealed normal results as regards ecg, troponin i, and computed tomography (ct) of the chest and abdomen . The next day, the patient reported headache and neurological examination showed rightsided hemiparesis and afferent pupillary defect of the left eye suggesting an afferent optic nerve defect . Within a few hours, the patient showed a rapid neurological deterioration with progressive tetraplegia and global decline . Mri of the spinal cord showed myelitis in the spinal cord segments c2 to th5 (fig . Csf examination revealed polymorphonuclear pleocytosis (leukocytes 1210 10/l, neutrophils 95%) and an increased total protein concentration (2273 mg / l). Due to spinal cord mri and csf findings, infectious transverse myelitis could not be excluded and the patient was treated with dexamethasone, acyclovir, ceftriaxone, ampicillin, and levofloxacin . (a) sagittal t2fse mri of the spinal cord showing high signal changes . (b) axial t2flair brain mri showing high signal changes in thalami, internal capsule, and corpus callosum . (c) axial t2flair brain mri showing high signal changes in pons, medulla oblongata, cerebellum, and middle cerebellar peduncle . The next day, the patient's condition worsened; she became comatose and had a respiratory failure that required assisted ventilation; this might be caused by bilateral phrenic nerve involvement as its roots originate from c3 to c5 where the lesion was also seen (fig . Brain mri showed high signal changes in thalami, internal capsule, and corpus callosum (fig . 1b) and also similar changes in pons, medulla oblongata, cerebellum, and middle cerebellar peduncle (fig . Treatment with methylprednisolone and immunoglobulin was attempted and as serum aqp4ab was confirmed as positive (indirect immunofluorescence assay was used, the titer was 19.85, normal <10) and the patient did not respond to the treatment, the patient was also treated by means of plasmapheresis . Histological examination of the cns revealed extensive, sharply limited demyelination and axon defect (fig . 2a and b). The spinal cord was almost entirely affected . Only the lumbar area was partly spared . Smaller demyelination foci were found in the periventricular area of the hippocampus and in the corpus callosum . Demyelination was verified by showing both cd68positive macrophage infiltration and betaapp positivity as signs of axonal damage . (b) the axon defect is shown by immunostaining (brown staining) of betaamyloid precursor protein (app). This is the first case report of nmo described from finland from the aqp4ab era . There is only one older publication of a finnish nmo patient from the preaqp4antibody era 11 . The patient was referred to hospital with an acuteonset chest pain, which is an unusual first symptom of nmo . Demyelination affected almost the entire spinal cord, sparing only partly the lumbar cord, which is unusual at first myelitis . Lesions involving the lumbar or sacral spinal cord in addition to the cervical and thoracic portions have been reported only in 11% of patients at first myelitis . Previous reports have revealed that 92% of the patients have at least one spinal cord lesion extending over three or more vertebral segments at their first myelitis . It has been reported that seropositive women have more severe clinical attacks than males, as evidenced by high lesion load in the spinal cord and other types of coexisting autoimmunity 6 . Brain mri abnormalities are relatively common and may be relatively unique by virtue of localization and configuration 12, as seen also in our patient . The histopathological findings in the cns, csf, and aqp4ab seropositivity are consistent with neuromyelitis opticatype demyelination, although the disease course of our case was not typical of nmo due to its rapid and severe course . According to hospitalbased observational studies, mortality of nmo ranges from 2.9% to 25% and reported that disease duration at the time of death ranged from 6 months to 23.6 years 6 . In addition, our patient's histological examination revealed extensive, sharply limited demyelination of the spinal cord and brain in the acute phase of the disease . To the best of our knowledge, the treatment in this particular case was targeted to multiple causes of the symptoms due to the unknown etiology in the beginning of the disease . Acute attacks and relapses of nmo are generally treated with intravenous glucocorticoids followed by plasmapheresis for refractory or progressive symptoms 13, 14 . However, there are no controlled trials evaluating the treatment of nmo, and recommendations are primarily supported by data from observational studies and by the clinical experience of experts . Despite several forms of treatment, the patient did not survive. |
A 16-month old, baby girl, weighing 9.5 kg and measuring 74 cm, visited the hospital because of a cough . In a chest radiograph done under the suspicion of an upper respiratory infection, a round foreign object with a diameter of 21 mm was detected in the upper esophagus (fig . 1). In a sleep endoscopy, it was confirmed to be a circular battery (fig . 2), and ingestion was estimated to occur three days prior to the hospital visit, and it was determined that endoscopic removal would not be easy . The infant had no underlying disease, and glycopyrrolate 0.05 mg was i m injected 30 minutes before arriving at the operating room as premedication for the anesthesia . The infant was monitored by ecg, non - invasive blood pressure (nibp), and a pulse oximetry, and before anesthesia, her blood pressure was 85/61 mmhg; her heart rate was 160 beats / min with 100% oxygen saturation . 10 mg of ketamine was iv injected and after loss of consciousness, 5 mg of rocunium was iv injected . When the muscles were sufficiently relaxed, an uncuffed endotracheal tube with a 4 mm inside diameter was intubated . After intubation, both lungs were checked through a stethoscope and found to be normal, and the endotracheal tube was set to 11 cm in accordance with the top front teeth . Anesthesia was maintained by 2 l / min of air, 2 l / min of o2, and 2.0 - 3.5 vol% of sevoflurane . The tidal volume was 90 ml; respiratory rate was 18/min through volume - controlled mechanical ventilation to maintain an end - tidal co2 (etco2) pressure of 35 - 40 mmhg and the peak inspiratory pressure (pip) at this point was 19 cmh2o . An adult endoscope with a 9 mm outer diameter was used for the removal procedure because the hospital did not have a pediatric endoscope with forceps . 2 minutes after inserting the endoscope, severe abdominal inflation was observed, and pip increased up to 28 - 30 cmh2o with the tidal volume decreasing to less than 50 ml . The battery had caused an inflammatory change and conglutinated onto surrounding tissue in the esophagus, and 3 minutes after inserting the endoscope, oxygen saturation decreased to 80%, and etco2 pressure rose to 70 mmhg therefore the surgery was stopped and the endoscope was removed . By manual ventilation using 100% oxygen, oxygen saturation was recovered to 100% and etco2 pressure to 40 mmhg, and thereafter, the endoscope was reinserted . In the second attempt of the procedure, manual ventilation was done instead of mechanical ventilation . However, 1 minute after the insertion of the endoscope, a sudden strong resistance was felt in the reservoir bag, and the tidal volume was less than 20 ml despite applying more than 35 cmh2o for the pip . Oxygen saturation dropped below 60% so the procedure could not be continued; therefore, the endoscope was removed again . Here, a pip of 25 - 30 cmh2o and a tidal volume of 50 ml were maintained . The endoscope was reinserted after recovering oxygen saturation to 100%, but due to the increased airway pressure, ventilation was not possible, and oxygen saturation dropped back down to less than 40% . The authors suspected the possibility of tef considering the period of intake and the excessive air volume seen in the stomach in the chest radiograph taken before the surgery . Hence, the endotracheal tube was inserted until one lung ventilation was possible and then retreated while auscultating to secure onto the location where the pulmonary sound from both lungs became equal . The adjusted position of the endotracheal tube was 15 cm based on the top front teeth . A pip of 25 - 30 cmh2o and a tidal volume of 80 - 100 ml were maintained . In the next insertion of the endoscope, a pip of 30 cmh2o and a tidal volume of 50 ml were maintained but abdominal inflation was excessive so air in the stomach was partially removed with the endoscope, and the operating doctor was required to use the minimal amount of air for the surgery to proceed . A pip of 25 - 30 cmh2o, a tidal volume of 50 - 80 ml, and oxygen saturation of 100% were maintained during the procedure, and the battery was removed . After the removal of the battery, the vital signs were blood pressure 96/69 mmhg, heart rate 152 beats / min, and 100% oxygen saturation . The patient was not extubated but moved to postoperative intensive care, and after pediatrics observed vital signs for about 3 hours to verify that there were no abnormalities, extubation was done . Subsequent vital sign checks and physical exam were normal, and there were no abnormalities found in the blood test . Moreover, the right main bronchus appeared on the screen in the postoperative esophagography (fig . 3), and the chest ct scan found tef at 1.4 cm in the upper carina (fig . 4). The guardian wanted to have surgery for tef at another hospital; therefore, 3 days after the surgery, she was transferred . Ingested batteries usually pass through the gastrointestinal tract and are defecated in a few days, but when it is caught in the esophagus, the moist environment of the esophagus allows for the discharge of substances inside the battery together with electrical discharges, which can cause tissue damage of the esophagus . In addition, necrosis can develop in the mucus membrane of the esophagus due to the pressure from the battery, and these can trigger complications such as esophageal burns, perforation, and tef . More severe complications arose in cases where the diameter of the battery was larger than 20 mm and the infant was younger than 4 years old . The main factors that cause severe complications in battery ingestion were the size (larger than 20 - 30 mm) and components of the battery . Especially if the negative terminal of the battery is attached to the tissue, it can lead to more severe results . In addition, lithium batteries cause the most severe damages, and it was reported that in a dog's esophagus, necrosis developed in the trachea within an hour . In this case study, the corroded battery and inflamed mucous membrane of the esophagus were confirmed in endoscopy before the surgery, but tef could not be tested and confirmed due to the urgency of the surgery . It is reported that esophageal burns start 4 hours after battery ingestion and perforations that form fistulas start in 6 hours . Since the estimated ingestion period for this case was 3 days, it is enough time for tef to develop . The infant in this case study did not have respiratory difficulties before of the surgery, but ventilation failure during the surgery was because the endotracheal tube was fixed at 11 cm at first . The tef located approximately 2.6 cm under the end of the endotracheal tube allowed the inhalation gas for the anesthesia to flow into the stomach leading to abdominal inflation, and consecutively, the air injected for the endoscopic surgery flowed over to the respiratory tract to greatly increase the airway pressure . Afterwards, when the endotracheal tube was inserted deeply into the carina, the tube was located past the tef so the influence of tef was eliminated for the decrease in airway pressure . When there is tef, it is important to position the endotracheal tube above the carina and below the tef to maintain anesthesia . This is because effective ventilation would not happen due to a loss of the tidal volume through the fistulous openings in the tef, the contents of the stomach being aspirated into the lungs, and excessive positive pressure ventilation when inducing anesthesia can cause abdominal inflation and cardiovascular suppression . However, in our case, ventilation was not completely recovered even when the endotracheal tube was inserted deeply to eliminate the influence of tef, and this is thought to be from accompanying ventilation failure from the endoscope . This ventilation failure can be caused by pressure on the pharynx and the trachea from the weight of the endoscope, or motor abnormality of the diaphragm due to abdominal inflation from the injected air . Wengrower et al . Reported that approximately 7% of infants who had endoscopic procedures under sedation or anesthesia exhibited temporary desaturation . There are reports that an infant with a similar height and weight developed ventilation failure from a tee probe with outer diameter of 10 8 mm . In our case, the fact that direct pressure on the respiratory tract was applied by using an adult endoscope with a 9 mm diameter and that air had to be injected continually since the battery had attached itself to the esophagus and was hard to remove could have been some other causes for the excessive airway pressure, ventilation failure, and hypoxemia . When upper gastrointestinal endoscopic procedures were done on 99 infants of 0.9 - 10.1 kg using an endoscope with a 5.2 mm outer diameter, only 1 infant with global developmental delay exhibited hypoxemia, and gryboski recommended using endoscopes with a 5 mm outer diameter on infants with esophageal diseases . It is important to use pediatric endoscopes with the smallest possible outer diameters to prevent hypoxemia during endoscopic procedures on infants . Since the removal of foreign objects in the esophagus of infants are usually done under general anesthesia, anesthesiologists need to anticipate ventilation failure and hypoxemia from the physical pressure from the procedural equipment and the excessive injection of air and proceed with anesthesia under close cooperation with the operating surgeon . Especially when a battery has been ingested, it is necessary to be aware that there could be complications such as tef in the location where the battery is depending on the battery's components, size, and ingestion period . In addition, to more effectively block the mutual flow of air and anesthetic gas towards either the esophagus or the trachea in the case of a potential tef, a cuffed endotracheal tube should be chosen preferentially and special caution should be taken to fix the position of the tube and in selecting a suitable size for the endoscope used in the procedure. |
Lung cancer is the main cause of cancer deaths both in poland and in the world . Non - small cell lung cancer accounts for about 85% of all lung cancers, and the progress in its treatment is still not very satisfactory . The therapeutic procedure of choice is surgery, but only every fifth patient qualifies for it . This is due to the fact that most patients at the time of diagnosis are in an advanced stage of the disease, usually accompanied with tumour metastases . In about 25% of such patients extension of life by a few month such disappointing results force us to search for new therapeutic options [2, 3]. One of the new molecular targets for non - small cell lung cancer (nsclc) therapy is the epidermal growth factor receptor (egfr). Egfr (her1) belongs to the erbb (her) receptor family . For its activation, not only a connection with a suitable ligand is necessary, but also homo- or heterodimerisation on the cell surface with other receptors of the her family (her 2 - 4). The intracellular domain of egfr has activity of tyrosine kinase and it is responsible for the phosphorylation of cellular proteins in the pi3k / akt signalling pathway . Furthermore, this domain has regulatory functions . In many cancers, including nsclc, activating mutations or overexpression of the egfr gene are found . In some cases progression of the disease uncontrolled cell proliferation, inhibition of apoptosis, and the ability to metastasise is the effect of excessive activation of intracellular pathways constantly stimulated by egfr . Therefore, there is more and more interest in treatment associated with inhibition of egfr [46]. One of them is blocking of the extracellular domain of the receptor through monoclonal antibodies (cetuximab, panitumumab), which prevents connection of the egfr ligand or receptor dimerisation . Blocking of signal transduction from the cell membrane to the nucleus by small molecule inhibitors of tyrosine and serine - threonine kinase is still in the experimental phase . The biggest hopes for improving the prognosis in nsclc are associated with the introduction of small molecule, reversible tyrosine kinase inhibitors of egfr (egfr tki) gefitinib and erlotinib . The mechanism of their action is based on reversible binding to the intracellular tyrosine kinase domain of egfr and blocking of atp binding . Selective connectivity of the inhibitor prevents phosphorylation of the tyrosine kinase domain, and in consequence activates the pathway of cellular signal transduction, and leads to cell cycle arrest in g1 phase and increase in apoptosis of tumour cells . The therapeutic effect of egfr tki depends on the amino acid structure of the tyrosine kinase domain conditioned upon the state of the egfr gene . Appearance of the most frequent activating mutation deletion of 15 nucleotides in codons 746 - 750 in exon 19 and the l858r substitution in exon 21 of the egfr gene is associated with permanent stimulation of the receptor, but they also lead to an increase in both efficiency of reversible egfr tki and effectiveness of radiotherapy . Activating mutations of the egfr gene have been reported in only about 10% of caucasians patients with nsclc, more often in non - smokers, women, and patients with adenocarcinoma . Therefore, the first studies on the efficacy of erlotinib and gefitinib in second - line treatment (br.21, isel, interest) have shown that an objective response to egfr tki treatment occurs in less than 10% of patients in the general population [1014]. In recent clinical trials (ipass, optimal, eurtac) conducted on carriers of activating mutations in the egfr gene, over 70% response and almost one year progression - free survival (pfs) for this reason, both inhibitors were granted registration in the treatment of locally advanced and advanced nsclc in first - line of treatment, and are an alternative to standard chemotherapy in patients with activating mutations of the egfr gene . The method of qualification for egfr tki monotherapy in second- or third - line treatment in nsclc is still debatable and unclear [1016]. In the case of the wild type form of the egfr gene, even if the receptor is overexpressed, egfr tki have not shown strong antitumor activity (none or a few percent of objective response) mainly for two reasons: lack of changes in the structure of the atp - binding pocket of tyrosine kinase domain and the small role of the normal egfr form in carcinogenesis of lung cancer . Therefore, investigation of the expression of egfr on the cell surface (by immunohistochemistry) or amplification of the egfr gene detected by molecular probes and fluorescence in situ hybridization (fish) did not find a wider application in qualification for egfr tki therapy . In some cases, it is possible to consider the usefulness of the determination of egfr gene amplification by the fish method, if examination of the mutation is unfeasible or the outcome is uncertain, bearing in mind the frequent co - existence of egfr gene mutations (10% of patients) with an increase in copy number of the gene (40% of patients) in tumour cells [7, 8]. Unfortunately, regardless of the applied line of egfr tki treatment, at some point of therapy, even in patients who carry an activating mutation in the egfr gene and show a response, there is a recurrence of the disease and the patient's life is not prolonged [17, 18]. Some mechanisms associated with resistance to reversible egfr tki in nsclc are already known . The t790 m mutation in exon 20 of the egfr gene was detected for the first time in tumour cells of a patient with progression after a few months of efficacious therapy with gefitinib . That point mutation is caused by a single nucleotide substitution (c-> t) at position 2369 (codon 790) in exon 20 of the egfr gene . The t790 m mutation leads to a substitution of threonine to methionine in the catalytic centre of egfr tyrosine kinase, which is located in the binding pocket of tki and atp . Substitution of threonine at codon 790 into larger methionine probably results in blocking of the binding sites of erlotinib and gefitinib aromatic residues with their point of action . In vitro studies demonstrated that the effective concentration of erlotinib in tumour cells harbouring both the l858r and t790 m mutations has to be 300 times higher to induce apoptosis than in cells only with an activating mutation in codon 858 [19, 20]. Presence of a mutation in exon 20 of the egfr gene is a potential prognostic and predictive marker of egfr tki therapy and may play an important role in the planning of therapy . Activating mutations in egfr were detected in cells obtained from primary tumour, circulating tumour cells in peripheral blood (consistency of results 92%) and in free circulating dna (consistency of results the authors also investigated presence of the t790 m mutation in similar samples, and they detected cells harbouring that mutation in 10 patients (n = 26; 38.5%). Median survival in patients with the t790 m mutation treated with reversible egfr tki was 7.7 months against 16.5 months in patients without that mutation (p <0.001). Mutations were detected using sarms real - time pcr technique . That investigation has also shown that mutation in exon 20 of the egfr gene leads to acquired resistance to treatment in patients not only with the wild type egfr gene, but also in patients with confirmed clinical sensitivity to egfr tyrosine kinase inhibitors . Presence of t790 m substitution may be an indication for treatment with irreversible egfr tki, such as neratinib, keratinib and especially afatinib, which is currently in the third phase of clinical trials . The lux - lung 1 study has shown that afatinib induces an objective response and prolongation of progression - free survival (pfs) in nsclc patients who have been previously treated with egfr tki for at least 12 weeks . The rationale for this type of study is the fact that afatinib has a different molecular structure when compared to gefitinib and erlotinib . This structure causes that afatinib forms a covalent bond with cysteine at codon 733 of the egfr tyrosine kinase domain . Therefore, inhibition of afatinib is only possible due to synthesis of new receptor proteins . Inhibition of phosphorylation by egfr tyrosine kinase in tumour cells after afatinib exposure remains active for 48 hours (after gefitinib only 8 hours), and phosphorylation activity of the kinase after that time ranges from 50 to 70% of the primary activity . In vitro studies and some case reports have shown that afatinib is effective (cell apoptosis and disease stabilisation) in cells harbouring the t790 m mutation in nsclc patients [19, 2226]. The mechanism of mutation appearance in nsclc recurrence in egfr tki treated patients should be thoroughly examined . A resistant cell subpopulation harbouring t790 m can emerge in the tumour probably as a result of massive apoptosis of tumour cells harbouring an activating mutation associated with response to therapy . The authors examined presence of mutations in exons 18 - 24 of the egfr gene in patients treated with egfr tki in order to determine if additional mutations in the egfr gene are associated with progression of the disease . In patients with mutations identified in exon 19 or 21 additional mutations samples obtained from patients tumour cells before treatment were re - examined to exclude the possibility of missing changes in exon 20 of egfr . However, no evidence for the presence of the sought mutations was found . Mutations associated with resistance to egfr tki were observed in three tumor recurrences that emerged after treatment . It was the t790 m mutation coexisting with deletion in exon 19 or l858r substitution in the egfr gene . Results of the investigations suggest that the resistance to treatment is acquired during therapy with egfr tki, and mutations may form de novo . It is worth mentioning that tumour cell clones harbouring t790 m substitution may be rare, and the mutation may not be detected (due to the small number of cells with the t790 m mutation in the whole sample). It is observed especially when the dna sequencing technique is employed, which is characterised by relatively low sensitivity and requires the presence of at least 50% of mutated tumour cells in the examined sample . Currently it is believed that t790 m substitution occurs in over 50% of cases of acquired resistance to reversible egfr tki in nsclc patients and in approximately 5% of patients before egfr tki treatment . Before the therapy with egfr tki, the t790 m mutation emerges along with activating mutations of the egfr gene, and secondarily it coexists with the primary activating mutation in egfr, especially l858r [17, 2831]. With time, it was found that other mutations in exon 20 and 21 of egfr (insertion - deletion, substitutions: d761y, t854a, etc .) These mutations account for less than 5% of all known mutations in the egfr gene . They are detected very rarely, so reports about their presence should be made carefully, and egfr tki treatment outcomes in patients harbouring these mutations should be confirmed on a larger group of patients . Furthermore, it is necessary to understand the mechanism of resistance caused by these mutations . D761y and t854a mutations in the egfr gene were detected for the first time in patients with activating l858r mutation . Probably substitution of aspartic acid with tyrosine at position 761 is responsible for acquisition of resistance to tki treatment of tumour cells with an activating mutation which are sensitive to the treatment (this theory was confirmed in tumour cell lines in vitro). However, this resistance to egfr tki has been many times lower than the resistance in cells harbouring both the l858r and t790 m mutations . In case of occurrence of both l858r and t790 m mutations, the concentration of erlotinib should be three times higher in order to achieve a therapeutic effect . Analysis of the egfr structure in patients harbouring the t854a mutation suggests the presence of an additional side chain, localised near the egfr tki binding site . The role of rare mutations in exon 20 such as s768i and v769l in development of acquired resistance to egfr tki is still unknown . These substitutions were reported for the first time in nsclc patients with progression, bearing activating mutations, after gefitinib therapy . In vitro cultures of cell lines harbouring the s768i substitution showed slightly more resistance to egfr tki than cells with wild type egfr . In these cells permanent hyperphosphorylation of tyrosine at codon 1045 of the tyrosine kinase domain has been observed [17, 3234]. Insertion - deletion mutations in exon 20 of egfr are also associated with acquired resistance to egfr tki . These mutations, similarly to activating mutations in the egfr gene, are more often detectable in asians, non - smokers, women and in patients with adenocarcinoma . Most of the pre - clinical investigations allowed observation of their impact on resistance to therapeutic doses of gefitinib or erlotinib, and some of the irreversible egfr tki, e.g. Neratinib . However, in the most common mutations such as n771gy and a767-v769 duplication, even though lack of sensitivity to erlotinib has been reported, low sensitivity to irreversible egfr tki such as afatinib and pf-00299804 was observed . Crystallographic analysis of epidermal growth factor receptor structure has shown that both mutations have an influence on the spatial structure of tyrosine kinase c - helix, which plays an important role in phosphorylation activity of that enzyme . Other insertions in exon 20 of the egfr gene such as v738inskipvai, m766insasv, d770insnpg and d770insnph seem to be associated with that process, but their role in development of resistance to reversible egfr tki is still unknown [35, 36]. Many studies have demonstrated that the presence of mutations at codons 12, 13 or 61 in the k - ras gene is not a predictive factor in treatment with egfr tki . These observations stem from the fact that mutations in the k - ras gene almost never coexist with mutations in the egfr gene . Lack of mutations in egfr determines the inefficiency of egfr tki used in therapeutic doses, which means that the occurrence of mutations in the k - ras gene is no longer relevant . Therefore there were no objective responses to treatment with egfr tki among carriers of k - ras mutations, which was initially considered as an independent, adverse predictive factor in egfr tki treatment . In fact, in vitro studies have shown that the destruction of tumour cells with the wild - type egfr and mutant k - ras gene is only possible with very high, non - therapeutic doses of egfr tki [3739]. However, in some individual case reports in which coexistence of both egfr and k - ras gene mutations have been observed, the efficacy of egfr tki was not entirely confirmed . The situation is presented in a different manner when monoclonal anti - egfr antibodies, such as cetuximab, are used in the treatment of colorectal cancer, head and neck cancer, and perhaps soon in nsclc with strong overexpression of egfr . Mutations in the k - ras gene are a negative predictor here, and are routinely determined in qualification of patients for therapy . However, in the case of therapy with egfr tki the only test eligible for treatment is investigation of egfr gene mutations [37, 41, 42]. Activation of an alternative signalling pathway from stimulated egfr protein leads to activation of ras protein and subsequently kinases associated with raf / mapk / erg proteins and transcription factors such as myc, fos and jun . Mutations which are present in the k - ras gene lead to constant activation of ras protein, so the tumour cells become independent of the signals from the egfr, which explains the mechanism of resistance conferred by the egfr tki and monoclonal anti - egfr antibodies . Mutations in the k - ras gene occur with a frequency of 1520% in caucasian nsclc patients . Substitutions in codons 12 (g12v, g12c, g12a, g12r, g12d, or g12s) and 13 (g13d) in the k - ras gene are much more common than in codon 61 and they are mostly observed in smokers with adenocarcinoma (about 30% of patients with this type of cancer) [37, 38]. Egfr is not the only receptor on the cell surface responsible for initiation of signal transduction for cell activation and proliferation through pi3k / akt and ras / raf / mapk / erg pathways . Insulin - like growth factor 1 receptor (igf-1r) and the c - met receptor for hepatocyte growth factor (hgf) also play an important role in this signal transduction . Overexpression of these receptors and amplification of the genes encoding them often occur in nsclc cells . Overexpression of c - met is associated with generation of an additional excitation signal (without egfr) in protein kinase of akt, which allows tumour cells to survive and proliferate and induces the formation of metalloproteinases responsible for invasion and metastasis . This mechanism is observed in 37% of patients who were not treated with egfr tki and may explain the initial resistance to this kind of treatment . However, approximately 20% of patients with egfr activating mutations develop met gene amplification as a result of the creation of acquired resistance to egfr tki . Moreover blocking of c - met can restore the sensitivity of cancer cells to the egfr tki . Unfortunately, more than half of patients with met gene amplification also presented the t790 m mutation in the egfr gene . Despite the lack of unequivocal efficacy, simultaneous inhibition of c - met and egfr function seems to be an attractive alternative therapeutic option in resistance to reversible egfr tki . There are ongoing second and third phase trials of the c - met inhibitors tivantinib and pf-2341066, used together with erlotinib in patients previously untreated with egfr tki or in case of progression after successful monotherapy with erlotinib [17, 4348]. Similarly to the c - met receptor, the igf-1r also leads to activation of the akt pathway without egfr in nsclc cells . Development of effective small - molecule inhibitors of igf-1r encountered difficulties due to the similarity in the tyrosine kinase domain of insulin and igf-1 receptors . Attempts to use such drugs (e.g. Linsitinib) had ended with serious side effects in the form of disorders in carbohydrate and lipid metabolism . Monoclonal anti - igf-1r antibodies, such as figitumumab, proved to be more selective for the igf-1r, but were also not devoid of side effects . As a result, attempts of the combined administration of figitumumab and erlotinib were discontinued in 2010 [4951]. Mutations or amplifications of the her2 gene, whose product as well as egfr (her1) belongs to the family of her receptors, plays an important role in the development of human tumours, such as breast, ovarian and stomach cancers . Reactions between these receptors may play an important role in pathogenesis of nsclc . In the case of increased expression of her2 protein and amplification of its gene (about 2030% of patients with nsclc, mainly patients with adenocarcinoma subtype) the dimerisation between her2 and egfr occurs more easily and the ability to increase proliferation of tumour cells is higher . Mutations in the tyrosine kinase domain of her2 are reported in lung cancer as very rare (about 24%, more often in adenocarcinoma, non - smokers and women). They occur as insertion - deletion changes, which change the reading frame in eight codons in exon 20 of the her2 gene . The most common disorders are insertion - deletion of 12 base pairs: a775yvma (66% of all discovered mutations in the her2 gene) and m774ayvm . These mutations are analogous to a mutation in exon 20 of the egfr gene and cause changes in the tyrosine kinase domain of the her2 receptor . On the basis of this similarity, it is assumed that a mutation in the her2 gene is caused by similar factors as in the egfr gene and causes similar effects . Narrowing of the atp binding gap leads to an increase in tyrosine kinase activity and excessive phosphorylation of signalling proteins and subsequent secondary resistance to the reversible egfr tki [53, 54]. Although the main mechanism of the decreased response to reversible egfr tki is caused by mutations in exon 20 (t790 m) of the egfr gene, equally strong resistance to reversible egfr tki may be caused by insertion - deletion changes in exon 20 of the her2 gene . However, studies of this phenomenon have been carried out only in cell cultures [5355]. Egfr tki, which are effective for the t790 m mutation of the egfr gene, may also prove to be effective in patients with mutations in exon 20 of the her2 gene, but only if they have the ability to block the function of the tyrosine kinase associated with both egfr and her2 . A double reversible inhibitor of egfr and her2 receptors called lapatinib has not shown efficacy in this case . However, irreversible inhibitors, such as afatinib and neratinib, which additionally have a likely inhibition effect on the her4 tyrosine kinase, may be effective in the case of mutations in both genes . Mutations in exon 20 of the her2 gene do not eliminate the possibility of afatinib binding to the tyrosine kinase domain, as the drug is covalently associated with cysteine at codon 805 of this domain . In in vitro cultures afatinib is characterised by about 10-fold greater ability to inhibit phosphorylation than gefitinib in case of mutations in exon 20 of egfr or her2 genes . Also several cases have been reported where afatinib was effective in nsclc patients with mutations in exon 20 of the her2 gene . There are also premises about the effectiveness of combined use of afatinib and mtor inhibitors (mammalian target of rapamycin) if her2 mutation is present . Signalling mtor protein is activated by the pi3k / akt cascade and provides the signal which regulates both mrna translation and cell growth . Its inhibition by such agents as temsirolimus, everolimus or deforolimus can increase the potency of dual inhibitors of egfr and her2 and overcome the resistance to their use [25, 5355]. The greatest hope for an extension of progression - free survival in patients treated with reversible egfr tki, in whom resistance has developed, is provided by test results on the effectiveness of irreversible egfr tki . In vitro studies have shown that these drugs exhibit activity against cells with the wild - type or mutated (with activating mutation) form of the egfr gene, as well as against cells which are resistant to them because of the presence of the t790 m mutation in the egfr gene and insertion- deletion changes in the her2 gene . However, in the case of wild - type egfr and mutations which cause resistance to drugs, the concentration of agents required to effectively induce apoptosis in tumour cells may exceed the tolerated dose level in therapy . Currently, it is known that afatinib, which is in the most advanced trials, is effective in some patients who have benefited from pre - treatment with reversible egfr tki . Therefore, the expansion of molecular tests with studies concerning mechanisms of resistance to reversible egfr tki is necessary . Determination of presence of resistance mutations that cause insensitivity of cancer cells to reversible egfr tki, but which does not rule out the effectiveness of irreversible egfr tki, may be considered as a qualifying factor for changing the type of therapy [5557]. There are also investigations on the effectiveness of other irreversible egfr tki such as pf-00299802, ekb-569, canertinib (ci-1033) and neratinib (hki-272). All of these agents are required in relatively high doses in order to overcome the resistance to egfr tki in cancer cells . However, an additional advantage of the irreversible egfr tki is their ability to suppress other receptors of the her group (pan - erbb inhibitors), which are necessary for heterodimerisation with egfr . Use of irreversible egfr tki and monoclonal anti - egfr (cetuximab) antibodies or concomitant administration of egfr and c - met inhibitors may present prospects for the future . The results of clinical trials of new generation drugs are promising and their usefulness in molecularly targeted therapies will probably be proven in the near future [5557]. |
Diffuse gliomas are the most common primary brain tumors in adults and encompass a heterogeneous group of tumors with different histopathological features, aggressiveness, imaging, response to treatment and survival . They are primarily defined by the histopathological tumor tissue analysis and subdivided by the world health organization (who) classification into grade ii (low grade glioma), grade iii (anaplastic glioma) and grade iv (glioblastoma multiforme, gbm). Accurate distinction between different grades is of significant clinical importance because of its strong prognostic and treatment decision - making implications (louis et al ., 2007). However, histopathological criteria of the grading system present some limitations such as the lack of reproducibility and the prognostic heterogeneity within the same group (ricard et al ., 2012). To improve this classification, some molecular markers not only have diagnostic and prognostic implications, but also therapeutic efficacy prediction (1p/19q co - deletion, idh1/idh2 mutations and mgmt promoter methylation) (riemenschneider et al ., 2010). However, these approaches require a resection or a biopsy and have limitations induced by intra - tumoral heterogeneity (van den bent, 2010). Furthermore, there is a need to identify criteria of aggressiveness for inoperable patients . Mri is a part of the daily management of the patients by providing anatomical and vascular information . The presence or the absence of t1 enhancement after gadolinium - chelate injection, necrosis, mass effect and surrounding tumor edema are established parameters used in characterizing tumor aggressiveness (dean et al ., the presence of contrast enhancement in diffuse glioma, related to the permeability of the blood brain - barrier (bbb) reflecting neovascularization, is often regarded as a sign of malignancy . However, it presents some limitations and does not allow for reliable separation between different grades . For example, although the absence of contrast enhancement is a commonly used criterion for identifying grade ii gliomas, it does not eliminate formally a malignant tumor (ginsberg et al . In contrast, the presence of contrast enhancement and even necrosis, characteristic of gbm, can be observed in pure grade iii oligodendrogliomas . In this context, multimodal imaging based on mri and pet parameters, by assessing tumor pathophysiology such as microvasculature, metabolism, proliferation or cellularity, could be of additional value . Previous reports have described and compared the performance of glioma grading using advanced mri techniques such as relative cerebral blood volume (rcbv), apparent diffusion coefficient (adc), and metabolites of magnetic resonance spectroscopy (mrs) (arvinda et al ., 2009; hilario et al ., 2012; law et al ., 2003; van den bent, 2010; yang et al ., 2002; zonari et al ., 2007; others focus specifically on glioma grading with the thymidine analog [f]-fluoro - l - thymidine ([f]-flt), developed as a positron emission tomography (pet) tracer to assess the proliferation activity of tumors in vivo, particularly in brain tumors (chalkidou et al ., 2012; chen et al ., 2005; hatakeyama et al ., 2008; jacobs et al ., even if these multimodal imaging parameters are useful to distinguish grade ii from higher grades (anaplastic and gbm), the differentiating criteria of grade iii from grade iv gliomas, two groups with different prognoses and management, are still poorly defined . The aim of this study was to compare the performance of these advanced mr techniques, namely perfusion, diffusion and proton mr spectroscopy (h - mrs) with that of [f]-flt - pet, by pre - operatively assessing the diagnostic accuracy of each parameter in differentiating glioma grades . This study was based on a prospective clinical trial funded by inca (institut national du cancer) and approved by the local ethics committee and afssaps agreement (clinicaltrials.gov identifier: nct00850278). Inclusion criteria were: a presumed diffuse glioma amenable to surgical resection or biopsy, age greater than or equal to 18, kps greater than or equal to 50, normal blood cell count, normal biological hepatic functions and a signed informed consent . The group sizes of the different tumor grades were the result of the incidence of each tumor in this prospective study . Patients first underwent [f]-flt - pet, followed by multiparametric mri / mrs within the same week and prior to surgery . Single voxel mrs was localized in the area with maximum visible uptake of [f]-flt . Thereafter, patients underwent surgery, resection or biopsy depending on the location of the tumor, and the specimens were histopathologically evaluated by an experienced neuropathologist (elz). Majority of patients had image - guided total or subtotal surgical resection (table 1). For patients with biopsy only, the biopsy was guided by the area with maximum visible uptake of [f]-flt . For grade iii tumors or for difficult cases, the diagnosis and grading were reviewed by the national multicentric network prise en charge des oligodendrogliomes anaplasiques pola (idbaih et al ., 2012). After scout - view and coronal t2-weighted imaging, an axial flair (fluid attenuated inversion recovery) sequence was performed (24 slices, slice spacing 5.5, pixel resolution 0.47 0.47 mm, tr / te = 9602/150 ms). Diffusion weighted imaging (dwi) was performed using spin - echo - echo planar imaging (se - epi) (3 diffusion directions, 36 slices, slice spacing: 7 mm, pixel resolution: 1.09 1.09 mm, tr / te = 6000/96 ms, b 0 and b 1000 smm). For perfusion, dynamic t2 * -weighted epi images were acquired 30 s before, during the first pass of gd - dota (dotarem, guerbet, france) and 1 min after with a standard 0.1 mmol / kg body weight dose (14 slices, 35 repetitions, slice spacing: 7 mm, pixel resolution 2.19 2.19 mm, tr / te = 2280/60 ms). Immediately thereafter, a 3dt1-weighted sequence, 3dt1w - gd (124 slices, slice spacing 1.5, pixel resolution 1.01 1.01 mm, tr / te = 17/3 ms) was performed to evaluate the tumor contrast enhancement . Finally, mrs data were acquired in a single voxel (1 cm) localized in the tumor in the area of maximal uptake of flt and in the normal - appearing contralateral side with press mrs sequence with multiple te (35, 144, 288 ms) and water suppression . Flt - pet [f]-flt was produced by the ldm - tep group and synthesized at the cyceron tep center as previously described by jacobs et al . Images of the brain were acquired 40 min after the intravenous injection of 5 mbq / kg of f - flt and lasted 10 min, to match a clinically feasible approach . The attenuation - corrected images were reconstructed with an osem 2d algorithm (9 subsets and 2 iterations) and filtered in 3d with a butterworth filter . The adc (apparent diffusion coefficient) maps were calculated pixel - by - pixel using imagej software (http://rsb.info.nih.gov/ij/, 19972012) using the following equation: adc = [ln(s / s0)]/b where s is the signal (averaged over the 3 directions) acquired, b = 1000, and s0 = the signal acquired without diffusion gradient . Variations of the t2 * signal in the tissue, which is proportional to the concentration of the contrast agent, were calculated with in - house macros based on imagej software as: r(t) = ln(s(t)/s0), where s0 = the signal intensity before contrast agent injection, and s(t) = the signal intensity over time . Then, cbv maps were generated by integrating the area under the -variate fitted curves to avoid an effect of recirculation . Images were then normalized by dividing cbv maps with the mean value of the normal - appearing contralateral side . Coregistration: adc maps, rcbv maps, flair and pet - flt images were coregistered with trilinear interpolation, rigid matching and normalized mutual information on 3dt1w - gd images (pmod 3.1 software). The hypersignal in flair images was manually delineated to define a region of interest (roi) in order to use a homogeneous method to define a pathological area (tumor, peripheral edema and infiltration areas) for the different grades, despite the presence or absence of t1 enhancement . When present, necrosis was excluded . Tumor rois were reported for each modality (rcbv, adc, t1 enhancement, flt - pet) to extract the mean value for each modality, the maximum value for rcbv, ce and pet - flt, and the minimum value for adc . To avoid sensitivity to extreme values, the minimum value was associated with the 10th percentile (p10) and the maximum value with the 90th percentile (p90). In mrs, choline (cho), creatine (cr), n - acethyl - aspartate (naa), phospholipids and lactate were quantified with sa / ge software (ge) to obtain peak amplitudes and areas (proportional to concentration and relaxation) from spectra with water resonance suppression, and expressed as a ratio . P - values of comparisons between grades were calculated using the non - parametric wilcoxon test . Ordinal logistic regression was used to assess the degree of correlation (r) of each parameter with the grade . Only r values with p - value <0.05 were considered significant . This study was based on a prospective clinical trial funded by inca (institut national du cancer) and approved by the local ethics committee and afssaps agreement (clinicaltrials.gov identifier: nct00850278). Inclusion criteria were: a presumed diffuse glioma amenable to surgical resection or biopsy, age greater than or equal to 18, kps greater than or equal to 50, normal blood cell count, normal biological hepatic functions and a signed informed consent . The group sizes of the different tumor grades were the result of the incidence of each tumor in this prospective study . Patients first underwent [f]-flt - pet, followed by multiparametric mri / mrs within the same week and prior to surgery . Single voxel mrs was localized in the area with maximum visible uptake of [f]-flt . Thereafter, patients underwent surgery, resection or biopsy depending on the location of the tumor, and the specimens were histopathologically evaluated by an experienced neuropathologist (elz). Majority of patients had image - guided total or subtotal surgical resection (table 1). For patients with biopsy only, the biopsy was guided by the area with maximum visible uptake of [f]-flt . For grade iii tumors or for difficult cases, the diagnosis and grading were reviewed by the national multicentric network prise en charge des oligodendrogliomes anaplasiques pola (idbaih et al ., 2012). After scout - view and coronal t2-weighted imaging, an axial flair (fluid attenuated inversion recovery) sequence was performed (24 slices, slice spacing 5.5, pixel resolution 0.47 0.47 mm, tr / te = 9602/150 ms). Diffusion weighted imaging (dwi) was performed using spin - echo - echo planar imaging (se - epi) (3 diffusion directions, 36 slices, slice spacing: 7 mm, pixel resolution: 1.09 1.09 mm, tr / te = 6000/96 ms, b 0 and b 1000 smm). For perfusion, dynamic t2 * -weighted epi images were acquired 30 s before, during the first pass of gd - dota (dotarem, guerbet, france) and 1 min after with a standard 0.1 mmol / kg body weight dose (14 slices, 35 repetitions, slice spacing: 7 mm, pixel resolution 2.19 2.19 mm, tr / te = 2280/60 ms). Immediately thereafter, a 3dt1-weighted sequence, 3dt1w - gd (124 slices, slice spacing 1.5, pixel resolution 1.01 1.01 mm, tr / te = 17/3 ms) was performed to evaluate the tumor contrast enhancement . Finally, mrs data were acquired in a single voxel (1 cm) localized in the tumor in the area of maximal uptake of flt and in the normal - appearing contralateral side with press mrs sequence with multiple te (35, 144, 288 ms) and water suppression . Flt - pet [f]-flt was produced by the ldm - tep group and synthesized at the cyceron tep center as previously described by jacobs et al . Images of the brain were acquired 40 min after the intravenous injection of 5 mbq / kg of f - flt and lasted 10 min, to match a clinically feasible approach . The attenuation - corrected images were reconstructed with an osem 2d algorithm (9 subsets and 2 iterations) and filtered in 3d with a butterworth filter . The adc (apparent diffusion coefficient) maps were calculated pixel - by - pixel using imagej software (http://rsb.info.nih.gov/ij/, 19972012) using the following equation: adc = [ln(s / s0)]/b where s is the signal (averaged over the 3 directions) acquired, b = 1000, and s0 = the signal acquired without diffusion gradient . Variations of the t2 * signal in the tissue, which is proportional to the concentration of the contrast agent, were calculated with in - house macros based on imagej software as: r(t) = ln(s(t)/s0), where s0 = the signal intensity before contrast agent injection, and s(t) = the signal intensity over time . Then, cbv maps were generated by integrating the area under the -variate fitted curves to avoid an effect of recirculation . Images were then normalized by dividing cbv maps with the mean value of the normal - appearing contralateral side . Coregistration: adc maps, rcbv maps, flair and pet - flt images were coregistered with trilinear interpolation, rigid matching and normalized mutual information on 3dt1w - gd images (pmod 3.1 software). The hypersignal in flair images was manually delineated to define a region of interest (roi) in order to use a homogeneous method to define a pathological area (tumor, peripheral edema and infiltration areas) for the different grades, despite the presence or absence of t1 enhancement . When present, necrosis was excluded . Tumor rois were reported for each modality (rcbv, adc, t1 enhancement, flt - pet) to extract the mean value for each modality, the maximum value for rcbv, ce and pet - flt, and the minimum value for adc . To avoid sensitivity to extreme values, the minimum value was associated with the 10th percentile (p10) and the maximum value with the 90th percentile (p90). In mrs, choline (cho), creatine (cr), n - acethyl - aspartate (naa), phospholipids and lactate were quantified with sa / ge software (ge) to obtain peak amplitudes and areas (proportional to concentration and relaxation) from spectra with water resonance suppression, and expressed as a ratio . P - values of comparisons between grades were calculated using the non - parametric wilcoxon test . Ordinal logistic regression was used to assess the degree of correlation (r) of each parameter with the grade . Among the 40 patients included in the study, 1 had an incomplete mri examination . Of the 39 remaining patients, all presented histopathologically proven diffuse glioma based on who criteria and were eligible in the final analysis (ranging from 21 to 79 years old, 17 women and 22 men). The diagnosis was established from biopsy specimens (n = 9) or from resection (10 patients with a partial resection and 20 patients with a macroscopically complete resection) yielding 7 patients with grade ii glioma, 9 patients with grade iii glioma and 23 patients with grade iv glioma . Grade ii gliomas typically looked like a non - enhancing lesion that had no modification on cbv maps and no [f]-flt uptake (fig . Most grade iii gliomas showed a slightly enhancing lesion with mild [f]-flt uptake (fig ., grade iv gliomas typically exhibited a strong contrast enhancement, elevated rcbv, and high [f]-flt uptake (fig . 1: grade iv (a)). Interestingly, some grade iii glioma presented a profile indicative of a gbm, i.e. Sustained contrast enhancement, strong modification in adc, elevated cho / cr and rcbv, appearance of lipids / lactate but [f]-flt clearly demonstrated a weak tumor cell proliferation (fig . A grade iv glioma presented non - objectivable modification in perfusion but an intense [f]-flt uptake favoring the diagnosis of a gbm instead of a grade iii glioma (fig . Grade ii and grade iv gliomas rcbvmean, rcbvmax, fltmean, fltmax, cemean, cemax, cho / cr and cho / naa showed significant differences (table 2). 2, table 2). Between grade iii and grade iv gliomas, adcmean, adcmin, rcbvmean, rcbvmax, fltmean, fltmax, cemean, and the most relevant parameter was fltmax (p <0.0001) (fig . Cho / cr showed significant differences between grade ii and grade iii gliomas (p = 0.03). The parameter showing the best significant correlation with the grade was fltmax (r = 0.5, p <among the 40 patients included in the study, 1 had an incomplete mri examination . Of the 39 remaining patients, all presented histopathologically proven diffuse glioma based on who criteria and were eligible in the final analysis (ranging from 21 to 79 years old, 17 women and 22 men). The diagnosis was established from biopsy specimens (n = 9) or from resection (10 patients with a partial resection and 20 patients with a macroscopically complete resection) yielding 7 patients with grade ii glioma, 9 patients with grade iii glioma and 23 patients with grade iv glioma . Grade ii gliomas typically looked like a non - enhancing lesion that had no modification on cbv maps and no [f]-flt uptake (fig . Most grade iii gliomas showed a slightly enhancing lesion with mild [f]-flt uptake (fig ., grade iv gliomas typically exhibited a strong contrast enhancement, elevated rcbv, and high [f]-flt uptake (fig . 1: grade iv (a)). Interestingly, some grade iii glioma presented a profile indicative of a gbm, i.e. Sustained contrast enhancement, strong modification in adc, elevated cho / cr and rcbv, appearance of lipids / lactate but [f]-flt clearly demonstrated a weak tumor cell proliferation (fig . A grade iv glioma presented non - objectivable modification in perfusion but an intense [f]-flt uptake favoring the diagnosis of a gbm instead of a grade iii glioma (fig . Between grade ii and grade iv gliomas rcbvmean, rcbvmax, fltmean, fltmax, cemean, cemax, cho / cr and cho / naa showed significant differences (table 2). The most relevant parameter was fltmax (p <0.001) (fig . 2, table 2). Between grade iii and grade iv gliomas, adcmean, adcmin, rcbvmean, rcbvmax, fltmean, fltmax, cemean, and the most relevant parameter was fltmax (p <0.0001) (fig . Cho / cr showed significant differences between grade ii and grade iii gliomas (p = 0.03). The parameter showing the best significant correlation with the grade was fltmax (r = 0.5, p <0.0001) (table 2). The prognosis and management of patients with diffuse glioma are strongly dependent on the accurate grading of the tumor . Mri plays a crucial role in the assessment of aggressiveness of gliomas before surgery but may remain insufficient to forecast prognosis of diffuse gliomas . Therefore, multimodal imaging parameters with advanced mri (cbv and adc), mrs and [f]-flt - pet could identify relevant markers to better predict the grading of gliomas . Among advanced technics, this was also shown in our study, particularly between grade ii and grade iii gliomas (p = 0.03). Indeed, cho / cr is well known to be correlated with tumor cell proliferation (herminghaus et al ., 2002) and usually presents significant differences between low grade and high grade gliomas (law et al ., 2003; server et al ., 2011; yang et al our results suggest that the use of cho / cr ratio could be of interest in the management of grade ii and grade iii rather than [f]-flt pet, that did not show significant differences between these grades . Rcbv has been shown to be correlated with tumor aggressiveness and with grade in enhancing and in non - enhancing lesions (aronen et al ., 1994; maia et al ., 2005; sadeghi et al ., 2008; shin et al ., 2002; sugahara et al ., rcbv has a better diagnostic performance in differentiating between low grade and high grade gliomas than cho / cr and cho / naa ratios obtained with mrs (law et al ., 2003), adc (arvinda et al ., 2009) or ktrans (law et al ., 2004). While most studies compare high grade and low grade, our study suggests that cbvmean and cbvmax significantly differ between patients with grade iii and patients with grade iv . For zonari et al ., rcbv is the most important parameter for accurate tumor grading by differentiating grade ii from iii gliomas (zonari et al ., 2007). Along with [f]-fdg, numerous other pet radiotracers have been developed (for review, see (dhermain et al ., 2010; wester, 2007)) to assess tumor aggressiveness such as 3-[f]fluoro-3-deoxy - l - thymidine ([f]-flt) (jacobs et al ., 2005) or amino acid metabolism by o-(2-[f]fluoroethyl)-l - tyrosine ([f]-fet) (hutterer et al ., 2011) or methyl-[c]-l - methionine ([c]-met) (derlon et al this tracer has already been used by us and others to assess grade (ferdov et al ., 2015), treatment efficacy (corroyer - dulmont et al ., 2013; schwarzenberg et al ., [f]-flt has also been assessed and compared with other tracers as a marker for high grade gliomas and probably more adapted for the grading compared to [c]-met or [f]-fet in this setting (chen et al ., 2005;, 2005; jeong and lim, 2012; miyake et al ., 2012). In agreement with these reports, our study showed that [f]-flt parameters were not sensitive enough to distinguish grade ii from grade iii gliomas, but was the best parameter to distinguish grade iv from lower grade gliomas . Our results are in line of previous work that already showed the interest of using [f]-flt to differentiate low and high grade gliomas (yamamoto et al ., 2012). We are also aware that pet imaging and more precisely flt pet are restricted, at the present time, to few hospital or research centers . In the present study, we propose that flt pet adds information in presence of suspicious patients where mri may be not sensitive enough before any treatment is decided but where biopsy examination may lose some very aggressive hot spot thanks to the great spatial heterogeneity . Of note, we chose a static and delayed acquisition of [f]-flt images since a dynamic acquisition (e.g. 2 h of acquisition) may not be realistic for routine clinical practice . It has been shown that [f]-flt uptake occurs due to increased transport through the blood when we focused on the condition for which the [f]-flt tracer seemed to be relevant, i.e. The distinction between patients with grade iii with ce and those with grade iv, all the tumors had an alteration of the bbb . Although the advanced mri and pet parameters show more and more interest and could become more accessible in the assessment of glioma (heiss et al . 2015), studies have often evaluated independently the interest of using either mri or pet . In the present study, we benefit from the ability to compare the parameters from both advanced mri and pet for each patient and illustrate their complementary role in glioma grading . In conclusion, this study shows that [f]-flt could be of interest in glioma classification particularly in differentiating grade iv glioblastoma from grade iii or grade ii gliomas . Our work also illustrates the added value to acquire both, advanced mri and [f]-flt pet, to overcome the limitations of conventional imaging for doubtful patients . This study was funded by the institut national contre le cancer (inca), the centre national de la recherche scientifique (cnrs), the ministre de l'enseignement suprieur et de la recherche (mesr), the universit de caen basse - normandie (ucbn), the conseil rgional de basse - normandie (crbn), the european union fonds europen de dveloppement rgional (feder), l'europe s'engage en basse - normandie and the french national agency for research called these sponsors were not involved in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the article for publication. |
Computational probe mapping is frequently applied in structure - based drug design (sbdd) to identify potential binding pockets along a protein surface (i.e., hot spots). However, mapping is usually limited by the implementation of gas - phase minimizations, wherein protein flexibility and solvent competition are ignored . This leads to a rugged potential surface and many local energy minima, where druggable sites are indistinguishable from irrelevant minima . Furthermore, predictions based on a static receptor structure often neglect important binding - site features, such as the presence of transient cavities or bridging water molecules . As a result, appropriately modeling the binding potential continues to be a challenge for sbdd . Several computational and experimental models have emerged that address the limitations of traditional solvent mapping . The multiple protein structure (mps) method addressed the issue of protein flexibility by creating pharmacophore models from consensus mapping of conformational ensembles with solvent probes . While this technique has demonstrated success in mapping the binding sites of pharmaceutically relevant targets, it cannot account for desolvation penalties or water - bridging contacts, which may be essential to accurate prediction . The multiple solvent crystal structure (mscs) technique uses x - ray crystallography to determine receptor structures in the presence of competing water and organic solvent . This paved the way for fragment - based methods by providing the first experimental identification of preferred sites for probe binding . Mscs results have demonstrated high potential for use in drug development and have inspired several new computational approaches . Simultaneous protein flexibility and solvent mapping was first implemented in 2009 when molecular dynamics (md) simulations were used as a tool to map hot spots . Seco et al . Performed md simulations with seven proteins that were solvated by a 20% volume / volume (v / v) solution of water and isopropanol (ipa). Although their method sought to detect binding sites and predict druggability, it did not address aromatic hotspots and was unable to reproduce some of the experimental binding sites . Yang and wang have conducted similar studies that included phenol with the alcohol / water mix to address aromatic interactions . Another md - based approach, site identification by ligand competitive saturation (silcs), was implemented with a ternary - solvent box composed of 1 m benzene (bnz), 1 m propane, and water to locate hot spots and to reproduce experimental binding sites . The authors introduced a dummy atom with a virtual repulsion term for both bnz and propane in order to solubilize the hydrophobic solvents and prevent probe their fragment maps for bnz along the trypsin surface found abundant local minima that were mapped equally or better than the valid binding site . In addition, guvench and mackerell noted that the repulsive term may also prevent the mapping of secondary binding sites due to the unnatural physical interactions that are enforced between the hydrophobic probes . The most recent technique was developed by bakan et al ., which uses mixtures of water with multiple probes simultaneously (ipa, acetamide, acetic acid, isopropylamine). Although each of these md - based techniques have shown some success in identifying binding sites, they were limited in their ability to selectively map hot spots without the use of either a weighting or artificial repulsion term . Many spurious minima were also identified . Over the past few years, we have worked to develop mixed - solvent molecular dynamics (mixmd) using amber, with an aim of solvent mapping across a wide range of targets . Instead of simply showing that probes could occupy regions of known binding sites, we sought to establish a stronger foundation that would allow for application of our method to target systems without requiring a priori knowledge of the binding sites . Our initial study with mixmd used a 50% w / w solvent box composed of acetonitrile (acn) and water, and the results showed that mixmd reproduced binding sites from mscs studies with excellent convergence to the true hot spots and no spurious minima . We were interested in extending the probe set for mixmd to fully enable identification of hydrogen - bonding sites, hydrophobic contacts, protein protein interactions, and aromatic pockets . Here, we show what happens when poor parameters are used in mapping a protein . We then use md simulations of water - probe boxes to examine which remain evenly mixed . It is important to identify additional functional sites, particularly aromatic sites, for mixmd to be most useful for sbdd . We also identify additional probe solvents that expand the ability of mixmd to locate important interaction profiles in protein ligand binding: acetone (ace), n - methylacetamide (nma), imidazole (imi), and pyrimidine (1p3). We highlight the importance of developing a solid foundation for mapping with md, particularly as it relates to the validation of parameters through detailed evaluation of metrics for probe probe dispersion . Solvent probes were selected to represent specific interaction types for use in mixmd (table 1). Parameters for ace, acn, and nma were obtained from studies of liquid solvent with amber . Therefore, we explored the suitability of opls parameters, which were developed to work with tip3p water and to reproduce the empirical data for pure liquids . The adaptation of nonbonded parameters from opls for use in amber simply required the conversion of to rmin, where 2 /2 = rmin . This is necessary because boss and amber use different combining rules for van der waals (vdw) parameters . A comprehensive list of the parameters used in our mixmd simulations is given in table s1 and figure s1 of the supporting information . Pure solvent boxes of no fewer than 200 probe molecules were built using the tleap module in ambertools . Md simulations were performed in amber10 through the sander module with shake and a 1 fs time step . Each solvent box was subjected to 1000 steps of steepest descent followed by 49,000 cycles of conjugate gradient minimization and then heated over 20 ps from 10 to 300 k at constant volume . Two nanoseconds of equilibration were followed by a 5 ns simulation at constant pressure with the temperature held at 300 k by a weak - coupling algorithm . The berendsen coupling method was chosen because it was used in the original publication of amber parameters for the solvent molecules used in this study . The behavior of the pure - probe boxes was used to confirm proper behavior in our setup . The final boxes of organic solvent were also used in the setup of the mixed boxes . Mixed - solvent boxes were created in tleap by solvating a single probe molecule with a layer of tip3p water and then a layer of the equilibrated box of pure, organic solvent . The size of the outer box of probes is adjusted to achieve the desired solvent ratio . At least 2500 water molecules and the equivalent mass of probe molecules necessary to achieve a 50% w / w solution were used in order to ensure that realistic solvent behavior would be observed (table s3, supporting information). Each layered mixed - solvent box underwent the same procedure for minimization, heating, equilibration, and production simulation as described for the pure - solvent boxes above . It should be noted that berendsen s coupling method can sometimes be problematic for simulations of mixtures because differential heating can occur for different components of the system . Our use of the method with the small boxes could be considered a worst - case scenario, where probes may (or may not) have a small bias to aggregate . Any mixture of water and probe solvent that displays homogeneous behavior under these circumstances is likely to be robust to a wide range of applications . In our examination of thermolysin with ipa+water, we chose the andersen coupling method to be consistent with our other published applications of mixmd . There is no bias from the temperature coupling that can cause the differences seen in the two parameter choices for ipa when used in mixmd of thermolysin . We characterized the distribution of probe density by computing atom atom radial distribution functions (rdfs) with the radial command in ptraj . The final 1 ns of production time was used to calculate the rdf with a bin size of 0.1 . When the solvent probes are fully solubilized into water, they are well dispersed throughout the solvent box, and the rdf converges toward unity at the vdw cutoff . When phase separation occurs in simulations of mixed solvent, too many probes and too little water occupy the local microenvironment around each probe . This makes the local environment too dense with organic probes, and the rdf will not converge to unity within the vdw cutoff . Accordingly, we used these rdf descriptions of mixed vs aggregated solvent systems to evaluate the structure of each mixed - solvent box . The carbon carbon (rcc), carbon oxygen (rco), carbon nitrogen (rcn), nitrogen nitrogen (rnn), nitrogen oxygen (rno), and oxygen oxygen (roo) distributions were assessed between probe probe, water water, and probe water as was relevant for each probe molecule . For brevity, cumulative density distributions of roo for water water distances in mixed solvent were also examined to determine the number density of water within the volume sphere . For the case of a 50% w / w mixed - solvent box, equitable distribution of solvent probes and water within the system will give a cumulative plot for roo of water the distribution of water molecules relative to one another is less than in pure solvent because obviously the presence of a miscible probe reduces the number of water molecules that can occupy the local microenvironment around each water . Earlier papers ours included have used the behavior at the edges of the simulation box to prove even mixing of probes and water . The reasoning was that the box edges are far from the protein, outside the vdw cutoff, and should have minimal bias in the ratio of probe to water . If the edges of the box had the same ratio as the setup solvent box, then there was even mixing . However, taking a step back to these basic simulations of solvent boxes provided a better means of measuring mixing: the use of a rdf . Rdfs of the solvents relative to one another can be calculated for simulations of proteins, and we recommend they be used in all mixed - solvent simulations to judge whether the behavior of the probes and waters are reasonable . The rdf, or pair correlation function g(r), can be used to describe the structure of the solvent based on atom / molecule pairs in a system . The function g(r) enables a precise description of how likely a probe molecule will have another probe present at a separation distance of r. this function may be simplified for a liquid system in a solvent box, where g(r) is proportional to the observed number density (o) divided by the expected number density (e). The value o is the total number of atoms at a given distance, and e is the number expected at that same distance if the solvent were uniformly distributed . If the probe solvent and water are evenly mixed, the rdf will converge to 1.0 at long ranges . If it converges to a larger number, this indicates phase separation (further discussion below). Previously, mixmd was validated with acn as a probe, which specifies hot spots for amphipathic nitrogen - containing ligands . We applied amber parameters for acn from grabuleda et al ., and they accurately reproduce experimental data from mscs . For completeness, we ran simulations of acn+h2o boxes to confirm that the rdf demonstrated appropriate convergence to unity (figure s2, supporting information). In trying to reproduce simulations of thermolysin in ipa+h2o published by seco et al ., we found that the ipa phase - separated from water (figure 1a). It is unclear whether the authors observed this same behavior, and they do not note which temperature - coupling method was used . They noted partial phase separation in the paper, and they rescaled the reference values for probe density to account for the solvent behavior . However, the bulk phase separation we observed signifies the implementation of inadequate parameters for liquid ipa, which were derived from the amber parameter files for threonine with charges assigned after resp calculations (ipaseco). Snapshots of mixmd simulations of thermolysin in ipa+h2o executed using the protocol outlined in seco et al . (a) fully flexible simulations of thermolysin were performed with a mixed box of 50% w / w ipaseco+h2o . Five independent runs were calculated, and every simulation resulted in the solvent layers separating between 4 and 5 ns and remaining separated when simulations were extended to 10 ns . (b) the same simulation using ipaopls resulted in solvent remaining well distributed for the entire equilibration and 10 ns of production in all five independent simulations . We turned to the work of jorgensen et al . For alcohol parameters because they were developed to specifically reproduce a variety of pure - solvent behaviors and interactions with tip3p water . For small boxes without protein, we compared our simulations of ipaopls+h2o to experiments by langdon and keyes that determined the density for ipa+h2o systems at different temperatures . We found that our mixed box of ipaopls+h2o reproduced the experimental density at 308 k (0.830g / ml) to within 0.06% . Our ability to replicate this fundamental data confirmed the use of good parameters for our ipa+h2o systems . Indeed, mixmd simulations of thermolysin resulted in proper mixing using the ipa parameters from jorgensen et al . The rdfs for the ipa probes (roo and rcc) and water (roo) in mixed - solvent boxes further justified the use of opls parameters . Figure 2 compares the o o rdf for both mixed - solvent and pure - solvent boxes of ipa . The roo for (ipa - ipa)opls converged to unity with an appropriately shorter peak than that of pure liquid alcohol . However, the roo for (ipa - ipa)seco remained well above 1.0 at 8 and featured a large peak for the first solvent shell, the same as seen in the simulation of a pure ipa box . All simulations with ipaseco feature rdfs that indicate aggregation of the solvent molecules . For this first example, the count data behind the rdfs will be discussed in detail to further explain our interpretation, which is supported by viewing the boxes . Water and (b, c) probe probe in a mixed - solvent environment with ipa . The impact of different parameters for ipa is demonstrated by the poor convergence to unity for o o in simulations of 50% w / w ipaseco (b) when compared to the appropriate convergence obtained for the same mixed solvent with ipaopls parameters (c). Ipa and the great majority of organic solvents chosen for this study are miscible with water (table 3). The definition of miscibility is that the two solutions are homogeneously distributed at all ratios of the two solvents . It might be reasonable to find some bias or local structure in the first and second solvent shells, but bulk separation should not be seen at long ranges . This has critical correspondence with one of the basic underlying assumptions of rdfs . Rdfs are founded on a uniform distribution of solvent to describe e (solvent count / box volume); any deviations from uniformity (1.0) reflects the local structure of the solvent . In all the rdfs in figure 2, water has its maximum g(r) at 2.75, and the ipa maxima are at 2.85 . For pure water at 2.75, the maximum g(r) is 2.6, and the cumulative count of water is 1.4 molecules (table 4). If we define the first solvent shell between 2.45 and 3.15, it contains 3.9 neighboring water molecules . When simulated in a mixture with ipaopls, there are 1.1 waters within 2.75 and 2.9 waters within 3.15 (table 4). Of course, both counts are reduced because some of the interactions are occasionally fulfilled by ipa . This is also incorporated into e, where the larger box volume reduces the expected density . It is that reduced expectation (actually 0.244 at 2.75) that results in a g(r)of 4.6 . This is higher than the g(r) maximum from the pure water simulation, but it does not reflect more interactions with water molecules . Within a 7.95 radius sphere, the observed and expected counts are nearly equal and g(r) approaches 1.0, showing that the molecules have a uniform distribution over larger scales . Both o and e depend on the volume of the simulation box; this drops out and makes each g(r) = no(r)/ne(r). The values in this table have been rounded; the g(r) in the figures are the exact values . Values for ne(r) are based on the volume of the count sphere, the number of solvent in the whole box, and size of the whole box during the simulation . For the mixture of water and ipaseco, the expected count of water was 34.0, but the observed count was 51.6 water molecules (table 4). Clearly, there are too many waters close to one another! Furthermore, phase separation (as in figure 1a) is best quantified by high g(r) at long r, but even the local changes reflected the phenomenon . Within 2.75 and 3.15, there are 1.3 and 3.4 waters (table 4), respectively, which is much closer to the values shown in the pure - water boxes . The mixed box equilibrated to a slightly larger volume (1% change), which is reflected in the slight differences in the expected counts between ipaseco+water and ipaopls+water . However, the 1% change does not explain the maximum g(r) of 5.1, which is based on the increase in number of water molecules . The same patterns are seen in the rdfs of the ipa oxygens (table 4). Pure ipa simulations show appropriate behavior for both sets of parameters (black lines in figure 2bc, table s2 and text in supporting information). Though the rdfs may imply ipaopls has slightly tighter solvent shells, they both sum to the same number of ipa molecules in the first solvent shell (2.1 for ipaopls and 2.0 for ipaseco). For mixed simulations, both ipaseco and ipaopls show lower counts than pure - solvent boxes at their g(r) maxima (2.85) and within their solvent shells (3.95). Influenced by the discrepancies in solvent behavior observed for ipaseco and ipaopls, we carefully examined the behavior of existing parameters for additional solvent probes to determine their applicability in mixmd . The inclusion of various probe types, including complicated molecular fragments, would facilitate the development of accurate pharmacophores for druggable hot spots, ligand binding sites, and protein protein interactions . The selection of additional probes for expanding the functional groups represented in mixmd was based on existing mscs data and common interaction types found in protein ligand systems . Ipa maps both hydrogen bond - accepting and -donating locations, but additional hydrogen - bonding probes are needed to develop robust pharmacophore maps of binding sites . Ace and nma were selected because each molecule represents a different hydrogen - bonding profile . Ace locates where the protein donates hydrogen bonds, and nma represents protein protein or peptide binding . Specific parameters for ace and nma had been developed for use with amber and opls . Simulations of ace+h2o and nma+h2o were performed using each parameter set to assess their suitability . The g(r) was calculated for probe probe, probe water, and water analysis of the resulting rdf plots indicated that in each case all g(r) converged to unity near 8 . We found that both the amber and opls parameters for liquid ace and nma demonstrated correct behavior according to rdf plots and visual inspection (figure 3). The o o rdf for water from the mixed - solvent simulations also illustrate that solvent mixing has occurred . Analysis of the cumulative plots for the roo of water in solution with ace or nma showed that the number density of water within the local volume sphere was half the number density observed in pure water simulations, which is the expected result for a well - distributed system of 50% w / w probe and water . Visual analysis of the trajectory snapshots served to corroborate the occurrence of proper solvent mixing . However, the rdf s deviation from unity at 8 was slightly higher for the opls descriptions of ace and nma (table 2). For this reason, we would recommend that the amber parameters be used for ace and nma in our mixmd method, especially when the amber parameters are also used to describe the protein . (a, d) o o and (b, e) n n radial distribution functions for probe probe and o o rdfs for water water (c, f) in a mixed - solvent environment with ace and nma . The impact of optimized parameters from amber versus general solvent parameters from opls is shown in the slightly better convergence to unity for simulations using amber parameters (d f) compared to opls (a c) parameters . In particular, we wanted to find parameters for soluble heterocycles that could map aromatic hot spots without requiring an artificial repulsive term . No other md approach for probe mapping has successfully integrated aromatic probes without an artificial interaction term . Futhermore, we were particularly interested in developing probes that matched common heterocycles used in modern pharmaceuticals . As a result, a highly polar diazole, imi, is miscible with water and is present as a functional group in a wide range of biologically active molecules, including mercaptopurine (anticancer), ketoconazole (antifungal), and moxonidine (antihypertensive). Imi parameters were derived from jorgensen and mcdonald, and then simulations of pure imi and imi+h2o were conducted to assess the potential of imi as a probe for mixmd . The proper convergence of the rdf plots to 1.0 showed that imi was properly solubilized and well distributed within the binary - solvent system (figure 4). Our pure - solvent rdfs were consistent with the results of jorgensen and co - workers and further validated our parameter choice and the accuracy of our protocol . Also, visualization of simulation snapshots confirmed that the imi probe was well dispersed in the aqueous solution . (c) water water in a mixed - solvent environment with (a) imi and (b) 1p3 . Opls parameters for pyr, 1p2, 1p3, and 1p4 were each simulated in a binary water probe solution . Visualization of the simulations of pyr+h2o, 1p2+h2o, and 1p4+h2o clearly showed that they underwent phase separation . This was proved by rdfs that converged to values well above 1.0 at 8 (figure 5). However, 1p3+h2o yielded a well - dispersed system with well - behaved rdf plots (figure 4). Probe probe radial distribution functions for mixed solvent environments composed of (a) bnz+h2o, (b) pyr+h2o, (c) iph+h2o, (d) 1p2+h2o, and (e) 1p4+h2o clearly showed phase separation, with g(r) values well above 1.0 at 8 . We also examined two nonpolar aromatic probes, bnz and iph, simply to confirm that they are not appropriate probes when an artificial repulsive term is not used . Comparison of the resultant rdf plots to the reference rdf plot of pure water showed that the g(r) values for bnz+h2o and iph+h2o do not converge to unity within 8 (figure 5). In fact, the g(r) for bnz+h2o indicated convergence to a value of 2 . The simulations with iph as a probe molecule showed a converged g(r) of approximately 1.45 at 8 . Visualization of snapshots from these simulations showed significant aggregation of the probe molecules, verifying that these probes are not be soluble enough for use with mixmd without inclusion of a repulsive term . Because bnz is one of the solvent probes used in silcs, we were able to compare the rdf results for our mixmd simulations of bnz+h2o to the published results from silcs mapping studies . The bnz probe used in silcs was parametrized based on the charmm force field and contained a repulsive term to correct for probe probe aggregation . Although a nonbonded cutoff of 8 with a 58 switching term was applied in silcs, the probe probe distance for bnz converged to 1.0 at 13 (solvent box size was 72 58 43). In comparison, the soluble aromatic probes applied in mixmd converged at approximately 67 . The first solvent shell of bnz in silcs was observed at 9, while we observed the first peak at 45 . The presence of the second hydrophobic probe (propane) in silcs simulations may have influenced these differences in rdf . However, the use of a repulsive term to prevent probe probe aggregation does not correspond with the experimental properties of bnz, suggesting that silcs simulations with high concentrations of bnz may yield incorrect results . To determine whether bnz and iph would disperse more readily in the presence of an intermediary probe, ternary mixed - solvent boxes were constructed to contain 1 m aromatic probe and 1 m ipa in water . We hypothesized that the introduction of the ipa molecule would enhance available interactions and aid in the dispersion of the aromatic probes into water . However, this was not observed in simulations of the ternary - solvent boxes . At 5 ns of production time, the bnz molecules were predominantly clustered along one side of the solvent box, while the ipa molecules were dispersed throughout the water . An additional 20 ns of production time did not change the observed aggregation (figure 6). Ternary - solvent simulations with iph indicated a similar result; after 5 ns of production time, iph was separated with some dispersion toward the interior . Elongating the run time out to 25 ns representative snapshots of md trajectory for solvent boxes of 1 m aromatic probe (yellow) and 1 m ipa (purple) in water (cyan) for (a) bnz+ipa+h2o at 25 ns and (b) iph+ipa+h2o at 25 ns . Although all of the probes selected for use in our validation study had experimental data establishing their solubility in water, not all of these probes were soluble in simulation (table 3). The solvation conditions applied in a mixmd simulation included high probe concentrations, which may have affected probe solubility . To determine whether the outcomes we observed were justified based on experimental data, we considered their miscibility . The terms soluble and miscible are frequently used interchangeably; however, they are two distinct properties . Solubility is dependent upon temperature and pressure and refers to the ability of a solute (solid, liquid, or gas) to dissolve into a solvent (solid, liquid, or gas), thereby forming a homogeneous mixture . Miscibility refers to the ability of two liquids to form a homogeneous solution, independent of proportion . All probes that have been experimentally categorized as miscible were well dispersed in our computational simulations, with two exceptions (table 3). Pyridine is a weak base with a nontrivial concentration of protonated pyridinium ions (pka of 5.3) following solubilization into water . This effect was not simulated in our studies, and we suggest that the charged species may be responsible for solubilizing the uncharged pyridine molecules into water . A similar explanation may also be extended to pyridazine . One advantage of using silcs as a tool for solvent mapping has been that the ternary - solvent box can enable the development of a complete pharmacophore model from a single md run because the three probe types identify aromatic, hydrophobic, and hydrogen - bonding sites . Using three of the probes with parameter sets we have validated for mixmd, we constructed a ternary system with imi (aromatic probe), ipa (hydrophobic and hydrogen - bonding probe), and water at a concentration of 33% w / w by probe . Visualization of the trajectory data indicated appropriate solvent mixing, and our rdf results showed that both organic probes were fully dispersed into solution (figure 7). Total run time required a comparable amount of simulation time to a binary mixmd simulation; the total cost was an additional 4 or 8 h of production time on an 8-core cpu as compared to a binary ipa+h2o or imi+h2o simulation, respectively . (a) final snapshot from the production simulation of a mixed - solvent box containing imi+ipa+h2o illustrates that the probes are well mixed within the system . (b d) probe probe and water water radial distribution functions for imi and ipa establish convergence to unity within the trisolvent environment . We suggest that the use of this ternary mixmd model may offer several advantages over the silcs approach . We have shown that mixmd can be used to identify maximally occupied sites without recovering additional spurious minima, which is a feature that was not consistently seen in the silcs studies . In addition, instead of requiring water to act as a hydrogen - bonding probe, in mixmd, the druggable hydrogen - bonding sites can be identified in competition with water using ipa as the probe . This is important for ascertaining whether a drug - like molecule that contains a similar function group could displace water molecules at the proposed hydrogen - bonding site . A further advantage of using mixmd is the array of available probes, which can be tailored to an investigator s mapping needs . For example, either imi or 1p3 could be used in the ternary box to locate aromatic hotspots that are specific to the size of the ring . The ternary mixture of 33% w / w ace+acn+h2o was also simulated, and the results depicted a well - distributed solvent system for use in hot spot mapping with mixmd (figure s3, supporting information). We have examined solvent parameters for neat liquid from the literature for use in hot spot mapping through mixmd . Our work highlights the importance of parameter validation and analysis of simulation data when performing computational solvent mapping in order to obtain appropriate behavior . Influenced by the poor results obtained using a standard set of parameters used in the field for liquid isopropanol in water, we identified a set of functional group probes with specific parameters available for liquid simulation . We pursued validation of these parameters for neat and mixed - solvent simulations and identified six probes for use with tip3p in mixmd: acetonitrile, acetone, imidazole, isopropanol, n - methylacetamide, and pyrimidine . Of course, these probes should be used with more proteins beyond thermolysin (figure 1) to prove their applicability . We have previously applied opls ipa parameters to also examine elastase, hewl, hewl, p53 core, and rnase a. furthermore, we are currently using all of these probes to map 10 additional protein systems, but these are separate studies in their own right . The extent of ideal dispersion is most easily quantified by using the cumulative rdf of roo for water . Although published results for pyridine and pyridazine indicated that they are miscible with water, these two probes were observed to separate from the aqueous phase during our simulations, rendering them unsuitable for solvent mapping in our context . We hypothesized that this disparity between experiment and computation was caused by the presence of the corresponding ionized species, which were not simulated . In order to avoid unphysical mapping or reduced accuracy, our simulations did not employ the use of an artificial repulsion or weighted density term . We have successfully expanded the range of probes that can be incorporated into mixmd studies to allow for the mapping of druggable sites, including hydrogen - bonding regions, aromatic pockets, and protein, a full pharmacophore model could be created from the simulation of a single protein+probes+water system, which would greatly reduce the computational costs of mixmd studies . This is a clear advantage of the silcs method that we would like to incorporate . Ultimately, investigators could mix and match the probes used in mixmd to identify hotspots with a greater degree of specificity. |
Autoimmune hepatitis (aih) is characterized by chronic necroinflammation, manifesting as severe lobular necrosis and inflammation with broad areas of parenchymal collapse with no known cause . In fact, aih might be associated with a number of other autoimmune diseases,1 but the exact mechanisms of onset remain unknown . In aih, the most common are antinuclear antibodies (ana), smooth muscle antibodies (sma), and antibodies to liver and kidney microsomes (anti - lkm).1 evidence suggests that aih is induced by antibody - dependent cell - mediated cytotoxicity, which involves both antibody - mediated and cellular immunity against specific liver antigens on hepatocyte membranes.2 several studies have documented the involvement of genetic factors including human leukocyte antigen (hla) types dr3 and dr4.3 some reports have described aih cases in which a virus such as hepatitis a,4 hepatitis b,5 or epstein barr6 was the causative agent . Sera from patients with multiple autoimmune diseases have been found to have elevated cytomegalovirus (cmv) igm titers, perhaps implying an as yet unidentified association between cmv and autoimmune diseases.7 we present a case of fluorescence ana - negative aih - associated primary biliary cirrhosis (pbc) that appears to have been triggered by reactivated cmv infection . In 2010, a 63-year - old japanese woman was admitted to a local hospital, after which she was transferred to our hospital for investigation of liver dysfunction . One month prior, she had experienced fever . She had no history of medicine or drug use . The findings of physical examinations of admission to our hospital were the following: body temperature, 36.8c; pulse rate, 69 beats / minute and regular; blood pressure, 122/77 mmhg; respiratory rate, 16/minute; no sign of anemia at the conjunctiva palpebra, but an icteric finding was made at the conjunctiva bulbi . The results of urinalysis were normal, with the exception of a positive result for urobilinogen . The results of biochemical analysis of the blood were the following: total bilirubin, 6.6 mg / dl (normal range: 0.21.2); direct bilirubin, 4.4 mg / dl (normal range: 0.00.2); aspartate aminotransferase, 344 iu / l (normal range: 1040); alanine aminotransferase, 238 iu / l (normal range: 545); alkaline phosphatase, 572 iu / l (normal range: 100325); -guanosine triphosphate, 129 iu / l (normal value: <30); igg, 2,498 mg / dl (normal range: 8701,700); and igm, 279 mg / dl (normal range: 46260). Cmvigm antibody was high; igg antibody was above the normal ranges at admission (table 1). Tests for hepatitis a igm antibody, hepatitis b surface antigen, and anti - hepatitis c virus antibody were negative . Ana was negative by fluorescence assay (<40), but it was positive as measured using enzyme - linked immunosorbent assay (elisa) (44.1 index; normal range <20), anti - mitochondria m2 antibody level was 18.4 (normal value: <7.0), anti - lkm antibody was negative, anti - sma was <20, and anti - dsdna antibody (<7.0 iu / ml; normal value: <20 iu / ml) was negative . The level of anti - ribonucleoproteins antibody was 20.3 (normal value: <17) (table 1). Histological examination showed severe lobular necrosis, inflammation with broad areas of parenchymal collapse, and both nondestructive and destructive cholangitis surrounded by many lymphocytes and plasma cells (figure 2). Regarding results of electron microscopy, migrating lymphocytes were found more frequently in a medium - sized interlobular bile duct surrounded by many inflammatory cells . Complete absence or partial loss of microvilli and microvillous bleb formation was visible in the same bile duct epithelial cell (figure 3). The clinical and pathological findings were highly suggestive of aih, the score of which was calculated according to the system proposed by the revised international aih group.8 the negative ana result assessed by fluorescent ana was used in the calculation . The clinical / pathological findings of anti - mitochondria m2 antibody and chronic nonsuppurative destructive cholangitis indicated pbc . Her severe jaundice was improved, and her bilirubin and transaminase levels began to decline after administration of prednisolone for 3 days . The role of viruses in aih has been proposed repeatedly, but convincing evidence has linked two viruses hepatitis a and epstein barr virus to type 1 of the disease, only in rare cases where a genetic predisposition exists and the viral infection occurs at the right time . In spite of an impressive amount of information conclusively showing molecular mimicry between cytochrome p4502d6 sequences (the target autoantigen of autoantibodies characteristic of aih type 2) and viral (hepatitis c virus, herpes simplex virus 1, cmv, human t lymphotropic viruses 1 and 2) or bacterial (salmonella typhimurium) antigens, no infectious agent has been clearly implicated for causing type 2 of the disease.9 at admission and at 2, 4, and 8 weeks after admission, the respective cmv igm indices (normal value: <0.8) were 2.17, 0.93, 1.08, and 1.407; and igg indices (normal value: <2.0) were 10, 34, 89.4,> 128, and> 128 . Consequently, serial cmv ig measurements demonstrated a slight increase of igm at admission which declined gradually over time, whereas igg increased with time to very high levels . These findings suggested cmv infection, consistent with a previous report that some patients with secondary cmv infection had long - lasting igm antibodies, and that all had igg antibodies to cmv.10 the present case is a rare case of negative fluorescence - ana and low - titer elisa - ana aih type 1 with coincident cmv infection . Although the clinical features strongly suggest aih, calculation of aih score using the result did not recommend a diagnosis of aih from negative fluorescence - ana . Immunofluorescence assay is the ana detection method used in the calculation of aih score.8 although immunofluorescence is a sensitive test, it is laborious when testing large quantities of patient samples and is subject to errors of human interpretation and variation in fluorescence microscopes.11 the enzyme immunoassay test system is an excellent alternative to the immunofluorescence assay system for screening patient serum for the presence of clinically significant anas . The enzyme immunoassay efficiently screens large quantities of patient samples and reduces risks of human error.12 both methods have different issues with respect to precision . Our patient was positive for ama, and liver biopsy showed a mixed portal inflammatory infiltrate with destructive and nondestructive cholangitis (figure 3c). The reported frequency of ama in patients with definitive aih was 18 in 206 (7.5%) patients as assessed by immunoblotting.13 therefore, ama positivity is not a typical aih finding . In the present case, the findings of ama positivity and destructive biliary injury resembling chronic nonsuppurative destructive cholangitis in the biopsy strongly suggest a diagnosis of pbc.14 although aih and pbc might share some common histological features, the patterns seen on liver biopsy typically differ . Interface hepatitis or lobular hepatitis with infiltration of plasma cells is a characteristic of acute or chronic aih.15 nondestructive ductular reaction is detected more frequently in acute aih than in chronic disease, but the destructive cholangitis lesions that are typical of pbc are not present.15,16 moreover, for electron microscopy, the bile duct epithelial cell membrane facing the lymphocyte was disrupted . Bile duct epithelial cell detachment is an important ultrastructural lesion associated with extensive bile duct destruction in pbc livers.17 cellular immune mechanisms involving t cell reaction were thought to be significantly involved in the formation of chronic nonsuppurative destructive cholangitis and bile duct loss.18 in our case, the presence of portal inflammation and mixed destructive and nondestructive cholangitis changes, supported by other biochemical changes, led to a final diagnosis of overlapping syndrome of acute exacerbation aih and pbc . This case is rare because these changes coincide or even precede cmv infection . In the present case, elisa assay for ana and liver biopsy led to aih and early treatment with prednisolone, which produced a good clinical outcome. |
European rabbits (oryctolagus cuniculus; figure 1) have played an important role as animal models in immunology for many decades . Today, rabbits are still a major source for a wide variety of monoclonal antibodies (mabs) and polyclonal antibodies (pabs) with broad utility . Pabs can be described as a set of different antibodies generated in response to a specific pathogen or antigen, generally targeting different epitopes . Mabs, on the other hand, contain a defined antigen - binding site (paratope) that typically binds with high affinity and specificity to only one epitope . From a pharmaceutical point of view, mabs provide a molecularly defined and reproducible product, whereas pabs are traditionally an imprecise mixture of different antibodies . As is the case for mouse and human mabs, igg is the most common isotype of rabbit mabs (figure 2). Rabbit pabs have been used extensively as analytical tools in biomedical research and especially for immunological techniques, such as immunohistochemistry (ihc), western blotting and flow cytometry . Atg is a mixture of purified polyclonal rabbit, horse or goat iggs against human t cells that has been used as an immunosuppressive drug for decades . In organ and allogeneic bone marrow transplantation, atg application causes rapid depletion of t cells, leading to a decreased risk for rejection and acute graft - versus - host disease . However, atg does not induce long - term tolerance . Rabbit atg is one of the most commonly used atgs, due to its higher lymphocytotoxicity compared to horse atg ., cambridge, ma, usa) was approved by the us food and drug administration (fda) in 1998 . More recently, an improved rabbit pabs cocktail targeting human leukocytes was reported as a potential immunosuppressive drug in xenogeneic (for example, pig to human) organ transplantation . In addition, one rabbit pab is currently approved by the fda as an in vitro diagnostic tool (c - kit pharmdx; agilent technologies, inc ., santa clara, ca, usa) for the ihc - based detection of cd117 (c - kit) expression in gastrointestinal stromal tumors to aid treatment decisions . Mabs and mab - derived antibody therapeutics are currently widely used to treat human diseases, such as cancer and autoimmune diseases . Although no therapeutic rabbit mabs have been approved by the fda thus far, 11 rabbit mabs are fda - approved in vitro diagnostic tools in the clinic . Ten of these mabs are being used to detect the expression of tumor - associated antigens, including her2, estrogen receptors, progesterone receptors and pd - l1 . A rabbit mab to human androgen receptor splice variant 7 has emerged as a promising tool for the detection of circulating tumor cells by immunofluorescence and ihc in prostate cancer . In addition, several rabbit mab - derived therapeutics are currently being investigated in clinical trials registered at clinicaltrials.gov . In oncology, examples include sevacizumab (simcere pharmaceutical group, inc ., nanjing, china), a humanized rabbit anti - human vascular endothelial growth factor mab (nct02453464), apx005 m (apexigen, inc ., san carlos, ca, usa), a humanized rabbit anti - human cd40 mab (nct02482168), and yyb101, a humanized rabbit anti - human hgf mab (yooyoung pharmaceutical co., inc ., further, chimeric antigen receptor t cells based on a rabbit anti - human ror1 mab have commenced clinical trials recently (nct02706392). In ophthalmology, humanized rabbit anti - vascular endothelial growth factor mab brolucizumab (alcon, inc ., hnenberg, switzerland), a mab in scfv format administered intravitreally, is being investigated in advanced clinical trials (nct02307682 and nct02434328). Following these examples, a number of rabbit mab - derived therapeutics are expected to transition from preclinical to clinical studies in the near future . Currently, only a handful of companies develop rabbit or rabbit - derived mabs for laboratory research and for diagnostic and therapeutic applications . (cambridge, uk; rabmab platform; through acquisition of epitomics, inc ., (through acquisition of esbatech, inc ., schlieren, switzerland in 2009); apexigen, inc . (san carlos, ca, usa; spun out by epitomics, inc . In 2010); cell signaling technology, inc . (danvers, ma, usa; currently listing> 4000 different rabbit mabs); agilent technologies, inc . ; mab discovery, inc ., neuried, germany; lab vision corporation, inc ., fremont, ca, usa; thermo fisher scientific, inc . (carlsbad, ca, usa; invitrogen abfinity recombinant rabbit antibodies); and ventana medical systems, inc . Rabbits have been used to investigate immunological questions and to develop immunological techniques for> 100 years . Thus, many standard procedures are established, published and validated, such as immunization and purification methods yielding high amounts of rabbit antibodies . In addition to these practical considerations, rabbits are characterized by a variety of natural features that make their antibody repertoire very attractive for the discussed applications . First, rabbits belong to the order lagomorpha, which is evolutionary distinct from the order rodentia, to which, for example, mice and rats belong . Rabbit antibodies are able to recognize epitopes on human antigens that are not immunogenic in rodents, increasing the total number of targetable epitopes and facilitating the generation of antibodies that cross - react with mouse orthologs of human antigens . This is an important aspect for basic research and preclinical investigations with, for example, human tumor xenografts, where the presence or absence of on - target - off - tumor toxicities of therapeutic antibodies provides important information prior to clinical translation . In general, rabbit anti - mouse reactivity is valuable in mouse models of human disease and has also been exploited in basic research, for example, on mouse stem cell antigens . Second, it has been observed that rabbits elicit strong immune responses against small molecules and haptens, which is uncommon in rodents . A third important aspect is the scarcity of inbred rabbit strains, while most mouse strains are inbred . It is thought that inbred strains in general elicit less diverse immune responses, which makes it more difficult to raise strong and diverse binders . Correspondingly, in many ihc studies that compared rabbit and mouse mabs to the same human antigens, rabbit mabs consistently revealed higher sensitivity . In a recent study, 1410 rabbit mabs raised against 15-amino - acid peptides representing 100 different antigens revealed a typical affinity range of 20200 pm (median 66 pm), as determined by high - throughput surface plasmon resonance . A fraction of rabbit mabs even revealed higher affinities near the detection limit of 1 pm . However, the affinity range of 46 mouse mabs (30300 pm; median 72 pm) analyzed in parallel was not significantly different . More direct comparisons of rabbit and mouse mabs to a wider variety of antigens are warranted to determine a significant difference in affinity . Fourth, most strategies to generate mabs are based on the recovery of b cells from spleen, bone marrow or blood, which are present in higher quantities in rabbits than in mice due to their overall larger body size . (the average body weight of a 3-month - old laboratory rabbit is 2.5 kg compared to 25 g for a 6-week - old laboratory mouse .) For example, 50 times more spleen b cells can be recovered from rabbits compared to mice . In addition, the larger blood volume of rabbits compared to mice facilitates mass spectrometry analyses of bulk serum igg . Fifth, as discussed in the next section, rabbits use different mechanisms to genetically generate and diversify their primary and secondary antibody repertoires compared to humans and mice, effectively creating a complementary set of binders for the discussed applications . The recent sequencing and annotation of the rabbit genome (orycun2.0 assembly) the development of the rabbit b - cell repertoire significantly differs from that of other mammals . The current model proposes a three - step process (figure 3) consisting of the neonatal b - cell repertoire generated by b lymphopoiesis in the fetal liver and omentum switching to bone marrow after birth, the primary pre - immune' b - cell repertoire evolving during the first 2 months after birth in gut - associated lymphoid tissue (galt) and the secondary immune' b - cell repertoire generated upon b - cell activation by immunogen binding . The neonatal b - cell repertoire starts developing between the second and third week of gestation . Interestingly, b lymphopoiesis is very limited in the bone marrow of adult rabbits, indicating that b lymphopoiesis is mainly restricted to early development . In addition, in a rabbit - to - rabbit adoptive transfer model, it was shown that rabbit b cells were able to engraft into host stem cell niches, which led to the conclusion that rabbit b cells are long - lived and potentially self - renewing and may thus sustain the rabbit antibody repertoire throughout a rabbit's lifetime . Rabbits mainly rearrange their heavy chains first followed by their light chains and thus follow the primary b - cell development pathway proposed by ehlich et al . In brief, this model proposes the vh jh recombination of the heavy chain, followed by its expression as a pre - b - cell receptor . Upon stimulation of the pre - b - cell receptor, vl some evidence for non - templated nucleotide - addition (also known as n - nucleotides) has been observed in rabbit vj rearrangements in 1-day - old rabbits, suggesting that terminal deoxynucleotidyl transferase was recently expressed . Although a potential pool of 200 vh genes are present for heavy - chain rearrangement, a majority of these are infrequently or not expressed . However, it is known that certain genes from these clusters are preferentially utilized: vh1, the most d - proximal vh gene, is present in 8090% of all heavy - chain gene rearrangements . Three different allotypes vha1, vha2 and vha3 are known, resulting in the vha - positive serotype . This finding was somewhat surprising, because there is another functional, d - proximal vh sequence significantly closer to the vh1 segment . Indeed, it could be shown that the vh4 segment is utilized in 8090% of the heavy - chain rearrangements in vh1-negative alicia strain rabbits . However, this heavy - chain rearrangement was very rare in adult rabbits, suggesting that the vh4 rearrangement is non - productive in most cases and thus lost in the course of development . . Suggested negative self - antigen effects and non - efficient pairing with light chains and surrogate light chains during b - cell development as possible reasons . In addition, preferential utilization of d2a, d2b and d1 as well as jh4 could be shown . It is thought that rabbits compensate for this preferential utilization of certain vh, d and jh genes in part by n - nucleotide addition at the vh d and d jh junctions during recombination . Using high - throughput sequencing of antibody repertoires from three new zealand white rabbits, lavinder et al . Determined that the means.d . Length of the third complementarity - determining region (cdr) of the heavy chain, which is known as hcdr3, includes both junctions, and thus is the most hypervariable of all six cdrs, is 154 (mode=13) amino acids compared to mouse and human hcdr3s with means.d . Lengths of 112 (mode=10 amino acids) and 154 (mode=15) amino acids, respectively . These findings confirmed that rabbit hcdr3s share more similarity with human hcdr3s than mouse hcdr3s and could be relevant for therapeutic applications . Although there is limited heavy - chain usage in the neonatal rabbits' b - cell repertoire, there may be compensation by usage of diverse light chains . There are two types of rabbit light chains and with the light chain present in two different isotypes called k1 and k2 . Four k1 -light - chain allotypes b4, b5, b6 and b9have been observed in domesticated rabbits . Notably, the constant domain sequences of these rabbit -light - chain allotypes have much higher amino - acid sequence diversity than human ig allotypes with pairwise amino - acid sequence differences of up to 40% . This high degree of polymorphism exceeds the allotypic diversity of the three heavy - chain allotypes, a1, a2 and a3 (~20% amino - acid sequence differences), and even surpasses the allotypic diversity of major histocompatibility complex loci . K1 is by far the most abundant isotype and represents between 70 and 90% of all light chains, whereas the rest is usually a mixture of both k2 and -light chains . Many k1 light chains are characterized by an intrachain disulfide bridge between cysteine 80 in v and cysteine 171 in c (figure 2). This additional disulfide bridge, which was discovered biochemically and later confirmed by x - ray crystallography, is not found in human or mouse light chains . It may contribute to the stability of rabbit antibodies and is one of many peculiarities of ig evolution in vertebrates . This disulfide bridge is absent from rabbits of the k1-negative basilea mutant strain that only expresses k2 and -light chains . Some but not all of the k1 light chains of rabbits homozygous for the b9 -light - chain allotype have a cysteine 108 in j that is thought to create an alternative intrachain disulfide bridge with cysteine 171 in c. these allotypes play an important role for the generation of rabbit mabs by phage display and are discussed in more detail below . Recently, using next - generation sequencing of rabbit antibody repertoires, kodangattil et al . Demonstrated that light - chain rearrangements are significantly more diverse than heavy - chain rearrangements in rabbits . In addition, the imprecise junction of vl and jl genes in rabbits encompasses particularly long stretches of n - nucleotides, resulting in, on average, longer lcdr3s (122 amino acids; mode=12) compared to mouse and human (91 amino acids; mode=9; figure 4). The longer rabbit lcdr3s are occasionally stabilized by disulfide bridges . Taken together, by generating a more diverse neonatal light - chain repertoire followed by a comparable degree of further diversification into primary and secondary light - chain repertoires, the light chain can compensate for the limited diversity of heavy - chain repertoires in rabbits . This may also explain the dominance of the rabbit light chain in general and lcdr3 in particular in several of the antibody / antigen complexes for which three - dimensional structures have been determined by x - ray crystallography . The limited neonatal antibody repertoire is further diversified between week 4 and 8 after birth resulting in the primary antibody repertoire . This postnatal diversification is an unusual phenomenon and has so far only been observed in rabbits and pigs . The two main mechanisms are somatic gene conversion (sgc; templated) and somatic hypermutation (shm; non - templated; figures 3 and 4). Sgc, predominantly used only in chicken and rabbit ig gene diversification, leads to the replacement of large nucleic acid sequence stretches with dna fragments from non - utilized vh genes . Thus, the non - expressible majority of vh genes play an important role for heavy - chain diversification . The predominance of this mechanism in rabbit (23%) compared to human (2.5%) and mouse (0.1%) heavy chains, as determined by high - throughput sequencing, is thought to lead to decreased wastage: a substantial portion of vh d jh recombinations with n - nucleotides addition have out - of - frame junctions, whereas sgc, a homologous dna recombination event, tends to favor in - frame substitutions and extensions . In addition, shm is observed at considerable levels during this developmental stage . Following rearrangement in the neonatal b - cell repertoire, rabbit light - chain genes also undergo sgc and shm to diversify the primary b - cell repertoire (figures 3 and 4). Further corroborating the importance of the light chain for generating diversity in rabbit antibody repertoires, tract length (8648 nucleotides) in rabbit -light chains compared to rabbit heavy chains . Interestingly, the generation of the primary repertoire is highly galt - dependent . In short, galt involves the uptake of pathogens from the gastrointestinal track by specialized epithelial cells known as m cells and the presentation of antigens to b cells leading to b - cell stimulation, diversification and proliferation . Surgical removal of galt tissues, such as the peyer's patches in the small intestines, the sacculus rotundus and the appendix resulted in severely immunodeficient rabbits . The secondary b - cell repertoire is generated upon antigen - dependent b - cell stimulation . Again, additional diversity is introduced by sgc and shm in both heavy and light chains (figures 3 and 4). These events further broaden the b - cell repertoire directed against a certain set of antigens associated with a specific pathogen . Notably, rabbits only have one igg isotype (one c gene) compared to four igg isotypes in mice (igg1, igg2a, igg2b and igg3) and humans (igg1, igg2, igg3 and igg4). In contrast, rabbits have 13 c genes giving rise to at least 10 functional iga isotypes, the most diverse iga system known, compared to just one iga isotype in mice and two in humans . Collectively, the unique features of b - cell ontogeny and antibody repertoire make rabbits a valuable source for the generation of antibodies of high affinity and specificity . The discovery and development of hybridoma technology for the generation of mabs by georges khler and csar milstein in 1975 has had a huge impact on biomedical research and its application to modern medicine . Hybridoma technology is a method to generate stable cell lines that constantly secret a defined mab . For this purpose, b cells derived from an immunized animal are fused with a myeloma cell line in the presence of polyethylene glycol . The hybridomas generated this way are cloned by limiting dilution, screened for favorable mab characteristics and then expanded in culture to obtain high amounts of the desired mab . Generally, two hybridoma types can be distinguished: first, homo - hybridomas where both host b cells and fusion cell line emerged from the same species and, second, hetero - hybridomas derived from two different species . Ever since their initial discovery, multiple aspects of the general technique have been modified in order to avoid certain problems related to fusion efficiency, hybridoma stability and mab titers . Hybridoma technology has been used extensively to generate thousands of different mabs against a wide variety of antigens . In fact, the majority of fda - approved chimeric, humanized and human mabs originate from hybridoma technology . However, all of these were derived from mouse b cells or transgenic mouse b cells with human ig genes . Due to the favorable properties of rabbit antibodies . Viral transformation of rabbit b cells to generate myeloma - like cell lines also proved to be difficult and rather inefficient . For these reasons, unfortunately, all hetero - hybridomas generated in the early days of hybridoma technology revealed poor fusion efficiency, genetic instability and impaired functional rabbit heavy- and light - chain pairings . In 1988, raybould et al . Mouse hetero - hybridoma by polyethylene glycol - mediated fusion of rabbit spleen b cells with the mouse myeloma cell line sp2/0-ag14 . Even though they observed stable rabbit igg expression for several months, other groups observed genetic instability and concomitant decrease of mab secretion . The first rabbit homo - hybridoma was developed in 1995 in the laboratory of katherine knight . In order to obtain a potential rabbit fusion cell line, transgenic rabbits were generated by single - cell zygote microinjection and mated to generate v - abl / c - myc double transgenic rabbits . This method led to the discovery of the first stable rabbit plasmacytoma cell line, 240e-1, which could be used as an efficient fusion partner to generate rabbit homo - hybridomas . Interestingly, spieker - polet et al . Also showed in this publication that b cells derived from different rabbit tissues led to the generation of hybridomas secreting different ratios of igg, igm and iga . However, the stability of the obtained homo - hybridomas was still a major concern and igg secretion decreased over time . Although this decay is frequently also observed for mouse homo - hybridomas, it appeared to be more drastic in the case of rabbit homo - hybridomas . For this reason, zhu and pytela attempted to further improve the initial 240e-1 cell line by iterative subcloning to screen for clones with higher fusion efficiency, yielding hybridomas with higher genetic stability and more stable rabbit igg secretion . The obtained fusion cell line 240e - w and its successors 240e - w2 and 240-w3, which are characterized by higher fusion efficiency and the absence of endogenous rabbit heavy- and light - chain secretion (us patent 7,429,487), are part of the proprietary rabmab platform of epitomics, inc . (now abcam, inc .) And were used to generate the therapeutic rabbit mabs sevacizumab and apx005 m discussed above . Aside from therapeutic applications, rabbit mabs generated by hybridoma technology have become highly valuable reagents for diagnostic applications and for laboratory research . For example, highly specific rabbit mabs can detect activating mutations in the tyrosine kinase domain of egfr by ihc of lung cancer tissues . Rabbit mabs against the hiv-1 protein gp120 were shown to mimic neutralizing human anti - hiv-1 gp120 mabs, promoting rabbit immunization as model for hiv-1 vaccine development . Bacteriophage, also simply known as phage, are viruses that infect and replicate within bacteria . Phage display was invented by george smith, who discovered that the minor coat protein (piii) of filamentous phage can be modified at its amino terminus to present peptide sequences without affecting phage infectivity . In addition, these phage particles contained the genomic information encoding the respectively modified coat protein, thus physically linking genotype and phenotype . A combination of phage selection and amplification could be used to efficiently enrich phage that contained certain peptide sequences . However, the incorporation of larger peptide sequences, protein domains or whole proteins represented a serious challenge due to decreasing infectivity . For this reason, two - component systems were developed that consisted of a phagemid encoding the piii fusion protein and a helper phage contributing the phage genome to encode all proteins necessary for generating infectious phage particles . Usually, these helper phage contain a modified packaging signal, leading to the preferential assembly of phage particles containing the phagemid . In the early 1990s, the first filamentous phage display antibody libraries based on piii fusion proteins were published using either scfv or fab fragments . To date, these formats are still dominating the selection of mabs by phage display . Although phage display was established with mouse and human antibody libraries to mine immune, naive and synthetic antibody repertoires, the fact that rabbit mabs were difficult to generate by hybridoma technology for a number of years provided a strong incentive for exploring the accessibility of rabbit immune antibody repertoires by phage display . The first rabbit antibody library selected by phage display was reported by ridder et al ., using a scfv format as in subsequent independent studies . Rabbit antibody libraries in fab format followed in short succession . Due to the higher expression levels of human compared to rabbit constant domains in bacteria, a chimeric rabbit / human fab format consisting of rabbit variable domains vl and vh recombinantly fused to human constant domains cl and ch1, respectively, proved particularly successful for the selection of rabbit mabs by phage display and their subsequent humanization (figure 5). However, the above - discussed intrachain disulfide bridge between cysteine 80 and cysteine 171 found in rabbit light chains of the dominating k1 isotype posed a challenge to the chimeric rabbit / human fab format as human ch1 does not harbor a cysteine 171 . In fact, only few fab originating from the k1 isotype were selected, indicating that the free thiol group of cysteine 80 is disfavored and that its presence diminishes the selectable diversity of chimeric rabbit / human fab . Indeed, chimeric rabbit / human fab derived by phage display from immunized k1-negative basilea strain rabbits revealed higher sequence diversity and higher affinity compared to those from k1-positive new zealand white strain rabbits immunized with the same immunogens . Interestingly, the same study by popkov et al . Also compared rabbits homozygous for the b9 -light - chain allotype (figure 1) with the presumed alternative intrachain disulfide bridge between cysteine 108 and cysteine 171 . Fusion of the rabbit v and human c encoding sequences in the generation of the chimeric rabbit / human fab library removes cysteine 108, thus avoiding the exposure of a free thiol group . Consequently, immunized b9 allotype rabbits also revealed superior selectable diversity and were subsequently used in several additional studies . These include the generation of a chimeric rabbit / human fab against the hiv-1 protein rev . The fab was able to invert rev polymerization and allowed for the formation of fab - rev co - crystals that could be analyzed with x - ray crystallography providing the first three - dimensional structure of rev and the first three - dimensional structure of a rabbit mab . Notably, the crystal structure revealed a dominant role for lcdr3 in the antigen - binding site (figure 6). A cyclic peptide derived from lcdr3 was shown to bind hiv-1 rev with high affinity and to potently inhibit rev polymerization, corroborating the functional importance of the above - discussed high sequence diversity of rabbit light chains . A key advantage of using the natural fab format for phage display is its robust monomeric nature that permits affinity - driven selections . By contrast, the unnatural scfv format has a tendency to dimerize, trimerize and tetramerize, potentially causing avidity - driven selections . Thus, we recommend using chimeric rabbit / human fab format - based phage display for applications that require rabbit mabs of high affinity . Even if the application calls for scfv, such as for the generation of intrabodies, the chimeric rabbit / human fab format has been used for selection by phage display followed by conversion to the rabbit scfv format . In addition to fab and scfv formats, single - domain antibody formats, that is, vl or vh alone, which due to their smaller sizes have advantages for certain applications, such as the recognition of cryptic epitopes, have also been engineered from rabbit mabs . The noted dominance of the rabbit light chain may make phage display of rabbit vl libraries particularly attractive . As discussed, hybridoma technology and phage display have distinct virtues and shortcomings that have fueled the development of alternative techniques to generate mabs . Unlike hybridoma technology, phage display relies on the proper transcription, translation, folding and assembly of light and heavy chains in bacteria . Also, a potential disadvantage of phage display, as well as other display technologies, is their combinatorial nature, leading to the random pairing of light and heavy chains . As discussed above, limiting factors encountered during hybridoma technology, at least initially, included fusion efficiency and hybridoma stability . Also, unlike mouse hybridoma technology, rabbit hybridoma technology was patented, imposing intellectual property restrictions that have contributed to the incentive of developing alternative methods . In the generation of human mabs, prominent alternative methods include the clonal expansion of b cells by, for example, epstein barr virus immortalization, and single b - cell sorting followed by light- and heavy - chain - encoding dna amplification and sequencing . Notably, like hybridoma technology but unlike phage display, both methods yield natural light- and heavy - chain pairs . Single b - cell isolation based on antigen capture by fluorescence - activated cell sorting, magnetic beads, solid - phase panning or hemolytic plaques followed by light- and heavy - chain cloning has also been applied to the generation of rabbit mabs from peripheral b cells, which does not require killing of the animal and allows for multiple sampling points from primary and secondary lymphoid tissues . Antigen capture - driven bulk spleen b - cell isolation from immunized rabbits followed by light- and heavy - chain - encoding dna amplification and their combinatorial assembly and expression in scfv fc or igg format in mammalian cells has also been reported . In the fluorescent foci method, plasma cells from rabbit bone marrow are identified by fluorescent microscopy, isolated and subjected to light- and heavy - chain - encoding dna amplification and sequencing . High - throughput dna sequencing technologies have been applied to the in silico generation of mabs as well as to the analysis of naive and immune antibody repertoires in different species . In the rabbit, high - throughput dna sequencing of b - cell repertoires along with mass spectrometry analysis of bulk serum igg has been used for the deconvolution of mabs . Interestingly, this method revealed that the serum igg response to an invertebrate protein following hyperimmunization was oligoclonal rather than polyclonal, comprising 34 rabbit mabs belonging to 30 distinct clonotypes . The discovery and development of hybridoma technology for the generation of mabs by georges khler and csar milstein in 1975 has had a huge impact on biomedical research and its application to modern medicine . Hybridoma technology is a method to generate stable cell lines that constantly secret a defined mab . For this purpose, b cells derived from an immunized animal are fused with a myeloma cell line in the presence of polyethylene glycol . The hybridomas generated this way are cloned by limiting dilution, screened for favorable mab characteristics and then expanded in culture to obtain high amounts of the desired mab . Generally, two hybridoma types can be distinguished: first, homo - hybridomas where both host b cells and fusion cell line emerged from the same species and, second, hetero - hybridomas derived from two different species . Ever since their initial discovery, multiple aspects of the general technique have been modified in order to avoid certain problems related to fusion efficiency, hybridoma stability and mab titers . Hybridoma technology has been used extensively to generate thousands of different mabs against a wide variety of antigens . In fact, the majority of fda - approved chimeric, humanized and human mabs originate from hybridoma technology . However, all of these were derived from mouse b cells or transgenic mouse b cells with human ig genes . Due to the favorable properties of rabbit antibodies . Viral transformation of rabbit b cells to generate myeloma - like cell lines also proved to be difficult and rather inefficient . For these reasons, unfortunately, all hetero - hybridomas generated in the early days of hybridoma technology revealed poor fusion efficiency, genetic instability and impaired functional rabbit heavy- and light - chain pairings . In 1988, raybould et al . Mouse hetero - hybridoma by polyethylene glycol - mediated fusion of rabbit spleen b cells with the mouse myeloma cell line sp2/0-ag14 . Even though they observed stable rabbit igg expression for several months, other groups observed genetic instability and concomitant decrease of mab secretion . The first rabbit homo - hybridoma was developed in 1995 in the laboratory of katherine knight . In order to obtain a potential rabbit fusion cell line, transgenic rabbits were generated by single - cell zygote microinjection and mated to generate v - abl / c - myc double transgenic rabbits . This method led to the discovery of the first stable rabbit plasmacytoma cell line, 240e-1, which could be used as an efficient fusion partner to generate rabbit homo - hybridomas . Interestingly, spieker - polet et al . Also showed in this publication that b cells derived from different rabbit tissues led to the generation of hybridomas secreting different ratios of igg, igm and iga . However, the stability of the obtained homo - hybridomas was still a major concern and igg secretion decreased over time . Although this decay is frequently also observed for mouse homo - hybridomas, it appeared to be more drastic in the case of rabbit homo - hybridomas . For this reason, zhu and pytela attempted to further improve the initial 240e-1 cell line by iterative subcloning to screen for clones with higher fusion efficiency, yielding hybridomas with higher genetic stability and more stable rabbit igg secretion . The obtained fusion cell line 240e - w and its successors 240e - w2 and 240-w3, which are characterized by higher fusion efficiency and the absence of endogenous rabbit heavy- and light - chain secretion (us patent 7,429,487), are part of the proprietary rabmab platform of epitomics, inc . (now abcam, inc .) And were used to generate the therapeutic rabbit mabs sevacizumab and apx005 m discussed above . Aside from therapeutic applications, rabbit mabs generated by hybridoma technology have become highly valuable reagents for diagnostic applications and for laboratory research . For example, highly specific rabbit mabs can detect activating mutations in the tyrosine kinase domain of egfr by ihc of lung cancer tissues . Rabbit mabs against the hiv-1 protein gp120 were shown to mimic neutralizing human anti - hiv-1 gp120 mabs, promoting rabbit immunization as model for hiv-1 vaccine development . Bacteriophage, also simply known as phage, are viruses that infect and replicate within bacteria . Phage display was invented by george smith, who discovered that the minor coat protein (piii) of filamentous phage can be modified at its amino terminus to present peptide sequences without affecting phage infectivity . In addition, these phage particles contained the genomic information encoding the respectively modified coat protein, thus physically linking genotype and phenotype . A combination of phage selection and amplification could be used to efficiently enrich phage that contained certain peptide sequences . However, the incorporation of larger peptide sequences, protein domains or whole proteins represented a serious challenge due to decreasing infectivity . For this reason, two - component systems were developed that consisted of a phagemid encoding the piii fusion protein and a helper phage contributing the phage genome to encode all proteins necessary for generating infectious phage particles . Usually, these helper phage contain a modified packaging signal, leading to the preferential assembly of phage particles containing the phagemid . In the early 1990s, the first filamentous phage display antibody libraries based on piii fusion proteins were published using either scfv or fab fragments . To date although phage display was established with mouse and human antibody libraries to mine immune, naive and synthetic antibody repertoires, the fact that rabbit mabs were difficult to generate by hybridoma technology for a number of years provided a strong incentive for exploring the accessibility of rabbit immune antibody repertoires by phage display . The first rabbit antibody library selected by phage display was reported by ridder et al ., using a scfv format as in subsequent independent studies . Rabbit antibody libraries in fab format followed in short succession . Due to the higher expression levels of human compared to rabbit constant domains in bacteria, a chimeric rabbit / human fab format consisting of rabbit variable domains vl and vh recombinantly fused to human constant domains cl and ch1, respectively, proved particularly successful for the selection of rabbit mabs by phage display and their subsequent humanization (figure 5). However, the above - discussed intrachain disulfide bridge between cysteine 80 and cysteine 171 found in rabbit light chains of the dominating k1 isotype posed a challenge to the chimeric rabbit / human fab format as human ch1 does not harbor a cysteine 171 . In fact, only few fab originating from the k1 isotype were selected, indicating that the free thiol group of cysteine 80 is disfavored and that its presence diminishes the selectable diversity of chimeric rabbit / human fab . Indeed, chimeric rabbit / human fab derived by phage display from immunized k1-negative basilea strain rabbits revealed higher sequence diversity and higher affinity compared to those from k1-positive new zealand white strain rabbits immunized with the same immunogens . Interestingly, the same study by popkov et al . Also compared rabbits homozygous for the b9 -light - chain allotype (figure 1) with the presumed alternative intrachain disulfide bridge between cysteine 108 and cysteine 171 . Fusion of the rabbit v and human c encoding sequences in the generation of the chimeric rabbit / human fab library removes cysteine 108, thus avoiding the exposure of a free thiol group . Consequently, immunized b9 allotype rabbits also revealed superior selectable diversity and were subsequently used in several additional studies . These include the generation of a chimeric rabbit / human fab against the hiv-1 protein rev . The fab was able to invert rev polymerization and allowed for the formation of fab - rev co - crystals that could be analyzed with x - ray crystallography providing the first three - dimensional structure of rev and the first three - dimensional structure of a rabbit mab . Notably, the crystal structure revealed a dominant role for lcdr3 in the antigen - binding site (figure 6). A cyclic peptide derived from lcdr3 was shown to bind hiv-1 rev with high affinity and to potently inhibit rev polymerization, corroborating the functional importance of the above - discussed high sequence diversity of rabbit light chains . A key advantage of using the natural fab format for phage display is its robust monomeric nature that permits affinity - driven selections . By contrast, the unnatural scfv format has a tendency to dimerize, trimerize and tetramerize, potentially causing avidity - driven selections . Thus, we recommend using chimeric rabbit / human fab format - based phage display for applications that require rabbit mabs of high affinity . Even if the application calls for scfv, such as for the generation of intrabodies, the chimeric rabbit / human fab format has been used for selection by phage display followed by conversion to the rabbit scfv format . In addition to fab and scfv formats, single - domain antibody formats, that is, vl or vh alone, which due to their smaller sizes have advantages for certain applications, such as the recognition of cryptic epitopes, have also been engineered from rabbit mabs . The noted dominance of the rabbit light chain may make phage display of rabbit vl libraries particularly attractive . As discussed, hybridoma technology and phage display have distinct virtues and shortcomings that have fueled the development of alternative techniques to generate mabs . Unlike hybridoma technology, phage display relies on the proper transcription, translation, folding and assembly of light and heavy chains in bacteria . Also, a potential disadvantage of phage display, as well as other display technologies, is their combinatorial nature, leading to the random pairing of light and heavy chains . As discussed above, limiting factors encountered during hybridoma technology, at least initially, included fusion efficiency and hybridoma stability . Also, unlike mouse hybridoma technology, rabbit hybridoma technology was patented, imposing intellectual property restrictions that have contributed to the incentive of developing alternative methods . In the generation of human mabs, prominent alternative methods include the clonal expansion of b cells by, for example, epstein barr virus immortalization, and single b - cell sorting followed by light- and heavy - chain - encoding dna amplification and sequencing . Notably, like hybridoma technology but unlike phage display, both methods yield natural light- and heavy - chain pairs . Single b - cell isolation based on antigen capture by fluorescence - activated cell sorting, magnetic beads, solid - phase panning or hemolytic plaques followed by light- and heavy - chain cloning has also been applied to the generation of rabbit mabs from peripheral b cells, which does not require killing of the animal and allows for multiple sampling points from primary and secondary lymphoid tissues . Antigen capture - driven bulk spleen b - cell isolation from immunized rabbits followed by light- and heavy - chain - encoding dna amplification and their combinatorial assembly and expression in scfv fc or igg format in mammalian cells has also been reported . In the fluorescent foci method, plasma cells from rabbit bone marrow are identified by fluorescent microscopy, isolated and subjected to light- and heavy - chain - encoding dna amplification and sequencing . High - throughput dna sequencing technologies have been applied to the in silico generation of mabs as well as to the analysis of naive and immune antibody repertoires in different species . In the rabbit, high - throughput dna sequencing of b - cell repertoires along with mass spectrometry analysis of bulk interestingly, this method revealed that the serum igg response to an invertebrate protein following hyperimmunization was oligoclonal rather than polyclonal, comprising 34 rabbit mabs belonging to 30 distinct clonotypes . The human immune system is intended to recognize and selectively remove potentially pathogenic organisms and substances . The respective immune responses are characterized by high titers of human antibodies directed against these foreign antibody sequences . This has two main physiological consequences; first of all, it leads to side effects comparable to allergic reactions of different levels of severity and, second, it leads to the rapid elimination of the administered mab, thus limiting its diagnostic or therapeutic efficacy . For these reasons, nonhuman mabs are now routinely converted to chimeric mabs by combining the nonhuman variable domains with human constant domains and further to humanized mabs by grafting all or some of the cdrs of the nonhuman variable domains into human frameworks . The first chimeric and humanized rabbit mabs were reported by rader et al . In this study, chimeric rabbit / human fab selected by phage display were humanized by grafting the six rabbit cdrs, three from each light and heavy chain, into human frameworks that were diversified at certain positions to allow the selection of either human or rabbit residues by phage display . The resulting humanized rabbit mabs retained the high affinity and specificity of their parental mabs . As discussed above, aside from having higher utility for downstream clinical applications, using chimeric rabbit / human fab format for phage display has the added advantage of affording higher expression levels in bacteria and, concomitantly, higher display levels on phage . Since this first report, a number of additional humanized rabbit mabs have been published and patented . In general, humanization strategies that have worked for mouse mabs also work for rabbit mabs, whether it is by rational design, directed evolution or a combination of both . As is the case for mouse mabs, grafting of all six cdrs followed by iterative fine - tuning of framework residues is the most frequently used method for humanizing rabbit mabs . Used a general acceptor framework for the humanization of rabbit scfv . In this study, a certain human framework carrying five specific human - to - rabbit mutations was able to generate humanized rabbit mabs to two different antigens with conserved affinities and specificities, and improved biophysical properties . Humanization strategies that confine the content of parental rabbit antibody sequences only to the most hypervariable of the cdrs, such as lcdr3 and hcdr3, have also been successfully applied to rabbit mabs . Thus far, there have been no reports that analyze the immunogenicity of clinically investigated humanized rabbit mabs . Recent studies indicate that patients can still mount an immune response to humanized or even fully human mabs . These findings indicate that additional aspects, such as idiotype, allotype, glycosylation and aggregation, contribute to the immunogenicity of mabs . Nonetheless, the occurrence of these unwanted side effects is significantly lower than previously observed for nonhuman antibodies . Driven by the success of rabbit pabs on one hand and mouse mabs on the other hand, rabbit mabs have become highly successful reagents for laboratory research and for diagnostic and therapeutic applications . The unique ontogeny of rabbit b cells affords highly distinctive antibody repertoires rich in in vivo pruned binders of high diversity, affinity and specificity . The ability to access rabbit antibody repertoires by hybridoma technology, phage display and alternative methods has fueled the increased use of rabbit mabs in many different applications . Rabbit mabs generated by hybridoma technology are particularly attractive for ihc, with many studies demonstrating higher sensitivity compared to benchmark mouse mabs . Rabbit mabs generated by phage display have found the use for applications ranging from the detection of uranium in water to chimeric antigen receptor t cell therapy of cancer . Given that humanization strategies are now well established, the therapeutic utility of rabbit mabs is especially intriguing . With the first rabbit mab - derived therapeutics already in clinical trials, we predict that rabbit mabs will gain further traction in preclinical and clinical pipelines over the next decade. |
All animal procedures were performed in accordance with the arvo statement for the use of animals in ophthalmic and vision research and were approved by the baylor scott & white institutional animal care and use committee . Domestic male pigs (812 weeks old, 811 kg) were purchased from real farms (san antonio, tx, usa). Diabetes (i.e., chronic hyperglycemia) was induced by selective ablation of pancreatic -cells with intravenous injection of streptozocin (stz; zanosar, 150 mg / kg in saline) via an ear vein (22 pigs) as described in detail in our previous study . The control group was injected intravenously with saline instead of stz (14 pigs). An additional group of nondiabetic pigs without saline injection was used for the acute hyperglycemia study in vitro as described below (24 pigs). Following stz or saline (control) injection, the animals were allowed free access to water and fed with syrup mixed with hog chow to prevent temporary hypoglycemia for 24 hours after stz injection . The animals were allowed free access to water and commercial diet thereafter . The general condition, body weight, and level of blood glucose were closely monitored in all pigs, and only those that had sustained hyperglycemia with a fasting blood glucose level between 250 and 540 mg / dl were included in the study . Fasting blood glucose levels were obtained each day in the morning using a bayer contour glucometer (bayer corporation, pittsburgh, pa, usa). Following the 2-week time period, pigs were sedated with telazol (48 mg / kg, intramuscularly), anesthetized with 2% to 4% isoflurane, and intubated . The techniques used for identification, isolation, cannulation, pressurization, and visualization of the retinal vasculature have been described previously . In brief, the isolated retinal arterioles (4060 m in situ diameter) were cannulated with a pair of glass micropipettes containing a physiologic salt solution (pss; in mm: nacl 145.0, kcl 4.7, cacl2 2.0, mgso4 1.17, nah2po4 1.2, pyruvate 2.0, edta 0.02, and mops 3.0) with normal 5 mm d - glucose and 1% albumin . For some vessels, the d - glucose was increased to 25 mm in the pss . The increased osmolarity in this solution was balanced to 290 mosm by reducing the nacl concentration . The vessels then were pressurized to 55 cm h2o intraluminal pressure without flow by two independent pressure reservoir systems . Cannulated, pressurized arterioles were bathed in pss - albumin at 36 to 37c to allow the development of basal tone . To evaluate the effect of chronic hyperglycemia on vasomotor function, endothelium - dependent vasodilation to bradykinin (1 pm to 1 nm) and endothelium - independent vasodilation to sodium nitroprusside (snp; 1 nm to 10 m) were established in vessels isolated from the 2-week diabetic and saline - control pigs . Vessels were exposed to each concentration of agonist for 4 to 5 minutes until a stable diameter was maintained . To assess the involvement of stress - activated kinases in the chronic hyperglycemia - induced effect, the vasodilator responses were examined following intraluminal treatment of vessels with jnk inhibitor sp600125 (5 m), jnk - interacting protein-1 (jip1) inhibitor bi-78d3 (7 m; bio - techne / tocris, minneapolis, mn, usa), or p38 kinase inhibitor sb203580 (0.1 m; emd millipore, billerica, ma, usa) for 2 hours . For some vessels, the contribution of no in the vasodilation to bradykinin was evaluated in the presence of nos inhibitor n - nitro - l - arginine methyl ester (l - name; 10 m, 40-minute incubation) with or without stress - activated kinase inhibitor treatment . The acute effect of high glucose on vasodilations to bradykinin and snp was evaluated in vitro after intraluminal incubation of vessels from nondiabetic pigs with 25 mm d - glucose or 5 mm d - glucose for 2 hours . The impact of stress - activated kinases on the no - mediated vasodilator responses was evaluated following co - incubation of 25 mm glucose with sp600125, bi-78d3, or sb203580 for 2 hours . In some vessels, the contribution of no was examined in the presence of a stress - activated kinase inhibitor by adding l - name (10 m, 40-minute incubation). Bradykinin, snp, and l - name were dissolved in pss, whereas sp600125, bi-78d3, and sb203580 were dissolved in dimethyl sulfoxide (dmso). The final concentrations of dmso in the vessel lumen did not exceed 0.07% by volume . The 0.07% dmso had no significant effect on vessel viability, vasodilator responses, or maintenance of tone (data not shown). At the end of each experiment, the maximum diameter of the vessels was obtained at 0.1 mm snp in the presence of calcium - free pss with edta (1 mm). Diameter changes in response to vasodilator agonists were normalized to this maximum vasodilation and expressed as percentage maximum dilation . Data are reported as mean sem and n value represents the number of vessels (1 per pig per treatment group) studied . Student's t - test or anova followed by bonferroni multiple - range test was used to determine the significance of experimental interventions, as appropriate . A value of p <0.05 was considered significant . All animal procedures were performed in accordance with the arvo statement for the use of animals in ophthalmic and vision research and were approved by the baylor scott & white institutional animal care and use committee . Domestic male pigs (812 weeks old, 811 kg) were purchased from real farms (san antonio, tx, usa). Diabetes (i.e., chronic hyperglycemia) was induced by selective ablation of pancreatic -cells with intravenous injection of streptozocin (stz; zanosar, 150 mg / kg in saline) via an ear vein (22 pigs) as described in detail in our previous study . The control group was injected intravenously with saline instead of stz (14 pigs). An additional group of nondiabetic pigs without saline injection was used for the acute hyperglycemia study in vitro as described below (24 pigs). Following stz or saline (control) injection, the animals were allowed free access to water and fed with syrup mixed with hog chow to prevent temporary hypoglycemia for 24 hours after stz injection . The animals were allowed free access to water and commercial diet thereafter . The general condition, body weight, and level of blood glucose were closely monitored in all pigs, and only those that had sustained hyperglycemia with a fasting blood glucose level between 250 and 540 mg / dl were included in the study . Fasting blood glucose levels were obtained each day in the morning using a bayer contour glucometer (bayer corporation, pittsburgh, pa, usa). Following the 2-week time period, pigs were sedated with telazol (48 mg / kg, intramuscularly), anesthetized with 2% to 4% isoflurane, and intubated . The techniques used for identification, isolation, cannulation, pressurization, and visualization of the retinal vasculature have been described previously . In brief, the isolated retinal arterioles (4060 m in situ diameter) were cannulated with a pair of glass micropipettes containing a physiologic salt solution (pss; in mm: nacl 145.0, kcl 4.7, cacl2 2.0, mgso4 1.17, nah2po4 1.2, pyruvate 2.0, edta 0.02, and mops 3.0) with normal 5 mm d - glucose and 1% albumin . For some vessels, the d - glucose was increased to 25 mm in the pss . The increased osmolarity in this solution was balanced to 290 mosm by reducing the nacl concentration . The vessels then were pressurized to 55 cm h2o intraluminal pressure without flow by two independent pressure reservoir systems . Cannulated, pressurized arterioles were bathed in pss - albumin at 36 to 37c to allow the development of basal tone . To evaluate the effect of chronic hyperglycemia on vasomotor function, endothelium - dependent vasodilation to bradykinin (1 pm to 1 nm) and endothelium - independent vasodilation to sodium nitroprusside (snp; 1 nm to 10 m) were established in vessels isolated from the 2-week diabetic and saline - control pigs . Vessels were exposed to each concentration of agonist for 4 to 5 minutes until a stable diameter was maintained . To assess the involvement of stress - activated kinases in the chronic hyperglycemia - induced effect, the vasodilator responses were examined following intraluminal treatment of vessels with jnk inhibitor sp600125 (5 m), jnk - interacting protein-1 (jip1) inhibitor bi-78d3 (7 m; bio - techne / tocris, minneapolis, mn, usa), or p38 kinase inhibitor sb203580 (0.1 m; emd millipore, billerica, ma, usa) for 2 hours . For some vessels, the contribution of no in the vasodilation to bradykinin was evaluated in the presence of nos inhibitor n - nitro - l - arginine methyl ester (l - name; 10 m, 40-minute incubation) with or without stress - activated kinase inhibitor treatment . The acute effect of high glucose on vasodilations to bradykinin and snp was evaluated in vitro after intraluminal incubation of vessels from nondiabetic pigs with 25 mm d - glucose or 5 mm d - glucose for 2 hours . The impact of stress - activated kinases on the no - mediated vasodilator responses was evaluated following co - incubation of 25 mm glucose with sp600125, bi-78d3, or sb203580 for 2 hours . In some vessels, the contribution of no was examined in the presence of a stress - activated kinase inhibitor by adding l - name (10 m, 40-minute incubation). (st . Louis, mo, usa) except as specifically stated . Bradykinin, snp, and l - name were dissolved in pss, whereas sp600125, bi-78d3, and sb203580 were dissolved in dimethyl sulfoxide (dmso). The final concentrations of dmso in the vessel lumen did not exceed 0.07% by volume . The 0.07% dmso had no significant effect on vessel viability, vasodilator responses, or maintenance of tone (data not shown). At the end of each experiment, the maximum diameter of the vessels was obtained at 0.1 mm snp in the presence of calcium - free pss with edta (1 mm). Diameter changes in response to vasodilator agonists were normalized to this maximum vasodilation and expressed as percentage maximum dilation . Data are reported as mean sem and n value represents the number of vessels (1 per pig per treatment group) studied . Student's t - test or anova followed by bonferroni multiple - range test was used to determine the significance of experimental interventions, as appropriate . A value of p <0.05 was considered significant . Two weeks following stz injection, blood glucose levels in pigs elevated from 85 6 (4.7 0.3 mm) to 471 23 (26.2 1.3 mm) mg / dl, and the body weight increased from 11.1 0.4 to 14.7 0.6 kg . Pigs injected with saline (control) had unaltered blood glucose levels after 2 weeks, 77 6 (4.3 0.4 mm) vs. 79 5 (4.4 0.3 mm) mg / dl, and the body weight increased from 10.3 0.6 to 17.1 1.4 kg . The weight gain was significantly greater for control than diabetic pigs (control, 6.8 1.0 kg versus diabetes, 3.7 0.5 kg). Retinal arterioles from control and diabetic pigs developed a comparable level of basal tone (control, 49 2% of maximum diameter, 97 3 m versus diabetes, 48 1% of maximum diameter, 97 2 m; p = 0.55), but the concentration - dependent dilation to bradykinin was significantly less in arterioles from diabetic pigs (fig . The maximum dilation to bradykinin at 1 nm was 37 4% in diabetic vessels and 71 5% in control vessels . In the presence of nos inhibitor l - name, 1). The l - name treatment did not alter basal tone (data not shown). Concentration - dependent dilation of isolated retinal arterioles to bradykinin was examined in the absence or presence of nos inhibitor l - name after 2 weeks of euglycemia (control; n = 6) or hyperglycemia (diabetes; n = 9) in pigs . * incubation of diabetic vessels with jnk inhibitor sp600125 or with jip1 inhibitor bi-78d3 restored the vasodilator response to bradykinin (fig . By contrast, p38 kinase inhibitor sb203580 did not affect the vasodilations to bradykinin (fig . The restored bradykinin - induced vasodilations by sp600125 or bi-78d3 were significantly reduced by l - name (fig . For control vessels, the sp600125, bi-78d3, and sb203580 treatments did not alter the bradykinin - induced vasodilations (data not shown). Blockade of jnk activation reverses chronic hyperglycemia - induced reduction of retinal arteriolar dilation to bradykinin . (a) dilation of retinal arterioles to bradykinin was examined after 2 weeks of euglycemia (control; n = 10) or hyperglycemia (diabetes; n = 18) in pigs in the absence or presence of jnk inhibitor sp600125 (n = 9), jip1 inhibitor bi-78d3 (n = 6), or p38 inhibitor sb203580 (n = 6). (b) dilation of retinal arterioles to bradykinin from diabetic pigs was examined in the presence of sp600125 (n = 4) or bi-78d3 (n = 6) before and after treatment with l - name . * p <0.05 versus diabetes / sp600125 or diabetes / bi-78d3 . The retinal arterioles isolated from the nondiabetic pigs developed a comparable level of basal tone after intraluminal exposure to normal glucose (ng; 5 mm) or high glucose (hg; 25 mm) for 2 hours (ng, 50 2% of maximum diameter versus hg, 49 3% of maximum diameter, p = 0.85). Concentration - dependent dilation to bradykinin was significantly less in arterioles with intraluminal exposure to hg (fig . The maximum dilation to bradykinin at 1 nm was 34 10% in hg - treated vessels and 69 7% in ng - treated vessels . These vasodilator responses in hg- and ng - treated vessels were almost completely eliminated in the presence of l - name (fig . Dilation of retinal arterioles to bradykinin was examined in the absence or presence of l - name after 2-hour intraluminal exposure in vitro to ng (5 mm; n = 6) or hg (25 mm; n = 6). * p <0.05 versus ng (5 mm); #p <0.05 versus ng (5 mm) or hg (25 mm). Incubation of hg - treated vessels with sp600125 or bi-78d3 but not sb203580 preserved the vasodilator response to bradykinin (fig . 4a) without altering basal tone (data not shown). These preserved vasodilations were attenuated in a similar manner by l - name (fig ., the sp600125 and bi-78d3 treatments did not alter the bradykinin - induced vasodilations (data not shown). Blockade of jnk activation prevents acute hyperglycemia - induced reduction of retinal arteriolar dilation to bradykinin . (a) dilation of retinal arterioles to bradykinin was examined after 2-hour intraluminal exposure in vitro to ng (5 mm; n = 19) or hg (25 mm; n = 22) in the absence or presence of sp600125 (n = 8), bi-78d3 (n = 11), or sb203580 (n = 5). * p <0.05 versus ng (5 mm). (b) dilation of retinal arterioles to bradykinin was examined following exposure to hg in the presence of sp600125 (n = 5) or bi-78d3 (n = 5) before and after treatment with l - name . * p <0.05 versus hg / sp600125 or hg / bi-78d3 . Retinal arterioles from nondiabetic (control) and diabetic pigs dilated in a comparable manner to endothelium - independent no donor snp with maximum dilation of approximately 70% at 10 m (fig . 5). This vasodilator response also was similar between ng- and hg - treated vessels (fig . Concentration - dependent vasodilation to snp was examined after 2 weeks of euglycemia (control; n = 5) or hyperglycemia (diabetes; n = 5) in pigs or after 2-hour intraluminal exposure in vitro to ng (5 mm; n = 5) or hg (25 mm; n = 5). Two weeks following stz injection, blood glucose levels in pigs elevated from 85 6 (4.7 0.3 mm) to 471 23 (26.2 1.3 mm) mg / dl, and the body weight increased from 11.1 0.4 to 14.7 0.6 kg . Pigs injected with saline (control) had unaltered blood glucose levels after 2 weeks, 77 6 (4.3 0.4 mm) vs. 79 5 (4.4 0.3 mm) mg / dl, and the body weight increased from 10.3 0.6 to 17.1 1.4 kg . The weight gain was significantly greater for control than diabetic pigs (control, 6.8 1.0 kg versus diabetes, 3.7 0.5 kg). Retinal arterioles from control and diabetic pigs developed a comparable level of basal tone (control, 49 2% of maximum diameter, 97 3 m versus diabetes, 48 1% of maximum diameter, 97 2 m; p = 0.55), but the concentration - dependent dilation to bradykinin was significantly less in arterioles from diabetic pigs (fig . The maximum dilation to bradykinin at 1 nm was 37 4% in diabetic vessels and 71 5% in control vessels . In the presence of nos inhibitor l - name, 1). The l - name treatment did not alter basal tone (data not shown). Concentration - dependent dilation of isolated retinal arterioles to bradykinin was examined in the absence or presence of nos inhibitor l - name after 2 weeks of euglycemia (control; n = 6) or hyperglycemia (diabetes; n = 9) in pigs . * p <0.05 versus control; #p <0.05 versus control or diabetes . Incubation of diabetic vessels with jnk inhibitor sp600125 or with jip1 inhibitor bi-78d3 restored the vasodilator response to bradykinin (fig . By contrast, p38 kinase inhibitor sb203580 did not affect the vasodilations to bradykinin (fig . The restored bradykinin - induced vasodilations by sp600125 or bi-78d3 were significantly reduced by l - name (fig ., the sp600125, bi-78d3, and sb203580 treatments did not alter the bradykinin - induced vasodilations (data not shown). Blockade of jnk activation reverses chronic hyperglycemia - induced reduction of retinal arteriolar dilation to bradykinin . (a) dilation of retinal arterioles to bradykinin was examined after 2 weeks of euglycemia (control; n = 10) or hyperglycemia (diabetes; n = 18) in pigs in the absence or presence of jnk inhibitor sp600125 (n = 9), jip1 inhibitor bi-78d3 (n = 6), or p38 inhibitor sb203580 (n = 6). * p <0.05 versus control . (b) dilation of retinal arterioles to bradykinin from diabetic pigs was examined in the presence of sp600125 (n = 4) or bi-78d3 (n = 6) before and after treatment with l - name . The retinal arterioles isolated from the nondiabetic pigs developed a comparable level of basal tone after intraluminal exposure to normal glucose (ng; 5 mm) or high glucose (hg; 25 mm) for 2 hours (ng, 50 2% of maximum diameter versus hg, 49 3% of maximum diameter, p = 0.85). Concentration - dependent dilation to bradykinin was significantly less in arterioles with intraluminal exposure to hg (fig . The maximum dilation to bradykinin at 1 nm was 34 10% in hg - treated vessels and 69 7% in ng - treated vessels . These vasodilator responses in hg- and ng - treated vessels were almost completely eliminated in the presence of l - name (fig . Dilation of retinal arterioles to bradykinin was examined in the absence or presence of l - name after 2-hour intraluminal exposure in vitro to ng (5 mm; n = 6) or hg (25 mm; n = 6). * p <0.05 versus ng (5 mm); #p <0.05 versus ng (5 mm) or hg (25 mm). Incubation of hg - treated vessels with sp600125 or bi-78d3 but not sb203580 preserved the vasodilator response to bradykinin (fig . 4a) without altering basal tone (data not shown). These preserved vasodilations were attenuated in a similar manner by l - name (fig ., the sp600125 and bi-78d3 treatments did not alter the bradykinin - induced vasodilations (data not shown). Blockade of jnk activation prevents acute hyperglycemia - induced reduction of retinal arteriolar dilation to bradykinin . (a) dilation of retinal arterioles to bradykinin was examined after 2-hour intraluminal exposure in vitro to ng (5 mm; n = 19) or hg (25 mm; n = 22) in the absence or presence of sp600125 (n = 8), bi-78d3 (n = 11), or sb203580 (n = 5). * p <0.05 versus ng (5 mm). (b) dilation of retinal arterioles to bradykinin was examined following exposure to hg in the presence of sp600125 (n = 5) or bi-78d3 (n = 5) before and after treatment with l - name . Retinal arterioles from nondiabetic (control) and diabetic pigs dilated in a comparable manner to endothelium - independent no donor snp with maximum dilation of approximately 70% at 10 m (fig . 5). This vasodilator response also was similar between ng- and hg - treated vessels (fig . Concentration - dependent vasodilation to snp was examined after 2 weeks of euglycemia (control; n = 5) or hyperglycemia (diabetes; n = 5) in pigs or after 2-hour intraluminal exposure in vitro to ng (5 mm; n = 5) or hg (25 mm; n = 5). This study showed that exposure of porcine retinal arterioles to chronic hyperglycemia in vivo or acute hyperglycemia in vitro selectively diminished endothelium - dependent no - mediated dilation to bradykinin . Pharmacologic inhibition of stress - activated kinase jnk and its upstream interaction with jip1 preserved retinal vasodilator function related to endothelial no . It appears that jip1/jnk signaling contributes directly to the impairment of endothelium - dependent no - mediated dilation of retinal arterioles following acute and chronic hyperglycemia . The current findings corroborated our previous report on selective impairment of endothelium - dependent dilation of retinal arterioles to bradykinin within 2 weeks of diabetes in pigs . This relatively rapid onset of endothelial vasodilator dysfunction in the pig model is consistent with previous evidence showing diminished increase in retinal blood flow following intravitreal administration of endothelial agonist acetylcholine in 2-week diabetic rats . However, these earlier studies did not investigate whether the endothelial impairment was a result of diminished nos activation . We tested this possibility by treating the isolated retinal arterioles with nonselective nos inhibitor l - name after 2 weeks of diabetes, and this series of experiments nearly abolished the remaining vasodilation to bradykinin . Because l - name also completely blocked the dilation of retinal arterioles from 2-week control pigs, it is likely that chronic hyperglycemia in vivo attenuates the ability of the endothelium in these vessels to produce and/or release no via nos . The sources of no production within the retina include neuronal nos (nnos) and inducible nos (inos) in the perivascular tissue, and endothelial nos (enos) in blood vessels . All three isoforms of nos have been shown to contribute to regulation of retinal arteriolar tone under physiologic conditions . The activation of inos and nnos in the perivascular retina during exposure to acute hypoxia (5 minutes) in pigs and flickering light stimulation in cats, respectively, promotes dilation of retinal arterioles . Interestingly, these vasodilator responses have been shown to be diminished in diabetic patients with and without retinopathy . Because bradykinin elicits endothelium - dependent dilation of porcine retinal arterioles and it predominantly activates enos in cultured endothelial cells, we believe that hyperglycemia can impair enos activation in the endothelium of arterioles . Although our studies used an isolated vessel preparation devoid of perivascular retinal tissue, the results do not exclude the possible contribution of inos and nnos to the vascular impact of diabetes / hyperglycemia in vivo . To demonstrate whether the endothelium of retinal arterioles is sensitive to hyperglycemia per se, we exposed these vessels to high glucose intraluminally in vitro . Within 2 hours of exposure to high glucose, the bradykinin - induced dilation of retinal arterioles was reduced to a similar level observed following 2 weeks of hyperglycemia in vivo . Notably, the high glucose concentration of 25 mm was comparable to the average glucose level in the diabetic pigs . In addition, osmolarity was maintained at a normal level in the high glucose - treated vessels to obviate the potential impact of hyperosmolarity on endothelial vasodilator function and basal tone, as well as stress - activated kinases . The complete blockade of the dilation of retinal arterioles to bradykinin by l - name in the presence of high glucose indicates that short - term hyperglycemia can directly impair endothelial no function without triggering the activation of compensatory vasodilator mechanisms under these conditions . Because endothelium - independent vasodilation to no donor snp was unaltered following the 2-hour high glucose exposure, the ability of the smooth muscle to relax in response to no appears to have remained intact . Therefore, the detrimental effect of acute hyperglycemia was selective for the impairment of no synthesis / release from the endothelium . Taken together, our findings directly support the notion that acute or chronic hyperglycemia for up to 2 weeks reduces the endothelium - dependent no - mediated dilation of retinal arterioles . Accumulating evidence supports an association of inflammation and endothelial dysfunction within the retina during diabetes . Interestingly, the inflammatory stress - activated kinases, jnk and p38, have been shown to be activated in the neural retina and cultured retinal endothelium following diabetes or acute high glucose exposure . The potential impact of jnk and p38 activation on retinal arteriolar vasomotor function during hyperglycemia had not been explored . These kinases appeared to be reasonable targets because we have previously shown that inflammatory molecules c - reactive protein and tnf- directly activate p38 and jnk, respectively, in isolated arterioles . In the present study, we found that simultaneous treatment of retinal arterioles with high glucose and jnk inhibitor sp600125 but not p38 inhibitor sb203580 prevented the reduction in dilation to bradykinin . These findings suggested a role for jnk in the initiation of endothelial vasodilator dysfunction during acute hyperglycemia . To assess the potential clinical significance of jnk blockade to restore vasodilator function after prolonged exposure to hyperglycemia in vivo, isolated retinal arterioles were treated with sp600125 after 2 weeks of diabetes . The intraluminal treatment of diabetic vessels with sp600125 preserved the dilation to bradykinin . Because these preserved vasodilator responses were sensitive to l - name, it is likely that sp600125 is able to effectively restore the ability of retinal arterioles to produce no via nos . On the other hand, sb203580 did not improve vasodilation to bradykinin following chronic hyperglycemia, suggesting that p38 kinase does not contribute to retinal endothelial dysfunction under these conditions . The concentration of sb203580 (0.1 m) used in this study was sufficient because we have shown previously its efficacy in preventing endothelial vasodilator dysfunction in retinal arterioles induced by c - reactive protein . Collectively, our current findings indicate that activation of jnk within retinal arterioles contributes to diabetes - induced endothelial vasodilator dysfunction . Cellular activation of mapks, including jnk, involves a distinct protein kinase cascade, which is organized in signaling modules by scaffold proteins for precise regulation in response to various stress stimuli . A common feature of mapk cascades is the organization of 3 kinases in which a mapk kinase kinase (map3k) activates a map2k, which subsequently activates a mapk . In the mammalian jnk module, the cytosolic jip group of scaffold proteins selectively enhance jnk signaling by interacting with and linking the upstream kinases to jnk activation . Specifically, the jip1 isoform serves as a docking site for the binding of jnk, map3ks, and map2k7, to facilitate sequential kinase activation of the jnk signaling pathway . The physiologic role for jip1 in jnk activation was supported by evidence that jip1 knockout mice lack the ability to elicit anoxic and excitotoxic stress - induced activation of jnk in hippocampal neurons . At the vascular level, in vitro studies showed that cultured rat retinal endothelial cells containing overexpression of glucose transporter-1 and elevated intracellular glucose concentrations exhibited an increased jip1 protein expression and jnk phosphorylation . Our current study extended these earlier findings to determine whether jip1 influences retinal arteriolar vasodilator function during acute and chronic hyperglycemia . In 2-week diabetic pigs, we observed reversal of impaired retinal arteriolar dilation to bradykinin with the jip1 inhibitor bi-78d3, which is a small molecule mimic of jip1 that competitively blocks the jip1 binding domain of jnk from interacting with its cognate substrates and endogenous jip1 . This jnk signaling inhibitor does not influence the atp - binding region of jnk but instead blocks protein protein interaction at the jnk - binding site of jip1 . Similarly, bradykinin - induced dilation of retinal arterioles during exposure to acute hyperglycemia was preserved in the presence of jip1 blockade . Taken together, our findings with 2 structurally distinct jnk pathway inhibitors, sp600125 and bi-78d3, suggest that the interaction of jip1 and jnk is important in initiating endothelial damage during hyperglycemia, and support the idea that this molecular event contributes to development of endothelial vasodilator dysfunction in retinal arterioles during the early stage of diabetes . At the mechanistic level it is reasonable to speculate that jnk activation may be linked with increased oxidative stress during diabetes in retinal arterioles with concomitant reduction in no bioavailability . This notion is supported by earlier work showing that pharmacologic blockade of superoxide production augmented the bradykinin - induced increase in retinal blood flow following 3 hours of hyperglycemia in cats in vivo . Our previous study showed that activation of jnk by tnf- in porcine coronary arterioles leads to superoxide generation and subsequent reduction of no release via xanthine oxidase activation . On the other hand, evidence also has been provided for superoxide - dependent activation of jnk in endothelial cells . Future molecular studies are warranted to investigate whether oxidative stress in retinal arterioles during hyperglycemia is requisite for impairing nos - mediated vasodilation . In summary, we demonstrated that acute and chronic hyperglycemia promote activation of jip1/jnk signaling in retinal arterioles leading to impairment of endothelium - dependent no - mediated dilation . The ability of pharmacologic blockade of jip1 or jnk to fully restore arteriolar vasodilator function following 2 weeks of hyperglycemia suggests that these specific proteins may provide useful clinical targets to consider for retinal vascular treatment to ameliorate retinal blood flow during early diabetes. |
