Unnamed: 0.1
int64 1
131k
| Unnamed: 0
int64 1
130k
| id
stringlengths 6
24
| title
stringclasses 2
values | context
stringlengths 151
44k
| question
stringlengths 2
25.7k
| answers
stringlengths 32
440
|
|---|---|---|---|---|---|---|
16,984
| 16,642
|
56e10f57cd28a01900c674ff
|
generic
|
In the Church of England, the ecclesiastical courts that formerly decided many matters such as disputes relating to marriage, divorce, wills, and defamation, still have jurisdiction of certain church-related matters (e.g. discipline of clergy, alteration of church property, and issues related to churchyards). Their separate status dates back to the 12th century when the Normans split them off from the mixed secular/religious county and local courts used by the Saxons. In contrast to the other courts of England the law used in ecclesiastical matters is at least partially a civil law system, not common law, although heavily governed by parliamentary statutes. Since the Reformation, ecclesiastical courts in England have been royal courts. The teaching of canon law at the Universities of Oxford and Cambridge was abrogated by Henry VIII; thereafter practitioners in the ecclesiastical courts were trained in civil law, receiving a Doctor of Civil Law (D.C.L.) degree from Oxford, or a Doctor of Laws (LL.D.) degree from Cambridge. Such lawyers (called "doctors" and "civilians") were centered at "Doctors Commons", a few streets south of St Paul's Cathedral in London, where they monopolized probate, matrimonial, and admiralty cases until their jurisdiction was removed to the common law courts in the mid-19th century.
|
In what institution do church courts still have relevant functions in secular society?
|
{'text': 'the Church of England', 'answer_start': 3}
|
20,611
| 20,269
|
56e7a01d37bdd419002c4286
|
generic
|
At present, the full name of the government of Nanjing is "People's Government of Nanjing City" and the city is under the one-party rule of the CPC, with the CPC Nanjing Committee Secretary as the de facto governor of the city and the mayor as the executive head of the government working under the secretary.
|
who is the executive leader of Nanjing, working under the secretary?
|
{'text': 'the mayor', 'answer_start': 231}
|
125,501
| 125,159
|
57329eb1cc179a14009dab72
|
generic
|
While the housing and credit bubbles were building, a series of factors caused the financial system to both expand and become increasingly fragile, a process called financialization. U.S. Government policy from the 1970s onward has emphasized deregulation to encourage business, which resulted in less oversight of activities and less disclosure of information about new activities undertaken by banks and other evolving financial institutions. Thus, policymakers did not immediately recognize the increasingly important role played by financial institutions such as investment banks and hedge funds, also known as the shadow banking system. Some experts believe these institutions had become as important as commercial (depository) banks in providing credit to the U.S. economy, but they were not subject to the same regulations.
|
What institutions comprise the shadow banking system?
|
{'text': 'investment banks and hedge funds', 'answer_start': 567}
|
105,881
| 105,539
|
572ed7a0c246551400ce4718
|
generic
|
The above explanation is merely a simple introduction to vacuum pumping, and is not representative of the entire range of pumps in use. Many variations of the positive displacement pump have been developed, and many other pump designs rely on fundamentally different principles. Momentum transfer pumps, which bear some similarities to dynamic pumps used at higher pressures, can achieve much higher quality vacuums than positive displacement pumps. Entrapment pumps can capture gases in a solid or absorbed state, often with no moving parts, no seals and no vibration. None of these pumps are universal; each type has important performance limitations. They all share a difficulty in pumping low molecular weight gases, especially hydrogen, helium, and neon.
|
What pump has a higher quality vacuum than a positive displacement pump?
|
{'text': 'Momentum transfer pumps', 'answer_start': 279}
|
77
| 77
|
138461
|
pubqa
|
An outbreak of cryptosporidiosis occurred in and around Clitheroe, Lancashire, in northwest England, during March 2000. Fifty-eight cases of diarrhea with Cryptosporidium identified in stool specimens were reported. Cryptosporidium oocysts were identified in samples from the water treatment works as well as domestic taps. Descriptive epidemiology suggested that drinking unboiled tap water in a single water zone was the common factor linking cases. Environmental investigation suggested that contamination with animal feces was the likely source of the outbreak. This outbreak was unusual in that hydrodynamic modeling was used to give a good estimate of the peak oocyst count at the time of the contamination incident. The oocysts persistence in the water distribution system after switching to another water source was also unusual. This persistence may have been due to oocysts being entrapped within biofilm. Despite the con- tinued presence of oocysts, epidemiologic evidence suggested that no one became ill after the water source was changed. Outbreaks of cryptosporidiosis associated with drinking water have been an emerging problem for the past 20 years. In the 1990s, cryptosporidiosis became the most common cause of outbreaks associated with public drinking water supplies in the United Kingdom (1). This disease is also responsible for several of the largest outbreaks of waterborne disease seen in the United States (1). Yet substantial areas of uncertainty over many aspects of the epidemiology of this infection remain. One of the most pressing such areas is deter- mining what concentration of oocysts in drinking water is con- sidered safe. In the United Kingdom, recent legislation was enacted that set a legal limit of 1 oocyst/10 L when water was sampled con- tinuously over a 24-hour period (2). However, this level was set as a treatment standard and was not derived from known public health standards. With current knowledge, proposing standards for cryptosporidia based on public health criteria is not possible, primarily because published reports of outbreaks have not had accurate measures of the concentration of oocysts in the water at the time when infection was thought to have occurred. We report, to our knowledge, the first outbreak to have occurred when a fairly accurate estimate of the concen- tration of oocysts in the water could be made. The Outbreak In March 2000, an outbreak of cryptosporidiosis occurred in and around the town of Clitheroe in Lancashire County in northwest England. This small market town, nestled in the hills near the Ribble River, is a thriving community that attracts many tourists. The surrounding countryside supports arable and dairy farming. Before this outbreak, reported cases of cryptosporidiosis were low. In the years 19971999, the mean annual attack rate of laboratory-confirmed cryptosporid- iosis was 4.83 per 10,000 residents per year, compared with 13.57 for the region as a whole. During March 115, 2000, the Ribble Valley Environmental Health Department reported nine cases of cryptosporidiosis to the East Lancashire Health Authority. All the patients lived in or near Clitheroe. Provisional information provided by the water company indicated that six of these nine patients lived in a single water zone supplied by the same water treatment works. On the basis of this information, an outbreak was declared, and an outbreak control team was established. The team met for the first time on March 16. Methods Epidemiologic Investigation Environmental health and public health department personnel interviewed patients with cryptosporidiosis in person or by telephone, using a structured questionnaire (3). Analysis was performed by using the computer program Epi-Info (version 6.02; Centers for Disease Control and Prevention, Atlanta, GA). Patients were defined as those with a positive stool sample who lived in or visited the implicated water zone and who had onset of diarrhea since March 1, 2000. Cases were defined as primary when no other member of the household had had diarrhea in the 2 weeks before the onset of symptoms; possible secondary cases were defined as those in which a member of the same household had had diarrhea in the previous 2 weeks. The case definitions included those who had traveled abroad for <7 days. *East Lancashire Health Authority, Nelson, United Kingdom; United Utilities Water PLC, Warrington, United Kingdom; Public Health Labo- ratory, Preston, United Kingdom; and University of East Anglia, Nor- wich, United Kingdom O RESEARCH 620 Emerging Infectious Diseases Vol. 8, No. 6, June 2002 Microbiologic Investigation General practitioners in the area submitted stool samples to the local hospital microbiology laboratory. Stools were examined by microscopy with the modified auramine phenol stain (4). Positive samples were then sent to the Public Health Laboratory Services Cryptosporidium Reference Unit for genotyping. Environmental Investigations The local water company provided information on the water supply, instituted a water-sampling schedule (from domestic properties, water treatment works, and fire hydrants during flushing operations), and analyzed the water samples to identify Cryptosporidium oocysts. Most of the samples were 10-L grab samples analyzed according to the U.K. standard method (5). The large-volume samples were analyzed by the method in the Water Supply (Water Quality) Amendment Reg- ulations of 1999 (2). The source of water to the affected area (Grindleton Springs) was visited by members of the outbreak control team. The local water company supplied rainfall statistics for the weeks preceding the outbreak. Local authority engineers were consulted for information on previous high water or flood warnings. After the incident, the water company constructed a physical model of the affected reservoir, Lowcocks, with a geometric scaling ratio of 32:1. Flows were tracked by using salt injection with an array of conductivity probes suspended above the tank and injecting colored dyes for visualization. As the ratio of the two respective inlet flows can vary, the baseline performance of the tank was evaluated over a range of opera- tional, but steady state, conditions. A series of transient tests was then conducted to mirror the operation of the reservoir in the time leading up to and covering the incident until the boil water notice was issued on March 21. Result Descriptive Epidemiology Fifty-eight cases met the case definition. Of these, three were in patients who had traveled abroad for <7 days in the 2 weeks before illness. Fifty-one cases were identified as pri- mary, and seven as possible secondary. The dates of onset of cases (Figure 1) showed peaks on March 10 and 17. Ages of patients ranged from 7 months to 95 years, but most patients were <5 years (52%). Thirty (52%) of the patients were male and 28 (48%) female. All 58 patients (100%) had diarrhea; 18 (31%) had fever, 48 (83%) abdominal pain, 19 (33%) vomit- ing, and three (5%) blood in the stool. Fifty-one patients lived in the same water supply zone and drank unboiled main tap water in the zone. The crude attack rate for residents of this zone was 29.6 per 10,000 population (based on general practitioner registered population of 17,252 linked by postal code of residences in the water supply zone). The crude attack rate for people within the same local government area but not living in the same water supply zone was 1.8 per 10,000 population, giving a relative risk associated with residence in the implicated water supply zone of 16.2 (95% confidence interval 7.5 to 35.0). The age-specific attack rate varied from 275 per 10,000 in children <5 years of age to 5.6 per 10,000 in those >44 years (Table 1). Seven patients lived in properties not in the affected water zone. However, six of these had drunk unboiled main water in the affected zone in the 2 weeks before illness; the other patient had visited a swimming pool in the zone. Other potential risk factors, such as travel, visit to a swimming pool, and consumption of certain foods, were included in the questionnaire. None was common in patients. Microbiologic Testing Of the 58 cases with a positive stool sample for Cryptosporidium, 47 specimens were typed. All were C. parvum genotype 2 (for nine cases there was insufficient material, and two specimens were untypable). Environmental Results Water Sample Analysis Lowcocks Water Treatment Works (WTW), sourced from Grindleton Springs, supplied approximately 90% of the water to the affected zone. The supply was a spring source that fed a single service reservoir and from there moved into distribu- tion. However, the reservoir could also be filled from a nearby larger water supply via an aqueduct. The supply was chlori- nated but not filtered. As part of the risk assessment carried out under water quality amendment regulations (2), Lowcocks Figure 1. Date of diarrhea onset, 58 cryptosporidiosis cases, Clitheroe, 2000. Table 1. Age-specific attack rates for cryptosporidiosis in residents of water zone 97, Clitheroe, March 2000 Age group Cases (n=51) Population Rate/10,000 95% confidence interval <4 26 945 275.1 170.8 to 379.4 514 9 2,283 39.4 13.7 to 65.1 1544 12 6,822 17.6 7.6 to 27.5 >45 4 7,202 5.6 0.1 to 11.0 Total 51 1,7252 29.6 21.5 to 37.7 Emerging Infectious Diseases Vol. 8, No. 6, June 2002 621 RESEARCH WTW was classified as being at significant risk from Cryptosporidium oocysts in water supplied from the works. However, continuous monitoring had not yet begun before the outbreak. The reservoir is rectangular with two inlets and a single outlet. The tank is 110 m long and 90 m wide with an opera- tional depth between 3.5 m and 5.4 m. The spring has one inlet, which varies from 2 to 6 megaliters per day and another from the aqueduct, which varies from 1.5 to 5 megaliters per day. The calculated capacity of the reservoir is 53 megaliters. The ratio of aqueduct to spring water varies considerably dur- ing normal operation; full advantage is taken of the increase in availability of the springs source after major rainfalls. On March 17, a large-volume sample of water (1,627 L) from a pumping station fed from Lowcocks WTW yielded 76 oocysts of Cryptosporidium per 1,000 L. Cryptosporidium oocysts were also identified in a water sample taken from a domestic tap in the water zone on March 16 at a concentration of five oocysts per 10 L of water. From March 16 to April 6, a total of 192 samples (10-L grab samples) from domestic taps or fire hydrants in the affected zone were analyzed; 47 (24%) contained Cryptosporidium oocysts in concentrations ranging from 1 to 9/10 L. Six water samples from domestic taps in areas adjoining the affected water zone were negative (Table 2, Figure 2). Site Visits The concrete casings of two of the Grindleton Springs col- lection chambers showed signs of aging and were in a poor state of repair (one could look directly into one chamber through holes in the concrete). Evidence of recent livestock excreta (cattle) was present in the areas around, and in direct contact with, the covers to several of the spring collection chambers; manure was also spread in a field within 5 m of one wellhead. Rainfall Statistics Abnormally heavy rainfall (up to 58 mm per day) and flood alerts were reported for the area on February 27 and March 27. Hydraulic Modeling A number of detailed transient state tests were conducted in which the flows and levels were altered in line with the res- ervoir operation before and during the outbreak. Initially, the first injection of oocysts was assumed to have come into the reservoir on February 27, after the first associated heavy rain- fall. However, results from these initial tests indicated that, because of the way the reservoir operated and its short nominal retention time (2 days) during part of this period, a large spike of oocysts entering the reservoir from the springs inlet on Feb- ruary 27 would have been effectively washed out by the time the sample was taken on March 17. Two potential contamination events, one after each major rainfall event on February 27 and March 2, respectively, were then proposed. This hypothesis was modeled by injection of two discrete salt pulses into the model springs inlet at the appropriately scaled time in the modeling run. Results indi- cated three peaks of oocyst counts at the tank outlet. The first peak occurred when the tank was operating on only spring flow, corresponding to February 29. The second peak came on March 1, when aqueduct flow was introduced. The final peak occurred on March 23, after the second salt pulse (simulating the rainfall incident). Based on the concentration found in the