contestId
int64 0
1.01k
| index
stringclasses 40
values | name
stringlengths 2
54
| type
stringclasses 2
values | rating
int64 0
3.4k
| tags
listlengths 0
7
| title
stringclasses 393
values | time-limit
stringclasses 7
values | memory-limit
stringclasses 6
values | problem-description
stringlengths 0
2.97k
| input-specification
stringlengths 4
1.87k
| output-specification
stringlengths 4
1.12k
| demo-input
listlengths 0
7
| demo-output
listlengths 0
7
| note
stringlengths 0
5.24k
| points
float64 0
3.5k
| test_cases
listlengths 0
402
| creationTimeSeconds
int64 1.37B
1.7B
| relativeTimeSeconds
int64 8
2.15B
| programmingLanguage
stringclasses 3
values | verdict
stringclasses 1
value | testset
stringclasses 9
values | passedTestCount
int64 1
402
| timeConsumedMillis
int64 15
8.06k
| memoryConsumedBytes
int64 0
514M
| code
stringlengths 11
61.4k
| prompt
stringlengths 297
7.35k
| response
stringlengths 25
61.4k
| score
float64 2.82
3.99
|
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
618
|
A
|
Slime Combining
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Your friend recently gave you some slimes for your birthday. You have *n* slimes all initially with value 1.
You are going to play a game with these slimes. Initially, you put a single slime by itself in a row. Then, you will add the other *n*<=-<=1 slimes one by one. When you add a slime, you place it at the right of all already placed slimes. Then, while the last two slimes in the row have the same value *v*, you combine them together to create a slime with value *v*<=+<=1.
You would like to see what the final state of the row is after you've added all *n* slimes. Please print the values of the slimes in the row from left to right.
|
The first line of the input will contain a single integer, *n* (1<=β€<=*n*<=β€<=100<=000).
|
Output a single line with *k* integers, where *k* is the number of slimes in the row after you've finished the procedure described in the problem statement. The *i*-th of these numbers should be the value of the *i*-th slime from the left.
|
[
"1\n",
"2\n",
"3\n",
"8\n"
] |
[
"1\n",
"2\n",
"2 1\n",
"4\n"
] |
In the first sample, we only have a single slime with value 1. The final state of the board is just a single slime with value 1.
In the second sample, we perform the following steps:
Initially we place a single slime in a row by itself. Thus, row is initially 1.
Then, we will add another slime. The row is now 1 1. Since two rightmost slimes have the same values, we should replace these slimes with one with value 2. Thus, the final state of the board is 2.
In the third sample, after adding the first two slimes, our row is 2. After adding one more slime, the row becomes 2 1.
In the last sample, the steps look as follows:
1. 1 1. 2 1. 2 1 1. 3 1. 3 1 1. 3 2 1. 3 2 1 1. 4
| 500
|
[
{
"input": "1",
"output": "1"
},
{
"input": "2",
"output": "2"
},
{
"input": "3",
"output": "2 1"
},
{
"input": "8",
"output": "4"
},
{
"input": "100000",
"output": "17 16 11 10 8 6"
},
{
"input": "12345",
"output": "14 13 6 5 4 1"
},
{
"input": "32",
"output": "6"
},
{
"input": "70958",
"output": "17 13 11 9 6 4 3 2"
},
{
"input": "97593",
"output": "17 15 14 13 12 11 9 6 5 4 1"
},
{
"input": "91706",
"output": "17 15 14 11 10 6 5 4 2"
},
{
"input": "85371",
"output": "17 15 12 11 9 7 6 5 4 2 1"
},
{
"input": "97205",
"output": "17 15 14 13 12 10 9 8 6 5 3 1"
},
{
"input": "34768",
"output": "16 11 10 9 8 7 5"
},
{
"input": "12705",
"output": "14 13 9 8 6 1"
},
{
"input": "30151",
"output": "15 14 13 11 9 8 7 3 2 1"
},
{
"input": "4974",
"output": "13 10 9 7 6 4 3 2"
},
{
"input": "32728",
"output": "15 14 13 12 11 10 9 8 7 5 4"
},
{
"input": "8192",
"output": "14"
},
{
"input": "65536",
"output": "17"
},
{
"input": "32",
"output": "6"
},
{
"input": "256",
"output": "9"
},
{
"input": "4096",
"output": "13"
},
{
"input": "33301",
"output": "16 10 5 3 1"
},
{
"input": "16725",
"output": "15 9 7 5 3 1"
},
{
"input": "149",
"output": "8 5 3 1"
},
{
"input": "16277",
"output": "14 13 12 11 10 9 8 5 3 1"
},
{
"input": "99701",
"output": "17 16 11 9 7 6 5 3 1"
}
] | 1,454,222,657
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 27
| 62
| 0
|
n=int(input())
i=1
k=1
a=[]
while i<=n:
if i&n:
a.append(k)
i<<=1
k+=1
for i in range(len(a)-1,-1,-1):
print(a[i],end=' ')
|
Title: Slime Combining
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Your friend recently gave you some slimes for your birthday. You have *n* slimes all initially with value 1.
You are going to play a game with these slimes. Initially, you put a single slime by itself in a row. Then, you will add the other *n*<=-<=1 slimes one by one. When you add a slime, you place it at the right of all already placed slimes. Then, while the last two slimes in the row have the same value *v*, you combine them together to create a slime with value *v*<=+<=1.
You would like to see what the final state of the row is after you've added all *n* slimes. Please print the values of the slimes in the row from left to right.
Input Specification:
The first line of the input will contain a single integer, *n* (1<=β€<=*n*<=β€<=100<=000).
Output Specification:
Output a single line with *k* integers, where *k* is the number of slimes in the row after you've finished the procedure described in the problem statement. The *i*-th of these numbers should be the value of the *i*-th slime from the left.
Demo Input:
['1\n', '2\n', '3\n', '8\n']
Demo Output:
['1\n', '2\n', '2 1\n', '4\n']
Note:
In the first sample, we only have a single slime with value 1. The final state of the board is just a single slime with value 1.
In the second sample, we perform the following steps:
Initially we place a single slime in a row by itself. Thus, row is initially 1.
Then, we will add another slime. The row is now 1 1. Since two rightmost slimes have the same values, we should replace these slimes with one with value 2. Thus, the final state of the board is 2.
In the third sample, after adding the first two slimes, our row is 2. After adding one more slime, the row becomes 2 1.
In the last sample, the steps look as follows:
1. 1 1. 2 1. 2 1 1. 3 1. 3 1 1. 3 2 1. 3 2 1 1. 4
|
```python
n=int(input())
i=1
k=1
a=[]
while i<=n:
if i&n:
a.append(k)
i<<=1
k+=1
for i in range(len(a)-1,-1,-1):
print(a[i],end=' ')
```
| 3
|
|
102
|
B
|
Sum of Digits
|
PROGRAMMING
| 1,000
|
[
"implementation"
] |
B. Sum of Digits
|
2
|
265
|
Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came across a number *n*. How many times can Gerald put a spell on it until the number becomes one-digit?
|
The first line contains the only integer *n* (0<=β€<=*n*<=β€<=10100000). It is guaranteed that *n* doesn't contain any leading zeroes.
|
Print the number of times a number can be replaced by the sum of its digits until it only contains one digit.
|
[
"0\n",
"10\n",
"991\n"
] |
[
"0\n",
"1\n",
"3\n"
] |
In the first sample the number already is one-digit β Herald can't cast a spell.
The second test contains number 10. After one casting of a spell it becomes 1, and here the process is completed. Thus, Gerald can only cast the spell once.
The third test contains number 991. As one casts a spell the following transformations take place: 991βββ19βββ10βββ1. After three transformations the number becomes one-digit.
| 1,000
|
[
{
"input": "0",
"output": "0"
},
{
"input": "10",
"output": "1"
},
{
"input": "991",
"output": "3"
},
{
"input": "99",
"output": "2"
},
{
"input": "100",
"output": "1"
},
{
"input": "123456789",
"output": "2"
},
{
"input": "32",
"output": "1"
},
{
"input": "86",
"output": "2"
},
{
"input": "2",
"output": "0"
},
{
"input": "8",
"output": "0"
},
{
"input": "34",
"output": "1"
},
{
"input": "13",
"output": "1"
},
{
"input": "28",
"output": "2"
},
{
"input": "23",
"output": "1"
},
{
"input": "57",
"output": "2"
},
{
"input": "29",
"output": "2"
},
{
"input": "353869285",
"output": "3"
},
{
"input": "549548646",
"output": "2"
},
{
"input": "858893424",
"output": "2"
},
{
"input": "644818852",
"output": "3"
},
{
"input": "360322525",
"output": "3"
},
{
"input": "122937520",
"output": "2"
},
{
"input": "288403032",
"output": "2"
},
{
"input": "677257481",
"output": "3"
},
{
"input": "58059561",
"output": "3"
},
{
"input": "211288847",
"output": "2"
},
{
"input": "339900034079539584",
"output": "2"
},
{
"input": "784084029310269952",
"output": "3"
},
{
"input": "774730557264864000",
"output": "3"
},
{
"input": "478233807148352256",
"output": "3"
},
{
"input": "165646874056812544",
"output": "3"
},
{
"input": "477533739511673792",
"output": "3"
},
{
"input": "660119944377002240",
"output": "3"
},
{
"input": "448375218506078080",
"output": "3"
},
{
"input": "77213334785795616",
"output": "3"
},
{
"input": "165767221702271872",
"output": "3"
},
{
"input": "1",
"output": "0"
},
{
"input": "5",
"output": "0"
},
{
"input": "8",
"output": "0"
},
{
"input": "156161456146164104103460452045416165146141414651641564105461465156445621465146514562146145465165145145614561465145614561",
"output": "3"
},
{
"input": "9",
"output": "0"
}
] | 1,596,712,617
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 51
| 1,308
| 28,160,000
|
import sys
import math
input = sys.stdin.readline
def solve():
def magic(n):
return sum([int(ch) for ch in str(n)])
n = int(input().strip())
ans = 0
while n >= 10:
ans += 1
n = magic(n)
print(ans)
if __name__ == '__main__':
solve()
|
Title: Sum of Digits
Time Limit: 2 seconds
Memory Limit: 265 megabytes
Problem Description:
Having watched the last Harry Potter film, little Gerald also decided to practice magic. He found in his father's magical book a spell that turns any number in the sum of its digits. At the moment Gerald learned that, he came across a number *n*. How many times can Gerald put a spell on it until the number becomes one-digit?
Input Specification:
The first line contains the only integer *n* (0<=β€<=*n*<=β€<=10100000). It is guaranteed that *n* doesn't contain any leading zeroes.
Output Specification:
Print the number of times a number can be replaced by the sum of its digits until it only contains one digit.
Demo Input:
['0\n', '10\n', '991\n']
Demo Output:
['0\n', '1\n', '3\n']
Note:
In the first sample the number already is one-digit β Herald can't cast a spell.
The second test contains number 10. After one casting of a spell it becomes 1, and here the process is completed. Thus, Gerald can only cast the spell once.
The third test contains number 991. As one casts a spell the following transformations take place: 991βββ19βββ10βββ1. After three transformations the number becomes one-digit.
|
```python
import sys
import math
input = sys.stdin.readline
def solve():
def magic(n):
return sum([int(ch) for ch in str(n)])
n = int(input().strip())
ans = 0
while n >= 10:
ans += 1
n = magic(n)
print(ans)
if __name__ == '__main__':
solve()
```
| 3.622329
|
389
|
A
|
Fox and Number Game
|
PROGRAMMING
| 1,000
|
[
"greedy",
"math"
] | null | null |
Fox Ciel is playing a game with numbers now.
Ciel has *n* positive integers: *x*1, *x*2, ..., *x**n*. She can do the following operation as many times as needed: select two different indexes *i* and *j* such that *x**i* > *x**j* hold, and then apply assignment *x**i* = *x**i* - *x**j*. The goal is to make the sum of all numbers as small as possible.
Please help Ciel to find this minimal sum.
|
The first line contains an integer *n* (2<=β€<=*n*<=β€<=100). Then the second line contains *n* integers: *x*1, *x*2, ..., *x**n* (1<=β€<=*x**i*<=β€<=100).
|
Output a single integer β the required minimal sum.
|
[
"2\n1 2\n",
"3\n2 4 6\n",
"2\n12 18\n",
"5\n45 12 27 30 18\n"
] |
[
"2\n",
"6\n",
"12\n",
"15\n"
] |
In the first example the optimal way is to do the assignment: *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>.
In the second example the optimal sequence of operations is: *x*<sub class="lower-index">3</sub> = *x*<sub class="lower-index">3</sub> - *x*<sub class="lower-index">2</sub>, *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>.
| 500
|
[
{
"input": "2\n1 2",
"output": "2"
},
{
"input": "3\n2 4 6",
"output": "6"
},
{
"input": "2\n12 18",
"output": "12"
},
{
"input": "5\n45 12 27 30 18",
"output": "15"
},
{
"input": "2\n1 1",
"output": "2"
},
{
"input": "2\n100 100",
"output": "200"
},
{
"input": "2\n87 58",
"output": "58"
},
{
"input": "39\n52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52 52",
"output": "2028"
},
{
"input": "59\n96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96 96",
"output": "5664"
},
{
"input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100",
"output": "10000"
},
{
"input": "100\n70 70 77 42 98 84 56 91 35 21 7 70 77 77 56 63 14 84 56 14 77 77 63 70 14 7 28 91 63 49 21 84 98 56 77 98 98 84 98 14 7 56 49 28 91 98 7 56 14 91 14 98 49 28 98 14 98 98 14 70 35 28 63 28 49 63 63 56 91 98 35 42 42 35 63 35 42 14 63 21 77 56 42 77 35 91 56 21 28 84 56 70 70 91 98 70 84 63 21 98",
"output": "700"
},
{
"input": "39\n63 21 21 42 21 63 21 84 42 21 84 63 42 63 84 84 84 42 42 84 21 63 42 63 42 42 63 42 42 63 84 42 21 84 21 63 42 21 42",
"output": "819"
},
{
"input": "59\n70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70 70",
"output": "4130"
},
{
"input": "87\n44 88 88 88 88 66 88 22 22 88 88 44 88 22 22 22 88 88 88 88 66 22 88 88 88 88 66 66 44 88 44 44 66 22 88 88 22 44 66 44 88 66 66 22 22 22 22 88 22 22 44 66 88 22 22 88 66 66 88 22 66 88 66 88 66 44 88 44 22 44 44 22 44 88 44 44 44 44 22 88 88 88 66 66 88 44 22",
"output": "1914"
},
{
"input": "15\n63 63 63 63 63 63 63 63 63 63 63 63 63 63 63",
"output": "945"
},
{
"input": "39\n63 77 21 14 14 35 21 21 70 42 21 70 28 77 28 77 7 42 63 7 98 49 98 84 35 70 70 91 14 42 98 7 42 7 98 42 56 35 91",
"output": "273"
},
{
"input": "18\n18 18 18 36 36 36 54 72 54 36 72 54 36 36 36 36 18 36",
"output": "324"
},
{
"input": "46\n71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71 71",
"output": "3266"
},
{
"input": "70\n66 11 66 11 44 11 44 99 55 22 88 11 11 22 55 44 22 77 44 77 77 22 44 55 88 11 99 99 88 22 77 77 66 11 11 66 99 55 55 44 66 44 77 44 44 55 33 55 44 88 77 77 22 66 33 44 11 22 55 44 22 66 77 33 33 44 44 44 22 33",
"output": "770"
},
{
"input": "10\n60 12 96 48 60 24 60 36 60 60",
"output": "120"
},
{
"input": "20\n51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51 51",
"output": "1020"
},
{
"input": "50\n58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58 58",
"output": "2900"
},
{
"input": "98\n70 60 100 30 70 20 30 50 50 30 90 40 30 40 60 80 60 60 80 50 10 80 20 10 20 10 50 70 30 80 30 50 60 90 90 100 60 30 90 20 30 60 90 80 60 60 10 90 10 50 40 40 80 90 100 40 70 40 30 50 60 50 60 30 40 20 90 60 20 20 20 70 60 70 50 100 90 50 20 40 80 60 10 60 50 40 40 10 50 10 40 10 80 100 100 90 10 90",
"output": "980"
},
{
"input": "100\n82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82 82",
"output": "8200"
},
{
"input": "100\n11 87 77 93 3 54 21 93 9 71 37 23 69 85 74 3 48 99 51 31 56 19 21 96 39 6 4 4 29 69 100 42 1 22 81 53 48 49 81 61 10 7 40 61 7 71 51 59 79 44 50 35 95 80 83 8 98 40 18 94 84 49 52 74 66 69 39 37 100 44 38 62 2 80 46 31 35 53 5 60 21 49 63 55 20 53 80 53 66 34 23 92 77 50 86 63 65 24 12 70",
"output": "100"
},
{
"input": "2\n100 1",
"output": "2"
},
{
"input": "2\n18 30",
"output": "12"
},
{
"input": "2\n3 5",
"output": "2"
},
{
"input": "2\n1 10",
"output": "2"
},
{
"input": "2\n8 5",
"output": "2"
},
{
"input": "5\n2 3 5 8 18",
"output": "5"
},
{
"input": "5\n2 4 1 6 8",
"output": "5"
},
{
"input": "3\n12 10 5",
"output": "3"
},
{
"input": "3\n6 10 15",
"output": "3"
}
] | 1,467,116,793
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 78
| 0
|
n = int(input())
a = [int(x) for x in input().split()]
while any(x != a[0] for x in a):
a.sort()
a = [a[i] - a[0] if a[i] > a[0] else a[i] for i in range(0, n)]
print(sum(a))
|
Title: Fox and Number Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Fox Ciel is playing a game with numbers now.
Ciel has *n* positive integers: *x*1, *x*2, ..., *x**n*. She can do the following operation as many times as needed: select two different indexes *i* and *j* such that *x**i* > *x**j* hold, and then apply assignment *x**i* = *x**i* - *x**j*. The goal is to make the sum of all numbers as small as possible.
Please help Ciel to find this minimal sum.
Input Specification:
The first line contains an integer *n* (2<=β€<=*n*<=β€<=100). Then the second line contains *n* integers: *x*1, *x*2, ..., *x**n* (1<=β€<=*x**i*<=β€<=100).
Output Specification:
Output a single integer β the required minimal sum.
Demo Input:
['2\n1 2\n', '3\n2 4 6\n', '2\n12 18\n', '5\n45 12 27 30 18\n']
Demo Output:
['2\n', '6\n', '12\n', '15\n']
Note:
In the first example the optimal way is to do the assignment: *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>.
In the second example the optimal sequence of operations is: *x*<sub class="lower-index">3</sub> = *x*<sub class="lower-index">3</sub> - *x*<sub class="lower-index">2</sub>, *x*<sub class="lower-index">2</sub> = *x*<sub class="lower-index">2</sub> - *x*<sub class="lower-index">1</sub>.
|
```python
n = int(input())
a = [int(x) for x in input().split()]
while any(x != a[0] for x in a):
a.sort()
a = [a[i] - a[0] if a[i] > a[0] else a[i] for i in range(0, n)]
print(sum(a))
```
| 3
|
|
124
|
A
|
The number of positions
|
PROGRAMMING
| 1,000
|
[
"math"
] | null | null |
Petr stands in line of *n* people, but he doesn't know exactly which position he occupies. He can say that there are no less than *a* people standing in front of him and no more than *b* people standing behind him. Find the number of different positions Petr can occupy.
|
The only line contains three integers *n*, *a* and *b* (0<=β€<=*a*,<=*b*<=<<=*n*<=β€<=100).
|
Print the single number β the number of the sought positions.
|
[
"3 1 1\n",
"5 2 3\n"
] |
[
"2\n",
"3\n"
] |
The possible positions in the first sample are: 2 and 3 (if we number the positions starting with 1).
In the second sample they are 3, 4 and 5.
| 500
|
[
{
"input": "3 1 1",
"output": "2"
},
{
"input": "5 2 3",
"output": "3"
},
{
"input": "5 4 0",
"output": "1"
},
{
"input": "6 5 5",
"output": "1"
},
{
"input": "9 4 3",
"output": "4"
},
{
"input": "11 4 6",
"output": "7"
},
{
"input": "13 8 7",
"output": "5"
},
{
"input": "14 5 5",
"output": "6"
},
{
"input": "16 6 9",
"output": "10"
},
{
"input": "20 13 17",
"output": "7"
},
{
"input": "22 4 8",
"output": "9"
},
{
"input": "23 8 14",
"output": "15"
},
{
"input": "26 18 22",
"output": "8"
},
{
"input": "28 6 1",
"output": "2"
},
{
"input": "29 5 23",
"output": "24"
},
{
"input": "32 27 15",
"output": "5"
},
{
"input": "33 11 5",
"output": "6"
},
{
"input": "37 21 15",
"output": "16"
},
{
"input": "39 34 33",
"output": "5"
},
{
"input": "41 27 11",
"output": "12"
},
{
"input": "42 25 16",
"output": "17"
},
{
"input": "45 7 43",
"output": "38"
},
{
"input": "47 16 17",
"output": "18"
},
{
"input": "49 11 37",
"output": "38"
},
{
"input": "51 38 39",
"output": "13"
},
{
"input": "52 29 7",
"output": "8"
},
{
"input": "56 43 12",
"output": "13"
},
{
"input": "58 57 28",
"output": "1"
},
{
"input": "59 12 39",
"output": "40"
},
{
"input": "62 9 52",
"output": "53"
},
{
"input": "63 29 44",
"output": "34"
},
{
"input": "65 30 22",
"output": "23"
},
{
"input": "66 27 38",
"output": "39"
},
{
"input": "71 33 53",
"output": "38"
},
{
"input": "73 14 12",
"output": "13"
},
{
"input": "73 37 35",
"output": "36"
},
{
"input": "76 69 44",
"output": "7"
},
{
"input": "79 25 20",
"output": "21"
},
{
"input": "81 60 20",
"output": "21"
},
{
"input": "81 79 14",
"output": "2"
},
{
"input": "84 0 42",
"output": "43"
},
{
"input": "88 79 8",
"output": "9"
},
{
"input": "90 76 59",
"output": "14"
},
{
"input": "92 2 22",
"output": "23"
},
{
"input": "94 5 88",
"output": "89"
},
{
"input": "94 62 48",
"output": "32"
},
{
"input": "96 22 72",
"output": "73"
},
{
"input": "100 11 88",
"output": "89"
},
{
"input": "100 81 91",
"output": "19"
},
{
"input": "1 0 0",
"output": "1"
}
] | 1,653,633,553
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 50
| 186
| 0
|
'''
β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬
β¬β¬ ββ ββ β¬β¬
β¬β¬ ββ ββ β¬β¬
β¬β¬ βββββββββ β¬β¬
β¬β¬ ββ ββ β¬β¬
β¬β¬ ββ ββ β¬β¬
β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬
###########################
// β’οΈΏβ’ \\
/\\ //\
/\\ //\
/\\//\
###########################
'''
import sys
input = lambda : sys.stdin.readline().strip()
import math as mt
from math import ceil as cl
from math import log2 as l2
mod = 10**9 + 7
def ii():
return int(input())
def lii():
return list(map(int, input().split()))
def ss():
return input()
def lss():
return list(map(str, input().split()))
def yes():
print("YES")
def no():
print("NO")
'''
β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬
'''
n,a,b = lii()
print(n-max(a+1,n-b)+1)
|
Title: The number of positions
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Petr stands in line of *n* people, but he doesn't know exactly which position he occupies. He can say that there are no less than *a* people standing in front of him and no more than *b* people standing behind him. Find the number of different positions Petr can occupy.
Input Specification:
The only line contains three integers *n*, *a* and *b* (0<=β€<=*a*,<=*b*<=<<=*n*<=β€<=100).
Output Specification:
Print the single number β the number of the sought positions.
Demo Input:
['3 1 1\n', '5 2 3\n']
Demo Output:
['2\n', '3\n']
Note:
The possible positions in the first sample are: 2 and 3 (if we number the positions starting with 1).
In the second sample they are 3, 4 and 5.
|
```python
'''
β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬
β¬β¬ ββ ββ β¬β¬
β¬β¬ ββ ββ β¬β¬
β¬β¬ βββββββββ β¬β¬
β¬β¬ ββ ββ β¬β¬
β¬β¬ ββ ββ β¬β¬
β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬
###########################
// β’οΈΏβ’ \\
/\\ //\
/\\ //\
/\\//\
###########################
'''
import sys
input = lambda : sys.stdin.readline().strip()
import math as mt
from math import ceil as cl
from math import log2 as l2
mod = 10**9 + 7
def ii():
return int(input())
def lii():
return list(map(int, input().split()))
def ss():
return input()
def lss():
return list(map(str, input().split()))
def yes():
print("YES")
def no():
print("NO")
'''
β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬β¬
'''
n,a,b = lii()
print(n-max(a+1,n-b)+1)
```
| 3
|
|
981
|
B
|
Businessmen Problems
|
PROGRAMMING
| 1,000
|
[
"sortings"
] | null | null |
Two famous competing companies ChemForces and TopChemist decided to show their sets of recently discovered chemical elements on an exhibition. However they know that no element should be present in the sets of both companies.
In order to avoid this representatives of both companies decided to make an agreement on the sets the companies should present. The sets should be chosen in the way that maximizes the total income of the companies.
All elements are enumerated with integers. The ChemForces company has discovered $n$ distinct chemical elements with indices $a_1, a_2, \ldots, a_n$, and will get an income of $x_i$ Berland rubles if the $i$-th element from this list is in the set of this company.
The TopChemist company discovered $m$ distinct chemical elements with indices $b_1, b_2, \ldots, b_m$, and it will get an income of $y_j$ Berland rubles for including the $j$-th element from this list to its set.
In other words, the first company can present any subset of elements from $\{a_1, a_2, \ldots, a_n\}$ (possibly empty subset), the second company can present any subset of elements from $\{b_1, b_2, \ldots, b_m\}$ (possibly empty subset). There shouldn't be equal elements in the subsets.
Help the representatives select the sets in such a way that no element is presented in both sets and the total income is the maximum possible.
|
The first line contains a single integer $n$ ($1 \leq n \leq 10^5$) Β β the number of elements discovered by ChemForces.
The $i$-th of the next $n$ lines contains two integers $a_i$ and $x_i$ ($1 \leq a_i \leq 10^9$, $1 \leq x_i \leq 10^9$) Β β the index of the $i$-th element and the income of its usage on the exhibition. It is guaranteed that all $a_i$ are distinct.
The next line contains a single integer $m$ ($1 \leq m \leq 10^5$) Β β the number of chemicals invented by TopChemist.
The $j$-th of the next $m$ lines contains two integers $b_j$ and $y_j$, ($1 \leq b_j \leq 10^9$, $1 \leq y_j \leq 10^9$) Β β the index of the $j$-th element and the income of its usage on the exhibition. It is guaranteed that all $b_j$ are distinct.
|
Print the maximum total income you can obtain by choosing the sets for both companies in such a way that no element is presented in both sets.
|
[
"3\n1 2\n7 2\n3 10\n4\n1 4\n2 4\n3 4\n4 4\n",
"1\n1000000000 239\n3\n14 15\n92 65\n35 89\n"
] |
[
"24\n",
"408\n"
] |
In the first example ChemForces can choose the set ($3, 7$), while TopChemist can choose ($1, 2, 4$). This way the total income is $(10 + 2) + (4 + 4 + 4) = 24$.
In the second example ChemForces can choose the only element $10^9$, while TopChemist can choose ($14, 92, 35$). This way the total income is $(239) + (15 + 65 + 89) = 408$.
| 750
|
[
{
"input": "3\n1 2\n7 2\n3 10\n4\n1 4\n2 4\n3 4\n4 4",
"output": "24"
},
{
"input": "1\n1000000000 239\n3\n14 15\n92 65\n35 89",
"output": "408"
},
{
"input": "10\n598654597 488228616\n544064902 21923894\n329635457 980089248\n988262691 654502493\n967529230 543358150\n835120075 128123793\n809901567 613170206\n152157661 479980560\n859252956 318029856\n614959273 735298093\n10\n849172317 361325206\n341655282 740807372\n453949939 809030434\n813199219 765838311\n725032511 427644854\n631233366 115983627\n825067417 721190169\n463026366 953335259\n881501578 987288937\n500099903 427659916",
"output": "11272808994"
},
{
"input": "10\n598654597 488228616\n544064902 21923894\n329635457 980089248\n988262691 654502493\n967529230 543358150\n835120075 128123793\n809901567 613170206\n152157661 479980560\n859252956 318029856\n614959273 735298093\n10\n544064902 740807372\n859252956 765838311\n835120075 115983627\n825067417 463026366\n809901567 500099903\n614959273 322932832\n33955432 657532637\n816892960 927933923\n916770606 754371712\n967529230 566149252",
"output": "8955052582"
},
{
"input": "1\n259021863 682413763\n1\n554146726 693647287",
"output": "1376061050"
},
{
"input": "1\n259021863 682413763\n1\n554146726 425883728",
"output": "1108297491"
},
{
"input": "1\n1000000000 1\n1\n1000000000 1000000000",
"output": "1000000000"
},
{
"input": "2\n1 4\n2 4\n2\n1 4\n2 4",
"output": "8"
},
{
"input": "1\n14 15\n3\n35 89\n92 65\n1000000000 239",
"output": "408"
}
] | 1,530,010,019
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 33
| 826
| 23,756,800
|
n=int(input())
dict1={}
for i in range(n):
a,x=map(int,input().split())
dict1[a]=[x]
m=int(input())
for i in range(m):
a,x=map(int,input().split())
try:
dict1[a].append(x)
except:
KeyError
dict1[a]=[x]
ans=0
for i in dict1:
ans+=max(dict1[i])
print(ans)
|
Title: Businessmen Problems
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Two famous competing companies ChemForces and TopChemist decided to show their sets of recently discovered chemical elements on an exhibition. However they know that no element should be present in the sets of both companies.
In order to avoid this representatives of both companies decided to make an agreement on the sets the companies should present. The sets should be chosen in the way that maximizes the total income of the companies.
All elements are enumerated with integers. The ChemForces company has discovered $n$ distinct chemical elements with indices $a_1, a_2, \ldots, a_n$, and will get an income of $x_i$ Berland rubles if the $i$-th element from this list is in the set of this company.
The TopChemist company discovered $m$ distinct chemical elements with indices $b_1, b_2, \ldots, b_m$, and it will get an income of $y_j$ Berland rubles for including the $j$-th element from this list to its set.
In other words, the first company can present any subset of elements from $\{a_1, a_2, \ldots, a_n\}$ (possibly empty subset), the second company can present any subset of elements from $\{b_1, b_2, \ldots, b_m\}$ (possibly empty subset). There shouldn't be equal elements in the subsets.
Help the representatives select the sets in such a way that no element is presented in both sets and the total income is the maximum possible.