The processes that lead to the gradual atrophy of brain cells, and thus to dementia, are affected by many different factors . Some researchers have called attention to the impact of activity over the lifespan, particularly in later periods of life, on the development of dementia . Although the results of research on this problem have been equivocal, many studies have shown that greater activity involving cognitive functions reduces the risk of dementia [13]. Activity manifests itself in diverse ways, in respect both to professional activity and to the realization of various personal interests . In studies conducted in the mid-1990s at the second clinic for mental illnesses at the gdansk academy of medicine, undertaken to identify risk factors for dementia of the alzheimer type (dat), attention was called to reduced activity in the premorbid period as a factor that occurred significantly more often in persons with dementia . It turned out that persons who showed a heightened risk for dementia with primary degenerative processes had limited contact with other people and a lack of complex activity, e.g., after retirement . Other research conducted during the same time period also showed reduced activity in the preclinical phase of dementia [68]. In addition, our own research pointed to a correlation between reduced activity immediately after the first manifestation of symptoms and the rate of progression of cognitive symptoms . The clinical manifestation of dementia is often preceded by many years of slight cognitive decline . It can be very difficult to differentiate the initial phases in the development of a dementive illness from other mental states that can also present with slight deterioration of cognitive functions . It is generally accepted that the appearance of mci is associated with a serious risk of dementia developing within a few years . Some studies have shown that within 34 years more than 50% of persons diagnosed with mci will develop full - blown dementia . On the other hand, this means that a significant number of persons diagnosed with mci will have no further deterioration of cognitive functions . Research has been under way for some time now to identify the factors that would facilitate an accurate prognosis for persons diagnosed with mci . However, despite the number of such studies, the results have been equivocal; therefore, it remains impossible at present to evaluate at an acceptable level of probability the degree of risk that mci will develop into dementia . Given that mci can be treated in some cases as a preliminary phase of dementia, it is hardly a surprise that the risk factors and protective factors identified in earlier research on the preclinical stages of dementia have taken on increased importance . Among all these factors, attention has also been drawn to the level of activity manifested by persons with mci as a possible predictive factor . Although the results achieved to date have been rather inconsistent, comparative analysis of a number of studies devoted to this problem have indicated that at least some kinds of activity manifested by study participants seem to be significant . From the methodological point of view, it is no easy task to make an accurate evaluation of the level of activity displayed by research subjects . Many studies have taken the average number of hours of activity in the course of a week as the measure of activity, without differentiating the types of activity . Other studies, although they have distinguished between intellectual, physical, and social activity, have not really identified the constitutive elements of any of these types . Moreover, it is not common practice to base the evaluation of activity on a measurement method that would make it possible to quantify the results . The goal of our study was to specify the relationship between the level of activity (intellectual, physical, and social) in persons diagnosed with mci and the further progression of cognitive dysfunction . The initial population consisted of persons who had reported to our mental health clinic in the period from 2005 to 2007 . It was assumed that these individuals would be under systematic psychiatric observation until dementia was diagnosed . Subjects were qualified for the study according to the following inclusion criteria: informed consent to participate . A diagnosis of mci based on the criteria published by the working group on mild cognitive impairment, assuming that dementia has been ruled out; i.e., that there has been a perceptible decline in cognitive function (based on self - evaluation or the reports of a caregiver, and then verified objectively by an examination confirming cognitive impairment and/or objective measures of a deterioration of cognitive functions over time), and that basic activities of daily living are preserved, with a slight or minimal level of impairment in carrying out complex activities . No psychiatric pharmacotherapy at the time of enrollment . The availability of an individual from the patient s own environment, someone who lives with the patient or at least visits several times a week, and who expresses a willingness to participate in the process of evaluating the patient s activity by providing information . A score on the global deterioration scale of reisberg et al . Placing the patient on the third level (slight impairment of cognitive functions) a score on the mini mental state examination (mmse) in the range from 24 to 30 points . The exclusion criteria were as follows: a diagnosis of dementia, regardless of its etiology . The presence at examination or in the history of affective disorder, schizophrenia, alcoholism, addiction to medications or drugs, epilepsy, parkinson s disease, or intellectual handicap . The presence at examination or during the evaluation period of disorders of consciousness or disturbances of locomotion, vision, or hearing that would impede compliance with instructions and procedures included in the clinical scales used in this study . All those who were qualified for enrollment were subjected to a complete examination, which included the mmse, the activity scale, and the instrumental activity of daily living (iadl) scale . Point scores of the mmse can range from 0 (severe dementia) to 30 (lack of cognitive impairment). Due to the impact of age and education on the mmse score, the raw scores were adjusted for these two factors, based on the equation proposed by mungas et al . And verified for polish conditions by jozwiak et al . . The activity scale was developed by christensen and mackinnon in 1993, and consists of three subscales covering intellectual (mental), physical, and social activity . The number of activities undertaken is evaluated (the degree of diversification of activity), as well as the average number of hours spent in particular activities . However, in the course of pilot research involving 10 patients who met the enrollment criteria, both the subjects and their caregivers had considerable difficulty in specifying the number of hours occupied by the various activities . Accordingly, we made a major modification of the activity scale by introducing a point scale to measure the intensity of the activity, ranging from 0 (no activity) to 3 (active for most of the day), and applying one score (03 points) for each type of activity, instead of the original three parameters (number of differentiated activities, average number of hours spent on each activity, and the ratio of the one to the other) used by christensen and mackinnon . The particular elements of the activity scale were divided into intellectual, physical, and social activity . Intellectual activity was divided into five types: (1) reading books and magazines or doing crosswords; (2) watching tv, listening to the radio, or using a computer on the internet; (3) personal creative activity, such as keeping a diary, working on collections, or professional work; (4) participation in discussions or lectures; and (5) playing chess, cards, or logical games . Physical activity was divided into three types: (1) participation in sports and recreation, such as bicycling, skiing, aerobics, or gymnastics; (2) physical work around the home, including gardening and yard work; and (3) going for walks, including the deliberate avoidance of mechanical transportation while attending to errands . Social activity was divided into five types: (1) participation in social organizations; (2) work for others, outside of institutional work; (3) receiving guests and visiting others; (4) informal meetings and conversations with other people, e.g., while walking or shopping; and (5) playing games or having a good time with others, or going on trips with others . All of the elements comprising one area (intellectual, physical, or social) were evaluated for average involvement during the preceding months on a scale from 0 (no involvement) to 1 (sporadic involvement) to 2 (rather frequent involvement) to 3 (frequent involvement). The sum of the points for each of the elements constituted the score in each area of activity . The scores for intellectual and social activity could range from 0 to 15 points, while the physical activity score could range from 0 to 9 points . The iadl scale was developed by m. p. lawton and e. m. brody in 1969 . This scale serves to evaluate functioning in daily living, and covers such activities as using the telephone, shopping, preparing meals, cleaning house, laundry, transportation, taking medications, and personal finances . The scores for particular functions ranged from 1 (full functionality) to a maximum of 3, 4, or 5, depending on which element was evaluated . The overall score ranged from 8 (no dysfunction) to 31 (no possibility of independent functioning). The mmse was re - administered to all patients in the study group after approximately one year (in practice, this occurred from 9 to 13 months after the baseline). The next administration of the mmse took place when the observation period ended: that is, either at the point when dementia was diagnosed or after seven years of observation . Because all of these individuals were under the immediate care of the first and second authors of the present study, their mental state was monitored systematically, usually several times a year . At each successive psychiatric consultation, if dementia was diagnosed, further tests were performed, including laboratory and radiological tests, in order to established the etiology . For statistical purposes, we used the two - tailed test for two independent means . Only those test results that were equal to or less than 0.05 (that is, p0.05) were regarded as statistically significant . The chi - squared test was used to verify the assumption of normal distribution in the research population (using tests for two means), whereas the assumption of equal variance was verified with the test for two variances . According to the guidelines of the helsinki declaration (2008), subjects participating in the experiment were informed in detail about the test procedure and provided written consent for participation in the project . The study protocols received ethical approval from the ethical committee of the regional medical chamber nkbbn/279/2014 . According to the guidelines of the helsinki declaration (2008), subjects participating in the experiment were informed in detail about the test procedure and provided written consent for participation in the project . The study protocols received ethical approval from the ethical committee of the regional medical chamber nkbbn/279/2014 . Of the 193 persons initially enrolled for the study, 75 were available for the final analysis because they had either gone through the preset limit of seven years or had been diagnosed with dementia, regardless of how much time had passed since the baseline . During the observation period, dementia appeared in 34 subjects, including 16 with dat, 4 with vascular dementia, 2 with lewy - body dementia, 3 with fronto - temporal dementia, and 9 for whom there was either no basis for establishing the etiology at the time when the results were being analyzed, or a mixed dementia had been diagnosed . The types of dementia were not subjected to further analysis, due both to the small numbers and to the relatively large percentage of patients with no final (etiological) diagnosis . Based on the final clinical diagnosis, in which dementia was either confirmed or precluded, we divided the subjects into two groups: those with mci that had converted to dementia at some point within the seven - year period (n=34), referred to hereinafter as mci - c . Those whose mci was stable, i.e., they had not developed dementia within that same period (n=41), hereinafter referred to as mci - s . Table 1 gives the average values of the analyzed variables for those persons who completed the planned observation period (n=75). (mmse - c), are given for the baseline (i) and second examination after one year (ii), with the differences between the baseline and second examinations given on the row below; the results at the end of the study are given as mmse - c vii . It was found that there were no statistically significant differences in the baseline mmse between the persons with stable mci and the persons who had progressed to dementia . Table 1 also provides the means from the two activity scales: the global score for the iadl and the scores for the three main areas of activity (a - intellectual, a - physical, a - social) and the global score (a - global) on the activity scale . Table 2 presents the means for the analyzed variables in the two study groups: those with mci - s and those with mci - c, regardless of the etiology . There were statistically significant differences between the groups in the global scores from both instruments measuring activity . The patients from the two groups also had significantly different scores in the physical activity subscale and in four of the subscales of the iadl: telephone use (iadl - tele), shopping (iadl - shop), transportation (iadl - tran), and personal finances (iadl - pfin). In table 3, the basis for dividing the subjects into two groups was the difference between the mmse scores at baseline and at the second examination (after one year). Based on the average difference (1.75 points), we divided the population into one group with a smaller difference (mmse - c i ii: s) and one group with a greater difference (mmse - c i ii: g) between the adjusted scores on the mmse - c i ii . Table 4 shows the number of persons presenting a low level of physical activity (14 points) and a high level of physical activity (510 points) in two groups of patients: those with mci - c and with mci - s . The basis for distinguishing between a low level and a high level of physical activity was the average score in this area (4.68 points) for the entire research group . The chi - squared result at df=1 was 13.38 (p=0.0003). With the yeats correction, a diagnosis of mci carries with it a substantial risk that dementia will develop later . A significant number of persons with mci show symptoms of dementia within several years . On the other hand, many others will not experience any further loss of cognitive functions . In predicting what will happen in the course of mci, an evaluation of the level of activity can play an important role, as indicated by many previous studies of dementia . In our research, we attempted to evaluate the level of activity manifested by persons with mci in light of their further history in terms of cognitive functions . The basis for this evaluation was our modification of the activity scale developed by christensen and mackinnon, which enabled us to evaluate three areas of activity: intellectual, physical, and social . Activity in these three areas was evaluated in respect to particular activities performed in the course of one month preceding each examination . On the one hand, this approach could cause some activities to be overlooked, but on the other, it enabled us to make, in our opinion, a more precise evaluation . The previous effort to estimate activity in a more global framework, and to express it in terms of the number of hours spent (e.g., in the course of a week), even if particular kinds of activity were taken into account (intellectual, physical, social), seems to entail a greater risk of error due to the retrospective and highly subjective nature of the judgments involved, especially in regards to the various domains of activity . This scale evaluates the level of disturbances in the performance of basic social activities, such as shopping, transportation, etc . In research on the preclinical phase of dementia, reduced competence in activities of daily mci - c and mci - s, we did not find at baseline any major difficulties in activities of daily living that would impair social functioning, as indicated by the average iadl scores in both groups: 12.71 and 10.46 respectively, where the minimum score is 8 . However, despite the very slight difficulties experienced by persons with mci, the scores on the scale (both the overall score and the subscores for some of its elements) proved to be significant discriminating factors for persons with greater progression of cognitive symptoms, culminating in dementia with onset during the observation period . In our research, the elements of daily functioning in which difficulties appear sooner include using the telephone, shopping, using transportation, and personal finances . In other studies, similar aspects of functioning have also been identified in the preclinical phase of dementia, where the earliest difficulties appear . It is generally recognized that losing the ability to use the telephone, avoiding the need to use transportation, poor management of personal finances, and problems with proper self - administration of medications can be predictive of the imminent onset of the disease . Differences in scores (shopping and taking medications) seem rather to result from certain differences in functioning caused by social circumstances . For example, the persons qualified for some studies available in the literature most often did not prepare meals without assistance, which would make it more difficult to measure any possible problems in the area of shopping . An analysis of the result from the activity scale (our own modification of the christensen and mackinnon scale) points up a lower level of activity among those persons who declined into dementia during the seven - year observation period . Although the persons from our mci - c group (conversion to dementia) had lower scores on the activity scale in each domain, this tendency still was confirmed statistically only in respect to physical activity . The lack of statistical significance in respect to intellectual activity can probably be explained on methodological grounds . The particular elements that contribute to the physical activity score consist of facts that are clearly delineated in time and differentiated from daily routine . By contrast, the particular activities that characterize intellectual activity may be harder to evaluate due to the difficulty inherent in distinguishing them from other activities being performed at the same time . One gets the general impression that in much of the research to date, more attention has been paid to intellectual activity, which can be related more directly to the concept of neurocognitive reserve . Tasks that require considerable intellectual engagement have particularly been regarded as a protective factor against progressive loss of cognitive functions and the resultant decline into dementia . Distinguishing the various domains of activity seems to have considerable importance because it very often points to different impacts on the process of cognitive decline . In view of the fact that the level of activity is typically evaluated retrospectively, in one such study, one year s observation of persons subjected to systematic exercises involving both cognitive and physical activity demonstrated a positive clinical effect . A thorough analysis of the data obtained from studies of the neuroprotective effect of physical exercise (or more generally physical activity per se) shows a marked reduction of the risk of dementia . It is worth noting that this does not necessarily refer only to activity manifested just before onset, but rather to a level of activity in middle age, which is to say many years, for the most part, before the presentation of the first symptoms of cognitive decline . Yet even among those persons who are already showing signs of such decline, physical activity can contribute to a milder course of the disease . Some results have suggested that the activity is associated with greater volume of the hippocampus . Other studies have suggested that physical activity can be associated with slowing the atrophy of gray matter . An evaluation of the neural network in functional magnetic resonance imaging tests has shown an increase in connectivity within the neural network after several months of systematic physical exercise . It seems that physical activity has an excitatory effect on the neurotrophic factors [2830]. Physical activity has also been shown to have a significant impact on reducing the risk of a number of vascular factors that can also lead to dementia . It has also been observed that there is a rise in the level of the brain - derived neurotrophic factor in response to physical activity . We make a significant error, however, if we evaluate only the activity manifested by persons with mci without considering other factors as well . It is essential to remember that a number of important factors determine how active an individual will be, including education, physical health, physical fitness, and the status of the sensory organs . The level of activity an individual shows over the lifespan is significantly affected by certain personality traits, which are surprising seldom taken into account in the research . Persons who display a more open and extraverted personality, with more activity, present with a higher level of cognitive ability later in life, as compared with persons who have other personality traits . In our own research, unfortunately, we were able to include only a few of the many factors that can affect the person s level of activity . Our inclusion criteria eliminated from the study those persons who were afflicted by significant disorders affecting their daily functioning . We did not, however, perform a more detailed analysis of the sensory systems of our subjects; moreover, their personality traits were not measured . The correlation between the level of activity over the lifespan and cognitive function, and thus the degree of impairment in the process of aging, can be explained at least partially by appealing to what is usually called the neurocognitive reserve . This concept pertains primarily to the degree of complexity of intersynaptic connections, which supports the performance of tasks that involve cognitive functions . The neurocognitive reserve is formed throughout the lifespan, but it would appear that the earlier periods of life are of key importance . Good socioeconomic conditions, a low level of stress, and exposure to a diversified environment that requires creative adaptation, including the possibility of education all these factors seem to support the formation of a greater neurocognitive reserve, which indirectly reduces the clinical impact of the progression of cognitive decline in old age . Although the younger years are of crucial importance for the formation of the neurocognitive reserve, a number of external factors can still have a positive or negative impact in every period of life . It has been demonstrated that any kind of activity that engages cognitive functions can have a protective effect . Persons with a greater neurocognitive reserve can compensate for the sequelae of neurodegenerative processes for a much longer period of time, which causes any possible dementive illness to present much later in life, if at all . It would be an oversimplification, however, to consider the whole concept of mental reserve exclusively in terms of the neural network . The broader category of mental reserve should also include the whole set of both conscious and unconscious cognitive strategies, developed and enriched in the process of formation . Thanks to a wide repertoire of such strategies, the individual can compensate for impaired functionality . In this way, complex cognitive functioning will have a protective impact, though it is important to clarify at this point that by protective activity we are referring to the delayed appearance of clinical signs of decline, and not to the stopping or slowing of the neurodegenerative process itself . In order to interpret properly the results reported here, some rather important limitations of the present study should be taken into account . There are certain objections that could be raised against the use of the mmse as the basis for the assessment of cognitive decline . We are fully aware that the mmse is not a very precise instrument for measurement, and does not enable the clinician to evaluate precisely any particular area of cognition . The purpose of our research, however, was not to make any such detailed analysis of cognitive domains, but only to assess overall functioning . Moreover, and perhaps especially, the practical aspect has been dominant in research on mci . The tools used here are those that can be used in daily clinical practice involving a large number of subjects . Although the mmse can be widely used in outpatient practice, many other more complex, elaborate instruments, especially those that are very time - consuming, cannot be used on such a scale . Even though we used a simplified instrument, it was possible to detect measurable differences within the first year of observation between persons who were well on their way to dementia and those who were not (cf ., table 2). Another limitation, this one also resulting from the number of persons included in the research group, was the impossibility of taking treatment under consideration . Although at the moment of enrollment none of the participants were taking psychotropic drugs, within the first year of observation (the most essential period for the analysis of results) some of them (n=39) were already taking such drugs . The reasons for beginning treatment were typically anxiety, depressed mood, or sleep disturbances, but there were also instances of aggressive or impulsive behavior . Whether or not it is actually possible to absolutely exclude the impact of such drugs on neurodegenerative mechanisms in the brain, their possible impact on the results of cognitive tests (the mmse) would seem to be an essential factor . Our study was observational in character, which made it impossible to suspend treatment (if there was any) during the period preceding our assessment of cognitive functions . Finally, the quantitative assessment of the level of activity displayed by individuals will always be a process subject to considerable simplification of the whole phenomenon, because a wide range of environmental factors and other factors with direct or indirect influence on activity scores [4042] are not taken into account . The use of quantifying instruments, though justified for methodological reasons, necessarily entails a narrowing of the field of observation . Despite the importance of all these limitations, the results obtained in our study seem to confirm the hypothesis (not a new one, to be sure, but not a well - documented one, either) that activity has a positive impact on the course of cognitive decline in advanced age . Therefore, our results clearly point to the practical utility of the functional assessment of persons with mci, especially the level of activity they display, in establishing a prognosis . Our results indicate that an assessment of the level of activity can be useful in establishing a prognosis for the future course of mci. |
Currently, virtually any psychiatric diagnosis is made through a combination of patient interviews, checklists, or self - report questionnaires, which rely on the symptoms coded in the diagnostic and statistical manual of mental disorders, either the fourth edition1 or the recently introduced fifth edition.2 yet, considerable debate exists about the actual validity of this sole symptom - based approach, thus sustaining the interest in objective biomarkers toward a better understanding of psychiatric disorders, including major depressive disorder (mdd), and their pharmacological response.3 furthermore, a number of issues, including heterogeneous patients variables, high medical and psychiatric comorbidity rates, medications / triggers, inconsistency in specimen collection, storage and measurement protocols, and complexity of neuropsychiatric biological determinants of disorders, hinder the search for reliable biomarkers.4,5 ideally, a hassle - free biomarker reflecting the central nervous system (cns) functioning should provide a simplified, yet reliable, proxy measure of the activity of those neurotransmitters that are supposed to be involved in major psychiatric disturbances, to be flexibly applied both to clinical and healthy samples . Among other approaches, the electroretinogram (erg) represents a relatively noninvasive, short, and cost - effective method developed to investigate the origin of a visual loss due to a retinal disease or injury, possibly representing a proxy of global cns activity of dopamine,6 a core monoamine in depression, directly or indirectly modulated by a number of antidepressant drugs with different pharmacodynamics.7 specifically, since the retina is part of the cns due to its embryonic origin, the erg has been used to investigate not only mdd, but also seasonal affective disorder, schizophrenia and bipolar disorder, autism spectrum disorders, and drug addiction,8 both in clinical and healthy samples exposed to different pharmacological agents,817 as well as in animal samples.6,18 of note, dopamine modulates different retinal functions, including counterbalancing of the synthesis of melatonin as measured with the erg.1921 melatonergic activity is also often impaired in the course of depressive episodes with prominent circadian rhythm disturbances, even if there is no antidepressant effect firmly documented for the hormone melatonin, neither for its analogue, ramelteon.2225 this seems quite puzzling considering that the recently released pro - melatonergic antidepressant agomelatine has been approved in europe for the treatment of mdd, though not in the us.26,27 a potential explanation for the claimed antidepressant effect of agomelatine should nonetheless be represented by its 5-hydroxytryptamine receptor type 2b (5-ht2b) and 5-ht2c serotonergic antagonism,28 which may also promote the dopaminergic firing at the ventral tegmental area, frontal cortex, hypothalamus, hippocampus, medulla and pons, and also the retina, which is part of the cns as well,29 via enhancement of norepinephrinergic activity at the locus coeruleus.30 yet, while there is no question about the impact of melatonergic modulation on circadian rhythms relevant for mood as well as other core functions, the discrimination of the most plausible antidepressant effect of agomelatine between 5-ht antagonism versus melatonergic receptor type 1 (mt1) and type 2 (mt2) agonism remains elusive, at least with regard to just the simplified paradigm of dopaminergic modulation . Additionally, ago - melatine has been proposed to indirectly modulate even the release of glutamate from prefrontal and frontal cortex and hippocampus,31,32 which further hinders the identification of a sole putative neurobiological pathway accounting for the claimed antidepressant effect of the drug . Therefore, the aim of this preliminary study carried out on healthy volunteers was to assess the impact of agomelatine on retinal dopaminergic activity measured using standard erg recording, to provide a dissertation on the potential clinical implications of a differential neuropsychopharmacological erg trend eventually observed for agomelatine versus the trend already documented for melatonin . The light reaches the photoreceptors (either cones or rods) hosted at the outer segment of the retina after crossing the anterior segment of the eye, then is absorbed by the photopigment of the photoreceptors, which ignites the phototransduction process . In dark conditions, photoreceptors rest in a depolarized state, while the photon absorption leads to their hyperpolarization followed by the depolarization of the on bipolar cells . Subsequently, the electric signal spreads to the ganglion cells, the axons of which reach the brain, mainly converging at the visual cortex . The retina also includes horizontal cells and amacrine cells, which are interneurons joining photoreceptors and bipolar cells, as well as the mller cells acting as glia.8 since dopamine represents a core retinal neurotransmitter involved in signal transduction, the erg should be a convenient technique by which to assess such dopaminergic activity both in light- and dark - adapted conditions,33 essentially by measurement of the implicit time and amplitude parameters of the b - wave,34 a trace component of the erg primarily determined by the bipolar cells.3537 any variation of the intensity or chromatic characteristic of the light stimulus could also be assessed by the erg, either for rods, cones, or mixed rod / cone photoreceptors functioning, thus allowing an objective quantitative measure of the retinal sensitivity to light.34 dopamine released by the amacrine and interplexiform cells38 interacts with the d1-like receptors (namely, d1 and d5 subtypes) at the horizontal, bipolar, amacrine, and ganglion cells, and with the d2-like (d2, d3, and d4) receptors located at the retinal pigment epithelium cells, photoreceptors, and mller glial cells,3943 all of which are involved in the modulation of a number of retinal functions, including melatonin release.20 also, the daily synthesis and release of retinal dopamine, which is primarily influenced by lighting condition, follows a 24-hour rhythm,44 being influenced by the interaction between the amacrine and interplexiform dopaminergic neurons and photoreceptors . Enhancement of dopamine activity via activation of d2-like receptors (namely d4 ones) located on photoreceptors inhibits the synthesis of melatonin, leading to subsequent inhibition of serotonergic n - acetyltransferase activity.45,46 in mammals, the d4 receptor accounts for the effects of the ligands on the whole d2 receptor family,42 either at the rods, cones, or retinal pigment epithelium,47 which, in turn, ultimately account for the impact of dopamine in the regulation of melatonin biosynthesis in vertebrate retina.48 substance p and dynorphin, which are expressed in d1 receptor - containing neurons, as well as preproenkephalin in d2 receptor - containing neurons, have also been used as monitors of dopaminergic activity in the cns,49 whereas there have been conflicting reports as to whether d1-like receptors are capable of increasing or decreasing the potassium efflux: d1-like agonists increase potassium current from chick retinal cells via an adenosine monophosphate (amp)-independent mechanism, but inhibit this efflux in rat striatal neurons;50 as such, a conclusive understanding of the actual effect of d1 (and possibly d5) stimulation or inhibition at the retina likewise remains elusive.51 melatonin suppresses the retinal release of dopamine via activation of its own melatonergic receptors (primarily mt1, but also mt2 and mt3 subtypes), widely distributed in the cns,52 including the retinal amacrine and interplexiform dopaminergic neurons.53,54 as mentioned previously, the b - wave response of the erg is influenced both by dopaminergic and melatonergic modulation . Specifically, in daylight conditions, the b - wave response seems linked to cone dominance, possibly related to a shift toward a relative dominance of dopaminergic tone . On the contrary, under scotopic conditions, the b - wave response could be influenced by a relative dominance of rod tone,55 when the presence of circulating melatonin could account for rod dominance.56 erg studies carried out on healthy volunteers receiving melatonin, performed during conditions usually characterized by the absence of the hormone itself, showed a decline of cone response, either recorded as a decrease of the b - wave amplitude at 10 mg / day,57 or as a significant reduction of cones erg maximal response associated to a prolonged implicit time with 15 mg / day melatonin.58 concordant results were recently documented in animal samples exposed to high doses of melatonin during the day (90 mg / day in anaesthetized beagle dogs), showing a decrease of the photopic amplitude of both a- and b - waves, but no impact on the implicit time, which may indicate that the negative impact of melatonin on the photopic system may promote night vision.21 agomelatine shares the mt1 and mt2 agonism provided by melatonin, but not the agonism on mt3 receptors, with mt3 receptors having not been documented in mammalian samples.59 by blocking 5-ht2c receptors, agomelatine promotes the cns release of dopamine, possibly at the retina as well . However, at the time of writing, there are no available data whatsoever about the investigation of agomelatine using the flash erg in contrast to previous evidence for melatonin, this being the aim of this preliminary study . Twenty - three healthy volunteers, both sexes, were enrolled at the department of neuroscience of the san martino hospital of genoa, genoa, italy, between september 2012 and march 2013, upon approval by the local ethical committee and patient signatures on a valid informed consent form after procedures had been fully explained by the investigators (either psychiatrists or neurologists). All procedures were carried out in accordance with the declaration of helsinki about human experimentation.60 no liver function monitoring was needed due to the prescription of just a single dose of agomelatine . In order to avoid any age - dependent effect affecting the b - wave amplitude,61 all subjects were aged between 22 and 35 years old . In addition, all subjects received the same single dose of agomelatine (25 mg / day), avoiding any concomitant medication to limit potential confounding biases as much as possible . Similar considerations led to the inclusion of female subjects only during the luteal phase of the menstrual cycle (objective measure of luteinizing hormone levels: range 120 iu / l) in order to avoid an additional confounding factor potentially affecting the b - wave amplitude.62 finally, the baseline erg assessments (with each session requiring about 1 hour for completion) were performed according to the following scheme: 1) first erg recording at 10 am (baseline = t0), immediately followed by oral intake of agomelatine 25 mg (one pill); 2) 1 hour s rest; 3) second erg recording; 4) 1 (more) hour s rest; 5) third (final) erg measurement . Finally, a pictorial description of the standard erg has been provided in figure 1 along with a synthetic flow of study procedures in figure 2 . The electric signal was recorded binocularly (dilated pupils) using 9 mm silver / silver chloride skin disc electrodes placed on the lower eyelid; the reference electrodes were placed close to the outer canthus of the eye and the ground electrode was placed on the forehead . The electrode impedance was maintained below 5 k in order to provide consistent results independent of the response yielded by skin electrodes with lower amplitude and higher noise levels with regard to either the corneal or conjunctival electrodes . The band - pass filter was set between 0.1 hz and 500 hz, and the subjects were dark - adapted for 20 minutes before recording . A full - field ganzfeld stimulator was used throughout the study, with the subjects seated in front of the stimulator bowl fixating on a point incorporated in the stimulus dome during each session . The dark - adapted 0.01 erg (rod response) was recorded using a dim white flash of 0.01 cdsm2 . After 10 minutes of light adaptation, the light - adapted 3.0 erg (single - flash cone response) was recorded, using a 3 cdsm2 stimulus with a background luminance of 30 cd / m2 measured at the surface of the full - field stimulus bowl . B - wave amplitude and time to peak (implicit time) were measured (ms) for all ergs . The a - wave amplitude was measured from baseline to a - wave trough, while the b - wave amplitude was measured from a - wave trough to b - wave peak (v); the a - wave and b - wave implicit times were measured from the time of the flash to the peak of each wave . Demographic and descriptive analyses were carried out using the ibm spss software package (v 21) for microsoft windows (v 7) (ibm corporation, armonk, ny, usa). Since data follow a nonparametric distribution, as assessed by the shapiro wilk test, friedman s analysis of variance was used in order to compare the median scores of the erg parameters . The light reaches the photoreceptors (either cones or rods) hosted at the outer segment of the retina after crossing the anterior segment of the eye, then is absorbed by the photopigment of the photoreceptors, which ignites the phototransduction process . In dark conditions, photoreceptors rest in a depolarized state, while the photon absorption leads to their hyperpolarization followed by the depolarization of the on bipolar cells . Subsequently, the electric signal spreads to the ganglion cells, the axons of which reach the brain, mainly converging at the visual cortex . The retina also includes horizontal cells and amacrine cells, which are interneurons joining photoreceptors and bipolar cells, as well as the mller cells acting as glia.8 since dopamine represents a core retinal neurotransmitter involved in signal transduction, the erg should be a convenient technique by which to assess such dopaminergic activity both in light- and dark - adapted conditions,33 essentially by measurement of the implicit time and amplitude parameters of the b - wave,34 a trace component of the erg primarily determined by the bipolar cells.3537 any variation of the intensity or chromatic characteristic of the light stimulus could also be assessed by the erg, either for rods, cones, or mixed rod / cone photoreceptors functioning, thus allowing an objective quantitative measure of the retinal sensitivity to light.34 dopamine released by the amacrine and interplexiform cells38 interacts with the d1-like receptors (namely, d1 and d5 subtypes) at the horizontal, bipolar, amacrine, and ganglion cells, and with the d2-like (d2, d3, and d4) receptors located at the retinal pigment epithelium cells, photoreceptors, and mller glial cells,3943 all of which are involved in the modulation of a number of retinal functions, including melatonin release.20 also, the daily synthesis and release of retinal dopamine, which is primarily influenced by lighting condition, follows a 24-hour rhythm,44 being influenced by the interaction between the amacrine and interplexiform dopaminergic neurons and photoreceptors . Enhancement of dopamine activity via activation of d2-like receptors (namely d4 ones) located on photoreceptors inhibits the synthesis of melatonin, leading to subsequent inhibition of serotonergic n - acetyltransferase activity.45,46 in mammals, the d4 receptor accounts for the effects of the ligands on the whole d2 receptor family,42 either at the rods, cones, or retinal pigment epithelium,47 which, in turn, ultimately account for the impact of dopamine in the regulation of melatonin biosynthesis in vertebrate retina.48 substance p and dynorphin, which are expressed in d1 receptor - containing neurons, as well as preproenkephalin in d2 receptor - containing neurons, have also been used as monitors of dopaminergic activity in the cns,49 whereas there have been conflicting reports as to whether d1-like receptors are capable of increasing or decreasing the potassium efflux: d1-like agonists increase potassium current from chick retinal cells via an adenosine monophosphate (amp)-independent mechanism, but inhibit this efflux in rat striatal neurons;50 as such, a conclusive understanding of the actual effect of d1 (and possibly d5) stimulation or inhibition at the retina likewise remains elusive.51 melatonin suppresses the retinal release of dopamine via activation of its own melatonergic receptors (primarily mt1, but also mt2 and mt3 subtypes), widely distributed in the cns,52 including the retinal amacrine and interplexiform dopaminergic neurons.53,54 as mentioned previously, the b - wave response of the erg is influenced both by dopaminergic and melatonergic modulation . Specifically, in daylight conditions, the b - wave response seems linked to cone dominance, possibly related to a shift toward a relative dominance of dopaminergic tone . On the contrary, under scotopic conditions, the b - wave response could be influenced by a relative dominance of rod tone,55 when the presence of circulating melatonin could account for rod dominance.56 erg studies carried out on healthy volunteers receiving melatonin, performed during conditions usually characterized by the absence of the hormone itself, showed a decline of cone response, either recorded as a decrease of the b - wave amplitude at 10 mg / day,57 or as a significant reduction of cones erg maximal response associated to a prolonged implicit time with 15 mg / day melatonin.58 concordant results were recently documented in animal samples exposed to high doses of melatonin during the day (90 mg / day in anaesthetized beagle dogs), showing a decrease of the photopic amplitude of both a- and b - waves, but no impact on the implicit time, which may indicate that the negative impact of melatonin on the photopic system may promote night vision.21 agomelatine shares the mt1 and mt2 agonism provided by melatonin, but not the agonism on mt3 receptors, with mt3 receptors having not been documented in mammalian samples.59 by blocking 5-ht2c receptors, agomelatine promotes the cns release of dopamine, possibly at the retina as well . However, at the time of writing, there are no available data whatsoever about the investigation of agomelatine using the flash erg in contrast to previous evidence for melatonin, this being the aim of this preliminary study . Twenty - three healthy volunteers, both sexes, were enrolled at the department of neuroscience of the san martino hospital of genoa, genoa, italy, between september 2012 and march 2013, upon approval by the local ethical committee and patient signatures on a valid informed consent form after procedures had been fully explained by the investigators (either psychiatrists or neurologists). All procedures were carried out in accordance with the declaration of helsinki about human experimentation.60 no liver function monitoring was needed due to the prescription of just a single dose of agomelatine . In order to avoid any age - dependent effect affecting the b - wave amplitude,61 all subjects were aged between 22 and 35 years old . In addition, all subjects received the same single dose of agomelatine (25 mg / day), avoiding any concomitant medication to limit potential confounding biases as much as possible . Similar considerations led to the inclusion of female subjects only during the luteal phase of the menstrual cycle (objective measure of luteinizing hormone levels: range 120 iu / l) in order to avoid an additional confounding factor potentially affecting the b - wave amplitude.62 finally, the baseline erg assessments (with each session requiring about 1 hour for completion) were performed according to the following scheme: 1) first erg recording at 10 am (baseline = t0), immediately followed by oral intake of agomelatine 25 mg (one pill); 2) 1 hour s rest; 3) second erg recording; 4) 1 (more) hour s rest; 5) third (final) erg measurement . Finally, a pictorial description of the standard erg has been provided in figure 1 along with a synthetic flow of study procedures in figure 2 . The electric signal was recorded binocularly (dilated pupils) using 9 mm silver / silver chloride skin disc electrodes placed on the lower eyelid; the reference electrodes were placed close to the outer canthus of the eye and the ground electrode was placed on the forehead . The electrode impedance was maintained below 5 k in order to provide consistent results independent of the response yielded by skin electrodes with lower amplitude and higher noise levels with regard to either the corneal or conjunctival electrodes . The band - pass filter was set between 0.1 hz and 500 hz, and the subjects were dark - adapted for 20 minutes before recording . A full - field ganzfeld stimulator was used throughout the study, with the subjects seated in front of the stimulator bowl fixating on a point incorporated in the stimulus dome during each session . The dark - adapted 0.01 erg (rod response) was recorded using a dim white flash of 0.01 cdsm2 . After 10 minutes of light adaptation, the light - adapted 3.0 erg (single - flash cone response) was recorded, using a 3 cdsm2 stimulus with a background luminance of 30 cd / m2 measured at the surface of the full - field stimulus bowl . B - wave amplitude and time to peak (implicit time) were measured (ms) for all ergs . The a - wave amplitude was measured from baseline to a - wave trough, while the b - wave amplitude was measured from a - wave trough to b - wave peak (v); the a - wave and b - wave implicit times were measured from the time of the flash to the peak of each wave . Demographic and descriptive analyses were carried out using the ibm spss software package (v 21) for microsoft windows (v 7) (ibm corporation, armonk, ny, usa). Since data follow a nonparametric distribution, as assessed by the shapiro wilk test, friedman s analysis of variance was used in order to compare the median scores of the erg parameters . Twenty - three subjects (females n=8 or 35% of the sample; males n=15 or 65%) were included in the study and completed all the scheduled appointments and procedures . Notably, among different measures of the b - wave parameters for both eyes (including latency and amplitude either for cones or rods, and for erg maximal response), the only statistically significant modifications observed across the study were those related to cones b - wave amplitude and latency, in both eyes (table 1). Finally, no statistically significant difference was observed for such parameters in males versus females . The absence of a control group, including differential doses of agomelatine, placebo, or melatonin, or depressed controls, make the present results merely indicative at this time . Moreover, while dopamine could also affect the erg, its effect was basically observed in terms of changes in the retinal sensitivity.63 therefore, in this study, the lack of a luminance response function to measure retinal sensitivity with the erg prompts for caution in the interpretation of our preliminary findings . Oscillatory potentials most likely generated by the dopaminergic neurons of the amacrine (or interplexiform) cells, should also be accounted for in replication studies . Similarly, we followed the international society for clinical electrophysiology of vision (iscev) standard64 to record the erg, which represents the minimum standard flashes to be used to investigate the retinal function (for patients with an eye disease); however, in terms of mere research purposes, assessing the dynamic of retinal functioning over a wide range of intensities should allow a more reliable assessment of the retinal sensitivity . Specifically, this latter consideration may have hampered the validity of the present preliminary protocol in the investigation of a possible impact of the erg . In our sample, agomelatine induced a slight, yet statistically significant, increase of the cones b - wave amplitude and latency in both eyes . While it may be argued that the above mentioned change in amplitude may actually be within the normal variation of the measure, this is nonetheless in contrast to previous reports5658 from comparable erg studies involving healthy subjects receiving melatonin . While both melatonin and agomelatine act on melatonergic receptors, the presence of 5-ht2c (and 5-ht2b) antagonism for the antidepressant drug should be prudently hypothesized to account for the differential trend observed at erg, eventually observed to play a role in the therapeutic effect claimed in depressed samples . Notably, a previous polysomnographic study carried out on a small sample of healthy volunteers with the same dose of agomelatine (25 mg / day) raised doubts about the actual blockade of 5-ht2c receptors in humans, based on the observation that this agent failed to increase slow - wave sleep, whereas potent 5-ht2c antagonists (eg, cyproheptadine 4 mg, ritanserin 5 mg, olanzapine 5 mg, or mirtazapine 30 mg) did.65 furthermore, in a recent animal study, neither the long - term administration of melatonin (40 mg / kg / day) nor the selective 5-ht2c receptor antagonist sb 242084 (0.5 mg / kg / day) had an effect on the firing rate and burst parameters of serotonergic and dopaminergic neurons . The combination of these latter mechanisms, however, enhanced only the number of spontaneously active dopaminergic neurons at the ventral tegmental area, while leaving the firing of the serotonergic neurons unaltered at the raphe dorsal nucleus . Finally, the addition of a specific 5-ht2b antagonist (ly 266097 at 0.6 mg / kg / day), which proved by itself to be devoid of effect, to the previous dual regimen increased the number of bursts per minute of dopaminergic neurons and the percentage of spikes occurring in burst, which ultimately mimics the effect of the antidepressant agomelatine.66 the absence of a control group, including differential doses of agomelatine, placebo, or melatonin, or depressed controls, make the present results merely indicative at this time . Moreover, while dopamine could also affect the erg, its effect was basically observed in terms of changes in the retinal sensitivity.63 therefore, in this study, the lack of a luminance response function to measure retinal sensitivity with the erg prompts for caution in the interpretation of our preliminary findings . Oscillatory potentials most likely generated by the dopaminergic neurons of the amacrine (or interplexiform) cells, should also be accounted for in replication studies . Similarly, we followed the international society for clinical electrophysiology of vision (iscev) standard64 to record the erg, which represents the minimum standard flashes to be used to investigate the retinal function (for patients with an eye disease); however, in terms of mere research purposes, assessing the dynamic of retinal functioning over a wide range of intensities should allow a more reliable assessment of the retinal sensitivity . Specifically, this latter consideration may have hampered the validity of the present preliminary protocol in the investigation of a possible impact of the erg . In our sample, agomelatine induced a slight, yet statistically significant, increase of the cones b - wave amplitude and latency in both eyes . While it may be argued that the above mentioned change in amplitude may actually be within the normal variation of the measure, this is nonetheless in contrast to previous reports5658 from comparable erg studies involving healthy subjects receiving melatonin . While both melatonin and agomelatine act on melatonergic receptors, the presence of 5-ht2c (and 5-ht2b) antagonism for the antidepressant drug should be prudently hypothesized to account for the differential trend observed at erg, eventually observed to play a role in the therapeutic effect claimed in depressed samples . Notably, a previous polysomnographic study carried out on a small sample of healthy volunteers with the same dose of agomelatine (25 mg / day) raised doubts about the actual blockade of 5-ht2c receptors in humans, based on the observation that this agent failed to increase slow - wave sleep, whereas potent 5-ht2c antagonists (eg, cyproheptadine 4 mg, ritanserin 5 mg, olanzapine 5 mg, or mirtazapine 30 mg) did.65 furthermore, in a recent animal study, neither the long - term administration of melatonin (40 mg / kg / day) nor the selective 5-ht2c receptor antagonist sb 242084 (0.5 mg / kg / day) had an effect on the firing rate and burst parameters of serotonergic and dopaminergic neurons . The combination of these latter mechanisms, however, enhanced only the number of spontaneously active dopaminergic neurons at the ventral tegmental area, while leaving the firing of the serotonergic neurons unaltered at the raphe dorsal nucleus . Finally, the addition of a specific 5-ht2b antagonist (ly 266097 at 0.6 mg / kg / day), which proved by itself to be devoid of effect, to the previous dual regimen increased the number of bursts per minute of dopaminergic neurons and the percentage of spikes occurring in burst, which ultimately mimics the effect of the antidepressant agomelatine.66 agomelatine may differ from melatonin not only in the absence of mt3 agonism, but also in the presence of a dual antagonism on 5-ht2c and 5-ht2b, which may corroborate the claimed clinical antidepressant effect and account for the increase of the b - wave amplitude and latency of the cones (in daylight conditions). Nonetheless, along with the abovementioned limitations urging much prudence in the interpretation of our results and the acknowledgement that a decline in the central serotonin activity may itself affect the cone b - wave latency, it pays to note that the classical paradigm of monoamines (including dopamine) as a core pathway involved in depression has been debated, shifting more attention toward impaired circadian rhythms in depression.67 therefore, with the ultimate goal of shedding further light on the mechanism of action of novel antidepressants, with agomelatine being the case in point, additional, more methodologically accurate erg studies on the matter are warranted. |
There was a time when numerous asthmatics had to be treated with systemic corticoids either on a regular basis or with repeated short courses in order to achieve asthma control . While inhaled 2 agonists became available in the seventies it took until late eighties to have corticoids administered by the inhaled route (ics). It was then demonstrated that regular treatment with inhaled beclomethasone and budesonide was superior to regular inhalation of short acting 2 agonists in improving asthma symptoms and airway caliber and also reducing the use of rescue inhaled bronchodilators . It soon appeared at the population level that asthma mortality was decreasing in parallel to the increasing use of ics . In the mid - nineties it became clear that adding long acting 2 agonists (laba) to ics markedly improved airway caliber and symptoms, and in particular night symptoms, in those patients who remained uncontrolled with low dose of ics . Due to their marked efficacy, the combination therapy rapidly became the gold standard of asthma treatment, and given the high prevalence of asthma in the general population, this drug association became a blockbuster in western world countries . At the same time was launched cysteinyl - leukotriene receptor antagonist (ltra) as an alternative to ics for maintenance asthma treatment in those patients who did not tolerate or were afraid of taking ics . In randomized controlled trials (rcts), ltra proved to be less efficient than low dose of ics in improving airway caliber, reducing symptoms, and controlling airway eosinophilic inflammation in asthmatics selected on the basis of a high reversibility to 2 agonists . However, the superiority of ics disappeared when comparing the two classes of drugs in mild to moderate asthmatics in a real - life setting where ltra performed equally to ics to improve asthma control and quality of life, probably because of a better adherence to treatment given by the oral as compared to the inhaled route . At the turn of the century it was demonstrated that the combination of ics / laba was particularly effective in reducing asthma exacerbation in moderate to severe asthma, both ics and laba contributing to this important effect . The combination of ics / laba has shown not only efficacy in rcts but also effectiveness in real - life setting where patient selection criteria are less stringent, allowing a greater range of patients to participate . The technique of induced sputum has been pivotal in the emergence of inflammatory phenotype concept in asthma and it has become usual to classify asthmatics according to the proportion of eosinophils and neutrophils in the airways . It appeared that while eosinophilic asthmatics display a good clinical and functional response to a few - week treatment with ics, it was not the same for those patients without raised eosinophilic inflammation, and in particular in those with high sputum neutrophil counts, who really seemed to be insensitive to ics . The concept of severe asthma has recently been reshaped in a practical way that severe asthmatics are those patients in whom control may not be achieved with or requires a combination of high dose ics / laba . The first class of drug that was shown to bring clinical benefit is monoclonal antibody directed towards ige . Omalizumab proved to be efficient in reducing exacerbation rate and improving quality of life in severe allergic asthmatics who remained uncontrolled despite a combination of high dose ics / laba . Furthermore, the effectiveness of this medication has also been demonstrated in real life partly because of the magic and the regular follow - up imposed by the subcutaneous injection route . Similar to mild to moderate asthma, severe asthma was found to be heterogeneous with respect to the type of airway inflammation . More than half of severe asthmatics display residual eosinophilic inflammation despite receiving high dose of ics and even oral corticoids by some of them . In those patients, increasing the dose of ics or even giving oral corticoids results in a significant reduction of exacerbation . In those severe eosinophilic asthmatics, mepolizumab, which is an antibody directed towards interleukin (il)-5, reduces exacerbation rate while allowing for a reduction and even a stop of oral corticoids in some patients . Efficacy of anti - il-5 regarding exacerbation rate seems to be particularly related to the blood eosinophil count . It has recently been demonstrated that asthmatics who had both high blood and sputum eosinophil counts were more prone to exacerbation and poorer asthma control . The effects of anti - il-5 on day - to - day asthma control and lung function are more controversial but shown in some studies using reslizumab . It has recently been shown that the effect of omalizumab in reducing exacerbation rate was essentially limited to those patients with elevated feno (fractional ex - haled nitric oxide) and blood eosinophil counts . Monoclonal antibodies directed towards other cytokines, and in particular towards tnf, have yielded disappointing results so far . Some of them exhibit a marked increase in neutrophil counts in the airways . In those subjects, a few - week treatment with clarithromycin may reduce the neutrophil counts and slightly improve the quality of life but fails to improve day - to - day asthma control . Long - term effect of such a treatment on asthma exacerbation remains unknown, but this point has to be clarified in the future . In this view it is worth noting that, in a pilot study, asthmatics uncontrolled with moderate to high doses of ics and displaying a low blood eosinophil count had their exacerbation rate reduced by chronic treatment with low dose azithromycin . Effects of macrolides on severe neutrophilic asthma have to be confirmed in large scale rcts . We can however ask whether choosing neutrophils as the main target of treatment may be a double - edged sword, as these cells play a critical role in innate immunity operating in the airways . While ics have a potent effect on eosinophilic inflammation, their ability to oppose the airway remodeling is much more controversial . Thermoplasty, a new technique that delivers high energy in the bronchi during an endoscopic procedure, may bring significant benefit there . Applying this technique three times three weeks apart has proved to be safe and has resulted in a reduction of exacerbation and hospitalization together with improved quality of life in asthmatics uncontrolled by a combination of ics / laba . This treatment, approved by the food and drug administration in usa, has still to make its way in europe before becoming the official treatment for asthma . In particular it remains to determine in prospective studies which population of asthmatics may be the most suitable to benefit from this treatment procedure . As thermoplasty requires a technical expertise ics have dramatically changed the course of daily life in many asthmatics over the past decades and are responsible for the sharp reduction in asthma mortality observed since the nineties . Nevertheless, this class of drugs may not be sufficient or even inefficient in some patients . The respiratory physician dealing with asthma, and in particular with severe asthma, has to proceed with detailed functional and inflammatory investigations to better phenotype his / her patient thereby allowing to choose the most appropriate treatment. |
The search strategies used for this review involved literature searches of the medline and psychinfo electronic databases . The main heading terms included major depressive disorder, neurobiology, antidepressant, hippocampus, brain - derived neurotrophic growth factor, glucocorticoids and monoamines . As part of the research strategy, each article's bibliography was reviewed for additional potential research findings relevant to these terms . Major depressive disorder (mdd) is an illness with significant neurobiological consequences involving structural, functional and molecular alterations in several areas of the brain . Clinicians are advised to intervene with mdd using an early, comprehensive treatment approach that has remission as the goal . Major depressive disorder (mdd) remains one of the most frequently seen psychiatric illnesses in primary care settings (1). Although family and primary care physicians have greatly increased their recognition and treatment of this illness, mdd remains an unresolved treatment challenge for many physicians and patients (2). Increasing evidence has accrued in recent years regarding the impact of mdd on the structural and functional processes occurring in the brain . From the initial views chemical imbalance in the brain, this body of research has developed into a complex theory involving neuronal networks and plasticity (3). The network model has also led to a greater understanding of the mechanisms of effective treatment interventions and their role in mitigating the deleterious effects of mdd (4). The objectives of the present review were to summarise the key findings from the clinical literature regarding the neurobiology of mdd and their implications for maximising treatment outcomes . First, the evidence that mdd is not only a chronic and recurrent illness, but also a progressive illness will be presented . Second, the impact of mdd on the primary neuroanatomical sites associated with mood regulation will be described at the structural and functional level . Third, the molecular processes that have been implicated for mediating these structural and functional changes will be explored . Fourth, the role of multiple neurotransmitter systems will be reviewed for their involvement in restoration and recovery from mdd . The last section will discuss the treatment guidelines for obtaining remission in the context of this neurobiological model . Epidemiological studies have consistently shown that mdd is one of the most prevalent lifetime psychiatric disorders . In the national comorbidity replication survey, based on dsm - iv criteria for mdd, the lifetime prevalence rate was 16.2%, with a 12-month estimate of 6.6% (5). The presentation of mdd is heterogeneous with respect to both core and associated symptoms (6). In the diagnostic and statistical manual of mental disorders fourth edition, text revision (7), the diagnosis of mdd requires the experience of major depressive episodes that are defined by at least five of the following symptoms for at least 2 weeks duration: loss of interest, depressed mood, appetite / weight disturbance, sleep disturbance, psychomotor change, loss of energy, worthlessness / guilt, concentration difficulties / indecisiveness and thoughts of death / suicide . Depressed mood or loss of interest must be one of the symptoms, but with the inclusion of compound criteria (e.g. Worthlessness or guilt), a diagnosis of mdd can be met by various permutations, and episodes may then be further qualified by other associated features (e.g. Postpartum, seasonal pattern, with melancholy or psychotic symptoms). Even though mdd is characterised as an episodic illness, prospective studies have found that recurrence is the norm rather than the exception . For example, in a naturalistic, 15-year follow - up of a sample of 380 patients experiencing an index mdd episode, 73% experienced a recurrent episode (8), with each subsequent episode increasing the probability of further episodes (9). Similarly, in the star*d project (sequenced treatment alternatives to relieve depression) that includes 1500 patients with mdd, 74% of patients had experienced more than one episode (10). Recurrence of mdd appears to be driven in part by neurobiological vulnerabilities . In the star*d project, patients who experienced multiple episodes were more likely to have a positive family history of depressive illness and an earlier age of onset of their index depressive episode compared with patients who were in their first episode (10). Kindling hypothesis in which depressive episodes become more easily triggered over time (11). As the number of depressive episodes increase, future episodes are predicted more by the number of prior episodes rather than by life stress (12) (figure 1). Kindling can be described as a process which occurs by a lowering of the threshold for the impact of stressful life events (i.e. Sensitisation to minor events) or by an increase in spontaneous dysregulation, both of which could indicate progressive effects of mdd (13). An analysis of the risk of recurrence in a large study of twins also suggests genetic contributions as patients with a high genetic risk were prekindled; that is, they had a lower association between stressful life events and the onset of depressive episodes compared with patients having a low genetic risk (14)., the risk for subsequent episodes is predicted more from the number of prior episodes and less from the occurrence of a recent life stress . (14) early adverse experiences may also contribute to long - term neurobiological alterations associated with depression . In preclinical studies, maternal deprivation of rat pups during critical development periods resulted in subsequent hyper - reactivity to stress and marked behavioural changes in adult rats (15). In children who had a history of early maltreatment, the risk for depressive symptoms was associated with an interaction between genotypes [e.g. Serotonin (5-ht) transporter] and history of maltreatment (16). Considering these findings, some researchers have suggested that greater neurobiological changes occur in patients with depression who have early adverse experiences compared with patients who are depressed but do not have such a history, indicating that these patients may represent an especially vulnerable subtype of depressive illness (17). Chronicity also suggests long - term neurobiological consequences associated with the mdd illness . In the star*d project, 25% of the patients (with single or recurrent mdd) were identified as having a chronic episode of more than 2 years duration (10). In another large multicentre treatment study (n = 681), patients depression was classified using dsm - iv modifiers into four categories: chronic mdd (episodes> 2 years), mdd with incomplete recovery (partial response), mdd superimposed on dysthymia (double depression) and chronic mdd superimposed on dysthymia (depressive symptoms> 4 years). Despite multiple comparisons across a broad range of clinical and psychological variables, few differences were found among the four groups, resulting in the conclusion that various manifestations of chronic depression represent the same illness (18). As the duration of depressive episodes increases, the probability of recovery substantially decreases over time . In a 5-year prospective study of outpatients with depression, approximately half recovered within the first 6 months, but afterwards the rate of recovery diminished substantially . For example, patients who had experienced depressive episodes of 1-year duration had a recovery rate of 16% compared with a 1% recovery rate for patients whose episodes persisted> 5 years (19). Similarly, in a prospective study of new onset depressive episodes, a longer duration (> 12 weeks) of previous episodes reduced the likelihood of recovery from the new onset episode by 37% (20). Even if patients no longer meet full criteria for an mdd episode, studies have found that a substantial subset of patients continue to experience residual symptoms and diminished functioning . In a 3-year longitudinal epidemiological study, 165 patients were assessed before and after an mdd episode . Although mean values on functional measures returned to premorbid levels, 1540% of patients experienced a worsening in psychosocial functioning that persisted after the episode, and the overall functioning of the entire sample continued to be lower than that of a healthy cohort (21). In a 10-year, naturalistic longitudinal study, patients who experienced subthreshold depressive symptoms following an mdd episode were at significantly greater risk for a recurrence, and they also had a much faster onset of their next episode compared with patients whose episode had fully remitted, suggesting that residual symptoms represent vulnerability because of an active disease state (22). The recurrence and chronicity of mdd along with possible kindling effects have shifted the perspective of the appropriate treatment goal . The gold standard for treatment outcome has been raised from response (reduction in symptoms) to remission (absence of symptoms) or recovery (extended period of remission) (23). However, obtaining recovery implies not only the remission of symptoms but also a restoration of the underlying physiology associated with the illness . Therefore, further understanding of the neurobiological changes associated with mdd is necessary for identifying true recovery processes . Although much information still needs to be attained, imaging and other methods have begun to elucidate the neurobiological abnormalities associated with mdd . In particular, several prefrontal and limbic structures and their interconnected circuits these neuroanatomical areas include the ventromedial prefrontal cortex (vmpfc), lateral orbital prefrontal cortex (lopfc), dorsolateral prefrontal cortex (dlpfc), anterior cingulated cortex (acc), ventral striatum (including nucleus accumbens), amygdala and the hippocampus . Abnormalities in these areas have been shown in patients with mdd compared with healthy controls and thus suggest a foundation for the symptomatic expression of mdd (24, 25). However, these deviations may be obscured or not present at the individual patient level and thus, these findings cannot necessarily be considered pathognomic . Major depressive disorder affects the dynamic connectivity among neuroanatomical structures involved in regulation of mood and stress response . Limbic structures (amygdala, hippocampus and nucleus accumbens) have reciprocal connections with para - limbic cortical areas, subgenual anterior cingluate and ventromedial prefrontal cortex (vmpfc). Connectivity between limbic / para - limbic areas and rostral integrative prefrontal formations, results in compromised feedback regulation of limbic activity . Consequently, dorsal cognitive / executive network is hypoactive while overly active limbic areas continue to stimulate the hypothalamus leading to neuroendocrine dysregulation and sympathetic hyperactivity as an integrated circuit, the prefrontal cortex, cingulate, amygdala, and hippocampus serves not only mood regulation, but also learning and contextual memory processes . Within the prefrontal cortex, the vmpfc mediates pain, aggression, sexual functioning and eating behaviours whereas the lopfc assesses risk and modulates maladaptive and perseverative affective states (behaviours). These two areas have a reciprocal pattern of activity with the dlfpc, which maintains executive function, effortful sustained attention, and working memory processes (26). Subdivisions within the acc assume diverse roles, with the dorsal acc being part of the cognitive / executive functioning network and the ventral acc being involved in assessing emotional and motivational information . The acc also monitors outcomes of behaviour and cognition and makes adjustments based on changing contingencies (27, 28). In patients with mdd, regional blood flow studies suggest hyperactivity in the vmpfc and lopfc and hypoactivity in the dlfpc compared with controls (24). Given the functions of these regions, as previously described, this abnormal activity pattern may be responsible for the manifestations of symptoms associated with mdd . Hyperactivity of the vmpfc is associated with enhanced sensitivity to pain, anxiety, depressive ruminations and tension whereas hypoactivity of the dlfpc may produce psychomotor retardation, apathy, and deficits in attention and working memory . Using fmri paradigms, connectivity studies have also suggested a decrement in the communication between amygdala and acc regions (29). A consequence of this loss of connectivity could be a failure of the acc to serve its inhibitory role in emotional regulation (30), resulting in further motivational and affective disruption (31). At the intersection of limbic, cognitive / executive and neuroendocrine regulatory circuits, including the hypothalamic - pituitary - adrenal axis (hpa) imaging studies of hippocampal volume have been of particular interest . In a meta - analysis of 12 studies, hippocampal volume was found to be consistently and significantly reduced in patients with mdd compared with controls, and these reductions occurred bilaterally with a slightly greater decrement in right hippocampal volume (32). Other studies have shown that the degree of hippocampal reduction is directly proportional to the number and the duration of untreated depressive episodes (33). Among depressed inpatients, while controlling for the effect of age, hippocampal volume was significantly correlated with duration of illness prior to hospitalisation (34). Even after remission of an episode, patients with recurrent mdd have continued to show significantly smaller hippocampal volume compared with healthy controls (35). Differences in hippocampal volume between patients with depression and healthy controls may not be fully attributable to the disease state . Heritability studies of hippocampal volume suggest both environmental and genetic contributions with heritability estimates of 54% in nonhuman primates and 40% in adult male twins (36, 37). Several genomic imaging studies, comparing patients with mdd and healthy controls, have shown associations between hippocampal volume and specific genes that are implicated in mood disorders (38, 39). In a 1-year prospective study of 30 patients with mdd, hippocampal volume did not significantly change during the study period, but patients whose depression failed to remit had a significantly smaller hippocampus at baseline and at 1 year than did patients who did remit (40). Combining the evidence from these genetic, cross - sectional, and clinical treatment studies suggests that morphological differences in the hippocampus may be a predisposing factor in mdd, but changes can also accumulate in the course of the disease and thereby create an obstacle to full recovery . The alteration in the hippocampus signifies a potential outcome of injurious feedback that occurs via neuroendocrine dysregulation . A consistent finding in patients with mdd is a high level of the stress hormone cortisol, which may cause impairment in neuroplasticity and cellular resistance (41). An imbalance between glucocorticoid and mineral corticoid receptors in mdd along with high - density glucocorticoid receptors (grs) may also contribute to the hippocampus susceptibility to neuronal damage (42). Subsequent hippocampal atrophy could result in further neuroendocrine dysfunction and hence a potential run - away system (43). Postmortem comparisons of brain tissue in patients with mdd and age - matched healthy controls have shown hippocampal shrinkage in depressed subjects that was caused by increased density of neuronal cells and a significant reduction in neuropil (i.e. Decreased dendridic branching and spine complexities) (44). A corollary of elevated glucocorticoids and compromised hippocampal functioning may also be the down - regulation of the gr sensitivity . Under conditions of chronic stress, decrease in gr sensitivity can have negative consequences as gr signalling becomes insufficient to turn off the initial responses to stress as part of a negative feedback process (45, 46) (figure 3). Subsequently, hpa hypothalamic overactivity, in conjunction with amygdala activation, leads to increased sympathetic tone, which promotes the release of cytokines from macrophages . Increase in pro - inflammatory cytokines has been associated with loss of insulin and gr sensitivity, which further perpetuates metabolic and neuroendocrine disruption (47). Symptomatically, disruptions as a result of proinflammatory cytokines may be experienced as fatigue, loss of appetite and libido as well as hypersensitivity to pain (48). Stress results in release of glucocorticoids and corticotrophin releasing hormones (crh) and pro - inflammatory cytokines (tnf, il-1, il-6). In depression, disruption of serotonin (5-ht), norepinephrine (ne) and dopamine (da) transmission impair the regulatory feedback loops that . They may also diminish central corticosteroid receptor sensitivity, leading to disruption of feedback control . (46) proinflammatory cytokines may also diminish neurotrophic support and monoamine neurotransmission that can lead to neuronal apoptosis and glial damage . Alterations in glia neuron relationships have been recently emphasised in the aetiology of neuropathic pain and mdd (47, 49). Glia cells are involved in an intricate interaction with neurons in which astroglia and microglia maintain homeostasis of the neuronal environment by modulating electrolytes, neurotransmitters, cytokines and neurotrophic factors (50). Stress, depression and ensuing peripheral immune dysregulation lead to activation of microglia that then contribute to the existing immune disruption by additional release of inflammatory cytokines (51). An integral part of maintaining the health of these glial neuron interactions may be mediated by brain - derived neurotrophic factor (bdnf) (52). Involved in neurogenesis, bdnf is the primary neurotrophin of the hippocampus . As a dimeric protein involved in cell maintenance, plasticity, growth and death (apoptosis), bdnf is structurally related to nerve growth factor and is distributed widely throughout the brain (53). When bdnf interacts with tyrosine receptor kinase receptors (trkb), it promotes cellular resilience and long - term potentiation . However, the precursor form of bdnf (pro - bdnf) can also precipitate reduction in dendritic spines and cell death when it binds with the p75 receptor . Thus, depending upon its expression, bdnf can prune neural networks in an activity dependent manner that is regulated by various neurotransmitters [glutamate, gaba, 5-ht, norepinephrine (ne), acetylcholine, dopamine and hormones] (54). Preclinical and clinical studies have suggested dysregulation in bdnf occurs under conditions of chronic stress and depression . In animal models, similar results were also observed following administration of acute and chronic pain stimuli (55). Within humans, levels of serum bdnf has been found to be significantly lower in untreated patients with mdd compared with treated patients or healthy controls (56). Similarly, postmortem analyses of brains of persons who committed suicide showed that bdnf and another neurotrophin (nt-3) were significantly reduced compared with non - suicide controls (57). From the above observations, the neurotrophic hypothesis has emerged as a major theory for the pathogenesis of major depression . In this model, stress and genetic vulnerability elevate glucocorticoid steroids and alter cellular plasticity via downregulation of growth factors and receptor sensitivity (4). The reduction in growth factors, such as bdnf, impacts negatively on the structural and functional processes within the limbic system, especially for the hippocampus . Chronic and recurrent mdd may result in subsequent atrophy and further disruptions in neurocircuitry . From this hypothesis, recovery and remission of mdd would be dependent upon a reversal of these processes, such as an increase in bdnf levels . Complementing the neurotrophic hypothesis of mdd is the monoamine theory, which postulates that depression a recent imaging study of patients with untreated depression found a high global receptor density for the monoamine oxidase a (mao - a), which nonspecifically metabolises these neurotransmitters . In this updated theory, long - term monoamine loss because of this global mao - a activity interacts with regional specific transporter densities (i.e. 5-ht, ne), resulting in the expression of the depressive illness (58). Both 5-ht and ne ascending fibres originate from brainstem nuclei and innervate the limbic system, prefrontal cortex and associated structures involved in the regulation of mood . Descending pathways project through the dorsolateral spinal column and are instrumental in the regulation of pain (59, 60). Therefore, depending upon the specific transporter densities within these regions, various symptoms of depression (mood, cognition and pain) will be manifested within the context of the overall global reduction in monoamine levels (58). Therapeutically, selective serotonergic reuptake inhibitors (ssris) and ne reuptake inhibitors (nris) are known to increase their respective monoamine levels in the brain . Chronic treatment with monoamine reuptake inhibitors increases activation of cyclic adenosine 3 - 5 monophosphatase (camp), which in turn stimulates protein kinase a. activation of this protein enzyme regulates target genes leading to an increase in bdnf synthesis (52). The antidepressant - induced camp activity can also enhance gr sensitivity and inhibit cytokine signalling, further assisting in the restoration of the neurocircuitry feedback loops (61). The effect of increasing monoamine levels (dopamine, 5-ht and ne) on bdnf and growth factors may be one mechanism that produces the antidepressant response . Preclinical study of rat brain cells has demonstrated that monoamenergic activity (ne, 5-ht) upregulates bdnf synthesis in astrocytes (62). Clinically, successful treatment with antidepressants results in normalisation of serum bdnf level, which is considered an indirect measure of cortical bdnf activity . Support for the relationship between serum and cortical bdnf levels has been derived from correlations in animal studies as well as findings that serum bdnf passes the blood brain barrier and reflects stored and circulating bdnf in humans (63, 64). In a study of 10 patients who were treated for 12 weeks with a dual reuptake inhibitor, improvement in depressive symptoms was correlated with increases in bdnf levels, and the bdnf levels of remitted patients had normalised to the same level observed in healthy controls (65). Response to various ssri and 5-ht noradrenalin reuptake inhibitors (snri) treatments has been similarly associated with restoration of normative bdnf values (66) (figure 4). Postmortem analysis of brain tissue has shown that subjects who had been treated with an antidepressant at time of death had greater hippocampal bdnf expression as measured by immunoreactivity than did untreated subjects with mood disorders (67). Treatment with various selective serotonin antidepressant treatments and serotonergic noradrenergic reuptake inhibitors resulted in increases in serum brain - derived neurotrophic factor (bdnf) for patients with mdd to levels comparable that were observed with healthy controls . (66) antidepressant therapeutic response is also associated with re - establishment of normative cortical activity . A study of 17 inpatients with mdd examined regional activity changes following 1 week and 6 week fluoxetine treatment . At 1 week, all patients showed increases in hippocampal activity and decreases in posterior cingulate and prefrontal cortex activity . After 6 weeks of treatment, patients who had responded to treatment showed a reversal of this pattern with decreased limbic activity and increased prefrontal cortical activity whereas non - responders continued to show the 1-week pattern (68). Normalisation in the amygdala and acc has also been associated with positive response to treatment . Using a masking paradigm for subconscious activation, patients with mdd showed a baseline hyper - reactivity of the left amygdala that attenuated following 8-week treatment with sertraline (69). Structural and functional mri assessments of patients with mdd who were treated with fluoxetine indicated the importance of acc grey matter volume for treatment response as there was a positive association among grey matter volume, normalisation of acc activity, and response to treatment (70). Conversely, in patients with mdd who failed to respond to antidepressant treatment, plasma levels of proinflammatory cytokines were elevated compared with healthy controls or euthymic patients with mdd (71). Symptomatically, improvements in specific mdd symptoms have been associated with regional improvements in brain metabolic activity . In 39 outpatients with mdd, improvement in cognitive symptoms was correlated with increases in dlpfc and improvements in fatigue / psychomotor retardation was associated with decreases in vmpfc activity . Interestingly, these changes were seen in responders regardless of whether treatment was pharmacological or psychological (72). Restoration of the neurobiological regulation in mdd via neurotrophic factors and neurogenesis appears to be a common factor across various effective treatments for mdd, including pharmacological, psychological and somatic treatments, such as diet and exercise (73). The neurobiological sequelae and repercussions of chronic or recurrent mdd indicate that interventions for mdd should be focused on achieving optimal treatment early . Longitudinal studies have shown that one of the best predictors of remission status at 2 years was response to acute treatment, i.e. Initial 6 weeks (74). In addition, the adequacy of treatment may also have prognostic implications . For patients with late - life depression, exposure to previous inadequate trials of antidepressants resulted in a reduced response rate to pharmacological intervention augmented by psychotherapy compared with treatment of naive patients, even after controlling for baseline severity (75). Similarly, in a large observational study of 996 patients with mdd, non - response or incomplete response to initial antidepressant treatment was a significant predictor of eventual treatment resistance (76). On the positive side, an early response to antidepressants one way of maximising early response is to apply a comprehensive treatment that increases activity of multiple monoaminergic systems . In a double - blind, randomised treatment study, 39 inpatients with mdd received either fluoxetine (a serotonergic intervention), desipramine (a noradrenergic intervention) or their combination . After 6 weeks of treatment, patients who had been given the combination treatment were more likely to achieve remission (53.8%) than either intervention alone (0% and 7.1%) (78). Similarly, a recent large meta - analysis encompassing 93 trials and 17,036 patients compared efficacy outcomes of ssri with snri treatments for mdd that showed a modest but significant advantage in efficacy with snri treatments (79). An earlier meta - analysis did not find a difference in efficacy between ssris and dual acting agents (mostly tricyclic antidepressants), with the exception of the inpatient populations, where dual acting tricyclic antidepressants had an advantage (80). Thus, although current treatment algorithms for mdd usually are initiated with ssris, the role of combination treatment or dual reuptake inhibitors are increasingly being considered as a preferred option (81). Another advantage of targeting both of 5-ht and ne systems is improvement not only in the core features of mdd, but also in associated physical symptoms . Painful physical symptoms are prevalent in patients with mdd, and these symptoms increase the illness burden and impair the ability to attain remission (82, 83). In a study of primary care patients with mdd who were treated with ssris for 9 months, mood symptoms continued to improve over time while painful physical symptoms persisted (84). The occurrence of painful physical symptoms and mdd reflects the shared underlying pathophysiology between mood and pain regulation . Importantly, there may be also a synergistic interaction between the 5-ht and ne systems to obtain analgesia . In an animal model of pain, treatment with dual reuptake inhibitors or combination treatment (5-ht / ne) appeared to enhance the effectiveness of pain alleviation (85). Clinically, patients with mdd who experienced a 50% or greater reduction in pain were more likely to achieve remission than patients whose pain reduction was <50% (86). With remission and recovery as the goal, the treatment guidelines derived from the neurobiological model emphasise the need for not only early and comprehensive intervention, but also vigorous attention to residual symptoms . In a 2-year study of outpatients with mdd, patients who obtained only a partial remission of symptoms were more likely to relapse (67.5%) than patients who had attained full remission (15.2%) (87). Specific recommendations for the treatment of residual symptoms have not been determined empirically, but likely require additional augmentation with other pharmacological and psychological treatments; in addition to reducing the risk of relapse, the treatment of residual symptoms may enhance compliance and long - term outcomes (88). As the underlying neurobiological model of depression is increasingly understood, treatment providers are directed to recognise that the factors that may initiate a mdd episode and those that maintain the illness are likely to be very different . Genetic and stress vulnerabilities interplay to initiate a cascade of neurobiological alterations that disrupt a dynamic system . Progressive effects of recurrent and chronic mdd may then be potentiated by further structural and functional abnormalities . Given these long - term consequences, an essential objective of treatment must be to restore normative functioning and prevent further neurobiological structural alterations . Increasing 5-ht and ne neurotransmission is likely to initiate true recovery with the restoration of neurotrophic support, glucocorticoid signalling and neuroendocrine regulation . The use of dual reuptake inhibitors enhances the probability of remission as it addresses the complex interplay of the emotional and physical symptoms of mdd . Painful physical symptoms are increasingly recognised as having a significant impact on functioning and recovery; thus, affirming the need for antidepressant treatments that can effectively reduce these symptoms as well . From the neurobiological model, the treatment guidelines of early, comprehensive and progressive treatment require a change in perspective for both patients and providers . A residual symptom may be interpreted as a proxy of an active disease state, with ensuing structural alterations and systemic consequences . With remission and recovery as the goal, patients will need to be educated about the benefits of long - term treatment rather than episodic or incomplete intervention . A biopsychosocial treatment model that incorporates cognitive - behavioural or interpersonal therapy along with pharmacological interventions serves to address both the initiation and maintenance factors and can reduce the risk of relapse (89). Once remission is attained, maintenance of effect may become the more appropriate term, rather than relapse prevention, to emphasise the necessity for an ongoing collaboration between patient and physician in order to maintain neurobiological homeostasis. |
Surface interactions of liquids in porous media are of great importance, particularly in the field of heterogeneous catalysis,[15] and the ability to understand surface interactions is essential for efficient and rational catalyst design . However, probing liquid surface interactions in liquid - saturated porous media is particularly challenging . Established techniques for probing the interaction of molecules at solid surfaces include isosteric heat of adsorption, temperature - programmed desorption (tpd), infra - red (ir) spectroscopy, and nuclear magnetic resonance (nmr) chemical shift (). However, all these measurements have limitations, and none are able to probe, non - destructively, the behaviour of molecules on catalyst surfaces at realistic reaction conditions . For example, whilst isosteric heat of adsorption measurements are non - invasive, they require the determination of adsorption isotherms at different temperatures, and are therefore extremely time - consuming; characterisation of co - adsorbed systems may take in excess of well over ten hours . Tpd is known to cause in situ reactions of some organic molecules leading to dehydration, isomerisation and decomposition, and is also limited in its ability to probe co - adsorption. [9, 10] ir is well known to be limited to liquids and solids that are transparent in the frequency range of interest . Finally, nmr chemical shift interpretation is robust only for monolayer surface coverage. [12, 13] it has recently been reported that under certain conditions chemical shift measurements can be used to probe surface interactions over pvp - stabilised metal nanoparticles . In this example, the chemical shift of formic acid (adsorbate) on metal colloid catalysts, measured by c nmr spectroscopy in aqueous suspension, was used to infer the strength of surface interaction . However, to achieve this measurement it was necessary to avoid direct contact between the c atom of the adsorbate and the metal surface by inserting oxygen - atom spacers, in order to eliminate spectral line broadening . Whilst this is clearly an elegant measurement, it cannot readily be transferred to measurements of liquid surface interactions in saturated porous materials of industrial relevance . In general, the use of nmr methods to probe adsorption is made challenging because of the broadening of the nmr lineshape associated with the adsorbed species, which arises because of the magnetic susceptibility differences between adsorbate and adsorbent . There exist many reports of nmr experiments probing different aspects of adsorption . C nmr is often the method of choice because of the wider chemical shift range, and hence spectral resolution attainable, relative to h observation . Examples of c nmr to study adsorption include chemical shift studies to investigate the structure of the adsorbed species and the determination of acid site strength (mostly in zeolites) using suitable probe molecules such as acetonitrile or acetone. [16, 17] c nmr approaches usually require the use of enriched c species due to the low signal - to - noise ratio of c signal at natural abundance . However, it is noted that c studies of adsorbed species at natural isotopic abundance using the distortionless enhancement by polarisation transfer (dept) technique have been reported, although the strength of interaction was not probed using this technique . H nmr has been used by various researchers to study acidic strength of hydroxyl groups in zeolites, using deuterated probe molecules such as acetonitrile and pyridine. [1719] for example, zheng et al . Have conducted experimental and theoretical studies of deuterated pyridine adsorption to investigate acidic strength of solid acids and found a linear correlation between the h chemical shift of adsorbed pyridine and the proton affinity . Thus, whilst various implementations of nmr spectroscopy have been used to study adsorption phenomena in porous media, a robust, generic technique readily applicable to co - adsorption and with the ability to study liquid - saturated pore spaces, as opposed to monolayer coverages, has not been presented . The method proposed in the present work exploits the modification of the nuclear spin relaxation time characteristics of the adsorbate that result from its interaction with the surface of the pore . The advantage of using so - called nmr relaxation measurements is that the characterisation of the adsorption interaction does not rely on the nmr lineshape and the peak positionthe actual peak position associated with liquid confined within a porous medium, or chemical shift, may be influenced by factors other than the adsorbate moreover, measurements based on chemical shift will be limited in terms of the systems that can be studied when multi - component liquid systems inside the pore space are of interest, because of the broad, overlapping, line shapes associated with each component . In contrast, the relaxation times of different chemical species in a multi - component system are often quite distinct even when their respective chemical shifts overlap . Thus far[2124] it has been used as a qualitative probe yielding the relative strength of interactions between different adsorbate adsorbent systems . It is the purpose of this paper to demonstrate that the ratio of the spin - lattice to spin - spin (or transverse) relaxation time (t1/t2) can be related directly to the activation energy of desorption characterising the strongest adsorption sites on the surface of the adsorbent, as determined by temperature programmed desorption (tpd). In recent years, nmr relaxation has emerged as a non - invasive, chemically sensitive technique for studying surface interactions of liquids in saturated porous media . Following radio - frequency (rf) excitation, longitudinal t1 relaxation processes drive the longitudinal magnetisation to the equilibrium position, that is, aligned with the external magnetic field, whilst transverse t2 relaxation processes determine the rate of loss of phase coherence of the magnetisation in the transverse plane . Reduced t1 and t2 relaxation times are observed when liquid molecules adsorb on a solid surface due to a change in the molecular mobility; in bulk liquids, t1t2 . Both t1 and t2 are affected by changes in the rotational correlation time of the adsorbate molecules . However, t2 is further influenced by a translational correlation time associated with surface diffusion. [27, 28] consequently, when molecules adsorb on surfaces, changes in their translational and rotational dynamics influence t2 more than t1, resulting in t1>t2 . In porous materials with a high surface - to - volume ratio, s / v, the observed relaxation rates are proportional to s / v, so absolute t1 and t2 measurements cannot be readily used to compare interactions between materials with differing pore geometry, pore size and density of adsorption sites . However, the ratio of relaxation times t1/t2 is (to leading order) independent of these characteristics . It has been observed empirically that the ratio t1/t2 provides an indication of the relative strength of surface interaction for different liquids in the same catalyst . For example, in the aforementioned work, it was observed that water imbibed in pd / al2o3 catalyst trilobes exhibits a much larger t1/t2 ratio (stronger surface interaction) than 2-butanone on the same surface; water is known to poison this palladium catalyst in the hydrogenation of 2-butanone by preferential adsorption on the active sites . Other studies, which exploit t1/t2 as a probe of surface interaction strength and the ability of these measurements to help understand catalytic performance, have recently been reported. [2123] it is important to note that besides the advantage of being independent of pore geometry, the use of t1 and t2 relaxation times is particularly advantageous if co - adsorption in porous materials is to be probed . This is because the method has the advantage that different species can often be separated based on their relaxation time values even when the two species cannot be separated in the chemical shift domain, which is often the case in porous materials . This was shown when studying co - adsorption of various binary mixtures in porous al2o3 and sio2 supported catalysts . The aim of the present work is to confirm theoretically that the ratio t1/t2 can be used as a qualitative descriptor of surface affinity, and extend the measurement to provide a quantitative metric of the same . Moreover, if this is the case, can the t1/t2 measurement be shown to correlate with an accepted laboratory characterisation of the adsorption interaction, namely tpd? Indeed, if the theoretical interpretation summarised below is appropriate, we might expect the value of t1/t2 to correlate with the strongest adsorption energies characterising a particular system, since nuclear spin relaxation is dominated by the strongest relaxation sinks present . In this section we establish proportionality between nmr relaxation and adsorption energy for a molecule interacting with the surface of a pore; the relaxation of the adsorbed molecule will be modulated by the reduction in molecular mobility and the dipole the present analysis develops from the established theory of surface relaxation, which assumes the pore surface contains paramagnetic impurities that act as relaxation sinks and it is dipole - electron coupling that determines t1/t2 . In recent work we demonstrated that the analysis of godefroy et al . For proton electron dipole coupling is extensible to proton proton dipole coupling, albeit with a much weaker coupling constant . In the absence of paramagnetic species, it is the active binding sites on the pore surface that are considered to be the relaxation sinks . Molecules adsorbed onto a surface undergo two - dimensional (2d) translational motion governed by the activation energy em . The diffusion coefficient associated with this surface motion is: in which dm0 is a temperature independent contribution to surface diffusion, r is the ideal gas constant, and t is the temperature . In liquid - saturated porous materials, adsorbed molecules the effective surface diffusion coefficient deff (observed) is modified from dm due to the finite residence time on the surface . Therefore, the effective diffusion coefficient is: in which e = emes is an activation energy for surface diffusion . The diffusion coefficient has an associated correlation time m that describes the time for diffusion between active binding sites, such that deff(t)/(4m), where is the thickness of the adsorbed surface layer . Thus, the surface correlation time is defined as: there will also be a surface residence time for adsorbed molecules, which is similarly defined as: the observed relaxation times for liquid saturated porous media are: in which 1,2 are the surface relaxivity values governing longitudinal and transverse relaxation processes at the pore surface, respectively, t1,2,bulk are the respective relaxation times of the bulk liquid, and p is the fraction of spins on the pore surface . For the catalyst supports of interest, the pore diameters are on the order of nanometres, such that the observed relaxation times are determined only by surface relaxation . The ratio of observed (surface) relaxation times is defined by the spectral density function j(0) as: at high field, this ratio is known to be insensitive to larmor frequency . Based on typical measured values of m, s for liquids on an alumina surface, and given that 0 is large, we assume that (m/s)(0m)1 . Through a series of trivial algebraic steps suggest that t1/t2 is sensitive to small changes in ln(m) but insensitive to large changes in ln(s/m) as m, s are not independent variables . Therefore, for the purpose of establishing a relationship between surface relaxation and adsorption energy it follows from equation (3) and the reduced form of equation (6), given 0 is constant, that: we define a dimensionless surface interaction parameter esurf=t2/t1 for the purpose of interpreting surface relaxation as a surface energy . For the materials of interest in this study, we are concerned only with the dynamics of the adsorbed liquid that give rise to altered nmr relaxation times . However, it is important to consider the extent to which other properties of the sample will influence the observed relaxation times, and the t1/t2 ratio . The most important of these are 1) the presence of paramagnetic species on the pore surface, and 2) the presence of magnetic susceptibility contrast between the solid and liquid . First, considering the case of presence of paramagnetic species on the pore surface; such species will alter the sensitivity of the relaxation mechanism to m and s . Empirical evidence suggests the ratio t1/t2 remains independent of the density of surface paramagnetic species (such as fe) when the concentration of the paramagnetic impurity is less than 5000 ppm,[36, 37] even though the individual values of t1 and t2 are affected by impurities at concentrations greater than 200 ppm . At paramagnetic impurity contents> 5000 ppm, re - calibration of the correlation between esurf (nmr) and emax (tpd), the presence of magnetic susceptibility contrast between the solid and liquid will distort the magnetic field such that the diffusion - sensitive t2 measurement is no longer determined by surface adsorption . We have shown recently that the correct t2 relaxation time can be extracted in the presence of pore - scale magnetic field inhomogeneities . Neither of these conditions apply to the materials studied here, so the observed t1/t2 ratios can be interpreted directly in terms of a surface adsorption energy . In this section we establish proportionality between nmr relaxation and adsorption energy for a molecule interacting with the surface of a pore; the relaxation of the adsorbed molecule will be modulated by the reduction in molecular mobility and the dipole dipole coupling between protons in the adsorbed molecule and those bound to the surface . The present analysis develops from the established theory of surface relaxation, which assumes the pore surface contains paramagnetic impurities that act as relaxation sinks and it is dipole - electron coupling that determines t1/t2 . In recent work we demonstrated that the analysis of godefroy et al . For proton electron dipole coupling is extensible to proton proton dipole coupling, albeit with a much weaker coupling constant . In the absence of paramagnetic species, it is the active binding sites on the pore surface that are considered to be the relaxation sinks . Molecules adsorbed onto a surface undergo two - dimensional (2d) translational motion governed by the activation energy em . The diffusion coefficient associated with this surface motion is: in which dm0 is a temperature independent contribution to surface diffusion, r is the ideal gas constant, and t is the temperature . In liquid - saturated porous materials, adsorbed molecules exchange with molecules not directly interacting with the pore surface . The effective surface diffusion coefficient deff (observed) is modified from dm due to the finite residence time on the surface . Therefore, the effective diffusion coefficient is: in which e = emes is an activation energy for surface diffusion . The diffusion coefficient has an associated correlation time m that describes the time for diffusion between active binding sites, such that deff(t)/(4m), where is the thickness of the adsorbed surface layer . Thus, the surface correlation time is defined as: there will also be a surface residence time for adsorbed molecules, which is similarly defined as: the observed relaxation times for liquid saturated porous media are: in which 1,2 are the surface relaxivity values governing longitudinal and transverse relaxation processes at the pore surface, respectively, t1,2,bulk are the respective relaxation times of the bulk liquid, and p is the fraction of spins on the pore surface . For the catalyst supports of interest, the pore diameters are on the order of nanometres, such that the observed relaxation times are determined only by surface relaxation . The ratio of observed (surface) relaxation times is defined by the spectral density function j(0) as: at high field, this ratio is known to be insensitive to larmor frequency . Based on typical measured values of m, s for liquids on an alumina surface, and given that 0 is large, we assume that (m/s)(0m)1 . Through a series of trivial algebraic steps it can be shown that t1/t2 is proportional to ln(s/m)/ln(0m). Theoretical calculations previously reported by mcdonald et al . Suggest that t1/t2 is sensitive to small changes in ln(m) but insensitive to large changes in ln(s/m) as m, s are not independent variables . Therefore, for the purpose of establishing a relationship between surface relaxation and adsorption energy it follows from equation (3) and the reduced form of equation (6), given 0 is constant, that: we define a dimensionless surface interaction parameter esurf=t2/t1 for the purpose of interpreting surface relaxation as a surface energy . For the materials of interest in this study, we are concerned only with the dynamics of the adsorbed liquid that give rise to altered nmr relaxation times . However, it is important to consider the extent to which other properties of the sample will influence the observed relaxation times, and the t1/t2 ratio . The most important of these are 1) the presence of paramagnetic species on the pore surface, and 2) the presence of magnetic susceptibility contrast between the solid and liquid . First, considering the case of presence of paramagnetic species on the pore surface; such species will alter the sensitivity of the relaxation mechanism to m and s . Empirical evidence suggests the ratio t1/t2 remains independent of the density of surface paramagnetic species (such as fe) when the concentration of the paramagnetic impurity is less than 5000 ppm,[36, 37] even though the individual values of t1 and t2 are affected by impurities at concentrations greater than 200 ppm . At paramagnetic impurity contents> 5000 ppm, re - calibration of the correlation between esurf (nmr) and emax (tpd), the presence of magnetic susceptibility contrast between the solid and liquid will distort the magnetic field such that the diffusion - sensitive t2 measurement is no longer determined by surface adsorption . We have shown recently that the correct t2 relaxation time can be extracted in the presence of pore - scale magnetic field inhomogeneities . Neither of these conditions apply to the materials studied here, so the observed t1/t2 ratios can be interpreted directly in terms of a surface adsorption energy . Zirconia (zro2), -alumina (-al2o3), -alumina (-al2o3) and silica (sio2) were supplied by johnson matthey plc; anatase titania (tio2-a) and rutile titania (tio2-r) were supplied by evonik - degussa . All materials were used as - received in the form of 34 mm diameter cylindrical and 45 mm length extrudate pellets . Samples for nmr relaxation and tpd measurements were prepared by impregnating the different porous materials in deionised water for at least 24 h. excess surface water was removed from the pellets by gently contacting them on a pre - soaked filter paper . The suppliers of the alumina, silica and zirconia samples do not report any measureable paramagnetic impurities . The average pore diameter determined was as follows: tio2-a (23 nm); tio2-r (38 nm); -al2o3 (15 nm); -al2o3 (7 nm); sio2 (5 nm) and zro2 (9 nm). Nmr experiments were carried out on a bruker biospec (horizontal bore) av 85 mhz spectrometer . Samples were prepared by soaking the different solid materials in the liquid for at least 24 h; the pellets of solid material were dried on a pre - soaked filter paper, in order to remove any excess liquid on the external surface, and finally transferred into 20 mm diameter glass vials, which were then sealed . A standard t1t2 pulse sequence was used to acquire 2d correlation data . The specific sequence of rf pulses is illustrated in figure 1 . A 180 rf inversion pulse rotates the spin magnetisation, initially at equilibrium along the z axis, onto the z axis . Longitudinal t1 relaxation then occurs for a time 1; during this time the spin system recovers along the z axis and is aligned with the static magnetic field of magnitude b0 . After this recovery time, a 90 rf excitation pulse is applied and rotates the recovered spin magnetisation into the xy plane . A series of 180 rf refocusing pulses are then applied to generate a train of n spin echoes, each separated in time by te=22 . The amplitude of each echo is recorded as a single point, and all echo amplitudes are recorded in a single scan (no chemical resolution). The amplitude of the initial echo is determined by the degree of recovery during 1; the envelope of the echo train is described by the transverse t2 relaxation of the spin ensemble . By repeating the experiment for different 1 recovery times, a 2d data matrix is constructed . Here, 16 t1 recovery delays were used, ranging from 1=1 ms to 10 s; n=1024 spin echoes were acquired in a single shot with an echo time spacing te=0.8 ms . A recycle delay of 10 s was included between each scan to ensure maximum signal was obtained at all times . The total experiment duration was 1.5 h, and included 32 repeat scans to accommodate the rf phase cycle and provide signal averaging to improve the signal - to - noise ratio (snr) of the data . The t1t2 pulse sequence, showing the rf pulses as thin (90) and thick (180) vertical bars . The amplitude of each of the n spin echoes is recorded as a single datum . The 2d data are inverted numerically to form a 2d distribution of t2 correlated against t1 . The nmr data are described by the first kind fredholm integral equation: in which the nmr signal is b, is the experimental error (noise), f(t1,t2) is the required 2d correlation, and the kernel function k(1,t1,nte, t2) represents the expected form of the data so that: in which the first exponent describes the t1 relaxation and the second exponent describes the t2 relaxation . As the two exponents do not share a common time base, the kernel function is separable, that is, the expected behaviour of the signal amplitude for a given set of (1,t1) can be determined separately from the expected behaviour of the signal amplitude for a given set of (nte, t2). This separation allows us to solve the fredholm integral equation in (9) efficiently in vector the result is biased to be positive, smooth, and bounded by pre - determined limits in t1 and t2 . A stable distribution, obtained in the presence of noise, is found using tikhonov regularisation with the smoothing parameter chosen using the generalised cross validation method; a review of data inversion techniques is presented elsewhere . The inversion is highly susceptible to noise fluctuations and the degree of smoothing increases as the snr decreases . Variations in distribution shape of less than an order of magnitude on the relaxation time axes are therefore considered to be determined by the signal quality and not the sample . Tpd experiments were performed on a catlab - pcs (hiden analytical), comprising a microreactor module with integrated mass spectrometer . Pellets saturated with water were placed into the glass microreactor in a high purity helium flow at a constant rate of 40 ml min and left for one hour at 45 c until all the physisorbed water was removed . Tpd curves of water (m=18 amu) were recorded in the range 451000 c with a heating rate of 20 c min . Each tpd measurement lasted 3 h. the amount of water desorbed from each porous material during the tpd experiments was calculated by using a calibration factor, which was obtained by measuring the area under the tpd profile corresponding to a known amount of desorbed water from a calibration sample . The analysis of the tpd curves was carried out according to the condensation approximation method reported by barrie in order to obtain the distribution function of the activation energy of desorption . Having derived equation (7), we now demonstrate that t1/t2 for the systems studied can indeed be related to the strongest relaxation sinks present (i.e., the strongest adsorption sites present)the strength of the strongest adsorption sites being determined by tpd analysis . We determine the strength of water adsorption in six porous oxides (extruded pellets) used as supports and catalysts: tio2-a (anatase), tio2-r (rutile) (supplied by evonik - degussa), zro2, -al2o3, -al2o3 and sio2 . We chose water as the adsorbate because it is central to aqueous - phase heterogeneous catalytic processes and, in the context of this work, has the additional advantages of not decomposing during thermally driven desorption . The tpd energy distributions for water desorbing from the porous oxides are shown in figure 2 . Due to the uncertainty associated with the tail of the tpd curves, we determine the maximum activation energy of desorption (emax) where the integral area of the desorption curves is 95% of the total, see figure 2 . Energy distribution functions obtained from tpd analysis of water in a) tio2-a, b) tio2-r, c) -al2o3, d) sio2, e) -al2o3 and f) zro2 . The vertical dashed lines indicate the activation energy of desorption (emax) at which 95% of species have desorbed . It is clearly seen that the shape of the tpd curves differs widely between the oxides studied . Ignoring any detailed structure in these plots, we see that the tio2 materials (figure 2a, b) are associated with significantly lower maximum desorption energies than the other materials studied . Based on the values of emax determined from the tpd the strength of the interaction of water with the porous solid decreases in the order: the t1t2 correlations for water in the porous oxides are shown in figure 3 . In each case, a single relaxation time component is observed; the relaxation times are dominated by surface adsorbed species due to the small pore size and high surface area in these oxides . The ratio t1/t2 is obtained from the logarithmic mean of the individual t1,2 dimensions, which corresponds almost exactly with the maximum intensity of the 2d peak in these mono - modal distributions . In these porous materials with narrow, mono - modal pore size distributions, details of the peak shape are determined predominantly by the raw data quality (degree of smoothing on inversion) and are not considered representative of physical sample properties . The 2d correlations provide a straightforward visual comparison and are required to interpret relaxation results obtained from complicated systems with multiple liquids or diffusive exchange. [24, 29] t1t2 correlation plots for water in: a) tio2-a, b) tio2-r, c) -al2o3, d) sio2, e) -al2o3 and f) zro2 . The solid diagonal line indicates t1=t2; the dashed line indicates t1/t2 at the maximum of the peak . A comparison between the nmr relaxation analysis and tpd is achieved by converting the t1/t2 ratio into an effective surface interaction parameter, esurf, using equation (7). The comparison between emax (tpd) and esurf (nmr) is given in figure 4, in which an excellent correlation is obtained between the two measurements . Notably, the tio2 samples have a markedly lower esurf value compared to the other oxides, consistent with their tpd spectra being significantly different to those of the other oxides . Elsewhere, a comparison between zro2 and tio2 surfaces has been carried out by ignatchenko and co - workers, who concluded, through isotopic exchange experiments and density functional theory (dft) calculations, that zro2 has a greater affinity for water than tio2 . Our results agree with these previous findings, and the high value of esurf obtained for water on zro2 correlates with the known strong affinity of water for this oxide surface . Values of the isosteric heat of adsorption for water on sio2[47, 48] have been reported to be comparable to those measured over -al2o3 . Again, this is in line with the finding of this work, which shows very similar esurf values for sio2 and -al2o3, with sio2 showing a slightly higher value . Overall, our results show that esurf for a given liquid adsorbed within a range of chemically similar materials does correlate directly with the maximum activation energy of desorption obtained by tpd analysis, as shown in figure 4 . Solid systems under investigation can be obtained, the esurf values can be converted to an estimate of the absolute maximum desorption energies characteristic of that system . Comparison of esurf (nmr) against emax (tpd) for water on oxides . Symbols correspond to (left to right) tio2-a, tio2-r, -al2o3, sio2, -al2o3 and zro2 . Error bars represent the uncertainty in determining the peak position in the t1t2 distributions (esurf) and 5% integral area under the tpd curves (emax). The adsorption site densities, calculated from the area under the tpd curve according to the procedure described in the experimental section, were: 0.11 (tio2-a and tio2-r), 0.84 (-al2o3), 1.38 (sio2), 2.95 (-al2o3), and 0.60 mmol m (zro2). No strong correlation is found between these values and the t1/t2 ratios, as expected from the earlier discussion[29, 30] regarding the relatively low sensitivity of t1/t2 to site density compared to the changing nature of interactions between liquids and surfaces of different chemistry . Zirconia (zro2), -alumina (-al2o3), -alumina (-al2o3) and silica (sio2) were supplied by johnson matthey plc; anatase titania (tio2-a) and rutile titania (tio2-r) were supplied by evonik - degussa . All materials were used as - received in the form of 34 mm diameter cylindrical and 45 mm length extrudate pellets . Samples for nmr relaxation and tpd measurements were prepared by impregnating the different porous materials in deionised water for at least 24 h. excess surface water was removed from the pellets by gently contacting them on a pre - soaked filter paper . The suppliers of the alumina, silica and zirconia samples do not report any measureable paramagnetic impurities . The average pore diameter determined was as follows: tio2-a (23 nm); tio2-r (38 nm); -al2o3 (15 nm); -al2o3 (7 nm); sio2 (5 nm) and zro2 (9 nm). Nmr experiments were carried out on a bruker biospec (horizontal bore) av 85 mhz spectrometer . Samples were prepared by soaking the different solid materials in the liquid for at least 24 h; the pellets of solid material were dried on a pre - soaked filter paper, in order to remove any excess liquid on the external surface, and finally transferred into 20 mm diameter glass vials, which were then sealed . A standard t1t2 pulse sequence was used to acquire 2d correlation data . A 180 rf inversion pulse rotates the spin magnetisation, initially at equilibrium along the z axis, onto the z axis . Longitudinal t1 relaxation then occurs for a time 1; during this time the spin system recovers along the z axis and is aligned with the static magnetic field of magnitude b0 . After this recovery time, a 90 rf excitation pulse is applied and rotates the recovered spin magnetisation into the xy plane . A series of 180 rf refocusing pulses are then applied to generate a train of n spin echoes, each separated in time by te=22 . The amplitude of each echo is recorded as a single point, and all echo amplitudes are recorded in a single scan (no chemical resolution). The amplitude of the initial echo is determined by the degree of recovery during 1; the envelope of the echo train is described by the transverse t2 relaxation of the spin ensemble . By repeating the experiment for different 1 recovery times, a 2d data matrix is constructed . Here, 16 t1 recovery delays were used, ranging from 1=1 ms to 10 s; n=1024 spin echoes were acquired in a single shot with an echo time spacing te=0.8 ms . A recycle delay of 10 s was included between each scan to ensure maximum signal was obtained at all times . The total experiment duration was 1.5 h, and included 32 repeat scans to accommodate the rf phase cycle and provide signal averaging to improve the signal - to - noise ratio (snr) of the data . The t1t2 pulse sequence, showing the rf pulses as thin (90) and thick (180) vertical bars . The amplitude of each of the n spin echoes is recorded as a single datum . The 2d data are inverted numerically to form a 2d distribution of t2 correlated against t1 . The nmr data are described by the first kind fredholm integral equation: in which the nmr signal is b, is the experimental error (noise), f(t1,t2) is the required 2d correlation, and the kernel function k(1,t1,nte, t2) represents the expected form of the data so that: in which the first exponent describes the t1 relaxation and the second exponent describes the t2 relaxation . As the two exponents do not share a common time base, the kernel function is separable, that is, the expected behaviour of the signal amplitude for a given set of (1,t1) can be determined separately from the expected behaviour of the signal amplitude for a given set of (nte, t2). This separation allows us to solve the fredholm integral equation in (9) efficiently in vector the result is biased to be positive, smooth, and bounded by pre - determined limits in t1 and t2 . A stable distribution, obtained in the presence of noise, is found using tikhonov regularisation with the smoothing parameter chosen using the generalised cross validation method; a review of data inversion techniques is presented elsewhere . The inversion is highly susceptible to noise fluctuations and the degree of smoothing increases as the snr decreases . Variations in distribution shape of less than an order of magnitude on the relaxation time axes are therefore considered to be determined by the signal quality and not the sample . Tpd experiments were performed on a catlab - pcs (hiden analytical), comprising a microreactor module with integrated mass spectrometer . Pellets saturated with water were placed into the glass microreactor in a high purity helium flow at a constant rate of 40 ml min and left for one hour at 45 c until all the physisorbed water was removed . Tpd curves of water (m=18 amu) were recorded in the range 451000 c with a heating rate of 20 c min . Each tpd measurement lasted 3 h. the amount of water desorbed from each porous material during the tpd experiments was calculated by using a calibration factor, which was obtained by measuring the area under the tpd profile corresponding to a known amount of desorbed water from a calibration sample . The analysis of the tpd curves was carried out according to the condensation approximation method reported by barrie in order to obtain the distribution function of the activation energy of desorption . Having derived equation (7), we now demonstrate that t1/t2 for the systems studied can indeed be related to the strongest relaxation sinks present (i.e., the strongest adsorption sites present)the strength of the strongest adsorption sites being determined by tpd analysis . We determine the strength of water adsorption in six porous oxides (extruded pellets) used as supports and catalysts: tio2-a (anatase), tio2-r (rutile) (supplied by evonik - degussa), zro2, -al2o3, -al2o3 and sio2 . We chose water as the adsorbate because it is central to aqueous - phase heterogeneous catalytic processes and, in the context of this work, has the additional advantages of not decomposing during thermally driven desorption . The tpd energy distributions for water desorbing from the porous oxides are shown in figure 2 . Due to the uncertainty associated with the tail of the tpd curves, we determine the maximum activation energy of desorption (emax) where the integral area of the desorption curves is 95% of the total, see figure 2 . Energy distribution functions obtained from tpd analysis of water in a) tio2-a, b) tio2-r, c) -al2o3, d) sio2, e) -al2o3 and f) zro2 . The vertical dashed lines indicate the activation energy of desorption (emax) at which 95% of species have desorbed . It is clearly seen that the shape of the tpd curves differs widely between the oxides studied . Ignoring any detailed structure in these plots, we see that the tio2 materials (figure 2a, b) are associated with significantly lower maximum desorption energies than the other materials studied . Based on the values of emax determined from the tpd the strength of the interaction of water with the porous solid decreases in the order: the t1t2 correlations for water in the porous oxides are shown in figure 3 . In each case, a single relaxation time component is observed; the relaxation times are dominated by surface adsorbed species due to the small pore size and high surface area in these oxides . The ratio t1/t2 is obtained from the logarithmic mean of the individual t1,2 dimensions, which corresponds almost exactly with the maximum intensity of the 2d peak in these mono - modal distributions . In these porous materials with narrow, mono - modal pore size distributions, details of the peak shape are determined predominantly by the raw data quality (degree of smoothing on inversion) and are not considered representative of physical sample properties . The 2d correlations provide a straightforward visual comparison and are required to interpret relaxation results obtained from complicated systems with multiple liquids or diffusive exchange. [24, 29] t1t2 correlation plots for water in: a) tio2-a, b) tio2-r, c) -al2o3, d) sio2, e) -al2o3 and f) zro2 . The solid diagonal line indicates t1=t2; the dashed line indicates t1/t2 at the maximum of the peak . A comparison between the nmr relaxation analysis and tpd is achieved by converting the t1/t2 ratio into an effective surface interaction parameter, esurf, using equation (7). The comparison between emax (tpd) and esurf (nmr) is given in figure 4, in which an excellent correlation is obtained between the two measurements . Notably, the tio2 samples have a markedly lower esurf value compared to the other oxides, consistent with their tpd spectra being significantly different to those of the other oxides . Elsewhere, a comparison between zro2 and tio2 surfaces has been carried out by ignatchenko and co - workers, who concluded, through isotopic exchange experiments and density functional theory (dft) calculations, that zro2 has a greater affinity for water than tio2 . Our results agree with these previous findings, and the high value of esurf obtained for water on zro2 correlates with the known strong affinity of water for this oxide surface . Measurements of isosteric heat of adsorption have also been used to study porous oxides . Values of the isosteric heat of adsorption for water on sio2[47, 48] have been reported to be comparable to those measured over -al2o3 . Again, this is in line with the finding of this work, which shows very similar esurf values for sio2 and -al2o3, with sio2 showing a slightly higher value . Overall, our results show that esurf for a given liquid adsorbed within a range of chemically similar materials does correlate directly with the maximum activation energy of desorption obtained by tpd analysis, as shown in figure 4 . Solid systems under investigation can be obtained, the esurf values can be converted to an estimate of the absolute maximum desorption energies characteristic of that system . Comparison of esurf (nmr) against emax (tpd) for water on oxides . Symbols correspond to (left to right) tio2-a, tio2-r, -al2o3, sio2, -al2o3 and zro2 . Error bars represent the uncertainty in determining the peak position in the t1t2 distributions (esurf) and 5% integral area under the tpd curves (emax). The adsorption site densities, calculated from the area under the tpd curve according to the procedure described in the experimental section, were: 0.11 (tio2-a and tio2-r), 0.84 (-al2o3), 1.38 (sio2), 2.95 (-al2o3), and 0.60 mmol m (zro2). No strong correlation is found between these values and the t1/t2 ratios, as expected from the earlier discussion[29, 30] regarding the relatively low sensitivity of t1/t2 to site density compared to the changing nature of interactions between liquids and surfaces of different chemistry . In this work we have presented a theoretical analysis to show that the ratio of nmr relaxation times, t1/t2, can be related directly to the adsorbate adsorbent interaction energy characterising adsorption in a porous material, and we introduce a quantitative metric esurf (based on the relaxation time ratio) characterising the strength of this surface interaction . We confirm that the t1/t2 ratio is insensitive to pore geometry, allowing adsorption of liquids to be compared between different materials . Given that the relaxation time characteristics of the nuclear spin system will be dominated by the strongest adsorption sites, the hypothesis that t2/t1 should correlate directly with the maximum activation energy of desorption observed in a temperature - programmed desorption experiment was tested; the data were found to support this hypothesis . Given this result, we now have a physical interpretation of the nmr relaxation data in terms of a surface activation energy of desorption . It follows from the analysis that for a series of materials for which at least two calibration values are obtainable by tpd, the esurf parameter yields a direct estimate of the maximum activation energy of desorption from the surface . Although the method has been demonstrated for water, the nmr relaxation analysis can be extended to probe non - invasively any adsorbed species, notably organic molecules . Further, given that nmr relaxation is readily extended to measurements at elevated conditions of temperature and pressure, these results suggest that the technique might be considered a useful addition to the toolkit of techniques employed to characterise adsorption in porous media used for applications in catalysis and separations processes . Beyond these applications, demonstrating that t1/t2, when expressed as esurf, is a quantitative measure of interaction strength has implications for determining surface wettability in oil - field reservoir rocks, an important parameter for predicting oil recovery . An improved correlation between relaxation time and surface adsorption energy could be obtained by measuring t1/t2 as a function of temperature or field strength, although such procedures for providing measurements of surface interaction strength would be considerably more time consuming . Nmr relaxation has been validated as a robust and versatile tool for quantitatively comparing liquid solid interactions in porous materials . In principle, the method is applicable to the characterisation of both liquid and gas phase adsorption, although signal - to - noise considerations may limit its applicability to gas solid interactions . This limitation and the consideration of chemically different surfaces (e.g., carbon - based), or materials with much smaller pore size (e.g., zeolites) are the subject of further consideration. |
Juvenile polyposis syndrome, a rare disorder in children, is characterized with multiple hamartomatous polyps in alimentary tract . A variety of manifestations include bleeding, intussusception, or polyp prolapse . In this study, we present an 8-month - old male infant of juvenile polyposis syndrome initially presenting with chronic anemia . To the best of our knowledge, we report a rare case of an 8-month - old male infant who presented with chronic anemia and gastrointestinal bleeding initially . Panendoscopy and abdominal computed tomography showed multiple polyposis throughout the entire alimentary tract leading to intussusception . Technetium-99m - labeled red blood cell (rbc) bleeding scan revealed the possibility of gastrointestinal tract bleeding in the jejunum . Histopathological examination on biopsy samples showed peutz - jeghers syndrome was excluded, whereas the diagnosis of juvenile polyposis syndrome was established . However, polyps recurred and occupied the majority of the gastrointestinal tract in 6 months . Juvenile polyposis syndrome is an inherited disease, so it is not possible to prevent it . Concerning of its poor outcome and high mortality rate, it is important that we should increase awareness and education of the parents at its earliest stages . It has been shown that affected children are susceptible to cancers and fatal medical conditions . The common presentations include anemia, recurrent gastrointestinal bleeding, diarrhea, rectal prolapse, intussusception, protein - losing enteropathy, starvation, and malnutrition . An 8-month - old male infant presented melena and iron deficiency anemia with hematocrit of 10.6% and hemoglobin of 2.9 g / dl . Panendoscopy revealed several polypoid lesions with ulceration over the body and the prepyloric area, which were bleeding to touch (fig . Computed tomography depicted numerous nodules throughout the entire alimentary tract, indicating intestinal polyposis (fig . Panendoscopy: at least 6 polypoid lesions over gastric body and prepyloric area with ulceration and touch bleeding . Abdominal computed tomography showed multiple nodules within the stomach, small intestine (including duodenum, jejunum, and ileum), and descending colon leading to intussusception . Owing to uncorrectable anemia as well as sonography constantly demonstrating intussusceptions (figs . 3 and 4), laparoscopy - assisted enteroscopic polypectomy and reduction of intussusceptions were performed (fig . The pathology report described hamartomatous polyps with elongation, tortuosity, and dilatation of the gastric foveae and intestinal mucosal glands . The underlying stroma is characterized by broadband smooth muscle fibers, intermingling with the glands (fig . Technetium-99m - labeled rbc bleeding scan: the possibility of gastrointestinal tract bleeding in the jejunum . -1 polypectomy and reduction of intussusceptions: (a) 2 intussusceptions were found, 1 at 20 cm distal to treitz ligament and another 1 at jejunoileal junction . (b, d) numerous polyps were found in whole small bowel, especially in jejunum . Microscopically, hamartomatous polyps composed of elongation, tortuosity, and dilatation of the gastric foveolae and intestinal mucosal glands . The underlying stroma is characterized by broadband smooth muscle fibers, intermingling with the glands . Thereafter, the patient suffered from multiple episodes of anemia, gastrointestinal hemorrhage, rectal prolapsed polyps, symptomatic colic - colic intussusceptions requiring radiologic reductions, protein - losing enteropathy, and immunodeficiency . It was our impression that the immunodeficiency was secondary to the remarkable protein - losing enteropathy and malnutrition . Human immunodeficiency virus (hiv) infection was excluded due to negative maternal hiv testing during prenatal checkups . It is not a routine in our institution to conduct another hiv examination before 24 months of age in infants with prior negative virologic tests . The serology study showed notably hypoglobulinemia with igg of 115 mg / dl and igm of 33 mg / dl . Complement levels were also significantly below the normal limits with c3 of 51 mg / dl and c4 of 7 mg / dl . Intravenous immunoglobulin was administered . In 6 months, polyps recurred and occupied the majority of the gastrointestinal tract . Juvenile polyps are mostly solitary, influencing approximately 1% of preschool and school - aged children . Juvenile polyposis syndrome may extensively affect a large portion of alimentary tract, and be usually related to malignant potential . It has been known with 3 subtypes: diffuse juvenile polyposis of infancy (<6 months of age), diffuse juvenile polyposis (6 months5 years of age), and juvenile polyposis coli (515 years of age). Histologically, the polyps in juvenile polyposis syndrome are composed of mucous filled, dilated glands that are often associated with inflammatory cell infiltration . Unlike those in peutz - jeghers syndrome, smooth muscle proliferation is rarely seen . Nevertheless, the polyps consisted of smooth muscle bands in stroma in this case . Peutz - jeghers syndrome was initially suspected . However, the patient had neither relevant family history nor oral pigmented lesions that were highly associated with peutz - jeghers syndrome . Peutz - jeghers syndrome was excluded, whereas the diagnosis of juvenile polyposis syndrome was established . It is featured with widespread hamartomatous polyps in the entire gastrointestinal tract in infants <6 months of age . The initial manifestations of anemia and gastrointestinal bleeding were present at 8 months of age . We presumed that this patient should be categorized to juvenile polyposis of infancy . With regard to treatment, surgery is the mainstay to remove polyps . However, repeated operations are usually required because recurrence is not uncommon . In our case, redo enteroscopic polypectomy was technically difficult as well as might bear much higher risks, so it was abandoned . As nearly the entire small bowel is involved, resection of affected bowels was less considered because it would lead to prominent intestinal failure . The decision was made to perform supportive treatment . To the best of our knowledge, |
The phylum apicomplexa includes a large group of protozoan parasites responsible for a wide range of animal and human diseases . Among the human pathogens are plasmodium falciparum and plasmodium vivax, the major causative agents of human malaria, as well as cryptosporidium parvum and toxoplasma gondii, which are particularly pathogenic in immunocompromised patients . Apicomplexa are intracellular obligatory parasites that multiply in a so - called parasitophorous vacuole . Although the alterations of the host cell harboring toxoplasma or plasmodium parasites have been extensively documented at the cellular level, still little is known about how the parasite manipulates the host cell at the molecular level, with the notable exception of plasmodium infection of host erythrocytes . So far, most molecular studies on the host - parasite interface have focused on the role of parasite factors that are secreted by the invading parasite, as well as by the resident intracellular parasite, into the host cell . These intracellular parasites are expected to profoundly reorganize the host cell for their own needs to ensure safe growth and persistence, and presumably to deploy the most sophisticated mechanisms to this end . Emerging evidence indicates that viruses and bacteria manipulate the microrna (mirna) pathways of the host cells they infect . Mirnas are the most abundant class of small, non - coding, single - stranded rnas and are involved in regulating gene expression at the post - transcriptional level . In silico target prediction suggests that mirnas may control up to 30% of the translation of the human transcriptome . As such, they govern a variety of fundamental cell functions, including cell proliferation and apoptosis, and are key regulators of cell metabolism . When homeostatic conditions are disrupted - for example, when cells encounter micro - organisms - these regulatory pathways might also contribute to host cell responses / defenses (i.e., the inflammatory response) against the foreign bodies . For example, cell infection by mammalian viruses might be counteracted by cellular mirnas that target either the virus itself, as in the case of the rhabdoviral vesicular stomatitis virus, or a host factor critical to the virus, as for the lentiviral hiv . Conversely, mirnas can also act in favor of the micro - organism, either when it is pathogen - encoded (e.g., mammalian virus - encoded mirnas) or when the micro - organism subverts host mirnas to its own benefit . Effectors from the bacteria pseudomonas syringae have been recently shown to suppress transcriptional activation of some mirnas generated upon sensing of pamps (pathogen - associated molecular patterns) by arabidopsis . Recent data have begun to show how two apicomplexan parasites, cryptosporidium and toxoplasma, are able to target mirnas in the host cell to alter the cellular environment in ways that favor their intracellular development . Cryptosporidium is able to trigger the down - regulation of let-7i (a mirna with complementarity to toll - like receptor (tlr)-4 mrna) in the host cell, leading to the up - regulation of tlr4, a key pathogen recognition molecule that plays a central role in epithelial innate immunity to cryptosporidium infection . Various studies have further substantiated the ability of cryptosporidium to alter mirna expression in cholangiocytes [9 - 11]. It is emerging from these studies that following cryptosporidium infection, specific mirna cluster genes are activated by the binding of the nf-b (nuclear factor - kappa b) p65 subunit to their promoter, and that inhibition of these mirnas increases parasite burden . These results mirror those showing differential alterations in mature mirna expression profiles in primary human fibroblast cells following toxoplasma infection . Zeiner et al . Showed that toxoplasma infection specifically increased the transcription of the mir-17/92 loci by two- to three - fold in human fibroblasts . The effect is apparently a specific response to toxoplasma infection since levels of the mature mir-17/92-derived mirnas remained unchanged upon infection by the closely related parasite neospora caninum . Microarray data comparing the mirna profiles of cells infected by toxoplasma or cryptosporidium or treated with lipopolysaccharide (lps) have revealed several important findings . For example, mir-155/bic is up - regulated upon toxoplasma infection but remains unaffected or is down - regulated when exposed to cryptosporidium or lps, respectively . Of note, mir-155 has an important role in the mammalian immune system, regulating, at least in part, cytokine production . Two other mirnas, mir-198 and mir-320, are both up - regulated upon toxoplasma infection whereas they are down - regulated after cryptosporidium infection and unaffected after lps stimulation . These data point to specific modifications of host mirna profiles upon cell infection by apicomplexa parasites . Obviously, any change in the host cell mirna pattern might indicate either a defense mechanism by the cell or a subversion strategy by the parasite, two processes that can be differentiated by evaluating the consequences on parasite growth of disruption or over - expression of the target mirna pathway . Given the propensity of apicomplexan parasites to co - opt cellular pathways and activities for their benefit, it is perhaps not surprising that these parasites could also reshape their cellular environment by reprogramming the host s rna interference machinery . Specific host mirnas could either counteract the intracellular growth of parasites or facilitate it, the two possibilities being not mutually exclusive and depending on the physiological context . These findings open an exciting opportunity to pursue a deep understanding of how the host proteome can be reprogrammed dynamically and reversibly upon apicomplexa infection . An additional line of research should explore the upstream regulatory mechanisms, that is, how the parasites directly interfere with rna silencing pathways and, more specifically, the parasite effectors that are involved in the process . As discussed above, in response to cryptosporidium and toxoplasma infections, the expression of specific mirna genes is altered at the transcriptional level . Mirna are generated through the concerted action of multi - subunit complexes that promote the sequential cleavage, export, and loading of mirna into silencing complexes . An increasing number of reports suggest that, beyond the transcriptional control of genes that code cluster mirnas, each of these steps serves as a potential point of regulation, and therefore adds additional complexity to mirna - dependent gene regulation . Could parasite regulators of host mirnas be ribonucleic acids? Unlike in cryptosporidium and plasmodium species, the toxoplasma genome encodes elaborate rna silencing machinery that generates endogenous small silencing rnas, including specific mirnas . Thus, an attractive hypothesis is that toxoplasma has the potential to secrete its own mirnas to hijack the host cell mirna defense pathway, similar to what some viruses are able to do . It is known that apicomplexan parasites inject various molecules into the host cell resulting in extensive remodeling of the host cell gene expression profile and metabolic pathways [17 - 19]. The expression of host mirnas can also be altered in response to parasite recognition by cell surface tlrs . Both intrinsic and extrinsic acting factors could then interfere with target host mirnas, at any point of the processing of the pri - mirnas and biogenesis of the mirnas - transcription, processing, or export. |