March 17 sample, the most probable peak concentration that the Clitheroe popu- lation would have been exposed to was 40 times greater, approximately 30 oocysts per 10 L. These values are based on tests in which the pulse was introduced instantaneously; in practice, contamination likely took place over several hours or days after each major rainfall event. While it is likely that the behavior of oocysts would not substantially differ in the water system and the salt and dye model, these numbers should not be considered exact; rather, they are a good indication of level of exposure over the period in question. Table 2. Results of 10-L grab samples taken within distribution range of water works during investigationa of cryptosporidial outbreak, Clitheroe, March 16April 6, 2001 Date Samples taken Samples positive Oocyst counts of positive samples/L 16 Mar 3 1 0.5 17 Mar 6 5 0.1 0.2 0.1 0.2 0.1 18 Mar 8 4 0.2 0.2 0.3 0.3 19 Mar 8 5 0.2 0.3 0.1 0.1 0.2 20 Mar 9 5 0.1 0.2 0.9 0.5 0.1 21 Mar 23 5 0.2 0.1 0.1 0.4 0.1 22 Mar 16 4 0.1 0.1 0.1 0.1 23 Mar 15 2 0.1 0.2 24 Mar 15 2 0.1 0.1 25 Mar 12 2 0.1 0.1 26 Mar 12 0 27 Mar 9 0 28 Mar 3 2 0.3 0.4 29 Mar 3 0 30 Mar 6 3 0.1 0.2 0.4 31 Mar 9 3 0.1 0.1 0.6 1 Apr 7 1 0.1 2 Apr 7 1 0.1 3 Apr 6 2 0.1 0.1 4 Apr 6 0 5 Apr 6 0 6 Apr 3 0 a Total volume examined each day (in L) = 10 X number of samples taken. RESEARCH 622 Emerging Infectious Diseases Vol. 8, No. 6, June 2002 Control Measures At the first outbreak control team meeting, 11 of 14 reported cryptosporidiosis cases were known to be in residents of the same water supply zone. As a result, the water supply to the affected area was changed to an alternate supply during the following night, and the system was flushed. The alternate supply was an approximately 50/50 blend of filtered surface water from two separate (protected) upland impounding reser- voirs. The first source (Watchgate) provides up to 600 megali- ters per day to a population of approximately 1.75 x 106; the second source (Hodder) provides up to 50 megaliters per day to a population of approximately 1.75 x 103. Both areas had had no observed increase in the rates of reported cryptosporid- iosis. At the third outbreak control team meeting, when results of sampling became available, it became evident that, although the water supply to the area had been changed by 9:30 a.m. on March 17 (and its distribution throughout the zone confirmed by chemical analysis of domestic water samples), substantial numbers of Cryptosporidium oocysts still existed in samples taken during the next 4 days (March 1720). Initial samples from the source of the new water supply showed no evidence of contamination. Historic archived data available for both new sources showed only a low frequency of detected oocysts in the raw (untreated source) water for each site. During the incident, five samples of treated water were taken from the first site and 13 samples from the second source. A single oocyst was reported in one 10-L sample taken from the first site; no oocysts were detected in the other samples. The outbreak control team agreed that there continued to be a risk to public health and issued a Boil Water Advisory on March 21. This advisory was rescinded on March 27 after extensive water system flushing operations and 2 days of domestic water samples being clear of Cryptosporidium oocysts. The peak in counts on March 28, although calculated from three samples, was associated with the sampling water from hydrants rather than from domestic taps. Water sampling continued, but samples were taken from fire hydrants rather than domestic taps. While inspections of the water system showed no evidence of ongoing contamina- tion, analysis of water continued to show cryptosporidia. When oocysts were detected in hydrant samples after the source of water had been changed, experienced operations staff inspected the route of the aqueduct, and boundary valves at the periphery of the affected distribution system were checked to ensure that water could not enter this system from an adjacent zone. At this stage, no further new cases of cryptosporidiosis were being reported. The original source of water, Grindleton Springs, had been identified as having a plausible source of oocysts within the watershed (cattle excreta), a plausible path- way (through the damaged spring head structure to one of the chambers), and inadequate treatment for removing oocysts (microfiltration with a pore size >40 ); this source of water had been isolated and discharged to waste. Thus, the change in sampling method, rather than ongoing contamination, might be causing the continuing positive oocyst results. For this rea- son, the boil water advisory was not reinstituted. Further flush- ing continued, no new cases of cryptosporidiosis were reported, and the last water sample positive for oocysts was on April 3. Discussion Use of U.K. Public Health Laboratory Service guidelines strongly associated this outbreak with the water supply because Cryptosporidium oocysts were detected in treated water and the descriptive epidemiology suggested that drinking tap water was the only common factor linking the cases (6). Environmental investigations suggested that contamination of Grindleton Springs with animal feces was the probable cause of the outbreak. Results of genotyping were consistent with an animal source. This outbreak is unusual because of the very high attack rate of laboratory-confirmed cases. The crude attack rate for microbiologically confirmed cases of cryptosporidiosis was much higher than previously reported in the United Kingdom (79). We suggest that this high attack rate occurred because of low immunity in the population and the probable high con- centration of oocysts at the time of the initial contamination. Although we have no direct measure of population immunity before this outbreak, the incidence of infection in previous years was low compared with that in the rest of the region. Furthermore, until the outbreak, the water supply was a groundwater source; various groups have suggested that such sources are associated with lower sporadic infections and lower population immunity (7,10). The other major issue raised by this outbreak was the impact of changing the source of water. The outbreak control team had suggested that changing the water supply to the affected area at the beginning of the outbreak would remove the Cryptosporidium oocysts from the water. However, this measure did not result in the expected immediate clearance of contamination. Indeed, despite lack of evidence of a new con- tamination source and with ongoing extensive flushing opera- tions, oocysts remained detectable at low levels for up to 19 days after the change. Counts did generally decline during the 10 days after the supply was changed; however, counts peaked on March 20 after a burst in the main supply pipe. Increased Figure 2. Mean daily cryptosporidia oocyst counts from 10-L grab samples taken during outbreak investigation, Clitheroe. Emerging Infectious Diseases Vol. 8, No. 6, June 2002 623 RESEARCH counts on March 2831 occurred when water samples started being taken from hydrants, rather than domestic taps. Hydrant water is discharged much more forcefully than that from domestic taps. The slow decline in oocyst counts after the change in supply may have been because of captured oocysts being released from the biofilm on the surface of the distribu- tion pipes. Subsequent peaks associated with the burst and use of hydrants for sampling could have increased oocyst counts by stripping biofilm from the inner surface. Cryptosporidium oocysts do attach to biofilm in this manner (1,11,12) Whatever the reasons for the continued detection of oocysts in water samples, few, if any, cases of infection were acquired after the source was changed. The epidemiologic analysis suggests that changing the water supply was the key public health measure. The boil-water advisory had little, if any, effect on reducing subsequent cases. The decision not to reintroduce the advisory when hydrant samples continued to show oocysts appears to have been justified. Monitoring water samples, particularly with 10-L small- volume samples, highlighted the difficulties in interpreting the public health importance of oocysts in the water (1315). Cur- rently, the level of detectable Cryptosporidium oocysts in domestic water samples that poses no public health risk is unknown. The number of oocysts detected in the large-volume filtration of water from the WTW was below the limit cur- rently defined as a national maximum permissible treatment standard (100 oocysts per 1,000 L) (2). However, this outbreak occurred 10 days after the most recent of three major rainfalls that could plausibly have given rise to contamination of the source water. Physical and computational fluid dynamics mod- eling suggested that the concentrations of oocysts in water leaving the WTW immediately after the heavy rainfall were 30 times the statutory treatment standard. The introduction of continuous monitoring in the United Kingdom, together with existing surveillance for cryptosporid- ium infection in humans, will hopefully result in a better defi- nition of an appropriate public health standard for this organism. However, recent human studies have shown a sub- stantial intraspecies variability in the infectivity of Cryptospo- ridium oocysts (16). Furthermore, we have recently identified a novel strain of C. parvum that appears to be widespread in sheep but has never been described in humans (17). These observations suggest that identifying a standard in drinking water that would lead to a tolerable level of illness in the com- munity may not be possible. Indeed, outbreaks of cryptospo- ridiosis associated with drinking water elsewhere in the United Kingdom have occurred despite the peak oocyst counts being well within the statutory standard (18,19). Several episodes have also been reported in which high oocyst counts (>10 oocysts in 100 L) have been detected in treated water with no episodes of illness subsequently being detected in the commu- nity (20). Further research is required to define the public health importance of low levels of Cryptosporidium oocysts as well as the optimal water sampling strategy during an outbreak. Similarly, the effectiveness and utility of system flushing remain to be shown. The current treatment standard should be reviewed, as further evidence relating to the public health impact of levels of Cryptosporidium oocysts becomes avail- able. Dr. Howe is a specialist registrar in public health medicine in northwest England. In addition to health protection and waterborne disease, his research interests include the public health response to violence.
|
How many cases were there?
|
{'answer_id': 263753, 'document_id': 394241, 'question_id': 138461, 'text': 'Fifty-eight cases', 'answer_start': 6469, 'answer_category': 'SHORT'}
|
23,930
| 23,588
|
56f83b11a6d7ea1400e174e3
|
generic
|
However, the NSA's report was completely disproved by Croatian experts. The report failed to recognize that Tito was a native speaker of the very distinctive local Kajkavian dialect of Zagorje. The acute accent, present only in Croatian dialects, which Tito is perfectly pronouncing, is the strongest proof of Tito's belonging to Kajkavian dialect.
|
Croatian experts disproved the report from which group concerning Tito's ethnic origins?
|
{'text': 'NSA', 'answer_start': 13}
|
19,282
| 18,940
|
56e74b9f37bdd419002c3e2b
|
generic
|
The war's end swung the pendulum back. Farmers continued to dislike DST, and many countries repealed it after the war. Britain was an exception: it retained DST nationwide but over the years adjusted transition dates for several reasons, including special rules during the 1920s and 1930s to avoid clock shifts on Easter mornings. The US was more typical: Congress repealed DST after 1919. President Woodrow Wilson, like Willett an avid golfer, vetoed the repeal twice but his second veto was overridden. Only a few US cities retained DST locally thereafter, including New York so that its financial exchanges could maintain an hour of arbitrage trading with London, and Chicago and Cleveland to keep pace with New York. Wilson's successor Warren G. Harding opposed DST as a "deception". Reasoning that people should instead get up and go to work earlier in the summer, he ordered District of Columbia federal employees to start work at 08:00 rather than 09:00 during summer 1922. Some businesses followed suit though many others did not; the experiment was not repeated.
|
After what year was daylight savings repealed in the U.S.?
|
{'text': '1919', 'answer_start': 384}
|
129,028
| 128,686
|
573425a6d058e614000b6a01
|
generic
|
Richmond recovered quickly from the war, and by 1782 was once again a thriving city. In 1786, the Virginia Statute for Religious Freedom (drafted by Thomas Jefferson) was passed at the temporary capitol in Richmond, providing the basis for the separation of church and state, a key element in the development of the freedom of religion in the United States. A permanent home for the new government, the Virginia State Capitol building, was designed by Thomas Jefferson with the assistance of Charles-Louis Clérisseau, and was completed in 1788.
|
What notable document was authored by Thomas Jefferson in 1786?
|
{'text': 'Virginia Statute for Religious Freedom', 'answer_start': 98}
|
15,524
| 15,182
|
56e064667aa994140058e441
|
generic
|
In 1989, Prince Andrew launched the replacement RMS St Helena to serve the island; the vessel was specially built for the Cardiff–Cape Town route and features a mixed cargo/passenger layout.
|
What year was the replacement for the RMS St Helena launched?
|
{'text': '1989', 'answer_start': 3}
|
86,740
| 86,398
|
5acfc84877cf76001a685f3b
|
generic
|
Title IV of the 1978 Spanish constitution invests the Consentimiento Real (Royal Assent) and promulgation (publication) of laws with the monarch of Spain, while Title III, The Cortes Generales, Chapter 2, Drafting of Bills, outlines the method by which bills are passed. According to Article 91, within fifteen days of passage of a bill by the Cortes Generales, the sovereign shall give his or her assent and publish the new law. Article 92 invests the monarch with the right to call for a referendum, on the advice of the president of the government (commonly referred to in English as the prime minister) and the authorisation of the cortes.
|
The sovereign has 25 days to give his or her assent according to what article?
|
{'text': '91', 'answer_start': 292}
|
124,194
| 123,852
|
5a53d803bdaabd001a386778
|
generic
|
Following the breakup of the Russian Empire in the aftermath of World War I for a brief period, from 1918 to 1920, Armenia was an independent republic. In late 1920, the communists came to power following an invasion of Armenia by the Red Army, and in 1922, Armenia became part of the Transcaucasian SFSR of the Soviet Union, later forming the Armenian Soviet Socialist Republic (1936 to September 21, 1991). In 1991, Armenia declared independence from the USSR and established the second Republic of Armenia.
|
When did Russia become independent from the USSR?
|
{'text': 'In 1991', 'answer_start': 409}
|
88,861
| 88,519
|
5a85aa4bb4e223001a8e7173
|
generic
|
The origins of al-Qaeda can be traced to the Soviet war in Afghanistan (December 1979 – February 1989). The United States, United Kingdom, Saudi Arabia, Pakistan, and the People's Republic of China supported the Islamist Afghan mujahadeen guerillas against the military forces of the Soviet Union and the Democratic Republic of Afghanistan. A small number of "Afghan Arab" volunteers joined the fight against the Soviets, including Osama bin Laden, but there is no evidence they received any external assistance. In May 1996 the group World Islamic Front for Jihad Against Jews and Crusaders (WIFJAJC), sponsored by bin Laden (and later re-formed as al-Qaeda), started forming a large base of operations in Afghanistan, where the Islamist extremist regime of the Taliban had seized power earlier in the year. In February 1998, Osama bin Laden signed a fatwā, as head of al-Qaeda, declaring war on the West and Israel, later in May of that same year al-Qaeda released a video declaring war on the U.S. and the West.
|
What war did al-Qaeda start in 1979?
|
{'text': 'the Soviet war in Afghanistan', 'answer_start': 41}
|
30,523
| 30,181
|
5706aab252bb891400689b3c
|
generic
|
Juan Atkins, an originator of Detroit techno music, claims the term "house" reflected the exclusive association of particular tracks with particular clubs and DJs; those records helped differentiate the clubs and DJs, and thus were considered to be their "house" records. In an effort to maintain such exclusives, the DJs were inspired to create their own "house" records.
|
Why were DJs inspired to create their own house records?