Input Specification:
The first line contains a single integer $n$ ($1 \leq n \leq 10^5$) Β β the number of elements discovered by ChemForces.
The $i$-th of the next $n$ lines contains two integers $a_i$ and $x_i$ ($1 \leq a_i \leq 10^9$, $1 \leq x_i \leq 10^9$) Β β the index of the $i$-th element and the income of its usage on the exhibition. It is guaranteed that all $a_i$ are distinct.
The next line contains a single integer $m$ ($1 \leq m \leq 10^5$) Β β the number of chemicals invented by TopChemist.
The $j$-th of the next $m$ lines contains two integers $b_j$ and $y_j$, ($1 \leq b_j \leq 10^9$, $1 \leq y_j \leq 10^9$) Β β the index of the $j$-th element and the income of its usage on the exhibition. It is guaranteed that all $b_j$ are distinct.
Output Specification:
Print the maximum total income you can obtain by choosing the sets for both companies in such a way that no element is presented in both sets.
Demo Input:
['3\n1 2\n7 2\n3 10\n4\n1 4\n2 4\n3 4\n4 4\n', '1\n1000000000 239\n3\n14 15\n92 65\n35 89\n']
Demo Output:
['24\n', '408\n']
Note:
In the first example ChemForces can choose the set ($3, 7$), while TopChemist can choose ($1, 2, 4$). This way the total income is $(10 + 2) + (4 + 4 + 4) = 24$.
In the second example ChemForces can choose the only element $10^9$, while TopChemist can choose ($14, 92, 35$). This way the total income is $(239) + (15 + 65 + 89) = 408$.
|
```python
n=int(input())
dict1={}
for i in range(n):
a,x=map(int,input().split())
dict1[a]=[x]
m=int(input())
for i in range(m):
a,x=map(int,input().split())
try:
dict1[a].append(x)
except:
KeyError
dict1[a]=[x]
ans=0
for i in dict1:
ans+=max(dict1[i])
print(ans)
```
| 3
|
|
701
|
B
|
Cells Not Under Attack
|
PROGRAMMING
| 1,200
|
[
"data structures",
"math"
] | null | null |
Vasya has the square chessboard of size *n*<=Γ<=*n* and *m* rooks. Initially the chessboard is empty. Vasya will consequently put the rooks on the board one after another.
The cell of the field is under rook's attack, if there is at least one rook located in the same row or in the same column with this cell. If there is a rook located in the cell, this cell is also under attack.
You are given the positions of the board where Vasya will put rooks. For each rook you have to determine the number of cells which are not under attack after Vasya puts it on the board.
|
The first line of the input contains two integers *n* and *m* (1<=β€<=*n*<=β€<=100<=000, 1<=β€<=*m*<=β€<=*min*(100<=000,<=*n*2))Β β the size of the board and the number of rooks.
Each of the next *m* lines contains integers *x**i* and *y**i* (1<=β€<=*x**i*,<=*y**i*<=β€<=*n*)Β β the number of the row and the number of the column where Vasya will put the *i*-th rook. Vasya puts rooks on the board in the order they appear in the input. It is guaranteed that any cell will contain no more than one rook.
|
Print *m* integer, the *i*-th of them should be equal to the number of cells that are not under attack after first *i* rooks are put.
|
[
"3 3\n1 1\n3 1\n2 2\n",
"5 2\n1 5\n5 1\n",
"100000 1\n300 400\n"
] |
[
"4 2 0 \n",
"16 9 \n",
"9999800001 \n"
] |
On the picture below show the state of the board after put each of the three rooks. The cells which painted with grey color is not under the attack.
| 750
|
[
{
"input": "3 3\n1 1\n3 1\n2 2",
"output": "4 2 0 "
},
{
"input": "5 2\n1 5\n5 1",
"output": "16 9 "
},
{
"input": "100000 1\n300 400",
"output": "9999800001 "
},
{
"input": "10 4\n2 8\n1 8\n9 8\n6 9",
"output": "81 72 63 48 "
},
{
"input": "30 30\n3 13\n27 23\n18 24\n18 19\n14 20\n7 10\n27 13\n20 27\n11 1\n21 10\n2 9\n28 12\n29 19\n28 27\n27 29\n30 12\n27 2\n4 5\n8 19\n21 2\n24 27\n14 22\n20 3\n18 3\n23 9\n28 6\n15 12\n2 2\n16 27\n1 14",
"output": "841 784 729 702 650 600 600 552 506 484 441 400 380 380 361 342 324 289 272 272 255 240 225 225 210 196 182 182 168 143 "
},
{
"input": "70 31\n22 39\n33 43\n50 27\n70 9\n20 67\n61 24\n60 4\n60 28\n4 25\n30 29\n46 47\n51 48\n37 5\n14 29\n45 44\n68 35\n52 21\n7 37\n18 43\n44 22\n26 12\n39 37\n51 55\n50 23\n51 16\n16 49\n22 62\n35 45\n56 2\n20 51\n3 37",
"output": "4761 4624 4489 4356 4225 4096 3969 3906 3782 3660 3540 3422 3306 3249 3136 3025 2916 2809 2756 2652 2550 2499 2450 2401 2352 2256 2208 2115 2024 1978 1935 "
},
{
"input": "330 17\n259 262\n146 20\n235 69\n84 74\n131 267\n153 101\n32 232\n214 212\n239 157\n121 156\n10 45\n266 78\n52 258\n109 279\n193 276\n239 142\n321 89",
"output": "108241 107584 106929 106276 105625 104976 104329 103684 103041 102400 101761 101124 100489 99856 99225 98910 98282 "
},
{
"input": "500 43\n176 85\n460 171\n233 260\n73 397\n474 35\n290 422\n309 318\n280 415\n485 169\n106 22\n355 129\n180 301\n205 347\n197 93\n263 318\n336 382\n314 350\n476 214\n367 277\n333 166\n500 376\n236 17\n94 73\n116 204\n166 50\n168 218\n144 369\n340 91\n274 360\n171 360\n41 251\n262 478\n27 163\n151 491\n208 415\n448 386\n293 486\n371 479\n330 435\n220 374\n163 316\n155 158\n26 126",
"output": "249001 248004 247009 246016 245025 244036 243049 242064 241081 240100 239121 238144 237169 236196 235710 234740 233772 232806 231842 230880 229920 228962 228006 227052 226100 225150 224202 223256 222312 221840 220899 219960 219023 218088 217620 216688 215758 214830 213904 212980 212058 211138 210220 "
},
{
"input": "99999 1\n54016 16192",
"output": "9999600004 "
},
{
"input": "99991 9\n80814 65974\n12100 98787\n9390 76191\n5628 47659\n80075 25361\n75330 1630\n38758 99962\n33848 40352\n43732 52281",
"output": "9998000100 9997800121 9997600144 9997400169 9997200196 9997000225 9996800256 9996600289 9996400324 "
},
{
"input": "1 1\n1 1",
"output": "0 "
}
] | 1,650,485,144
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 436
| 10,649,600
|
n, m = map(int, input().split())
rows = set()
columns = set()
answers = []
for i in range(m):
r, c = map(int, input().split())
rows.add(r)
columns.add(c)
answers.append((n-len(rows)) * (n-len(columns)))
for i in range(m):
if i == m-1:
print(answers[i])
else:
print(answers[i], end=' ')
|
Title: Cells Not Under Attack
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Vasya has the square chessboard of size *n*<=Γ<=*n* and *m* rooks. Initially the chessboard is empty. Vasya will consequently put the rooks on the board one after another.
The cell of the field is under rook's attack, if there is at least one rook located in the same row or in the same column with this cell. If there is a rook located in the cell, this cell is also under attack.
You are given the positions of the board where Vasya will put rooks. For each rook you have to determine the number of cells which are not under attack after Vasya puts it on the board.
Input Specification:
The first line of the input contains two integers *n* and *m* (1<=β€<=*n*<=β€<=100<=000, 1<=β€<=*m*<=β€<=*min*(100<=000,<=*n*2))Β β the size of the board and the number of rooks.
Each of the next *m* lines contains integers *x**i* and *y**i* (1<=β€<=*x**i*,<=*y**i*<=β€<=*n*)Β β the number of the row and the number of the column where Vasya will put the *i*-th rook. Vasya puts rooks on the board in the order they appear in the input. It is guaranteed that any cell will contain no more than one rook.
Output Specification:
Print *m* integer, the *i*-th of them should be equal to the number of cells that are not under attack after first *i* rooks are put.
Demo Input:
['3 3\n1 1\n3 1\n2 2\n', '5 2\n1 5\n5 1\n', '100000 1\n300 400\n']
Demo Output:
['4 2 0 \n', '16 9 \n', '9999800001 \n']
Note:
On the picture below show the state of the board after put each of the three rooks. The cells which painted with grey color is not under the attack.
|
```python
n, m = map(int, input().split())
rows = set()
columns = set()
answers = []
for i in range(m):
r, c = map(int, input().split())
rows.add(r)
columns.add(c)
answers.append((n-len(rows)) * (n-len(columns)))
for i in range(m):
if i == m-1:
print(answers[i])
else:
print(answers[i], end=' ')
```
| 3
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
Hongcow is ruler of the world. As ruler of the world, he wants to make it easier for people to travel by road within their own countries.
The world can be modeled as an undirected graph with *n* nodes and *m* edges. *k* of the nodes are home to the governments of the *k* countries that make up the world.
There is at most one edge connecting any two nodes and no edge connects a node to itself. Furthermore, for any two nodes corresponding to governments, there is no path between those two nodes. Any graph that satisfies all of these conditions is stable.
Hongcow wants to add as many edges as possible to the graph while keeping it stable. Determine the maximum number of edges Hongcow can add.
|
The first line of input will contain three integers *n*, *m* and *k* (1<=β€<=*n*<=β€<=1<=000, 0<=β€<=*m*<=β€<=100<=000, 1<=β€<=*k*<=β€<=*n*)Β β the number of vertices and edges in the graph, and the number of vertices that are homes of the government.
The next line of input will contain *k* integers *c*1,<=*c*2,<=...,<=*c**k* (1<=β€<=*c**i*<=β€<=*n*). These integers will be pairwise distinct and denote the nodes that are home to the governments in this world.
The following *m* lines of input will contain two integers *u**i* and *v**i* (1<=β€<=*u**i*,<=*v**i*<=β€<=*n*). This denotes an undirected edge between nodes *u**i* and *v**i*.
It is guaranteed that the graph described by the input is stable.
|
Output a single integer, the maximum number of edges Hongcow can add to the graph while keeping it stable.
|
[
"4 1 2\n1 3\n1 2\n",
"3 3 1\n2\n1 2\n1 3\n2 3\n"
] |
[
"2\n",
"0\n"
] |
For the first sample test, the graph looks like this:
For the second sample test, the graph looks like this:
| 0
|
[
{
"input": "4 1 2\n1 3\n1 2",
"output": "2"
},
{
"input": "3 3 1\n2\n1 2\n1 3\n2 3",
"output": "0"
},
{
"input": "10 3 2\n1 10\n1 2\n1 3\n4 5",
"output": "33"
},
{
"input": "1 0 1\n1",
"output": "0"
},
{
"input": "1000 0 1\n72",
"output": "499500"
},
{
"input": "24 38 2\n4 13\n7 1\n24 1\n2 8\n17 2\n2 18\n22 2\n23 3\n5 9\n21 5\n6 7\n6 19\n6 20\n11 7\n7 20\n13 8\n16 8\n9 10\n14 9\n21 9\n12 10\n10 22\n23 10\n17 11\n11 24\n20 12\n13 16\n13 23\n15 14\n17 14\n14 20\n19 16\n17 20\n17 23\n18 22\n18 23\n22 19\n21 20\n23 24",
"output": "215"
},
{
"input": "10 30 1\n4\n1 2\n3 1\n4 1\n1 6\n1 8\n10 1\n2 4\n2 7\n3 4\n3 5\n7 3\n3 9\n10 3\n5 4\n6 4\n7 4\n9 4\n10 4\n6 5\n5 8\n9 5\n10 5\n6 7\n9 6\n10 6\n7 8\n9 7\n10 7\n9 8\n10 8",
"output": "15"
},
{
"input": "10 13 2\n5 10\n2 1\n1 4\n2 3\n2 8\n3 4\n7 3\n4 6\n8 4\n4 9\n6 7\n6 9\n10 6\n7 8",
"output": "23"
},
{
"input": "10 10 3\n2 5 6\n1 3\n4 1\n4 3\n5 3\n3 9\n8 4\n9 4\n5 10\n8 7\n10 8",
"output": "18"
},
{
"input": "10 5 3\n1 5 9\n1 3\n1 8\n2 3\n8 4\n5 7",
"output": "17"
},
{
"input": "6 4 2\n1 4\n1 2\n2 3\n4 5\n5 6",
"output": "2"
},
{
"input": "7 8 2\n1 4\n1 2\n2 3\n4 5\n4 6\n4 7\n5 6\n5 7\n6 7",
"output": "1"
},
{
"input": "5 2 3\n1 3 4\n1 5\n2 4",
"output": "0"
},
{
"input": "5 3 2\n1 2\n2 3\n2 4\n1 5",
"output": "1"
},
{
"input": "9 5 2\n1 5\n1 2\n2 3\n3 4\n5 6\n6 7",
"output": "13"
},
{
"input": "6 4 1\n1\n2 3\n3 4\n4 5\n5 6",
"output": "11"
},
{
"input": "6 4 2\n1 5\n1 2\n2 3\n3 4\n5 6",
"output": "3"
},
{
"input": "7 3 3\n1 5 6\n1 2\n1 3\n6 7",
"output": "4"
},
{
"input": "5 2 2\n1 2\n1 3\n2 4",
"output": "2"
},
{
"input": "11 7 2\n1 4\n1 2\n1 3\n4 5\n4 6\n5 6\n9 10\n1 11",
"output": "24"
},
{
"input": "20 4 5\n1 3 9 10 20\n5 6\n1 2\n7 9\n4 10",
"output": "89"
}
] | 1,481,996,981
| 4,481
|
Python 3
|
OK
|
TESTS
| 61
| 374
| 7,782,400
|
def dfs(vertex, summ, has_capital, am):
summ += len(neigh[vertex])
am += 1
if vertex in capitals:
has_capital = True
used[vertex] = True
for nei in neigh[vertex]:
if not used[nei]:
tmp_c, am, summ = dfs(nei, summ, has_capital, am)
has_capital |= tmp_c
return [has_capital, am, summ]
n, m, k = [int(i) for i in input().split()]
neigh = []
for i in range(n):
neigh.append([])
capitals = [int(i) - 1 for i in input().split()]
for i in range(m):
u, v = [int(i) - 1 for i in input().split()]
neigh[u].append(v)
neigh[v].append(u)
result = 0
used = [False] * n
comp = []
while False in used:
comp.append(dfs(used.index(False), 0, False, 0))
comp[len(comp) - 1][2] /= 2
for i in range(len(comp)):
result -= comp[i][2]
comp.sort(reverse=True)
total_ns = comp[0][1]
for i in range(1, len(comp)):
if not comp[i][0]:
total_ns += comp[i][1]
else:
result += comp[i][1] * (comp[i][1] - 1) / 2
result += (total_ns) * (total_ns - 1) / 2
print(int(result))
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Hongcow is ruler of the world. As ruler of the world, he wants to make it easier for people to travel by road within their own countries.
The world can be modeled as an undirected graph with *n* nodes and *m* edges. *k* of the nodes are home to the governments of the *k* countries that make up the world.
There is at most one edge connecting any two nodes and no edge connects a node to itself. Furthermore, for any two nodes corresponding to governments, there is no path between those two nodes. Any graph that satisfies all of these conditions is stable.
Hongcow wants to add as many edges as possible to the graph while keeping it stable. Determine the maximum number of edges Hongcow can add.
Input Specification:
The first line of input will contain three integers *n*, *m* and *k* (1<=β€<=*n*<=β€<=1<=000, 0<=β€<=*m*<=β€<=100<=000, 1<=β€<=*k*<=β€<=*n*)Β β the number of vertices and edges in the graph, and the number of vertices that are homes of the government.
The next line of input will contain *k* integers *c*1,<=*c*2,<=...,<=*c**k* (1<=β€<=*c**i*<=β€<=*n*). These integers will be pairwise distinct and denote the nodes that are home to the governments in this world.
The following *m* lines of input will contain two integers *u**i* and *v**i* (1<=β€<=*u**i*,<=*v**i*<=β€<=*n*). This denotes an undirected edge between nodes *u**i* and *v**i*.
It is guaranteed that the graph described by the input is stable.
Output Specification:
Output a single integer, the maximum number of edges Hongcow can add to the graph while keeping it stable.
Demo Input:
['4 1 2\n1 3\n1 2\n', '3 3 1\n2\n1 2\n1 3\n2 3\n']
Demo Output:
['2\n', '0\n']
Note:
For the first sample test, the graph looks like this:
For the second sample test, the graph looks like this:
|
```python
def dfs(vertex, summ, has_capital, am):
summ += len(neigh[vertex])
am += 1
if vertex in capitals:
has_capital = True
used[vertex] = True
for nei in neigh[vertex]:
if not used[nei]:
tmp_c, am, summ = dfs(nei, summ, has_capital, am)
has_capital |= tmp_c
return [has_capital, am, summ]
n, m, k = [int(i) for i in input().split()]
neigh = []
for i in range(n):
neigh.append([])
capitals = [int(i) - 1 for i in input().split()]
for i in range(m):
u, v = [int(i) - 1 for i in input().split()]
neigh[u].append(v)
neigh[v].append(u)
result = 0
used = [False] * n
comp = []
while False in used:
comp.append(dfs(used.index(False), 0, False, 0))
comp[len(comp) - 1][2] /= 2
for i in range(len(comp)):
result -= comp[i][2]
comp.sort(reverse=True)
total_ns = comp[0][1]
for i in range(1, len(comp)):
if not comp[i][0]:
total_ns += comp[i][1]
else:
result += comp[i][1] * (comp[i][1] - 1) / 2
result += (total_ns) * (total_ns - 1) / 2
print(int(result))
```
| 3
|
|
507
|
B
|
Amr and Pins
|
PROGRAMMING
| 1,400
|
[
"geometry",
"math"
] | null | null |
Amr loves Geometry. One day he came up with a very interesting problem.
Amr has a circle of radius *r* and center in point (*x*,<=*y*). He wants the circle center to be in new position (*x*',<=*y*').
In one step Amr can put a pin to the border of the circle in a certain point, then rotate the circle around that pin by any angle and finally remove the pin.
Help Amr to achieve his goal in minimum number of steps.
|
Input consists of 5 space-separated integers *r*, *x*, *y*, *x*' *y*' (1<=β€<=*r*<=β€<=105, <=-<=105<=β€<=*x*,<=*y*,<=*x*',<=*y*'<=β€<=105), circle radius, coordinates of original center of the circle and coordinates of destination center of the circle respectively.
|
Output a single integer β minimum number of steps required to move the center of the circle to the destination point.
|
[
"2 0 0 0 4\n",
"1 1 1 4 4\n",
"4 5 6 5 6\n"
] |
[
"1\n",
"3\n",
"0\n"
] |
In the first sample test the optimal way is to put a pin at point (0,β2) and rotate the circle by 180 degrees counter-clockwise (or clockwise, no matter).
<img class="tex-graphics" src="https://espresso.codeforces.com/4e40fd4cc24a2050a0488aa131e6244369328039.png" style="max-width: 100.0%;max-height: 100.0%;"/>
| 1,000
|
[
{
"input": "2 0 0 0 4",
"output": "1"
},
{
"input": "1 1 1 4 4",
"output": "3"
},
{
"input": "4 5 6 5 6",
"output": "0"
},
{
"input": "10 20 0 40 0",
"output": "1"
},
{
"input": "9 20 0 40 0",
"output": "2"
},
{
"input": "5 -1 -6 -5 1",
"output": "1"
},
{
"input": "99125 26876 -21414 14176 17443",
"output": "1"
},
{
"input": "8066 7339 19155 -90534 -60666",
"output": "8"
},
{
"input": "100000 -100000 -100000 100000 100000",
"output": "2"
},
{
"input": "10 20 0 41 0",
"output": "2"
},
{
"input": "25 -64 -6 -56 64",
"output": "2"
},
{
"input": "125 455 450 439 721",
"output": "2"
},
{
"input": "5 6 3 7 2",
"output": "1"
},
{
"input": "24 130 14786 3147 2140",
"output": "271"
},
{
"input": "125 -363 176 93 330",
"output": "2"
},
{
"input": "1 14 30 30 14",
"output": "12"
},
{
"input": "25 96 13 7 2",
"output": "2"
},
{
"input": "4 100000 -100000 100000 -100000",
"output": "0"
},
{
"input": "1 3 4 2 5",
"output": "1"
},
{
"input": "1 -3 3 2 6",
"output": "3"
},
{
"input": "2 7 20 13 -5",
"output": "7"
},
{
"input": "1 1 1 1 4",
"output": "2"
},
{
"input": "249 -54242 -30537 -45023 -89682",
"output": "121"
},
{
"input": "4 100000 -100000 100000 -99999",
"output": "1"
},
{
"input": "97741 23818 78751 97583 26933",
"output": "1"
},
{
"input": "56767 -29030 51625 79823 -56297",
"output": "2"
},
{
"input": "98260 13729 74998 23701 9253",
"output": "1"
},
{
"input": "67377 -80131 -90254 -57320 14102",
"output": "1"
},
{
"input": "1 100000 100000 100000 -100000",
"output": "100000"
},
{
"input": "19312 19470 82059 58064 62231",
"output": "2"
},
{
"input": "67398 -68747 -79056 -34193 29400",
"output": "1"
},
{
"input": "91099 37184 -71137 75650 -3655",
"output": "1"
},
{
"input": "46456 -2621 -23623 -98302 -99305",
"output": "2"
},
{
"input": "100 100000 -100000 100000 -99999",
"output": "1"
},
{
"input": "1 100000 -100000 100000 -100000",
"output": "0"
},
{
"input": "8 0 0 0 32",
"output": "2"
},
{
"input": "100000 100000 1 -100000 0",
"output": "2"
}
] | 1,622,635,025
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 37
| 155
| 102,400
|
from math import *
r,x,y,xd,yd=map(int,input().split())
d=sqrt((x-xd)**2+(y-yd)**2)
print(ceil(d/(2*r)))
|
Title: Amr and Pins
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Amr loves Geometry. One day he came up with a very interesting problem.
Amr has a circle of radius *r* and center in point (*x*,<=*y*). He wants the circle center to be in new position (*x*',<=*y*').
In one step Amr can put a pin to the border of the circle in a certain point, then rotate the circle around that pin by any angle and finally remove the pin.
Help Amr to achieve his goal in minimum number of steps.
Input Specification:
Input consists of 5 space-separated integers *r*, *x*, *y*, *x*' *y*' (1<=β€<=*r*<=β€<=105, <=-<=105<=β€<=*x*,<=*y*,<=*x*',<=*y*'<=β€<=105), circle radius, coordinates of original center of the circle and coordinates of destination center of the circle respectively.
Output Specification:
Output a single integer β minimum number of steps required to move the center of the circle to the destination point.
Demo Input:
['2 0 0 0 4\n', '1 1 1 4 4\n', '4 5 6 5 6\n']
Demo Output:
['1\n', '3\n', '0\n']
Note:
In the first sample test the optimal way is to put a pin at point (0,β2) and rotate the circle by 180 degrees counter-clockwise (or clockwise, no matter).
<img class="tex-graphics" src="https://espresso.codeforces.com/4e40fd4cc24a2050a0488aa131e6244369328039.png" style="max-width: 100.0%;max-height: 100.0%;"/>
|
```python
from math import *
r,x,y,xd,yd=map(int,input().split())
d=sqrt((x-xd)**2+(y-yd)**2)
print(ceil(d/(2*r)))
```
| 3
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
Let's introduce a number system which is based on a roman digits. There are digits I, V, X, L which correspond to the numbers $1$, $5$, $10$ and $50$ respectively. The use of other roman digits is not allowed.
Numbers in this system are written as a sequence of one or more digits. We define the value of the sequence simply as the sum of digits in it.
For example, the number XXXV evaluates to $35$ and the number IXIΒ β to $12$.
Pay attention to the difference to the traditional roman systemΒ β in our system any sequence of digits is valid, moreover the order of digits doesn't matter, for example IX means $11$, not $9$.
One can notice that this system is ambiguous, and some numbers can be written in many different ways. Your goal is to determine how many distinct integers can be represented by exactly $n$ roman digits I, V, X, L.
|
The only line of the input file contains a single integer $n$ ($1 \le n \le 10^9$)Β β the number of roman digits to use.
|
Output a single integerΒ β the number of distinct integers which can be represented using $n$ roman digits exactly.
|
[
"1\n",
"2\n",
"10\n"
] |
[
"4\n",
"10\n",
"244\n"
] |
In the first sample there are exactly $4$ integers which can be representedΒ β I, V, X and L.
In the second sample it is possible to represent integers $2$ (II), $6$ (VI), $10$ (VV), $11$ (XI), $15$ (XV), $20$ (XX), $51$ (IL), $55$ (VL), $60$ (XL) and $100$ (LL).
| 0
|
[
{
"input": "1",
"output": "4"
},
{
"input": "2",
"output": "10"
},
{
"input": "10",
"output": "244"
},
{
"input": "1000",
"output": "48753"
},
{
"input": "2000",
"output": "97753"
},
{
"input": "5000",
"output": "244753"
},
{
"input": "10000",
"output": "489753"
},
{
"input": "111199",
"output": "5448504"
},
{
"input": "101232812",
"output": "4960407541"
},
{
"input": "1000000000",
"output": "48999999753"
},
{
"input": "3",
"output": "20"
},
{
"input": "4",
"output": "35"
},
{
"input": "5",
"output": "56"
},
{
"input": "6",
"output": "83"
},
{
"input": "7",
"output": "116"
},
{
"input": "8",
"output": "155"
},
{
"input": "9",
"output": "198"
},
{
"input": "11",
"output": "292"
},
{
"input": "12",
"output": "341"
},
{
"input": "13",
"output": "390"
},
{
"input": "55",
"output": "2448"
},
{
"input": "100",
"output": "4653"
},
{
"input": "150",
"output": "7103"
},
{
"input": "1200",
"output": "58553"
},
{
"input": "9999999",
"output": "489999704"
},
{
"input": "100000000",
"output": "4899999753"
},
{
"input": "500000000",
"output": "24499999753"
},
{
"input": "600000000",
"output": "29399999753"
},
{
"input": "709000900",
"output": "34741043853"
},
{
"input": "999999999",
"output": "48999999704"
},
{
"input": "12",
"output": "341"
},
{
"input": "10",
"output": "244"
},
{
"input": "20",
"output": "733"
},
{
"input": "35",
"output": "1468"
},
{
"input": "56",
"output": "2497"
},
{
"input": "83",
"output": "3820"
},
{
"input": "116",
"output": "5437"
},
{
"input": "155",
"output": "7348"
},
{
"input": "198",
"output": "9455"
},
{
"input": "244",
"output": "11709"
},
{
"input": "292",
"output": "14061"
},
{
"input": "14",
"output": "439"
}
] | 1,602,544,827
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 42
| 109
| 0
|
non_representable = {
1: 46,
2: 89,
3: 128,
4: 162,
5: 190,
6: 212,
7: 228,
8: 238,
9: 244,
10: 247,
}
n = int(input())
print(49 * n + 1 - non_representable.get(n, 248))
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Let's introduce a number system which is based on a roman digits. There are digits I, V, X, L which correspond to the numbers $1$, $5$, $10$ and $50$ respectively. The use of other roman digits is not allowed.
Numbers in this system are written as a sequence of one or more digits. We define the value of the sequence simply as the sum of digits in it.
For example, the number XXXV evaluates to $35$ and the number IXIΒ β to $12$.
Pay attention to the difference to the traditional roman systemΒ β in our system any sequence of digits is valid, moreover the order of digits doesn't matter, for example IX means $11$, not $9$.
One can notice that this system is ambiguous, and some numbers can be written in many different ways. Your goal is to determine how many distinct integers can be represented by exactly $n$ roman digits I, V, X, L.
Input Specification:
The only line of the input file contains a single integer $n$ ($1 \le n \le 10^9$)Β β the number of roman digits to use.
Output Specification:
Output a single integerΒ β the number of distinct integers which can be represented using $n$ roman digits exactly.
Demo Input:
['1\n', '2\n', '10\n']
Demo Output:
['4\n', '10\n', '244\n']
Note:
In the first sample there are exactly $4$ integers which can be representedΒ β I, V, X and L.
In the second sample it is possible to represent integers $2$ (II), $6$ (VI), $10$ (VV), $11$ (XI), $15$ (XV), $20$ (XX), $51$ (IL), $55$ (VL), $60$ (XL) and $100$ (LL).
|
```python
non_representable = {
1: 46,
2: 89,
3: 128,
4: 162,
5: 190,
6: 212,
7: 228,
8: 238,
9: 244,
10: 247,
}
n = int(input())
print(49 * n + 1 - non_representable.get(n, 248))
```
| 3
|
|
265
|
A
|
Colorful Stones (Simplified Edition)
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
|
The input contains two lines. The first line contains the string *s* (1<=β€<=|*s*|<=β€<=50). The second line contains the string *t* (1<=β€<=|*t*|<=β€<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
|
Print the final 1-based position of Liss in a single line.
|
[
"RGB\nRRR\n",
"RRRBGBRBBB\nBBBRR\n",
"BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n"
] |
[
"2\n",
"3\n",
"15\n"
] |
none
| 500
|
[
{
"input": "RGB\nRRR",
"output": "2"
},
{
"input": "RRRBGBRBBB\nBBBRR",
"output": "3"
},
{
"input": "BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB",
"output": "15"
},
{
"input": "G\nRRBBRBRRBR",
"output": "1"
},
{
"input": "RRRRRBRRBRRGRBGGRRRGRBBRBBBBBRGRBGBRRGBBBRBBGBRGBB\nB",
"output": "1"
},
{
"input": "RRGGBRGRBG\nBRRGGBBGGR",
"output": "7"
},
{
"input": "BBRRGBGGRGBRGBRBRBGR\nGGGRBGGGBRRRRGRBGBGRGRRBGRBGBG",
"output": "15"
},
{
"input": "GBRRBGBGBBBBRRRGBGRRRGBGBBBRGR\nRRGBRRGRBBBBBBGRRBBR",
"output": "8"
},
{
"input": "BRGRRGRGRRGBBGBBBRRBBRRBGBBGRGBBGGRGBRBGGGRRRBGGBB\nRGBBGRRBBBRRGRRBRBBRGBBGGGRGBGRRRRBRBGGBRBGGGRGBRR",
"output": "16"
},
{
"input": "GGRGGBRRGRGBRRGGRBBGGRRGBBBGBBBGGRBGGBRBBRGBRRRBRG\nGGRGRRRRRRRRRGBBBBRGBRGRGRRGBBRGGBRBBRBGBRGRRRRGGR",
"output": "18"
},
{
"input": "RBBRBGBBGGGBRRBGBRGRRGGRBBBBGRBGGBRRBGBBRBRGBBGGGG\nBRRGRBGRBGBRGBRBGGBBBGBBRGRBGRGRBGRBGGRRBGBRGRRBBG",
"output": "23"
},
{
"input": "RRGGRRBRGRGBRGBRGBBRGGGBRBGBRGBRGGBRBRGBGRRBBGGRBR\nBRGRBBBGRBGRRGGRRRRRRRRGGGGGGGGBGGGGGGGRGRBBRGRGBR",
"output": "14"
},
{
"input": "RBRBRRRRRGGR\nBBBBRRGGBGRBRGBBRGGGRGGBRRBRBRBGGG",
"output": "12"
},
{
"input": "GGRGGGBRGRGRBBRGGGRBGRRR\nGBBBBGBGBGBBBRGGRGGBGRRGRRRGBGB",
"output": "12"
},
{
"input": "RGRBGBRBBGBRRGGGBBGBRRBGRGBBBBBGRRRGGRBB\nBGR",
"output": "2"
},
{
"input": "R\nB",
"output": "1"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR",
"output": "50"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
},
{
"input": "R\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
}
] | 1,604,213,151
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 19
| 216
| 0
|
s1=input()
s2=input()
i=j=0
while i<len(s1) and j<len(s2):
if s1[i]==s2[j]:
i+=1
j+=1
else:
j+=1
print(i+1)
|
Title: Colorful Stones (Simplified Edition)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
Input Specification:
The input contains two lines. The first line contains the string *s* (1<=β€<=|*s*|<=β€<=50). The second line contains the string *t* (1<=β€<=|*t*|<=β€<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
Output Specification:
Print the final 1-based position of Liss in a single line.