We have observed a case of renal involvement complicated by granular corneal dystrophy type ii (gcd2). Gcd2, also known as avellino corneal dystrophy (cd), is an autosomal dominant disorder caused by a mutation in the transforming growth factor--induced (tgfbi) gene . This mutation can be found in several distinct autosomal dominant genetically determined cases of cd; however, it is not known whether this mutation produces other clinical manifestations other than cd . Tgfbi proteins (tgfbip) interact with several extracellular matrix (ecm) components [3, 4]. We believe that our study was a type of oculorenal syndrome associated with a tgfbi mutation, which remains to be acknowledged . The following clinical laboratory values were noted: serum urea nitrogen (bun), 14.9 mg / dl; creatinine (cre), 0.79 mg / dl; total cholesterol, 189 mg / d; total protein, 6.4 g / dl; and albumin, 3.9 g / dl . The levels of c - reactive protein, immunoglobulins (ig), and total complement, c3, c4, and c1q were all normal . Tests for antinuclear antibody, hepatitis b virus surface antigen, hepatitis c virus antibody, and cryoglobulins were all negative . Renal ultrasound and computed tomography revealed normal kidneys . A kidney biopsy, performed using light microscopy, revealed 11 glomeruli, 1 of which was obsolete or sclerosed (fig 1a). Light microscopy did not demonstrate any remarkable changes in the glomeruli (fig 1b). Focal tubular atrophy with dilation of peritubular capillaries and focal infiltration of small round cells were observed . After 7 years, the patient developed mild hypertension and began taking 4 mg / day of losartan potassium . The patient's mild proteinuria (11.5 g / g cre) continued, and her renal function was mildly decreased . After 10 years, the patient was re - admitted for additional evaluation of proteinuria . Laboratory testing revealed the following: urinary protein level of 1.5 g / day, bun level of 15.0 mg / dl, and cre level of 0.94 mg / dl . Approximately 2 years before her second admission, the patient complained of mild blurred vision and was diagnosed with cd . Slit - lamp examination revealed a large number of gray - white central granular and linear opacities in both eyes (fig 2); therefore, we diagnosed her condition as gcd2 . A second kidney biopsy was performed under light microscopy, revealing 18 glomeruli, 6 of which were obsolete or sclerosed (fig 3a). Segmental double contours of the glomerular capillary walls were also observed (fig 3c). Focal tubular atrophy with mild interstitial inflammation, dilation of peritubular capillaries, and segmental thickening of tubular basement membranes (tbm) were observed . The subendothelial space was widened, and irregularity of the glomerular basement membrane (gbm) was segmentally observed . Segmental irregular thinning, basket - waving, duplication, lamellation, and reticulation of gbm and tbm were observed partially and slightly (fig 3e immunostaining of the -5 chains of type iv collagen was normal . Upon her renal pathological findings, we assumed the existence of a genetic cause . After obtaining informed consent, we collected dna from the patient . The genome dna was extracted from the whole blood, and targeted next - generation sequencing of candidate genes for inherited renal diseases was negative (online suppl . . Real - time polymerase chain reaction using a simple buccal swab (avellino labs universal test; alut) revealed tgfbi heteromutation (r124h). We speculated that this condition was a novel case of oculorenal syndrome associated with tgfbi mutation . Her 74-year - old father had the same mutation of tgfbi (r124h) and was diagnosed with relatively mild gcd2 . Her 77-year - old mother and 26-year - old daughter, however, did not have mutated tgfbi (r124h) or gcd2 . Her father had no proteinuria but had a slightly elevated level of urinary n - acetyl--d - glucosaminidase (3.0 u / g cre); however, his renal function was normal (serum cre, 0.79 mg / dl). Subsequently, the patient was again treated in our outpatient clinic with 4 mg / day of losartan potassium but with no immunosuppressive agents . These two conditions may coincidentally coexist; however, findings demonstrating an association between renal involvement and gcd2 have been presented . The tgfbip (also known as ig - h3, keratoepithelin) is a 68-kda ecm protein with four evolutionary conserved fasciclin-1 domains and a carboxy - terminal arg - gly - asp sequence . This protein participates in many physiological processes, including morphogenesis, adhesion / migration, tumorigenesis, angiogenesis, wound healing, and inflammation . Tgfbip is found in ecm of several human tissues and is abundant in the cornea . Mutations of the human tgfbi gene have been linked to several autosomal dominant multiple types of cd, including gcd2 . Almost all cases of gcd2 are caused by tgfbi gene mutations (5q31), particularly p.arg124his (r124h). In a previous study, tgfbi gene mutation was estimated to have a prevalence of at least 11.5 affected people per 10,000 individuals in korea . According to embryonic expression studies using a mouse knock - out model of tgfbi, schorderet et al . Mutations in adhesion and ecm molecules, such as integrins and laminin-2, play an important role in the pathogenesis of focal segmental glomerulosclerosis; however, thus far, the relationship between tgfbi mutation and kidney disease has not been established . In an autopsy patient with tgfbi - related cd, pathologic deposits caused by tgfbip accumulation were only observed in the cornea and in no other tissue or organ, including the kidney; however, an electromicroscopic examination was not performed in that report . Tgfbip was present in the capsule and tbm of the developing kidney and was predominantly localized in the epithelial cells of the collecting ducts as well as the distal proximal tubules . Tgfbip is secreted into the extracellular space and may bind to fibronectin, laminin, and type i, ii, and iv collagens as well as integrins [12, 13]. Proteomic analysis revealed that tgfbip is a component of glomerular ecm [3, 4], and it exhibits protein - protein interactions between the following ecm proteins: -2 macroglobulin; -1, -2 chain type i collagen; -1 chain type ii collagen; -1, -2, -3, and -4 chain type iv collagen; fibronectin; and fibrillin-1 . Proteoglycans directly bind to tgfbip and affect collagen vi aggregation and possibly the interaction between integrin and collagen vi . Binding allows tgfbip, including ecm proteins, to play an important role in cell - collagen signaling interactions that comprise bm, bone formation, and development as well as cell migration and growth . In our patient, various pathological findings of gbm and tbm and widening of the subendothelial space of gbm were observed by electron microscopy . A negative genetic analysis of well - known monogenic kidney diseases prompted us to consider that tgfbi mutation could affect the bm of the developing kidneys and produce such bm findings . The pathophysiological mechanisms and the incidence of this condition or genotype - phenotype correlation for tgfbi mutations are not obvious . If detailed examination of the corneas is not performed, gcd2 may not be observed until middle - age and older . It should be noted that detailed ocular examinations, including cornea assessments, are valuable when diagnosing nephropathy associated with tgfbi mutations . Presently, alut testing is beneficial for laser - assisted in situ keratomileusis to protect patients from accelerated vision loss . As demonstrated with our patient, this test is easy and safe to perform when diagnosing patients with nephropathy associated with tgfbi mutations . In conclusion, we have reported the first case of a unique nephropathy complicated by tgfbi - related cd . Tgfbi - related nephropathy remains unknown and is difficult to diagnose without electron microscopic examination . Further reports should be accumulated to determine whether the incidence of renal diseases associated with this mutation may presently be more frequent . Patients with tgfbi - related cds, including gcd2, should be examined for renal abnormalities . The authors have no ethical conflicts to disclose, and the patient provided informed consent. |
A 60-year - old male patient, with a known history of arterial hypertension and type-2 diabetes mellitus, was referred to the outpatient echocardiography laboratory to undergo stress echocardiography because of recent episodes of chest pain occurring on mild exertion . He was on drug therapy with angiotensin - receptor blocker, thiazide diuretic, nondihydropyridine calcium antagonist, and dronedarone, which had been started because of recent episodes of paroxysmal atrial fibrillation and discontinued 2 days before the stress test . The patient received a standard protocol of high dipyridamole infusion in two doses (0.56 mg / kg and 0.28 mg / kg) followed by atropine administration (1 mg in four 0.25 mg doses). At rest, no ischemic abnormalities were observed on electrocardiogram (ecg) and transthoracic echocardiography (tte) [figure 1 and videos 13]. After completion of dipyridamole infusion, the patient complained a mild chest discomfort, without any significant ecg changes and any apparent wall - motion abnormalities on tte [videos 46]. After atropine injection, a worsening of the anginal symptoms combined with a descending st - depression in v3 occurred; despite the absence of relevant echocardiographic changes, two - dimensional (2d) strain analysis showed lower longitudinal strain of the anterior interventricular septum from rest to peak dose [figure 2]. Afterward, as recommended, aminophylline was administered; interestingly, a more pronounced st - depression and deep inverted t - waves in v2v4 appeared [figure 3]. The patient was admitted to the cardiology department and underwent coronary angiography from the radial access, which revealed a long myocardial bridge (mb) of the left anterior descending (lad) artery with systolic milking [figures 4, 5 and videos 79]. The patient was, thereafter, treated with a beta - blocker and discharged without symptoms and ischemic abnormalities on rest ecg . Electrocardiogram at rest two - dimensional strain analysis showing global longitudinal strain at rest (upper panel) and at peak dose of dipyridamole (lower panel) electrocardiogram after injection of atropine and aminophylline coronary angiography images in diastole (left) and systole (right) showing myocardial bridge of the left anterior descending artery with systolic milking angiographic images did not change after intracoronary nitroglycerine administration this case depicts a clinical scenario of positive dipyridamole stress test in a patient affected by mb of the lad . Although mb has been classically deemed a benign coronary artery abnormality, it has been recently related to acute myocardial infarction and sudden cardiac death . Moreover, mb has been also associated with endothelial dysfunction, early atherosclerosis, and coronary vasospasm . In particular, a worsening of systolic coronary narrowing of mb has been found when using vasodilator agents, such as nitroglycerine, which are usually not administered in these patients . In our case, dipyridamole provoked chest pain associated with minor ecg ischemic changes, such as an only one - lead (v3) st - depression; these abnormalities worsened after the administration of atropine and later, aminophylline, likely because of drug - induced positive inotropic and chronotropic effects . Atropine might also have determined myocardial ischemia through a paradoxical coronary vasoconstriction induced by acetylcholine as observed in the presence of endothelial dysfunction and mb . This case has the following interesting implications: (1) the ability to detect mb also using a vasodilator stress test (and not only dobutamine echocardiography or exercise test), particularly with the addition of atropine injection, (2) the utility of 2d strain analysis in confirming subtle regional wall - motion abnormalities, and (3) peculiar diagnostic features, on stress echocardiography, suggesting mb rather than obstructive coronary artery disease . In particular, the observed ecg and echocardiographic ischemic changes, although suggestive of a lad disease, appeared to be late occurring and less extended than usually observed in patients with stable hemodynamic lad obstruction, which should have determined more pronounced ecg and wall - motion abnormalities . Indeed mb, differently from a fixed coronary obstruction, is a dynamic stenotic lesion, requiring a consistent increase in heart rate and myocardial contractility to provoke myocardial ischemia . Hence, mb could have been clearly unmasked only whenever positive inotropic and chronotropic agents had been added to the vasodilator stress caused by dipyridamole . Thus, the finding of worsening ischemic abnormalities after the administration of atropine ad aminophylline, during dipyridamole stress echocardiography, may represent a particular diagnostic feature of mb. |
Natriuretic peptides are a family of hormones, sharing similar chemical structure (a characteristic 17-amino acid ring structure, stabilized by a cysteine bridge, which contains several invariant amino acids and variable c- and n - terminal tails) and biological function, with relevant effects in cardiovascular physiology and pathology . The study of natriuretic peptides began 50 years ago, when electron microscopy revealed the presence of secretory granules in cardiac atrial cells containing atrial natriuretic peptide (anp) as demonstrated by de bold and coworkers in the early 80s . From 1988 to 1990, two more members of the natriuretic peptide family, the brain natriuretic peptide (bnp) and c - type natriuretic peptide (cnp) were identified in porcine brain [2, 3]. More recently a new peptide that shares structural and functional characteristics with the previous natriuretic peptides was identified in the venom of the green mamba (dendroaspis angusticeps) and received the denomination of dendroaspis natriuretic peptide (dnp). In addition, other peptides with similar cardiovascular effects have been identified in mammalians, including urodilatin, a peptide derived from alternative cleavage of pro - anp in the distal tubules of the kidney, where it exerts its natriuretic actions, or the intestinal epithelium derived peptides, guanylin and uroguanylin, which participate in water absorption . The classic physiological role of natriuretic peptides includes promotion of renal excretion of sodium (natriuresis) and water (diuresis). Natriuretic peptides also exert autocrine and paracrine effects within circulation, such as vasodilatation by relaxing vascular smooth muscle cells, regulation of renin, progesterone, endothelin and vasopressin secretion . Anp and bnp are 28- and 32-amino acid peptides, respectively, mainly synthesized and released by atrial (in the case of anp) and ventricular cardiomyocytes (for bnp) in response to blood pressure and volume loading [8, 9]. In addition, anp and bnp secretion from the ventricles increases associated to a number of ventricular dysfunctions, and the extent of anp and bnp release under these circumstances is in relation to the severity of the pathology, that has led to the use of both natriuretic peptides as diagnostic tests for heart failure [10, 11]. Anp and bnp are synthesized as larger molecules that are subsequently cleaved to yield the active peptide hormone and the biologically inactive n - terminal peptide fragment [12, 13]. Both natriuretic peptides circulate in the blood reducing vascular tone and promoting diuresis / natriuresis to lower blood volume and pressure . Anp and bnp are removed from the circulation by two different mechanisms: receptor - mediated internalization and proteolytic degradation by neutral endopeptidase, that has been shown to take place in the kidneys, vascular endothelium, lungs and heart . Circulating half - life of anp is approximately 35 min, whereas the half - life of bnp is significantly greater, about 23 min ., and even greater is that of the inactive terminal fragment of bnp, nt - probnp, from 60 to 120 min, which is relevant to their value as diagnostic tests . Cnp, the third natriuretic peptide identified, is mainly expressed in the nervous system and vascular endothelial cells [14, 15], where cnp exerts autocrine and paracrine actions on vascular tone and muscle cell growth [15, 16]. The cardiovascular effects of cnp are more likely mediated by its vascular local effects or by central actions on vasopressin and adrenocorticotropine release than to its natriuretic and diuretic effects, that are weaker than that of anp and bnp [16, 17]. Cnp gene expression is stimulated by several vasoactive mediators, such as interleukin 1, vascular endothelial growth factor, transforming growth factor, tumour necrosis factor - a and insulin [15, 1820]. Dnp is a recently isolated 38-amino acid peptide that shows structural and functional properties of the previously identified members of the natriuretic peptide family . Although dnp purification from human blood has not yet been achieved, dnp immunoreactivity has been reported in human plasma . Dnplike immunoreactivity has been found in rat aorta, carotid artery and kidney [22, 23], where it has been found to induce vasorelaxation and inhibition of vascular smooth muscle cell proliferation . Natriuretic peptides regulate cardiovascular homeostasis by the occupation of three membrane receptors; two are guanylyl cyclase - coupled receptors, known as natriuretic peptide receptor (npr)-a and npr - b, while npr - c lacks enzymatic activity and among other functions acts as a clearance receptor [24, 25]. Npr - a is activated by anp, bnp and dnp [25, 26], npr - b shows high affinity and is activated by cnp and, finally, the npr - c binds all natriuretic peptides . Npr - a and npr - b are single - transmembrane receptors of approximately 120 kd with a similar basic structure that consist of a variable extracellular natriuretic peptide - binding region, a conserved intracellular kinase homology domain and a guanylyl cyclase domain with enzyme activity . Occupation of npr - a and npr - b induces cellular responses through the elevation of intracellular cgmp levels, which, in turn, leads to the activation of a cgmpdependent protein kinase that phosphorylates a target protein in serine of threonine residues and mediates the specific physiological function . Signal transduction activated by these receptors is terminated by cgmp phosphodiesterases that modulate the intracellular concentrations of cgmp and the duration and magnitude of the responses . Npr - c is a transmembrane receptor with an extracellular domain containing the natriuretic peptide - binding region, a transmembrane domain and a cytosolic domain . Two different subtypes of npr - c, of approximately 67 and 77 kd in size, have been identified [28, 29]. Npr - c has been involved in peptide clearance, removing natriuretic peptides from the circulation and in the mediation of natriuretic peptide - induced inhibition of camp synthesis, an effect that requires the involvement of a heterotrimeric g protein [7, 31, 32]. We have provided evidence that the 77 kd npr - c - like protein is involved in peptide internalization whereas the 67 kd npr - c - like protein is likely involved in adenylyl cyclase inhibition . In the past decade, much attention has been given to the investigation of natriuretic peptides testing in the evaluation of patients with different pathologies, such as congestive heart failure (chf). Studies in patients with chf showed that both anp and bnp secretion from ventricular myocytes increases in relation to the rigor of dysfunction . These findings led to investigate whether the plasma levels of anp and bnp may assist in the diagnosis of patients with heart failure . Since half - life of bnp is greater than that of anp comparison of the diagnostic value of anp and bnp as reported above, the inactive n - terminal fragment of bnp, ntprobnp, has an even greater half - life than bnp; thus, most of the clinical investigations concerning natriuretic peptides as biochemical markers for chf has focused on bnp or nt - probnp . Basal plasma levels of bnp have been established between 5 and 50 pg / ml, while the corresponding values for nt - probnp are from 7 to 160 pg / ml . The approved cut - off levels to consider an abnormal range are 100 pg / ml for bnp and 125 pg / ml for ntprobnp (450 pg / ml for individuals older than 75 years old), although they vary according to age, sex and estimated glomerular filtration rate . Levels of both bnp and nt - probnp are elevated under a number of pathological situations including cardiac dysfunctions, such as chf, diastolic dysfunction, valvular heart disease, atrial fibrillation and non - cardiac pathologies, such as acute pulmonary embolism, pulmonary hypertension, sepsis or hyperthyroidism [11, 3436]. Four major applications of bnp and nt - probnp testing in patients with chf have been presented in the last few years, including diagnosis, screening, prognosis and monitoring of therapy . Different studies have reported the efficacy of bnp and ntprobnp tests increasing the diagnostic accuracy of heart failure [37, 38]. The sensitivity and specificity of the test is especially high at a cut - off of 76 pg / ml bnp, and nt - probnp has been proved to be particularly important in decreasing the overdiagnosis of heart failure that occurs in primary care . For ntprobnp, levels over 450 pg / ml (over 900 pg / ml for patients older than 50 years old) are sensitive and specific for heart failure; however, if the value is below 300 pg / ml, heart failure is highly unlikely with a negative predictive value of 99% . In addition, recent studies have reported that bnp is a significant prognostic indicator in patients diagnosed with heart failure and in asymptomatic patients . Nt - probnp has been found to be a stronger risk biomarker for cardiovascular disease and death than c - reactive protein . High - risk subject with cardiovascular risk, which would be a great advance prompting more aggressive primary prevention . However, a number of limitations have been reported about the prognostic value of bnp and nt - probnp . In patients with advanced chf, atrial fibrillation bnp or nt - probnp can also be used as a guide for therapy in heart failure . For this use, it should be taken into account that therapies that reduce clinical disorders in heart failure also reduce bnp levels and those that improve heart failure conditions act primarily through mechanisms that are linked with changes in natriuretic peptide levels . In addition, bnp and nt - probnp levels do not decrease as rapidly in response to therapy as might be expected from their short half - lives, suggesting that the natriuretic peptide system need some time to autoregulate . Considering this, bnp and nt - probnp levels might guide the clinician to adjust the treatment in order to achieve a plasmatic level of these agents below a critical value . Sepsis and septic shock is associated with an elevation of cardiac troponin levels that has been shown to indicate left ventricular dysfunction and a poor prognosis . Whereas cardiac troponins are a good biomarker for myocardial dysfunction in patients with severe sepsis or septic shock the use of natriuretic peptides, including bnp, as an indicator of prognosis remains controversial . Renal insufficiency has also been shown to affect the plasmatic levels of both bnp and nt - probnp both in children and adult patients . The levels of bnp are correlated with renal function, so that an increase reaching about 200 pg / ml have been reported in patients with reduced creatinine clearance (below 60 ml similar observations have been reported with nt - probnp and a recommended reference value of 1200 pg / ml has been shown for patients with reduced creatinine clearance . It has been shown that peritoneal dialysis does not alter plasma nt - bnp or bnp levels in patients with renal failure, whereas both blood urea nitrogen and creatinine levels declined as expected, which should be taken into account if plasmatic levels of these hormones are used as a guide to the management of patients with renal failure . Nt - pro - bnp and bnp have been recently presented as useful biomarkers for coronary artery disease and left ventricular hypertrophy in patients with chronic kidney disease, where detection of coronary artery disease and left ventricular hypertrophy in these patients has remained elusive despite the greater prevalence in patients with chronic kidney disease . Natriuretic peptides, especially anp, have long been reported to have the potential to restore renal function after ischaemic injury, and have been shown to counteract renal sympathetic nerve activity in renal function . Anp overexpression has been shown to exhibit protection against gentamycin - induced nephrotoxicity, as demonstrated by daily subcutaneous administration of gentamycin, for 10 days, in sprague dawley rats either treated with an intravenous injection of adenovirus (ad.rsv-anp), carrying the human anp gene, the first day of gentamycin administration, or not treated (control) for comparison . This finding raises the possibility of using anp gene therapy for the treatment of drug - induced renal failure . In addition, anp has been reported to exert a protective effect on the outcome of acute renal failure in animals when infused over short periods of time, while it has been shown that prolonged infusion of anp does not alter the course of acute renal failure . On the other hand, infusion of wistar rats with anp exerted little renoprotective effect against endotoxin - induced acute renal failure, since anp infusion did not improve the hyponatriuresis and oliguria induced by endotoxin administration . Recent studies have pointed out that continuous infusion of synthetic human anp is effective for preventing acute renal failure, which is a major problem occurring immediately after liver transplantation and requiring haemodialysis . This is the case of a model of transgenic mice overexpressing bnp that show reduced glomerular injury than control mice during the development of diabetes mellitus . Glomerular hyperfiltration is an early haemodynamic alteration and one of the key mechanisms of the pathogenesis of diabetic nephropathy . This observation suggests that renoprotective effects of natriuretic peptides may prevent the progression of diabetic nephropathy, although further studies are necessary to establish therapeutic strategies to palliate renal complications associated to diabetes mellitus . Further evidences for the renoprotective role of natriuretic peptides come from studies where the peptide hydrolysis is inhibited . Neutral endopeptidase is an endothelial cell surface zinc metallopeptidase and the major pathway involved in the degradation of the natriuretic peptides . Inhibition of neutral endopeptidase increases levels of anp, bnp and cnp, and has been shown to offer a therapeutic advantage in the treatment of hypertension, heart failure and endothelial dysfunction . Endopeptidase inhibitors reduce vasoconstriction and improve sodium / water balance; as a result these inhibitors decrease peripheral vascular resistance and blood pressure and improve local blood flow . Endopeptidase inhibitors also reduce the activity of the angiotensin - converting enzyme (ace), leading to a reduction of vasoconstrictor and proliferative mediators, such as angiotensin ii and increase local levels of bradykinin . Recent studies have reported that anp reduces angiotensin ii - induced renomedullary interstitial cells proliferation and extracellular matrix synthesis in diabetic subjects more efficiently in neutral endopeptidase - deficient mice, which provide evidence for the beneficial effect of inhibition of neutral endopeptidase in attenuating abnormal cell growth associated with diabetic nephropathy . In addition to the renoprotective effect, neutral endopeptidase inhibition, in combination with inhibition of the ace activity, has been shown to reduce blood pressure in spontaneously hypertensive rats . This is the case of omapatrilat, a potent vasopeptidase inhibitor that exerts anti - hypertensive effects by inhibition of the neutral endopeptidase and ace at the tissue level, which results in beneficial effects on the cardiovascular structure . The dual metalloprotease inhibitors of ace and neutral endopeptidases, called vasopeptidase inhibitors, provide an advance over individual ace or neutral endopeptidase inhibitors, and might represent a new and attractive therapeutic strategy for the treatment of cardiovascular disease . Nesiritide is a recombinant form of human bnp and its amino acid sequence is identical to that of endogenous human bnp . Administration of nesiritide results in venous, arterial and coronary vasodilatation, reducing cardiac the pre - load and after - load, which increase cardiac output without direct inotropic effects [6062]. In addition, nesiritide increases glomerular filtration rate and filtration fraction, suppresses the renin - angiotensin - aldosterone axis, and enhances diuresis and natriuresis . Nesiritide is currently used in the treatment of acute decompensated heart failure, where it has been shown to decrease pulmonary capillary wedge pressure, pulmonary artery pressure, right atrial pressure and systemic vascular resistance, as well as increase cardiac index and stroke volume index [6466]. In comparison with nitroglycerin, treatment with nesiritide did not induce the appearance of tachyphylaxis and other adverse effects . Unlike inotropes, the beneficial haemodynamic effects produced by nesiritide do not cause an increase in myocardial oxygen consumption, an important consideration for patients with acutely decompensated heart failure . Since nesiritide is not an inotrope, it does not affect myocardial contractility, as does the agonists of -adrenergic receptors or the inhibitors of phosphodiesterase iii . As a result studies aimed to determine the impact of early initiation of acute decompensated heart failure therapy with nesiritide on subsequent outcomes have confirmed its beneficial effects reducing the severity of the associated complications, reducing the mean total hospital length of stay and the requirement of transfer to the intensive care unit . In comparison with dobutamine and milrinone, nesiritide therapy was associated with a lower in - hospital mortality rate and shorter length of stay . In addition, total health care costs with nesiritide were decreased compared with the other drugs, since although the acquisition cost of nesiritide was higher than that of milrinone and dobutamine, nesiritide has been shown as a more cost - effective treatment option for patients with acute decompensated heart failure [69, 70]. Despite its beneficial effects on the cardiovascular system, recent studies have raised the question of safety with nesiritide therapy . In three randomized controlled trials sackner - bernstein and coworkers expressed concern of possible short - term (30-day) risk of death after nesiritide use for the treatment of acute decompensated heart failure . As mentioned by the authors, first, the three randomized controlled trials used the nesiritide study group efficacy trial (nsget), the vasodilation in the management of acute congestive heart failure (vmac), and the prospective randomized outcomes study of acutely decompensated chf treated initially in outpatients with natrecor (proaction) were not designed to determine whether nesiritide is associated with risk of death . In addition, there was not complete information concerning the use of additional medications or procedures through the 30-day period of the study . The same group has reported that nesiritide significantly increases the risk of worsening renal function in patients with acute decompensated heart failure, although whether renal dysfunction reflects haemodynamic effect or renal injury is unclear . Concerning this issue, more recent studies have reported that the effect of nesiritide on renal function strongly depends on the infusion times, so that nesiritide infusion time 24 hrs is associated with elevated markers of worsening renal function in patients with acutely decompensated heart failure compare with infusion of less than 24 hrs . Several studies have reported that an increase in serum creatinine levels, such as that observed with nesiritide, predicts a higher risk of death even when that increase is transient [74, 75]. Unlike these previous studies, a more recent meta - analysis has reported that nesiritide is not associated with a higher 30- or 180-day mortality . Given the limitations of the meta - analyses, without randomized controlled trials powered to evaluate mortality, arora and coworkers suggest that it is premature to abandon the use of nesiritide . A summary of the current information concerning the benefits and deleterious effects of the use of nesiritide is provided in table 1 . Future clinical trials are necessary to address the concerns raised and provide a better understanding of the actions of nesiritide in the management of acute decompensated heart failure . In addition, recent studies have reported that npr - b, not npr - a, which is the receptor of nesiritide, is the predominant npr in the failing heart, suggesting that drugs directed towards both nprs might provide a greater benefit than nesiritide per se . Beneficial and deleterious effects of nesiritide in cardiovascular and renal systems the clinical role of natriuretic peptides either as biomarkers for diagnosis, prognosis or monitoring of therapy, or as therapeutic strategies for cardiovascular and renal disorders has gained acceptance over the last decade . Despite specific basic studies and clinical trials necessary to better understand the possibilities of natriuretic peptides in therapeutic interventions, the use of these peptides to treat cardiovascular dysfunction seems to be most promising. |
Forty - five - year - old male shelter resident, chronic alcoholic, chronic smoker, and marijuana abuser presented to emergency department (ed) with complaints of intermittent fever with night sweats and productive - cough for 10 days with yellowish sputum associated with pleuritic chest pain . He complained of generalized weakness and decreased appetite and claimed to have lost approximately 10 pounds in 2 weeks . Laboratory results showed leukocytosis of 17,000/mm with neutrophil differential of 11,200/mm (65%) with band neutrophils of 10% . Chest radiograph was reported as right middle lobe consolidation but careful observation revealed a foreign body (fb), likely a tooth in the right bronchus intermedius (fig . Ct scan of chest showed a well calcified fb likely a tooth at the level of carina obstructing right intermedius bronchus and consolidation in right lower lobe indicating post - obstructive pneumonia (fig . 2). Patient was admitted and prescribed intravenous antibiotics targeting gram - negative organisms and anaerobes . Deep conscious sedation was achieved by propofol infusion in the presence of an anesthesiologist and cardiothoracic surgery backup . Bronchoscopy showed tooth in right intermediate bronchus with ~75% occlusion, and purulent secretions from the right main stem (figs . The fb was removed successfully with rat tooth forceps (figs . 7 and 8). Post bronchoscopy inspection showed right main stem, bronchus intermedius, and right middle and lower lobe bronchi to be well patent . Closer view of the foreign body, identifiable as tooth in right main stem bronchus . The aspirated tooth removed by rat tooth forceps . Upon further questioning, the patient said that he did not remember having aspirated the tooth and hence the duration of aspiration could not be known . He was discharged home on oral antibiotics a couple of days after the bronchoscopy and counseled to quit alcohol and drugs . Fba is more common in children than adults with about 80% occurring in children aged less than 15 years . It is the fourth most common cause of unintentional injury deaths in the united states . While choking is a hazard for all ages, choking deaths peaked at age 84 in 2011 as per national safety council injury facts 2015 (1). Fba in adults is often overlooked as a potential cause of airway obstruction especially if there is no asphyxiation . Adults with risk factors such as alcoholism, drug abuse, mental retardation, and neuromuscular conditions are predisposed to aspiration . However, accidental aspiration in adults without the aforementioned risk factors has been described (25). In adults, most common foreign bodies aspirated are food and broken fragments of teeth (68). Ct scan is more sensitive and specific than chest radiograph in diagnosing radiolucent foreign bodies and for characterizing the attenuation of a suspected fb (9). Unlike in children, less than half of fbs are lodged in the proximal airways in adults . Most of the fbs are lodged in the right bronchial tree, whereas in children no significant difference was seen between right and left bronchial tree (6). Bronchoscopy for the removal of fb was introduced by gustav killian, an otolaryngologist in 1897 . Animal studies performed by zavala and rhodes (11) showed that fbr could be used to retrieve different kinds of fbs by using grasping forceps through the bronchoscope . Fbr is considered as the diagnostic test of choice for initial diagnosis of fb in adults . The advantages of fbr over rigid bronchoscopy are that it can be performed under local anesthesia, visualization of smaller peripheral airway is better with relatively easier manipulation, and can be performed in patients with deformities of c - spine and pharynx . It is also a relatively easy and safer procedure in experienced - hands (10, 12). Rigid bronchoscopy is recommended if fbr fails, if the fb is centrally located, if firmly embedded in scar tissue, and for removal of sharp objects which require maneuvering to minimize mucosal trauma (13). There have been several case series which have reported successful removal of foreign bodies by fbr . Cunanan (12) reported a success rate of 89% in using fbr for the removal of fb in 300 mentally retarded and physically handicapped patients . They reported a decrease in mortality from 12 to 1% with the use of fbr over rigid bronchoscope . They, however, attribute to the increased mortality from rigid bronchoscopy to complications of general anesthesia in patients with comorbidities . Limper and prakash had a success rate of 60% with fbr, whereas rigid bronchoscopy showed a success rate of 98% . In their experience, fbr is advantageous in distally lodged fb, in cases with cervical instability, mechanically ventilated patients, and also in removal of small fbs, which can be securely grasped with a fiberoptic bronchoscope (14). (15) report a success rate of 97% for fb removal via fbr with low mortality and morbidity . They also reported that granulation tissue can be removed without much bleeding; thus, removal of fb can be achieved in a repeat fbr a week later . (13) indicate that fbr can be used to remove foreign bodies especially if they are small and peripheral and that fbr may be superior to rigid bronchoscopy for grasping tiny and far - reaching foreign bodies . Rigid bronchoscopy is recommended if fbr fails and especially if the fb is large and located in central bronchi or trachea . However, in children who may have central, asphyxiating foreign bodies, the rigid bronchoscope under general anesthesia is preferentially indicated . Team - based approach with designated roles for team members improves the chances of a successful procedure . Anesthesia and ct surgery backup is essential . Team - based analysis of the nature, location of the fb, and appropriate accessory instruments is equally necessary . Steroids can be given to minimize inflammatory changes as they may lead to difficulty in fb extraction . Orotracheal approach is preferred over nasotracheal, as it avoids fb from being lost in the nasal passages if accidently dislodged . Care should be taken to keep fb in the center of visual field and to avoid pushing fb distally into the airways . Once fb has been secured, bronchoscope, accessory instrument, and the secured fb are all withdrawn from the airway simultaneously . Rare complications of fbr are likelihood of asphyxiation from losing the fb in the subglottic area and hemoptysis (10). Another approach is to reinsert flexible bronchoscope to push the fb into more peripheral airway thus resolving the central airway obstruction . In case of hemoptysis, airway can be better managed by rigid bronchoscope, but this complication is very rare if performed by trained operators . Incidence of massive hemoptysis even in patients with significant granulation tissue around the fb is extremely low (15). Organic materials can cause severe inflammation in a short period of time and tend to absorb water with development of airway obstruction relatively earlier . In contrast, inorganic fbs are inert, and so patients might be asymptomatic for a prolonged period (16). Grasping forceps, baskets, magnet extractors, yag laser, and cryoprobes are available as accessories for fb removal via flexible bronchoscope (10). Rat tooth forceps is a type of a grasping forceps, which is particularly useful for removing hard, flat, or thin organic or inorganic foreign bodies . These are used primarily when the fb is hard as a firm grip can be achieved . These cannot be used for the retrieval of organic friable objects which tend to fracture due to the firmness of the grip provided by these forceps (10). Zero - tip basket is used in urological procedures like retrieval of ureteral stones . The tipless design allows close approximation to fb . They are used to retrieve fbs lodged in distal bronchi and mobile fbs (16, 17). Fish net basket, a modified polypectomy snare, is useful in removing bulky fbs (10). Magnet extractors contain flexible probe tipped with a magnet, useful for retrieval of metallic fbs (10). Fbs embedded in granulation tissue can be removed by yag laser, which vaporizes the surrounding granulation tissue . Cryoprobe is used to freeze friable organic and small inorganic materials . Freezing the foreign bodies high index of suspicion is needed especially for high - risk patients presenting with compatible symptoms . Fbr is the initial diagnostic and therapeutic procedure recommended with low complication rates in experienced hands . Rigid bronchoscopy is performed if the flexible bronchoscopy fails or if the fb is large and centrally located, in case of significant hemoptysis and if significant granulation tissue is present with a fb which is deeply embedded. |
Porcine reproductive and respiratory syndrome virus (prrsv) was first reported in north america in 1987, and is one of the most economically important diseases in the swine industry . Infection with prrsv is characterized by two clinical signs: reproductive failure in sows during the early - to - late stage of gestation and respiratory problems in piglets at any age . Numerous studies have been conducted to determine the localization of the virus in experimental pigs . In boars, prrsv appears to persist in lymphoid tissues, particularly in tonsils, rather than the reproductive system . A study of stillborn and live birth piglets from intranasally inoculated sows indicated that prrsv replicates primarily in lymphoid tissues before the virus affects internal organs such as the lungs, heart, liver, spleen, and kidneys . In experimentally infected sows, prrsv was detected in the tonsils, heart, uterus, kidneys, and lymph nodes . However, little information is available on localization of prrsv in sows in the field . There are several situations in which oral fluid sampling may be advantageous for a breeding herd since this method can be performed more frequently at any time during gestation without jeopardizing the welfare of the animals . Although it has been reported that oral fluid has the potential for replacing serum to detect prrsv in experimental pigs, the source of prrsv in oral fluid has not been determined . In breeding herds, gilt introduction is a very important factor for prrsv control . Gilts are susceptible to prrsv infection and are a potential reservoir of the virus in the herd if they become viremic during the breeding via horizontal as well as vertical viral transmission . The goal of a prrsv acclimatization program is to expose gilts to the same strain of virus to which the herd is resistant . This allows sufficient time to permit full recovery of the gilts before their introduction into the breeding herd . Information on natural prrsv infection in replacement gilts during the acclimatization period would be useful for establishing a suitable acclimatization program and prrsv elimination strategy . Therefore, the goals of the present study were to clarify the localization of prrsv in infected swine and to evaluate the use of oral fluid specimens for prrsv detection in the field . Pigs were collected from a 400-sow herd isolated from other pig farms in miyazaki, japan . Reduction in the farrowing rate and increased incidences of abortion were observed among the sows . The herd was considered to be endemically infected with prrsv based on diagnostic history and on - going surveillance . Two 3-year - old pregnant sows (a and b) that naturally aborted after 76 and 92 days of gestation along with seven 2-month - old grower pigs with respiratory problems were euthanized with mafropane (ds pharma animal health, japan) and subjected to necropsy . One hour prior to euthanasia, serum and oral fluid were collected . Samples of lungs, brain, heart, liver, spleen, kidneys, ileum, and tissues from the oral cavity (i.e., tonsils, salivary glands, submandibular lymph nodes, and oral mucosa) were taken from each animal . Eight fetuses were randomly selected from the sow litters to survey for prrsv with nested reverse transcription pcr (nrt - pcr). In order to assess prrsv infection during the acclimatization period, 70 6-month - old prrsv - free gilts were purchased from zen - noh livestock (japan) and housed in seven pens (10 gilts / pen) in an isolated acclimation building at the farthest corner of the farm . Disinfectant footbaths and changing coveralls (kenis, japan) were used prior to entering each pen . During the 3-week period after arrival, the technician worked in other pig buildings before going to the acclimation zone without changing coveralls in order to introduce gilts to the current prrsv strain circulating in the farm . The gilts were vaccinated with a prrsv modified live vaccine 2 ml dose (ingelvac prrs mlv; boehringer ingelheim vetmedica, usa) three times 1 day after arrival, 4 weeks after the first injection, and 3 weeks before first round of insemination . In the breeding herd, oral fluids were collected using a sterile cotton rope (100% cotton rope; kenis) to absorb the fluid in the oral cavity from pigs in each pen at 1 week intervals for 11 weeks . Serum samples were collected from individual gilts by using serum separator tube (venoject ii; terumo medical corporation, usa) on the first and eighth weeks of the acclimatization period . Prrsv antibody in serum was identified by an enzyme - linked immunosorbent assay (elisa) kit (anigen prrs ab elisa kit; bionote, korean) according to the manufacturer's instructions . Rna from the tissue samples was extracted with trizol (trizol reagent; invitrogen, usa) while that in sera and oral fluid was extracted with viral rna extraction kit (qiaamp viral rna mini kit; qiagen, germany) according to the manufacturer's instructions . The first pcr primers were 13586f (5'-gtggtatttggcaatg tgtc-3')/14652r (5'-ctccaggtttctatggctga-3'), which amplified 1067 bp of the open reading frame (orf) 4 - 6 region of prrsv . The second primers, p420f (5'-ccattctgttggcaatttga-3')/p620r (5'-ggcatatatcatcactggcg-3'), which amplified 713 bp of the first rt - pcr product . The first rt - pcr was performed with accessquick rt - pcr system (promega, usa) and the second pcr was performed with gotaq green master mix (promega). The first rt - pcr reaction was carried out for one cycle of reverse transcription at 45 for 45 min, inactivation at 94 in 2 min, and 40 cycles of denaturation at 94 for 15 sec, annealing at 55 for 30 sec, extension at 68 for 1 min, and final incubation at 72 for 5 min . The second pcr reaction was performed as first denaturation at 94 for 2 min, on 40 cycles of denaturation at 94 for 15 sec, annealing at 55 for 30 sec, extension at 68 for 1 min, and following the final incubation at 72 for 5 min . Multiplex pcr and multiplex rt - pcr were also performed as previously described to screen for other pathogens including porcine circovirus type 2 (pcv2), suid herpesvirus 1, porcine parvovirus, getah virus, and japanese encephalitis virus . The north american (na)-type prrsv open reading frame (orf) 5 gene was sequenced with abi prism bigdye terminator v3.1 cycle sequencing kits (applied biosystems, usa) using primer p420f / p620r (sigma - aldrich, usa). Alignment was performed with isolates in this study, 3 previous isolates from the farm (farm10/2011, farm 11/2011, and farm 12/2011), and the inoculated vaccine strain . A phylogenetic tree was constructed using the neighbor - joining method and a bootstrap analysis was carried out with 1,000 replications . Tissue samples from the sows and grower pigs were fixed in 4% paraformaldehyde for one day then embedded in paraffin by standard histologic procedures . Two - micrometer - thick tissue sections were made for hematoxylin and eosin (he), immunohistochemistry (ihc), in situ hybridization (ish), double ihc - ish, and double immunofluorescence stain . For ihc, antigens were retrieved by incubation with 20 g / ml proteinase k (wako, japan) at 37 in 10 min . Endogenous peroxidase activity was suppressed by 3% hydrogen peroxide in methanol for 30 min at room temperature . Non - specific binding was inhibited with a blocking reagent (blocking one; nacalai tesque, japan) for 30 min at 37 in moist chamber . The tissue samples were then incubated at 4 overnight with a monoclonal anti - prrsv antibody sr30 (dilute 1: 10,000 in phosphate - buffered saline [pbs]; rural technologies, usa). Next, the sections were incubated with envision (dakocytomation, japan) as a secondary antibody for 30 min at 37. after each incubation period, the sections were washed three times with pbs . Finally, the sections were stained using a peroxidase stain diaminobenzidine (dab) kit (nacalai tesque). For ish, antisense crna probes specific for prrsv rna were synthesized from the orf 7 gene sequence as previously described . Digoxigenin (dig)-labeled crna probes were prepared using a dig rna labeling kit (roche diagnostics, germany). Tissues positive for prrsv according to ihc and/or ish were further subjected to double staining to confirm whether macrophages were the target cells for prrsv . For double ihc - ish, the tissue sections were first processed for ihc staining using lysozyme ec 3.2.1.17 (dilute 1: 1,000 in pbs; dako, denmark) as a macrophage marker . Sections were incubated with an universal immnuno - alkaline - phosphatase polymer, anti - mouse and -rabbit (histofine simple stain ap (multi); nichirei, japan) for 30 min at 37. immnunoreactivity was visualized by fast red ii (nichirei). Consequently, sections were process for ish using prrsv rna probe . Finally, color was developed using the dab substrate (liquid dab+substrate chromogen system; dakocytomation) and counterstained with hematoxylin . Double immunofluorescence labeling was performed with lysozyme ec 3.2.1.17 (dilute 1: 1,000 in pbs) and fluorescein isothiocyanate (fitc)-conjugated polyclonal swine anti - rabbit igg (dilute 1: 40 in pbs; dakocytomation). The sections were subsequently incubated with the monoclonal anti - prrsv antibody sr30 (dilute 1: 10,000) followed by alexa fluor 594 (dilute 1: 200, molecular probes, usa) at room temperature in dark moist chamber for 60 min each antibody . Finally, the tissue sections were mounted using vectashield with 4',6-diamidino-2-phenylindole (vector laboratories, usa). Confocal microscope (a1 confocal microscope; nikon, japan) was used to view and analyze the stained cells . Pigs were collected from a 400-sow herd isolated from other pig farms in miyazaki, japan . Reduction in the farrowing rate and increased incidences of abortion were observed among the sows . The herd was considered to be endemically infected with prrsv based on diagnostic history and on - going surveillance . Two 3-year - old pregnant sows (a and b) that naturally aborted after 76 and 92 days of gestation along with seven 2-month - old grower pigs with respiratory problems were euthanized with mafropane (ds pharma animal health, japan) and subjected to necropsy . One hour prior to euthanasia, serum and oral fluid were collected . Samples of lungs, brain, heart, liver, spleen, kidneys, ileum, and tissues from the oral cavity (i.e., tonsils, salivary glands, submandibular lymph nodes, and oral mucosa) were taken from each animal . Eight fetuses were randomly selected from the sow litters to survey for prrsv with nested reverse transcription pcr (nrt - pcr). In order to assess prrsv infection during the acclimatization period, 70 6-month - old prrsv - free gilts were purchased from zen - noh livestock (japan) and housed in seven pens (10 gilts / pen) in an isolated acclimation building at the farthest corner of the farm . Disinfectant footbaths and changing coveralls (kenis, japan) were used prior to entering each pen . During the 3-week period after arrival, the technician worked in other pig buildings before going to the acclimation zone without changing coveralls in order to introduce gilts to the current prrsv strain circulating in the farm . The gilts were vaccinated with a prrsv modified live vaccine 2 ml dose (ingelvac prrs mlv; boehringer ingelheim vetmedica, usa) three times 1 day after arrival, 4 weeks after the first injection, and 3 weeks before first round of insemination . In the breeding herd, oral fluids were collected using a sterile cotton rope (100% cotton rope; kenis) to absorb the fluid in the oral cavity from pigs in each pen at 1 week intervals for 11 weeks . Serum samples were collected from individual gilts by using serum separator tube (venoject ii; terumo medical corporation, usa) on the first and eighth weeks of the acclimatization period . Prrsv antibody in serum was identified by an enzyme - linked immunosorbent assay (elisa) kit (anigen prrs ab elisa kit; bionote, korean) according to the manufacturer's instructions . Rna from the tissue samples was extracted with trizol (trizol reagent; invitrogen, usa) while that in sera and oral fluid was extracted with viral rna extraction kit (qiaamp viral rna mini kit; qiagen, germany) according to the manufacturer's instructions . The first pcr primers were 13586f (5'-gtggtatttggcaatg tgtc-3')/14652r (5'-ctccaggtttctatggctga-3'), which amplified 1067 bp of the open reading frame (orf) 4 - 6 region of prrsv . The second primers, p420f (5'-ccattctgttggcaatttga-3')/p620r (5'-ggcatatatcatcactggcg-3'), which amplified 713 bp of the first rt - pcr product . The first rt - pcr was performed with accessquick rt - pcr system (promega, usa) and the second pcr was performed with gotaq green master mix (promega). The first rt - pcr reaction was carried out for one cycle of reverse transcription at 45 for 45 min, inactivation at 94 in 2 min, and 40 cycles of denaturation at 94 for 15 sec, annealing at 55 for 30 sec, extension at 68 for 1 min, and final incubation at 72 for 5 min . The second pcr reaction was performed as first denaturation at 94 for 2 min, on 40 cycles of denaturation at 94 for 15 sec, annealing at 55 for 30 sec, extension at 68 for 1 min, and following the final incubation at 72 for 5 min . Multiplex pcr and multiplex rt - pcr were also performed as previously described to screen for other pathogens including porcine circovirus type 2 (pcv2), suid herpesvirus 1, porcine parvovirus, getah virus, and japanese encephalitis virus . The north american (na)-type prrsv open reading frame (orf) 5 gene was sequenced with abi prism bigdye terminator v3.1 cycle sequencing kits (applied biosystems, usa) using primer p420f / p620r (sigma - aldrich, usa). Alignment was performed with isolates in this study, 3 previous isolates from the farm (farm10/2011, farm 11/2011, and farm 12/2011), and the inoculated vaccine strain . A phylogenetic tree was constructed using the neighbor - joining method and a bootstrap analysis was carried out with 1,000 replications . Tissue samples from the sows and grower pigs were fixed in 4% paraformaldehyde for one day then embedded in paraffin by standard histologic procedures . Two - micrometer - thick tissue sections were made for hematoxylin and eosin (he), immunohistochemistry (ihc), in situ hybridization (ish), double ihc - ish, and double immunofluorescence stain . For ihc, antigens were retrieved by incubation with 20 g / ml proteinase k (wako, japan) at 37 in 10 min . Endogenous peroxidase activity was suppressed by 3% hydrogen peroxide in methanol for 30 min at room temperature . Non - specific binding was inhibited with a blocking reagent (blocking one; nacalai tesque, japan) for 30 min at 37 in moist chamber . The tissue samples were then incubated at 4 overnight with a monoclonal anti - prrsv antibody sr30 (dilute 1: 10,000 in phosphate - buffered saline [pbs]; rural technologies, usa). Next, the sections were incubated with envision (dakocytomation, japan) as a secondary antibody for 30 min at 37. after each incubation period, the sections were washed three times with pbs . Finally, the sections were stained using a peroxidase stain diaminobenzidine (dab) kit (nacalai tesque). For ish, antisense crna probes specific for prrsv rna were synthesized from the orf 7 gene sequence as previously described . Digoxigenin (dig)-labeled crna probes were prepared using a dig rna labeling kit (roche diagnostics, germany). Tissues positive for prrsv according to ihc and/or ish were further subjected to double staining to confirm whether macrophages were the target cells for prrsv . For double ihc - ish, the tissue sections were first processed for ihc staining using lysozyme ec 3.2.1.17 (dilute 1: 1,000 in pbs; dako, denmark) as a macrophage marker . Sections were incubated with an universal immnuno - alkaline - phosphatase polymer, anti - mouse and -rabbit (histofine simple stain ap (multi); nichirei, japan) for 30 min at 37. immnunoreactivity was visualized by fast red ii (nichirei). Consequently, sections were process for ish using prrsv rna probe . Finally, color was developed using the dab substrate (liquid dab+substrate chromogen system; dakocytomation) and counterstained with hematoxylin . Double immunofluorescence labeling was performed with lysozyme ec 3.2.1.17 (dilute 1: 1,000 in pbs) and fluorescein isothiocyanate (fitc)-conjugated polyclonal swine anti - rabbit igg (dilute 1: 40 in pbs; dakocytomation). The sections were subsequently incubated with the monoclonal anti - prrsv antibody sr30 (dilute 1: 10,000) followed by alexa fluor 594 (dilute 1: 200, molecular probes, usa) at room temperature in dark moist chamber for 60 min each antibody . Finally, the tissue sections were mounted using vectashield with 4',6-diamidino-2-phenylindole (vector laboratories, usa). Confocal microscope (a1 confocal microscope; nikon, japan) was used to view and analyze the stained cells . Prrsv rna was identified in the oral fluid and tonsils of both sows but not in the sera, salivary glands, uterus, or other organs (table 1). Viral rna was detected in lungs and placentas of three out of eight fetuses from these sows . Histologically, tonsils from the sows were characterized by mild infiltration of macrophages, neutrophils, lymphocytes, and cryptal epithelial cells in the dilated tonsillar crypts . With ish, prrsv rna was detected in the cytoplasm of large oval cells that possessed morphological features similar to those of macrophages or dendritic cells near tonsillar crypts . Prrsv antigens, however, were not identified by ihc in formalin - fixed tissues from the sows . In all seven grower pigs, lesions were mainly observed in cranioventral lung lobes that were characterized by consolidation, discoloration, and failure to collapse when the thorax was opened . Microscopically, all seven animals were found to have interstitial pneumonia based on evaluation of the lung samples . Alveolar walls were thickened due to the infiltration of macrophages, lymphocytes, and neutrophils . Tonsillitis in the grower pigs was characterized by erosion of the crypt epithelia and dilated crypt lumina filled with macrophages, neutrophils, lymphocytes, and cryptal epithelial cells (a and b in fig . 1). A few prrsv - positive cells were found in the tonsillar cryptal lumen by ish (c and d in fig . Prrsv was consistently detected in the tonsils, oral fluid, salivary glands, and lungs of all seven grower pigs along with the oral mucosae and submandibular lymph nodes of six grower pigs . In contrast, only two serum samples were positive for the virus as detected by nrt - pcr . Viral antigen and nucleic acids were detected in the lungs (grower pigs 1 and 6) and tonsils (grower pigs 1 and 3) by both ihc and ish (table 1). None of the samples from the brain, heart, liver, spleen, kidney, or ileum obtained from these grower pigs was positive for prrsv . No other viruses, including pcv2, suid herpesvirus 1, porcine parvovirus, getah virus, and japanese encephalitis virus, were detected in any samples from the sows or grower pigs . Sections of tonsils from the sows and grower pigs were double stained to identify target cells of prrsv . In the double labeling ihc - ish experiment, macrophages and prrsv rna were stained red or brown, respectively . Double ihc - ish findings revealed that prrsv rna was distributed in the cytoplasm of macrophages within and adjacent to the crypt epithelium (fig . Double immunofluorescence produced positive signals for prrsv antigen and lysozymes that appeared as red or green, respectively . Prrsv antigen that colocalized with lysozymes was visualized as red and green or orange signals in the cytoplasm of macrophages near the tonsillar crypts (fig . The course of prrsv infection in replacement gilts during acclimatization is shown in table 2 . At the first week following introduction, oral fluid was collected from animals in three out of seven pens . After the first collection, the pigs became more familiar with the rope and oral fluid samples from all animals could be collected . Prrsv rna was detected in the serum of one gilt 1 week after the live vaccine was injected . Three weeks post - introduction, the gilts were anorexic and prrsv was detected in oral fluid from the animals in three pens . By week 4, gilts in all seven pens were infected by the virus . The periods during which the virus could be detected in oral fluid differed from pen to pen and ranged from 3 to 6 weeks . Virus was detected in oral fluid from the pigs in five pens until week 8, but was not found in any serum samples taken from individual gilts . Prrsv was not identified in oral fluid samples obtained between week 9 and week 11 . At week 1, all gilts were seronegative with sample: positive (s: p) ratios 0.4 . By week 8, the anti - prrsv antibody levels had increased with mean s: p ratios 2.6 indicating that all gilts had seroconverted . Prrsv isolates from tonsils of the sows and grower pigs or oral fluids from the gilts were sequenced . Percent identity of orf 5 nucleotide sequences among virus from the sows, grower pigs, gilts, and previous isolates from the farm (farm10/2011, farm 11/2011, and farm 12/2011) ranged from 95% to 100% . In contrast, all sequence from this farm shared an 87% to 89% nucleotide identity with the inoculated vaccine strain . Thus, it was concluded that the replacement gilts were infected with the same virus strain that exist in the farm (fig . In order to determine the localization of prrsv, sera and tissue samples from two sows that had naturally aborted and seven grower pigs were examined . In sows, viral nucleic acids were detected in the absence of gross and microscopic lesions with the exception of mild tonsillitis . Similar to previous studies, abortion associated with prrsv infection was not associated with the appearance of lesions . An acceptable explanation for these observations may be that the present study was conducted on naturally infected sows whereas previous investigations examined experimentally infected sows . One possible reason is that the sows were vaccinated four times per year whereas grower pigs were not vaccinated . Therefore, immune responses to prrsv in the sows might have been stronger than that in grower pigs . Previous studies demonstrated that prrsv primarily replicates in tonsils and then spreads to other organs . Therefore, tonsils may also be an important site for prrsv replication in naturally infected sows and grower pigs . Traditionally, serum has been the specimen of choice for detecting various pathogens including prrsv . Oral fluids are increasingly being used for analysis in the swine industry since they are easily collected from individual pigs and are suitable for pen - based sampling . In the current study, prrsv was examined in oral fluid and serum from prrsv - free gilts during acclimatization . One week following inoculation, the virus was detected in the serum of one gilt . Unfortunately, sequencing could not be performed for this sample to confirm whether the gilt was infected by the vaccine strain or field strain due to a low rna concentration . Because a modified live prrsv vaccine was used one week post - vaccination, the gilt may have been in the acute phase of infection . In agreement with findings from a previous study, the virus was detected in the serum of gilts 3 days post - vaccination . During acute infection, serum was found to be superior to oral fluid for early detection of prrsv . However, prrsv was identified week 8 post - arrival in five out of seven oral fluid samples from the gilts but none of the serum samples from all 70 swine . Prrsv was detected in all oral fluid samples from the grower pigs but in only two out of seven serum samples . For the sows, prrsv rna was detectable in both oral fluid specimens but was not found in serum . Therefore, analysis of oral fluid specimens could be used as an alternative to serum sampling to identify prrsv in cases of persistent infection . Early in the acclimatization period, gilts can be exposed to viruses through vaccination or live virus injection as well as exposure to viremic nursery pigs . Live virus injection is associated with potential risks such as the spread of other pathogens and increased mortality . In the current study, gilts were introduced to a farm where prrsv was endemic and a modified live vaccine was used to exposure the gilts to the virus . However, the gilts were infected by the prrsv field strain 3 weeks post - introduction . Thus, the gilts may have been infected before the vaccine - induced immune response to the virus was initiated . Moreover, nucleotide sequencing data indicated that the gilts were infected by the field strain, which shared only a 87% to 89% nucleotide identity with the vaccine strain . A previous investigation demonstrated that the degree of protection conferred by vaccination depends on the degree of similarity between the prrsv vaccine strain and field strain to which the pigs are exposed . Therefore, the current vaccine that contains a single strain of prrsv might not be effective for protecting the animals against infection with genetically different strains of prrsv . The source of infection in this study may have involved indirect routes of transmission such as ones associated with contaminated fomites . Indirect transmission might be a useful method for exposing replacement gilts to the current prrsv circulating in the farm and inducing an immune response before entering the prrsv - positive breeding herd . This technique may also reduce the risk of transmission of other pathogens unlike exposure to viremic pigs or live virus injection . Further studies are necessary to confirm the effect of indirect transmission on replacement gilt immunization . In conclusion, |
Tooth wear (tw), also known as tooth surface loss (tsl), is an insidious and cumulative multifactorial process involving destruction of enamel and dentine which can threaten tooth survival and the oral health related quality of life of affected individuals [1, 2]. Despite the overall trends towards improved oral health and reduced dental caries incidence over the last decades, epidemiological evidence supports the contention that tw is increasing in severity and prevalence, not only amongst older people who are living longer and retaining more teeth, but also amongst those in the early decades of their adult life [3, 4]. Greater understanding of the pathophysiology of tw has driven advances in dental materials and techniques for the benefit of affected patients . These advances have led to biologically based prosthodontic strategies that challenge many traditional or currently prevailing concepts of tw management . Will ensure that as much good as possible is achieved for the patient (beneficence) whilst avoiding harm (nonmaleficience) and upholding the patients' rights to have the reasonable treatment undertaken that most closely matches their wishes and expectations (autonomy). Traditional concepts must now be reassessed in order to achieve a radical paradigm shift in the philosophies behind tw management . This paper will therefore, review the fundamental principles that should be considered when deciding how to manage patients with tw . The current state of knowledge of the aetiology and differential diagnoses of tw will be discussed, followed by an analysis of patient wishes and expectations when seeking sensible solutions for their tw problems . The relative risks and benefits of the possible management options will then be weighed up with reference to current available evidence . Possible solutions which aim to put patients' long - term interests first will be outlined with reference to ethically sound healthcare principles and using some case examples . There are three main, or widely recognized, aetiologies of tw, namely, erosion, attrition, and abrasion . There is a fourth aetiological factor which has been recognized by some but is certainly not universally accepted, namely, abfraction . Each of these has many different clinical presentations which can be challenging to accurately diagnose, because the aetiology is usually multifactorial . Erosion (loss of tooth tissue by the chemical dissolution of enamel or dentine by the action of nonbacterial acids from dietary or gastric sources) initially appears as silky - glazed dull enamel surfaces, with loss of enamel characterization such as perikymata . In moderate cases, the buccal and lingual surfaces of maxillary anterior teeth appear smooth and shiny with the loss of some anatomical features (figure 1(a)). In advanced cases, there is complete loss of the enamel, and dentine is exposed . Often an intact ring of enamel is spared and remains present around the gingival area of the teeth, as seen in figure 1(b). This enamel ring is probably due to the neutralisation of the acid by the gingival crevicular fluid . As the lesion advances, multiple hollowed or cupped out areas form on the occlusal surfaces, as seen in (c) of figure 1 . In gastric erosion, the palatal surfaces of maxillary anterior teeth are initially affected, as the tongue and the buccal mucosa protect the other surfaces from exposure to gastric acid . However, as the condition progresses, the protective effect is often lost, and the erosive tw becomes more widespread [11, 12]. In contrast, dietary erosion presents as widespread cupped out lesions with the specific pattern being dependent upon the specific habits and diet of the patient . Modern sociocultural standards of the ideal body image have resulted in the ubiquitous use in the media and fashion industries of very slim models to portray the supposedly ideal female body shape and size . Increased exposure to such media has been shown to be psychologically detrimental to the well - being and perceived self - image of many young women . The emphasis on thinness may cause impressionable young people to adopt obsessive dieting and/or exercise behaviours, and there is evidence that increased exposure to such media may lead to an increased risk of eating disorders such as anorexia nervosa . One unfortunate outcome of these pressures to be slim can be excessive oral exposure to both dietary and gastric acids which may partly explain the increased prevalence of tw in young adults in the uk between 1998 and 2009 . Refrigerated transportation and increased soft drinks consumption are also likely to contribute to the increase in dietary dental erosion, as fruit and fruit juices are available all year round rather than being limited by seasons . If fresh fruits (particularly fruits containing citric or malic acid with high titratable acidity) are consumed regularly, then the frequency of acid contact episodes increase as does the risk of dental erosion . The quantity and quality of saliva, salivary pellicle, physiological soft - tissue movements, and tooth anatomy and position in relation to the soft tissues will also influence the development and progression of erosive tw . Behavioural factors, such as style and frequency of eating and drinking, have important consequences . Sluiced in the mouth before swallowing will increase the contact time of the solution with the tooth surface and therefore the risk of dissolution of the hard tissues increases . Frequent sipping of small quantities of acidic drinks will also increase their erosive potential . Figure 2 shows localized tooth wear due to frequent sipping of carbonated drinks in a 15 year old . The area of erosion corresponds to the ring pull (v shaped) area of the can, which explains the localisation of the erosion to the central incisors only and the relative sparing of the lateral incisors and canines . Attrition (wear of dental hard tissue as a result of tooth - to - tooth contact with no foreign substance intervening) usually affects the incisal / occlusal surfaces of teeth in such a way that the opposing occluding surfaces of mandibular and maxillary teeth interrelate . There is usually symmetry with an antagonist tooth but this is often in one of the border positions and frequently not in their habitual intercuspal position . The specific pattern of wear coincides with how and where the patient bruxes or rubs their teeth forcibly against one another during their parafunction . Figure 3 illustrates a pattern of attritional tw which shows even wear of the maxillary and mandibular teeth . Although there is considerable evidence of bruxism, there is a marked absence of buccocervical wear lesions, which further refutes the role of stress - related wear (abfraction) as a plausible cause of buccocervical tw . Abrasion (mechanical wear of dental hard tissue not involving tooth - to - tooth contact) often presents in the cervical region of teeth, especially when associated with tooth brushing habits removing acid softened enamel and dentine in areas where gingival recession has occurred . Figures 4(a) and 4(b) show the extensive abrasion of her third full mouth reconstruction in five years . The patient was referred for psychiatric help with her destructive habits . As the dentition has previously been extensively prepared for conventional porcelain crowns, the dentition was subsequently restored, as shown in (c)-(d), using conventional materials and metal on occluding surfaces . Dietary, medical, social, and dental histories are very important to help to distinguish between the various clinical presentations . It is especially important to distinguish erosion from attrition so that the tw can be managed appropriately, taking into account the very different aetiologies and their consequences . For instance, if the chemical dissolution from dietary acids is the main aetiological factor, then the restorative material primarily needs resistance to acid attack in order to protect the remaining sound tooth tissue from further acid dissolution . Diagnosis has been made and the patient concerns have been determined, the main aims of biologically sensible management are the following: the preservation of the remaining tooth tissue, a pragmatic improvement in aesthetics, the restoration of patient confidence (both in terms of their ability to manage their own condition and the likelihood of their remaining tooth tissue lasting for the rest of their lifetime). The preservation of tooth structure is of the greatest concern . In cases of gastric erosion, it is of real importance to prevent further exposure of the eroded teeth to the damaging gastric contents . The management strategy may include, for example, referring the patient to a gastroenterologist for medical management of their gastro - oesophageal reflux or to a psychologist or psychiatrist for behavioural and/or psychological management of an eating disorder . Effectively managing gastro - oesophageal reflux has been shown to reduce enamel erosion even within a six week period of effective treatment . However, with the exception of management of gastric erosion, there is, currently, no high - level evidence about the clinical effectiveness of any other preventative measures such as monitoring periods and/or the use of oral care products in tw . Epidemiological data from industrialized countries such as the uk show that increasingly more patients will retain many of their teeth for their lifetime . Therefore, any dental material used to manage tw must ensure the survival of the structural strength of the underlying remaining tooth tissue . It follows, therefore, that the survival of the tooth is of paramount importance, and by way of comparison, the survival of the restoration is of far less consequence . In fact, because modern restorative materials are now considered expendable, reparable, and renewable, the traditional full mouth rehabilitation approach as a rationale for restoring a worn dentition must now change and focus instead on protecting the remaining sound tooth structure . Studies into the use of dentine bonding agents as a management strategy have found that the coating was retained for a short period of time only . Figure 5 shows an example of directly applied resin composite bonded at an increased vertical dimension in order to provide long - term protection to (a) the eroded palatal surface of a maxillary incisor and (b) the occlusal surfaces of mandibular molars (compare with figure 1). The social and psychological impact of dental disease have been well documented, and it has been shown that poor oral health has a detrimental effect on one's ability to live comfortably, be successful in employment, enjoy life, experience relationships, and possess a positive self - image . When seeking a solution for the management of patients with tw, it is important to determine what specific aspects of the problems are of most concern to the patient, for example, lack of visibility or sharpness of teeth, sensitivity to thermal changes, or the colour of their teeth or shape problems . This brings patient's wishes and expectations to the forefront by considering how they wish to have their problem managed . When the biologically sound concept of protecting their remaining sound tooth tissue is explained to patients, not only do they readily understand the value and rationale of such an approach, but also they usually actively seek to avoid destructive treatments which would remove more of their sound tooth tissue, and involve possible pulpal damage, loss of vitality, further endodontic complications, or ultimately loss of aggressively treated teeth . It is vital to remember that the survival of the tooth and dentinopulpal complex is of paramount importance, and therefore, the focus should be on the survival of the tooth or teeth rather than on the success or survival of the restorations . This biologically sensible approach accepts a lifetime of repair and renewal of restorations, in lieu of, further loss of sound tooth tissue . When choosing the appropriate material to manage tw, the daughter test in elective aesthetic dentistry is of pertinence . This test proposes that whenever elective intervention is contemplated, the following question should be asked: knowing what i know about dentistry and the effects of this elective treatment on the health and structure of these teeth in the long - term, would i carry out this treatment on my own daughter? . If, in answering this question honestly, dentists would be unwilling to carry out electively destructive treatment on their own daughter (or son, younger sister / brother, mother / father, husband / wife), then why would they ever consider carrying out such dental treatment on one of their trusting patients? There is evidence that when patients are adequately informed, most prefer more conservative options such as resin composite rather than destructive options such as porcelain . Patients do not perceive porcelain restorations to be necessarily more aesthetic than resin composite restorations . Using resin composite to manage tw is conservative, predictable, and usually aesthetically acceptable to patients (figure 5). The use of resin composite is also safe with minimal long - term pulpal or structural complications being reported when this is applied to the external aspects of teeth in thick section . Long - term follow - up studies show that the main complications are repairable and retrievable with no loss of tooth vitality or need for loss of further teeth . In marked contrast, the use of dental porcelain veneered onto various copings requires much more of the remaining sound tooth tissue to be removed from the already worn teeth in order to gain adequate space for the brittle porcelain . Few patients with tooth wear are told that in order to have an all - ceramic or ceramic - bonded - to - metal approach to manage their wear that much more of their already reduced teeth will be further destroyed . Edelhoff and sorensen demonstrated that when teeth are prepared for metal - ceramic or all - ceramic crown between 63%72% of coronal tooth structure is removed . The long - term biological costs of this amount of elective structural and pulpal damage can be potentially huge . Ethical clinicians are under a duty of care to ensure that informed consent has been obtained for any elective destructive procedures . Informed consent means that the patient must fully understand that alternative safer or more biologically sound treatment options actually do exist for them . Managing worn incisors using a conservative approach is a critical part of the overall approach to biologically sound tw management . Incisors are relatively small teeth, and therefore, what little structure they have left following significant wear needs to be protected and preserved . Figure 6 shows photographic images of a female patient with tw, resulting in short maxillary anterior clinical crown height . The aetiology was erosion from intrinsic acid as a result of bulimia, to which the patient readily admitted on direct questioning . She had previously been managed on a watch and wait basis by the making of impressions to provide stone casts of her teeth on a yearly basis for seven years . This approach proved futile and costly in terms of both valuable sound tooth tissue and expensive clinical time . A resin composite mock up on the unetched, but dried enamel was used to show the patient what could be done to change her dental appearance . As the patient liked that appearance, the temporary mock up resin composite was removed, the affected teeth were then etched, and a three bottle bonding system was used prior to placing resin composite freehand directly onto just the anterior eroded teeth, at an increased anterior occlusal vertical dimension . This was done without damaging the already eroded teeth in any way or involving the mainly intact posterior teeth . Pragmatic one - hit direct resin composite bonding has been shown to be clinically successful with minimal or no - long - term iatrogenic effects [29, 3133], and the use of three - step (etch, primer, and bond) bonding system is still the gold standard for mixed enamel / dentine bonding . Mocked up with directly applied hybrid resin composite at an increased occlusal vertical dimension . This resulted in improved aesthetics with minimal biological costs, as the residual eroded tooth tissue was protected in one appointment without any treatment of the posterior dentition, which returned to full occlusal contact within 3 months . Increasing the anterior occlusion only is a predictable and safe procedure with a mean time to re - establishing posterior occlusal contacts of 7 months [29, 31]. It should be explained to patients to be treated with this approach that they will need time to adapt to the changes in their occlusion . The resin composite acts as a direct fixed orthodontic device and the teeth are protected by proprioception in the periodontal ligaments while the patient adapts . Confidence in this procedure is based on work originally undertaken by anderson in 1962 showing that patients readily adapt to changes in their occlusion [3235]. These original studies have now been backed up by 30 years of follow - up data showing minimal or no - long - term biological costs occur from this increase in the occlusal vertical dimension . Figure 8 shows some of the clinical procedures used to treat a patient using this approach . Management of generalised tw can be facilitated by raising the occlusal vertical dimension using direct composite resin bonding techniques in the incisor and canine areas, thus opening the posterior occlusion . If the tw is generalised, this space can be secured by temporarily placing fast setting, contrasting colour, glass ionomer cement onto the molar teeth at the increased anterior vertical dimension . The premolars or molars in between these newly bonded teeth can then be definitively restored at leisure during subsequent appointments with an appropriate approach and materials, all depending on the degree of wear or the existing restorations in the posterior teeth . Figure 9 shows photographs of gold adhesive onlays used to restore worn posterior teeth at 15 year followup . If the premolar or molar teeth have existing large restorations and need conventional crowns or onlays, then the longer preparations that are made possible, due to the fact that no further occlusal reduction is required, mean that these longer castings made possible in this biologically sensible way will be better retained with either conventional or resin - based cements as indicated . These biologically based approaches advocated in this paper are worthy of equal, if not greater, financial reward than traditional destructive approaches using conventional crown and bridgework . Dentists who are able to practice and hone their skills using additive techniques with resin composite and not subtractive techniques with a dental bur usually have greater artistic craft skills and a profounder appreciation of the biologic long term value of their patients remaining sound enamel and dentine . These valuable skills are more likely to be sought after by sensible patients with tw, and when they understand the real issues they will usually be willing to pay a fair fee for this biologically sound approach which ensures that they retain their remaining sound tooth tissue with their intact and healthy pulps . Medium destructive approaches and only then consider the highly destructive tooth preparations required for full mouth rehabilitations . In the authors' view, the philosophy of full mouth reconstruction using conventional fixed prosthodontics has very limited biological advantages . The preparation of multiple sound or minimally worn teeth for indirect all - porcelain or porcelain - fused - to - metal restorations is not justifiable, simply because teeth elsewhere in the dentition have been affected by tw, or because it is easier, traditional, or more lucrative, for the clinician to aggressively treat the tw in this manner . Regretfully, many remuneration systems and prosthodontic training courses have retained an emphasis on teaching highly destructive management strategies which have a very poor fallback position (i.e., the ability to repair, retrieve, and retain the teeth and place new sound restorations) when problems inevitably occur . This paper has argued that a paradigm shift is now required in relation to managing tooth wear . For far too long, the emphasis in managing tooth wear has been on the wrong aspects, namely, the length of time that the dental restoration is successful or survives . The emphasis has to change to a more biologically sensible, patient - centred approach, involving minimal destruction of their worn teeth and an acceptance that the materials used to repair or protect the worn tooth tissue will need to be repaired, repolished, renewed, or recycled as required . Damage or chipping of the resin composite itself is of minimal consequence, as it can be readily repaired, whereas the residual load - bearing sound tooth structure and pulpal health are invaluable . The focus for restorative management of tooth wear should, therefore, be on using additive, constructive prosthodontic skills rather than relying on the destructive approaches and skills involved in the traditional full mouth reconstruction using full - ceramic or cast - ceramic veneered restorations . In biologic terms, the destruction of sound tooth structure or the hazarding of dental pulps can no longer be condoned by sensible, caring dentists, whose trusting patients depend on when seeking help with their tooth wear. |
There is extensive evidence that benzodiazepines, the most widely prescribed psychotropic drug class (greenblatt et al 1983), induce anterograde amnesia in both humans and animals (lister 1985; thiebot 1985). The findings of several experiments suggest that the anxiolytic properties of benzodiazepines involve effects mediated by the amygdala . Intra - amygdala injections of benzodiazepines produce anxiolytic effects comparable to those induced by systemic injections (nagy et al 1979; scheel - krger and petersen 1982; shibata et al 1982; niehoff and kuhar 1983; petersen et al 1985). Furthermore, intra - amygdala injections of the benzodiazepine antagonist flumazenil attenuate the anxiolytic effects of systemically administered benzodiazepines (hodges et al 1987). Recent findings by izquierdo and colleagues (1990) suggest that benzodiazepine impairment of memory involves gabaergic type a receptors in the amygdala . Post - training intra - amygdala injection of flumazenil causes memory facilitation comparable to that found with systemic injections, and systemic injection of flumazenil before training attenuates the amnestic effects of post - training intra - amygdala injection of muscimol . Studies examining the memory - modulating effects of drug treatments have provided evidence that memory can be modulated by systemic as well as intra - amygdala gabaergic compounds . When administered shortly after training, gabaergic agonists (eg, muscimol and baclofen) impair memory retention, while gabaergic antagonists (eg, picrotoxin and bicuculline) enhance retention (breen and mcgaugh 1961; brioni and mcgaugh 1988; brioni et al 1989; castellano et al 1989; ammassari - teule et al 1991). On the other hand, there is extensive evidence indicating a key role for gaba neurotransmission in the modulation of fearful / defensive behaviors . It has been found that systemic or intra - amygdala injections of gaba agonists reduce and gaba antagonists enhance experimental fear and anxiety (graeff 1990). Furthermore, lesions of the amygdala attenuate the antianxiety as well as the memory - modulating effects of gabaergic drugs (shibata et al 1989; ammassari - teule et al 1991). A recent study with magnetic resonance spectroscopy revealed low gaba levels in the occipital cortex of depressed patients, cortical benzodiazepine binding to gaba(a) receptors has been measured with i - labeled flumazenil and single photon emission computed tomography in unmedicated patients with major depression and healthy volunteers (kugaya et al 2003). Depression is currently seen as a chronic medical disorder that produces as much functional limitation and morbidity as chronic diseases such as hypertension and diabetes (angst 1999). One of the most frequent and neuropsychologically well investigated symptoms in depression is reduced memory capacity (burt et al 1995; ilsley et al 1995). The condition is thought to result from dysfunctions in monoaminergic systems affecting norepinephrine, serotonin, and dopamine at several effector sites . Disturbances of the limbic hypothalamic pituitary adrenal axis and the serotonin system were found, and changes in adrenoceptors associated with the pituitary adrenal axis function strongly implicate a disorder in central noradrenergic transmission (leonard 2000). The effect of corticotropin - releasing factor in modulating the activity of noradrenergic neurons in the locus ceruleus may provide a link between environmental trigger factors and central noradrenergic dysfunction (leonard 2000). We hypothesized that depression may affect the amygdala noradrenergic modulation of memory and, through the noradrenergic / gabaergic connection, may modify the anterograde amnestic effect of benzodiazepines . Furthermore, the action of benzodiazepines may block the negative tendency on emotional memory tasks described for depressed patients . The purpose of the present study was evaluation of the effect of diazepam on explicit memory (emotional and non - emotional tasks) in patients with major depression who were not previously receiving benzodiazepines . A double - blind, placebo - controlled experiment with diazepam 10 mg (novaquim - sigma) was carried out with dsm - iv major depression patients (by certificated psychiatrists) during the first 24 hours after admission in the psychiatric unit of a general university hospital . Exclusion criteria were psychotic symptoms, other psychiatric comorbidity (eg, alcohol and drug abuse), long - term use of benzodiazepines (last 30 days), cognitive deficit, use of tricyclic antidepressants, and previous ect . Cognitive status was checked with the mini - mental state examination (folstein et al 1975) with cut - offs 24 and 17 for education of> 4 and 4 years, respectively (baseline mini - mental). During this period, drug groups did not differ in age, education, and sex distributions (table 1). Demographic variables and baseline mini - mental (mm) of the studied groups; mean and standard deviation (range) chi - square (fisher s test). All patients signed a written consent after the nature of procedures and objectives of the study were explained . Only patients who were not taking benzodiazepines were selected for the study (before and after hospitalization). There were no group differences (diazepam versus placebo) in the dose or type of antidepressant being taken . Patients who presented severe insomnia received promethazine 25 mg, whereas anxiety was behaviorally handled . All patients were given either placebo (50 mg of starch) or diazepam (10 mg) on the morning of the fourth day (figure 1). The drugs were given orally in enteric capsules, and patients were assigned to the two groups by a double - blind design . The medications were specially processed for the experiment in the hospital pharmacy, where they were assembled in identical capsules . Only one member of the team carried out the randomization and kept the codes of identification of the medications . Those who applied tests and gave medication to patients did not know which was being administered to each patient, and patients did not know which medication they were receiving . Thirty minutes and 6 hours after drug or placebo administration, patients were exposed to an emotionally neutral word list, and to two closely matched and emotionally arousing lists negative and positive (ceitlin et al 1995). Also administered were the logical memory (subtest of the wechsler memory scale; a neutral short story) (wechsler 1973) and the non - verbal silhouette test (black images of universally recognized buildings) (rosat et al 1990). Two sets of equivalent tests (word lists, short story, and silhouettes) were used in the study . These tests for explicit memory were selected because they evaluate immediate and delayed (short - term) memory, recognition, and semantic memory in visual or auditory modality and were well studied in the population from which the sample was recruited . The brazilian portuguese words were obtained in two studies (ceitlin et al 1995) for the development of emotionally negative, positive, and neutral lists . The emotional content of the words, effect on other words in mixed lists, and effect of age, education, and symptoms of depression were evaluated before the final lists were achieved . The portuguese idiom in brazil still lacks population studies on quantitative linguistics (such as word frequency and age of acquisition). Therefore, the ceitlin study covered most of these factors for generation of the present word lists . The effect of the emotionally arousing word lists on a patient s subjective states (mood and anxiety) was evaluated by the visual analog mood scale (vams) (norris 1971), which consists of 16 analog items composed of two adjectives with opposite feelings, separated by a 10-cm line on which the subject has to mark the point which best describes his / her feelings at the time . These items were combined into four factors (anxiety: calm excited, relaxed feeble; mental sedation: alert drowsy, attentive dreamy; other feelings and attitudes: interested bored, amicable antagonistic, happy sad, contented discontented) according to a factorial analysis performed on a brazilian sample (zuardi et al 1993). All procedures were executed by the statistical package for the social sciences (spss / pc plus) and epi - info 6.4 . Parametric data were analyzed by student s t - test for independent samples and by multivariate procedures of manova . Categories were tested by analysis of association (chi - square test with yates correction or fisher s exact test). Neuropsychological scores were submitted to a pegboard test (normal probability plot) before being analyzed by manova (either between or within effects). The univariate analysis within the multivariate procedure was family - wise controlled for alpha values, and two - tailed significance values were chosen . An index of variation (rate) for the word lists was calculated from the recalls at 30 minutes and 6 hours, based on the calculation for rate of forgetfulness (isaac and mayes 1999): where xi is the score of recall 30 minutes after drug intake and xii of recall at 6 hours . This rate may enhance the effect of the intervention because both retrievals occurred after exposure to the list (auditory task); consequently, second recall was more likely to be higher owing to the learning effect . In the case of a positive index, first retrieval was higher than second, expressing a greater effect of the drug than of practice . All procedures were executed by the statistical package for the social sciences (spss / pc plus) and epi - info 6.4 . Parametric data were analyzed by student s t - test for independent samples and by multivariate procedures of manova . Categories were tested by analysis of association (chi - square test with yates correction or fisher s exact test). Neuropsychological scores were submitted to a pegboard test (normal probability plot) before being analyzed by manova (either between or within effects). The univariate analysis within the multivariate procedure was family - wise controlled for alpha values, and two - tailed significance values were chosen . An index of variation (rate) for the word lists was calculated from the recalls at 30 minutes and 6 hours, based on the calculation for rate of forgetfulness (isaac and mayes 1999): where xi is the score of recall 30 minutes after drug intake and xii of recall at 6 hours . This rate may enhance the effect of the intervention because both retrievals occurred after exposure to the list (auditory task); consequently, second recall was more likely to be higher owing to the learning effect . In the case of a positive index, first retrieval was higher than second, expressing a greater effect of the drug than of practice . Performance on word lists with positive emotional content showed a statistically significant score gradient from 30 minutes to 6 hours after drug administration only in the group of patients who received diazepam (figure 2). Patients who received diazepam presented higher and more positive indexes for positive words, while negative and neutral words presented negative rates . Although not statistically significant, the index negativity was lower for negative and higher for neutral words . We observed a very large standard deviation for recall of neutral words; however, individual scores of this word list were all negative within the diazepam group and both negative and positive within the placebo group . For positive words, the gradient showed the least variation among the diazepam group, significantly less than in placebo patients . These findings may suggest a facilitatory effect of diazepam (10 mg) on the recall of positive words (30 minutes after administration). At the 6-hour evaluation, performance on the positively loaded words decreased to a similar level to that of the placebo group . Mean and standard deviation of rate of recall of the word lists emotionally toned (positive, negative, neutral) of patients on diazepam and on placebo . The scores of the vams were not different within each group (p> 0.05) or between groups (p> 0.05). Therefore, the significant rate of recall for positively loaded words among diazepam patients could not be explained by lower levels of anxiety or other symptoms . Patients, either diazepam or placebo, showed similar levels of symptoms at the two time - points . No parallel improvement on other immediate recall was seen at 30 minutes relative to 6 hours after dosing (diazepam group). The score of the immediate recall of the short history at 30 minutes was lower than at 6 hours (p = 0.035) (table 2). There was no difference between the immediate and delayed retrievals of this test at 30 minutes after medication (p = 0.361). However, at the 6-hour evaluation, immediate recall was higher than delayed (p = 0.028). Mean and standard deviation (range) of scores of tests without emotional content and with immediate (i) and delayed (d) recalls within - group comparison . P = 0.028 (immediate> delayed recall short story at 6 hours). For the positive word list, the score during the effect of diazepam was higher than 6 hours later (p = 0.043). The visual recognition task (silhouette test) showed higher performance at 6 hours than at 30 minutes for the immediate (p = 0.018) and delayed (p = 0.028) retrievals (table 2). However, no significant difference was observed for the comparison of the immediate and delayed recalls 30 minutes and 6 hours after drug intake (p = 0.139 and p = 0.234, respectively). In the placebo group, the score of immediate recall of the short history at 6 hours after medication was higher than that at 30 minutes (p = 0.012), as was the delayed retrieval (p = 0.036). There was no significant difference between the immediate and delayed retrievals either 30 minutes or 6 hours after medication (p = 0.753 and p = 0.655, respectively). Immediate performance in the visual recognition task (silhouette test) after 6 hours was higher than at the 30-minute session (p = 0.030). The comparison of performances between immediate and delayed at 30 minutes and at 6 hours (p = 0.484 and p = 0.675, respectively) and between the delayed recognitions (p = 0.183) showed no statistical differences (table 2). The enhancement of emotionally positive tasks in the diazepam group relative to the placebo group may suggest improvement of the retrieval of information by diazepam . Improvement of retrieval by benzodiazepines has been observed (izquierdo and chaves 1988; chaves et al 1990), and it was hypothesized that the phenomenon would not be a true facilitation of retrieval processes, but the result of reduced interference from items presented after drug administration and thus a secondary consequence of drug - induced amnesia (retroactive interference) (loftus and palmer 1974; chaves et al 1990). Because of the small sample size and the relatively large number of comparisons that were carried out, consideration of our results should take these limitations into account . For that reason, selection of the statistical techniques (analyses and alpha control) was especially careful . However, our results are provocative and raise an interesting hypothesis . Comparisons between diazepam and placebo groups showed no difference on non - emotional memory tests . Patients did not present anterograde amnesia following administration of diazepam; however, this effect has been demonstrated in normal volunteers and animals (sutton et al 1988; zuardi et al 1993). Benzodiazepine effects are mediated through the gaba(a) complex by enhancing gaba - induced synaptic inhibition . As the gabaergic system in the amygdaloid complex is a site of action for the anxiolytic effects of benzodiazepines, it has been suggested that benzodiazepines may also influence memory through the amygdala . Lesions in the amygdaloid complex can block diazepam - induced retention deficits, and central and lateral, but not basolateral, amygdala nuclei lesions impaired retention (tomaz et al 1993). The amygdala is a key structure in the brain s integration of emotional meaning with perception and experience and has been implicated in the pathophysiology of major depression (drevets 1999; bremner et al 2000). There is growing interest in understanding brain mechanisms of memory formation for emotionally arousing events, a development closely related to renewed interest in the concept of memory consolidation . There is little doubt that memory for emotionally arousing events is better than for neutral stimuli . This is clearly adaptive, because emotional stimuli, whether pleasant or aversive, are generally more important to species survival (hamann et al 1999). Most current evidence indicates that the amygdala is not a site of storage of memory processes but plays a key role in modulation of emotional memory for both human (mcgaugh et al 1996; cahill and mcgaugh 1998) and nonhuman subjects (barros et al 1999; bianchin et al 1999). Long - term, but not short - term, memory has been shown to be enhanced by emotional arousal (quevedo et al 2003). Depression may affect the amygdala noradrenergic modulation of memory and, through the noradrenergic / gabaergic connection, may modify the anterograde amnestic effect of benzodiazepines . Functional neuro - imaging studies of the anatomical correlates of familial major depressive disorder and bipolar disorder have identified abnormalities of resting blood flow and glucose metabolism in depression in the amygdala and the orbital and medial prefrontal cortical areas that are extensively connected with the amygdala (drevets 1999). The amygdala metabolism in major depression and bipolar disorder is positively correlated with both depression severity and stressed plasma cortisol concentrations measured during scanning . Thus, a neural model of a dysfunction of limbic prefrontal cortical structures impairing modulation of the amygdala in major depression, leading to abnormal processing of emotional stimuli, may be considered . Consequently, the action of diazepam on the amygdala, which has been proposed to be the basis of its anxiolytic action, might be altered, modifying the modulation of memory in our patients . Substantial evidence from animal and human subject studies converges on the view that memory for emotionally arousing events is modulated by an endogenous memory - modulating system consisting, at a minimum, of stress hormones and the amygdaloid complex . Within the normal range of emotions experienced, this system is viewed as an evolutionarily adaptive method of creating memory strength that is, in general, proportional to memory importance (cahill 1997). |
Syphilis is a chronic systemic infectious disease caused by treponema pallidum, a microaerophilic spirochete, whose transmission occurs mainly by sexual contact . Its course is characterized by a multistage evolution, in a total of 4 distinct clinical stages in cases of non - treated disease, in which symptomatic phases alternate with periods of latency . The myriad of possible clinical manifestations often represent a great challenge, a fact that led sir william osler to label it as the great imitator. In this report, we present 2 cases in which the clinical manifestations of the patients initially simulated other dermatologic diseases, giving the impression of mucha - habermann disease (pityriasis lichenoides et varioliformis acuta), in the first case and reiter's syndrome (reactive arthritis), in the second . Male patient, 18 years old, white, single, student, born in and resident of rio de janeiro . He presented with a 1-month history of cutaneous lesions, jaundice, darkened urine and acholic stools . There was lesional polymorphism with lesions varying from erythematous papules and pustules to ulceronecrotic lesions with disseminated crusts on the face, trunk and limbs (fig . 1). Physical examination revealed jaundice (+ + /4 +) and bilateral inguinal lymphadenopathy . The exams showed positive serology for hepatitis b and alteration of the hepatic function tests . The initial impression of cutaneous vasculitis was not confirmed and clinical data, serologic tests and histologic findings led to the diagnosis of early malignant syphilis in an immunocompetent patient . Male patient, 19 years old, single, student, born in and resident of rio de janeiro, presenting with conjunctival hyperemia and eyelid swelling on the right side for almost 2 years, which initially improved with steroid eye drops . Later, there was progressive loss of visual acuity and onset of erythematous scaly lesions on the buttocks, palms and soles, besides erosions on the glans and inside the oral cavity (fig . 3). During the 6-month period preceding the medical consultation, arthralgia appeared on the knees, left sacroiliac articulation and elbows, accompanied by headache . The ophthalmological examination revealed panuveitis and the dermatological examination revealed keratoderma palmoplantaris, diffuse erythema on the trunk, scrotum erythema and erosion, circular residual violaceous erythema on the glans, anonychia and onychodystrophy, which hinted at the diagnosis of reactive arthritis . Male patient, 18 years old, white, single, student, born in and resident of rio de janeiro . He presented with a 1-month history of cutaneous lesions, jaundice, darkened urine and acholic stools . There was lesional polymorphism with lesions varying from erythematous papules and pustules to ulceronecrotic lesions with disseminated crusts on the face, trunk and limbs (fig . 1). Physical examination revealed jaundice (+ + /4 +) and bilateral inguinal lymphadenopathy . The exams showed positive serology for hepatitis b and alteration of the hepatic function tests . The initial impression of cutaneous vasculitis was not confirmed and clinical data, serologic tests and histologic findings led to the diagnosis of early malignant syphilis in an immunocompetent patient . Male patient, 19 years old, single, student, born in and resident of rio de janeiro, presenting with conjunctival hyperemia and eyelid swelling on the right side for almost 2 years, which initially improved with steroid eye drops . Later, there was progressive loss of visual acuity and onset of erythematous scaly lesions on the buttocks, palms and soles, besides erosions on the glans and inside the oral cavity (fig . 3). During the 6-month period preceding the medical consultation, arthralgia appeared on the knees, left sacroiliac articulation and elbows, accompanied by headache . The ophthalmological examination revealed panuveitis and the dermatological examination revealed keratoderma palmoplantaris, diffuse erythema on the trunk, scrotum erythema and erosion, circular residual violaceous erythema on the glans, anonychia and onychodystrophy, which hinted at the diagnosis of reactive arthritis . Syphilis is characterized not only for evolving in distinct clinical stages, but also for having the ability to mimic a wide variety of diseases, in each of its phases . In primary syphilis, localized erythema develops at the site of inoculation, which evolves into hardened and painless papules . Classically, after the surface necrosis, the typical well - circumscribed ulceration develops, with hardened borders and clear base the chancre associated with regional adenopathy . Primary syphilis, however, may present atypical morphology, location and symptoms, causing diagnostic difficulties, which results in only 3040% of patients being diagnosed in the primary stage . Extragenital chancres can occur in any mucocutaneous surface exposed to the infection, but are more common in the oral cavity and anal region . Any ulcerated nodular lesion associated to lymph adenopathy should lead to the suspicion of primary syphilis . Differential diagnosis must be made with other infections, including tularemia; cat - scratch disease; sporotrichosis; mycobacteriosis; leishmaniasis and staphylococcal lymphangitis; and with granulomatous diseases and neoplasms with nodal metastasis . In the anal region, it is rarely restricted only to a nodular hardening and can be accompanied by fissures, which leads to confusion with hemorrhoids, anal fissures or even neoplasms . Features vary according to the number of inoculated spirochetes, concomitant use of antibiotics, presence of co - infections, and the patient's immune state [1, 4]. The secondary stage results from the hematogenous and lymphatic dissemination and multiplication of the microorganism in different tissues . These may be subtle, transient and pass unnoticed; or so severe as to require hospitalization . However, over 90% of patients present rash, which is almost always characteristic . At the beginning, there is a macular rash with discrete pink, non - scaling, oval lesions the syphilitic roseola, predominantly on the trunk and upper flexor areas of limbs . Then, the lesions may develop into a papular - macular, papular - desquamative, lenticular, corymbose, nodular, annular, follicular, pustular or impetiginous aspect . Secondary syphilis polymorphism depends entirely on the intensity of the inflammatory infiltrate, level of cutaneous vascular involvement and the resulting ischemia . When papular lesions are pruritic and lichenoid, it may be difficult to differentiate from lichen planus . Annular lesions may also resemble annular granuloma, pityriasis rosea and dermatophytosis . Where there is a hyper keratotic component, the resulting lesions are indistinguishable from psoriasis [5, 8]. Hyperkeratotic plaques on the soles give the impression of calluses and, when desquamative, can mimic tinea pedis [1, 5]. The differential diagnosis of nodular syphilis includes systemic mycosis, kaposi's sarcoma, bacillary angiomatosis, foreign body granuloma type, lymphoma, pseudolymphoma, leprosy, sarcoidosis, and halogenoderma . Secondary syphilis with pustular lesions can also lead to the erroneous diagnosis of pustular acne [8, 9]. Mucosal involvement can be part of the condition, consisting mainly of mucous patches, pharyngitis and condyloma lata . Hair can be affected on the scalp, eyebrows and beard, and diffuse pattern alopecia increases the index of suspicion for the disease . The latter may be similar to alopecia areata, neoplastic alopecia, tinea capitis or trichotillomania . Ungual disorders include fissures, beau lines, onycholysis, onychomadesis, onychogryphosis, nail pitting and others [1, 6]. Completing the picture, general symptoms may occur and rarely hepatitis, periostitis, arthritis, gastritis, meningitis and uveitis . In the second case reported here, the ocular and articular involvements associated with the mucocutaneous lesions led to a first diagnostic impression of reactive arthritis . This syndrome is characterized by the classical triad of arthritis, urethritis and conjunctivitis, after urethral or gastrointestinal infection . Despite conjunctivitis being classically described in the syndrome, there are other associated ocular involvements, such as iritis and uveitis, the latter being diagnosed in our patient . That young man also presented, at the dermatological examination, keratoderma palmoplantaris and erosions on the glans, simulating, respectively, keratoderma blenorrhagica and circinate balanitis, and erosive lesions of the oral cavity . All these findings have been described in up to 20% of patients with reactive arthritis . A variant of secondary syphilis known as early malignant syphilis is characterized by a fast progression of papules, plaques, nodules, and polymorphic vesicular pustules with tendency to ulceration, covered with several layers of thick crusts, acquiring a rupioid aspect . However, at first glance, the acute onset and the exuberant features of the lesions led to the diagnostic hypothesis of pityriasis lichenoides et varioliformis acuta . Also known as mucha - habermann disease, this disease is characterized by the appearance of generalized erythematous - purpuric papules that evolve with necrosis . Finally, untreated syphilis evolves into a third form, very rare nowadays, with a variety of manifestations that occur months to years after the beginning of the infection . This stage is characterized by the presence of a small number of treponema, but with high cellular immune reactivity against this agent . Microorganisms can invade different systems and lead to injury by a delayed type of hypersensitivity reaction . Syphilis presents a highly variable clinical course and wide diversity of manifestations, which has made it known as the great mimicker . Its ability to simulate various other diseases often causes its diagnosis to be a challenge . However, the lack of diagnosis of this quite prevalent disease can entail serious consequences for the patient . Thus, it is of considerable importance that dermatologists and other specialists be familiarized with the many manifestations of syphilis and start considering it more often among their diagnostic hypotheses. |
Inflammatory bowel disease (ibd) is a common diagnostic and therapeutic problem, affecting patients at increasingly young ages . A standard diagnostic method includes macroscopic assessment of the intestinal mucosa during colonoscopy and histopathological evaluation of the obtained biopsies . According to porto criteria, the diagnosis of ibd is based on the clinical presentation, intestinal endoscopic and histological features, laboratory tests, and radiological examination . Recently, reports on the usefulness of a noninvasive examination, that is, faecal calprotectin measurement in ibd diagnosis, have been published . Evaluation of faecal calprotectin (fc) seems to be a screening test selecting patients requiring further invasive diagnostics . Furthermore, there have been reports on using calprotectin assays in monitoring the treatment of crohn's disease and ulcerative colitis in adults and children [14]. To our knowledge, there are no published data on the usefulness of faecal calprotectin assays in the diagnosis of other atypical forms of bowel inflammation, such as eosinophilic, lymphocytic, or nonspecific colitis . The aim of the study is to assess the usefulness of faecal calprotectin measurement in children with various types of ibd and to evaluate fc concentration in children with crohn's disease and ulcerative colitis in relation to disease activity . 91 patients were included in the analysis, including 49 boys (53.85%) and 42 girls (46.15%), ranging from 6 to 18 years of age (the mean age was 13.38 years). The study group comprised 71 children with various types of ibd, who were subsequently divided into six subgroups: b124 (33.8%) children with crohn's disease (cd), b216 (22.5%) with ulcerative colitis (uc), b37 (9.8%) with eosinophilic colitis (ec), b48 (11.26%) with lymphocytic colitis (lc), and b516 (22.5%) with nonspecific colitis (nc, colitis indeterminata the control group (k) comprised 20 healthy, age- and sex - matched subjects . Patients with ibd underwent following procedures: anamnesis, physical examination, laboratory tests (inflammatory state markers, biochemical parameters of liver, pancreas, and kidney function, sweat test, coprological tests, and immunoassays), diagnostic imaging (abdominal ultrasound), and endoscopy with histopathological evaluation . In all patients, faecal calprotectin was measured by means of elisa method, using phical test (calpro). Calprotectin concentrations ranging from 0 to 50 mg / kg were considered to be normal reference values . The results were evaluated by using the following tests: komogorow - smirnow, t - student, u mann - whitney, fisher, and yates; the analysis of correlation was based on the spearman's rank correlation coefficient . A p value of <0.05 was considered statistically significant . All patients and their caregivers gave informed consent to participate in the study, which was approved by the bioethics committee of the medical university of silesia in katowice (consent no . A statistically significant increase in the mean concentrations of faecal calprotectin was observed in the group of children with cd and uc, as compared to the control group . Concentrations of fc were also higher in children with uc than in patients with cd . Faecal calprotectin concentrations were within the normal limits in patients with eosinophilic, lymphocytic, and nonspecific colitis, similarly to the healthy subjects (table 1, figure 1) in children with cd, faecal calprotectin concentrations positively correlated with the disease severity assessed according to the pcdai scale . In patients suffering from uc, faecal calprotectin also positively correlated with the truelove - witts scale and the rachmilewitz endoscopic index (figures 2, 3, and 4). A significant increase in faecal calprotectin concentrations was observed in children suffering from cd, with lesions located in both small and large intestine, and in patients presenting with inflammatory changes in 5 or more sections of the intestine (figure 5). Faecal calprotectin is a promising, noninvasive screening method for diagnosing patients suffering from gastrointestinal disorders, such as abdominal pain or diarrhea, which are also typical for ibd [57]. So far, many authors have considered calprotectin as a useful marker in differential diagnosis of ibd and functional gastrointestinal disorders (e.g., irritable bowel syndrome) [8, 9]. Many authors evaluated faecal calprotectin concentrations in patients with suspected inflammatory process of the large intestine . Demonstrated in the group of paediatric patients that this assay is characterised by 95% sensitivity and 93% specificity, and high calprotectin concentrations show strong positive correlation with the presence of inflammatory lesions in the large intestine . According to these authors so far, only limited studies, based on very small groups of patients, evaluated faecal calprotectin concentrations in patients with other types of bowel inflammations less common than cd and uc, such as lymphocytic, eosinophilic, and nonspecific colitis, which seem to be a considerable clinical problem in everyday pediatric practice . In studies conducted by bunn et al ., two children with nonspecific colitis and 3 children with allergic colitis were included in the analysis . In both cases, calprotectin concentrations were found to be within the normal ranges . In our study involving 31 children: 7 with eosinophilic colitis, 8 with lymphocytic colitis, and 16 with nonspecific colitis, respectively, these results support the hypothesis that in the aforementioned types of bowel inflammation, histopathological examination does not reveal infiltrations of neutrophil cells, whose cytosols contain calprotectin . Therefore, its concentration in faeces is directly related to the number of neutrophils in the large intestine lumen [11, 12]. In paediatric patients, the diagnosis of nonspecific colitis (indeterminata colitis) remains unchanged in approximately 36% . Over time in some patients, the diagnosis may be changed into ulcerative colitis (in approximately 3372.5%) or crohn's disease (in approximately 1727.5%). In our group of 6 cd patients, previously diagnosed conditions included single cases of ulcerative colitis, lymphocytic colitis, and nonspecific colitis, whereas eosinophilic colitis was found in 3 subjects . Increased calprotectin concentrations may be useful when making a decision on extending diagnostic procedures in patients with less frequent types of bowel inflammation . In our study, the mean calprotectin concentration in the examined patients with ibd was higher than it was observed by bremner et al . ; however, patients in remission were also enrolled in the latter research . In the presented material, a significant correlation was demonstrated between calprotectin activity and the disease severity assessed by the modified pcdai scale for cd and the modified truelove - witts scale and the rachmilewitz endoscopic index for uc ., demonstrating a strong positive correlation between calprotectin concentrations and the disease severity according to the modified truelove - witts scale only in uc . Analyses performed in children assessed a correlation between fc concentrations and intensity of macroscopic and microscopic inflammatory lesions in the large intestine, observed in the course of ibd . Studies carried out by fagerberg et al . Included 39 children with ibd, in whom calprotectin concentrations strongly correlated with intensity and extent of micro- and macroscopic abnormalities . Norwegian researchers also confirmed such a correlation and, moreover, suggested that intensity of inflammatory lesions rather than their extent influences faecal calprotectin concentration . This suggestion can be supported by data obtained from our study, indicating that in patients with uc calprotectin concentration depends on disease activity and not on the extent of lesions, in contrast to patients suffering from cd . In the latter group, calprotectin concentrations correlated with the disease activity and were significantly higher in children with inflammatory lesions present in both small and large intestine and located in 5 or more sections of the large intestine . These results support conclusions from the studies on clinical expression of the disease, which demonstrated that in children and adolescents the disease is more severe and cd lesions are located in the small intestine [17, 18]. So far faecal calprotectin measurement seems a promising test to evaluate disease activity and a tool for monitoring ibd treatment . In everyday practice, a disadvantage of this method is its low specificity, which is connected with the fact that in patients with increased calprotectin concentration many organic diseases should be excluded . It seems that measurement of faecal calprotectin concentration can be a useful, safe, and noninvasive test in children suspected for ibd, since it is found to be increased in children with cd and uc as compared to patients with other inflammatory diseases (eosinophilic, lymphocytic, and nonspecific colitis) and also in the reference to healthy subjects . When the faecal calprotectin concentration is increased in children with less common types of bowel inflammation, a further follow - up of such patients faecal calprotectin concentration correlates positively with the disease severity in cd and uc patients; thus, it may be useful when choosing or modifying the appropriate treatment regimen. |
Periodontal diseases (pd) are chronic inflammatory disorders encompassing destructive and nondestructive diseases of the periodontal supporting tissues of the teeth . Aggressive periodontitis is characterized by severe and rapid loss of periodontal attachment often commencing at or after puberty . Even though the diagnosis and classification of pd is essentially based on clinical parameters, new auxiliary diagnostic tools based on the analysis of saliva and gingival crevicular fluid have been studied and developed . In particular, saliva has been extensively studied in relation to pd since it can be easily collected and analyzed . Saliva is necessary for the maintenance of oral health, and the unique properties of this fluid are derived in large part from the proteins that are present . In the oral cavity, salivary proteins participate in formation of the acquired enamel pellicle, occur in the biofilm covering oral surfaces, initiate digestion, promote agglutination and clearance of bacteria, and protect oral tissues against noxious compounds produced by various microorganisms . In particular, mucin glycoprotein-2 (mg2) was reported to be present in pellicle formed on cementum surfaces, to exhibit candidacidal activity, and to kill the periodontal pathogen aggregatibacter actinomycetemcomitans . Salivary lactoferrin removes free iron in fluids decreasing the availability of this metal to microbes . In addition, lactoferrin exhibits antibacterial, antimycotic, antiviral, and anti - inflammatory activity . Thus, mg2 and lactoferrin are active components of the innate immune system in the oral environment . Several studies reported that the levels of distinct salivary proteins are altered in individuals with pd . Therefore, the present study was undertaken to investigate and compare the pattern of secretion and the expression of mg2 and lactoferrin in individuals with aggressive periodontitis, chronic periodontitis and without periodontitis . During a 12-month period, individuals that were referred to the authors' department for treatment and volunteered to participate in this study were screened . Exclusion criteria for the study included: pregnancy; use of antibiotics within the past 3 months; individuals with systemic debilitating diseases or conditions that could affect periodontal status (e.g. Diabetes); smokers and former smokers; recent trauma . Additionally, individuals that had aggressive or chronic periodontitis and had received periodontal treatment within the previous year were excluded in order to observe the expression of the salivary glycoproteins mg2 and lactoferrin in the inflammatory context of periodontitis . Individuals meeting inclusion criteria received a complete periodontal exam that included assessment of probing depth, probing attachment level and recession, evaluation of bleeding and/or suppuration on probing, radiographic examination and complete anamnesis . Probing depths were measured at six sites per tooth (mesio-, mid-, disto - vestibular / palatal or lingual). The specific inclusion criteria used to differentiate the 3 groups were based on previous publications including: aggressive periodontitis group (apg): (i) localized aggressive periodontitis - periodontal damage being localized to permanent first molars and incisors; generalized aggressive periodontitis: (ii) generalized interproximal attachment loss affecting at least 3 permanent teeth other than the permanent first molars and incisors; (iii) clinical attachment loss (cal) 5 mm; probing depths 6 mm . Generalized chronic periodontitis group (cpg): (i) more than 30% of sites involved; moderate: cal 3 - 4 mm; probing depths 4 - 6 mm; severe: cal 5 mm; probing depths 6 mm . Each group had 5 individuals (2 males and 3 females) with age ranges of 19 - 28 years for apg, 36 - 50 years for cpg, 21 - 50 years for cg and as expected individuals from apg exhibited a lower age range . This study was independently reviewed and approved by the local research ethics committee, informed consent was obtained from all individuals prior to their participation and subjects' rights were protected at all times . Non - stimulated and stimulated submandibular and sublingual saliva (smsl) was collected from subjects between 10:00 a.m. and 11:00 a.m. subjects were asked to refrain from eating or drinking two h prior to collection . Subjects rinsed with water, and smsl samples were collected with a custom - fitted device as described previously . The first 4 min of non - stimulated smsl were discarded in order to avoid possible interference of the device dead volume . Four consecutive two - minute samples collected in separate 1.5 ml centrifuge tubes and subsequently four consecutive two - minute samples of stimulated smsl were collected in separate 15 ml falcon screw cap tubes . Gustatory stimulation of stimulated samples was induced by placing lemon fruit flavored candies on the tongue . Tubes of non - stimulated smsl were labeled t1, t2, t3 and t4 . All samples were kept on ice during the collection procedure, the flow rate from each subject was recorded and samples were frozen at -20c until used . Smsl samples were thawed, and for each subject, equal volumes (50 l) of non - stimulated and stimulated smsl were lyophilized, taken up in 15 l of sample buffer, heated at 95c for 5 min and subjected to sodium dodecylsulfate polyacrylamide gel electrophoresis (sds - page) on 7.5% gels . Proteins in gels were electrophoretically transferred to nitrocellulose membranes (protran, schleicher and schuell, keene, nh, usa) in 25 mm tris - hcl, ph 8.3, containing 192 mm glycine and 20% methanol at 100 volts for 1 h at room temperature . Briefly, blots were equilibrated in 10 mm tris - hcl, ph 8.0 containing 150 mm nacl and 0.1% tween-20 (tbst) for 5 min and blocked with 5% non - fat, dried milk in tbst overnight at room temperature . After blocking, the specificity of the anti - mg2 antibody has been demonstrated in previous studies, and this antibody was diluted 1:1000 . Antibodies were diluted in 1% milk / tbst and incubated for 1 h at room temperature . After washing, blots were incubated with the second antibody, which was anti - rabbit igg coupled to alkaline phosphatase (promega, madison, wi, usa) diluted 1:7,500 in 1% milk / tbst for 1 h at room temperature . Blots were washed three times in tbst for 5 min and color development was carried out with 5-bromo-4-chloro-3-indolyl - phosphate (bcip) and nitro blue tetrazolium (nbt) according to the manufacturer's (promega) instructions . Comparison of the effect of non - stimulated and stimulated conditions on smsl flow rate was tested for statistical significance (=0.05) by a two - way repeated - measures analysis of variance (anova; post hoc analysis - fisher's exact test). The statistical analysis was performed using statview 4.5 (abacus concepts inc ., berkeley, ca, usa). During a 12-month period, individuals that were referred to the authors' department for treatment and volunteered to participate in this study were screened . Exclusion criteria for the study included: pregnancy; use of antibiotics within the past 3 months; individuals with systemic debilitating diseases or conditions that could affect periodontal status (e.g. Diabetes); smokers and former smokers; recent trauma . Additionally, individuals that had aggressive or chronic periodontitis and had received periodontal treatment within the previous year were excluded in order to observe the expression of the salivary glycoproteins mg2 and lactoferrin in the inflammatory context of periodontitis . Individuals meeting inclusion criteria received a complete periodontal exam that included assessment of probing depth, probing attachment level and recession, evaluation of bleeding and/or suppuration on probing, radiographic examination and complete anamnesis . Probing depths were measured at six sites per tooth (mesio-, mid-, disto - vestibular / palatal or lingual). The specific inclusion criteria used to differentiate the 3 groups were based on previous publications including: aggressive periodontitis group (apg): (i) localized aggressive periodontitis - periodontal damage being localized to permanent first molars and incisors; generalized aggressive periodontitis: (ii) generalized interproximal attachment loss affecting at least 3 permanent teeth other than the permanent first molars and incisors; (iii) clinical attachment loss (cal) 5 mm; probing depths 6 mm . Generalized chronic periodontitis group (cpg): (i) more than 30% of sites involved; moderate: cal 3 - 4 mm; probing depths 4 - 6 mm; severe: cal 5 mm; probing depths 6 mm . Each group had 5 individuals (2 males and 3 females) with age ranges of 19 - 28 years for apg, 36 - 50 years for cpg, 21 - 50 years for cg and as expected individuals from apg exhibited a lower age range . This study was independently reviewed and approved by the local research ethics committee, informed consent was obtained from all individuals prior to their participation and subjects' rights were protected at all times . Non - stimulated and stimulated submandibular and sublingual saliva (smsl) was collected from subjects between 10:00 a.m. and 11:00 a.m. subjects were asked to refrain from eating or drinking two h prior to collection . Subjects rinsed with water, and smsl samples were collected with a custom - fitted device as described previously . The first 4 min of non - stimulated smsl were discarded in order to avoid possible interference of the device dead volume . Four consecutive two - minute samples collected in separate 1.5 ml centrifuge tubes and subsequently four consecutive two - minute samples of stimulated smsl were collected in separate 15 ml falcon screw cap tubes . Gustatory stimulation of stimulated samples was induced by placing lemon fruit flavored candies on the tongue . Tubes of non - stimulated smsl were labeled t1, t2, t3 and t4 . All samples were kept on ice during the collection procedure, the flow rate from each subject was recorded and samples were frozen at -20c until used . Smsl samples were thawed, and for each subject, equal volumes (50 l) of non - stimulated and stimulated smsl were lyophilized, taken up in 15 l of sample buffer, heated at 95c for 5 min and subjected to sodium dodecylsulfate polyacrylamide gel electrophoresis (sds - page) on 7.5% gels . Proteins in gels were electrophoretically transferred to nitrocellulose membranes (protran, schleicher and schuell, keene, nh, usa) in 25 mm tris - hcl, ph 8.3, containing 192 mm glycine and 20% methanol at 100 volts for 1 h at room temperature . Briefly, blots were equilibrated in 10 mm tris - hcl, ph 8.0 containing 150 mm nacl and 0.1% tween-20 (tbst) for 5 min and blocked with 5% non - fat, dried milk in tbst overnight at room temperature . After blocking, the specificity of the anti - mg2 antibody has been demonstrated in previous studies, and this antibody was diluted 1:1000 . The anti - lactoferrin antibody (sigma, st . Antibodies were diluted in 1% milk / tbst and incubated for 1 h at room temperature . After washing, blots were incubated with the second antibody, which was anti - rabbit igg coupled to alkaline phosphatase (promega, madison, wi, usa) diluted 1:7,500 in 1% milk / tbst for 1 h at room temperature . Blots were washed three times in tbst for 5 min and color development was carried out with 5-bromo-4-chloro-3-indolyl - phosphate (bcip) and nitro blue tetrazolium (nbt) according to the manufacturer's (promega) instructions . Comparison of the effect of non - stimulated and stimulated conditions on smsl flow rate was tested for statistical significance (=0.05) by a two - way repeated - measures analysis of variance (anova; post hoc analysis - fisher's exact test). As expected, the observed flow rate values obtained at rest (t1-t4) were lower than stimulated (t5-t8) conditions in all groups . The mean value for flow rates under non - stimulated conditions was 0.460.18 ml / min for apg, 0.300.20 for cpg and 0.470.31 for cg . Under stimulated conditions, it was 1.790.92 ml / min for apg, 1.470.38 ml / min for cpg and 1.870.99 ml / min for cg . Stimulation significantly raised salivary volumes in all groups (apg - p=0.01; cpg - p=0.03; cg - p=0.01); no significant time effect was observed for non - stimulated or stimulated conditions, and the observed flow rates under both conditions did not differ among groups . Mg2 immunoreactive bands from apg, cpg and cg exhibited a weak immunoreactive signal under non - stimulated conditions whereas upon gustatory stimulation, the intensity of the immunoreactive signal increased (figure 1a). Blots probed with anti - lactoferrin antibodies revealed a difference in banding pattern among groups (figure 1b); individuals from apg and cpg had an increase in expression upon gustatory stimulation, whereas individuals from cg exhibited a decrease . A - representative western blots of mg2 pattern observed in all individuals from each group . B - representative western blots of lactoferrin pattern observed in all individuals from each group . T1t4 (non - stimulated submandibular and sublingual saliva - smsl) and t5t8 (stimulated submandibular and sublingual saliva - smsl). Apg - aggressive periodontitis group; cpg - generalized chronic periodontitis group; cg - control group comparison of expression among groups under non - stimulated conditions revealed that cg exhibited the highest expression of mg2 and lactoferrin (figures 2a and 2b). Apg showed the lowest levels of mg2, and cpg of lactoferrin (figures 2a and 2b). Comparison of expression among groups under stimulated conditions showed that cg exhibited the highest expression of mg2, whereas apg the highest of lactoferrin (figures 2c and 2d). Again, apg showed the lowest levels of mg2, and cpg of lactoferrin (figures 2c and 2d). Comparison of glycoproteins expression under non - stimulated (a, b) or stimulated (c, d) conditions . A - mg2 western blot; b - lactoferrin western blot; c - mg2 western blot; d - lactoferrin western blot; apgaggressive periodontitis group; cpg - generalized chronic periodontitis group; cg - control group as expected, the observed flow rate values obtained at rest (t1-t4) were lower than stimulated (t5-t8) conditions in all groups . The mean value for flow rates under non - stimulated conditions was 0.460.18 ml / min for apg, 0.300.20 for cpg and 0.470.31 for cg . Under stimulated conditions, it was 1.790.92 ml / min for apg, 1.470.38 ml / min for cpg and 1.870.99 ml / min for cg . Stimulation significantly raised salivary volumes in all groups (apg - p=0.01; cpg - p=0.03; cg - p=0.01); no significant time effect was observed for non - stimulated or stimulated conditions, and the observed flow rates under both conditions did not differ among groups . Mg2 immunoreactive bands from apg, cpg and cg exhibited a weak immunoreactive signal under non - stimulated conditions whereas upon gustatory stimulation, the intensity of the immunoreactive signal increased (figure 1a). Blots probed with anti - lactoferrin antibodies revealed a difference in banding pattern among groups (figure 1b); individuals from apg and cpg had an increase in expression upon gustatory stimulation, whereas individuals from cg exhibited a decrease . Pattern of secretion of salivary glycoproteins . A - representative western blots of mg2 pattern observed in all individuals from each group . B - representative western blots of lactoferrin pattern observed in all individuals from each group . T1t4 (non - stimulated submandibular and sublingual saliva - smsl) and t5t8 (stimulated submandibular and sublingual saliva - smsl). Apg - aggressive periodontitis group; cpg - generalized chronic periodontitis group; cg - control group comparison of expression among groups under non - stimulated conditions revealed that cg exhibited the highest expression of mg2 and lactoferrin (figures 2a and 2b). Apg showed the lowest levels of mg2, and cpg of lactoferrin (figures 2a and 2b). Comparison of expression among groups under stimulated conditions showed that cg exhibited the highest expression of mg2, whereas apg the highest of lactoferrin (figures 2c and 2d). Again, apg showed the lowest levels of mg2, and cpg of lactoferrin (figures 2c and 2d). Comparison of glycoproteins expression under non - stimulated (a, b) or stimulated (c, d) conditions . A - mg2 western blot; b - lactoferrin western blot; c - mg2 western blot; d - lactoferrin western blot; apgaggressive periodontitis group; cpg - generalized chronic periodontitis group; cg - control group the infectious nature of the periodontitis is related to specific microbiota as well as to the expression of particular inflammatory markers . Additionally, initiation and progression of periodontal infections is clearly modified by local and systemic conditions (risk factors), such as diabetes mellitus and cigarette smoking, as well as potentially important risk indicators including stress . Salivary proteins are not included in the category of risk indicators, but this concept is being explored . Investigation of salivary proteins in individuals with periodontitis may be useful to enhance the knowledge of their role in this population . Statistical analysis did not reveal flow rate differences among groups, stimulated or non - stimulated . Therefore, we decided to analyze equal volumes (50 l) of smsl by immunoblotting, instead of equal amounts of protein . It has been previously reported that mg2 can agglutinate several pathogens from the oral cavity, and in addition, interact and kill the periodontal pathogen a. actinomycetemcomitans . In a previous study, the concentration of mg2 was determined in stimulated whole saliva of subjects suffering from a. actinomycetemcomitans associated pd . It has been reported that mg2 output in the diseased subjects was decreased at least by a factor three in comparison to periodontally healthy subjects and that this low concentration of mg2 suggested a decline in mucin defense and consequently, a higher susceptibility to oral infections . In the present study, blotting analysis revealed that all groups showed an increase of mg2 expression upon stimulation revealing a similar pattern (figures 1a and 1b). A previous study that analyzed the pattern of secretion of mg2 in samples from individuals without periodontitis reported that pas stained gels did not reveal differences in mg2 secretion patterns upon stimulation . However, western blots indicated that mg2 expression was enhanced after stimulation; a result that is in agreement with the observed pattern in the present study for cg . It was also observed that individuals without periodontitis exhibited the highest expression of this small salivary mucin under specific conditions (figures 2a and 2c). The reduced output of this salivary mucin in individuals with aggressive periodontitis observed on blots (figures 2a and 2c) is similar to the one described . Since in chronic periodontitis the destruction of the periodontal ligament and loss of the adjacent supporting bone usually displays a slow to moderate rate of progression, we hypothesize that the intermediate expression of mg2 observed in individuals belonging to this group (figures 2a and 2c) could in part contribute to decrease the disease progression rate in comparison to aggressive periodontitis . Salivary lactoferrin is a single chain iron - binding glycoprotein that binds ferric ions and possesses antibacterial, antimycotic, antiviral and anti - inflammatory properties . The impact of a surgical periodontal treatment in the concentration of this glycoprotein in non - stimulated and stimulated whole saliva samples from individuals with chronic periodontitis was analyzed previously . It was reported that the concentrations decreased significantly in both non - stimulated and stimulated samples after the surgical treatment, suggesting that lactoferrin may be suitable for monitoring periodontal treatment results . Another study evaluated lactoferrin levels from individuals with localized aggressive periodontitis before and after periodontal therapy . Among other samples, paraffin - stimulated whole saliva was obtained from these individuals and from periodontally healthy controls . Differences between groups and with respect to periodontal therapy were not observed in lactoferrin concentrations in whole saliva . Concentrations and output of lactoferrin were also determined in whole saliva samples from subjects suffering from a. actinomycetemcomitans - associated pd . The output of lactoferrin was not significantly different in healthy and diseased subjects although a higher iron - saturation of lactoferrin in subjects with the disease was described . Lactoferrin expression was examined in whole and parotid saliva from individuals with localized aggressive periodontitis and compared to age-, gender-, and race - matched controls . It was reported that whole saliva from the test group had higher levels of the glycoprotein although the levels of bound iron were significantly reduced, suggesting that lactoferrin from individuals with localized aggressive periodontitis might interfere in the disease progression . In the present study, it was observed that individuals with or without periodontitis exhibited a similar pattern of lactoferrin secretion (figure 1b). Comparison of expression among groups revealed that under non - stimulated conditions individuals without periodontitis (cg) showed the highest expression of lactoferrin (figure 2b) whereas under stimulated conditions individuals with periodontitis (apg and cpg) exhibited a more intense immunoreactive signal (figure 2d). The higher expression of this glycoprotein in individuals with aggressive periodontitis is in agreement with a previous report, but is in contrast to others . The differences in these two studies from the present could be at least in part explained by variations in samples that were analyzed (i.e. Smsl versus whole saliva) since lactoferrin derived from the gingival crevicular fluid will be present in samples from whole saliva . The increase in the amount of lactoferrin in stimulated samples from smsl of individuals with generalized chronic periodontitis (figure 2d) found in the present study is in contrast to another report in which the levels of lactoferrin in samples from non - stimulated whole saliva were higher than in samples of stimulated whole saliva . Again, the differences in this study from the present could also be in part explained by smsl versus whole saliva . Exclusion of individuals that had aggressive or chronic periodontitis and received periodontal treatment during the last year had a direct impact in our sample size, since it was difficult to select individuals that met this specific criterion . Nevertheless, this is the first study that compares the expression of salivary proteins among individuals with aggressive and chronic periodontitis at the same time, and that evaluates the influence of stimulation over time in the expression of mg2 and lactoferrin in individuals with periodontitis . Analysis of these salivary constituents appears to have potential to be used as markers for aggressive or chronic periodontitis, and since both mg2 and lactoferrin possess antimicrobial activity, specific domains could be considered as possible candidates for the development of new drugs that in principle could be of benefit to individuals with periodontitis . The biological plausibility of the differences observed in smsl physiology in our study could be derived by periodontal bacterial components triggering the host - immune response, and causing inflammation and activation of pro - inflammatory mediators . It has been described that these molecules traveling via blood to other organs and tissues might influence a variety of mechanisms . It is important to mention that the observed results show that future studies should purposely collect non - stimulated and/or stimulated saliva samples since protein expression under these circumstances varies . The reduced expression of these glycoproteins observed in apg and cpg particularly under non - stimulated conditions, decrease the oral cavity innate defense mechanisms provided by these salivary components in these individuals . It remains unclear to what extent the reduced output of mg2 and lactoferrin might impact the etiopathogenesis of aggressive and chronic periodontitis . However, the data suggest an active role of these glycoproteins in the innate immune regulation of periodontal bacterial colonization and disease progression. |