|
{'text': 'differentiate the clubs and DJs', 'answer_start': 185}
|
121,101
| 120,759
|
57317b4d05b4da19006bd1e4
|
generic
|
The United States provides Egypt with annual military assistance, which in 2015 amounted to US$1.3 billion. In 1989, Egypt was designated as a major non-NATO ally of the United States. Nevertheless, ties between the two countries have partially soured since the July 2013 military coup that deposed Islamist president Mohamed Morsi, with the Obama administration condemning Egypt's violent crackdown on the Muslim Brotherhood and its supporters, and cancelling future military exercises involving the two countries. There have been recent attempts, however, to normalise relations between the two, with both governments frequently calling for mutual support in the fight against regional and international terrorism.
|
How much military assistance di US give Egypt in 2015?
|
{'text': 'US$1.3 billion', 'answer_start': 92}
|
58,596
| 58,254
|
5726731d708984140094c684
|
generic
|
Panama's first department stores such as Bazaar Francés, La Dalia and La Villa de Paris started as textile retailers at the turn of the nineteenth century. Later on in the twentieth century these eventually gave way to stores such as Felix B. Maduro, Sarah Panamá, Figali, Danté, Sears, Gran Morrison and smaller ones such as Bon Bini, Cocos, El Lider, Piccolo and Clubman among others. Of these only Felix B. Maduro (usually referred to as Felix by locals) and Danté remain strong. All the others have either folded or declined although Cocos has managed to secure a good position in the market.
|
What store has managed to survive despite much it's competition going under?
|
{'text': 'Cocos', 'answer_start': 538}
|
41,832
| 41,490
|
570d3c0eb3d812140066d5a6
|
generic
|
Collective training at the unit level takes place at the unit's assigned station, but the most intensive training at higher echelons is conducted at the three combat training centers (CTC); the National Training Center (NTC) at Fort Irwin, California, the Joint Readiness Training Center (JRTC) at Fort Polk, Louisiana, and the Joint Multinational Training Center (JMRC) at the Hohenfels Training Area in Hohenfels, Germany. ARFORGEN is the Army Force Generation process approved in 2006 to meet the need to continuously replenish forces for deployment, at unit level, and for other echelons as required by the mission. Individual-level replenishment still requires training at a unit level, which is conducted at the continental US (CONUS) replacement center at Fort Bliss, in New Mexico and Texas, before their individual deployment.
|
Where is the Joint Readiness Training Center located?
|
{'text': 'Fort Polk, Louisiana', 'answer_start': 298}
|
126,730
| 126,388
|
5a4eb85eaf0d07001ae8cbf2
|
generic
|
The Cenozoic Era covers the 66 million years since the Cretaceous–Paleogene extinction event up to and including the present day. By the end of the Mesozoic era, the continents had rifted into nearly their present form. Laurasia became North America and Eurasia, while Gondwana split into South America, Africa, Australia, Antarctica and the Indian subcontinent, which collided with the Asian plate. This impact gave rise to the Himalayas. The Tethys Sea, which had separated the northern continents from Africa and India, began to close up, forming the Mediterranean sea.
|
What were still grouped together by the end of the Mesozoic?
|
{'text': 'continents', 'answer_start': 166}
|
8,007
| 7,665
|
56dc6a5c14d3a41400c26881
|
generic
|
In principle, comprehensive schools were conceived as "neighbourhood" schools for all students in a specified catchment area. Current education reforms with Academies Programme, Free Schools and University Technical Colleges will no doubt have some impact on the comprehensive ideal but it is too early to say to what degree.
|
What is a word that can be used to describe the scope of a comprehensive school's intake?
|
{'text': 'neighbourhood', 'answer_start': 55}
|
87,388
| 87,046
|
5a501ab599b975001ade80c8
|
generic
|
Exercise can trigger bronchoconstriction both in people with or without asthma. It occurs in most people with asthma and up to 20% of people without asthma. Exercise-induced bronchoconstriction is common in professional athletes. The highest rates are among cyclists (up to 45%), swimmers, and cross-country skiers. While it may occur with any weather conditions it is more common when it is dry and cold. Inhaled beta2-agonists do not appear to improve athletic performance among those without asthma however oral doses may improve endurance and strength.
|
What percentage of people use inhaled beta2 agonists?
|
{'text': 'up to 20%', 'answer_start': 121}
|
5,951
| 5,609
|
56d2641d59d6e41400145f54
|
generic
|
According to both Bronkhorst and Anderson, the four truths became a substitution for prajna, or "liberating insight", in the suttas in those texts where "liberating insight" was preceded by the four jhanas. According to Bronkhorst, the four truths may not have been formulated in earliest Buddhism, and did not serve in earliest Buddhism as a description of "liberating insight". Gotama's teachings may have been personal, "adjusted to the need of each person."
|
Gotamas teachings may have been personal and adjusted to the need of each what?
|
{'text': 'person', 'answer_start': 413}
|
126,523
| 126,181
|
5732889806a3a419008acae1
|
generic
|
In his book, Humanism (1997), Tony Davies calls these critics "humanist anti-humanists". Critics of antihumanism, most notably Jürgen Habermas, counter that while antihumanists may highlight humanism's failure to fulfil its emancipatory ideal, they do not offer an alternative emancipatory project of their own. Others, like the German philosopher Heidegger considered themselves humanists on the model of the ancient Greeks, but thought humanism applied only to the German "race" and specifically to the Nazis and thus, in Davies' words, were anti-humanist humanists. Such a reading of Heidegger's thought is itself deeply controversial; Heidegger includes his own views and critique of Humanism in Letter On Humanism. Davies acknowledges that after the horrific experiences of the wars of the 20th century "it should no longer be possible to formulate phrases like 'the destiny of man' or the 'triumph of human reason' without an instant consciousness of the folly and brutality they drag behind them". For "it is almost impossible to think of a crime that has not been committed in the name of human reason". Yet, he continues, "it would be unwise to simply abandon the ground occupied by the historical humanisms. For one thing humanism remains on many occasions the only available alternative to bigotry and persecution. The freedom to speak and write, to organise and campaign in defence of individual or collective interests, to protest and disobey: all these can only be articulated in humanist terms."
|
In what year was the book humanism published?
|
{'text': '1997', 'answer_start': 23}
|
43,925
| 43,583
|
5ad115f9645df0001a2d0cf9
|
generic
|
Uranium was also used in photographic chemicals (especially uranium nitrate as a toner), in lamp filaments for stage lighting bulbs, to improve the appearance of dentures, and in the leather and wood industries for stains and dyes. Uranium salts are mordants of silk or wool. Uranyl acetate and uranyl formate are used as electron-dense "stains" in transmission electron microscopy, to increase the contrast of biological specimens in ultrathin sections and in negative staining of viruses, isolated cell organelles and macromolecules.
|
Along with leather, what industry uses no uranium in dyes and stains?
|
{'text': 'wool.', 'answer_start': 270}
|
36,159
| 35,817
|
570ae2e74103511400d59ac0
|
generic
|
The Triassic was generally dry, a trend that began in the late Carboniferous, and highly seasonal, especially in the interior of Pangaea. Low sea levels may have also exacerbated temperature extremes. With its high specific heat capacity, water acts as a temperature-stabilizing heat reservoir, and land areas near large bodies of water—especially the oceans—experience less variation in temperature. Because much of the land that constituted Pangaea was distant from the oceans, temperatures fluctuated greatly, and the interior of Pangaea probably included expansive areas of desert. Abundant red beds and evaporites such as halite support these conclusions, but evidence exists that the generally dry climate of the Triassic was punctuated by episodes of increased rainfall. Most important humid episodes were the Carnian Pluvial Event and one in the Rhaetian, few million years before the Triassic–Jurassic extinction event.
|
What was the general rainfall in the Triassic?
|
{'text': 'dry', 'answer_start': 27}
|
5,415
| 5,073
|
56cf83a7234ae51400d9bde4
|
generic
|
The funeral and burial for Donda West was held in Oklahoma City on November 20, 2007. West played his first concert following the funeral at The O2 in London on November 22. He dedicated a performance of "Hey Mama", as well as a cover of Journey's "Don't Stop Believin'", to his mother, and did so on all other dates of his Glow in the Dark tour.
|
What songs did Kanye dedicate to his late mother as his performance at The O2 in London?
|
{'text': '"Hey Mama", as well as a cover of Journey\'s "Don\'t Stop Believin\'"', 'answer_start': 204}
|
117,248
| 116,906
|
5a429fb54a4859001aac7247
|
generic
|
The Super Nintendo Entertainment System (officially abbreviated the Super NES[b] or SNES[c], and commonly shortened to Super Nintendo[d]) is a 16-bit home video game console developed by Nintendo that was released in 1990 in Japan and South Korea, 1991 in North America, 1992 in Europe and Australasia (Oceania), and 1993 in South America. In Japan, the system is called the Super Famicom (Japanese: スーパーファミコン, Hepburn: Sūpā Famikon?, officially adopting the abbreviated name of its predecessor, the Family Computer), or SFC for short. In South Korea, it is known as the Super Comboy (슈퍼 컴보이 Syupeo Keomboi) and was distributed by Hyundai Electronics. Although each version is essentially the same, several forms of regional lockout prevent the different versions from being compatible with one another. It was released in Brazil on September 2, 1992, by Playtronic.
|
What company developed the Super Comboy in Brazil in 1990?
|
{'text': 'Playtronic', 'answer_start': 855}
|
124,450
| 124,108
|
57324509e17f3d14004227aa
|
generic
|
The offices of elder and ministerial servant were restored to Witness congregations in 1972, with appointments made from headquarters (and later, also by branch committees). It was announced that, starting in September 2014, appointments would be made by traveling overseers. In a major organizational overhaul in 1976, the power of the Watch Tower Society president was diminished, with authority for doctrinal and organizational decisions passed to the Governing Body. Since Knorr's death in 1977, the position of president has been occupied by Frederick Franz (1977–1992) and Milton Henschel (1992–2000), both members of the Governing Body, and since 2000 by Don A. Adams, not a member of the Governing Body. In 1995, Jehovah's Witnesses abandoned the idea that Armageddon must occur during the lives of the generation that was alive in 1914 and in 2013 changed their teaching on the "generation".
|
Starting in September 2014, who was responsible for making appointments in the Church?
|
{'text': 'traveling overseers', 'answer_start': 255}
|
73,698
| 73,356
|
5a8c9999fd22b3001a8d8bbc
|
generic
|
Until the 1990s further replays would be played until one team was victorious. Some ties took as many as six matches to settle; in their 1975 campaign, Fulham played a total of 12 games over six rounds, which remains the most games played by a team to reach a final. Replays were traditionally played three or four days after the original game, but from 1991–92 they were staged at least 10 days later on police advice. This led to penalty shoot-outs being introduced, the first of which came on 26 November 1991 when Rotherham United eliminated Scunthorpe United.
|
How much did clubs replay each other after the 1990s?
|
{'text': 'until one team was victorious', 'answer_start': 48}
|
84,555
| 84,213
|
57284349ff5b5019007da043
|
generic
|
Through his actions and speeches, and because he was able to symbolize the popular Arab will, Nasser inspired several nationalist revolutions in the Arab world. He defined the politics of his generation and communicated directly with the public masses of the Arab world, bypassing the various heads of states of those countries—an accomplishment not repeated by other Arab leaders. The extent of Nasser's centrality in the region made it a priority for incoming Arab nationalist heads of state to seek good relations with Egypt, in order to gain popular legitimacy from their own citizens.
|
What did Nasser symbolize?
|
{'text': 'the popular Arab will', 'answer_start': 71}
|
65,441
| 65,099
|
5acfcebc77cf76001a686104
|
generic
|
The Cubism of Picasso, Braque and Gris had more than a technical or formal significance, and the distinct attitudes and intentions of the Salon Cubists produced different kinds of Cubism, rather than a derivative of their work. "It is by no means clear, in any case," wrote Christopher Green, "to what extent these other Cubists depended on Picasso and Braque for their development of such techniques as faceting, 'passage' and multiple perspective; they could well have arrived at such practices with little knowledge of 'true' Cubism in its early stages, guided above all by their own understanding of Cézanne." The works exhibited by these Cubists at the 1911 and 1912 Salons extended beyond the conventional Cézanne-like subjects—the posed model, still-life and landscape—favored by Picasso and Braque to include large-scale modern-life subjects. Aimed at a large public, these works stressed the use of multiple perspective and complex planar faceting for expressive effect while preserving the eloquence of subjects endowed with literary and philosophical connotations.
|
Whom did Braque and Picasso not aim their works at?
|
{'text': 'large public', 'answer_start': 862}
|
70,792
| 70,450
|
5726e30ddd62a815002e93fc
|
generic
|
Everything in between the far south and the far north is savannah (insignificant tree cover, with grasses and flowers located between trees). Rainfall is more limited, to between 500 and 1,500 millimetres (20 and 60 in) per year. The savannah zone's three categories are Guinean forest-savanna mosaic, Sudan savannah, and Sahel savannah. Guinean forest-savanna mosaic is plains of tall grass interrupted by trees. Sudan savannah is similar but with shorter grasses and shorter trees. Sahel savannah consists of patches of grass and sand, found in the northeast. In the Sahel region, rain is less than 500 millimetres (20 in) per year and the Sahara Desert is encroaching. In the dry north-east corner of the country lies Lake Chad, which Nigeria shares with Niger, Chad and Cameroon.
|
Which desert is encroaching into northeastern Nigeria?
|
{'text': 'Sahara', 'answer_start': 642}
|
101,834
| 101,492
|
5a8dd80bdf8bba001a0f9c8a
|
generic
|
He also developed Feynman diagrams, a bookkeeping device that helps in conceptualizing and calculating interactions between particles in spacetime, including the interactions between electrons and their antimatter counterparts, positrons. This device allowed him, and later others, to approach time reversibility and other fundamental processes. Feynman's mental picture for these diagrams started with the hard sphere approximation, and the interactions could be thought of as collisions at first. It was not until decades later that physicists thought of analyzing the nodes of the Feynman diagrams more closely. Feynman painted Feynman diagrams on the exterior of his van.
|
What did Feynman diagrams allow nobody to do?
|
{'text': 'approach time reversibility and other fundamental processes', 'answer_start': 285}
|
8,567
| 8,225
|
5acfa4e977cf76001a6856db
|
generic
|
When the monarch grew tired of a first minister, he or she could be dismissed, or worse: Cromwell was executed and Clarendon driven into exile when they lost favour. Kings sometimes divided power equally between two or more ministers to prevent one minister from becoming too powerful. Late in Anne's reign, for example, the Tory ministers Harley and St John shared power.
|
Who exiled the monarch?