Demo Input:
['RGB\nRRR\n', 'RRRBGBRBBB\nBBBRR\n', 'BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n']
Demo Output:
['2\n', '3\n', '15\n']
Note:
none
|
```python
s1=input()
s2=input()
i=j=0
while i<len(s1) and j<len(s2):
if s1[i]==s2[j]:
i+=1
j+=1
else:
j+=1
print(i+1)
```
| 3
|
|
66
|
B
|
Petya and Countryside
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation"
] |
B. Petya and Countryside
|
2
|
256
|
Little Petya often travels to his grandmother in the countryside. The grandmother has a large garden, which can be represented as a rectangle 1<=Γ<=*n* in size, when viewed from above. This rectangle is divided into *n* equal square sections. The garden is very unusual as each of the square sections possesses its own fixed height and due to the newest irrigation system we can create artificial rain above each section.
Creating artificial rain is an expensive operation. That's why we limit ourselves to creating the artificial rain only above one section. At that, the water from each watered section will flow into its neighbouring sections if their height does not exceed the height of the section. That is, for example, the garden can be represented by a 1<=Γ<=5 rectangle, where the section heights are equal to 4, 2, 3, 3, 2. Then if we create an artificial rain over any of the sections with the height of 3, the water will flow over all the sections, except the ones with the height of 4. See the illustration of this example at the picture:
As Petya is keen on programming, he decided to find such a section that if we create artificial rain above it, the number of watered sections will be maximal. Help him.
|
The first line contains a positive integer *n* (1<=β€<=*n*<=β€<=1000). The second line contains *n* positive integers which are the height of the sections. All the numbers are no less than 1 and not more than 1000.
|
Print a single number, the maximal number of watered sections if we create artificial rain above exactly one section.
|
[
"1\n2\n",
"5\n1 2 1 2 1\n",
"8\n1 2 1 1 1 3 3 4\n"
] |
[
"1\n",
"3\n",
"6\n"
] |
none
| 1,000
|
[
{
"input": "1\n2",
"output": "1"
},
{
"input": "5\n1 2 1 2 1",
"output": "3"
},
{
"input": "8\n1 2 1 1 1 3 3 4",
"output": "6"
},
{
"input": "10\n1 2 3 4 5 6 7 8 9 10",
"output": "10"
},
{
"input": "10\n10 9 8 7 6 5 4 3 2 1",
"output": "10"
},
{
"input": "2\n100 100",
"output": "2"
},
{
"input": "3\n100 100 100",
"output": "3"
},
{
"input": "11\n1 2 3 4 5 6 5 4 3 2 1",
"output": "11"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 100 88 87 86 85 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 1 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "61"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 1 82 83 84 85 86 87 88 89 90 91 92 93 94 100 5 4 3 2 1",
"output": "81"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 1 86 87 88 89 90 91 92 93 100 6 5 4 3 2 1",
"output": "85"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 1 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 100 7 6 5 4 3 2 1",
"output": "61"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 100 8 7 6 1 4 3 2 1",
"output": "96"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 100 10 9 8 7 6 5 4 3 2 1",
"output": "100"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 1 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 100 11 10 9 8 7 6 5 4 3 2 1",
"output": "55"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 1 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 100 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "59"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 100 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "86"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 1 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 100 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "83"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 100 63 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 1 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "74"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 100 9 8 7 6 5 4 3 2 1",
"output": "100"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 100 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 61 60 59 58 57 56 55 54 53 1 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "52"
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 100 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 1 2 1",
"output": "98"
},
{
"input": "10\n1 4 4 4 4 4 1 2 4 3",
"output": "7"
}
] | 1,609,676,460
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 80
| 342
| 1,536,000
|
def main():
n = int(input())
a = [int(i) for i in input().split()]
cnt = 0
for i in range(n):
temp = 1
k = i
j = i - 1
while j >= 0 and a[j] <= a[k]:
temp += 1
j -= 1
k -= 1
if i == n - 1:
cnt = max(cnt, temp)
break
k = i
j = i + 1
while j <= n - 1 and a[j] <= a[k]:
temp += 1
j += 1
k += 1
cnt = max(cnt, temp)
print(cnt)
if __name__ == '__main__':
main()
# 1 2 1 1 1 3 3 4
# 0
|
Title: Petya and Countryside
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Little Petya often travels to his grandmother in the countryside. The grandmother has a large garden, which can be represented as a rectangle 1<=Γ<=*n* in size, when viewed from above. This rectangle is divided into *n* equal square sections. The garden is very unusual as each of the square sections possesses its own fixed height and due to the newest irrigation system we can create artificial rain above each section.
Creating artificial rain is an expensive operation. That's why we limit ourselves to creating the artificial rain only above one section. At that, the water from each watered section will flow into its neighbouring sections if their height does not exceed the height of the section. That is, for example, the garden can be represented by a 1<=Γ<=5 rectangle, where the section heights are equal to 4, 2, 3, 3, 2. Then if we create an artificial rain over any of the sections with the height of 3, the water will flow over all the sections, except the ones with the height of 4. See the illustration of this example at the picture:
As Petya is keen on programming, he decided to find such a section that if we create artificial rain above it, the number of watered sections will be maximal. Help him.
Input Specification:
The first line contains a positive integer *n* (1<=β€<=*n*<=β€<=1000). The second line contains *n* positive integers which are the height of the sections. All the numbers are no less than 1 and not more than 1000.
Output Specification:
Print a single number, the maximal number of watered sections if we create artificial rain above exactly one section.
Demo Input:
['1\n2\n', '5\n1 2 1 2 1\n', '8\n1 2 1 1 1 3 3 4\n']
Demo Output:
['1\n', '3\n', '6\n']
Note:
none
|
```python
def main():
n = int(input())
a = [int(i) for i in input().split()]
cnt = 0
for i in range(n):
temp = 1
k = i
j = i - 1
while j >= 0 and a[j] <= a[k]:
temp += 1
j -= 1
k -= 1
if i == n - 1:
cnt = max(cnt, temp)
break
k = i
j = i + 1
while j <= n - 1 and a[j] <= a[k]:
temp += 1
j += 1
k += 1
cnt = max(cnt, temp)
print(cnt)
if __name__ == '__main__':
main()
# 1 2 1 1 1 3 3 4
# 0
```
| 3.911639
|
330
|
B
|
Road Construction
|
PROGRAMMING
| 1,300
|
[
"constructive algorithms",
"graphs"
] | null | null |
A country has *n* cities. Initially, there is no road in the country. One day, the king decides to construct some roads connecting pairs of cities. Roads can be traversed either way. He wants those roads to be constructed in such a way that it is possible to go from each city to any other city by traversing at most two roads. You are also given *m* pairs of cities β roads cannot be constructed between these pairs of cities.
Your task is to construct the minimum number of roads that still satisfy the above conditions. The constraints will guarantee that this is always possible.
|
The first line consists of two integers *n* and *m* .
Then *m* lines follow, each consisting of two integers *a**i* and *b**i* (1<=β€<=*a**i*,<=*b**i*<=β€<=*n*, *a**i*<=β <=*b**i*), which means that it is not possible to construct a road connecting cities *a**i* and *b**i*. Consider the cities are numbered from 1 to *n*.
It is guaranteed that every pair of cities will appear at most once in the input.
|
You should print an integer *s*: the minimum number of roads that should be constructed, in the first line. Then *s* lines should follow, each consisting of two integers *a**i* and *b**i* (1<=β€<=*a**i*,<=*b**i*<=β€<=*n*,<=*a**i*<=β <=*b**i*), which means that a road should be constructed between cities *a**i* and *b**i*.
If there are several solutions, you may print any of them.
|
[
"4 1\n1 3\n"
] |
[
"3\n1 2\n4 2\n2 3\n"
] |
This is one possible solution of the example:
These are examples of wrong solutions:
| 1,000
|
[
{
"input": "4 1\n1 3",
"output": "3\n1 2\n4 2\n2 3"
},
{
"input": "1000 0",
"output": "999\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "484 11\n414 97\n414 224\n444 414\n414 483\n414 399\n414 484\n414 189\n414 246\n414 115\n89 414\n14 414",
"output": "483\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "150 3\n112 30\n61 45\n37 135",
"output": "149\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "34 7\n10 28\n10 19\n10 13\n24 10\n10 29\n20 10\n10 26",
"output": "33\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34"
},
{
"input": "1000 48\n816 885\n576 357\n878 659\n610 647\n37 670\n192 184\n393 407\n598 160\n547 995\n177 276\n788 44\n14 184\n604 281\n176 97\n176 293\n10 57\n852 579\n223 669\n313 260\n476 691\n667 22\n851 792\n411 489\n526 66\n233 566\n35 396\n964 815\n672 123\n148 210\n163 339\n379 598\n382 675\n132 955\n221 441\n253 490\n856 532\n135 119\n276 319\n525 835\n996 270\n92 778\n434 369\n351 927\n758 983\n798 267\n272 830\n539 728\n166 26",
"output": "999\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "534 0",
"output": "533\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "226 54\n80 165\n2 53\n191 141\n107 207\n95 196\n61 82\n42 168\n118 94\n205 182\n172 160\n84 224\n113 143\n122 93\n37 209\n176 32\n56 83\n151 81\n70 190\n99 171\n68 204\n212 48\n4 67\n116 7\n206 199\n105 62\n158 51\n178 147\n17 129\n22 47\n72 162\n188 77\n24 111\n184 26\n175 128\n110 89\n139 120\n127 92\n121 39\n217 75\n145 69\n20 161\n30 220\n222 154\n54 46\n21 87\n144 185\n164 115\n73 202\n173 35\n9 132\n74 180\n137 5\n157 117\n31 177",
"output": "225\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "84 3\n39 19\n55 73\n42 43",
"output": "83\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84"
},
{
"input": "207 35\n34 116\n184 5\n90 203\n12 195\n138 101\n40 150\n189 109\n115 91\n93 201\n106 18\n51 187\n139 197\n168 130\n182 64\n31 42\n86 107\n158 111\n159 132\n119 191\n53 127\n81 13\n153 112\n38 2\n87 84\n121 82\n120 22\n21 177\n151 202\n23 58\n68 192\n29 46\n105 70\n8 167\n56 54\n149 15",
"output": "206\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "91 37\n50 90\n26 82\n61 1\n50 17\n51 73\n45 9\n39 53\n78 35\n12 45\n43 47\n83 20\n9 59\n18 48\n68 31\n47 33\n10 25\n15 78\n5 3\n73 65\n77 4\n62 31\n73 3\n53 7\n29 58\n52 14\n56 20\n6 87\n71 16\n17 19\n77 86\n1 50\n74 79\n15 54\n55 80\n13 77\n4 69\n24 69",
"output": "90\n2 1\n2 3\n2 4\n2 5\n2 6\n2 7\n2 8\n2 9\n2 10\n2 11\n2 12\n2 13\n2 14\n2 15\n2 16\n2 17\n2 18\n2 19\n2 20\n2 21\n2 22\n2 23\n2 24\n2 25\n2 26\n2 27\n2 28\n2 29\n2 30\n2 31\n2 32\n2 33\n2 34\n2 35\n2 36\n2 37\n2 38\n2 39\n2 40\n2 41\n2 42\n2 43\n2 44\n2 45\n2 46\n2 47\n2 48\n2 49\n2 50\n2 51\n2 52\n2 53\n2 54\n2 55\n2 56\n2 57\n2 58\n2 59\n2 60\n2 61\n2 62\n2 63\n2 64\n2 65\n2 66\n2 67\n2 68\n2 69\n2 70\n2 71\n2 72\n2 73\n2 74\n2 75\n2 76\n2 77\n2 78\n2 79\n2 80\n2 81\n2 82\n2 83\n2 84\n2 85\n2 86\n2 87\n..."
},
{
"input": "226 54\n197 107\n181 146\n218 115\n36 169\n199 196\n116 93\n152 75\n213 164\n156 95\n165 58\n90 42\n141 58\n203 221\n179 204\n186 69\n27 127\n76 189\n40 195\n111 29\n85 189\n45 88\n84 135\n82 186\n185 17\n156 217\n8 123\n179 112\n92 137\n114 89\n10 152\n132 24\n135 36\n61 218\n10 120\n155 102\n222 79\n150 92\n184 34\n102 180\n154 196\n171 9\n217 105\n84 207\n56 189\n152 179\n43 165\n115 209\n208 167\n52 14\n92 47\n197 95\n13 78\n222 138\n75 36",
"output": "225\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "207 35\n154 79\n174 101\n189 86\n137 56\n66 23\n199 69\n18 28\n32 53\n13 179\n182 170\n199 12\n24 158\n105 133\n25 10\n40 162\n64 72\n108 9\n172 125\n43 190\n15 39\n128 150\n102 129\n90 97\n64 196\n70 123\n163 41\n12 126\n127 186\n107 23\n182 51\n29 46\n46 123\n89 35\n59 80\n206 171",
"output": "206\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "84 0",
"output": "83\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84"
},
{
"input": "226 54\n5 29\n130 29\n55 29\n19 29\n29 92\n29 38\n185 29\n29 150\n29 202\n29 25\n29 66\n184 29\n29 189\n177 29\n50 29\n87 29\n138 29\n29 48\n151 29\n125 29\n16 29\n42 29\n29 157\n90 29\n21 29\n29 45\n29 80\n29 67\n29 26\n29 173\n74 29\n29 193\n29 40\n172 29\n29 85\n29 102\n88 29\n29 182\n116 29\n180 29\n161 29\n10 29\n171 29\n144 29\n29 218\n190 29\n213 29\n29 71\n29 191\n29 160\n29 137\n29 58\n29 135\n127 29",
"output": "225\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "207 35\n25 61\n188 61\n170 61\n113 61\n35 61\n61 177\n77 61\n61 39\n61 141\n116 61\n61 163\n30 61\n192 61\n19 61\n61 162\n61 133\n185 61\n8 61\n118 61\n61 115\n7 61\n61 105\n107 61\n61 11\n161 61\n61 149\n136 61\n82 61\n20 61\n151 61\n156 61\n12 61\n87 61\n61 205\n61 108",
"output": "206\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "34 7\n11 32\n33 29\n17 16\n15 5\n13 25\n8 19\n20 4",
"output": "33\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34"
},
{
"input": "43 21\n38 19\n43 8\n40 31\n3 14\n24 21\n12 17\n1 9\n5 27\n25 37\n11 6\n13 26\n16 22\n10 32\n36 7\n30 29\n42 35\n20 33\n4 23\n18 15\n41 34\n2 28",
"output": "42\n39 1\n39 2\n39 3\n39 4\n39 5\n39 6\n39 7\n39 8\n39 9\n39 10\n39 11\n39 12\n39 13\n39 14\n39 15\n39 16\n39 17\n39 18\n39 19\n39 20\n39 21\n39 22\n39 23\n39 24\n39 25\n39 26\n39 27\n39 28\n39 29\n39 30\n39 31\n39 32\n39 33\n39 34\n39 35\n39 36\n39 37\n39 38\n39 40\n39 41\n39 42\n39 43"
},
{
"input": "34 7\n22 4\n5 25\n15 7\n5 9\n27 7\n34 21\n3 13",
"output": "33\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34"
},
{
"input": "50 7\n19 37\n30 32\n43 20\n48 14\n30 29\n18 36\n9 46",
"output": "49\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50"
},
{
"input": "41 12\n41 12\n29 13\n3 37\n2 20\n4 24\n27 6\n39 20\n28 41\n30 1\n35 9\n5 39\n12 31",
"output": "40\n7 1\n7 2\n7 3\n7 4\n7 5\n7 6\n7 8\n7 9\n7 10\n7 11\n7 12\n7 13\n7 14\n7 15\n7 16\n7 17\n7 18\n7 19\n7 20\n7 21\n7 22\n7 23\n7 24\n7 25\n7 26\n7 27\n7 28\n7 29\n7 30\n7 31\n7 32\n7 33\n7 34\n7 35\n7 36\n7 37\n7 38\n7 39\n7 40\n7 41"
},
{
"input": "26 2\n22 1\n14 10",
"output": "25\n2 1\n2 3\n2 4\n2 5\n2 6\n2 7\n2 8\n2 9\n2 10\n2 11\n2 12\n2 13\n2 14\n2 15\n2 16\n2 17\n2 18\n2 19\n2 20\n2 21\n2 22\n2 23\n2 24\n2 25\n2 26"
},
{
"input": "7 3\n4 7\n4 6\n6 5",
"output": "6\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7"
},
{
"input": "484 11\n459 166\n12 217\n14 231\n477 111\n365 225\n62 412\n221 223\n258 184\n266 404\n425 236\n83 269",
"output": "483\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50\n1 51\n1 52\n1 53\n1 54\n1 55\n1 56\n1 57\n1 58\n1 59\n1 60\n1 61\n1 62\n1 63\n1 64\n1 65\n1 66\n1 67\n1 68\n1 69\n1 70\n1 71\n1 72\n1 73\n1 74\n1 75\n1 76\n1 77\n1 78\n1 79\n1 80\n1 81\n1 82\n1 83\n1 84\n1 85\n1 86\n1 87..."
},
{
"input": "50 24\n18 36\n11 18\n22 18\n18 47\n18 10\n45 18\n18 29\n13 18\n8 18\n18 30\n26 18\n18 6\n5 18\n18 7\n46 18\n50 18\n18 3\n18 32\n4 18\n18 24\n18 19\n23 18\n35 18\n31 18",
"output": "49\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7\n1 8\n1 9\n1 10\n1 11\n1 12\n1 13\n1 14\n1 15\n1 16\n1 17\n1 18\n1 19\n1 20\n1 21\n1 22\n1 23\n1 24\n1 25\n1 26\n1 27\n1 28\n1 29\n1 30\n1 31\n1 32\n1 33\n1 34\n1 35\n1 36\n1 37\n1 38\n1 39\n1 40\n1 41\n1 42\n1 43\n1 44\n1 45\n1 46\n1 47\n1 48\n1 49\n1 50"
},
{
"input": "7 3\n3 4\n7 3\n3 2",
"output": "6\n1 2\n1 3\n1 4\n1 5\n1 6\n1 7"
},
{
"input": "1 0",
"output": "0"
},
{
"input": "2 0",
"output": "1\n1 2"
},
{
"input": "4 1\n1 2",
"output": "3\n3 1\n3 2\n3 4"
},
{
"input": "3 1\n1 2",
"output": "2\n3 1\n3 2"
},
{
"input": "5 1\n1 5",
"output": "4\n2 1\n2 3\n2 4\n2 5"
}
] | 1,620,829,160
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 43
| 124
| 6,963,200
|
termo1, termo2 = (int(_) for _ in input().split())
lista = [True]*termo1
for i in range(termo2):
x, y = (int(_) for _ in input().split())
lista[x - 1] = lista[y - 1] = False
aux = -1
for i in range(termo1):
if lista[i]:
aux = i
break
print(termo1 - 1)
for i in range(termo1):
if aux != i:
print(i+1, aux+1)
|
Title: Road Construction
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A country has *n* cities. Initially, there is no road in the country. One day, the king decides to construct some roads connecting pairs of cities. Roads can be traversed either way. He wants those roads to be constructed in such a way that it is possible to go from each city to any other city by traversing at most two roads. You are also given *m* pairs of cities β roads cannot be constructed between these pairs of cities.
Your task is to construct the minimum number of roads that still satisfy the above conditions. The constraints will guarantee that this is always possible.
Input Specification:
The first line consists of two integers *n* and *m* .
Then *m* lines follow, each consisting of two integers *a**i* and *b**i* (1<=β€<=*a**i*,<=*b**i*<=β€<=*n*, *a**i*<=β <=*b**i*), which means that it is not possible to construct a road connecting cities *a**i* and *b**i*. Consider the cities are numbered from 1 to *n*.
It is guaranteed that every pair of cities will appear at most once in the input.
Output Specification:
You should print an integer *s*: the minimum number of roads that should be constructed, in the first line. Then *s* lines should follow, each consisting of two integers *a**i* and *b**i* (1<=β€<=*a**i*,<=*b**i*<=β€<=*n*,<=*a**i*<=β <=*b**i*), which means that a road should be constructed between cities *a**i* and *b**i*.
If there are several solutions, you may print any of them.
Demo Input:
['4 1\n1 3\n']
Demo Output:
['3\n1 2\n4 2\n2 3\n']
Note:
This is one possible solution of the example:
These are examples of wrong solutions:
|
```python
termo1, termo2 = (int(_) for _ in input().split())
lista = [True]*termo1
for i in range(termo2):
x, y = (int(_) for _ in input().split())
lista[x - 1] = lista[y - 1] = False
aux = -1
for i in range(termo1):
if lista[i]:
aux = i
break
print(termo1 - 1)
for i in range(termo1):
if aux != i:
print(i+1, aux+1)
```
| 3
|
|
996
|
A
|
Hit the Lottery
|
PROGRAMMING
| 800
|
[
"dp",
"greedy"
] | null | null |
Allen has a LOT of money. He has $n$ dollars in the bank. For security reasons, he wants to withdraw it in cash (we will not disclose the reasons here). The denominations for dollar bills are $1$, $5$, $10$, $20$, $100$. What is the minimum number of bills Allen could receive after withdrawing his entire balance?
|
The first and only line of input contains a single integer $n$ ($1 \le n \le 10^9$).
|
Output the minimum number of bills that Allen could receive.
|
[
"125\n",
"43\n",
"1000000000\n"
] |
[
"3\n",
"5\n",
"10000000\n"
] |
In the first sample case, Allen can withdraw this with a $100$ dollar bill, a $20$ dollar bill, and a $5$ dollar bill. There is no way for Allen to receive $125$ dollars in one or two bills.
In the second sample case, Allen can withdraw two $20$ dollar bills and three $1$ dollar bills.
In the third sample case, Allen can withdraw $100000000$ (ten million!) $100$ dollar bills.
| 500
|
[
{
"input": "125",
"output": "3"
},
{
"input": "43",
"output": "5"
},
{
"input": "1000000000",
"output": "10000000"
},
{
"input": "4",
"output": "4"
},
{
"input": "5",
"output": "1"
},
{
"input": "1",
"output": "1"
},
{
"input": "74",
"output": "8"
},
{
"input": "31",
"output": "3"
},
{
"input": "59",
"output": "8"
},
{
"input": "79",
"output": "9"
},
{
"input": "7",
"output": "3"
},
{
"input": "55",
"output": "4"
},
{
"input": "40",
"output": "2"
},
{
"input": "719",
"output": "13"
},
{
"input": "847",
"output": "13"
},
{
"input": "225",
"output": "4"
},
{
"input": "4704",
"output": "51"
},
{
"input": "1132",
"output": "15"
},
{
"input": "7811",
"output": "80"
},
{
"input": "7981",
"output": "84"
},
{
"input": "82655",
"output": "830"
},
{
"input": "6364",
"output": "70"
},
{
"input": "74611",
"output": "748"
},
{
"input": "45391",
"output": "459"
},
{
"input": "620448",
"output": "6210"
},
{
"input": "265145",
"output": "2654"
},
{
"input": "671704",
"output": "6721"
},
{
"input": "365173",
"output": "3658"
},
{
"input": "7130872",
"output": "71314"
},
{
"input": "9628747",
"output": "96292"
},
{
"input": "8898399",
"output": "88993"
},
{
"input": "9497953",
"output": "94985"
},
{
"input": "19070947",
"output": "190714"
},
{
"input": "20185520",
"output": "201856"
},
{
"input": "91402248",
"output": "914028"
},
{
"input": "27035533",
"output": "270360"
},
{
"input": "22717528",
"output": "227180"
},
{
"input": "24403439",
"output": "244041"
},
{
"input": "163565555",
"output": "1635659"
},
{
"input": "152541908",
"output": "1525423"
},
{
"input": "668439837",
"output": "6684403"
},
{
"input": "20",
"output": "1"
},
{
"input": "999999999",
"output": "10000009"
},
{
"input": "10",
"output": "1"
},
{
"input": "7",
"output": "3"
},
{
"input": "6",
"output": "2"
},
{
"input": "99999999",
"output": "1000009"
},
{
"input": "1000001",
"output": "10001"
},
{
"input": "2521",
"output": "27"
}
] | 1,690,758,241
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 49
| 46
| 0
|
n = int(input())
ans = 0
money = [1, 5, 10, 20, 100]
for x in money[::-1]:
ans += n // x
n = n % x
# print(ans, n)
print(ans)
|
Title: Hit the Lottery
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Allen has a LOT of money. He has $n$ dollars in the bank. For security reasons, he wants to withdraw it in cash (we will not disclose the reasons here). The denominations for dollar bills are $1$, $5$, $10$, $20$, $100$. What is the minimum number of bills Allen could receive after withdrawing his entire balance?
Input Specification:
The first and only line of input contains a single integer $n$ ($1 \le n \le 10^9$).
Output Specification:
Output the minimum number of bills that Allen could receive.
Demo Input:
['125\n', '43\n', '1000000000\n']
Demo Output:
['3\n', '5\n', '10000000\n']
Note:
In the first sample case, Allen can withdraw this with a $100$ dollar bill, a $20$ dollar bill, and a $5$ dollar bill. There is no way for Allen to receive $125$ dollars in one or two bills.
In the second sample case, Allen can withdraw two $20$ dollar bills and three $1$ dollar bills.
In the third sample case, Allen can withdraw $100000000$ (ten million!) $100$ dollar bills.
|
```python
n = int(input())
ans = 0
money = [1, 5, 10, 20, 100]
for x in money[::-1]:
ans += n // x
n = n % x
# print(ans, n)
print(ans)
```
| 3
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
Julia is going to cook a chicken in the kitchen of her dormitory. To save energy, the stove in the kitchen automatically turns off after *k* minutes after turning on.
During cooking, Julia goes to the kitchen every *d* minutes and turns on the stove if it is turned off. While the cooker is turned off, it stays warm. The stove switches on and off instantly.
It is known that the chicken needs *t* minutes to be cooked on the stove, if it is turned on, and 2*t* minutes, if it is turned off. You need to find out, how much time will Julia have to cook the chicken, if it is considered that the chicken is cooked evenly, with constant speed when the stove is turned on and at a constant speed when it is turned off.
|
The single line contains three integers *k*, *d* and *t* (1<=β€<=*k*,<=*d*,<=*t*<=β€<=1018).
|
Print a single number, the total time of cooking in minutes. The relative or absolute error must not exceed 10<=-<=9.