Parasitic protozoans of the phylum apicomplexa are the most prevalent and successful pathogens known to humankind . Today, half of the world's population is at risk of malaria caused by four plasmodium species, and more than 50 billion livestock reared for food production suffer from debilitating intestinal diseases caused by many species of eimeria, theileria, and babesia, amongst others . Eimeria is the cause of coccidiosis in chickens, a parasite that infects the intestinal mucosa of the infected bird leading to severe weight loss and even death of the host . Cryptosporidiosis is caused by cryptosporidium species and, like eimeria, is transmitted by accidental ingestion of highly resistant and environmentally stable oocysts that contaminate the food and water . The disease is marked by self - limiting diarrhoea in immunocompetent individuals, but in immunocompromised patients, the disease can be fatal . Babesia is related to the malaria parasite in that it infects the reticulocytes of the infected cow and causes severe pathology and can cause death as well . Toxoplasma is the cause of toxoplasmosis in humans, a disease characterized by mild flu - like symptoms in healthy hosts . However, immunocompromised individuals, such as hiv / aids patients and organ transplant recipients, often suffer from ocular toxoplasmosis or even encephalitis . Theileria, an important cattle parasite transmitted by ticks, is characterized by anaemia and high mortality rate especially in pregnant cows . Plasmodium infects red blood cells and is the cause of malaria in humans as well as in several other vertebrate and bird species . Nearly one million human deaths are attributed to malaria each year, meaning that every 30 seconds a child dies of this disease in africa . This high toll in human and animal life and wellbeing has been further exacerbated by the inappropriate use of antimicrobial compounds over the years . Thus, widespread resistance to most (if not all) drugs used to date makes control of these parasites extremely difficult [3, 4]. The novel artemisinin - based therapies are considered to be the new hope for malaria control and have proved to be successful in interrupting the maturation of the infectious stages (oocysts) in the related parasite, eimeria, thereby reducing or blocking the transmission and spread of the parasite [57]. However, there are fears that overuse of these novel compounds will also facilitate the selection of even more potent strains . Over the past three decades, a number of putative protective antigens from several members of the phylum has attracted a great deal of research and commercial interest in the hope to develop vaccines and alleviate the burden on public health and world economy imposed by this class of parasites [817]. The first antiprotozoan subunit vaccine developed to date, coxabic, which contains antigens isolated from the sexual stages of development of eimeria is a proof of principle for transmission - blocking immunity and an example of a strategy that has been proved successful in helping to tackle one of these important apicomplexan diseases [1821]. Despite the enormous efforts to characterise the apicomplexan immunostimulatory antigens and genes encoding them, the fine cellular and molecular details of the effector mechanisms crucial for parasite inhibition and stimulation of protective immunity are still not fully understood . It is hoped that unravelling the proteomes and genome sequences of these protozoan pathogens will facilitate our understanding of the mechanisms involved in the infectious process and lead to the design of new effective control strategies . Early studies concerning the developmental biology and immunology of the apicomplexans have provided valuable insights into the immune mechanisms responsible for the inhibition of parasite growth and development and in the establishment of host resistance to infection [2327]. Efforts by research laboratories across the globe have demonstrated that, in order to control the infection, both the innate and adaptive arms of the immune system are crucial for resistance and cross - protection . This paper provides an overview of apicomplexan biology and focuses on the protective immune response against the various types of apicomplexan parasites, from eimeria to plasmodium including toxoplasma, cryptosporidium, theileria, and babesia . It also addresses the evolutionary relationship of these parasites and their hosts and the modulation of the host immune response that are critical in determining the outcome of an infection . The apicomplexan life cycle includes both asexual multiplication (schizogony, merogony) and sexual reproduction (gametogony) [25, 29, 30]. While some members of the phylum require an intermediate host and a variety of cell types to complete their developmental life cycle (i.e., plasmodium, babesia, theileria, toxoplasma), others lead a monoxenous life style with the asexual and sexual stages of development restricted to specific tissues of a single host (i.e., eimeria and cryptosporidium species). Thus, the possibility of culturing asexual stages in vitro, as well as the feasibility of isolating relatively large numbers of sexual forms (gametocytes), has granted eimeria species a status of an attractive and a relatively simple model for investigating parasite - host interactions, as well as applying transmission - blocking immunity . Apicomplexan parasites affect all classes of vertebrates, including fish, amphibians, reptiles, birds and mammals . The apparently long coevolutionary history of the apicomplexans means that targeting the metabolic reactions and pathways of the parasite also harms the host, making the identification of therapeutic targets extremely difficult . Recent advancements in molecular biology have shed new light into the coevolutionary history of the apicomplexa and their hosts . This is based on the finding that the branching of the evolutionary tree of at least some of these parasites coincided with the evolution of the vertebrate host . In addition, it was found that several enzymes involved in a variety of metabolic pathways are highly conserved between the parasite and its host . Furthermore, comparative studies of whole genome nucleotide sequences in several members of the phylum have revealed that surface proteins, unlike the house - keeping proteins and enzymes, have evolved rapidly over the past 500 million years due to functional and immune selective pressure . This is especially evident in the molecules comprising the apical complex, the invasion machinery mediating physical recognition, cytoadherence, and penetration of the host, which are parasite specific . The successful invasion of the host cell by the apicomplexan parasite is dependent upon the sequential secretion of proteins and other molecules from the rhoptries, micronemes, and dense granules and results in the formation of the parasitophorous vacuole (pv) (i.e., toxoplasma, cryptosporidium, plasmodium, and eimeria spp . ). This in turn provides access to intracellular nutrients and protection from the host's immune system . Although the pv shields the parasite from the host defences, at the same time it restricts access to nutrients in the host's cytoplasm . Thus, the apicomplexa has adopted different tactics to circumvent this problem, including biochemical modification of the pv making it permeable to essential nutrients . In contrast, some parasites, such as theileria spp ., do not form the pv and proliferate freely in the cytoplasm with direct access to host nutrients . Lateral gene transfer, best known for its role in antibiotic resistance in bacteria, has been proposed as a mechanism by which these opportunistic organisms acquire new genes that confer parasite fitness [3638]. For example, the apical complex, actin - myosin - powered motor, evolved as a result of the nuclear transfer of genes acquired during the secondary endosymbiotic event . It is believed that origin of the apicoplast can be attributed to endosymbiotic partnership in which the plastid - containing eukaryote was engulfed by a second eukaryotic cell . In addition, sexual replication appears to be another contributing factor to the diverse functions of the apicomplexan surface proteins and the adaptations to genera - specific niches [3941]. Therefore, it is not surprising that plasmodium and babesia species share evolutionarily conserved mechanisms of erythrocyte invasion . Moreover, transmembrane proteins (thrombospondin - related anonymous proteins trap) bridging the apical complex to the host cell in plasmodium, eimeria, and toxoplasma also share a high degree of homology [34, 4244], suggesting that apicomplexa use the same molecular machinery to invade a wide variety of cells . A great deal of research has also been carried out to study the role of surface antigens in parasite growth, development, and survival . Passive transfer of polyclonal and monoclonal antibodies raised to asexual stage surface antigens of t. gondii are capable of conferring resistance against lethal challenge with this parasite [45, 46]. Similarly, eimeria and plasmodium antisporozoite and antimerozoite antibodies that recognize surface antigens, namely, glycosyl - phosphatidylinositol- (gpi-) anchored antigens in e. tenella (etsag1) and p. falciparum (msp1), respectively, are able to induce a strong inhibitory response and provide protection against infection [47, 48]. In addition, the antigens found on the surface of sporozoites have been implicated in the recognition and invasion of the hepatocytes in malaria and, therefore, represent promising targets for vaccine developers [10, 42, 49, 50] (a detailed description of apicomplexan invasion and egress has been reviewed recently by westwood and colleagues with a special emphasis on elements of the apical complex and their potential role as vaccine targets). Thus, both asexual - stage surface proteins and the molecules associated with the apical complex have been proposed as potential candidates for vaccine development . Another conserved feature of the phylum is the transmissible, environmentally durable oocyst / cyst, the zygote stage of the coccidia (i.e., toxoplasma, eimeria, cryptosporidium, and neospora species) [29, 52]. It is intriguing that asexual reproduction in eimeria is tightly regulated, and although signals initiating the start of sexual reproduction have not yet been identified, the 2nd, 3rd, and 4th generation merozoites (depending upon which eimeria species infects the host chicken) differentiate into male (micro-) and female (macro-) gametes in a synchronised manner . The trademark of apicomplexan gametogenesis is the synthesis of numerous lipid bodies and polysaccharide granules, believed to be acquired from the host cell, serving as an energy source for the developing zygote . Moreover, increased dna synthesis and rna transcription to produce multinucleated microgametocytes and heightened protein synthesis in the macrogametocytes to produce wall forming bodies (wfbs) are characteristics of sexual stage development at the molecular level [5356]. Gametogenesis is completed by the formation of environmentally resilient oocysts in the mucosae lining the gastrointestinal tract of chickens, humans, and cats, respectively . The oocysts are then excreted with the faeces where they mature (sporulate) becoming infectious . Cryptosporidium is slightly different from eimeria and toxoplasma in that the cryptosporidium oocysts can also release sporozoites in the gut which are capable of infecting new epithelial cells (i.e., autoreinfection). In all three cases, transmission is primarily by the accidental ingestion of sporulated oocysts . Unlike the intestinal parasites described above, gametogenesis of plasmodium and babesia spp . Is completed in the gut of their arthropod hosts . During development, after fertilization of macrogametes by the microgametes and invasion of the gut by the ookinete, the zygotes encase themselves in a protective single - layered cyst wall to form an oocyst . Sporozoites then exit the oocyst and migrate from the midgut to the salivary gland of their arthropod host . From there, they are injected into the blood and subcutaneous tissue of the next vertebrate host the arthropod bites . Studies to elucidate the mechanism(s) of the protective immune response to apicomplexan parasites have been limited mainly due to the lack of being able to carry out such studies in the definitive host such as cattle or human beings . Thus, much of our understanding of the protective immune response to apicomplexan infections has been derived from murine models which can be genetically modified [26, 57]. Generally speaking, parasite replication in the host eventually leads to host cell lysis and parasite egress . It is now widely accepted that cells of the innate immune system and the molecules they produce and/or secrete are important controlling factors of parasite infectivity and in limiting the extent of parasitemia [5861]. It is not clear exactly how these molecules, particularly in the case of parasites infecting host erythrocytes (i.e., plasmodium and babesia spp . ), interfere with parasite development . What does appear to be the case is that this inhibition is accomplished by the production of gamma interferon (ifn-),by natural killer cells (nk), and tumour necrosis factor alpha (tnf-), nitric oxide (no) and reactive oxygen species (ros) by macrophages [6264]. Despite the fact that the mechanisms by which ifn- mediates protection are not completely understood, studies using ifn- and inos knock - out mice infected with t. gondii indicated that activation of p47 guanosine triphosphatases (gtpases) leads to degradation of the pv in infected cells . While the immune response in healthy hosts is often but not always able to control parasite replication and limit the disease, immunocompromised individuals fail to stop parasite growth, and clinical disease develops in nearly all cases . This is especially evident in toxoplasmosis where immunocompetent hosts control parasite replication causing tachyzoites (the rapidly replicating asexual stages) to migrate to muscle and brain tissues where they differentiate into bradyzoite cysts (the slow - replicating form) and persist throughout the host's life . Although the tissue cysts can become reactivated periodically, most healthy hosts never develop clinical disease . In contrast, immunocompromised patients, such as those suffering from aids, remain chronically infected, whereby reactivation of the tissue cysts can lead to toxoplasmic encephalitis with severe pathological consequences . The ability to clear acute and chronic infections with the apicomplexa seems to correlate with host cd4 + t - cell levels [62, 66, 67]. Thus, studies involving athymic animals have shown that t cells play a crucial role in the infectious process [62, 68]. The population of t cells coexpressing markers appears to be important for host defence against apicomplexan infections [69, 70]. Thus, it was demonstrated that tcr-deficient mice developed severe disease when compared to controls . Furthermore, mice lacking major histocompatibility complex class ii expression (i.e., cd4 + t - cell deficient) appeared more susceptible to apicomplexan infections [62, 67]. Cd8 + t cells also appear to play a role in parasite growth and dissemination because they provide sporozoite transport from their initial infection site, as is the case for eimeria and toxoplasma infections [69, 71]. During the course of primary infection with eimeria, cd8 + t cells appear to play a role in parasite growth and dissemination because they provide sporozoite transport from their initial infection site to the crypt cells . On the other hand, reports have also shown that increased numbers of cd8 + t cells in the crypt epithelium act as cytotoxic killer cells facilitating the clearance of the parasite - infected cells [72, 73]. Furthermore, studies in infected chickens have shown that the contribution of both cd4 + and cd8 + t - cell populations differs according to the infective species used . Nevertheless, during avian coccidiosis and babesiosis, cd4 + t - cell subsets were found to be elevated in animals following challenge infections [67, 70, 72]. An intriguing question arises from all of these observations: why are some species or strains of parasites extremely immunogenic and induce protective immunity, while others seem to be invisible to the immune system? Studies on naturally acquired immunity to malaria have shown that adequate protective immunity to p. falciparum, the etiological agent of the most severe malaria in humans, usually required repeated infections . Thus, protection against this particular strain appeared to be acquired more slowly than against the less pathogenic p. vivax or p. malariae . Moreover, numerous studies have shown that immunity appeared to be species specific and did not confer protection against challenge with heterologous species . However, it was reported that heavy exposure to parasites induces the development of antigenic memory . Although the molecular and cellular mechanisms driving the onset of protective host immunity against malaria or any other pathogenic protozoan are not entirely understood, it is believed that susceptibility to infection is driven by extrinsic factors such as antigenic variation and also by intrinsically inappropriate immune responses . This is particularly evident in theileria infections of immunocompromised cattle, which often results in the death of the host animal . It is theorised that the ability of theileria to interfere with the host's apoptotic pathways is the crucial factor contributing to mortality [35, 76]. Once inside the host cell, theileria resides free in the cytoplasm and induces uncontrolled proliferation of the infected cell . Thus, it appears that during theileria infection the immune system fails to control this proliferation in time, in turn resulting in potent, nonspecific lysis of both infected and noninfected cells . Studies using immunocompetent animals have shown that, in addition to innate host resistance, ifn- plays a key role in the development of adaptive immunity and clearing of apicomplexa infections . For example, cryptosporidium - infected mice, with faulty ifn- gene expression, suffered from severe mucosal destruction, and as a result they also secreted more oocysts [60, 77]. Furthermore, mopping - up the secreted ifn- by antibodies in immunocompromised animals seemed to worsen c. parvum infection . In addition, it is now widely accepted that il-12, known to increase host ifn- production, can reduce the severity and even prevent infection by apicomplexan parasites . Although believed to be mediated by an ifn--dependent mechanism, the pathways or downstream molecules crucial in this process have not been well defined to date . Although viruses, which entirely depend on the host machinery for replication and assembly of new viral particles, are the experts in host cell manipulation, the apicomplexa are considered to be the masters of disguise . This is because they have evolved to evade the host immune system to aid in their own survival . Antigenic variation has been proposed as a key factor in this process . Unlike allelic polymorphism, which results in different phenotypes or so - called parasite strains, antigenic variation is the tightly regulated expression of different genes of a clonal population of parasites over the natural course of infection . Antigenic variation amongst malarial and babesia parasites is a prime example of sophistication apicomplexans employed to avoid antibody - mediated inhibition [7981]. P. falciparum achieves this by secreting a single type of a variant molecule (parasite - derived erythrocyte membrane protein 1 - pfemp1) on the surface of the infected erythrocyte at any one time . The pfemp1 surface proteins are encoded by a family of genes, called var genes, and each individual parasite expresses only a single var gene, keeping all other members of var gene family in a transcriptionally silent state [8284]. This strategy in turn induces adhesion of the parasite - infected erythrocytes to the blood vessels to avoid reaching the spleen, whose main function is to rid the body of damaged and/or infected blood cells . Similarly, sequestration of babesia - infected erythrocytes in the microvasculature enables the babesia to persist within the host maximizing its chances of transmission . This cytoadherence in babesia is mediated by constant gene conversion of ves family genes encoding the variant erythrocyte surface antigen 1 (vesa1). A puzzling question arises from these observations: if infected erythrocytes pass through the body unchecked since they lack major histocompatibility complex (mhc) expression, overwhelming proliferation of the parasites may cause premature death of the host prior to successful transmission to an arthropod vector? Interestingly, in spite of the fact that malaria parasites sequentially express variant surface molecules exposing the immunodominant antigens to the host immune defences, infection is actually prolonged . Thus, the parasite must undergo antigenic variation and rates of growth that enable the host to control infection while allowing for transmission of the parasite prior to its death . Due to coating of the merozoite surface with glycosyl - phosphatidyl - anchored proteins crucial for initial attachment to the host erythrocyte surface, they are targeted by host - protective antibodies . These surface - anchored proteins (variable merozoite surface antigens - vmsa) exhibit varying degrees of intra - species antigenic polymorphisms allowing these parasites to evade the host immune system at the population level . Nevertheless, studies involving african children have shown that variant specific immunity, namely, secretion of igg antibodies directed against p. falciparum variant surface antigens (vsa), has been correlated with protection from clinical malaria in ghana, kenya, and tanzania [79, 87, 88]. Thus, vsa antigens have been proposed as excellent candidates for malaria and babesia vaccine development . Although b cells have been regarded as minor contributors to protective immunity and resistance to primary infections with apicomplexa, numerous studies have shown that hosts infected with these parasites are capable of producing protective, parasite - specific immunoglobulins (ig) of all major classes after an episode of infection and recovery [57, 8992]. Thus, early work by rose and colleagues has shown that humoral antibodies, induced by live eimeria infection, can provide excellent passive protection against challenge infections with the same parasite [93, 94]. Likewise, studies on mice infected with t. gondii have shown that intestinal iga antibodies to major surface protein sag-1 (p30) were produced after peroral infection and found to inhibit infection of murine enterocytes by directly blocking the parasite entry . In addition, precigout et al . Have demonstrated an inhibitory effect of antibodies directed against a 17-kda merozoites membrane protein on b. divergens parasite growth . Furthermore, studies on invasion of red blood cells by p. falciparum merozoites have revealed that since rbcs do not express the mhc complex, parasite killing by t lymphocytes is not important . Instead, antibodies specific to merozoite surface molecules (msp-1) and proteins externalised from the apical complex play a major role in immunity to asexual blood stages . The plasmodium merozoite surface protein 1 (msp-1) is a 200 kda multicomponent precursor complex derived by proteolytic processing during erythrocyte invasion . The 42 kda c - terminal component is cleaved (i.e., secondary processing) to produce soluble 33 kda and 19 kda fragments that remain on the merozoites surface . Studies have shown that anti - merozoite antibodies are capable of neutralizing parasites by fc - dependent mechanisms involving macrophages, thus reducing the parasitemia and clinical disease [87, 97, 98]. In addition, a number of recent studies have shown that children naturally infected with malaria secrete anti - msp-1 antibodies (msp-119 mab) that block the binding of plasmodium merozoites to the surface of the red blood cells and also inhibit secondary processing of msp-1 . In addition, studies investigating the protective properties of maternally derived igg and igm antibodies to the 19 kda domain of msp-1 of p. falciparum have shown that mothers who have tested positive for anti - msp-1 (19 kda fragment) igg antibodies conferred protection against placental infection and infection in their infants . It has been shown that, in babesiosis infection, igg antibodies produced as a result of live infection can prevent infection of erythrocytes by binding and neutralizing sporozoites before they invade their target cells . Similar observations were reported in chickens where antisporozoite antibodies specific to glycosyl - phosphatidylinositol - anchored e. tenella surface antigen 1 (etsag1) appeared to inhibit parasite binding and invasion of the host cell . However, it seems that the protective role of these antibodies is limited since it can only neutralize sporozoites from the time the parasites egress and the time they gain access to new cells . Thus, it is hoped that genome - wide fingerprinting techniques will aid in the identification of additional immunoprotective antigens that can be used in combination to induce the maximal inhibitory humoral immune response . In addition to antigen - specific polyclonal and monoclonal antibodies capable of inhibiting asexual stages, antibodies raised to antigens localized exclusively to gametocyte / zygote stages were also found to be highly immunogenic and capable of providing passive protection in vivo [20, 101, 102]. Early experiments involving immunisation with purified sexual - stage gametes of p. gallinaceum in chickens showed that effective transmission - blocking immunity can be achieved by reducing the infectivity of gametocytes and oocyst development [103, 104]. Thus, pfs25 and pvs25 proteins expressed on the surface of ookinetes in the mosquito stage of p. falciparum and p. vivax have been used extensively as candidates for malaria transmission - blocking vaccines, since lowering the density of circulating parasites would not produce sterilizing immunity, instead it would allow individuals to develop long - lasting, naturally acquired immunity to malaria [12, 105, 106]. Work by wallach and coworkers, aimed at applying transmission - blocking immunity to control infections caused by eimeria, hypothesised that antibodies raised against the gametocyte / zygote stages of development can act to inhibit oocyst development and thereby provide a block in parasite transmission (see figure 1). A method was developed for purifying e. maxima gametocytes from the infected chicken gut mucosa and immunodominant gametocyte antigens, namely, emgam56, emgam82, and emgam230 localized to the wfbs and the oocyst wall of the maturing zygote, were extracted [53, 102, 108]. Passive immunisation experiments showed that there was a good correlation between the intensity of igg and igm antibodies binding to gametocyte antigens by western and elisa with the ability of those sera to provide passive protection in vivo . The mechanisms by which these antibodies inhibit oocyst maturation are still obscure; however, it is hypothesised that antibodies raised to the immunodominant antigens retard zygote development by interfering with the processing of wall proteins or the wall - hardening processes [53, 110]. In addition, a protective monoclonal antibody raised against emgam56 localised to the wfb2 (1e11 - 11), as well as the inner layer of the oocyst wall, was also found to react strongly with the stieda body of the sporulated oocysts (m. wallach, unpublished data). Similar results were reported by krcken et al . Using a monoclonal antibody e2e5 raised to wfb2s of e. tenella . The in vitro excystation inhibition assay showed that the antibody e2e5 can significantly interfere with parasite development by impairing sporozoite excystation . It is tempting to speculate that the 1e11 - 11 monoclonal antibody inhibits or blocks excystation of the sporocyst in a similar manner, thereby reducing the number of infectious sporozoites released in the intestine of infected birds allowing them to develop protective immunity induced by exposure to low doses of parasites . Jenkins and colleagues have shown that ruminants immunized with a dna vaccine expressing a gene isolated from c. parvum encoding a sporozoite antigen (cp 15/60) were capable of inducing antigen - specific antibodies [111, 112]. In that study, it was found that using various routes of vaccination resulted in differing antibody responses and titres . The authors, therefore, suggested that the route of antigen delivery of any protozoan vaccine requires careful formulation and optimisation of delivery systems . Finally, in studies carried out by wallach and co - workers on eimeria, it was found that in order to achieve protective immunity using parasite extracts requires the inclusion of the correct antigens and exclusion of the irrelevant ones . Their results indicated that while some parasite - specific antigens induce protective immunity, others actually induce an exacerbation of the infection . Therefore, in the design of any parasitic vaccine, it is crucial that the combination of various antigens maximizes their inhibitory effect on parasite growth and development . One of the main defence mechanisms employed by host cells is programmed cell death (apoptosis) ensuring regulated removal of damaged and infected cells . But because the survival and development of intracellular apicomplexan parasites is dependent upon the continuous supply of host cell nutrients and protection from immune attack, the parasites have adapted to extend the life of the infected cells by inhibiting the host cell apoptotic machinery through interference with the intracellular signalling molecules, notably phosphatidylinositol 3-kinase (pi3-k). Pi3-k is involved in a variety of functions including cell growth, proliferation, and intracellular trafficking, amongst others [61, 114117]. P. falciparum is a good example of how parasite secreted proteins prevent host cell death to ensure its own development and survival . Sporozoites of plasmodium species are stealthy invaders that first travel to the liver (hepatocyte) cells, where the growth and development of the daughter cells, hepatic merozoites, takes place . Recent results have shown that prior to the establishment of the pv, sporozoites of p. falciparum transmigrate through a number of hepatocytes before they anchor to and invade the suitable cell via exocytosis of proteins contained within the apical complex . It has been shown that the thrombospondin - related adhesive - protein- (trap-) like protein plays a role in this process . Additionally, the wounding of the hepatocyte induced by invading sporozoites releases growth factors which in turn appear to inhibit pi3-k and block the signalling pathways destined for apoptosis . Leirio and colleagues have shown that once the parasite is established in the hepatocyte, it secretes hgf / met signalling molecules into the host cell cytoplasm, thereby conferring resistance to apoptosis to ensure survival and maturation of the daughter cells . However, which signalling upstream of pi3-k occurs during plasmodium infection is yet to be determined . Interestingly, upon maturation of merozoites, plasmodium seems to be able to induce host cell death to liberate the motile progeny . Have shown that this process involves cysteine proteases [49, 50]. Moreover, similar mechanisms were found to play a role in release of sporozoites from the oocysts . Although work is ongoing to try and elucidate the mechanisms involved in these processes, it appears that the apicomplexa have learned to inhibit host cell death during parasite development and subsequently activate it, liberating thousands of new progeny . T. gondii has also evolved a broad spectrum of adaptations to challenges presented by its life style . Chronic toxoplasmosis is the trademark of the parasite's success and is induced by the slow - replicating bradyzoites safely tucked away in the remodelled pv, the tissue cyst . Like plasmodium, t. gondii modulates host cell apoptosis by both inhibiting and triggering the programmed cell death . Chen et al . Have shown that fas / fasl ligand - dependent mechanisms mediate the inflammatory responses induced by the apicomplexan infection [115, 121]. But the parasites have evolved to neutralize granzyme / perforin - mediated killing of infected t cells and natural killer cells (nk) by modifying transcription and posttranscriptional modification of ifn--regulated genes, the major mediators of resistance to t. gondii infections . Likewise, del cacho et al . Have demonstrated that e. tenella and e. necatrix second - generation schizonts first induce nf- activation to protect the transformed cells from apoptosis, allowing the schizonts to mature and later cause nf- inhibition to trigger host cell apoptosis to facilitate the release of merozoites . The apicomplexa have evolved to live in synergy with their infected hosts because they completely depend on it for survival; however, some apicomplexan infections induce a great deal of immunopathology and can lead to host cell death . For example, eimeria and cyclospora both interfere with the absorption of nutrients across the intestinal mucosa and can cause death due to malaise, diarrhoea, and dehydration . Because apicomplexans increase in numbers while, in their hosts, the severity of infection is proportional to the parasite density the smaller the number, the greater the chance of asymptomatic infection and the greater the chances of the parasite survival . However, the immunological defence of a host can also cause extensive tissue damage and clinical symptoms . Patients with cerebral malaria usually have elevated levels of tumour necrosis factor alpha (tnf-) and ige considered to be responsible for fever and tissue lesions to an extent where vital functions of the host fail leading to a coma . Despite a great deal of effort and technological advancements in biotechnology, molecular biology, genetics, immunology, and vaccinology, there are no vaccines for humans against malaria and toxoplasmosis at the present time, and it seems that we are losing the battle in the fight against pathogenic protozoans . The current failure to develop a practical vaccine may well be attributed to our inadequate understanding of the mechanisms underlying (1) the naturally acquired immunity against apicomplexans, (2) acquired parasite resistance to most (if not all) antimicrobial compounds used to date, and (3) in the case of arthropod transmitted protozoans, failure to implement adequate vector control programs in tropical and subtropical regions . The life cycles of the apicomplexa are complex, thus, it is hoped that a multivalent, multistage vaccine will alleviate the problems caused by these pathogenic protozoans . Although this approach has attracted a great deal of commercial and research interest, the critical issues to be addressed include the identification of stage - specific antigens capable of inducing protective immunity and the delivery methods in a form that will stimulate an adequate protective immune response . The main impediment in the search and selection for immunostimulatory antigens is the lack of in vitro assays to analyse and predict immune responses . The transmission blocking assays, relying on counting the number of oocysts produced, and the inhibition of sporozoite invasion assays have both been used extensively to evaluate parasite inhibition induced by neutralizing antibodies . Although in vivo experimentation is extremely difficult for malaria, other model systems can be used to dissect the fine details and the effect of neutralizing antibodies . It is very possible that, in the development of an antiprotozoan vaccine capable of inducing only partial immunity, resistant mutants would be selected that are even more pathogenic than existing strains . In the malaria scenario, this could be catastrophic since the parasite would undergo recycling and be transmitted throughout the community leading to an increase in morbidity and mortality . It is, therefore, of great hope that in the battle against these pathogenic protozoan parasites, including plasmodium, cryptosporidium, and toxoplasma, the completion of their genomes and proteomes may provide information needed to design vaccines, assess the effects of immunization on parasite pathogenicity and the selection of unwanted mutants, and in the final analysis control the diseases caused by this class of parasites. |
Giant cell tumour is the commonest benign bone tumour arising at the epiphyseometaphyseal regions of long bones . Around the knee there are very few similar cases reported worldwide and it is the purpose of this report to describe the management of such a case . A 17 year old girl presented with swelling of ankle and pain while walking for six months . Radiographs were suggestive of a giant cell tumour, computerised tomography revealed cortical break, en block resection was done with ipsilateral proximal fibula used in reconstruction of ankle mortise . Giant cell tumour of long bones are common but those involving the distal fibula are exceedingly rare . The management of such tumours with high recurrence rates can be easily accomplished by en block resection and reconstruction of the ankle mortise with proximal fibula ensuring good range of motion of the joint post operatively . First described by sir astley cooper in the year 1818, giant cell tumour of bone or osteoclastoma is the commonest benign bone tumour encountered by an orthopaedic surgeon . It is characterised radiographically as a lytic lesion occurring in the ends of bones and has well known propensity for local recurrence after surgical management . Current treatment modalities including a meticulous curettage with extension of tumour removal using high speed burrs and adjuvant local therapy has significantly lowered the recurrence rates to less than 10% from 60% in the past with curettage alone . The commonest age is the 3rd or the 4th decade with a slight female predominance . The other less common infrequent sites are sacrum, distal tibia, proximal humerus, proximal femur and proximal fibula . Involvement of distal fibula by benign aggressive and malignant tumors usually necessitates resection of the involved segment of fibula . The incidence of giant cell tumour of distal fibula was found to be less than 1% of 1182 cases . Schajowicz, in his series of 362 cases has reported only a single case affecting the lower end of the fibula (0.28%). A seventeen year old girl presented with swelling around the right ankle for six months associated with pain while walking and restriction on squatting . The swelling was six by four by two centimetres in size, firm to hard in consistency, no tenderness on deep palpation . [fig 1] clinical picture showing swelling and radiographs showing expansile lesion with soap bubble appearance . Anteroposterior and lateral radiographs were taken which showed single epiphyseal expansile lesion with soap bubble appearance . Magnetic resonance imaging could not be done as the facility was not available then in our government hospital and patient s financial background prevented us getting an imaging from private centres . All routine haematological investigations were found to be normal and chest radiograph was also found to be normal . An excisional biopsy was planned with reconstruction using the proximal end of the ipsilateral fibula . Under pneumatic tourniquet without exsanguination an en bloc excision of the lateral malleolus with lower third of the fibula the level of resection of distal fibula was determined by the computerised tomography, clinical intra operative findings and by pre operative radiographs . The proximal fibula was reversed with head of fibula incorporating into the ankle mortise and fixed to the remaining fibula using plate and screws . Meticulous haemostasis was achieved after release of the tourniquet, and the wounds were closed in layers . Patient kept non weight bearing for three months and full weight bearing at six months after the removal of screws . Patient was followed up and at the end of one year patient had full range of motions with mild restriction of dorsiflexion of the affected ankle [figs 3]. B- fixation of the reversed proximal end of fibula and incorporation into the ankle mortise . D - photomicrograph of the specimen showing multinucleate giant cells suggestive of giant cell tumor six month follow up showing good radiological union (a) and clinical photograph showing good dorsiflexion and plantar flexion (b, c). The proximal fibula can be sacrificed for the purposes of reconstruction as is recommended for lower end fibula and distal radius . Giant cell tumour of the bone has an unpredictable behaviour, not always related to radiographic or histological appearance . Many earlier studies had shown very high local recurrence rates after curettage and bone grafting . The use of modern imaging techniques and extended curettage through the use of power burrs and local adjuvants have improved outcome with reduced recurrence rates . Phenol, liquid nitrogen, bone cement, hydrogen peroxide, zinc chloride and more recently, argon beam cauterization have been employed as local adjuvants . Chemical or physical agents work by inducing an additional circumferential area of necrosis to extend the curettage . In distal fibular resection without reconstruction, soft - tissue reinforcement, even when it is possible, cannot fully compensate for the loss of stability . Resection of the lateral ankle can cause a varus instability or a collapse into valgus . This technique of ankle resection and reconstruction has provided good oncological and functional results and recommended in young active patients requiring resection of distal fibula . Giant cell tumour of long bones are common but those involving the distal fibula are exceedingly rare . The management of such tumours with high recurrence rates can be easily accomplished by en block resection and reconstruction of the ankle mortise with proximal fibula ensuring good range of motion of the joint post operatively . Resection arthrodesis which was the method primarily employed for bone tumours involving ankle can now be replaced with ankle reconstruction . Distal fibula gct being an extremely rare entity and its management not been described, reconstruction of ankle with proximal giant cell tumour of distal fibula are extremely rare and such benign tumours with high recurrence rates with the evidence of medial cortical break should be managed by an en block resection and reconstruction of the ankle mortise and the preferable method would be by the usage of proximal fibula graft . This method produced no recurrence and ensured good range of motions and can effectively replace resection arthrodesis as management in cases which require resection of lateral malleolus. |
Diagnostic hysteroscopy for direct assessment of the uterine cavity has been a relatively recent acquisition in the armamentarium of the gynecologists . In an outpatient setting, the entire evaluatory workup takes at least two to three visits prior to arriving at a definitive diagnosis and commencement of appropriate therapy . In the current scenario of increasing cost awareness and an ever - increasing litigious environment, a balance has to be achieved between the practice of blanket medicine aiming at performance of all investigations possibly contributing to a diagnosis versus a condition appropriate approach . The study presented was undertaken to evaluate the sensitivity and specificity of embx and transvaginal ultrasound tvs for detection of intracavitary uterine lesions compared with results of office hysteroscopy (oh), which were taken as the gold standard . A secondary objective of the study was to evaluate the protocol for assessment of the common problem of aub . Appropriate management could thus be instituted at the earliest possible opportunity, minimizing the number of unnecessary investigations as well as the numerical patient visits to the clinic, without compromising the quality of patient care . Prospective observational study conducted at the department of gynecology at massachusetts general hospital (mgh) between january, 1995, and september, 1996 . Patients attending the gynecology department at mgh with complaints of abnormal uterine bleeding were evaluated for inclusion in the study . The catchment population was from the resident managed gynecology clinic and from practices of two attending physicians with a special interest in reproductive endocrinology . Aub was defined as either cyclic excessive bleeding, irregular menstrual cycles, postmenopausal bleeding, and excessive or unscheduled withdrawal bleeding on hormone replacement therapy (hrt). Each patient presenting underwent a preliminary assessment by history and clinical examination; pap smear status was evaluated and updated if indicated . The uterine size was assessed clinically and determined as normal or enlarged . The study protocol aimed at obtaining an outpatient endometrial biopsy (embx) usually at the initial presentation, followed by a transvaginal pelvic ultrasound (tvs). Other than oh, the other investigations were performed without consideration of the phase of the menstrual cycle; oh was scheduled in the early proliferative phase of the menstrual cycle in patients complaining of regular aub . Aseptic precautions were employed by cleansing the cervix with betadine prior to insertion of the catheter . Antibiotic prophylaxis was given if indicated, using doxycycline 100 mg bid for 5 days . The tvs was performed in an office setting by one of the two attendings in gynecology . The uterine anatomy and the adnexae were visualized using a 7.5 mhz vaginal probe transducer (general electric, milwaukee, rt 3200 advantage ii real time sector scanner). Appearance of the endometrial stripe was commented upon as either normal or abnormal; a specific note was made of any focal lesion seen in terms of impression of an endometrial polyp, submucous fibroid, intramural fibroid, suspicion of hyperplasia or endometrial carcinoma . The contour of the endometrial stripe was assessed in the midline sagittal plane and the point of maximum thickness of the stripe (et) was measured on a frozen image at 1.5 magnification . Office hysteroscopy (oh) was performed using a 3.6 mm single channel flexible hysteroscope (hyf - p olympus america, ny) with a fiberoptic cold light source; normal saline was used as the distending medium and the procedure was performed under direct video monitoring . A total of 54 patients completed the study and underwent embx, tvs and oh . In none of the oh procedures was cervical dilatation required, nor was any form of local anesthetic used . Baseline laboratory investigations included a complete blood count, results for which were available for 47 patients . The results of oh were taken as the gold standard for detection of intracavitary pathology as a contributing factor to the clinical presentation . Sensitivity and specificity of the embx and tvs in detecting the intracavitary lesions were calculated . The sensitivity of clinical finding of an enlarged uterus and the pattern of bleeding in predicting an intracavitary lesion were also estimated, as was the association of significant anemia (hb <11 gm%) and the incidence of concomitant intrauterine lesions . An age - related prevalence of intracavitary lesions (submucous fibroids / polyps / endometrial hyperplasia / chronic endometritis / endometrial cancer) was calculated in the study population . Statistical analysis was performed using unpaired t tests using the statistical package graphpad in stat version 1.01 . Thirteen patients were postmenopausal . Fifty - two percent of the patients presenting with abnormal uterine bleeding had evidence of an intracavitary lesion as detected by office hysteroscopy . Congenital uterine anomalies detected incidentally on oh included one case each of a unicornuate, and bicornuate and two cases of septate uterus . (tvs) performed detected a distortion of the endometrial cavity suggestive of a focal pathology in 20 patients . A subsequent oh confirmed the diagnosis in 17/20 cases where a focal lesion was suspected (table 1). However, of the 34 patients in whom tvs showed a normal endometrium, oh confirmed 11 false negative cases . The sensitivity of an abnormal transvaginal ultrasound scan when compared to office hysteroscopy for detection of an intracavitary lesion was thus calculated as 0.60 . Of the 11 false negative tvs results, oh demonstrated five cases of endometrial polyp and six submucous myomas; in 5/6 of the latter there was of the 54 patients who underwent tvs, a specific mention of the thickness of the endometrial stripe was available in 28, the thickness of the endometrium (et) ranging from 1.8 mm to 25 mm . When correlating the thickness in mm with the presence of intracavitary lesions confirmed by oh, it was noted that the et 6 mm had a negative predictive value of 92%; et of 10 mm had a positive predictive value of 89% . Detection of intracavitary uterine lesions: comparison of results of office hysteroscopy to transvaginal ultrasound . Tvs: transvaginal ultrasound the highest prevalence of intracavitary lesions was seen in the age group of 36 - 40 years (71%); in the <30 years age group, the incidence was 50%, the difference in the prevalence between the different ages not being of statistical significance (table 2). Submucous myomas were the most common lesions seen in the younger patients; an increasing incidence of endometrial polyps was seen with increasing age, polyps being the most frequently diagnosed pathology in the postmenopausal women, as shown in earlier studies . Age related prevalence of intracavitary lesions determined by oh . The endometrial biopsy (embx) specimens were considered adequate for reporting in 49/54 cases; two samples had inadequate tissue and three specimens showed menstrual blood, making interpretation difficult . No evidence of pathology was seen in 44/49 specimens . Of the patients with a normal embx, 19 were true negative and 25 were false negative, when compared to results of oh (table 3). The negative predictive value of a normal embx was calculated as 51% . In 5/49 biopsy specimens, a pathology was detected and included fragments of endometrial polyp in two cases; office hysteroscopy confirmed the presence of a residual polyp in one of these patients . There was evidence of chronic endometritis in one patient, in whom an endometrial polyp was detected on hysteroscopy, and focal hyperplasia within a secretory endometrium was shown in the fourth patient, who had a normal appearing endometrial cavity on oh . The sensitivity of endometrial biopsy was 0.04 with a specificity of 0.83 . No pathological evidence of endometrial carcinoma was detected in the embx specimens available, which included 14 specimens from postmenopausal patients . The incidence of inconclusive sampling was 9% and that of focal endometrial hyperplasia was 2% . Detection of intracavitary uterine lesions: comparison of results of office hysteroscopy to endometrial biopsy . Difference between a and b is statistically significant p<0.05 of the 13 postmenopausal patients, the age range was 47 - 74 years; seven patients were on some form of hrt for a period of at least three months prior to the presentation . The prevalence of intracavitary lesions in the post - menopausal group was 31% (4/13); two of the lesions were confirmed to be benign endometrial polyps on histology and the third was a submucous myoma; in the fourth patient the biopsy of an irregular focal area of the endometrium provided a benign proliferative histological specimen . Results of tvs specifically noted endometrial thickness in 10 postmenopausal patients, the thickness ranging from 1.8 mm -15 mm . In 7/10 patients, the et was <6 mm and 6/7 had a normal uterine cavity of oh; the seventh patient, a 72-year - old woman, was noted to have an area of endometrial irregularity on the anterior uterine wall and a directed biopsy performed showed histological evidence of proliferative endometrium with no evidence of malignancy . Of the three postmenopausal patients in whom a tvs showed an endometrial thickness of greater than 6 mm, all were found to have an endometrial polyp on oh . Thus taking the et of 6 mm as the cut - off in the postmenopausal women, the positive predictive value for detection of intracavitary lesions for et> 6 mm was deter - mined to be 100%, whereas the negative predictive value for an et of <6 mm was also calculated as 100% . Of the 54 patients included in the evaluation, 26 underwent definitive surgical management for the presenting problem; two patients had a normal uterine cavity and opted to undergo endometrial ablation, whereas 24 had operative hysteroscopic resection of the focal lesion . The most common histological diagnosis was a submucous myoma, seen in 65%, followed by benign endometrial polyps in 26% of the resected lesions; in 5%, a combination of the two existed . The uterus was classified as normal in size on clinical examination in 63% of the patients (36/54). Of the 18 enlarged uteri, 12 showed an intracavitary lesion on oh, giving a ppv of 67% . In eight of the 47 patients in whom a cbc was available, the hemoglobin was less than 11 gm%; 6/8 (75%) of these patients had an abnormal finding on oh . Nineteen of the 54 patients were experiencing heavy, though regular menstrual flow; of these, 14 (74%) had an abnormal oh compared to 14/35 (40%) of those presenting with irregular bleeding, the difference in the prevalence of lesions being statistically significant (p=0.008). The high incidence of intrauterine lesions (52%) in our patient population presenting with abnormal uterine bleeding (aub) is consistent with results of earlier studies.1 the traditional approach to evaluation of aub in an outpatient setting has included an endometrial sampling following a preliminary assessment based on the history and clinical examination . The patient commonly makes an average of two to three clinic visits, depending on the urgency of presentation, before being commenced on a specific treatment protocol . In the present era of cost containment and capping of procedure related reimbursements, the physicians should be acquainted not only with the relative informative yield but also the cost per investigation, so as to channelize their diagnostic approach . The aim of management is to thus minimize the cost incurred per patient, while adhering to the principals of the standard of care . Diagnostic hysteroscopy, though being increasingly employed for evaluation of aub, is still underutilized . Since the introduction of the hysteroscopic technique, the procedure has undergone significant modifications, contributing to an increase in patient acceptance . Introduction of fiberoptics, reduction in the caliber of the endoscopes, use of simpler distending media and availability of safer local infiltrative anesthetics have all contributed to an increasing utilization of this technique in evaluation of the uterine cavity . Baskett et al . In a recent commentary on the efficiency of a one - stop menstrual clinic have demonstrated the cost and clinical effectiveness of utilizing hysteroscopy as a preliminary investigation performed at the initial visit in selected patients . More than 50% of all diagnostic hysteroscopies, however, are still being performed in the operating room (or), and this trend could be attributed to a combination of a lack of awareness on the part of the physician and perhaps nonavailability of smaller caliber endoscopes . Compared to tvs, hysteroscopy allows for a direct visualization of the endometrial cavity and hence detection of any focal lesion . It offers the additional opportunity of obtaining a directed biopsy in the same setting if indicated, thus obviating the need for a separate scheduling of the procedure . Studies have demonstrated a superior yield of directed biopsies compared to d&c in providing representative histological specimens . In terms of cost containment, the procedure being performed by the investigating gynecologist precludes the involvement, and hence need for reimbursement of an additional specialist . Furthermore, it dictates the need for a histological specimen if indicated, and allows for a directed biopsy, ensuring provision of a representative specimen of the focal pathology for evaluation . Performing an oh early in the evaluation in appropriately selected patients would render utilization of any further investigation like embx or tvs unnecessary . The net result would ensure cost containment by reduction in the number of patient visits for investigational purposes, and by enabling the physician to embark on an appropriate management plan at the earliest opportunity, contribute significantly to patient satisfaction . The significant incidence of intrauterine lesions in the postmenopausal patients evaluated (31%) is comparable to other studies and underscores the importance of direct visualization of the uterine cavity in this subgroup . Since this represents the patient population at the highest risk for significant uterine pathology, i.e. Endometrial carcinoma, and because the hysteroscopic appearances of early lesions are well recognized, the argument is further strengthened in favor for an early visualization of the cavity . An insight into the clinical staging of an existing endometrial carcinoma would be an additional benefit contributing to the final management plan . The high incidence of intracavitary lesions seen in the patients with clinically enlarged uteri (62%) and in those with significant anemia (80%) underscores the importance of proceeding with oh early in the evaluatory process in this subcategory of patients . The rationale for attempting to evaluate the endometrial specimen histologically, obtained by either d&c or outpatient biopsy, is to provide an early diagnosis of a significant pathology, namely endometrial cancer and/or endometrial hyperplasia . While the risk of such an occurrence is high in a subset of patients, i.e. Postmenopausal women with abnormal bleeding (10%), anovulatory patients and those with a history of prior endometrial hyperplasia, the yield of endometrial sampling from the rest of the patient population in terms of obtaining a pathological diagnosis is negligible . This is consistent with our data and questions the almost universal practice of biopsying the endometrium in any patient presenting with aub . In our experience, an expenditure of approximately $250 for an embx could be easily avoided in the majority of premenopausal patients with aub . An embx, however, has a definite place in the diagnostic workup of postmenopausal patients as well as those premenopausal patients who are at high risk for endometrial hyperplasia . The high propensity of missing focal intrauterine lesions like submucous myomas and polyps with d&c is well documented in recent literature . Moreover, the alleged therapeutic effect of d&c in the management of aub remains questionable . Most of the data available on the diagnostic accuracy of tvs in evaluation of abnormal uterine bleeding is relevant only for the postmenopausal patients . The general consensus of opinion is that an endometrial thickness of less than 5 - 6 mm in a patient presenting with postmenopausal bleeding does not warrant an extensive workup, as the risk of endometrial carcinoma and/or hyperplasia is negligible.11,13 the sensitivity and specificity of tvs in detecting focal intrauterine lesions in the study presented is comparable to the results shown by tombin et al . (0.54 and 0.40, respectively). Scheduling the ultrasound evaluation in the follicular phase of the menstrual cycle in the premenopausal patients may enhance the sensitivity since the hyperechoic secretory endometrium may mask the endometrial polyps . Presence of intramural myomas may obscure the endometrial stripe, thus contributing to a significant incidence of false negative interpretations, as shown in our series . The majority of pelvic ultrasound scans are still being performed by the radiologists; the cost of a tvs ranges from $250-$400, depending on the involvement of the radiology department . Furthermore, an impression of an intracavitary lesion directs the management towards performance of a hysteroscopic procedure for the ultimate diagnosis and management . There is a high incidence of intracavitary uterine pathology in patients presenting with abnormal uterine bleeding . This is especially true when considering the 35 - 50 years age group who present with heavy regular bleeding, clinically enlarged uteri and significant anemia . The relatively poor sensitivity of both endometrial biopsy and transvaginal ultrasound in the detection of intrauterine focal pathology encourage us to propose that oh be utilized as a first line investigation in these patient evaluations . The cost - benefit analysis of investigations like embx and tvs as well as the financial burden of clinic visits during the entire evaluatory process |
Endodontically treated teeth presenting partial or total destruction of crowns require reconstruction to create a core to provide mechanical conditions for the indirect restoration to be fixed and remain in function for a long period . The materials most employed for that purpose are composite resins and cast metallic posts . Resin - based cements have been widely employed for cementation of metaloceramic or ceramic crowns due to their adhesive capacity to both tooth structure and restoration, combined with esthetic and mechanical properties . Since the success of cementation depends on the achievement of a strong and long - lasting bond among cement, restoration and tooth structure, the strength of such adhesion procedure is directly proportional to the adequate curing of the cement and is crucial to achieve optimal physical and mechanical properties and satisfactory clinical performance . Several factors may influence the curing of the cement used for luting ceramic crowns . These include: the composition, thickness, opacity and shade of the ceramic, which may reduce the light transmission and consequently affect the light - curing of the cement; characteristics of substrates and luting agent; incompatibility of simplified adhesive systems with self- or dual - cured resin cements; and permeability of simplified adhesives, which ultimately compromises the bonding between the cement and the adhesive . Considering the lack of information in the literature on the possible influence of the type of material used as coronal reconstruction on the physical properties of the cement used for luting ceramic crowns, this study evaluated the microhardness of the resin cement variolink ii along the cement line in the cervical, medium and occlusal thirds on the buccal and lingual aspects, and on the occlusal surface, when used for luting ceramic crowns on different substrates (dentin, metal, and composite resin), after 7 days and 3 months of water storage . The null hypotheses tested were that microhardness would not be influenced by the region of prepared surfaces, coronal substrate, and water storage . Thirty human third molars were embedded with plaster in plastic cylinders with the cementoenamel junction approximately 3 mm above the top of the cylinder . The teeth were prepared with diamond burs for full - ceramic crowns with a shoulder of 1.2 mm with internal rounded angles, and axial reduction of 1.5 mm with 6 to 10 convergence angle was performed . Occlusal reduction was performed resulting in an axial height of 4.0 mm (figure 1a). They were randomly divided into 3 groups (n=10) as follows: group d- the prepared crown surface was kept in dentin; group m- the crowns were sectioned at the level of the cementoenamel junction and the core was modeled in acrylic resin duralay (reliance dental mfg . Co. worth, illinois, usa), cast in aluminum - copper alloy, and luted with zinc phosphate (s. s. white artigos dentrios ltda ., rio de janeiro, rj, brasil); group r- the crowns were sectioned as in group m, and filling of the cores was performed with composite resin filtek z250 (3 m espe, st paul, mn, usa) by the incremental technique . Light irradiation was obtained from a quartz tungsten halogen (qth) device v.i.p . Junior (bisco, schaumburg, il, usa, 500 mw / cm) for 20 s for each increment, and 40 s for the last one . The reduction, convergence and height of axial walls followed the same principles described above for group d. scheme of experimental stages: a) prepared tooth; b) wax relief; c) cemented crown; d) sectioned crown exhibiting microhardness measurements along the cement line and ceramic thicknesses silicon molds were made of all sound tooth crowns before preparation . These were then used to guide the construction of the ceramic crowns to a thickness of 1.5 mm on the axial walls and 2.0 mm on the occlusal surfaces . On the center of buccal, occlusal and lingual aspects of the prepared surfaces, a relief was made in wax with approximate thickness of 0.25 mm and width of 2.0 mm to purposely allow for a thicker cement line and permit the microhardness tests (figure 1b). Impressions of the preparations were taken with polyvinyl siloxane express (3 m espe, st paul, mn, usa) and cast with type iv plaster . The crowns were fabricated from the type iv models with monolithic ceramic ips e.max press lt (ivoclar vivadent, schaan, liechtenstein), shade a2, following the manufacturer's instructions . After fitting adjustments, all crowns were luted with variolink ii cement (figure 2), following the procedures described in figure 3, and submitted to a static load of 5 kg during light - curing process . After removal of the excess of cement, light curing was performed on the buccal, lingual and occlusal surfaces, for 40 s on each surface (figure 1c). The specimens were then stored in lightproof flasks, immersed in deionized water and kept at 37c . The specimens were randomly divided in subgroups of 5 for each substrate and sectioned either after 7 days or 3 months of water storage . Chemical composition of the resin cement and adhesive system the teeth were removed from the embedding cups and transversely sectioned below the crown margins using a diamond disc (buehler, lake bluff, il, usa) under constant irrigation . The crowns were then sectioned in a buccolingual direction, at the center of the relief area, to expose the cement line . To facilitate positioning of the specimen in the microhardness tester, a second parallel section limited to ceramic was made to keep the surface to be analyzed perpendicular to the indenter . The cut surface was sequentially polished with 600- and 1200-grit sic paper, followed by 1-m diamond paste on a cloth, under constant irrigation . Between each polishing step, the specimens were rinsed with water for 30 s and ultrasonicated in deionized water for 2 min . The polished crown sections were kept in moist gauze in lightproof flasks until tested . Measurements were performed on a shimadzu microhardness tester hmv-2,000 (shimadzu corporation - kyoto, japan) with knoop indenter under a static load of 50 g for 10 s. indentations were made from cervical to occlusal surface in 0.5 mm intervals along the cement line (figure 1d). The hardness was expressed as a knoop hardness number (khn), and at the end of measurements the average microhardness values were obtained for the cervical, medium and occlusal thirds and occlusal surface . Data were analyzed by three - way anova (substrates, thirds / occlusal surface, and storage), and two - way anova was applied (substrate / storage). The teeth were removed from the embedding cups and transversely sectioned below the crown margins using a diamond disc (buehler, lake bluff, il, usa) under constant irrigation . The crowns were then sectioned in a buccolingual direction, at the center of the relief area, to expose the cement line . To facilitate positioning of the specimen in the microhardness tester, a second parallel section limited to ceramic was made to keep the surface to be analyzed perpendicular to the indenter . The cut surface was sequentially polished with 600- and 1200-grit sic paper, followed by 1-m diamond paste on a cloth, under constant irrigation . Between each polishing step, the specimens were rinsed with water for 30 s and ultrasonicated in deionized water for 2 min . The polished crown sections were kept in moist gauze in lightproof flasks until tested . Measurements were performed on a shimadzu microhardness tester hmv-2,000 (shimadzu corporation - kyoto, japan) with knoop indenter under a static load of 50 g for 10 s. indentations were made from cervical to occlusal surface in 0.5 mm intervals along the cement line (figure 1d). The hardness was expressed as a knoop hardness number (khn), and at the end of measurements the average microhardness values were obtained for the cervical, medium and occlusal thirds and occlusal surface . Data were analyzed by three - way anova (substrates, thirds / occlusal surface, and storage), and two - way anova was applied (substrate / storage). Data were analyzed by three - way anova (substrates, thirds, and storage). Considering each factor independently, the substrates showed significant differences (p=0.000), without differences for factors storage (p=0.573) or thirds (p=0.231) (table 1) since the analysis did not reveal significant differences between thirds, the values of substrate and storage were submitted to two - way anova, which showed significant effects of core materials (p<0.001). Hardness values were significantly lower when crowns were cemented on resin cores and measured after 7 days of storage (p=0.007) (table 2, figure 4). Knoop hardness number (standard deviation) at cervical, middle, occlusal thirds and occlusal surface according to the conditions substrate / time storage n=5 specimens in each group . Equal capital letters indicate lack of statistically significant difference (analysis of storage); equal lowercase letters indicate lack of statistically significant difference (analysis of substrate); equal symbols indicate lack of statistically significant difference (analysis of thirds). P<0.05 knoop hardness number (standard deviation) of samples according to the conditions substrate / time storage n=5 specimens in each group . Equal capital letters indicate lack of statistically significant difference (analysis by row); equal lowercase letters indicate lack of statistically significant difference (analysis by column). P<0.05 box plots: a) results after 7 days in water storage; b) results after 3 months in water storage the fact that there were no differences among thirds and faces is probably due to the ceramic thickness employed (1.5 mm on axial walls and 2.0 mm on the occlusal aspect) and the composition of ceramic ips e.max press, a vitreous ceramic composed of lithium disilicate, which may have allowed sufficient light transmission throughout the crown extent . (2008) also found uniform microhardness values along the cement layer for the cement variolink ii used to cement leucite - based ceramic crowns with 1.4 mm and 2.0 mm of thickness . Concerning the type of substrate, only the composite resin core, after storage in water for 7 days, resulted in significantly lower hardness values when compared with the other groups and storage conditions . When full crowns are cemented on metal or fiber - reinforced resin posts or cores, the permeability of the simplified adhesive will not be in effect . But when the substrate is hydrated dentin, the permeability might be more relevant and harmful than the chemical incompatibility in relation to metal and composite resin substrates . This occurs because the fluid transudation through the adhesive may result in water accumulation at the interface between adhesive and cement, causing significant reductions in bond strength . This water accumulation is originated from the hydrated dentin, and the negative effect of this permeability on the adhesive resistance of resin cements was confirmed by in vitro studies . When crowns are cemented on core substrates other than dentin, the permeability is absent or reduced, but the chemical incompatibility persists between the acidity of simplified adhesives and the components of the chemical curing route of resins . The reduction of mechanical properties of composites stored in water is predominantly related to water absorption by the polymer, which is softened by the tumescence of polymeric chains and reduction of frictional strength of these chains . Once saturated in water, the polymeric chains are stabilized and there is no further reduction of material properties . The effects of humidity on the mechanical properties of resin cements have been extensively investigated, and there is consensus that the action of solvents on the polymeric chain is deleterious to the mechanical properties of the cement . As previously mentioned, it has been reported that resin monomers originated from two - step conventional and one - step self - etching adhesives may impair the co - curing and consequent bond between these types of adhesives and composites, whose curing reaction is initiated by a redox reaction between the tertiary amine and benzoyl peroxide . As a consequence, low adhesive strength values are reported when these materials are combined . In an attempt to avoid this chemical incompatibility and enhance the adhesive strength, manufacturers have been adding co - initiators in adhesive systems that react with acidic resin monomers and produce phenyl or benzenesulphonic radicals that initiate the curing reaction in dual resin cements or when there is no adequate light exposure . The microbrush of the adhesive system used in this study contains initiators that are fundamental for the self - cure mechanism . Additionally, this mechanism requires other initiators that are originated from a composite that also presents a self - cure mechanism and may come from a dual or chemically cured reconstruction composite (when the adhesive is used for reconstruction) or dual or chemically cured cement (in cases of luting). That is to say, the self - cure mechanism of dsc adhesive may not occur if it does not get in contact with dual or self - cured resin . For this reason, if the dsc adhesive is exclusively used with a light - cured resin, it should necessarily be light - cured before placement of composite resin . Based on this assumption, it is understood that there clearly is a chemical reaction between the dsc adhesive and self - cured or dual - cured resins . This reaction should favor both the adhesive and cement curing . In this context, the dsc adhesive layer applied on the substrates, though light - cured, contained initiators of chemical reaction ready to react with initiators present in the cement variolink ii and provide fast consolidation of curing of the dsc adhesive, also favoring the cement curing, especially in areas less accessible to light, thus characterizing a " collaboration " reaction of initiators of the adhesive and cement to enhance the curing of both . Considering that the quantity of such initiators in the adhesive is limited to the applied layer, when the adhesive was applied on dentin, all radicals were free to react with the cement . However, when the adhesive was applied on the core resin, it is speculated that some initiators of the adhesive reacted with uncured free radicals of the core resin and consequently reduced the availability of initiators to react with the cement . The consequence was that the cement cure and certainly also the adhesive cure were delayed, resulting in lower microhardness values in the initial storage period (7 days). Analysis of table 1 reveals that, although not statistically significant, the microhardness of group r after 7 days of storage decreased from the cervical margin to the occlusal aspect, suggesting that in areas close to margins, in which the light acts on the cement curing with greater intensity, the conflict of utilization of initiators between core resin and cement is surpassed by the curing achieved by light - curing . Since the effects of this conflict are temporary, causing only a delay in the curing process, the same phenomenon is not observed after 3 months of storage . The composite resin, when used as filling material for cores, provides advantages as easy handling, fast curing, good translucency shade, which does not interfere with the ceramic shade . However, in the routine clinical practice, the resin is often in contact with saliva for a considerable time . It is not known to which extent the lower hardness outcomes observed when cementing over the composite resin core may cause any relevant clinical problem . Further studies should be conducted to enhance the understanding on the reactions occurring between this substrate and the resin cement . Based on the results, the following could be concluded: there was no significant difference in the microhardness results between the cervical, medium, and occlusal thirds and occlusal surface; there was significant difference in the microhardness results between substrates . For the 7-day storage period, the results of the composite resin substrate were lower than dentin and metal . After 3 months of storage, the results were similar for the 3 substrates; the type of material employed for coronal reconstruction of preparations for prosthetic purposes may influence the cement properties. |
Lung transplantation is an established therapeutic option for patients with advanced cystic fibrosis (cf). The success of the first transplant for a patient with cf in 1983 spurred further refinement of the management and selection criteria of patients, leading to significant survival benefit . However, patients with advanced cf present a unique microbiological challenge, with disease characterised by bronchiectasis, severe airflow obstruction, high bacterial loads, and recurrent lower respiratory tract infections [46]. Unsurprisingly, some centres turn down patients on the basis of colonisation with multiresistant bacteria . The most common respiratory pathogen that colonises patients with cf is pseudomonas aeruginosa, with up to 80% of patients being culture - positive for this organism . As the presence of this microorganism has negative prognostic implications, it is disturbing to note that levels of resistance to frontline antipseudomonal agents are very high . The presence of multi- and pan - resistant p. aeruginosa renders methods of single - agent antibiotic susceptibility testing suboptimal . The conventional manner of managing patients who are colonised with these microorganisms is to empirically treat them with combinations of antibiotics in the peritransplant period . Unfortunately, an empirical approach might lead to inadequate bactericidal levels and the prescription of antibiotics that antagonise each other . This approach is undesirable, as patients with pan - resistant bacteria have shorter follow - up periods and decreased survival rates after transplant . An alternative approach is to utilise multiple combination bactericidal testing (mcbt), a technique that had previously been used to systematically test bacterial isolates against multiple combinations of antibiotics to determine susceptibility patterns and identify optimal combinations for potential treatment . Previous studies have demonstrated that using combinations of antimicrobials may generate higher levels of in vitro bactericidal activity against p. aeruginosa and burkholderia cepacia complex . Our centre currently advocates the use of mcbt (with modified antimicrobial concentrations) to determine appropriate prophylactic regimens in patients about to undergo lung transplantation for cf and other lung pathologies that are colonised with antibiotic - resistant gram - negative bacteria . To evaluate the effectiveness of our strategy, we undertook a retrospective analysis to compare the rates of posttransplant infection in patients whose peritransplant antimicrobial regimens were determined using the mcbt versus those who had their antibiotics chosen via conventional sensitivity testing . We performed a retrospective analysis of all patients who underwent lung transplantation for cf between january 2000 and august 2010 . Patients were included in the review if they were colonized pretransplant with p. aeruginosa (as demonstrated by sequential sputum cultures) and were excluded if they were colonized with b. cepacia complex . Data was collected from patients' case notes and clinical charts; looking specifically at incidences of septicaemia at 30 days, posttransplant wound infection at 30 days, empyema at 30 days, all - cause mortality at 30 days, and all - cause mortality at one year . These were mapped against antibiotic resistance, method of sensitivity testing, and choice of antibiotics that were administered . Infections were defined by combining positive laboratory culture from tissue source (blood, surgical wound, and pleural fluid) with at least two of the following four parameters: tachycardia (heart rate> 90 beats per minute),hypotension (systolic blood pressure <90 mmhg),body temperature <36c or> 38c, abnormal inflammatory markers (white cell count <4 10 cells / l or> 12 10 cells / l, c - reactive protein> 10 mg / l). Tachycardia (heart rate> 90 beats per minute), hypotension (systolic blood pressure <90 mmhg), body temperature <36c or> 38c, abnormal inflammatory markers (white cell count <4 10 cells / l or> 12 10 cells / l, c - reactive protein> 10 mg prophylactic antimicrobials were chosen based on disc susceptibility testing using british society for antimicrobial chemotherapy (bsac) breakpoints . If sputum was culture positive for pan - resistant p. aeruginosa or recent culture results were unavailable, patients were treated empirically with aztreonam, an antistaphylococcal agent (either flucloxacillin or clindamycin), and metronidazole . Patients who did not receive peritransplant antibiotics chosen via the mcbt method were deemed to have received antibiotics using conventional means . Perioperative antibiotics were continued until the patient was extubated and could demonstrate a good cough, (two - three days) to a maximum of seven days . This was used in conjunction with conventional means of choosing peritransplant antibiotics, but, since 2008, mcbt became the default method for the determination of bactericidal agents for all patients colonised with antibiotic - resistant gram - negative nonfermenters . Bactericidal activity was determined by testing at least 12 antimicrobials individually and in combination with each other, leading to 66 different combinations . Several morphotypes of p. aeruginosa from at least two pretransplant sputa were selected for testing . Each antimicrobial or combination of antimicrobials was tested in isosensitest broth using systemic breakpoint concentrations as specified by the bsac . After 48 hours incubation at 37c, the turbidity of each broth was measured at 620 nm . Broths without detectable bacterial growth were subcultured onto blood agar to calculate 99.9% bacterial kill . Peritransplant antibiotic regimens were then chosen based on mcbt results and patients' allergy history . Any other gram - negative species (including nonfermenters and/or enterobacteriaceae) that may have isolated alongside p. aeruginosa were also tested using the mcbt, and antibiotic cocktails were chosen that showed bactericidal activity against such mixtures of species . Our centre used a three - day induction protocol with antithymocyte globulin (titrated by flow cytometric analysis of peripheral blood t lymphocytes) and intravenous methylprednisolone at a dose of 2 mg / kg . Alternatives were used in the context of an international clinical trial (mycophenolate) or in cases of ciclosporin intolerance (tacrolimus was used). Up to five days of intravenous ciclosporin was given in the context of poor ciclosporin absorption in patients with cf . Between january 27, 2000 and august 23, 2010, 163 lung transplants were performed on patients with cf . This number included patients who were previously turned down by other centres on the basis of their microbiology . A total of 129 patients were colonized with p. aeruginosa and not colonized with b. cepacia complex . Fifty patients were given antibiotics that were chosen based on the mcbt, and there were 79 patients in the conventional group . Our patients were colonized with strains of p. aeruginosa with varying degrees of antibiotic resistance . We defined pan - resistance as resistance to antipseudomonal quinolones, -lactams, aminoglycosides, and colomycin . In this cohort these organisms were resistant to all single agents tested but bactericidal combinations with colomycin and another agent were identified . Seventy - one patients were colonised with multiresistant p. aeruginosa, and nine patients were colonised with fully susceptible strains . Forty - seven patients were colonised with organisms that were resistant to one or two groups of antimicrobials . Figure 1 shows the relative rates of infectious complications after lung transplantation in both groups . Two patients (4%) who were given antibiotics based on mcbt developed septicaemia compared to 13 (16.5%) in the conventional group (p 0.05). The occurrence of gram - negative sepsis was statistically lower in the mcbt group, and p. aeruginosa was responsible for only one case of septicaemia compared with seven in the conventional therapy group (see table 2). P. aeruginosa was recovered from the posttransplant pleural fluid of one patient (2%) in the mcbt group, as opposed to six (7.6%) in the conventional group (p = 0.25). There were no statistically significant differences in the rates of surgical wound infection (6% in the mcbt group, 3.8% in the conventional group). There were no statistically significant differences in all - cause mortality rate at 30 days, with a 10% mortality rate in the mcbt cohort and 6.33% in the conventional group . This lack of statistical significance was replicated in all - cause mortality rate at one year (22% in the mcbt group, 19% in the conventional group). Lung transplantation for cf accounts for approximately one - third of all single sequential lung transplants performed at our centre . The complex microbiology involved in this cohort of patients may lead to anxiety when listing patients with multi- and pan - resistant p. aeruginosa, but this paper demonstrates for the first time that the mcbt may have a significant role in altering posttransplant infective complications for patients with cf . The data indicates that whilst there may not be evidence for an effect on all - cause mortality, patients who had antibiotics chosen using mcbt had lower rates of morbidity . The presence of pleural infection and septicaemia not only negatively impacts the patients' transplant journey but prolongs the hospital length - of - stay and adds substantial economic burden . We had excluded patients who were colonised with b. cepacia complex for the purposes of this retrospective analysis . This is due to the tendency of these patients to succumb to overwhelming sepsis with one - year mortality rates of between 50% and 100% [18, 19]. Our group had also previously noted that infection with burkholderia cenocepacia in particular led to even poorer mortality outcomes . Unfortunately, we were unable to look at exact causes of death (septicaemia in particular) in our patient cohort as causes of death were not readily identifiable in all cases . This is a reflection of the wide geographical referral area that is covered by our centre as well as the degree of shared care with referring centres (covering the north of england, scotland, northern ireland, and the republic of ireland). A previous analysis of all patients who underwent lung transplantation for cf at our centre had identified sepsis as the cause of death in 18 cases (26% of all recorded cf transplantation recipient deaths). B. cepacia complex was implicated in seven of these cases . In an additional three cases, clinical sepsis prospective studies would play an important role in determining if the use of mcbt can significantly decrease the rate of early mortality due to septicaemia . Aaron et al . Had compared the efficacy of using antimicrobial combinations derived from mcbt with those derived from conventional susceptibility testing for treatment of acute pulmonary exacerbations of cf . They concluded that regimens based on mcbt results did not result in a better clinical or bacteriological outcome . It is difficult to make comparisons between our findings and theirs for both clinical and technical reasons . On the clinical side, the patient populations (post - lung - transplant cf versus non - lung - transplant cf) and outcome measures were different . There are also major differences in the antimicrobial concentrations used in our modified mcbt test and the test as originally described [13, 14]. In our study, systemic breakpoint concentrations specified by the bsac to define susceptibility were used in a modified mcbt whereas antimicrobial concentrations in the original mcbt were chosen on the basis of published estimates of the average peak levels seen in serum after standard single - dose intravenous administration . As a result, the antimicrobial concentrations used in our modified mcbt were typically two- to eightfold lower than those previously described . As a consequence, fewer isolates would be likely to be classified as susceptible in our study . It is impossible to conclude whether the use of lower breakpoint concentrations of antimicrobials would have led to more favourable outcomes in the study of aaron et al . . As this is a retrospective study, we readily acknowledge that there are inherent limitations to our findings . The ten - year period covered by the study has seen numerous changes with regards to developments in lung transplantation . These include changes in immunosuppression regimen and the natural progression with regards to peritransplant management as the members of our centre gain more experience . Given the nonrandomized nature of this study and temporal confounding factors, we cannot definitely conclude that mcbt should be given at induction to all patients colonized with p. aeruginosa . However, the fact that we are dealing with a unique cohort of patients with significant microbiological challenges might render it unethical to conduct a full randomized control trial . Furthermore, it is unlikely that sufficient numbers are recruited to adequately power such a study . The data presented is the first indication that patients given antibiotics based on mcbt results had significantly lower rates of septicaemia and lower rates of positive microbiological cultures in their pleural effusions . This is an encouraging finding, lending credence to the need for multi - centre prospective studies to be performed that will ideally lead to no patients being turned down for a lung transplant on the basis of colonisation with resistant microorganisms. |
Acute promyelocytic leukemia (apl) is one of the most characteristic subtypes of aml in which abnormal promyelocytes predominate within peripheral blood or bone marrow . Also, t(15;17)(q22;q21) shows a characteristic chromosomal translocation in apl, observable in 70 - 90% of apl patients . Owing to all trans - retinoic acid (atra) combined with chemotherapy, apl has one of the highest cure rates of all types of aml . Seventy to eighty percent of newly diagnosed apl patients with the pml - rara rearrangement are cured or under long - term remission, yet some of them have a poor prognosis [2 - 5]. Because cytogenetics is one of the most powerful prognostic factors for the outcome of aml, cytogenetic abnormalities can cause change in treatment response, relapse, and clinicopathological characteristics . Incidence of secondary cytogenetic abnormalities has been observed in ~40% of apl cases, but their prognostic significance is still unclear [5 - 7]. About 1% of the reported secondary cytogenetic abnormalities in apl patients are ider(17)(q10)t(15;17)(q22;q12), an infrequent type of additional recurrent chromosomal abnormality, according to a recent study . However, ider(17)(q10)t(15;17) associated with the pml - rara rearrangement in microgranular variant apl is even more rare . As far as we know, only 2 cases of the ider(17)(q10)t(15;17) abnormality in microgranular apl have been previously reported [8, 9]. Here, we describe an unusual microgranular apl case associated with ider(17)(q10)t(15;17), identified by both conventional cytogenetics and fish analyses at the initial diagnosis . A 59-yr - old woman who had previously been diagnosed with cerebral infarction was brought to our hospital due to right side weakness in november 2007 . The initial complete blood count showed pancytopenia, hb level of 9.9 g / dl (reference range 12 - 16 g / dl), platelet count of 83,000/l (reference range 150,000 - 350,000/l), and white blood cell count of 1,000/l (reference range 4,000 - 10,000/l). Bone marrow aspiration showed a hypercellular marrow replaced by increased promyelocytes with a paucity or absence of granules, accounting for 36% of all nucleated cells (fig . The results of special staining of bone marrow specimens were as follows: myeloperoxidase, positive; periodic acid schiff, negative; nonspecific esterase, negative . Flow cytometric analysis was conducted and showed that the blasts were positive for cd13 (91.1%), cd33 (83.9%), cd117 (59.2%), cd2 (43.9%), and cd45 (25.4%), and negative for hla - dr (3.4%), cd3 (1.3%), cd7 (0.6%), cd10 (1.8%), cd14 (2.4%), cd19 (5.1%), cd34 (1.4%), cd41 (2.9%), cd56 (1.2%), and tdt (0.9%). Fish signals from pml - rara probes (abbott molecular / vysis, des plaines, il, usa) yielded the results of nuc ish(pml, rara)4(rara con pml3)[24/138], (pml, rara)6(rara con pml5)[14/138], (pml, rara)3(rara con pml2)[13/138], consistent with the abnormal fusion signal patterns seen in 37% of the nuclei examined (fig . The patient was diagnosed with apl and treated with induction chemotherapy consisting of daunorubicin, cytosine arabinoside, and atra . After completing induction chemotherapy, follow up bone marrow examination in january 2008 showed no evidence of morphologically visible residual leukemia . The concurrent karyotype analysis result was 46,xx in all analyzed cells; and pml - rara fish showed " nuc ish (pml, rara)2 " in which the abnormal signal pattern was not observed . There was no evidence of a pml - rara fusion gene in the reverse transcriptase - pcr (rt - pcr) analysis . As indicated by follow - up bone marrow biopsies conducted until september 2008, the patient remained in complete remission . During this period, the rt - pcr analysis did not show any signs of the pml - rara fusion gene while other cytogenetic studies also indicated normal findings . Apl is a distinct subtype of aml and constitutes about 5 - 8% of all cases of aml diagnosis . According to the 2008 who classification, apl can be diagnosed when there is a t(15;17) or a pml - rara rearrangement, even if peripheral blood or bone marrow studies show less than 20% promyelocytes . As recently reported by manola et al . And our study group, the ider(17)(q10)t(15;17), an isochromosomal abnormality that occurs on the long arm of ider(17)t(15;17) after reciprocal translocation of t(15;17), is a relatively rare type of an additional recurrent cytogenetic abnormality that has been reported in 62 apl patients worldwide [8 - 13]. According to these studies, the influence of ider(17)(q10)t(15; 17) on the prognosis of adult apl patients indeed, 4 previously reported apl cases in children were all related to poor prognosis [8, 13 - 15], inferring that a more close and careful interpretation is necessary for childhood apl cases . What is interesting is that so far, reports of ider(17)(q10)t(15;17) from microgranular variant (aml - m3v) type are extremely rare . Out of 62 total cases, information on apl morphology type were available in 42 cases, and most of these cases (40/42) were of the hypergranular apl type, except for 2 cases that clearly indicated aml - m3v (table 1) [8, 9]. Therefore, further research is required to determine whether ider(17)(q10) and aml - m3v have a low association, and more careful observation should be conducted to prevent underestimating aml - m3v patients among ider(17)(q10)t(15;17) cases . Furthermore, double ider(17) (q10)t(15;17) is so rare in the international public databases that only 2 cases of apl patients indicating double ider(17)(q10)t(15;17) chromosomal abnormalities have been reported (table 2) [16, 17]. In double ider(17)(q10)t(15;17), a gene dosage effect is observed owing to chromosomal abnormalities such as the pml - rara fusion gene on chromosome 17 or the quadruplication of der(17q). In addition, since the deletion of the tumor suppressor gene tp53 occurs by the loss of 17p, further research is necessary to resolve the adverse prognosis of the apl group related to such copy number variations . Owing to the limited amount of clinical data in the literature, the relatedness between double ider(17)(q10)t(15;17) and an adverse prognosis is still unclear [16, 17]. In the case of our patient, it was hard to determine a strong association between the additional genetic aberration and prognosis because of the small clonal size of the " double ider(17)(q10)t(15;17) " abnormality . Nevertheless, at least from a diagnostic perspective and as indicated in the authors' recent studies [13, 18], minimal residual disease detection using such multiple abnormal fusion signals through the pml - rara fish analysis in apl patients associated with ider(17)(q10)t(15;17) or double ider(17)(q10)t(15;17) would be considered to be a useful follow - up marker in clinical laboratories or hospitals . Additional study would contribute toward a better understanding of the influence of ider(17)(q10)t(15;17) on the prognosis, survival, and treatment response of such apl cases in adults or children . To the best of our knowledge, however, this is the third case report of microgranular variant apl associated with ider(17)(q10)t(15;17). |
The three most commonly encountered forms of mercury are metal vapor (hg), ionic compounds (hg) and organic mercury, principally methyl mercury (hgch3). Organic mercury is the most deadly of the mercury compounds, probably due to its ability to penetrate cells . Within the cell it can destroy various components selectively or in total by releasing lysosomes, damaging dna and rupturing the cell membrane . The toxicity of high levels of mercury contamination was brought to public attention in the 1950s as a result of mercury dumping in the minamata bay in japan 8 9]. The general population is primarily exposed to mercury via food, fish being a major source of methyl mercury exposure . Mercury is incorporated into the food chain as methyl mercury, primarily through the action of bacteria and other microbes transforming elemental or inorganic forms . Humans are also exposed to mercury via thimerosal (a preservative added to vaccines and many other pharmaceuticals), and amalgam or mercury - based dental fillings . Mercury vapor released from mercury dental fillings is absorbed very rapidly and thoroughly by the body, mainly through inhalation and swallowing . Adverse health effects, particularly of a neurological nature, have resulted from low exposure levels, especially to the fetus in pregnant women . Using young rats as a model of mercury toxicity, results from previous studies and from our group have demonstrated that exposure to hgcl2 (25 mg / kg) for only five consecutive days causes cerebral and whole body weight losses, increases in kidney weight, mercury accumulation in tissues, inhibition of porphobilinogen synthase activity[1517], alterations in renal and hepatic functions and glycemia . Metal intoxication is usually treated with chelating agents, which are not specific and are often more toxic than the metal itself . Because chelation therapy for heavy metals intoxication can also be toxic, researchers are looking for natural preventive and therapeutic agents for heavy metal toxicity . Kumis, also known as koumiss, is an alcoholic beverage made from fermented mare's milk . Mare's milk is usually not consumed raw, because it tends to have a strong laxative effect, although this effect is sometimes used medically . Instead, fermentation destroys lactose in milk, converting it into lactic acid, ethanol, and carbon dioxide . Fermentation takes place in 3 - 8 hours and is carried out by a mixture of indigenous yeasts and lactic acid bacteria . Currently, kumis is manufactured at an industrial level in some countries using pure cultures of yeasts and lactic acid bacteria . Kumis is rich in ferments, trace elements, antibiotics, vitamins a, b1, b2, b12, d, e, c, ethyl alcohol, lactic acid and carbonic acid . Kumis drinking has a healing influence on the gastrointestinal tract, metabolism, cardiovascular and nervous systems, and kidneys; it aids the development of immunity; and has been used to treat weight loss and anemia . Adding soluble fiber to the diet has also been shown to have positive effects on health . Various studies have shown a reduction in colon cancer risk and enhanced health by consuming inulin and oligo fructose in ratios ranging from 2% to 10% . Probiotics include viable lactic acid bacteria and other bacilli that are able to survive in the intestine . Prebiotics include carbohydrates that are not digested in the upper part of the gastrointestinal tract, but selectively fermented by bacteria in the colon . This selective fermentation affects the composition of the intestinal microflora by stimulating bifidobacteria and lactobacilli, both in humans and in animals, where these bacteria have health promoting properties . We have combined these three health - promoting materials to produce a functional food composed of fermented mare's milk plus a high level (6%) of soluble fiber and probiotics . The current study was designed to determine if feeding the high fiber probiotic fermented mare's milk could alleviate the toxic effects of mercury in rat model . Starter cultures of streptococcus thermophilus, lactobacillus acidophilus, and bifidobacterium bifidum were obtained from hansen's laboratory, copenhagen, denmark . Dandelion root (taraxacum officinale) was purchased from haraz herbal market, cairo, egypt . Fresh mare's milk was obtained from lactating and healthy arabian mares in the experimental animal unit, college of agriculture and veterinary medicine, qassim university, saudi arabia . Briefly, fresh mare's milk (11% total solid) was heated at 85 c for 15 minutes, cooled to 40 c, then inoculated with the 1.0 10 probiotic bacteria streptococcus thermophilus, lactobacillus acidophilus and bifidobacterium bifidum and was then incubated for 4 - 8 hours at 42 c. after coagulation, the curd was tested for ph and stored refrigerated (4 - 6 c). A hot water extract of soluble dandelion root fiber was prepared according the methods described by abdel - salam et al .. dandelion roots were cut into small pieces and boiled for 10 minutes in distilled water . The mixture was filtered twice: first through cheesecloth (50% cotton/50% polyester), and then through filter paper (whatman no.2). The solutions obtained were preserved in sterile dark bottles in a cool environment (4 c) until use . The high fiber probiotic mare's milk was prepared by mixing the concentrated hot water extract of dandelion root with the fermented mare's milk at 6% total solids . A sensory evaluation test of the fermented milk products was adopted from the national aeronautics and space administration (n.a.s.a . ). The evaluation was performed by a panel composed of the staff and students in the department of food science and human nutrition . The evaluation rated the appearance, color, odor, flavor, and overall impression of the product, and results were expressed as very good (+ + +), good (+ +), acceptable (+), or unacceptable (-). Antioxidant capacity was measured with a 1,1-diphenyl-2-picrylhydrazyl (dpph) assay according to the method of brand - williams et al . With some modifications . A stock solution was prepared by dissolving 24 mg of dpph in 100 ml methanol . The working solution was obtained by mixing 10 ml stock solution with 45 ml methanol to obtain an absorbance of 1.1 0.02 units at 515 nm using a spectrophotometer . Milk extracts (750 l) were allowed to react with 1500 l of the dpph solution for 5 minutes in the dark . Trolox is a water - soluble derivative of vitamin e it is an antioxidant, like vitamin e, and is used in biological or biochemical applications to reduce oxidative stress or damage . Trolox equivalent antioxidant activity (teac) is a measurement of antioxidant strength based on trolox, measured in units called trolox equivalents (te), trolox equivalency is used as a benchmark for the antioxidant capacity of such a mixture . Thirty male adult swiss albino rats weighing 200 - 250 g 40 g were used . The animals were housed in standard cages and were assigned to a specific treatment diet . The composition of the basal diet was as follows: milk protein (12%), sucrose (5%), fat (10%), vitamin mixtures (1%), salt mixtures (4%), fiber (4%) and starch (64%). The positive control group was fed the basal diet and received 25 ppm mercury as mercuric chloride (hgcl2) in drinking water . The third group was fed the basal diet, received 25 ppm mercury as mercuric chloride (hgcl2) in drinking water, and was fed the high fiber fermented mare's milk solution containing probiotics . The weights of the rats were measured at the beginning and end of the experiment . Sera were harvested, labeled and stored frozen (-20 c) pending analysis . In sera the following parameters were analyzed: urea was determined according to the methods of tietz . Glutathione - s - transferase (gst) activity was determined according to habig et.al .. lactate dehydrogenase (ldh) activity was determined according to bergmeyer . Samples of brain, cerebellum, and kidneys were taken, and fixed in 10% neutral buffered formalin for 24 hours . Paraffin sections 6 m thick were prepared and stained with hematoxylin and eosin (h & e) for the examination of tissue and cellular changes by light microscopy . Mean and standard deviation of the data from each experimental group were calculated and briefly, fresh mare's milk (11% total solid) was heated at 85 c for 15 minutes, cooled to 40 c, then inoculated with the 1.0 10 probiotic bacteria streptococcus thermophilus, lactobacillus acidophilus and bifidobacterium bifidum and was then incubated for 4 - 8 hours at 42 c. after coagulation, the curd was tested for ph and stored refrigerated (4 - 6 c). A hot water extract of soluble dandelion root fiber was prepared according the methods described by abdel - salam et al .. dandelion roots were cut into small pieces and boiled for 10 minutes in distilled water . The mixture was filtered twice: first through cheesecloth (50% cotton/50% polyester), and then through filter paper (whatman no.2). The solutions obtained were preserved in sterile dark bottles in a cool environment (4 c) until use . The high fiber probiotic mare's milk was prepared by mixing the concentrated hot water extract of dandelion root with the fermented mare's milk at 6% total solids . A sensory evaluation test of the fermented milk products was adopted from the national aeronautics and space administration (n.a.s.a . ). The evaluation was performed by a panel composed of the staff and students in the department of food science and human nutrition . The evaluation rated the appearance, color, odor, flavor, and overall impression of the product, and results were expressed as very good (+ + +), good (+ +), acceptable (+), or unacceptable (-). Antioxidant capacity was measured with a 1,1-diphenyl-2-picrylhydrazyl (dpph) assay according to the method of brand - williams et al . With some modifications . A stock solution was prepared by dissolving 24 mg of dpph in 100 ml methanol . The working solution was obtained by mixing 10 ml stock solution with 45 ml methanol to obtain an absorbance of 1.1 0.02 units at 515 nm using a spectrophotometer . Milk extracts (750 l) were allowed to react with 1500 l of the dpph solution for 5 minutes in the dark . Trolox is a water - soluble derivative of vitamin e it is an antioxidant, like vitamin e, and is used in biological or biochemical applications to reduce oxidative stress or damage . Trolox equivalent antioxidant activity (teac) is a measurement of antioxidant strength based on trolox, measured in units called trolox equivalents (te), trolox equivalency is used as a benchmark for the antioxidant capacity of such a mixture . Thirty male adult swiss albino rats weighing 200 - 250 g 40 g were used . The animals were housed in standard cages and were assigned to a specific treatment diet . The composition of the basal diet was as follows: milk protein (12%), sucrose (5%), fat (10%), vitamin mixtures (1%), salt mixtures (4%), fiber (4%) and starch (64%). The positive control group was fed the basal diet and received 25 ppm mercury as mercuric chloride (hgcl2) in drinking water . The third group was fed the basal diet, received 25 ppm mercury as mercuric chloride (hgcl2) in drinking water, and was fed the high fiber fermented mare's milk solution containing probiotics . The weights of the rats were measured at the beginning and end of the experiment . Sera were harvested, labeled and stored frozen (-20 c) pending analysis . In sera the following parameters were analyzed: urea was determined according to the methods of tietz . Glutathione - s - transferase (gst) activity was determined according to habig et.al .. lactate dehydrogenase (ldh) activity was determined according to bergmeyer . Samples of brain, cerebellum, and kidneys were taken, and fixed in 10% neutral buffered formalin for 24 hours . Paraffin sections 6 m thick were prepared and stained with hematoxylin and eosin (h & e) for the examination of tissue and cellular changes by light microscopy . Mean and standard deviation of the data from each experimental group were calculated and according the method described by miller and miller . Briefly, fresh mare's milk (11% total solid) was heated at 85 c for 15 minutes, cooled to 40 c, then inoculated with the 1.0 10 probiotic bacteria streptococcus thermophilus, lactobacillus acidophilus and bifidobacterium bifidum and was then incubated for 4 - 8 hours at 42 c. after coagulation, the curd was tested for ph and stored refrigerated (4 - 6 c). A hot water extract of soluble dandelion root fiber was prepared according the methods described by abdel - salam et al .. dandelion roots were cut into small pieces and boiled for 10 minutes in distilled water . The mixture was filtered twice: first through cheesecloth (50% cotton/50% polyester), and then through filter paper (whatman no.2). The solutions obtained were preserved in sterile dark bottles in a cool environment (4 c) until use . The high fiber probiotic mare's milk was prepared by mixing the concentrated hot water extract of dandelion root with the fermented mare's milk at 6% total solids . A sensory evaluation test of the fermented milk products was adopted from the national aeronautics and space administration (n.a.s.a . ). The evaluation was performed by a panel composed of the staff and students in the department of food science and human nutrition . The evaluation rated the appearance, color, odor, flavor, and overall impression of the product, and results were expressed as very good (+ + +), good (+ +), acceptable (+), or unacceptable (-). Antioxidant capacity was measured with a 1,1-diphenyl-2-picrylhydrazyl (dpph) assay according to the method of brand - williams et al . With some modifications . A stock solution was prepared by dissolving 24 mg of dpph in 100 ml methanol . The working solution was obtained by mixing 10 ml stock solution with 45 ml methanol to obtain an absorbance of 1.1 0.02 units at 515 nm using a spectrophotometer . Milk extracts (750 l) were allowed to react with 1500 l of the dpph solution for 5 minutes in the dark . Trolox is a water - soluble derivative of vitamin e it is an antioxidant, like vitamin e, and is used in biological or biochemical applications to reduce oxidative stress or damage . Trolox equivalent antioxidant activity (teac) is a measurement of antioxidant strength based on trolox, measured in units called trolox equivalents (te), trolox equivalency is used as a benchmark for the antioxidant capacity of such a mixture . Thirty male adult swiss albino rats weighing 200 - 250 g 40 g were used . The animals were housed in standard cages and were assigned to a specific treatment diet . The composition of the basal diet was as follows: milk protein (12%), sucrose (5%), fat (10%), vitamin mixtures (1%), salt mixtures (4%), fiber (4%) and starch (64%). The positive control group was fed the basal diet and received 25 ppm mercury as mercuric chloride (hgcl2) in drinking water . The third group was fed the basal diet, received 25 ppm mercury as mercuric chloride (hgcl2) in drinking water, and was fed the high fiber fermented mare's milk solution containing probiotics . The weights of the rats were measured at the beginning and end of the experiment . In sera the following parameters were analyzed: urea was determined according to the methods of tietz . Glutathione - s - transferase (gst) activity was determined according to habig et.al .. lactate dehydrogenase (ldh) activity was determined according to bergmeyer . Samples of brain, cerebellum, and kidneys were taken, and fixed in 10% neutral buffered formalin for 24 hours . Paraffin sections 6 m thick were prepared and stained with hematoxylin and eosin (h & e) for the examination of tissue and cellular changes by light microscopy . Mean and standard deviation of the data from each experimental group were calculated and according the method described by miller and miller . The results of the sensory evaluation of the high fiber fermented mare's milk containing probiotics showed that it's appearance and color were rated good, and it's odor, flavor, and overall impression were rated table 1 shows a comparison of the composition and antioxidant capacity of fresh, fermented, and high fiber fermented mare's milk containing probiotics . Although the composition of all 3 was similar, the antioxidant capacity was highest in the high fiber probiotic fermented mare's milk compared to fresh or fermented mare's milk . Chemical compositions and antioxidant capacity of fresh, fermented, and high fiber fermented mare's milk as shown in table 2, the untreated (negative control) rats gained weight during this experiment, while there was a large decrease in the weight of the rats in the positive control group . The weight of the rats consuming the high fiber probiotic fermented mare's milk treated group increased rather than decreased during the course of this experiment . Body weight changes following different treatments treatment with mercuric chloride (positive control)resulted in an increase in the rat's kidney weight compared to the untreated negative control rats (table 3). Less kidney weight increase was observed in rats treated with mercury and high fiber probiotic fermented mare's milk, compared to the positive control animals . Kidney weight following different treatments the values of several biochemical markers measured in serum are shown in table 4 . There was a decrease in the activity of glutathione - s- transferase (gst) in the sera of the positive control rats compared to the untreated negative control rats . However, gst activity increased in the rats receiving the high fiber probiotic fermented mare's milk in addition to mercury . The activity of lactate dehydrogenase (ldh) increased in the group treated with mercuric chloride only; however, ldh activity decreased in the group that received mercuric chloride and high fiber probiotic fermented mare's milk . Serum creatinine levels in the positive control group decreased compared to the negative control . However, treatment with high fiber probiotic fermented mare's milk resulted in serum creatinine levels returning to normal values . There was a decrease in the concentration of serum triglycerides in the control positive group receiving mercury only, but the concentration of serum triglycerides was almost normal in the group that received mercury together with high fiber probiotic fermented mare's milk . There was a significant increase in the level of uric acid and urea in serum of the positive control group compared to the negative controls . However, uric acid and urea were lower in the group that ingested high fiber probiotic fermented mare's milk with mercury than in the negative control group . Biochemical markers of kidney function measured in serum histopathological changes in the brain and kidney sections stained with h&e were evaluated by light microscopy . There was generalized and localized edema in the white matter of cerebrum and cerebellum in the positive control rats . The positive controls also showed congested blood vessels in both cerebrum and cerebellum which may occur prior to edema . These sections showed neuronal necrosis in cerebrum, necrosis and chromatolysis of purkinje cells in the cerebellum, and demyelination in the axons of the neuropil . Histopathological changes in rat brain and kidney following different treatments the histopathological changes in kidneys of rats were also evaluated . In the positive control group, the renal epithelium suffered vacuolar and hydropic degeneration in most tubules . Necrotic debris occasionally formed acidophil casts within the tubuli . In some cases, necrosis of the whole tubules was observed . A few tubules showed hyaline droplet degeneration in their epithelium, together with some hyaline casts within tubular lumen . Perivascular and interstitial inflammatory cellular infiltrate with pyknosis of the nucleus was observed, as was severe cloudy swelling of renal tubular epithelium with moderate necrosis and hydropic degeneration but no significant histological alterations were shown in the glomeruli . Administration of high fiber probiotic fermented mare's milk partially protected the kidneys from the histopathological changes produced by mercury . The histopathological changes were severe with mercury alone but they were moderate to mild when mercury was administered together with high fiber probiotic fermented mare's milk . Rats treated with high fiber probiotic fermented mare's milk showed no histopathological changes in the brain . Mild changes were observed in kidneys as manifested by hydrophobic degeneration, necrosis, and hemorrhage, but no inflammatory cells or cloudy swelling were observed . These results indicate that high fiber probiotic fermented mare's milk protected the rats against the adverse effects produced by mercury in brain and kidney . In recent years the popularity of complementary medicine, such as the use of probiotics and functional foods has increased . Knowledge is accumulating that microbiota modulates gut physiology, immunological functions, and may produce other beneficial effects . This has led scientists to investigate the efficacy of probiotics, prebiotics and synbiotics in the treatment of diseases and toxicities . Increasing the variety of functional foods is a challenge, and the promotion and formulation of functional foods and may enhance human health . It is well documented that hgcl2 exposure promotes hg accumulation in all tissues, with the highest levels in the liver, followed by the kidney and blood . The increased blood urea and creatinine are in agreement with the results obtained by rana et al . In male rats treated with mercury . Elevated blood urea is known to be a function of or related to increased protein catabolism in mammals and/or the conversion of ammonia to urea as a result of increased synthesis of arginase enzyme involved in urea production . In agreement with this, the present results show that body weights decreased in animals treated with mercury indicating body wasting and increased protein catabolism . The increase in plasma urea and creatinine concentrations in the present experiment may be due to kidney dysfunction, as suggested by the increased weight of the kidneys . The decrease in the activity of gst in serum of rats receiving mercury is similar to the findings reported by el - missiry and shalaby, who found that the heavy metal cadmium decreased the activity of gst in brain and testes of male rats . El - demerdash also reported that cadmium caused a decrease in gst activity in fish . Gst catalyses the reaction of alkylating agents with the thiol (-sh) group of glutathione, thereby neutralizing an electrophilic site and rendering the products more water soluble . The decline in serum gst activity may be due to the effect of mercury on glutathione . Mercury has a high affinity to this molecule where a sulfhydryl, an amino and two carboxylic acid groups, as well as two peptide linkages, represents reactive sites for metals . Reactions of metals with glutathione may lead to either the formation of complexes or the oxidation of glutathione . High fiber probiotics fermented mare's milk was found to have a high antioxidant capacity (table 1). This high antioxidant capacity may contribute in ameliorating the oxidative stress effects and damage produced by mercury . Our results were similar to those of hussain et al, who found that the nervous system is affected by mercuric chloride toxicity . In our study, cellular and tissue changes were noticed in the positive control, including generalized and localized edema in the white mater of cerebrum and cerebellum . Edema is a clear sign of compromised blood - brain barrier to mercuric chloride intoxication . The positive control also showed congested blood vessels in both cerebrum and cerebellum which could be prior to edema . The neuronal changes could be due to oxidative stress secondary to mercuric chloride toxicity . In the rats fed the high fiber fermented mare's milk containing probiotic, the histological picture improved; this could be due to antioxidative stress effect of the high fiber fermented mare's milk containing probiotic . Oxidative stress may induce peroxidation injury in the membrane of lipids and protein as well as dna fragmentation, which can result in disruption of nerve cell function and integrity . It is well known that brain is more sensitive tissue to oxidative damage because of its high concentration of unsaturated lipids and its high rate of oxidative metabolism . We conclude that high fiber fermented mare's milk containing probiotic had a protective effect against brain and kidney alterations produced by mercury toxicity. |
Type 2 diabetes mellitus (t2 dm) has become a worldwide epidemic . It is estimated that 60% of the world's diabetic population is in asia . This rapid increase in the prevalence of t2 dm in asia has been fuelled by urbanization, economic growth and associated changes in diet and physical activity levels . Specifically, in korea, data derived from the korean national health and nutrition examination survey shows that t2 dm prevalence has increased moderately over the last decade from 7.7% in 2001 to 10.2% in 2010 . The most recent data report that the overall prevalence of diabetes in adults aged 30 years or older is 12.4% . In general, asian populations tend to develop diabetes at a younger age and at lower body mass index (bmi) levels than has been observed in caucasian populations . Recent research in korea has, however, revealed differences between both gender and age groups: prevalence had decreased amongst women aged 30 to 59 years (6.9% in 2001 to 4.5% in 2010), but increased amongst males aged 60 years or more (15.9% in 2001 to 21.6% in 2010). A similar age - related trend is also reflected in data from the korean health insurance review and assessment database, in which there were significant (p<0.001) decreases in annual incidence rates in younger adults (20 to 49 years) and increases in the elderly (70 to 79 years). In recognition of the progressive nature of t2 dm, the current korean clinical practice guidelines (korean diabetes association) suggest a stepped interventional approach . Lifestyle modification (which incorporates diet, exercise, and education) remains the foundation of the current clinical guidelines . However, because lifestyle modification alone does not enable glycemic goals to be achieved or maintained in most patients, metformin monotherapy should be added at, or soon after, diagnosis, unless there are contraindications or intolerance . Ultimately the addition of a basal insulin either alone or in combination with other agents will be required to maintain glucose control . Glycosylated hemoglobin (hba1c) plays an important role in monitoring and targeting glycemic control and is the gold standard index for follow - up of glycemic control . After lifestyle modification, treatment options are stratified according to the individual's hba1c status; patients whose hba1c is <8% would initially receive oral hypoglycemic agents only, those in whom it is 8% to 10% would receive oral hypoglycemic agent combination therapy with basal insulin and those whose hba1c is> 10% would receive insulin with or without oral hypoglycemic agents . Patients not at target (ideally 6.5%) within 2 to 6 months would receive an additional oral hypoglycemic agent (e.g., triple therapy) or a multiple - component insulin regimen again with or without oral hypoglycemic agents . Within these guidelines glucagon - like peptide-1 receptor agonists (glp-1ras) are recognized as providing a moderate (0.5% to 1.0%) reduction in hba1c, with no hypoglycemia and no weight gain . However, there are some concerns with respect to gastrointestinal (gi) side effects and the lack of long - term established safety profile . In this paper we review recent data on glp-1ras to help better understand their current risk / benefit profile and provide primary care practitioners with guidance on how this evidence can inform their clinical practice . Glp-1 is an incretin hormone secreted from gi l - cells early (within 10 minutes) after an ingested meal . Glp-1 stimulates insulin secretion in a glucose - dependent manner, suppresses glucagon secretion, delays gastric emptying, and suppresses appetite . This combination of effects makes a significant contribution to glucose homeostasis, particularly the control of postprandial glucose . The incretin response is markedly attenuated in people with t2 dm, making the incretin based system an attractive therapeutic target . However, the short plasma half - life (1 to 2 minutes) of glp-1 limits its suitability as a therapeutic agent for diabetes . Incretin enhancers, including dipeptidyl - peptidase 4 (dpp4) inhibitors and glp-1ras have therefore emerged as a novel class of glucose - lowering therapy . A systematic review aimed at evaluating the comparative effectiveness of these two drug classes has found both to be effective, with hba1c reductions of 0.59% to 0.90% with dpp4 inhibitors and 0.77% to 1.62% with glp-1ras . Here we focus only on the glp-1ras, which mimic the effects of endogenous glp-1, thereby stimulating pancreatic insulin secretion in a glucose dependent fashion, supressing glucagon out - put, slowing gastric emptying and decreasing appetite . Overall, the clinical advantages of glp-1ras are established in the literature; they provide significant improvements in glycemic control with a relatively low risk of hypoglycemia and are associated with moderate, but significant, weight loss (up to 3 kg in some clinical trials). Efficacy has been confirmed in a meta - analysis of 17 randomized trials comparing glp-1ras (exenatide, liraglutide, albiglutide, taspoglutide, lixisenatide) with placebo or an active comparator (insulin glargine, dpp4 inhibitor, thiazolidinedione, sulfonylurea) in patients with t2 dm and suboptimal control on one or two oral hypoglycemic agents (metformin and/or sulfonylurea). Although the duration of the individual trials ranged from 8 to 30 weeks, overall, in comparison to placebo, all glp-1ras reduced hba1c by approximately 1% (treatment difference 0.47% to 1.56%). Body weight reduction with glp-1ras has been confirmed in a meta - analysis of 21 industry - sponsored trials comparing glp-1ras with placebo, no intervention, or other diabetes medications in overweight patients with or without diabetes (weighted mean difference, -2.9 kg; 95% confidence interval [ci], -3.6 to -2.2). However, long - terms data on the durability of this effect are currently lacking . In addition, glp-1ras have beneficial effects on cardiovascular (cv) risk factors (body weight, blood pressure, postprandial lipids, markers of oxidative stress) with no suggestion of increased risk of cv disease: for example, exenatide cv disease - extended events, relative risk (rr) 0.69 (95% ci, 0.46 to 1.04); liraglutide major adverse cv events, incidence ratio 0.73 (95% ci, 0.38 to 1.41). In a recent ultrasonography study, 3 months treatment with a glp-1ra induced a redistribution of adipose tissue deposits, which may contribute to a better cv risk profile in patients with t2 dm . There are no long - term data to assess durability of weight loss, clinically important health outcomes (cv events, mortality), or safety of glp-1ras . The results of the liraglutide effect and action in diabetes: evaluation of cardiovascular outcome results (leader) study, formally assessing the cv safety of liraglutide, are awaited . Control of postprandial hyperglycemia is an important aspect of overall glycemic control and may contribute to lower cv morbidity and mortality . Data suggest that reduction of postprandial hyperglycemia may be particularly beneficial for patients early in the progression of diabetes . The relevance of postprandial hyperglycemia is heightened as hba1c levels decrease; thus, focusing on strategies to control it may increase a patient's ability to achieve their hba1c target . Recognizing the importance of postprandial glucose, international organizations (american association of clinical endocrinologists / american college of endocrinology, international diabetes federation, american diabetes association) now provide 2-hour postprandial glucose targets of between 7.8 to 10.00 mmol / l (140 to 180 mg / dl) in their treatment guidelines . Data from the diabetes epidemiology: collaborative analysis of diagnostic criteria in asia (decoda) and diabetes epidemiology: collaborative analysis of diagnostic criteria in europe (decode) studies suggest that the prevalence of post - challenge hyperglycemia is higher in asian patients than it is in caucasians . In a study of 68 korean patients with well - controlled t2 dm, glycemic variability and total glucose exposure were both mostly explained by postprandial glucose . It has been suggested that the high carbohydrate diet eaten by asians, including koreans, may increase postprandial glucose more rapidly than does a lower carbohydrate diet . In the authors' experience, postprandial hyperglycemia continues to present a problem when determining choice of treatment in patients with t2 dm; in korea anecdotal reports suggest that 50% to 60% of patients may be affected by postprandial glucose excursions . When lifestyle interventions have failed, the addition of oral anti diabetic agents (glucosidase inhibitors or meglitinides), a dpp4 inhibitor, short- or prandial - acting glp-1ra, or short - acting insulin (for patients already on basal insulin) may be of benefit . The glp-1ra class can be subdivided into two types: short - acting agonists and long - acting agonists, which each have different mechanisms of action and result in different effects on fasting and postprandial glucose levels . Short - acting glp-1ras (exenatide twice - daily and lixisenatide once a day) act intermittently to activate the glp-1 receptor and slow gastric emptying exerting their effects predominantly on postprandial plasma glucose . Phase ii data and the results from randomised controlled clinical trials consistently demonstrate that these glp-1ras reduce postprandial plasma glucose more effectively than they do fasting plasma glucose . For example, adding exenatide twice - daily to basal insulin (alone or in combination with metformin and/or pioglitazone), lead to significant reductions in morning and evening 2-hour postprandial excursions (both p<0.001 vs. placebo) whilst lixisenatide 20 g once a day has been shown to significantly reduce postprandial glucose when compared with placebo after breakfast (p<0.0001), lunch (p<0.001), and dinner (p<0.05). It is because of this effect on postprandial glucose that short - acting glp-1ras may be considered as prandial - acting glp-1ras . In contrast long - acting glp-1ras (liraglutide, dulaglutide, exenatide long - acting release [lar]) lead to sustained activation of the glp-1 receptor and have a greater impact on fasting plasma glucose and a lesser impact on gastric emptying owing to tachyphylaxis . To date there have been five studies directly comparing short- and long - acting glp-1ras, each demonstrating that the latter have a lesser effect on postprandial glucose . In duration-1, exenatide 10 g twice - daily had a greater effect on postprandial glucose than did exenatide lar 2 mg once weekly (least - squares meanstandard error -6.9 mmol / l vs. -5.30.5 similar results were found in the liraglutide effect and action in diabetes (lead) 6 study; the estimated difference in postprandial glucose reduction was higher with exenatide 10 g twice - daily than with liraglutide 1.8 mg once a day, when measured at breakfast (1.33 mmol / l, p<0.0001) and at dinner (1.01 mmol / l, p<0.0005). In a study comparing lixisenatide 20 g once a day and liraglutide 1.8 mg once a day in patients with t2 dm insufficiently controlled on metformin, more patients in the lixisenatide group achieved a 2-hour postprandial plasma glucose of <7.8 mmol / l (69% vs. 29%). In a study comparing once - daily lixisenatide with liraglutide in patients on optimised insulin glargine with or without metformin therapy improvement in postprandial glucose levels was significantly greater with lixisenatide 20 g once a day versus liraglutide 1.2 and 1.8 mg once a day (p<0.0001 for both comparisons). Most recently, the assessment of weekly administration of ly2189265 (dulaglutide) in diabetes-1 (award-1) study, comparing dulaglutide 0.75 and 1.5 mg once weekly with exenatide 10 g twice - daily, demonstrated significantly greater reductions in the mean of all 2-hour postprandial glucose excursions with exenatide than in the two dulaglutide dose groups (p<0.001 for both comparisons). Recently published data have demonstrated differences in the efficacy of glp-1ras between asian and non - asian populations . Whilst this meta - analysis included data from studies with liraglutide and exenatide, it demonstrated a significant difference in the hba1c - lowering efficacy of glp-1ras in asians (weighted mean difference -0.32 [-0.64; 0.01]; p=0.044) and a trend for more asian patients to achieve target hba1c goals . Nevertheless, data from a population with a significant proportion of korean patients are rare . Amongst the studies included in the recent meta - analysis three included only japanese patients whilst one included patients of asian descent, of which 17% were korean . In addition to the study by gao et al ., four other studies, have reported efficacy data for glp-1ras in korean patients with t2 dm (table 1). Evaluated the efficacy of exenatide in asian patients with t2 dm inadequately controlled with oral agents, showing improved glycemic control (mean hba1c reduction: -1.2% vs. -0.4%, p<0.001), and greater weight reduction (-1.2 kg vs. -0.1 kg) compared with placebo . Shin et al . Reported the results of a retrospective cohort analysis of 52 korean patients; 6 months' therapy with exenatide had significantly reduced hba1c (8.5% to 6.7%, p<0.001) and body weight (82.3 to 78.6 kg, p<0.001); no serious adverse events were reported . Of note the patients were young (mean age 45.1 years) and obese (mean bmi 30.0 kg / m). 2011 included chinese, indian, and korean (167/929, 18%) patients; it demonstrated liraglutide to have a similar efficacy profile in asian patients to that seen in caucasian, african american and hispanic populations in other global liraglutide phase iii trials . In the global harmony-7 study, five of the 162 study sites were in korea . Patients who received liraglutide once a day had greater reductions in hba1c than did those who received albiglutide once weekly . Of note the patients were older (mean age 55 years), had a long duration of diabetes (mean 8.4 years) and were obese (mean bmi> 30.0 kg / m). Lixisenatide, 20 g once a day, as add - on therapy in patients with t2 dm insufficiently controlled on basal insulin (with or without sulfonylurea) significantly improved hba1c vs. placebo and enabled more patients to achieve hba1c target (<7% and <6.5%). Although there was a trend towards weight loss for lixisenatide (p=0.0857) in this study, the observed weight losses were small (-0.38 kg and + 0.06 kg in the lixisenatide and placebo groups, respectively) possibly due to the low mean baseline bmi (25 kg / m) and body weight (66 kg). Fear of hypoglycemia is a major barrier to optimizing glycemic control in patients with t2 dm . Hypoglycemic events increase the direct and indirect economic burden of diabetes and also have a negative impact on a patient's quality of life and confidence in diabetes self - management ability . Preventing hypoglycemic events and the early detection of patients at high risk for hypoglycemia are important aspects of clinical care . In the recent meta - analysis by kim et al ., there was no significant difference in the rr of hypoglycemia with glp-1ras between asian and non - asian populations (2.8 vs. 1.5, respectively; p=0.164). In the study by gao et al . The incidence of symptomatic hypoglycemia was higher in exenatide - treated patients than those who received placebo (36% and 9%, respectively; p<0.001). Hypoglycemia rates (events / patient - year) for patients taking exenatide with metformin alone were 1.8 and this increased to 4.7 amongst those taking metformin plus a sulfonylurea . There were no reported incidences of hypoglycemia in the retrospective cohort analysis 52 korean patients after 6 months' therapy with exenatide ., only two subjects in the glimepiride group reported major hypoglycemia while there were none in the liraglutide groups . In the getgoal - l - asia study 42.9% of lixisenatide - treated patients and 23.6% of those receiving placebo reported symptomatic hypoglycemia; none of these events was severe . When patients also receiving a sulfonylurea were excluded the incidence of hypoglycemia in the lixisenatide group was comparable to that in the placebo group (32.6% vs. 28.3%). The most frequently reported adverse events with glp-1ras are gi related and include nausea, vomiting, and diarrhea . For example, a study of lixisenatide versus liraglutide found that the incidences of nausea (23% vs. 22%) and vomiting (10% vs. 7%) were similar in both groups, whereas diarrhea was more common in the liraglutide group (16% vs. 3%). A recent meta - analysis sought to interrogate the data from randomised controlled trials with glp-1ras (liraglutide and exenatide) and assess the impact of different doses on gi adverse events . Pairwise random - effects meta - analyses and mixed treatment comparisons found that, relative to placebo, exenatide 10 mg twice - daily is significantly more likely to cause nausea and vomiting whilst liraglutide 1.2 mg once a day is significantly more likely to cause diarrhea . However the meta - analysis included only liraglutide and exenatide and did not provide specific data on asian patients . As with efficacy, there is limited data on the gi tolerability of glp-1ras in asian populations and even more so in korean patients . The recent meta - analysis found that the rr of nausea (13.8 vs. 3.3, p=0.100) and vomiting (21.0 vs. 5.2, p=0.205) were numerically higher in asians than in non - asians but were not statistically significantly different . Conversely, the rr of diarrhea was numerically, but not statistically, higher in non - asians (1.7 vs. 2.6, p=0.275). In a korean retrospective cohort analysis of patients who used exenatide, 23/143 (16.1%) had nausea and 17 (11.9%) suffered from vomiting . Only eight patients stopped taking exenatide due to anorexia or vomiting, all had above target hba1c levels and were receiving two oral hypoglycemic agents but not insulin in the 3 months prior to study inclusion . Reported a similar safety profile with the use of exenatide in asians as in non - asian patients; nausea, which was generally mild - to - moderate, as the most common adverse event with exenatide (25% vs. 1% with placebo). A total of 64 subjects (7%) withdrew from the study by yang et al . Adverse gi events, predominantly diarrhea, nausea, and vomiting led to the majority of these withdrawals . Amongst those gi adverse events most occurred within the first 4 weeks, were transient and decreased over time . In the harmony-7 study patients in the albiglutide group had more injection - site reactions and fewer gi adverse events than did those in the liraglutide group . In the getgoal - l - asia study 61% of patients in the lixisenatide group reported having had a gi adverse event versus 14.6% in the placebo group; nausea occurred most frequently (39.6% of patients), followed by vomiting (18.9%) and diarrhea (6.5%). In this exclusively asian population, the frequency of nausea was slightly higher than had been observed in global populations (39.6% vs. 22% to 25%). Potential explanations for the higher incidence of gi adverse events amongst asian patients include higher drug exposure due to the lower bmi of the participants (vs. non - asian studies). Gi adverse events are generally transient; they tend to be higher during the first 2 weeks of treatment and often decrease with ongoing use . Nevertheless, when such events are experienced in the early stages of treatment they have the potential to impact patient compliance . To help with this, patients should be informed of the potential for these effects, including their likely duration, before treatment commences . Fear of hypoglycemia is a major barrier to optimizing glycemic control in patients with t2 dm . Hypoglycemic events increase the direct and indirect economic burden of diabetes and also have a negative impact on a patient's quality of life and confidence in diabetes self - management ability . Preventing hypoglycemic events and the early detection of patients at high risk for hypoglycemia are important aspects of clinical care . In the recent meta - analysis by kim et al ., there was no significant difference in the rr of hypoglycemia with glp-1ras between asian and non - asian populations (2.8 vs. 1.5, respectively; p=0.164). In the study by gao et al . The incidence of symptomatic hypoglycemia was higher in exenatide - treated patients than those who received placebo (36% and 9%, respectively; p<0.001). Hypoglycemia rates (events / patient - year) for patients taking exenatide with metformin alone were 1.8 and this increased to 4.7 amongst those taking metformin plus a sulfonylurea . There were no reported incidences of hypoglycemia in the retrospective cohort analysis 52 korean patients after 6 months' therapy with exenatide ., only two subjects in the glimepiride group reported major hypoglycemia while there were none in the liraglutide groups . In the getgoal - l - asia study 42.9% of lixisenatide - treated patients and 23.6% of those receiving placebo reported symptomatic hypoglycemia; none of these events was severe . When patients also receiving a sulfonylurea were excluded the incidence of hypoglycemia in the lixisenatide group was comparable to that in the placebo group (32.6% vs. 28.3%). The most frequently reported adverse events with glp-1ras are gi related and include nausea, vomiting, and diarrhea . For example, a study of lixisenatide versus liraglutide found that the incidences of nausea (23% vs. 22%) and vomiting (10% vs. 7%) were similar in both groups, whereas diarrhea was more common in the liraglutide group (16% vs. 3%). A recent meta - analysis sought to interrogate the data from randomised controlled trials with glp-1ras (liraglutide and exenatide) and assess the impact of different doses on gi adverse events . Pairwise random - effects meta - analyses and mixed treatment comparisons found that, relative to placebo, exenatide 10 mg twice - daily is significantly more likely to cause nausea and vomiting whilst liraglutide 1.2 mg once a day is significantly more likely to cause diarrhea . However the meta - analysis included only liraglutide and exenatide and did not provide specific data on asian patients . As with efficacy, there is limited data on the gi tolerability of glp-1ras in asian populations and even more so in korean patients . The recent meta - analysis found that the rr of nausea (13.8 vs. 3.3, p=0.100) and vomiting (21.0 vs. 5.2, p=0.205) were numerically higher in asians than in non - asians but were not statistically significantly different . Conversely, the rr of diarrhea was numerically, but not statistically, higher in non - asians (1.7 vs. 2.6, p=0.275). In a korean retrospective cohort analysis of patients who used exenatide, 23/143 (16.1%) only eight patients stopped taking exenatide due to anorexia or vomiting, all had above target hba1c levels and were receiving two oral hypoglycemic agents but not insulin in the 3 months prior to study inclusion . Reported a similar safety profile with the use of exenatide in asians as in non - asian patients; nausea, which was generally mild - to - moderate, as the most common adverse event with exenatide (25% vs. 1% with placebo). A total of 64 subjects (7%) withdrew from the study by yang et al . Adverse gi events, predominantly diarrhea, nausea, and vomiting led to the majority of these withdrawals . Amongst those gi adverse events most occurred within the first 4 weeks, were transient and decreased over time . In the harmony-7 study patients in the albiglutide group had more injection - site reactions and fewer gi adverse events than did those in the liraglutide group . In the getgoal - l - asia study 61% of patients in the lixisenatide group reported having had a gi adverse event versus 14.6% in the placebo group; nausea occurred most frequently (39.6% of patients), followed by vomiting (18.9%) and diarrhea (6.5%). In this exclusively asian population, the frequency of nausea was slightly higher than had been observed in global populations (39.6% vs. 22% to 25%). Potential explanations for the higher incidence of gi adverse events amongst asian patients include higher drug exposure due to the lower bmi of the participants (vs. non - asian studies). Gi adverse events are generally transient; they tend to be higher during the first 2 weeks of treatment and often decrease with ongoing use . Nevertheless, when such events are experienced in the early stages of treatment they have the potential to impact patient compliance . To help with this, patients should be informed of the potential for these effects, including their likely duration, before treatment commences . The available data, in global and asian populations, support a number of benefits with the use of glp-1ras . These include a reduction hba1c levels, weight maintenance or loss, and a relatively low risk of hypoglycemia . These benefits are offset against the propensity for gi adverse effects early in the course of treatment and a lack of long - term outcomes data . Population statistics suggest that increasing age and obesity are key factors contributing to t2 dm in korea . In a cohort study involving 34,999 korean men and women aged 30 to 59 years who were free of diabetes at baseline, metabolic health status, obesity, and weight change were all shown to be independently associated with increased incidence of t2 dm over 5 years of follow - up . Whilst the overall prevalence of diabetes in adults 30 years and older is 12.4%, it increases with age such that it affects 23.2% of koreans aged 60 to 69 years and 25.9% of those aged 70 years or more . Half of all koreans with t2 dm are obese (when defined as a bmi 25.0 kg / m and a waist circumference> 90 cm in men and> 85 cm in women) with data showing the highest prevalence of obesity (63.6%) and abdominal obesity (57.6%) amongst those aged 40 to 49 years . Given these statistics, treatment approaches that contribute to weight management such as the glp-1ras are becoming more relevant in the current management of t2 dm in korea . The inclusion of a prandial glp-1ra into the treatment regimen of overweight patients with high hba1c due to postprandial hyperglycemia is reasonable . Other clinical factors that may aid in treatment choice include uncontrolled hba1c due to high postprandial (rather than fasting) blood glucose levels, need to control weight particularly amongst patients who already have a basal insulin as part of their regimen, patients at increased risk of hypoglycemia and patients with or at high risk of cv comorbidities, such as hypertension and fatty liver . The different pharmacodynamic features of glp-1ras may help guide the decision to administer a glp-1ra with basal insulin; using short - acting lixisenatide or exenatide twice - daily in patients with prandial or postprandial hyperglycemia after near normalisation of fasting blood glucose and long - acting exenatide lar, liraglutide, albiglutide or dulaglutide if the main concern is elevated fasting blood glucose levels . Whilst korean - specific data are limited, much progress has been made in understanding the full scope of their utility in the management of t2 dm . Gaps in the literature that would warrant further research in the korean population include the impact of glp-1ra treatment on the recovery of insulin secretion, their effects on -cell function and insulin sensitivity, whether they modulate improvements in endothelial dysfunction, their impact on lipid metabolism and any associations between their glucose lowering efficacy and gi side effects . In concluding, we ask the question how does the above data help inform the optimal management of t2 dm in korea? The global data, in general, demonstrate that glp-1ras can contribute to patient management, providing beneficial reduction in hba1c, without weight gain or hypoglycemia . More data are needed to examine efficacy, safety, and optimal dosing of glp-1ras in korean patients with t2 dm . However, based on the data currently available, their use is appropriate in several patient groups, including patients whose hba1c is uncontrolled, especially if this is due to postprandial glucose excursions and patients who are overweight or obese due to dietary problems (e.g., appetite control). Whether or not the potential for gi adverse events is increased in asian patients, the possibility that it might occur should be explained to patients at treatment initiation to help maintain patient compliance. |
A recent survey showed that oral cancer, which accounts for 2.8% of all malignant tumors in europe, is the most common cause of maxillofacial defects . Moreover, the incidence of oral cancer in china is relatively high compared with the rest of the world . Severe deficiencies in appearance, pronunciation and swallowing occur when maxillofacial defects cause oral nasal transport ., prosthodontists have tried to help these patients by separating the oral and the nasal cavity using obturator prostheses to improve deglutition, articulation, pronunciation and facial appearance, and in some cases to support the orbital contents to prevent enophthalmos and diplopia . The absence of teeth, and the size and configuration of the maxillary defect, may influence the masticatory function of patients wearing an obturator prosthesis and may lead to a poor rehabilitation outcome . Moreover, the adequate retention of these prostheses is difficult to achieve, especially for large - sized defects . For many years, prosthodontists have tried different ways to achieve better retention for cases who have undergone extensive maxillectomy . Schmidt et al . Used zygomatic and standard endosseous implants to retain prostheses in near - total and total maxillectomy patients . Reported the case of a partial maxillectomy patient with an obturator that was supported by five mini - dental implants . The author concluded that mini - dental implants can be used when there is a lack of adequate bone tissue for conventional implant placement in the region of the resection . However, for some patients, these implants are not acceptable due to their general health, personal inclination or economic reasons . Finding payne and welton designed a latex rubber balloon attached to a denture that was inflated with air to fill the surgical defect, but its clinical usage has not been reported . In the last decade, this article is the first to describe the restoration of maxillary defects with inflatable obturator prostheses based on silicone, which also represented an alternative technique for maxillofacial rehabilitation . A 20-year - old male patient diagnosed with fibrous dysplasia was referred to the department of prosthodontics, peking university school and hospital of stomatology . His chief complaints were deficiencies in speaking and swallowing after extensive resection of the maxilla 3 months previously (figure 1). The patient had undergone bilateral sub - total maxillectomy, which resected most of the maxillary structures; only a portion of the maxillary tuberosity remained . No surgical reconstruction or any graft for the defect had been applied . Clinical investigation showed an extensive defect of the palatal area and crest ridge, which was classified as a class iv defect according to aramany's classification . Transport between the oral cavity and the nasal cavity was observed, and the surgical site showed tolerable healing with the formation of a scab and no sign of recrudescence (figure 2). As the maxillectomy defect included almost the whole palatal area, the amount of undercut area available to provide retention for a prosthesis was very limited, making adequate retention by traditional methods extremely difficult . However, the use of endosseous implants in pathological bone has not been thoroughly investigated and some commentaries suggest avoiding it for cases of fibrous dysplasia . Furthermore, the patient did not want to accept implant therapy for economic reasons . Sectional maxillary prosthesis, including a complete denture and an inflatable obturator, was used to restore the extensive maxillary defect . The definitive maxillary denture (luciton 199 denture base material; dentsply, york, pennsylvania, usa) was made according to the mandibular dentition with proper occlusion contact . On the intaglio side of the denture, an appropriate undercut that imitated an edentulous ridge contour was made so that the complete denture could be retained afterwards (figure 3). Then, impression material (rapid putty soft; coltene / whaledent, altsttten, switzerland) was placed into the intaglio surface of the denture . This material is easy to control and it is not likely to enter deep undercut areas under appropriate pressure . When the impression was made, we ensured that the maxillary denture had a good occlusal contact with the mandibular dentition . The jaw position was guided to the appropriate occlusal vertical dimensions by measuring the distance of the points marked on the patient's face at rest, and was maintained in this position until the impression material had set (figures 3 and 4). The impression was poured with dental stone (die - stone type iii; heraeus, south bend, indiana, usa) to form the working cast, and a one - way air valve (botou shengwei factory, botou city, hebei province, china) was fixed on the palatal surface of the obturator when the obturator prosthesis was made . Odontosil (dreves, unna, germany) silicone material was used to process the hollow silicone obturator prosthesis in the laboratory (figure 5). The obturator prosthesis and the definitive denture were then trialed by the patient, and an adequate vertical dimension and retention of the prosthesis was demonstrated (figure 6). When the patient tried the sectional maxillary prosthesis by himself, the compressed obturator was firstly seated in the defect, and the patient could inflate it using a portable air pump (figure 7) to connect the installed air - valve on the palatal surface of the obturator . When inflated, the obturator was well - fitted with extending evenly into the undercuts . The denture was then seated on the inflated obturator by engaging the suitable undercuts on the palatal surface of the obturator formed during the manufacture of the denture . When the patient wishes to remove the obturator, the compressed air pump is connected directly with the valve to deflate it after the denture is removed . A 68-year - old male complained of deficiencies in speaking, swallowing and mastication after bilateral total maxillectomy 3 months previously (figure 8). A hollow inflatable silicone obturator prosthesis combined with a complete denture was prescribed for the patient according to the procedure described above (figures 9 and 10). When inflated, the obturator was well - fitted and provided adequate support and retention for the complete denture . A 20-year - old male patient diagnosed with fibrous dysplasia was referred to the department of prosthodontics, peking university school and hospital of stomatology . His chief complaints were deficiencies in speaking and swallowing after extensive resection of the maxilla 3 months previously (figure 1). The patient had undergone bilateral sub - total maxillectomy, which resected most of the maxillary structures; only a portion of the maxillary tuberosity remained . No surgical reconstruction or any graft for the defect had been applied . Clinical investigation showed an extensive defect of the palatal area and crest ridge, which was classified as a class iv defect according to aramany's classification . Transport between the oral cavity and the nasal cavity was observed, and the surgical site showed tolerable healing with the formation of a scab and no sign of recrudescence (figure 2). As the maxillectomy defect included almost the whole palatal area, the amount of undercut area available to provide retention for a prosthesis was very limited, making adequate retention by traditional methods extremely difficult . However, the use of endosseous implants in pathological bone has not been thoroughly investigated and some commentaries suggest avoiding it for cases of fibrous dysplasia . Furthermore, the patient did not want to accept implant therapy for economic reasons . Sectional maxillary prosthesis, including a complete denture and an inflatable obturator, was used to restore the extensive maxillary defect . The definitive maxillary denture (luciton 199 denture base material; dentsply, york, pennsylvania, usa) was made according to the mandibular dentition with proper occlusion contact . On the intaglio side of the denture, an appropriate undercut that imitated an edentulous ridge contour was made so that the complete denture could be retained afterwards (figure 3). Then, impression material (rapid putty soft; coltene / whaledent, altsttten, switzerland) was placed into the intaglio surface of the denture . This material is easy to control and it is not likely to enter deep undercut areas under appropriate pressure . When the impression was made, we ensured that the maxillary denture had a good occlusal contact with the mandibular dentition . The jaw position was guided to the appropriate occlusal vertical dimensions by measuring the distance of the points marked on the patient's face at rest, and was maintained in this position until the impression material had set (figures 3 and 4). The impression was poured with dental stone (die - stone type iii; heraeus, south bend, indiana, usa) to form the working cast, and a one - way air valve (botou shengwei factory, botou city, hebei province, china) was fixed on the palatal surface of the obturator when the obturator prosthesis was made . Odontosil (dreves, unna, germany) silicone material was used to process the hollow silicone obturator prosthesis in the laboratory (figure 5). The obturator prosthesis and the definitive denture were then trialed by the patient, and an adequate vertical dimension and retention of the prosthesis was demonstrated (figure 6). When the patient tried the sectional maxillary prosthesis by himself, the compressed obturator was firstly seated in the defect, and the patient could inflate it using a portable air pump (figure 7) to connect the installed air - valve on the palatal surface of the obturator . When inflated, the obturator was well - fitted with extending evenly into the undercuts . The denture was then seated on the inflated obturator by engaging the suitable undercuts on the palatal surface of the obturator formed during the manufacture of the denture . When the patient wishes to remove the obturator, the compressed air pump is connected directly with the valve to deflate it after the denture is removed . A 68-year - old male complained of deficiencies in speaking, swallowing and mastication after bilateral total maxillectomy 3 months previously (figure 8). A hollow inflatable silicone obturator prosthesis combined with a complete denture was prescribed for the patient according to the procedure described above (figures 9 and 10). When inflated, the obturator was well - fitted and provided adequate support and retention for the complete denture . In case 1, a large palatal defect was evident after surgery for fibrous dysplasia . Oral nasal transport and the resultant functional deficiencies greatly affected the patient's quality of life . However, the lack of structures to provide retention made it extremely difficult to construct a conventional prosthesis for him . A recent report of the use of endosseous implants has been described in a patient with fibrous dysplasia; however, osseointegration in the pathological bone at a microscopic level has not yet been proven . The inflatable hollow obturator prosthesis may be a suitable alternative in patients such as this one who did not want to undergo oral implant treatment for medical and/or economic reasons . When dealing with extensive defects, the prosthesis requires greater extension into the defect and is therefore heavier . As described in the literature, the continuous stress placed on the remaining tissues by a large, heavy obturator jeopardizes their health, compromises the function of the prosthesis and can cause discomfort to the patient . The use of a hollow maxillary obturator may reduce the weight of the prosthesis by up to 33%, depending on the size of the maxillary defect . Shaker used medical - grade silicone to fabricate the obturator part of the prosthesis with mushroom - like extensions . It was retained by this resilient material which engaged the soft tissue undercuts within the defect . However, the extension into the undercut by this obturator has to be limited, or else its insertion may cause discomfort and bleeding . Our inflatable obturator can be easily placed in undercuts when compressed and extends further when inflated, thereby improving retention without causing obvious discomfort . Compared with the semi - customized balloon - shaped inflatable latex obturator designed by payne and welton, this new hollow and inflatable obturator is completely customized according to the configuration and size of defects and has been proven clinically . With this advantage, an obturator with the same shape as the defect can extend into the undercut area and engage the undercut more evenly . The inflatable hollow obturator is lightweight, can be retained well and creates an adequate oral deglutition, pronunciation and mastication can be improved and the psychological impact of extensive maxillectomies on patients can therefore be minimized . When faced with patients with microstomia after surgery, an inflatable obturator may also be an alternative option as the obturator can be seated into the oral cavity while deflated and compressed . In cases of extensive maxillectomy in which implants cannot be used, as in the two cases in this report, the inflatable obturator makes prosthetic treatment more acceptable as good retention is achieved by engaging more undercut areas after inflation . In cases of partial maxillectomy, the use of an inflatable obturator may minimize deleterious forces on the remaining structures as further support is gained from surrounding tissues . Silicone - based inflatable obturators offer a simple technique for the reconstruction of maxillary defects, can be used by most prosthodontists and offer a treatment alternative for patients who may not be able to receive conventional implants . However, the extent to which the inflatable obturator improves pronunciation, deglutition and mastication compared with traditional prostheses, and the long - term serviceability of this prosthesis, requires further investigation. |
Administrative qof data describing performance of family practices under the program were analyzed for the years 20042008 (3). Data for each family practice included the number of registered diabetic subjects, the proportion of eligible subjects who achieved the targets, and the proportion of diabetic subjects excluded from evaluation of each target as exceptions . Exceptions arise because practices are permitted to identify some individuals as ineligible for evaluation if the target is regarded as clinically inappropriate (4). The targets included in this report were the percent of diabetic subjects with the last a1c 7.5%, with last blood pressure 145/85 mmhg, or with the last measured total cholesterol 5 mmol / l . We estimated the total number of registered diabetic subjects, the total number excluded as ineligible, and the number (and percent) of subjects who achieved the target after allowing for exclusions . The linear association between outcomes and year was estimated using robust standard errors to allow for repeated measures . Data were analyzed for family practices in england that remained independent and had more than 750 registered patients or more than 500 patients per doctor, in the study year . Data were analyzed for 8,423 practices in 20042005, 8,264 in 20052006, 8,192 in 20062007, and 8,255 in 20072008, representing 98% of all practices . The median number of registered diabetic subjects per practice increased from 181 (interquartile range [iqr] 107284) in 20042005 to 218 (iqr 130342) in 20072008 (table 1). The estimated resident population of england is 51 million (5), giving an overall prevalence of 4% . The median practice - specific proportion of diabetic subjects declared ineligible for the a1c target was 9.4% in 20042005 but declined to 8.7% in 20072008 (p <0.001). The median proportion excluded for the blood pressure target was 6.3% in 20042005 declining to 5.7% in 20072008 (p <0.001) and for cholesterol was 9.0% in 20042005 declining to 8.4% in 20072008 (p <0.001). The median practice - specific proportion achieving the a1c target of 7.5% increased from 59.1% in 20042005 to 66.7% in 20072008 (table 1). The proportion achieving the blood pressure target of 145/85 mmhg increased from 70.9% in 20042005 to 80.2% in 20072008 . The proportion achieving the cholesterol target of 5 mmol / l increased from 72.6% in 20042005 to 83.6% in 20072008 . The estimated annual increase in percent of diabetes subjects achieving targets was 3.03% (95% ci 2.953.10; p <0.001) for the a1c target, 3.26% (3.183.34; p <0.001) for the blood pressure target, and 3.99% (3.924.07; p <0.001) for the cholesterol target . The total number of diabetic subjects in england achieving the a1c target, after allowing for exclusions from assessment, increased by 341,173 between 20042005 and 20072008, representing 16% of diabetic subjects registered in 20072008 . Over the same period, the number achieving the blood pressure target increased by 453,785 (22% of 20072008 registrations), and the number achieving the cholesterol target increased by 452,347 (22% of 20072008 registrations). Practices were classified as low performing if they achieved less than the 25th centile for the a1c target across all practices in 20062007 . There were 57% of practices classified as low performing in 20042005 . Among the 10 english regions, 69.9% of practices were low performing in london compared with the overall proportion of low - performing practices declined to 47.4% in 20052006, 25.0% in 20062007, and 26.0% in 20072008 . In 20072008, the proportion of low - performing practices ranged from 37.5% in london to 11.6% in the north east . In the u.k ., the care of subjects with type 2 diabetes is increasingly undertaken outside of specialist clinics by family physicians and practice nurses in primary care . This has led to concerns that some patients may experience poor - quality care (6). The new national contract for family practices introduced in 2004 appears to have achieved favorable results in its initial year (4,7) and may have contributed to reducing socioeconomic inequalities in care (8,9). Lower - performing practices have shown the greatest improvements, and regional variations in care have reduced . There has been a substantial increase in the proportion of all diabetic subjects achieving intermediate outcome targets . In our previous report (7), we analyzed clinical data from individual patient records for 26 practices during the period of 20002003 that gave results consistent with administrative data from the qof . Two other reports, including data from the first or second years of qof, suggest that qof data are consistent with audits of individual patient records (10,11). In a single group study, without any control practices, it is not possible to conclude that pay - for - performance incentives caused the observed changes . There was already evidence of improving quality of care before the introduction of qof (7,12). The qof targets are designed for audit rather than best practice, and practitioners may be utilizing clinical practice guidelines that recommend more stringent targets . Recommendations for a widespread use of statins were introduced in many countries at the start of this period, leading to improvements even in the absence of pay - for - performance . The greater improvement of low - performing practices may, in part, be accounted for by a ceiling effect, which restricted the potential improvement in high - performing practices . We caution that it is not clear that proposed benefits from pay - for - performance would be observed if this model is adopted in systems with different organizational arrangements and models of practitioner remuneration. |
Polycystic ovary syndrome (pcos) is a heterogeneous syndrome, involving a growing number of women in reproductive age, diagnosed on the basis of three different factors: oligo- or anovulation, clinical / biochemical hyperandrogenism, and polycystic ovary, with the presence on ultrasound of 12 follicles in each ovary measuring 2 9 mm in diameter and/or increased ovarian volume (> 10 ml) [1, 2]. Pcos affected patients that had menstrual irregularity, followed in many cases by infertility [3, 4] and mood disorders, such as anxiety and depression . Though pcos pathogenesis still remains unclear, insulin resistance (ir) and the consequential hyperinsulinemia are considered primary triggers, both in obese and in lean women with this syndrome [68]. Indeed, hyperinsulinemia induced by ir occurs in roughly 80% of pcos obese women, as in 3040% of pcos lean women, suggesting that ir is independent but also exacerbated by obesity; this latter considered an enhancing factor that positively correlates with the multifactorial syndrome [1012]. It was hypothesized that in patients with pcos altered insulin signaling may generate the ir which in turn causes abnormal ovarian steroidogenesis [13, 14], so that several insulin - sensitizing compounds have been proposed as possibly safe and efficacious long - term treatment of pcos . Among these drugs, metformin resulted to be the most used and studied drug, even if this molecule is predominantly associated with gastrointestinal discomforts consisting of bloating, nausea, and diarrhea [14, 16]. Interesting and promising results have been obtained focusing on two inositol stereoisomers, such as myo - inositol (mi) and d - chiro - inositol (dci), acting like insulin mediators [1719]. As insulin second messengers, both these molecules are involved in increasing insulin sensitivity of different tissues to improve metabolic and ovulatory functions . In particular, at low dosage, dci restores normal insulin sensitivity in the typical insulin target tissues, reducing the circulating insulin and androgens and inducing an enhancement in ovulation frequency . On the contrary, mi exerts its beneficial effects mainly at the ovary level, where it is highly concentrated, both enhancing insulin pattern and also directly acting on a number of ovarian functions, including steroidogenesis . Some authors postulated that pcos affected women, with ir, presenting in the ovary a misbalance in mi / dci ratio, resulting in dci overproduction and in turn in a deficiency in mi, which would explain the excessive androgen biosynthesis . Other authors, instead, proposed that the increased androgen levels in pcos patients might be linked to a decreased mi / dci . In a recent study, facchinetti et al . Discovered that the physiological mi / dci ratio was 40: 1 and, based on this finding, as well as on the specific behavior of both stereoisomers, we investigated the effects of a therapy that combines mi plus dci in the ratio of 40: 1, versus placebo, in order to improve some clinical outcomes in pcos young overweight women . This randomized controlled trial enrolled 46 obese women with bmi> 30 who were affected by pcos according to rotterdam criteria [1, 2]. All the women were enrolled at the department of clinical and experimental medicine, university of pisa . Patients with diabetes, smokers, and alcohol users were ruled out from the study . After all patients subscribed their written informed consent to be involved into the study, they were randomly assigned to two groups, a and b. at baseline, patients in groups a and b did not differ significantly . In group a, 21 women received mi plus dci combined treatment at the ratio of 40: 1 (the physiologic ratio of the two isomers in the body) in soft gel capsule containing 550 mg of mi, 13.8 mg of dci, and 200 g of folic acid (inofolic combi, lo.li.pharma) twice a day . Group b, with 25 women, received the same amount of folic acid (200 g) as placebo twice a day . All patients were evaluated for fsh, lh, 17-beta - estradiol (e), sex hormone binding globulin (shbg), androstenedione, free testosterone, and dehydroepiandrosterone sulphate (dheas) levels at the baseline and after the six months of therapy with mi plus dci association or with placebo . Fsh and lh serum levels were detected by immune - enzymatic assay (access immunoassay system, hlh, hfsh, beckman coulter, brea, ca, usa). Estradiol levels were measured by competitive immunoassay (access immunoassay system, estradiol, beckman coulter, brea, ca, usa). Shbg levels were detected by immunoassay (access immunoassay system, shbg, beckman coulter, brea, ca, usa). Serum levels of androstenedione were measured by conventional immune - enzymatic assay (access immunoassay system, androstenedione, beckman coulter, brea, ca, usa). Free testosterone serum levels were measured by immune - enzymatic assay (access immunoassay system, free testosterone, beckman coulter, brea, ca, usa). Dheas was measured by conventional immunoassay (access immunoassay system, dheas, beckman coulter, brea, ca, usa). Insulin resistance was measured by means of homeostasis model assessment (homa) in addition to determining fasting glucose and insulin with the same timeline and modalities . Blood samples, taken at the baseline and after the six - month treatment period under similar conditions, were separated by centrifugation at 2000 g for 15 minutes at 4c, and the serum obtained was stored at 20c within one hour of collection . Before the analysis, all the serum samples were thawed and entirely mixed . Data reported indicate mean values standard deviation (sd). Paired t - test was used to identify the differences between variables at baseline and after six months of treatment with mi plus dci or with placebo, respectively . The goal of this study was to investigate if the therapy combining mi and dci in the ratio of 40: 1 could improve the endocrine profile and the insulin resistance of obese women with a pcos diagnosis . To address this issue, 46 young obese patients affected by this syndrome, whose characteristics are summarized in table 1, were randomly included in two groups and then treated with mi plus dci at the ratio of 40: 1 with or placebo for six months . Insulin resistance, evaluated as homa index, fasting insulin, and fasting glucose, and also hormonal parameters were determined at the baseline and after the six - month therapy . As shown in table 2, we observed that, with respect to the baseline values, only the combined therapy of mi plus dci significantly rebalanced the endocrine and metabolic profiles of these patients, ameliorating their insulin resistance and the ovulatory function, as successfully recorded by ultrasound . As a matter of fact, lh and free testosterone levels decreased after the combined treatment, downregulating the hyperandrogenism, and even homa index and fasting insulin, markers of insulin resistance, resulted to be significantly reduced . On the other hand, e and shbg significantly increased, showing restoring in ovulation capability . No relevant changes in these sex hormones were reported in group b, treated with placebo, and no significant modifications were observed after the treatment in both groups a and b for what concerns bmi, fsh, androstenedione, dheas, and fasting glucose . Importantly, no relevant side effect was recorded during the combined therapy with mi plus dci . Overall, these results demonstrated the clinical importance of a combined therapy of mi plus dci to correct the pcos metabolic and reproductive aspects and they are largely in agreement with the issues discussed on the two international consensus conferences on mi, dci, and their link with pcos [25, 26]. Pcos is a syndrome whose pathogenesis remains still largely unclear, even though several etiological factors are demonstrated to be involved . Compelling evidences claimed the pivotal role of insulin resistance and/or compensatory hyperinsulinemia in this syndrome [9, 2729]; indeed they tightly contribute both directly (increasing the ovarian production of androgens) and indirectly (modulating the hepatic shbg synthesis) to hyperandrogenism development, one of the main features of those patients affected by pcos [30, 31], especially in case of overweight women . Nevertheless, literature findings consistently demonstrated that a deficiency in the tissue availability and/or usage of mi and/or dci in women diagnosed with pcos could likely concur to the ir typical of this syndrome [22, 23]. The two inositol stereoisomers, mi and dci, acting as insulin - sensitizers, have been demonstrated to positively influence the clinical history of pcos patients, ameliorating their endocrine and metabolic profile both alone and in combination [19, 3337]. Dci alone, at low dosage, may restore normal insulin sensitivity in the typical insulin target tissues, inducing an enhancement in ovulation frequency which could be ascribed to the general improved insulin sensitivity and to the reduced circulating insulin and androgens . On the contrary, mi exerts its beneficial effects mainly at the ovary level, both enhancing insulin pattern and also directly acting on a number of ovarian functions, including steroidogenesis . The ability of both inositol stereoisomers to regulate glucose metabolism in a different manner (dci promotes glycogen synthesis, while mi may support glucose cell intake) is mirrored by their different concentration in the tissues: while dci is highly concentrated in glycogen storage tissues (liver, muscles, and fat), mi is more abundant in those tissues that need a large amount of glucose, such as brain, heart, or ovary . From this knowledge, a combined therapy with mi plus dci in their physiological plasma ratio (mi / dci 40: 1) seems to be the most appropriated clinical approach to integrate the positive effects exerted by both inositol stereoisomers . The data reported are encouraging and they offer therapeutic options to the first - line treatments in pcos women with moderate or severe hyperandrogenism and/or menstrual abnormalities, which are represented by metformin as well as by oral contraceptives . These compounds effectively suppress lh release and the consequent androgen production from the ovary; also they increase the sex hormone binding protein synthesis, lowering the levels of circulating free androgens . Unfortunately, if the patient aims to restore ovulation in order to conceive, contraceptives are not the clinical strategy to follow . Furthermore, prolonged use of contraceptives may increase homocysteine levels after six months of treatment, as well as the risk of venous thromboembolism . For what concerns metformin, several side gastrointestinal effects (diarrhoea, nausea, vomiting, and abdominal bloating) and metabolic complications have been evidenced after a long - term treatment . For all these reasons, even though more studies on a higher number of patients and with greater statistical significance are needed to confirm these striking posttreatment outcomes, safe combined use of inositol stereoisomers should be largely suitable and it might represent a valid clinical approach in pcos management. |