|
{'text': 'Clarendon', 'answer_start': 115}
|
67,444
| 67,102
|
5ad16800645df0001a2d1a04
|
generic
|
Doubly fed electric motors have two independent multiphase winding sets, which contribute active (i.e., working) power to the energy conversion process, with at least one of the winding sets electronically controlled for variable speed operation. Two independent multiphase winding sets (i.e., dual armature) are the maximum provided in a single package without topology duplication. Doubly-fed electric motors are machines with an effective constant torque speed range that is twice synchronous speed for a given frequency of excitation. This is twice the constant torque speed range as singly-fed electric machines, which have only one active winding set.
|
What is one of the dependent multiphase winding sets configured for?
|
{'text': 'variable speed operation', 'answer_start': 221}
|
127,309
| 126,967
|
5a69a8665ce1a5001a969664
|
generic
|
Barbara Harff and Ted Gurr defined genocide as "the promotion and execution of policies by a state or its agents which result in the deaths of a substantial portion of a group ...[when] the victimized groups are defined primarily in terms of their communal characteristics, i.e., ethnicity, religion or nationality." Harff and Gurr also differentiate between genocides and politicides by the characteristics by which members of a group are identified by the state. In genocides, the victimized groups are defined primarily in terms of their communal characteristics, i.e., ethnicity, religion or nationality. In politicides the victim groups are defined primarily in terms of their hierarchical position or political opposition to the regime and dominant groups. Daniel D. Polsby and Don B. Kates, Jr. state that "... we follow Harff's distinction between genocides and 'pogroms,' which she describes as 'short-lived outbursts by mobs, which, although often condoned by authorities, rarely persist.' If the violence persists for long enough, however, Harff argues, the distinction between condonation and complicity collapses."
|
What was important to Harff and Gurr to distinguish between opposition?
|
{'text': 'politicides', 'answer_start': 612}
|
42,929
| 42,587
|
5ad2415cd7d075001a42895f
|
generic
|
Positioned asymmetrically around the South Pole and largely south of the Antarctic Circle, Antarctica is the southernmost continent and is surrounded by the Southern Ocean; alternatively, it may be considered to be surrounded by the southern Pacific, Atlantic, and Indian Oceans, or by the southern waters of the World Ocean. It covers more than 14,000,000 km2 (5,400,000 sq mi), making it the fifth-largest continent, about 1.3 times as large as Europe. The coastline measures 17,968 km (11,165 mi) and is mostly characterized by ice formations, as the following table shows:
|
What ocean does Antarctica surround?
|
{'text': 'Southern Ocean', 'answer_start': 157}
|
235
| 235
|
138423
|
pubqa
|
Campylobacter sp. (2/56), norovirus GI and GII (11/56), rotavirus (1/56) and Giardia lamblia (3/56) were detected in stool samples. On 6 December 2010 there was a fire in a textile factory in the centre of Hemiksem, Belgium. Fireghters used water from two hydrants, connected to the tap water network, and from a unit hydrosub, which is used for pumping surface and river water. Car pumps collected water from both sources in a pressurized water tank. The hydrosub was connected to the river Vliet, a small river that ows to the river Scheldt. On 7 December three out of four routinely taken tap water samples in Hemiksem and Schelle suggested fecal contamination. Local general practitioners (GPs) reported an increase in consultations for gastroenteritis on 8 December. On 9 December the residents were advised not to consume or use tap water. The water avoidance notice was lifted on 20 December 2010. Tap water in the neighbouring municipalities of Hemiksem and Schelle (n=18620 residents), is supplied by one water supply company that uses purified ground water. The company takes care of collecting, cleaning and distributing drinking water. The surveillance, done according to the specic legislation, is a responsibility of the water company. Belgium has no specic surveillance system on waterborne outbreaks. We conducted an epidemiological study to describe the size and identify the source of the outbreak. METHODS The study population comprised of all the residents of Hemiksem and Schelle. We included no other municipalities given that elsewhere no faecal contamination in routinely taken samples of drinking water had been reported, and no increase of gastroenteritis had been registered. Considering that symptoms of gastroenteritis can be very mild, we combined a physicians case-finding survey with a randomly sampled survey among the subscribers of the water company in Hemiksem and Schelle. Case reporting by physicians On 9 December all 18 local GPs were asked to report cases of gastroenteritis. Additionally, the emergency department of a neighbouring hospital was contacted and asked to report any resident of Hemiksem or Schelle who presented with gastroenteritis. Inclusion criteria were patients who lived in Hemiksem or Schelle, and who had symptoms of diarrhoea (53 loose stools per 24 h) or vomiting from 6 to 13 December 2010. Retrospective cohort study A retrospective cohort study was conducted among a randomly selected sample of 1000 households from Hemiksem and Schelle. The sample was selected from a list of customers of the water supply company. A household was identifed as all persons living at the same address. Through a postal survey every house- hold member was asked for his personal usage of tap water (consumption, cooking, teeth brushing, cleaning), the usage of other water (ground water, bottled water), symptoms, with a focus on gastrointestinal symptoms, and the onset date of these symptoms and treatments. Any person reporting diarrhoea (53 loose stools per 24 h) and/or vomiting between 6 and 13 December 2010, was identifed as a case. Patients with an onset of diarrhoea or vomiting between 14 and 31 December 2010 were considered as late or secondary cases. Non-cases were people who did not re- port any symptoms. Households in which symptoms of gastroenteritis were reported prior to 6 December 2010 and persons who spent time abroad in the week prior to the outbreak were excluded from the study. We did not correct for a baseline number of gastroenteritis cases as no adequate incidence data for gastroenteritis was present for this region and time period. Based on the address of the respondent, 712 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at the shortest distance, in metres, to the site of the re was calculated. Descriptive statistics were calculated for the retrospective cohort study. We performed univariate analysis (cross tables, 2 tests, linear trend analysis, relative risk) and multivariate analysis (Poisson regression). P<005 was considered statistically significant. Variables associated with the outcome at P<020 in uni- variate analysis were introduced in the multivariate regression model. The nal multivariate model was built using backwards elimination [22]. The data were entered using EpiData v. 3.1 (EpiData Associ- ation, Denmark) and analysed using SAS v. 9.2 (SAS Institute Inc., USA) and R 2.14 (R Foundation, Austria). An additional analysis focusing on the geo- graphical distribution of the cases was performed using the R package sparr [23]. With this software the spatial density of the cases and the spatial density of non-cases was compared. Microbiological study Patients included in the physicians survey were con- tacted and asked to provide a stool sample. These stool samples were tested for pathogenic gastrointestinal bacteria on culture media for isolation of entero- pathogens (MacConkey agar, XLD and CIN agar) in a laboratory with accreditation to ISO 15189. Antigen tests were used to test for Cryptosporidium and G. lamblia (Xpect Immunochromatographic Assays, Oxoid, UK). For the detection of NoV two methods were used. Three stool samples were send to the Scientic Institute of Public Health, Brussels, where they used a real-time RTPCR for the detection and differentiation of the two most important human genogroups of NoV, GI and GII. This method is de- scribed in ISO/TS 152161: 2013. The other 53 stool samples were send to the Clinical Virology Labora- tory, Leuven and were analysed with a NoV RT PCR. Two pairs of specic primers G1SKF/G1SKR and COG2F/G2SKR, that amplify the capsid gene, were used to respectively detect NoV GI (330 bp) and NoV GII (387 bp) [24]. An in-house RTPCR was developed for detection of astrovirus. The primer set used to amplify 272 bp in the capsid protein gene was HASTV-F: ACAGAAGAGCAACTCCATCGC and HASTV-R: TGACACCYTGTTTCCTGAGTTG. A RTPCR was used for rotavirus and adenovirus de- tection as described previously [25, 26]. The analyses of the tap water were performed by the water supply company. Samples were tested for bacterial indicators of faecal contamination: non-specic coliforms, Escherichia coli, Clostridium sp. and Pseudomonas aeruginosa. In two river water samples protozoa were isolated by the department of Parasitology of the University of Ghent. RESULTS Physicians case-finding study All 18 GPs participated in the study. We included 603 patients; 326 (54%) were men and 277 (46%) women. The age ranged from 1 to 91 years with a median age of 36 years. Three hundred and ninety-seven (66%) cases lived in Hemiksem, and 206 (34%) in Schelle. Consultations for gastroenteritis peaked on 8 December 2010. Six patients were hospitalized. One patient, aged 91 years, died due to intestinal bleeding on 12 December after being admitted to the hospital for gastroenteritis on 9 December 2010. Retrospective cohort study The questionnaire was distributed on 20 December. The response rate was 528% (n=528). The responses included information on a total of 1185 household members. This is 66% of the total population (n=18620) of Hemiksem and Schelle (December 2010). The respondents age ranged from 0 to 99 years and the median age was 39 years. Gender was balanced with 481% males and 519% females. Out of all respondents, 37% regularly drank tap water, with an average of 37 glasses a day, 99% used tap water to brush their teeth, and 98% used tap water to wash vegetables and fruit. Gastrointestinal symptoms were reported by 365% (n=432). The mean duration of ill- ness was 41 days. Diarrhoea was the most frequently reported symptom, present in 654% of those reporting symptoms, fever in 15%, vomiting in 39% and nausea in 60%. Thirty-four respondents reported symptoms prior to 6 December. A total of 222 [187%, 95% condence interval (CI) 164209] persons met the case definition (onset of symptoms 613 December) and 176 were late or secondary cases (onset after 13 December). The incidence of gastroenteritis followed a steep incline from 6 to 8 December and peaked on 8 December (Fig. 1). The density of the cases (n=222) over non-cases (n=753) shows the highest proportion of cases slightly Waterborne outbreak, Hemiksem, 2010 713 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at north of the site of the re (Fig. 2). The density of self- reported tap-water drinkers is compared to the den- sity of non-tap-water drinkers (see Fig. 3). A higher proportion of tap-water drinkers was observed east of Hemiksem. Univariate analysis Drinking tap water was associated with gastrointestinal symptoms [relative risk (RR) 228, 95% CI 194 267] (Table 1). The relative risk was higher for cases 80 70 60 50 40 30 20 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 December 2010 Stop consumption of tap water Fire 20 21 26 28 New cases Pre-load Early eases Late/secondary cases Fig. 1. Cases over time, subscribers study, Hemiksem and Schelle, 2010. Fig. 2. Density cases over non-cases. A redder region indicates a higher proportion of cases over non-cases; dotted line=contour line for signicance P<005; full line=contour line for signicance P<001; Hemiksem and Schelle, 2010. 714 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at (RR 367, 95% CI 286470) than for secondary or late cases (RR 191, 95% CI 147249) (Table 1). The distance from the home address of the respondent to the site of the re was signicantly shorter for cases com- pared to non-cases. Other variables such as gender, household size, age and the presence of young children (<12 years) in the family were not signicant (Table 2). Multivariate analysis The independent variables included in the multivari- ate model were: glasses of tap water a day, location and gender. Location (distance from the site of the re) as well as drinking tap water (glasses per day) were signicantly (P<005) associated with outcome in a Poisson regression model. For each glass of tap water consumed the risk was augmented by 21% (RR 121, 95% CI 116126). For each 250 m that families lived further away from the site of the re the risk dimin- ished by 84% (RR 092, 95% CI 084099) (Table 3). Microbiological patient data Sixteen of 56 stool samples were diagnosed with a pathogen. In the stool sample of 14 patients a single Table 1. Contingency table for drinking tap water and the different case denitions (for 46 respondents information on tap water consumption was missing), Hemiskem and Schelle, 2010 Non-cases Secondary and late cases Cases Total Tapwater No N 549 95 74 718 % 7369 5523 3303 Yes N 196 77 148 421 % 2631 4477 6697 Total N 745 172 222 1139 Table 2. Univariate analysis of risk factors in cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water 367 286470 0001 Gender (male/female) 08 0611 008 Distance to re site (unit: 750 m) 089 082097 004 Young children (<12 years) 09 0712 06 Household size Linear trend 043 Age Linear trend 052 RR, Relative risk; CI, condence interval. Fig. 3. Density of tap-water drinkers over non-tap-water drinkers. A redder region indicates a higher proportion of tap-water drinkers; Hemiksen and Schelle, 2010. Waterborne outbreak, Hemiksem, 2010 715 https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at pathogen was detected: Campylobacter sp. was detected in one, NoV GI in two and NoV GII in seven patients. Rotavirus was detected in one patient and G. lamblia was detected in three samples. Two patients were diagnosed with a multi-pathogen infec- tion: one patient with a double infection: NoV GI and GII, and one patient with a mixed infection with Campylobacter jejuni, NoV GI and GII. Environmental study Between 8 and 25 December 2010, 625 water samples were analysed in Hemiksem and Schelle. In Hemiksem, high densities of faecal pollution indicators were detected in tap water samples: >200 c.f.u./100 ml for E. coli and >1100 c.f.u./100 ml for enterococci. Parasites, G. lamblia and Cryptospori- dium sp. were isolated from samples taken from the river. Control measures There were different authorities involved in control- ling the outbreak and informing the population; the local municipal authorities, the environmental health team and the drinking water company. Bottled potable water was distributed to the population. Sanitation of water pipes (flushing, disinfection) was performed from 9 December 2010 to 25 December 2010. Our research pointed towards an incident during the firefighting on 6 December 2010 as the cause of the contamination. Additional research eliminated other possible reasons by checking installations in the surrounding area. An investigation into the actions taken by firefighters pointed towards the absence of reflux valves as the most likely cause. Once this hazard was identified, a warning was sent to other re brigades in Belgium to avoid similar incidents. DISCUSSION We have described a large community outbreak of gastroenteritis associated with the consumption of water contaminated by river water during fire extinguishing. This is the rst large waterborne outbreak described in Belgium. Waterborne disease, especially cryptosporidiosis, has been reported as a work- related disease exposure for firefighters, but it is the first time a community outbreak has been described in which the probable cause was associated with firefighting [27]. Our study estimated an attack rate of gastrointestinal infections of 18.7% without correction for baseline illness. The attack rate in our study can be explained by the high doses of pathogens in the tap water, a high daily consumption of tap water, a period of 3 days between the contamination and the water avoidance notice, and the low infectious dose of some pathogens. Attack rates in comparable studies vary and can be quite high, e.g. 514% in a tourist resort and new housing estate, 53% in a Finnish town [15, 20, 21, 28]. The number of cases per outbreak has been associated to the pathogens involved. Giardia- and Cryptosporidium-associated outbreaks have the lowest mean number of cases per outbreak (116 and 177, respectively). Viral outbreaks and out- breaks associated with Campylobacter sp. have the highest mean number of cases per outbreak (1545 and 1802, respectively) [1]. In a multi-pathogen out- break, as we have described, one can expect an even higher number of cases. The number of hospitalizations was limited, but gastrointestinal disease can be associated with severe illness, especially in hig- risk patients [6] such as AIDS patients [29]. We found an unadjusted relative risk of 367 and the doseresponse relationship was signicant. A threefold increased risk for illness with the con- sumption of tap water is commonly associated with waterborne outbreaks [13, 16, 18, 19]. In E. coli and Campylobacter sp. outbreaks with relative risks of 11 were reported [7, 9]. In waterborne outbreaks, the strength of evidence implicating water as the cause of an outbreak is deter- mined on the basis of ndings from epidemiological and microbiological investigations. Tillett et al. devel- oped a system of levels of evidence to link an outbreak to water [30]. We complement this by adding an important spatial component. We observed a steep increase in reported gastroen- teritis among the surveys responders on the 6 Table 3. Multivariate analysis (Poisson regression) for cases compared to non-cases, Hemiksem and Schelle, 2010 Variable RR 95% CI P value Tap water (glasses/day) 121 116127 <0001 Distance to re site (unit: 250 m) 092 084099 <004 RR, Relative risk; CI, condence interval. 