Namely, let's assume that your answer is *x* and the answer of the jury is *y*. The checker program will consider your answer correct if .
|
[
"3 2 6\n",
"4 2 20\n"
] |
[
"6.5\n",
"20.0\n"
] |
In the first example, the chicken will be cooked for 3 minutes on the turned on stove, after this it will be cooked for <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/cce5d3f2f46552034d5ae5d487725705429ec7a5.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Then the chicken will be cooked for one minute on a turned off stove, it will be cooked for <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a10fa55d1324328f9ba60c9343ed0ecb0506d678.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Thus, after four minutes the chicken will be cooked for <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/6fcc8bd6c2188b260d9d18e7b6c9e3908848df71.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Before the fifth minute Julia will turn on the stove and after 2.5 minutes the chicken will be ready <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/87a86c8e9632089279245fff912c077126c4e704.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the second example, when the stove is turned off, Julia will immediately turn it on, so the stove will always be turned on and the chicken will be cooked in 20 minutes.
| 0
|
[
{
"input": "3 2 6",
"output": "6.5"
},
{
"input": "4 2 20",
"output": "20.0"
},
{
"input": "8 10 9",
"output": "10.0"
},
{
"input": "43 50 140",
"output": "150.5"
},
{
"input": "251 79 76",
"output": "76.0"
},
{
"input": "892 67 1000",
"output": "1023.0"
},
{
"input": "1000 1000 1000",
"output": "1000.0"
},
{
"input": "87 4 1000",
"output": "1005.5"
},
{
"input": "1 629 384378949109878497",
"output": "767537647587662141"
},
{
"input": "2124 6621 12695",
"output": "19018"
},
{
"input": "27548 68747 111",
"output": "111.0"
},
{
"input": "74974 46016 1000000000",
"output": "1102134775.0"
},
{
"input": "223 844 704",
"output": "1014.5"
},
{
"input": "1 558 743",
"output": "1483"
},
{
"input": "43 387 402",
"output": "718"
},
{
"input": "972 2 763",
"output": "763.0"
},
{
"input": "330 167 15",
"output": "15.0"
},
{
"input": "387 43 650",
"output": "650.0"
},
{
"input": "1 314 824",
"output": "1642"
},
{
"input": "2 4 18",
"output": "24.0"
},
{
"input": "3 5 127",
"output": "158.0"
},
{
"input": "3260 4439 6837",
"output": "7426.5"
},
{
"input": "3950 7386 195",
"output": "195.0"
},
{
"input": "18036 47899 1000000000",
"output": "1452914012"
},
{
"input": "29 46 1000000000",
"output": "1226666661.0"
},
{
"input": "403 957 1000000000000000000",
"output": "1407352941176470446"
},
{
"input": "999999999999999999 1000000000000000000 1000000000000000000",
"output": "1000000000000000000.5"
},
{
"input": "9 1000000000000000000 1000000000000000000",
"output": "1999999999999999982"
},
{
"input": "1 2 1000000000000000000",
"output": "1333333333333333333.0"
},
{
"input": "2 5 1000000000000000000",
"output": "1428571428571428571.0"
},
{
"input": "81413279254461199 310548139128293806 1000000000000000000",
"output": "1572837149684581517.5"
},
{
"input": "6 3 417701740543616353",
"output": "417701740543616353.0"
},
{
"input": "17 68 4913",
"output": "7854"
},
{
"input": "68 17 4913",
"output": "4913.0"
},
{
"input": "121 395 621154158314692955",
"output": "950991831528308936"
},
{
"input": "897 443 134730567336441375",
"output": "160877739434079591.0"
},
{
"input": "200 10 979220166595737684",
"output": "979220166595737684.0"
},
{
"input": "740 251 930540301905511549",
"output": "938642796161889076.5"
},
{
"input": "4 232 801899894850800409",
"output": "1576616742418522838"
},
{
"input": "472 499 166288453006087540",
"output": "170912333779686266.5"
},
{
"input": "42 9 1000000000000000000",
"output": "1034482758620689654.0"
},
{
"input": "312 93 1000000000000000000",
"output": "1087719298245614020.0"
},
{
"input": "1000 1000 1000000000000000000",
"output": "1000000000000000000.0"
},
{
"input": "6000 1000 1000000000",
"output": "1000000000.0"
},
{
"input": "9999999999 33333 1000000000",
"output": "1000000000.0"
},
{
"input": "33333 9999999999 1000000000",
"output": "1999966667"
},
{
"input": "25441360464 2658201820 1000000000",
"output": "1000000000.0"
},
{
"input": "20958318104 46685 253251869",
"output": "253251869.0"
},
{
"input": "963276084 698548036 1000000000",
"output": "1036723916"
},
{
"input": "574520976350867177 413897686591532160 1000000000000000000",
"output": "1126637198416098571.5"
},
{
"input": "575556838390916379 15 1000000000000000000",
"output": "1000000000000000003.0"
},
{
"input": "1000000000000000000 1000000000000000000 1000000000000000000",
"output": "1000000000000000000.0"
},
{
"input": "1 1000000000000000000 1000000000000000000",
"output": "1999999999999999998"
},
{
"input": "8 1000000000000000000 1000000000000000000",
"output": "1999999999999999984"
},
{
"input": "1 976958144546785462 1000000000000000000",
"output": "1999999999999999997"
},
{
"input": "3 10 1000000000000000000",
"output": "1538461538461538461.0"
},
{
"input": "312200625484460654 543737694709247394 1000000000000000000",
"output": "1231537069224786740.0"
},
{
"input": "2 99 53",
"output": "102"
},
{
"input": "900000000000000000 1 1234",
"output": "1234.0"
}
] | 1,527,260,786
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 59
| 78
| 0
|
k,d,t=input().split()
k,d,t=int(k),int(d),int(t)
on=k
off=d-(k-1)%d-1
cycle=on+off/2
time=(on+off)*(t//cycle)
t-=cycle*(t//cycle)
if t<k:
print(t+time)
else:
print(time+k+(t-k)*2)
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Julia is going to cook a chicken in the kitchen of her dormitory. To save energy, the stove in the kitchen automatically turns off after *k* minutes after turning on.
During cooking, Julia goes to the kitchen every *d* minutes and turns on the stove if it is turned off. While the cooker is turned off, it stays warm. The stove switches on and off instantly.
It is known that the chicken needs *t* minutes to be cooked on the stove, if it is turned on, and 2*t* minutes, if it is turned off. You need to find out, how much time will Julia have to cook the chicken, if it is considered that the chicken is cooked evenly, with constant speed when the stove is turned on and at a constant speed when it is turned off.
Input Specification:
The single line contains three integers *k*, *d* and *t* (1<=β€<=*k*,<=*d*,<=*t*<=β€<=1018).
Output Specification:
Print a single number, the total time of cooking in minutes. The relative or absolute error must not exceed 10<=-<=9.
Namely, let's assume that your answer is *x* and the answer of the jury is *y*. The checker program will consider your answer correct if .
Demo Input:
['3 2 6\n', '4 2 20\n']
Demo Output:
['6.5\n', '20.0\n']
Note:
In the first example, the chicken will be cooked for 3 minutes on the turned on stove, after this it will be cooked for <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/cce5d3f2f46552034d5ae5d487725705429ec7a5.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Then the chicken will be cooked for one minute on a turned off stove, it will be cooked for <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a10fa55d1324328f9ba60c9343ed0ecb0506d678.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Thus, after four minutes the chicken will be cooked for <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/6fcc8bd6c2188b260d9d18e7b6c9e3908848df71.png" style="max-width: 100.0%;max-height: 100.0%;"/>. Before the fifth minute Julia will turn on the stove and after 2.5 minutes the chicken will be ready <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/87a86c8e9632089279245fff912c077126c4e704.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In the second example, when the stove is turned off, Julia will immediately turn it on, so the stove will always be turned on and the chicken will be cooked in 20 minutes.
|
```python
k,d,t=input().split()
k,d,t=int(k),int(d),int(t)
on=k
off=d-(k-1)%d-1
cycle=on+off/2
time=(on+off)*(t//cycle)
t-=cycle*(t//cycle)
if t<k:
print(t+time)
else:
print(time+k+(t-k)*2)
```
| 3
|
|
75
|
A
|
Life Without Zeros
|
PROGRAMMING
| 1,000
|
[
"implementation"
] |
A. Life Without Zeros
|
2
|
256
|
Can you imagine our life if we removed all zeros from it? For sure we will have many problems.
In this problem we will have a simple example if we removed all zeros from our life, it's the addition operation. Let's assume you are given this equation *a*<=+<=*b*<==<=*c*, where *a* and *b* are positive integers, and *c* is the sum of *a* and *b*. Now let's remove all zeros from this equation. Will the equation remain correct after removing all zeros?
For example if the equation is 101<=+<=102<==<=203, if we removed all zeros it will be 11<=+<=12<==<=23 which is still a correct equation.
But if the equation is 105<=+<=106<==<=211, if we removed all zeros it will be 15<=+<=16<==<=211 which is not a correct equation.
|
The input will consist of two lines, the first line will contain the integer *a*, and the second line will contain the integer *b* which are in the equation as described above (1<=β€<=*a*,<=*b*<=β€<=109). There won't be any leading zeros in both. The value of *c* should be calculated as *c*<==<=*a*<=+<=*b*.
|
The output will be just one line, you should print "YES" if the equation will remain correct after removing all zeros, and print "NO" otherwise.
|
[
"101\n102\n",
"105\n106\n"
] |
[
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "101\n102",
"output": "YES"
},
{
"input": "105\n106",
"output": "NO"
},
{
"input": "544\n397",
"output": "YES"
},
{
"input": "822\n280",
"output": "NO"
},
{
"input": "101\n413",
"output": "NO"
},
{
"input": "309\n139",
"output": "NO"
},
{
"input": "693\n970",
"output": "NO"
},
{
"input": "981\n1",
"output": "YES"
},
{
"input": "352\n276",
"output": "YES"
},
{
"input": "164\n691",
"output": "YES"
},
{
"input": "110036\n43",
"output": "YES"
},
{
"input": "100\n1000",
"output": "NO"
},
{
"input": "1000000000\n1000000000",
"output": "YES"
},
{
"input": "999999999\n999999999",
"output": "YES"
},
{
"input": "6\n4",
"output": "NO"
},
{
"input": "123456\n876543",
"output": "YES"
},
{
"input": "1234567\n9876543",
"output": "NO"
},
{
"input": "1111111\n1119111",
"output": "NO"
},
{
"input": "10502405\n40403403",
"output": "YES"
},
{
"input": "1\n1",
"output": "YES"
},
{
"input": "5\n4",
"output": "YES"
},
{
"input": "1\n6",
"output": "YES"
},
{
"input": "40\n17",
"output": "NO"
},
{
"input": "35\n81",
"output": "YES"
},
{
"input": "347\n908",
"output": "NO"
},
{
"input": "2081\n7450",
"output": "NO"
},
{
"input": "84355694\n373629503",
"output": "NO"
},
{
"input": "885992048\n510468672",
"output": "NO"
},
{
"input": "540144752\n647307841",
"output": "NO"
},
{
"input": "341781108\n784147010",
"output": "NO"
},
{
"input": "960440938\n572334653",
"output": "NO"
},
{
"input": "657414510\n768771903",
"output": "NO"
},
{
"input": "501871728\n725074574",
"output": "NO"
},
{
"input": "968\n851",
"output": "YES"
},
{
"input": "943\n939",
"output": "YES"
},
{
"input": "347\n908",
"output": "NO"
},
{
"input": "611\n41",
"output": "YES"
},
{
"input": "737\n289",
"output": "NO"
},
{
"input": "168\n571",
"output": "YES"
},
{
"input": "868\n463",
"output": "YES"
},
{
"input": "815732007\n913882008",
"output": "NO"
},
{
"input": "459039901\n453033850",
"output": "NO"
},
{
"input": "975305404\n484601256",
"output": "NO"
}
] | 1,534,888,032
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 43
| 218
| 0
|
n = input()
m = input()
s1 = int(n) + int(m)
s = str(s1)
s = s.replace('0','')
n = n.replace('0','')
m = m.replace('0','')
k = int(n) + int(m)
if(int(k)==int(s)):
print("YES")
else:
print("NO")
# 1534888106664
|
Title: Life Without Zeros
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Can you imagine our life if we removed all zeros from it? For sure we will have many problems.
In this problem we will have a simple example if we removed all zeros from our life, it's the addition operation. Let's assume you are given this equation *a*<=+<=*b*<==<=*c*, where *a* and *b* are positive integers, and *c* is the sum of *a* and *b*. Now let's remove all zeros from this equation. Will the equation remain correct after removing all zeros?
For example if the equation is 101<=+<=102<==<=203, if we removed all zeros it will be 11<=+<=12<==<=23 which is still a correct equation.
But if the equation is 105<=+<=106<==<=211, if we removed all zeros it will be 15<=+<=16<==<=211 which is not a correct equation.
Input Specification:
The input will consist of two lines, the first line will contain the integer *a*, and the second line will contain the integer *b* which are in the equation as described above (1<=β€<=*a*,<=*b*<=β€<=109). There won't be any leading zeros in both. The value of *c* should be calculated as *c*<==<=*a*<=+<=*b*.
Output Specification:
The output will be just one line, you should print "YES" if the equation will remain correct after removing all zeros, and print "NO" otherwise.
Demo Input:
['101\n102\n', '105\n106\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none
|
```python
n = input()
m = input()
s1 = int(n) + int(m)
s = str(s1)
s = s.replace('0','')
n = n.replace('0','')
m = m.replace('0','')
k = int(n) + int(m)
if(int(k)==int(s)):
print("YES")
else:
print("NO")
# 1534888106664
```
| 3.9455
|
992
|
A
|
Nastya and an Array
|
PROGRAMMING
| 800
|
[
"implementation",
"sortings"
] | null | null |
Nastya owns too many arrays now, so she wants to delete the least important of them. However, she discovered that this array is magic! Nastya now knows that the array has the following properties:
- In one second we can add an arbitrary (possibly negative) integer to all elements of the array that are not equal to zero. - When all elements of the array become equal to zero, the array explodes.
Nastya is always busy, so she wants to explode the array as fast as possible. Compute the minimum time in which the array can be exploded.
|
The first line contains a single integer *n* (1<=β€<=*n*<=β€<=105) β the size of the array.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=105<=β€<=*a**i*<=β€<=105) β the elements of the array.
|
Print a single integer β the minimum number of seconds needed to make all elements of the array equal to zero.
|
[
"5\n1 1 1 1 1\n",
"3\n2 0 -1\n",
"4\n5 -6 -5 1\n"
] |
[
"1\n",
"2\n",
"4\n"
] |
In the first example you can add β-β1 to all non-zero elements in one second and make them equal to zero.
In the second example you can add β-β2 on the first second, then the array becomes equal to [0,β0,ββ-β3]. On the second second you can add 3 to the third (the only non-zero) element.
| 500
|
[
{
"input": "5\n1 1 1 1 1",
"output": "1"
},
{
"input": "3\n2 0 -1",
"output": "2"
},
{
"input": "4\n5 -6 -5 1",
"output": "4"
},
{
"input": "1\n0",
"output": "0"
},
{
"input": "2\n21794 -79194",
"output": "2"
},
{
"input": "3\n-63526 95085 -5239",
"output": "3"
},
{
"input": "3\n0 53372 -20572",
"output": "2"
},
{
"input": "13\n-2075 -32242 27034 -37618 -96962 82203 64846 48249 -71761 28908 -21222 -61370 46899",
"output": "13"
},
{
"input": "5\n806 0 1308 1954 683",
"output": "4"
},
{
"input": "8\n-26 0 -249 -289 -126 -206 288 -11",
"output": "7"
},
{
"input": "10\n2 2 2 1 2 -1 0 2 -1 1",
"output": "3"
},
{
"input": "1\n8",
"output": "1"
},
{
"input": "3\n0 0 0",
"output": "0"
},
{
"input": "10\n1 2 3 4 5 6 7 8 9 10",
"output": "10"
},
{
"input": "5\n2 0 -1 0 0",
"output": "2"
},
{
"input": "2\n0 0",
"output": "0"
},
{
"input": "5\n0 0 0 0 0",
"output": "0"
},
{
"input": "2\n1 0",
"output": "1"
},
{
"input": "2\n-1 0",
"output": "1"
},
{
"input": "4\n0 0 0 0",
"output": "0"
},
{
"input": "8\n10 9 -1 0 0 3 2 3",
"output": "5"
},
{
"input": "5\n5 0 1 2 3",
"output": "4"
},
{
"input": "3\n1 1 0",
"output": "1"
},
{
"input": "1\n-1",
"output": "1"
},
{
"input": "5\n1 2 0 0 0",
"output": "2"
},
{
"input": "5\n1 0 0 0 0",
"output": "1"
},
{
"input": "5\n4 5 6 0 0",
"output": "3"
},
{
"input": "4\n-1 0 0 1",
"output": "2"
},
{
"input": "5\n3 0 0 4 5",
"output": "3"
},
{
"input": "3\n0 0 2",
"output": "1"
},
{
"input": "3\n1 0 0",
"output": "1"
},
{
"input": "4\n0 0 0 4",
"output": "1"
},
{
"input": "5\n-1 0 0 0 0",
"output": "1"
},
{
"input": "2\n0 1",
"output": "1"
},
{
"input": "3\n1 2 3",
"output": "3"
},
{
"input": "1\n5",
"output": "1"
},
{
"input": "10\n0 0 0 0 0 1 2 3 0 0",
"output": "3"
},
{
"input": "4\n0 1 2 3",
"output": "3"
},
{
"input": "3\n0 1 2",
"output": "2"
},
{
"input": "4\n2 0 0 -1",
"output": "2"
}
] | 1,534,962,160
| 520
|
Python 3
|
OK
|
TESTS
| 79
| 186
| 8,908,800
|
from collections import Counter
n = int(input())
arr = [int(x) for x in input().split()]
count = Counter(arr)
if 0 in arr:
print(len(count) - 1)
else:
print(len(count))
|
Title: Nastya and an Array
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Nastya owns too many arrays now, so she wants to delete the least important of them. However, she discovered that this array is magic! Nastya now knows that the array has the following properties:
- In one second we can add an arbitrary (possibly negative) integer to all elements of the array that are not equal to zero. - When all elements of the array become equal to zero, the array explodes.
Nastya is always busy, so she wants to explode the array as fast as possible. Compute the minimum time in which the array can be exploded.
Input Specification:
The first line contains a single integer *n* (1<=β€<=*n*<=β€<=105) β the size of the array.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=105<=β€<=*a**i*<=β€<=105) β the elements of the array.
Output Specification:
Print a single integer β the minimum number of seconds needed to make all elements of the array equal to zero.
Demo Input:
['5\n1 1 1 1 1\n', '3\n2 0 -1\n', '4\n5 -6 -5 1\n']
Demo Output:
['1\n', '2\n', '4\n']
Note:
In the first example you can add β-β1 to all non-zero elements in one second and make them equal to zero.
In the second example you can add β-β2 on the first second, then the array becomes equal to [0,β0,ββ-β3]. On the second second you can add 3 to the third (the only non-zero) element.
|
```python
from collections import Counter
n = int(input())
arr = [int(x) for x in input().split()]
count = Counter(arr)
if 0 in arr:
print(len(count) - 1)
else:
print(len(count))
```
| 3
|
|
63
|
A
|
Sinking Ship
|
PROGRAMMING
| 900
|
[
"implementation",
"sortings",
"strings"
] |
A. Sinking Ship
|
2
|
256
|
The ship crashed into a reef and is sinking. Now the entire crew must be evacuated. All *n* crew members have already lined up in a row (for convenience let's label them all from left to right with positive integers from 1 to *n*) and await further instructions. However, one should evacuate the crew properly, in a strict order. Specifically:
The first crew members to leave the ship are rats. Then women and children (both groups have the same priority) leave the ship. After that all men are evacuated from the ship. The captain leaves the sinking ship last.
If we cannot determine exactly who should leave the ship first for any two members of the crew by the rules from the previous paragraph, then the one who stands to the left in the line leaves the ship first (or in other words, the one whose number in the line is less).
For each crew member we know his status as a crew member, and also his name. All crew members have different names. Determine the order in which to evacuate the crew.
|
The first line contains an integer *n*, which is the number of people in the crew (1<=β€<=*n*<=β€<=100). Then follow *n* lines. The *i*-th of those lines contains two words β the name of the crew member who is *i*-th in line, and his status on the ship. The words are separated by exactly one space. There are no other spaces in the line. The names consist of Latin letters, the first letter is uppercase, the rest are lowercase. The length of any name is from 1 to 10 characters. The status can have the following values: rat for a rat, woman for a woman, child for a child, man for a man, captain for the captain. The crew contains exactly one captain.
|
Print *n* lines. The *i*-th of them should contain the name of the crew member who must be the *i*-th one to leave the ship.
|
[
"6\nJack captain\nAlice woman\nCharlie man\nTeddy rat\nBob child\nJulia woman\n"
] |
[
"Teddy\nAlice\nBob\nJulia\nCharlie\nJack\n"
] |
none
| 500
|
[
{
"input": "6\nJack captain\nAlice woman\nCharlie man\nTeddy rat\nBob child\nJulia woman",
"output": "Teddy\nAlice\nBob\nJulia\nCharlie\nJack"
},
{
"input": "1\nA captain",
"output": "A"
},
{
"input": "1\nAbcdefjhij captain",
"output": "Abcdefjhij"
},
{
"input": "5\nA captain\nB man\nD woman\nC child\nE rat",
"output": "E\nD\nC\nB\nA"
},
{
"input": "10\nCap captain\nD child\nC woman\nA woman\nE child\nMan man\nB child\nF woman\nRat rat\nRatt rat",
"output": "Rat\nRatt\nD\nC\nA\nE\nB\nF\nMan\nCap"
},
{
"input": "5\nJoyxnkypf captain\nDxssgr woman\nKeojmnpd rat\nGdv man\nHnw man",
"output": "Keojmnpd\nDxssgr\nGdv\nHnw\nJoyxnkypf"
},
{
"input": "11\nJue rat\nWyglbyphk rat\nGjlgu child\nGi man\nAttx rat\nTheorpkgx man\nYm rat\nX child\nB captain\nEnualf rat\nKktsgyuyv woman",
"output": "Jue\nWyglbyphk\nAttx\nYm\nEnualf\nGjlgu\nX\nKktsgyuyv\nGi\nTheorpkgx\nB"
},
{
"input": "22\nWswwcvvm woman\nBtmfats rat\nI rat\nOcmtsnwx man\nUrcqv rat\nYghnogt woman\nWtyfc man\nWqle child\nUjfrelpu rat\nDstixj man\nAhksnio woman\nKhkvaap woman\nSjppvwm rat\nEgdmsv rat\nDank rat\nNquicjnw rat\nLh captain\nTdyaqaqln rat\nQtj rat\nTfgwijvq rat\nNbiso child\nNqthvbf woman",
"output": "Btmfats\nI\nUrcqv\nUjfrelpu\nSjppvwm\nEgdmsv\nDank\nNquicjnw\nTdyaqaqln\nQtj\nTfgwijvq\nWswwcvvm\nYghnogt\nWqle\nAhksnio\nKhkvaap\nNbiso\nNqthvbf\nOcmtsnwx\nWtyfc\nDstixj\nLh"
},
{
"input": "36\nKqxmtwmsf child\nIze woman\nDlpr child\nK woman\nF captain\nRjwfeuhba rat\nBbv rat\nS rat\nMnmg woman\nSmzyx woman\nSr man\nQmhroracn rat\nSoqpuqock rat\nPibdq man\nIlrkrptx rat\nZaecfyqka man\nMmersfs child\nVvvocqi man\nHjeqxvq rat\nMpmb woman\nWmgu woman\nCerelmhoxi child\nA man\nDylv man\nXrdgmmtcpq woman\nXj woman\nCeh child\nOfccguo man\nNevr man\nAknkwdkq child\nBmo man\nLqo woman\nVej child\nT child\nRlijc man\nNsdtpdg woman",
"output": "Rjwfeuhba\nBbv\nS\nQmhroracn\nSoqpuqock\nIlrkrptx\nHjeqxvq\nKqxmtwmsf\nIze\nDlpr\nK\nMnmg\nSmzyx\nMmersfs\nMpmb\nWmgu\nCerelmhoxi\nXrdgmmtcpq\nXj\nCeh\nAknkwdkq\nLqo\nVej\nT\nNsdtpdg\nSr\nPibdq\nZaecfyqka\nVvvocqi\nA\nDylv\nOfccguo\nNevr\nBmo\nRlijc\nF"
},
{
"input": "2\nA captain\nB man",
"output": "B\nA"
},
{
"input": "2\nB woman\nA captain",
"output": "B\nA"
},
{
"input": "2\nX child\nY captain",
"output": "X\nY"
},
{
"input": "2\nX captain\nY rat",
"output": "Y\nX"
},
{
"input": "6\nAbdelrhman captain\nAlice woman\nCharlie man\nTeddy rat\nBob child\nJulia woman",
"output": "Teddy\nAlice\nBob\nJulia\nCharlie\nAbdelrhman"
},
{
"input": "4\nAratos captain\nMind child\nAman woman\nCarrot man",
"output": "Mind\nAman\nCarrot\nAratos"
}
] | 1,622,129,337
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 26
| 186
| 0
|
from sys import stdin
d={}
for _ in range(int(stdin.readline())):
n,k=stdin.readline().split()
if k=='woman' or k=='child': k='common'
d[k]=d.get(k,"")+n+"\n"
print(str(d.get('rat',""))+str(d.get('common',""))+str(d.get('man',""))+str(d.get('captain',"")),end="")
|
Title: Sinking Ship
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The ship crashed into a reef and is sinking. Now the entire crew must be evacuated. All *n* crew members have already lined up in a row (for convenience let's label them all from left to right with positive integers from 1 to *n*) and await further instructions. However, one should evacuate the crew properly, in a strict order. Specifically:
The first crew members to leave the ship are rats. Then women and children (both groups have the same priority) leave the ship. After that all men are evacuated from the ship. The captain leaves the sinking ship last.
If we cannot determine exactly who should leave the ship first for any two members of the crew by the rules from the previous paragraph, then the one who stands to the left in the line leaves the ship first (or in other words, the one whose number in the line is less).
For each crew member we know his status as a crew member, and also his name. All crew members have different names. Determine the order in which to evacuate the crew.
Input Specification:
The first line contains an integer *n*, which is the number of people in the crew (1<=β€<=*n*<=β€<=100). Then follow *n* lines. The *i*-th of those lines contains two words β the name of the crew member who is *i*-th in line, and his status on the ship. The words are separated by exactly one space. There are no other spaces in the line. The names consist of Latin letters, the first letter is uppercase, the rest are lowercase. The length of any name is from 1 to 10 characters. The status can have the following values: rat for a rat, woman for a woman, child for a child, man for a man, captain for the captain. The crew contains exactly one captain.
Output Specification:
Print *n* lines. The *i*-th of them should contain the name of the crew member who must be the *i*-th one to leave the ship.
Demo Input:
['6\nJack captain\nAlice woman\nCharlie man\nTeddy rat\nBob child\nJulia woman\n']
Demo Output:
['Teddy\nAlice\nBob\nJulia\nCharlie\nJack\n']
Note:
none
|
```python
from sys import stdin
d={}
for _ in range(int(stdin.readline())):
n,k=stdin.readline().split()
if k=='woman' or k=='child': k='common'
d[k]=d.get(k,"")+n+"\n"
print(str(d.get('rat',""))+str(d.get('common',""))+str(d.get('man',""))+str(d.get('captain',"")),end="")
```
| 3.9535
|
441
|
A
|
Valera and Antique Items
|
PROGRAMMING
| 1,000
|
[
"implementation"
] | null | null |
Valera is a collector. Once he wanted to expand his collection with exactly one antique item.
Valera knows *n* sellers of antiques, the *i*-th of them auctioned *k**i* items. Currently the auction price of the *j*-th object of the *i*-th seller is *s**ij*. Valera gets on well with each of the *n* sellers. He is perfectly sure that if he outbids the current price of one of the items in the auction (in other words, offers the seller the money that is strictly greater than the current price of the item at the auction), the seller of the object will immediately sign a contract with him.
Unfortunately, Valera has only *v* units of money. Help him to determine which of the *n* sellers he can make a deal with.
|
The first line contains two space-separated integers *n*,<=*v* (1<=β€<=*n*<=β€<=50;Β 104<=β€<=*v*<=β€<=106) β the number of sellers and the units of money the Valera has.
Then *n* lines follow. The *i*-th line first contains integer *k**i* (1<=β€<=*k**i*<=β€<=50) the number of items of the *i*-th seller. Then go *k**i* space-separated integers *s**i*1,<=*s**i*2,<=...,<=*s**ik**i* (104<=β€<=*s**ij*<=β€<=106) β the current prices of the items of the *i*-th seller.
|
In the first line, print integer *p* β the number of sellers with who Valera can make a deal.
In the second line print *p* space-separated integers *q*1,<=*q*2,<=...,<=*q**p* (1<=β€<=*q**i*<=β€<=*n*) β the numbers of the sellers with who Valera can make a deal. Print the numbers of the sellers in the increasing order.
|
[
"3 50000\n1 40000\n2 20000 60000\n3 10000 70000 190000\n",
"3 50000\n1 50000\n3 100000 120000 110000\n3 120000 110000 120000\n"
] |
[
"3\n1 2 3\n",
"0\n\n"
] |
In the first sample Valera can bargain with each of the sellers. He can outbid the following items: a 40000 item from the first seller, a 20000 item from the second seller, and a 10000 item from the third seller.
In the second sample Valera can not make a deal with any of the sellers, as the prices of all items in the auction too big for him.
| 500
|
[
{
"input": "3 50000\n1 40000\n2 20000 60000\n3 10000 70000 190000",
"output": "3\n1 2 3"
},
{
"input": "3 50000\n1 50000\n3 100000 120000 110000\n3 120000 110000 120000",
"output": "0"
},
{
"input": "2 100001\n1 895737\n1 541571",
"output": "0"
},
{
"input": "1 1000000\n1 1000000",
"output": "0"
},
{
"input": "1 1000000\n1 561774",
"output": "1\n1"
},
{
"input": "3 1000000\n5 1000000 568832 1000000 1000000 1000000\n13 1000000 1000000 1000000 596527 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000\n20 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000",
"output": "2\n1 2"
},
{
"input": "3 999999\n7 1000000 1000000 1000000 999999 1000000 999999 1000000\n6 999999 1000000 999999 1000000 999999 999999\n7 999999 1000000 1000000 999999 1000000 1000000 1000000",
"output": "0"
},
{
"input": "3 999999\n22 1000000 1000000 999999 999999 1000000 1000000 1000000 1000000 1000000 1000000 1000000 1000000 999999 1000000 1000000 999999 1000000 1000000 1000000 352800 999999 1000000\n14 999999 999999 999999 999999 999999 1000000 999999 999999 999999 999999 702638 999999 1000000 999999\n5 999999 1000000 1000000 999999 363236",
"output": "3\n1 2 3"
},
{
"input": "1 50001\n1 50000",
"output": "1\n1"
}
] | 1,467,767,896
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 26
| 62
| 0
|
enteros = input()
#n es nΓΊmero de vendedores
#v cantidad de dinero de Valera
n, v = enteros.split()
n = int(n)
v = int(v)
#print("n", n, "v", v)
resultado = []
for i in range(1, n+1):
#print("i =", i)
datos = input().split()
for j in datos[1:]:
if v > int(j):
resultado.append(i)
break
#print(datos[1])
print(len(resultado))
ordenados = sorted(resultado)
str_ordenados = [str(x) for x in ordenados]
print(" ".join(str_ordenados))
|
Title: Valera and Antique Items
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Valera is a collector. Once he wanted to expand his collection with exactly one antique item.
Valera knows *n* sellers of antiques, the *i*-th of them auctioned *k**i* items. Currently the auction price of the *j*-th object of the *i*-th seller is *s**ij*. Valera gets on well with each of the *n* sellers. He is perfectly sure that if he outbids the current price of one of the items in the auction (in other words, offers the seller the money that is strictly greater than the current price of the item at the auction), the seller of the object will immediately sign a contract with him.
Unfortunately, Valera has only *v* units of money. Help him to determine which of the *n* sellers he can make a deal with.
Input Specification:
The first line contains two space-separated integers *n*,<=*v* (1<=β€<=*n*<=β€<=50;Β 104<=β€<=*v*<=β€<=106) β the number of sellers and the units of money the Valera has.
Then *n* lines follow. The *i*-th line first contains integer *k**i* (1<=β€<=*k**i*<=β€<=50) the number of items of the *i*-th seller. Then go *k**i* space-separated integers *s**i*1,<=*s**i*2,<=...,<=*s**ik**i* (104<=β€<=*s**ij*<=β€<=106) β the current prices of the items of the *i*-th seller.
Output Specification:
In the first line, print integer *p* β the number of sellers with who Valera can make a deal.
In the second line print *p* space-separated integers *q*1,<=*q*2,<=...,<=*q**p* (1<=β€<=*q**i*<=β€<=*n*) β the numbers of the sellers with who Valera can make a deal. Print the numbers of the sellers in the increasing order.