Chronic mastitis (cm) is a group of diseases characterized by chronic inflammation of the breast, affecting mainly women of reproductive age in their fourth decade [13]. Cm is histopathologically defined as inflammation of the breast, with the microabscess formation and/or the presence of granulomas . This disease generally involves the breast unilaterally and may affect every quadrant region except for the subareolar area . Cases mainly present with a breast mass, which may involve the overlying skin or penetrate the underlying pectoralis muscle with nipple retraction, sinus formation, and axillary lymphadenopathy . Other symptoms may include galactorrhea, inflammation, pain, peau d'orange, tumorous indurations, nipple retraction and/or discharge, diffuse heaviness and enlargement, and ulcerations of the skin . Due to this variable clinical presentation and these similarities in symptoms as well as clinical and radiological findings with inflammatory breast cancer, diagnosis is difficult and must be confirmed histopathologically after surgical excision or core biopsy . Diagnosis of cm should be done after exclusion of other causes of infective lesions of the breast including brucellosis, filariasis, actinomycosis, sarcoidosis, histoplasmosis, wegner's granulomatosis, giant - cell arteritis, duct ectasia, fat necrosis, and breast cancer [2, 4]. Known etiologies of cm are diverse and include diabetes, lupus erythematosus, mycobacterium tuberculosis, staphylococcus aureus, and candida albicans, as well as several species of corynebacterium and other rare syndromes and infections [35]. Several other suspected predisposing or related diseases have been mentioned in the literature, including weber - christian disease, sjogren's syndrome, hyperprolactinemia, igg4 sclerosing disease, immune response to local trauma, and even cat scratch disease [610]. However, many cases of cm are idiopathic, presenting difficulties for determining the etiology and optimal treatment . Nearly all published case series on cm find that the average age of women at presentation is in their fourth decade [14, 1114]. Studies have suggested risk factors involving parity, breastfeeding habits, contraception use, socioeconomic status, and treatment patterns; however, all of these stated risks are based on physicians' observations in small case series reports and have not been studied epidemiologically . The prevalence of cm is generally reported at less than 1% worldwide among women presenting with breast problems in studied hospitals; however, reports vary greatly by country and ethnic group . Reports from pakistan show prevalence at less than 1% among women undergoing biopsy for breast diseases, and a study of granulomatous mastitis (gm) in the united states demonstrated a prevalence of less than 1% among women who underwent biopsy for breast diseases . In the uk, periductal mastitis a second us - based study of gm found a prevalence of 2.4/100,000 women; however, the prevalence was 12 times higher among hispanic women . A study in saudi arabia found idiopathic granulomatous mastitis (igm), one form of chronic mastitis, to be 1.8% of cases presenting with breast diseases; likewise, a study in turkey found that 6.8% of patients undergoing surgery for benign breast diseases had gm . Initial reports from hospitals in morocco and egypt, as well as our review of chronic mastitis diagnoses at the department of pathology at the national cancer institute of cairo university, indicate that the disease may be less rare than in the developed countries, with prevalence rates estimated between 1% and 10% . However, due to the lack of access to specialized care, cases captured in tertiary hospitals and cancer centers are likely to be a very low estimate of total prevalence within these countries . Given the rarity of cm worldwide, little is known about etiology, risk factors, and treatment . A thorough literature review of pubmed, scopus, and isi web of knowledge using the search term breast disease or mastitis or chronic mastitis or granulomatous mastitis and covering 1960 through 2011 revealed that almost all published studies are hospital - based case - series reports . The only exception is one small retrospective case - control study of 18 cases of gm . Therefore, a major gap seems to exist in the literature regarding epidemiological study of chronic mastitis . The current state of knowledge on cm is inadequate to inform treatment protocols, prevention efforts, or patient education . No risk factors are statistically shown to be associated with cm, severely limiting the potential prevention efforts . The lack of information, combined with the relatively high estimated prevalence in north africa, created an optimal setting for the study of a neglected rare disease . The aim of this study was to identify potential risk factors for cm to inform future clinical research and possible prevention interventions . Based on a previous case - series work, we hypothesized that breastfeeding and reproductive factors would have important associations with diagnosis of cm . We preformed a retrospective hospital - based case - control study and identified 85 cases of cm and 112 controls from 5 hospitals in morocco and egypt . The hospitals in morocco included l'hopital ibn rochd, hassan ii university, in casablanca, and l'hopital ibn tofail in marrakech . The hospitals in egypt were cairo university medical school in cairo, the mansoura university oncology center in mansoura city (in the east nile delta region), and the tanta cancer center in tanta, in the center of the nile delta region . Cases were defined as any female patient with histopathological diagnosis of chronic mastitis (periductal, lobular, granulomatous, lymphocytic, and duct ectasia with mastitis) seen at the study hospitals between 2008 and 2011 . Controls were women with histopathologic diagnoses of other forms of benign breast diseases, excluding mastitis and malignancy, and including fibroadenoma, benign phyllodes, and adenosis, diagnosed at the same hospitals during the same period . Cases and controls identified from pathology records of each collaborating hospital were frequency age - matched within 5 years . Pathological records of the study subjects were linked to their medical records, and both were abstracted for relevant information . Any contact information available from medical records was used to contact and obtain consent from patients, as well as to conduct a follow - up interview . The consent process and interview were generally conducted in tandem by an arabic - speaking interviewer over the telephone . At the mansoura study site in egypt, interviews were conducted in a face - to - face format at the hospital . No incentive was provided to interview, and the overall response rate among those contacted was 89% . The 20082011 databases of the pathology departments of the participating hospitals included 204 cases and 419 controls meeting the study criteria (figure 1). Of these subjects originally identified, 165 cases and 251 controls were linked to existing medical records . Seventy - four cases and 79 controls had working contact information and were contacted for interviews . An additional 19 cases and 34 controls had sufficient information contained in their records to complete the interview questions and were included in the analysis, for a total of 85 cases and 112 controls . Interviewer - administered questionnaire included questions on demographics, reproductive history, breastfeeding history, hormone use, menstrual and menopause history, and occupational history, as well as a section on description of symptoms and treatment for their breast diseases . This questionnaire was a shortened version of a risk - factor assessment that was pilot - tested for reliability and validity in morocco and egypt and is currently in use in our ongoing study of the epidemiology of breast cancer in north africa . The study questionnaire was translated from english into arabic by an experienced native - speaking translator . The study protocol was approved by the institutional review board at the university of michigan, as well as by ethics boards at all collaborating institutions . Data were compiled and imported into sas, version 9.1, statistical software (sas institute, car, nc, usa) for statistical analysis . Crude associations were assessed by frequency tables and descriptive statistics, and differences between cases and controls were tested by chi - square tests or fisher's exact tests for categorical variables and by student's t - tests for continuous variables, with a two - sided significance level of = 0.05 . Bivariate analysis was performed using logistic regression, adjusted for age and hospital site in the model to control matching factors, to assess significance of variables as risk factors for case status . Due to the small sample size and the large number of strata created in the presence of two matching factors, conditional logistic regression was not used . The dataset was then imputed twenty times to allow for complete - case analysis by logistic regression . Imputation was carried out using iveware, imputation and variance estimation version 0.2, survey methodology program (survey research center, institute for social research, university of mi, usa). Following imputation, the complete set of twenty datasets was used to conduct bivariate analyses and multivariate analyses, adjusted for age and study site, to model predictors of the dichotomous outcome cases status and create an integrated predictive model . In the crude modeling of variables, 10 factors were shown to be significant at alpha 0.05 . These variables were then included in an adjusted model, and all but 1 variable remained significant . This variable was breastfed at least one child, as its significance was accounted for in the variables breastfed all children and did not breastfeed . Additionally, 3 interaction terms were shown to significantly predict case status in the fully adjusted model, and these were included in the final analysis . Table 1 provides information on the sociodemographic characteristics of the study population, divided by case status and compared by chi - square or fischer's exact tests . The median age of cases at presentation was 33 (range: 1759 years). Cases and controls had similar rates of urban versus rural residence (63% and 61%, resp . ); however, controls were significantly more likely to be employed outside home (32% of controls versus 11% of cases, p = 0.005). Significantly larger numbers of cases (96%) were parous, compared to only 67% of controls (p <0.0001). Additionally, cases had a higher average parity of 3.46 births than controls, 2.30 births (p = 0.0002). Median ages at first birth (22 years) and last birth (29 years) were the same for cases and controls . Similar frequencies of miscarriage (12%), irregular menstruation (18%), and infertility (13%) were seen among cases and controls . A significantly higher proportion of cases reported past use of contraceptive methods (p = 0.005), but when broken down by type of contraception used, no difference was seen . For those for whom information was available, 76% of cases were pre - menopausal; the distribution between menopausal statuses did not differ significantly for cases and controls . However, average age at menopause was 1.25 years lower for cases than for controls ., no significant differences were seen between cases and controls regarding the number of those who breastfed all of their children or who breastfed at least one child . However, significant differences were seen in the history of always using both breasts in feeding, with significantly lower rates among cases (51%) than controls (83%); p = 0.0019 . Cases were less likely to wear a bra (78%) than controls (90%); p = 0.071 . Table 4 depicts information on the characteristics of the breast problems experienced by subjects in the study . Cases were more likely to experience their breast problem in the left breast (55%) than the right breast (34%); however, this information was reported for too few of the cases for the finding to be significant . The majority of the cases were granulomatous mastitis (n = 37, 43.5%), one of the types of chronic mastitis included . In terms of temporal proximity to lactation (defined as problem within 6 months of lactation), no significant differences were seen between cases and controls; however, information was missing for the majority of both cases and controls . The main symptom of the breast problem was most likely to be swelling for both cases (40.0%) and controls (74.6%), but cases were more likely to report abscess, secretions, and redness . Treatment administered to cases was most likely to be antibiotics or radiation; controls reported other treatments or radiation as most common . Results from the adjusted bivariate analysis and fully adjusted logistic regression model, completing postimputation, are shown in table 5 . The bivariate analysis found 10 variables to be significant: 9 of these were included in the fully adjusted model after stepwise addition . In the multivariate analysis, several potentially important predictors were found to be significantly associated with an outcome of cm . Parity was significantly associated with an outcome of cm; cases experienced a 75% increase in odds of each additional birth . Cases were more likely to have a history of contraception use (or = 2.73, 2.073.61), but this significance could not be related to type of contraception . Postmenopausal status was found to be protective against chronic mastitis when compared to premenopausal status (or = 0.62, 0.490.79). A case of cm was 3.76 times more likely to have breastfed all of her children than a control, and cases who breastfed were 4.40 times more likely to have not alternated breasts when breastfeeding . Cases wore a bra less often than controls (or = 0.56, 0.470.67). Temporal proximity of problem to pregnancy and lactation was also found to be significant in the final model, with cases being 67% more likely than controls to have experienced their breast problem during pregnancy, lactation, or within 6 months after lactation . A woman with cm was found to have 0.71 times lower odds of maintaining employment outside home than a control subject . Additionally, variables associated with reporting mice in the study subject's neighborhood or household were found to be risk factors; cases had a 47% increase in odds of reporting a campaign to control mice in their neighborhoods and a 63% increase in odds of reporting attempts to control mice in their households . Interactions between parity and contraception were found to be significant; likewise, the effect of whether or not a woman breastfed all of her children varied across levels of parity . Both effects were less than additive (or = 0.86, 0.800.93, and or = 0.80, 0.730.87, resp . ), with the effect of breastfeeding all children decreasing with each additional birth . Use of only one breast as a risk factor appeared to have a significant interaction with whether or not the breast problem was associated with lactation (or = 0.32, 0.220.46). Previous studies have suggested risk factors for cm involving parity, breastfeeding habits, contraception use, socioeconomic status, and treatment patterns; however, ours is the first study to present statistically significant findings [3, 17, 22]. Our results indicate that the strongest measured risk factors for cm are breastfeeding all children and not alternating breasts when breastfeeding . These risks match observations made by clinicians and reported in published case - series [3, 4, 17]. Several additional factors in this study appear to be associated with chronic mastitis, including premenopausal status, employment, higher parity, use of contraceptives, not wearing a bra, and reporting mice in one's household . Some of these coincide with factors that have been previously identified as potential risk factors, and all can potentially lead to hypothesis - based testing for mechanisms of etiology . History of contraception has been suggested in previous studies as a potential risk factor [4, 7, 11, 22]. In our study, any history of contraceptive use was found to be statistically more common in cases than controls, adding evidence to the importance of contraceptive use as a risk factor for cm . However, individual types of contraceptives could not be associated with case outcome, indicating that further research should be done to establish risk behavior . Suspected associations with pregnancy have been reported previously in case - series [3, 4, 7, 11, 14, 17]. Even after controlling for breastfeeding, parity was associated with cm in our study, indicating that it has a statistical significance outside its relation to breastfeeding . Interactions between parity and any history of contraception were found to be significant, indicating that the effect of history of contraception use varied across levels of parity . Specifically, the effects of parity and contraception were less than additive (or = 0.86). This indicates that there is only so much explanatory power that can be attributed to contraception with each increasing birth for each additional child that a woman has, the added importance of history of contraception use decreases . This concept of less - than - additive interaction is illustrated in figure 2(a). Breastfeeding has previously been correlated with cm in several case - series [4, 7, 17, 22]; however, in another study, no association was found . In our study, breastfeeding all children was found to be very significant in the full model, accounting for the significance of breastfeeding at least one child . This finding is probably related to the fact that cases were more likely than controls to experience their breast problem during or within 6 months after lactation, although it was independently significant . However, this strong effect of breastfeeding all children decreases with increasing parity, as the interaction between parity and breastfeeding all children is less than additive (or = 0.80, figure 2(b)). The association of breastfeeding all children is seen to decrease with each additional birth, tempering the effect of breastfeeding all children in the presence of high parity . One of the main expected risk factors, as communicated by clinicians and reported in the literature, is the failure to alternate between breasts when breastfeeding . This practice was found to be highly significant as a predictor of cm in our study . However, among those with a problem during lactation, the importance of using both breasts or not breastfeeding at all decreases in explaining case status . This interaction indicates that the present study cannot separate cause and effect whether a woman experiences a problem because she is breastfeeding from only one breast or whether she breastfeeds in this pattern due to a breast problem . This problem has been described elsewhere, in the use of mastitis - related terms such as milk stasis, retention, obstruction, or breast engorgement, since these processes are considered as both predisposing factors and direct consequences of the disease . Nearly all published reports [14, 1114] on cm find that the average age of women at presentation is in their fourth decade . Additionally, menopausal status was also found to be significant in the final model, with postmenopausal status seen to be protective . This finding correlates with the view of cm as a reproductive - age problem often associated with pregnancy and lactation . Other protective factors seen in this study include being employed outside home and wearing a bra, both of which could potentially be related to higher socioeconomic status . We included the condition of having mice in one's household on the basis of a hypothesis relating mouse mammary tumor virus (mmtv) to breast cancer . The results from the modeling of this variable indicate that there may be a dose - response relationship with the odds of case status increase . Therefore, exposure to mice may be related to an important risk factor for disease . However, the relationship to mice could also indicate lower socioeconomic status of cases, which is unlikely . While presentation and treatment were not included in the final predictive models, due to temporal occurrence after presentation with disease, differences in presentation and treatment between cases and controls were seen . The main symptom of the breast problem was most likely to be swelling for both cases and controls, but cases were more likely to report abscess, secretions, and redness . Treatment administered to cases was most likely to be antibiotics or radiation; controls reported other treatments or radiation as most common . From the published literature, the optimal treatment of cm is still unclear [18, 25]. Reported case - series have described treatment with antibiotics, steroids, abscess drainage, wide surgical resection, and even mastectomy, with variable results [2, 2530]. There are currently insufficient data to make definitive recommendations, but conservative treatment with steroids and surgery only if necessary is generally agreed upon, following the exclusion of infection [1, 2, 11, 25]. Successful treatment with prednisolone, methotrexate, and azathioprine has been reported [13, 2529]. Antibiotics should only be used in the treatment of cm if a bacterial infection is identified, despite the prevalent use of antibiotics seen in this study and reported elsewhere . No information was available on the identification of infection before prescription of antibiotics . In the presence of abscess data and prior studies on cm are extremely limited; however, when compared with the previously published associations, our results reveal similar findings . The majority of published papers and case reports have come from the developing countries, which has been hypothesized to be due to lower prevalence of cm in the developed countries, overdiagnosis in the developing countries, or underdiagnosis of tuberculosis mastitis in the developing countries [3, 7]. A study in the usa found that hispanic women had 12 times the risk of cm as non - hispanic women, and a study in the uk found that women with cm were significantly less likely to be caucasian . This indicates that the disease may be more common in minority or developing - country settings, an idea that correlates with our findings in morocco and egypt . Conclusions drawn from this study therefore require an assumption of nondifferential missingness patterns between cases and controls, along with an assumption that those who could be contacted were a representative sample of all cases and controls . The case definition used in this study was wider than that commonly used to study cm, as the vast majority of the published literature studies specific types of cm . Due to the rarity of the disease and the commonalities in presentation and treatment, as well as a general lack of knowledge while recall bias is often a concern in case - control studies, the fact that both our case and control populations experienced past breast disease potentially mitigates this concern . There is still some temporal ambiguity; however, many of the potential risk factors surround pregnancy and lactation, and dates of pregnancy were known, eliminating some ambiguity . Despite these limitations, this study is a landmark picture of the epidemiology of cm . Clinical observations long reported in the literature but never studied broadly now have statistical significance, opening the way for future studies . Little is known about the etiology or risk factors for the disease . Because studies on risks, etiologies, and treatments are lacking, women experiencing cm are often incorrectly treated . Despite its relatively severe presentation and lack of standard treatment protocol, we are unaware of any controlled analytic studies modeling risk factors for cm to date . Therefore, we believe that we have conducted the largest case - control study of cm in the literature, investigating the epidemiology and potential risk factors for the disease . Our findings indicate that the disease typically occurs in the fourth decade of life and has a statistically significant association with pregnancy / parity, lactation, breastfeeding patterns, menopausal status, employment status, history of use of contraception, having mice in one's household, and not wearing a bra . Further studies are required to parse out understandings of mechanisms, establish temporality, and further understand risks and etiologies of chronic mastitis. |
Despite the explosive increase in cancer genomics data, the actual application of genomics data and approach to clinics offers big challenges [1, 2]. The main reason for the delay in the application to clinics is non - connectivity between bioinformaticians, non - clinical scientists, and clinicians . Clinicians are not confident in how much additional information might be given through genomics technology compared to conventional tools, and non - clinical scientists and bioinformaticians are not aware of what clinical problems should be solved with priority . Cancer clinicians expect novel diagnostic, prognostic, and therapeutic values of this new technology . Now, the clinical field is aware that multiple assays using next - generation sequencing (ngs) has some advantage over single genetic tests [1, 3]. A recent cancer guideline from the national comprehensive cancer network (nccn) pointed out that epidermal growth factor receptor (egfr) and/or anaplastic lymphoma kinase (alk) testing should be conducted as part of multiplex / ngs in non - small - cell lung cancer (nsclc). The feasibility of an ngs diagnostic platform at cancer clinics was validated by cancer centers in the united states and europe . One platform showed that potential hurdles, time, cost, purity, and ethical problems could be overcome in implementing ngs using low - coverage whole - genome sequencing, whole - exome sequencing (wes), and whole - transcriptome sequencing . Another platform sequenced clinical samples, including formalin - fixed, paraffin - embedded ones, and showed that this approach is practical and can give some benefits to the patients with lung cancer . The wes approach in mendelian disorders showed that ~25% of sequencing can give a specific diagnosis based on the germline genetic make - up from the data of 250 probands, mostly consisting of neurological phenotypes in real practice . The clinical application of cancer genomics should be considered in the context of unmet clinical needs to maximize the value of this novel paradigm . Here, we dealt with the potential clinical application of cancer genomics in the aspect of practical management of cancer patients, along with a clinical scenario covering the whole course of cancer management . We overviewed the potential of cancer genomics in the context of real cancer practice through this approach . He quit smoking 10 years ago and had smoked an average of one pack per day for 30 years . He had regular check - ups every year and had the last check - up with no abnormality 6 months ago . He got a percutaneous needle aspiration (pcna) and biopsy but did not have any tumor cells . He repeated the pcna and biopsy but developed pneumothorax (air leakage from lung) related to the diagnostic procedure . After a staging work - up with a computed tomography (ct) scan, positron - emission tomography (pet) scan, brain magnetic resonance imaging scan, and bronchoscopy, his tumor was revealed as t2n0 clinical stage . He got a surgery based on the result of the pathology and staging work - up . In this situation, we face unmet clinical needs of early cancer diagnosis . He was diagnosed with symptoms related to the cancer, despite his regular check - up . If we detect his malignancy before the symptoms, we can get a better result compared with the symptomatic case . This imaginary patient was diagnosed with operable cancer, but as many as 60% to 70% of lung cancer patients are diagnosed with inoperable, advanced disease . To diagnose the cancer sooner, lots of trials failed to show an actual benefit of screening strategy in lung cancer [10, 11], but recently, a screening trial using low - dose chest ct of lung cancer was proven to be successful . Low - dose chest ct reduced the mortality from lung cancer through early detection in people with a history of at least 30 pack - years of smoking . Despite this good approach to detect early lung cancer, this advantage should be counterbalanced with the potential harmful effects of radiation exposure or false positivity many biomarkers were investigated for the early detection of lung cancer - for example, circulating tumor dna and rna . But, false positivity and false negativity of single tests prevent these tests from clinical usage . If we use multiple biomarkers using cancer genomics for the detection of early cancer, the false positives and negatives could be reduced to the level of clinical usage . Another effective approach of early diagnosis of cancer is to select a high - risk population for screening tests . Many genome - wide association studies identified some germline single - nucleotide polymorphism (snps) that are associated with the risk of cancers [14 - 16], and these findings suggested important potential germline markers for the definition of high - risk populations . Mardis told the case of mike snyder as an example of an actual application of a germline genome test . He sequenced his own genome and found a higher risk of type 2 diabetes; since that time, he checked his glucose level regularly, and he detected high glucose levels at the very beginning . The concept of early diagnosis, like the story of mike snyder, can be applied to the early detection of cancer, too . If we define a high - risk population with germline genetic tests, we could focus on the use of screening tests in this population . This complication gives pain and discomfort of the sensation of dyspnea, prolongs the period of admission, and increases the cost of cancer management . This problem originated from the invasive nature of the diagnostic procedure - pcna and biopsy using a needle, moving back and forth through the patient's fragile lung tissue . New diagnostic tools using cancer genomics - for example, identification of cancer - specific genetic alterations from circulating tumor dna - can avoid this type of complication from invasive procedures . One pioneering study showed that circulating tumor dna could be combined with genomic technology to diagnose and monitor the status of cancer very safely . His final pathological diagnosis was adenocarcinoma and revealed the involvement of some mediastinal lymph nodes; therefore, the final pathological stage was t2n2, iiia . This stage required adjuvant chemotherapy, and he was referred to the department of medical oncology . A medical oncologist prescribed adjuvant chemotherapy - a navelbine and cisplatin regimen (np) for 4 cycles . Np 4 cycles has been prescribed to patients with high - risk clinical stage ib, iia, iib, iiia, and iiib, regardless of other clinicopathological factors . The actual benefit from this treatment is only a 4% long - term survival advantage, with some hematological and non - hematological toxicities [19, 20]. The way to improve the risk - to - benefit ratio of adjuvant treatment is further selection of a patient population that could benefit from this treatment . Stage - based risk calculation - the current practice - cannot predict an accurate risk of relapse and attenuates the value of adjuvant treatment . Single patient - based risk calculation should be done to identify the adequate patients for adjuvant treatment . Cancer genomics will provide useful tools for a single patient - based risk calculation model . This personalized adjuvant model will definitely increase the proportion of patients who benefit from it . If he had been diagnosed as stage iiia preoperatively, he might have chosen a no - surgery option, such as concurrent chemoradiation, because no definite benefit of surgery was demonstrated until now, although this is controversial [21, 22]. We have relatively sensitive diagnostic methods, such as ct, pet, and endobronchial ultrasonography, but the sensitivity and specificity are still not perfect . One focus of genomics technology should be a more accurate prognosis preoperatively, in addition to postoperatively . Prediction issues in cancer patients are not limited to survival, recurrence, and response to specific treatment . The goal of cancer care is improvement of survival and, more importantly, quality of life . Predictive markers of bone metastasis or bone - related events, such as fracture or paralysis, are very important to improve the quality of life in cancer patients . An unbiased approach is needed to discover good biomarker for these events, because we have very limited clues to dig into these problems . The most important advantage of genomics approach is that is " unbiased " with regard to any hypotheses or theories . That is why clinical problems with low - depth knowledge are a good candidate for the application of cancer genomics . The connection between clinicians and genomic scientists can facilitate the development of clinical problems that are solved with a genomic approach . He got 4 cycles of adjuvant chemotherapy and then followed up regularly with a physical examination, blood test, ct scan, and/or pet scan . At 6 months since the completion of adjuvant chemotherapy, he presented with right - side chest pain, and his ct scan showed tumor relapse in the right lung and pleura . He planned systemic anticancer treatment for life prolongation and palliation of symptom, not curative . The role of ct scan and/or pet scan is not defined, but many clinicians use this high - cost image for monitoring relapse . The reason for the popular use of this high - cost image is that there is no other alternative of monitoring cancer status . Recent studies showed the possibility of circulating tumor cell and cell - free dna as a tool for monitoring tumor status [18, 25]. Cancer genomics enables circulating tumor cell or cell - free dna to detect relapse earlier than image findings or tumor markers . The delicate delineation of circulating dna with ngs technologies is an essential part of this success story . No tool is available with a definite clinical benefit for the monitoring of cancer; therefore, we absolutely need new, non - invasive tools for it . Because it takes at least several years to prove the benefit of monitoring, we should start a well - designed prospective study using cancer genomics to prove it as soon as possible . The medical oncologist who was in charge of him tested for egfr mutation and alk by fluorescence in situ hybridization to see rearrangements of alk . He chose cytotoxic chemotherapy with pemetrexed and cisplatin according to the double - negative results of the egfr and alk tests . The ultimate goal of the clinical application of cancer genomics should be therapeutics . There are increasing gene lists for nsclc that have matching targeted agents [26, 27], but many patients do not have genetic alterations that can be a target . Even for the same type of cancer - for example, lung adenocarcinoma - the genetic make - up is very heterogeneous . The accurate definition of the genetic make - up of each patient will be the first step for personalized medicine . Many target panels have been developed by many vendors and hospitals for commercial or non - commercial use, but the usage is still very limited . As more cancer genome data are available [28, 29], the list of target panels will increase and be specified to tumor types . Now, we have two targeted agents to prolong the survival of lung cancer patients: the egfr tyrosine kinase inhibitor (tki) erlotinib or gefitinib for egfr mutations and the alk tki crizotinib for alk translocations . For this case, there was no targeted agent, because he did not have egfr or alk alterations . Based on the histology of his tumor, he was treated with pemetrexed and cisplatin . Despite the substantial toxicity of cytotoxic chemotherapy, many patients are prescribed these drugs with the individualized possibility of this agent not known . This decision relies on population data from large - scale prospective trials . Because clinical trials targeting specific genetic alterations are increasing, the clinical need for more genetic information is also increasing . If the patient was diagnosed as stage iv initially, the amount of tissue for genetic testing is very limited . The amount of tissue is enough for 2 or 3 genetic tests . For these patients, multiplexing or ngs technologies have important advantages to overcome the limitation of tissue amounts in the clinic . This patient got adjuvant chemotherapy with np for 4 cycles but progressed 6 months after the completion . The way to increase the benefit of adjuvant treatment could be the application of variable adjuvant treatment that is selected from individualized factors . Personalized cancer genomic analysis can show different and private profiles of individual cancers, and accumulation of these genomic data enables different adjuvant treatment strategies for each patient . Despite the theoretical promise of personalized cancer genomic analysis for the selection of the right drug, one of important example is the story of lukas wartman, a doctor at washington university in st . He suffered from a second relapse of acute lymphoblastic leukemia and sequenced the tumor dna and rna . He found very high expression of flt3 and then figured out that sunitinib, a kidney cancer drug, could block tumor survival signals . Sunitinib induced complete remission in him, and thereafter, he received allogeneic stem cell transplantation and is now in remission . Another story from the fox chase cancer center was reported on kit mutations from a pancreatic neuroendocrine tumor . The patient had an advanced pancreatic neuroendocrine tumor and sequenced his tumor using a cancer panel . He had a kit mutation and was treated with imatinib, a well - known kit inhibitor that is not approved for his tumor, for more than 2 years . If he had been in in routine practice without cancer panel sequencing, he would have died without imatinib treatment . A pharmacogenomic approach could be used to minimize toxicity to cancer treatment, too . In this case if the patient has a homozygous polymorphism in the ugt1a1 gene - the * 28 variant - he should be prescribed with a dose reduction to avoid severe, sometimes fatal, toxicity from irinotecan . A genomic approach is required to properly assess pharmacogenomics in association with drug toxicity . A commercial chip, the affymetric dmet chip, covers 25 - 32% of genes of pharmacogenomics, and it is an important question whether more coverage with wes will be more beneficial . He was treated with pemetrexed and cisplatin for 4 cycles, and his tumor shrank with the treatment . But, his tumor rebounded, with a complaint of dyspnea and cough, 4 months after the completion of treatment . After 4 cycles of second - line chemotherapy with docetaxel, he had stable disease . Even in the case of a dramatic response to the first - line treatment, nearly all cancers rebound with various relapse - free durations [30, 34]. The choice of second - line treatment depends on clinical guidelines, clinical parameters, and clinicians' experiences . Any of the parameters may not be best if a specific patient's situation is not considered . We do not know the exact mechanism of resistance to the previous treatment and do not have any good way to assess the mechanism of resistance . If cancer genomics is adopted in this situation, we can profile the tumor tissue that was resistant to the previous treatment . The profile can help clinicians decide on a second - line treatment option and improve the individual's outcome . The resistance mechanism could vary, depending on multidimensional factors, such as the patient, tumor biology, and previous treatment . Especially, this situation should be approached individually with the concept of true personalized medicine . He was in hospice care and died 1 year after the initial diagnosis of relapse . After his death, his tumor was sequenced by whole - transcriptome analysis, and his tumor showed a ros1 translocation . The median overall survival of metastatic lung cancer patients is 1 year if there is no genetic alteration for which targeted agents are available [30, 34], as in this case . If the patient has an egfr - sensitive mutation or alk translocation, the median overall survival time reaches 2 years [35, 36]. A ros1 targeting agent, another example of successful targeting of oncogene addiction, is now available after his death . If the ros1 translocation was known for his tumor and he was treated with a ros1 inhibitor, he could have a chance to live an additional one year or more . Tumors have very heterogeneous profiles [37, 38], and resistant tumors have even more heterogeneous ones . This is why tumors should ultimately be approached on an individual basis, rather than a population basis . Now is the right time to think about how we can use cancer genomics for individual patients . Functional annotation of sequencing results, the way to integrate multi - dimensional data, and the exploration of the clinical meaning of sequencing variants for the routine clinical usage of cancer genomics . Defining unmet clinical needs is as important as overcoming technological hurdles to maximize the benefit from cancer genomics . Early detection, non - invasive molecular diagnosis, risk prediction of relapse and tumor - related events, monitoring of disease status, matching good drugs, and finding out personal grade resistance mechanisms are good examples of unmet clinical needs that should be solved with cancer genomics . It would speed up and optimize the application of genomics to cancer clinics if cancer biologists, bioinformaticians, and cancer clinicians cooperate towards one goal of achieving it. |
Atherosclerosis represents a major factor of coronary heart disease characterized by the formation of fat - laden plaque in large and medium - sized vessels . During atherogenesis, the endothelial layer of the vessels is constantly confronted with a range of stress signals . Elevated levels of circulating oxidized low - density lipoprotein (ox - ldl), increased turbulent blood flow, and excessive inflammation all contribute to endothelial injury . Regardless of the nature of the stress cue, the transcriptome of vascular endothelial cells is profoundly altered. For instance, down - regulation of enos transcription and simultaneous up - regulation of et-1 transcription in endothelial cells precedes the impairment of vasodilation and rhythmic vessel tone . Transcriptional activation of adhesion molecules, on the other hand, enables circulating leukocytes to attach to the endothelium and establish a pro - inflammatory microenvironment . Therefore, elucidation of the mechanisms underlying these characteristic transcriptional events will potentially further our understanding of atherogenesis and yield druggable targets for the intervention and prevention of atherosclerosis . Recent advances in the transcriptional regulation of atherosclerosis suggest a growing involvement of the epigenetic machinery, . This mini - review is a modest attempt to summarize the current state of research on the epigenetic regulation of endothelial disorder in atherosclerosis and to provide an outlook . Unlike prokaryotic organisms, eukaryotic transcription takes place on nucleosome - wrapped chromatin . In order for the basic transcription machinery to be recruited to promoter region and initiate transcription the epigenetic machinery, composed of histone modifying enzymes, dna modifying enzymes, chromatin remodeling proteins, non - coding regulatory small rnas, and histone variants, serves as an intricate regulatory layer for eukaryotic transcription by altering chromatin structure . Due to space constraints, we only give a brief overview of histone modifications and chromatin remodeling, which will be the focus of discussion in this review . The n - terminal tails of core histones, h3 and h4 in particular, can be post - translationally modified . The term histone code was coined to correlate a specific set of histone modifications to a predictable transcriptional outcome . Though a subject of constant controversy and debate, it is generally believed that acetylation of histones h3 and h4 surrounding the promoter region is synonymous with transcriptional activation . Whereas methylation of histone h3 lysine 4 (h3k4) may herald activation, h3k9 methylation often marks repressed chromatin . In order for sequence - specific transcription factors and the basic transcription machinery to access the dna and initiate transcription, this is achieved by moving the nucleosomes along the dna at the expense of atp hydrolysis . Initially identified and characterized in yeast,, the chromatin remodeling proteins represent a most conserved branch of the epigenetic machinery during evolution . The mammalian chromatin remodeling complex is a multi - subunit mega - protein conglomerate that contains a catalytic component . Brahma related gene 1 (brg1) and brahma (brm) are the best studied chromatin remodeling proteins with atpase activity . Brg1 and brm have been known to participate in both transcriptional activation and repression depending on the specific chromatin environment and the transcription factors they interact with . The n - terminal tails of core histones, h3 and h4 in particular, can be post - translationally modified . The term histone code was coined to correlate a specific set of histone modifications to a predictable transcriptional outcome . Though a subject of constant controversy and debate, it is generally believed that acetylation of histones h3 and h4 surrounding the promoter region is synonymous with transcriptional activation . Whereas methylation of histone h3 lysine 4 (h3k4) may herald activation, h3k9 methylation often marks repressed chromatin . In order for sequence - specific transcription factors and the basic transcription machinery to access the dna and initiate transcription, the chromatin has to be unwound and loosened . This is achieved by moving the nucleosomes along the dna at the expense of atp hydrolysis . Initially identified and characterized in yeast,, the chromatin remodeling proteins represent a most conserved branch of the epigenetic machinery during evolution . The mammalian chromatin remodeling complex is a multi - subunit mega - protein conglomerate that contains a catalytic component . Brahma related gene 1 (brg1) and brahma (brm) are the best studied chromatin remodeling proteins with atpase activity . Brg1 and brm have been known to participate in both transcriptional activation and repression depending on the specific chromatin environment and the transcription factors they interact with . Under physiological conditions, the vessel wall is free from the attachment of circulating leukocytes . Under certain pro - atherogenic conditions, such as turbulent shear stress, oxidative stress, intermittent hypoxia, and excessive nutrition, endothelial cells up - regulate the transcription of adhesion molecules (cam) including icams, vcams, and selectins, which consequently allow a much stronger interaction between leukocytes and the endothelium perpetuating a pro - inflammatory niche, . Diabetes is one of the leading causes for vasculopathies including atherosclerosis . A seminal study by brownlee and colleagues examined the effect of transient hyperglycemia on endothelial function . Of great intrigue, these authors have found that exposure to high glucose (hg) for a short period time (16 hours) induced a prolonged activation of vcam-1 in bovine aortic endothelial cells even when these cells were switched to and maintained in low glucose (lg) for additional 6 days, a phenomenon dubbed as metabolic memory . Chromatin immunoprecipitation (chip) revealed an uptick of h4k4 monomethylation on the proximal promoter of the p65 gene mediated by the histone methyltransferase set7/9 . Transient hg, these authors propose, leaves an epigenetic dent on the p65 gene such that even in the absence of the original stimulus endothelial dysfunction will sustain . Circulating oxldl presents a major risk to atherosclerosis in part by promoting the expression of adhesion molecules . Have recently reported a novel epigenetic mechanism underlying the induction of icam-1 in human endothelial cells . Oxldl activated the transcriptional modulator mrtf - a, which in turn was recruited to the icam-1 promoter by p65 and synergistically stimulated icam-1 transcription with oxldl . Depletion of mrtf - a erased h3/h4 acetylation and h3k4 dimethylation but restored h3k9 trimethylation on the icam-1 promoter . Since mrtf - a is known to engage the epigenetic machinery in regulating transcription within the vasculature, it is conceivable that mrtf - a may serve as the critical link of endothelial injury bringing histone modifying enzymes to the chromatin . Alternatively, kim et al . Propose that the regulatory subunit of the napdh oxidase complex p66shc mediates the induction of icam-1 by ldl . Ldl induced histone acetylation but inhibited dna methylation of the p66shc promoter to up - regulate the transcription of p66shc . Of note, oxldl has been reported to elicit epigenetic changes on a host of gene promoters in endothelial cells, although a genome - wide survey is lacking . Chronic hypoxia has emerged as an independent risk factor of atherosclerosis . As a result of intermittent low oxygen supply, the transcriptome of endothelial cells undergoes marked changes that include an increase in the transcription rate of adhesion molecules . Our laboratory has recently uncovered a potential role for brg1 and brm in hypoxia induced endothelium - leukocyte interaction . Expression of brg1 and brm in vitro was up - regulated in cultured endothelial cells exposed to 1% o2 and in vivo in pulmonary arteries isolated from mice kept in a low - oxygen chamber for 4 weeks . Introduction of brg1 and brm into a brg1/brm - negative cell line (sw-13) greatly potentiated hypoxia - induced cam transactivation whereas silencing of brg1/brm in endothelial cells crippled the effect of hypoxia . Brg1 and brm formed a dynamic interaction with p65 on the cam promoters where p65 recruits brg1/brm and brg1/brm reciprocally stabilizes p65 . Brg1/brm influenced cam transactivation by altering histone h3/h4 acetylation and h3k4 methylation creating a friendly chromatin structure for the basic transcription machinery . More important, endothelial - specific targeting of brg1 and brm normalized cam expression and attenuated hypoxia induced leukocyte adhesion in mice . Of intrigue, a similar strategy also alleviated the development of atherosclerotic lesions in apoe mice, indicating that brg1 and brm might be able to orchestrate endothelial injury in response to a range of different pro - inflammatory stimuli (unpublished observation). Endothelium derived no plays a critical role in maintaining vascular integrity, the disruption of which contributes to atherogenesis . Oxldl decreases acetylation of h3 and h4 and dimethylation of h3k4 while simultaneously increasing h3k9 trimethylation surrounding the enos promoter consistent with the repression of enos transcription in endothelial cells . Again, mrtf - a appears to be the key coordinator of these epigenetic changes . In addition, there is a decrease of enos expression in mice deficient in lsd1, an h3k4/k9 demethylase, highlighting the role of histone methylation in fine - tuning enos transcription . Fish et al . Conducted a comprehensive survey of histone modifications on the enos promoter region in endothelial cells challenged with anoxia . In the proximal region of the enos promoter (-166/-26), h3/h4 acetylation and h3k4 dimethylation declined as early as 1 hour following exposure to low oxygen . In contrast, these signature changes were not observed on the distal enos promoter (-891/-797 and -488/-398). A closer examination revealed that acetylation levels of specific lysine residues fluctuated with distinct patterns . For instance, 1 hour after hypoxia, only h3k14 and h4k5 acetylation plummeted significantly, which was joined by a decrease in h3k9/h4k8/h4k12 acetylation at 2 hours with h4k16 acetylation unaltered . Interestingly, histone h2a.z was evicted from the proximal enos promoter during hypoxia thereby creating a closed chromatin conformation and rendering a repressed transcription state . Consistently, a recent study has correlated decreased enos expression with high levels of dna methylation on the proximal enos promoter in patients with obstructive sleep apnea (osa), a typical pathology of hypoxia . Paradoxically, enos expression has been observed to increase, rather than decrease, in endothelial cells in response to hypoxia probably as means of compensation . The up - regulation of enos transcription is accompanied by increased h3 and h4 acetylation across the enos promoter region (-4501/+23). Therefore, while it remains debatable how enos transcription responds to hypoxia, suffice it to say that a specific epigenetic code is intimately associated with the transcription status . The vessel wall, particularly the endothelial layer, is subject to the pressure caused by various hemodynamic forces . Whereas laminar shear stress (lss) is considered atheroprotective and stimulates enos transcription, turbulent blood flow creates shear stress that damages the vascular endothelium especially at the sites of arterial branches . Among the detrimental effects exerted by pro - atherogenic shear stress are accelerated turnover of endothelial cells, increased adhesion of leukocytes, accumulation of reactive oxygen species, and decreased synthesis of no stemming from enos repression. Illi et al . Have reported that lss increased global h3 and h4 acetylation levels in endothelial cells through activating histone acetyltransferases (hats). In addition, lss augmented h3 and h4 acetylation on c - jun and c - fos promoters . Since c - jun / c - fos is considered essential for enos transactivation, increase ap-1 activity likely explains elevated enos transcription in response to lss . Impaired vessel relaxation during atherogenesis is also rooted in the enhanced expression of endothelin, a potent vasoconstrictor . Accumulating evidence has provided a clear link between histone modification and et-1 transactivation . In diabetic rats, increased et-1 release was accompanied by an up - regulation of the histone acetyltransferase p300 . Silencing of p300 completely abolished et-1 activation by high glucose thought it remained unclear whether p300 acted through histone or non - histone factors . Have demonstrated that h4 acetylation was increased on the et-1 promoter surrounding a conserved p65 binding element in endothelial cells treated with two pro - inflammatory stimuli, tnf- and ifn-, suggesting a potential role for a hat like p300 . In rats with intrauterine growth retardation (iugr) where hypoxia plays a determining role, h3k9/k18 and h4 acetylation increased on the et-1 promoter . Recently, our investigation has led to the identification of an mrtf - a - centered epigenetic complex on the et-1 promoter in response to hypoxia . Under hypoxic conditions, mrtf - a interacted with and was recruited by the sequence specific transcription factor srf to the proximal et-1 promoter (-81/+150). Upon the joining of brg1/brm, this epigenetic complex altered histone acetylation and h3k4 methylation to facilitate the binding of rna polymerase ii thereby activating et-1 transcription . The turn - of - the - century saw a boom in research on epigenetics with the initiation of several epigenomics projects . Relying on high - fidelity chromatin immunoprecipitation (chip) coupled with high - throughput sequencing techniques, these projects aim to decode the epigenetic information bringing insights for the prevention and intervention of human diseases . Several exciting findings have provided clues for such basic biological events as adipogenesis, macrophage activation, and cell cycle progression . So far, there has been a lack of effort in deciphering the epigenetic code on a genomewide scale in any of the major cardiovascular diseases including atherosclerosis . Since single - gene based epigenetic analysis tends to give very limited and often biased knowledge to the understanding of atherogenesis, long considered a multifactorial disease, basic scientists and clinicians like will benefit from an undertaking that unveils a comprehensive picture of epigenetic regulation of endothelial injury in atherosclerosis. |
Removal of third molars is a common procedure in oral surgery and it is associated with postoperative complications such as pain, swelling and trismus . Therefore, several medications such as corticosteroids and non - steroidal anti - inflammatory drugs are often recommended despite their common side effects such as bleeding, gastrointestinal irritation and allergic reactions, which can evoke discomfort and health risks in patients1 . In terms of strategies used to minimize tissue damage in oral surgeries, the low - level laser therapy (lllt) seems to offer many benefits in the stimulation of the healing process and control of the inflammatory process by reducing the swelling and pain, with no reports of adverse effects2 . According to medeiros et al.3, the effects of lllt are more evident in the early stages of wound healing . The use of polarized light helps in resolution of inflammation and in increasing the collagen deposition as well as the number of myofibroblasts however, previous studies have reported that in teenagers, lllt reduces pain intensity without modifying the healing process4 . On the other hand, lllt showed better results in controlling swelling and trismus when compared to ozone therapy5 . However, lopez - ramirez et al.2 found that lllt showed no positive effects in reducing pain, swelling and trismus after the removal of third molars . These differences in the effects of lllt may be explained by the variability in the protocols and surgical procedures performed1, 2, 6 . The lllt protocol should be determined considering the type of light used as well as the tissue layers that need to be irradiated . In this context, the red spectra in the visible to near - infrared spectra (620830 nm) have the potential to stimulate photoreceptors in the plasma membranes of cells . The higher wavelengths are absorbed by the deeper tissues and are less active in the surface tissues7 . Therefore, this study aimed to evaluate the efficacy of intraoral application of lllt (660 nm) in controlling pain intensity, swelling and interincisal opening in oral surgery . This study included 10 patients (7 women, 3 men, mean age 23 6 years) and it was initiated after obtaining the approval of the ethics in research committee (protocol number: 512.476). The exclusion criteria were as follows: presence of local infections, various systemic diseases, smoking habit, use of oral contraceptives, pregnancy and lactation . All patients underwent the same surgical protocol standardized by the same surgeon (r.l.n . ). However, the values recorded for pain, swelling and trismus were assessed by a different surgeon in order to conduct a blind experiment . Before the laser application, the mean power of the equipment was measured and calibrated using the laser check power meter instrument . Intraoral lllt was applied using continuous scan mode at four different points, covering the entire suppurative surgical area, which was divided into four quadrants, each of 1 cm area at a distance of 1 cm . Preoperatively, all patients used a mouthwash with chlorhexidine (0.12%) and received a topical application of povidone - iodine (1%). Postoperatively, all patients received amoxicillin 500 mg, every 8 hours, for 7 days, ibuprofen 600 mg, every 8 hours, for 3 days, and paracetamol 500 mg, every 6 hours as rescue medication for pain during the first 72 hours . In cases with penicillin allergy, clindamycin was selected as the antibiotic at a dose of 300 mg, every 8 hours, for 7 days . In this study,, amparo, sp, brazil) with a pen station beam area of 0.035 cm, algalnp visible diode with continuous wave (35 mw and wavelength of 660 nm) was used . The energy applied at each point was equal to 5 j / cm / dose, continuous rate for 8 seconds, as specified by the manufacturer . The formula below was used to calculate the energy density (d), where the area (a: cm) corresponds to the broadcast area of the pen tip, power (p: w) corresponds to the maximum and constant power (20 mw or w 0.020) and the time (t) is measured in seconds . After applying the values supplied by the manufacturer in the formula, the energy density applied at each point was calculated to be 4.57 j / cm multiplied by 4 quadrants of 1 cm, resulting in a total of 18.28 j / cm in each session . Considering previous reports of several authors, a dose of 3 j / cm up to 6 j / cm2, 8, 9 has a regenerative action . Four consecutive daily sessions, with the first session occurring 24 hours after surgery, were applied . This protocol was chosen based on the fact that the process of wound repair is composed of 3 phases: inflammatory, proliferative, and remodeling phases involving the formation of collagen10, and lllt is more evident in the initial stages of healing2 . The outcome variables assessed were pain, interincisal opening, facial swelling, and presence of late infection . The experimental times considered in this protocol were as follows: t0 (initial time), t1 (24 h), t2 (48 h), t3 (72 h), t4 (96 h), t5 (120 h), t6 (144 h), and t7 (7 days after the surgery). The interincisal opening was assessed by measuring with a caliper of maximum opening between the right upper and lower central incisors before surgery and in all subsequent sessions11 . To evaluate swelling, a measurement from one tragus to the opposite one all patients were instructed to register the daily intensity of pain, beginning 24 hours after surgery, for seven postoperative days, using a visual analogue scale (vas) of 100 mm, in which the score for lack of pain was 0 (zero), and 100 (one hundred) was the score used for the worst imaginary pain . All data were analyzed using graphpad 5.0 (graphpad software, la jolla, california, usa). The level of significance was set at p <0.05 with a confidence interval of 95% . This study included 10 patients (mean age: 23 6.03 years) with asymptomatic third molars (no pain observed on the day prior to the surgery, as assessed by vas). All data on the interincisal opening, swelling and pain intensity are shown in table 1table 1.all data on the interincisal opening, swelling, and pain intensitypost - operatory evaluationt0t1*t2t3t4t5interincisal openning (mm)25th . Quartile24.525.223.013.76.0median49.040.028.523.016.575th . Quartile70.254.045.029.725.2 * statistically different from t0, friedman test, p<0.05 . * * statistically different from t0, friedman test, p<0.05 . * * * statistically different from t0, friedman test, p<0.05 .. * statistically different from t0, friedman test, p<0.05 . * * statistically different from t0, friedman test, p<0.05 . * * * statistically different from t0, friedman test, p<0.05 . With regard to the interincisal opening, a statistical decrease was observed 24 hours after the surgery (friedman test, p = 0.0001). Similarly, an increase in swelling was observed when comparing the initial condition and the first postoperative day (friedman test, p = 0.01). Therefore, it may be noted that both the swelling and interincisal opening returned to normal condition 24 hours after the first lllt application . Concerning the pain intensity (assessed by vas), no differences were observed between the first and second postoperative days (median: 49 versus median: 40). However, a reduction in pain intensity was observed immediately after the third postoperative day, reinforcing the possible effect of lllt on pain (friedman test, p = 0.001). Additionally, on the seventh day, the patients were asymptomatic . Even though the patients with a greater surgical duration had a slight increase in pain intensity on the first day, it was not statistically significant (spearman s correlation, p> 0.05) in this case series, we have focused on the local postoperative clinical factors after removal of third molars, such as pain, swelling and trismus . Despite the proven efficacy of lllt in the prevention of these factors, its mechanism of action thus, studies with positive as well as negative results have been reported, due mainly to a poorly calculated dosimetry and lack of uniformity in laser application1, 2, 6 . Sezer et al.13 found that only the diode laser with 808 nm wavelength were effective in reduction of trismus, whereas applying a laser diode with 660 nm wavelength was ineffective . Carrillo et al.14 showed that the incidence of trismus in the laser group (helio neon, 633 nm with energy density of 10 j / cm) was significantly lower than that in the placebo group seven days after extraction of third molars . Aras and gngrm15, 16 found that irradiation with diode laser with wavelength of 808 nm and 4 j / cm significantly decreases trismus . Moreover, lopez - ramirez et al.2 reported that lllt (gaalas, 810 nm, energy density of 5 j / cm) demonstrated no benefits in reducing pain and trismus after removal of impacted third molars . Similar results were described by roynesdal and colleagues17 when applying lllt with 830 nm 40 mw laser at 6 j. according to gngrm and aras15, 16, extraction of teeth can cause spasms of certain muscles, especially the masseter; therefore, applying an intraoral laser on a small area would not affect this muscle directly . However, in this study, favorable results were verified, as the reduction in trismus was probably related to the relaxation effect of lllt on other masticatory muscles such as masseter as well as the medial pterygoid . Lpez - ramirez and colleagues2 reported that lllt was not statistically effective in the reduction of trismus . Amarillas - escobar et al.18 conducted a similar study, but in order to assess the cumulative effect of the therapeutic laser, they applied multiple daily intraoral doses to the patients, immediately after surgery, and three sessions post - operatively (24, 48, and 72 h), using lllt (660 nm). The results of this study showed no significant differences in reducing pain, swelling, or trismus between the laser and the control group, although better conditions were noted in the laser group 24 hours after the application . However, sezer and colleagues13 found that only the diode laser (808 nm) was effective in biostimulation, whereas the diode laser (660 nm) was ineffective . However, the positive result observed at this study is probably due to the onset of laser application . Although lllt is considered to have analgesic effects, especially in neuralgic and muscular pain, its effects on pain related to inflammation are controversial2, 15,16,17, 19 . There is evidence suggesting that lllt can have significant pharmacological effects on the synthesis, release and metabolism of a series of biochemical mediators20, such as increase in the production of serotonin and acetylcholine in the central nervous system as well as histamine and prostaglandins peripherally21, 22 . It has also been shown that lllt induces analgesia by stimulating the synthesis of endogenous endorphins (-endorphin), decreasing the activity of bradykinin and c fibers and changing the pain threshold21, 22 . Lllt induces morphological changes of neurons, reduces the power of the mitochondrial membrane and blocks nerve conduction23, 24 . A steady decrease in pain was observed during the application days in this study, which is in agreement with the results of a previous study by markovi and todorovi25, who reported pain reduction by application of a gaalas laser after surgical removal of third molars, suggesting a dose - dependent effect . Moreover, it is important to state that there is a lack of knowledge concerning the use of this wavelength in oral surgery . A recently published meta - analysis and systematic review of the literature concluded that previous studies have important methodological differences that prevent establishment of the exact dose and ideal parameters for lllt26, 27, considering that there is a lack of standardization in the parameters as well as assessment tools employed27 . In conclusion, considering the limitations of this case series, these data suggest that oral application of lllt has anti - inflammatory and analgesic effects, which consequently reduces postoperative complications of oral surgeries . Further studies are needed, especially randomized controlled clinical trials, to help elucidate the impact of laser therapy after third molar extraction and establish the ideal parameters for lllt as an assessment tool in this promising therapy field. |
The transversus abdominis plane (tap) block provides effective post - operative analgesia after abdominal surgery . Rafi first described tap block, who injected local anesthetic through the ilio - lumbar triangle of petit within the tap between the internal oblique muscle and transversus abdominis muscle utilizing the double - loss of resistance technique . Virtually, the ultrasound - guided tap block is highly effective and easy technique for rendering analgesia for post anterior abdominal incision as supported by literature; however, it can also be used as a sole anesthetic technique for abdominal surgeries where the autonomic innervation is partly or not involved . A 67-year - old woman, 55 kg was admitted to hospital with a 3-day history of abdominal pain, nausea and vomiting . She was diagnosed to have chronic obstructive pulmonary disease (copd) 5 years ago and had four episodes of prior hospitalization secondary to acute exacerbation . She often required nebulisers and had an exercise tolerance of approximately 100 yards . In the week prior to admission she had received oral antibiotics and steroids for an infective exacerbation of copd . On admission to the hospital she had signs of peritonitis and her abdomen examination revealed reduced bi - basal air entry with crepitations all over the chest and chest x - ray showed consolidation of the right middle and lower lobe . Her arterial blood gas revealed type i respiratory failure (fio2 0.60, ph 7.37, po258 mmhg, pco245 mmhg). Intravenous acetaminophen was administered for pain relief, but despite this she could not cough or take deep inspiration due to ongoing pain . She was categorized as american society of anesthesiologists (asa) physical status grade iv / e and was planned for emergency laparotomy . We planned to avoid general, epidural or spinal anesthesia, so we opted for tap block under ultrasound guidance as a sole anesthetic technique . After proper explanation to the patient about the technique of tap block, she was taken to operation theatre table and monitors attached . Hence oxygen supplementation was carried out with venturi mask with oxygen flow at 6 l / min . Saturation improved to 92% . After securing an iv access with 18 g (gauge) needle on the right dorsum of the hand, she was sedated with intravenous dexmedetomidine infusion at 4 mcg / kg / min to make her comfortable, cooperative, and pain free for performing the block . Then she was laid supine with the anterolateral abdominal wall exposed bilaterally from the iliac crest to the sub - costal margins and scrubbed aseptically . The block was performed using an aseptic ultrasound guided in - plane technique (s - nerve sonosite, hfl38 (company brand name of the 6.0 to 13.0 mhz linear probe) probe, 100 mm sonoplex needle). When the needle tip position is within the tap neuro - fascial plane a mixture of 20 ml of 0.25% bupivacaine, 20 ml of 1% lidocaine and 0.2 mg adrenaline a remarkably good clinical effect was achieved within 30 min with almost complete resolution of pain . She made a slow post - operative recovery to be discharged from hospital 14 days after admission . The use of tap blocks for control of post - operative analgesia has been described following a variety of abdominal operations such as appendectomy, hernia repair, caesarean section, abdominal hysterectomy, and prostatectomy etc . Bilateral blocks can be given for midline incisions or laparoscopic surgery with careful safe dosing . To our knowledge, the use of ultrasound - guided bilateral tap for a sole anesthetic technique for upper abdominal surgery in a very high - risk patient has been rarely reported . The skin, muscles and parietal peritoneum of the anterior abdominal wall are innervated by the lower six thoracic nerves and the first lumbar nerve . After leaving the respective intervertebral foramina the anterior rami (sensory afferents) of these nerves course around the transverse process, then pierce the musculature of the lateral abdominal wall to course through a muscle neurovascular plane superficial to the transversus abdominis . In the midaxillary line, the sensory afferents branch out as a lateral cutaneous branch and continue within the tap to perforate anteriorly supplying the skin as far as the midline . The tap plane thus provides a space into which the local anesthetic can be deposited to achieve myocutaneous sensory blockade . Whilst early studies showed a t7 to l1 spread with a single posterior injection making the block suitable for midline abdominal incisions, other studies, however, failed to demonstrate a spread cephalad to t10 making it more suited for lower abdominal surgery . In a small cadaveric study, t11, t12, and l1 were most consistently present in the tap while t10 was present in 50% of the cases . However, augmentation with a subcostal injection will help attain a higher block up to t7 which is a modification of the original technique in which the ultrasound probe is placed just beneath the costal margin and parallel to it . The needle is then introduced from the lateral side of the rectus muscle in the plane of the ultrasound beam and 10 ml of local injected into the tap to extend the analgesia provided by the posterior tap block above the umbilicus . In our patient bilateral, sub - costal tap block under ultrasound guidance resulted in highly effective myocutaneous sensory blockade . As the patient was categorized as asa iv / e general anesthesia or central neuraxial blockade for the emergency operation for such a high - risk case would have resulted in untoward and fatal complications both intra - operatively and postoperatively . The abdominal wall sensory afferents, which course through the tap plane could be blocked successfully and effectively by abdominal field blocks or tap block under ultrasound guidance then the abdominal incision and operation could be carried out without patient's discomfort . Pain caused by visceral stimulation of the celiac plexus may still challenge intraabdominal surgical success which is a major limitation . When the surgeons manipulated the intestine, the patient complained of pain due to stimulation of autonomic nervous system through celiac plexus (vagus), but dexmedetomidine infusion helped in relieving the pain or retching sensation . Anatomically, sympathetic and somatic innervation are closely related near the neuraxis, but become separated peripherally . Thus, spinal, epidural or paravertebral blocks will cause significant sympathetic block, resulting in major cardiovascular changes and other physiological effects . On the other hand, if complete denervation of viscera is required, vagal afferents have to be blocked by celiac plexus block . The extent and spread of the local anesthetic solution in the tap affecting anterior abdominal wall sensory afferents depend on time factor . It seems that the full effect of analgesia takes at least 20 - 25 min after injection of local anesthetic solution . Mcdonnell et al . Suggest that local anesthetic spreads within the tap plane progressively over the several hours and an early assessment of the extensive tap block may be missed . As ultrasound - guided bilateral transversus abdominais neurofascial plane block is quite simple, quick, safe, and effective especially for a very high - risk patient with multi - medical problems and geriatric patients needing an elective or emergency abdominal surgery, the surgeons and anesthesiologists should encourage this technique, even in this advanced era, when it is deemed suitable. |
A retrospective review of clinical records of late postpartum eclampsia patients who had presented with acute onset of visual and/or neurological symptoms to the emergency department of a medical college hospital in south india between april 2009 and may 2013 was done . All patients had underwent mri with diffusion weighted imaging (dwi) and apparent diffusion coefficient (adc) mapping to differentiate vasogenic from cytotoxic cerebral edema . Patient records were analyzed for presence of visual symptoms, peak systolic and diastolic blood pressures, associated neurological symptoms, location of mri lesions and time taken for recovery . The mr images were graded for extent and severity of cortex and white matter vasogenic edema, degree of confluence, mass effect and ventricular distortion on a scale from 1 to 5 . Statistical analysis was performed using chi - square test and a p value of less than 0.05 was considered to be statistically significant . Clinical and imaging findings are summarized in table 1 . Clinical profile of patients with pres the 10 patients ranged in age from 21 to 32 years (average-26 3.49 years). Mean peak systolic and diastolic blood pressures were 144 21.71 and 93 9.19 mm of hg, respectively . Bilateral visual loss was noted in five patients of whom three patients were able to perceive hand movements and two patients had only perception of light . The most common abnormality noted on mri included bilateral symmetrical hyperintensities on t2-weighted images and fluid attenuated inversion recovery (flair) sequences in the parieto - occipital regions [figs . 1 and 2]. Dwi showed high signal intensity with no areas of restricted diffusion while adc mapping did not show corresponding low signal intensity thus suggesting vasogenic edema . Axial mr image (fluid attenuated inversion recovery) showing confluent edema in subcortical and deep white matter (grade 4) seen as hyperintensities in bilateral parieto - occipital lobes (patient 6) axial mr image (fluid attenuation inversion recovery) showing edema in subcortical white matter (grade 2) seen as hyperintensities in bilateral occipital lobes (patient 9) five patients had additional abnormalities in the cerebellar hemispheres and three patients had involvement of frontal lobes . Average time taken for visual recovery was 2.6 1.34 days . Follow - up mri in four patients after 1 month revealed complete resolution of these abnormalities . In the remaining, clinical symptoms and signs follow - up scans were not performed due to financial constraints . The extent of cerebral edema in patients with and without visual loss was compared and results summarized in table 2 . Posterior reversible encephalopathy syndrome (pres) is a rare neurotoxic state that presents with altered mental status, headache, seizures, and visual disturbances along with neuroimaging features of vasogenic edema involving the posterior cerebral circulation . Although several cases of pres have been reported in neurology and neuroradiology literature, exposure in ophthalmic literature has been rather limited . The causes of pres are diverse and include pre - eclampsia, eclampsia, renal insufficiency, solid organ transplantation and immunosuppressive therapy . Hypertensive encephalopathy is said to be the cause of this syndrome which has been demonstrated by various clinical and experimental studies . Patients with hypertensive encephalopathy have the same clinical signs as those with pres and they also have rapid resolution of clinical and imaging abnormalities once the blood pressure is lowered . The most widely accepted theory states that sudden elevation of blood pressure causes failure of autoregulation in the cerebral blood vessels leading to hyperperfusion, breakdown of blood brain barrier, and vasogenic edema . The posterior circulation is preferentially affected since it has less sympathetic innervation than the carotid circulation, thus rendering it less able to adjust to blood pressure fluctuations . However, this theory is not comprehensive because pres can affect normotensives . High degree of suspicion is required in these patients of late postpartum eclampsia because it occurs between 48 hours postpartum and 1 month after delivery frequently in women who have had a normal pregnancy and delivery and no signs of a pre - eclamptic syndrome . Alternative theory implicates endothelial dysfunction as the cause for occurrence of pres in eclampsia and sepsis . This is supported by the fact that elevations in markers of endothelial dysfunction such as lactate dehydrogenase and abnormal red blood cell fragmentation have been reported in pres . Vasospasm with subsequent ischemia has also been hypothesized to cause loss of integrity of the blood brain barrier in eclampsia . Although reversible by definition early recognition and prompt treatment is essential to prevent secondary complications like intracerebral hemorrhage and infarction . A large retrospective study of pres in diverse clinical situations revealed the occurrence of visual symptoms in 20% and headache in 26% while seizures was observed in 74% of cases . The visual disturbances reported with pres include cortical blindness, visual neglect, homonymous hemianopia and blurred vision . Cortical visual loss was observed in five of our patients (50%) while the remaining denied any visual disturbances . Our findings are in line with liman et al ., who observed that visual disturbances like cortical blindness, blurred vision and hemianopia are more common in eclampsia related pres (50%). Patients with pres due to other etiologies more often present with severe symptoms like altered mental status or neurological deficit and lesser visual disturbances (27.8%). Roth et al ., have also reported a higher percentage of disturbed vision in pre - eclampsia - eclampsia - related pres . This could be because of the younger age and lesser associated comorbidities in these patients as compared to patients with pres due to other etiologies . All patients (with / without visual loss) demonstrated bilateral symmetrical hyperintensities in the parieto - occipital regions on t2-weighted images . This feature along with predominant involvement of the white matter distinguishes this syndrome from bilateral posterior cerebral artery territory infarction . Although several studies have reported visual symptoms of varying degrees in pres, to the best of our knowledge no study has attempted to correlate the visual symptoms with imaging abnormalities . The limitations of our study include its retrospective design, and smaller sample size of postpartum eclampsia patients . We conclude that there is a higher prevalence of cortical visual loss in patients with pres associated with late postpartum eclampsia . Patients with higher degree of vasogenic edema of the posterior cerebral white matter might present with visual loss . Ophthalmologists should be aware of this clinical entity since it is reversible and readily treated by controlling the blood pressure . Further prospective studies comprising larger sample size and different etiologies of pres are warranted in this regard. |
Isotretinoin is a systemic synthetic retinoid used to treat moderate to severe nodulocystic acne vulgaris that is not responding to other therapies, as well as a number of other dermatologic diseases, including psoriasis, hidradenitis suppurativa, ichthyosis, lesions associated with lupus erythematosus, some cases of severe acne rosacea, and various skin cancers, or even adjunctive therapy for acute promyelocytic leukemia.1 among other adverse effects, isotretinoin has repeatedly been associated with depression, suicidality, and psychotic symptoms, although the link between isotretinoin use and psychiatric events remains controversial.2 remarkably, when affective psychosis and obsessive - compulsive disorder (ocd) occur following isotretinoin treatment, associated psychopathology is generally severe and eventually poorly responsive to conventional treatment, as highlighted by recent, large, retrospective studies.3 also, although patients suffering from bipolar disorder may be at increased risk for mood symptom exacerbations due to isotretinoin therapy, including suicidal ideation, even with a concurrent antimanic therapy,3 less is known about the risk for developing ex novo affective psychosis and antidepressant manic vulnerability when isotretinoin treatment is used during adolescence . Furthermore, acne itself often occurs during adolescence, and can be eventually induced by lithium, a standard treatment for bipolar disorder, which, in turn, usually has its onset at the same age . A 25-year - old caucasian male came to his first psychiatric consultation at the age of 23 years at the suggestion of his general practitioner due to complaints about intrusive obsessive thoughts starting about one year earlier . Obsessive symptoms essentially consisted of self - reproachment about his ineptitude in sitting academic examinations and consequent overwhelming feelings of guilt toward his parents . There were no associated physical problems, although he reported a history of severe acne vulgaris that had been successfully treated by a dermatologist with isotretinoin 10 mg / day since the age of about 16 years . Initial evaluation led to a diagnosis of ocd, after excluding a personal or family history for psychiatric disorders . Diagnosis was also made on the basis of the mini international neuropsychiatric interview4 and yale - brown obsessive - compulsive scale,5 the total score for which was 26 (24 indicates severe ocd). He was prescribed fluvoxamine 100 mg / day, having agreed to the proposal of dose augmentation within the following weeks . Two weeks later he had an unexpected precocious response with a marked ego - dystonic reaction, so current therapy was maintained . More surprisingly, two weeks later, intrusive thoughts reappeared, now associated with loss, concomitant intractable delusions of grandeur, flight of ideas, and an increase in goal - directed activity (eg, a sudden desire to start guitar lessons and to leave law school to become a theatrical agent). A diagnosis of mixed state with psychotic features was made on the basis of a young mania rating scale6 total score of 24 (12 indicates mania, although mixed state assessment may be roughly estimated). Therapy was then revised, halving the antidepressant dose and adding 1200 mg / day of carbamazepine (lithium, a neuroprotective antisuicidal drug having the potential to worsen psoriasis, and typical antipsychotic augmentation options being disregarded due to a likely lack of compliance and the patient s concerns about potential dermatologic recurrences). Despite the proposal of cognitive behavioral therapy augmentation or other nonpharmacologic interventions, the patient refused to take advantage of any therapy likely to be free of side effects, apparently for compliance reasons . After a further month the patient had a relapse of obsessive symptoms, with a substantial persistence of elation (despite considerably high carbamazepine serum levels, usually increasing by up to 60% in case of fluvoxamine coadministration), so he was prescribed fluvoxamine 25 mg / day and olanzapine 5 mg / day . Doses were then increased every three weeks, reaching a final amount of 300 mg / day and 15 mg / day, respectively . Both obsessive and mood symptoms progressively remitted until almost complete resolution was observed six months later . Patients with ocd and related disorders, eg, body dysmorphic disorder, may have excessive concern about minor variations in skin color or texture, ordinary moles, or thinning hair.7 a minority of cases, eg, some patients with severe psychotic body dysmorphic disorder and acne vulgaris, may abuse dermatologic drugs and cosmetics to inhibit normal seborrhea, as in the dorian gray syndrome (dream of eternal youth), eventually increasing the risk of long - term development of other psychiatric disorders, including affective psychosis.8 on the other hand, acne, alopecia areata, atopic dermatitis, and psoriasis may be associated with psychiatric conditions such as depression and suicidal ideation, as well as with the use of some psychotropic medications, possibly suggesting a substantial immunoneuroendocrine overlap.9 nonetheless, when a psychiatric comorbidity is diagnosed, patients seeking dermatologic care may interpret a suggestion to see a psychiatrist as indicating that the dermatologist thinks they are crazy or wants to get rid of them, thereby further reducing the chance of appropriate treatment . Concerning the relationship between isotretinoin and the potential for subsequent onset of psychopathology, positive dechallenge and rechallenge cases have been reported, prompting physicians to look out for the onset or worsening of psychiatric symptoms, including bipolar disorder.10,13 nonetheless, the neurotoxicity of the synthetic retinoic acid analogs is supported by a considerable body of literature . In fact, retinoids may lead to a decrease in dopaminergic orbitofrontal functioning via their effect on the hippocampus, which modulates dopaminergic function in the medial prefrontal cortex . Retinoic acid - induced deficits in hippocampal function may lead to a downstream effect on orbitofrontal function . However, evidence regarding the effects of retinoic acid in the serotonin pathways is controversial, although higher doses have resulted in decreased or complete loss of serotonergic neurons.1 this finding has psychiatric implications because the prefrontal dopaminergic imbalance may be closely associated with depression . Recent evidence from positron emission tomography studies in human subjects showed isotretinoin to be associated with a decrease in orbitofrontal metabolism, which is known to play a major role in the symptomatology of both ocd and bipolar disorder . In fact, the molecular components required for retinoic acid signaling are expressed in the adult brain, and the overlap of brain areas implicated in retinoic acid function, stress, and depression suggests that retinoids could play a role in affective and anxiety disorders,14 which are often comorbid . In this case, the choice of the selective serotonin reuptake inhibitor fluvoxamine was based on its proven efficacy in ocd and on its modulatory effects on -1 receptors, which might increase the antipsychotic effect of atypical antipsychotic drugs, possibly contributing to the early psychotic resolution showed by the patient described here.15,16 naturally occurring neurosteroids, as well as many psychotropic drugs, bind to -receptors, which may mediate some neuroprotective action, including mood and cognition improvement.17,18 although olanzapine and other atypical antipsychotic augmentation strategies for selective serotonin reuptake inhibitor - refractory, psychotic ocds and/or concomitant mood disorder are supported by an increasing body of literature,19,20 the choice of a single agent is often difficult.21 given their higher affinity for 5-ht2a receptors than for dopamine receptors, it has been speculated that atypical antipsychotics may induce ocd, even at low doses, due to high 5-ht2a antagonism, whereas improvement is thought to occur only at high doses in response to high dopaminergic antagonism.22 the choice of olanzapine augmentation for fluvoxamine therapy was also suggested by pharmacokinetic considerations . Fluvoxamine increases the olanzapine plasma concentration by approximately two - fold via cyp1a2 inhibition . On the other side, the alternative strategy of adding carbamazepine (even at low doses) to fluvoxamine and olanzapine was discounted for compliance reasons . Moreover, the patient did not originally show a satisfactory response to this antiepileptic drug even at 1200 mg / day (whereas olanzapine was indeed more effective, especially in reducing psychotic features). There were also pharmacokinetic considerations in the decision not to add carbamazepine, because it increases the renal clearance of olanzapine by about 45% and reduces the half - life of olanzapine by about 20%.23 in this case, the unusually rapid exacerbation on antidepressants, as well as the presence of plausible iatrogenic - induced depression with flights of ideas,24 pointed to a bipolar diathesis related to previous treatment with isotretinoin, suggesting the switch to an atypical antipsychotic that is associated with a rapid positive antipsychotic response . Indeed, antidepressant lability could occur even without any previous or current isotretinoin exposure, and it may be difficult to discriminate whether mood switches and rapid exacerbation phenomena are due to isotretinoin or not . It is noteworthy that the patient had no prior familial or personal predictors of bipolar disorder, including during adolescence, which is the usual age of onset . Moreover, in this case it is remarkable that even a considerable dose of carbamazepine was not able to prevent the mood switch . Also, the use of antidepressants such as fluvoxamine in the course of mixed states is debatable, although they are apparently well established in the management of ocd symptoms . Although the demonstration of a def initive causal relationship between isotretinoin use and increased risk for subsequent ocd development characterized by iatrogenic vulnerability for affective psychosis is beyond the scope of this report, the modern pathogenic concept of the vulnerability stress model25 (with isotretinoin considered an essential stress factor) of psychiatric disease may prompt further controlled research on this association . Finally, in addition to the suggestion of a relationship between isotretinoin and psychiatric disorders, this case report suggests that we should consider carefully both the course of illness and psychopharmacologic choices for patients reporting long - term use of isotretinoin during adolescence and complicated by ocd. |
Gentamicin (gm) is one of the amino glycoside drugs used in gram - negative infections . Nephrotoxicity is specified by renal dysfunction, which is distinguished by increasing serum levels of blood urea nitrogen (bun) and creatinine (cr). Compounds such as lycopene, metformin, garlic, vitamin e, probucol, and erythropoietin could prevent renal damage induced by gm . Furthermore, several studies have suggested that supplementations of herbal extracts such as ginkgo biloba, bauhinia variegata, pongamia pinnata flower, and grape seed may attenuate gm - induced nephrotoxicity . Althaea officinalis (marshmallow, marshmallow, or a common marshmallow), the member of malvaceae family, is well - known for its medicinal properties . It is demonstrated that a. officinalis has potential therapeutic benefits in lipomia, inflammation, gastric ulcer, and platelet aggregation . The pharmacological and antioxidant activities of a. officinalis refer to various compounds such as polysaccharides and flavonoids present in the plant . In the present study, we attempted to investigate the effect of a. officinalis flower extract (aofe) as an antioxidant against nephrotoxicity - induced by gm in male rats . Adult male wistar rats (animal centre, isfahan university of medical sciences) were used in this study . This research was approved in advance by the isfahan university of medical sciences ethics committee . Dried violet flowers of a. officinalis preparation of the extract was fulfilled in two steps; first, 600 ml ethanol 70% was added to 150 g prepared powder and the total mixture was shaken for 24 h at the temperature of 23 - 25c ., 600 ml ethanol 96% was added to the material remained from the first step and again the total mixture was shaken for 24 h at the temperature of 23 - 25c . The extract obtained after filtration in this step was mixed with the yield of the first step . Then, the total extract was incubated at the temperature of 50c for 48 h and finally 100% dried extract was obtained . Group 1 (n = 6) as negative control group received aofe 250 mg / kg / day for 9 days, and saline was added from day 3 ongroups 2 (n = 5) as positive control group received saline during the study and gm (100 mg / kg / day) was added from day 3 ongroup 3 (n = 6) received aofe 50 mg / kg / day for 9 days, and gm (100 mg / kg / day) was added from day 3 on . Groups 4 (n = 7) and 5 (n = 6) had the same regimen of group 3 except aofe dose which were 250 mg / kg / day and 500 mg / kg / day, respectively . All administrations were done intraperitoneally . At the end of the experiment, blood samples were obtained via heart puncture, and the serum was kept at 20c to measure the serum levels of bun and cr . Finally, the animals were killed . The kidneys were removed and weighed immediately . Left kidney was fixed in formalin and staining was performed to detect the tissue damage . Group 1 (n = 6) as negative control group received aofe 250 mg / kg / day for 9 days, and saline was added from day 3 on groups 2 (n = 5) as positive control group received saline during the study and gm (100 mg / kg / day) was added from day 3 on group 3 (n = 6) received aofe 50 mg / kg / day for 9 days, and gm (100 mg / kg / day) was added from day 3 on . Groups 4 (n = 7) and 5 (n = 6) had the same regimen of group 3 except aofe dose which were 250 mg / kg / day and 500 mg / kg / day, respectively . Blood samples were obtained via heart puncture, and the serum was kept at 20c to measure the serum levels of bun and cr . Finally, the animals were killed . The kidneys were removed and weighed immediately . Left kidney was fixed in formalin and staining was performed to detect the tissue damage . The left kidney was fixed in 10% neutral formalin and embedded in paraffin . After slicing, hematoxylin and eosin staining was performed to examine tissue damage including tubular atrophy, cast, debris, and necrotic materials in the tubular lumen . Intensity of tubular lesion was scored from 1 to 4, while zero score was assigned to normal tissue without damage . The two groups were compared with regard to the serum levels of bun and cr, and kidney weight (kw) by independent student's t - test . The parameters were analyzed by one - way anova followed by least significant difference test among the groups . The kidney tissue damage score (ktds) was compared using kruskal wallis or mann whitney tests . Preparation of the extract was fulfilled in two steps; first, 600 ml ethanol 70% was added to 150 g prepared powder and the total mixture was shaken for 24 h at the temperature of 23 - 25c ., 600 ml ethanol 96% was added to the material remained from the first step and again the total mixture was shaken for 24 h at the temperature of 23 - 25c . The extract obtained after filtration in this step was mixed with the yield of the first step . Then, the total extract was incubated at the temperature of 50c for 48 h and finally 100% dried extract was obtained . Group 1 (n = 6) as negative control group received aofe 250 mg / kg / day for 9 days, and saline was added from day 3 ongroups 2 (n = 5) as positive control group received saline during the study and gm (100 mg / kg / day) was added from day 3 ongroup 3 (n = 6) received aofe 50 mg / kg / day for 9 days, and gm (100 mg / kg / day) was added from day 3 on . Groups 4 (n = 7) and 5 (n = 6) had the same regimen of group 3 except aofe dose which were 250 mg / kg / day and 500 mg / kg / day, respectively . Blood samples were obtained via heart puncture, and the serum was kept at 20c to measure the serum levels of bun and cr . Finally, the animals were killed . Group 1 (n = 6) as negative control group received aofe 250 mg / kg / day for 9 days, and saline was added from day 3 on groups 2 (n = 5) as positive control group received saline during the study and gm (100 mg / kg / day) was added from day 3 on group 3 (n = 6) received aofe 50 mg / kg / day for 9 days, and gm (100 mg / kg / day) was added from day 3 on . Groups 4 (n = 7) and 5 (n = 6) had the same regimen of group 3 except aofe dose which were 250 mg / kg / day and 500 mg / kg / day, respectively . Blood samples were obtained via heart puncture, and the serum was kept at 20c to measure the serum levels of bun and cr . Finally, the animals were killed . The kidneys were removed and weighed immediately . Left kidney was fixed in formalin and staining was performed to detect the tissue damage . The left kidney was fixed in 10% neutral formalin and embedded in paraffin . After slicing, hematoxylin and eosin staining was performed to examine tissue damage including tubular atrophy, cast, debris, and necrotic materials in the tubular lumen . Intensity of tubular lesion was scored from 1 to 4, while zero score was assigned to normal tissue without damage . The two groups were compared with regard to the serum levels of bun and cr, and kidney weight (kw) by independent student's t - test . The parameters were analyzed by one - way anova followed by least significant difference test among the groups . Gentamicin itself induced nephrotoxicity, which was confirmed by increasing in the serum levels of bun and cr as well as elevating in ktds and kw (p <0.05) [table 1]. Administration of various doses of aofe accompanied with gm did not attenuate the serum levels of bun and cr; rather it increased the values (p <0.05). High dose of aofe aggravated renal damage induced by gm in comparison with other groups (p <0.05) [figure 1]. Sample images from group 1 treated with aofe alone and group 5 treated with gm plus high dose of aofe are demonstrated in figure 2 . Bun and cr serum levels, ktds, and kw g/100 g body weight in the experiment groups blood urea nitrogen (bun) and creatinine (cr) serum levels, kidney tissue damage score (ktds), and kidney weight g/100 g of body weight in the experiment groups . Gentamicin (gm), althaea officinalis flower extract (aofe) 50 + gm, aofe 250 + gm, and aofe 500 + gm groups received saline, aofe 50 mg / kg / day, aofe 250 mg / kg / day, and aofe 500 mg / kg / day for 9 days, respectively, and gm (gm; 100 mg / kg / day) was added from day 3 on . Indicates significant difference from aofe 250 + gm group sample images from group 1 treated with althaea officinalis flower extract (aofe) alone (left) and group 5 treated with gm plus high dose of aofe (right). The aim of this study was to investigate whether aofe could ameliorate nephrotoxicity induced by gm in the male rat . We observed that aofe administration did not ameliorate nephrotoxicity induced by gm; rather it intensified renal failure . Gm induces renal dysfunction, which is characterized by increase in levels of cr, uric acid, and bun . In addition, it is accompanied with tissue alterations such as glomerular congestion, disruption of glomerular capillaries, vacuolar degeneration of tubular epithelial cells, and hyaline cast formation . Furthermore, the present study indicated that gm enhanced normalized kw probably due to edema caused by tubular necrosis . Useful properties of a. officinalis flower were documented in the literature, but we did not obtain positive results in the administered doses . It is demonstrated that administration of 50 mg / kg dose of a. officinalis flower result in a significant increase in serum hdl cholesterol level . Also, antiinflammatory and antiulcerogenic effects of the extract were observed at doses of 50, 100, and 250 mg / kg . In contrast, we observed that doses of 50 and 250 mg / kg of aofe aggravated the increased levels of bun and cr induced by gm . In addition, aofe at the dose of 500 mg / kg aggravated both renal dysfunction and tissue damage . It has reported that increasing the dose of aofe to 500 mg / kg significantly decreased stool water content . It is also reported that high doses of some antioxidants provide a harmful effect on survival of the subjects . Therefore, it is possible that aofe at the doses lower than 50 mg / kg may ameliorate nephrotoxicity induced by gm . Although aofe acts as an antioxidant, doses of aofe used in the current study did not ameliorate nephrotoxicity induced by gm, and it is necessary to test doses lower than 50 mg / kg. |
Institutional review board approval was obtained from the wake forest university, and informed consent forms were completed for all participants . Items for four concepts identified in the literature were glucose control, well - being and side - effects, lifestyle burden, and treatment complexity and convenience and were evaluated in a series of five focus groups made up of five to eight patients drawn from an evaluation study of community diabetes clinics in north carolina (11). Participants were male and female and white and nonwhite with simple and complex medication regimens and a1c levels that ranged from well controlled to uncontrolled . The resulting 35-item prototype instrument was administered by mail to a convenience sample of 75 patients (the exploratory sample), who were treated with diabetes medications at our study community - care site, to assess item reliability, mean and distribution, redundancy or uniqueness, skewness, and construct validity . Also examined were item correlations with a1c level, the multidimensional diabetes questionnaire (12) lifestyle interference scale, the medical outcomes studies (mos) health worries scale score (13), and global items assessing extent that blood glucose has been unacceptably high or low . An item performance score was constructed (0, weak; 1, moderate; or 2, ideal performance) to guide item retention . Fifty - five (73%) patients completed the survey, and nine items were removed based on skewness or redundancy (r> 0.75) with other items . In the initial test sample, patients of a large family - medicine practice treated for diabetes with a recent a1c value within the last 3 months (the evaluation sample) were invited to complete the study survey packet including the revised 26-item instrument and validation instrument described above . Medication complexity was assessed using a score of 0 or 1 (no / yes) for common diabetes medications and a score of 0 or 2 (no / yes) for insulin, a more demanding regimen . Self - reported adherence to medications was by recall of skipped or missed doses over the last 10 days . Packets were mailed to patients with instructions and a voucher for a 25 usd gift certificate . Exploratory factor analysis (efa) of the dmsat items was conducted using sas (version 8; sas, cary, nc) to assess whether the common factor model was appropriate (14) based on kaiser's sampling adequacy, scree plot, and model fit . Discriminant validity of the dmsat was examined by comparing means across levels of a1c (<8% and 8%), treatment complexity (low and high), self - reported adherence, and mos health worries . For the final test sample, another sample of patients from our community diabetes care clinics (11) and from an academic medical center was recruited to conduct and evaluate confirmatory factor analysis of the dmsat and confirm validity in the evaluation sample, 194 (63%) of 307 eligible patients returned the survey packet; of these, 140 reported current medication use . Participants had a mean age of 63 years, and most had completed high school (77%) and had been diagnosed with diabetes at least 5 years previously (61%). One - third (2939%) were taking one, two, or three medications for diabetes, with 16% taking insulin; 14% had a recent a1c> 8.0%, and 19% rated their adherence to their medication regimen in the last 10 days as less than complete . Ten items displayed high inter - item correlations (> 0.75) and were removed . Initial factor analysis of the reduced 16-item questionnaire identified a four - factor structure consistent with our domains of lifestyle, medical control, convenience, and well - being and explained 75% of the total variance . As shown in table 1, dmsat scales and total score discriminated (p <0.05) between high and low levels of treatment complexity, self - rated glucose control, mos health worries scale score, and clinical value for recent a1c (<8% vs. 8%) in the expected direction . Correlation of the dmsat scores with continuous a1c values was 0.24 (p = 0.0049). In the final, confirmatory sample, as shown in table 1, dmsat scales and total scores discriminated between validity groups as in the previous sample and were highly correlated with the dtsq (r = 0.68; p <0.001). Unlike the dmsat, the dtsq total score did not discriminate between levels of treatment complexity and clinical a1c value . The dmsat is intended as a brief measure of diabetes medication treatment satisfaction and discriminates between important correlates of patient management . It performed as well as the dtsq in detecting self - rated glucose control and health worries but showed superior properties in correspondence with treatment complexity and a1c . Note that appraisals of cost of medications or specific side effects that may be caused by diabetes or its treatment, such as diminished sexual functioning, bloating, or weight gain, are not separately assessed and may require assessment elsewhere ., we believe that the 16-item dmsat offers a comprehensive assessment of satisfaction with diabetes therapy and may aid in individualizing patient diabetes treatment. |
The incidence of infective endocarditis (ie) remained relatively stable from 1950 through 2000 at about 3.6 to 7.0 cases per 100,000 patient - years.1 in selected areas, the incidence may rise because of the concentration of populations at uniquely high risk of infection, specifically intravenous (iv) drug abusers . The risk of ie among iv drug abusers, 2 to 5% per patient - years, is several - fold greater than that for patients with rheumatic heart disease or prosthetic valves . Ie is located on the tricuspid valve in 46 to 58% of patients with iv drug abuse . Staphylococcus aureus causes more than 50% of ie occurring in iv drug abusers overall and 60 to 70% of infection involving the tricuspid valve . The clinical manifestation of ie in iv drug abusers depends on the valve involved and, to a lesser degree, on the infecting organism . The sensitivity of transthoracic echocardiography (tte) for the detection of vegetations in patients with native valve endocarditis (nve) is approximately 65%, whereas that of transesophageal echocardiography (tee) in these patients is 85 to 95%.2 tee is the preferred approach in patients in whom tte is technically suboptimal and is the procedure of choice for imaging the pulmonic valve.3 when initial tee is negative and the clinical suspicion of ie remains, repeating tee within 7 to 10 days is advocated.4 perivalvular abscess or intracardiac fistula formation occurs in 10 to 14% of patients with nve.6 persistent, otherwise unexplained, fever despite appropriate antimicrobial therapy in patients with ie suggests infection extending beyond the valve leaflet . Tee is superior to tte for detecting invasive infection in patients with nve and prosthetic valve endocarditis (pve). Cardiac surgery should be considered to debride abscesses, allowing the eradication of uncontrolled infection, and to reconstruct cardiac structures, restoring homodynamic and alleviating congestive heart failure . A 21-year - old man, who was an iv drug abuser, presented with fever and dyspnea . Tte showed highly mobile, large vegetation on the anterior leaflet of the tricuspid valve and no vegetation on the aortic valve, mitral valve, and pulmonic valve . The patient was admitted to the cardiology ward for antibiotic therapy and received vancomycin and gentamycin . The blood culture of the patient became positive for staphylococcus areus 3 times in 24-hour intervals . Despite the antibiotic therapy for 10 days tee revealed severe aortic insufficiency, moderate tricuspid regurgitation, and an echo - lucent space between the tricuspid and aortic valves (figures 1). Color doppler demonstrated a flow within the echo - lucent space and a connection between that and the left ventricle, suggesting a perivalvular abscess of the tricuspid valve opening in the left ventricle (figure 2). After consultation with a cardiac surgeon, the patient was transferred to the operating room, where he unfortunately expired due to severe bleeding and disseminated intravascular coagulation . Ie is a serious complication of iv drug abuse, with a reported mortality of 5 to 10%.1 endocarditis in iv drug abusers commonly involves the tricuspid valve, and staphylococcus aureus is the most common causative organism . Dyspnea, cough, and chest pain are the common complaints of iv drug users . This is likely related to the predominance of tricuspid valve endocarditis in this group and secondary embolic showering of the pulmonary vasculature . Within a week after the initiation of effective antimicrobial therapy, almost 70% of patients with nve or pve are afebrile and 90% have defervesced by the end of the second week of treatment.5 persistence or recurrence of fever more than 10 days after the initiation of antibiotic therapy identifies patients with increased mortality rates and with complications of infection or therapy.5 patients with a prolonged or recurrent fever should be evaluated for intracardiac complications . Perivalvular infection beyond the valve leaflet results in abscesses in the annulus or adjacent structures, intracardiac fistulas, and purulent pericarditis . Periannular extension is common, occurring in 10 to 40% of all native valve ie and complicates aortic valve endocarditis more commonly than mitral or tricuspid valve endocarditis.3 intra - cardiac fistulas are rarely seen and they are estimated to account for <1% of all cases of ie.6 fistulization of the paravalvular abscess has been found in 6 to 9% of all cases.7 perivalvular abscess and intracardiac fistula of the tricuspid valve is very rare . Ie is a lethal disease if not treated aggressively with parental antibiotics, often in combination with surgery . Cardiac surgery should be considered in patients with perivalvular abscess and intracardiac fistula to debride abscesses and to reconstruct cardiac structures, restoring homodynamic and alleviating congestive heart failure. |
Six hundred officers were recruited from the police departments of new york, ny, and oakland and san jose, calif, usa . Fifty - two percent of the sample was caucasian . The mean age was 36,50 years (standard deviation [sd])=6.96). Years in the police force everaged 12.37 (sd=6.78). Number of exposure to critical incidents ranged from 2 to 670 (mean [m]= 171.27, sd=130.93).the incident selected for completing the questionnaires had occured on average 6.50 (sd= 5.11) years ago . The peritraumatic distress scale (pds) was used to assess emotional, cognitive, and physical reactions occuring during a critical incident and immediatly after . Dissociation at the time of the incident was measured with the peritraumatic dissociative experience questionnaire (pdeq).the impact of event scale - revised (ies - r) was used to measure ptsd symptoms in the last 7 days . The mississippi scale (mcs) was used to measure ptsd and associated symptoms since the critical incident . We conducted a cronbach alpha reliability analysis and an oblique principal factor analysis with promax rotation on the items of the pds . Two series of hierarchical multiple regression analyses were conducted using sociodemographics (gender, ethnicity, years of service), exposure, the pdeq and pds as predictors of either the mcs or the ies - r six hundred officers were recruited from the police departments of new york, ny, and oakland and san jose, calif, usa . Fifty - two percent of the sample was caucasian . The mean age was 36,50 years (standard deviation [sd])=6.96). Years in the police force everaged 12.37 (sd=6.78). Number of exposure to critical incidents ranged from 2 to 670 (mean [m]= 171.27, sd=130.93).the incident selected for completing the questionnaires had occured on average 6.50 (sd= 5.11) years ago . The peritraumatic distress scale (pds) was used to assess emotional, cognitive, and physical reactions occuring during a critical incident and immediatly after . Dissociation at the time of the incident was measured with the peritraumatic dissociative experience questionnaire (pdeq).the impact of event scale - revised (ies - r) was used to measure ptsd symptoms in the last 7 days . The mississippi scale (mcs) was used to measure ptsd and associated symptoms since the critical incident . We conducted a cronbach alpha reliability analysis and an oblique principal factor analysis with promax rotation on the items of the pds . Two series of hierarchical multiple regression analyses were conducted using sociodemographics (gender, ethnicity, years of service), exposure, the pdeq and pds as predictors of either the mcs or the ies - r the pds scores ranged from 0.10 to 3.57 and the mean was 1.37 (sd=0.56). The scale was internally consistent (=0.80) and showed strong convergent validity with the pdeq, r(599)=0.55, p<0.001 . The pds factor solution is presented in table i items defining factor 1 included dysphoric emotions such as helplessness, sadness and grief, frustration and anger, and horror . Factor 2 was mostly defined by items related to loss of safety and arousal, such as being afraid, thinking one might die, and having intense bodily reactions (sweating, shaking, heart - pounding). Items loading on factor 3 were related to the loss of positive beliefs about the self and others, such as thinking that one had done all he or she could during the critical incident, not felling prepared by one's experience, and not believing tha others understood . We labeled the factors negative emotions, perceived life threat and bodily arousal, and appraisal . The sum of communality estimates was 7.58, explaining 38% of the communality estimates was 7.58, explaining 38% of the total variance and 93% of trace . Intercorrelations among the pds factors were low, ranging from -0.25 to 0.12 (p<0.05). The low pds factor intercorrelation coupled with correlations of 0.17 to 0.42 (p<0.001) with the outcome measures (ies - r and mcs) suggest that various forms of peritraumatic distress, as captured by the pds, can lead to the development of ptsd symptoms . Two stepwise regression analyses (not fully reported here) were conducted . In predicting the mcs and ies - r, the pdeq, entered in the second step, explained 20% and 16% of unique variance on the mcs and ies - r, respectively . Entering the pds in step 3 explained 11% and 8% unique variance on the mcs and ies - r, respectively . We repeated this set of analyses with the inclusion order of the pdeq and pds reversed . Entered in the second step, the pds explained 29% and 17% of unique variance on the mcs and ies - r, respectively . Entered in the third step, the pdeq explained 3% of unique variance on both the mcs and the ies - r . The items and factors of the pds provide insight as to what some of the salient peritraumatic dimensions may be, in addition to peritraumatic dissociation . In this study, the pds explained a significant amount of variance over and above peritraumatic dissociation which is currently considered among the mos powerful predictors of ptsd symptoms . Test - retest data for the pds is currently being gathered as well as data from individuals not working in the police . In future, it would be useful to investigate prospectively the power of the pds in predicting ptsd diagnosis rather than symptoms, as well as other trauma - related disorders. |
The most important goal of health systems is improving quality, effectiveness and efficiency of healthcare services (1). However, scattered health information has a negative effect on healthcare services and would impose more expenses to the healthcare system (2). Electronic health record (ehr) as a modern method of storing and processing health information is a solution for imp - roving quality, safety and efficiency of patient care and health system . The basis of ehr is clinical information; however, it is used not only by clinicians, but also by those who manage healthcare operations, quality, risk, research, education and payment . However, iso / tr 20514 defined it as a repository of information regarding the health status of a subject of care in computer processable form, stored and transmitted securely, and accessible by multiple authorized users . It has a standardized or commonly agreed logical information model which is independent of ehr systems . Its primary purpose is the support of continuing, efficient and quality integrated healthcare and it contains information which is retrospective, concurrent, and prospective (4). The benefits of ehr have been examined by considering clinical, organizational, and social outcomes . However, social outcomes include more ability for conducting research and improving population health (5). It should even be capable of integrating data across providers and from personal medical records to form a longitudinal health record . However, ehr requires a significant investment of time and money, while many of healthcare providers have very limited access to capital . That is why the cost benefit issue and the application of open source software (oss) have been taken into consideration in some ehr projects (3). The present study identifies the potential impact of application of open source software in developing national electronic health record in iran . Open source software (oss), free and open source software (foss) and free, libre and open source software (floss) - although are not exactly the same- are alternative terms to describe free software (6). There are basic principles for open source software including free redistribution, inclusion of source code, allowing for modification, integrity of the author s source code, no discrimination against any person or group, no discrimination against fields of usage, no need for an additional license . Also the license should not be specific to a product or technology and should not restrict other software (7). The promise of open source software is better quality, higher reliability, more flexibility, lower cost, and an end to predatory vendor lock - in . Open source technology is one of the most effective mechanisms for technology transfer which could foster the national economy . This is because the source codes and licensing of the software are free of charge and open for inspection and usage (9). Today, a wide range of open source applications is accessible through the web including web servers, web browsers, databases, programming languages, image editors and email clients (1015). Oss could provide competition in commercial market, encourage innovation and promote compatibility and interoperation in health domain . This would guarantee better quality and lower cost . Also it would make the systems more responsive to changing clinical and organizational requirements (16). Several communities work on developing open source ehr systems to reduce the costs of ehr deployment and maintenance (17). In america, many systems deployed by the u.s . Nowadays, a large number of health information systems are available as open source evidence based guideline and decision support system (egadss) is an open source clinical decision support system (cdss) project began in may 2004 to provide patient specific point of care reminders . Egadss would respond to requests from electronic medical records to provide patient specific clinical guidance based on its internal guidelines . It operates on decision algorithms, medical knowledge, and specific patient data to generate recommendations and guidance for clinicians in order to aid them provide high quality care (19). Care2x is a hospital information system through which the authorized staff like physicians can access patients data even from outside the hospital without using specialized software . Open source cluster application resources (oscar) is open source electronic medical record (emr) which was started by the department of family medicine at mcmaster university in 2001 . It contains healthcare information with a lot of functions including complete scheduling, e - charting, prescribing, billing, lab downloads, tables and graphs, chronic disease management tools, disease registry, automated customizable forms, sophisticated antenatal care record and planner, tabulation of outstanding preventative and intervention practices, and also research tools . Oscar is used by healthcare professionals including physicians, nurses, midwives, social workers, psychologists and physiotherapists (21). Open source ehr project directed by the american academy of family physicians (aafp) is an attempt to lower the cost of ehr by sharing the source code (3) another example is orca (open receipt computer advanced) which is a project of information and communication infra - structure based on oss to overcome problems of high costs, inflexibility and restrictions associated with proprietary systems . About 14,000 medical providers in japan are using products of orca (22). The advantages of an open source ehr outweigh the costs of a proprietary ehr system (23). Open source technology makes the opportunity for advanced innovation in the health information sector of low income countries (24). In iran several scattered attempts to design these systems were produced by different companies and applied in different regions . As they did not follow particular standards, integrating their outputs however, development of a set of standards is always a necessary requirement for integrating different information systems (26). In iran, several studies on medical information systems have been done focusing on various domains especially on usability, efficacy, standards, architecture, structure and content . In 2001, the usability of software packages in medical records departments of several hospitals in tehran was compared . The findings showed that the overall usability of medical records software packages in the hospitals was 55% which indicated the available packages did not have the necessary capabilities to meet the requirements of medical records departments (27). In another study nine hospital information systems applied in a number of hospitals in iran the results showed that total average of compatibility of systems with the general requirements of his was 65.4%, (28). In 2006, an object - oriented model for some key messages was designed to support ehr through comparing weaknesses and strengths of hl7 and openehr standards . According to the study, it could ensure open, future - oriented electronic health records in iran (29). In 2007, ehr content, structure, and terminology standards in selected organizations were investigated in order to design an appropriate model of ehr for iran . The study suggested a national model for ehr based on the weakness and capabilities of standards provided by the investigated organizations (2). According to the evidences, a wide range of information systems are used in iranian hospitals, clinics, pharmacies and offices . However, the majority of these systems are originally designed as non - shareable . To design an integrated ehr system, all components of the health system therefore, the available clinical data on the existing systems in iran have neither been applied in decision making nor served as a basis for evidence based medicine . This situation addresses the need for developing an integrated shareable information system of ehr in iran . Such a system will not only help using the collected data for different purposes, but also serves as an infrastructure for a variety of e - health activities in the country (25). The evidences also showed that financial limitation is one of the obstacles to implement electronic health records in developing countries . Therefore, establishment of an open source ehr system capable of modifications according to the national requirements seems to be inevitable in iran . Establishment of a national ehr requires a wide cooperation and coordination among involved ministries and organizations . The prerequisites for a national ehr can be summarized as follows: electronic record in a national extent including health data centerfacilities for electronic recording and transferring information produced in health data centers including hardware and software equipments and also cultural infrastructuresdeveloping standards for coding and data exchangedevelopment of information technology infrastructures with sufficient band - width and connections to meet the present and future needs of national health systemdevelopment plan for communication and messaging services to support new information cycles (25). Electronic record in a national extent including health data center facilities for electronic recording and transferring information produced in health data centers including hardware and software equipments and also cultural infrastructures developing standards for coding and data exchange development of information technology infrastructures with sufficient band - width and connections to meet the present and future needs of national health system development plan for communication and messaging services to support new information cycles (25). The project of iranian electronic health record (sepas) supported by iranian ministry of health is the greatest information technology project in the health sector in the country . At the present time, the infrastructure of sepas is being processed to provide a platform for data exchange among health centers all over the country . Health information of all citizens from birth to death will be recorded in their individual ehrs . As a result the key values of sepas include providing citizen rights, justice, data confidentiality and information security . The main objectives of this project are: integration of citizens health information;improving the quality of health services;equitable distribution of health resources;improving the management of health resources and improving healthcare system based on quick access to correct and accurate information;expediting and facilitating production and management of biomedical knowledge;contribution to the development of evidence based medicine;reducing complications resulted from medical errors;reducing healthcare costs;increasing security of health information;strengthening the monitoring role of the health system;improving the quality of medical education;providing new electronic services;improving the industry of healthcare in iran (30). Integration of citizens health information; improving the quality of health services; equitable distribution of health resources; improving the management of health resources and improving healthcare system based on quick access to correct and accurate information; expediting and facilitating production and management of biomedical knowledge; contribution to the development of evidence based medicine; reducing complications resulted from medical errors; reducing healthcare costs; increasing security of health information; strengthening the monitoring role of the health system; improving the quality of medical education; providing new electronic services; improving the industry of healthcare in iran (30). According to the architecture plan for national ehr in iran, information systems would be categorized in three levels which are peripheral, intermediate and central . These systems are independent and connected to one another via certain standard protocols . As a result, information would flow upwards through the following levels and circulate throughout the whole network: information system level 1 (peripheral level) which is connected to medical equipments or portable devices such as smart cards or pdas . It can simply be used at intermediate health providing centers for the ease of data entry and transfer.information system level 2 (intermediate level) which is installed and utilized in health providing centers . Such systems are customized according to the needs and specification of healthcare providing centers.information system level 3 (central level) which will be installed at the ministry of health and medical universities . Information system level 1 (peripheral level) which is connected to medical equipments or portable devices such as smart cards or pdas . It can simply be used at intermediate health providing centers for the ease of data entry and transfer . Information system level 2 (intermediate level) which is installed and utilized in health providing centers . Information system level 3 (central level) which will be installed at the ministry of health and medical universities . Development of electronic health record in iran would increase: public access to healthcare services especially in deprived regions and evenly distribution of healthcare services throughout the country;modification of the national health management system based on the evidence and precise data;utilization of healthcare resources;delivery of modern electronic services such as teleappointing, teleconsulting, reminder and alerting systems;provision of a proper background for production and management of medical knowledge;supervision, evaluation and audition of healthcare services;establishment of statistical registry system;community cooperation in public health;individual accessibility to personal health information to choose the appropriate method of diagnosis and treatment;provision of necessary tools for clinical decision making;the work flow of the whole system through reengineering the process and performance of different units;the income cycle;citizens ` satisfaction;quality of care through developing a standard method for collection and interpretation of data;time and cost effectiveness and efficiency;medical knowledge by creating a suitable structure for retrospective as well as prospective medical researches;documentation and audition of documents;following the medical guidelines through sending alerts by the system;management of health centers;and the accessibility of medical information in cases of crisis and natural disasters . Public access to healthcare services especially in deprived regions and evenly distribution of healthcare services throughout the country; modification of the national health management system based on the evidence and precise data; utilization of healthcare resources; delivery of modern electronic services such as teleappointing, teleconsulting, reminder and alerting systems; provision of a proper background for production and management of medical knowledge; supervision, evaluation and audition of healthcare services; establishment of statistical registry system; community cooperation in public health; individual accessibility to personal health information to choose the appropriate method of diagnosis and treatment; provision of necessary tools for clinical decision making; the work flow of the whole system through reengineering the process and performance of different units; citizens ` satisfaction; quality of care through developing a standard method for collection and interpretation of data; time and cost effectiveness and efficiency; medical knowledge by creating a suitable structure for retrospective as well as prospective medical researches; documentation and audition of documents; following the medical guidelines through sending alerts by the system; management of health centers; and the accessibility of medical information in cases of crisis and natural disasters . On the other hand, developing electronic health record in iran could decrease: medical errors and the consequent complications;mortality rate caused by medical errors;drug adverse effects through recording individuals previous reactions;need for more human resources especially in accounting and medical records departments;cost of healthcare by cutting repeated or unnecessary services;cost of stationary materials e.g. Paper charts and radiology films and fixed expenses for equipments;accounting, documentation and archiving expenses;required time for retrieving and analyzing medical data;waiting time for admission;hospitalization time (31). Medical errors and the consequent complications; mortality rate caused by medical errors; drug adverse effects through recording individuals previous reactions; need for more human resources especially in accounting and medical records departments; cost of healthcare by cutting repeated or unnecessary services; cost of stationary materials e.g. Paper charts and radiology films and fixed expenses for equipments; accounting, documentation and archiving expenses; required time for retrieving and analyzing medical data; waiting time for admission; hospitalization time (31). Open source technology is one of the most effective mechanisms for technology transfer which could foster the national economy . This is because the source codes and licensing of the software are free of charge and open for inspection and usage (9). Many organizations and countries face various problems in using proprietary software which could be resolved through using oss . Among them, the cost of licensing, the difficulty of choosing a system capable of being modified according to the changing needs with the ability to integrate with the existing and future systems are major barriers (22). Open source solution provides many potential benefits for the establishment of national ehr in iran . It allows quick implementation of the tools, while reducing medical errors and costs in a fast and easy process (32). The advantages of utilizing oss in developing national ehr include high quality, reliability and security of system resulting from continuous and extensive peer review of software; availability of source code which enables any modification in response to the changing missions and threats; avoidance of vendor lock - in; freedom to use; and low total cost of ownership (18). The approach of open source is similar to the peer - review scientific process through which one can see and reproduce results to understand and promote what is already shared (33). In healthcare systems, continuous and broad peer review of source code could make the system secure and reliable . This will improve data confidentiality and will also be useful for quality assessment (34, 35). Evaluation of health information system would improve the performance of the system (36). At present time, developing countries are well - positioned to take advantage of the open - source movement especially in health sector to overcome health inequity (37). Open source software would create a mutually beneficial relationship between vendor and customer while proprietary software generally lacks this characteristic . Open source is a collaborative process that is improved by the coordinated sharing of information (38). In other words, cooperative development of high quality software is one of the main advantages of open source approach . Well - designed open source software could enable other developers to adopt and modify the software according to their requirements . Finally, they can build their own tools based on the contribution of other expert s experiences (39). Millard and colleagues believe that a new millennium development goal should include the creation of a universal open - source health informatics platform that will allow the collection, management and delivery of clinical and population data that will guide decision processes at the local, regional and global levels (40). By using open source systems, institutions are not locked in to specific vendors and have more control over the application s features . Some believe that the reduced total cost of ownership is the major benefit of oss (35). However, this is highly dependent on the financial situations of the country and its total income . For a developing country like iran, the application of oss in the establishment of national ehr and other health information systems would create a great opportunity to improve national healthcare setting without paying major costs for development and maintenance of health information systems . Open source software (oss), free and open source software (foss) and free, libre and open source software (floss) - although are not exactly the same- are alternative terms to describe free software (6). There are basic principles for open source software including free redistribution, inclusion of source code, allowing for modification, integrity of the author s source code, no discrimination against any person or group, no discrimination against fields of usage, no need for an additional license . Also the license should not be specific to a product or technology and should not restrict other software (7). The promise of open source software is better quality, higher reliability, more flexibility, lower cost, and an end to predatory vendor lock - in . Open source technology is one of the most effective mechanisms for technology transfer which could foster the national economy . This is because the source codes and licensing of the software are free of charge and open for inspection and usage (9). Today, a wide range of open source applications is accessible through the web including web servers, web browsers, databases, programming languages, image editors and email clients (1015). Oss could provide competition in commercial market, encourage innovation and promote compatibility and interoperation in health domain . This would guarantee better quality and lower cost . Also it would make the systems more responsive to changing clinical and organizational requirements (16). Several communities work on developing open source ehr systems to reduce the costs of ehr deployment and maintenance (17). In america, many systems deployed by the u.s . Nowadays, a large number of health information systems are available as open source evidence based guideline and decision support system (egadss) is an open source clinical decision support system (cdss) project began in may 2004 to provide patient specific point of care reminders . Egadss would respond to requests from electronic medical records to provide patient specific clinical guidance based on its internal guidelines . It operates on decision algorithms, medical knowledge, and specific patient data to generate recommendations and guidance for clinicians in order to aid them provide high quality care (19). Care2x is a hospital information system through which the authorized staff like physicians can access patients data even from outside the hospital without using specialized software . Open source cluster application resources (oscar) is open source electronic medical record (emr) which was started by the department of family medicine at mcmaster university in 2001 . It contains healthcare information with a lot of functions including complete scheduling, e - charting, prescribing, billing, lab downloads, tables and graphs, chronic disease management tools, disease registry, automated customizable forms, sophisticated antenatal care record and planner, tabulation of outstanding preventative and intervention practices, and also research tools . Oscar is used by healthcare professionals including physicians, nurses, midwives, social workers, psychologists and physiotherapists (21). Open source ehr project directed by the american academy of family physicians (aafp) is an attempt to lower the cost of ehr by sharing the source code (3) another example is orca (open receipt computer advanced) which is a project of information and communication infra - structure based on oss to overcome problems of high costs, inflexibility and restrictions associated with proprietary systems . The advantages of an open source ehr outweigh the costs of a proprietary ehr system (23). Open source technology makes the opportunity for advanced innovation in the health information sector of low income countries (24). In iran several scattered attempts to design health information systems software has been made so far . As they did not follow particular standards, integrating their outputs is not possible (25). However, development of a set of standards is always a necessary requirement for integrating different information systems (26). In iran, several studies on medical information systems have been done focusing on various domains especially on usability, efficacy, standards, architecture, structure and content . In 2001, the usability of software packages in medical records departments of several hospitals in tehran was compared . The findings showed that the overall usability of medical records software packages in the hospitals was 55% which indicated the available packages did not have the necessary capabilities to meet the requirements of medical records departments (27). In another study nine hospital information systems applied in a number of hospitals in iran were evaluated based on the general requirements of hospital information system (his). The results showed that total average of compatibility of systems with the general requirements of his was 65.4%, (28). In 2006, an object - oriented model for some key messages was designed to support ehr through comparing weaknesses and strengths of hl7 and openehr standards . According to the study, it could ensure open, future - oriented electronic health records in iran (29). In 2007, ehr content, structure, and terminology standards in selected organizations were investigated in order to design an appropriate model of ehr for iran . The study suggested a national model for ehr based on the weakness and capabilities of standards provided by the investigated organizations (2). According to the evidences, a wide range of information systems are used in iranian hospitals, clinics, pharmacies and offices . To design an integrated ehr system, all components of the health system should be engaged through an organized shareable information system . Therefore, the available clinical data on the existing systems in iran have neither been applied in decision making nor served as a basis for evidence based medicine . This situation addresses the need for developing an integrated shareable information system of ehr in iran . Such a system will not only help using the collected data for different purposes, but also serves as an infrastructure for a variety of e - health activities in the country (25). The evidences also showed that financial limitation is one of the obstacles to implement electronic health records in developing countries . Therefore, establishment of an open source ehr system capable of modifications according to the national requirements seems to be inevitable in iran . Establishment of a national ehr requires a wide cooperation and coordination among involved ministries and organizations . The prerequisites for a national ehr can be summarized as follows: electronic record in a national extent including health data centerfacilities for electronic recording and transferring information produced in health data centers including hardware and software equipments and also cultural infrastructuresdeveloping standards for coding and data exchangedevelopment of information technology infrastructures with sufficient band - width and connections to meet the present and future needs of national health systemdevelopment plan for communication and messaging services to support new information cycles (25). Electronic record in a national extent including health data center facilities for electronic recording and transferring information produced in health data centers including hardware and software equipments and also cultural infrastructures developing standards for coding and data exchange development of information technology infrastructures with sufficient band - width and connections to meet the present and future needs of national health system development plan for communication and messaging services to support new information cycles (25). The project of iranian electronic health record (sepas) supported by iranian ministry of health is the greatest information technology project in the health sector in the country . At the present time, the infrastructure of sepas is being processed to provide a platform for data exchange among health centers all over the country . Health information of all citizens from birth to death will be recorded in their individual ehrs . As a result the key values of sepas include providing citizen rights, justice, data confidentiality and information security . The main objectives of this project are: integration of citizens health information;improving the quality of health services;equitable distribution of health resources;improving the management of health resources and improving healthcare system based on quick access to correct and accurate information;expediting and facilitating production and management of biomedical knowledge;contribution to the development of evidence based medicine;reducing complications resulted from medical errors;reducing healthcare costs;increasing security of health information;strengthening the monitoring role of the health system;improving the quality of medical education;providing new electronic services;improving the industry of healthcare in iran (30). Integration of citizens health information; improving the quality of health services; equitable distribution of health resources; improving the management of health resources and improving healthcare system based on quick access to correct and accurate information; expediting and facilitating production and management of biomedical knowledge; contribution to the development of evidence based medicine; reducing complications resulted from medical errors; reducing healthcare costs; increasing security of health information; strengthening the monitoring role of the health system; improving the quality of medical education; providing new electronic services; improving the industry of healthcare in iran (30). According to the architecture plan for national ehr in iran, information systems would be categorized in three levels which are peripheral, intermediate and central . These systems are independent and connected to one another via certain standard protocols . As a result, information would flow upwards through the following levels and circulate throughout the whole network: information system level 1 (peripheral level) which is connected to medical equipments or portable devices such as smart cards or pdas . It can simply be used at intermediate health providing centers for the ease of data entry and transfer.information system level 2 (intermediate level) which is installed and utilized in health providing centers . Such systems are customized according to the needs and specification of healthcare providing centers.information system level 3 (central level) which will be installed at the ministry of health and medical universities . Information system level 1 (peripheral level) which is connected to medical equipments or portable devices such as smart cards or pdas . It can simply be used at intermediate health providing centers for the ease of data entry and transfer . Information system level 2 (intermediate level) which is installed and utilized in health providing centers . Information system level 3 (central level) which will be installed at the ministry of health and medical universities . Development of electronic health record in iran would increase: public access to healthcare services especially in deprived regions and evenly distribution of healthcare services throughout the country;modification of the national health management system based on the evidence and precise data;utilization of healthcare resources;delivery of modern electronic services such as teleappointing, teleconsulting, reminder and alerting systems;provision of a proper background for production and management of medical knowledge;supervision, evaluation and audition of healthcare services;establishment of statistical registry system;community cooperation in public health;individual accessibility to personal health information to choose the appropriate method of diagnosis and treatment;provision of necessary tools for clinical decision making;the work flow of the whole system through reengineering the process and performance of different units;the income cycle;citizens ` satisfaction;quality of care through developing a standard method for collection and interpretation of data;time and cost effectiveness and efficiency;medical knowledge by creating a suitable structure for retrospective as well as prospective medical researches;documentation and audition of documents;following the medical guidelines through sending alerts by the system;management of health centers;and the accessibility of medical information in cases of crisis and natural disasters . Public access to healthcare services especially in deprived regions and evenly distribution of healthcare services throughout the country; modification of the national health management system based on the evidence and precise data; utilization of healthcare resources; delivery of modern electronic services such as teleappointing, teleconsulting, reminder and alerting systems; provision of a proper background for production and management of medical knowledge; supervision, evaluation and audition of healthcare services; establishment of statistical registry system; community cooperation in public health; individual accessibility to personal health information to choose the appropriate method of diagnosis and treatment; provision of necessary tools for clinical decision making; the work flow of the whole system through reengineering the process and performance of different units; citizens ` satisfaction; quality of care through developing a standard method for collection and interpretation of data; time and cost effectiveness and efficiency; medical knowledge by creating a suitable structure for retrospective as well as prospective medical researches; documentation and audition of documents; following the medical guidelines through sending alerts by the system; management of health centers; and the accessibility of medical information in cases of crisis and natural disasters . On the other hand, developing electronic health record in iran could decrease: medical errors and the consequent complications;mortality rate caused by medical errors;drug adverse effects through recording individuals previous reactions;need for more human resources especially in accounting and medical records departments;cost of healthcare by cutting repeated or unnecessary services;cost of stationary materials e.g. Paper charts and radiology films and fixed expenses for equipments;accounting, documentation and archiving expenses;required time for retrieving and analyzing medical data;waiting time for admission;hospitalization time (31). Medical errors and the consequent complications; mortality rate caused by medical errors; drug adverse effects through recording individuals previous reactions; need for more human resources especially in accounting and medical records departments; cost of healthcare by cutting repeated or unnecessary services; cost of stationary materials e.g. Paper charts and radiology films and fixed expenses for equipments; accounting, documentation and archiving expenses; required time for retrieving and analyzing medical data; waiting time for admission; hospitalization time (31). Open source technology is one of the most effective mechanisms for technology transfer which could foster the national economy . This is because the source codes and licensing of the software are free of charge and open for inspection and usage (9). Many organizations and countries face various problems in using proprietary software which could be resolved through using oss . Among them, the cost of licensing, the difficulty of choosing a system capable of being modified according to the changing needs with the ability to integrate with the existing and future systems are major barriers (22). Open source solution provides many potential benefits for the establishment of national ehr in iran . It allows quick implementation of the tools, while reducing medical errors and costs in a fast and easy process (32). The advantages of utilizing oss in developing national ehr include high quality, reliability and security of system resulting from continuous and extensive peer review of software; availability of source code which enables any modification in response to the changing missions and threats; avoidance of vendor lock - in; freedom to use; and low total cost of ownership (18). The approach of open source is similar to the peer - review scientific process through which one can see and reproduce results to understand and promote what is already shared (33). In healthcare systems, continuous and broad peer review of source code could make the system secure and reliable . This will improve data confidentiality and will also be useful for quality assessment (34, 35). Evaluation of health information system would improve the performance of the system (36). At present time, developing countries are well - positioned to take advantage of the open - source movement especially in health sector to overcome health inequity (37). Open source software would create a mutually beneficial relationship between vendor and customer while proprietary software generally lacks this characteristic . Open source is a collaborative process that is improved by the coordinated sharing of information (38). In other words, cooperative development of high quality software well - designed open source software could enable other developers to adopt and modify the software according to their requirements . Finally, they can build their own tools based on the contribution of other expert s experiences (39). Millard and colleagues believe that a new millennium development goal should include the creation of a universal open - source health informatics platform that will allow the collection, management and delivery of clinical and population data that will guide decision processes at the local, regional and global levels (40). By using open source systems, institutions are not locked in to specific vendors and have more control over the application s features . Some believe that the reduced total cost of ownership is the major benefit of oss (35). However, this is highly dependent on the financial situations of the country and its total income . For a developing country like iran, the application of oss in the establishment of national ehr and other health information systems would create a great opportunity to improve national healthcare setting without paying major costs for development and maintenance of health information systems . As most developing countries like iran suffer from insufficient financial resources to purchase and support ehr commercial software, the application of open source ehr with the ability to be customized based on the national needs seems inevitable . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors. |