716 T. Braeye and others https://www.cambridge.org/core/terms. https://doi.org/10.1017/S0950268814001629 Downloaded from https://www.cambridge.org/core. IP address: 82.217.87.172, on 14 Oct 2021 at 12:20:23, subject to the Cambridge Core terms of use, available at December which indicates a sudden contamination. Microbiological investigations during this increase identified multiple pathogens in the stool samples of patients. This is consistent with the hypothesis of a waterborne outbreak rather than a community-wide person-to-person transmission of e.g. a NoV [31]. Furthermore, tap water was a likely mode of trans- mission as there was a significant association between gastroenteritis and the consumption of tap water. Enterobacteriaceae were found in the tap water. We linked the firefighting to the outbreak by spatial and temporal analysis. We documented the association be- tween place of residence and the risk of gastroenteritis by comparing the ratio of cases (n=222) over non-cases (n=753) with the ratio of tap-water drinkers over non-tap-water drinkers. We observed that one peak in the ratio of cases over controls was not accompanied bya high ratio of tap-water drinkers over non-tap-water drinkers. This cluster was located slightly north of the site of the re. We have no data on quantitative difference of pathogen load in the pipelines. A major weakness of this study is the incomplete microbiological investigation. Drinking watercontami- nated by sewage is known to result in mixed bacterial and viral infections and severe acute gastroenteritis regardless of the aetiological agents [17, 32]. Investigation of the tap water was limited to indicator bacteria for faecal contamination and a one-time detection of Cryptosporidium sp. and G. lamblia. Patients were not tested for protozoa. Detection of e.g. levels of serum antibody to G. lamblia or testing of patients for Cryptosporidium should be performed in this kind of outbreak investigation [33, 34]. No attempt was made to match the clinical and environmental pathogens. Pathogens from the environmental samples were not stored and therefore not available for further testing. Since the incubation period of several gastrointestinal pathogens can vary from hours to weeks, we took the entire month of December 2010 as study period. However, the difference between cases and late or secondary cases is artificial and only used as a means to better analyse the data. Long incubation periods and secondary infections by person-to-person transmission are hard to differentiate. Self-reported information on symptoms and water consumption is known to be biased, especially after media attention [35]. However, the media did not report on possible sources and the connection to the fire. The media only started to report on the outbreak after the water avoidance notice. We tried to collect objective information by contacting healthcare personnel. The questionnaire was sent rather late, on 20 December 2010, which could generate recall bias. Moreover, persons affected by the outbreak might be more inclined to respond to the survey leading to selection bias. No information was collected on the costs of this outbreak. Previous research shows that the costs for preventive measures clearly are smaller than the costs of a waterborne outbreak [36]. We did not investigate compliance with the water avoidance notice. A study in The Netherlands estimated compliance with a boil water advice at 818% [37]. Several improvements can be recommended such as the development of a surveillance system and a wider and more thorough microbiological investigation. Syndromic surveillance combined with water incident and consumer complaints data can be used for the timely detection of outbreaks, but this needs to be further evaluated [38]. More intense microbiological investigations are necessary both during standard controls and outbreaks. Previous studies have indicated that water-treatment technologies have become inad- equate, and that a negative coliform test result does not guarantee that water is free from all pathogens, especially from protozoan agents [6]. Both enteric viruses, such as caliciviruses, and some protozoan agents, such as Cryptosporidium, are candidates for endemic transmission and outbreaks with these pathogens will go undetected with standard controls [39]. Furthermore, a more thorough microbiological investigation can be used to predict the likelihood of various transmission routes or vehicles [40]. This outbreak also highlights the need to rapidly connect an outbreak to its cause to reduce attack rates by implementing the correct measurements. This outbreak could have been detected quicker if additional surveillance systems had been in place. Rapid detection and intervention necessitates the collaboration between physicians, public health services, microbiologists and water providers.
|
How many people died?
|
{'answer_id': 273628, 'document_id': 445514, 'question_id': 138423, 'text': 'One patient', 'answer_start': 6918, 'answer_category': 'SHORT'}
|
12,219
| 11,877
|
56de6fdecffd8e1900b4b8c3
|
generic
|
The term is usually used to refer to violations of important religious teachings, but is used also of views strongly opposed to any generally accepted ideas. It is used in particular in reference to Christianity, Judaism, Islam and Marxism.
|
What religions and idea of thought is heresy cited as being used frequently in?
|
{'text': 'Christianity, Judaism, Islam and Marxism', 'answer_start': 199}
|
96,573
| 96,231
|
572a13e2af94a219006aa7a7
|
generic
|
With Constantinople as its capital and control of lands around the Mediterranean basin, the Ottoman Empire was at the centre of interactions between the Eastern and Western worlds for six centuries. Following a long period of military setbacks against European powers, the Ottoman Empire gradually declined into the late nineteenth century. The empire allied with Germany in the early 20th century, with the imperial ambition of recovering its lost territories, joining in World War I to achieve this ambition on the side of Germany and the Central Powers. While the Empire was able to largely hold its own during the conflict, it was struggling with internal dissent, especially with the Arab Revolt in its Arabian holdings. Starting before the war, but growing increasingly common and violent during it, major atrocities were committed by the Ottoman government against the Armenians, Assyrians and Pontic Greeks. The Empire's defeat and the occupation of part of its territory by the Allied Powers in the aftermath of World War I resulted in the emergence of a new state, Turkey, in the Ottoman Anatolian heartland following the Turkish War of Independence, as well as the founding of modern Balkan and Middle Eastern states and the partitioning of the Ottoman Empire.
|
What was the capital of the Ottoman empire?
|
{'text': 'Constantinople', 'answer_start': 5}
|
83,524
| 83,182
|
5727cfa22ca10214002d9719
|
generic
|
The state holds populations of white-tailed deer, mule deer, antelope, coyotes, mountain lions, bobcats, elk, and birds such as quail, doves, cardinals, bald eagles, red-tailed hawks, and pheasants. In prairie ecosystems, American bison, greater prairie chickens, badgers, and armadillo are common, and some of the nation's largest prairie dog towns inhabit shortgrass prairie in the state's panhandle. The Cross Timbers, a region transitioning from prairie to woodlands in Central Oklahoma, harbors 351 vertebrate species. The Ouachita Mountains are home to black bear, red fox, grey fox, and river otter populations, which coexist with a total of 328 vertebrate species in southeastern Oklahoma. Also, in southeastern Oklahoma lives the American alligator.
|
What part of Oklahoma is Cross Timbers in?
|
{'text': 'Central', 'answer_start': 474}
|
106,288
| 105,946
|
572ea5f5dfa6aa1500f8d24b
|
generic
|
The Quran describes Muhammad as "ummi", which is traditionally interpreted as "illiterate," but the meaning is rather more complex. Medieval commentators such as Al-Tabari maintained that the term induced two meanings: first, the inability to read or write in general; second, the inexperience or ignorance of the previous books or scriptures (but they gave priority to the first meaning). Muhammad's illiteracy was taken as a sign of the genuineness of his prophethood. For example, according to Fakhr al-Din al-Razi, if Muhammad had mastered writing and reading he possibly would have been suspected of having studied the books of the ancestors. Some scholars such as Watt prefer the second meaning of "ummi" - they take it to indicate unfamiliarity with earlier sacred texts.
|
What term does the Quran use to describe Mohammad's lack of exposure to scripture?
|
{'text': 'ummi', 'answer_start': 33}
|
42,078
| 41,736
|
570d2fe9fed7b91900d45cd9
|
generic
|
The army was still equipped with the Dreyse needle gun of Battle of Königgrätz fame, which was by this time showing the age of its 25-year-old design. The rifle had a range of only 600 m (2,000 ft) and lacked the rubber breech seal that permitted aimed shots. The deficiencies of the needle gun were more than compensated for by the famous Krupp 6-pounder (3 kg) steel breech-loading cannons being issued to Prussian artillery batteries. Firing a contact-detonated shell, the Krupp gun had a longer range and a higher rate of fire than the French bronze muzzle loading cannon, which relied on faulty time fuses.
|
In which battle did the Dreyse needle gun gain its fame?
|
{'text': 'Battle of Königgrätz', 'answer_start': 58}
|
93,789
| 93,447
|
57292b05af94a219006aa14f
|
generic
|
The photoelectric effect is the emission of electrons (called "photoelectrons") from a surface when light is shone on it. It was first observed by Alexandre Edmond Becquerel in 1839, although credit is usually reserved for Heinrich Hertz, who published the first thorough investigation in 1887. Another particularly thorough investigation was published by Philipp Lenard in 1902. Einstein's 1905 paper discussing the effect in terms of light quanta would earn him the Nobel Prize in 1921, when his predictions had been confirmed by the experimental work of Robert Andrews Millikan. The Nobel committee awarded the prize for his work on the photo-electric effect, rather than relativity, both because of a bias against purely theoretical physics not grounded in discovery or experiment, and dissent amongst its members as to the actual proof that relativity was real.
|
What did Einstein with the 1921 Nobel Prize for?
|
{'text': 'his work on the photo-electric effect', 'answer_start': 624}
|
36,258
| 35,916
|
570afc276b8089140040f683
|
generic
|
A videoconference system is generally higher cost than a videophone and deploys greater capabilities. A videoconference (also known as a videoteleconference) allows two or more locations to communicate via live, simultaneous two-way video and audio transmissions. This is often accomplished by the use of a multipoint control unit (a centralized distribution and call management system) or by a similar non-centralized multipoint capability embedded in each videoconferencing unit. Again, technology improvements have circumvented traditional definitions by allowing multiple party videoconferencing via web-based applications.
|
How does video-conferencing allow multiple parties to communicate with each other?
|
{'text': 'web-based applications', 'answer_start': 604}
|
26,614
| 26,272
|
5acfc68477cf76001a685ea1
|
generic
|
Since ancient times, north Zhejiang and neighbouring south Jiangsu have been famed for their prosperity and opulence[citation needed], and simply inserting north Zhejiang place names (Hangzhou, Jiaxing, etc.) into poetry gave an effect of dreaminess, a practice followed by many noted poets. In particular, the fame of Hangzhou (as well as Suzhou in neighbouring Jiangsu province) has led to the popular saying: "Above there is heaven; below there is Suzhou and Hangzhou" (上有天堂,下有苏杭), a saying that continues to be a source of pride for the people of these two still prosperous cities.
|
What neighbours south Jiangsu to the west?
|
{'text': 'Zhejiang', 'answer_start': 162}
|
97,829
| 97,487
|
5ace41ec32bba1001ae4a0cd
|
generic
|
Madaris were largely centred on the study of fiqh (Islamic jurisprudence). The ijāzat al-tadrīs wa-al-iftāʼ ("licence to teach and issue legal opinions") in the medieval Islamic legal education system had its origins in the 9th century after the formation of the madhāhib (schools of jurisprudence). George Makdisi considers the ijāzah to be the origin of the European doctorate. However, in an earlier article, he considered the ijāzah to be of "fundamental difference" to the medieval doctorate, since the former was awarded by an individual teacher-scholar not obliged to follow any formal criteria, whereas the latter was conferred on the student by the collective authority of the faculty. To obtain an ijāzah, a student "had to study in a guild school of law, usually four years for the basic undergraduate course" and ten or more years for a post-graduate course. The "doctorate was obtained after an oral examination to determine the originality of the candidate's theses", and to test the student's "ability to defend them against all objections, in disputations set up for the purpose." These were scholarly exercises practised throughout the student's "career as a graduate student of law." After students completed their post-graduate education, they were awarded ijazas giving them the status of faqīh 'scholar of jurisprudence', muftī 'scholar competent in issuing fatwās', and mudarris 'teacher'.
|
What term refers to non-Islamic law?
|
{'text': 'fiqh', 'answer_start': 45}
|
79,767
| 79,425
|
5a5d72bf5e8782001a9d5f25
|
generic
|
The Cork Suburban Rail system also departs from Kent Station and provides connections to parts of Metropolitan Cork. Stations include Little Island, Mallow, Midleton, Fota and Cobh. In July 2009 the Glounthaune to Midleton line was reopened, with new stations at Carrigtwohill and Midleton (with future stations planned for Kilbarry, Monard, Carrigtwohill West and Blarney). Little Island Railway Station serves Cork's Eastern Suburbs, while Kilbarry Railway Station is planned to serve the Northern Suburbs.
|
What rail system has connections arriving in Kent?
|
{'text': 'Cork Suburban Rail system', 'answer_start': 4}
|
93,070
| 92,728
|
5a7b8d4d21c2de001afea15a
|
generic
|
Unit testing is a software development process that involves synchronized application of a broad spectrum of defect prevention and detection strategies in order to reduce software development risks, time, and costs. It is performed by the software developer or engineer during the construction phase of the software development lifecycle. Rather than replace traditional QA focuses, it augments it. Unit testing aims to eliminate construction errors before code is promoted to QA; this strategy is intended to increase the quality of the resulting software as well as the efficiency of the overall development and QA process.
|
Instead of reducing traditional QA focuses, unit testing does what to it?
|
{'text': 'augments', 'answer_start': 386}
|
116,682
| 116,340
|
5730846a069b531400832147
|
generic
|
One of the first recorded instances of translation in the West was the rendering of the Old Testament into Greek in the 3rd century BCE. The translation is known as the "Septuagint", a name that refers to the seventy translators (seventy-two, in some versions) who were commissioned to translate the Bible at Alexandria, Egypt. Each translator worked in solitary confinement in his own cell, and according to legend all seventy versions proved identical. The Septuagint became the source text for later translations into many languages, including Latin, Coptic, Armenian and Georgian.