Demo Input:
['3 50000\n1 40000\n2 20000 60000\n3 10000 70000 190000\n', '3 50000\n1 50000\n3 100000 120000 110000\n3 120000 110000 120000\n']
Demo Output:
['3\n1 2 3\n', '0\n\n']
Note:
In the first sample Valera can bargain with each of the sellers. He can outbid the following items: a 40000 item from the first seller, a 20000 item from the second seller, and a 10000 item from the third seller.
In the second sample Valera can not make a deal with any of the sellers, as the prices of all items in the auction too big for him.
|
```python
enteros = input()
#n es nΓΊmero de vendedores
#v cantidad de dinero de Valera
n, v = enteros.split()
n = int(n)
v = int(v)
#print("n", n, "v", v)
resultado = []
for i in range(1, n+1):
#print("i =", i)
datos = input().split()
for j in datos[1:]:
if v > int(j):
resultado.append(i)
break
#print(datos[1])
print(len(resultado))
ordenados = sorted(resultado)
str_ordenados = [str(x) for x in ordenados]
print(" ".join(str_ordenados))
```
| 3
|
|
799
|
A
|
Carrot Cakes
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation"
] | null | null |
In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven.
Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable.
|
The only line contains four integers *n*, *t*, *k*, *d* (1<=β€<=*n*,<=*t*,<=*k*,<=*d*<=β€<=1<=000)Β β the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven.
|
If it is reasonable to build the second oven, print "YES". Otherwise print "NO".
|
[
"8 6 4 5\n",
"8 6 4 6\n",
"10 3 11 4\n",
"4 2 1 4\n"
] |
[
"YES\n",
"NO\n",
"NO\n",
"YES\n"
] |
In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven.
In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven.
In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
| 500
|
[
{
"input": "8 6 4 5",
"output": "YES"
},
{
"input": "8 6 4 6",
"output": "NO"
},
{
"input": "10 3 11 4",
"output": "NO"
},
{
"input": "4 2 1 4",
"output": "YES"
},
{
"input": "28 17 16 26",
"output": "NO"
},
{
"input": "60 69 9 438",
"output": "NO"
},
{
"input": "599 97 54 992",
"output": "YES"
},
{
"input": "11 22 18 17",
"output": "NO"
},
{
"input": "1 13 22 11",
"output": "NO"
},
{
"input": "1 1 1 1",
"output": "NO"
},
{
"input": "3 1 1 1",
"output": "YES"
},
{
"input": "1000 1000 1000 1000",
"output": "NO"
},
{
"input": "1000 1000 1 1",
"output": "YES"
},
{
"input": "1000 1000 1 400",
"output": "YES"
},
{
"input": "1000 1000 1 1000",
"output": "YES"
},
{
"input": "1000 1000 1 999",
"output": "YES"
},
{
"input": "53 11 3 166",
"output": "YES"
},
{
"input": "313 2 3 385",
"output": "NO"
},
{
"input": "214 9 9 412",
"output": "NO"
},
{
"input": "349 9 5 268",
"output": "YES"
},
{
"input": "611 16 8 153",
"output": "YES"
},
{
"input": "877 13 3 191",
"output": "YES"
},
{
"input": "340 9 9 10",
"output": "YES"
},
{
"input": "31 8 2 205",
"output": "NO"
},
{
"input": "519 3 2 148",
"output": "YES"
},
{
"input": "882 2 21 219",
"output": "NO"
},
{
"input": "982 13 5 198",
"output": "YES"
},
{
"input": "428 13 6 272",
"output": "YES"
},
{
"input": "436 16 14 26",
"output": "YES"
},
{
"input": "628 10 9 386",
"output": "YES"
},
{
"input": "77 33 18 31",
"output": "YES"
},
{
"input": "527 36 4 8",
"output": "YES"
},
{
"input": "128 18 2 169",
"output": "YES"
},
{
"input": "904 4 2 288",
"output": "YES"
},
{
"input": "986 4 3 25",
"output": "YES"
},
{
"input": "134 8 22 162",
"output": "NO"
},
{
"input": "942 42 3 69",
"output": "YES"
},
{
"input": "894 4 9 4",
"output": "YES"
},
{
"input": "953 8 10 312",
"output": "YES"
},
{
"input": "43 8 1 121",
"output": "YES"
},
{
"input": "12 13 19 273",
"output": "NO"
},
{
"input": "204 45 10 871",
"output": "YES"
},
{
"input": "342 69 50 425",
"output": "NO"
},
{
"input": "982 93 99 875",
"output": "NO"
},
{
"input": "283 21 39 132",
"output": "YES"
},
{
"input": "1000 45 83 686",
"output": "NO"
},
{
"input": "246 69 36 432",
"output": "NO"
},
{
"input": "607 93 76 689",
"output": "NO"
},
{
"input": "503 21 24 435",
"output": "NO"
},
{
"input": "1000 45 65 989",
"output": "NO"
},
{
"input": "30 21 2 250",
"output": "YES"
},
{
"input": "1000 49 50 995",
"output": "NO"
},
{
"input": "383 69 95 253",
"output": "YES"
},
{
"input": "393 98 35 999",
"output": "YES"
},
{
"input": "1000 22 79 552",
"output": "NO"
},
{
"input": "268 294 268 154",
"output": "NO"
},
{
"input": "963 465 706 146",
"output": "YES"
},
{
"input": "304 635 304 257",
"output": "NO"
},
{
"input": "4 2 1 6",
"output": "NO"
},
{
"input": "1 51 10 50",
"output": "NO"
},
{
"input": "5 5 4 4",
"output": "YES"
},
{
"input": "3 2 1 1",
"output": "YES"
},
{
"input": "3 4 3 3",
"output": "NO"
},
{
"input": "7 3 4 1",
"output": "YES"
},
{
"input": "101 10 1 1000",
"output": "NO"
},
{
"input": "5 1 1 1",
"output": "YES"
},
{
"input": "5 10 5 5",
"output": "NO"
},
{
"input": "19 1 7 1",
"output": "YES"
},
{
"input": "763 572 745 262",
"output": "YES"
},
{
"input": "1 2 1 1",
"output": "NO"
},
{
"input": "5 1 1 3",
"output": "YES"
},
{
"input": "170 725 479 359",
"output": "NO"
},
{
"input": "6 2 1 7",
"output": "YES"
},
{
"input": "6 2 5 1",
"output": "YES"
},
{
"input": "1 2 2 1",
"output": "NO"
},
{
"input": "24 2 8 3",
"output": "YES"
},
{
"input": "7 3 3 3",
"output": "YES"
},
{
"input": "5 2 2 2",
"output": "YES"
},
{
"input": "3 2 1 2",
"output": "YES"
},
{
"input": "1000 2 200 8",
"output": "NO"
},
{
"input": "3 100 2 100",
"output": "NO"
},
{
"input": "2 999 1 1000",
"output": "NO"
},
{
"input": "2 1 1 1",
"output": "NO"
},
{
"input": "2 3 5 1",
"output": "NO"
},
{
"input": "100 1 5 1",
"output": "YES"
},
{
"input": "7 2 3 3",
"output": "YES"
},
{
"input": "4 1 1 3",
"output": "NO"
},
{
"input": "3 2 2 1",
"output": "YES"
},
{
"input": "1 1 1 2",
"output": "NO"
},
{
"input": "91 8 7 13",
"output": "YES"
},
{
"input": "3 1 2 1",
"output": "NO"
},
{
"input": "5 3 2 3",
"output": "YES"
},
{
"input": "9 6 6 3",
"output": "YES"
}
] | 1,677,433,180
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 93
| 46
| 0
|
n,t,k,d=map(int,input().split())
u=0--n//k
u-=d//t+1
print('YNEOS'[u<=0::2])
|
Title: Carrot Cakes
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In some game by Playrix it takes *t* minutes for an oven to bake *k* carrot cakes, all cakes are ready at the same moment *t* minutes after they started baking. Arkady needs at least *n* cakes to complete a task, but he currently don't have any. However, he has infinitely many ingredients and one oven. Moreover, Arkady can build one more similar oven to make the process faster, it would take *d* minutes to build the oven. While the new oven is being built, only old one can bake cakes, after the new oven is built, both ovens bake simultaneously. Arkady can't build more than one oven.
Determine if it is reasonable to build the second oven, i.e. will it decrease the minimum time needed to get *n* cakes or not. If the time needed with the second oven is the same as with one oven, then it is unreasonable.
Input Specification:
The only line contains four integers *n*, *t*, *k*, *d* (1<=β€<=*n*,<=*t*,<=*k*,<=*d*<=β€<=1<=000)Β β the number of cakes needed, the time needed for one oven to bake *k* cakes, the number of cakes baked at the same time, the time needed to build the second oven.
Output Specification:
If it is reasonable to build the second oven, print "YES". Otherwise print "NO".
Demo Input:
['8 6 4 5\n', '8 6 4 6\n', '10 3 11 4\n', '4 2 1 4\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n', 'YES\n']
Note:
In the first example it is possible to get 8 cakes in 12 minutes using one oven. The second oven can be built in 5 minutes, so after 6 minutes the first oven bakes 4 cakes, the second oven bakes 4 more ovens after 11 minutes. Thus, it is reasonable to build the second oven.
In the second example it doesn't matter whether we build the second oven or not, thus it takes 12 minutes to bake 8 cakes in both cases. Thus, it is unreasonable to build the second oven.
In the third example the first oven bakes 11 cakes in 3 minutes, that is more than needed 10. It is unreasonable to build the second oven, because its building takes more time that baking the needed number of cakes using the only oven.
|
```python
n,t,k,d=map(int,input().split())
u=0--n//k
u-=d//t+1
print('YNEOS'[u<=0::2])
```
| 3
|
|
61
|
A
|
Ultra-Fast Mathematician
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Ultra-Fast Mathematician
|
2
|
256
|
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length β (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
|
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
|
Write one line β the corresponding answer. Do not omit the leading 0s.
|
[
"1010100\n0100101\n",
"000\n111\n",
"1110\n1010\n",
"01110\n01100\n"
] |
[
"1110001\n",
"111\n",
"0100\n",
"00010\n"
] |
none
| 500
|
[
{
"input": "1010100\n0100101",
"output": "1110001"
},
{
"input": "000\n111",
"output": "111"
},
{
"input": "1110\n1010",
"output": "0100"
},
{
"input": "01110\n01100",
"output": "00010"
},
{
"input": "011101\n000001",
"output": "011100"
},
{
"input": "10\n01",
"output": "11"
},
{
"input": "00111111\n11011101",
"output": "11100010"
},
{
"input": "011001100\n101001010",
"output": "110000110"
},
{
"input": "1100100001\n0110101100",
"output": "1010001101"
},
{
"input": "00011101010\n10010100101",
"output": "10001001111"
},
{
"input": "100000101101\n111010100011",
"output": "011010001110"
},
{
"input": "1000001111010\n1101100110001",
"output": "0101101001011"
},
{
"input": "01011111010111\n10001110111010",
"output": "11010001101101"
},
{
"input": "110010000111100\n001100101011010",
"output": "111110101100110"
},
{
"input": "0010010111110000\n0000000011010110",
"output": "0010010100100110"
},
{
"input": "00111110111110000\n01111100001100000",
"output": "01000010110010000"
},
{
"input": "101010101111010001\n001001111101111101",
"output": "100011010010101100"
},
{
"input": "0110010101111100000\n0011000101000000110",
"output": "0101010000111100110"
},
{
"input": "11110100011101010111\n00001000011011000000",
"output": "11111100000110010111"
},
{
"input": "101010101111101101001\n111010010010000011111",
"output": "010000111101101110110"
},
{
"input": "0000111111100011000010\n1110110110110000001010",
"output": "1110001001010011001000"
},
{
"input": "10010010101000110111000\n00101110100110111000111",
"output": "10111100001110001111111"
},
{
"input": "010010010010111100000111\n100100111111100011001110",
"output": "110110101101011111001001"
},
{
"input": "0101110100100111011010010\n0101100011010111001010001",
"output": "0000010111110000010000011"
},
{
"input": "10010010100011110111111011\n10000110101100000001000100",
"output": "00010100001111110110111111"
},
{
"input": "000001111000000100001000000\n011100111101111001110110001",
"output": "011101000101111101111110001"
},
{
"input": "0011110010001001011001011100\n0000101101000011101011001010",
"output": "0011011111001010110010010110"
},
{
"input": "11111000000000010011001101111\n11101110011001010100010000000",
"output": "00010110011001000111011101111"
},
{
"input": "011001110000110100001100101100\n001010000011110000001000101001",
"output": "010011110011000100000100000101"
},
{
"input": "1011111010001100011010110101111\n1011001110010000000101100010101",
"output": "0000110100011100011111010111010"
},
{
"input": "10111000100001000001010110000001\n10111000001100101011011001011000",
"output": "00000000101101101010001111011001"
},
{
"input": "000001010000100001000000011011100\n111111111001010100100001100000111",
"output": "111110101001110101100001111011011"
},
{
"input": "1101000000000010011011101100000110\n1110000001100010011010000011011110",
"output": "0011000001100000000001101111011000"
},
{
"input": "01011011000010100001100100011110001\n01011010111000001010010100001110000",
"output": "00000001111010101011110000010000001"
},
{
"input": "000011111000011001000110111100000100\n011011000110000111101011100111000111",
"output": "011000111110011110101101011011000011"
},
{
"input": "1001000010101110001000000011111110010\n0010001011010111000011101001010110000",
"output": "1011001001111001001011101010101000010"
},
{
"input": "00011101011001100101111111000000010101\n10010011011011001011111000000011101011",
"output": "10001110000010101110000111000011111110"
},
{
"input": "111011100110001001101111110010111001010\n111111101101111001110010000101101000100",
"output": "000100001011110000011101110111010001110"
},
{
"input": "1111001001101000001000000010010101001010\n0010111100111110001011000010111110111001",
"output": "1101110101010110000011000000101011110011"
},
{
"input": "00100101111000000101011111110010100011010\n11101110001010010101001000111110101010100",
"output": "11001011110010010000010111001100001001110"
},
{
"input": "101011001110110100101001000111010101101111\n100111100110101011010100111100111111010110",
"output": "001100101000011111111101111011101010111001"
},
{
"input": "1111100001100101000111101001001010011100001\n1000110011000011110010001011001110001000001",
"output": "0111010010100110110101100010000100010100000"
},
{
"input": "01100111011111010101000001101110000001110101\n10011001011111110000000101011001001101101100",
"output": "11111110000000100101000100110111001100011001"
},
{
"input": "110010100111000100100101100000011100000011001\n011001111011100110000110111001110110100111011",
"output": "101011011100100010100011011001101010100100010"
},
{
"input": "0001100111111011010110100100111000000111000110\n1100101011000000000001010010010111001100110001",
"output": "1101001100111011010111110110101111001011110111"
},
{
"input": "00000101110110110001110010100001110100000100000\n10010000110011110001101000111111101010011010001",
"output": "10010101000101000000011010011110011110011110001"
},
{
"input": "110000100101011100100011001111110011111110010001\n101011111001011100110110111101110011010110101100",
"output": "011011011100000000010101110010000000101000111101"
},
{
"input": "0101111101011111010101011101000011101100000000111\n0000101010110110001110101011011110111001010100100",
"output": "0101010111101001011011110110011101010101010100011"
},
{
"input": "11000100010101110011101000011111001010110111111100\n00001111000111001011111110000010101110111001000011",
"output": "11001011010010111000010110011101100100001110111111"
},
{
"input": "101000001101111101101111111000001110110010101101010\n010011100111100001100000010001100101000000111011011",
"output": "111011101010011100001111101001101011110010010110001"
},
{
"input": "0011111110010001010100010110111000110011001101010100\n0111000000100010101010000100101000000100101000111001",
"output": "0100111110110011111110010010010000110111100101101101"
},
{
"input": "11101010000110000011011010000001111101000111011111100\n10110011110001010100010110010010101001010111100100100",
"output": "01011001110111010111001100010011010100010000111011000"
},
{
"input": "011000100001000001101000010110100110011110100111111011\n111011001000001001110011001111011110111110110011011111",
"output": "100011101001001000011011011001111000100000010100100100"
},
{
"input": "0111010110010100000110111011010110100000000111110110000\n1011100100010001101100000100111111101001110010000100110",
"output": "1100110010000101101010111111101001001001110101110010110"
},
{
"input": "10101000100111000111010001011011011011110100110101100011\n11101111000000001100100011111000100100000110011001101110",
"output": "01000111100111001011110010100011111111110010101100001101"
},
{
"input": "000000111001010001000000110001001011100010011101010011011\n110001101000010010000101000100001111101001100100001010010",
"output": "110001010001000011000101110101000100001011111001011001001"
},
{
"input": "0101011100111010000111110010101101111111000000111100011100\n1011111110000010101110111001000011100000100111111111000111",
"output": "1110100010111000101001001011101110011111100111000011011011"
},
{
"input": "11001000001100100111100111100100101011000101001111001001101\n10111110100010000011010100110100100011101001100000001110110",
"output": "01110110101110100100110011010000001000101100101111000111011"
},
{
"input": "010111011011101000000110000110100110001110100001110110111011\n101011110011101011101101011111010100100001100111100100111011",
"output": "111100101000000011101011011001110010101111000110010010000000"
},
{
"input": "1001011110110110000100011001010110000100011010010111010101110\n1101111100001000010111110011010101111010010100000001000010111",
"output": "0100100010111110010011101010000011111110001110010110010111001"
},
{
"input": "10000010101111100111110101111000010100110111101101111111111010\n10110110101100101010011001011010100110111011101100011001100111",
"output": "00110100000011001101101100100010110010001100000001100110011101"
},
{
"input": "011111010011111000001010101001101001000010100010111110010100001\n011111001011000011111001000001111001010110001010111101000010011",
"output": "000000011000111011110011101000010000010100101000000011010110010"
},
{
"input": "1111000000110001011101000100100100001111011100001111001100011111\n1101100110000101100001100000001001011011111011010101000101001010",
"output": "0010100110110100111100100100101101010100100111011010001001010101"
},
{
"input": "01100000101010010011001110100110110010000110010011011001100100011\n10110110010110111100100111000111000110010000000101101110000010111",
"output": "11010110111100101111101001100001110100010110010110110111100110100"
},
{
"input": "001111111010000100001100001010011001111110011110010111110001100111\n110000101001011000100010101100100110000111100000001101001110010111",
"output": "111111010011011100101110100110111111111001111110011010111111110000"
},
{
"input": "1011101011101101011110101101011101011000010011100101010101000100110\n0001000001001111010111100100111101100000000001110001000110000000110",
"output": "1010101010100010001001001001100000111000010010010100010011000100000"
},
{
"input": "01000001011001010011011100010000100100110101111011011011110000001110\n01011110000110011011000000000011000111100001010000000011111001110000",
"output": "00011111011111001000011100010011100011010100101011011000001001111110"
},
{
"input": "110101010100110101000001111110110100010010000100111110010100110011100\n111010010111111011100110101011001011001110110111110100000110110100111",
"output": "001111000011001110100111010101111111011100110011001010010010000111011"
},
{
"input": "1001101011000001011111100110010010000011010001001111011100010100110001\n1111100111110101001111010001010000011001001001010110001111000000100101",
"output": "0110001100110100010000110111000010011010011000011001010011010100010100"
},
{
"input": "00000111110010110001110110001010010101000111011001111111100110011110010\n00010111110100000100110101000010010001100001100011100000001100010100010",
"output": "00010000000110110101000011001000000100100110111010011111101010001010000"
},
{
"input": "100101011100101101000011010001011001101110101110001100010001010111001110\n100001111100101011011111110000001111000111001011111110000010101110111001",
"output": "000100100000000110011100100001010110101001100101110010010011111001110111"
},
{
"input": "1101100001000111001101001011101000111000011110000001001101101001111011010\n0101011101010100011011010110101000010010110010011110101100000110110001000",
"output": "1000111100010011010110011101000000101010101100011111100001101111001010010"
},
{
"input": "01101101010011110101100001110101111011100010000010001101111000011110111111\n00101111001101001100111010000101110000100101101111100111101110010100011011",
"output": "01000010011110111001011011110000001011000111101101101010010110001010100100"
},
{
"input": "101100101100011001101111110110110010100110110010100001110010110011001101011\n000001011010101011110011111101001110000111000010001101000010010000010001101",
"output": "101101110110110010011100001011111100100001110000101100110000100011011100110"
},
{
"input": "0010001011001010001100000010010011110110011000100000000100110000101111001110\n1100110100111000110100001110111001011101001100001010100001010011100110110001",
"output": "1110111111110010111000001100101010101011010100101010100101100011001001111111"
},
{
"input": "00101101010000000101011001101011001100010001100000101011101110000001111001000\n10010110010111000000101101000011101011001010000011011101101011010000000011111",
"output": "10111011000111000101110100101000100111011011100011110110000101010001111010111"
},
{
"input": "111100000100100000101001100001001111001010001000001000000111010000010101101011\n001000100010100101111011111011010110101100001111011000010011011011100010010110",
"output": "110100100110000101010010011010011001100110000111010000010100001011110111111101"
},
{
"input": "0110001101100100001111110101101000100101010010101010011001101001001101110000000\n0111011000000010010111011110010000000001000110001000011001101000000001110100111",
"output": "0001010101100110011000101011111000100100010100100010000000000001001100000100111"
},
{
"input": "10001111111001000101001011110101111010100001011010101100111001010001010010001000\n10000111010010011110111000111010101100000011110001101111001000111010100000000001",
"output": "00001000101011011011110011001111010110100010101011000011110001101011110010001001"
},
{
"input": "100110001110110000100101001110000011110110000110000000100011110100110110011001101\n110001110101110000000100101001101011111100100100001001000110000001111100011110110",
"output": "010111111011000000100001100111101000001010100010001001100101110101001010000111011"
},
{
"input": "0000010100100000010110111100011111111010011101000000100000011001001101101100111010\n0100111110011101010110101011110110010111001111000110101100101110111100101000111111",
"output": "0100101010111101000000010111101001101101010010000110001100110111110001000100000101"
},
{
"input": "11000111001010100001110000001001011010010010110000001110100101000001010101100110111\n11001100100100100001101010110100000111100011101110011010110100001001000011011011010",
"output": "00001011101110000000011010111101011101110001011110010100010001001000010110111101101"
},
{
"input": "010110100010001000100010101001101010011010111110100001000100101000111011100010100001\n110000011111101101010011111000101010111010100001001100001001100101000000111000000000",
"output": "100110111101100101110001010001000000100000011111101101001101001101111011011010100001"
},
{
"input": "0000011110101110010101110110110101100001011001101010101001000010000010000000101001101\n1100111111011100000110000111101110011111100111110001011001000010011111100001001100011",
"output": "1100100001110010010011110001011011111110111110011011110000000000011101100001100101110"
},
{
"input": "10100000101101110001100010010010100101100011010010101000110011100000101010110010000000\n10001110011011010010111011011101101111000111110000111000011010010101001100000001010011",
"output": "00101110110110100011011001001111001010100100100010010000101001110101100110110011010011"
},
{
"input": "001110000011111101101010011111000101010111010100001001100001001100101000000111000000000\n111010000000000000101001110011001000111011001100101010011001000011101001001011110000011",
"output": "110100000011111101000011101100001101101100011000100011111000001111000001001100110000011"
},
{
"input": "1110111100111011010101011011001110001010010010110011110010011111000010011111010101100001\n1001010101011001001010100010101100000110111101011000100010101111111010111100001110010010",
"output": "0111101001100010011111111001100010001100101111101011010000110000111000100011011011110011"
},
{
"input": "11100010001100010011001100001100010011010001101110011110100101110010101101011101000111111\n01110000000110111010110100001010000101011110100101010011000110101110101101110111011110001",
"output": "10010010001010101001111000000110010110001111001011001101100011011100000000101010011001110"
},
{
"input": "001101011001100101101100110000111000101011001001100100000100101000100000110100010111111101\n101001111110000010111101111110001001111001111101111010000110111000100100110010010001011111",
"output": "100100100111100111010001001110110001010010110100011110000010010000000100000110000110100010"
},
{
"input": "1010110110010101000110010010110101011101010100011001101011000110000000100011100100011000000\n0011011111100010001111101101000111001011101110100000110111100100101111010110101111011100011",
"output": "1001101001110111001001111111110010010110111010111001011100100010101111110101001011000100011"
},
{
"input": "10010010000111010111011111110010100101100000001100011100111011100010000010010001011100001100\n00111010100010110010000100010111010001111110100100100011101000101111111111001101101100100100",
"output": "10101000100101100101011011100101110100011110101000111111010011001101111101011100110000101000"
},
{
"input": "010101110001010101100000010111010000000111110011001101100011001000000011001111110000000010100\n010010111011100101010101111110110000000111000100001101101001001000001100101110001010000100001",
"output": "000111001010110000110101101001100000000000110111000000001010000000001111100001111010000110101"
},
{
"input": "1100111110011001000111101001001011000110011010111111100010111111001100111111011101100111101011\n1100000011001000110100110111000001011001010111101000010010100011000001100100111101101000010110",
"output": "0000111101010001110011011110001010011111001101010111110000011100001101011011100000001111111101"
},
{
"input": "00011000100100110111100101100100000000010011110111110010101110110011100001010111010011110100101\n00011011111011111011100101100111100101001110010111000010000111000100100100000001110101111011011",
"output": "00000011011111001100000000000011100101011101100000110000101001110111000101010110100110001111110"
},
{
"input": "000101011001001100000111100010110101111011110101111101000110001101011010111110110011100100000001\n011000101010011111011000111000100000000011011000000001111110001000001111101010110000011100001111",
"output": "011101110011010011011111011010010101111000101101111100111000000101010101010100000011111000001110"
},
{
"input": "1000101001011010000100100100010010011101011001110101111011101111111110010101001101010001010101001\n0110110010011100011111011111110111000000010001110100001010111110101011010011111011111110000110000",
"output": "1110011011000110011011111011100101011101001000000001110001010001010101000110110110101111010011001"
},
{
"input": "01111010010101100111110111111011011010100001011101010000111100101101101110111011001100101011100111\n00001100110110100001111011000010001001001100000010111101000001111011100000010111010010000011000010",
"output": "01110110100011000110001100111001010011101101011111101101111101010110001110101100011110101000100101"
},
{
"input": "111101011101111000001011001101111010110111001101110100100011111011011101001101010101011010111000110\n101111100101101101001100110011000001111010011101110111110110101110011011110011111100001001110101101",
"output": "010010111000010101000111111110111011001101010000000011010101010101000110111110101001010011001101011"
},
{
"input": "1010000011010110011101001101110001110010000111011101110010110110111111001001110100101100010101010001\n0111101000111100101100000101111010100100001000011101010100110011100011010011010101000100101011100011",
"output": "1101101011101010110001001000001011010110001111000000100110000101011100011010100001101000111110110010"
},
{
"input": "0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001\n1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111010",
"output": "1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111011"
},
{
"input": "0\n0",
"output": "0"
},
{
"input": "0\n1",
"output": "1"
}
] | 1,612,329,908
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 102
| 77
| 0
|
n1=input()
n2=input()
res=''
for i in range(len(n2)):
if n1[i]=='1' and n2[i]=='1':
res=res+'0'
elif n1[i]=='0' and n2[i]=='0':
res=res+'0'
else:
res=res+'1'
print(res)
|
Title: Ultra-Fast Mathematician
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length β (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
Input Specification:
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
Output Specification:
Write one line β the corresponding answer. Do not omit the leading 0s.
Demo Input:
['1010100\n0100101\n', '000\n111\n', '1110\n1010\n', '01110\n01100\n']
Demo Output:
['1110001\n', '111\n', '0100\n', '00010\n']
Note:
none
|
```python
n1=input()
n2=input()
res=''
for i in range(len(n2)):
if n1[i]=='1' and n2[i]=='1':
res=res+'0'
elif n1[i]=='0' and n2[i]=='0':
res=res+'0'
else:
res=res+'1'
print(res)
```
| 3.98075
|
673
|
A
|
Bear and Game
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Bear Limak likes watching sports on TV. He is going to watch a game today. The game lasts 90 minutes and there are no breaks.
Each minute can be either interesting or boring. If 15 consecutive minutes are boring then Limak immediately turns TV off.
You know that there will be *n* interesting minutes *t*1,<=*t*2,<=...,<=*t**n*. Your task is to calculate for how many minutes Limak will watch the game.
|
The first line of the input contains one integer *n* (1<=β€<=*n*<=β€<=90)Β β the number of interesting minutes.
The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=β€<=*t*1<=<<=*t*2<=<<=... *t**n*<=β€<=90), given in the increasing order.
|
Print the number of minutes Limak will watch the game.
|
[
"3\n7 20 88\n",
"9\n16 20 30 40 50 60 70 80 90\n",
"9\n15 20 30 40 50 60 70 80 90\n"
] |
[
"35\n",
"15\n",
"90\n"
] |
In the first sample, minutes 21,β22,β...,β35 are all boring and thus Limak will turn TV off immediately after the 35-th minute. So, he would watch the game for 35 minutes.
In the second sample, the first 15 minutes are boring.