Oral lichen planus (olp), a common mucocutaneous disease, was first described by wilson in 1869 . Poor described the formation of cavities in lichen planus of the mucosa, corresponding in character to subepithelial bullae and gougerot described the reticular, annular, plaque, ulcerated, dotted and sclerotic forms of lichen planus . Olp is considered to be a t - cell mediated autoimmune disease in which cytotoxic cd8 + t - cells trigger the apoptosis in oral epithelial cells . The lichen planus antigen has not been definitely identified and it may be a self - peptide . In most of the studies, olp is considered to be a t - cell - mediated chronic inflammatory oral mucosal disease . It is mainly observed among women and symmetrically affects the buccal mucosa, tongue, gingiva, floor of the mouth, lips, and palate . The role of angiogenesis in the pathogenesis of chronic inflammatory diseases is of considerable interest . A positive feedback loop, in which an inflammatory state promotes angiogenesis and the angiogenesis in turn facilitates chronic inflammation, has been found in some inflammatory diseases . There is increasing evidence that chronic inflammation is tightly linked to diseases associated with endothelial dysfunction, and plays a role in the induction of aberrant angiogenesis . Microvessel density (mvd) evaluation is commonly applied for the estimation of tumor angiogenesis and is widely accepted to play a role in the pathogenesis of some inflammatory conditions also . Cd34 monoclonal antibody can be used to highlight the microvessels in inflammatory or neoplastic disorders because of its capability of staining the vascular endothelial cells (membranous staining pattern). The purpose of this study was to evaluate the role of angiogenesis in the pathogenesis of olp, using cd34 stain to highlight the blood vessels for measuring the mvd . Better understanding of the etiopathological mechanism underlying olp will help in the development of new treatment strategies, as well as to manage persistent inflammation in patients showing poor response to conventional immunosuppressive drug regimes . This study included 40 cases, categorized into two groups: group i and group ii . Group i, the control group, consisted of 15 specimens of normal oral mucosa (buccal mucosa / gingival tissue) from individuals who underwent extractions as part of orthodontic treatment and from the paraffin blocks available with the archives of the department of oral and maxillofacial pathology and microbiology, m. m. college of dental sciences and research, mullana . Group ii consisted of 25 diagnosed cases of olp; these cases were subdivided into two groups: group iia and group iib . Group iia consisted of 18 diagnosed cases of reticular olp and group iib consisted of 7 diagnosed cases of erosive olp . These cases were obtained either from the blocks of previously diagnosed cases from the archives of the department of oral and maxillofacial pathology and microbiology, m. m. college of dental sciences and research, mullana, or from fresh cases identified at the department of oral medicine and radiology . Case history pertaining to the lesion was obtained and recorded . Sections of 4-m thickness were cut from the paraffin blocks and were used for immunohistochemical staining . Briefly, endogenous peroxidase activity was blocked with 0.6% h2o2 and sections were incubated at room temperature with 100 l of prediluted primary cd34 antibody (dako). After washing in phosphate - buffered saline (pbs), secondary antibody was applied on the section and then washed with pbs . After counterstaining with hematoxylin, the sections were mounted with dibutyl phthalate xylol (dpx) and the slides were observed under a nikon research microscope . Negative and positive controls were used simultaneously to assess the specificity and reliability of the staining process . Pbs was substituted for the primary antibodies of cd34 as a negative control, and placental tissue sections with known cd34 positivity were used as the positive control . Microvessels were highlighted on the sections of olp and normal oral mucosal tissue by immunostaining with anti - cd34 monoclonal antibody [figures 13]. Any single brown - stained cell or cluster of endothelial cells that were clearly separated from adjacent microvessels, histiocytes, and other connective tissue elements were considered as a single vessel . Cd34-stained brown - colored blood vessels in normal oral mucosal tissue cd34-stained brown - colored blood vessels in reticular oral lichen planus cd34-stained brown - colored blood vessels in erosive oral lichen planus cd34-stained sections were scanned at low magnification to identify the most vascular areas (hot spot areas), which were almost exclusively localized within the inflammatory infiltrate . A maximum of five fields were selected and the images were captured on the computer under the 20 objective of a nikon research microscope (y - thr - l; japan; 0132508) for counting of the number of blood vessels in hot spot areas . Briefly, endogenous peroxidase activity was blocked with 0.6% h2o2 and sections were incubated at room temperature with 100 l of prediluted primary cd34 antibody (dako). After washing in phosphate - buffered saline (pbs), after counterstaining with hematoxylin, the sections were mounted with dibutyl phthalate xylol (dpx) and the slides were observed under a nikon research microscope . Negative and positive controls were used simultaneously to assess the specificity and reliability of the staining process . Pbs was substituted for the primary antibodies of cd34 as a negative control, and placental tissue sections with known cd34 positivity were used as the positive control . Microvessels were highlighted on the sections of olp and normal oral mucosal tissue by immunostaining with anti - cd34 monoclonal antibody [figures 13]. Any single brown - stained cell or cluster of endothelial cells that were clearly separated from adjacent microvessels, histiocytes, and other connective tissue elements were considered as a single vessel . Cd34-stained brown - colored blood vessels in normal oral mucosal tissue cd34-stained brown - colored blood vessels in reticular oral lichen planus cd34-stained brown - colored blood vessels in erosive oral lichen planus cd34-stained sections were scanned at low magnification to identify the most vascular areas (hot spot areas), which were almost exclusively localized within the inflammatory infiltrate . A maximum of five fields were selected and the images were captured on the computer under the 20 objective of a nikon research microscope (y - thr - l; japan; 0132508) for counting of the number of blood vessels in hot spot areas . In the present study, of the difference between mean mvd in group i (44.47) and that in group ii (97.24) was statistically highly significant (p=.001) [table 1]. A comparison of the mean mvd in group iia (84.61) with that in group iib (129.71) also showed a statistically significant difference (p=.015) [table 2]. Comparison of microvessel density between group i and group ii comparison of mvd between group iia and group iib various concepts have been quoted by different authors but the differences have not yet been sorted . As an autoimmune disease with inflammatory origin and chronic progression, macrophages and the other cells of the immune system produce vascular endothelial growth factor (vegf), which stimulates the degradation, proliferation, and migration of endothelial cells . Tnf - alpha, il-1 alpha, interleukin-6, and interleukin-8 also upregulate the expression of vegf, and these factors have been found in the oral fluids of patients with olp . Also, olp shows significantly increased vegf as compared to normal oral mucosa . Proangiogenic and angiogenic factors such as histamine, heparin, chymase, bfgf, vegf, and tgf - beta are produced by mast cells, and an increase in the number of mast cells has been observed in olp . A significant correlation between mast cell density and mvd has been found during the evolution of oral squamous cell carcinoma from normal oral tissue through premalignant lesion with various degrees of dysplasia to carcinoma . The malignant potential of olp remains controversial, and different research groups have proposed different approaches and interpretations . It appears advisable to carry out a meticulous follow - up of patients with olp for early detection of the malignant transformation of suspected lesions . Malignant transformation of olp may be related to, or dependent on, a series of molecular stimuli originating in the inflammatory infiltrate . Some molecules and radicals generated by inflammatory cells can act as mutagenic agents for epithelial cells or influence important cell cycle regulation mechanisms, e.g., apoptosis, cell cycle arrest, and cell proliferation, among others . A source of possible mutation in olp derives from the action of cyclooxygenase-2 (cox-2) that is produced by inflammatory infiltrating cells . Apart from its other actions, cox-2 also intervenes in the metabolism of arachidonic acid, generating the carcinogenic metabolite malondialdehyde, which can damage dna . Attraction of lymphocytes to a particular site would require cytokine - mediated upregulation of adhesion molecules on endothelial cells and concomitant expression of receptor molecules by circulating lymphocytes . In olp, there is in fact increased expression of several vascular adhesion molecules (known by the acronyms elam-1, icam-1, and vcam-1) and infiltrating lymphocytes that express reciprocal receptors (known as l - selectin, lfa-1, and vla4), supporting the hypothesis that there is activation of a lymphocyte homing mechanism in lichen planus . Thus, if angiogenesis is increased, it will lead to more recruitment and retention of lymphocytes or inflammatory infiltrate, or progression of disease or recurrence of the lesions; the inflammatory infiltrate can further lead to carcinogenesis . Cd34, a myeloid progenitor cell antigen present in endothelial cells, is detectable in all types of endothelium . The monoclonal antibody against cd34 reacts with the endothelium of arteries and venules and has been found to stain capillary endothelium most intensely, because it is highly sensitive for endothelium and produces lowest background staining . Therefore, in the present study, mvd was estimated by cd34 immunostaining . In the present study, comparison of mean mvd between group i (44.47) and group ii (97.24) showed a statistically highly significant result . Our study suggests that angiogenesis is significantly increased in olp as compared to normal oral mucosa [figure 1], also in erosive olp [figure 3] as compared to reticular olp [figure 2]; this suggests that angiogenesis is one of the main contributing factors in the progression of olp . Malignant transformation in olp is said to occur in 0.3%3% of cases and is more common in the erosive form . Thus, the increased mvd in erosive olp as compared to reticular olp in our study could be suggested as one of the factors contributing to this higher malignant potential . Angiogenesis has long been known to be closely linked to chronic inflammation, and it is a component of various chronic inflammatory diseases . However, the exact etiopathological mechanism of olp is still not clear . Most of the studies have not been able to demonstrate a direct relation between angiogenesis and olp . If antiangiogenic drugs can be demonstrated to be beneficial in olp patients, it would reduce the dependency on corticosteroid drugs . Considering the role of angiogenesis in the inflammatory lesions of olp, and the fact that some olp patients respond poorly to conventional immunosuppressive drugs, angiogenesis could be a possible therapeutic target to reverse the persistent and stubborn inflammation . From this study, we conclude that angiogenesis can be considered to play a role in both the etiopathogenesis and progression of olp . Our findings could be helpful for formulating new treatment strategies for olp utilizing antiangiogenic medications. |
Age - related structural and functional deterioration of sensory and motor mechanisms, especially of the vestibular system, is a leading cause of dizziness and imbalance in older adults (1, 2). It is well established that older individuals with a history of imbalance and dizziness are at higher risk of fall related injuries, loss of independence, and even death (1), all depicting the importance of determining the effect of aging on the vestibular system (3). The peripheral vestibular apparatus consists of the labyrinth (semicircular canals and otoliths), vestibular nerve, and a central component consisting of the vestibular nuclei (4). The otoliths (saccule and utricle) register forces related to linear acceleration (2). Vestibular evoked myogenic potential (vemp) is a reliable clinical tool to assess the accuracy of the sacculo - collic reflex (5), first introduced by colebatch and halmagyi (1992) and further described by colebatch et al . Vemp is a short - latency myogenic response evoked by loud sounds and recorded using surface electrodes placed over cervical muscles (6). The vemp response consists of a positive peak (p1) in the ipsilateral sternocleidomastoid (scm) followed by a negative peak (n1) (6). The effect of aging on vemp response has been reported in previous studies (e.g. Su et al . (7), lee et al . The evidence is accumulated that the aging influences on p1 and/or n1 latencies, although a new study by nguyen et al . (10) did not report any significant difference between latency measurement and aging . Furthermore, the effects of aging on vemp amplitude has also been reported in previous studies (3, 5, 9, 10) (8) did not find any effect of aging on vemp amplitude at the threshold level, though amplitude was negatively correlated with age in suprathreshold level . Age- dependent anatomical and physiological changes in vestibular system has also been reported in previous studies (11 - 19). As age - related loss of vestibular otolith - ocular function is associated with increased mediolateral measures of sway (20), characterizing the impact of aging on saccular function is important . However, little is known about the influence of aging on the function of otolith organ . In recent years, vemp has become a standard clinical test of otolith (mainly saccular) function (6). The vemp is an easy - to - use test that can be performed in a relatively short time, though some previous studies have contradictory recommendations (3, 5, 7 - 10). The aim of the present study was to evaluate the impact of aging on saccular function using cvemp response . Sixty - two subjects were including, 31 young adults (62 ears) with a mean age of 22.15 1.93yr (range: 19 - 26yr) comprising 27 females and 4 males as control group, and 31 old adults (50 ears) with a mean age of 69.76 5.14yr (over age 60) comprising 26 females and 5 males, as test group . The mean pure tone average at 500, 1000, and 2000hz was 25db hl for both groups . Inclusion criteria were as follows: participants with no history of middle ear pathology, and no vestibular, cervical and neurological disorders . The study protocol was approved by the ethics committee of shahidbeheshti university of medical sciences, and informed consent was obtained from all participants . Adherence to inclusion criteria was confirmed by having all volunteers complete a case history, berg balance test (to evaluate total balance status), otoscopy and acoustic immittance evaluation (to test middle ear health using an impedance - interacoustic at235 audiometer, denmark), and pure tone and speech audiometry (to evaluate the integrity of auditory pathway - interacoustic ac40 audiometer, denmark). Participants also underwent a cervical vemp (cvemp) test performed using electrophysiologic equipment (ics charter ep, usa, software version 6.20). To activate the scm muscle, participants were asked to sit in a chair and turn their head toward the contralateral side shoulder . For cvemp recording, 150 responses to air - conducted 500 hz tone bursts with two - cycle rise / fall and no plateau (blackman gated) were presented monaurally with rarefaction polarity via an insert receiver . The responses were amplified (5000) and band - pass filtered (10 hz-2000hz). The skin was prepared and the active electrode was placed at the midpoint of the scm muscle belly; the reference electrode was set on the sternoclavicular junction, and the ground electrode was placed on the forehead . The cvemp responses were obtained at threshold level (vemp threshold was defined as the lowest level at which vemp parameters were repeatable and distinctive) and at 95db nhl intensity level . Vemp response thresholds were obtained using a down 10, up 5 db step manner . Each recording was repeated twice to assure reproducibility . To avoid distortion of the results by neck muscle fatigue, the vemp threshold, p1 and n1 latency, p1/n1 amplitude, and asymmetry ratio were determined for all participants after the vemp responses were recorded . The asymmetry ratio (ar) between the right and left ears was computed according to the following formula (21). The data was analyzed using a paired - samples t - test and independent - samples t - test . Adherence to inclusion criteria was confirmed by having all volunteers complete a case history, berg balance test (to evaluate total balance status), otoscopy and acoustic immittance evaluation (to test middle ear health using an impedance - interacoustic at235 audiometer, denmark), and pure tone and speech audiometry (to evaluate the integrity of auditory pathway - interacoustic ac40 audiometer, denmark). Participants also underwent a cervical vemp (cvemp) test performed using electrophysiologic equipment (ics charter ep, usa, software version 6.20). To activate the scm muscle, participants were asked to sit in a chair and turn their head toward the contralateral side shoulder . For cvemp recording, 150 responses to air - conducted 500 hz tone bursts with two - cycle rise / fall and no plateau (blackman gated) were presented monaurally with rarefaction polarity via an insert receiver . The responses were amplified (5000) and band - pass filtered (10 hz-2000hz). The skin was prepared and the active electrode was placed at the midpoint of the scm muscle belly; the reference electrode was set on the sternoclavicular junction, and the ground electrode was placed on the forehead . The cvemp responses were obtained at threshold level (vemp threshold was defined as the lowest level at which vemp parameters were repeatable and distinctive) and at 95db nhl intensity level . Vemp response thresholds were obtained using a down 10, up 5 db step manner . Each recording was repeated twice to assure reproducibility . To avoid distortion of the results by neck muscle fatigue, the vemp threshold, p1 and n1 latency, p1/n1 amplitude, and asymmetry ratio were determined for all participants after the vemp responses were recorded . The asymmetry ratio (ar) between the right and left ears was computed according to the following formula (21). The data was analyzed using a paired - samples t - test and independent - samples t - test . To examine the effect of aging on saccular function, cvemp results for the older group were compared with the controls . There was no significant difference between vemp parameters for the right and left ears, therefore, the results for both ears were combined . The vemp responses revealed that 23 participants had bilateral vemp response and 4 participants had unilateral vemp response (in 112 of 124 ears in the 62 participants). 1 shows the cvemp waveforms obtained at 95 db nhl from the right ear for a young and an old adult . The independent - samples t - test demonstrated a significant difference in vemp response threshold between the two groups (p<0.001). There was also a significant difference in p1 wave latency between the two groups (p<0.001). No significant difference existed for n1 wave latency between the two groups (p=0.06). The independent t - test showed a significant difference in p1/n1 amplitude (p<0.001), and asymmetry ratio of p1/n1 amplitude showed a significant difference between the two groups (p=0.01). The standard deviation, mean threshold level, latency, amplitude, and asymmetry ratio of p1/n1 amplitude of vemp for the two groups are shown in table 1 . The cervical vestibular evoked myogenic potentials recorded in the right ear of a young and an old adult at 95 db nhl and threshold intensity level . Sd: standard deviation, ms: millisecond, v: microvolt, and db nhl: decibel normalized hearing level . Dizziness and imbalance are common complaints by older adults . Although, in recent years, research has demonstrated the role of otolith function in postural stability (20), few studies have investigated age - related loss of otolith organ function . The purpose of this study was to examine the effect of aging on saccular function in the elderly . The cvemp measurements were recorded using tone burst 500 hz stimuli delivered through air conduction and compared between the two study groups . Unilateral or bilateral omission of cvemp response in some of the elderly has also been reported in the previous studies (7, 8, 22), which might be due to age- dependent changes in the course of producing the required response . Effects of age on cvemp threshold: the results showed that cvemp thresholdsincreases with an increase in the age, which is in association with previous studies (8, 22, 23). Ochi and ohashi (23) reported the effects of age on vemp response in 60 healthy adults . Welgampola and colebatch (22) investigated the influence of aging on the vestibule - collic reflex in response to click stimuli and demonstrated that vemp thresholds increased as age increased . Janky and shepard studied 46 normal adults ranging in age from 20 to 76 yr . Cvemp responses were recorded at threshold with a click for 250, 500, 750, and 1000 hz tone burst stimuli and at a suprathreshold level for a 500 hz tone burst stimuli . The increase in cvemp threshold may be caused by age - related functional changes in the sensory and neural components involved in the projection of cvemp responses . In fact, aging may affect the cvemp response pathway from the saccule, scarpa ganglion, inferior vestibular nerve, lateral vestibular nucleus and lateral vestibule - spinal tract to the scm muscle . Effects of age on cvemp latency: the present research demonstrated a difference for p1 wave latency between the two study groups where p1 wave latency increased as age increased . Analysis of the data also indicated that there was no n1 wave latency difference between the two study groups . This may be because the spread of central transmission and the time required to activate the vestibulo - collic reflex that causes the vemp response changed as age increased . Previous studies have reported inconsistent results on age - related changes in the latency of cvemp responses . The findings of the present study are in agreement with those of janky and shepard (8) who reported no difference between groups for n23 latency in response to click and tone burst stimuli . Su et al (7) reported that the p13 latency increased as age increased, although this difference was not significant . These results, however, are in disagreement with those of nguyen et al . (10), who found no correlation between latency of vemp response and age . Possible explanations for this discrepancy are differences in recording techniques, such as variations in stimuli rise / fall time, and filter setting, for instance, in nguyen et al ., tone bursts stimuli with a linear envelope and 1ms rise / fall time and 2 ms plateau time were used . Age - dependent variations observed in latency of cvemp response might probably be due to the created changes in processing messages from otolith organs by central nervous system but might not be related to reduced function in peripheral vestibular system . Effects of age on cvemp p1/n1amplitude: the results of the present study showed a difference in p1/n1 amplitude between the two groups . In other words, the p1/n1 amplitude decreased as age increased . These findings confirm the results of other studies (3, 5, 7, 22 - 25). This decrease may be caused by several factors, such as age - dependent anatomical and physiological changes in the vestibular end organ and central pathways or age - related changes in the tonic scm muscle electromyogram level . Effects of age on cvempasymmetry ratio: the results of the present study also showed no difference between left - right cvemp parameters, which again confirms the results of the previous research (5, 8, 22, 23). Although the mean asymmetry ratio for p1/n1 amplitude in each group was within normal range, the mean asymmetry ratio showed a significant difference between the two groups . The cvemp response is an easy - to - use test that can be performed in a short time . Thus, cvemp response can be used as an objective screening tool to identity the first symptoms of vestibular disorders . Pathologies affecting vemp parameters include: acute vestibular neuritis (26), benign positioning vertigo (27), meniere s disease (28), vestibular schwannoma (29), otosclerosis (30), middle ear disease and hearing loss (31, 32), superior canal dehiscence syndrome (33), gentamicin toxicity (34), central vestibular disorders (35 - 37). It is proposed that audiology clinics establish normative data for different age groups using standard protocols for recording vemp responses similar to auditory evoked potential and vestibular - ocular reflex function tests . A limitation of the present study was inability of the device to record the emg level, which required maintaining muscle tone using the feedback method (38). The results of the present study showed that aging can influence the parameters of the vemp response . The cvemp response threshold, latency (especially p1), and asymmetry ratio of p1/n1amplitude increased, while the p1/n1amplitude decreased . Vemp abnormalities observed in healthy older adults indicated the sensitivity of this test in identifying the first signs of vestibular dysfunction . The vemp response is easy to use, can be performed in a short time and only requires equipment for evaluating auditory evoked brainstem responses . Therefore, the cvemp response can be used as a selective objective screening test to detect vestibular disorders . The results of the present study can provide normative data for correct interpretation of vemp response results in the identification of saccular disorders, which are representative of vestibular disease. |
This retrospective, cohort study includes patient data collected at 5 etus operated by international medical corps (imc) in liberia and sierra leone from 15 september 2014 to 15 september 2015 as part of its comprehensive response to the west african evd epidemic . All patients who presented to the study etus with symptoms concerning for evd were triaged to ensure that they met the suspect case definition, which was created based on world health organization (who) and ministry of health guidelines from each country (supplementary appendix 1). After triage, patients who met the suspect case definition were admitted to the etu suspect ward and had a blood sample drawn within 24 hours for evd and malaria diagnostic testing . Patients with an initial negative evd test remained as inpatients for repeated testing after 2 days . Patients with a second negative evd result were discharged or transferred to another healthcare facility . All patients aged <18 years who were admitted at any of imc s 5 etus with a positive evd test and outcome data were included for analysis . All patients were treated according to standard treatment protocols based on guidelines developed by the who, mdecins sans frontires, and local ministries of health, as permitted by local resources . Empiric treatment included antimalarial medications, broad - spectrum antibiotics, and nutritional supplementation, as well as focused supportive treatment (appendix 1). Patients were cared for by trained medical staff who recorded clinical data on paper forms . These data were digitized at each etu and unified into a database, as described previously . Laboratory data, including evd real - time polymerase chain reaction (rt - pcr) and malaria testing, were linked to clinical data for analyses . Rt - pcr testing was performed by the us naval medical research center for etus in liberia, by public health england laboratories for lunsar and makeni etus in sierra leone, and by the nigerian laboratory for the kambia etu in sierra leone . Cycle threshold (ct) values, which are based on rt - pcr of the same ebola virus (ebov) zaire locus, are presented in this study as surrogates of viral load . A ct> 40 was considered negative in all cases, though rna extraction procedures differed slightly between laboratories . Malaria testing (conducted in sierra leone only) was performed at each laboratory site using the commercially available binaxnow rapid diagnostic test, which identifies 4 plasmodium species: falciparum, malariae, vivax, and ovale . Throughout hospitalization, patients were cared for by trained local or international nurses, physician assistants, or physicians, who rounded at least daily and recorded vital signs, clinical data, and laboratory results on paper forms . Patient temperatures were measured with infrared or oral thermometers . For children who were unable to communicate history and who had no accompanying guardians, a random sampling audit concluded that> 99% of the data in imc s unified database was accurate . The variables of interest included demographic and clinical characteristics, malaria status, initial evd rt - pcr ct values, and mortality . Length of stay was calculated as the number of days from date of admission to date of discharge . Age was categorized into the following groups: <2 years, 24 years, 59 years, 1014 years, and 1517 years . For descriptive statistics, median values with interquartile ranges (iqrs) were calculated for nonnormally distributed continuous data, and proportions were calculated for categorical data . Bivariate analyses were performed to determine the associations between mortality, the primary outcome of interest, and independent covariates using the mann - whitney u test for continuous variables and or fisher exact test for categorical variables where appropriate . Covariates that had a p value <0.1 from bivariate analyses were entered in a backward stepwise logistic regression model to determine which variables independently predicted mortality . We used kaplan - meier curves and the log - rank test to compare survival among children by age group, hemorrhagic features, and viral loads estimated by ct values . The sierra leone ethics and scientific review committee, the university of liberia pacific institute for research & evaluation institutional review board, and the lifespan (rhode island hospital) institutional review board provided ethics approval for this study and exemption from informed consent . This retrospective, cohort study includes patient data collected at 5 etus operated by international medical corps (imc) in liberia and sierra leone from 15 september 2014 to 15 september 2015 as part of its comprehensive response to the west african evd epidemic . All patients who presented to the study etus with symptoms concerning for evd were triaged to ensure that they met the suspect case definition, which was created based on world health organization (who) and ministry of health guidelines from each country (supplementary appendix 1). After triage, patients who met the suspect case definition were admitted to the etu suspect ward and had a blood sample drawn within 24 hours for evd and malaria diagnostic testing . Patients with an initial negative evd test remained as inpatients for repeated testing after 2 days . Patients with a second negative evd result were discharged or transferred to another healthcare facility . All patients aged <18 years who were admitted at any of imc s 5 etus with a positive evd test and outcome data were included for analysis . All patients were treated according to standard treatment protocols based on guidelines developed by the who, mdecins sans frontires, and local ministries of health, as permitted by local resources . Empiric treatment included antimalarial medications, broad - spectrum antibiotics, and nutritional supplementation, as well as focused supportive treatment (appendix 1). Patients were cared for by trained medical staff who recorded clinical data on paper forms . These data were digitized at each etu and unified into a database, as described previously . Laboratory data, including evd real - time polymerase chain reaction (rt - pcr) and malaria testing, were linked to clinical data for analyses . Rt - pcr testing was performed by the us naval medical research center for etus in liberia, by public health england laboratories for lunsar and makeni etus in sierra leone, and by the nigerian laboratory for the kambia etu in sierra leone . Cycle threshold (ct) values, which are based on rt - pcr of the same ebola virus (ebov) zaire locus, are presented in this study as surrogates of viral load . A ct> 40 was considered negative in all cases, though rna extraction procedures differed slightly between laboratories . Malaria testing (conducted in sierra leone only) was performed at each laboratory site using the commercially available binaxnow rapid diagnostic test, which identifies 4 plasmodium species: falciparum, malariae, vivax, and ovale . Throughout hospitalization, patients were cared for by trained local or international nurses, physician assistants, or physicians, who rounded at least daily and recorded vital signs, clinical data, and laboratory results on paper forms . Patient temperatures were measured with infrared or oral thermometers . For children who were unable to communicate history and who had no accompanying guardians, a random sampling audit concluded that> 99% of the data in imc s unified database was accurate . The variables of interest included demographic and clinical characteristics, malaria status, initial evd rt - pcr ct values, and mortality . Length of stay was calculated as the number of days from date of admission to date of discharge . Age was categorized into the following groups: <2 years, 24 years, 59 years, 1014 years, and 1517 years . For descriptive statistics, median values with interquartile ranges (iqrs) were calculated for nonnormally distributed continuous data, and proportions were calculated for categorical data . Bivariate analyses were performed to determine the associations between mortality, the primary outcome of interest, and independent covariates using the mann - whitney u test for continuous variables and or fisher exact test for categorical variables where appropriate . Covariates that had a p value <0.1 from bivariate analyses were entered in a backward stepwise logistic regression model to determine which variables independently predicted mortality . We used kaplan - meier curves and the log - rank test to compare survival among children by age group, hemorrhagic features, and viral loads estimated by ct values . The sierra leone ethics and scientific review committee, the university of liberia pacific institute for research & evaluation institutional review board, and the lifespan (rhode island hospital) institutional review board provided ethics approval for this study and exemption from informed consent . Among the 547 pediatric cases admitted to imc etus in liberia and sierra leone during the study period, 123 had pcr - confirmed evd . One patient, whose outcome was unknown, was transferred to another facility, leaving 122 patients available for analysis . Included in this number were 7 patients who were previously admitted briefly with suspected evd but whose diagnosis was confirmed during second admissions . Children were divided into 5 age categories: younger than 2 years (15%), 24 years (21%), 59 years (25%), 1014 years (26%), and 1517 years (13%). The median length of stay was 9 days (iqr, 615; range, 131). Almost all children (94%) had a history of contact with documented cases of evd . At triage, more than 50% of children had fever, anorexia, and weakness (table 1). The most commonly observed signs and symptoms during hospitalization were weakness, fever, diarrhea, and anorexia (table 1). Clinical characteristics of ebola virus disease patients observed at triage and during hospitalization at ebola treatment units in liberia and sierra leone abbreviation: nd, no data available . Self - reported at triage; measured during hospitalization at least daily (range 16 times per person per day). Malaria testing was available at the sierra leone sites only; 68 of 84 (81%) children were tested, of whom 27 (40%) were positive for plasmodium parasitemia . The differences in incidence by age group were significant (p = .024), with the most cases reported among children aged <5 years (56%) compared with 59 years (50%), 1014 years (25%), and 1517 years (9%). There was no difference in rates of plasmodium parasitemia in children with or without fever (38% vs 43%, respectively; p = 1.0). As shown in table 2, median length of stay was significantly longer for those who survived compared with those who died (16 vs 6 days; p <.001). The median age of patients who died was significantly younger than of patients who survived (4 vs 11 years; p <.001). Stratified by age, the cfr was highest (89%) for children aged <5 years compared with other age groups (59 years, 43%; 1014 years, 41%; 1517 years, 25%; p <.001; figure 1). In addition to age, other significant predictors of mortality included evidence of bleeding at any time during hospitalization (58% in children who died vs 27% in survivors; p = .003; figure 2) and median initial pcr ct values (19.2 in children who died vs 25.0 in survivors; p <.001). Overall, a pcr ct cutoff value of 20 predicted mortality across age groups better than a cutoff value of 25, except for children aged <2 years (figure 3, supplementary figure 1). A diagnosis of plasmodium parasitemia did not influence mortality in aggregate (p = .76) or by age stratified analyses (data not shown). Comparison of demographic and clinical characteristics in children who survived vs those who died number (%) unless otherwise stated . Differences remained significant when stratified by age (<5, 59, 1014, 1517 years; p <.02 for each comparison of outcomes). Kaplan - meier curve for overall survival among 122 ebola virus disease patients stratified by age . Children aged <5 years had significantly greater mortality than older children (log rank test, p <.001). Kaplan - meier curve for overall survival among 112 ebola virus disease patients stratified by bleeding status . Children with evidence of bleeding at any time during their hospitalization had significantly greater mortality (log rank test, p = .003). Kaplan - meier curve for overall survival among 95 ebola virus disease (evd) patients based on initial evd real - time polymerase chain reaction (rt - pcr) cycle threshold (ct) cutoff of 20, stratified by age . Overall, mortality of children with initial rt - pcr ct values 20 was significantly greater than for those with higher values (log rank test, p <.001). The youngest and oldest groups of children accounted for most of the difference in outcome . The difference in death rates among afebrile hospitalized children stratified by age (<5 years, 2; 59 years, 2; 1014 years, 2) was not significant (p = .6). Fifty percent of the afebrile children died, but no distinguishing clinical features or rt - pcr ct values predicted these deaths . Significant variables from the bivariate analyses (table 2) were entered in backward stepwise logistic regression models . In the first model that excluded pcr tests (n = 112; goodness of fit, 0.68), the odds of mortality were 20.1-fold higher for patients aged <5 years compared with older children (95% confidence interval [ci], 5.969.0) and 5.9-fold higher if there was evidence of bleeding at any time during hospitalization (95% ci, 2.215.6). When evd rt - pcr ct values were added to the model (n = 86; goodness of fit, 0.53), the odds of mortality were 14.8-fold higher for patients aged <5 years compared with older children (95% ci, 3.562.1), 5.2-fold higher if the rt - pcr ct value was 20 (95% ci, 1.518.3), and 5.0-fold higher if there was evidence of bleeding at any time during hospitalization (95% ci, 1.615.8). This is one of the largest cohort studies of children and adolescents with evd published to date . The odds of death were 20-fold higher in evd patients aged <5 years compared with older children . This finding is consistent with other data reported from the west african evd epidemic [4, 21, 27, 28]. Days of hospitalization before death for half of those aged <2 years ranged from 6 to 12 days . This range is comparable to that reported by shah et al [21, 28]. Hemorrhagic features developed in fewer than half of pediatric patients; when present, they were associated with a 5-fold higher odds of mortality . This observation is in line with other reports that bleeding was not a prominent finding among all evd patients during this epidemic [19, 21, 22, 29]. It is also noteworthy that 1 in 5 children presented without fever and, of these, 27% never developed fever, which is similar to findings from one study but not another . Our findings support the mounting evidence that fever is not a sensitive screening tool for evd [17, 28]. In fact, the low frequency of hemorrhagic features and the conspicuous absence of fever at presentation in up to 20% of patients during the west african epidemic questions the utility of referring to evd as a disease characterized primarily as viral hemorrhagic fever, which may mislead clinicians . We confirmed that a high viral load estimated by a low rt - pcr ct value (<20) at the time of presentation reliably predicted mortality in infected children who had 5-fold higher odds of mortality . The fact that pcr ct values did not differ between survivors and fatal cases in those aged <2 years (unlike the older age groups) suggests that factors other than viral load, such as immunological or physiological dysregulation, contributed to death in the youngest age group . Therefore, semiquantitative molecular diagnostic testing at the time of initial evaluation is a simple and effective method for screening for evd as well as for prognosticating outcomes (especially in children aged> 2 years) if ct values are below a predefined threshold and should be used routinely . A diagnosis of plasmodium parasitemia did not impact the risk of mortality or presence of fever in a subpopulation of children who had testing performed, which differs from a recent report in which a diagnosis of malaria reduced the risk of evd mortality . Considering that children s body surface area to volume ratio is higher than that of adults and some children are malnourished, children are particularly susceptible to life - threatening dehydration and nutritional decompensation . Chertow et al made the observation that large volumes of diarrhea caused by evd were not unlike that of cholera . Treatment protocols for future evd outbreaks could potentially improve outcomes by instituting early and aggressive rehydration strategies . This along with serum electrolyte balance and nutrition could be the most important treatments to reduce mortality in those aged <5 years in a low - resource setting . Furthermore, prompt, accurate diagnosis and isolation precautions are critically important to reduce transmission both in the community and in healthcare facilities . The first and historically most often associated reason is multiorgan failure secondary to coagulopathy associated with a cytokine storm and immune dysregulation . The odds of mortality in our cohort were significantly higher in children with the classic presentation of viral hemorrhagic fever . The large volumes of diarrhea often accompanied by vomiting and exacerbated by weakness and inability to drink fluids quickly depletes the younger children . In the low - resource settings of west africa, the scarcity of healthcare providers to administer oral fluids frequently or appropriate continuous intravenous (iv) fluids probably resulted in numerous deaths that could have been prevented with more resources . The third reason for death is cardiac arrest from electrolyte disturbances . In patients treated in high - resource settings, abnormal serum levels of potassium and magnesium were observed, along with cardiac arrhythmias; similar electrolyte findings were noted in children in west africa [3436]. The abnormal electrolyte levels may result from profuse diarrhea, prerenal kidney dysfunction from dehydration, or direct acute kidney injury (aki) from evd . Beyond the direct effects of the virus on the kidney, evd has been associated with rhabdomyolysis, which can cause aki and subsequent electrolyte abnormalities . This study had limitations in common with others conducted during the west african evd epidemic . Environmental conditions made it challenging for clinicians to collect patient data, given that they were working in full evd personal protective equipment in extreme heat, which limited the time with each patient . Patients temperatures were measured with an infrared digital thermometer gun or oral thermometer, which may be less accurate than the gold standard rectal thermometer . Frequently, clinicians were unable to collect dependable medical histories because of patients severity of illness, absence of accompanying guardians, varying skills of clinicians, or language and cultural barriers . Because accurate nutritional assessments were not performed, the additional impact of malnutrition was not taken into account . Without clinicians ability to confirm the length of illness prior to arrival at etus, we were limited in determining the total duration of illness and in assessing accurately patients clinical courses . A few of the patients included in this analysis received an experimental antiviral treatment as part of a separate trial, which may have impacted their outcomes . In addition, it is quite likely many patients either died or recovered from evd without seeking medical attention, thereby potentially introducing ascertainment bias . Two important interventions that were not accounted for in the analyses could have impacted mortality rates . First was whether or not patients received iv fluids, which typically was inconsistent among etus because of varying practices relating to the use of iv catheters . The second intervention that was not taken into consideration was whether young children had constant bedside caregivers, either family members or healthcare workers, who administered and encouraged oral rehydration and nutrition and provided critical emotional support . Practices varied among etus because some parents were incapacitated or did not want to assume the risk of nosocomial infection and caregivers were not always continuously available . In conclusion, we found that 3 clinical and virologic factors, after adjustment, were significant poor prognostic factors for children with evd: aged <5 years, bleeding at any time during hospitalization, and high viral loads as estimated by rt - pcr ct values . There is an urgent need to investigate the mechanisms of disease to understand how these risk factors as well as malnutrition, dehydration, and electrolyte imbalance contribute to severe outcomes . The goal is to identify simple, scalable, and relatively inexpensive measures that can improve health outcomes substantially in children in resource - limited settings . These fundamental interventions will effectively complement vaccines and antiviral agents that are currently undergoing human trials . Consisting of data provided by the author to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the author, so questions or comments should be addressed to the author . Acknowledgements . The authors thank the governments of liberia, sierra leone, and guinea for contributing to international medical corps(icm) humanitarian response . We also thank all of our generous institutional, corporate, foundation, and individual donors who placed their confidence and trust in international medical corps (icm) and made our work during the ebola epidemic possible . We thank the us naval medical research center, public health england, the european union mobile laboratory, and the nigerian laboratory for providing laboratory data to our ebola treatment units (etus). We further acknowledge the many contributions made by all members of our research review committee and other technical teams that contributed to this research, including rabih torbay, ann canavan, dennis walto, dan rodman, yoav rappaport, samuel grindley, syed hassan, erin shedd, ryan burbach, saikrishna madhireddy, benedict adjogah, melody xie, nadezda sekularac, inka weissbecker, sean casey, farrah zughni, natalie sarles, and august felix . We also thank medical directors vanessa wolfman and kassahun gebrehiwot and monitoring and evaluation staff including annie abbate, razia laghari, allison stewart, alex tran, matthew siakor, david mansaray, lamin bangura, sorie sesay, and joseph fangawa as well as all other data collection officers at our etus . Finally, we thank the medical and support staff, both local and ex - patriot, who set up and operated international medical corps (icm) etus and cared for the patients during the ebola epidemic in west africa . Financial support . Icm was supported by grants from the national institutes of health, national institute of allergy and infectious diseases (k08 ai100997) and national institute of general medical sciences (p20gm 104317). Conflicts that the editors consider relevant to the content of the manuscript have been disclosed. |
Gastrointestinal perforations constitute one of the commonest surgical emergency encountered by surgeons [1, 2]. Management of these patients continues to be highly demanding despite the advances made in diagnosis and surgical therapy . The etiological spectrum of perforation peritonitis in india differs significantly from its western counter parts [35]. Our study was carried out to highlight the spectrum of perforation peritonitis (diffuse) in a single unit at lok nayak hospital, a tertiary care hospital in delhi . The retrospective study was conducted at the department of surgery, maulana azad medical college and associated lok nayak hospital, delhi, from may 2010 to june 2013 . The study population included 400 patients of perforation peritonitis (diffuse or localized) presenting to the surgical emergency of lok nayak hospital, delhi, who underwent exploratory laparotomy . Cases were studied with respect to clinical features at the time of presentation, comorbid conditions, radiological investigations, operative findings, and postoperative course . After establishing the clinical diagnosis of perforation peritonitis on performing exploratory laparotomy, the operative findings were noted and the source of peritonitis was found and managed accordingly . All patients were then treated in the postoperative ward initially under the cover of parenteral broad spectrum antibiotics and fluids; orals were started on the appearance of bowel sounds . 98% patients presented with the history of abdominal pain, 62.5% with altered bowel habit, 41.5% with nausea and vomiting, and 28% with abdominal distention . 15% patients had positive history of nsaid intake for more than 6 months (table 1). In our study, the commonly associated comorbidity was chronic obstructive pulmonary disease followed by renal disease, diabetes, and hypertension . Multiple air fluid levels on abdominal x - ray in erect position were present in 28% patients . Electrolyte imbalances included hyponatremia in 21%, hypokalemia in 19% and elevated serum creatinine in 18% patients . Most of the patients were operated within 24 hours of presentation under the cover of broad spectrum antibiotics after adequate resuscitation and correction of electrolyte imbalances . The commonest cause of perforation peritonitis in our study was gastroduodenal perforation due to acid peptic disease (45%) followed by appendicitis (18.5%), typhoid fever (12%), tuberculosis (10%), and trauma (9%), (table 2). Patients of peptic ulcer perforation usually had a short history of pain starting in epigastrium followed by generalized tenderness . 175 such were managed by an omental pedicle repair, in the other 4 cases a feeding jejunostomy was also done due to the large size of the perforation . 8% of these patients were managed by a limited resection with ileo - ascending anastomosis due to associated unhealthy caecum . Patients of typhoid perforation had an initial history of high grade fever prior to abdominal complaints . Of the 40 patients of tubercular perforation, 60% had previous history of tuberculosis and 50% of these patients took antitubercular therapy for <6 months . In cases of traumatic perforation, the most common site was jejunum (49%) followed by ileum (42%). The most commonly performed procedure was omental pedicle closure of peptic ulcer perforation (43.75%), followed by exteriorization of the gut in the form of ileostomy or colostomy (22.5%). Appendectomy was the third most common procedure (17%), (table 2). The most common complication was wound infection followed by dyselectrolytaemia, abdominal collection, and respiratory complications . The morbidity rate was higher in the patients with intestinal perforation (58%) than those with gastroduodenal perforation (32%). Factors involved in death included septicemia due to fecal peritonitis, respiratory complications, pulmonary embolism, and late presentation . It is commonly seen in a younger age group in the tropical countries (mean age in our study was 37.8 years) as compared to the studies in the west [79]. More commonly the perforations involve the proximal part of the gastrointestinal tract; [1013] this being in contrast to studies from the western countries, where perforations are common in the distal part [1416]. Etiological factors also show a wide geographical variation . According to a study from india, infections formed the most common cause of perforation peritonitis, around 50% cases in this study were due to typhoid . In our study 22% of the cases were due to typhoid and tuberculosis . In contrast to this, noon et al . From texas in their study reported only 2.7% cases due to infections . Also studies from the west have shown that around 1520% cases are due to malignancy [19, 20], this being in stark contrast to our study where malignancy was ascertained to be the cause of perforation peritonitis in only 3% of the cases . This shows that malignancy is not a common cause of perforation peritonitis in our setup as compared to our western counterparts . Adequate preoperative resuscitation (with fluids, etc . ), correction of electrolyte imbalances followed by an early surgical intervention, to remove the source of infection and stop further contamination, is imperative for good outcomes minimizing morbidity and mortality . Peptic ulcer perforation, perforating appendicitis, typhoid, and tubercular perforations are the major causes of gastrointestinal perforations . Early surgical intervention under the cover of broad spectrum antibiotics preceded by adequate aggressive resuscitation and correction of electrolyte imbalances is imperative for good outcomes minimizing morbidity and mortality. |
The term isotopic response connotes the occurrence of a new skin disorder at the site of another, unrelated, and already healed skin disease . Since the introduction of this phenomenon in dermatology, a variety of dermatoses we hereby describe a young girl who developed lesions of lichen planus pemphigoides (lpp) over preexisting atrophic scars, an example of wolf's isotopic response . To the best of our knowledge, such a clinical presentation of lichen planus (lp) pemphigoides is not documented yet in the english literature . An 18-year - old girl presented with multiple itchy hyperpigmented papules and plaques, along with intermittent blisters over the lower limbs and buttocks for last 3 months [figures 1 and 2]. Past history was significant for painful ulcers over the lower limbs and buttocks 6 years back . The diagnosis of pyoderma gangrenosum was made (as evident from documents available with patient), and she was treated for a year, resulting in complete resolution of ulcers . The bulla was noted over both lichenified plaques and otherwise normal appearing skin of scars . Interestingly, most of the lichenified plaques and bullae were found over preexisting scars only [figure 3]. Skin biopsy was done from multiple sites, for both histopathological examination and direct immunofluorescence (dif). The histological features of lichenified plaque were orthokeratotic hyperkeratosis, acanthosis, wedge shaped hypergranulosis, basal layer degeneration and band - like of infiltrate of lymphocytes in the papillary dermis; thus corroborating with a diagnosis of lp [figure 4a c]. Histopathology of bulla showed a subepidermal bulla with eosinophilic infiltrate; which were suggestive of bullous pemphigoid (bp) [figure 5a c]. The scar tissue was characterized histologically by the presence of abundant collagen fibers without any features of inflammation [figure 6]. Dif from plaque showed a linear pattern of deposition of igg and c3 along the basement membrane zone [figure 7]. Dif from the perilesional skin surrounding a bulla showed linear igg and c3 along basement membrane zone; a feature suggestive of bp [figure 8]. Thus, in conjunction with the clinical, histopathological and dif findings, the final diagnosis for our case was lp pemhigoides developing over preexisting scars, as an isotopic phenomenon . Atrophic scars with overlying lichenoid papules and plaques; and tense bulla on lower limbs atrophic scars with overlying lichenoid papules and plaques on buttocks close - up of lesions on the leg . Lesions are restricted to area of scar only histopathology from plaque showing hyperkeratosis, hypergranulosis, saw toothing of rete ridges, band - like infiltration in upper dermis (a) (h and e, 40) and (b) (h and e, 100) with basal layer degeneration (c) (h and e, 400) histopathology from bulla showing partial loss of epidermis including basal layer (a) (h and e, 40) and (b) (h and e, 100) and plenty of eosinophils in split (c) (h and e, 400) histopathology from scar showing unremarkable epidermis, increased collagen in dermis and no inflammatory cells (h and e, 40) direct immunofluorescence from plaque showing linear deposition of ig g and c 3 along basement membrane zone direct immunofluorescence from perilesional skin of bulla showing linear deposition of ig g and c3 along basement membrane zone lpp is an uncommon variant of bp, clinically manifested with bullous lesions over papules and plaques of lp, as well as on the uninvolved skin . It was first described by kaposi in 1892 as a classical case of lp complicated by extensive bullous dermatosis; which was termed as lpp . It can be precipitated by certain medications like cinnarizine, captopril, ramipril, psoralen and ultraviolet a (puva), simvastatin, and antituberculous medications . Igg autoantibodies against both bpag2 and bpag1 are thought to play a pivotal role in the development of the dermatosis . The widely accepted mechanism proposed is that lp or sometimes, puva causes damage to basal cells leading to unmasking of hidden antigens; thus paving the pathway for the formation of antibodies and development of lesions of bp . A report described the correlation of levels of antibodies against bpag2 with the disease activity in lpp . The salient points of difference between lpp and bullous lp have been summarized in table 1 . Dif testing show a smooth linear distribution of immunoreactants (c3, igg, igm, and iga) along the basement membrane zone of dermoepidermal junction . However, a unique 200 kd antigen has been recognized on the epidermal side of salt split skin of patients with lpp and thus, lpp may represent a clinically distinct entity and not merely, a co - existence of lp and bp . Effective treatment modalities include topical and systemic steroids, tetracycline, nicotinamide, dapsone, isotretinoin, methotrexate and other immunosuppressive drugs . This could be explained by the hypothesis that lpp has a unique antigenic target and thus, represents a distinct entity from bp . Lpp has been reported in association with keratoacanthoma and colon adenocarcinoma . A unilateral presentation has also been reported . The occurrence of a different or unrelated dermatological disease at the site of the healed disease is termed as an isotopic phenomenon . The proposed etiologies of isotopic response include viral, immunologic, neural, vascular and locus minoris resistentiae (a site of lessened resistance). However, development of lpp over preexisting scars is extremely unique and to the best of our knowledge, is not described in the english literature . It is a well - known fact that bulla formation in lpp is mediated by immunological damage against bp antigen along basement membrane zone . The predilection of the blisters to develop on the lower extremities could be explained by sluggish circulation in those regions . In our case, scars involving the dermis and subcutaneous tissue with largely unaffected epidermis might have altered the blood circulation in that particular area . This could explain the preferential deposition of immunoglobulins in the scar area and subsequent bulla formation . Wolf's isotopic response in lpp has probably not been described earlier in the medical literature . Wolf's isotopic response in lpp has probably not been described earlier in the medical literature . Wolf's isotopic response in lpp has probably not been described earlier in the medical literature. |
Charcoal was originally used for localizing a non - palpable tumor mass (1), however, it is being increasingly used for localizing suspicious metastatic cervical lymph nodes or recurrent tumors in the thyroid bed after surgery (2).although, charcoal is known to be safe and stable when injected subcutaneously for preoperative tumor localization, it may cause foreign body reactions and granuloma, if it remains in situ for more than 6 months (1). Until recently, charcoal granuloma in the neck was not reported in the literature . Under the approval of the institutional review board of our hospital, we reported a case of a charcoal granuloma that was suspected to be a recurrent tumor on ultrasonography (us) and f - fluorodeoxyglucose (fdg)-positron emission tomography / computed tomography (pet / ct), but was correctly identified after us - guided core biopsy . A 47-year - old woman was referred to our department for us - guided biopsy due to a persistent hypermetabolic nodule in the right level iv nodal station . She was diagnosed with invasive ductal carcinoma of the right breast and cervical lymph node metastasis at the right level iv (tnm stage; t2n3m0). She had undergone breast - conserving surgery and excision of a metastatic lymph node (fig . Before excision of cervical lymph node metastasis, us - guided localization had been performed using charcoal . After surgery, she received chemotherapy and radiotherapy (up to 50.4 gy) for the right breast and the right lower cervical area . On her first follow - up fdg - pet / ct (fig . 1d), which was performed 6 months after completion of treatment, a focal hypermetabolic lesion (maximum standardized uptake value [suvmax] = 4.0) was noted at the lateral aspect of the previous operative bed in the right level iv . The second follow - up pet / ct examination, performed 1 year after the first follow - up pet / ct scan, showed a persistent hypermetabolic lesion (suvmax = 4.3) at the same site (fig the lesion was ovoid, measured 9.8 mm in its maximal longitudinal diameter, and had an indistinct margin from the adjacent sternocleidomastoid muscle (fig . On pre - contrast ct, the image noise and suspicious beam hardening artifact related to overlapped clavicles and shoulder girdles, rendered identification of the lesion difficult . However, the lesion seemed to be slightly hyperdense relative to the adjacent sternocleidomastoid muscle (mean attenuation: 89 - 100 hounsfield unit) and did not significantly enhance after contrast administration (fig . 1 g). Since there was no evidence of recurrence at any other site of the body except the right side of the neck, and given the conflicting results of the previous cytological and pet / ct or chest ct examinations were, we decided to closely monitor and follow - up again 6 months later . Six months later, us showed a change in the echogenicity of the nodule with no change in size, but a slight change in shape (fig . As the morphology of the nodule changed, we could not rule out the possibility of a recurrent tumor . Thus, we decided to perform a core - needle biopsy, as the previous us - guided fine - needle aspiration did not yield sufficient tissue for an accurate diagnosis . Us - guided core - needle biopsy was performed thrice using an 18-g semi - automatic biopsy needle (tsk stericut; tsk laboratory, soja, japan). Microscopically, these dark - pigmented specimens were foreign body granulomas that comprised extensive deposits of charcoal and multinucleated giant cells, as well as fibrosis; no tumor cells were detected (fig . Patients who undergo surgery for malignant lesions in the neck may subsequently show benign conditions mimicking recurrent tumors . These include reactive lymph nodes, traumatic neuroma, postoperative fibrosis, and suture granuloma (3, 4, 5). Charcoal is originally used for localization of the non - palpable breast mass (1). Charcoal is known to be a biologically inert material when injected subcutaneously and may remain in situ for up to 60 days without triggering a foreign body reaction (1). However, in an experimental study, charcoal particles were ingested by macrophages and very slowly carried away from the injection site, causing inflammatory processes (6). Charcoal particles that remained in the surgical bed might have facilitated an inflammatory reaction during the healing process after surgery in our patient . Our patient also received radiotherapy after excision of the metastatic lymph node, possibly resulting in synergistic effects leading to fibrotic charcoal granuloma . The us features of charcoal granuloma in our report were characterized by ill - defined irregular shaped lesion with initial hyperechogenicty that changed over time, and posterior shadowing . Indistinct margin and posterior shadowing of the charcoal granuloma in our patient was in accordance with the finding of charcoal granuloma in the breast (7). Conversely, our lesion was hyperechoic at first, and decreased in echogenicity over time . Initial hyperechogenicity of our lesion might be a helpful finding for differentiating a tumor recurrence from a non - tumorous lesion, such as a charcoal granuloma . Tumor recurrence was reported to be hypoechoic to markedly hypoechoic in the surgical bed in the post - thyroidectomy neck (8). Although the size of the nodule was not helpful to differentiate recurrence from benign postoperative change at one time point (8), the interval change of the nodule size could become one of the important imaging findings to differentiate recurrence from benign lesion . In our case, the shape and echogenicity of the lesion was changed over time, however, the lesion did not significantly increase in size during a follow - up, which suggested a benign status . Ct and fdg - pet imaging findings in our patient were consistent with those of charcoal granulomas in the peritoneal cavity related to intraoperative, intraperitoneal chemotherapy (9). The lesions showed high attenuation on precontrast ct with no remarkable enhancement on post - contrast scans . Higher attenuation of the lesion compared to the adjacent muscles might be attributed to the high concentration of carbon particles (9). Both suture granulomas and charcoal granulomas can present hypermetabolic lesions due to increased utilization of glucose by activated multinucleated giant cells (9, 10). Therefore, such foreign body granulomas can be a common cause of false positive findings in the evaluation of tumor recurrence in the postoperative neck . Ultrasonography is the first line of imaging follow - up in patients with neck dissection or thyroid surgery . Suture granulomas as a result of the knotted suture materials after thyroid surgery, usually had characteristic irregularly shaped, multiple or paired central or paracentral echogenic foci> 1 mm, and heterogeneous hypo- to isoechoic lesions on us (4). Although us alone is not easy to distinguish tumor recurrence from other benign lesions, initial hyperechogenicity might be a feature of a non - tumorous condition . Ct may be helpful to differentiate the 2 entities because of the hyperattenuation of the charcoal granuloma . Following imaging workup, us - guided fine - needle aspiration biopsy is generally indicated for the evaluation of recurrent nodal metastases . However, as in our patient, charcoal granuloma with charcoal materials may not be diagnosed properly with fine needle aspiration cytology alone . Cases suspected of charcoal granuloma are better diagnosed by us - guided core - needle biopsy . In summary, we reported us, ct, and fdg - pet / ct findings of a charcoal granuloma in the neck after excision of a metastatic lymph node resulting from breast cancer . These findings included an irregular, heterogeneous hyperechoic nodule with subsequent decreased echogenicity and development of posterior acoustic shadowing on us, a high attenuating nodule on precontrast ct and a hypermetabolic lesion on pet / ct . Charcoal granulomas should be included in the differential diagnosis of incidentally detected mass - like lesions at the site of presurgical localization using charcoal. |
Lesch - nyhan syndrome was first recognized and clinically characterized in 1964 by lesch and nyhan, observing two affected brothers . Lns is a rare x - linked recessive disorder, resulting from a mutation on the gene encoding for the enzyme hypoxanthine - guanine phosphoribosyltransferase (hgprt), located on the long arm of the x chromosome between xq26 and xq27 . The hgprt is an enzyme involved in purine metabolism, which catalyses the condensation reaction which combines phosphoribosyl pyrophosphate (prpp) and the purine bases hypoxanthine and guanine to form the respective nucleotides, inosinic acid, and guanylin acid . The hgprt deficiency causes a backlog of guanine and hypoxanthine that oxidize in uric acid and an increase of intracellular prpp with a consequent major production of new purine . It results in an overproduction and accumulation of uric acid, which, if untreated, usually leads to renal failure and death in early childhood . One of the first symptoms of the disease is the presence of orange sand - like crystals of uric acid in the diapers of the affected infant . Overproduction of uric acid may lead to the development of uric acid crystals or stones in the kidneys (nephrolithiasis), ureters, or bladder, causing hematuria and increasing the risk of urinary tract infection, of nephrite, and of renal failure . Another potential consequence of untreated hyperuricemia is gouty arthritis caused by uric acid crystal deposition in articular cartilage . The affected children appear to be normal for the first few months of life, but hypotonia and development delay are evident from age three to six months . Later extrapyramidal involvement with dystonia, choreoathetosis, opisthotonos, dysarthria, dysphagia, and sometimes ballismus becomes evident . The patients also develop signs of pyramidal involvement as spasticity, hyperreflexia, and extensor plantar reflexes . The motor disability is so extensive that most individuals never walk and are confined to a wheelchair . The cognitive disturbs, attention deficit problems, and mental retardation are also present in patients with lesch - nyhan syndrome . The affected children appear normal for the first months of life; with the eruption of deciduous teeth, they begin to show self - mutilative behavior, biting their oral / perioral tissue and their fingers . The finger nails may be completely ripped, and the self - destructive process involves the bone . In some cases, extensive lesions the secondary infection complicates and retards the healing of traumatic lesions [4, 5]. Nyhan (1997) reported that children with lns feel pain and remorse when they mutilate themselves, but they are unable to control and to stop their action . They are usually relaxed when they have physical restraints, instead when it is removed the patients become agitated and their compulsive actions increase . The relationship between the enzyme deficiency and the neurological manifestations in lesch - nyhan syndrome is not so clear . Those disorders may be associated with deficits in dopaminergic activity in the basal ganglia; neurochemical studies of lns patients' brains show large reductions in da levels, elevated numbers of da receptors, and decreased levels of da transporters . The therapy with allopurinol, a xanthine oxidase inhibitor which blocks the metabolism of hypoxanthine and xanthine into uric acid, can control the overproduction of uric acid, reducing the risk of nephrolithiasis, gouty arthritis, and correlated diseases . The dose of allopurinol has to maintain the uric acid within normal limits; an excessive allopurinol therapy results in the accumulation of hypoxanthine and xanthine, which could result in xanthine stones . The pharmacological treatment of self - injurious behavior is addressed to control the deregulation in the dopaminergic, opiatergic, or serotonergic systems, as a possible cause of compulsive self - mutilating behavior . The administration of baclofen or benzodiazepines helps in muscle relaxation and keeps the patient calm . The use of hydroxytryptophan together with decarboxylase inhibitor has been proven effective in reducing self - mutilation for a short time . Recent therapeutic options also include gabapentin, botulinum toxin a, injected into bilateral masseters, and deep brain stimulation in globus pallidus . The self - destruction behavior should be managed by a combination of physical restraints, behavior modifications, and pharmaceutical therapy, according to olson and houlihan 2000 . In the literature various therapeutic approaches to manage self - destruction behavior are described, but to date the treatment to solve the source of the problem has not been found yet . Pharmacological treatment of dopaminergic dysfunction, the possible opiate, and/or serotonin system dysfunction have shown variable successes, but there are disadvantages to pharmacologic treatment, as it usually requires chronic use of the drug that often places the patients in a state of chronic stupor . The use of botulinum toxin a (btx - a) should be considered as a good treatment for self - mutilating behavior in lns, but the action of btx - a in decreasing self - inflicted injury is not clear . Btx - a may be acting directly on peripheral nerve endings, inhibiting the release of acetylcholine and indirectly on the basal ganglia, resulting in muscle weakness and in decreased behavior . Inquiries on btx - a nowadays are not enough and a further study is necessary to define the mechanism of action and the therapeutic results [9, 10]. The deep - brain stimulation has been performed on a few patients with lesch - nyhan syndrome and some patients experienced a decrease in spastic self - injurious symptoms . Published literature suggests that the role of dentist is crucial to prevent and control self - mutilation . In several cases, the extraction of deciduous teeth is adopted in young patient, but the extraction of all teeth is necessary also in permanent dentition . The extraction of only anterior permanent teeth (incisors and canines), as recommended by rosenbloom and other authors, is not effective in preventing self - injury and so all permanent teeth are involved . The extraction of all teeth represents an extreme solution that may cause functional problems and requires a treatment under general anesthesia . To avoid the extractions, a series of intraoral appliance budnick studying a lesch - nyhan syndrome patient, unable to chew his lips for lack of anterior occlusion, decided to create an acrylic splint firstly cemented in the lower arch and secondly in the upper one . He experimented a new technique by covering the posterior teeth to create anterior open bite, eliminating wounds caused by incisors . In the most collaborative patients with few self - mutilations he proposed only normal care of preventive odontology; in patients showing such a grade of collaboration and of spasticity to allow the intraoral alginate impression, he suggested the use of soft splint without cemented retention which caused hygienic and demineralization problems . Finally, in patients with insufficient collaboration the only solution was represented by the extractions of all teeth . A hard acrylic chin - cup with lip extension fitted by means of orthodontic headgear was proposed . The appliance was well tolerated by patients and it guaranteed the health of the oral tissue but increased the dribbling habit with a consequent fungal infection of chins dermis . To solve fungal inflammation the appliance had to be removed . A thin soft resin mouth guard was employed to prevent finger and lower lip self - mutilation in combination with an arm restraint . In six days of treatment and after three months the patient self - mutilations disappeared and he stopped biting himself, also without the mouthguard . In order to prevent dermatitis a soft resin mouthguard not covering the lip was built . It was first cemented and then to increase the retention he preferred heat - cured acrylic resin due to adequate rigidity and he added head strap; it had to rebuild to be adapted to development of teeth and it was not indicated in periodontal patients . In some resistant casese orthognathic surgery was proposed to create open bite and when the conservative options of treatment failed he suggested the amputation of teeth, as an alternative method to extraction of all teeth to preserve the alveolar bone . The upper and the lower incisors, canines, and the first premolars were performed with formocresol pulpotomies, the crowns were amputated on gingival level, and the dental root canals were filled with light curing glass ionomer cement and polished with softlex discs . The patient was sedated using choral hydrate and hydroxane, but in case of poor cooperation the general anesthesia was indicated [1719]. A removable acrylic dental appliance was made to create anterior open bite, orthodontic acrylic resin covered the palate, and occlusal surface of posterior teeth and adam's claps on first upper molar increased the retention . A resin mouthguard thick in posterior part was combined with a lip bumper in order to open anterior bite and to protrude lower lip from the teeth, but this treatment had minimal to partial success . The acrylic resin bite plate's retention was increased by a combination between adam's clasps on the premolars and ball clasps among incisors . The operators of the orthodontic ward of gaslini hospital realized a new orthodontic device to preserve oral and perioral tissue of lns patients . At first irreversible hydrocolloid impressions of maxillary and mandibular arches these impressions were finally taken in spite of patient's lack of compliance; operators' persuasive capacity, family, and operators' efforts to change the negative behavior of m.c . Were crucial . On these impressions a plaster model was built, the undercuts were eliminated (figures 1 and 2), and the orthodontic dispositive was realized by thermoforming disc materials (with a hard copolyster outer layer and a soft polyurethane inner layer) (figure 3), using a positive - pressure thermoformer (ministar) (figures 2 and 5). The hard side was placed in contact with teeth to increase friction and retention; on the contrary the soft one was placed in contact with antagonist dental arch to prevent traumatic occlusion . The first devices were removed by patients' tongue, so it was decided to change the dispositive, reducing mucosal flange to prevent the mouthguard's removal (figure 4). At the beginning, patients used the device only for few hours, but time by time they were persuaded to wear it longer . At first a thick lower bite was made to produce an anterior open bite; then it was substituted by a thinner maxillary and mandibular mouthguards well tolerated by the patient also during the meals . After these treatments, the patients were able to wear the device for 24 hours and it guaranteed the health of the oral and perioral tissue . The most common disadvantages of preventive intraoral devices are the design that may cause fungal infections, extensive laboratory time, and difficulty in daily oral care . Also frequent adjustments are required and heavy biting forces added to poor cooperation may interfere with impression taking . These devices extend to the vestibule area and the splint that creates an open bite increases the drooling habit with a consequent fungal infection of chin dermis . Cemented splint requires an extensive laboratory work, daily hygiene care is difficult, and the demineralization of the teeth is frequent . Some patients with lns show a degree of collaboration to allow the intraoral alginate impression, in other lns patients is impossible to have a degree of cooperation on making the intraoral impression; in fact sedation is sometime necessary . The use of putty - type vinyl polysiloxane impression material or quick alginate to overcome the insufficient patient's collaboration that makes the intraoral impression very difficult is suggested . It is possible to obtain greater patient's collaboration thanks to behavioral modification and persuasive capacity of family and operators . The simple intraoral device presented by gaslini operators is easy to fabricate; it is a mouthguard realized by thermoforming disc and characterized by two different matrices: hard and soft . The hard matrix guarantees a good retention, so during the cementation, the head straps, the splint extension to vestibule area, and the metal clasps are not necessary to give stability . The double matrix device is readily removed for everyday cleaning and the placement is also comfortable . The bite is very thin, it permits that the patient can wear the mouthguard all day, also during the meals, and consequently the drooling habit is not accentuated . The device is built on the patient plaster model; it can be customized for each individual case . Heavy biting force and poor patient's collaboration may interfere with impression taking . In the case described here the first impression to create an individual impression trays was taken and a second one to fabricate the device . Also the work was simplified by the use of quick alginate . In a second moment the efficacy of this device was observed during a period of about 7 years . During these years the major difficulties encountered during this therapy are as follows: necessity of modifying the dispositive to adapt it to the mouth changes, risk of small cracks on the occlusal resin bite that must be often repaired . Necessity of modifying the dispositive to adapt it to the mouth changes, risk of small cracks on the occlusal resin bite that must be often repaired . In conclusion the literature analysis demonstrates that the intraoral appliances, despite some limitations, can represent a good alternative option to invasive treatment and a good choice of therapy to limit and to prevent self - mutilative behavior in lns patients . The thin resin mouthguard described was successfully employed to prevent self - mutilation of oral and perioral structures . It represented a conservative solution and a good alternative option to invasive treatment of extracting the teeth or of orthognathic surgery . In addition, the device is easy to build and is well accepted by patient . A good choice of treatment for improving the quality of life of these patients can be represented. |
This review will focus on scorpion venom and its major toxins and their functions in excitable cells . It well also compares some of the research done on scorpions from different parts of the world to highlight open areas of interest . These animals are found in all continents except antarctica, and are known to cause problems in tropical and subtropical regions . They are adapted to survive in a wide variety of habitats including tropical forests, rain forests, grasslands, savanna, temperate forests, caves, and even snow covered mountains . Actually these animals are represented by 16 families and approximately 1500 different species and subspecies which conserved their morphology almost unaltered [1, 2]. The scorpion species that present medically importance belonging to the family buthidae are represented by the genera androctonus, buthus, mesobuthus, buthotus, parabuthus, and leirus located in north africa, asia, the middle east, and india . Centruroides spp are located in southwest of united states, mexico, and central america, while tityus spp are found in central and south america and caribbean . In these different regions of the world the scorpionism is considered a public heath problem, with frequent statements that scorpion stings are dangerous . Accidents caused by scorpion stings are a relatively common event in subtropical and tropical countries and can cause lethal envenomation in humans, especially in children . The signs of the scorpion envenomation are determined by the following: (a) scorpion species, (b) venom composition, and (c) the victim's physiological reaction to the venom . The symptoms of the sting start immediately with a few minutes after the sting and usually progress to a maximum severity within 5 hours . At this period the massive release of neurotransmitters results in sweating, nausea, and vomiting . The victims usually have the major signs, with the most common being mydriasis, nystagmus, hypersalivation, dysphagia, and restlessness . They may exhibit signs and symptoms involving the central nervous system, stimulation of the autonomic nervous system, and occasionally, respiratory and heart failure, and even death . After stings by dangerous scorpions from different parts of the world the signs and symptoms are similar . The victims of scorpion envenoming that presented multi - system - organ failure characterized by changes in hormonal environment with a massive release of counter - regulatory hormones, such as catecholamine, glucagon, cortisol, angiotensin - ii, and with decreased levels of insulin and an increase blood glucose level . The grading of these scorpions envenomation depends on local signs and whether or not neurological signs predominant . The local signs observed in victims can present effects that can separate in a neurotoxic and cytotoxic local (table 1). Central nervous system signs are sympathetic, parasympathetic, somatic, cranial, and peripheral nervous system and their major characteristics are shown in table 2 . The nonneurological signs which include cardiovascular, respiratory, gastrointestinal, genitourinary, hematological, and metabolic signs . With respect the neurological signs, most of the symptoms are due to either the release of catecholamine from the adrenal glands or the release of acetylcholine from postganglionic parasympathetic neurons . Table 3 shows the summarized characteristics of the different grade of envenomation caused by scorpion venom . Scorpion uses its venom for both prey capture and defense . The venom is constituted by mucopolysaccharides, hyaluronidase, phospholipase, serotonin, histamine, enzyme inhibitors, and proteins namely neurotoxic peptides [7, 8]. The signs of the scorpion envenomation are determined by the symptoms presented by victims of scorpion envenomation are usually complex in nature and can be attributed mainly to hyperactivity of the autonomic nervous system . The venom contain neurotoxic peptides which are responsible for the symptoms that present during envenomation by interacting with ion channels and have the potential to cause massive damage to nervous system of both vertebrates and invertebrates . Ion channels are gated pores of which gating may be intrinsic or regulated by binding or changes in the voltage gradient . This gradient across is responsible by excitation of the nerve and muscle, hormonal secretion, cell proliferation, sensory transduction, the control of salt and water balance and regulation of blood pressure . Scorpion toxins presents specificity and high affinity and have been used as pharmacological tools to characterize various receptor proteins involved in normal ion channel functionating, as abnormal channel functionating in disease - states [10, 11]. Advanced methods of fractionation, chromatography, and peptide sequencing have made it possible to characterize the components of scorpion, snakes and spiders venoms [1214]. The venoms can be characterized by identification of peptide toxins analysis of the structure of the toxins and also have proven to be among the most and selective antagonists available for voltage - gated channels permeable to k, na, and ca [1517]. The neurotoxic peptides and small proteins lead to dysfunction and provoke pathophysiological actions, such as membrane destabilization, blocking of the central, and peripheral nervous systems or alteration of smooth or skeletal muscle activity . The comparison of pharmacological characteristics with the different structures of scorpion toxins is important to understand and the mechanisms of action [17, 19, 20]. These toxins are responsible to overcome the defensive systems of the hosts such as proteases and/or significant local ph variations that may result from inflammation states induced by the animal bite itself [21, 22]. Scorpion toxins are classified according to their structure, mode of action, and binding site on different channels or channel subtypes [1719]. Each class consists of several peptides isolated from the venom of different species of scorpion and are based on their pharmacological action and also agrees well with the structural properties of this peptide family . The long - chain toxins affecting sodium channels have been subdivided primarily into two major subtypes, - and -toxins [23, 24]. The -toxins bind to receptor site 3 of the voltage - gated na channels of vertebrates in a membrane - dependent manner . The major effects of -toxins induce a prolongation of the action potential of nerves and muscles by fast inactivation of sodium channels receptor affinity dependent upon membrane potential [17, 19, 2532]. The -toxins are isolated from american scorpions, bind to receptor site 4 on vertebrate na channels and producing a shift to a more negative membrane potential [3338]. Several studies described the mode of action of these toxins that are related with the increment of sodium [36, 3942]. The -scorpion toxin cssiv obtained from centruroides suffussus scorpion venom is believed to specific bind in sodium channel [23, 24, 33, 34]. Other toxin also described such as ts1 is also known as ts which is a major toxic component obtained of the venom from the brazilian scorpion tityus serrulatus . This toxin has also been classified as a -scorpion toxin based on its structural homology, competitive binding assay, and its site of action [4143]. The effect of these toxins has been described in different cell types [4143]. The -scorpion toxin is believed to bind, to only one of the four voltage sensors of the sodium channel [34, 36, 42, 44]. In accordance to the classical models of sodium channel gating, the voltage sensors of the sodium channel activate independently, and at least three of them have to be in an activated position for the channel to open [4548]. However, if one of them is activated by the -toxin, the threshold of activation is unlikely to shift significantly since other voltage sensors remain unaffected . Voltage - gated sodium channels are critical for generation and propagation of action potentials initiation and propagation in excitable cells [25, 33, 49]. These channels are targeted for neurotoxins present a large variety of chemically distinct compounds that bind to several receptor sites on the pore - forming -subunit [34, 35, 49]. With respect to scorpion toxins have been observed that they show a preference for distinct sodium channels subtypes of mammals or insects [20, 3335, 50]. Potassium channels are part of a large variety of biological processes and also are involved in an increasing number of human pathologies [9, 51]. The diversity of potassium channel blockers and their therapeutic value to overcome in the potential treatment of a number of specific human diseases specially autoimmune disorders, inflammatory neuropathies and cancer . Scorpion toxins that target kchannels (ktx) are short - chain peptides cross - linked by three or four disulfide bridges . The -ktx family constitutes by more than 50 different -ktx have been reported and listed in more than 18 families [18, 5254]. 2000 described that / scaffold formed by an -helix and a two- or three - stranted -sheet linked by two bridges . However the / fold is shared by a variety of polypeptides with diverse functions, such as toxins active on na channels . The neurotoxin -ktx 12.1 initially named as tstx - iv was isolated from the t. serrulatus venom which is constituted with four disulfide - bridged described by several studies [18, 53, 5659]. The voltage - gated potassium channel has been shown to play a role in immune responsiveness . Previous in vitro studies described that the blockade of the channel leads to diminution of t cell activation and delayed type hypersensitivity . Butantoxin which is present in the venoms of three brazilian scorpions t. serrulatus, t. bahiensis, and t. stigmurus has shown to reversibly block the potassium channels and inhibit the proliferation of t cells and il-2 production . Ca ions play important roles in regulating a variety of cellular functions such as second messenger - coupling - receptor to active many cellular processes that including cellular excitability, neurotransmitter release, intracellular metabolism, and gene expression . The increment of ca concentration is mediated by voltage - gated ca channels that regulate ca influx across the plasma membrane and control the release of ca from intracellular stores . The ca channels are widely distributed in the body such as heart muscle, smooth muscle, skeletal muscle neurons, and endocrine cells [9, 25]. Scorpion venom consists of numerous peptides that may interfere with the activity of ion channels and modulate their functional properties . Various studies have been shown that scorpion toxins are used in insecticides, vaccines, cancer treatment, and protein engineering scaffolds . The inflammatory response is triggered by cascade that includes systems, cell elements, and release of mediators . After exposure to antigen vertebrates respond by antibodies production through a series of events involving multiple cellular interaction . Initially, antigen presenting cells is recognized by a t cell antigen receptor . At the end, b cells produce antibodies that are able to specifically recognize the antigen that provoked their formation . In between the two antigen - specific events t cells help b cells to make antibody by producing cytokines and/or cell - cell interaction . The two subpopulations of th cells which are named as th1 and th2 that differ in the effectors functions that differ mainly in the repertoire of cytokine secreted in response to antigenic stimulation [62, 63]. Th1 type cells secrete mainly interleukin-2 (il-2), tumor necrosis factor (tnf-), and interferon- (ifn-) which are responsible for macrophages activation and promote cell - mediated immune responses against invasive intracellular pathogens or the presence of toxins . The other subpopulation, th2 type cells are important in the defense against extracellular parasites by induction of the ige and iga and produce a variety of cytokines such as il-4, il-5, il-6, and il-13 . Both th1 and th2 cells secrete lesser amounts of tnf-, granulocyte - macrophage colony - stimulating factor (gm - csf), and il-13 . Mutual cross - inhibition between th1 and th2 type cytokines polarize functional th cell responses into cell - mediated or humoral immune responses [6267]. In accordance with their actions or properties pro - inflammatory cytokines such as il-1, il-6, and tnf are primarily responsible for initiating an effective defense against exogenous pathogens . However, the overproduction of these mediators can be harmful and may ultimately lead to shock, multiple organ failure, and death (table 4) [68, 69]. By contrary, anti - inflammatory cytokines include il-4, il-5, il-6, and il-10 are crucial for downregulating the exacerbated inflammatory process and maintaining homoeostasis for proper functionating of vital organs, but excessive anti - inflammatory response may also result in the suppression of body immune function (table 4) [7073]. The balance between pro- and anti - inflammatory activities determines the degree and extent of inflammation, and thus can lead to different clinical effects [7476]. Anti - inflammatory cytokines counteract the effects of proinflammatory cytokines and therefore the relative concentration of a cytokine to its inhibitor or antagonist will determine its final effect . Cytokines imbalances mediate the development of organ damage and lethality during severe sepsis and envenomation, a lethal syndrome that can develop after infection or injury . Health requires that cytokine production is balanced; low levels are required to maintain homeostasis . Overproduction of some cytokines causes diseases that span the range of severity from mild to lethal . In addition, the setting of local infection or tissue injury, a well - adapted anti - inflammatory response may contain local inflammation and prevent it from evolving into systemic inflammation . Systemic inflammation may be divided as acute or chronic; in acute systemic inflammation such as in sepsis, trauma, burns, and surgery is characterized by rapid and increments in plasma - levels of proinflammatory cytokines [77, 78]. In contrast, chronic low - grade inflammation is characterized by a modest but sustained increment in cytokines and acute phase reactants, usually of two to three folds and may be a key player in the pathogenesis of most chronic noncommunicable diseases [79, 80]. Much evidence supports the role of cytokines in scorpion envenomation seem that both pro- and anti - inflammatory cytokines levels are overproduced in sepsis syndrome . Their clinical significance and prognostic value have not been elucidated [76, 8186]. The production of cytokines in the envenomation has previously been referred to as a cascade (table 5). With respect to the pathogenesis of tissue injury is complex and cannot be attributed to a single agent . Tissue injury occurs during inflammation and is a progressive process which may eventually lead to organ dysfunction failure . The categorization of cytokines into pro- and anti - inflammatory response is essential for structural and functional repair of injured tissue, but excessive generation of proinflammatory signals can aggravate tissue damage because of the products derived from inflammatory cells . Il-1 is a prototypic proinflammatory cytokine that exists in two forms named as il-1 and il-1, both of which exert similar but not completely overlapping biological functions mediated through the il-1 receptor (il-1r). After binding to il-1r, il-1 induces the production of a high spectrum of cytokines and chemokines as well as the expression of adhesion molecules on endothelial cells, thus leading to the recruitment of inflammatory cells . In addition, il-1 also contributes to the development of vascular damage by stimulating cell proliferation and differentiation and the release of matrix - degrading enzymes . Il-1r antagonist (il-1ra) is a structural homologue of il-1 that binds to il-1r but does not induce any cellular responses and is therefore a natural inhibitor of il-1 activity . Both are synthesized as precursor molecules (pro - il-1 and pro - il-1) by many different cell types . Pro - il-1 is biologically active and needs to be cleaved by calpain to generate the smaller mature protein . In contrast, pro - il-1 is biologically inactive and requires enzymatic cleavage by caspase-1 in order to become active . Il-1 is primarily bound to the membrane, whereas il-1 is secreted and thus represents the predominant extracellular form of il-1 . The levels of il-1 in serum from human and mice injected with brazilian scorpion t. serrulatus and/or its majors toxins are characterized by rapid increments of this proinflammatory cytokine . High levels of these cytokines were observed in supernatants of macrophage from mice exposed to t. serrulatus venom and its major toxins [91, 92]. Increased levels of il-1 were determined in plasma from patients moderately or severely envenomed by t. serrulatus sting . High levels of il-1 and il-1 were observed in sera from mice exposed to mexican scorpion centruroides noxius . The role of il-1 in scorpion envenomation has been investigated through influencing its level or activity . Table 5 shows the presence of this cytokine production after accident caused by different scorpions . Il-6 is a multifunctional cytokine that regulates various aspects of the immune response, acute - phase reaction, and haematopoiesis . Il-6 is inducible by il-1 and consequently concentrations in serum are often a reflection of il-1 in vivo activity . Contrarily other cytokines, the il-6 is a pleiotropic cytokine that exerts its proinflammatory effects is produced by a variety of cells including b and t lymphocytes, monocytes, fibroblasts, keratinocytes, endothelial cells, mesenchymal cells, and certain types of tumor cells . High levels of il-6 were observed in sera from mice exposed to centruroides noxius and t. serrulatus scorpion venoms [76, 84]. Increased levels of il-6 were also observed in plasma from patients with different grade of envenomation by t. serrulatus [81, 82]. The cytokine production caused by different scorpions it downregulates the synthesis of il-1 and tnf- and also inhibits the production of gm - csf, ifn-, and mip-2 [9598]. Scorpion venoms can stimulate the neuroendocrinal - immunological axis by its ability to release catecholamines, corticosteroids, bradykinin, and prostaglandins and all these agents proved to induce the release of immunological mediator cytokines . There is now accumulating evidence to suggest a causal relationship between overproduction of certain cytokines such as il-1 and il-6 and morbility and mortality associated with critically ill patients . Sofer 1995,, was the first that reported the involvement of the inflammatory systems after scorpion envenomation in humans . In this work is documented the increment of il-6 levels in the serum of 8 of 10 children severely envenomed by the scorpions l. quinquestriatus and b. judaicus . The cytokines were measured on admission to the hospital and 1 to 3 hours after the sting il-6 levels gradually returned to normal values at 12 and 24 hours measurements, but remained above control levels in all measurements . These results were quite similar to those found by others authors that described the cytokine production after sting caused by tityus serrulatus scorpion in humans [81, 82]. With respect the experimental animal high levels of cytokines were found in serum from mice injected with centruroides noxius and t. serrulatus venom [76, 84]. In all works the authors concluded that the activation and release of cytokines may play an important role in the pathophysiology of envenomation after stings and may be responsible for some systemic inflammatory manifestations and organ failure . More human and experimental animal studies are required to determine the contribution of the inflammatory system in the genesis of scorpion envenomation . Il-8 as pivotal mediator of cerebral reperfusion is increased in brain tissues and a neutralizing anti - il-8 antibody significantly reduced brain oedema and infarct size in comparison to rabbits receiving a control antibody . Increased levels of il-8 were observed in serum from patients with different grade of envenomation caused by t. serrulatus and leiurus quinquestriatus scorpions (table 5) [82, 89, 90]. Tnf is a pleiotropic cytokine that exerts potent proinflammatory effects on envenomed and other metabolic and inflammatory disorders which are also risk factors for cardiovascular diseases . Lymphocytes and macrophages orchestrate a lot of the inflammation in envenomation, mainly the production of tnf- that exerts its proinflammatory effects through increased production of il-1 and il-6, expression of adhesion molecules, proliferation of fibroblasts, and procoagulant factors, as well as initiation of cytotoxic, apoptotic, and acute - phase responses [87, 100, 101]. Tnf- is a major inflammatory cytokine due to its ability to stimulate the synthesis of nitric oxide and other inflammatory mediators that drive chronically delayed hypersensitivity reaction [102, 103]. With respect to tnf-, il-1 seems to be important in the pathogenesis of envenoming because of its immunological upregulatory and proinflammatory activities [76, 84, 87]. The il-1 system consists of il-1 and il-1, both of which are produced by various cell types through the initiation of cyclooxygenase type 2, phospholipase a, and inducible nitric oxide synthase [102, 103]. High levels of tnf- were observed in human and mice serum and also in mice macrophages supernatant (table 5). Ifn-: the pleiotropic cytokine ifn- is a proinflammatory mediator that is expressed at high levels in envenomation by various cells, including monocytes / macrophages, th 1 cells, and natural killer t cells (nk). High levels of ifn- were observed and documented during the envenomation caused in human and experimental animals by different scorpion venoms centruroides noxius and tityus serrulatus (table 5) [76, 8284]. Il-4 is a highly pleiotropic cytokine that is able to influence th cell differentiation, its early secretion leads to polarization of th cell differentiation toward th2 like cells . Th2 cells secrete their own il-4, and subsequent autocrine production of il-4 supports cell proliferation . The th2 cell secretion such as il-4 and il-10 has marked inhibitory effects on the expression and release of the inflammatory cytokines . Il-4 is considered to be able to block or suppress the monocyte - derived cytokines, including il-1, il-6, il-8, tnf-, and macrophage inflammatory protein 1 alpha [104, 105]. Overall anti - inflammatory cytokines whose roles are less well characterized in envenomation include il-4 which has a stimulatory molecule for b and t cells, and has known immunosuppressive effects in the intestine . T - cell receptor chain - deficient mice (tcr-/-) treated with anti - il-4 monoclonal antibody showed a decrease in th2 cells mrna cytokine production and an increase in expression of ifn-, suggesting that il-4 plays a major role in inducing th2 type cd4 + cells in the gut to shift towards a th1 response . Increment of il-4 production was observed in serum from rats exposed to androctonus australis hector scorpion (table 5). Il-10 is produced by several cell types including cd4 + and cd8 +, t cells, macrophages, monocytes, b cells, dendritic cells, and epithelial cells . Il-10 is the most important anti - inflammatory cytokine found within the human immune response . It is the potent inhibitor of th1 cytokines, including ifn-, tnf-, il-1, il-2, il-6, il-8, and il-12 [63, 108]. In addition, a major stimulus for the production of il-10 is inflammation itself and il-1 and tnf- can stimulate il-10 production directly . The one other property of il-10 is to suppress free oxygen radical release and nitric oxide activity of macrophages and the production of prostaglandins . In serum from patients envenomated with tityus serrulatus scorpions and in experimental animals exposed to androctonus australis hector, centruroides noxius, and t. serrulatus venoms were observed modified levels of il-10 (table 5). The pathophysiology of envenomation is complex, but there is little doubt that injection often progresses from systemic inflammatory response to severe envenomation . In humans envenomed or experimental animal exposed to venom crude and/or purified toxins from different scorpions is the primary event in this sequence . During the interaction of venom components with cells and serum proteins to initiate a series of reactions that generally may lead to cell injury and death . The discovery that cytokines have the capacity to cause disease focused a new field of investigation on the physiological control mechanisms that maintain health by restraining on counter regulation cytokine release . Systemic effects of the cytokines have been shown to induce fever and increase symptoms . In the local action the balance between pro- and anti - inflammatory cytokines determines the degree and extent of inflammation, and thus can lead to different clinical effects . Anti - inflammatory cytokines counteract the effects of proinflammatory cytokines and therefore the relative concentration of a cytokine to its inhibitor or antagonist will determine its final effect . Following the injection of venoms, a variety of proinflammatory cytokines are released, along with counter - regulatory or anti - inflammatory cytokines, and the outcome of an inflammatory response is dictated by a variety of factors, that including the duration of the stimulus, and the balance between the proinflammatory and anti - inflammatory response . An excessive proinflammatory response is thought to be important in the pathogenesis of septic shock . In contrast, an excessive anti - inflammatory response could result in failure to clear a venom action, with equally deleterious effects [73, 85, 110]. However the prolonged compensating anti - inflammatory response syndrome may be associated with excess mortality and morbidity because of increased risk for envenomation (figure 1). With respect to the functions of many cytokines, and frequently multiple antagonists for any given agonist, the ability to compensate for a certain amount of divergence in production of individual cytokine is significant . Cytokines are important for regulation of inflammatory response . During the local and systemic responses are observed the release of proinflammatory cytokines, arachidonic acid metabolites proteins of the contact phase and coagulation system, complement factors; it is defined as systemic inflammatory response . The massive production of the cytokines causes that spam the range of severity mild to lethal . However, in parallel, anti - inflammatory mediators which produce an imbalance of these dual immune responses seems to be responsible for organ dysfunction . The pathogenesis of tissue injury is complex and cannot be attributed to a single agent . Tissue injury occurs during inflammation and is a progressive process which may eventually lead to organ dysfunction and failure . The systemic inflammatory response is the overproduction inflammatory reaction resulting from systemic mediator release that may lead to multiple organ dysfunctions (figure 2). Excessive generation of proinflammatory signals can aggravate tissue damage because of the products derived from inflammatory cells . The increment of the levels of proinflammatory cytokines leads to activation of macrophages, neutrophils, nk cells, t cells, and b cells [67, 73, 111]. The inflammatory response is essential for structural and functional repair of injured tissue . Among the clinical features observed in severely envenomed patients, mainly children, the gastrointestinal symptoms such as vomiting, excessive salivation, and abdominal pain based on these and others clinical observations, several studies have been carried out to improve our understanding of the effects of scorpion venom on the gastrointestinal system . Experimental studies have shown that the injection of whole venom and purified toxins from the venom of scorpions can cause profuse salivation, increased gastric and pancreatic injuries as well as disorders of intestinal motility [113117]. Most of these effects have been related to the acute autonomic disturbances triggered by the venom, which can provoke both the activation and delayed inactivation of neuronal sodium channels, where they modulate the release of neurotransmitters, that leads to a variety of adverse effects which include respiratory failure, lung edema, arrythmias, tachycardia followed by bradycardia, skeletal muscle stimulation, lacrimation, convulsions, and enlarged pupils, among others [112, 116124]. However, the role of other members of il - family in envenomation is increasingly appreciated, and in the present work are summarized all currently available information from human and experimental studies . With respect to the scorpion envenomation the immune response also is triggered by cascade that including the released of mediators such as nitric oxide and complement system . Nitric oxide (no) is a free radical generated by the conversion of the aminoacid l - arginine to no and l - citrulline by the enzyme no synthase and is the key endothelium - derived releasing factor implicated in the regulation of vascular tone and vasomotor function . No is also considered as a second messenger for a number of physiological in processes including neurotransmission, maintenance of vasodilator tone, and arterial pressure and it has been suggested that cytokine - mediated circulatory shock is caused by activation of the inducible isoform of nos . Oneb of the isoforms, the endothelial nos, plays an important role in determining and maintaining aspects of normal renal function, for instance proximal tubule sodium reabsorption . In biological systems such as cardiovascular and nervous, the no has important functions by its implication as vasodilator and neurotransmitter . In some instances the no decomposes to nitrite and nitrate, and cytokine - mediated increases in concentrations of nitrite / nitrate . Several inducers of insulin resistance that including proinflammatory cytokines and oxidative stress are capable to cause modifications in the levels of nitrite and nitrate production have been associated with several conditions: severe envenomation, septic shock, and hypertension [83, 84]. No plays a pivotal role in the pathophysiology and pathology in various systems including the envenomation caused by scorpion venom . The presence of no in serum from patients envenomed with l. quinquestriatus and mice exposed to t. serrulatus venom, and supernatants of macrophage treated with t. serrulatus venom and/or and its toxins are shown in table 5 . The oxidant and anti - oxidant balance is an important determinant of immune cell function, not only for maintaining the integrity and functionality of membrane lipids, cellular proteins, and nucleic acids, but also for the control of signal transduction and gene expression in immune cells . The cells of the immune system are sensitive to changes in the balance of the oxidant / antioxidant because high levels of ros are produced as part of their normal function . One other effect is associated with complement - activating components in the venoms that indirectly contribute to tissue damage . Bertazzi et al ., 2003, described the effects of t.serrulatus venom and tstx1 gamma on lytic activity of the complement system . In this study the authors showed that the complement system is involved in inflammatory process induced by the venom or toxin and consequently in the lung edema, hemolysis, leukocytosis, among other clinical manifestation of severe envenomation . The effects of androctonus australis hector venom on the lytic activity of the complement system were also studied and reported . Scorpion envenoming essentially results in a syndrome of fuel - energy deficits and causes an inability to utilize the existing metabolic substrates by vital organs causing multi - organ system failure and death . The effect of stings of scorpion venoms in humans and experimental animals exposed to venom, such as rabbits, rats, and mice were studied in serum biochemical parameters and are presented in table 6 . 2009 shown that the brazilian scorpion t. serrulatus resulted in increased lung, kidney, liver, and heart inflammation, characterized by an increased density of mononuclear cells after injection in rats . These authors concluded that this venom leads to acute lung injury, characterized by altered lung mechanisms and increased pulmonary inflammation . The primary pathological process is pulmonary capillary endothelial dysfunction resulting in interstitial and alveolar oedema of protein and phagocytic immune cell rich exudative fluid . The symptoms associated with pulmonary oedema are variable but may be rapid . Depending on the severity and duration of the renal dysfunction this accumulation is accompanied by disturbances such as metabolic acidosis and hyperkalemia, changes in blood fluid balance, and effects on may other organ systems . The scorpion venom caused a great increase in renal oedema which is related to the decreased glomerular filtration rate and urinary flow . The t. serrulatus venom also affects haemodynamics probably by a direct vasoconstrictor action leading to increased renal flow in mice [136, 137]. Acute renal failure is a rapid loss of renal function due to damage to the kidneys, resulting in retention of nitrogenous such as creatinine and non - nitrogenous waste products that are normally excreted by the kidney . In various works the authors described that scorpion venom caused a great increase in renal oedema, which is related to the decreased glomerular filtration rate and urinary flow . During the acute renal failure has been reported to occur after scorpion stings [127, 138, 139]. In normal state the kidney maintains renal blood flow and glomerular filtration through autoregulation dependent on the tone of the afferent and efferent arterioles . The cytokine - induced systemic vasodilation and relative hypovolaemia in sepsis are responsible for renal hypoperfusion . The renal vasculature has been shown to participate variably to mediators of systemic vasodilation and renal blood . In particular, the arachidonic acid metabolites of thromboxane and leukotrienes both reduce renal blood flow and antagonists of these substances have been shown to have renal protective effects . The kidney is susceptible to leukocyte mediated tissue injury with neutrophil aggregation in response to production of proteases and ros . Fatality after scorpion envenomation may be the result of cardiovascular failure complicated by pulmonary oedema as well as by respiratory arrest . Both of heart and the blood vessels are sensitive to the effects of proinflammatory cytokines as well as vasoactive substances present in excessive amounts in envenomation . A direct effect of scorpion venom on myocardium has been shown in several studies [128, 130, 131, 133, 140142]. Aspartate aminotransferase (ast) is distributed to all parts of the body but mostly concentrates in the liver and the heart . The activity of alanine aminotransferase (alt) is similar to ast that is considered a liver - specific enzyme . Therefore, the increase in ast and alt levels may be due to a direct action of the venom on the liver and the heart . Envenoming by different scorpions has showed an increase of circulating enzymes levels those are succinate dehydrogenase, creatine phosphokinase, lactate dehydrogenase (ldh), glucose-6-phosphate dehydrogenase (g6pd), alt, and ast (table 6). Following venom injection the highest toxin concentration has been found in the kidneys, liver, heart, and lungs [128134, 140148]. The alt and ast activities have reported in the serum change during scorpion envenomation [128134, 140149]. Scorpion venom also acts on the sodium - potassium pump, producing from local symptoms to systemic problems which lead to changes in the victim's life . Various studies described that the mechanisms of action toxins on cell membranes that producing changes on the transmembrane action potential and permeability changes in calcium and potassium channels altering the release of neurotransmitters such as acetylcholine . Scorpion venom increases the membrane permeability to sodium by opening the voltage sensitive sodium channels, which is accompanied with calcium entry, and blockade of calcium - activated potassium channels resulting in relative hyperkalemia who induces the release of catecholamines . One of main metabolic changes produced by scorpion stings is hyperkalemia . In human victims of the mexican scorpion these authors described that hyponatremia could be explain abdominal distention caused by hypokalemic intestinal paralysis and hypernatremia, the cause of irritability . One factor that contributes and aggravates the hyperkalemia condition is that the potassium influx causes the pronounced and prolonged hyperglycemia, enhanced glycolysis, and inhibited glycogenesis from decreased insulin secretion . Some researchers have emphasized that blood glucose levels increase after envenomation resulting in hyperglycemia in animal models . Also several studies have reported that this might be to a massive release of catecholamines, increased glucagon and cortisol levels, changes in thyroid hormone levels and changes in insulin secretion [84, 87, 149]. The elevation of circulatory catecholamines and angiotensin result in intense vasoconstriction and cardiac stimulation, increased myocardial oxygen requirement, and alterations in myocardial perfusion and metabolism, with hyperglycaemia and an increase in circulating free fatty acids . Murthy and hase in 1994 described that the insulin has a primary metabolic role in preventing and reversing the cardiovascular, haemodynamic, and neurological manifestations and pulmonary oedema induced by scorpion envenoming . Insulin is a pleiotropic hormone which has diverse functions including stimulation of nutrient transport into cells regulation of gene expression modification of enzymatic activity and regulation of energy homeostasis actions . Rabbits and dogs following scorpion envenomation present a reduction of insulin, hyperglycemia, and enlace glycogenolisis in heart, liver, and skeletal muscle [149, 150]. Various studies described the electrolytes changes such as occurrence of hyponatremia accompanied by normal to increased levels of serum potassium and lowered serum calcium after injection of scorpion venom from different species . The production and/or release of cytokines may also play a role in the development of hyperglycemia, in particular tnf- has been demonstrated to induce insulin resistance in animals models . Recent studies have showed that the proinflammatory cytokines, such as il-1, tnf-, and ifn-, are putative mediators of the progressive loss of pancreatic -cells in type diabetes mellitus . These cytokines are released by macrophages and t cells in infiltrated islets of langerhans and cause impaired function and ultimately cell death by apoptosis or necrosis . With respect to anti - inflammatory cytokines in particular il-4, il-10, and il-13, cytokines acting alone or in combination induce various transcription factors and signal transduction pathways within -cells . One of the most important signaling events is the activation of transcription factor, nuclear factor kappa b . These factors play the role of a master switch in -cells, activating transcription of a number of genes involved in cytokine - mediated toxicity . Of great importance for cytokine toxicity in -cells are in particular the generation of nitric oxide via induction of the inducible nitric oxide synthase (inos) and production of reactive oxygen species . Cytokine - induced nitrosative and oxidative stresses trigger eventually -cells death [153, 156, 157]. Although the action of anti - inflammatory cytokines has been studied in different cell types during recent years, little is known about the effects of these cytokines in pancreatic -cells [158161]. It is known from the studies in different cell models that il-4 is able to counteract many of the il-1 effects, and reduced no production has been considered an important element for this beneficial effect [159, 162, 163]. The biological effects of il-13 may be achieved through binding to the il-4 receptor and therefore it is generally assumed that these two cytokines overlap in the biological effects . The effects of il-10 on the nitric oxide pathway are unclear and the opposite findings have been reported . Some studies on anti - inflammatory cytokine action in insulin - producing cells have been published recently, but opposite effects with respect to -cell survival have been reported and the underlying molecular mechanisms of the action of anti - inflammatory cytokines still remain unknown . The mediators affecting inflammatory processes may be released after scorpion envenomation including kinins, ecosanoids, platelet activating factor, permeability increasing factor, nitric oxide, and cytokines . This released of cytokines and other mediators may account for several of inflammatory manifestations observed such as acute respiratory of inflammatory manifestations observed such as acute respiratory distress syndrome, systemic inflammatory responses syndrome and multiple organ failure . The cytokines regulate and amplify the immune response, induce tissue injury and mediate complications of the inflammatory response . Equilibrium between pro- and anti - inflammatory is essential to maintain the homeostasis in the system . Dysregulations of the pro- versus anti - inflammatory are involved in the pathogenesis of envenomation in humans and experimental animals . The balance between proinflammatory and anti - inflammatory cytokines in envenomation determines the degree and extent of inflammation which can lead to major clinical effects such as cardiac dysfunction, pulmonary edema and shock . In line with the findings, high levels of tnf-, il-1, il-6 and il-8 |
Cytokines are known to play essential roles in hematopoiesis such as the regulation of differentiation and production of progenitor cells and mature blood cells . The knowledge of cytokine function has not only contributed to the development of supportive therapies (i.e., erythropoietin (epo)), but dysregulation of cytokines also argues in the diagnosis of some hematopoietic disorders . For example, one of the minor criteria of polycythemia vera (pv) according to who 2008 classification is the subnormal serum epo level . Recently, clinical trials with janus kinase (jak) inhibitors have confirmed the presence of aberrant production of inflammatory cytokines and highlighted their role in the pathophysiology of philadelphia negative myeloproliferative neoplasms (ph mpns). Indeed, clinical impact of jak inhibitors on the functional symptoms and splenomegaly in patients were concomitant with a significant effect on the plasma levels of many cytokines [3, 4]. The first experimental data that showed elevations of serum and/or plasma cytokines in ph mpn date back to more than 15 years . In the 90s, changes in serum levels of interleukin (il) such as il6 [5, 6], il2 and its soluble receptor, and of tumor necrosis factor (tnf) the study of hermouet et al . In 2002 has expanded this panel, showing elevated serum levels of il8 and il11 in patients with pv, compared to healthy subjects . Elevated serum concentrations of il11 and il8 were observed in 30% and 100%, respectively, of the pv but not in controls . This high concentration of these two cytokines was also observed in the bone marrow plasma in 48% and 100% of pv patients, respectively, concerning il11 and il8 . The authors have also shown that the stimulation of stromal cells with il1 induced an increase in the production of these two cytokines, suggesting that bone marrow stromal cells regulate il11 and il8 production . This study also described an elevation of il8 both in sera and in bone marrow plasma among patients classified as idiopathic erythrocytosis (in the absence of endogenous erythroid colonies). In 2005, panteli et al . Measured the serum levels of il1, il1, il2, il6, soluble il2 receptor alpha (sil2-ra), and thrombopoietin (tpo) in 25 primary myelofibrosis (pmf), 40 essential thrombocytemia (et), and 8 pv in comparison with a group of 27 healthy subjects and a subgroup of 10 chronic myeloid leukemia (cml) patients . The interest issue of this study was to show that all ph mpns mpns (pmf, et, and pv) had significant increased serum levels of il2 and its soluble receptor, compared to healthy subjects . The cml patients showed the same increases compared to the healthy subjects, but with significantly lower values than pmf . Similarly, pv and et patients had significantly lower levels of il2 compared to pmf ones . Overall, pmf patients displayed a gain of all cytokines measured in this study, with the exception of il1 and il1, compared to healthy subjects and cml, pv, and et patients . The profiles of et and pv patients were relatively similar with no significant difference reported between these 2 subgroups, although the rate of il2 and its receptor were higher in pv (but not significant). Concerning all the patients evaluated (ph mpn and cml), the authors did not find any significant increase of il1 nor il1 compared to healthy subjects . Regarding tpo results, the authors found a significant increase in tpo serum compared to controls only for patients with pmf . Et and pv patients, despite moderately higher median levels, had no significant overexpression of tpo (versus controls), although high levels of tpo in et have previously been reported [10, 11]. No difference between pv and et could be demonstrated in this study . The moderate increase of tpo levels must be interpreted in view of the decreasing rates of epo reported in several studies, in correlation with epo independent growth of hematopoietic progenitors in mpns . In particular, a multicenter study on a cohort of 116 pv reported a significant reduction in rates of epo in 85% of patients compared to secondary polycythemia, confirming the interest of the diagnostic assessment of serum epo in pv . In the study of panteli et al ., the observed changes do not suggest that the assay of tpo can serve as a diagnostic marker of et . Indeed, increasing levels of tpo were not correlated to platelet count or bone marrow megakaryocyte to clumping . In 2011, tefferi et al ., using a multiplex assay using magnetic nanobeads coupled with flow cytometry, have assessed plasma levels of 30 cytokines including several growth factors such as granulocyte colony - stimulating factor (g - csf), vascular endothelial growth factor (vegf), and hepatocyte growth factor (hgf), in a cohort of 127 patients with pmf . Firstly, this study confirmed the wide deregulation of cytokine expression described in pmf patients . In fact, 20 of the 30 cytokines tested in plasma showed significant differences, compared to healthy subjects . The authors approved the previously described increases of il2, il6, and il8 but also found significant increases in il10, il12, il13, il15, tnf, and interferon alpha (inf). Contrary to previous results, the authors found elevated levels of il1 and il1. This difference is probably due to the different techniques / antibodies used (conventional elisa versus multiplex assay). In this inflammatory profile, additional deregulations of hematopoietic growth factors such as g - csf, hgf, and vegf were observed . Of the 127 patients included in this study, 90 patients had a blood sample taken at diagnosis before any treatment, showing that inflammatory conditions characterized by a cytokine overproduction play an integral part in the disease . Were able to study the cytokine profiles of another cohort of 65 pv compared to the results obtained in their cohort of 127 pmf and 35 controls . In this study, they showed that several plasma cytokines were abnormally expressed in pv compared to normal controls, but pv patients presented a different pattern to pmf patients . Compared to normal controls, pv patients demonstrated significantly higher levels of il1ra, il5, il6, il7, il8, il12, il13, ifn, granulocyte - macrophage colony - stimulating factor (gm - csf), macrophage inflammatory protein 1 and 1 (mip-1 and mip-1), hgf, ifn inducible protein 10 (ip-10), monokine induced by ifn (mig), monocyte chemotactic protein-1 (mcp-1), and vegf . Conversely, levels of epidermal growth factor (egf) and regulated on activation normal t - cell expressed and secreted (rantes) were lower in pv compared to normal controls . Differences between pv and pmf were numerous . Levels of the following cytokines were significantly higher in pmf compared to pv: il-1, il1ra, il-2r, egf, il10, basic fibroblast growth factor (b - fgf), il12, ifn, and rantes . In contrast, levels of il7, ifn, gm - csf, mip-1, ip-10, mig, and vegf were significantly higher in pv compared to pmf . Using the same multiplex assay technology, these results were improved by pourcelot et al ., who studied the plasma concentrations of 13 cytokines in the plasma of 17 pv and added data on 21 et . This study firstly permitted to highlight a significant elevation of these 13 cytokines in pv and in et . As in the study of vaidya et al ., the authors found previously reported increases in il6, il8, il12, ifn, gm - csf, hgf, and vegf in pv . Moreover, the study of pourcelot et al . Found a significant increase in plasma levels of il4, il10, mcp-1, tnf (not significant in the study of vaidya et al . ), and platelet derived growth factor (pdgf - bb) (not determined in the study of vaidya et al . ). Interestingly, the authors showed that pv and et patients differ by their plasma cytokine profiles . Et patients had higher levels of il4, il8, gm - csf, ifn, mcp-1, pdgf, and vegf compared to pv . It is interesting to note that cytokines evaluated in this study were higher in et patients than in pv . All these studies confirmed the existence of an inflammatory context associated with mpns; gangemi et al . Have focused on the evaluation of il22, il23, and il10 circulating cytokines which are considered as markers for the activation of t helper lymphocytes . However, et patients did not show any changes in these 3 cytokines compared with controls and no difference between pv and et could be demonstrated . From all of these studies, several comments emerge: (i) ph mpns (pv, et, and pmf) are all characterized by a significant change in the cytokine production objectified by increased plasma levels of many inflammatory cytokines (i.e., il1, il2, il6, il8, il12, tnf, and ifn), several growth factors (e.g., gm - csf, g - csf, hgf, pdgf, and egf), and angiogenic factors (i.e., vegf) (table 1); (ii) deregulations also concern anti - inflammatory cytokines such as il4 and il10; (iii) there are differences in levels and cytokine profiles among mpns but no particular continuum between these diseases could be objectified (figure 1). Some cytokines are overexpressed in pmf versus pv (i.e., il1, il1ra, il2-ra, egf, and il10). Conversely, some are overexpressed in pv versus pmf (i.e., il7, ifn, gm - csf, mip-1, ip-10, and mig) and, finally, et also have higher rates than pv concerning il6, il8, il12, ifn, gm - csf, and hgf; (iv) on a technical level, in the absence of standardization of methods between different studies, it is difficult to compare these results to each other; (v) the investigation of a large cohort of mfp, pv, and et using the same technology would clarify these differences and allows to better define the existence of specific profile of each disease; (vi) interpretation of cytokine levels should take into account other factors that may limit the ability to use cytokines in everyday practice . Consequently, in healthy patients, age was shown to increase the measurement of il6 and interferon - gamma inducible chemokines (mig and ip-10) and conversely to decrease il2, egf, and egfr measurements [17, 18]. In the normal bone marrow, the stroma cells comprise fibrocytes / fibroblasts, endothelial cells, osteocytes / osteoblasts as well as osteoclasts . Fibrosis is the result of collagen production by fibroblasts and its deposition in the extracellular space and in parallel scar tissue formation . In general, megakaryocytic clustering can be regarded as surrogate for increased megakaryocytic proliferation . In mpns, clonal (mutated) neutrophilic or erythroid cells are morphologically indistinguishable from their polyclonal counterparts but the increase in bone marrow granulocytic progenitors and neutrophils is the morphological surrogate for aberrantly increased proliferation . Erythropoiesis is usually not increased in pmf and patients can have normal hemoglobin values or anemia . The shape of the megakaryocytic nuclei and the emphasis of granulocytic proliferation are matters of dogmatic debate, in particular cloud - like (pmf) versus staghorn - like (et) megakaryocytic nuclei [2123]. The fundamental question is, why do fibroblasts start to produce more fibers and why are these fibers not degraded? All bone marrow cells (hematopoietic and nonhematopoietic) communicate with each other via direct cell - cell contact and via cytokine - receptor signaling . In his editorial article some speculations on the myeloproliferative syndromes, william dameshek raised the hypothesis that hormonal signaling factors (myelostimulatory factors) may lead to these myeloid diseases . Nowadays, although we have found clonal markers, aberrant expression of cell signaling molecules, and regulatory micrornas [2527], we still speculate on the causes of these diseases and in particular why progressive and prognostic adverse myelofibrosis develops in these patients . The fact that prefibrotic pmf has similar megakaryocytic atypia as fibrotic - stage pmf and that megakaryoblastic acute myeloid leukemia (aml) is frequently associated with fibrosis make it likely that megakaryocytes could be the neoplastic cell subtype which predominantly forces fibroblasts to produce fibers . In contrast to et megakaryocytes, pmf megakaryocytes form a more dense net of proplatelets within the bone marrow . Two central fibrosis - related cytokine / receptor pairs in mpns are pdgf and its receptor (pdgfra) and transforming growth factor beta 1 (tgf1) and the tgf type ii receptor (tgfbr2) [2931]. However, the link between the production of pdgf and tgf1 and mpn - associated mutations remains unclear . The jak2v617f mutation does not directly result in fibrosis although it was observed that, in pmf, the mutant allele frequency is high . In fact, jak2v617f is mutated in 5060% of pmf (including mf0 - 3) as well as 5060% of et, but in almost all cases of pv [25, 32]. Jak2v617f, through its association with pdgfra and tgfbr2, may contribute to enhance their signaling, mimicking the action of their ligands . It is more likely a progressive and long - lasting shift of the cytokine microenvironment towards fibrosis rather than one single genetic trigger . Several matrix modulating factors are increased, in particular thrombospondins (thbs) 1 and 2 and matrix metalloproteinases (mmps) such as mmp14 which are produced by megakaryocytes (figure 2) [33, 34]. Mmps degrade fibers while tissue inhibitors of metalloproteinase (timp) contribute to fiber accumulation but, in the most advanced stage pmf, timps are not increased . Therefore, increased expression of mmp14 could reflect a higher turnover of the extracellular matrix . Profibrogenic and simultaneously antiangiogenic thbs are matricellular factors which are not involved in structuring the extracellular matrix, but which regulate other factors of the extracellular matrix . It is thought that angiogenesis plays a critical role in the pathogenesis of pmf . Increased thbs acts ineffectively against exaggerated angiogenesis (e.g., mediated by increased pdgfra levels) [29, 36]. Data from bone marrow histopathology suggest an increase in the microvessel density (mvd) and vegf . Reported that pmf patients were characterized by a significant increase of mvd, particularly microvessels assessed by cd105 expression, compared to pv, et, and controls . Similarly, post - pv and post - et myelofibrosis harbored significantly higher numbers of microvessels compared to pv and et, respectively . In parallel to the increasing density of microvessels, a significant increase expression of vegf has been observed in pmf patients compared to et, pv, and mds / mpn . Gianelli et al . Confirmed high levels of vegf expression in pmf compared to et or controls but failed to objectify differences between pmf and pv . Both receptors were weakly expressed, mainly in megakaryopoietic and erythropoietic progenitors, with heterogeneous intensity . Mvd have been shown to correlate with a high jak2v617f allele burden (55%) in mutated patients suggesting that angiogenesis may be influenced by allele burden in these patients, keeping in mind that about half of pmf are jak2 wild type which clearly indicate that other factors (yet unknown mutations or aberrant cytokine expression) mediate microvessel proliferation . One of the first issues is the existence of a correlation between the level of circulating cytokines and the intensity of hematopoietic production and/or the existence of specific cytokine overproduction correlated to a cell type overproduction . The study of tefferi et al . Showed, in pmf, the existence of a correlation between the rate of sil2-ra, hgf and ip-10 (only sil2-ra in multivariate analysis), and leukocytosis . In pv, correlation of il-1, il2, il7, b - fgf, and hgf with leukocytosis has been described . Reported a correlation between il6, tnf, and the number of lymphocytes in pv, and a correlation between hgf, il6, il12, gm - csf, and vegf with the numbers of neutrophils in et . Regarding erythrocyte production, significant correlations were reported in pv between il12 and hematocrit (ht), tnf, and ht and between il4 or mcp-1 and hemoglobin (hb). Moreover, pourcelot et al . These results suggest a relative specificity of the plasma levels of some cytokines with the deregulation of the red cell mass . Regarding the platelet count, no cytokine plasma levels were correlated with platelet count in et patients in the literature . However, vaidya et al . In 2012 reported a significant reduction of inf and in patients with a platelet number greater than 450, and a significant increase of il6, capable of regulating the platelet count, has been reported for et patients in several studies . The difficulty in interpretation of these data is related to the fact that the mechanisms of cytokine production can be multiple (bone marrow stroma cells, tumor cells, and extra - hematopoietic cells) and the plasma cytokine changes may also be linked to chronic inflammation associated with mpns and therefore not only reflect myeloproliferation . Surprisingly, there are few data on cytokine plasma levels correlated to jak2v617f status . In their study on pmf, tefferi et al . Found a correlation in multivariate analysis between the presence of the mutation and il1ra, ip-10, and il2-ra rates . The study of pourcelot et al . Showed a correlation between the presence of the mutation and the plasma concentration of tnf and pdgf - bb in pv and et, respectively . The impact of the jak2v617f mutation on cytokine secretion seems to be restricted, suggesting that the regulation of cytokine production is done by both phenomena jak2v617f - driven and not driven . On the other hand, cytokines which appear jak2v617f - driven differ between pmf, pv, and et . This suggests that there is a difference in the cytokine impact of the mutation according to the pathology or conversely that these differences of cytokine profiles could contribute to the phenotypic differences within the jak2 mutated mpn . Indeed, when comparing jak2v617f mutated et and pv patients, significant differences in the expression of some cytokines such as il4, il8, ifn, and pdgf - bb have been demonstrated . To summarize, il4 rates were also correlated with ht in this study . For example, tnf levels were reported previously to be correlated with jak2v67f allelic burden . This may explain why in pv patients who express the highest levels of jak2 mutated, a correlation between tnf and the presence of the mutation was observed . This suggests in pv a direct link between plasma levels of tnf, jak2v617f allelic burden, and increased red cell mass . The increase of pdgf in et patients and its correlation with the presence of jak2v617f mutation probably reflect the impact of the mutation on the regulation of megakaryopoiesis via tpo and the deregulation of this pathway in mutated patients . This suggests that, in et patients, pdgf assay may be a functional marker of jak2v617f allelic load and indirectly a marker of jak2 activation level . Thus, the plasma level of pdgf could identify et patients for whom a jak2 inhibitor therapy would be the most fruitful . To our knowledge, no studies have until now described any correlation between calr or mpl mutations and circulating cytokines . Fibrosis progression during the chronic phase of myeloid neoplasms is regarded as an indirect surrogate of the aggressiveness of the clonal disease . The mechanisms which lead to myelofibrosis, primary or secondary, are still an enigma . It is likely that in bone marrow cytokines secreted by mpn cells, in particular megakaryocytes, could induce activation of fibroblasts and endothelial cells . Moreover, circulating cytokines (not originating from bone marrow) could by themselves influence the bone marrow microenvironment and thereby contribute to the development of myelofibrosis . Hence, circulating cytokines represent an interesting opportunity of simple, accessible, and easily measurable biomarkers for the evaluation of the disease at diagnosis (in addition to usual genetic and clinical markers), but also the determination of prognosis . In tefferi, the follow - up of patients naive to treatment assessed the prognostic value of some of these biomarkers . In particular, the rate of il8, il10, il12, and il15 and sil2-ra levels were independent predictors of low survival, correlated with dipss categories . The prognostic value of these biomarkers was confirmed retrospectively on 127 patients, including those who received a therapeutic treatment, proving their clinical interests . Plasma levels of il8 and sil2-ra allowed a prognostic classification of patients as they showed an increase of one or two of these cytokines . Patients with elevation of at least one of these markers displayed a significantly decreased survival among both treatment - naive patients and those who had already received therapy at the time of cytokine explorations . Moreover, the study of distribution of patients according to their prognosis has shown a concomitant increase in the frequency of patients with elevation of one or two cytokines and the severity of the pathology . Thus, there were more frequently patients with an increase in one of these two markers within intermediate risk groups 1 and 2 (classified according to dipss plus). In addition, patients with 2 elevated markers were only found in risk group 2 patients . In pv and et, the study of gangemi et al . Found a link between increased levels of il2 and its soluble receptor with progression to myelofibrosis . Furthermore, the prognostic value of high levels of 13 cytokines significantly associated with a lower survival in pv patients has also been reported . In univariate analysis, fibrotic transformation was significantly associated with high levels of the following cytokines: il-1, il5, il6, il10, il12, il15, il17, and ip-10 . However, in multivariate analysis, only mip-1 remained significant even when age and leukocytosis were added as covariates . The ability to predict the evolution towards this serious complication by a circulating marker would allow early therapeutic management of these patients with a very poor prognosis . Showed that pmf patients who evolved into acute leukemia had elevated il8 and sil2-ra levels . In particular, the elevation of il8 levels was significantly correlated with decrease in leukemia - free survival and an increase in the incidence of transformation in acute leukemia . The predictive value of il2 rate and its soluble receptor was also highlighted in the study of gangemi in pmf patients progressing into acute leukemia . The prognostic value of plasma levels of il8 and sil2-ra has been reported in other hematological tumors [40, 41] or solid cancer (head, neck, and esophagus). To our knowledge, there is no data in the literature on predictive cytokine markers of leukemic evolution concerning pv or et . Assessment of vascular risk, particularly thrombosis, is a key element in the therapeutic management of patients for prescription of cytoreductive and antithrombotic treatments . This assessment of vascular risk is important because it could cause inappropriate exposure of patients to potentially leukemogenic drugs . This assessment is still based on indirect criteria such as age, a history of stroke, or the presence of vascular risk factors . The existence of an inflammatory context in thrombotic events has long been demonstrated, suggesting the importance of the evaluation of inflammatory cytokines in the evaluation of thrombotic risk . However, little is known about the existence of cytokine dysregulation associated with thromboembolic events in mpn and their potential predictive values . In the study of pourcelot et al . Comparison of both subgroups did not show significant statistical difference for age, jak2 mutational status, and biological parameters (leukocytes, platelets, numbers of neutrophils and lymphocytes, red cells, hb, and ht). Except for il12 (p70) which was increased in patients with vascular complications, there were no significant differences in other cytokine levels between patients with or without vascular complications . Comparison of vascular complications within pv and et revealed a significant difference of il12 and gm - csf in the pv subgroup . The decrease of il12 has been previously reported in patients presenting a thrombotic event without any mpn diagnosis suggesting that this cytokine is a specific marker of the occurrence of thromboembolic events independent of mpn pathogenesis . However, these results must be interpreted with caution since some thrombotic events occurred before diagnosis, and therefore the cytokine evaluation was done after the accident . It would be necessary to assess changes in cytokine levels at multiple times, before and after thrombosis, to identify more specifically predictive biomarkers of vascular complications . A study of barbui et al . Has focused on the interest of c - reactive protein (crp) and pentraxin 3 (ptx3) as markers of thrombotic risk . In this study of 244 et and pv patients, a difference in prognostic value high thrombosis risk patients were characterized by a significant increase (> 3rd percentile) of crp . Prognostic stratification based on serum levels of these two inflammation markers has shown that patients with high crp and low ptx3 levels had a significantly higher risk of thrombotic stroke (or = 2.66, p = 0.045). In addition, the levels of these two markers were correlated with the mutational status of patients and with an allelic load greater than 50% . In this review, we highlight the usefulness of cytokines as potent markers of prognosis . But in which way do treatments especially jak inhibitors modify cytokines and cytokine levels? Treatment with ruxolitinib, the first jak inhibitors approved in myelofibrosis, leads to a rapid and sustained downregulation of cytokine levels in myelofibrosis patients . Another proof of the action of ruxolitinib on cytokine levels is the withdrawal syndrome consistent with cytokine storm observed after its discontinuation . Independently of jak status or of mpn subtype (myelofibrosis or pv), several cytokines were reduced after ruxolitinib treatment such as il1ra, il6, il8, tnf, and bfgf [3, 4]. Reduction of il16, il18, vegf, and mip-1 was also reported more specifically in myelofibrosis and reduction of sil2ra, sil6r in pv . Moreover, a correlation between symptomatic reduction of the spleen size in myelofibrosis and reductions of il-1ra, mip-1, il6, and tnf was observed . Data reported on mouse models and on supernatants of in vitro cultures of mononuclear cells confirmed reductions of il6 and tnf after jak1/2 inhibitors [47, 48]. Showed that ruxolitinib treatment normalizes cytokine levels in mice transplanted with jak2v617f - mutant as well as those transplanted with mplw515l - mutant cells . Beyond mpn, there is a rising interest in jak inhibitors for other disorders such as autoimmune diseases, solid cancers, or other hematopoietic malignancies [5052]. Reduction of cytokines was also observed in experimental models of those disorders [53, 54]. Nowadays, the only jak inhibitor approved for the treatment of primary and secondary myelofibrosis is ruxolitinib, which inhibits not only jak2 but also jak1 . Nevertheless, more selective jak2 inhibitors (i.e., fedratinib, lestaurtinib, pacritinib) are in clinical development and differences between selective jak2 inhibitors and jak1/jak2 inhibitors could be observed . On one hand, more selective jak2 inhibitors appear to have a less pronounced anticytokine effect and, on the other hand, they induce a more pronounced antierythropoiesis effect . For example, no consistent changes in levels of proinflammatory cytokines (il6, il2, il8, and tnf) relative to baseline were observed during the course of fedratinib treatment; however a rapid and durable improvement of symptoms concomitantly with an impact on jak2v617f allele burden was induced . Similarly, santos et al . Studied effects of lestaurtinib (cep701), a selective jak2 inhibitor, on the levels of 19 cytokines (il-1, il-1ra, il2, il6, il8, il9, il10, il12, il13, il15, bfgf, gm - csf, ifn, ip-10, mip-1, mip-1, rantes, tnf-, and vegf). In the same way in contrast to selective jak2 inhibitors, momelotinib (cyt387), a jak1/jak2 inhibitor, normalized inflammatory cytokines in jak2v617f - transduced mice . Even if jak inhibitors affect cytokine levels, recent studies suggest that cytokine regulation by jak inhibitors is not enough by itself to fully abort this aberrant inflammatory cytokine production . . Showed in myelofibrosis, pv, or et patients receiving either ruxolitinib or fedratinib a significant decrease of cytokines after the first month (ifn, ifn, il10, il2r, il4, and il17) but a weak rise in cytokine levels after six months . This fact argues a possible therapeutic failure but also supports the interest for drug associations in mpn treatment targeting other molecular pathways implicated in inflammatory response . Moreover, the role of tumor microenvironment in hematopoietic neoplasms development is essential; not only malignant cells but also nonmalignant cells induce cytokine dysregulation . Altogether, those studies suggest the interest of synergistic associations of jak inhibitors with others drugs to normalize aberrant cytokine production in mpn . The cytokine profiles of mpn patients involving deregulation of proinflammatory and anti - inflammatory cytokines as well as growth factors suggest that the impact of these deregulations is involved in hematological but also extra - hematological manifestations of these pathologies . These deregulations confirm the existence of an inflammatory reaction in mpns that may contribute to the initiation and progression of the disease . In this context, circulating cytokine levels could be useful markers of mpns for their characterization at diagnosis but could also be interesting in prognostic evaluation of these patients . Moreover, the impact of jak2 inhibitors on plasma concentrations of inflammatory cytokines suggests that circulating cytokine assays could be useful to monitor therapeutic efficacy of these molecules . Long - term treatment with jak2 inhibitors may also raise the question of patient compliance with their treatment . As a result, the significant reduction of cytokines by mechanisms of inhibition of jak2, and most likely jak1, could serve as an indirect marker for evaluation of therapeutic compliance in case of absence or inadequate therapeutic response. |