|
What is one of the first known instances of translation in the West?
|
{'text': 'rendering of the Old Testament into Greek', 'answer_start': 71}
|
117,512
| 117,170
|
5730a9732461fd1900a9cf67
|
generic
|
The Ubaid period is marked by a distinctive style of fine quality painted pottery which spread throughout Mesopotamia and the Persian Gulf. During this time, the first settlement in southern Mesopotamia was established at Eridu (Cuneiform: NUN.KI), c. 5300 BC, by farmers who brought with them the Hadji Muhammed culture, which first pioneered irrigation agriculture. It appears that this culture was derived from the Samarran culture from northern Mesopotamia. It is not known whether or not these were the actual Sumerians who are identified with the later Uruk culture. Eridu remained an important religious center when it was gradually surpassed in size by the nearby city of Uruk. The story of the passing of the me (gifts of civilization) to Inanna, goddess of Uruk and of love and war, by Enki, god of wisdom and chief god of Eridu, may reflect this shift in hegemony.
|
Who was the chief god of Eridu?
|
{'text': 'Enki', 'answer_start': 796}
|
19,216
| 18,874
|
56e722d937bdd419002c3d8e
|
generic
|
The manipulation of time at higher latitudes (for example Iceland, Nunavut or Alaska) has little impact on daily life, because the length of day and night changes more extremely throughout the seasons (in comparison to other latitudes), and thus sunrise and sunset times are significantly out of sync with standard working hours regardless of manipulations of the clock. DST is also of little use for locations near the equator, because these regions see only a small variation in daylight in the course of the year.
|
Would observing Daylight Saving Time have a small or large effect on how light it is during the workday in areas at high latitudes?
|
{'text': 'small', 'answer_start': 462}
|
108,872
| 108,530
|
572f3f8f04bcaa1900d767cf
|
generic
|
Classified as a Subtropical Mediterranean climate (Köppen Csb), Santa Monica enjoys an average of 310 days of sunshine a year. It is located in USDA plant hardiness zone 11a. Because of its location, nestled on the vast and open Santa Monica Bay, morning fog is a common phenomenon in May, June and early July (caused by ocean temperature variations and currents). Like other inhabitants of the greater Los Angeles area, residents have a particular terminology for this phenomenon: the "May Gray" and the "June Gloom". Overcast skies are common during June mornings, but usually the strong sun burns the fog off by noon. In the late winter/early summer, daily fog is a phenomenon too. It happens suddenly and it may last some hours or past sunset time. Nonetheless, it will sometimes stay cloudy and cool all day during June, even as other parts of the Los Angeles area enjoy sunny skies and warmer temperatures. At times, the sun can be shining east of 20th Street, while the beach area is overcast. As a general rule, the beach temperature is from 5 to 10 degrees Fahrenheit (3 to 6 degrees Celsius) cooler than it is inland during summer days, and 5–10 degrees warmer during winter nights.
|
What commonly occurs on the mornings in May?
|
{'text': 'fog', 'answer_start': 255}
|
63,076
| 62,734
|
57269b9bdd62a815002e8af5
|
generic
|
Under a front page headline "The Truth", the paper printed allegations provided to them that some fans picked the pockets of crushed victims, that others urinated on members of the emergency services as they tried to help and that some even assaulted a police constable "whilst he was administering the kiss of life to a patient." Despite the headline, written by Kelvin MacKenzie, the story was based on allegations either by unnamed and unattributable sources, or hearsay accounts of what named individuals had said – a fact made clear to MacKenzie by Harry Arnold, the reporter who wrote the story.
|
Who was reported to have been assaulted while trying to help a patient?
|
{'text': 'a police constable', 'answer_start': 251}
|
1,342
| 1,000
|
56cbf5106d243a140015ee1c
|
generic
|
Two Polish friends in Paris were also to play important roles in Chopin's life there. His fellow student at the Warsaw Conservatory, Julian Fontana, had originally tried unsuccessfully to establish himself in England; Albert Grzymała, who in Paris became a wealthy financier and society figure, often acted as Chopin's adviser and "gradually began to fill the role of elder brother in [his] life." Fontana was to become, in the words of Michałowski and Samson, Chopin's "general factotum and copyist".
|
What nationality were the two friends who served as a pivotal influence in Frédéric's life while in Paris?
|
{'text': 'Polish', 'answer_start': 4}
|
8,512
| 8,170
|
56dd1ff566d3e219004dabed
|
generic
|
Public expenditure of the GDP was less in 2002–05 than in 1991. Public education is theoretically free and mandatory for under-16-year-olds, but in practice, expenses exist. Net primary enrollment rate was 44% in 2005, much less than the 79% in 1991. The country has universities. Education between ages six and sixteen is compulsory. Pupils who complete six years of primary school and seven years of secondary school obtain a baccalaureate. At the university, students can obtain a bachelor's degree in three years and a master's after four. Marien Ngouabi University—which offers courses in medicine, law and several other fields—is the country's only public university. Instruction at all levels is in French, and the educational system as a whole models the French system. The educational infrastructure has been seriously degraded as a result of political and economic crises. There are no seats in most classrooms, forcing children to sit on the floor. Enterprising individuals have set up private schools, but they often lack the technical knowledge and familiarity with the national curriculum to teach effectively. Families frequently enroll their children in private schools only to find they cannot make the payments.
|
What language is used in Congolese schools?
|
{'text': 'French', 'answer_start': 706}
|
34,387
| 34,045
|
570a5f946d058f1900182ddc
|
generic
|
Imperial acquired Silwood Park in 1947, to provide a site for research and teaching in those aspects of biology not well suited for the main London campus. Felix, Imperial's student newspaper, was launched on 9 December 1949. On 29 January 1950, the government announced that it was intended that Imperial should expand to meet the scientific and technological challenges of the 20th century and a major expansion of the College followed over the next decade. In 1959 the Wolfson Foundation donated £350,000 for the establishment of a new Biochemistry Department.[citation needed] A special relationship between Imperial and the Indian Institute of Technology Delhi was established in 1963.[citation needed]
|
Imperial formed a relationship with which other entity in 1963?
|
{'text': 'Indian Institute of Technology Delhi', 'answer_start': 629}
|
126,593
| 126,251
|
5a4e78a0755ab9001a10f47a
|
generic
|
The geologic record of the Proterozoic (2,500 to 541 million years ago) is more complete than that for the preceding Archean. In contrast to the deep-water deposits of the Archean, the Proterozoic features many strata that were laid down in extensive shallow epicontinental seas; furthermore, many of these rocks are less metamorphosed than Archean-age ones, and plenty are unaltered. Study of these rocks show that the eon featured massive, rapid continental accretion (unique to the Proterozoic), supercontinent cycles, and wholly modern orogenic activity. Roughly 750 million years ago, the earliest-known supercontinent Rodinia, began to break apart. The continents later recombined to form Pannotia, 600–540 Ma.
|
what was layed down in deep seas during the Proterozoic period?
|
{'text': 'deposits', 'answer_start': 156}
|
5,287
| 4,945
|
56cf78de4df3c31400b0d800
|
generic
|
On October 1, 2011, Kanye West premiered his women's fashion label, DW Kanye West at Paris Fashion Week. He received support from DSquared2 duo Dean and Dan Caten, Olivier Theyskens, Jeremy Scott, Azzedine Alaïa, and the Olsen twins, who were also in attendance during his show. His debut fashion show received mixed-to-negative reviews, ranging from reserved observations by Style.com to excoriating commentary by The Wall Street Journal, The New York Times, the International Herald Tribune, Elleuk.com, The Daily Telegraph, Harper's Bazaar and many others. On March 6, 2012, West premiered a second fashion line at Paris Fashion Week. The line's reception was markedly improved from the previous presentation, with a number of critics heralding West for his "much improved" sophomore effort.
|
What kind of reviews did Kanye's fashion line spark?
|
{'text': 'mixed-to-negative reviews', 'answer_start': 311}
|
116,748
| 116,406
|
5a4e7dae755ab9001a10f48d
|
generic
|
Airports may also contain premium and VIP services. The premium and VIP services may include express check-in and dedicated check-in counters. These services are usually reserved for First and Business class passengers, premium frequent flyers, and members of the airline's clubs. Premium services may sometimes be open to passengers who are members of a different airline's frequent flyer program. This can sometimes be part of a reciprocal deal, as when multiple airlines are part of the same alliance, or as a ploy to attract premium customers away from rival airlines.
|
What do rival airlines offer to customers?
|
{'text': 'premium and VIP services', 'answer_start': 26}
|
39,809
| 39,467
|
570e5ce90dc6ce1900204f99
|
generic
|
Melbourne's rich and diverse literary history was recognised in 2008 when it became the second UNESCO City of Literature. The State Library of Victoria is one of Australia's oldest cultural institutions and one of many public and university libraries across the city. Melbourne also has Australia's widest range of bookstores, as well the nation's largest publishing sector. The city is home to significant writers' festivals, most notably the Melbourne Writers Festival. Several major literary prizes are open to local writers including the Melbourne Prize for Literature and the Victorian Premier's Literary Awards. Significant novels set in Melbourne include Fergus Hume's The Mystery of a Hansom Cab, Helen Garner's Monkey Grip and Christos Tsiolkas' The Slap. Notable writers and poets from Melbourne include Thomas Browne, C. J. Dennis, Germaine Greer and Peter Carey.
|
What do the novels The Mystery of a Hansom Cab, Monkey Grip, and The Slap have in common?
|
{'text': 'set in Melbourne', 'answer_start': 637}
|
2,219
| 1,877
|
56cfb3e3234ae51400d9be9d
|
generic
|
Beginning in mid-2007, four major airlines, United, Continental, Delta, and Emirates, reached agreements to install iPod seat connections. The free service will allow passengers to power and charge an iPod, and view video and music libraries on individual seat-back displays. Originally KLM and Air France were reported to be part of the deal with Apple, but they later released statements explaining that they were only contemplating the possibility of incorporating such systems.
|
Which airlines first agreed to install seat connections for iPods?
|
{'text': 'United, Continental, Delta, and Emirates', 'answer_start': 44}
|
9,865
| 9,523
|
56dde75466d3e219004dadc5
|
generic
|
There is disagreement about the origin of the term, but general consensus that "cardinalis" from the word cardo (meaning 'pivot' or 'hinge') was first used in late antiquity to designate a bishop or priest who was incorporated into a church for which he had not originally been ordained. In Rome the first persons to be called cardinals were the deacons of the seven regions of the city at the beginning of the 6th century, when the word began to mean “principal,” “eminent,” or "superior." The name was also given to the senior priest in each of the "title" churches (the parish churches) of Rome and to the bishops of the seven sees surrounding the city. By the 8th century the Roman cardinals constituted a privileged class among the Roman clergy. They took part in the administration of the church of Rome and in the papal liturgy. By decree of a synod of 769, only a cardinal was eligible to become pope. In 1059, during the pontificate of Nicholas II, cardinals were given the right to elect the pope under the Papal Bull In nomine Domini. For a time this power was assigned exclusively to the cardinal bishops, but the Third Lateran Council in 1179 gave back the right to the whole body of cardinals. Cardinals were granted the privilege of wearing the red hat by Pope Innocent IV in 1244.
|
When were the Roman cardinals perceived as a privleged class among the Roman clergy?
|
{'text': '8th century', 'answer_start': 664}
|
87,958
| 87,616
|
572833243acd2414000df6cf
|
generic
|
Although the drafts of both the Maastricht treaty and the Treaty establishing a Constitution for Europe mentioned federalism, the representatives of the member countries (all of whom would have had to agree to use of the term) never formally adopted it. The strongest advocates of European federalism have been Germany, Italy, Belgium and Luxembourg while those historically most strongly opposed have been the United Kingdom, Denmark and France (with conservative presidents and governments). Since the presidency of François Mitterrand (1981-1995), the French authorities have adopted a much more pro-European Unification position, as they consider that a strong EU is presenting the best "insurance" against a unified Germany which might become too strong and thus a threat for its neighbours.
|
When did the French authorities adopted the pro-European Unification position?
|
{'text': 'Since the presidency of François Mitterrand (1981-1995', 'answer_start': 494}
|
82,180
| 81,838
|
5a3b63a13ff257001ab8443d
|
generic
|
The General Assembly has considered rule of law as an agenda item since 1992, with renewed interest since 2006 and has adopted resolutions at its last three sessions. The Security Council has held a number of thematic debates on the rule of law, and adopted resolutions emphasizing the importance of these issues in the context of women, peace and security, children in armed conflict, and the protection of civilians in armed conflict. The Peacebuilding Commission has also regularly addressed rule of law issues with respect to countries on its agenda. The Vienna Declaration and Programme of Action also requires the rule of law be included in human rights education.
|
Who has opposed the rule of law through several debates?
|
{'text': 'The Security Council', 'answer_start': 167}
|
129,639
| 129,297
|
5ace562032bba1001ae4a300
|
generic
|
Hunter-gathering lifestyles remained prevalent in some parts of the New World, Sub-Saharan Africa, and Siberia, as well as all of Australia, until the European Age of Discovery. They still persist in some tribal societies, albeit in rapid decline. Peoples that preserved paleolithic hunting-gathering until the recent past include some indigenous peoples of the Amazonas (Aché), some Central and Southern African (San people), some peoples of New Guinea (Fayu), the Mlabri of Thailand and Laos, the Vedda people of Sri Lanka, and a handful of uncontacted peoples. In Africa, the only remaining full-time hunter-gatherers are the Hadza of Tanzania.[citation needed]
|
What has happened to Australian society to cause it to fail?
|
{'text': 'rapid decline', 'answer_start': 233}
|
59,383
| 59,041
|
5726c029f1498d1400e8ea32
|
generic
|
Brian May and Roger Taylor performed together at several award ceremonies and charity concerts, sharing vocals with various guest singers. During this time, they were billed as Queen + followed by the guest singer's name. In 1998, the duo appeared at Luciano Pavarotti's benefit concert with May performing "Too Much Love Will Kill You" with Pavarotti, later playing "Radio Ga Ga", "We Will Rock You", and "We Are the Champions" with Zucchero. They again attended and performed at Pavarotti's benefit concert in Modena, Italy in May 2003. Several of the guest singers recorded new versions of Queen's hits under the Queen + name, such as Robbie Williams providing vocals for "We Are the Champions" for the soundtrack of A Knight's Tale (2001).