In the third sample, there are no consecutive 15 boring minutes. So, Limak will watch the whole game.
| 500
|
[
{
"input": "3\n7 20 88",
"output": "35"
},
{
"input": "9\n16 20 30 40 50 60 70 80 90",
"output": "15"
},
{
"input": "9\n15 20 30 40 50 60 70 80 90",
"output": "90"
},
{
"input": "30\n6 11 12 15 22 24 30 31 32 33 34 35 40 42 44 45 47 50 53 54 57 58 63 67 75 77 79 81 83 88",
"output": "90"
},
{
"input": "60\n1 2 4 5 6 7 11 14 16 18 20 21 22 23 24 25 26 33 34 35 36 37 38 39 41 42 43 44 46 47 48 49 52 55 56 57 58 59 60 61 63 64 65 67 68 70 71 72 73 74 75 77 78 80 82 83 84 85 86 88",
"output": "90"
},
{
"input": "90\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90",
"output": "90"
},
{
"input": "1\n1",
"output": "16"
},
{
"input": "5\n15 30 45 60 75",
"output": "90"
},
{
"input": "6\n14 29 43 59 70 74",
"output": "58"
},
{
"input": "1\n15",
"output": "30"
},
{
"input": "1\n16",
"output": "15"
},
{
"input": "14\n14 22 27 31 35 44 46 61 62 69 74 79 88 89",
"output": "90"
},
{
"input": "76\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90",
"output": "90"
},
{
"input": "1\n90",
"output": "15"
},
{
"input": "6\n13 17 32 47 60 66",
"output": "81"
},
{
"input": "84\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84",
"output": "90"
},
{
"input": "9\n6 20 27 28 40 53 59 70 85",
"output": "90"
},
{
"input": "12\n14 22 27 31 35 44 62 69 74 79 88 89",
"output": "59"
},
{
"input": "5\n15 30 45 60 74",
"output": "89"
},
{
"input": "72\n3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89",
"output": "54"
},
{
"input": "8\n1 16 30 31 32 33 34 50",
"output": "49"
},
{
"input": "12\n1 3 6 10 15 21 28 36 45 55 66 78",
"output": "90"
},
{
"input": "25\n1 2 3 4 5 6 7 8 9 10 11 23 36 50 65 81 82 83 84 85 86 87 88 89 90",
"output": "80"
},
{
"input": "8\n5 17 20 35 42 53 67 76",
"output": "90"
},
{
"input": "9\n15 28 39 48 55 60 63 64 74",
"output": "89"
},
{
"input": "10\n15 28 39 48 55 60 63 64 74 82",
"output": "90"
},
{
"input": "2\n1 18",
"output": "16"
},
{
"input": "9\n10 20 30 40 50 60 70 80 84",
"output": "90"
},
{
"input": "2\n16 50",
"output": "15"
},
{
"input": "6\n15 30 45 60 75 84",
"output": "90"
},
{
"input": "8\n15 20 30 40 50 60 73 83",
"output": "90"
},
{
"input": "8\n10 20 30 40 50 60 70 80",
"output": "90"
},
{
"input": "3\n1 20 90",
"output": "16"
},
{
"input": "6\n15 30 45 60 74 89",
"output": "90"
}
] | 1,556,799,013
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 108
| 0
|
def main():
input()
t = [int(_) for _ in input().split()] + [90]
end = 0
still_interesting = True
next_interesting = 0
while end < 90 and still_interesting:
end = min(end + 15, 90)
if end >= t[next_interesting]:
end = t[next_interesting]
next_interesting += 1
else:
still_interesting = False
print(end)
if __name__ == '__main__':
main()
|
Title: Bear and Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bear Limak likes watching sports on TV. He is going to watch a game today. The game lasts 90 minutes and there are no breaks.
Each minute can be either interesting or boring. If 15 consecutive minutes are boring then Limak immediately turns TV off.
You know that there will be *n* interesting minutes *t*1,<=*t*2,<=...,<=*t**n*. Your task is to calculate for how many minutes Limak will watch the game.
Input Specification:
The first line of the input contains one integer *n* (1<=β€<=*n*<=β€<=90)Β β the number of interesting minutes.
The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=β€<=*t*1<=<<=*t*2<=<<=... *t**n*<=β€<=90), given in the increasing order.
Output Specification:
Print the number of minutes Limak will watch the game.
Demo Input:
['3\n7 20 88\n', '9\n16 20 30 40 50 60 70 80 90\n', '9\n15 20 30 40 50 60 70 80 90\n']
Demo Output:
['35\n', '15\n', '90\n']
Note:
In the first sample, minutes 21,β22,β...,β35 are all boring and thus Limak will turn TV off immediately after the 35-th minute. So, he would watch the game for 35 minutes.
In the second sample, the first 15 minutes are boring.
In the third sample, there are no consecutive 15 boring minutes. So, Limak will watch the whole game.
|
```python
def main():
input()
t = [int(_) for _ in input().split()] + [90]
end = 0
still_interesting = True
next_interesting = 0
while end < 90 and still_interesting:
end = min(end + 15, 90)
if end >= t[next_interesting]:
end = t[next_interesting]
next_interesting += 1
else:
still_interesting = False
print(end)
if __name__ == '__main__':
main()
```
| 3
|
|
672
|
B
|
Different is Good
|
PROGRAMMING
| 1,000
|
[
"constructive algorithms",
"implementation",
"strings"
] | null | null |
A wise man told Kerem "Different is good" once, so Kerem wants all things in his life to be different.
Kerem recently got a string *s* consisting of lowercase English letters. Since Kerem likes it when things are different, he wants all substrings of his string *s* to be distinct. Substring is a string formed by some number of consecutive characters of the string. For example, string "aba" has substrings "" (empty substring), "a", "b", "a", "ab", "ba", "aba".
If string *s* has at least two equal substrings then Kerem will change characters at some positions to some other lowercase English letters. Changing characters is a very tiring job, so Kerem want to perform as few changes as possible.
Your task is to find the minimum number of changes needed to make all the substrings of the given string distinct, or determine that it is impossible.
|
The first line of the input contains an integer *n* (1<=β€<=*n*<=β€<=100<=000)Β β the length of the string *s*.
The second line contains the string *s* of length *n* consisting of only lowercase English letters.
|
If it's impossible to change the string *s* such that all its substring are distinct print -1. Otherwise print the minimum required number of changes.
|
[
"2\naa\n",
"4\nkoko\n",
"5\nmurat\n"
] |
[
"1\n",
"2\n",
"0\n"
] |
In the first sample one of the possible solutions is to change the first character to 'b'.
In the second sample, one may change the first character to 'a' and second character to 'b', so the string becomes "abko".
| 1,000
|
[
{
"input": "2\naa",
"output": "1"
},
{
"input": "4\nkoko",
"output": "2"
},
{
"input": "5\nmurat",
"output": "0"
},
{
"input": "6\nacbead",
"output": "1"
},
{
"input": "7\ncdaadad",
"output": "4"
},
{
"input": "25\npeoaicnbisdocqofsqdpgobpn",
"output": "12"
},
{
"input": "25\ntcqpchnqskqjacruoaqilgebu",
"output": "7"
},
{
"input": "13\naebaecedabbee",
"output": "8"
},
{
"input": "27\naaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "-1"
},
{
"input": "10\nbababbdaee",
"output": "6"
},
{
"input": "11\ndbadcdbdbca",
"output": "7"
},
{
"input": "12\nacceaabddaaa",
"output": "7"
},
{
"input": "13\nabddfbfaeecfa",
"output": "7"
},
{
"input": "14\neeceecacdbcbbb",
"output": "9"
},
{
"input": "15\ndcbceaaggabaheb",
"output": "8"
},
{
"input": "16\nhgiegfbadgcicbhd",
"output": "7"
},
{
"input": "17\nabhfibbdddfghgfdi",
"output": "10"
},
{
"input": "26\nbbbbbabbaababaaabaaababbaa",
"output": "24"
},
{
"input": "26\nahnxdnbfbcrirerssyzydihuee",
"output": "11"
},
{
"input": "26\nhwqeqhkpxwulbsiwmnlfyhgknc",
"output": "8"
},
{
"input": "26\nrvxmulriorilidecqwmfaemifj",
"output": "10"
},
{
"input": "26\naowpmreooavnmamogdoopuisge",
"output": "12"
},
{
"input": "26\ninimevtuefhvuefirdehmmfudh",
"output": "15"
},
{
"input": "26\naaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "25"
},
{
"input": "27\nqdcfjtblgglnilgassirrjekcjt",
"output": "-1"
},
{
"input": "27\nabcdefghijklmnopqrstuvwxyza",
"output": "-1"
},
{
"input": "26\nqwertyuiopasdfghjklzxcvbnm",
"output": "0"
},
{
"input": "5\nzzzzz",
"output": "4"
},
{
"input": "27\naaaaaaaaaaaaaaaaabaaaaaaaaa",
"output": "-1"
},
{
"input": "1\nq",
"output": "0"
},
{
"input": "27\nqwertyuioplkjhgfdsazxcvbnmm",
"output": "-1"
},
{
"input": "9\nxxxyyyzzz",
"output": "6"
},
{
"input": "45\naaabbbcccdddeeefffgghhiijjkkkkkkkkkkkkkkkkkkk",
"output": "-1"
},
{
"input": "27\nqwertyuiopasdfghjklzxcvbnmm",
"output": "-1"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxyz",
"output": "0"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxya",
"output": "1"
},
{
"input": "27\nabcdefghijklmnopqrstuvwxyzz",
"output": "-1"
},
{
"input": "26\naaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "25"
},
{
"input": "26\nqwertyuioplkjhgfdsazxcvbnm",
"output": "0"
},
{
"input": "10\nzzzzzzzzzz",
"output": "9"
},
{
"input": "1\na",
"output": "0"
},
{
"input": "30\nabcdefghtyabcdefghtyabcdefghty",
"output": "-1"
}
] | 1,616,284,191
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 47
| 108
| 0
|
n = int(input())
if n <= 26:
print(n-len(set(input())))
else:
print("-1")
|
Title: Different is Good
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A wise man told Kerem "Different is good" once, so Kerem wants all things in his life to be different.
Kerem recently got a string *s* consisting of lowercase English letters. Since Kerem likes it when things are different, he wants all substrings of his string *s* to be distinct. Substring is a string formed by some number of consecutive characters of the string. For example, string "aba" has substrings "" (empty substring), "a", "b", "a", "ab", "ba", "aba".
If string *s* has at least two equal substrings then Kerem will change characters at some positions to some other lowercase English letters. Changing characters is a very tiring job, so Kerem want to perform as few changes as possible.
Your task is to find the minimum number of changes needed to make all the substrings of the given string distinct, or determine that it is impossible.
Input Specification:
The first line of the input contains an integer *n* (1<=β€<=*n*<=β€<=100<=000)Β β the length of the string *s*.
The second line contains the string *s* of length *n* consisting of only lowercase English letters.
Output Specification:
If it's impossible to change the string *s* such that all its substring are distinct print -1. Otherwise print the minimum required number of changes.
Demo Input:
['2\naa\n', '4\nkoko\n', '5\nmurat\n']
Demo Output:
['1\n', '2\n', '0\n']
Note:
In the first sample one of the possible solutions is to change the first character to 'b'.
In the second sample, one may change the first character to 'a' and second character to 'b', so the string becomes "abko".
|
```python
n = int(input())
if n <= 26:
print(n-len(set(input())))
else:
print("-1")
```
| 3
|
|
950
|
A
|
Left-handers, Right-handers and Ambidexters
|
PROGRAMMING
| 800
|
[
"implementation",
"math"
] | null | null |
You are at a water bowling training. There are *l* people who play with their left hand, *r* people, who play with their right hand, and *a* ambidexters, who can play with left or right hand.
The coach decided to form a team of even number of players, exactly half of the players should play with their right hand, and exactly half of the players should play with their left hand. One player should use only on of his hands.
Ambidexters play as well with their right hand as with their left hand. In the team, an ambidexter can play with their left hand, or with their right hand.
Please find the maximum possible size of the team, where equal number of players use their left and right hands, respectively.
|
The only line contains three integers *l*, *r* and *a* (0<=β€<=*l*,<=*r*,<=*a*<=β€<=100) β the number of left-handers, the number of right-handers and the number of ambidexters at the training.
|
Print a single even integerΒ β the maximum number of players in the team. It is possible that the team can only have zero number of players.
|
[
"1 4 2\n",
"5 5 5\n",
"0 2 0\n"
] |
[
"6\n",
"14\n",
"0\n"
] |
In the first example you can form a team of 6 players. You should take the only left-hander and two ambidexters to play with left hand, and three right-handers to play with right hand. The only person left can't be taken into the team.
In the second example you can form a team of 14 people. You have to take all five left-handers, all five right-handers, two ambidexters to play with left hand and two ambidexters to play with right hand.
| 500
|
[
{
"input": "1 4 2",
"output": "6"
},
{
"input": "5 5 5",
"output": "14"
},
{
"input": "0 2 0",
"output": "0"
},
{
"input": "30 70 34",
"output": "128"
},
{
"input": "89 32 24",
"output": "112"
},
{
"input": "89 44 77",
"output": "210"
},
{
"input": "0 0 0",
"output": "0"
},
{
"input": "100 100 100",
"output": "300"
},
{
"input": "1 1 1",
"output": "2"
},
{
"input": "30 70 35",
"output": "130"
},
{
"input": "89 44 76",
"output": "208"
},
{
"input": "0 100 100",
"output": "200"
},
{
"input": "100 0 100",
"output": "200"
},
{
"input": "100 1 100",
"output": "200"
},
{
"input": "1 100 100",
"output": "200"
},
{
"input": "100 100 0",
"output": "200"
},
{
"input": "100 100 1",
"output": "200"
},
{
"input": "1 2 1",
"output": "4"
},
{
"input": "0 0 100",
"output": "100"
},
{
"input": "0 100 0",
"output": "0"
},
{
"input": "100 0 0",
"output": "0"
},
{
"input": "10 8 7",
"output": "24"
},
{
"input": "45 47 16",
"output": "108"
},
{
"input": "59 43 100",
"output": "202"
},
{
"input": "34 1 30",
"output": "62"
},
{
"input": "14 81 1",
"output": "30"
},
{
"input": "53 96 94",
"output": "242"
},
{
"input": "62 81 75",
"output": "218"
},
{
"input": "21 71 97",
"output": "188"
},
{
"input": "49 82 73",
"output": "204"
},
{
"input": "88 19 29",
"output": "96"
},
{
"input": "89 4 62",
"output": "132"
},
{
"input": "58 3 65",
"output": "126"
},
{
"input": "27 86 11",
"output": "76"
},
{
"input": "35 19 80",
"output": "134"
},
{
"input": "4 86 74",
"output": "156"
},
{
"input": "32 61 89",
"output": "182"
},
{
"input": "68 60 98",
"output": "226"
},
{
"input": "37 89 34",
"output": "142"
},
{
"input": "92 9 28",
"output": "74"
},
{
"input": "79 58 98",
"output": "234"
},
{
"input": "35 44 88",
"output": "166"
},
{
"input": "16 24 19",
"output": "58"
},
{
"input": "74 71 75",
"output": "220"
},
{
"input": "83 86 99",
"output": "268"
},
{
"input": "97 73 15",
"output": "176"
},
{
"input": "77 76 73",
"output": "226"
},
{
"input": "48 85 55",
"output": "188"
},
{
"input": "1 2 2",
"output": "4"
},
{
"input": "2 2 2",
"output": "6"
},
{
"input": "2 1 2",
"output": "4"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "3 2 1",
"output": "6"
},
{
"input": "1 2 3",
"output": "6"
},
{
"input": "1 3 2",
"output": "6"
},
{
"input": "2 1 3",
"output": "6"
},
{
"input": "2 3 1",
"output": "6"
},
{
"input": "3 1 2",
"output": "6"
},
{
"input": "99 99 99",
"output": "296"
},
{
"input": "99 99 100",
"output": "298"
},
{
"input": "99 100 99",
"output": "298"
},
{
"input": "99 100 100",
"output": "298"
},
{
"input": "100 99 99",
"output": "298"
},
{
"input": "100 99 100",
"output": "298"
},
{
"input": "100 100 99",
"output": "298"
},
{
"input": "89 32 23",
"output": "110"
},
{
"input": "4 5 0",
"output": "8"
},
{
"input": "3 0 3",
"output": "6"
},
{
"input": "0 0 2",
"output": "2"
},
{
"input": "97 97 0",
"output": "194"
},
{
"input": "1 4 0",
"output": "2"
},
{
"input": "5 2 0",
"output": "4"
},
{
"input": "0 5 10",
"output": "14"
},
{
"input": "0 1 2",
"output": "2"
},
{
"input": "5 2 3",
"output": "10"
},
{
"input": "5 5 0",
"output": "10"
},
{
"input": "0 0 10",
"output": "10"
},
{
"input": "0 1 1",
"output": "2"
},
{
"input": "0 0 1",
"output": "0"
}
] | 1,579,257,569
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 79
| 109
| 307,200
|
def solve(l, r, a):
x = abs(l - r)
y = min(x, a)
x = min(l, r) + y
return (x + (a - y)//2)*2
def main():
l, r, a = list(map(int, input().split()))
print(solve(l, r, a))
main()
|
Title: Left-handers, Right-handers and Ambidexters
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are at a water bowling training. There are *l* people who play with their left hand, *r* people, who play with their right hand, and *a* ambidexters, who can play with left or right hand.
The coach decided to form a team of even number of players, exactly half of the players should play with their right hand, and exactly half of the players should play with their left hand. One player should use only on of his hands.
Ambidexters play as well with their right hand as with their left hand. In the team, an ambidexter can play with their left hand, or with their right hand.
Please find the maximum possible size of the team, where equal number of players use their left and right hands, respectively.
Input Specification:
The only line contains three integers *l*, *r* and *a* (0<=β€<=*l*,<=*r*,<=*a*<=β€<=100) β the number of left-handers, the number of right-handers and the number of ambidexters at the training.
Output Specification:
Print a single even integerΒ β the maximum number of players in the team. It is possible that the team can only have zero number of players.
Demo Input:
['1 4 2\n', '5 5 5\n', '0 2 0\n']
Demo Output:
['6\n', '14\n', '0\n']
Note:
In the first example you can form a team of 6 players. You should take the only left-hander and two ambidexters to play with left hand, and three right-handers to play with right hand. The only person left can't be taken into the team.
In the second example you can form a team of 14 people. You have to take all five left-handers, all five right-handers, two ambidexters to play with left hand and two ambidexters to play with right hand.
|
```python
def solve(l, r, a):
x = abs(l - r)
y = min(x, a)
x = min(l, r) + y
return (x + (a - y)//2)*2
def main():
l, r, a = list(map(int, input().split()))
print(solve(l, r, a))
main()
```
| 3
|
|
994
|
A
|
Fingerprints
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
You are locked in a room with a door that has a keypad with 10 keys corresponding to digits from 0 to 9. To escape from the room, you need to enter a correct code. You also have a sequence of digits.
Some keys on the keypad have fingerprints. You believe the correct code is the longest not necessarily contiguous subsequence of the sequence you have that only contains digits with fingerprints on the corresponding keys. Find such code.
|
The first line contains two integers $n$ and $m$ ($1 \le n, m \le 10$) representing the number of digits in the sequence you have and the number of keys on the keypad that have fingerprints.
The next line contains $n$ distinct space-separated integers $x_1, x_2, \ldots, x_n$ ($0 \le x_i \le 9$) representing the sequence.
The next line contains $m$ distinct space-separated integers $y_1, y_2, \ldots, y_m$ ($0 \le y_i \le 9$) β the keys with fingerprints.
|
In a single line print a space-separated sequence of integers representing the code. If the resulting sequence is empty, both printing nothing and printing a single line break is acceptable.
|
[
"7 3\n3 5 7 1 6 2 8\n1 2 7\n",
"4 4\n3 4 1 0\n0 1 7 9\n"
] |
[
"7 1 2\n",
"1 0\n"
] |
In the first example, the only digits with fingerprints are $1$, $2$ and $7$. All three of them appear in the sequence you know, $7$ first, then $1$ and then $2$. Therefore the output is 7 1 2. Note that the order is important, and shall be the same as the order in the original sequence.
In the second example digits $0$, $1$, $7$ and $9$ have fingerprints, however only $0$ and $1$ appear in the original sequence. $1$ appears earlier, so the output is 1 0. Again, the order is important.
| 500
|
[
{
"input": "7 3\n3 5 7 1 6 2 8\n1 2 7",
"output": "7 1 2"
},
{
"input": "4 4\n3 4 1 0\n0 1 7 9",
"output": "1 0"
},
{
"input": "9 4\n9 8 7 6 5 4 3 2 1\n2 4 6 8",
"output": "8 6 4 2"
},
{
"input": "10 5\n3 7 1 2 4 6 9 0 5 8\n4 3 0 7 9",
"output": "3 7 4 9 0"
},
{
"input": "10 10\n1 2 3 4 5 6 7 8 9 0\n4 5 6 7 1 2 3 0 9 8",
"output": "1 2 3 4 5 6 7 8 9 0"
},
{
"input": "1 1\n4\n4",
"output": "4"
},
{
"input": "3 7\n6 3 4\n4 9 0 1 7 8 6",
"output": "6 4"
},
{
"input": "10 1\n9 0 8 1 7 4 6 5 2 3\n0",
"output": "0"
},
{
"input": "5 10\n6 0 3 8 1\n3 1 0 5 4 7 2 8 9 6",
"output": "6 0 3 8 1"
},
{
"input": "8 2\n7 2 9 6 1 0 3 4\n6 3",
"output": "6 3"
},
{
"input": "5 4\n7 0 1 4 9\n0 9 5 3",
"output": "0 9"
},
{
"input": "10 1\n9 6 2 0 1 8 3 4 7 5\n6",
"output": "6"
},
{
"input": "10 2\n7 1 0 2 4 6 5 9 3 8\n3 2",
"output": "2 3"
},
{
"input": "5 9\n3 7 9 2 4\n3 8 4 5 9 6 1 0 2",
"output": "3 9 2 4"
},
{
"input": "10 6\n7 1 2 3 8 0 6 4 5 9\n1 5 8 2 3 6",
"output": "1 2 3 8 6 5"
},
{
"input": "8 2\n7 4 8 9 2 5 6 1\n6 4",
"output": "4 6"
},
{
"input": "10 2\n1 0 3 5 8 9 4 7 6 2\n0 3",
"output": "0 3"
},
{
"input": "7 6\n9 2 8 6 1 3 7\n4 2 0 3 1 8",
"output": "2 8 1 3"
},
{
"input": "1 6\n3\n6 8 2 4 5 3",
"output": "3"
},
{
"input": "1 8\n0\n9 2 4 8 1 5 0 7",
"output": "0"
},
{
"input": "6 9\n7 3 9 4 1 0\n9 1 5 8 0 6 2 7 4",
"output": "7 9 4 1 0"
},
{
"input": "10 2\n4 9 6 8 3 0 1 5 7 2\n0 1",
"output": "0 1"
},
{
"input": "10 5\n5 2 8 0 9 7 6 1 4 3\n9 6 4 1 2",
"output": "2 9 6 1 4"
},
{
"input": "6 3\n8 3 9 2 7 6\n5 4 3",
"output": "3"
},
{
"input": "4 10\n8 3 9 6\n4 9 6 2 7 0 8 1 3 5",
"output": "8 3 9 6"
},
{
"input": "1 2\n1\n1 0",
"output": "1"
},
{
"input": "3 6\n1 2 3\n4 5 6 1 2 3",
"output": "1 2 3"
},
{
"input": "1 2\n2\n1 2",
"output": "2"
},
{
"input": "1 10\n9\n0 1 2 3 4 5 6 7 8 9",
"output": "9"
}
] | 1,573,106,381
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 31
| 109
| 0
|
n,m=[int(x) for x in input().split()]
l=[int(x) for x in input().split()]
a=[int(x) for x in input().split()]
res=[]
for i in l:
if i in a:
res.append(i)
print(*res,sep=' ')
|
Title: Fingerprints
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are locked in a room with a door that has a keypad with 10 keys corresponding to digits from 0 to 9. To escape from the room, you need to enter a correct code. You also have a sequence of digits.
Some keys on the keypad have fingerprints. You believe the correct code is the longest not necessarily contiguous subsequence of the sequence you have that only contains digits with fingerprints on the corresponding keys. Find such code.
Input Specification:
The first line contains two integers $n$ and $m$ ($1 \le n, m \le 10$) representing the number of digits in the sequence you have and the number of keys on the keypad that have fingerprints.
The next line contains $n$ distinct space-separated integers $x_1, x_2, \ldots, x_n$ ($0 \le x_i \le 9$) representing the sequence.
The next line contains $m$ distinct space-separated integers $y_1, y_2, \ldots, y_m$ ($0 \le y_i \le 9$) β the keys with fingerprints.
Output Specification:
In a single line print a space-separated sequence of integers representing the code. If the resulting sequence is empty, both printing nothing and printing a single line break is acceptable.
Demo Input:
['7 3\n3 5 7 1 6 2 8\n1 2 7\n', '4 4\n3 4 1 0\n0 1 7 9\n']
Demo Output:
['7 1 2\n', '1 0\n']
Note:
In the first example, the only digits with fingerprints are $1$, $2$ and $7$. All three of them appear in the sequence you know, $7$ first, then $1$ and then $2$. Therefore the output is 7 1 2. Note that the order is important, and shall be the same as the order in the original sequence.
In the second example digits $0$, $1$, $7$ and $9$ have fingerprints, however only $0$ and $1$ appear in the original sequence. $1$ appears earlier, so the output is 1 0. Again, the order is important.
|
```python
n,m=[int(x) for x in input().split()]
l=[int(x) for x in input().split()]
a=[int(x) for x in input().split()]
res=[]
for i in l:
if i in a:
res.append(i)
print(*res,sep=' ')
```
| 3
|
|
11
|
A
|
Increasing Sequence
|
PROGRAMMING
| 900
|
[
"constructive algorithms",
"implementation",
"math"
] |
A. Increasing Sequence
|
1
|
64
|
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing?
|
The first line of the input contains two integer numbers *n* and *d* (2<=β€<=*n*<=β€<=2000,<=1<=β€<=*d*<=β€<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=β€<=*b**i*<=β€<=106).
|
Output the minimal number of moves needed to make the sequence increasing.
|
[
"4 2\n1 3 3 2\n"
] |
[
"3\n"
] |
none
| 0
|
[
{
"input": "4 2\n1 3 3 2",
"output": "3"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 1\n2 5",
"output": "0"
},
{
"input": "2 1\n1 2",
"output": "0"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 7\n10 20",
"output": "0"
},
{
"input": "2 7\n1 1",
"output": "1"
},
{
"input": "3 3\n18 1 9",
"output": "10"
},
{
"input": "3 3\n15 17 9",
"output": "3"
},
{
"input": "3 3\n10 9 12",
"output": "2"
},
{
"input": "10 3\n2 1 17 10 5 16 8 4 15 17",
"output": "31"
},
{
"input": "10 3\n6 11 4 12 22 15 23 26 24 26",
"output": "13"
},
{
"input": "10 3\n10 24 13 15 18 14 15 26 33 35",
"output": "29"
},
{
"input": "100 3\n529 178 280 403 326 531 671 427 188 866 669 646 421 804 494 609 53 1012 211 243 887 833 900 543 226 42 859 718 454 372 971 692 846 770 511 395 499 479 641 756 115 269 206 45 1039 727 400 779 859 614 146 214 196 919 702 959 380 830 535 878 859 784 316 305 782 924 536 243 236 978 564 150 291 877 808 983 537 839 490 120 168 838 267 650 900 170 211 504 326 771 895 984 994 483 776 100 471 1078 317 580",
"output": "15717"
},
{
"input": "100 3\n329 226 331 909 962 112 837 1005 194 818 506 416 125 648 367 459 400 582 989 547 329 438 234 121 272 226 821 376 834 427 718 164 834 113 654 177 737 212 169 696 744 180 89 944 233 147 667 990 809 1072 1085 1093 814 265 1067 312 833 572 303 901 1032 504 185 817 389 158 613 723 239 269 911 352 769 404 225 822 897 606 947 323 913 804 923 1084 552 901 486 249 209 898 847 610 728 1122 986 669 1116 1076 367 327",
"output": "16133"
}
] | 1,598,711,889
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 25
| 310
| 1,843,200
|
n,d = map(int,input().split())
bi = list(map(int,input().split()))
maxn = bi[0]
ans = 0
for i in range(1,n):
maxn = max(maxn+1,bi[i])
n = (maxn - bi[i])//d + int((maxn - bi[i])% d != 0)
maxn = bi[i] + n * d
ans += n
print(ans)
|
Title: Increasing Sequence
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing?
Input Specification:
The first line of the input contains two integer numbers *n* and *d* (2<=β€<=*n*<=β€<=2000,<=1<=β€<=*d*<=β€<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=β€<=*b**i*<=β€<=106).
Output Specification:
Output the minimal number of moves needed to make the sequence increasing.
Demo Input:
['4 2\n1 3 3 2\n']
Demo Output:
['3\n']
Note:
none
|
```python
n,d = map(int,input().split())
bi = list(map(int,input().split()))
maxn = bi[0]
ans = 0
for i in range(1,n):
maxn = max(maxn+1,bi[i])
n = (maxn - bi[i])//d + int((maxn - bi[i])% d != 0)
maxn = bi[i] + n * d
ans += n
print(ans)
```
| 3.831267
|
80
|
A
|
Panoramix's Prediction
|
PROGRAMMING
| 800
|
[
"brute force"
] |
A. Panoramix's Prediction
|
2
|
256
|
A prime number is a number which has exactly two distinct divisors: one and itself. For example, numbers 2, 7, 3 are prime, and 1, 6, 4 are not.
The next prime number after *x* is the smallest prime number greater than *x*. For example, the next prime number after 2 is 3, and the next prime number after 3 is 5. Note that there is exactly one next prime number after each number. So 5 isΒ not the next prime number for 2.
One cold April morning Panoramix predicted that soon Kakofonix will break free from his straitjacket, and this will be a black day for the residents of the Gallic countryside.
Panoramix's prophecy tells that if some day Asterix and Obelix beat exactly *x* Roman soldiers, where *x* is a prime number, and next day they beat exactly *y* Roman soldiers, where *y* is the next prime number after *x*, then it's time to wait for Armageddon, for nothing can shut Kakofonix up while he sings his infernal song.
Yesterday the Gauls beat *n* Roman soldiers and it turned out that the number *n* was prime! Today their victims were a troop of *m* Romans (*m*<=><=*n*). Determine whether the Gauls should wait for the black day after today's victory of Asterix and Obelix?
|
The first and only input line contains two positive integers β *n* and *m* (2<=β€<=*n*<=<<=*m*<=β€<=50). It is guaranteed that *n* is prime.
Pretests contain all the cases with restrictions 2<=β€<=*n*<=<<=*m*<=β€<=4.
|
Print YES, if *m* is the next prime number after *n*, or NO otherwise.
|
[
"3 5\n",
"7 11\n",
"7 9\n"
] |
[
"YES",
"YES",
"NO"
] |
none
| 500
|
[
{
"input": "3 5",
"output": "YES"
},
{
"input": "7 11",
"output": "YES"
},
{
"input": "7 9",
"output": "NO"
},
{
"input": "2 3",
"output": "YES"
},
{
"input": "2 4",
"output": "NO"
},
{
"input": "3 4",
"output": "NO"
},
{
"input": "3 5",
"output": "YES"
},
{
"input": "5 7",
"output": "YES"
},
{
"input": "7 11",
"output": "YES"
},
{
"input": "11 13",
"output": "YES"
},
{
"input": "13 17",
"output": "YES"
},
{
"input": "17 19",
"output": "YES"
},
{
"input": "19 23",
"output": "YES"
},
{
"input": "23 29",
"output": "YES"
},
{
"input": "29 31",
"output": "YES"
},
{
"input": "31 37",
"output": "YES"
},
{
"input": "37 41",
"output": "YES"
},
{
"input": "41 43",
"output": "YES"
},
{
"input": "43 47",
"output": "YES"
},
{
"input": "2 5",
"output": "NO"
},
{
"input": "2 7",
"output": "NO"
},
{
"input": "2 6",
"output": "NO"
},
{
"input": "2 11",
"output": "NO"
},
{
"input": "3 6",
"output": "NO"
},
{
"input": "3 7",
"output": "NO"
},
{
"input": "3 9",
"output": "NO"
},
{
"input": "5 6",
"output": "NO"
},
{
"input": "5 9",
"output": "NO"
},
{
"input": "5 11",
"output": "NO"
},
{
"input": "5 13",
"output": "NO"
},
{
"input": "5 15",
"output": "NO"
},
{
"input": "7 8",
"output": "NO"
},
{
"input": "7 13",
"output": "NO"
},
{
"input": "13 15",
"output": "NO"
},
{
"input": "13 17",
"output": "YES"
},
{
"input": "19 21",
"output": "NO"
},
{
"input": "13 20",
"output": "NO"
},
{
"input": "41 49",
"output": "NO"
},
{
"input": "43 49",
"output": "NO"
},
{
"input": "47 50",
"output": "NO"
},
{
"input": "47 49",
"output": "NO"
},
{
"input": "47 48",
"output": "NO"
},
{
"input": "23 25",
"output": "NO"
},
{
"input": "2 50",
"output": "NO"
},
{
"input": "31 33",
"output": "NO"
}
] | 1,652,515,834
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 45
| 124
| 0
|
ls = [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47]
n, m = map(int, input().split())
if m == n:
print('NO')
elif m < n:
print('NO')
else:
if n in ls and m in ls:
x = ls.index(n)
y = ls.index(m)
if y - x == 1:
print('YES')
else:
print('NO')
else:
print('NO')
|
Title: Panoramix's Prediction
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
A prime number is a number which has exactly two distinct divisors: one and itself. For example, numbers 2, 7, 3 are prime, and 1, 6, 4 are not.