The study was conducted at the microbial containment complex, national institute of virology (niv), pashan, pune, india . Infected mosquitoes were kept in plastic jars inside mosquito cages and all these experiments were carried out inside a bio - safety level-2 laboratory . Normal as well as infected mosquitoes were maintained at 282c with 805 per cent relative humidity and 12:12 h light: dark cycle . This isolate has undergone six passages in baby hamster kidney (bhk-21) cell line . The virus at p-7 (stock) had a titre of 5.0 log10 50 per cent tissue culture infective dose (tcid50)/ml. (ii)jev - strain no . 057434, a human isolate obtained from gorakhpur, india, in 2005 (niv, unpublished data) has undergone several passages in mice and two passages in vero e6 cell line . The stock virus prepared in vero e6 cell line had a titre of 7 log10 tcid50/ml. (iii)wnv - the prototype strain of wnv (eg101) procured from niv virus repository was used in the study . The strain has undergone several passages in mouse brain and passaged once in vero e6 cell line for stock preparation . This isolate has undergone six passages in baby hamster kidney (bhk-21) cell line . The virus at p-7 (stock) had a titre of 5.0 log10 50 per cent tissue culture infective dose (tcid50)/ml . 057434, a human isolate obtained from gorakhpur, india, in 2005 (niv, unpublished data) has undergone several passages in mice and two passages in vero e6 cell line . The stock virus prepared in vero e6 cell line had a titre of 7 log10 tcid50/ml . Wnv - the prototype strain of wnv (eg101) procured from niv virus repository was used in the study . The strain has undergone several passages in mouse brain and passaged once in vero e6 cell line for stock preparation . Virus stock preparation: bhk-21 cell line was preferred for stock preparation and virus titration based on the high virus yield in the cell line (unpublished data). To prepare virus stock, bhk-21 cells grown in 225 cm bottles were infected with 1moi (multiplicity of infection) of bagv as described earlier1 . The cultures were observed daily for appearance of cytopathic effect (cpe) and when 70 - 80 per cent cells showed cpe, cultures were harvested . Virus was extracted from cells by freeze - thawing thrice and collecting the supernatant after centrifugation at 2790 g in a refrigerated (+ 4c) centrifuge (hettich, germany) for 20 min . One ml aliquots of the suspension was made in sterile vials and stored at -86c . One of the aliquots was titrated in the same cell line and virus titre was determined as mentioned earlier . Bhk-21 cell line was maintained in minimum essential medium (mem) supplemented with 10 per cent foetal bovine serum (fbs) and was passaged at every 3 - 4 days . Both mem and fbs used for cell line maintenance were procured from invitrogen, usa . Insect flavivirus free mosquitoes were procured from the niv insectary maintained at 282c with 805 per cent relative humidity and 12:12 h light: dark cycle . Mosquito larvae were fed on a mixture of yeast powder and dog biscuit (3:1 w / w) while adults were maintained on a diet of 10 per cent glucose . Female mosquitoes were provided with 5 - 6 wk old chickens for blood meal on alternate days . Infection of mosquitoes with virus: infection of mosquitoes was carried out by intrathoracic inoculation (it) and oral feeding . For it inoculation, 50 mosquitoes for each experiment were immobilized by keeping them in ice for 5 - 10 min and inoculated intrathoracically with 100 plaque forming units (pfu) of bagv inside a bsl-2 laboratory following the method described by rosen and gubler8 . For oral feeding, mosquitoes (n=50 for each experiment) were starved for 12 h and allowed to feed on blood virus mixture through a chicken membrane as previously described1 . Infected mosquitoes (both it inoculated and oral fed) were secured in plastic mosquito holding jars inside double walled mosquito cages and incubated at 282c with 70 - 80 per cent humidity . After completion of the experiment, mosquitoes of each day post - infection (pi) were triturated in 1 ml mem containing 2 per cent fbs using a chilled mortar and pestle . The mosquito suspension was centrifuged; millipore filtered (pore size=0.22 m), diluted serially (ten - fold) and titrated in bhk-21 cells in quadruplicate . The cultures were observed daily, readings (cells with cytopathic effects) were scored, stained with amido black and virus titre of each day pi was determined9 . Determination of jev / wnv replication in bagv infected mosquitoes: the influence of bagv in replication of jev and wnv was studied using two methods . In the first method, mosquitoes were infected simultaneously with a mixture of bagv and jev or wnv by it inoculation . In the second method, mosquitoes were infected with bagv, incubated for eight days and superinfected with jev / wnv . The infections were made by it inoculation . In the oral infection method, mosquitoes were fed blood - virus mixture as described earlier . In all the cases, mosquitoes were incubated further, harvested on days 7 and 14 of infection with jev / wnv, titrated and determined virus titre as described earlier . Jev / wnv yield in bagv infected mosquitoes was compared with virus yield of mosquitoes infected with jev / wnv alone and determined the influence of bagv in replication of jev / wnv . Determination of effect of bagv in oviposition and life cycle of mosquitoes: culex quinquefasciatus and cx . Tritaeniorhynchus mosquitoes (n=50 each) were infected orally with bagv and allowed to oviposit . The number of egg rafts obtained, duration of oviposition, hatching rate and duration to complete the larval and pupal stages, duration of emergence and adult survival were recorded . Similar data from an equal number of uninfected adults were also recorded and analyzed to determine the effect of bagv in mosquito survival and oviposition . Tritaeniorhynchus mosquitoes: culex tritaeniorhynchus mosquitoes were inoculated with bagv as described earlier1, incubated for seven days and fed on normal infant mice . Fully engorged mosquitoes were collected, placed in double walled mosquito holding cages and allowed to lay eggs . The eggs, larvae and adults were screened for presence of bagv by tissue culture assay1 . This isolate has undergone six passages in baby hamster kidney (bhk-21) cell line . The virus at p-7 (stock) had a titre of 5.0 log10 50 per cent tissue culture infective dose (tcid50)/ml. (ii)jev - strain no . 057434, a human isolate obtained from gorakhpur, india, in 2005 (niv, unpublished data) has undergone several passages in mice and two passages in vero e6 cell line . The stock virus prepared in vero e6 cell line had a titre of 7 log10 tcid50/ml. (iii)wnv - the prototype strain of wnv (eg101) procured from niv virus repository was used in the study . The strain has undergone several passages in mouse brain and passaged once in vero e6 cell line for stock preparation . This isolate has undergone six passages in baby hamster kidney (bhk-21) cell line . The virus at p-7 (stock) had a titre of 5.0 log10 50 per cent tissue culture infective dose (tcid50)/ml . 057434, a human isolate obtained from gorakhpur, india, in 2005 (niv, unpublished data) has undergone several passages in mice and two passages in vero e6 cell line . The stock virus prepared in vero e6 cell line wnv - the prototype strain of wnv (eg101) procured from niv virus repository was used in the study . The strain has undergone several passages in mouse brain and passaged once in vero e6 cell line for stock preparation . Virus stock preparation: bhk-21 cell line was preferred for stock preparation and virus titration based on the high virus yield in the cell line (unpublished data). To prepare virus stock, bhk-21 cells grown in 225 cm bottles were infected with 1moi (multiplicity of infection) of bagv as described earlier1 . The cultures were observed daily for appearance of cytopathic effect (cpe) and when 70 - 80 per cent cells showed cpe, cultures were harvested . Virus was extracted from cells by freeze - thawing thrice and collecting the supernatant after centrifugation at 2790 g in a refrigerated (+ 4c) centrifuge (hettich, germany) for 20 min . One ml aliquots of the suspension was made in sterile vials and stored at -86c . One of the aliquots was titrated in the same cell line and virus titre was determined as mentioned earlier . Bhk-21 cell line was maintained in minimum essential medium (mem) supplemented with 10 per cent foetal bovine serum (fbs) and was passaged at every 3 - 4 days . Both mem and fbs used for cell line maintenance were procured from invitrogen, usa . Insect flavivirus free mosquitoes were procured from the niv insectary maintained at 282c with 805 per cent relative humidity and 12:12 h light: dark cycle . Mosquito larvae were fed on a mixture of yeast powder and dog biscuit (3:1 w / w) while adults were maintained on a diet of 10 per cent glucose . Female mosquitoes were provided with 5 - 6 wk old chickens for blood meal on alternate days . Infection of mosquitoes with virus: infection of mosquitoes was carried out by intrathoracic inoculation (it) and oral feeding . For it inoculation, 50 mosquitoes for each experiment were immobilized by keeping them in ice for 5 - 10 min and inoculated intrathoracically with 100 plaque forming units (pfu) of bagv inside a bsl-2 laboratory following the method described by rosen and gubler8 . For oral feeding, mosquitoes (n=50 for each experiment) were starved for 12 h and allowed to feed on blood virus mixture through a chicken membrane as previously described1 . Fully engorged mosquitoes were separated and used for the study . Infected mosquitoes (both it inoculated and oral fed) were secured in plastic mosquito holding jars inside double walled mosquito cages and incubated at 282c with 70 - 80 per cent humidity . After completion of the experiment, mosquitoes of each day post - infection (pi) were triturated in 1 ml mem containing 2 per cent fbs using a chilled mortar and pestle . The mosquito suspension was centrifuged; millipore filtered (pore size=0.22 m), diluted serially (ten - fold) and titrated in bhk-21 cells in quadruplicate . The cultures were observed daily, readings (cells with cytopathic effects) were scored, stained with amido black and virus titre of each day pi was determined9 . Determination of jev / wnv replication in bagv infected mosquitoes: the influence of bagv in replication of jev and wnv was studied using two methods . In the first method, mosquitoes were infected simultaneously with a mixture of bagv and jev or wnv by it inoculation . In the second method, mosquitoes were infected with bagv, incubated for eight days and superinfected with jev / wnv . The infections were made by it inoculation . In the oral infection method, mosquitoes were fed blood - virus mixture as described earlier . In all the cases, mosquitoes were incubated further, harvested on days 7 and 14 of infection with jev / wnv, titrated and determined virus titre as described earlier . Jev / wnv yield in bagv infected mosquitoes was compared with virus yield of mosquitoes infected with jev / wnv alone and determined the influence of bagv in replication of jev / wnv . Determination of effect of bagv in oviposition and life cycle of mosquitoes: culex quinquefasciatus and cx . Tritaeniorhynchus mosquitoes (n=50 each) were infected orally with bagv and allowed to oviposit . The number of egg rafts obtained, duration of oviposition, hatching rate and duration to complete the larval and pupal stages, duration of emergence and adult survival were recorded . Similar data from an equal number of uninfected adults were also recorded and analyzed to determine the effect of bagv in mosquito survival and oviposition . Tritaeniorhynchus mosquitoes: culex tritaeniorhynchus mosquitoes were inoculated with bagv as described earlier1, incubated for seven days and fed on normal infant mice . Fully engorged mosquitoes were collected, placed in double walled mosquito holding cages and allowed to lay eggs . The eggs, larvae and adults were screened for presence of bagv by tissue culture assay1 . This isolate has undergone six passages in baby hamster kidney (bhk-21) cell line . The virus at p-7 (stock) had a titre of 5.0 log10 50 per cent tissue culture infective dose (tcid50)/ml. (ii)jev - strain no . 057434, a human isolate obtained from gorakhpur, india, in 2005 (niv, unpublished data) has undergone several passages in mice and two passages in vero e6 cell line . The stock virus prepared in vero e6 cell line had a titre of 7 log10 tcid50/ml. (iii)wnv - the prototype strain of wnv (eg101) procured from niv virus repository was used in the study . The strain has undergone several passages in mouse brain and passaged once in vero e6 cell line for stock preparation . This isolate has undergone six passages in baby hamster kidney (bhk-21) cell line . The virus at p-7 (stock) had a titre of 5.0 log10 50 per cent tissue culture infective dose (tcid50)/ml . 057434, a human isolate obtained from gorakhpur, india, in 2005 (niv, unpublished data) has undergone several passages in mice and two passages in vero e6 cell line . The stock virus prepared in vero e6 cell line wnv - the prototype strain of wnv (eg101) procured from niv virus repository was used in the study . The strain has undergone several passages in mouse brain and passaged once in vero e6 cell line for stock preparation . Virus stock preparation: bhk-21 cell line was preferred for stock preparation and virus titration based on the high virus yield in the cell line (unpublished data). To prepare virus stock, bhk-21 cells grown in 225 cm bottles were infected with 1moi (multiplicity of infection) of bagv as described earlier1 . The cultures were observed daily for appearance of cytopathic effect (cpe) and when 70 - 80 per cent cells showed cpe, cultures were harvested . Virus was extracted from cells by freeze - thawing thrice and collecting the supernatant after centrifugation at 2790 g in a refrigerated (+ 4c) centrifuge (hettich, germany) for 20 min . One ml aliquots of the suspension was made in sterile vials and stored at -86c . One of the aliquots was titrated in the same cell line and virus titre was determined as mentioned earlier . Bhk-21 cell line was maintained in minimum essential medium (mem) supplemented with 10 per cent foetal bovine serum (fbs) and was passaged at every 3 - 4 days . Both mem and fbs used for cell line maintenance were procured from invitrogen, usa . Insect flavivirus free mosquitoes were procured from the niv insectary maintained at 282c with 805 per cent relative humidity and 12:12 h light: dark cycle . Mosquito larvae were fed on a mixture of yeast powder and dog biscuit (3:1 w / w) while adults were maintained on a diet of 10 per cent glucose . Female mosquitoes were provided with 5 - 6 wk old chickens for blood meal on alternate days . Infection of mosquitoes with virus: infection of mosquitoes was carried out by intrathoracic inoculation (it) and oral feeding . For it inoculation, 50 mosquitoes for each experiment were immobilized by keeping them in ice for 5 - 10 min and inoculated intrathoracically with 100 plaque forming units (pfu) of bagv inside a bsl-2 laboratory following the method described by rosen and gubler8 . For oral feeding, mosquitoes (n=50 for each experiment) were starved for 12 h and allowed to feed on blood virus mixture through a chicken membrane as previously described1 . Fully engorged mosquitoes were separated and used for the study . Infected mosquitoes (both it inoculated and oral fed) were secured in plastic mosquito holding jars inside double walled mosquito cages and incubated at 282c with 70 - 80 per cent humidity . After completion of the experiment, mosquitoes of each day post - infection (pi) were triturated in 1 ml mem containing 2 per cent fbs using a chilled mortar and pestle . The mosquito suspension was centrifuged; millipore filtered (pore size=0.22 m), diluted serially (ten - fold) and titrated in bhk-21 cells in quadruplicate . The cultures were observed daily, readings (cells with cytopathic effects) were scored, stained with amido black and virus titre of each day pi was determined9 . Determination of jev / wnv replication in bagv infected mosquitoes: the influence of bagv in replication of jev and wnv was studied using two methods . In the first method, mosquitoes were infected simultaneously with a mixture of bagv and jev or wnv by it inoculation . In the second method, mosquitoes were infected with bagv, incubated for eight days and superinfected with jev / wnv . The infections were made by it inoculation . In the oral infection method, mosquitoes were fed blood - virus mixture as described earlier . In all the cases, mosquitoes were incubated further, harvested on days 7 and 14 of infection with jev / wnv, titrated and determined virus titre as described earlier . Jev / wnv yield in bagv infected mosquitoes was compared with virus yield of mosquitoes infected with jev / wnv alone and determined the influence of bagv in replication of jev / wnv . Determination of effect of bagv in oviposition and life cycle of mosquitoes: culex quinquefasciatus and cx . Tritaeniorhynchus mosquitoes (n=50 each) were infected orally with bagv and allowed to oviposit . The number of egg rafts obtained, duration of oviposition, hatching rate and duration to complete the larval and pupal stages, duration of emergence and adult survival were recorded . Similar data from an equal number of uninfected adults were also recorded and analyzed to determine the effect of bagv in mosquito survival and oviposition . Tritaeniorhynchus mosquitoes: culex tritaeniorhynchus mosquitoes were inoculated with bagv as described earlier1, incubated for seven days and fed on normal infant mice . Fully engorged mosquitoes were collected, placed in double walled mosquito holding cages and allowed to lay eggs . The eggs, larvae and adults were screened for presence of bagv by tissue culture assay1 . Bagv yield in bhk-21 cell line: bagv growth kinetics in bhk-21 cell line showed maximum yield of 5.5 and 5 log10 tcid50/ml in cells and tissue culture fluid (tcf), respectively at 36 h pi . However, virus titre in tcf was maintained upto 84 h pi while a sharp decline in titre was detected in cells (fig ., cells were harvested at 60 h pi and the titre was determined as 5 log10 tcid50/ml . Growth kinetics of bagv in bhk-21 cell line and tissue culture fluid (tcf). Bagv infection alters the replication of jev / wnv during simultaneous infection: in the pilot study carried out by intrathoracic inoculation of cx . Tritaeniorhynchus mosquitoes, bagv was found to play a significant role in inhibition of replication of both jev and wnv (fig . Jev replication was found affected both by simultaneous infection as well as in mosquitoes previously infected with bagv . However, the influence was more prominent in the latter case as approximately 4 log reduction in virus titre was obtained both at 7 and 14 day pi (fig . 2b) while the reduction in the simultaneous infection was only 2 log10 tcid50/ml (fig . 0 day was approximately 2 log virus (100 pfu) in all the experiments . In the case of wnv replication in cx . Tritaeniorhynchus, simultaneous infection or super - infection with wnv yielded almost identical results (fig . 2c, d) despite the initial titre of 2 log tcid50/ml on 0day in all the experiments . At 7 day pi, reduction in wnv yield was prominent (4 log) while on 14 day pi, the difference in wnv yield was approximately 2 log10 tcid50/ml in either mode of infection . Tritaeniorhynchus mosquitoes (intrathoracic inoculation method); (a) differential yield of jev in mosquitoes infected simultaneously with bagv to mosquitoes infected with jev alone; (b) differential yield of jev in mosquitoes previously infected with bagv to mosquitoes infected with jev alone; (c) differential yield of wnv in mosquitoes infected simultaneously with bagv to mosquitoes infected with wnv alone; (d) differential yield of wnv in mosquitoes previously infected with bagv to mosquitoes infected with wnv alone . Both the methods of infection, reduction in jev yield in presence of bagv was approximately 1 log10 tcid50/ml only (fig . No difference in virus yield was found on 14 day pi in simultaneously infected mosquitoes as identical titres were obtained in bagv infected mosquitoes and normal mosquitoes (fig . 3a) though a difference of 1 log was detected in mosquitoes previously infected with bagv (fig . However, susceptibility to wnv was found to be altered as remarkable reduction was observed in both simultaneously infected and mosquitoes previously exposed to bagv (fig . The reduction in virus yield was more prominent at day 7 pi than day 14 pi as the differences in titre of 3 log10 and 1log10tcid50/ml were observed, respectively . Influence of bagv infection in replication of jev and wnv in cx . Quinquefasciatus mosquitoes (intrathoracic inoculation method); (a) differential yield of jev in mosquitoes infected simultaneously with bagv to mosquitoes infected with jev alone; (b) differential yield of jev in mosquitoes previously infected with bagv to mosquitoes infected with jev alone; (c) differential yield of wnv in mosquitoes infected simultaneously with bagv to mosquitoes infected with wnv alone; (d) differential yield of wnv in mosquitoes previously infected with bagv to mosquitoes infected with wnv alone . Effect of bagv in orally fed mosquitoes: oral feeding experiments were conducted only with jev in cx . . Simultaneous infection of the viruses was not conducted in the study (oral feeding). In both species of mosquitoes, bagv was found to be playing an important role in inhibiting jev and wnv (fig . Jev replication was found restricted to approximately 2 log10 tcid50/ml in bagv infected mosquitoes upto 9 day pi in comparison to jev yield in normal mosquitoes which yielded approximately 5 log10 tcid50/ml during the same period (fig . However, from 9 day pi onwards, enhanced replication of jev was observed yielding titres comparable to jev yield in normal mosquitoes . In cx . Quinquefasciatus mosquitoes the influence of bagv was found prominent in inhibiting wnv replication upto 15 day pi (fig . The difference in virus yield was prominent during 5 to 13 day pi which showed 2 - 3 log10 tcid50/ml reduction in wnv titre in comparison to wnv yield in the controls . Tritaeniorhynchus mosquitoes and their susceptibility to jev: persistent infection of bagv was established in cx . Presence of bagv was detected in eggs (1.7 log10 tcid50/ml) laid by the 3 generation of mosquitoes . The progeny of the 4 generation adults, when infected with jev showed a gradual decline and maintained at a titre of 2 log10tcid50/ml upto 9 day pi demonstrating a reduction of approximately 3 log10 tcid50/ml in comparison to jev yield in normal mosquitoes (fig . 5). However, an increase in jev titre to approximately 5 log10 was detected on 11 day pi, which was maintained upto 14 day pi . Tritaenior - hynchus mosquitoes: during the establishment of persistent infection, it was observed that egg laying and hatching of eggs was affected by bagv . When a virus titre of 4.7 log10 tcid50/ml was used to infect mosquitoes by oral feeding, only three egg rafts could be obtained from 43 fully engorged mosquitoes . However, none of the eggs hatched . The virus concentration was lowered 10- and 100-folds which resulted in higher number of egg rafts (table). However, the number of eggs laid was comparatively lower than what was obtained in normal mosquitoes (table). In the present study, we explored the potential of bagv in influencing replication of jev and wnv in cx . Earlier studies have shown that mosquito cell line or a susceptible mosquito, once infected with an arbovirus, does not get infected from subsequent infection with another virus of the same group1011121314151617 . It was observed that mosquito cell lines persistently infected with sindbis virus altered the productivity of other togaviruses in the cell lines upon subsequent infection . Hobson - peters et al19 demonstrated suppression of wnv and murray valley fever encephalitis viruses in mosquito cell cultures infected with palm creek virus, a new flavivirus isolated from coquillettidia xanthogaster mosquitoes . Contradictory to the above findings, kent et al20 could not demonstrate suppression of wnv replication in cx . They could not find any significant impact either on virus replication or transmission of wnv in the mosquitoes previously infected with the mosquito flavivirus . Using intrathoracic inoculation of mosquitoes, suppression of replication of both jev and wnv was observed in mosquitoes on 7 and 14 day pi either infected simultaneously or sequentially . Tritaeniorhynchus infected sequentially with bagv rather than simultaneous infection . Unlike jev, significant reduction in wnv titre was observed in both cx . Quinquefasciatus mosquitoes in presence of bagv especially on 7 day pi . In the oral feeding experiment, which is the natural route of infection, the findings were almost identical to that of inoculation method . This has significance in nature as there is a possibility of mosquitoes being infected with different insect viruses and these viruses might be playing an important role in the control of pathogenic viruses21 . The major limitation of the present study was the inability to determine the individual titres of bagv, jev and wnv in the co - infected mosquitoes as we could not standardize real time rt - pcr for bagv . That would have given the exact picture of the reduction in the titres of jev or wnv . Quinquefasciatus mosquitoes showed that the maximum titre bagv yielded in the mosquitoes never exceeded 5 log10 and 4 log10 tcid50/ml, respectively in repeated experiments . That substantiated the fact that the observed reduction in the titres of jev and wnv in the present study in co - infected mosquitoes could be due to these viruses only and not bagv . Another important finding of the present study was that mosquitoes infected with 4.7 log of bagv, did not oviposit, but retained eggs in the ovaries . Oviposition was observed when lower concentrations of virus were administered; however, majority of the eggs did not hatch . This shows that infection with bagv alters oogenesis and oviposition depending on the virus titre . This is also an important observation which has importance in the natural control of mosquitoes . However, laboratory and field conditions are quite different and more studies will be needed before using bagv or other insect viruses in the natural control of mosquitoes . The findings of the present study pointed towards the role of bagv in the inhibition of jev and wnv replication in two important vector mosquitoes though we could not determine the exact quantity of reduction in virus titres individually due to the lack of quantitative assay for bagv . Bagv and other novel flaviviruses are associated with mosquitoes naturally without causing pathogenicity in the hosts . Tritaeniorhynchus mosquitoes which affected oviposition and hatching of eggs that clearly showed that bagv was not a co - evolved symbiont of cx . Other studies have demonstrated the isolation and characterization of a number of novel flaviviruses, of which, a few are known to enhance / suppress subsequent infection with flaviviruses of public health importance192021 . The precise mechanism of inhibition of replication of a second member of the same family is not yet understood fully . To understand the host competition by different viruses, studies at the receptor and cellular levels are warranted . With the advancements made in molecular virology, it will be possible to identify the factors in the near future . The unfolding of the mechanism, therefore, would have great epidemiological significance as viruses of less pathogenicity could be used as a tool to control / limit the spread of highly pathogenic mosquito borne viruses such as jev, wnv and other encephalitis causing viruses. |
Signature peptide based quantification of proteins using liquid chromatography - tandem mass spectrometry (lc - ms / ms) is increasingly used to measure endogenous or therapeutic proteins because it is a high - throughput, selective, and sensitive method when compared with other quantitative proteomics and immunoblotting methods . In this approach, the analyte protein is first digested, the peptides are separated by lc, and the unique peptide representing target protein is analyzed by ms in multiple reaction monitoring (mrm) mode [2, 3]. The protein abundance is typically measured based on calibration curve generated using the unique synthetic peptide as an external standard and the stable isotope labeled peptide (sil) as an internal standard . Although this approach has been validated for lc - ms / ms variability [2, 3], variation in trypsin digestion is not addressed by this approach . Conventionally, trypsin digestion conditions (e.g., incubation time and trypsin: protein ratio) that ensure maximum protein digestion are established to minimize the influence of such variability [57]. However, even under these circumstances, the sample or process dependent factors can cause variability in protein digestion . As a result, relying on the sil peptide as an internal standard can be questioned . In such cases, in theory, the use of the whole stable isotope labeled protein (silac) as an internal standard would be considered to be superior to the use of sil peptide [4, 913]. Therefore, we investigated if the use of silac protein as an internal standard would result in greater assay precision than using the sil peptide . We compared these methods using four hepatic drug transporter proteins, that is, organic anion transporter polypeptide (oatp) 1b1, oatp1b3, oatp2b1, and p - glycoprotein (p - gp). It is important to note here that our method differs in a fundamental way from the absolute silac method proposed by hanke et al . . In that method, the labeled silac protein is used as a calibrator while it is used as an internal standard in our method . Because hanke et al . Used the silac protein as a calibrator, the quantity of the protein used must be known and therefore it must be purified before use . While this approach is ideal and takes into consideration variability in trypsin digestion, it cannot be used to quantify expression of membrane proteins (e.g., transporters) because purified recombinant versions of these proteins are extremely difficult to routinely obtain . Therefore, our approach utilizes synthetic pure peptides as calibrators and the labeled silac protein as the internal standard . Since the silac protein is used only as an internal standard, it does not need to be pure though it must be completely or almost completely labeled (i.e., isotopically pure). Heavy amino acids, c6n2-lysine and c6n4-arginine, were obtained from sigma - aldrich (st . Louis, mo). Low - glucose dulbecco's modified eagle's medium (dmem), phosphate - buffered saline (pbs), penicillin / streptomycin, and geneticin were purchased from invitrogen, carlsbad, ca . Fetal bovine serum (fbs) and silac dmem (without l - lysine and l - arginine) was purchased from thermo fisher scientific, ma, usa . The proteoextract native membrane protein extraction kit was purchased from calbiochem (temecula, ca). The protein quantification bca kit and the in - solution digestion kit were from pierce biotechnology (rockford, il). Pure synthetic unlabeled peptides, nvtgffqsfk, nvtgffqslk, vlavtdspar, and nttgalttr, with purity determined by quantitative amino acid analysis, were obtained from new england peptides (boston, ma). The sil internal standards, nvtgffqsf[c6n2]k, nvtgffqsl[c6n2]k, vlavtdspa[c6n4]r, and nttgaltt[c6n4]r, were from thermo fisher scientific (rockford, il). Hplc - grade acetonitrile and other solvents were purchased from fischer scientific (fair lawn, nj) and formic acid was purchased from sigma - aldrich (st . Twenty human liver samples (hl1-hl20) were obtained from human liver bank of the university of washington (uw) school of pharmacy . All the subjects were caucasians; age 2567 yr; 11 female and 9 male . Procurement, characteristics, and storage of these liver samples has been previously described [14, 15]. Due to the anonymous nature of these samples, their use was classified as non - human subjects research by the uw human subjects division . Human oatp1b1, oatp1b3, and oatp2b1 expressing hek293 cells were kindly provided by dr . The p - gp - expressing llcpk - mdr1 cells were grown in dmem supplemented with 10% fbs, 100 u / ml penicillin, and 100 g / ml streptomycin at 37c under 5% co2 and 95% humidity . The individual oatp1b1, oatp1b3, and oatp2b1 expressing hek cells were grown using pdl - coated flasks for better cell adhesion and growth . Geneticin (g-418 sulfate, invitrogen) (750 g / ml) was used as selection antibiotic in the media . Briefly, stock solutions of c6n2-l - lysine and c6n4-l - arginine were prepared in pbs at concentrations of 146 mg / ml and 84 mg / ml, respectively . 0.5 ml of the stock solutions was then added to 1 liter silac dmem containing fbs and antibiotics as discussed above . The silac labeling was performed using exactly the same conditions as used for normal cell culture except the normal medium was replaced with the silac medium . After approximately five doublings of the cells, ~10 cells were isolated and subjected to membrane extraction . Trypsin digestion was performed of the membrane fraction to quantify the extent of labeling by comparing ms response for three labeled and unlabeled peptides in full scan ms mode for each protein . The cells were exposed to the silac medium until more than> 95% of the protein was labeled . Later, the cells were harvested and cell pellet was stored at 80c before membrane extraction . The liver tissue (~100 mg) was processed to isolate the membrane fraction as per manufacturer's instructions (calbiochem, temecula, ca) and the previously described method [1517]. Briefly, the tissue was subjected to homogenization in 2 ml extraction buffer i (eb - i; proteoextract native membrane protein extraction kit) plus protease inhibitor cocktail of the kit and incubated with gentle shaking for 10 min . The homogenate was centrifuged at 16,000 g for 15 min and the supernatant was removed . The pellet was resuspended in 1 ml eb - ii (containing surfactants) from the kit plus 10 l of protease inhibitor cocktail . The suspension was incubated with gentle shaking for 30 min at 4c followed by centrifugation at 16,000 g for 15 min at 4c . Total membrane protein concentration in the isolated membrane fraction (i.e., supernatant) was determined using the bca protein assay kit and diluted to a working concentration of 2 g/l . Similar to the tissues, the labeled cell pellet (25 10 cells) was processed as discussed above except that the cells were washed twice with pbs before adding 2 ml of the eb - i to the cells followed by gently shaking for 10 min . The signature peptides were selected based on online in silico prediction tools as well as the literature [4, 15] (table 1). Briefly, peptides susceptible to degradation, that is, containing methionine, cysteine, histidine, and tryptophan, were not selected . Peptides within the transmembrane regions or containing single nucleotide polymorphism and posttranslational modifications were not considered . Continuous sequences of r and k (rr, rk, kr, kk) were avoided in the region of trypsin digestion to avoid miscleavages . A genome wide blast search was also performed to ensure that the peptide was selective for the protein . Only one peptide per protein was selected in this study because our goal was to compare the precision of sil peptide versus silac protein internal standards . The indicated peptide (table 1) was selected over other possible signature peptides, because it yielded the best signal to noise ratio in the liver membrane samples . Slightly different sample preparation conditions were used for sil versus silac internal standard methods prior to lc - ms analysis as shown in figure 1 . For trypsin digestion, the optimized protein: trypsin ratio was maintained at 25: 1 for both methods . Before trypsin digestion, the labeled cell membrane extracts were assessed for protein expression and pooled to prepare a cocktail of labeled oatp1b1, oatp1b3, oatp2b1, and p - gp . For the silac method, 20 l of 2.0 g/l of tissue membrane fraction and 12 l of 0.67 g/l of labeled cell membrane fraction were denatured with 4 l dithiothreitol (100 mm) and alkylated with 4 l iodoacetamide (200 mm) in 10 l ammonium bicarbonate digestion buffer (50 mm, ph 7.8) using the previously outlined protocol [15, 17]. The protein samples were digested by trypsin (10 l) in a final volume of 60 l at 37c for 24 h and the reaction was quenched by 30 l of quenching solvent (70% acetonitrile in water containing 0.1% formic acid). Samples were centrifuged at 4000 g for 5 min and supernatant was used for lc - ms / ms analysis . For the sil internal standard method, the synthetic sil peptide was used as internal standard . 20 l of 2.0 g/l total membrane protein was trypsin digested as described above except that eb ii was used instead of the silac protein . The reaction was quenched by 20 l of sil peptide internal standard cocktail (prepared in the quenching solvent described above) and 10 l of the neat quenching solvent . The samples were centrifuged as described above . For both methods (sil and silac), the calibration curves were generated by using 20 l of eb ii instead of 20 l of the tissue membrane protein in samples and the neat quenching solvent above was replaced with the signature peptide cocktail . The uhplc - ms / ms system consisting of agilent 6460a triple - quadrupole mass spectrometer coupled to agilent 1290 infinity lc system (agilent technologies, santa clara, ca) was operated in esi positive ionization mode . For quantification, the dynamic mrm algorithm was used to maximize dwell time on each transition to allow multiplexed quantification . Approximately 22.5 g of the digest (5 l) was injected onto the column (kinetex 2.6 m, c18, 100 3 mm, phenomenex, torrance, ca) and eluted at 0.4 ml / min by a mobile phase with initial conditions of 97% a (water containing 0.1% v / v formic acid) and 3% b (acetonitrile containing 0.1% v / v formic acid) held for 4 min, followed by seven steps of linear gradient of mobile phase b concentration of 3% to 12.5%, 12.5% to 18%, 18% to 19.5%, 19.5% to 20%, 20% to 35%, 35% to 50%, and 50% to 90% over 48 min, 811 min, 1113.5 min, 13.516 min, 1618 min, 1818.4 min, and 18.418.6 min . Then, the column was washed using 90% mobile phase b for 1.6 min followed by a reequilibration period of 4.8 min . The doubly charged parent to singly charged product transitions for the analyte peptides and their respective labeled peptides were monitored . Sil internal standard method was validated for lower limit of quantification, linearity, range, accuracy, precision, and stability . The calibration curve was generated using 7 calibrators, ranging 0.16.0 fmol/g of total digested protein for oatp1b1, oatp1b3, oatp2b1, and p - gp, respectively . Assay accuracy and precision was performed in triplicate at three different quality control (qc) concentrations (low, middle, and high) of each peptide across the calibration range . Two different matrices were used, that is, pooled human liver membrane protein (n = 50) or eb ii . Although mrm data were acquired using three different transitions, only the two most intense transitions (table 1) were processed by integrating the peak areas generated from the reconstructed ion chromatograms for the analyte peptides and their respective internal standards using the masshunter software (agilent technologies, santa clara, ca). The average peak areas of these two mrm transitions were used for the calibrators and internal standard (sil or silac) to construct the calibration line and to estimate the transporter protein concentration in the unknown samples . The impact of freeze - thaw stress on protein quantification was assessed by exposing liver tissue membrane extracts (n = 3) to zero or three freeze and thaw cycles before trypsin digestion . Similarly, the effect of bench - top stability on protein quantification was investigated by storing the membrane preparation at ambient temperature for 6 h prior to trypsin digestion . Additionally, the autosampler stability of the peptide was determined by repeating analysis of the extracted samples, stored in the lc - ms autosampler (at 6c), over 48 hr . The silac internal standard method was also validated for all the parameters described for sil internal standard method except stability, which was common for both methods . Additionally, to ensure maximum trypsin digestion, membrane fraction isolated from a pooled human liver sample was subjected to digestion in triplicates up to 24 h (1, 2, 5, 16, and 24 h) as described above . After 24 h, fresh trypsin was added to the samples and incubated for another 24 h. the magnitude of protein digestion in all samples was expressed relative to that in the 24 h samples . Finally, protein expression in 20 liver samples was determined in triplicate using the two internal standard methods . Since 100% silac labeling is rarely achieved, the concentration of silac protein as internal standard was kept low to minimize the effect of endogenous unlabeled protein on quantification . In addition, the endogenous unlabeled protein response of silac protein was taken into consideration by subtracting it from the analyte response . Similarly, the endogenous protein expression in qc samples, which were prepared by spiking standards into the pooled liver membrane matrix, was also taken into consideration . The precision of the two methods (silac versus sil) was compared by the paired t - test analysis of the standard deviation of protein expression in the three independently trypsin digested samples from each liver . Prior to statistical analysis, the data were log transformed as they were found to be log - normally distributed . The individual and population mean sd protein expression across the 20 livers was also computed . Lc - ms / ms chromatograms (figure 2) show the specificity of the analytical method . The calibration curves generated using both sil and silac internal standard methods showed linear response throughout the range . The lower limit of quantification, defined as the lowest concentration of spiked peptides in pooled human liver membrane fraction with error and precision less than or equal to 25%, was 0.13, 0.08, 0.05, and 0.10 fmol/g digested protein for oatp1b1, oatp1b3, oatp2b1, and p - gp, respectively . Accuracy and precision (% coefficient of variance (% cv)) in the quantification of the qc samples were found to be acceptable (table 2) at the three different concentrations using both the mrm transitions (table 1) as per fda bioanalytical method validation guideline for proteins immunoquantification . Rate of protein digestion of unlabeled versus silac oatp1b1, oatp1b3, oatp2b1 and p - gp was parallel (figure 3). Optimum trypsin digestion was confirmed by comparing peptide recovery at 24 h versus 48 h. the peptide recovery after 48 h did not change significantly (figure 3). It is important to note here that maximum digestion may not be equivalent to complete digestion . Test of complete digestion is possible only when pure protein standards for these transporters are available . Although three of the four peptides selected contain a potentially labile asparagine residue at the n - terminus, the peptide response was stable even when sample was exposed to three freeze - thaw cycles and at bench - top for 6 h (table 3). This indicates that sample processing variables do not affect quantification of these transporters using selected peptide approach . The mean and range of standard deviation of triplicate measurements of oatp1b1, oatp1b3, and p - gp in 20 liver tissue samples were marginally (but significantly) larger with the silac versus the sil internal standard method (figure 4, table 4). In other words, the sil method was slightly more precise than the silac method when quantifying the hepatic expression of oatp1b1, oatp1b3, and p - gp . For quantification of oatp2b1, the precision of the two methods was not significantly different (figure 4, table 4). As assessed by the paired student's t - test, the population mean (sd) protein expression (fmol/g of membrane protein) in twenty livers estimated by the sil versus silac method was not significantly different for oatp1b3 (0.97 0.47 versus 0.94 0.54) or p - gp (0.34 0.23 versus 0.34 0.25) but was marginally different for oatp1b1 (1.86 0.68 versus 2.07 0.77) and oatp2b1 (1.91 0.50 versus 2.10 0.73). Hence, in contrast to the theoretical prediction, we found that the sil internal standard method was either marginally more precise than the silac method or the precision of the two methods was not significantly different (figure 4 and table 4). Consistent with this observation, the variability in the qc samples was also higher when using the silac versus sil internal standard approach (table 2). This was perhaps due to the small ms response of these low abundant transporters, where variability, introduced due to the additional biological matrix present in the silac internal standard method, exceeded the variability in trypsin digestion . The latter was consistent across samples as measured by the standard deviation of the lc - ms / ms response of the labeled peptide originating from silac protein . The above statement is supported by our observation that the precision in determination of expression of the highly ms responsive protein, oatp2b1 (table 4), was not different between the two methods . Surprisingly, the estimate of the mean value of transporter expression in each liver sample was also found to be marginally but significantly different (see above). The silac internal standard method reported marginally higher expression for two of the four transporters (oatp1b1, oatp2b1), perhaps due to the unlabeled protein in the silac internal standard . Based on these data, when trypsin digestion is maximized and all other constituents are the same (e.g., the matrix) and the conditions are strictly controlled (e.g., protein concentration), we predict that sil internal standard method will perform as good or better than the silac internal standard method . The population mean transporter expression in human liver in our study was comparable or modestly lower than those reported by other groups [1922]. However, unless confirmed by pure protein standards, the limitation of these peptide based lc - ms / ms quantification methods is the assumption of complete trypsin digestion . To address the latter, we recently validated the surrogate peptides based protein quantification method using the only available purified transporter available to us, namely, p - gp . When this purified transporter was used as qc sample, the recovery of quantity in these p - gp quality control samples was within 73125% of the actual value . The mean expression and variability of individual transporters by the two methods are presented in figures 4(e)to 4(h). Metabolic labeling of proteins by labeled amino acids, that is, silac, is an established technique for relative quantification of proteins [2326] and has also been used for quantification of proteins [4, 911]. As outlined in the introduction, use of labeled protein generated using silac approach is considered better in peptide based lc - ms / ms protein quantification because the sil method cannot take into account any variability in trypsin digestion . Since trypsin digestion is expected to be affected by different sample and process dependent variables, the sil method is theoretically expected to be less precise than the silac method . However, the accuracy of the two methods is expected to be equivalent as the two methods differ only in the internal standard used . Here, we tested for the first time these theoretical predictions . Our study concludes that if trypsin digestion is consistent across samples, the precision of the sil method in quantification of proteins is similar to silac internal standard method . Thus, we recommend that the sil method be used for quantification of proteins when a single matrix is used . Whether this conclusion will remain the same when different biological matrices (e.g., liver versus kidney or different sample extraction buffers) are used remains to be tested . Quantification of transporter expression in various human tissues, including the interindividual variability in expression due to age, sex, or genotype, will be invaluable for prediction of in vivo disposition of drugs from in vitro data. |
Advances in treatment have led to an increase in survival in people with cystic fibrosis (cf). As patients age with cf, they experience an increased rate of complications, including cystic fibrosis related diabetes (cfrd). Cfrd results from the progressive inflammatory destruction of the pancreas [2, 3] and leads to the development of insulin insufficiency with varying levels of insulin resistance during acute illness . The ferret cf model also shows that early inflammation leads to pancreatic cell destruction and replacement with fibrosis . While patients with cf have not been observed to develop macrovascular complications of diabetes, microvascular complications are seen . Importantly, diagnosis of cfrd is associated with poor nutrition status and decreased lung function and survival [711]. Recommendations for diagnosis, screening, and management of cfrd were written in a jointly created clinical care guideline by the cystic fibrosis foundation (cff), the american diabetes association (ada), and the pediatric endocrine society (pes). Based on the guideline, screening for cfrd should be performed annually on patients with cf> 10 years of age using the 2-hour 75-gram oral glucose tolerance test (ogtt). Patients with 2 h ogtt plasma glucose> 200 mg / dl meet criteria for the diagnosis of cfrd . Because of the time - consuming nature of the test, and requirement that patients fast prior to testing, adherence to the guidelines has been challenging; approximately one - quarter of adults with cf were tested in 2014 . This result suggests that an alternative means of evaluation is needed for the timely diagnosis of cfrd . Although infrequently used in us cf centers, cgm has been validated in children and adolescents with cf [13, 14]. Additionally, two small studies showed that early glucose abnormalities are detectable by cgm in children and adults with cf and are associated with historical decline and contemporaneously worse health outcomes [15, 16]. One study in children with cf <18 years of age showed that abnormal cgm was the strongest predictor of abnormal glucose metabolism at 2.5-year follow - up . However, these studies did not answer the question of whether abnormal cgm predicts future health outcomes in adults with cf . Our objectives for this study were to determine whether abnormal cgm results are associated with subsequent development of cfrd, lung function, and bmi decline and increased rate of cf pulmonary exacerbations . To evaluate the correlation between cgm and ogtt for detection of cfrd in adult patients with cf, we conducted a prospective single center trial in 2009 - 2010 in which 21 adult patients due for routine ogtt underwent simultaneous 3-day cgm and 2-hour 75 g ogtt . Subsequently, to determine whether abnormal cgm predicted health decline, we performed a retrospective observational study . Medical records and data from medical charts and the cff registry were reviewed from 2008 to 2015 to obtain clinical information (diagnosis of cfrd, pulmonary function, bmi, and pulmonary exacerbations). The original protocol was approved by the national jewish health institutional review board (njh irb), and subjects provided written informed consent . Prior to the conduct of the retrospective review, the new proposal underwent expedited review and approval by the njh irb ., the following definitions were used: fasting glucose> 126 mg / dl or 2-hour glucose> 200 mg / dl indicated cfrd, fasting glucose 100125 mg / dl indicated impaired fasting glucose (ifg), and 2-hour glucose 140199 mg / dl indicated impaired glucose tolerance (igt) [12, 19]. In order to explore the correlation between 1-hour ogtt glucose levels and cgm results, 1-hour ogtt results were also interpreted using the 2-hour ogtt definitions . For subjects without diabetes who did not have ogtt in the observation period (n = 5/10), the alternative guideline criteria were used to determine the development of cfrd: hemoglobin a1c (a1c) 6.5% or rpg 200 mg / dl in conjunction with polyuria and polydipsia . One touch glucometer and medtronic cgm system were used to obtain cgm data . A board - certified endocrinologist (jj) who was blinded to the ogtt results interpreted cgm data . Although there are no officially defined criteria for interpreting cgm, for our pilot study, a priori we used the american diabetes association criteria for ogtt to define the following criteria to interpret cgm, all values were required on two separate dates: fasting glucose> 126 mg / dl or random glucose> 200 mg / dl indicated cfrd; random glucose> 140 mg / dl indicated igt; fasting glucose> 100 mg / dl indicated ifg . Each subject's highest lung function and bmi for the year prior to ogtt / cgm testing, and for each of the 5 years following ogtt / cgm testing, were extracted from the cf registry . The number of exacerbations each subject had for each of the 5 years following ogtt / cgm testing was also extracted from the cf registry, and the average number of exacerbations per year was calculated . During the period of retrospective review, three subjects died and three patients moved away from the center; all available data points were included for these subjects . Six patients began chronic use of cystic fibrosis transmembrane conductance regulator (cftr) modulators during the period of retrospective review (two patients began ivacaftor, and four patients began lumacaftor / ivacaftor). The highest fev1 and bmi for the year prior to initiation of cftr modulators were used for analysis of decline in these parameters over time . Means and standard deviations are reported for demographic information (graph pad prism v6.07). Agreement between test methods (ogtt and cgm) was evaluated using both pearson correlation and the bland - altman method . Test was used to evaluate whether abnormal cgm predicts subsequent development of cfrd . Using two - sample t - tests, average lung function, bmi, and average exacerbation rate were compared between subjects who developed cfrd and those who did not develop cfrd . Standard error of the mean is reported for group means compared by t - tests . Pearson correlation was calculated to evaluate the relationship between maximum cgm and lung function and bmi decline . The average age of the subjects was 32.4 years (sd 13.1; median 27.0, range 2065). Fifty - two percent (11/21) of subjects were homozygous for the f508del mutation; 90% (19/21) of subjects had at least one copy of the f508del mutation . Average percent of predicted fev1 and average bmi of subjects at the time of enrollment was 68.8 (sd 5.5; range, 22109) and 21.6 (range 17.129.1; sd 0.72), respectively (table 1). One patient did not have adequate data for ogtt interpretation due to improper collection of the timed samples . Two patients did not have adequate data for interpretation by cgm due to failure of the device and/or data retrieval . For these 18 patients (mean results for test methods shown in figure 1), there was a modest correlation between interpreted results from ogtt and cgm (r = 0.52, 95% ci 0.07 to 0.79, p = 0.03; not shown); only 3/18 (17%) comparisons yielded the same result (two subjects with impaired glucose tolerance and one subject with cfrd). In 14 of 15 (93%) subjects for whom results differed between the two tests one - hour ogtt glucose interpretation yielded the same result as that of cgm in 11/17 (65%) subjects . There was a strong positive correlation between one - hour ogtt interpretation and that of cgm (r = 0.77, 95% ci 0.46 to 0.91, p = 0.0003; not shown). In 5/6 (83%) of the subjects for whom results differed between the two tests, we also compared maximum cgm glucose to blood glucose based on 1-hour and 2-hour ogtt using the bland - altman method (figure 2). The comparison between ogtt and maximum cgm values showed poor agreement between the two methods (bias 96.06, sd 56.91, 95% limit of agreement 207.6 to 15.49). In contrast, the comparison between 1-hour ogtt and maximum cgm values showed some agreement (bias 32.81, sd 41.18, 95% limit of agreement 113.5 to 47.9). One subject met criteria for cfrd by ogtt (as well as by the cgm criteria defined for this study: glucose> 200 mg / dl on two dates) at the time of the prospective study . Of those remaining subjects with complete cgm and ogtt data (n = 17), 7/17 (41%) subjects were diagnosed with cfrd within 4 years of their study enrollment (5 subjects were diagnosed by symptoms in combination with rpg> 200 mg / dl, and 2 subjects were diagnosed by subsequent ogtt) (table 2). All of the subjects who were subsequently diagnosed with cfrd had abnormal cgm results at the time of the original study; cgm results were interpreted as consistent with igt in 3 subjects and with cfrd in 4 subjects . One hundred percent of the subjects whose cgm results were consistent with cfrd went on to develop cfrd in the follow - up study period . Abnormal cgm (glucose> 200 mg / dl on two dates) correctly identified those subjects who would subsequently be diagnosed with cfrd (= 17.27, df = 2, p = 0.0002). Two of the 7 subjects had normal ogtts at the time of the original study; the remainder of the subjects had ifg / igt by ogtt . One - hour glucose results were normal in 2 subjects, but the remaining 5 subjects had 1-hour ogtt results consistent with cfrd . Thus, the 1-hour ogtt result was also useful in determining which subjects would develop cfrd (= 13.26, df = 2, p = 0.001). Of the 10 subjects who have not met criteria for cfrd since study enrollment (two of these subjects died, and 3 moved from the center), 5 subjects (50%) had at least one ogtt in the 4 - 5 years subsequent to study enrollment . Although 3 of 5 of the subjects had normal ogtts at enrollment (cgm results indicated igt in all three subjects), those 3 subjects have subsequently been diagnosed with igt by ogtt . All 10 subjects who have not met criteria for cfrd since study enrollment have had at least one rpg and/or a1c measured in the 4 - 5 years subsequent to enrollment . None of the 10 subjects met criteria for cfrd based on an a1c 6.5% or rpg 200 mg / dl in conjunction with polyuria and polydipsia . Using current glucose metabolism as the outcome (table 2), we calculated the sensitivity, specificity, and positive (ppv) and negative predictive values (npv) for cfrd of subjects' initial testing (cgm, 1-hour ogtt and 2-hour ogtt results). The sensitivity, specificity, ppv, and npv of cgm for subsequent diagnosis of cfrd were 0.63 (ci 0.30.86), 1.0 (ci 0.711.0), 1 (ci 0.541.0), and 0.77 (ci 0.490.92), respectively . The sensitivity, specificity, ppv, and npv of 1-hour ogtt for subsequent diagnosis of cfrd were 0.75 (ci 0.40.92), 1.0 (ci 0.691.0), 1 (ci 0.591.0), and 0.82 (ci 0.520.95), respectively . Finally, the sensitivity, specificity, ppv, and npv of 2-hour ogtt for the subsequent diagnosis of cfrd were 0.13 (ci 0.030.48), 1.0 (ci 0.711.0), 1 (ci 0.151.0), and 0.59 (ci 0.350.78), respectively . There was no difference in baseline lung function between the patients who went on to develop cfrd and those who did not (67.1 10.7 versus 66.3 7.9, p = 0.95). There was a trend towards a correlation between maximum cgm values and decline in lung function over time in the group as a whole (r = 0.45; 95% ci 0.01 to 0.76, p = 0.06), but there was no correlation between these values in those later diagnosed with dm (r = 0.03, 95% ci 0.69 to 0.72, p = 0.9416). There was no difference in baseline bmi between the patients who went on to develop cfrd and those who did not (20.80 1.08 versus 22.83 1.13, p = 0.22). There was no correlation between maximum cgm and decline in bmi over time in the group as a whole (r = 0.33, 95% ci 0.160.69, p = 0.18), although there was a trend towards decline in bmi in those later diagnosed with cfrd (r = 0.67, 95% ci 0.93 to 0.07, p = 0.07). There was no difference between rate of exacerbations in subjects who went on to develop cfrd versus those who did not (1.21 0.29 versus 1.71 0.26, p = 0.22). There was no correlation between maximum cgm and rate of exacerbations in the group as a whole (r = 0.34, 95% ci 0.70 to 0.15, p = 0.16), nor in those who later were diagnosed with cfrd (r = 0.59, 95% ci 0.20 to 0.91, p = 0.12). The goal of the prospective pilot study was to compare the ability of the gold standard ogtt versus cgm to evaluate glucose metabolism in cf . Subsequently, we sought to determine if glucose abnormalities detected by cgm predicted decline in health . In our small study population, abnormal cgm results were not associated with decline in lung function or bmi or increased rate of exacerbations over the 5 years following the study . However, abnormal glucose metabolism (glucose> 200 mg / dl on two dates) identified by cgm accurately identified those who would later be diagnosed with cfrd . The sensitivity of cgm was similar to that of 1-hour ogtt, and both were better than that of 2-hour ogtt for subsequent development of cfrd . Numerous studies have shown that development of cfrd is associated with lung function and bmi decline [4, 8, 9, 20]; these adverse health effects can begin in the years prior to diagnosis . A recent review of diabetes - related mortality in cf showed that the overall mortality for patients with cfrd was 1.8 per 100 person - years, compared with 0.5 in patients with cf without diabetes (p = 0.0002). Importantly, the increased morbidity and mortality can be improved with use of insulin therapy in patients with cfrd [4, 2127]. In addition to those patients who are diagnosed with cfrd, 1020% of patients with cf who do not meet criteria for diagnosis of cfrd have impaired glucose tolerance when it is evaluated . Other investigators have shown that patients with elevated 1-hour ogtt values are at increased risk of developing cfrd [28, 29]. Furthermore, patients with one - hour ogtt glucose greater than 140 mg / dl have been shown to be at risk for lung function decline directly related to the degree of one - hour glucose elevation . While treatment of patients with igt is not well studied, 2 case series have shown reversal of decline in lung function and bmi decline with use of insulin therapy in cf patients with igt [31, 32]. Thus, impaired glucose metabolism is a prevalent issue leading to increased morbidity and mortality that can be reversed with treatment when it is diagnosed . Although rates of screening for cfrd using ogtt have increased since the guidelines were published, rates of screening are still quite low . In 2014, only approximately 54% of children between 10 and 17 years of age and 28% of adults 18 years of age underwent cfrd screening with the recommended ogtt . At our center in 2014, approximately 36% of patients 10 years of age underwent ogtt screening . Because of the difficulty in obtaining annual screening ogtt, it would be ideal to use a sensitive test that does not require fasting (in a patient population that suffers from malnutrition) and an additional 2 - 3 hours in clinic . Although aic is quick and easy to assess, it is not recommended for cfrd screening because it demonstrates a low degree of correlation with ogtt and is insensitive for the diagnosis of cfrd [33, 34]. In contrast to the performance of a1c against ogtt, we showed a strong correlation with cgm and 1-hour ogtt and a moderate degree of correlation with 2-hour ogtt results . Cgm detected a greater degree of glucose excursions> 140 mg / dl than ogtt . Because there are no dietary restrictions during cgm, cf patients' recommended diet however, a glucose> 140 mg / dl occurs very rarely in nondiabetic individuals tested by cgm . Furthermore, the test can be performed with relative ease, with a small increase in overall cost of diabetes screening . O'riordan and colleagues sought to validate the use of cgm in a prospective cohort of children and adolescents with cf . They demonstrated that cgm performed on two occasions over a 12-month period was reliable when compared with ogtt (bland - altman agreement 0.81 mmol / l; 95% ci for bias 2.90 nineteen of the twenty - one patients in our study had adequate data for analysis . Subsequent to the validation of cgm in children and adolescents with cf, other researchers have examined whether abnormal glucose metabolism by cgm predicts clinical outcomes . Prospectively studied 33 children with cf who were scheduled to undergo ogtt as part of routine health screening . They found that the amount of time a patient experienced elevated blood glucose, specifically a blood glucose of> 7.8 mmol / l (140.4 mg / dl) for 4.5% of the time, was associated with declining nutritional status and lung function in the preceding 12 months . Additionally, in a single center cross - sectional study in stable adult and pediatric patients with cf undergoing routine annual ogtt, investigators performed cgm and evaluated the effects of cgm glucose> 11 mmol / l (198 mg / dl) on health outcomes . Patients with cgm glucose> 11 mmol / l had lower lung function and increased prevalence of pseudomonas aeruginosa lung infection . These two studies show that early glucose abnormalities are detectable by cgm in children and adults with cf and are associated with historical decline and contemporaneous worse health outcomes . Obtained ogtt and cgm on 17 children (mean age approximately 13 years) with cf followed by repeat ogtt in 2.5 years . They found that altered glucose metabolism measured by cgm was the best predictor of future glucose metabolism abnormalities . These studies did not answer the question of whether abnormal cgm predicts future health outcomes in adults with cf . We were unable to show that maximum cgm value predicted declines in lung function and / bmi or increased rate of exacerbations . Because this study was a pilot study, it was underpowered to detect such differences . Limitations . Although ogtt and cgm were collected prospectively, information regarding subsequent diagnosis of cfrd, lung function, and bmi was collected retrospectively . In the original study, cgm data was interpreted in a blinded fashion; however, knowledge of cgm results might have led to bias / more sensitivity to symptoms by clinicians . On the other hand, abnormal ogtt results (i.e., impaired fasting glucose and/or impaired glucose tolerance) should also alert clinicians / caregivers to increase monitoring of a patient's glucose metabolism . Although a formal study of the impact of ivacaftor on glucose metabolism is underway (nct02039986), to date only a case report and a case series have been published [36, 37]. Based on these reports, it is possible that cftr modulation may have improved glucose metabolism in our six patients who received them, thus influencing their current state of glucose metabolism . In adult patients with cf, cgm identified a greater degree of impaired glucose metabolism than the gold standard 2-hour ogtt . Furthermore, glucose> 200 mg / dl on two dates by cgm correctly identified subjects who developed cfrd over time . The sensitivity and negative predictive values were similar for both cgm and 1-hour ogtt for subsequent development of cfrd, and both exceeded those values for the traditional ogtt measurements . Our findings suggest that either including a 1-hour ogtt measurement or using cgm may provide a better tool for identifying patients who are at highest risk for the development of cfrd . Larger studies are required to test this hypothesis and to more accurately evaluate the ability of cgm data to predict changes in clinical endpoints such as lung function, nutritional status, and rate of pulmonary exacerbations . Impaired glucose metabolism is clearly associated with poor health outcomes in patients with cf; therefore, such investigation may be important as we look for better ways to quickly identify and intervene in subjects at greater risk of clinical decline. |
. The baff / april axis plays an important role in the pathogenesis of various autoimmune diseases including sle; inhibitors of this axis are therefore useful in treatment of these disordersresults from bliss-52 and bliss-76 trials have shown belimumab to be efficacious in treating patients with sleserious adverse effects noted with belimumab such as progressive multifocal leukoencephalopathy, depression, suicidal tendency, and malignancy are to be watched for . The baff / april axis plays an important role in the pathogenesis of various autoimmune diseases including sle; inhibitors of this axis are therefore useful in treatment of these disorders results from bliss-52 and bliss-76 trials have shown belimumab to be efficacious in treating patients with sle serious adverse effects noted with belimumab such as progressive multifocal leukoencephalopathy, depression, suicidal tendency, and malignancy are to be watched for . . The baff / april axis plays an important role in the pathogenesis of various autoimmune diseases including sle; inhibitors of this axis are therefore useful in treatment of these disordersresults from bliss-52 and bliss-76 trials have shown belimumab to be efficacious in treating patients with sleserious adverse effects noted with belimumab such as progressive multifocal leukoencephalopathy, depression, suicidal tendency, and malignancy are to be watched for . The baff / april axis plays an important role in the pathogenesis of various autoimmune diseases including sle; inhibitors of this axis are therefore useful in treatment of these disorders results from bliss-52 and bliss-76 trials have shown belimumab to be efficacious in treating patients with sle serious adverse effects noted with belimumab such as progressive multifocal leukoencephalopathy, depression, suicidal tendency, and malignancy are to be watched for. |
Ovarian cancer affects close to 25,000 women yearly and most patients have extensive metastatic disease at the time of diagnosis.ovarian cancer metastasis is thought to result from exfoliation of tumor cells from the ovary and/or direct extension onto the peritoneal surfaces, the omentum, and the surface of organs such as the liver and bowel . A standard approach to therapy is to surgically remove surgically as much of the tumor(s) as possible, a process known as surgical cytoreduction . This technique, which leaves only microscopic residual disease, is used in conjunction with chemotherapy . These dismal statistics show the need for improved understanding of the process of metastatic colonization, the final step in metastasis, in which cancer cells undergo progressive growth at secondary sites [2, 3] (see figure 1). While invasion and adhesion have been well studied, mechanisms regulating metastatic colonization are largely unknown . Remarkably, in 2000 when our laboratory began working on metastasis suppressors in ovarian cancer, there were only a handful of papers that specifically addressed aspects of ovarian cancer metastasis . Not surprisingly, research in the molecular underpinnings of ovarian cancer metastasis continues to lag behind other cancer types . In addition to fundamental aspects of metastasis, there are promising developments in the area of therapeutic application of metastasis suppressors . Dan theodorescu (university of virginia) demonstrates the feasibility of taking metastasis suppressors into the clinic (reviewed in). The following sections describe our approach to using the jnkk1/mkk4 metastasis suppressor to dissect molecular events governing omental metastatic colonization in the skov3ip.1 model . It is our goal to encourage others to examine metastasis suppressors in clinical and experimental ovarian cancer metastases . This observation prompted the hypothesis that molecular processes regulating tumorigenicity and metastasis are distinguishable and could be targeted therapeutically . To identify events specifically involved in metastasis regulation, our laboratory and others hypothesized that genes and their encoded proteins that specifically regulate metastasis formation could be functionally identified [47]. Metastasis suppressors are operationally defined as genes which, when ectopically expressed in metastatic cells, can inhibit the development of spontaneous overt metastases without significantly affecting primary tumor growth . This definition has been extended to include genes and their encoded proteins which specifically inhibit metastatic colonization (i.e., experimental metastasis formation using intravenous or intraperitoneal injection). Identification of metastasis suppressors requires in vivo testing since in vitro assays generally do not model the process of metastasis . When efforts to find metastasis suppressors were initiated, it was expected that their utility would be in predicting disease outcome; however, robust in vivo studies have showed that metastasis suppressors can control the growth of cancer cells at metastatic sites [4, 8]. As a result there now is evidence that metastasis suppressors can influence the interaction of disseminated cells with the microenvironment of distant organs and impair metastatic colonization . Interestingly, other investigators, working on completely different questions, also identified metastatic colonization as a rate - limiting step in metastasis formation [8, 9]. To date our laboratory and others have identified 23 bona fide metastasis suppressors, many of which would not have been predicted a priori based on their previously known function(s) [4, 5]. Determining how metastasis suppressors modulate cancer cell - microenvironmental interactions will shed light on their function in metastatic colonization, a clinically tractable therapeutic target [2, 10]. Our laboratory identified c - jun nh2-terminal kinase (jnk) kinase 1/mitogen - activated protein kinase (mapk) kinase 4 (jnkk1/mkk4) as a prostate cancer metastasis suppressor in 1999 and subsequently as an ovarian cancer metastasis suppressor in 2002 . Map kinases occupy a central position in cell growth, differentiation, and transformation . To date, three map kinase modules have been well characterized: extracellular signal - regulated protein kinase (erk), c - jun nh2-terminal protein kinase (jnk), and p38 . The jnk signaling cascade consists of two map2ks, jnkk1, and mkk7, while the p38 signaling cascade map2ks includes jnkk1, mkk3, and mkk6 . Jnkk1/mkk4 is a dual - specificity kinase which, in response to extracellular stimuli, can become activated and in turn can phosphorylate and activate the jnk and p38 mapks (figure 2 [24]). In contrast, the mkk7 map2k can only phosphorylate jnk, while the mkk3 and mkk6 map2ks can only phosphorylate p38 . Downstream targets of mapk signaling include components of the ap-1 transcription factor complex . The biological outcome of mapk activation can depend, in part, on the transcriptional regulation of target genes . Specificity depends on factors such as cell type, cell environment, signal strength and duration, and the particular composition of the transcription factor, such as ap-1 . While conventional wisdom stipulates that the jnk and p38 pathways mediate viability to stresses, increasing evidence from several model systems indicates a role for both of these mapks in cell cycle and consequent proliferation . For instance, reports demonstrate important functions for jnk in the g1/s transition, g2/m progression, and/or cytokinesis . Similarly, p38 can activate the g2/m and spindle assembly checkpoints in mammalian cells and delay entry into mitosis or may prevent anaphase entry when the mitotic spindle is damaged [16, 17]. In sum, the biological and biochemical functions of jnkk1 were consistent with its putative role in metastasis suppression; however, there were no published studies testing its function in complex and dynamic pathological processes such as metastasis . Jnkk1/mkk4 protein levels were significantly decreased in metastases as compared to normal ovarian surface epithelium . Profiling studies identified high jnkk1/mkk4 expression as a significant predictor of improved response to surgical cytoreduction . In vivo functional studies used skov3ip.1 human ovarian cancer cells, which form metastatic deposits of a serious papillary histology and produce highly reproducible numbers of metastases on the omentum, liver, and bowel . After intraperitoneal injection of 1 10 parental skov3ip.1 or skov3ip.1-vector control cells into female immunodeficient mice, the cells adhere to target organs and by 30 days post injection (dpi) animals have 30 metastases . Skov3ip.1 cells have low endogenous levels of jnkk1/mkk4 but retain physiologic levels of other components of its signaling cascade . Ectopic jnkk1/mkk4 decreased the number of skov3ip.1 metastases by 88% (p <.0001) and increased the animal lifespan by 70% (wilcoxon, p = .0045). Its metastasis suppressor function is kinase - dependent and studies showed that selective activation of p38 by ectopic mkk6 reduced skov3ip.1 metastasis formation by 70% (p = .0082), while selective activation of jnk by ectopic mkk7 had no effect (p = .43) (figure 3, 3(a)). These data further defined jnkk1/mkk4's metastasis suppressor activity and prompted the question what is the biological mechanism of jnkk1/mkk4-mediated metastasis suppression? Jnkk1/mkk4-mediated metastasis suppression could be due to decreased adhesion of cells, increased apoptosis of cells, or inhibition of cell proliferation . Quantitative real time pcr showed that there was not a significant difference between the numbers of vector - only and jnkk1/mkk4-expressing cells present on the omentum at 3 dpi (p = .06;). This showed rare apoptotic cells (<1%) in both groups (p = .43, figure 4(a)). These data were confirmed by morphological assessment as well as immunohistochemistry (ihc) for cleaved caspase 3, which is an early marker of apoptosis . To determine if skov3ip.1-jnkk1/mkk4 cells were deficient in proliferation, incorporation of brdu (a marker of s - phase cells) and endogenous levels of phospho - histone h3 ((ph3), a marker of m - phase cells) these studies showed that brdu incorporation was decreased in skov3ip.1-jnkk1/mkk4 cells (figure 4; 6% versus 19% positive cells, p <.0001). Similarly, ph3 staining showed decreased numbers of mitotic skov3ip.1-jnkk1/mkk4 cells (average of 0.7% versus 2.5% positive cells in the skov3ip.1-vector cells, p = .004). The decrease in brdu incorporation and ph3-staining in skov3ip.1-ha - jnkk1/mkk4 microscopic lesions suggested that fewer cells were traversing s- and subsequently m - phase compared to controls . This prompted the examination of cell cycle inhibitory proteins, including p21 and p27, using ihc . This showed a nearly 10-fold increase in p21 in skov3ip.1-jnkk1/mkk4 microscopic lesions in vivo as compared to controls (average 9% versus 1%, p <.0001, figure 4(c)). Since only a portion of the total population of skov3ip.1 cells is in cell cycle at any point in time (with 19% entering s - phase in a 4-hour window), the observed increase in p21 (9% of the population) is biologically relevant . The observation that jnkk1/mkk4 activation inhibits disseminated cell growth prompted us to examine the extent and duration of this suppression . Despite the reduction in the number of skov3ip.1-jnkk1/mkk4 metastases at 30 dpi and extension of survival, a mathematical analysis of the rates of overt metastasis formation suggested that suppression and outgrowth of jnkk1/mkk4 cells are due to the behavior of the population and not selection of a subset of cells, as would occur with increased apoptosis or differential adhesion to the omentum [20, 21]. Molecular analyses showed that overt metastases still express functional jnkk1/mkk4, supporting the notion that metastasis formation was not due to selection for cells that have permanently altered their jnkk1/mkk4 signaling status . Our accumulated data support a model in which binding of cells to the omentum results in the activation of jnkk1/mkk4 and induction of a cell cycle arrest . In order to determine what cellular and molecular signals activate jnkk1/mkk4 and how overt metastases ultimately form, we must consider the microenvironment in which suppression is taking place . In essence we are ahead of ourselves and need to step back and consider what is known about the structure, function, and morphology of the omentum and integrate this knowledge into our current understanding of jnkk1/mkk4-mediated suppression of metastatic colonization . The omentum, the primary site for ovarian cancer metastases, is a fatty peritoneal fold that covers most of the abdominal organs and serves as a storage site for lipids, as a regulator of fluid exchange, and as a reservoir for immune cells . Despite its importance, prevailing views of ovarian cancer metastasis formation do not consider the potentially dynamic and specialized functions that the omentum may contribute to this process . Historically, the omentum is viewed as being somewhat of an inert, black box the implication is that ovarian cancer metastasis formation is the result of uncontrolled growth of cancer cells and not a regulated process which is in part controlled by the omental microenvironment . A review of the literature challenges the view that the omentum plays a passive role in ovarian cancer metastasis formation . The human and murine omenta are structurally similar, being composed of both adipose - rich and translucent membranous tissues covered by a mesothelial layer . Mesothelial cells share characteristics of both epithelial and mesenchymal cell types and range from flattened to cuboidal in shape, depending on the body site or state of activation [23, 24]. It is well established that omenta from a wide variety of animals, including immunodeficinet rodents, contain aggregates of immune cells known as milky spots . These were first described by von recklinghausen in 1863 and termed milky spots by ranvier in 1874 . In the omentum, these structures are specialized to enable mobilization of immune cells for migration into the peritoneal cavity . They may also facilitate reentry of immune cells from the peritoneum into the connective tissue (and therefore bloodstream) [18, 2230]. Remarkably, physiologic functions of milky spots, or even their existence, have not been integrated into generally accepted models of ovarian cancer metastasis . This is a crucial oversight, as it does not consider the possibility that ovarian cancer cells may exploit a highly regulated physiologic system in order to adhere, survive, and grow into metastases . There is a limited amount of published data that suggests that cancer cells can specifically interact with milky spot structures [31, 32]. Interestingly, in our studies, lotan et al . Found the association of skov3ip.1-vector and skov3ip.1-jnkk1/mkk4 cells with immune aggregates which we now suspect that they are milky spot structures (figure 5). Our laboratory is currently investigating the potential role for milky spot interactions in jnkk1/mkk4-mediated suppression of metastatic colonization . We hypothesize that disseminated skov3ip.1 cells interact with milky spots in the omentum, and these interactions contribute to the microenvironmental context - dependent activation of jnkk1/mkk4, resulting in impaired metastatic colonization . Evidence for specific interactions of ovarian cancer cells with milky spot structures immediately identifies a target for mechanism - based studies of ovarian metastatic colonization . Therapeutic leads may be discerned by determining why disseminated cancer cells, which have molecular modifications that should enable their growth at distant sites, often lodge at target organs and persist as undetectable, or dormant disease . Our data to date support the hypothesis that activated jnkk1/mkk4 impairs proliferation of cells early in the course of metastatic colonization . It is remarkable that few, if any, studies have been conducted that specifically examine growth control of cells during metastatic colonization . From the standpoint of translational science, the crucial yet underexplored question is how disseminated cells ultimately bypass suppression and form progressively growing metastases . Historically, the fundamental tenets of metastasis biology dictate that acquisition of metastatic ability is the result of the drive of malignant cells towards growth . Thus it was predicted that bypass of suppression is simply the result of mutation - selection cycles which permanently inactivate jnkk1 or members of its signaling cascade . Challenge this paradigm and suggest that jnkk1-mediated suppression may be due to a reversible cell cycle arrest concomitant with changes in jnkk1 activation status [20, 21]. These findings demonstrate a crucial need to reexamine important but scattered literature on population - dependent behaviors of metastatic cells, which have heretofore been refractory to mechanistic study [3336]. This also presents an opportunity to examine the interaction of ovarian cancer cells with their microenvironment of the omentum during metastatic colonization . Given the rich literature on the bidirectional communication between cancer cells and their microenvironments, it is important that we consider microenvironmental functions and adaptations as we examine the population - dependent behaviors of cancer cells . Ultimately such studies can lay the foundation for the development of adjuvant therapies that can be used in conjunction with local therapy to delay the onset of disease recurrence, extend survival, and improve quality of life for patients with ovarian cancer. |
Imaging techniques play an important role in the diagnosis, staging, and follow - up of cancer patients . While standard imaging techniques, such as computed tomography (ct), are based on differences in the anatomical structure of the tissues, positron emission tomography (pet) uses radiolabeled molecular probes to assess differences in biological or biochemical properties of tissues . The most commonly used tracer for pet is the glucose analogue 2-[f]fluoro-2-deoxy - d - glucose ([f]fdg), which provides an estimate of tissue glucose utilization . Today, [f]fdg pet is widely used in clinical diagnoses of cancer, including lung cancer, non - hodgkin lymphoma, and glioblastoma . Because of this increased utility in oncology [57], [f]fdg pet is being evaluated as a tool to assess antitumor effects of standard or novel anticancer drugs in both human subjects and in animal models of cancer . Pet imaging may provide evidence of biological responses of novel anticancer compounds, which, in turn, can facilitate the transition of compounds from preclinical to clinical investigation . One such novel compound is enzastaurin, which was developed as a protein kinase c - beta (pkc-) inhibitor . The family of protein kinase c (pkc) has been implicated in processes that control tumor growth, survival, and progression . In particular, pkc- activation has been recognized as an important contributor to malignant growth in diffuse large cell b cell lymphoma and in glioblastoma . Recently, enzastaurin has shown antitumor activity in xenograft models of the colorectal cancer cell line hct116 and in the glioblastoma cell line u87 mg . While enzastaurin was designed as a selective pkc- inhibitor, recent studies suggest that its antitumor activity is modulated by activation of gsk-3 and the pi3k / akt pathway . In this study we evaluated the extent to which [f]fdg pet imaging can accurately characterize the antitumor activity of enzastaurin in two different mouse xenograft tumor models . Nonobese diabetic / severe combined immunodeficient (nod / scid) mice were raised and cared for by the indiana university simon cancer center transplant and xenograft core following the institutional guidelines of animal care . The glioblastoma cell line, u87 mg, and burkitt's lymphoma cell line, raji, were obtained from the american type culture collection (atcc, manassas, va, usa) and cultured as recommended by atcc . As previously published, u87 mg and raji cells express high levels of pkc- [12, 13]. Injection, cells were resuspended in a 1: 1 ratio of tumor cells: matrigel (bd biosciences, bedford, mass, usa) and burkitt's lymphoma cell line, raji was resuspended in a 1: 2 ratio of tumor cells: matrigel . Each mouse was injected s.c . In the right flank with 5 10 cells . Enzastaurin treatment was initiated when the tumors reached a volume of at least 150 mm . Mice with similar tumor sizes were matched in the control and enzastaurin treated groups . Enzastaurin was suspended in 10% acacia (fisher scientific, fair lawn, nj, usa) in water and dosed by gavage twice daily at 75 mg / kg based upon weekly body measurements for each treated group . Each animal was anesthetized with acepromazine (1 - 2 mg / kg i.m .) And torbugesic (2 mg / kg i.m .) And placed on a custom bed for imaging . A static 15-minute pet study was performed using the indypet ii scanner [14, 15] at 45 minutes posttracer injection . Following the pet study, the animal bed was moved to and mounted on an evs rs9 microct scanner, and a volumetric image that encompassed the tumor volume was imaged at approximately 90 micron spatial resolution . Fdg utilization estimatesfdg uptake estimates are generated by placing rois on pet images acquired over the time period from 4560 minutes posttracer administration . Indices of tumor fdg uptake were generated by calculating a ratio of the tumor to muscle uptake and by calculating the standardized uptake value (suv): (1)suvfdg=[4560ct(t)dt](id)/m . In (1) ct(t) is the concentration of [f-18] in the tumor from the pet image, m is the mass of the animal, i d is the dose of the tracer injected into the animal, and is tissue density . [f]fdg was prepared by the hamacher method using a commercial synthesis unit provided by petnet / cti (knoxville, tenn, usa). Fdg uptake estimates are generated by placing rois on pet images acquired over the time period from 4560 minutes posttracer administration . Indices of tumor fdg uptake were generated by calculating a ratio of the tumor to muscle uptake and by calculating the standardized uptake value (suv): (1)suvfdg=[4560ct(t)dt](id)/m . In (1) ct(t) is the concentration of [f-18] in the tumor from the pet image, m is the mass of the animal, i d is the dose of the tracer injected into the animal, and is tissue density . [f]fdg was prepared by the hamacher method using a commercial synthesis unit provided by petnet / cti (knoxville, tenn, usa). Endpoints included tumor volume via calipers, tumor volume via ct, pet - determined measures for tumor, muscle, tumor / muscle ratio, and a standardized measure of uptake . Changes from baseline for each endpoint were analyzed for each cell line (u87 mg, raji) and each time point (week 2, week 3) using nonparametric statistical methods (wilcoxon rank - sum test) to compare treated versus control animals . Due to the exploratory nature of the analyses, p - values were used to indicate trends and potential future research hypotheses, rather than to test and confirm prespecified hypotheses . We first investigated whether two tumor cell lines provided acceptable tumor growth in nod / scid mice to allow reproducible imaging with [f]fdg pet (figure 1). We used u87 mg cells as a representative cell line for solid tumors, and raji as a model for hematologic cancers . Both the u87 mg (figure 1(a)) and the raji (data not shown) tumor types grew consistently in nod / scid mice prior to drug treatment and [f]fdg pet imaging reliably detected glucose uptake in xenografts as determined by standardized uptake value (suv) (see materials and methods). In these feasibility studies, we also found that suv correlated with u87 mg tumor size as measured by ct (figure 1(b)). Based on these preliminary observations of initial tumor growth, we elected to use both tumor cell lines to evaluate enzastaurin - induced metabolic changes as detected by [f]fdg uptake . Enzastaurin - induced metabolic changes were evaluated using [f]fdg uptake in two independent experiments for each tumor cell line, u87 mg and raji, respectively (table 1). Consistent with previous studies in nude mice, enzastaurin induced tumor growth delay in nod / scid mice implanted with u87 mg and raji (figures 2(a) and 2(b)). U87 mg cells grew slower than raji cells, and enzastaurin had a tumor growth delay mainly in the u87 mg tumor cell model (figures 2(a) and 2(b)). A significant tumor growth delay was seen in u87 mg after treatment with enzastaurin over the period of 3 weeks (figure 2(a)). In the raji xenograft model, there was a trend in the tumor growth delay, but not a statistically significant difference between vehicle and enzastaurin - treated groups (figure 2(b)). [f]fdg pet imaging was evaluated using suv (figures 2(c) and 2(d)) and tumor / muscle ratio (figures 2(e) and 2(f)). Enzastaurin administration did not alter tumor glucose metabolism as measured by suv changes in u87 mg xenografts (figure 2(c)). Compared to raji, the suv changes in u87 mg xenografts occurred at smaller signal intensities, and thus contributed to an overlap of suv measurements between vehicle- and enzastaurin - treated mice (compare figures 2(c) and 2(d)). In raji, suv uptake appeared to be increased at weeks 2 and 3 in enzastaurin - treated compared to vehicle - treated mice (p <.10 at weeks 2 and 3; figure 2(d)). It is possible that metabolic heterogeneity of the tumor glucose metabolism in different areas of the tumor may have caused this difference in suv uptake . In addition to suv, we also used tumor / muscle ratio to determine the metabolic effect of enzastaurin in tumors . The tumor / muscle ratio uses muscle tissue with its low metabolic rate to normalize the tumor tissue [f]fdg uptake . Based on this analysis there was no clear evidence of a metabolic change induced by enzastaurin compared to vehicle treatment (figures 2(e) and 2(f)). However, for u87 mg there was a trend in fdg uptake in enzastaurin - treated mice (p <.10 at week 3), which was not observed in raji xenografts (figures 2(e) and 2(f), resp . ). After enzastaurin treatment, we observed a trend in tumor size reduction for raji xenografts but not for u87 mg xenografts at week 2 (p while the collective analysis of all animals from 2 independent experiments did not reveal a clear distinction between enzastaurin- and vehicle - treated animals, there were some animals that did show a metabolic change after enzastaurin treatment . In these cases we saw a decline only after two weeks of treatment that was essentially undetectable after the third week of treatment (figures 3(a)3(f) and figures 4(a)4(f)). The changes observed in u87 mg were different from changes observed in raji . In u87 mg xenografts, [f]fdg uptake declined after the 2nd week of treatment . The raji tumors were fast growing and had large areas of necrotic tissue and some areas with newly increased [f]fdg uptake (figure 5). The growth pattern of these tumors is partly responsible for the intertumoral heterogeneity seen in this study and may contribute to the lack of detecting enzastaurin - induced changes in the tumor . In this study we used a specialized pet imaging approach which was developed to assess activity of anti - cancer agents in small animals . Changes in [f]fdg uptake were generally found to correlate with reduction in tumor size as determined by caliper measurements [17, 18]. Our study uses a metabolic kinase inhibitor to compare drug - mediated tumor growth reduction with metabolic alterations in vivo . While previous imaging studies evaluated anti - tumor activity of cytotoxic agents, it is not clear how [f]fdg pet imaging can help determine antitumor activity of kinase inhibitors . In addition to its cost, the use of pet imaging may be limited due to the spatial resolution of current pet scanners . Thus, few studies have been published which evaluate the use of small animal imaging in drug discovery . For the first time, we assessed the anti - tumor activity of the serine / threonine kinase inhibitor enzastaurin by [f]fdg uptake in mice . Because we used nod / scid instead of conventional nude mice, we first confirmed that [f]fdg pet images could reproducibly be obtained in xenografts of glioblastoma and lymphoma . This feasibility assessment was important to establish the tumor size at which [f]fdg uptake is detectable in mice . Tumors had to be at least 150 mm in volume to be visualized by the scanner, and the best assessment was observed in tumors that were more than 400 mm (figure 1). This is consistent with other studies which reported on the need of specific tumor sizes for scanner assessment . The subsequent studies with enzastaurin treatment did not provide clear evidence of enzastaurin - induced metabolic changes in either of the two tumor types examined . However, there are several possibilities why enzastaurin - induced changes were not detected by [f]fdg pet imaging . First, it is possible that enzastaurin may not have a homogenous impact on the metabolic rate in the tumor tissue . Although pkc isoenzymes have been implicated in cell proliferation, their specific role during glucose metabolism is still not understood . On one hand, glucose can induce pkc- expression, and on the other hand, overexpression of pkc- reduces glucose uptake in cells . Hence, selective pkc- inhibitors have been investigated as potential treatments for diabetes . Whether such a pkc--dependent glucose regulation exists in tumor cells is not known . Considering the observation of this study, in which tumor growth delay and glucose metabolism are not correlated with enzastaurin activity in xenograft tumors, it is possible that enzastaurin is not able to modulate the complex glucose regulation in the tumor cells . Recently, the antiangiogenic kinase inhibitor azd2171 was also evaluated in a small animal study for its metabolic change in tumors . Compared to [f]fdg pet imaging, only [f] fluoromethane proved as a useful tool to assess the anti - tumor activity of azd2171 . Therefore, it appears that only some kinase inhibitors will have metabolic changes in tumors, which can be assessed by [f]fdg pet imaging . Implanted tumors tend to grow initially along the skin surface and infiltrate the underlying tissue to a lesser extent . This observation might explain why perhaps the caliper measurements can be used to demonstrate anti - tumor effects while the imaging of the deeper tissue by [f]fdg or ct is not able to detect differences of treatment effect . Because of the inability to delineate clearly the borders of the infiltrating tumor tissue, the current study may underestimate the metabolic change and thus lead to false - negative imaging results . In some animals, we used contrast dye to delineate better the tumor border in mice ., future studies will need to be conducted with contrast imaging techniques to approximate the anatomical borders of the tumor . Tumor weight did not correlate with caliper measurements, because ct scans or caliper measurements were taken during the course of the study, while tumor weight was collected only at the end of the study, when animals were sacrificed, and tumors had become heterogeneous . Finally, the observed [f]fdg uptake signals are considerably lower relative to what is measured in humans . The low baseline level in the present xenograft study negatively impacted the ability to assess early changes in metabolism associated with treatment effect . Other factors influencing the low uptake signal are heterogeneity of glucose uptake in tumors, possible emergence of drug - resistant tumor cells, variability of pharmacokinetic exposure of the inhibitor, and the diffusion of tracer to the tumor site . In summary, our data are consistent with the hypothesis that shrinking tumor size (assessed by caliper measurements) does not equate to reduction in overall tumor metabolism . In fact, pockets of drug - resistant tumor cells with increased glucose uptake and growth kinetics may become prevalent in certain areas of the tumor, while glucose reduction will be present in other areas . Additional longitudinal pet imaging studies will have to examine in detail the variables which affect the accurate measurement of tumor response to drug treatment . Our study implies that [f]fdg pet imaging will be useful only in a select type of tumors and perhaps detect antitumor activity only for a limited number of drugs. |
Review articles in the scientific literature can be classified as a general review article, a systematic review (sr), or meta - analysis (ma). The purpose of a review article is to provide readers with a summary of published research in a particular field . Reviews usually focus on areas of progress over the recent past, for example five years . A general review article attempts to summarize all the relevant, published literature and provide some analysis of the controversial areas of the field or topic . In addition, it may suggest some novel ways to advance the field further 1 . Such review articles provide a concise analysis of a large body of literature and hence are important for readers from a variety of fields . Articles in pubmed, for example, can be searched based on whether they are classified as review articles . In contrast, srs seek to be more rigorous and comprehensive in addition to providing an opinion about outcomes or practice . For example, in medical science, srs are used in hopes of ascertaining whether treatment a is superior to treatment b. why is such an analysis necessary? Unfortunately, few research protocols are perfect so there may be controversy surrounding treatment options even after numerous studies . Therefore however, there is another reason explained by greenhalgh: experts, who have been steeped in a subject for years and know what the answer' ought' to be, are less able to produce an objective review of the literature in their subject than non - experts . This would be of little consequence if experts' opinions could be relied on to be congruent with the results of independent systematic reviews, but they cannot 2 . One of the premises upon which the practice of srs is based, is the inability of informed scientists to evaluate, without bias, the controversies in their own field . This is a reflection of human nature and is unlikely to change anytime in the near future 3 . A sr requires clearly stated objectives and rigorous criteria for what studies can and cannot be included, should be reproducible, include all relevant studies, seek to detect bias, and attempt to make determinations 4, 5 . Srs are acknowledged as being an integral component of evidence based medicine, where the goal is to analyze the evidence gained from the best scientific studies that qualify for consideration in order to make a determination regarding clinical intervention . The sr is thus the conscientious, explicit, judicious use of current best evidence in making decisions about the care of individual patients 6 . The term meta - analysis was coined in 1980 by smith, glass and miller and involves a statistical analysis of the topic of a sr . Greenhalgh stated: a meta - analysis is a mathematical synthesis of the results of two or more primary studies that addressed the same hypothesis in the same way 2 . While the purpose of any scientific literature review is to summarize and evaluate relevant articles in a scholarly and rigorous manner, the review must also consider relevant research in other disciplines of science consilience as well as the scientific underpinnings of the topic under consideration . For example, any sr of research articles regarding acupuncture should take place in light of the fact that no mechanisms have been discovered that would allow scientists to expect success from using acupuncture in order to alleviate objective pathology 8, 9 . In contrast, the germ theory of disease supports a sr of the efficacy of antibacterial use for preventing complications from, or shortening the course of, ear infections in children . An example of this concept comes from oncological surgeon david gorski who criticized the national center for complementary and alternative medicine (nccam) for spending resources to study: treatment modalities that are inherently unscientific, being as they are based on prescientific or demonstrably incorrect understandings of human physiology and disease 10 . An example of knowledge from other fields of science affecting how a sr might be conducted can be found in homeopathy . Knowledge from chemistry and physics vis - - vis how to apply avogadro's number when calculating dilutions, should inform scientists seeking to evaluate homeopathy by conducting a sr 11 . Finally, the fact that conclusions drawn from srs and mas have been shown to be wrong should also be considered when evaluating a treatment or other practice being evaluated by a sr or ma . For example, a meta - analysis by the cochrane group reported that albumin increased deaths in critically ill patients 12 . However, a large randomized study in australia later revealed no such effects 13 . In summary, srs and mas are a valuable tool in assessing what is currently known regarding a subject but, like any tool, can fail . Because nonhuman animal models (hereafter referred to as animal models or animals) have on multiple occasions been unsuccessful in predicting human response to drugs and disease (we will address this claim in depth), many have called for srs in order to improve the models 14 - 24 . An example of this predicament would be the animal models used to determine which drugs to develop in an attempt to diminish neurological damage from ischemia events of the central nervous system (cns) 17, 25 - 30 . By analyzing animal - based research with srs, flaws in the methodology this would ostensibly also lead to better predictive values for humans (see table 1 for calculating such values). Bracken supports this, stating: one reason why animal experiments often do not translate into replications in human trials or into cancer chemoprevention is that many animal experiments are poorly designed, conducted and analyzed . Another possible contribution to failure to replicate the results of animal research in humans is that reviews and summaries of evidence from animal research are methodologically inadequate 18 . Further evidence that srs are expected to transform the predictive value of animal - based research comes in the form of the 1 international symposium and workshop on systematic reviews in laboratory animal science that was held at the radboud university nijmegen medical centre on february 9 - 10, 2012 . The workshop celebrated 5 years of the 3r [the 3r here refers to reduce, refine, and replace animals used in research] research centre (3rrc) and stimulating an international discussion and collaboration between animal and clinical researchers on systematic reviews (srs) of animal studies31 . Malcolm macleod, the keynote speaker, discussed, the transforming potential of the systematic evaluation of laboratory research . The use of srs for the optimisation of animal testing is still rare which can lead to waste in funding and harm to patients and research volunteers . The 3rrc encourages the use of srs in animal studies as they improve scientific quality, lead to implementation of the 3rs principles, improve translational research and help in determining the value of animal studies to human health 31 . While we do not dispute the value of srs to improve the quality of research and perhaps increase acceptance of the 3rs, we strongly contest the notion that srs will allow scientists to develop animal models that are predictive modalities for human responses to drugs and disease . Claims such as those above by bracken and the organizers of the symposium (and more we will cite below) regarding the benefit of using animal models in translational research however, directly assumes predictive ability . 32 highlighted some of the potential flaws when using animal models, including: variations in drug dosing schedules and regimens that are of uncertain relevance to the human condition.variability in the way animals are selected for study, methods of randomization, choice of comparison therapy (none, placebo, vehicle), and reporting of loss to follow up.small experimental groups with inadequate power, simplistic statistical analysis that does not account for potential confounding, and failure to follow intention to treat principles.nuances in laboratory technique that may influence results may be neither recognized nor reported, e.g. Methods for blinding investigators.selection of a variety of outcome measures, which may be disease surrogates or precursors and which are of uncertain relevance to the human clinical condition.length of follow up before determination of disease outcome varies and may not correspond to disease latency in humans 32 . Variations in drug dosing schedules and regimens that are of uncertain relevance to the human condition . Variability in the way animals are selected for study, methods of randomization, choice of comparison therapy (none, placebo, vehicle), and reporting of loss to follow up . Small experimental groups with inadequate power, simplistic statistical analysis that does not account for potential confounding, and failure to follow intention to treat principles . Nuances in laboratory technique that may influence results may be neither recognized nor reported, e.g. Methods for blinding investigators . Selection of a variety of outcome measures, which may be disease surrogates or precursors and which are of uncertain relevance to the human clinical condition . Length of follow up before determination of disease outcome varies and may not correspond to disease latency in humans 32 . Hooijmans et al 14 have called for a gold standard for research involving animals that includes stating the specifics regarding housing, species, randomization, cage size and bedding among other parameters . Other checklists and suggestions aimed toward improving standardizations note that even here however, hooijmans et al link standardization to prediction of human response stating: in addition, an improved experimental design contributes to a better translation to the clinic and increases patient safety 14 . Many reviews and opinions have echoed the above reasons for translational failure or predictive failure and have suggested ways to improve the likelihood of successfully predicting human responses to drugs and disease . The arrive (animals in research: reporting in vivo experiments) guidelines for reporting animal research 39 consist of a 20 item checklist containing: the minimum information that all scientific publications reporting research using animals should include, such as the number and specific characteristics of animals used (including species, strain, sex, and genetic background); details of housing and husbandry; and the experimental, statistical, and analytical methods (including details of methods used to reduce bias such as randomization and blinding) 39 . Another example of such an effort is the camarades group (the collaborative approach to meta - analysis and review of animal data in experimental studies). For example, the camarades group identified significant sources of bias in a sample of almost 5,000 animal studies . These shortcomings included a frequent lack of blinding, randomization, and sample size calculation, in addition to overstatement of treatment efficacy due to unpublished studies . While some scientists are more modest in their claims for the value of srs and the standardization of protocols, clearly there are high hopes for what srs can accomplish regarding the predictive value of animal models . We will now examine, in more depth, the reasons for the above concerns regarding the predictive value of animal models . The use of animals in science and research can be categorized per table 2 40 . While all uses of sentient animals are cause for ethical concern 41 - 43, the use of animal models to predict human response to drugs and disease appears to be the main focus of the scientific community when attempting to justify animal use to society 44 - 52 [53 p3]. This is consistent with giles, writing in nature, who stated: in the contentious world of animal research, one question surfaces time and again: how useful are animal experiments as a way to prepare for trials of medical treatments in humans? The issue is crucial, as public opinion is behind animal research only if it helps develop better drugs . Consequently, scientists defending animal experiments insist they are essential for safe clinical trials, whereas animal - rights activists vehemently maintain that they are useless 54 . Statements from advocates for animal - based research acknowledge the importance society places on animal models being able to predict human response to drugs and disease . For example, cheng stated: animal tests are necessary for some research, such as testing drugs for toxicity . It would be, in my opinion, improper to release drugs for human use without animal testing 55 . Heywood likewise stated: animal studies fall into two main categories: predictive evaluations of new compounds and their incorporation into schemes designed to help lessen or clarify a recognised hazard 56 . Vassar agrees, stating: chronic dosing in mice and monkeys is necessary to show the efficacy and safety of the antibody before it's taken into humans 51 . The council for international organizations of medical sciences implies prediction when they state: clinical testing must be preceded by adequate laboratory or animal experimentation to demonstrate a reasonable probability of success without undue risk 45 . Rudczynski wrote: the basic research model used by yale university and its peer institutions is scientifically valid and predictive of human disease 57 . The animal - based research community clearly stresses the importance and validity of using animals to predict human response to drugs and disease . The above claims are, however, in direct opposition to those advocating for srs in order to improve the predictive ability of animal - based research . Before we survey the literature for empirical confirmation and present views of other scientists that strongly disagree with the above, we need to first define the term predict and refresh the reader's memory of how it is used in science . Several confirmations of the hypothesis, by predictions that are found to be true, strengthen the hypothesis while one failed prediction may neccesitate revising the hypothesis or even destroy it altogether . This is standard science based on the hypothetico - deductive method and we have no issues with using the term predict in this manner . Animal use involving categories 5, 7, and 9 in table 2 would employ this use of predict . The second manner predict is used is when discussing the predictive value of a modality or practice . An example outside of biomedical science would be when italian geologists were asked whether a series of small quakes in the area meant that residents should evacuate their houses because a major earthquake was likely forthcoming . The geologists stated that a major earthquake was unlikely and this was consistent with current knowledge of earthquakes . Nevertheless, the italian legal system convicted the scientists on charges that essentially said they were negligent in failing to warn the residents to evacuate 58 . This was a cause for concern in the scientific community as an analysis revealed that small quakes forecast a major quake only 2% of the time 59, 60 . Clearly, a practice or modality that correctly calculates the answer only 2% of the time does not qualify as predictive . Exactly what percentage is necessary to qualify will vary with the field of study . Finding a method that will result in the correct answer 51% in the field of gambling, in blackjack for example, would be very productive and probably qualify as meeting the criteria for being a predictive practice . Using instruments to fly an aircraft on the other hand, requires that the instruments correctly communicate the exact location of the aircraft 100% of the time . While medical science does not require predictive values of 100%, tests that correlate with reality even 70% of the time are not very useful . Just as important as what the word predict means in terms of predictive value and how ppv and npv are calculated for example, a single example of correlation does not qualify a model as predictive or indicate a high ppv or npv . A modality or practice must be evaluated based on its history of correlating with reality . Moreover, one must be very precise when defining what is being evaluated for predictive value . If one wishes to evaluate animal models in general then all the wrong answers by all species must be included in the calculation as well as all the correct answers . If one is calculating ppv for a specific animal model, say using beagles in hepatotoxicity testing, then all correct and incorrect answers for beagles should be included but not outcomes from different species or even different breeds . With that background we can now evaluate the claims of animal models being, or not being, predictive for human response to drugs and disease . The assumption that animal models are predictive of human outcome is foundational for much of their use in biomedical research and for justifying animal - based research in general . Whether this assumption is true is a separate issue from that of methodology and study design although methodology may influence predictive value . The prevailing view within the animal model community among those calling for standardization and srs, per above, is that animal models would perform better, meaning they would have a higher ppv and npv for humans, if researchers adhered to strict criteria with respect to study design and methodology 61 . It is important to note that the potential validity of the animal model per se for predicting human response to drugs and disease is not questioned, at least in most of the literature that addresses srs and standardization . We acknowledge that animals can successfully be used in categories 3 - 9 in table 2 and that srs could positively impact on such use and that some calling for srs and standardization advocate for such on this basis . However, it appears that the main emphasis among those calling for srs and standardization is to improve predictive value . Therefore we consider it appropriate to explore whether a proper understanding of evolutionary biology and complexity science allows for the use of one species to predict responses to drugs and diseases for another, even under ideal circumstances 40, 41, 62 - 66 . If the practice per se is not viable, then srs will be of little value . We will now present the empirical evidence and later seek to place it within the context of complexity science and evolutionary biology . Empirical evidence regarding the predictive value of animal models comes in the form of research amenable to quantification via table 1 and examples of multiple failures over many years in the same subject . Examples of the latter would include the search for a vaccine against hiv and neuroprotective drugs . Approximately 100 vaccines have been shown effective against an hiv - like virus in animal models, however, none have prevented hiv in humans 67, 68 . Even if an hiv vaccine came from animal - based research tomorrow, the animal model per se would not be predictive for humans as the ppv would be somewhere in the 0.01 area . Likewise, up to one - thousand drugs have been shown effective for neuroprotection in animal models but none have been effective for humans 23 - 25, 29, 38, 61, 69 - 71 . The predictive value is again minimal even if a successful drug is currently in development . The animal model has failed as a modality for predicting neuroprotection . Along the same lines, of twenty two drugs tested on animals and shown to be therapeutic in spinal cord injury, none were effective in humans 72 . As we are attempting to prove that animal models are not predictive such examples are important . Relatively few failures can disqualify a practice from being of predictive value while proving the opposite requires a large number of successes . The success of the animal model in basic research can also be questioned based on the fact that, according to one report, only 0.004% of basic research papers in leading journals led to a new class of drugs 41, 73 and the fact that the success rate for target identification is similarly dismal 74 - 78 . For example, in part because the targets derived from animal models are not predictive for humans, the percentage of new drugs in development, after initial evaluation, that ultimately make it to market is somewhere in the area of 0.0002% 79, 80 . We acknowledge that the goals of basic research differ from the goals of applied research where predictive values are most often evaluated . However, because of funding challenges, research that would have historically been considered basic is now being promoted as applied and hence should be judged accordingly 41 . The empirical evidence from research outcomes quantifiable by the calculations in table 1 also supports our position that animal models cannot currently predict human response . Litchfield 81 studied rats, dogs, and humans in order to evaluate responses to six drugs . The rat model demonstrated a ppv of 0.49 while the dog model demonstrated a ppv of 0.55 . A ppv around 0.5 is not sufficient to qualify a modality as predictive in medical science . Medical science demands values of 0.8 or higher if the modality is to be used for anything that will intersect with patient care . (drug development is a clear example of a product or modality intersecting with patient care .) A similar study reported in 1990, examined six drugs in animal models, the side effects of which were already known from human data . The study found that at least one species demonstrated 22 side effects, but the models incorrectly identified 48 side effects that did not occur in humans, while missing 20 side effects that did occur in humans . A similar study - reported in 1990 - examined drugs abandoned during clinical trials secondary to toxicity . In 16 out of 24 cases, a 1994 study revealed that only six of 114 drug toxicities had animal correlates [84 p57 - 67]. While the data do not allow the calculations in table 1 to be made, obviously these numbers fall far short of qualifying as a predictive medical modality or test . These examples could be easily multiplied (for example, see 85 [86 p67 - 74] 38, 87 - 93). Moreover, in 1995, lin compared pharmacologically important parameters in different species and pointed out that many examples of animal models predicting human response were in fact retrospective and hence not predictive at all 94 . First, the animal model per se is simply not predictive of human response to drugs and disease . (for more on the failure of animal models of human disease to correlate with humans, see 62, 64 - 66, 96 - 100 .) Second, perhaps the proposed srs and standardization will allow for correction of methodological problems that have resulted in animal models failing to be of predictive value ., the following questions must be addressed: is there an all - encompassing explanation for the failure of animal models to be of predictive value regardless of methodology? Is there a theory or law in science that explains the empirical evidence we presented? We propose that the fact that all animals are examples of evolved complex systems constitutes a scientific theory explaining why animal models fail to be predictive modalities for human response to drugs and disease . In addition, this theory requires us to question whether an animal model will ever be a predictive modality for humans at the level of organization where disease and drug response occurs, regardless of methodological improvements . The assumption that animal models are predictive of human outcome is foundational for much of their use in biomedical research and for justifying animal - based research in general . Whether this assumption is true is a separate issue from that of methodology and study design although methodology may influence predictive value . The prevailing view within the animal model community among those calling for standardization and srs, per above, is that animal models would perform better, meaning they would have a higher ppv and npv for humans, if researchers adhered to strict criteria with respect to study design and methodology 61 . It is important to note that the potential validity of the animal model per se for predicting human response to drugs and disease is not questioned, at least in most of the literature that addresses srs and standardization . We acknowledge that animals can successfully be used in categories 3 - 9 in table 2 and that srs could positively impact on such use and that some calling for srs and standardization advocate for such on this basis . However, it appears that the main emphasis among those calling for srs and standardization is to improve predictive value . Therefore we consider it appropriate to explore whether a proper understanding of evolutionary biology and complexity science allows for the use of one species to predict responses to drugs and diseases for another, even under ideal circumstances 40, 41, 62 - 66 . If the practice per se is not viable, then srs will be of little value . We will now present the empirical evidence and later seek to place it within the context of complexity science and evolutionary biology . Empirical evidence regarding the predictive value of animal models comes in the form of research amenable to quantification via table 1 and examples of multiple failures over many years in the same subject . Examples of the latter would include the search for a vaccine against hiv and neuroprotective drugs . Approximately 100 vaccines have been shown effective against an hiv - like virus in animal models, however, none have prevented hiv in humans 67, 68 . Even if an hiv vaccine came from animal - based research tomorrow, the animal model per se would not be predictive for humans as the ppv would be somewhere in the 0.01 area . Likewise, up to one - thousand drugs have been shown effective for neuroprotection in animal models but none have been effective for humans 23 - 25, 29, 38, 61, 69 - 71 . The predictive value is again minimal even if a successful drug is currently in development . The animal model has failed as a modality for predicting neuroprotection . Along the same lines, of twenty two drugs tested on animals and shown to be therapeutic in spinal cord injury, none were effective in humans 72 . As we are attempting to prove that animal models are not predictive such examples are important . Relatively few failures can disqualify a practice from being of predictive value while proving the opposite requires a large number of successes . The success of the animal model in basic research can also be questioned based on the fact that, according to one report, only 0.004% of basic research papers in leading journals led to a new class of drugs 41, 73 and the fact that the success rate for target identification is similarly dismal 74 - 78 . For example, in part because the targets derived from animal models are not predictive for humans, the percentage of new drugs in development, after initial evaluation, that ultimately make it to market is somewhere in the area of 0.0002% 79, 80 . We acknowledge that the goals of basic research differ from the goals of applied research where predictive values are most often evaluated . However, because of funding challenges, research that would have historically been considered basic is now being promoted as applied and hence should be judged accordingly 41 . The empirical evidence from research outcomes quantifiable by the calculations in table 1 also supports our position that animal models cannot currently predict human response . Litchfield 81 studied rats, dogs, and humans in order to evaluate responses to six drugs . The rat model demonstrated a ppv of 0.49 while the dog model demonstrated a ppv of 0.55 . A ppv around 0.5 is not sufficient to qualify a modality as predictive in medical science . Medical science demands values of 0.8 or higher if the modality is to be used for anything that will intersect with patient care . (drug development is a clear example of a product or modality intersecting with patient care .) A similar study reported in 1990, examined six drugs in animal models, the side effects of which were already known from human data . The study found that at least one species demonstrated 22 side effects, but the models incorrectly identified 48 side effects that did not occur in humans, while missing 20 side effects that did occur in humans . A similar study - reported in 1990 - examined drugs abandoned during clinical trials secondary to toxicity . In 16 out of 24 cases, a 1994 study revealed that only six of 114 drug toxicities had animal correlates [84 p57 - 67]. While the data do not allow the calculations in table 1 to be made, obviously these numbers fall far short of qualifying as a predictive medical modality or test . These examples could be easily multiplied (for example, see 85 [86 p67 - 74] 38, 87 - 93). Moreover, in 1995, lin compared pharmacologically important parameters in different species and pointed out that many examples of animal models predicting human response were in fact retrospective and hence not predictive at all 94 . First, the animal model per se is simply not predictive of human response to drugs and disease . (for more on the failure of animal models of human disease to correlate with humans, see 62, 64 - 66, 96 - 100 .) Second, perhaps the proposed srs and standardization will allow for correction of methodological problems that have resulted in animal models failing to be of predictive value ., the following questions must be addressed: is there an all - encompassing explanation for the failure of animal models to be of predictive value regardless of methodology? Is there a theory or law in science that explains the empirical evidence we presented? We propose that the fact that all animals are examples of evolved complex systems constitutes a scientific theory explaining why animal models fail to be predictive modalities for human response to drugs and disease . In addition, this theory requires us to question whether an animal model will ever be a predictive modality for humans at the level of organization where disease and drug response occurs, regardless of methodological improvements . Science as a discipline can arguably be dated to newton and descartes, both of whom accepted a mechanistic, deterministic universe amenable to study by reductionism 101, 102 . Because the systems under examination at that time were simple systems that were no more than the sum of their parts, exhibited predictable behavior with few interactions and feedback loops, and hence could be intuitively understood, linear cause and effect relationships were the order of the day . Because of the nature of the universe, such systems are amenable to laws while complex systems are usually described using statistics . Hence biological complex systems are more likely to be described by theories than laws 103 - 105 . Moreover, outcomes are usually described as involving a causal chain as opposed to a linear cause and effect relationship 105 . Ecosystems, climate, financial markets, and the us power grids are examples of complex systems, while humans and animals are examples of evolved complex systems . Reductionism has been of value in the study of complex systems but because of the nature of complex systems, reductionism alone is inadequate to fully describe the system 106 - 108 . Van regenmortel states: the reductionist method of dissecting biological systems into their constituent parts has been effective in explaining the chemical basis of numerous living processes . However, many biologists now realize that this approach has reached its limit . Biological systems are extremely complex and have emergent properties that cannot be explained, or even predicted, by studying their individual parts . The reductionist approach although successful in the early days of molecular biology underestimates this complexity and therefore has an increasingly detrimental influence on many areas of biomedical research, including drug discovery and vaccine development 109 . Complex systems have very specific characteristics that influence the ability of one complex system to predict the response of another 102, 106, 107, 109-127.complex systems are more than the sum of their parts, thus reductionism will yield an incomplete analysis of a complex system . As animal modeling is based in large part on reductionism 65, 105, 109, 120, 125, 128 - 132, this portends problems.complex systems exhibit emergence, meaning that new properties of a complex system arise from the interactions of the parts . These new properties cannot be determined even in light of full knowledge of the component parts, thus compromising reductionism even further.complex systems are resistant to changes and exhibit redundancy in their components . This again complicates extrapolation between complex systems.complex systems exhibit self-organization.complex systems demonstrate responses to perturbations that are nonlinear.complex systems are very dependent upon initial conditions (for example, genetic make - up). For example, strains of mice have been noted to respond very differently to gene deletion 133, 134 and groups of humans, such as sexes 135 - 140 and ethnic groups 141 - 149, respond differently to drugs and disease . Monozygotic twins have also been discovered to respond differently to perturbations because of small differences in genetic make - up 150-154.complex systems are composed of many components, which can be grouped into modules that interact with each other.complex systems have hierarchal levels of organization (different levels can even respond oppositely to the same perturbation).complex systems have feedback loops.complex systems interact with their environment are dynamic.complex systems are nonsimulable 155 - 158 . Complex systems are more than the sum of their parts, thus reductionism will yield an incomplete analysis of a complex system . As animal modeling is based in large part on reductionism 65, 105, 109, 120, 125, 128 - 132, this portends problems . Complex systems exhibit emergence, meaning that new properties of a complex system arise from the interactions of the parts . These new properties cannot be determined even in light of full knowledge of the component parts, thus compromising reductionism even further . Complex systems are very dependent upon initial conditions (for example, genetic make - up). For example, strains of mice have been noted to respond very differently to gene deletion 133, 134 and groups of humans, such as sexes 135 - 140 and ethnic groups 141 - 149, respond differently to drugs and disease . Monozygotic twins have also been discovered to respond differently to perturbations because of small differences in genetic make - up 150 - 154 . Complex systems are composed of many components, which can be grouped into modules that interact with each other . Complex systems have hierarchal levels of organization (different levels can even respond oppositely to the same perturbation). Koch describes the problems of studying complex systems: such systems [like the human brain] are characterized by large numbers of highly heterogeneous components, be they genes, proteins, or cells . These components interact causally in myriad ways across a very large spectrum of space - time, from nanometers to meters and from microseconds to years . A complete understanding of these systems demands that a large fraction of these interactions be experimentally or computationally probed . Fields as diverse as neuroscience and cancer biology have proven resistant to facile predictions about imminent practical applications . Improved technologies for observing and probing biological systems has only led to discoveries of further levels of complexity that need to be dealt with . We are far away from understanding cell biology, genomes, or brains, and turning this understanding into practical knowledge 159 . In summary, complex systems are very different from the simple systems described so well by newtonian physics and which are routinely studied by reductionism . Complex systems are best described by partial differential equations and many of the values of the variables are unknown . Hence predicting intra - complex system response is difficult and predicting inter - complex system response is essentially impossible at higher levels of organization . The fact that the complex systems under study have evolved is also significant (see figure 2). While all of the characteristics of a complex system influence inter - system extrapolation, we will illustrate the importance of evolution on just one characteristic evolution has used numerous mechanisms to match species to niche and all of these mechanisms affect initial conditions . Even among humans, very small differences in genetic makeup can result in dramatically different outcomes to perturbations such as drugs and disease . For example, copy number variants (cnvs) in monozygotic twins can influence outcomes 150 . Single nucleotide polymorphisms (snps) among family members and/or other humans 161 - 163, pleiotropy 164, alternative splicing 165, the fact that different genes and molecules can accomplish the same purpose, and that the same gene can be used for different purposes 166 all influence response to drugs and disease . Changes in initial conditions such as the presence of different alleles, snps, cnvs and so forth negate the similarities between complex systems in terms of predicting response to perturbations that occur at higher levels of organization such as where drug and disease response occurs . The reality is even more complicated however, as gene regulation and expression account for the major changes in evolution 167, 168 . Theoretically, by varying the regulation and expression of the same genes, a new species could evolve with the same structural genes of its ancestor . Gene expression varies greatly in humans 169 - 172 and in animals 173 - 176 . Studied gene expression in the brains of humans, chimpanzees, and macaques and discovered accelerated evolution of gene expression in the human prefrontal cortex 177 thus casting doubt on the ability to extrapolate inter - species research for that area . Puente et al discovered at least twenty genes implicated in human cancers that differ significantly from chimpanzees 178 . In addition, chimpanzees are essentially immune to hiv, hepatitis b, and common malaria and they respond differently to other human pathogens 179 - 182.h according to caldwell, it has been obvious for some time that there is generally no evolutionary basis behind the particular - metabolizing ability of a particular species . Indeed, among rodents and primates, zoologically closely related species exhibit markedly different patterns of metabolism 183 . Festing stated: there is substantial genetic variation in the response of laboratory rats to xenobiotics, and this variation has important implications for toxicologic research and screening . Articles published in the journal toxicology and applied pharmacology from 1979 to 1999 . In a majority of the articles, the authors did not specify which rat strain was being used 184 . The above has profound consequences for using animal models to predict human response to drugs and disease . It is important to note here that many of the scientists quoted above do not take the position that animal models will never be predictive modalities . While we do not want to speculate as to their reasons, we must point out that the fact that animals and humans are evolved complex systems that are differently complex and this leads us to our conclusion that animal models will fail as predictive modalities . The fact, and implications, of models as differently complex is not addressed by most animal modelers quoted above and we suspect this may, in part, explain their position . This brings us to the logical conclusion of our animals as evolved complex systems argument . It is also perhaps our best reason against expecting animal models to ever be capable of predicting human response to drugs and disease: the concept of personalized medicine . Personalized medicine is perhaps best illustrated by allen roses, then - worldwide vice - president of genetics at glaxosmithkline (gsk), who stated: the vast majority of drugs - more than 90% - only work in 30 or 50% of the people 185 . Physicians have long recognized intra - species variation in response to drugs and disease 186, 187 . It is now understood that the variations in response are caused by variations in the genome (see tables 3 and 4) including epigenetic changes . For example, because of differences in genes, like snps, some children are not protected by a vaccine 162, 163 . King states: between 5 and 20 per cent of people vaccinated against hepatitis b, and between 2 and 10 per cent of those vaccinated against measles, will not be protected if they ever encounter these viruses 163 . In the future, such children may be able to receive a personalized vaccine . Personalized medicine will result in medical practice resembling the outline in figure 3 whereas today medical practice is more often the fact there is such variation among humans and that this variation causes so much concern 188 - 197 should cast doubts on the ability of another species to predict human response to drugs and disease 63, 65 . Also illustrative of the problems of extrapolation between complex systems, and in line with the basis for personalized medicine, is the fact that the sexes respond differently to drugs and diseases 135 - 140, 198, as do ethnic groups 141 - 149 . Moreover, monozygotic twins respond differently to drugs and disease 74, 199 - 204 . If monozygotic twins respond differently to perturbations such as drugs and disease, then expecting even genetically modified animals to be of predictive value seems nave . Indeed genetically modified animals have failed to be of predictive value 74, 199 - 204 . Our position, and apparently the position of scientists calling for standardization of animal protocols and srs, that animal models do not currently qualify as predictive modalities for human response to drugs and disease is supported by experts in various fields of science . For example, alan oliff, then - executive director for cancer research at merck research laboratories stated: the fundamental problem in drug discovery for cancer is that the model systems are not predictive at all 210 . An editorial in nature reviews drug discovery states: clearly, one part of the problem [of drug research] is poorly predictive animal models . . . Ellis and fidler echo this staing: preclinical models, unfortunately, seldom reflect the disease state within humans 212 . Horrobin addressed the use of animal models stating: does the use of animal models of disease take us any closer to understanding human disease? With rare exceptions, the answer to this question is likely to be negative 98 . Fliri pointed out that: currently, no method exists for forecasting broad biological activity profiles of medicinal agents even within narrow boundaries of structurally similar molecules 213 . Speaking of toxicity trials for new drugs in humans, an unnamed clinician was quoted in science as stating: if you were to look in [a big company's] files for testing small - molecule drugs you'd find hundreds of deaths 214 . Frances collins, director of nih, has also spoken out on the poor predictive value of animal models 215, 216 . Neuzil et al state: animal testing is not ideal either, as the predictive value of such tests is limited owing to metabolic differences between humans and animals, and many ethical issues are raised by the testing 217 . Cook et al state: over many years now there has been a poor correlation between preclinical therapeutic findings and the eventual efficacy of these [anti - cancer] compounds in clinical trials 218, 219 . . . The development of antineoplastics is a large investment by the private and public sectors, however, the limited availability of predictive preclinical systems obscures our ability to select the therapeutics that might succeed or fail during clinical investigation . 220 seidle 221 reported on the conclusions of a conference of experts in toxicology from pharmaceutical companies, contract research companies and others . The consensus was that: the information obtained from conventional acute toxicity studies is of little or no value in the pharmaceutical development process 222 . This statement was subsequently considered and endorsed by regulators and scientists from the eu, us and japan at a workshop in november 2006 222 . A survey at the conference 223 revealed that:100% of respondents found data from acute toxicity studies of little or no use and only used the information in dose setting for other studies in exceptional circumstances.100% of respondents agreed that they would not carry out acute toxicity testing if it were not a regulatory requirement.100% of respondents agreed that acute toxicity studies were not used to identify target organs.100% of respondents never use acute toxicity data to help set the starting dose in man.81% of respondents thought the data obtained from acute toxicity studies was of no use to regulators or clinicians . 221 100% of respondents found data from acute toxicity studies of little or no use and only used the information in dose setting for other studies in exceptional circumstances . 100% of respondents agreed that they would not carry out acute toxicity testing if it were not a regulatory requirement . 100% of respondents agreed that acute toxicity studies were not used to identify target organs . 100% of respondents never use acute toxicity data to help set the starting dose in man . 81% of respondents thought the data obtained from acute toxicity studies was of no use to regulators or clinicians . 221 sharp and langer summarized the current situation: the next challenge for biomedical research will be to solve problems of highly complex and integrated biological systems within the human body . Predictive models of these systems in either normal or disease states are beyond the capability of current knowledge and technology 224 . We note that the above scientists have not, to the best of our knowledge, agreed with us that animal models are incapable of being predictive modalities . We again attribute this to the fact that the discussion regarding evolved complex systems is relatively new . We also again note that srs and standardization may contribute to the use of animals in categories 3 - 9 of table 2 . We do not deny that animals can be successfully used for such endeavors in science and research and recognize the value of srs in improving such uses . However, we have presented a case against expecting animal models to ever be predictive modalities for human response to drugs and disease regardless of improvement in methodology . Even if methodological issues were to prove the problem in some of the studies that reveal ppvs of ~0.5, the lack of studies revealing any animal model to be predictive modality (for example in teratogenicity, carcinogenicity, hepatotoxicity, efficacy for a class of drugs, mechanisms of a class of diseases) is consistent with our theory . Animal models have historically been unable to predict human response to drugs and disease and animal - based research has historically displayed methodological problems that make srs difficult . One proposed solution that would address both problems is standardization of protocols thus permitting srs of animal models, which would in turn improve the models thus possibly allowing accurate predictions, via high ppv and npvs, for human response to drugs and disease . We have argued that even if the methodology for animal models could be standardized and subject to srs, animal models would still fail to be predictive modalities for human response to drugs and disease because of considerations from complexity theory and evolutionary biology . We also reject the notion that a combination of the results of several studies in a sr or meta - analysis may produce information relevant for judging the safety and efficacy of drugs that is not directly visible in the individual animal studies (such as significant side effects or overall efficacy). The problem is that animal models are not predictive modalities, not that animal models fail to reveal side effects . Many side effects from drugs in development are already observed in animal models but there is no predictive value for humans . As we discussed, srs are only useful if there is scientific validity to the assumptions or axioms underlying the research . There is no reason to conduct srs of homeopathy nor does complexity theory and evolutionary biology offer any reason to expect srs of animal models to be productive . Regardless of how the problem is approached, animal and humans will always be differently complex . One reason srs are necessary is that experts are unreliable for evaluating controversies in their own field . We would extend that concept to include the fact that human nature is also problematic when questioning assumptions is required . Tradition, the status quo, we always do it that way, resistance to change both individually and in the form of institutional inertia, all combine to challenge those who ask epistemological questions . Add to all of this the fact that the axioms underlying such practices are not usually discussed among scientists (being i the realm of philosophy of science) and the result is that challenging the axioms upon which these practices are based becomes almost impossible . Nevertheless it is vital to do so in order for science in general, and medical science in particular, to advance. |
Cementoblastoma in the current world health organization classification of odontogenic tumor, is in the category of tumors of mesenchyme and/or odontogenic ectomesenchyme with or without odontogenic epithelium . It generally occurs in young persons, comprises <1 - 6.2% of all odontogenic tumor and is characterized as being attached to the roots, most frequently associated with first permanent molar . The majority of these tumor are radiopaque, but radiolucent tumor may occur in rare instances . Histologically, it presents as a well - circumscribed tumor composed of cementum like tissue surrounded by a fibrous capsule . This was a case report of a 16-year - old male patient who reported to the department of oral medicine, gdc, ahmedabad with the chief complaint of swelling and mild pain in the right side of the jaw since 6 months, with a history of extraction of 46 because of pain before 6 months in a private dental clinic . On clinical examination, there was diffuse bony hard swelling present in the right body of mandible with normal overlying skin . Intra - orally, there was diffuse bony hard swelling in 46 region with normal overlying mucosa and expanded buccal and lingual cortical plates [figure 1]. Adjacent teeth were immobile and undisplaced . Radiological examination revealed a well - defined round radiopacity with radiolucent rim in the right body of mandible [figure 2]. He had pre - extraction intraoral periapical radiography (iopa) radiograph of 46 region, which showed a well - defined radiopacity surrounded by radiolucent rim attached to roots of 46 [figure 3]. The typical radiographic presentation of radiopacity attached to root with radiolucent rim suggested of benign cementoblastoma with differential diagnosis of hypercementosis, osteoblastoma, periapical cemental dysplasia and condensing osteitis . Histopathologically it showed a well - circumscribed tumor composed of cementum like tissue surrounded by a fibrous capsule [figure 4]. Intra - oral view showing diffuse swelling in right lower quadrant with missing 46 and expansion of buccal and lingual cortical plates right lateral oblique of mandible showing well defined radiopacity surrounded by radiolucent zone in body of mandible with missing 46 pre - extraction radiograph showing radiopaque lesion attached to roots of 46 microphotograph showing sheet of cementum like tissue with intervening loose fibrovascular connective tissue stroma the male to female ratio of the prevalence has been reported to be 2.1:1 with a mean age of 20.7 years . Benign cementoblastoma is also reported in the maxillary sinus and associated with deciduous and unerupted permanent tooth and multiple teeth . Clinical sign and the radiographic appearance of benign cementoblastoma is well - defined radiopacity with radiolucent zone . Though it is a benign tumor, but some cases reported in the literature exhibited signs of local aggressiveness and destruction, including bony expansion, erosion of cortical plates, displacement of adjacent teeth, maxillary sinus involvement, invasion of the pulp chamber and root canals and extension to and incorporation of adjacent teeth . Expansion, pain and erosion or perforation of bony cortex were seen in a higher percentage of recurrent tumors, but were also seen in non - recurrent tumors . The differential diagnosis for a periapical radiopacity include cementoma, osteoblastoma, periapical cemental dysplasia, condensing osteitis and hypercementosis . Histologically, this tumor presents sheets of cementum like tissue, which may contain a large number of reversal lines with active cementoblasts . Cementoblastoma and osteoblastoma are essentially identical histologically and the only distinguishing feature is attachment of cementoblastoma to the root of a tooth . Histologically, the cementoblast in cementoblastoma may be plump with pleomorphic and hyperchromatic nuclei, however, mitotic figures are not seen in cementoblastoma . In contrast to osteoblastoma, the cementoblastoma is an odontogenic tumor that recapitulates cementum deposition similar to that during root formation in the later stages of odontogenesis . Furthermore, the cementoblastoma is continuous with the cemental layer of the apical third of the tooth root and remains separated from bone by a continuation of the periodontal ligament, all of which supports an odontogenic origin . Whereas osteoblastoma arises in the medullary cavity of bones . The treatment of choice is complete removal of the lesion with extraction of associated tooth, followed by thorough curettage and peripheral ostectomy . Cases have been also reported of endodontically preserving the tooth while surgical removal of benign cementoblastoma is done . We presented a rare case of benign cementoblastoma in mandible and it should be considered in differential diagnosis of bony swellings of mandible . When extraction is attempted in such cases leaving the lesion behind makes the clinical diagnosis difficult . Though the patient had pre - extraction records, which helped in formulating the diagnosis. |
Understanding the physical interactions governing the structure and dynamics of ribonucleosides should improve the accuracy of simulations of ribonucleic acid (rna) molecules . Methods for simulating biological systems include residue - centered force fields (coarse - grained),(1) atom - centered force fields (amber,(2) charmm, gromos), approximate quantum mechanics, and mixed quantum mechanics / molecular mechanics methods (qm / mm). With advances in computer power, it is possible to run simulations at least as long as milliseconds and microseconds with coarse - grained and atom - centered potentials, respectively . They have provided satisfactory descriptions of structural and thermodynamic properties for some rna and deoxyribonucleic acid (dna) systems, while some challenging systems still provide difficulty . Predictions for the individual ribonucleosides have not been extensively used as benchmarks for amber force fields . A fundamental understanding of nucleosides is crucial to simulate the behavior of residues in single strands, noncanonical base pairs, and hairpins . Due to limitations of computer power, small model systems were used to parametrize the glycosidic dihedral angle in the amber94 force field. (2) in this article, the glycosidic dihedral angle,, of ribonucleic acids is reparameterized by extending the quantum mechanical (qm) fitting protocol, and new parameters are used in a revised force field, amber99. Structural and thermodynamic results are extracted from molecular dynamics (md) simulations using amber99(33) and amber99 force fields . Previous experimental work on nucleosides and nucleotides has classified the behavior of individual torsion angles . Structures of modified and unmodified nucleosides / nucleotides have been interrogated by one - dimensional (1d) h nuclear magnetic resonance (nmr) and steady - state 1d h nuclear overhauser effect (noe) difference spectroscopy (ssnoe). In this work, transient 1d h noe spectroscopy(51) and sugar proton coupling constants extracted from 1d h nmr spectra for cytidine (c) and uridine (u) are used to quantitatively deduce the preferred conformations of the glycosidic dihedral angle and the sugar pucker, respectively . The amber99 force field overestimates the fraction of syn conformations for the base orientation and of c2-endo sugar puckering of the pyrimidines, while the results of amber99 are more consistent with that of the experimental nmr data . Simulations on adenosine (a) and guanosine (g) show that amber99 prefers high anti conformations around 310, while amber99 prefers anti conformations around 185. the latter is more consistent with qm energy profiles and is the typical anti region seen in crystal structures of nucleic acids . Solutions of 0.2, 1, and 5 mm nucleosides were made in h2o with an nmr buffer consisting of 80 mm nacl, 10 mm sodium phosphate, and 0.5 mm disodium edta at a ph of 7.0 . Two lyophilizations were performed on each sample, reconstituting each time with 99.9% d2o (cambridge isotopes laboratories). One final lyophilization was performed, and each sample was reconstituted with 99.990% d2o (sigma aldrich). Chemical shift data were extracted from 1d h nmr (see supporting information). For a, the chemical shifts of h8, h2, h1, and h2 protons vary with concentration, implying that there is base stacking and/or base pairing interactions (see supporting information). (52) the 5-guanosine monophosphate is known to form quadruplex structures and other kinds of aggregates in solution, and presumably, guanosine does the same . Thus, the nmr spectra for nucleosides of a and g were not interpreted, except that j spinspin couplings of 0.2 mm samples were measured as a function of temperature (see supporting information). For c and u, transient 1d noe measurements were performed with a selective inversionrecovery experiment in which the frequency of the selective inversion pulse was alternated between on resonance with the h6 proton and 2000 hz downfield, where no resonances are present . The on / off resonance spectra were subtracted, and the integral of the resulting noe peaks was divided by peak integrals in a 1d spectrum to obtain percent enhancement . Steady - state 1d noe spectra were acquired in a similar manner with the inversionrecovery replaced by low - power irradiation for 10 s that was on / off the h6 resonance . Initial geometries were chosen to represent experimental conformations . The dihedral angle (o5c5c4c3) was set to 54, which is the observed value for a - form rna . The dihedral angle (c5c4c3o3) was set to either 140 or 81, which is c2- or c3-endo sugar pucker, respectively . The o4c1c2c3 dihedral was set to either 32 or 24 to force the sugar pucker to stay in c2- or c3-endo conformations, respectively . In ribonucleosides, there are three oh groups (5, 3, and 2) that are free to rotate in solution . The 3 oh group will not interact with the base as much as the 5 and 2 oh groups . Thus, different conformations of 5 and 2 oh groups were included in the fitting . For each nucleoside (figure 1), four different sugar conformations (table 1) were chosen for qm calculations with gaussian03. (56) for each sugar conformation, a potential energy surface (pes) scan was done around the glycosidic dihedral angle with increments of 5, yielding 4 72 = 288 conformations for each nucleoside . For each conformation in the pes scan, the structures were first optimized with hf/6 - 31 g * level of theory . During the optimization, most dihedrals were frozen in order to have a smooth energy profile with respect to the torsion angle (see supporting information). Then, qm energies, eqm, were calculated with mp2/6 - 31 g * level of theory . Atom notations of nucleosides: (a) cytidine, (b) uridine, (c) adenosine, and (d) guanosine . For c and u, is the dihedral angle defined by o4c1n1c2, and for a and g, is defined by o4c1n9c4 . The molecular mechanics (mm) energies, emm(nochi), of each conformation were calculated by restraining the dihedral angles to the values of the optimized qm geometries with a force constant of 1500 kcal / mola using the amber99(33) force field parameters, except torsion parameters were set to zero (see supporting information). Amber9(57) was used to calculate the mm energies, which use the default 14 vdw and electrostatic screening factors of 2.0 and 1.2, respectively . The energy difference, eqm emm(nochi), represents the potential energy due to torsion: for each nucleoside, the 4 72 = 288 data points from eq 1 were fitted by linear least - squares to the fourier series shown in eq 2 . Here, 1 and 2 are the dihedral angles of o4c1n1c6 (o4c1n9c8) and c2c1n1c6 (c2c1n9c8), respectively . Vn1 and vn2 are the potential energy barriers of o4c1n1c6 (o4c1n9c8) and c2c1n1c6 (c2c1n9c8) torsions . For each nucleoside, a separate fitting each structure was created with the xleap module of amber9. (57) two conformations were used as initial structures: c3-endo sugar puckering with base orientations of anti or syn . C, u, a, and g were solvated with tip3p water molecules(58) in a truncated octahedral box, having 458, 451, 427, and 430 water molecules, respectively . The structures were minimized in two steps: (i) with the nucleoside held fixed with a restraint force of 500 kcal / mol, steepest descent minimization of 500 steps was followed by a conjugate gradient minimization of 500 steps . (ii) with all restraints removed, steepest descent minimization of 1000 steps was followed by a conjugate gradient minimization of 1500 steps . After minimization, two steps of pressure equilibration were done with the sander module in amber9: (i) nucleosides were held fixed with a restraint force of 10 kcal / mol . A total of 20 ps of md were run with a 2 fs time step . (ii) the above conditions were chosen, except the constant pressure dynamics with isotropic position scaling was turned on . A total of 100 ps of md were run with a 2 fs time step . The production run was similar to the second step of the pressure equilibration described above ., a total of 30 ns of md were run with a 1 fs time step . For cytidine with amber99 force field, the simulation time was 120 ns for convergence purposes . In production runs, simulations were carried out with the pmemd module in amber9. (57) trajectory files were written at each 250 fs time step . Simulations were performed for systems prepared with the amber99 and amber99 force fields . For c, u, a, and g, and each force field, 10 separate simulations of 30 ns each were run at 300 k yielding a total of 300 ns of explicit solvent md simulation (see supporting information). Five of the 10 md simulations had a starting structure of anti type, while the other five had a starting structure of syn type (see supporting information). For c with amber99 force field, the simulations were extended to 11 separate simulations with 120 ns each (see supporting information). The fractions of anti and syn conformations observed were essentially independent of the starting structure as were values obtained for c when the time for each of the 11 simulations was extended from 30 to 60 ns and 120 ns (see supporting information). Ultrasonic relaxation studies in aqueous solution revealed a relaxation time of 3 ns for a and no relaxation signal for pyrimidines . Evidently, 300 ns of md simulations of the nucleosides is sufficient to sample adequately the synanti transformation . In solution, nucleosides have two important regions that describe their structures: (i) the glycosidic dihedral angle, and (ii) the sugar pucker . Nmr noe experiments were done to analyze the structures of c and u. the magnitudes of noes are proportional to 1/(rij), where rij is the distance between the protons of i and j. when the base of a pyrimidine is oriented in an anti conformation, the h6 proton is about 3.5 from the h1 proton, essentially independent of sugar pucker. (62) thus, irradiation of h6 yields a moderate noe to h1. When the base of a pyrimidine is oriented in a syn conformation, however, the h6 proton is about 2.1 from h1, yielding a strong noe to h1 when h6 is irradiated. (62) in pyrimidines, the distance between the h5 and h6 protons is constant at 2.48, which can be used as a reference for calculating interproton distances from noesy or transient noe experiments according to eq 3:(63) here, noeij is the noe between protons i and j, noeh5h6 is the noe between h5 and h6 protons, and rh5h6 is the distance between the h5 and h6 protons, i.e. 2.48 . Transient noe spectroscopy(51) with different mixing times was used to quantitatively analyze the preferences for anti / syn populations, and the results are presented in table 3 (also see supporting information). Transient noe is similar to noesy nmr except that it is 1d . To minimize spin diffusion effects and maximize signal - to - noise ratio, mixing times in the linear region of intensity vs mixing time plots were used to estimate distances between protons (see supporting information). A two - state model described by the following equation, which assumes that the structure is in either syn or anti conformations, was used to determine the proportions of each conformation: for a transformation of ab, gab = rtln(k), where r = 1.987 cal k mol, t is the temperature in kelvins, and k is the ratio of the concentrations of each species, [b]/[a] (see supporting information). Measurements of the syn / anti proportions of pyrimidines were extracted from transient noe experiments at 10 c, while the simulations were done at 300 k (27 c). Nmr spectra for c at 2 and 10 c indicate essentially no temperature dependence for the synanti equilibrium (see supporting information), so all g s were calculated at 300 k. these values are for 30 c (see supporting information). These values are for 0.2 mm samples of a and g at 30 c where there may be some association (see supporting information). These values represent populations of high anti conformations with 310 (see supporting information and figure 7). These values represent populations of anti conformations with 185 (see supporting information and figure 7). Here, noeh1h6 is the noe between the protons of h1 and h6, fanti and fsyn are the fractions of anti and syn conformations satisfying fanti + fsyn = 1, rh1h6,anti and rh1h6,syn are the distances between the protons of h1 and h6 when the structures are in anti and syn conformations, respectively, which are 3.48 and 2.12, corresponding to the distances extracted from the minimum energy structures of the pes scans for c and u (see methods section). As can be seen from table 3, the anti orientation is favored over syn . Comparison of nmr results for c at 2 and 10 c show that the fraction of anti base orientation is essentially independent of temperature (supporting information). Higher temperature could not be used because of the overlap of the h1 and h5 peaks (see supporting information). Ssnoe spectroscopy confirms that anti is favored over syn base orientation (see supporting information). Sugar proton coupling constants extracted from 1d h nmr spectra were used to determine the sugar puckering on the basis of the following equation:(64) where j12 and j34 are j spinspin couplings between h1 and h2 and between h3 and h4 protons, respectively . The proportion of c2-endo sugar puckering is equal to (1 fraction of c3-endo). Sugar pucker (2%) is independent of temperature from 5 to 40 c (supporting information), and results at 30 c are presented in table 3 . Figures 25 show the qm, mmamber99, mmamber99, and mmode(65) energy profiles with respect to the glycosidic dihedral angle of all the structures used in the fitting protocol for the nucleosides, where amber99, amber99, and ode(65) force fields were used to calculate mmamber99, mmamber99, and mmode energies, respectively . In all the plots, energy profiles of the amber99 force field describe the qm energy profiles best, although the ode force field s energy profile is also similar to the qm energy profiles . The differences between the predictions of the amber99 and ode force fields is likely due to the ode force field using ch3, h2cch3 and h2coch3 as model systems to represent the sugar, while the amber99 force field used the entire ribose with four different sugar conformations to calculate the torsional parameters ., both ode and amber99 force fields should provide similar predictions for structural and/or dynamical properties of rna . Comparisons of the force fields to qm calculations on eight sugar conformations not included in the fitting showed that amber99 also describes those qm energy profiles better than amber99 and ode force fields (see supporting information). Total energy (in kcal / mol) vs o4c1n1c6 of cytidine with amber99 (black), amber99 (red), qm (green), and ode force field (blue) for: (a) sc 1, (b) sc 2, (c) sc 3, and (d) sc 4 (see table 1). For visualization purposes, minimum energies of each curve anti, high anti, and syn base orientations correspond to x - axis ranges of 070, 100180, and 200300, respectively, because the x - axis is + 180 to be consistent with the amber94 force field. (2) total energy (in kcal / mol) vs o4c1n1c6 of uridine with amber99 (black), amber99 (red), qm (green), and ode force field (blue) for: (a) sc 1, (b) sc 2, (c) sc 3, and (d) sc 4 (see table 1). For visualization purposes, minimum energies of each curve anti, high anti, and syn base orientations correspond to x - axis ranges of 070, 100180, and 200300, respectively, because the x - axis is + 180 to be consistent with the amber94 force field. (2) total energy (in kcal / mol) vs o4c1n9c8 of adenosine with amber99 (black), amber99 (red), qm (green), and ode force field (blue) for: (a) sc 1, (b) sc 2, (c) sc 3, and (d) sc 4 (see table 1). For visualization purposes, minimum energies of each curve anti, high anti, and syn base orientations correspond to x - axis ranges of 070, 100180, and 200300, respectively, because the x - axis is + 180 to be consistent with the amber94 force field. (2) total energy (in kcal / mol) vs o4c1n9c8 of guanosine with amber99 (black), amber99 (red), qm (green), and ode force field (blue) for: (a) sc 1, (b) sc 2, (c) sc 3, and (d) sc 4 (see table 1). For visualization purposes, minimum energies of each curve are set to zero . Anti, high anti, and syn base orientations correspond to x - axis ranges of 070, 100180, and 200300, respectively, because the x - axis is + 180 to be consistent with the amber94 force field. (2) for comparison with nmr results, predictions of population distributions of dihedral angle and sugar pucker were analyzed for c, u, a, and g using the combined trajectories of the 10 individual md simulations with amber99 and amber99 force fields (see methods). Population distribution plots in 2d of dihedral and pseudorotation angles for each nucleoside are shown in figures 6 and 7 . Table 3 shows the force field predictions of base orientation and sugar pucker for each nucleoside (also see table 4 and supporting information). Analyses of the individual md simulations show at least seven synanti transformations for each (see supporting information). Population distribution of cytidine and uridine using amber99 (a and b, respectively) and amber99 (c and d, respectively) force fields . Pse (y - axis) and chi (x - axis) stand for the pseudorotation and dihedral angles . Pse angles of 18 and 162 correspond to c3-endo and c2-endo sugar pucker, respectively . Angles of 200, 300, and 60 correspond to anti, high - anti, and syn conformations, respectively. (70) population distribution of adenosine and guanosine using amber99 (a and b, respectively), and amber99 (c and d, respectively) force fields . Pse (y - axis) and chi (x - axis) stand for the pseudorotation and dihedral angles . Table 4 shows the predicted populations of (i), (ii), (iii), (iv), (v), and (vi). Pse angles of 18 and 162 correspond to c3-endo and c2-endo sugar pucker, respectively . Angles of 200, 300, and 60 correspond to anti, high - anti, and syn conformations, respectively. (70) regions of (i) syn / c2-endo, (ii) syn / c3-endo, (iii) anti / c2-endo, (iv) anti / c3-endo, (v) high anti / c2-endo, and (vi) high - anti / c3-endo (figures 6 and 7). Table 3 shows the experimental results for c and u as well as the predictions of amber99 and amber99 force fields of the base orientation and the sugar pucker for c, u, a, and g. for the synanti equilibrium of c and u, nmr indicates 87% and 93% anti conformation, respectively, corresponding to gsynanti of 1.07 and 1.45 kcal / mol . The amber99 force field predicts 30% and 28% anti conformation, respectively, corresponding to gsynanti of 0.49 and 0.55 kcal / mol . In comparison, the amber99 force field predicts 66% and 83% anti conformation, respectively, corresponding to gsynanti of 0.45 and 0.95 kcal / mol, closer to the nmr results . Evidently, amber99 overestimates the syn conformations of c and u (see figure 6). For the c2-endoc3-endo equilibrium of c and u, nmr indicates 60% and 56% c3-endo sugar puckering at 30 c, respectively, corresponding to free energy differences, gc2c3, of 0.24 and 0.15 kcal / mol (table 3). The percentages are essentially independent of temperature from 5 to 40 c (see supporting information). The amber99 force field predicts 27% and 35% c3-endo sugar pucker at 27 c, respectively, corresponding to gc2c3 of 0.58 and 0.36 kcal / mol . In comparison, the amber99 force field predicts 54% and 55% c3-endo sugar pucker at 27 c, respectively, corresponding to gc2c3 of 0.11 and 0.13 kcal / mol, which is close to the experimental values . Evidently, amber99 underestimates c3-endo sugar puckering of c and u (see figure 6). The amber99 force field predicts a and g to have 13% and 24% anti conformation (table 3), respectively, with a dihedral angle around 185, which is consistent with qm calculations and typical of the anti region seen in crystal structures of rna. (66) the amber99 force field predicts 15% and 11% anti conformation (table 3), respectively, but with a dihedral angle around 310 (figure 7), which is the high anti region . Qm pes scans did not find any minimum around 310 but rather between 180250 for three different sugar puckers for a and g (figures 45 and supporting information, where the x - axis, however, is + 180). The concentration dependence of chemical shifts for a and g indicated aggregation at concentrations required to determine noes with enough signal - to - noise to determine the base orientation quantitatively . Pioneering studies of 2- and 3- amp and gmp at high concentrations, however, indicated syn populations well over 50% . The amber99 force field predicts a and g to have 24% and 35% c3-endo sugar puckering, respectively, while amber99 predicts 32% and 54% . Chemical shift data of 0.2, 1.0, and 5.0 mm a implies base stacking that differs with concentration . The differences of the chemical shifts between 0.2 and 1.0 mm samples are small, however . Therefore, the 0.2 mm samples of a and g were used to calculate j spinspin couplings to estimate the sugar puckering (see supporting information). At room temperature, the c3-endo sugar puckering of a and g is about 40% (table 3 and supporting information). For a, both force fields predictions are similar to the experimental results . For g, it is known, however, that guanosine monophosphate forms quadruplex structures and other aggregates in solution . Thus, it is not conclusive whether 0.2 mm g can be used to reveal the sugar puckering of monomer g. there are several reasons why the amber99 force field improves predictions for nucleosides . When the torsions were parametrized for amber99, model systems for adenosine and thymidine were used, and the results were generalized for all dna / rna residues. (2) moreover, the model systems mimicked deoxyribose c2-endo sugar puckering . At that time, qm calculations were limited by computer power and only 89 data points were used in the qm fitting . Also, in the amber99 force field, the original cornell force field parameters for torsions were changed without doing any fitting . The v2 term of torsion parameters was zeroed to improve the c2-endo sugar puckering phase angle for dna residues. (69) this effect, however, changes the whole predicted potential energy surface of the nucleosides, which, therefore, does not represent the qm energy surface well . For the amber99 force field, the torsions of c, u, a, and g were reparameterized individually . A multiconformational fitting that included the entire nucleoside with different sugar puckering was done to provide the torsion parameters . In the pes scan, a total of 4 72 = 288 data points were used in the fitting protocol for each nucleoside . The new parameter set was tested on 12 different sugar conformations (four separate conformations for each of c2-endo, c3-endo, and o4-endo sugar puckering) for each nucleoside and shown to predict well the qm energy surface for these conformations (see figures 25 and supporting information). The shape of the qm energy surfaces of these conformations is also predicted well by the ode force field,(65) although not quite as well as by amber99 (see figures 25 and supporting information). As a result, there should not be any big difference between amber99 and ode force field(65) predictions for structural and thermodynamic properties of nucleosides . Many reasonable combinations of parameters were tested for approximating the qm pes representing the four major conformations of each nucleoside . For instance, we tried fitting to two dihedrals with three cosine terms, four dihedrals with two cosine terms, and four dihedrals with three cosine terms . Two dihedrals with four cosine terms provided excellent fits, and more terms gave minimal improvement . As a comparison, the ode force field(65) uses 3 dihedrals (a total of 13 vi parameters) to represent the torsions, while we use 2 dihedrals (a total of 8 vi parameters), but comparisons of the force fields to the qm potential energy surfaces shown in figures 25 and supporting information reveal that amber99 provides a better fit . It is crucial to use a force field that appropriately models the true behavior of rna systems . Otherwise, during md simulations, sampling space will include unphysical regions, which will cause errors in predictions . With the amber99 modification, significant improvements are seen in the structural and thermodynamic predictions for cytidine and uridine in solution (table 3). This modification should be particularly important for non - watsoncrick regions and terminal base pairs because sampling will not include unrealistic populations of syn conformations or of c2-endo sugar puckering . In watsoncrick regions, the torsion is restricted by hydrogen bonding in base pairs, so little effect should be seen there . Thus, the amber99 force field should improve structural and thermodynamic predictions for rna. |