|
Which two members of Queen performed together at several charity concerts?
|
{'text': 'Brian May and Roger Taylor', 'answer_start': 0}
|
111,281
| 110,939
|
572fba31947a6a140053cbf0
|
generic
|
Of the new eastern religions introduced into the Greek world, the most successful was Christianity. From the early centuries of the Common Era, the Greeks identified as Romaioi ("Romans"), by that time the name ‘Hellenes’ denoted pagans. While ethnic distinctions still existed in the Roman Empire, they became secondary to religious considerations and the renewed empire used Christianity as a tool to support its cohesion and promoted a robust Roman national identity. Concurrently the secular, urban civilization of late antiquity survived in the Eastern Mediterranean along with Greco-Roman educational system, although it was from Christianity that the culture's essential values were drawn.
|
Did the Roman world consider one ethnocentric lineage to be a great concern ?
|
{'text': 'secondary to religious considerations', 'answer_start': 311}
|
123,781
| 123,439
|
5a7b55e021c2de001afe9ef1
|
generic
|
According to Eurostat, Greece's largest port by tons of goods transported in 2010 is the port of Aghioi Theodoroi, with 17.38 million tons. The Port of Thessaloniki comes second with 15.8 million tons, followed by the Port of Piraeus, with 13.2 million tons, and the port of Eleusis, with 12.37 million tons. The total number of goods transported through Greece in 2010 amounted to 124.38 million tons, a considerable drop from the 164.3 million tons transported through the country in 2007. Since then, Piraeus has grown to become the Mediterranean's third-largest port thanks to heavy investment by Chinese logistics giant COSCO. In 2013, Piraeus was declared the fastest-growing port in the world.
|
How many tons of goods were lost in transport through Greece in 2007?
|
{'text': '164.3 million tons', 'answer_start': 432}
|
20,128
| 19,786
|
5ad3dec0604f3c001a3ff478
|
generic
|
Although Tristan da Cunha shares the +290 code with St Helena, residents have access to the Foreign and Commonwealth Office Telecommunications Network, provided by Global Crossing. This uses a London 020 numbering range, meaning that numbers are accessed via the UK telephone numbering plan. From 1998 to 2006, internet was available in Tristan da Cunha but its high cost made it almost unaffordable for the local population, who primarily used it only to send email. The connection was also extremely unreliable, connecting through a 64 kbit/s satellite phone connection provided by Inmarsat. From 2006, a very-small-aperture terminal provides 3072 kbit/s of publicly accessible bandwidth via an internet cafe.
|
Who does Tristan Da Cunha share Global Crossing codes with?
|
{'text': 'St Helena', 'answer_start': 52}
|
47,362
| 47,020
|
571a72d84faf5e1900b8a9b2
|
generic
|
Brain areas involved in the neuroanatomy of memory such as the hippocampus, the amygdala, the striatum, or the mammillary bodies are thought to be involved in specific types of memory. For example, the hippocampus is believed to be involved in spatial learning and declarative learning, while the amygdala is thought to be involved in emotional memory. Damage to certain areas in patients and animal models and subsequent memory deficits is a primary source of information. However, rather than implicating a specific area, it could be that damage to adjacent areas, or to a pathway traveling through the area is actually responsible for the observed deficit. Further, it is not sufficient to describe memory, and its counterpart, learning, as solely dependent on specific brain regions. Learning and memory are attributed to changes in neuronal synapses, thought to be mediated by long-term potentiation and long-term depression.
|
What role does the amygdala play in memory?
|
{'text': 'thought to be involved in emotional memory', 'answer_start': 309}
|
116,714
| 116,372
|
5a4e7415755ab9001a10f45d
|
generic
|
The majority of the world's airports are non-towered, with no air traffic control presence. Busy airports have air traffic control (ATC) system. All airports use a traffic pattern to assure smooth traffic flow between departing and arriving aircraft. There are a number of aids available to pilots, though not all airports are equipped with them. Many airports have lighting that help guide planes using the runways and taxiways at night or in rain, snow, or fog. In the U.S. and Canada, the vast majority of airports, large and small, will either have some form of automated airport weather station, a human observer or a combination of the two. Air safety is an important concern in the operation of an airport, and airports often have their own safety services.
|
What is available to help air traffic control with flights?
|
{'text': 'lighting that help guide planes using the runways and taxiways at night or in rain, snow, or fog', 'answer_start': 366}
|
105,292
| 104,950
|
573050f28ab72b1400f9c44a
|
generic
|
Improved aircraft designs were in the offing with the Bristol Beaufighter, then under development. It would prove formidable, but its development was slow. The Beaufighter had a maximum speed of 320 mph (510 km/h), an operational ceiling of 26,000 ft (7,900 m) and a climb rate of 2,500 ft (760 m) per minute. Its armament of four 20 mm (0.79 in) Hispano cannon and six .303 in Browning machine guns offered a serious threat to German bombers. On 19 November, John Cunningham of No. 604 Squadron RAF shot down a bomber flying an AI-equipped Beaufighter. It was the first air victory for the airborne radar.
|
how many machine guns did the Beaufighter include?
|
{'text': 'six .303 in Browning machine guns', 'answer_start': 366}
|
32,254
| 31,912
|
57096d4bed30961900e840f3
|
generic
|
The "Neo-Eriksonian" identity status paradigm emerged in later years[when?], driven largely by the work of James Marcia. This paradigm focuses upon the twin concepts of exploration and commitment. The central idea is that any individual's sense of identity is determined in large part by the explorations and commitments that he or she makes regarding certain personal and social traits. It follows that the core of the research in this paradigm investigates the degrees to which a person has made certain explorations, and the degree to which he or she displays a commitment to those explorations.
|
The Neo-Eriksonian identity status paradigm focuses on what twin concepts?
|
{'text': 'exploration and commitment', 'answer_start': 169}
|
20,618
| 20,276
|
56e7a1d137bdd419002c4297
|
generic
|
As in most of eastern China the ethnic makeup of Nanjing is predominantly Han nationality (98.56 percent), with 50 other minority nationalities. In 1999, 77,394 residents belonged to minority nationalities, among which the vast majority (64,832) were Hui nationalities, contributing 83.76 percent to the minority population. The second and third largest minority groups were Manchu (2,311) and Zhuang (533) nationalities. Most of the minority nationalities resided in Jianye District, comprising 9.13 percent of the district's population.
|
What minority nationality is most common?
|
{'text': 'Hui nationalities', 'answer_start': 251}
|
1,917
| 1,575
|
56cd6a3d62d2951400fa659c
|
generic
|
Shih-Shan Henry Tsai writes that the Yongle Emperor sent his eunuch Yang Sanbao into Tibet in 1413 to gain the allegiance of various Tibetan princes, while the Yongle Emperor paid a small fortune in return gifts for tributes in order to maintain the loyalty of neighboring vassal states such as Nepal and Tibet. However, Van Praag states that Tibetan rulers upheld their own separate relations with the kingdoms of Nepal and Kashmir, and at times "engaged in armed confrontation with them."
|
What was the name of the eunuch?
|
{'text': 'Yang Sanbao', 'answer_start': 68}
|
1,828
| 1,486
|
56cc52186d243a140015ef03
|
generic
|
Kublai Khan did not conquer the Song dynasty in South China until 1279, so Tibet was a component of the early Mongol Empire before it was combined into one of its descendant empires with the whole of China under the Yuan dynasty (1271–1368). Van Praag writes that this conquest "marked the end of independent China," which was then incorporated into the Yuan dynasty that ruled China, Tibet, Mongolia, Korea, parts of Siberia and Upper Burma. Morris Rossabi, a professor of Asian history at Queens College, City University of New York, writes that "Khubilai wished to be perceived both as the legitimate Khan of Khans of the Mongols and as the Emperor of China. Though he had, by the early 1260s, become closely identified with China, he still, for a time, claimed universal rule", and yet "despite his successes in China and Korea, Khubilai was unable to have himself accepted as the Great Khan". Thus, with such limited acceptance of his position as Great Khan, Kublai Khan increasingly became identified with China and sought support as Emperor of China.
|
What did Khubilai claim for a while?
|
{'text': 'universal rule', 'answer_start': 765}
|
42,533
| 42,191
|
570dcc300b85d914000d7b64
|
generic
|
Until mid-to-late adolescence, boys and girls show relatively little difference in drinking motives. Distinctions between the reasons for alcohol consumption of males and females begin to emerge around ages 14–15; overall, boys tend to view drinking in a more social light than girls, who report on average a more frequent use of alcohol as a coping mechanism. The latter effect appears to shift in late adolescence and onset of early adulthood (18–19 years of age); however, despite this trend, age tends to bring a greater desire to drink for pleasure rather than coping in both boys and girls.
|
Do boys or girls view drinking in a more social light?
|
{'text': 'boys', 'answer_start': 223}
|
110,911
| 110,569
|
5ace6bfc32bba1001ae4a659
|
generic
|
Matte solder is usually fused to provide a better bonding surface or stripped to bare copper. Treatments, such as benzimidazolethiol, prevent surface oxidation of bare copper. The places to which components will be mounted are typically plated, because untreated bare copper oxidizes quickly, and therefore is not readily solderable. Traditionally, any exposed copper was coated with solder by hot air solder levelling (HASL). The HASL finish prevents oxidation from the underlying copper, thereby guaranteeing a solderable surface. This solder was a tin-lead alloy, however new solder compounds are now used to achieve compliance with the RoHS directive in the EU and US, which restricts the use of lead. One of these lead-free compounds is SN100CL, made up of 99.3% tin, 0.7% copper, 0.05% nickel, and a nominal of 60ppm germanium.
|
What is now used in compliance with the RoHS directive in the EU and China?
|
{'text': 'new solder compounds', 'answer_start': 575}
|
78,477
| 78,135
|
5727a03f3acd2414000de839
|
generic
|
While worship in the Temple in Jerusalem included musical instruments (2 Chronicles 29:25–27), traditional Jewish religious services in the Synagogue, both before and after the last destruction of the Temple, did not include musical instruments given the practice of scriptural cantillation. The use of musical instruments is traditionally forbidden on the Sabbath out of concern that players would be tempted to repair (or tune) their instruments, which is forbidden on those days. (This prohibition has been relaxed in many Reform and some Conservative congregations.) Similarly, when Jewish families and larger groups sing traditional Sabbath songs known as zemirot outside the context of formal religious services, they usually do so a cappella, and Bar and Bat Mitzvah celebrations on the Sabbath sometimes feature entertainment by a cappella ensembles. During the Three Weeks musical instruments are prohibited. Many Jews consider a portion of the 49-day period of the counting of the omer between Passover and Shavuot to be a time of semi-mourning and instrumental music is not allowed during that time. This has led to a tradition of a cappella singing sometimes known as sefirah music.
|
What is a cappella music occasionally called among those of Jewish faith?
|
{'text': 'sefirah music', 'answer_start': 1180}
|
104,537
| 104,195
|
5ad4196e604f3c001a400460
|
generic
|
The community was established by several shiploads of settlers from Bermuda (which lies due east of South Carolina, although at 1,030 km or 640 mi, it is closest to Cape Hatteras, North Carolina), under the leadership of governor William Sayle, on the west bank of the Ashley River, a few miles northwest of the present-day city center. It was soon predicted by the Earl of Shaftesbury, one of the Lords Proprietors, to become a "great port towne", a destiny the city quickly fulfilled. In 1680, the settlement was moved east of the Ashley River to the peninsula between the Ashley and Cooper Rivers. Not only was this location more defensible, but it also offered access to a fine natural harbor.
|
Bermuda is located near which South Carolina town?
|
{'text': 'Cape Hatteras', 'answer_start': 165}
|
67,584
| 67,242
|
5726ab0ddd62a815002e8c67
|
generic
|
Switzerland is one of the richest and wealthiest countries in the world. Switzerland ranks top or close to the top in several metrics of national performance, including government transparency, civil liberties, quality of life, economic competitiveness, and human development. It has the highest nominal wealth (financial and non-financial assets) per adult in the world according to Credit Suisse and the eighth-highest per capita gross domestic product on the IMF list. Zürich and Geneva have each been ranked among the top cities with the highest quality of life in the world, with the former ranked 2nd globally, according to Mercer.
|
Which country has the highest nominal wealth per adult in the world according to Credit Suisse?
|
{'text': 'Switzerland', 'answer_start': 0}
|
127,534
| 127,192
|
57336eb64776f41900660ac2
|
generic
|
International investment and the wealth generated by wealthy tourists explain the high standard of living on the island. St. Barthélemy is considered a playground of the rich and famous,[citation needed] especially as a winter haven, and is known for its beaches, gourmet dining and high-end designers. Most of the food is imported by airplane or boat from the US or France. Tourism attracts about 200,000 visitors every year. As a result, there is a boom in house building activity catering to the tourists and also to the permanent residents of the island, with prices as high as €61,200,000 for a beachfront villa.
|
What is the highest propoerty value recorded in St. Barts?
|
{'text': '€61,200,000', 'answer_start': 582}
|
104,587
| 104,245
|
5ad41acf604f3c001a4004e0
|
generic
|
By the mid-18th century, Charles Town had become a bustling trade center, the hub of the Atlantic trade for the southern colonies. Charles Towne was also the wealthiest and largest city south of Philadelphia, in part because of the lucrative slave trade. By 1770, it was the fourth-largest port in the colonies, after Boston, New York, and Philadelphia, with a population of 11,000—slightly more than half of them slaves. By 1708, the majority of the colony's population was slaves, and the future state would continue to be a majority of African descent until after the Great Migration of the early 20th century.
|
When did Charles Town become the fifth largest colonial port?
|
{'text': '1770', 'answer_start': 258}
|
36,976
| 36,634
|
5ad17238645df0001a2d1bf0
|
generic
|
The Spanish–American War was a short decisive war marked by quick, overwhelming American victories at sea and on land against Spain. The Navy was well-prepared and won laurels, even as politicians tried (and failed) to have it redeployed to defend East Coast cities against potential threats from the feeble Spanish fleet. The Army performed well in combat in Cuba. However, it was too oriented to small posts in the West and not as well-prepared for an overseas conflict. It relied on volunteers and state militia units, which faced logistical, training and food problems in the staging areas in Florida. The United States freed Cuba (after an occupation by the U.S. Army). By the peace treaty Spain ceded to the United States its colonies of Puerto Rico, Guam, and the Philippines. The Navy set up coaling stations there and in Hawaii (which voluntarily joined the U.S. in 1898). The U.S. Navy now had a major forward presence across the Pacific and (with the lease of Guantánamo Bay Naval Base in Cuba) a major base in the Caribbean guarding the approaches to the Gulf Coast and the Panama Canal.