The next prime number after *x* is the smallest prime number greater than *x*. For example, the next prime number after 2 is 3, and the next prime number after 3 is 5. Note that there is exactly one next prime number after each number. So 5 isΒ not the next prime number for 2.
One cold April morning Panoramix predicted that soon Kakofonix will break free from his straitjacket, and this will be a black day for the residents of the Gallic countryside.
Panoramix's prophecy tells that if some day Asterix and Obelix beat exactly *x* Roman soldiers, where *x* is a prime number, and next day they beat exactly *y* Roman soldiers, where *y* is the next prime number after *x*, then it's time to wait for Armageddon, for nothing can shut Kakofonix up while he sings his infernal song.
Yesterday the Gauls beat *n* Roman soldiers and it turned out that the number *n* was prime! Today their victims were a troop of *m* Romans (*m*<=><=*n*). Determine whether the Gauls should wait for the black day after today's victory of Asterix and Obelix?
Input Specification:
The first and only input line contains two positive integers β *n* and *m* (2<=β€<=*n*<=<<=*m*<=β€<=50). It is guaranteed that *n* is prime.
Pretests contain all the cases with restrictions 2<=β€<=*n*<=<<=*m*<=β€<=4.
Output Specification:
Print YES, if *m* is the next prime number after *n*, or NO otherwise.
Demo Input:
['3 5\n', '7 11\n', '7 9\n']
Demo Output:
['YES', 'YES', 'NO']
Note:
none
|
```python
ls = [2, 3, 5, 7, 11, 13, 17, 19, 23, 29, 31, 37, 41, 43, 47]
n, m = map(int, input().split())
if m == n:
print('NO')
elif m < n:
print('NO')
else:
if n in ls and m in ls:
x = ls.index(n)
y = ls.index(m)
if y - x == 1:
print('YES')
else:
print('NO')
else:
print('NO')
```
| 3.969
|
466
|
C
|
Number of Ways
|
PROGRAMMING
| 1,700
|
[
"binary search",
"brute force",
"data structures",
"dp",
"two pointers"
] | null | null |
You've got array *a*[1],<=*a*[2],<=...,<=*a*[*n*], consisting of *n* integers. Count the number of ways to split all the elements of the array into three contiguous parts so that the sum of elements in each part is the same.
More formally, you need to find the number of such pairs of indices *i*,<=*j* (2<=β€<=*i*<=β€<=*j*<=β€<=*n*<=-<=1), that .
|
The first line contains integer *n* (1<=β€<=*n*<=β€<=5Β·105), showing how many numbers are in the array. The second line contains *n* integers *a*[1], *a*[2], ..., *a*[*n*] (|*a*[*i*]|<=β€<=<=109) β the elements of array *a*.
|
Print a single integer β the number of ways to split the array into three parts with the same sum.
|
[
"5\n1 2 3 0 3\n",
"4\n0 1 -1 0\n",
"2\n4 1\n"
] |
[
"2\n",
"1\n",
"0\n"
] |
none
| 1,500
|
[
{
"input": "5\n1 2 3 0 3",
"output": "2"
},
{
"input": "4\n0 1 -1 0",
"output": "1"
},
{
"input": "2\n4 1",
"output": "0"
},
{
"input": "9\n0 0 0 0 0 0 0 0 0",
"output": "28"
},
{
"input": "10\n2 5 -2 2 -3 -2 3 5 -5 -2",
"output": "0"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "3\n1 2 3",
"output": "0"
},
{
"input": "100\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1",
"output": "2030"
},
{
"input": "6\n1000000000 1000000000 1000000000 1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "10\n1 0 0 0 1 1 1 0 1 1",
"output": "2"
},
{
"input": "10\n-2 2 -2 0 -2 -1 1 -1 2 0",
"output": "0"
},
{
"input": "4\n0 2 -1 2",
"output": "0"
},
{
"input": "5\n3 3 -3 3 3",
"output": "3"
},
{
"input": "5\n1 1 1 1 1",
"output": "0"
},
{
"input": "8\n-1 -1 -1 -1 -1 -1 -1 -1",
"output": "0"
},
{
"input": "2\n0 0",
"output": "0"
},
{
"input": "4\n1 -1 0 0",
"output": "1"
},
{
"input": "3\n6 -3 6",
"output": "0"
}
] | 1,699,580,934
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 358
| 62,361,600
|
N=int(input())
arr=list(map(int,input().split()))
s=sum(arr)
if s%3!=0:
print('0')
else:
s=s//3
L=count=0
tot=arr[0]
for i in arr[1:]:
if tot == s*2:
count+=L
if tot == s:
L+=1
tot+=i
print(count)
|
Title: Number of Ways
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've got array *a*[1],<=*a*[2],<=...,<=*a*[*n*], consisting of *n* integers. Count the number of ways to split all the elements of the array into three contiguous parts so that the sum of elements in each part is the same.
More formally, you need to find the number of such pairs of indices *i*,<=*j* (2<=β€<=*i*<=β€<=*j*<=β€<=*n*<=-<=1), that .
Input Specification:
The first line contains integer *n* (1<=β€<=*n*<=β€<=5Β·105), showing how many numbers are in the array. The second line contains *n* integers *a*[1], *a*[2], ..., *a*[*n*] (|*a*[*i*]|<=β€<=<=109) β the elements of array *a*.
Output Specification:
Print a single integer β the number of ways to split the array into three parts with the same sum.
Demo Input:
['5\n1 2 3 0 3\n', '4\n0 1 -1 0\n', '2\n4 1\n']
Demo Output:
['2\n', '1\n', '0\n']
Note:
none
|
```python
N=int(input())
arr=list(map(int,input().split()))
s=sum(arr)
if s%3!=0:
print('0')
else:
s=s//3
L=count=0
tot=arr[0]
for i in arr[1:]:
if tot == s*2:
count+=L
if tot == s:
L+=1
tot+=i
print(count)
```
| 3
|
|
387
|
B
|
George and Round
|
PROGRAMMING
| 1,200
|
[
"brute force",
"greedy",
"two pointers"
] | null | null |
George decided to prepare a Codesecrof round, so he has prepared *m* problems for the round. Let's number the problems with integers 1 through *m*. George estimates the *i*-th problem's complexity by integer *b**i*.
To make the round good, he needs to put at least *n* problems there. Besides, he needs to have at least one problem with complexity exactly *a*1, at least one with complexity exactly *a*2, ..., and at least one with complexity exactly *a**n*. Of course, the round can also have problems with other complexities.
George has a poor imagination. It's easier for him to make some already prepared problem simpler than to come up with a new one and prepare it. George is magnificent at simplifying problems. He can simplify any already prepared problem with complexity *c* to any positive integer complexity *d* (*c*<=β₯<=*d*), by changing limits on the input data.
However, nothing is so simple. George understood that even if he simplifies some problems, he can run out of problems for a good round. That's why he decided to find out the minimum number of problems he needs to come up with in addition to the *m* he's prepared in order to make a good round. Note that George can come up with a new problem of any complexity.
|
The first line contains two integers *n* and *m* (1<=β€<=*n*,<=*m*<=β€<=3000) β the minimal number of problems in a good round and the number of problems George's prepared. The second line contains space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*<=β€<=106) β the requirements for the complexity of the problems in a good round. The third line contains space-separated integers *b*1,<=*b*2,<=...,<=*b**m* (1<=β€<=*b*1<=β€<=*b*2...<=β€<=*b**m*<=β€<=106) β the complexities of the problems prepared by George.
|
Print a single integer β the answer to the problem.
|
[
"3 5\n1 2 3\n1 2 2 3 3\n",
"3 5\n1 2 3\n1 1 1 1 1\n",
"3 1\n2 3 4\n1\n"
] |
[
"0\n",
"2\n",
"3\n"
] |
In the first sample the set of the prepared problems meets the requirements for a good round.
In the second sample, it is enough to come up with and prepare two problems with complexities 2 and 3 to get a good round.
In the third sample it is very easy to get a good round if come up with and prepare extra problems with complexities: 2,β3,β4.
| 1,000
|
[
{
"input": "3 5\n1 2 3\n1 2 2 3 3",
"output": "0"
},
{
"input": "3 5\n1 2 3\n1 1 1 1 1",
"output": "2"
},
{
"input": "3 1\n2 3 4\n1",
"output": "3"
},
{
"input": "29 100\n20 32 41 67 72 155 331 382 399 412 465 470 484 511 515 529 616 637 679 715 733 763 826 843 862 903 925 979 989\n15 15 15 17 18 19 19 20 21 21 22 24 25 26 26 27 28 31 32 32 37 38 38 39 39 40 41 42 43 43 45 45 46 47 49 49 50 50 50 51 52 53 53 55 56 57 59 59 59 60 60 62 62 63 63 64 64 64 66 67 69 69 70 70 72 72 73 74 75 76 77 78 80 80 81 81 83 83 83 84 86 86 86 86 87 88 89 91 91 91 92 93 94 94 96 97 97 97 98 98",
"output": "24"
}
] | 1,606,040,105
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 41
| 109
| 614,400
|
[n, m] = list(map(int, input().split()))
a = list(map(int, input().split()))[:n]
b = list(map(int, input().split()))[:m]
result = 0
j = 0
for i in range(n):
while(j < m):
if(a[i] <= b[j]):
result = result + 1
j = j + 1
break
j = j + 1
print(n - result)
|
Title: George and Round
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
George decided to prepare a Codesecrof round, so he has prepared *m* problems for the round. Let's number the problems with integers 1 through *m*. George estimates the *i*-th problem's complexity by integer *b**i*.
To make the round good, he needs to put at least *n* problems there. Besides, he needs to have at least one problem with complexity exactly *a*1, at least one with complexity exactly *a*2, ..., and at least one with complexity exactly *a**n*. Of course, the round can also have problems with other complexities.
George has a poor imagination. It's easier for him to make some already prepared problem simpler than to come up with a new one and prepare it. George is magnificent at simplifying problems. He can simplify any already prepared problem with complexity *c* to any positive integer complexity *d* (*c*<=β₯<=*d*), by changing limits on the input data.
However, nothing is so simple. George understood that even if he simplifies some problems, he can run out of problems for a good round. That's why he decided to find out the minimum number of problems he needs to come up with in addition to the *m* he's prepared in order to make a good round. Note that George can come up with a new problem of any complexity.
Input Specification:
The first line contains two integers *n* and *m* (1<=β€<=*n*,<=*m*<=β€<=3000) β the minimal number of problems in a good round and the number of problems George's prepared. The second line contains space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a*1<=<<=*a*2<=<<=...<=<<=*a**n*<=β€<=106) β the requirements for the complexity of the problems in a good round. The third line contains space-separated integers *b*1,<=*b*2,<=...,<=*b**m* (1<=β€<=*b*1<=β€<=*b*2...<=β€<=*b**m*<=β€<=106) β the complexities of the problems prepared by George.
Output Specification:
Print a single integer β the answer to the problem.
Demo Input:
['3 5\n1 2 3\n1 2 2 3 3\n', '3 5\n1 2 3\n1 1 1 1 1\n', '3 1\n2 3 4\n1\n']
Demo Output:
['0\n', '2\n', '3\n']
Note:
In the first sample the set of the prepared problems meets the requirements for a good round.
In the second sample, it is enough to come up with and prepare two problems with complexities 2 and 3 to get a good round.
In the third sample it is very easy to get a good round if come up with and prepare extra problems with complexities: 2,β3,β4.
|
```python
[n, m] = list(map(int, input().split()))
a = list(map(int, input().split()))[:n]
b = list(map(int, input().split()))[:m]
result = 0
j = 0
for i in range(n):
while(j < m):
if(a[i] <= b[j]):
result = result + 1
j = j + 1
break
j = j + 1
print(n - result)
```
| 3
|
|
408
|
A
|
Line to Cashier
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Little Vasya went to the supermarket to get some groceries. He walked about the supermarket for a long time and got a basket full of products. Now he needs to choose the cashier to pay for the products.
There are *n* cashiers at the exit from the supermarket. At the moment the queue for the *i*-th cashier already has *k**i* people. The *j*-th person standing in the queue to the *i*-th cashier has *m**i*,<=*j* items in the basket. Vasya knows that:
- the cashier needs 5 seconds to scan one item; - after the cashier scans each item of some customer, he needs 15 seconds to take the customer's money and give him the change.
Of course, Vasya wants to select a queue so that he can leave the supermarket as soon as possible. Help him write a program that displays the minimum number of seconds after which Vasya can get to one of the cashiers.
|
The first line contains integer *n* (1<=β€<=*n*<=β€<=100)Β β the number of cashes in the shop. The second line contains *n* space-separated integers: *k*1,<=*k*2,<=...,<=*k**n* (1<=β€<=*k**i*<=β€<=100), where *k**i* is the number of people in the queue to the *i*-th cashier.
The *i*-th of the next *n* lines contains *k**i* space-separated integers: *m**i*,<=1,<=*m**i*,<=2,<=...,<=*m**i*,<=*k**i* (1<=β€<=*m**i*,<=*j*<=β€<=100)Β β the number of products the *j*-th person in the queue for the *i*-th cash has.
|
Print a single integer β the minimum number of seconds Vasya needs to get to the cashier.
|
[
"1\n1\n1\n",
"4\n1 4 3 2\n100\n1 2 2 3\n1 9 1\n7 8\n"
] |
[
"20\n",
"100\n"
] |
In the second test sample, if Vasya goes to the first queue, he gets to the cashier in 100Β·5β+β15β=β515 seconds. But if he chooses the second queue, he will need 1Β·5β+β2Β·5β+β2Β·5β+β3Β·5β+β4Β·15β=β100 seconds. He will need 1Β·5β+β9Β·5β+β1Β·5β+β3Β·15β=β100 seconds for the third one and 7Β·5β+β8Β·5β+β2Β·15β=β105 seconds for the fourth one. Thus, Vasya gets to the cashier quicker if he chooses the second or the third queue.
| 500
|
[
{
"input": "1\n1\n1",
"output": "20"
},
{
"input": "4\n1 4 3 2\n100\n1 2 2 3\n1 9 1\n7 8",
"output": "100"
},
{
"input": "4\n5 4 5 5\n3 1 3 1 2\n3 1 1 3\n1 1 1 2 2\n2 2 1 1 3",
"output": "100"
},
{
"input": "5\n5 3 6 6 4\n7 5 3 3 9\n6 8 2\n1 10 8 5 9 2\n9 7 8 5 9 10\n9 8 3 3",
"output": "125"
},
{
"input": "5\n10 10 10 10 10\n6 7 8 6 8 5 9 8 10 5\n9 6 9 8 7 8 8 10 8 5\n8 7 7 8 7 5 6 8 9 5\n6 5 10 5 5 10 7 8 5 5\n10 9 8 7 6 9 7 9 6 5",
"output": "480"
},
{
"input": "10\n9 10 10 10 9 5 9 7 8 7\n11 6 10 4 4 15 7 15 5\n3 9 11 12 11 1 13 13 1 5\n6 15 9 12 3 2 8 12 11 10\n7 1 1 6 10 2 6 1 14 2\n8 14 2 3 6 1 14 1 12\n6 10 9 3 5\n13 12 12 7 13 4 4 8 10\n5 6 4 3 14 9 13\n8 12 1 5 7 4 13 1\n1 9 5 3 5 1 4",
"output": "240"
},
{
"input": "10\n5 5 5 5 5 5 5 5 5 5\n5 5 4 5 4\n6 5 7 7 6\n5 4 4 5 5\n4 4 5 5 5\n7 6 4 5 7\n4 6 5 4 5\n6 6 7 6 6\n4 5 4 4 7\n7 5 4 4 5\n6 6 7 4 4",
"output": "190"
},
{
"input": "1\n1\n100",
"output": "515"
},
{
"input": "1\n90\n90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90 90",
"output": "41850"
}
] | 1,539,191,683
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 20
| 124
| 0
|
n=int(input())
a= list(map(int, input().split()))
b=[]
for i in range(n):
c= list(map(int, input().split()))
temp=sum(c)*5+a[i]*15
b.append(temp)
print(min(b))
|
Title: Line to Cashier
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Vasya went to the supermarket to get some groceries. He walked about the supermarket for a long time and got a basket full of products. Now he needs to choose the cashier to pay for the products.
There are *n* cashiers at the exit from the supermarket. At the moment the queue for the *i*-th cashier already has *k**i* people. The *j*-th person standing in the queue to the *i*-th cashier has *m**i*,<=*j* items in the basket. Vasya knows that:
- the cashier needs 5 seconds to scan one item; - after the cashier scans each item of some customer, he needs 15 seconds to take the customer's money and give him the change.
Of course, Vasya wants to select a queue so that he can leave the supermarket as soon as possible. Help him write a program that displays the minimum number of seconds after which Vasya can get to one of the cashiers.
Input Specification:
The first line contains integer *n* (1<=β€<=*n*<=β€<=100)Β β the number of cashes in the shop. The second line contains *n* space-separated integers: *k*1,<=*k*2,<=...,<=*k**n* (1<=β€<=*k**i*<=β€<=100), where *k**i* is the number of people in the queue to the *i*-th cashier.
The *i*-th of the next *n* lines contains *k**i* space-separated integers: *m**i*,<=1,<=*m**i*,<=2,<=...,<=*m**i*,<=*k**i* (1<=β€<=*m**i*,<=*j*<=β€<=100)Β β the number of products the *j*-th person in the queue for the *i*-th cash has.
Output Specification:
Print a single integer β the minimum number of seconds Vasya needs to get to the cashier.
Demo Input:
['1\n1\n1\n', '4\n1 4 3 2\n100\n1 2 2 3\n1 9 1\n7 8\n']
Demo Output:
['20\n', '100\n']
Note:
In the second test sample, if Vasya goes to the first queue, he gets to the cashier in 100Β·5β+β15β=β515 seconds. But if he chooses the second queue, he will need 1Β·5β+β2Β·5β+β2Β·5β+β3Β·5β+β4Β·15β=β100 seconds. He will need 1Β·5β+β9Β·5β+β1Β·5β+β3Β·15β=β100 seconds for the third one and 7Β·5β+β8Β·5β+β2Β·15β=β105 seconds for the fourth one. Thus, Vasya gets to the cashier quicker if he chooses the second or the third queue.
|
```python
n=int(input())
a= list(map(int, input().split()))
b=[]
for i in range(n):
c= list(map(int, input().split()))
temp=sum(c)*5+a[i]*15
b.append(temp)
print(min(b))
```
| 3
|
|
266
|
B
|
Queue at the School
|
PROGRAMMING
| 800
|
[
"constructive algorithms",
"graph matchings",
"implementation",
"shortest paths"
] | null | null |
During the break the schoolchildren, boys and girls, formed a queue of *n* people in the canteen. Initially the children stood in the order they entered the canteen. However, after a while the boys started feeling awkward for standing in front of the girls in the queue and they started letting the girls move forward each second.
Let's describe the process more precisely. Let's say that the positions in the queue are sequentially numbered by integers from 1 to *n*, at that the person in the position number 1 is served first. Then, if at time *x* a boy stands on the *i*-th position and a girl stands on the (*i*<=+<=1)-th position, then at time *x*<=+<=1 the *i*-th position will have a girl and the (*i*<=+<=1)-th position will have a boy. The time is given in seconds.
You've got the initial position of the children, at the initial moment of time. Determine the way the queue is going to look after *t* seconds.
|
The first line contains two integers *n* and *t* (1<=β€<=*n*,<=*t*<=β€<=50), which represent the number of children in the queue and the time after which the queue will transform into the arrangement you need to find.
The next line contains string *s*, which represents the schoolchildren's initial arrangement. If the *i*-th position in the queue contains a boy, then the *i*-th character of string *s* equals "B", otherwise the *i*-th character equals "G".
|
Print string *a*, which describes the arrangement after *t* seconds. If the *i*-th position has a boy after the needed time, then the *i*-th character *a* must equal "B", otherwise it must equal "G".
|
[
"5 1\nBGGBG\n",
"5 2\nBGGBG\n",
"4 1\nGGGB\n"
] |
[
"GBGGB\n",
"GGBGB\n",
"GGGB\n"
] |
none
| 500
|
[
{
"input": "5 1\nBGGBG",
"output": "GBGGB"
},
{
"input": "5 2\nBGGBG",
"output": "GGBGB"
},
{
"input": "4 1\nGGGB",
"output": "GGGB"
},
{
"input": "2 1\nBB",
"output": "BB"
},
{
"input": "2 1\nBG",
"output": "GB"
},
{
"input": "6 2\nBBGBBG",
"output": "GBBGBB"
},
{
"input": "8 3\nBBGBGBGB",
"output": "GGBGBBBB"
},
{
"input": "10 3\nBBGBBBBBBG",
"output": "GBBBBBGBBB"
},
{
"input": "22 7\nGBGGBGGGGGBBBGGBGBGBBB",
"output": "GGGGGGGGBGGBGGBBBBBBBB"
},
{
"input": "50 4\nGBBGBBBGGGGGBBGGBBBBGGGBBBGBBBGGBGGBGBBBGGBGGBGGBG",
"output": "GGBGBGBGBGBGGGBBGBGBGBGBBBGBGBGBGBGBGBGBGBGBGGBGBB"
},
{
"input": "50 8\nGGGGBGGBGGGBGBBBGGGGGGGGBBGBGBGBBGGBGGBGGGGGGGGBBG",
"output": "GGGGGGGGGGGGBGGBGBGBGBGBGGGGGGBGBGBGBGBGBGGBGGBGBB"
},
{
"input": "50 30\nBGGGGGGBGGBGBGGGGBGBBGBBBGGBBBGBGBGGGGGBGBBGBGBGGG",
"output": "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "20 20\nBBGGBGGGGBBBGBBGGGBB",
"output": "GGGGGGGGGGBBBBBBBBBB"
},
{
"input": "27 6\nGBGBGBGGGGGGBGGBGGBBGBBBGBB",
"output": "GGGGGGGBGBGBGGGGGBGBBBBBBBB"
},
{
"input": "46 11\nBGGGGGBGBGGBGGGBBGBBGBBGGBBGBBGBGGGGGGGBGBGBGB",
"output": "GGGGGGGGGGGBGGGGGBBGBGBGBGBGBGBGBGBGBGBGBBBBBB"
},
{
"input": "50 6\nBGGBBBBGGBBBBBBGGBGBGBBBBGBBBBBBGBBBBBBBBBBBBBBBBB",
"output": "GGGGBBBBBGBGBGBGBBBGBBBBBBGBBBBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "50 10\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB",
"output": "BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "50 8\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"
},
{
"input": "50 10\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBGB",
"output": "BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBGBBBBBBBBBBB"
},
{
"input": "50 13\nGGGBGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "GGGGGGGGGGGGGGGGBGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG"
},
{
"input": "1 1\nB",
"output": "B"
},
{
"input": "1 1\nG",
"output": "G"
},
{
"input": "1 50\nB",
"output": "B"
},
{
"input": "1 50\nG",
"output": "G"
},
{
"input": "50 50\nBBBBBBBBGGBBBBBBGBBBBBBBBBBBGBBBBBBBBBBBBBBGBBBBBB",
"output": "GGGGGBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "50 50\nGGBBGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBBGGGGGGBG",
"output": "GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGBBBBB"
},
{
"input": "6 3\nGGBBBG",
"output": "GGGBBB"
},
{
"input": "26 3\nGBBGBBBBBGGGBGBGGGBGBGGBBG",
"output": "GGBBBBGBGBGBGGGBGBGGGBGBBB"
},
{
"input": "46 3\nGGBBGGGGBBGBGBBBBBGGGBGGGBBGGGBBBGGBGGBBBGBGBB",
"output": "GGGGBGBGGGBBBBBGBGBGBGGGBGGBGBGBGBGBGBGBGBBBBB"
},
{
"input": "44 8\nBGBBBBBBBBBGGBBGBGBGGBBBBBGBBGBBBBBBBBBGBBGB",
"output": "GBBGBGBGBGBGBGBBBBGBBGBBBBBBBBBGBBGBBBBBBBBB"
},
{
"input": "20 20\nBBGGBGGGGBBBGBBGGGBB",
"output": "GGGGGGGGGGBBBBBBBBBB"
},
{
"input": "30 25\nBGGBBGBGGBGBGBBGBGGGGBGBGGBBBB",
"output": "GGGGGGGGGGGGGGGBBBBBBBBBBBBBBB"
},
{
"input": "17 42\nBBGBGBGGGGGGBBGGG",
"output": "GGGGGGGGGGGBBBBBB"
},
{
"input": "30 50\nBGGBBGGGGGGGGBBGGGBBGGBBBGBBGG",
"output": "GGGGGGGGGGGGGGGGGGBBBBBBBBBBBB"
},
{
"input": "31 33\nBBGGBBGGBGBBBBGGBGBBBGBGGBBGBBB",
"output": "GGGGGGGGGGGGBBBBBBBBBBBBBBBBBBB"
},
{
"input": "2 2\nBG",
"output": "GB"
},
{
"input": "8 8\nGGGBGGBB",
"output": "GGGGGBBB"
},
{
"input": "34 34\nBGGBBBBGGBBGBGGGGGGBBGGGGGBGGBGGGB",
"output": "GGGGGGGGGGGGGGGGGGGGGBBBBBBBBBBBBB"
},
{
"input": "34 20\nBBBBGBGGGBGGGBGBGGBBBBGGBBGGGBGBBG",
"output": "GGGGGGGGGGGGGGGGGBBBBBBBBBBBBBBBBB"
},
{
"input": "50 50\nBBGBBBBBBBBBBBBGBBBGBBBBBBBGBBBBBBGBBBGBBGBBGBBBGG",
"output": "GGGGGGGGGGBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB"
},
{
"input": "10 10\nGGGGGGGGGG",
"output": "GGGGGGGGGG"
},
{
"input": "10 10\nBBBBBBBBBB",
"output": "BBBBBBBBBB"
},
{
"input": "10 10\nBGBGBGBGBG",
"output": "GGGGGBBBBB"
},
{
"input": "1 1\nB",
"output": "B"
}
] | 1,698,147,002
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 44
| 124
| 0
|
a,b = map(int,input().split())
c = list(input())
for i in range(b):
j = 1
while j<a:
if c[-j] == 'G' and c[-j-1] == 'B':
c[-j],c[-j-1] = c[-j-1],c[-j]
j += 2
else:
j += 1
print(''.join(c))
|
Title: Queue at the School
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
During the break the schoolchildren, boys and girls, formed a queue of *n* people in the canteen. Initially the children stood in the order they entered the canteen. However, after a while the boys started feeling awkward for standing in front of the girls in the queue and they started letting the girls move forward each second.
Let's describe the process more precisely. Let's say that the positions in the queue are sequentially numbered by integers from 1 to *n*, at that the person in the position number 1 is served first. Then, if at time *x* a boy stands on the *i*-th position and a girl stands on the (*i*<=+<=1)-th position, then at time *x*<=+<=1 the *i*-th position will have a girl and the (*i*<=+<=1)-th position will have a boy. The time is given in seconds.
You've got the initial position of the children, at the initial moment of time. Determine the way the queue is going to look after *t* seconds.
Input Specification:
The first line contains two integers *n* and *t* (1<=β€<=*n*,<=*t*<=β€<=50), which represent the number of children in the queue and the time after which the queue will transform into the arrangement you need to find.
The next line contains string *s*, which represents the schoolchildren's initial arrangement. If the *i*-th position in the queue contains a boy, then the *i*-th character of string *s* equals "B", otherwise the *i*-th character equals "G".
Output Specification:
Print string *a*, which describes the arrangement after *t* seconds. If the *i*-th position has a boy after the needed time, then the *i*-th character *a* must equal "B", otherwise it must equal "G".