Fructose is a monosaccharide that is widely available in natural food sources such as fruits and honey . However, in most countries the main source of fructose is from sucrose, a disaccharide composed of equal portions of fructose and glucose . In the united states another major source of fructose is high - fructose corn syrup (hfcs), which is a commercial liquid product consisting of fructose and glucose in varying proportions, but which in soft drinks is usually 55% fructose and 45% glucose . Fructose intake has increased markedly over the last 2 centuries, primarily due to the increasing intake of sucrose and hfcs [13]. In particular, the introduction of hfcs in the 1970s resulted in an accelerated intake of added sugars in the usa, in part because hfcs was inexpensive and could be easily mixed in with processed foods . It has been suggested that the increase in added sugars worldwide may partially explain the marked increase in frequency of overweight and obese humans and may explain the rising frequency of metabolic syndrome, diabetes, hypertension, and cardiovascular diseases (coronary artery disease, congestive heart failure, stroke, and chronic kidney disease) [13]. Fructose is absorbed into the intestine enterocyte by the glut-5 specific transporter . While some fructose is metabolized in the small intestinal wall, much of it is passed via the portal vein to the liver, with perhaps 20 to 30% escaping into the systemic circulation [5, 6]. Within the hepatocyte, fructose is phosphorylated to fructose-1-phosphate by fructokinase . Because this reaction has no negative feedback system, this results in the generation of amp which is metabolized by amp deaminase to inosine monophosphate and eventually to uric acid . The transient atp depletion has some similarities to ischemia and can result in arrest of protein synthesis with the induction of oxidative stress and inflammation [79]. Circulating fructose is taken up by a variety of cell types, including endothelial cells, but also is excreted into the urine where it is absorbed via the glut-5 transporter into the s3 segment of the proximal tubule . This cell also expresses fructokinase; as such, the metabolism of fructose by this proximal tubular cell can also lead to local oxidative stress and inflammation [8, 10]. Fructose is known to stimulate fat accumulation in the liver by both increasing synthesis and blocking fat oxidation [11, 12]. Perhaps not surprisingly, clinical studies have linked the intake of excessive fructose with the development of nonalcoholic fatty liver disease in humans, and the amount of fructose ingested correlates with the risk for progression to cirrhosis [15, 16]. Fructose is also known to stimulate glycogen accumulation in the liver [17, 18], which primarily appears to be due to inhibiting glycogenolysis due to inhibition of glycogen phosphorylase . Fructose intake has been shown to induce insulin resistance in rats [20, 21]; fructose can also induce insulin resistance in humans . The proposed mechanisms are complex but may include a consequence of hepatic lipid deposition, with diacylglycerol accumulation leading to activation of protein kinase [22, 23] or via the hepatic stimulation of pgc-1 . Some of the effects may also be due to fructose - induced hyperuricemia with effects on endothelial and adipocyte function [14, 25]. However, the lowering of uric acid with allopurinol did not prevent the development of insulin resistance in subjects administered large doses (200 g / d for two weeks) of fructose . Fructose intake may also accelerate the development of type 2 diabetes in rats, possibly by accelerating islet dysfunction via induction of mild islet inflammation and oxidative stress [12, 27]. One study suggests that this might be due in part to the effects of systemic uric acid that increase in response to fructose (or sucrose) ingestion . Fructose may also stimulate the production of advanced glycation end products (ages) that have been shown to be toxic in diabetes . Indeed, chronic fructose ingestion has been associated with the accelerated formation of cataracts in diabetic rats . Intake of sugary soft drinks has also been associated with the development of obesity and diabetes . [30, 31] indeed, a recent meta - analysis by malik et al . Found a strong independent relationship between the intake of sugar - containing soft drinks with the subsequent development of diabetes . Fructose does not acutely stimulate leptin or insulin release and hence may not trigger normal satiety responses . In addition, added sugars such as sucrose have been found to trigger dopamine responses in the ventral and dorsal striatum, which chronically may lead to downregulation of the d2 receptors and sugar bingeing . Fructose intake can also induce a central leptin resistance in rats, leading to increased food intake and the development of visceral obesity . Interestingly, rats on a high - fructose diet may not show an increase in overall body weight unless it is associated with diets high in fat . Fructose intake from added sugars is also associated with elevated blood pressure in humans, and diets low in added sugar have been reported to lower blood pressure . Furthermore, the acute ingestion of fructose (60 g) can increase systolic blood pressure in humans, and this is not seen in subjects given the same dose as glucose . In addition, in one study, overweight men were administered 200 g fructose daily for two weeks and sustained a significant increase in ambulatory blood pressure . Interestingly, the increase in blood pressure in response to fructose is better observed by tail cuff measurement as opposed to intra - aortic telemetry [40, 41]. However, blood pressure rises in response to sucrose or fructose diet by telemetry during the first hours of feeding [12, 42]. The mechanism of hypertension in response to fructose is complex but appears to be mediated by increased sodium absorption in the intestine, by inhibition of systemic endothelial function, and by stimulation of the sympathetic nervous system [14, 43, 44] (figure 1). In addition, some of the effect of fructose to increase blood pressure may be the consequence of fructose - induced increases in intracellular and serum uric acid . First, fructose - induced hypertension in rats is largely ameliorated by lowering uric acid levels . Second, in one study in overweight men, the rise in ambulatory blood pressure in response to 200 g of oral fructose per day for two weeks was blocked in those subjects concomitantly administered allopurinol . Fructose and sucrose are also known to induce renal hypertrophy and tubulointerstitial disease in rats [10, 45, 46]. First, the rise in uric acid in response to uric acid may cause an afferent arteriolopathy resulting in glomerular hypertension . Second, fructose may also be filtered into the urine where it is taken up in the s3 segment of the proximal tubule, leading to local intracellular generation of uric acid with oxidative stress and local inflammation . The administration of fructose to rats with reduced renal function (the remnant kidney model) can accelerate the progression of renal disease, resulting in worse proteinuria, glomerulosclerosis, and tubulointerstitial fibrosis . Fructose intake also impairs calcium absorption and reduces 25-oh vitamin d and 1,25-dihydroxy vitamin d levels in this model . Furthermore, the intake of sugary soft drinks in humans is associated with increased prevalence of albuminuria . Our group has also recently administered a low - fructose diet to subjects with stable chronic kidney disease for a period of 6 weeks . While we observed no effect on renal function during the period of the study, we did observe a reduction in inflammatory markers and a fall in blood pressure in subjects with the dipper physiology (i.e., those subjects whose blood pressure spontaneously falls at night during sleep). Clearly further studies are needed to determine if limiting added sugars may benefit subjects with kidney disease . While much work has focused on fructose as driving obesity, insulin resistance, and cardiorenal disease, not all fructose sources may be the same . Thus, natural fruits also are rich in antioxidants, ascorbate, polyphenols, potassium, and fiber that may counter the effects of fructose [13, 50]. Indeed, forman et al . Reported that fructose intake did not correlate with elevated blood pressure in a population in which much of the fructose intake was from fruit, whereas jalal et al . Found a strong association of fructose intake with blood pressure when the fructose content from natural fruits was excluded . While there is increasing evidence for a role for fructose as a contributory factor to obesity and metabolic syndrome, most of the data has relied on epidemiological studies, experimental models, and cell culture . In contrast, studies in which fructose or sucrose is administered to subjects have shown variable effects on metabolic parameters . In general, few metabolic effects are observed with fructose when it is given to young, healthy, and lean subjects [5254]. This contrasts with studies in overweight / obese or insulin - resistant subjects in which metabolic effects from fructose or sucrose are commonly observed [22, 26, 5558]. One potential explanation may relate to the absorption of fructose, which is known to increase with fructose exposure [59, 60]. Fructose effects are also potentiated by glucose [61, 62], and most studies have only examined fructose alone . Most studies also show, both in animals and humans, that the effects of fructose are greater on postprandial lipids, fatty liver, and insulin resistance rather than on weight gain per se . Indeed, the effects of fructose may be more on inducing leptin resistance, and it may require the addition of high - fat diet to show the weight gain . Nevertheless, the evidence that excessive intake of fructose may have multiple adverse effects on human health seems to be mounting . There are likely multiple mechanisms driving the current epidemic of obesity, diabetes, and cardiorenal disease . Future studies should investigate the effect of reducing fructose intake or blocking the metabolic effects of fructose as a means for preventing or treating these important diseases. |
On february 23, 2010, a military service member preparing for deployment received smallpox vaccination and was counseled by the us department of defense about postvaccination care and infection control . On february 27, the index patient wrestled 2 persons in a semiprofessional match, during which the dressing covering the vaccination site was detached . Within 3 days, skin lesions developed in both contacts . One of these 2 wrestlers participated in another wrestling match on march 5, exposing a third person in whom lesions on the chest developed . A fourth contact, a household member of a wrestler from the february 27 match, had lesions develop on the face . All were examined, and test results of specimens were negative for vacv (figure 1). * timeline of investigation of secondary and tertiary transmission of vaccinia virus from a us military service member, new york, usa, 2010 . Nysdoh, new york state department of health; ph, public health; vig, varicella immune globulin; pmd, private physician; derm, dermatologist . On march 11, a 26-year - old male wrestler with no noteworthy medical history visited a dermatologist after being referred by his private physician who had prescribed trimethoprim / sulfamethoxazole for presumed methicillin - resistant staphylococcus aureus from lesions on his face, neck, and chest (figure 2). Molluscum contagiosum and impetigo were included in the differential diagnosis, and a culture was sent to a local laboratory to test for methicillin - resistant s. aureus . The dermatologist notified the local health department of the patient s possible exposure to vacv . A nysdoh public health physician evaluated the patient on march 12 . On examination, he had clinically compatible vacv lesions, including papular, umbilicated lesions with overlying vesicles and a few pustules . Vaccinia lesions in patients with secondary and tertiary cases, new york, usa, 2010 . Top row, case - patient 1; bottom row, case - patient 3 . On march 11, a 24-year - old male wrestler with no noteworthy medical history was contacted by the nysdoh because he was a wrestling contact of the vaccinee . He reported lesions on his face, neck, chin, and left eye that developed several days after the wrestling event and were associated with substantial pruritus, exudate, and erythema . At his public health evaluation on march 12, he had numerous papular lesions that were umbilicated with overlying vesicles, several of which were draining serous fluid, and vacv was clinically diagnosed . He received slit - lamp examination by a local ophthalmologist, who after consultation with cdc and nysdoh, treated him with trifluridine ophthalmic solution (4). The blepharitis and eyelid erythema resolved within 48 hours after initiation of trifluridine . On march 10, a 25-year - old male wrestler and roommate of the vaccinee sought treatment for vesicular lesions on his trunk and chest . He reported that several pruritic papules had developed 2 days after wrestling case - patient 1 . The physician thought the lesions appeared to be molluscum contagiosum, but given the patient s history, consulted an infectious disease physician, who observed lesions compatible with vacv . At the public health clinical evaluation on march 12, the patient had grouping of vesicular lesions with central umbilication on mildly erythematous bases on his trunk (figure 2), with a solitary lesion near his left areola and on the volar aspect of his right forearm . Vacv was clinically diagnosed . On march 9, lesions developed along the mandible of the 29-year - old household contact of case - patient 1 . On march 11, she was evaluated by a dermatologist, who performed a punch biopsy for suspected herpes . Over the next several days, she was seen by the nysdoh public health physician on march 16, and vacv was clinically diagnosed . The most plausible route of exposure was a shared hand towel with case - patient 1 . Over the next several days, her lesions started draining and became substantially more erythematous and painful . After consultation between her physician, nysdoh, and cdc, varicella immune globulin was released from the strategic national stockpile for administration because of the new mucosal involvement (5). Varicella immune globulin was administered with no complications on march 19 at a local hospital . Samples were obtained by unroofing vesicles, collecting the tissue, performing slide touch preps of the unearthed base of each vesicle, and obtaining viral swabs by using pox collection kits that had been distributed through nysdoh . All patient specimens were tested at the nysdoh wadsworth center (albany, ny, usa) by real - time pcr, and preliminary results indicated vacv . Vacv subsequently was confirmed in all 4 patients by real - time pcr at the nysdoh wadsworth center . The complete hemagglutinin gene was sequenced by cdc for 3 of the samples (cases 1, 3, 4) and was identical to that of acam2000 (6). Nysdoh provided appropriate transmission precautions and wound care instructions to all 4 case - patients (7). On march 11, a 26-year - old male wrestler with no noteworthy medical history visited a dermatologist after being referred by his private physician who had prescribed trimethoprim / sulfamethoxazole for presumed methicillin - resistant staphylococcus aureus from lesions on his face, neck, and chest (figure 2). Molluscum contagiosum and impetigo were included in the differential diagnosis, and a culture was sent to a local laboratory to test for methicillin - resistant s. aureus . The dermatologist notified the local health department of the patient s possible exposure to vacv . A nysdoh public health physician evaluated the patient on march 12 . On examination, he had clinically compatible vacv lesions, including papular, umbilicated lesions with overlying vesicles and a few pustules . Vaccinia lesions in patients with secondary and tertiary cases, new york, usa, 2010 . Top row, case - patient 1; bottom row, case - patient 3 . On march 11, a 24-year - old male wrestler with no noteworthy medical history was contacted by the nysdoh because he was a wrestling contact of the vaccinee . He reported lesions on his face, neck, chin, and left eye that developed several days after the wrestling event and were associated with substantial pruritus, exudate, and erythema . At his public health evaluation on march 12, he had numerous papular lesions that were umbilicated with overlying vesicles, several of which were draining serous fluid, and vacv was clinically diagnosed . He received slit - lamp examination by a local ophthalmologist, who after consultation with cdc and nysdoh, treated him with trifluridine ophthalmic solution (4). On march 10, a 25-year - old male wrestler and roommate of the vaccinee sought treatment for vesicular lesions on his trunk and chest . He reported that several pruritic papules had developed 2 days after wrestling case - patient 1 . The physician thought the lesions appeared to be molluscum contagiosum, but given the patient s history, consulted an infectious disease physician, who observed lesions compatible with vacv . At the public health clinical evaluation on march 12, the patient had grouping of vesicular lesions with central umbilication on mildly erythematous bases on his trunk (figure 2), with a solitary lesion near his left areola and on the volar aspect of his right forearm . On march 9, lesions developed along the mandible of the 29-year - old household contact of case - patient 1 . On march 11, she was evaluated by a dermatologist, who performed a punch biopsy for suspected herpes . Over the next several days, she was seen by the nysdoh public health physician on march 16, and vacv was clinically diagnosed . The most plausible route of exposure was a shared hand towel with case - patient 1 . Over the next several days, her lesions started draining and became substantially more erythematous and painful . After consultation between her physician, nysdoh, and cdc, varicella immune globulin was released from the strategic national stockpile for administration because of the new mucosal involvement (5). Varicella immune globulin was administered with no complications on march 19 at a local hospital . Samples were obtained by unroofing vesicles, collecting the tissue, performing slide touch preps of the unearthed base of each vesicle, and obtaining viral swabs by using pox collection kits that had been distributed through nysdoh . All patient specimens were tested at the nysdoh wadsworth center (albany, ny, usa) by real - time pcr, and preliminary results indicated vacv . Vacv subsequently was confirmed in all 4 patients by real - time pcr at the nysdoh wadsworth center . The complete hemagglutinin gene was sequenced by cdc for 3 of the samples (cases 1, 3, 4) and was identical to that of acam2000 (6). Nysdoh provided appropriate transmission precautions and wound care instructions to all 4 case - patients (7). In 2003, members of the military, selected health care workers, public health personnel, and first responders began receiving smallpox vaccinations as part of bioterrorism preparedness (8). Although smallpox vaccination campaigns directed toward health care workers and public health officials ended in january 2008 (9), smallpox vaccinations continue for military service members . This case report illustrates the need to ensure that military vaccinees understand the risk associated with contact transmission . Regions with active military smallpox vaccination programs need to maintain awareness among community medical providers, health departments, and laboratories to facilitate recognition, correct diagnosis, and appropriate response to inadvertent inoculation of vaccinia virus to help limit further transmission . Especially in areas with ongoing smallpox vaccination programs, finally, updates are needed on identification of vacv cases, along with the notification and involvement of public health. |
Strontium titanate (srtio3, sto), the prototypical perovskite oxide, has long been known to show interesting effects taking place on its surfaces . For example, it is commonly used as a substrate for the growth of complex oxides, and it supports the formation of a two - dimensional electron gas on its surfaces . Furthermore, srtio3 was one of the first materials to show a higher photocatalytic water - splitting efficiency than the classical photocatalyst tio2 . What makes a material a good photocatalyst are an appropriate band gap allowing harvesting most of the solar spectrum (maximum intensity at around 2.4 ev) and a suitable alignment of the valence band maximum (vbm) and conduction band minimum (cbm) with respect to the redox potentials of water . As was found by scaife, for most semiconducting transition metal oxides, the (h2o / h2) redox potential of water lies around 3 v above the vbm, i.e., inside the band gap for srtio3 (eg = 3.2 ev). This means that band engineering toward an efficient photocatalyst should decrease the magnitude of the band gap while retaining the position of the cbm . Such band engineering was already successfully demonstrated by konta et al . By doping sto with rhodium . The rhodium dopants introduce an impurity level located 2.3 ev below the cbm of sto . Visible light can therefore excite electrons from the dopant levels into the conduction band of sto, and the photocatalytic process is initiated . Recently, we have studied the adsorption of water on the pristine srtio3(110)-(4 1) surface . This reconstruction is formed to compensate for the polarity of the sto(110) surface . The structure consists of six- and ten - membered rings of tio4 tetrahedra, sitting on a bulk - truncated sto(110) plane, in which titanium is octahedrally coordinated . We found that this surface is remarkably inert toward the interaction with water, providing a very good starting point for studying the effect of promoters . The photocatalytic activity of the srtio3:nio system has already been demonstrated successfully by townsend and co - workers . In their study, townsend et al . Showed that niox - sto is more likely a three - component ni - sto - nio catalyst, in which sto absorbs the light, ni reduces protons, and nio oxidizes water . The present study is intended to provide fundamental information on the srtio3:nio system . We have performed x - ray absorption near - edge structure (xanes), x - ray and ultraviolet photoelectron spectroscopy (xps / ups), and scanning tunneling microscopy (stm) to determine the effects of adsorption of nio onto the sto(110)-(4 1) surface . Nio was prepared by either (i) postoxidation of submonolayer amounts of ni deposited by molecular beam epitaxy (mbe) in ultrahigh vacuum or (ii) reactive mbe growth of metallic ni in a molecular oxygen background . Stm reveals that the nanometer - sized nio patches that develop on sto(110)-(4 1) distort the local surface structure independently of the preparation method . Consistently, xanes indicates a distortion / transformation of the surface tio4 tetrahedra upon nio growth . Band bending is observed in both xps and ups, which increases with the amount of nio . The onset of the vbm is effectively shifted upward, while minimal changes are observed on the cbm, as seen in the xanes results . Combining xps, ups, and low - energy ion scattering spectroscopy (leis), a clear signature of dissociative adsorption of water nb - doped (0.5 wt%) srtio3 single crystals with polished (110) surface were purchased from mateck (germany) and crystec (germany). The sto(110)-(4 1) surface was prepared by cycles of sputtering (ar, 1 kev, 5 a, 10 min) and annealing (900 c, 3 10 mbar o2, 1 h). The samples were heated either by passing alternating current (7.6 v, 1.75 a) through the samples or by bombarding them with electrons from the back (900 v, 15 ma). The sto(110) surface exhibits a series of well - defined reconstructions, which can be tuned by the sr / ti stoichiometry in the near - surface region . For the present investigation the surface structure was adjusted to yield the 4 1 reconstruction, as checked by low - energy electron diffraction (leed). Nickel metal (purity of 99.999%) was deposited onto the surface from an electron beam evaporator (omicron efm3), with a typical growth rate of 0.1 / min, as measured in uhv via a home - built quartz - crystal microbalance . The oxidation of metallic ni was achieved either by reactively depositing (rd) ni in 5 10 mbar of o2 at different temperatures (room temperature [rt], <300 c, and 355 c) or by postoxidizing (po) the submonolayer ni amounts (deposited in ultrahigh vacuum at rt) in 5 10 mbar of o2 for 20 min . In the latter case, the substrate temperature was adjusted to be slightly below the onset of the ir pyrometer reading (300 c), unless otherwise stated . In the following, synchrotron radiation photoemission spectroscopy (pes) and x - ray absorption spectroscopy (xanes) experiments were performed at beamline i311 at the max - lab laboratory . The base pressure of the beamline end station was below 1 10 mbar . All synchrotron - based photoemission spectra (scienta ses200 analyzer) were acquired with a takeoff angle for the photoelectrons of approximately 55 away from the surface normal and with suitable kinetic energies (see spectra for photon energies) to ensure highest surface sensitivity . Only one set of photon energy measurements was carried out for each sample treatment by measuring the fermi - edge position on the ta sample holder . Therefore, uncertainties of binding energies are stated for the shown synchrotron - based spectra . Work functions () were determined from a straight line tangent to the leading edge of the low kinetic - energy cutoff of the secondary electrons, as measured at normal emission with a sample bias of 10 v. x - ray absorption was performed in two different modes . Auger - electron yield (aey) spectra were acquired by measuring the intensity of the ti l2m2,3m2,3 auger peak, while sweeping the photon energy across the ti l2,3 edge . In secondary - electron yield (sey), the increase of low - kinetic - energy electrons (ekin 60 ev) was measured as an indication of the absorption of x - rays . Stm experiments were performed in a separate uhv system with a specs aarhus stm at room temperature (rt), using electrochemically etched w tips . All stm images were taken in constant - current mode with approximately + 2 v sample bias voltage (empty states) and a tunneling current of around 0.2 na . Xps (omicron x - ray source with al anode, h = 1486.7 ev) and leis (specs iq12/38, 1000 ev he ions, 5.8 10 he/[cms], and total scattering angle = 127) experiments were performed with a specs phoibos 100 hemispherical analyzer in the same analysis chamber with a base pressure below 6 10 mbar . Because of the small uncertainties in the photon energy calibration for the experiments performed at max - lab synchrotron radiation facility, measurements of band bending as a result of different surface treatments were repeated in the home laboratory, providing a well - defined photon energy . Such band bending was derived from the binding energy of fitted xps core - levels (o 1s and ti 2p3/2). Samples were prepared in a connected preparation chamber with a base pressure of 3 10 mbar . Deionized water and isotopically labeled h2o (sigma - aldrich) were cleaned by repeated freeze pump thaw cycles and dosed onto the sample in the preparation chambers through high - precision leak valves . Peaks in ion scattering spectra have been assigned by calculating the kinetic energy of he ions elastically scattered by o, o, ti, ni, and sr atoms, considering a 127 total scattering angle . Figure 1a shows photoemission spectra (raw data) of the valence band region of differently treated srtio3(110)-(4 1) surfaces . The inset shows a zoom into the gap region with the spectra aligned at the o 2s peak at eb 22 ev (not shown). Vbm were determined from the intersection of the horizontal (zero counts) line with a straight segment tangent to the leading edge of the ups spectra, as represented in the inset of figure 1a . For the clean surface (black curve), the onset of the valence band is located at approximately 3.2 ev below the fermi level, in nice agreement with the n - type doping of the sto crystals and a reported band gap of 3.2 ev, i.e., a flat - band situation . The gap - region of the pristine surface does not show any detectable density of states, meaning that no in - gap states are introduced by the nb dopants in the sto single crystal . Black, red, and blue spectra correspond to the pristine surface, the surface after deposition of 0.1 ni, and after postoxidizing the same ni amount at 300 c, respectively . The inset shows a zoom into the gap region with the spectra aligned to the o 2s feature at 22 ev . (b) ni 2p core levels before and after oxidizing 0.1 ni . (c) the insets show the o 1s high binding - energy region (c) and the ti 2p3/2 low binding - energy region (d) after aligning the spectra to the corresponding main peak . (e) band bending as measured from the o 1s and ti 2p peak positions with al k radiation as a function of the rd - deposited nio deposition amount (quartz crystal microbalance readings assuming ni density; error bars represent 99% confidence intervals on the fitted peak positions). Evaporation of ni (red curve) shifts all spectral features to lower binding energies (by 0.22 0.15 ev) and an in - gap state is formed . The adsorption of single ni adatoms at the srtio3(110)-(4 1) surface has been studied recently, showing that isolated ni adatoms are formed up to a coverage of 0.05 [see figure 2b]. Upon postoxidizing the ni adatoms, the valence band shifts to even lower binding energies by 0.38 0.15 ev compared to the pristine surface, and the in - gap state is shifted downward, forming a shoulder of the valence band . In the case of 0.1 ni postoxidized, the onset of the valence band is shifted to lower binding energies by around 1.5 ev [inset of figure 1a]. The upward bending of the energy bands as a result of nio adsorption is consistent with the higher workfunction of nio compared to the pristine sto surface (sto(110)-(41) 4.9 ev, nio = 6.26.7 ev) and the measured increase of the workfunction of the nio - loaded surface (sto+0.1 nio 5.3 ev). Figure 1b shows the ni 2p core - level spectra measured on as - deposited 0.1 ni (red) and after postoxidizing the sample (blue). The as - deposited ni exhibits the typical metallic ni 2p core - level features with a binding energy of the j = 3/2 component of 853.6 0.3 ev and a 17.1 ev spin orbit - split (sos) 2p1/2 peak (compared to 2p3/2 photoemission from pure metallic ni at eb = 852.7 ev with a sos of 17.3 ev). Upon postoxidizing the nickel, the ni 2p core - level features change to the typical nio line shape, with a binding energy of the j = 3/2 component of 855.9 0.3 ev and a sos of 17.6 ev (compared to literature values of eb = 853.8 ev of 2p3/2 and sos = 17.5 ev for bulk nio). The o 1s core - level [figure 1c] shows only a very weak change . The presence of ni adatoms causes the main o 1s spectral feature to be damped and a small shoulder at higher binding energy is formed . This shoulder is slightly diminished upon postoxidation [see inset of figure 1c, in which the spectra are shifted for clarity, aligning the main o 1s feature]. The effect of nickel adatoms binding to the surface oxygen can also be seen in the ti 2p core - level spectra in figure 1d . Here, the pristine surface (black) shows the commonly observed ti 2p features of ti ions (ti 2p3/2eb = 459 0.15 ev with a sos of 5.7 ev). Upon deposition of ni adatoms, a shoulder at lower binding energies is formed, as it can be seen in the inset of figure 1d . Such a shoulder is normally assigned to reduced ti species, as described elsewhere . Upon oxidation, this shoulder vanishes, and the spectrum resembles the pristine surface, except for a rigid shift of 0.2 0.15 ev to lower be . Band bending is found to progressively increase with the successive deposition of nio, attaining a saturation value of approximately 0.8 ev at deposited amounts above 1 nio [see figure 1e]. The (4 1) reconstructed surface of srtio3(110), having a unit cell size of 15.6 5.52, appears in stm images as periodic double lines of weak maxima along the [110] direction [see figure 2a]. These maxima correspond to tio4 tetrahedra, which form six- and ten - membered rings via corner - sharing oxygen atoms . Bright protrusions on the (4 1) rows [a few marked by green dots in figure 2a] are assigned to single strontium adatoms, which are stabilized on antiphase domain boundaries of the reconstruction, ensuring polarity compensation . We have recently investigated the adsorption of nickel on this surface, showing that isolated single ni adatoms [red stars in figure 2b] are stabilized when submonolayer ni amounts are deposited on sto at rt . Ni adatoms can adsorb either at the center of (4 1) rows (six - membered tio4 rings) or on their sides, in proximity of the dark trenches (ten - membered tio4 rings). Upon postoxidizing 0.1 ni in 5 10 mbar of o2 at 375 c, the ni adatoms coalesce into irregularly shaped patches [highlighted by the dashed blue line in figure 2c], extending over several adjacent (4 1) lines, and not showing any apparent preferential adsorption site . No clear ordering of atomic - scale features could be observed on such patches, likely indicating the formation of a locally defective nio structure . Similar morphological and structural features are observed when growth is carried out by reactively depositing ni in o2 atmosphere [figure 2d, e], and no significant improvement of the measurable atomic - scale structure is obtained upon increasing the deposited ni amount [cf . The area of nio patches progressively extends with increasing the deposited amount, and 0.3 nio (not shown) nearly fully cover the sto surface, with only little (4 1) structure visible in stm . Leed images acquired on the samples at different nio coverages (not shown) do not exhibit any additional features in the diffraction pattern, but an overall increase of the inelastic background upon increasing the deposited material . Stm images [(a d) 20 20 nm, (e) 16 16 nm, (f) 30 30 nm] of differently treated srtio3(110)-(4 1) surfaces . (b) pristine surface after deposition of 0.05 ni . Panels c and d show 0.1 ni postoxidized (po) and reactively deposited (rd), respectively . (e) reactively deposited 0.2 ni . (f) 0.1 ni after postoxidation at 600 c . Tunneling parameters for panels a f: us = + 2.0 to + 2.5 v, it = 0.02 to 0.3 na . It is worth pointing out that a local distortion of the (4 1) rows is visible in stm in close proximity of the nio patches . This is mostly evident wherever nio patches extend up to the dark trenches separating adjacent dotted rows, as indicated by the white arrows in figure 2c, d . In such regions the dark trenches appear wider in the in - plane direction, and a deeper corrugation (by 1020 pm) is measured in stm . Figure 2f shows the sample surface with 0.1 nio postoxidized at 600 c . The nio patches coalesce into rectangular islands, and several defect structures are introduced in the sto substrate [orange solid lines in figure 2f]. One type of defect appears as periodic, bright dots centered within the (4 1) structure . Another type of defect is a cross - shaped vacancy centered on one of the two rows of periodic dots, which build up the (4 1) structure . Finally, localized depressions occasionally appear next to nio patches and possibly correspond to missing units of the surface structure . It should be mentioned that despite the relatively high temperature of 600 c, only a small decrease (<6%) of the ni 2p xps intensity was measured (not shown), excluding an extended intermixing of ni atoms into the sto crystal . Electrons from occupied core levels get excited into unoccupied conduction band states, e.g., ti 2p ti 3d transitions . As has been already pointed out, the (4 1) surface consists of tetrahedral tio4 units residing on bulk srtio3 consisting of octahedral tio6 units . The spectral features corresponding to these two configurations can be disentangled in the xanes line shape, as has been recently shown [wang et al ., the ti 3d levels split into subsets with t2g / eg or t / e symmetry in an octahedral (oh) or tetrahedral (td) crystal field, respectively . Figure 3a shows xanes spectra of the ti l2,3 absorption edge for differently treated srtio3(110) surfaces . Common to all spectra are a strong absorption peak at a photon energy of approximately 458 ev (ti 2p3/2 ti 3d oh - t2 g) followed by two overlapping peaks at 459 ev (ti 2p3/2 ti 3d td - e) and 460 ev (ti 2p3/2 ti 3d oh - eg) and two broad overlapping features at 463 and 465 ev (ti 2p1/2 ti 3d oh - t2 g and ti 2p1/2 ti 3d oh - eg). Note the small shifts of the ti l2,3 peak at 458 ev for different treatments of the surface . These cannot be ascribed to band bending, which is caused by a local difference in electrostatic potential and should therefore affect all core levels and conduction band states equally . The shifts are therefore related to changes in the conduction band, i.e., in the ti 3d levels . This indicates that the cbm is only minimally altered upon adsorption of nio, as compared to the change in the vbm [see inset of figure 1a]. A strong decrease of the tetrahedral signature after adsorption of ni and nio is visible in figure 3a . This indicates that either the tetrahedral information is damped by the adsorbates or that the latter distort the tio4 tetrahedra . The latter possibility is consistent with the distortion, and disruption of the surface structure, which was visible in stm after preparing a nio - loaded surface at 300 c [white arrows in figure 2c, d] and 600 c [figure 2f], respectively . In general, ti l2,3 xanes spectra acquired in sey mode (not shown) show the same absorption peaks as aey with the relative peak ratios dominated by the octahedral coordination of ti in bulk sto . The spectrum appears similar for all surface treatments and acquisition modes (aey and sey), showing only minimal variations in the relative intensities of the main features . Because of the low signal, related to the small amounts of ni deposited, the ni l2,3 xanes spectrum [figure 3c] was acquired in secondary electron yield mode (see materials and methods section) therefore, the use of sey mode is not limiting the surface sensitivity of the measurement . The photon energy at which adsorption at the l3 edge occurs (approximately 853 ev) is consistent with previous reports for both metallic ni and nio samples . In the case of postoxidized samples the main features of the characteristic line shape of nio are observed . Namely, the intensity of the l2,3 white lines with respect to the background is increased due to the oxidation of metallic ni, resulting in an increased number of d holes for oxidized ni species . X - ray absorption spectra of the pristine surface, with 0.1 ni adatoms, and after postoxidation to nio (black, red, and blue curve, respectively). Features related to ti coordinated in tetrahedral or octahedral environment are indicated by td and oh, respectively . Here we studied the interaction of h2o with the nio - loaded srtio3(110)-(4 1) surface by means of ups / xps and leis . The valence states of the adsorbed molecule allow distinguishing whether water is adsorbed molecularly or dissociatively . Molecularly adsorbed h2o is characterized by its 1b1, 3a1, and 1b2 valence orbitals, with typical binding energies of 7, 10, and 14 ev, respectively . On the other hand, oh species are characterized by their 1 (6 ev) and 3 (11 ev) valence orbitals . Figure 4 shows valence band and o 1s core level photoemission spectra before (blue) and after (green) dosing 50 langmuirs (1 langmuir = 1.33 10 mbar s) of h2o on a (4 1) surface with 0.1 nio . An increased density of states is found in regions commonly assigned to adsorbed oh, i.e., the oh 3 state at 11 ev binding energy [see inset of figure 4a, in which the spectra are aligned to the o 2s peak at eb 22 ev to highlight differences], and the high binding - energy shoulder of the o 1s core - level [inset of figure 4b, again with aligned o 1s peak energies]. After dosing 50 langmuirs of h2o, (a) valence band and (b) o 1s photoemission spectra of nio - loaded surfaces before (blue) and after (green) dosing 50 langmuirs of water at rt . The inset of (a) shows a zoom into the oh 3 region (spectra aligned to the o 2s peak at 22 ev). Inset of (b) shows the o 1s high binding - energy region after aligning the spectra to the corresponding main peak . A different approach for detecting adsorbed water is low - energy he ion scattering (leis). Leis is considered one of the most surface sensitive spectroscopic techniques with the ability of resolving small mass differences by choosing a suitable primary ion mass . Figure 5 shows ion scattering spectra of differently treated srtio3(110)-(4 1) surfaces . The spectrum of the pristine (4 1) surface (black curve) shows peaks related to he ions scattered at o (400 ev), ti (710 ev), and sr (795 ev) atoms . It should be mentioned that upon impingement of 1000 ev he ions a progressive degradation of the surface is observed, most likely due to intermixing of the first few surface layers . In particular, an inversion of the apparent ti to sr ratio is visible already after 15 scans (each scan takes about 1 min; the ion currents ranged from 15 to 23 na, which translates into a total ion fluence of (1.11.7) 10 ions / cm for each spectrum). In order to limit beam damage as much as possible while still retaining good statistics, we used only the sum of the first four scans for each leis spectrum in figure 5 . To investigate the adsorption of water on the nio - loaded srtio3(110)-(4 1) surface, we performed leis after dosing up to 100 langmuirs (1.3 10 mbar 1000 s) of isotopically labeled water (h2o). Dosing up to 100 langmuirs of h2o onto the pristine surface does not introduce any further features in the leis spectrum, consistent with the inert nature of this surface . We successively deposited increasing amounts of nio onto the surface and subsequently dosed up to 100 langmuirs of h2o, and each spectrum in figure 5 corresponds to a freshly prepared sample . Nickel introduces a peak in leis spectra at a kinetic energy of approximately 770 ev . This peak is assigned to he ions scattered at o belonging to adsorbed water . The spectra acquired on samples with different amounts of nio clearly show that water binds to the nio - loaded surface, in agreement with the photoemission data in figure 4 . The existence of a larger o peak in the case of 0.2 nio compared to the case of 0.3 nio (close to full coverage) possibly indicates that either h2o adsorption or dissociation takes place at the nio / srtio3 boundary . Low - energy he ion scattering spectra acquired on the pristine srtio3(110)-(4 1) and after depositing different amounts of nio with subsequent dosing of 100 langmuirs of h2o . The combination of various spectroscopic techniques and direct - space imaging provides new insights into the nio / sto system . Ups and xanes results indicate that the deposition of nio onto the sto(110)-(4 1) surface effectively reduces the band gap of the system from 3.2 to approximately 1.7 ev . This change is visible in the altered onset of the valence band when nio is present at the surface as well as in the relatively stable positions (within 0.2 ev) of ti l2,3 xanes peaks (probing the cbm) with and without nio . Assuming that this vbm shoulder is hybridized with the o 2p valence band, these results suggest a considerable reduction of the band gap of the system nio / sto, allowing harvesting of visible light (1.7 ev corresponding to 729 nm, i.e., near - infrared). Although the present data do not provide information on hybridization of these states, it is known from experiments with n - doped tio2 that such vbm shoulders can considerably enhance the visible - light response in photocatalysis experiments . In addition, a pronounced (up to 0.8 ev) upward band bending is observed for the nio - loaded surface . Photogenerated excitons can effectively dissociate in the electrostatic potential gradient related to the band bending, which drives electrons toward the bulk of the substrate and holes to the very surface, provided that extended states exist to allow charge transport before electron the excess holes located at the surface can then participate in the catalytic splitting of adsorbed h2o . Combining stm and xanes, a disruption of the reconstructed surface lattice the resulting defects probably represent favorable adsorption sites for water, which is also consistent with ion scattering results . Leis shows a higher water signal for the surface with 0.2 nio compared to the nearly full coverage obtained upon depositing 0.3 nio . This indicates that the adsorption may take place at the circumference of the nio patches, i.e., at the triple phase boundary nio / sto / uhv . No interdiffusion of ni was detected; i.e., the two oxide phases are well separated . It should be mentioned that the patches observed in stm possibly consist of a mixed ni ti oxide phase, since the amount of reactively deposited ni resulting in a nearly full coverage (0.3) approximately corresponds to 33% of a single nio(110) layer . Such a mixed oxide phase might contribute to the damping of the tetrahedral feature in xanes . In a previous study, we argued about the inertness of the pristine (4 1) surface to be caused by the undistorted tetrahedra forming the surface reconstruction . Therefore, the distortion or disruption of these tetrahedra could be a reason for the enhanced reactivity of the surface toward water adsorption . We have studied the morphology and electronic structure of the nio - modified srtio3(110)-(4 1) surface . An in - gap state, formed by the deposition of metallic ni onto this surface, is transformed into a valence band shoulder upon oxidation of the ni into nio . This effectively increases the vbm with the cbm being unchanged, as seen in xanes, and therefore decreases the band gap of the system . Furthermore, xanes results indicate that surface tio4 tetrahedra get considerably distorted or disrupted upon bonding with nio, as is also evident from stm images of nio - covered surfaces . Ups and leis experiments confirm that the nio activates the surface toward dissociative adsorption of h2o, possibly involving sites at the interface between nio patches and the substrate. |
According to the world health organization's classification of glomerular diseases, both thrombotic microangiopathy (tma) and fibrillary glomerulonephritis (fgn) consist of glomerular lesions, the former in the context of a vascular disease and the latter in the setting of a metabolic disease . Anti - glomerular basement membrane (gbm) antibody glomerulonephritis is considered to be a glomerular nephritis of a systemic disease . Here, we report an anti - gbm antibody - positive patient with fgn associated with tma . Our patient was a 54-year - old male who presented with anuria, fever, and lower - leg edema . On june 3, 2012, the patient visited the urology department of a local community hospital with macroscopic hematuria and dysuria . He was diagnosed with acute prostatitis and began treatment with levofloxacin hydrate, loxoprofen sodium hydrate, and cernitin pollen extract . However, his condition did not improve, and he subsequently developed lower extremity numbness, bilateral flank pain, and diarrhea, followed by anuria . On june 11, he visited another hospital in his community and was eventually transferred to our hospital on june 13 for inpatient treatment of possible acute kidney injury . Physical examination on admission revealed the following: height 175 cm; body weight 80 kg; systolic and diastolic blood pressure values 179 and 102 mm hg, respectively; pulse 98 beats / min (regular), and body temperature 37.9c . G / l), blood (+ + +), pyuria, and a fractional sodium excretion rate of 20.3% . Hematological analyses of peripheral blood yielded a white blood cell count of 9.61 10 cells / l (neutrophils 85.0%, lymphocytes 8.5%), a red blood cell count of 3.44 10 cells / l, a hemoglobin level of 100 g / l, the presence of fragmented red blood cells, and a platelet count of 90 10 cells / l . G / l, the prothrombin time was 45.6 s, and the fibrinogen level was 4.1 serum biochemistry tests yielded a blood urea nitrogen level of 58.1 mmol / l and a creatinine level of 2,044 mol / l, suggesting significant renal impairment . Iu / l, and the haptoglobin level was below 1.2 mol / l . The patient had hypoproteinemia, as evidenced by a total serum protein level of 58 serum samples were negative for anti - nuclear antibodies as well as myeloperoxidase- and proteinase 3-specific antineutrophil cytoplasmic autoantibodies, although anti - gbm antibody levels were high at 230 elisa units . The patient reported a history of cervical disc herniation diagnosed at the age of 52 years . He had no noteworthy family history and was not taking any medications on a regular basis at the time of admission to our hospital . Changes in platelet counts, lactate dehydrogenase levels, and mean blood pressure over time during the 119-day hospital stay are schematically represented in figure 1, along with major therapeutic interventions . Computed tomography (ct) imaging conducted on admission indicated renal atrophy and ascites, but no collapse of the inferior vena cava . These findings negated the possibility of prerenal and postrenal failure and suggested an acute aggravation of chronic kidney disease rather than a typical acute kidney injury . Since the patient had not undergone regular medical checkups, it was not clear whether proteinuria had existed in the past . During the early hospitalization period, we administered -globulin, diuretics, and hemodialysis, under the assumption that the patient had either sepsis- or drug - induced acute kidney injury . Peripheral blood smears revealed the presence of fragmented red blood cells (hospital day 2), suggesting hemolytic uremic syndrome (hus) resulting from food poisoning caused by escherichia coli o-157:h7 or other pathogenic strains . However, the patient had no diarrhea and was negative for intestinal pathogens and verotoxins . Epistaxis developed on hospital day 4, platelet counts and hemoglobin levels decreased to 29 10 cells / l and 55 g / l, respectively, and the lactate dehydrogenase level rose to 1,253 iu / l . The patient's anemia was unresponsive to erythropoiesis - stimulating therapy, and frequent blood transfusions were required (i.e., a total of 16 units of irradiated red cell concentrates). The patient was diagnosed with tma [thrombotic thrombocytopenic purpura (ttp) or hus] based on the following findings: thrombocytopenia, hemolytic anemia evidenced by anemic signs and elevated lactate dehydrogenase levels, signs of renal impairment, fever, bleeding episodes (i.e., epistaxis), neuropsychiatric manifestations (i.e., headache), direct and indirect coombs test results, and haptoglobin levels below 1.2 assays conducted several days later indicated an adamts13 activity of 31.6% (reference range 70 - 120%), and adamts13 inhibitors were negative . These findings led us to administer plasma exchange therapy with a total of 30 units of fresh frozen plasma, starting on hospital day 8 . On hospital day 15, steroid pulse therapy (3 methylprednisolone doses of 1,000 mg / day) was initiated to lower the elevated anti - gbm antibody level . Following the completion of this 3-day course, the patient was given oral prednisolone at a starting dose of 50 mg / day, which was gradually tapered and discontinued . After this, platelet counts rose to 197 10 cells / l, and kidney biopsy was conducted on hospital day 22 (fig . Seventeen glomeruli examined by optic microscopy all showed destructive patterns with characteristic architecture ranging from atypical proliferative changes to global sclerosis . Renal arterioles, both afferent and efferent, showed extensive endothelial cell edema and swelling, indicative of glomeruloid changes . Electron microscopy showed that the loss of glomerular structure observed under optic microscopy was the result of an extensive and dense extracellular deposition of fibrillar components, which were larger in diameter than amyloid fibers and aggregated to form large bundles . Immunofluorescence analysis for immunoglobulin g and third component (c3) deposits was not carried out because of glomerular collapse . Available findings supported the diagnosis of fgn involving severe glomerular destruction . On hospital day 29, a second course of steroid pulse therapy was started due to significantly decreased platelet counts . On hospital day 46, the mean blood pressure values started to increase gradually . Although the target body weight was lowered and arotinolol hydrochloride and methyldopa hydrate were added to nifedipine and candesartan cilexetil, these measures did not achieve successful blood pressure control . On hospital day 56, the patient had a mild seizure . T2-weighted fluid - attenuated inversion recovery (flair) magnetic resonance scans of the bilateral cerebellum, occipital lobe, and parietal lobe showed multiple high - intensity areas, suggesting a diagnosis of reversible posterior leukoencephalopathy syndrome (fig . Carvedilol, nifedipine, and nitroglycerin infusion, hypertension persisted, and the patient's headache continued . On hospital day 61, generalized convulsions recurred, and head ct images showed multiple hemorrhagic lesions in the right temporal, right parietal, and right frontal lobes (fig . Blood pressure levels gradually decreased with the increase in platelet counts, starting around hospital day 65 . On hospital day 72, the patient started rehabilitation exercises . Fgn and immunotactoid glomerulonephritis are characterized by electron - dense deposits of fibrillary structures in the glomerular extracellular matrix . For both conditions, optical microscopy of renal biopsies fgn is characterized by randomly oriented nonbranching fibrils with a mean diameter of 15 - 25 nm, a size comparatively larger than that of amyloid fibrils (8 - 10 nm). In our case, although immunofluorescence analysis of immunoglobulin g and c3 was not conducted because of glomerular collapse, the diagnosis of fgn was established based on the negative congo red staining and electron microscopy findings . The term tma designates pathological conditions characterized by microangiopathic hemolytic anemia, thrombocytopenia resulting from peripheral destruction of platelets, and organ damage due to platelet thrombi (notably, renal impairment). The differential diagnoses include disseminated intravascular coagulation syndrome, idiopathic thrombocytopenic purpura, heparin - induced thrombocytopenia, paroxysmal nocturnal hemoglobinuria, and systemic lupus erythematosus . Analyses of adamts13 activity and adamts13 inhibitors and further investigation suggested that idiopathic ttp or hus, autoimmune diseases or malignant tumors were highly probable diagnoses . Considering that adamts13 activity and observed clinical signs did not meet the diagnostic criteria for atypical hus, we judged that atypical ttp was more likely than atypical hus . They are present at high levels in patients with anti - gbm nephritis and goodpasture's syndrome, a condition often culminating in rapidly progressive glomerulonephritis . The likelihood of goodpasture's syndrome was rejected in our case because the patient did not present with any pulmonary disorders . While admitting the possibility that high levels of anti - gbm antibodies had a complicating impact on tma or fgn, we considered it unlikely that anti - gbm nephritis was the primary cause given the renal biopsy findings . With all of the above taken into consideration, we concluded that the patient had fgn associated with tma and high levels of anti - gbm antibodies . Our literature search identified a patient with fgn who was diagnosed as having anti - gbm glomerulonephritis based on immunofluorescence microscopy findings . This patient was found to be negative for circulating anti - gbm antibodies 1 week after the start of treatment . This example illustrates the possibility that the anti - gbm antibody status could shift from positive to negative over time in patients with anti - gbm nephritis, suggesting that anti - gbm antibodies may have aggravated the fgn in our patient . A literature search conducted in 2011 identified 11 reported cases of tma patients positive for anti - gbm antibodies . Due to tma - induced glomerular collapse, we did not attempt to diagnose anti - gbm nephritis via immunofluoroscopy examination of immunoglobulin g or c3 depositions . The fact that our patient was positive for anti - gbm antibodies may suggest that he had anti - gbm nephritis . Deficiency of factor h induces uncontrolled activation of the alternative pathway and c3 consumption, resulting in endothelial injury . Research suggests that factor h mutations confer a predisposition to the development of hus, and factor h deficiency has been reported in anecdotal cases of fgn and membranoproliferative glomerulonephritis type ii . These findings suggest that decreased levels of factor h contributed to the co - occurrence of fgn and tma . However, the direct relation of fgn and tma through factor h was not accepted because the factor h was within normal levels in our case . There may be a relationship between fgn and tma through anti - gbm antibody in our case . Reversible posterior leukoencephalopathy syndrome (rpls) is characterized by neurologic conditions resulting from hypertensive cerebral edema . To the best of our knowledge, 6 cases of antineutrophil cytoplasmic autoantibody - negative anti - gbm disease with central nervous system involvement have been reported in the literature . It is likely that rpls was caused by hypertension, which developed from the combination of anti - gbm antibody- and tma - induced vasculitis, judging from uncontrolled rises in blood pressure and the onset of numbness and seizures . Our medical opinion was supported by a retrospective analysis of 46 acute ttp patients by burrus et al ., which showed that renal function was the only variable highly associated with the occurrence of rpls on brain magnetic resonance imaging in acute ttp patients . Plasma exchange therapy can effectively improve atypical ttp through the following mechanisms: elimination of ultralarge von willebrand factor multimers; supplementation of normal - size von willebrand factor multimers, which play an important role in blood coagulation; removal of proinflammatory cytokines from the circulation; elimination of adamts13 inhibitors, and supplementation with adamts13 . A previous study reported a case of fgn in which repeat plasma exchange therapy resulted in remission of refractory nephrotic syndrome . These previous findings suggest that plasma exchange therapy contributed to improving both tma and fgn in our case. |
Traditionally, the presence of specific clinical signs and symptoms coupled with abnormalities in cardiacspecific measurements and estimates of endorgan dysfunction generates an integrated view of an individual patient's risk profile . Recently, the broad acceptance of novel bloodbased biomarkers has emerged in the arena of risk stratification, even though the true incremental value of such measures in routine clinical practice has been challenged in populationbased studies . The ability to determine functional capacity has relied on subjective assessment based on direct patient interviews during the history and physical examination and objectively by quantifying measures identified from standardized exercise testing . Standardized instruments to assess functional capacity and/or health status have been developed, but their clinical adoption has been challenged by both logistical hurdles and an emphasis on hard clinical end points in the determination of treatment responses . Remarkably, few studies have undertaken the prospective validation of the functional capacity measures in the prediction of future major adverse cardiac outcomes beyond allcause mortality alone or direct comparisons with clinically available biomarkers . Here, we sought to determine the prognostic value of estimating functional capacity using a simple selfadministered assessment tool in a contemporary stable cardiac patient population . The genebank study was conducted via prospective screening of patients aged 18 years who underwent elective coronary evaluation with coronary angiography or computed tomography between 2001 and 2007 . Consecutive patients were screened and considered for enrollment without intentional exclusion . At the time of enrollment, we excluded patients who had known acute coronary syndrome within 30 days of enrollment and those who were unable to comply with or unwilling to follow study protocol . All potentially eligible patients were approached, and those who agreed to participate were provided with written informed consent . All clinical characteristics were determined by patient selfreport and confirmed by clinical histories from electronic medical record . Coronary artery disease (cad) was defined as any clinical history of myocardial infarction (mi), percutaneous coronary intervention, or coronary artery bypass graft surgery . Peripheral artery disease (pad) was defined as a selfreported history of noncad cardiovascular disease and/or history of or repair of aortic dissection / aneurysm . Selfreported degree of angina was quantified by canadian cardiovascular society (ccs) angina classification . The duke activity status index (dasi) questionnaire is a selfassessment tool to estimate functional capacity, which includes 12 activities representative of major aspects of physical function (personal care, ambulation, household tasks, sexual function, and recreational activities). A score is calculated based on weighted answers from 12 questions related to daily activities of living, for which each item is weighted by its known metabolic cost, and weights of positive terms are summed to form the individual patient dasi score . The possible scores range from 0 (all no answers) to 58.2 (all yes answers). The dasi assessment was prospectively performed in this study as a predefined assessment of signs and symptoms related to activities of daily living at the time of enrollment and was performed by study personnel in a systematic manner whereby only definitive answers were scored . Specifically, trained research personnel approached each patient shortly after informed consent to administer the dasi questionnaire . Estimated peak oxygen consumption was calculated according the original formula from hlatky and colleagues: peak vo2 (in mlkgmin)=0.43dasi+9.6, whereas metabolic equivalent (met) was calculated as: 1 met=3.5 mlkgmin vo2 . All 8987 patients were followed prospectively over the ensuing 3 years by telephone contact, mailing, and medical record review by designated research personnel independent of study investigators . All major adverse cardiovascular events (mace), defined as death, nonfatal mi, or nonfatal stroke after enrollment, were adjudicated with source documentation . Significantly obstructive cad was defined as any clinical history of mi, percutaneous coronary intervention, coronary artery bypass graft surgery, or angiographic evidence of cad (50% stenosis) in 1 major coronary artery . Subsequent mi was adjudicated from source documentation with supporting evidence including elevated cardiac enzymes, significant qwave definitive electrocardiographic evidence of new infarction, the presence of myocardial wall akinesis or scar on imaging, or treatment with thrombolytic agents or direct percutaneous intervention . Stroke was defined as documented loss of neurologic function caused by an ischemic event with residual symptoms continuing 24 hours after onset (not to include transient ischemic attacks, microvascular infarcts, or amarosis fugax). Blood samples were obtained either via venipuncture (in the case of coronary computed tomography patients) or during diagnostic coronary angiographic procedure right after arterial sheath access but before any heparin administration . The biomarker subset included 4805 patients, for whom stored samples were randomly selected to undergo biomarker testing in a central core laboratory . Specifically, highsensitivity creactive protein (hscrp), btype natriuretic peptide (bnp), creatinine, fasting lipid profile, apolipoprotein a1 (apoa1), and apolipoprotein b (apob) were all measured in the architect ci8200 platform (abbott laboratories). Myeloperoxidase (mpo) was measured by using the cardiompo assay kit (cleveland heart lab). Total leukocyte count was measured by using the advia 120 hematology system (siemens medical systems). We used the student's t test or wilcoxon rank sum test for continuous variables and test for categorical variables for betweengroup comparisons . Cox proportional hazards regression was used for timetoevent analysis to determine hazard ratio (hr) and 95% confidence intervals (cis) for mace in comparing the highest with the lowest dasi quartiles for each cohort of interest . Adjustments were made for individual traditional cardiac risk factors (including age, sex, lowdensity and highdensity lipoprotein cholesterol, systolic blood pressure, former or current cigarette smoking, and diabetes mellitus) to predict incident 3year mace risk . The survival curve was derived using kaplan meier survival analysis . A cubic spline term of dasi was fitted in the cox model to assess how the spectrum of dasi scores related to the hr of mace . A nomogram for mace based on survival models was constructed (details of the nomogram construction methods are listed in data s1 as previously published) to visually display the predicted probability of a mace event from a multivariate cox model . Net reclassification analysis was performed to quantify improvement in models with and without dasi scores . In cutoff values for net reclassification index estimation, we used a ratio of 6:3:1 for low, medium and highrisk categories . Comparison between dasi score and adult treatment panel iii score, which estimates the 10year risk of developing cad outcomes (mi or coronary death), was performed by resampling (250 bootstrap samples from the whole cohort [n=8987]). All data analyses, including receiver operator characteristic analyses and area under the curve (auc) determinations, were separately recalculated at each resampling, and the aucs calculated from the bootstrap samples were compared . The genebank study was conducted via prospective screening of patients aged 18 years who underwent elective coronary evaluation with coronary angiography or computed tomography between 2001 and 2007 . Consecutive patients were screened and considered for enrollment without intentional exclusion . At the time of enrollment, we excluded patients who had known acute coronary syndrome within 30 days of enrollment and those who were unable to comply with or unwilling to follow study protocol . All potentially eligible patients were approached, and those who agreed to participate were provided with written informed consent . All clinical characteristics were determined by patient selfreport and confirmed by clinical histories from electronic medical record . Coronary artery disease (cad) was defined as any clinical history of myocardial infarction (mi), percutaneous coronary intervention, or coronary artery bypass graft surgery . Peripheral artery disease (pad) was defined as a selfreported history of noncad cardiovascular disease and/or history of or repair of aortic dissection / aneurysm . Selfreported degree of angina was quantified by canadian cardiovascular society (ccs) angina classification . The duke activity status index (dasi) questionnaire is a selfassessment tool to estimate functional capacity, which includes 12 activities representative of major aspects of physical function (personal care, ambulation, household tasks, sexual function, and recreational activities). A score is calculated based on weighted answers from 12 questions related to daily activities of living, for which each item is weighted by its known metabolic cost, and weights of positive terms are summed to form the individual patient dasi score . The possible scores range from 0 (all no answers) to 58.2 (all yes answers). The dasi assessment was prospectively performed in this study as a predefined assessment of signs and symptoms related to activities of daily living at the time of enrollment and was performed by study personnel in a systematic manner whereby only definitive answers were scored . Specifically, trained research personnel approached each patient shortly after informed consent to administer the dasi questionnaire . Estimated peak oxygen consumption was calculated according the original formula from hlatky and colleagues: peak vo2 (in mlkgmin)=0.43dasi+9.6, whereas metabolic equivalent (met) was calculated as: 1 met=3.5 mlkgmin vo2 . All 8987 patients were followed prospectively over the ensuing 3 years by telephone contact, mailing, and medical record review by designated research personnel independent of study investigators . All major adverse cardiovascular events (mace), defined as death, nonfatal mi, or nonfatal stroke after enrollment, were adjudicated with source documentation . Significantly obstructive cad was defined as any clinical history of mi, percutaneous coronary intervention, coronary artery bypass graft surgery, or angiographic evidence of cad (50% stenosis) in 1 major coronary artery . Subsequent mi was adjudicated from source documentation with supporting evidence including elevated cardiac enzymes, significant qwave definitive electrocardiographic evidence of new infarction, the presence of myocardial wall akinesis or scar on imaging, or treatment with thrombolytic agents or direct percutaneous intervention . Stroke was defined as documented loss of neurologic function caused by an ischemic event with residual symptoms continuing 24 hours after onset (not to include transient ischemic attacks, microvascular infarcts, or amarosis fugax). Blood samples were obtained either via venipuncture (in the case of coronary computed tomography patients) or during diagnostic coronary angiographic procedure right after arterial sheath access but before any heparin administration . The biomarker subset included 4805 patients, for whom stored samples were randomly selected to undergo biomarker testing in a central core laboratory . Specifically, highsensitivity creactive protein (hscrp), btype natriuretic peptide (bnp), creatinine, fasting lipid profile, apolipoprotein a1 (apoa1), and apolipoprotein b (apob) were all measured in the architect ci8200 platform (abbott laboratories). Myeloperoxidase (mpo) was measured by using the cardiompo assay kit (cleveland heart lab). Total leukocyte count was measured by using the advia 120 hematology system (siemens medical systems). We used the student's t test or wilcoxon rank sum test for continuous variables and test for categorical variables for betweengroup comparisons . Cox proportional hazards regression was used for timetoevent analysis to determine hazard ratio (hr) and 95% confidence intervals (cis) for mace in comparing the highest with the lowest dasi quartiles for each cohort of interest . Adjustments were made for individual traditional cardiac risk factors (including age, sex, lowdensity and highdensity lipoprotein cholesterol, systolic blood pressure, former or current cigarette smoking, and diabetes mellitus) to predict incident 3year mace risk . A cubic spline term of dasi was fitted in the cox model to assess how the spectrum of dasi scores related to the hr of mace . A nomogram for mace based on survival models was constructed (details of the nomogram construction methods are listed in data s1 as previously published) to visually display the predicted probability of a mace event from a multivariate cox model . Net reclassification analysis was performed to quantify improvement in models with and without dasi scores . In cutoff values for net reclassification index estimation, we used a ratio of 6:3:1 for low, medium and highrisk categories . Comparison between dasi score and adult treatment panel iii score, which estimates the 10year risk of developing cad outcomes (mi or coronary death), was performed by resampling (250 bootstrap samples from the whole cohort [n=8987]). All data analyses, including receiver operator characteristic analyses and area under the curve (auc) determinations, were separately recalculated at each resampling, and the aucs calculated from the bootstrap samples were compared . Table 1 shows the baseline characteristics of the study population, which is representative of a contemporary patient population undergoing elective diagnostic coronary angiography (see data s2). The reasons for angiography included history of positive or indeterminate stress test (45%), evaluation for possible ischemic causes of symptoms (63%), preoperative evaluation (15%), and history of cardiomyopathy (4%). The median dasi score was 38.2 (iqr 24.2 to 50.7), which corresponded to an estimated peak oxygen consumption of 26 ml / kg per minute (iqr 20 to 31 ml / kg per minute). As expected, patients with a lower dasi score were more likely to be older and female and to have an underlying history of hf, previous mi, or pad (table 1). We observed the association between lower dasi score with higher likelihood of underlying cad (quartile 4 versus quartile 1 of dasi score, unadjusted odds ratio [or] 2.99, 95% ci 2.59 to 3.46, p<0.01) or pad (unadjusted or 5.65, 95% ci 4.74 to 6.73, p<0.01). After adjustment for traditional risk factors, the association remained statistically significant (cad: adjusted or 2.65, .95% ci 2.22 to 3.15, p<0.01; pad: adjusted or 4.61, 95% ci 3.73 to 5.71, p<0.01). Baseline characteristics for whole cohort and across quartiles of duke activity status index (dasi) score cad indicates coronary artery disease; mi, myocardial infarction; hf, heart failure; pad, peripheral artery disease; lvef, left ventricular ejection fraction; bmi, body mass index; ldl, lowdensity lipoprotein; hdl, highdensity lipoprotein; hscrp, highsensitivity creactive protein; egfr, estimated glomerular filtration rate; mpo, myeloperoxidase; bnp, btype natriuretic peptide; wbc, total leukocyte count; apoa1, apolipoprotein a1; apob, apolipoprotein b; ace, angiotensinconverting enzyme; arb, angiotensin ii receptor blocker . The relationship between dasi score and incident cardiovascular risk is illustrated in figure 1, in which the kaplan meier analysis revealed that lower dasi score (across quartiles of dasi score as well as estimated mets) is associated with a greater risk of future development of mace . Over a 3year prospective followup period, there were a total of 829 deaths, 404 mis, and 178 strokes in our study cohort . We observed that a lower dasi score was associated with a higher risk of future death, mi, or stroke (quartile 4 versus quartile 1 of dasi score, unadjusted hr 4.76, 95% ci 4.03 to 5.61, p<0.01). The prognostic value of dasi score was preserved when adjusted for traditional risk factors (adjusted hr 3.77, 95% ci 3.15 to 4.51, p<0.01) or even plus history of heart failure and history of pad (adjusted hr 2.89, 95% ci 2.39 to 3.50, p<0.01) and in cohorts with and without significantly obstructive cad (table 2). As illustrated by the cubic spline curve, the risk for future mace appeared to be steep and linear, with hr significantly above unity, particularly for dasi scores <38 (or the median, figure 2). Lower dasi scores also predicted higher future risk of mace at 3 years regardless of age, sex, body mass index, diabetes mellitus, hypertension, lipid status, hscrp status, or prior mi (all p<0.01, figure 3). The prognostic value of dasi score was also consistent regardless of the clinically assessed ccs angina class (see data s3). Use of dasi score over traditional risk factors was also shown to reclassify patients (net reclassification index 15%, p<0.001; integrated discrimination improvement 13%, p<0.001; cstatistics 66.5% versus 71.5%, p<0.001). Direct headtohead comparison also demonstrated that dasi score provided more robust prediction of future development of mace over a 3year period than did the adult treatment panel iii score (auc: 0.67 [95% ci 0.66 to 0.69] versus 0.59 [0.57 to 0.60], p<0.001) in our study population . Combining traditional risk factors and comorbidities with dasi score, a nomogram is constructed with a point scoring system indicative of prospective risk for future mace at 3 years (figure 4). Kaplan meier analysis of duke activity status index (dasi) scores in predicting future risk of major adverse cardiac events in stable cardiac patients undergoing elective coronary angiography according to dasi quartiles (a) and estimated metabolic equivalents (mets, b). Ranges of dasi and mets are the same as for groups in tables 2 and 3 . Unadjusted and adjusted hazard ratio (hr) for major adverse cardiac events at 3 years stratified according to quartiles of dasi score model 1: adjusted for traditional risk factors including age, sex, systolic blood pressure, lowdensity lipoprotein cholesterol, highdensity lipoprotein cholesterol, smoking, and diabetes mellitus . Model 2: adjusted for model 1 plus history of heart failure and peripheral artery disease . Cad indicates coronary artery disease; dasi, duke activity status index . Unadjusted and adjusted hazard ratio (hr) for major adverse cardiac events at 3 years stratified according to previously reported metabolic equivalents (mets) categories model 1: adjusted for traditional risk factors including age, sex, systolic blood pressure, lowdensity lipoprotein cholesterol, highdensity lipoprotein cholesterol, and smoking, diabetes mellitus . Model 2: adjusted for model 1 plus history of heart failure and peripheral artery disease . Cubic spline curve for hazard ratios for major adverse clinical events (mace) at 3 years with duke activity status index (dasi) scores . Subgroup analysis of duke activity status index (dasi) scores and future risk of major adverse cardiac events (mace) according to standard cardiac biomarkers . Hazard ratio (xaxis) of 3year mace similar to that presented in table 2 (quartile 4 vs quartile 1 of dasi score) but across subgroups of different biomarker cutoffs . Apoa1 indicates apolipoprotein a1; apob, apolipoprotein b; bnp, btype natriuretic peptide; egfr, estimated glomerular filtration rate; hdl, highdensity lipoprotein; hscrp, highsensitivity creactive protein; ldl, lowdensity lipoprotein; mpo, myeloperoxidase; wbc, white blood cell count . Nomogram for estimating risk of major adverse cardiac events (mace) incorporating duke activity status index (dasi) score with traditional risk factors hdl indicates highdensity lipoprotein; ldl, lowdensity lipoprotein; sbp, systolic blood pressure . In the subset of patients with biomarkers measured (n=4805), there were no significant differences in baseline characteristics compared with those without biomarker assessment . Lower dasi scores remained prognostically significant in both high and low levels of fasting lipid profiles, hscrp, and bnp, as well as total leukocyte count and mpo . In fact, the predictive value of dasi score in predicting future mace (auc: 0.67 [95% ci 0.66 to 0.69]) appears to be comparable with commonly used prognostic cardiac biomarkers such as bnp (auc: 0.68 [95% ci 0.66 to 0.70] or hscrp (auc: 0.61 [95% ci 0.59 to 0.64]). When hscrp, bnp, and estimated glomerular filtration rate were all added to the multivariate model that included traditional risk factors, lower dasi score (quartile 4 versus quartile 1) still demonstrated a significant 2fold increased risk in future mace at 3 years (adjusted hr 2.00, 95% ci 1.55 to 2.58, p<0.01). The key finding of this study is the strong prognostic value of functional capacity estimated by using a simple 12question evaluation tool in a large, contemporary cohort of stable cardiac patients undergoing coronary angiography . We observed that the functional capacity estimated with the dasi score is incremental and superior to that of traditional cardiovascular risk factors, with or without underlying heart failure . We further established the association between functional capacity estimated by dasi score and markers of inflammation and oxidative stress in a subset of patients . Taken together, our findings underscore the relative importance of objectively determining the functional capacity for purposes of risk stratification in cardiac patients . Although the dasi questionnaire was developed over 2 decades ago, the primary focus in using this selfassessment tool thus far has been to estimate functional capacity in the setting of preoperative evaluation or prediction of underlying ischemia . While the original objective of dasi was to estimate functional capacity, the responses can also be used to assess physical limitations relevant to an individual's quality of life and to potentially uncover significant problems related to patients who experienced cad, pad, or heart failure . The importance of prognostication of dasi in our study, particularly with its strong incremental value to traditional risk factors and cardiac biomarkers, underscores the need to systematically assess how dasi score can be of clinical utility . Indeed, the findings of our study may not be limited to dasi or even to cad patients, in that other instruments that assess daily physical activity such as the rand physical limitation scale or the kansas city cardiomyopathy questionnaire for heart failure have also demonstrated their incremental prognostic utilities and responses to therapeutic interventions . These latter instruments aim to assess health status and have not been evaluated as to whether they correlate directly with functional capacity . Interestingly, the design of dasi queries an individual's selfperception of his or her functional capacity (ie, what an individual is able to do) rather than a direct recall of prior physical activities and/or limitations . Therefore, the dasi questionnaire may potentially overestimate the actual functional capacity as illustrated in the validation studies, yet this further underscores an even greater importance for a standardized instrument such as the dasi questionnaire to estimate functional capacity when the ability to reclassify risk may be up to 15% as shown in our study . While the prognostic value for functional capacity as determined by standardized exercise testing has been well established, the requirements of testing skills, equipment, and experience often hinder broad adoption . At the other end of the spectrum, simple grading systems such as new york heart association classification and ccs angina classification have aided physicians in communicating the degrees of symptomatic severity, yet they are often subjective and imprecise . Hence, the ability for a series of questions that can be collected at the bedside (or adapted to remote monitoring devices or portals) to risk stratify patients for future mace above and beyond established prognostic cardiac biomarkers speaks to the enduring importance of bedside evaluation of patientcentered reporting of functional limitations in the era of biomarker testing . Our findings also highlight the limitations of any clinical or biochemical measure to adequately quantify functional limitations that may be more meaningful to patients . Based on our findings, the quest is to examine what treatment strategies (eg, the ability to detect impaired functional capacity as a target of physical training and cardiac rehabilitation) can be effectively incorporated in those patients with low dasi scores to improve their perceived or objective functional capacity and to determine whether such interventions can modify the natural history of the disease . Few studies have directly examined the potential use of dasi to predict longterm adverse cardiovascular risk in a broad patient population with stable cardiac disease . Indeed, the women's ischemia syndrome evaluation (wise) study was one of the first studies to identify that functional impairment estimated by the dasi correlates with indeterminate exercise test results and is associated with an adverse prognosis among women with suspected myocardial ischemia . Surgical studies also illustrated the finding that poor functional capacity estimated by dasi following cardiac surgery identifies patients who are at risk for reduced longterm survival . Of note, the relationship between dasi score and risk was linear and extended to the higher functional capacity end (higher score). Thus, those who achieved a maximum baseline dasi demonstrated better riskadjusted longterm survival (hr 0.64; 95% ci 0.50 to 0.83; p=0.0005). Such a finding is consistent with improved overall survival conferred by improved functional capacity achieved during cardiac rehabilitation in the post cardiothoracic surgical setting . In the setting of heart failure or chronic kidney disease, the ability to assess functional status and prognosis has been demonstrated . Recent data from a large heart failure cohort further implied that those with changes in dasi scores over 1 year demonstrated stronger association with longterm outcomes than objective assessment (6minute walk distance). These findings are supportive of the ability of improving dasi score as a potential therapeutic target . Future investigations into potential benefits of using dasi scores (especially those with dasi <38) to triage cardiac evaluation and guide therapeutic interventions, such as more indepth evaluation of disability, more aggressive secondary prevention strategies, more intensive cardiac rehabilitation, or closer outpatient followup, are therefore warranted for this higherrisk population . Despite one of the largest studies conducted to date on the prognostic value of dasi and functional capacity in the cardiovascular population, our study has several limitations . The large sample size is reassuring regarding how the results can be generalized, although it may not be completely generalizable beyond the setting of coronary evaluation due to referral and ascertainment bias at the point of recruitment and study (ie, cardiac catheterization laboratory). First, while dasi has been validated in the past as a measure of metabolic capacity and function, there is no objective validation of functional capacity measurement in our large cohort besides angina class, and the ability to respond to the questions is required (thus excluding those that were unable to complete the questionnaires due to their underlying diseases or functional or communication limitations). We did not systematically collect baseline or interim information regarding history of atrial fibrillation and stroke in those enrolled . Second, we only have biochemical analyses on roughly half of the study cohort, although there is still adequate power to determine the incremental prognostic value of the dasi score . Third, although we have provided subgroup assessment in the non heart failure and nonpad cohorts (potential confounding effect due to underlying cardiac and vascular insufficiency), we cannot exclude other reasons that affect an individual's functional limitations . Nevertheless, this also speaks to the power of this simple questionnaire that can depict risks that are otherwise unaccounted for, such as frailty, deconditioning, or psychosocial issues . Last, the fact that there is only a single timepoint assessment may require further studies to determine if improvement in dasi score can be associated with improvement in short and longterm prognosis as implied in the postsurgical or heart failure literature or with treatment strategies such as cardiac rehabilitation . We would also like to emphasize that the nomogram is largely derived to highlight the relative clinical contributions of dasi to the overall prognostic value when other factors of functional capacity are under consideration . All patients were used in deriving the score, and further validation of this score is warranted in an independent study population . The dasi, a selfassessment tool of functional capacity, provides strong independent and incremental prognostic value for longterm adverse clinical events that is comparable to cardiac biomarkers in stable cardiac patients undergoing coronary evaluation. |
Emergency peripartum hysterectomy (eph) is a major surgical venture invariably performed in the setting of life threatening hemorrhage during or immediately after abdominal and vaginal deliveries [15]. Despite advances in medical and surgical fields, post partum hemorrhage continues to be the leading cause of maternal morbidity and mortality . Eph is the most dramatic operation in modern obstetrics and is generally performed when all conservative measures have failed to achieve haemostasis in the setting of life threatening hemorrhage . The unplanned nature of the surgery and the need for performing it expeditiously, compound matters . Moreover the acute loss of blood renders the patient in a less than ideal condition to undergo emergency surgical intervention . The predominant indications for eph are placenta previa / accreta and uterine atony and eph in some of them is unavoidable . However recognizing and assessing patients at risk and appropriate and timely intervention would go a long way in ensuring a better outcome in this otherwise difficult situation . Hysterectomy following cesarean section (cs) was first described by porro, and was used to prevent maternal mortality due to post partum hemorrhage . The reported incidence of eph varies from 0.24 to 8.9 per 1000 deliveries [16], ranging from 0.33(netherland), 0.2 (norway), 0.3 (ireland), 0.5 (israel), 0.63 (saudi arabia) and 1.2 to 2.7 per 1000 deliveries in usa [25810]. A difference in the incidence of eph is noted following vaginal delivery and cesarean section . While the incidence of eph after vaginal delivery varies from 0.1 to 0.3/1000 deliveries and is rather constant between european and us studies, the incidence of eph following cs varies widely between 0.17 and 8.7/1000 deliveries . This is attributed to the proportion of women with previous cs with the concomitant risk of placenta previa andaccreta [16]. The risk factors for post partum hemorrhage include coagulopathies, uterine atony, retained products of conception, precipitate or prolonged labor, fetal macrosomia or multiparity, maternal obesity and previous primary post partum hemorrhage [16814]. According to one report the indication for eph which was uterine atony in 43.45% and placenta previa or accreta in 33.9% cases in 1984 changed 9 years later to placenta accreta (45%) and uterine atony in 20% of the cases . Similar findings are reported by others with abnormal placentation as the predominant indication, the incidence ranging from (45 to 73.3%); and uterine atony in (26.6% to 35.6%) [18815]. In recent years, abnormal placentation has become a more common indication due to the greater number of pregnant women with previous cesarean section deliveries [16]. The incidence of previous cesarean section ranges between 59.8% in patients with adherent placenta and 75% in patients with placenta previa . In view of several such reports, association between abnormal placentation and cesarean delivery has been suggested and the high incidence of eph is directly related to the increasing number of cesarean sections [1616]. This was further substantiated by another report where the incidence of placenta previa which was 1.9/1000 after one previous cs, increased by 47 fold to 91/1000 in patients with four previous cs . Patients with placenta previa and scarred uterus had 16% risk of undergoing eph compared to 3.6% in patients with unscarred uterus . Advancing age and parity are also reported to be important risk factors in developing placenta previa and accrete . The incidence of eph was higher in patients with placenta previa and accreta than in patients with placenta previa alone . The combination of factors including high parity, number of previous cesarean sections, abortion, previous curettage, strongly increased the likelihood of placenta previa and increased risk of abnormal adherent placenta . Therefore, it appears prudent for the obstetrician to prepare for the possibility of eph for massive hemorrhage in patients undergoing cesarean section with these risk factors . Of concern however, is the limited experience of performing emergency hysterectomy among the younger obstetricians as according to one report from netherlands, the average chance of performing one eph is once in 11 years . The decreasing rate of abdominal hysterectomy for gynecological conditions in recent years does not help matters with regard to gaining this valuable experience . This implies that more effort should be undertaken to recognize the potential risk of patients requiring eph and the need for involvement of an experienced obstetrician in the management at an early stage . Eph being performed by an experienced surgeon is reported to significantly reduce the operating time, number of units of blood transfusion and hospital stay . The predisposing risk factors can be determined to a certain extent by performing antenatal ultrasound with color doppler and magnetic resonance imaging (mri) [1820]. However, the limiting factor is the high cost of mri and extensive experience needed . The measures include uterotonic drugs, uterine or hypogastric artery embolisation, hemostatic sutures, uterine or internal iliac artery ligation . Conservative management is of particular importance in patients who are young, have low parity and who are haemodynamically stable . However while there are reports of 96% success rate following uterine artery ligation there are others who have achieved success in only 39.4% of these cases . The choice between conservative management and eph should be individualized . In situations where conservative treatment is likely to fail or has failed, there should be no further delay in performing eph as delay leads to increase in blood loss, transfusion requirement, operative time, dic, and increased possibility of admission to icu [16]. Uterine atony is an indication for eph in 20.6% to 43% of the cases [16817]. While this was traditionally the leading cause for eph the incidence has reduced due to the use of newly developed pharmacologic treatment strategies including prostaglandins . Multiparity and oxytocin use for uterine stimulation were found to be the risk factors for uterine atony requiring eph [16]. Combs et al in their large case control study of patients with post partum hemorrhage reported that pre - eclampsia, nulliparity, twins, induction, prolonged labor and augmentation were all identified as independent risk factors for uterine atony . Patients with uterine rupture as an indication for eph ranged from 11.4% to 45.5% . The risk factor for this would be multiple previous cesarean sections with a scarred uterus (figure 1). Total hysterectomy is the recommended surgical method of eph due to the potential risk of malignancy developing in the cervical stump and the need for regular cytology and other associated problems such as bleeding or discharge associated with the residual cervical stump . Currently the proportion of subtotal hysterectomy performed for eph ranges from 53% to 80% . The proponents of subtotal hysterectomy report a lesser blood loss, a reduced need for blood transfusion, reduced operating time and reduced intra and postoperative complications . Total hysterectomy should however be considered when active bleeding occurs from lower uterine segment as the cervical branch of uterine artery may remain intact . The final decision to perform subtotal or total hysterectomy would be influenced by patient's condition . Hence, while total abdominal hysterectomy is a more convenient procedure, subtotal eph may be a better choice in certain conditions where surgery needs to be completed in a shorter time . Uterine atony is an indication for eph in 20.6% to 43% of the cases [16817]. While this was traditionally the leading cause for eph the incidence has reduced due to the use of newly developed pharmacologic treatment strategies including prostaglandins . Multiparity and oxytocin use for uterine stimulation were found to be the risk factors for uterine atony requiring eph [16]. Combs et al in their large case control study of patients with post partum hemorrhage reported that pre - eclampsia, nulliparity, twins, induction, prolonged labor and augmentation were all identified as independent risk factors for uterine atony . The risk factor for this would be multiple previous cesarean sections with a scarred uterus (figure 1). Uterine rupture with life threatening hemorrhage managed by peripartum hysterectomy . Total hysterectomy is the recommended surgical method of eph due to the potential risk of malignancy developing in the cervical stump and the need for regular cytology and other associated problems such as bleeding or discharge associated with the residual cervical stump . Currently the proportion of subtotal hysterectomy performed for eph ranges from 53% to 80% . The proponents of subtotal hysterectomy report a lesser blood loss, a reduced need for blood transfusion, reduced operating time and reduced intra and postoperative complications . Total hysterectomy should however be considered when active bleeding occurs from lower uterine segment as the cervical branch of uterine artery may remain intact . The final decision to perform subtotal or total hysterectomy would be influenced by patient's condition . Hence, while total abdominal hysterectomy is a more convenient procedure, subtotal eph may be a better choice in certain conditions where surgery needs to be completed in a shorter time . Uterine atony is an indication for eph in 20.6% to 43% of the cases [16817]. While this was traditionally the leading cause for eph the incidence has reduced due to the use of newly developed pharmacologic treatment strategies including prostaglandins . Multiparity and oxytocin use for uterine stimulation were found to be the risk factors for uterine atony requiring eph [16]. Combs et al in their large case control study of patients with post partum hemorrhage reported that pre - eclampsia, nulliparity, twins, induction, prolonged labor and augmentation were all identified as independent risk factors for uterine atony . The risk factor for this would be multiple previous cesarean sections with a scarred uterus (figure 1). Total hysterectomy is the recommended surgical method of eph due to the potential risk of malignancy developing in the cervical stump and the need for regular cytology and other associated problems such as bleeding or discharge associated with the residual cervical stump . Currently the proportion of subtotal hysterectomy performed for eph ranges from 53% to 80% . The proponents of subtotal hysterectomy report a lesser blood loss, a reduced need for blood transfusion, reduced operating time and reduced intra and postoperative complications . Total hysterectomy should however be considered when active bleeding occurs from lower uterine segment as the cervical branch of uterine artery may remain intact . The final decision to perform subtotal or total hysterectomy would be influenced by patient's condition . Hence, while total abdominal hysterectomy is a more convenient procedure, subtotal eph may be a better choice in certain conditions where surgery needs to be completed in a shorter time . The complications included blood transfusion (88%), febrile episodes (26.5%), perinatal death (22.8%), bladder injuries (8.8%), wound infection, dic, ileus, vaginal cuff bleeding and adnexectomy . The maternal mortality ranged from 0 to 12.5% with a mean of 4.8% [168192124]. Although no risk assessment system can predict all instances where cesarean delivery will be needed, a significant percentage of the patients who are at high risk for severe hemorrhage and the subsequent need of emergency hysterectomy can be identified before surgery . The presence of preoperative risk factors should facilitate consultation, referral or transfer of patients before surgery to a tertiary care facility . Due to the complexity of the surgery and decision making, proper surgical measures such as hemostatic sutures or uterine or hypogastric artery ligation or embolization are options in attempting uterine conservation particularly in patients who are young and in whom future fertility is important and who are relatively haemodynamically stable . When conservative treatment is not feasible or has failed, prompt eph is performed failing which the delay would contribute to the maternal morbidity and in unfortunate cases mortality. |
After obtaining institutional ethical committee approval and written informed consent, 50 asa physical status i - iii patiets, aged from 30 to 75 years, undergoing elective major abdominal surgery were included in this prospective, randomized, double blind study . Patients with cardiac desease, uncontrolled hypertension, hypovolemia, cronically hepatic or renal disease, significant electrolyte disorder, restrictive or obstructive respiratory disease, acute intermittent porphyria, neurological disorder, bleeding or coagulation test abnormalities, diabetes, allergy to local anesthetics or opioids and psychological disorders were excluded . The anesthetists who performed the epidural catheterisation and collected the datas were blinded to the solutions . I (n=25), 250 mg bupivacaine 0.5% and 400 g fentanyl in 150 cc saline 0.9% and in group ii (n=25), 250 mg levobupivacaine 0.5% and 400 g fentanyl in 150 cc saline 0.9% was infused via epidural pca . The concentration of the solution was 0.125% for bupivacaine and levobupivacaine, 3 /ml for fentanyl as used in previous studies.1415 the device was consisted of a syringe pump and activated by a hand switch that delivered the demand dose of solution epidurally . The instructions about pca (grasebay 3300), holter mashines (dms300 - 12l) and vas scores were given during the preoperative patient visits . The degree of motor blockade was assessed using the modified bromage scale: 0 = free movement of legs and feet; 1 = inability to raise extended leg but able to move knees and feet 2 = unable to flex knees but with free movement of feet 3 = unable to move feet or knees.16 maximum cephalad sensory blockade to pinprick, cold and touch was measured . Would mean no pain and 10 would mean worst possible pain. Vas values were recorded at 0, 1, 3, 5, 7, 11, 15, 19 and 23 hour in the postoperative period . 0.25% bupivacaine in 10 ml for group i and 0.25% levobupivacaine for group ii was injected via epidural catheter following the record of vas value immediatly after the surgery in the recovery room . Infusion rate was set as 4 ml / h and bolus dose was set as 5 ml with lockout 20 minutes . When the vas value of the patient was higher than 3, additional 5 ml bolus dose was given and recorded . The datas were compared as excessive analgesic requirement . Before epidural catheterisation, a peripheral 18 g mean arterial blood pressure was measured at 5 minutes interval before and during the procedure . 18 g tuohy needle was introduced in the midline at the lumbar 3 - 4 or 4 - 5 interspace with the patients undergoing low anterior resection for rectum cancer and at the thoracal 7 - 8 or 6 - 7 interspace with the patients undergoing total gastrectomy for stomach cancer . 20 g epidural catheter was settled via tuohy cannula and 60 mg lidocaine test dose was performed . Then the patients were premedicated by 0.03 mg / kg intravenous (iv) midazolam . After completion of epidural block, anesthesia was induced with iv penthotal 5 mg / kg and iv fentanyl 3 g / kg . Patients lungs were mechanically ventilated with 65% nitrous oxide and 35% oxygen with a fresh gas flow of 5 lt / min . A heart rate under 45 beat / min was accepted as bradycardia and treated with atropine 0.5 mg iv . Mean arterial pressure under 50 mmhg was considered as hypotension and treated by 500 ml iv colloid infusion . If colloid did not rise the blood pressure, 10 mg iv ephedrine was administered . The patients were again moniterized after the surgery in recovery room and the values of arterial systolic and diastolic pressure, heart rate, vas, oxygen saturation and respiratory rates were recorded . The sedation scores were determined by ramsay sedation scale: agitated or restless patientco - operative, oriented and tranquil patientresponds to commands onlybrisk response to a light glabellar tap or auditory stimulusdoes not respond to mild prodding or shakingexhibits no response agitated or restless patient co - operative, oriented and tranquil patient responds to commands only brisk response to a light glabellar tap or auditory stimulus does not respond to mild prodding or shaking the patients who were awake and hemodynamically stable were transported to intensive care unit (icu). Nausea and vomiting were treated by metoclopramid 10 mg iv and pruritus by difenhydramine 10 mg iv and were repeated as necessary . Statistical package for social sciences (spss) for windows programe (ver.10) was used for statistical analyses . For categorical variables, proportions of the variances in two groups were compared by the chi - square test . Group size was selected using proportions sample size estimates (= 0.05, = 0.09). Statistical package for social sciences (spss) for windows programe (ver.10) was used for statistical analyses . For categorical variables, proportions of the variances in two groups were compared by the chi - square test . Group size was selected using proportions sample size estimates (= 0.05, = 0.09). Statistical package for social sciences (spss) for windows programe (ver.10) was used for statistical analyses . For categorical variables, proportions of the variances in two groups were compared by the chi - square test . Group size was selected using proportions sample size estimates (= 0.05, = 0.09). One patient in bupivacaine group was excluded from the analyses because of failure to perform the epidural blockade and the patient was treated with iv pca . This left 25 patients in group i. 16 female and 34 male patients were studied . No significant difference was obtained in systolic or diastolic pressure values between groups (figure 1). Thirty two patients (64%) underwent low anterior resection operation for rectum cancer and 18 (36%) patients underwent total gastrectomy for stomach cancer . Eleven patients who had low anterior resection and four patients who had total gastrectomy needed blood transfusion . Mean duration of surgery for rectum cancer and stomach cancer was 128 21 min and 79 12 min respectively . The data analysis showed that the incidence of pruritus was not clinically and statistically different in patients receiving epidural bupivacaine compared with patients receiving levobupivacaine (p> 0.05). Postoperative satisfaction with the epidural analgesia was similar with median scores of 69 (levobupivacaine) and 73 (bupivacaine) (vas; 100 mm = extremely satisfied) in the first 24 hour after operation . Demographic characteristics systolic and diastolic arterial pressure group i: 0.125% bupivacaine and 3 /ml fentanyl pca was used in major abdominal surgery . Group ii: 0.125% levobupivacaine and 3 /ml fentanyl pca was used in major abdominal surgery . P> 0.05 there was no significant difference between groups for heart rate (figure 2), arterial oxygen saturation (figure 3), vas values (figure 4) and postoperative analgesic requirements . Total analgesic consumption was 145 ml for group i and 150 ml for group ii (p = 0.091). Additional analgesic need was 25 ml for group i and 30 ml for group ii (p = 0.185). Supraventricular arrhythmia (sva) incidence for the postoperative period was significantly higher in bupivacaine group (p <0.05). Total number of pca demands was 14 and 15 for group i and group ii, respectively . However the incidence increased to 20 times in bupivacaine group and 9 times in levobupivacaine group . The type of supraventricular arrhythmias included atrial fibrillation (0%), atrial flutter (0%), paroxysmal supraventricular tachycardia (92%) and wolf - parkinson - white syndrome (8%). Postoperative incidence of ventricular arrhythmia (va), conduction abnormalities and pauses longer than two seconds were similar in both preoperative and postoperative period (p> 0.05). Additionally, the heart rate of patients in bupivacaine group increased during first postoperative three hours but this result was not statistically significant . Group i: 0.125% bupivacaine and 3 /ml fentanyl pca was used in major abdominal surgery . Group ii: 0.125% levobupivacaine and 3 /ml fentanyl pca was used in major abdominal surgery . P> 0.05 pulse oxygen saturation group i: 0.125% bupivacaine and 3 /ml fentanyl pca was used in major abdominal surgery . Group ii: 0.125% levobupivacaine and 3 /ml fentanyl pca was used in major abdominal surgery . P> 0.05 group i: 0.125% bupivacaine and 3 /ml fentanyl pca was used in major abdominal surgery . Group ii: 0.125% levobupivacaine and 3 /ml fentanyl pca was used in major abdominal surgery . P> 0.05 two patients had hypotension (mean arterial pressure under 50 mmhg) after epidural catheterisation . They were treated with colloid infusion but one of them needed 10 mg ephedrine after liquid infusion . There were no clinically meaningful differences between treatment groups in physical findings or laboratory parameters . The levels of sensory and motor block did not differ among groups at all time . Bromage scores (n, 0/1/2/3) of group i were 21/4/0/0 patients and of group ii were 22/3/0/0 patients . Asa categorization (n, 1/2/3) of group i was 15/6/4 and of group ii was 12/8/5 patients . No cases of cardiac depression or central nervous system toxicity caused by vascular absorption or direct intravascular injection of local anesthetic occurred . Our postoperative repeated visits for sedation and respiratory rate monitorization was a precaution for early detection of respiratory depression and provides increased patient satisfaction . The present study demonstrates that levobupivacaine, the pure s(_)-enantiomer of racemic bupivacaine, is as effective as bupivacaine in epidural analgesia when used with fentanyl for major abdominal surgeries . Racemic bupivacaine has been compared to levobupivacaine for epidural, spinal or infiltration anesthesia and for supraclavicular brachial plexus block . The comparisons of these two local anesthetics were planned for lower abdominal surgeries, lower limb surgeries or gynecologic surgeries.1317 no significant difference for the quality of analgesia was recorded between these local agents and all of them provided efficient clinical anesthesia.1819 morphine or fentanyl was used in order to rise the quality of analgesia in the postoperative period . However there are no comparative studies of efficacy for patient controlled epidural analgesia with fentanyl addition in both lower and upper abdominal surgeries . In a separate study, three of seven animals given racemic bupivacaine died from sudden onset ventricular fibrillation, whereas the same doses of levobupivacaine produced only nonfatal arrhythmias such as single premature ventricular contractions, bigeminy or couplets . These findings spontaneously reverted to sinus rhythm.12 we found sva incidence significantly higher in our setting . Same concentrations of epidural bupivacaine and levobupivacaine with fentanyl increased the incidence of supraventricular arrhythmias but the increase in bupivacaine group was significantly higher than levobupivacaine group . The number of patients with sva for bupivacaine group in the preoperative period was only 4 but it was recorded in 20 patients after epidural analgesia application . When we checked the results of levobupivacaine group, sva incidence before local anesthetic application was again 4 but it has reached only up to 9 in the postoperative period . There was not significant variability in the frequencies of va levels both in preoperative and postoperative periods . The basic cardiac rythm status of the patients was determined first by holter machine before the operation . Then we compared the arrhythmogenic, analgesic and hemodynamic effects of bupivacaine and levobupivacaine in the postoperative period . Bupivacaine produces local anesthesia by blocking sodium channels and this action is probably the main mechanism responsible for its cardiotoxicity.18 because levobupivacaine has less potention for sodium channel blockade and produces less arrhythmias, it has been a popular local anesthetic agent.2021 it was thought that it can be used instead of bupivacaine because of its less toxic side effects to cardiovascular and central nervous system.2223 corrected qt is used to evaluate the arythmogenic potential of drugs . Levobupivacaine has also a poor influence on qrs or corrected qt.24 previously, ropivacaine was also compared with bupivacaine . The epidural injection of a 1.0% concentration of ropivacaine produced similar sensory and motor block to 0.75% racemic bupivacaine in a similar group of gynecological surgery patients.25 casati et al . Compared same volume of 0.5% levobupivacaine, bupivacaine and ropivacaine for major orthopedic surgery.14 they reported that onset, duration and quality of epidural anesthesia were similar . However, motor block level after levobupivacaine was deeper than the others . In the current trial, levobupivacaine and this result was similar with the study of glaser et al.13 the increase in heart rate between postoperative first and third hours was higher in group i. this result also supported that bupivacaine has more negative effects on haemodynamic parameters . However this does nt prop up the results of the trial from burke et al.26 these physicians performed spinal anesthesia and they observed additional bradicardy . This diversity may be also related to sympathetic or high sensorial blockade effect of spinal anesthesia . In an experimental trial, levobupivacaine and bupivacaine this result was releated with the stimulation of sympathetic nervous system.27 the vas scores did not differ between groups . Several studies had the same result as our trial.2829 number of demand or bolus doses of pca were also similar between groups . One limitation of our study is that we only assessed the local anesthetic toxicity according to the records of arrhythmogenic and hemodynamic side effects instead of studying the variability of blood levels of local anesthetics . To summarize, the results of this study indicated that levobupivacaine - fentanyl and racemic bupivacaine - fentanyl show equally effective potencies for epidural analgesia . We aimed to obtain the effects of both solutions on systolic, diastolic arterial blood pressure, periferic oxygen saturation and analgesia . The rate of other type of arrhythmias like va, did not vary . As a result, we concluded that same concentration of epidural levobupivacaine with fentanyl has less arrhythmogenic but similar analgesic potential than bupivacaine in major abdominal surgeries . With regard to the safety of the s - isomer of bupivacaine au carried out the design of the study, developed and wrote the protocol, did the statistical analysis and participated in manuscript preparation . Kts provided assistance in the design of the study and participated in manuscript preparation and did the statistical analysis . As provided assistance in the design of study, collected data and participated in manuscript preparation. |
Debate regarding the indications, timing and technique for tracheostomy seems to have been raging ever since the procedure itself was first described in ancient egypt . The topic is of global interest, with research from a number of continents published during the past few months . These recently published papers add new information to the' round table' discussion that often goes with this controversial and topical subject . The first report, that by griffiths and coworkers, is a well researched systematic review and meta - analysis of five controlled studies that aimed to compare outcomes in critically ill patients undergoing artificial ventilation who received a tracheostomy early or late in their treatment . Early tracheostomy was defined as up to 7 days following intubation, and late was defined as any time thereafter, if at all . The results showed that the duration of artificial ventilation was significantly lower in the early group, as was the length of intensive care unit (icu) stay . This has obvious implications for icu service provision and patient care, assuming that patients leave the icu to make equal recoveries in the two groups . However, it is difficult to analyze the impact of the results because there was significant heterogeneity between the inclusion and exclusion criteria of the studies . The hospital and 30-day mortality rates were no different between the two groups, and the risk for hospital - acquired pneumonia was also unchanged . A recent retrospective study conducted by chia - lin hsu and coworkers investigated the optimal timing of tracheostomy formation, its impact on weaning from artificial ventilation, and the outcomes in patients in a medical icu at the 1500-bedded national taiwan university hospital . A total of 163 patients were included and divided into two groups: successful weaning and failure to wean . Interestingly, the study discusses rates of associated complications of both percutaneous tracheostomies (pts) and surgical tracheostomies (sts). The results showed that patients undergoing tracheostomy more than 3 weeks after intubation had higher icu mortality rates (28.3% versus 14.5%), higher rates of weaning failure (56.4% versus 30.2%) and longer icu stays (14.2 days versus 10.8 days). This study also showed no difference in hospital mortality or nosocomial pneumonia during the weaning period . The authors concluded that tracheostomy after 21 days was associated with prolonged weaning, low weaning success rates and prolonged icu stay . In the third study, blot and melot performed a retrospective analysis of the indications, timing and techniques of tracheostomy in 152 of the 708 french icus contacted . Although the study had a relatively low reply rate (21.5%), it raised several interesting points . First, their definition of early tracheostomy was any time during the first 3 weeks after intubation . Second, early tracheostomy was considered more often in nonteaching hospitals than in teaching hospitals . Finally, sts were preferred over pts on surgical icus, and vice versa on medical icus . The authors concluded that long - term mechanical ventilation and failed extubation are the major indications for tracheostomy, and that tracheostomy is considered after a mean time of 3 weeks (later than recommended by several consensus conferences). This prospective and retrospective observational study looked into the problem of tracheal stenosis caused by both pt and st individually . The investigators studied 29 patients presenting with tracheal stenosis to a uk national referral centre for tracheal reconstruction . Following bronchoscopy preoperatively, they were able to assess the level, length and diameter of tracheal stenosis . This potentially life - threatening complication differs between the two groups in the above parameters, and therefore affects the treatment options available to the patient . The results showed that, compared with st, pt caused tracheal stenosis closer to the vocal cords (1.6 cm versus 3.4 cm; p = 0.04) and the onset of tracheal stenosis occurred significantly quicker in the pt group (5 weeks versus 28.5 weeks). Other quoted studies support the finding that pt resulted in the tracheal wall' caving in' due to cartilage fracture significantly more often (50% versus <2%). They also conclude that stenosis caused by pt occurred earlier and was more subglottic in nature compared with st . Considerable variety in the timing of tracheostomy formation and the technique employed continues to exist, with a number of other publications both supporting and opposing the reports discussed above . Intensive care practitioners clearly need further information and research to enable agreement to be reached on optimum tracheostomy care . From these studies, first, early tracheostomy (<7 days) reduces the duration of artificial ventilation . Third, patients undergoing tracheostomy after 3 weeks have a higher mortality, longer duration of ventilation, reduced successful weaning and longer icu stay . Finally, pt causes more subglottic stenosis, with a quicker onset than with st . The much anticipated tracman study is now underway in the uk and will hopefully shed much more light on some of these issues . The vast majority of acute care hospitals in the uk are without on - site neurosurgical and neurointensive care facilities, necessitating expedient assessment of the brain - injured patient . Those with severe traumatic brain injury (tbi; i.e. Those with glasgow coma scale [gcs] score <9) should undergo prompt transfer to a neurosurgical centre unless the prognosis is deemed to be hopeless . For those with mild (gcs score 1415) and moderate (gcs score 913) tbi, with no indication for immediate surgery, it may well be preferable that they stay in the admitting non - neurosurgical centre, given the demand on the all too few neurosurgical intensive care beds in the uk . Subsequent monitoring, and therefore management, of this group of patients for secondary neurological deterioration is often suboptimal, given the inability to institute' gold standard' techniques such as intracranial pressure and jugular venous saturation monitoring, relying largely on clinical deterioration and computed tomography (ct). A study by jaffres and coworkers may represent a glimmer of light in this otherwise dark tunnel . In a prospective cohort study (n = 78) set in the emergency room of a french district hospital, consecutive patients admitted with mild or moderate tbi underwent both ct and transcranial doppler (tcd) studies within 12 hours of admission . Patients were then assessed, based on objective predefined criteria, for neurological deterioration 7 days after admission . The study attempted to correlate deterioration with initial measured variables: tcd, ct of the head, and biochemical, haematological and clinical measures, including a variety of composite scoring systems . Seven (17%) patients from the mild tbi group suffered deterioration . Using univariate analysis the investigators demonstrated a significant difference in both ct findings and pulsatility index (pi), as measured using tcd, in this subgroup compared with those who did not deteriorate . The injury severity score and maximal head abbreviated injury scale score were also significantly different . In pi and ct scoring were again significantly different in this group, along with the scoring systems mentioned above, initial gcs score and use of vasoactive drugs . Jaffres and coworkers go on to discuss the mechanisms by which pi is inversely related to cerebral perfusion pressure, and suggest that an appropriate combination of ct classification of tbi and measurement of pi on admission may be used to identify those at risk for subsequent deterioration . However, they point out that the feasibility and practicalities of early tcd are not inconsequential and that no threshold value for pi was identified in this small study . Less invasive does not necessarily mean less useful, and cuschieri and coworkers including dr e rivers, who utilized central venous oxygen saturations in early goal - directed therapy for severe sepsis investigated the correlation between central venous arterial carbon dioxide difference (cv aco2), mixed venous arterial carbon dioxide difference (mv aco2) and cardiac index (ci) in a group of mechanically ventilated patients with various diagnoses . For inclusion, patients needed to have a pulmonary artery catheter in situ . Simultaneous arterial, mixed venous and central venous blood samples were obtained, along with measurement of cardiac indices using the thermodilution technique . The group found excellent correlation between cv aco2 and mv aco2, with a correlation coefficient across all diagnoses and circulation types (high, low and normal) of 0.978 . Furthermore, both were found to be inversely related to ci, with similar magnitudes of correlation, as compared with thermodilution - derived values . Although the relationship between mv aco2 and ci has long been recognized, as derived from the fick principle, this study suggests an easier and less invasive way to apply the same concept and, in conjunction with centrally derived arteriovenous oxygen differences, this may be very useful in the early assessment of global tissue hypoxia . Finally, a thought - provoking review, although one that is not terribly helpful on a practical level, was recently published in chest . Hennessy and colleagues carried out a thorough literature search on post - icu outcomes of elderly patients . The elderly population, variously defined as> 65 years,> 70 years,> 75 years or> 85 years, is set to grow massively, and this will undoubtedly have major implications for service provision . Although many studies have scrutinized mortality rates from critical illness in the elderly, little is known about health - related quality of life (hrqol) and functional status in the survivors . The investigators identified only 16 studies (involving a total of 3247 patients), only one of which was multicentred, addressing this issue . Encouragingly, the majority of these studies reported good hrqol and functional status post - icu, although some discordance was evident, suggesting a change in conceptualization of quality of life following critical illness . However, the authors were unable to pool results and draw any significant conclusions because of poor quality study designs and lack of consensus on how to measure hrqol . They urge the need for further research, which must be well designed, prospective and use validated, reliable and responsive measures of hrqol . Aco2 = central venous arterial carbon dioxide difference; gcs = glasgow coma scale; hrqol = health related quality of life; icu = intensive care unit; mv aco2 = mixed venous arterial carbon dioxide difference; pi = pulsatility index; pt = percutaneous tracheostomy; st = surgical tracheostomy; tbi = traumatic brain injury; tcd = transcranial doppler. |
At indiana universitypurdue university indianapolis (iupui), we have developed a concept called distributed drug discovery (d). Herein is reported the first example of a key component of d: the distributed rehearsal of reagents and their subsequent use in real and virtual catalog production . The premise of d is that the availability of simple, inexpensive equipment and procedures for each of the core scientific drug discovery disciplines (computational chemistry, synthetic chemistry, and biochemical screening) will enable large drug discovery problems to be broken down into manageable smaller units to be solved at multiple sites throughout the developing and developed world . The recombined and coordinated results of these resources can inexpensively accelerate the identification of leads (primarily for developing world and other neglected disease targets) in the early stages of the drug discovery process . In addition, this effort provides educational and job opportunities in both the developed and developing worlds while building cultural and economic bridges for the common good . Combinatorial virtual catalogs, realistically accessible by globally distributed synthesis, are key to the implementation of d. in classical combinatorial chemistry, reagent rehearsal increases the likelihood that any individual member of an enumerated virtual library can be synthesized from each unique combination of rehearsed reagents . However, it imposes additional strong constraints on reagent - rehearsed virtual catalogs: any member of the library must be accessible by rehearsed or precedented synthesis, anywhere in the world, using simple, inexpensive equipment and procedures . Part i reports the first successful global reagent rehearsal, conducted by undergraduate and graduate students in the united states, poland, russia, and spain . In part ii, a virtual d catalog based on this work one of the most common types of intermediates used in combinatorial chemistry is the resin - bound natural or unnatural -amino acid 1 (scheme 1). The -amino acid substructure occurs in 28% of the structures cited in a recent comprehensive survey of combinatorial library synthesis . Scheme 1 gives examples of a few of the published libraries based on 1 . With the exception of proline, the methodology for the introduction of side chains by carboncarbon bond construction has expanded considerably the availability of these unnatural -amino acids . Of the existing routes to such molecules thus, introduction of an unnatural side chain onto the -position of a suitable glycine or higher amino acid derivative by alkylation can provide, respectively, -substituted or,-disubstituted amino acid products . Because of the central role of 1 in combinatorial chemistry, and the ability to greatly expand its numbers through alkylation chemistry, we chose to focus on rehearsing alkylating agents r1x for our first exemplification of d synthesis . In the process, we wished to show the likelihood that undergraduate or graduate students would be able to make any given member of a resulting virtual d catalog, further demonstrating the potential of distributed drug discovery . We modified our published synthesis of 1(17c) and incorporated the rehearsal into a student combinatorial chemistry laboratory that transformed 1 to the acylated derivatives 5 (scheme 2). This generic structure 5 would then become the basis of our first virtual d catalog . The time ranges shown in scheme 2 accommodated the details of laboratory scheduling in academic institutions at different geographic locations . Simple, inexpensive bill - board 6-pack equipment (figure 1) was used to carry out this procedure, six reactions at a time . Every bill - board 6-pack had six reaction vessels in a grid of two rows (a and b) by three columns (1, 2, and 3), and reactions were correspondingly identified by row, column (e.g., a1b3). The equipment was designed to enable the essential steps common to most solid - phase synthetic procedures: cycles of reaction and filtration workup, followed by product cleavage, and collection . Bill - board components and 2 3 experimental grid . In this first demonstration of the distributed process, twenty - four alkylating agents r1x were rehearsed, often in quadruplicate, sometimes at geographical locations remote from one another (indianapolis, in; lublin, poland; moscow, russia; and barcelona, spain). In all cases the quality of the crude products was assessed by lc / ms to obtain a marker of the suitability of a given reagent in combinatorial library generation . This analytical measurement of quality is not definitive because uv detection can overlook, among other things, poor absolute recovery, the presence of insoluble impurities, or soluble impurities not revealed by the detection system . Nevertheless, the lc / ms data permits elimination, from a rehearsed virtual library, products based on alkylating agents that are clearly problematic . Follow up synthesis and purification conducted at iupui allowed the isolation and characterization of all the unnatural amino acids reported in this distributed reagent rehearsal study . Since reagent rehearsal was done by students with little to no prior experience in either organic synthesis or solid - phase chemistry, two key elements were incorporated into the laboratory: (1) students worldwide conducted the same control alkylation reaction, using r1x = benzyl bromide (6) in column 1 . (2) the evaluation of new alkylating agents was replicated by at least one other student or student team . This worldwide distributed process permits the assessment of both the quality of the work carried out by any given student / team and the reproducible efficacy of the evaluated reagents . The first synthetic rehearsals were conducted at iupui, utilizing four concurrent laboratory sections, to pilot the process of replicated synthesis in multiple students hands . There were up to 20 students in each section . A total of 65 students operated in 32 teams of two per bill - board (192 reactions), with one extra bill - board used for the solo student . The control alkylating agent, benzyl bromide (6), was used by all students in column 1 (figure 1). The new alkylating agents were rehearsed in columns 2 and 3 . In these experiments, the acylating agents used in rows a and b of the bill - board were always fmoc chloride and 2-naphthoyl chloride, respectively . In this first extensive study, two commercial suppliers, i and ii, were commissioned to produce the starting benzophenone imine resin 2 . For comparison purposes, resin from source i was used in sections one, two, and four (teams 18, 1017, and 2633), and resin from source ii was used in section three (teams 1825). Since all 32 teams prepared the same product (fmocphe 5{6}a, see table 1) in position a1 of their bill - boards it was informative to analyze the quality, as a function of resin source, of all 32 of these replicated products . Figure 2 shows a comparison of representative products a1 from teams using resins from these two suppliers . Representative uv trace from lc / ms analysis of a1 from either resin supplier i or ii . (a) lc trace of product (team 1, al) using resin from supplier i. (b) lc trace of product (team 18, al) using resin from supplier ii . In the products obtained from reactions using resin from i (figure 2a), there was, in addition to desired product (5.04 min, m + 1 = 388, 77%), the universal presence of three impurities (2.5 min, m + 1 = 256, 4%; 4.8 min, m + 1 = 445, 11%; 5.3 min, m + 1 = 494, 8%). The ms data allowed the tentative assignment of the structures 23, 24, and 25 for these respective peaks (figure 3). In contrast, there were insignificant levels of the impurities at 2.5 and 4.8 min in samples prepared from resin supplier ii (figure 2b). The supporting information contains a more complete discussion of the origin of these proposed impurities 23 and 24 in resin from i, and 25 in both resins from either i or ii . Proposed structures for impurities produced from resin source i. although resins from i and ii were used in the initial laboratories at iupui, because of its higher quality, only resin from commercial source ii was used in subsequent laboratories at iupui, and in laboratories conducted in poland, russia, and spain . Replicated alkylations (24 replicates), using the same resin and alkylating agent, gave strikingly similar results (table 1). Individual results rarely differed from the average by more than 3% . As expected, because of the impurities present in the starting resin from i (see earlier discussion and supporting information) the purity of alkylation products from this resin was lower (by 1520%) than those from ii (compare, for example, the results for the fmoc derivatives 5{7}a through 5{12}a from alkylating agents 7 through 12, where the first two results for each compound were from resin source i, and the second two results were from resin source ii). Nevertheless, from the same resin source the alkylation results are very reproducible . In rare cases, this is to be expected when so many different researchers (students) are performing this work for the first time . For example, team 28 obtained none of the expected products 5{15}b or 5{17}b, whereas three other teams using the same reagent combinations (teams 12, 13, 29 and 11, 12, 27) were successful and had similar results (63% 3% and 80% 8%, respectively) for each of these compounds in the appropriate bill - board positions . Encouraged by the success of the iupui student alkylating agent rehearsal, we tested the ability to further distribute this process to students outside of the united states . Using the same procedures (with minor modifications), equipment, and resin from source ii, the laboratory was first replicated in spain . In 36 separate reactions, teams at the university of barcelona (two or three students per bill - board) evaluated control benzyl bromide (6, six replicates) and six additional alkylating agents in duplicate (table 2). With the exclusive use of starting resin purchased from supplier ii, the barcelona laboratories obtained excellent results, providing strong documentation for the ability of distributed discovery to reproducibly synthesize molecules, both within the same site, and around the world . Barcelona, team 3), all the control fmocphe samples 5{6}a were synthesized in> 92% purity as determined by lc / ms (table 2). This was consistent with the data generated in the united states at iupui, where the subset of compounds 5{6}a synthesized used starting resin from the same supplier (ii) produced 7 of 8 products in> 93% purity (table 1). The barcelona laboratories also rehearsed, in duplicate, six new alkylating agents, 2631 . The data from teams 2 and 3 for 5{28}b indicates that the alkylating agent 28 is also likely to give desired product but with moderate purity . The methoxy - substituted reagents 29 and 31 illustrate the need for a nuanced interpretation of results . The crude material recoveries for the methoxy derivatives 5{29}a, b and 5{31}a, b were notably lower compared to the rest of the products in this laboratory . These molecules, as anisole derivatives, are susceptible to friedelcrafts reactions . It is well established in the peptide field that, in the absence of a powerful cation quenching agent (such as anisole itself), products capable of friedelcrafts reactions can reattach themselves to the resin cation generated in the cleavage process . Accordingly, selective, cleavage - condition dependent removal of desired product (by reattachment to the resin) could mask a successful alkylation prior to cleavage . To further demonstrate the ability of the distributed reagent rehearsal project to provide replicated results in student laboratories across the globe, table 3 compares a set of molecules prepared at iupui (united states), the university of barcelona (spain), moscow state university (russia), and the lublin school of pharmacy (poland). These results indicate that d syntheses can be carried out at multiple global locations and afford reproducible results . The product 5{32}a (figure 4) was obtained in 76% purity (lc / ms analysis). Moscow single - site result . To fully characterize products from the reagent rehearsal and confirm that student - generated results can reliably predict synthetic outcomes, all of the listed alkylating agents were subsequently re - evaluated by a postdoctoral fellow at iupui . Using resin from source ii, the experimental procedure used was identical to that employed in the rehearsal laboratories at iupui . The results, summarized in table 4, confirm the ability of student rehearsed chemistry to be replicated by a third party . These results also resolved the questions arising from the large variability of results in the rehearsal of reagents 28 and 29 reported in table 2 . In addition, the single result reported by the moscow site for reagent 32 was confirmed . The supporting information provides lc / ms data for all the crude products from indianapolis, lublin, and moscow, along with nmr data for all the purified, new compounds prepared . Rl = averaged results from student rehearsal laboratories; pd = result from postdoc synthesis at iupui . Single value, other value was 0% . In summary, these first reagent rehearsal laboratories document a key requirement of the distributed drug discovery concept: the global ability of students to evaluate reagents and reproducibly make new potential drug leads, using simple, inexpensive equipment and procedures . These reagents are now acceptable as input in the enumeration of the d accessible virtual catalogs to be described in part ii . An essential component of distributed drug discovery is the open - access availability of databases of molecules accessible through distributed chemistry . Computational chemists can then analyze these large databases to identify and make globally available smaller databases of potential drug leads targeted for developing world diseases . Subsequently, the synthesis of the selected molecules can be carried out, in a distributed fashion, at sites across the world . The compounds (including stereoisomers when appropriate) in this virtual d catalog were enumerated with commercial software . To ensure that virtual library generation is not limited by cost we also enumerate libraries with alternative software currently available for free to academia . On the basis of the distributed chemistry developed and reported in this article, two types of library enumeration were envisioned ., a much larger, virtual d catalog (including the compounds actually made) can be enumerated from all combinations of rehearsed or otherwise well - precedented reagents used at the variable alkylation and acylation steps . To illustrate this process, we assembled lists of acceptable, commercially available, alkylating and acylating agents (tables 5 and 6, respectively) to enumerate a representative virtual d catalog of acylated unnatural amino acids (scheme 2). For the alkylation step extensive precedence is available, both from our solution- and solid - phase studies and those of others, to predict the reactivity of schiff base esters and related systems with these electrophiles under a variety of basic conditions . For example, even though michael addition reactions were not rehearsed in the present study, we have confidence, based on our earlier solid - phase research using resin - bound schiff bases and michael acceptors as electrophiles, that reactants 93108 (table 5) can be utilized successfully ., we plan to incorporate all rehearsed reagent information into a single database to further assist reagent selection . In the acylation step however, we have since modified our d laboratories to use carboxylic acids to form the amides by traditional carbodiimide mediated couplings . This makes available a much wider repertoire of inexpensive reactants for enumeration at the second variable position . Because the reactivity of carboxylic acids in forming amide bonds is extensively documented, simple chemical intuition and reactivity considerations were used to select the 100 carboxylic acids (table 6) for enumeration . On the basis of these considerations, a virtual d catalog of 24 416 acylated unnatural amino acids 5 was enumerated . As discussed in the following article, an additional 24 192 methyl esters of these acylated unnatural amino acids were enumerated on the basis of the cleavage of resin - bound products 4 by methanolysis . Thus, a total of 48 608 unique products are available for d catalog access and searching . The 100 commercially available alkylating agents and michael acceptors and 100 carboxylic acids used to perform these enumerations are shown in tables 5 and 6, respectively . The catalog of acylated unnatural amino acids contains more than the 20 000 members that would arise from a simple 100 100 combinatorial process . This is caused by the formation of stereoisomers in the alkylation step and their combination with other stereoisomers sometimes present in the alkylating or acylating reagents . Thus, from two to eight stereoisomers appear for each structure in the virtual d catalog . The separate listing of each of these anticipated stereoisomeric products allows appropriate computational discrimination and selection when three - dimensional modeling software is employed and chirality is important . Two stereoisomers arise when there are no other stereogenic elements in either the electrophile or the acid [e.g., (r)-5{12,207} plus enantiomer] or when the electrophile or acid is present as a single enantiomer (r, r)-5{22,117} plus diastereomer] or geometric isomer (r, e)-5{82,208} plus enantiomer]. Four stereoisomers are contained in the library when a racemic or prochiral electrophile or a racemic carboxylic acid is used (s, s)-5{18,121} or (r)-5{93,159} plus three other stereoisomers for each]. Eight stereoisomers arise when both a racemic electrophile and a racemic carboxylic acid are used (r, r, r)-5{47,186} plus seven other stereoisomers]. The synthesis of stereoisomeric mixtures of unnatural amino acid derivatives has the advantage of providing stereoisomers for evaluation . The follow up work to identify the active stereoisomer can be accomplished, without stereoselective synthesis, through bioassay guided fractionation or chiral chromatography . The active stereoisomer identified by these techniques can be subsequently prepared by known stereoselective synthetic routes, separation techniques, or resolution procedures . It is important to consider potential side - reactions during the various steps of the synthesis of acylated unnatural amino acids 5 . For example, the tert - butyl esters present in resin - bound products 4 that originated in the reactants used for alkylation, michael addition, or acylation (36, 75, 96) will be converted to the carboxylic acids during tfa cleavage . Likewise, the t - butyl carbamate (n - boc) group in reactant 83 will be cleaved to the free indole nh on tfa cleavage to products 5 . A lead reference for each of these subsequent reactions is noted with the respective reactant, and this is reflected in the enumerated product structures . Other more subtle side reactions will be incorporated into the enumeration products as they are discovered on the basis of literature precedence or rehearsal of reagents by our group or by others . To illustrate the variety of virtual molecules available through this enumeration the open - access availability of this virtual d catalog makes possible the global computational selection of candidates for drug synthesis, while simultaneously enabling the prioritization of future reagent rehearsals . When computational analysis suggests a particular library member may be a drug lead for a developing world disease target, that molecule will be selected for distributed synthesis . If the reagent used as input in its enumeration is unrehearsed, the synthesis will evaluate its suitability as a reagent and enable it to become a part of this expanding rehearsed reagent database, stored electronically and available through open - access . Students carry out, using simple procedures and inexpensive equipment, worldwide replicated solid - phase combinatorial chemistry, rehearsing new reagents and generating new compounds for library production . At the same time they learn and develop important synthetic skills and methodologies . The data generated and reported here allows the construction of a globally accessible d database of well - documented alkylating agents and michael acceptors for the synthesis of resin - bound unnatural amino acids 1 . This intermediate can then be incorporated into a wide variety of published combinatorial chemistry procedures . Virtual d catalogs based on rehearsed or well - precedented reagents and inexpensive global procedures are essential to the goals of distributed drug discovery . Accordingly, we have enumerated a 24 416-member virtual d catalog of acylated unnatural amino acids 5 based on the current work . Freely available virtual d catalogs, such as the one reported in this article, can be computationally analyzed to select potential drug leads for developing - world and other neglected diseases . In turn, the distributed reagent rehearsal provides strong precedent and documented procedures to successfully make, through distributed synthesis, any of the molecules selected by this process . Anhydrous nmp, chloroform - d1, 2-fluorobenzyl bromide, 4-fluorobenzyl bromide, 2-(trifluoromethyl)benzyl bromide, 4-(trifluoromethyl)benzyl bromide, 2-bromobenzyl bromide, allyl bromide, 2-nitrobenzyl bromide, 2,4-dichlorobenzyl chloride, and benzyl 2-bromoacetate and were purchased from acros organics . Btpp (tert - butyl - imino - tri(pyrrolidino)phosphorane). And fmoc chloride were purchased from fluka . 5-(chloromethyl)-2-chloropyridine, n, n - diisopropylethylamine, benzyl bromide, 3-fluorobenzyl chloride, 3-(trifluoromethyl)benzyl chloride, 3-bromobenzyl bromide, 4-bromobenzyl bromide, 2-(bromomethyl)benzonitrile, 3-(bromomethyl)benzonitrile, 4-(bromomethyl)benzonitrile, 2-iodobenzyl bromide, 4-iodobenzyl bromide, 1-(chloromethyl)naphthalene, 2-(bromomethyl)naphthalene, 4-methoxybenzyl bromide, 3-methoxybenzyl bromide, and methanol - d4 were obtained from aldrich chemical co. all resins were purchased from midwest bio - tech laboratories (resin i) or polymer laboratories (resin ii) unless otherwise noted . Manual solid - phase organic syntheses at ambient temperature were carried out in 3.5 ml fritted glass reaction vessels equipped with polypropylene screw caps with teflon - faced silicon septa on the bill - board set, which was designed by one of us (wls) as inexpensive equipment to simplify and expedite multiple, manual solid - phase syntheses . The bill - board reaction vessel components are available from chemglass: iup-0305270h for 3.5 ml reaction vessel; iup-0305280h (polypropylene screw cap); iup-0305281h (teflon faced silicone septa). Analytical thin layer chromatography (tlc) flash column chromatography was performed on silica gel 60 (230400 mesh) from silicycle chemical division . The yields of the final compounds, after chromatographic purification, were calculated on the basis of the initial loading of the starting resins and are the overall yields of all reaction steps starting from these resins . H nmr spectra were recorded at 200 mhz (varian spectrometer) using tms (0.00 ppm) and chloroform - d1 mixed with methanol - d4 (310%). Electrospray ionization mass spectrometry was conducted using a pesciex api iii triple stage quadrupole mass spectrometer operated in either positive - ion or negative - ion detection mode . The composition of reaction mixtures was determined based on the integration of nmr spectra as well as lc - ms results . Lc - ms analyses were conducted using an agilent system, consisting of a 1100 series hplc connected to a diode array detector and a 1946d mass spectrometer configured for positive - ion / negative - ion electrospray ionization . The lc - ms samples were analyzed as solutions in ch3cn, prepared at 0.080.12 mg / ml concentration . The lc - ms derived composition of mixtures was determined based on uv integration at 210 nm . Depending on the number of reactions to be performed, resin 2 was distributed either by weight or as aliquots from an isopycnic suspension . In the case of distribution by volume from an isopycnic suspension, the bill - boards were placed in their drain trays, and from a neutral buoyancy suspension in ch2cl2/nmp, 50 mols of the benzophenone imine of glycine wang resin (2, the resin loading is 0.7 0.9 mmol / g) was distributed, via repeated 1 ml aliquots, to each of the six reaction vessels in a given bill - board 6-pack . During the distribution of the resin, when distribution was complete, residual solvent was removed with an air - push from a disposable plastic pipet (fisher, 1371123) fitted with a pierced septum (aldrich, z 127434). The resin was washed with nmp (3 3 ml) (this nmp wash was also done when resin was weighed out into reaction vessels). The bottom of each reaction vessel was then capped, and a new calibrated pipet (fisher, 13 - 711 - 24) was used for adding each alkylation reagent in the following step . The first r1-x (benzyl bromide) [0.5 ml of a 0.20 m solution in nmp, 100 mols, 2 equiv] was added to the resin in the two reaction vessels in the first column positions (i.e., a1 and b1). Then the second r1-x [0.5 ml of a 0.20 m solution in nmp, 100 mols, 2 equiv] was added to the resin in the two vessels in the second column positions (i.e., a2 and b2). Finally, the third r1-x [0.5 ml of a 0.20 m solution in nmp, 100 mols, 2 equiv] was added to the resin in the two vessels in the third column positions (i.e., a3 and b3). Base was then added [0.5 ml of a 0.20 m solution of btpp in nmp, 100 mols, 2 equiv] to each of the six reaction vessels . The tops of all reaction vessels were capped, and the bill - board was placed in a rotation apparatus . Depending on the school location and laboratory schedule, the reaction was allowed to proceed from 24 h to 2 days with rotation . The bill - board was removed from the rotation apparatus and, after inverting the board, the bottom caps were removed . The board was then placed, top side up, in the drain tray, the top caps were removed, and the reagents from the alkylation step were allowed to drain, followed by an air - push . The alkylated resin - bound resin products 3 were washed with thf (1 3 ml). Using 6 clean caps, the bottom of each reaction vessel was capped, and a 1 n aqueous hcl / thf solution (1:2, 2.5 ml) was added to each of the six reaction vessels . The caps were then put on the top of each vessel, and the bill - board was returned to the rotator for 20 min . The reagents and byproduct from the hydrolysis were then removed from hydrolyzed resin - bound product (1) by filtration and washing with thf (1 3 ml) and then nmp (1 3 ml). The bottom of each reaction vessel was capped, and the acylating agent, r2cocl [0.5 ml of a 0.30 m solution of r2cocl in nmp, 150 mols, 3 equiv] was added to the resin 1 in each of the three vessels in row a (a1, a2, and a3). Then the second acylating agent, r2cocl [0.5 ml of a 0.30 m solution of r2cocl in nmp, 150 mols, 3 equiv] was added to the resin 1 in each of the three vessels in row b (b1, b2, and b3). This was followed by addition of diea [0.5 ml of a 0.30 m solution in nmp, 150 mols, 3 equiv] to each of the six reaction vessels . The tops of the reaction vessels were capped, and the reaction was allowed to rotate overnight or up to 5 days (again, dependent on school laboratory schedules). Acylated resin product 4 was washed with nmp (2 3 ml), thf (2 3 ml), and ch2cl2 (3 3 ml). The product was cleaved from resin with tfa / h2o (95:5, 2 ml) for 30 min . The filtrate from the cleavage reaction was collected, and the resin was washed with tfa / h2o (95:5, 2 ml) and ch2cl2 (1 2 ml). After each collection vial was swirled to thoroughly mix the cleavage and rinse solutions, a sample of each solution (100 l) containing product 5 was transferred to an autosampler vial for lc / ms analysis . Designed to speed up the evaporation with a stream of nitrogen, in a contained system, while trapping the evaporating tfa in 2 n naoh . Purification of the crude product was performed via flash column chromatography, using the glass fritted reaction vessel (3.5 ml) loaded with bulk silica gel (650700 mg). The crude product was dissolved in ch2cl2 and, if necessary, meoh (total solution volume 0.5 ml) and applied to the column . Then a gradient of eluting solvent was applied starting with ch2cl2 to ch2cl2/meoh / h2o (300:10:0.5). The purified product was dried in the evaporation equipment described above at ambient temperature under a flow of nitrogen . Forty eight hours later (wednesday), the reactions were worked - up; the imine was hydrolyzed and worked - up, and the acylation reactions were begun . Five days later (the following monday), the acylation reactions were worked - up; the product was cleaved from the resin, and samples taken for tlc and lc / ms analysis . All samples were analyzed by lc / ms in the analytical department at eli lilly & company (indianapolis). At each of these locations, the next day the reactions were worked - up; the imine was hydrolyzed and worked - up, and the acylation reactions were begun . The next (and last) day the acylation reactions were worked - up; the product was cleaved from the resin, and samples taken for tlc and lc / ms analysis . The samples from moscow and lublin were taken back to indianapolis where they were analyzed by lc / ms in the analytical department at eli lilly . 6.9 mg (35% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 82%, tr = 5.11 min; h nmr (200 mhz, cdcl3/cd3od) 3.003.14 (m, 1h), 3.20 (dd, j = 13.9 hz, j = 5.5 hz, 1h), 4.144.27 (m, 1h), 4.284.49 (m, 2h), 4.59 (t, j = 5.8 hz, 1h), 7.16 (m, 2h), 7.237.46 (m, 7h), 7.527.62 (m, 2h), 7.78 (d, j = 6.8 hz, 2h); lc / ms calcd for c24h22no4 [m + h] 388.1; found 388.1 . 8.3 mg (41% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 83%, tr = 5.12 min;h nmr (200 mhz, cdcl3/cd3od) 3.09 (dd, j = 14.2 hz, j = 7.7 hz, 1h), 3.32 (dd, j = 14.2 hz, j = 4.9 hz, 1h), 4.124.23 (m, 1h), 4.244.44 (m, 2h), 4.61 (t, j = 5.5 hz, 1h), 6.967.10 (m, 2h), 7.147.45 (m, 6h), 7.517.60 (m, 2h), 7.76 (d, j = 7.2 hz, 2h); lc / ms calcd for c24h21fno4 [m + h] 406.1; found 406.2 . 10.0 mg (49% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 82%, tr = 5.17 min; h nmr (200 mhz, cdcl3/cd3od) 3.08 (dd, j = 13.8 hz, j = 6.2 hz, 1h), 3.19 (dd, j = 13.9 hz, j = 5.5 hz, 1h), 4.20 (t, j = 7.0 hz, 1h), 4.284.51 (m, 2h), 4.60 (t, j = 5.5 hz, 1h), 6.857.00 (m, 2h), 7.177.45 (m, 6h), 7.517.63 (m, 2h), 7.77 (d, j = 7.4 hz, 2h); lc / ms calcd for c24h21fno4 [m + h] 406.1; found 406.3 . 7.0 mg (34% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 97%, tr = 5.18 min; h nmr (200 mhz, cdcl3/cd3od) 3.02 (dd, j = 13.8 hz, j = 6.0 hz, 1h), 3.15 (dd, j = 14.1 hz, j = 5.3 hz, 1h), 4.19 (t, j = 6.7 hz, 1h), 4.284.52 (m, 2h), 4.56 (m, 1h), 6.95 (m, 2h), 7.057.15 (m, 2h), 7.287.46 (m, 4h), 7.527.61 (m, 2h), 7.77 (d, j = 7.2 hz, 2h); lc / ms calcd for c24h21fno4 [m + h] 406.1; found 405.8 . 12.2 mg (54% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 94%, tr = 5.46 min; h nmr (200 mhz, cdcl3/cd3od) 3.10 (dd, j = 14.2 hz, j = 9.6 hz, 1h), 3.46 (dd, j = 14.7 hz, j = 5.1 hz, 1h), 4.074.20 (m, 1h), 4.214.36 (m, 2h), 4.64 (dd, j = 9.5 hz, j = 5.1 hz, 1h), 7.247.48 (m, 7h), 7.54 (t, j = 6.6 hz, 2h), 7.64 (d, j = 7.4 hz, 1h), 7.75 (d, j = 7.4 hz, 2h); lc / ms calcd for c25h19f3no4 [m + h] 456.1; found 456.2 . 9.4 mg (41% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 90%, tr = 5.53 min; h nmr (200 mhz, cdcl3/cd3od) 3.14 (dd, j = 13.8 hz, j = 6.0 hz, 1h), 3.26 (dd, j = 13.7 hz, j = 5.3 hz, 1h), 4.19 (t, j = 6.6 hz, 1h), 4.274.51 (m, 2h), 4.61 (t, j = 5.5 hz), 7.287.50 (m, 8h), 7.517.62 (m, 2h), 7.77 (dd, j = 7.4 hz, 2h); lc / ms calcd for c25h19f3no4 [m + h] 456.1; found 456.1 . 9.4 mg (41% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 88%, tr = 5.55 min; h nmr (200 mhz, cdcl3/cd3od) 3.12 (dd, j = 13.7 hz, j = 5.9 hz, 1h), 3.26 (dd, j = 14 hz, j = 5.6 hz, 1h), 4.19 (t, j = 6.6 hz, 1h), 4.304.54 (m, 2h), 4.63 (t, j = 5.3 hz, 1h), 7.217.46 (m, 6h), 7.477.61 (m, 4h), 7.77 (d, j = 7.2 hz, 2h); lc / ms calcd for c25h19f3no4 [m h] 454.1; found 454.2 . 11.2 mg (48% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5): initial lc / ms purity 90%, tr = 5.39 min; h nmr (200 mhz, cdcl3/cd3od) 3.12 (dd, j = 13.8 hz, 9.2 hz, 1h), 3.44 (dd, j = 14.1 hz, 5.3 hz, 1h), 4.054.40 (m, 3h), 4.68 (dd, j = 8.8 hz, 5.1 hz, 1h), 7.037.16 (m, 1h), 7.187.45 (m, 6h), 7.55 (d, j = 7.6 hz, 3h), 7.76 (d, j = 7.4 hz, 2h); lc / ms calcd for c24h21brno4 [m + h] 466.1; found 468.0 . 10.7 mg (46% isolated yield) following chromatographic purification (ch2cl / meoh / h2o, 300:10:0.5); initial lc / ms purity 97%, tr = 5.49 min; h nmr (200 mhz, cdcl3/cd3od) 3.05 (dd, j = 13.8 hz, 6.6 hz, 1h), 3.17 (dd, j = 13.9 hz, 5.5 hz, 1h), 4.154.51 (m, 3h), 4.59 (t, j = 5.5 hz, 1h), 7.067.21 (m, 2h), 7.307.46 (m, 6h), 7.527.63 (m, 2h), 7.77 (d, j = 7.4 hz, 2h); lc / ms calcd for c24h21brno4 [m + h] 466.1; found 466.1 . 9.8 mg (42% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 98%, tr = 5.52 min; h nmr (200 mhz, cdcl3/cd3od): 3.03 (dd, j = 13.6 hz, j = 6.1 hz, 1h), 3.15 (dd, j = 14.4 hz, j = 5.8 hz, 1h), 4.19 (t, j = 6.2 hz, 1h), 4.284.51 (m, 2h), 4.524.62 (m, 1h), 7.01 (d, j = 8.4 hz, 2h), 7.317.46 (m, 6h), 7.537.62 (m, 2h), 7.78 (d, j = 7.0 hz, 2h); lc / ms calcd for c24h21brno4 [m + h] 466.1; found 467.8 . 7.8 mg (38% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 94%, tr = 4.87 min; h nmr (200 mhz, cdcl3/cd3od): 3.25 (dd, j = 14.3 hz, j = 7.7 hz, 1h), 3.48 (dd, j = 14.3 hz, j = 5.5 hz, 1h), 4.16 (t, j = 6.7 hz, 1h), 4.224.44 (m, 2h), 4.604.76 (m, 1h), 7.267.64 (m, 10h), 7.76 (d, j = 7.0 hz, 2h); lc / ms calcd for c25h19n2o4 [m + h] 413.1; found 413.2 . 7.8 mg (38% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 82%, tr = 4.81 min;h nmr (200 mhz, cdcl3/cd3od) 3.09 (dd, j = 13.8 hz, j = 6.2 hz, 1h), 3.22 (dd, j = 13.5 hz, j = 5.1 hz, 1h), 4.19 (t, j = 6.4 hz, 1h), 4.294.54 (m, 2h), 4.58 (m, 1h), 7.277.62 (m, 10h), 7.77 (d, j = 7.4 hz, 2h); lc / ms calcd for c25h19n2o4 [m h] 412.1; found 411.3 . 7.5 mg (36% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 91%, tr = 4.79 min; h nmr (200 mhz, cdcl3/cd3od) 3.10 (dd, j = 13.7 hz, j = 7.2 hz, 1h), 3.193.33 (m, 1h), 4.19 (t, j = 6.4 hz, 1h), 4.314.55 (m, 2h), 4.564.64 (m, 1h), 7.227.46 (m, 6h), 7.527.62 (m, 4h), 7.78 (d, j = 7.4 hz, 2h); lc / ms calcd for c25h19n2o4 [m h] 412.1; found 412.5 . 11.4 mg (44% isolated yield) following chromatographic purification (ch2cl2-meoh - h2o, 300:10:0.5); initial lc / ms purity 97%, tr = 5.51 min; h nmr (200 mhz, cdcl3/cd3od) 3.11 (dd, j = 14.4 hz, j = 9.2 hz, 1h), 3.40 (dd, j = 13.9 hz, j = 5.1 hz, 1h), 4.094.21 (m, 1h), 4.224.39 (m, 2h), 4.67 (dd, j = 9.2 hz, j = 5.1 hz, 1h), 6.866.97 (m, 1h), 7.227.44 (m, 6h), 7.527.61 (m, 2h), 7.75 (d, j = 7.4 hz, 2h), 7.83 (d, j = 7.8 hz, 1h); lc / ms: calcd for c24h21ino4 [m + h] 514.0; found 514.0 . 7.1 mg (28% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 97%, tr = 5.61 min; h nmr (200 mhz, cdcl3/cd3od): 3.01 (dd, j = 14.2 hz, j = 6.4 hz, 1h), 3.14 (dd, j = 13.7 hz, j = 5.3 hz, 1h), 4.19 (t, j = 6.6 hz, 1h), 4.274.49 (m, 2h), 4.504.62 (m, 1h), 5.82 (d, j = 8.4 hz, 1h), 6.89 (d, j = 8.2 hz, 2h), 7.277.47 (m, 4h), 7.517.64 (m, 4h), 7.78 (d, j = 7.4 hz, 2h); lc / ms calcd for c24h21ino4 [m + h] 514.0; found 514.0 . 5.9 mg (27% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 86%, tr = 5.57 min; h nmr (200 mhz, cdcl3/cd3od) 3.383.50 (m, 1h), 3.75 (dd, j = 14.2 hz, 5.4 hz, 1h), 4.084.22 (m, 1h), 4.234.39 (m, 2h), 4.73 (dd, j = 7.4 hz, 5.6 hz, 1h), 7.237.55 (m, 10h), 7.707.89 (m, 4h), 8.16 (d, j = 7.8 hz, 1h); lc / ms calcd for c28h24no4 [m + h] 438.2; found 438.2 . 8.8 mg (40% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 85%, tr = 5.58 min;h nmr (200 mhz, cdcl3/cd3od) 3.24 (dd, j = 14 hz, j = 6.8 hz, 1h), 3.313.45 (m, 1h), 4.124.45 (m, 1h), 4.274.46 (m, 2h), 4.69 (t, j = 5.6 hz, 1h), 7.197.56 (m, 10h), 7.64 (m, 1h), 7.717.83 (m, 4h); lc / ms calcd for c28h24no4 [m + h] 438.2; found 438.2 . 10.2 mg (60% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 93%, tr = 4.74 min; h nmr (200 mhz, cdcl3/cd3od) 2.452.71 (m, 2h), 4.23 (t, j = 6.7 hz, 1h), 4.304.49 (m, 3h), 5.055.25 (m, 2h), 5.73 (m, 1h), 7.297.46 (m, 4h), 7.61 (d, j = 7.2 hz, 2h), 7.77 (d, j = 6.6 hz, 2h); lc / ms calcd for c20h20no4 [m + na] 360.1; found 360.1 . 9.6 mg (44% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 91%, tr = 5.00 min; h nmr (200 mhz, cdcl3/cd3od) 3.25 (dd, j = 13.2 hz, 9.4 hz, 1h), 3.63 (dd, j = 13.9 hz, 5.5 hz, 1h), 4.064.20 (m, 1h), 4.204.37 (m, 2h), 4.70 (dd, j = 8.6 hz, 5.4 hz, 1h), 7.277.59 (m, 9h), 7.75 (d, j = 7.2 hz, 2h), 7.94 (d, j = 8.0 hz, 1h); lc / ms calcd for c24h21n2o6 [m + h] 433.1; found 433.2 . 8.9 mg (39% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 89%, tr = 5.71 min; h nmr (200 mhz, cdcl3/cd3od) 3.07 (dd, j = 13.6 hz, 8.8 hz, 1h), 3.323.46 (m, 1h), 4.16 (m, 1h), 4.224.42 (m, 2h), 4.62 (dd, j = 8.4 hz, 5.4 hz, 1h), 7.16 (s, 2h), 7.287.45 (m, 5h), 7.497.61 (m, 2h), 7.76 (d, j = 6.8 hz, 2h); lc / ms calcd for c24h20cl2no4 [m + h] 456.1; found 456.2 . 10.3 mg (49% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 94%, tr = 5.08 min; h nmr (200 mhz, cdcl3/cd3od) 3.03 (dd, j = 13.9 hz, 6.7 hz, 1h), 3.34 (dd, j = 13.9 hz, 5.5 hz, 1h), 3.77 (s, 3h), 4.19 (t, j = 6.9 hz, 1h), 4.254.49 (m, 2h), 4.56 (t, j = 5.5 hz, 1h), 6.82 (d, j = 7.6 hz, 2h), 7.07 (d, j = 8.0 hz, 2h), 7.297.48 (m, 4h), 7.527.64 (m, 2h), 7.77 (d, j = 7.2 hz, 2h); lc / ms calcd for c25h24no5 [m + h] 418.2; found 418.2 . 7.9 mg (35% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 84%, tr = 5.25 min; h nmr (200 mhz, cdcl3/cd3od) 2.94 (dd, j = 16.7 hz, 4.5 hz, 1h), 3.05 (dd, j = 17.2 hz, 5.2 hz, 1h), 4.22 (t, j = 7.1 hz, 1h), 4.294.45 (m, 2h), 4.62 (m, 1h), 5.15 (s, 2h), 6.18 (d, j = 8.0 hz, 1h), 7.267.46 (m, 9h), 7.60 (d, j = 7.4 hz, 2h), 7.76 (d, j = 7.4 hz, 2h); lc / ms calcd for c26h24no6 [m + h] 446.2; found 446.2 . 5.6 mg (27% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5) initial lc / ms purity 89%, tr = 5.14 min; h nmr (200 mhz, cdcl3/cd3od) 3.003.26 (m, 2h), 3.76 (s, 3h), 4.144.46 (m, 3h), 4.57 (m, 1h), 6.736.83 (m, 2h), 7.147.46 (m, 6h), 7.527.62 (m, 2h), 7.76 (d, j = 7.0 hz, 2h); lc / ms calcd for c25h24no5 [m + h] 418.2; found 418.2 . 5.5 mg (26% isolated yield) following chromatographic purification (ch2cl2/meoh / h2o, 300:10:0.5); initial lc / ms purity 80%, tr = 2.53 min; h nmr (200 mhz, cdcl3/cd3od) 2.753.00 (m, 2 h), 3.95 (t, j = 6.4 hz, 1 h), 4.064.38 (m, 3 h), 6.947.22 (m, 6 h), 7.32 (d, j = 7.2 hz, 2 h), 7.52 (d, j = 7.0 hz, 2 h), 7.90 (s, 1 h); lc / ms calcd for c23h19cln2o4 [m h] 421.1; found 421.0. |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.