|
What is the name of the naval base the UK leased from a newly independent Cuba?
|
{'text': 'Guantánamo Bay Naval Base', 'answer_start': 971}
|
45,587
| 45,245
|
57100c99a58dae1900cd6811
|
generic
|
Four states in the modern era, Nebraska in 2008, New York and Kansas in 2004, and Massachusetts in 1984, had their statutes ruled unconstitutional by state courts. The death rows of New York and Massachusetts were disestablished, and attempts to restore the death penalty were unsuccessful. Kansas successfully appealed State v. Kleypas, the Kansas Supreme Court decision that declared the state's death penalty statute unconstitutional, to the United States Supreme Court. Nebraska's death penalty statute was rendered ineffective on February 8, 2008 when the required method, electrocution, was ruled unconstitutional by the Nebraska Supreme Court. In 2009, Nebraska enacted a bill that changed its method of execution to lethal injection.
|
What state's court ruled capital punishment unconstitutional in 1984?
|
{'text': 'Massachusetts', 'answer_start': 82}
|
49,376
| 49,034
|
571b684832177014007ea08f
|
generic
|
Selenizza is a naturally occurring solid hydrocarbon bitumen found in the native asphalt deposit of Selenice, in Albania, the only European asphalt mine still in use. The rock asphalt is found in the form of veins, filling cracks in a more or less horizontal direction. The bitumen content varies from 83% to 92% (soluble in carbon disulphide), with a penetration value near to zero and a softening point (ring & ball) around 120 °C. The insoluble matter, consisting mainly of silica ore, ranges from 8% to 17%.
|
What is the variance in bitumen content rock asphalt?
|
{'text': '83% to 92%', 'answer_start': 302}
|
58,067
| 57,725
|
5ace9a4432bba1001ae4ac57
|
generic
|
Franklin S. Harris was appointed the university's president in 1921. He was the first BYU president to have a doctoral degree. Harris made several important changes to the school, reorganizing it into a true university, whereas before, its organization had remnants of the Academy days. At the beginning of his tenure, the school was not officially recognized as a university by any accreditation organization. By the end of his term, the school was accredited under all major accrediting organizations at the time. He was eventually replaced by Howard S. McDonald, who received his doctorate from the University of California. When he first received the position, the Second World War had just ended, and thousands of students were flooding into BYU. By the end of his stay, the school had grown nearly five times to an enrollment of 5,440 students. The university did not have the facilities to handle such a large influx, so he bought part of an Air Force Base in Ogden, Utah and rebuilt it to house some of the students. The next president, Ernest L. Wilkinson, also oversaw a period of intense growth, as the school adopted an accelerated building program. Wilkinson was responsible for the building of over eighty structures on the campus, many of which still stand. During his tenure, the student body increased six times, making BYU the largest private school at the time. The quality of the students also increased, leading to higher educational standards at the school. Finally, Wilkinson reorganized the LDS Church units on campus, with ten stakes and over 100 wards being added during his administration.
|
Who was appointed president in 1912?
|
{'text': 'Franklin S. Harris', 'answer_start': 0}
|
91,922
| 91,580
|
5728f5652ca10214002dab42
|
generic
|
Theatre traditionally has occupied a large place in Parisian culture, and many of its most popular actors today are also stars of French television. The oldest and most famous Paris theatre is the Comédie-Française, founded in 1680. Run by the French government, it performs mostly French classics at the Salle Richelieu in the Palais-Royal at 2 rue de Richelieu, next to the Louvre. of Other famous theaters include the Odéon-Théâtre de l'Europe, next to the Luxembourg Gardens, also a state institution and theatrical landmark; the Théâtre Mogador, and the Théâtre de la Gaîté-Montparnasse.
|
When was the oldest Paris theater founded?
|
{'text': '1680', 'answer_start': 227}
|
64,323
| 63,981
|
5ad01ec877cf76001a686aba
|
generic
|
Bohemia prospered in the 14th century, and the Golden Bull of 1356 made the king of Bohemia first among the imperial electors, but the Hussite revolution threw the country into crisis. The Holy Roman Empire passed to the Habsburgs in 1438, where it remained until its dissolution in 1806. Yet in spite of the extensive territories held by the Habsburgs, the Empire itself remained fragmented, and much real power and influence lay with the individual principalities. In addition, financial institutions, such as the Hanseatic League and the Fugger family, held great power, on both economic and a political levels.
|
In what year did a Golden Bull make the king of Bohemia last among the imperial electors?
|
{'text': '1356', 'answer_start': 62}
|
42,101
| 41,759
|
570d3e52b3d812140066d5d8
|
generic
|
With the defeat of Marshal Bazaine's Army of the Rhine at Gravelotte, the French were forced to retire to Metz, where they were besieged by over 150,000 Prussian troops of the First and Second Armies. Napoleon III and MacMahon formed the new French Army of Châlons, to march on to Metz to rescue Bazaine. Napoleon III personally led the army with Marshal MacMahon in attendance. The Army of Châlons marched northeast towards the Belgian border to avoid the Prussians before striking south to link up with Bazaine. The Prussians, under the command of Field Marshal Count Helmuth von Moltke, took advantage of this maneuver to catch the French in a pincer grip. He left the Prussian First and Second Armies besieging Metz, except three corps detached to form the Army of the Meuse under the Crown Prince of Saxony. With this army and the Prussian Third Army, Moltke marched northward and caught up with the French at Beaumont on 30 August. After a sharp fight in which they lost 5,000 men and 40 cannons, the French withdrew toward Sedan. Having reformed in the town, the Army of Châlons was immediately isolated by the converging Prussian armies. Napoleon III ordered the army to break out of the encirclement immediately. With MacMahon wounded on the previous day, General Auguste Ducrot took command of the French troops in the field.
|
Along with the Army of the Meuse, what other army did Moltke march north with?
|
{'text': 'the Prussian Third Army', 'answer_start': 832}
|
30,105
| 29,763
|
57061edc75f01819005e79b0
|
generic
|
The immediate predecessors of MP3 were "Optimum Coding in the Frequency Domain" (OCF), and Perceptual Transform Coding (PXFM). These two codecs, along with block-switching contributions from Thomson-Brandt, were merged into a codec called ASPEC, which was submitted to MPEG, and which won the quality competition, but that was mistakenly rejected as too complex to implement. The first practical implementation of an audio perceptual coder (OCF) in hardware (Krasner's hardware was too cumbersome and slow for practical use), was an implementation of a psychoacoustic transform coder based on Motorola 56000 DSP chips.
|
What was the first practical implementation based on?
|
{'text': 'Motorola 56000 DSP chips', 'answer_start': 593}
|
6,469
| 6,127
|
56d3793a59d6e414001464c2
|
generic
|
In the first major change to the judging panel, a fourth judge, Kara DioGuardi, was introduced. This was also the first season without executive producer Nigel Lythgoe who left to focus on the international versions of his show So You Think You Can Dance. The Hollywood round was moved to the Kodak Theatre for 2009 and was also extended to two weeks. Idol Gives Back was canceled for this season due to the global recession at the time.
|
How long did the Hollywood round air for in season eight of American Idol?
|
{'text': 'two weeks', 'answer_start': 341}
|
128,644
| 128,302
|
57341184d058e614000b68dd
|
generic
|
In presidential elections, Montana was long classified as a swing state, though the state has voted for the Republican candidate in all but two elections from 1952 to the present. The state last supported a Democrat for president in 1992, when Bill Clinton won a plurality victory. Overall, since 1889 the state has voted for Democratic governors 60 percent of the time and Democratic presidents 40 percent of the time, with these numbers being 40/60 for Republican candidates. In the 2008 presidential election, Montana was considered a swing state and was ultimately won by Republican John McCain, albeit by a narrow margin of two percent.
|
How often does Montana voted for a Democratic president?
|
{'text': '40 percent', 'answer_start': 396}
|
97,579
| 97,237
|
5a0dfd6ed7c85000188644b5
|
generic
|
Secretory diarrhea means that there is an increase in the active secretion, or there is an inhibition of absorption. There is little to no structural damage. The most common cause of this type of diarrhea is a cholera toxin that stimulates the secretion of anions, especially chloride ions. Therefore, to maintain a charge balance in the lumen, sodium is carried with it, along with water. In this type of diarrhea intestinal fluid secretion is isotonic with plasma even during fasting. It continues even when there is no oral food intake.
|
What means there is an increase in structural damage or absorption inhibition?
|
{'text': 'Secretory diarrhea', 'answer_start': 0}
|
88,236
| 87,894
|
572825042ca10214002d9eed
|
generic
|
Earthworms are Oligochaetes that support terrestrial food chains both as prey and in some regions are important in aeration and enriching of soil. The burrowing of marine polychaetes, which may constitute up to a third of all species in near-shore environments, encourages the development of ecosystems by enabling water and oxygen to penetrate the sea floor. In addition to improving soil fertility, annelids serve humans as food and as bait. Scientists observe annelids to monitor the quality of marine and fresh water. Although blood-letting is no longer in favor with doctors, some leech species are regarded as endangered species because they have been over-harvested for this purpose in the last few centuries. Ragworms' jaws are now being studied by engineers as they offer an exceptional combination of lightness and strength.
|
What annelids' jaws are being studied by engineers?
|
{'text': 'Ragworms', 'answer_start': 717}
|
46,514
| 46,172
|
5ad2b18cd7d075001a429f51
|
generic
|
The NES dropped the hardwired controllers, instead featuring two custom 7-pin ports on the front of the console. Also in contrast to the Famicom, the controllers included with the NES were identical to each other—the second controller lacked the microphone that was present on the Famicom model and possessed the same START and SELECT buttons as the primary controller. Some NES localizations of games, such as The Legend of Zelda, which required the use of the Famicom microphone in order to kill certain enemies, suffered from the lack of hardware to do so.
|
Unlike the Famicom, the SNES controllers possessed what consistent feature?
|
{'text': 'identical', 'answer_start': 189}
|
113,689
| 113,347
|
572ffbc2b2c2fd14005686d5
|
generic
|
In 550 BC, Cyrus the Great, son of Mandane and Cambyses I, took over the Median Empire, and founded the Achaemenid Empire by unifying other city states. The conquest of Media was a result of what is called the Persian Revolt. The brouhaha was initially triggered by the actions of the Median ruler Astyages, and was quickly spread to other provinces, as they allied with the Persians. Later conquests under Cyrus and his successors expanded the empire to include Lydia, Babylon, Egypt, parts of the Balkans and Eastern Europe proper, as well as the lands to the west of the Indus and Oxus rivers.
|
Who triggered the Persian Revolt?
|
{'text': 'the Median ruler Astyages', 'answer_start': 281}
|
79,239
| 78,897
|
5ad21aa6d7d075001a428425
|
generic
|
Societies tend to come and go, of course, depending on the special enthusiasms of the masters and boys in the school at the time, but some have been in existence many years. Those in existence at present include: Aeronautical, African, Alexander Cozens (Art), Amnesty, Archeological, Architectural, Astronomy, Banks (conservation), Caledonian, Cheese, Classical, Comedy, Cosmopolitan, Debating, Design, Entrepreneurship, Geographical, Henry Fielding, Hispanic, History, Keynes (economics), Law, Literary, Mathematical, Medical, Middle Eastern, Model United Nations, Modern Languages, Oriental, Orwell (left-wing), Simeon (Christian), Parry (music), Photographic, Political, Praed (poetry), Rock (music), Rous (equestrian), Salisbury (diplomatic), Savile (Rare Books and Manuscripts), Shelley, Scientific, Sports, Tech Club, Theatre, Wellington (military), Wine and Wotton’s (philosophy).
|
What is one of the societies started in the 15th century?
|
{'text': 'Theatre', 'answer_start': 824}
|
10,954
| 10,612
|
5acfb0eb77cf76001a6858ba
|
generic
|
When modern architecture was first practiced, it was an avant-garde movement with moral, philosophical, and aesthetic underpinnings. Immediately after World War I, pioneering modernist architects sought to develop a completely new style appropriate for a new post-war social and economic order, focused on meeting the needs of the middle and working classes. They rejected the architectural practice of the academic refinement of historical styles which served the rapidly declining aristocratic order. The approach of the Modernist architects was to reduce buildings to pure forms, removing historical references and ornament in favor of functionalist details. Buildings displayed their functional and structural elements, exposing steel beams and concrete surfaces instead of hiding them behind decorative forms.
|
Who was the old movement meant to suit the needs of?
|
{'text': 'middle and working classes', 'answer_start': 331}
|
846
| 504
|
56d4e2142ccc5a1400d832ed
|
generic
|
Beyoncé has received praise for her stage presence and voice during live performances. Jarett Wieselman of the New York Post placed her at number one on her list of the Five Best Singer/Dancers. According to Barbara Ellen of The Guardian Beyoncé is the most in-charge female artist she's seen onstage, while Alice Jones of The Independent wrote she "takes her role as entertainer so seriously she's almost too good." The ex-President of Def Jam L.A. Reid has described Beyoncé as the greatest entertainer alive. Jim Farber of the Daily News and Stephanie Classen of Star Phoenix both praised her strong voice and her stage presence.
|
Who has said that Beyoncé is the best entertainer alive?
|
{'text': 'L.A. Reid', 'answer_start': 445}
|
53,441
| 53,099
|
5acd132b07355d001abf337d
|
generic
|
Expansion of Highbury was restricted because the East Stand had been designated as a Grade II listed building and the other three stands were close to residential properties. These limitations prevented the club from maximising matchday revenue during the 1990s and first decade of the 21st century, putting them in danger of being left behind in the football boom of that time. After considering various options, in 2000 Arsenal proposed building a new 60,361-capacity stadium at Ashburton Grove, since named the Emirates Stadium, about 500 metres south-west of Highbury. The project was initially delayed by red tape and rising costs, and construction was completed in July 2006, in time for the start of the 2006–07 season. The stadium was named after its sponsors, the airline company Emirates, with whom the club signed the largest sponsorship deal in English football history, worth around £100 million; some fans referred to the ground as Ashburton Grove, or the Grove, as they did not agree with corporate sponsorship of stadium names. The stadium will be officially known as Emirates Stadium until at least 2028, and the airline will be the club's shirt sponsor until the end of the 2018–19 season. From the start of the 2010–11 season on, the stands of the stadium have been officially known as North Bank, East Stand, West Stand and Clock end.
|
How many people could fit into Highbury?
|
{'text': '60,361', 'answer_start': 454}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.