Demo Input:
['5 1\nBGGBG\n', '5 2\nBGGBG\n', '4 1\nGGGB\n']
Demo Output:
['GBGGB\n', 'GGBGB\n', 'GGGB\n']
Note:
none
|
```python
a,b = map(int,input().split())
c = list(input())
for i in range(b):
j = 1
while j<a:
if c[-j] == 'G' and c[-j-1] == 'B':
c[-j],c[-j-1] = c[-j-1],c[-j]
j += 2
else:
j += 1
print(''.join(c))
```
| 3
|
|
112
|
A
|
Petya and Strings
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Petya and Strings
|
2
|
256
|
Little Petya loves presents. His mum bought him two strings of the same size for his birthday. The strings consist of uppercase and lowercase Latin letters. Now Petya wants to compare those two strings lexicographically. The letters' case does not matter, that is an uppercase letter is considered equivalent to the corresponding lowercase letter. Help Petya perform the comparison.
|
Each of the first two lines contains a bought string. The strings' lengths range from 1 to 100 inclusive. It is guaranteed that the strings are of the same length and also consist of uppercase and lowercase Latin letters.
|
If the first string is less than the second one, print "-1". If the second string is less than the first one, print "1". If the strings are equal, print "0". Note that the letters' case is not taken into consideration when the strings are compared.
|
[
"aaaa\naaaA\n",
"abs\nAbz\n",
"abcdefg\nAbCdEfF\n"
] |
[
"0\n",
"-1\n",
"1\n"
] |
If you want more formal information about the lexicographical order (also known as the "dictionary order" or "alphabetical order"), you can visit the following site:
- http://en.wikipedia.org/wiki/Lexicographical_order
| 500
|
[
{
"input": "aaaa\naaaA",
"output": "0"
},
{
"input": "abs\nAbz",
"output": "-1"
},
{
"input": "abcdefg\nAbCdEfF",
"output": "1"
},
{
"input": "asadasdasd\nasdwasdawd",
"output": "-1"
},
{
"input": "aslkjlkasdd\nasdlkjdajwi",
"output": "1"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "0"
},
{
"input": "aAaaaAAaAaaAzZsssSsdDfeEaeqZlpP\nAaaaAaaAaaAaZzSSSSsDdFeeAeQZLpp",
"output": "0"
},
{
"input": "bwuEhEveouaTECagLZiqmUdxEmhRSOzMauJRWLQMppZOumxhAmwuGeDIkvkBLvMXwUoFmpAfDprBcFtEwOULcZWRQhcTbTbX\nHhoDWbcxwiMnCNexOsKsujLiSGcLllXOkRSbnOzThAjnnliLYFFmsYkOfpTxRNEfBsoUHfoLTiqAINRPxWRqrTJhgfkKcDOH",
"output": "-1"
},
{
"input": "kGWUuguKzcvxqKTNpxeDWXpXkrXDvGMFGoXKDfPBZvWSDUyIYBynbKOUonHvmZaKeirUhfmVRKtGhAdBfKMWXDUoqvbfpfHYcg\ncvOULleuIIiYVVxcLZmHVpNGXuEpzcWZZWyMOwIwbpkKPwCfkVbKkUuosvxYCKjqfVmHfJKbdrsAcatPYgrCABaFcoBuOmMfFt",
"output": "1"
},
{
"input": "nCeNVIzHqPceNhjHeHvJvgBsNFiXBATRrjSTXJzhLMDMxiJztphxBRlDlqwDFImWeEPkggZCXSRwelOdpNrYnTepiOqpvkr\nHJbjJFtlvNxIbkKlxQUwmZHJFVNMwPAPDRslIoXISBYHHfymyIaQHLgECPxAmqnOCizwXnIUBRmpYUBVPenoUKhCobKdOjL",
"output": "1"
},
{
"input": "ttXjenUAlfixytHEOrPkgXmkKTSGYuyVXGIHYmWWYGlBYpHkujueqBSgjLguSgiMGJWATIGEUjjAjKXdMiVbHozZUmqQtFrT\nJziDBFBDmDJCcGqFsQwDFBYdOidLxxhBCtScznnDgnsiStlWFnEXQrJxqTXKPxZyIGfLIToETKWZBPUIBmLeImrlSBWCkTNo",
"output": "1"
},
{
"input": "AjQhPqSVhwQQjcgCycjKorWBgFCRuQBwgdVuAPSMJAvTyxGVuFHjfJzkKfsmfhFbKqFrFIohSZBbpjgEHebezmVlGLTPSCTMf\nXhxWuSnMmKFrCUOwkTUmvKAfbTbHWzzOTzxJatLLCdlGnHVaBUnxDlsqpvjLHMThOPAFBggVKDyKBrZAmjnjrhHlrnSkyzBja",
"output": "-1"
},
{
"input": "HCIgYtnqcMyjVngziNflxKHtdTmcRJhzMAjFAsNdWXFJYEhiTzsQUtFNkAbdrFBRmvLirkuirqTDvIpEfyiIqkrwsjvpPWTEdI\nErqiiWKsmIjyZuzgTlTqxYZwlrpvRyaVhRTOYUqtPMVGGtWOkDCOOQRKrkkRzPftyQCkYkzKkzTPqqXmeZhvvEEiEhkdOmoMvy",
"output": "1"
},
{
"input": "mtBeJYILXcECGyEVSyzLFdQJbiVnnfkbsYYsdUJSIRmyzLfTTtFwIBmRLVnwcewIqcuydkcLpflHAFyDaToLiFMgeHvQorTVbI\nClLvyejznjbRfCDcrCzkLvqQaGzTjwmWONBdCctJAPJBcQrcYvHaSLQgPIJbmkFBhFzuQLBiRzAdNHulCjIAkBvZxxlkdzUWLR",
"output": "1"
},
{
"input": "tjucSbGESVmVridTBjTmpVBCwwdWKBPeBvmgdxgIVLwQxveETnSdxkTVJpXoperWSgdpPMKNmwDiGeHfxnuqaDissgXPlMuNZIr\nHfjOOJhomqNIKHvqSgfySjlsWJQBuWYwhLQhlZYlpZwboMpoLoluGsBmhhlYgeIouwdkPfiaAIrkYRlxtiFazOPOllPsNZHcIZd",
"output": "1"
},
{
"input": "AanbDfbZNlUodtBQlvPMyomStKNhgvSGhSbTdabxGFGGXCdpsJDimsAykKjfBDPMulkhBMsqLmVKLDoesHZsRAEEdEzqigueXInY\ncwfyjoppiJNrjrOLNZkqcGimrpTsiyFBVgMWEPXsMrxLJDDbtYzerXiFGuLBcQYitLdqhGHBpdjRnkUegmnwhGHAKXGyFtscWDSI",
"output": "-1"
},
{
"input": "HRfxniwuJCaHOcaOVgjOGHXKrwxrDQxJpppeGDXnTAowyKbCsCQPbchCKeTWOcKbySSYnoaTJDnmRcyGPbfXJyZoPcARHBu\nxkLXvwkvGIWSQaFTznLOctUXNuzzBBOlqvzmVfTSejekTAlwidRrsxkbZTsGGeEWxCXHzqWVuLGoCyrGjKkQoHqduXwYQKC",
"output": "-1"
},
{
"input": "OjYwwNuPESIazoyLFREpObIaMKhCaKAMWMfRGgucEuyNYRantwdwQkmflzfqbcFRaXBnZoIUGsFqXZHGKwlaBUXABBcQEWWPvkjW\nRxLqGcTTpBwHrHltCOllnTpRKLDofBUqqHxnOtVWPgvGaeHIevgUSOeeDOJubfqonFpVNGVbHFcAhjnyFvrrqnRgKhkYqQZmRfUl",
"output": "-1"
},
{
"input": "tatuhQPIzjptlzzJpCAPXSRTKZRlwgfoCIsFjJquRoIDyZZYRSPdFUTjjUPhLBBfeEIfLQpygKXRcyQFiQsEtRtLnZErBqW\ntkHUjllbafLUWhVCnvblKjgYIEoHhsjVmrDBmAWbvtkHxDbRFvsXAjHIrujaDbYwOZmacknhZPeCcorbRgHjjgAgoJdjvLo",
"output": "-1"
},
{
"input": "cymCPGqdXKUdADEWDdUaLEEMHiXHsdAZuDnJDMUvxvrLRBrPSDpXPAgMRoGplLtniFRTomDTAHXWAdgUveTxaqKVSvnOyhOwiRN\nuhmyEWzapiRNPFDisvHTbenXMfeZaHqOFlKjrfQjUBwdFktNpeiRoDWuBftZLcCZZAVfioOihZVNqiNCNDIsUdIhvbcaxpTRWoV",
"output": "-1"
},
{
"input": "sSvpcITJAwghVfJaLKBmyjOkhltTGjYJVLWCYMFUomiJaKQYhXTajvZVHIMHbyckYROGQZzjWyWCcnmDmrkvTKfHSSzCIhsXgEZa\nvhCXkCwAmErGVBPBAnkSYEYvseFKbWSktoqaHYXUmYkHfOkRwuEyBRoGoBrOXBKVxXycjZGStuvDarnXMbZLWrbjrisDoJBdSvWJ",
"output": "-1"
},
{
"input": "hJDANKUNBisOOINDsTixJmYgHNogtpwswwcvVMptfGwIjvqgwTYFcqTdyAqaqlnhOCMtsnWXQqtjFwQlEcBtMFAtSqnqthVb\nrNquIcjNWESjpPVWmzUJFrelpUZeGDmSvCurCqVmKHKVAAPkaHksniOlzjiKYIJtvbuQWZRufMebpTFPqyxIWWjfPaWYiNlK",
"output": "-1"
},
{
"input": "ycLoapxsfsDTHMSfAAPIUpiEhQKUIXUcXEiopMBuuZLHtfPpLmCHwNMNQUwsEXxCEmKHTBSnKhtQhGWUvppUFZUgSpbeChX\ndCZhgVXofkGousCzObxZSJwXcHIaqUDSCPKzXntcVmPxtNcXmVcjsetZYxedmgQzXTZHMvzjoaXCMKsncGciSDqQWIIRlys",
"output": "1"
},
{
"input": "nvUbnrywIePXcoukIhwTfUVcHUEgXcsMyNQhmMlTltZiCooyZiIKRIGVHMCnTKgzXXIuvoNDEZswKoACOBGSyVNqTNQqMhAG\nplxuGSsyyJjdvpddrSebOARSAYcZKEaKjqbCwvjhNykuaECoQVHTVFMKXwvrQXRaqXsHsBaGVhCxGRxNyGUbMlxOarMZNXxy",
"output": "-1"
},
{
"input": "EncmXtAblQzcVRzMQqdDqXfAhXbtJKQwZVWyHoWUckohnZqfoCmNJDzexFgFJYrwNHGgzCJTzQQFnxGlhmvQTpicTkEeVICKac\nNIUNZoMLFMyAjVgQLITELJSodIXcGSDWfhFypRoGYuogJpnqGTotWxVqpvBHjFOWcDRDtARsaHarHaOkeNWEHGTaGOFCOFEwvK",
"output": "-1"
},
{
"input": "UG\nak",
"output": "1"
},
{
"input": "JZR\nVae",
"output": "-1"
},
{
"input": "a\nZ",
"output": "-1"
},
{
"input": "rk\nkv",
"output": "1"
},
{
"input": "RvuT\nbJzE",
"output": "1"
},
{
"input": "PPS\nydq",
"output": "-1"
},
{
"input": "q\nq",
"output": "0"
},
{
"input": "peOw\nIgSJ",
"output": "1"
},
{
"input": "PyK\noKN",
"output": "1"
},
{
"input": "O\ni",
"output": "1"
},
{
"input": "NmGY\npDlP",
"output": "-1"
},
{
"input": "nG\nZf",
"output": "-1"
},
{
"input": "m\na",
"output": "1"
},
{
"input": "MWyB\nWZEV",
"output": "-1"
},
{
"input": "Gre\nfxc",
"output": "1"
},
{
"input": "Ooq\nwap",
"output": "-1"
},
{
"input": "XId\nlbB",
"output": "1"
},
{
"input": "lfFpECEqUMEOJhipvkZjDPcpDNJedOVXiSMgBvBZbtfzIKekcvpWPCazKAhJyHircRtgcBIJwwstpHaLAgxFOngAWUZRgCef\nLfFPEcequmeojHIpVkzjDPcpdNJEDOVXiSmGBVBZBtfZikEKcvPwpCAzKAHJyHIrCRTgCbIJWwSTphALagXfOnGAwUzRGcEF",
"output": "0"
},
{
"input": "DQBdtSEDtFGiNRUeJNbOIfDZnsryUlzJHGTXGFXnwsVyxNtLgmklmFvRCzYETBVdmkpJJIvIOkMDgCFHZOTODiYrkwXd\nDQbDtsEdTFginRUEJNBOIfdZnsryulZJHGtxGFxnwSvYxnTLgmKlmFVRCzyEtBVdmKpJjiVioKMDgCFhzoTODiYrKwXD",
"output": "0"
},
{
"input": "tYWRijFQSzHBpCjUzqBtNvBKyzZRnIdWEuyqnORBQTLyOQglIGfYJIRjuxnbLvkqZakNqPiGDvgpWYkfxYNXsdoKXZtRkSasfa\nTYwRiJfqsZHBPcJuZQBTnVbkyZZRnidwEuYQnorbQTLYOqGligFyjirJUxnblVKqZaknQpigDVGPwyKfxyNXSDoKxztRKSaSFA",
"output": "0"
},
{
"input": "KhScXYiErQIUtmVhNTCXSLAviefIeHIIdiGhsYnPkSBaDTvMkyanfMLBOvDWgRybLtDqvXVdVjccNunDyijhhZEAKBrdz\nkHsCXyiErqIuTMVHNTCxSLaViEFIEhIIDiGHsYNpKsBAdTvMKyANFMLBovdwGRYbLtdQVxvDVJCcNUndYiJHhzeakBrdZ",
"output": "0"
},
{
"input": "cpPQMpjRQJKQVXjWDYECXbagSmNcVfOuBWNZxihdERraVuiOpSVDCPgTGuSQALNoVjySceHcKXwOEpSzXrEqWwwrYeppNiWhDVg\nCPPqmPjRqJkQvxJwdyECXBAGsMNcVfOuBWNzxIhderRavUiOpSvDCpGTgusqAlNovjyScEhCKXwoePSZxrEQwWwryEPPniWHDvG",
"output": "0"
},
{
"input": "SajcCGMepaLjZIWLRBGFcrZRCRvvoCsIyKsQerbrwsIamxxpRmQSZSalasJLVFbCHCuXJlubciQAvLxXYBazLsMKLHLdDQ\nsaJcCgmEpaLJziWlrBgFcRzrCrVVOcSIykSQerBrwSIamxxPrMqSzSalASjLVFbChCUxjLUbCIQAVlxxybAZLsmkLhLDdQ",
"output": "0"
},
{
"input": "kigPrWNTOUNDBskAfefjhHYZNYdnfZWuXWzHiBxFQryBbAkPtenFwWvCSTYGpzOntUNzNUhxRWjKmicTwLwJAnbAxj\nkigpRWntOUNdBsKaFEFjhhYZnYDNfzWuXwZhibxFQRybbakPteNfwwvcStyGPzoNTunznuHXrWjKMIctWLWJANBAxJ",
"output": "0"
},
{
"input": "nTomZZuTTRTAAPoUsySVFGElrpQRNLjqvFmcYytiheQnjUhPLnqNBiYtQkljbcvmjuNAVKbvQOWpqqFlQhAhULIhquoCnjUI\nntOmzZuttrtAAPOUSySVFgeLRPQrNLjQvfmCyYTiHEQnjuHPlNQNbIYtqKLJBCVmjunavkbvQOWPQQFlqHaHULIHQuOcnJUi",
"output": "0"
},
{
"input": "abac\nadaa",
"output": "-1"
},
{
"input": "Bbc\nabc",
"output": "1"
},
{
"input": "aaaba\naaaab",
"output": "1"
}
] | 1,699,207,616
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 53
| 92
| 0
|
n1 = input()
n2 = input()
if n1.lower() < n2.lower():
print(-1)
elif n1.lower() > n2.lower():
print(1)
else:
print(0)
|
Title: Petya and Strings
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Little Petya loves presents. His mum bought him two strings of the same size for his birthday. The strings consist of uppercase and lowercase Latin letters. Now Petya wants to compare those two strings lexicographically. The letters' case does not matter, that is an uppercase letter is considered equivalent to the corresponding lowercase letter. Help Petya perform the comparison.
Input Specification:
Each of the first two lines contains a bought string. The strings' lengths range from 1 to 100 inclusive. It is guaranteed that the strings are of the same length and also consist of uppercase and lowercase Latin letters.
Output Specification:
If the first string is less than the second one, print "-1". If the second string is less than the first one, print "1". If the strings are equal, print "0". Note that the letters' case is not taken into consideration when the strings are compared.
Demo Input:
['aaaa\naaaA\n', 'abs\nAbz\n', 'abcdefg\nAbCdEfF\n']
Demo Output:
['0\n', '-1\n', '1\n']
Note:
If you want more formal information about the lexicographical order (also known as the "dictionary order" or "alphabetical order"), you can visit the following site:
- http://en.wikipedia.org/wiki/Lexicographical_order
|
```python
n1 = input()
n2 = input()
if n1.lower() < n2.lower():
print(-1)
elif n1.lower() > n2.lower():
print(1)
else:
print(0)
```
| 3.977
|
609
|
A
|
USB Flash Drives
|
PROGRAMMING
| 800
|
[
"greedy",
"implementation",
"sortings"
] | null | null |
Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes.
Find the minimum number of USB flash drives needed to write Sean's file, if he can split the file between drives.
|
The first line contains positive integer *n* (1<=β€<=*n*<=β€<=100) β the number of USB flash drives.
The second line contains positive integer *m* (1<=β€<=*m*<=β€<=105) β the size of Sean's file.
Each of the next *n* lines contains positive integer *a**i* (1<=β€<=*a**i*<=β€<=1000) β the sizes of USB flash drives in megabytes.
It is guaranteed that the answer exists, i. e. the sum of all *a**i* is not less than *m*.
|
Print the minimum number of USB flash drives to write Sean's file, if he can split the file between drives.
|
[
"3\n5\n2\n1\n3\n",
"3\n6\n2\n3\n2\n",
"2\n5\n5\n10\n"
] |
[
"2\n",
"3\n",
"1\n"
] |
In the first example Sean needs only two USB flash drives β the first and the third.
In the second example Sean needs all three USB flash drives.
In the third example Sean needs only one USB flash drive and he can use any available USB flash drive β the first or the second.
| 0
|
[
{
"input": "3\n5\n2\n1\n3",
"output": "2"
},
{
"input": "3\n6\n2\n3\n2",
"output": "3"
},
{
"input": "2\n5\n5\n10",
"output": "1"
},
{
"input": "5\n16\n8\n1\n3\n4\n9",
"output": "2"
},
{
"input": "10\n121\n10\n37\n74\n56\n42\n39\n6\n68\n8\n100",
"output": "2"
},
{
"input": "12\n4773\n325\n377\n192\n780\n881\n816\n839\n223\n215\n125\n952\n8",
"output": "7"
},
{
"input": "15\n7758\n182\n272\n763\n910\n24\n359\n583\n890\n735\n819\n66\n992\n440\n496\n227",
"output": "15"
},
{
"input": "30\n70\n6\n2\n10\n4\n7\n10\n5\n1\n8\n10\n4\n3\n5\n9\n3\n6\n6\n4\n2\n6\n5\n10\n1\n9\n7\n2\n1\n10\n7\n5",
"output": "8"
},
{
"input": "40\n15705\n702\n722\n105\n873\n417\n477\n794\n300\n869\n496\n572\n232\n456\n298\n473\n584\n486\n713\n934\n121\n303\n956\n934\n840\n358\n201\n861\n497\n131\n312\n957\n96\n914\n509\n60\n300\n722\n658\n820\n103",
"output": "21"
},
{
"input": "50\n18239\n300\n151\n770\n9\n200\n52\n247\n753\n523\n263\n744\n463\n540\n244\n608\n569\n771\n32\n425\n777\n624\n761\n628\n124\n405\n396\n726\n626\n679\n237\n229\n49\n512\n18\n671\n290\n768\n632\n739\n18\n136\n413\n117\n83\n413\n452\n767\n664\n203\n404",
"output": "31"
},
{
"input": "70\n149\n5\n3\n3\n4\n6\n1\n2\n9\n8\n3\n1\n8\n4\n4\n3\n6\n10\n7\n1\n10\n8\n4\n9\n3\n8\n3\n2\n5\n1\n8\n6\n9\n10\n4\n8\n6\n9\n9\n9\n3\n4\n2\n2\n5\n8\n9\n1\n10\n3\n4\n3\n1\n9\n3\n5\n1\n3\n7\n6\n9\n8\n9\n1\n7\n4\n4\n2\n3\n5\n7",
"output": "17"
},
{
"input": "70\n2731\n26\n75\n86\n94\n37\n25\n32\n35\n92\n1\n51\n73\n53\n66\n16\n80\n15\n81\n100\n87\n55\n48\n30\n71\n39\n87\n77\n25\n70\n22\n75\n23\n97\n16\n75\n95\n61\n61\n28\n10\n78\n54\n80\n51\n25\n24\n90\n58\n4\n77\n40\n54\n53\n47\n62\n30\n38\n71\n97\n71\n60\n58\n1\n21\n15\n55\n99\n34\n88\n99",
"output": "35"
},
{
"input": "70\n28625\n34\n132\n181\n232\n593\n413\n862\n887\n808\n18\n35\n89\n356\n640\n339\n280\n975\n82\n345\n398\n948\n372\n91\n755\n75\n153\n948\n603\n35\n694\n722\n293\n363\n884\n264\n813\n175\n169\n646\n138\n449\n488\n828\n417\n134\n84\n763\n288\n845\n801\n556\n972\n332\n564\n934\n699\n842\n942\n644\n203\n406\n140\n37\n9\n423\n546\n675\n491\n113\n587",
"output": "45"
},
{
"input": "80\n248\n3\n9\n4\n5\n10\n7\n2\n6\n2\n2\n8\n2\n1\n3\n7\n9\n2\n8\n4\n4\n8\n5\n4\n4\n10\n2\n1\n4\n8\n4\n10\n1\n2\n10\n2\n3\n3\n1\n1\n8\n9\n5\n10\n2\n8\n10\n5\n3\n6\n1\n7\n8\n9\n10\n5\n10\n10\n2\n10\n1\n2\n4\n1\n9\n4\n7\n10\n8\n5\n8\n1\n4\n2\n2\n3\n9\n9\n9\n10\n6",
"output": "27"
},
{
"input": "80\n2993\n18\n14\n73\n38\n14\n73\n77\n18\n81\n6\n96\n65\n77\n86\n76\n8\n16\n81\n83\n83\n34\n69\n58\n15\n19\n1\n16\n57\n95\n35\n5\n49\n8\n15\n47\n84\n99\n94\n93\n55\n43\n47\n51\n61\n57\n13\n7\n92\n14\n4\n83\n100\n60\n75\n41\n95\n74\n40\n1\n4\n95\n68\n59\n65\n15\n15\n75\n85\n46\n77\n26\n30\n51\n64\n75\n40\n22\n88\n68\n24",
"output": "38"
},
{
"input": "80\n37947\n117\n569\n702\n272\n573\n629\n90\n337\n673\n589\n576\n205\n11\n284\n645\n719\n777\n271\n567\n466\n251\n402\n3\n97\n288\n699\n208\n173\n530\n782\n266\n395\n957\n159\n463\n43\n316\n603\n197\n386\n132\n799\n778\n905\n784\n71\n851\n963\n883\n705\n454\n275\n425\n727\n223\n4\n870\n833\n431\n463\n85\n505\n800\n41\n954\n981\n242\n578\n336\n48\n858\n702\n349\n929\n646\n528\n993\n506\n274\n227",
"output": "70"
},
{
"input": "90\n413\n5\n8\n10\n7\n5\n7\n5\n7\n1\n7\n8\n4\n3\n9\n4\n1\n10\n3\n1\n10\n9\n3\n1\n8\n4\n7\n5\n2\n9\n3\n10\n10\n3\n6\n3\n3\n10\n7\n5\n1\n1\n2\n4\n8\n2\n5\n5\n3\n9\n5\n5\n3\n10\n2\n3\n8\n5\n9\n1\n3\n6\n5\n9\n2\n3\n7\n10\n3\n4\n4\n1\n5\n9\n2\n6\n9\n1\n1\n9\n9\n7\n7\n7\n8\n4\n5\n3\n4\n6\n9",
"output": "59"
},
{
"input": "90\n4226\n33\n43\n83\n46\n75\n14\n88\n36\n8\n25\n47\n4\n96\n19\n33\n49\n65\n17\n59\n72\n1\n55\n94\n92\n27\n33\n39\n14\n62\n79\n12\n89\n22\n86\n13\n19\n77\n53\n96\n74\n24\n25\n17\n64\n71\n81\n87\n52\n72\n55\n49\n74\n36\n65\n86\n91\n33\n61\n97\n38\n87\n61\n14\n73\n95\n43\n67\n42\n67\n22\n12\n62\n32\n96\n24\n49\n82\n46\n89\n36\n75\n91\n11\n10\n9\n33\n86\n28\n75\n39",
"output": "64"
},
{
"input": "90\n40579\n448\n977\n607\n745\n268\n826\n479\n59\n330\n609\n43\n301\n970\n726\n172\n632\n600\n181\n712\n195\n491\n312\n849\n722\n679\n682\n780\n131\n404\n293\n387\n567\n660\n54\n339\n111\n833\n612\n911\n869\n356\n884\n635\n126\n639\n712\n473\n663\n773\n435\n32\n973\n484\n662\n464\n699\n274\n919\n95\n904\n253\n589\n543\n454\n250\n349\n237\n829\n511\n536\n36\n45\n152\n626\n384\n199\n877\n941\n84\n781\n115\n20\n52\n726\n751\n920\n291\n571\n6\n199",
"output": "64"
},
{
"input": "100\n66\n7\n9\n10\n5\n2\n8\n6\n5\n4\n10\n10\n6\n5\n2\n2\n1\n1\n5\n8\n7\n8\n10\n5\n6\n6\n5\n9\n9\n6\n3\n8\n7\n10\n5\n9\n6\n7\n3\n5\n8\n6\n8\n9\n1\n1\n1\n2\n4\n5\n5\n1\n1\n2\n6\n7\n1\n5\n8\n7\n2\n1\n7\n10\n9\n10\n2\n4\n10\n4\n10\n10\n5\n3\n9\n1\n2\n1\n10\n5\n1\n7\n4\n4\n5\n7\n6\n10\n4\n7\n3\n4\n3\n6\n2\n5\n2\n4\n9\n5\n3",
"output": "7"
},
{
"input": "100\n4862\n20\n47\n85\n47\n76\n38\n48\n93\n91\n81\n31\n51\n23\n60\n59\n3\n73\n72\n57\n67\n54\n9\n42\n5\n32\n46\n72\n79\n95\n61\n79\n88\n33\n52\n97\n10\n3\n20\n79\n82\n93\n90\n38\n80\n18\n21\n43\n60\n73\n34\n75\n65\n10\n84\n100\n29\n94\n56\n22\n59\n95\n46\n22\n57\n69\n67\n90\n11\n10\n61\n27\n2\n48\n69\n86\n91\n69\n76\n36\n71\n18\n54\n90\n74\n69\n50\n46\n8\n5\n41\n96\n5\n14\n55\n85\n39\n6\n79\n75\n87",
"output": "70"
},
{
"input": "100\n45570\n14\n881\n678\n687\n993\n413\n760\n451\n426\n787\n503\n343\n234\n530\n294\n725\n941\n524\n574\n441\n798\n399\n360\n609\n376\n525\n229\n995\n478\n347\n47\n23\n468\n525\n749\n601\n235\n89\n995\n489\n1\n239\n415\n122\n671\n128\n357\n886\n401\n964\n212\n968\n210\n130\n871\n360\n661\n844\n414\n187\n21\n824\n266\n713\n126\n496\n916\n37\n193\n755\n894\n641\n300\n170\n176\n383\n488\n627\n61\n897\n33\n242\n419\n881\n698\n107\n391\n418\n774\n905\n87\n5\n896\n835\n318\n373\n916\n393\n91\n460",
"output": "78"
},
{
"input": "100\n522\n1\n5\n2\n4\n2\n6\n3\n4\n2\n10\n10\n6\n7\n9\n7\n1\n7\n2\n5\n3\n1\n5\n2\n3\n5\n1\n7\n10\n10\n4\n4\n10\n9\n10\n6\n2\n8\n2\n6\n10\n9\n2\n7\n5\n9\n4\n6\n10\n7\n3\n1\n1\n9\n5\n10\n9\n2\n8\n3\n7\n5\n4\n7\n5\n9\n10\n6\n2\n9\n2\n5\n10\n1\n7\n7\n10\n5\n6\n2\n9\n4\n7\n10\n10\n8\n3\n4\n9\n3\n6\n9\n10\n2\n9\n9\n3\n4\n1\n10\n2",
"output": "74"
},
{
"input": "100\n32294\n414\n116\n131\n649\n130\n476\n630\n605\n213\n117\n757\n42\n109\n85\n127\n635\n629\n994\n410\n764\n204\n161\n231\n577\n116\n936\n537\n565\n571\n317\n722\n819\n229\n284\n487\n649\n304\n628\n727\n816\n854\n91\n111\n549\n87\n374\n417\n3\n868\n882\n168\n743\n77\n534\n781\n75\n956\n910\n734\n507\n568\n802\n946\n891\n659\n116\n678\n375\n380\n430\n627\n873\n350\n930\n285\n6\n183\n96\n517\n81\n794\n235\n360\n551\n6\n28\n799\n226\n996\n894\n981\n551\n60\n40\n460\n479\n161\n318\n952\n433",
"output": "42"
},
{
"input": "100\n178\n71\n23\n84\n98\n8\n14\n4\n42\n56\n83\n87\n28\n22\n32\n50\n5\n96\n90\n1\n59\n74\n56\n96\n77\n88\n71\n38\n62\n36\n85\n1\n97\n98\n98\n32\n99\n42\n6\n81\n20\n49\n57\n71\n66\n9\n45\n41\n29\n28\n32\n68\n38\n29\n35\n29\n19\n27\n76\n85\n68\n68\n41\n32\n78\n72\n38\n19\n55\n83\n83\n25\n46\n62\n48\n26\n53\n14\n39\n31\n94\n84\n22\n39\n34\n96\n63\n37\n42\n6\n78\n76\n64\n16\n26\n6\n79\n53\n24\n29\n63",
"output": "2"
},
{
"input": "100\n885\n226\n266\n321\n72\n719\n29\n121\n533\n85\n672\n225\n830\n783\n822\n30\n791\n618\n166\n487\n922\n434\n814\n473\n5\n741\n947\n910\n305\n998\n49\n945\n588\n868\n809\n803\n168\n280\n614\n434\n634\n538\n591\n437\n540\n445\n313\n177\n171\n799\n778\n55\n617\n554\n583\n611\n12\n94\n599\n182\n765\n556\n965\n542\n35\n460\n177\n313\n485\n744\n384\n21\n52\n879\n792\n411\n614\n811\n565\n695\n428\n587\n631\n794\n461\n258\n193\n696\n936\n646\n756\n267\n55\n690\n730\n742\n734\n988\n235\n762\n440",
"output": "1"
},
{
"input": "100\n29\n9\n2\n10\n8\n6\n7\n7\n3\n3\n10\n4\n5\n2\n5\n1\n6\n3\n2\n5\n10\n10\n9\n1\n4\n5\n2\n2\n3\n1\n2\n2\n9\n6\n9\n7\n8\n8\n1\n5\n5\n3\n1\n5\n6\n1\n9\n2\n3\n8\n10\n8\n3\n2\n7\n1\n2\n1\n2\n8\n10\n5\n2\n3\n1\n10\n7\n1\n7\n4\n9\n6\n6\n4\n7\n1\n2\n7\n7\n9\n9\n7\n10\n4\n10\n8\n2\n1\n5\n5\n10\n5\n8\n1\n5\n6\n5\n1\n5\n6\n8",
"output": "3"
},
{
"input": "100\n644\n94\n69\n43\n36\n54\n93\n30\n74\n56\n95\n70\n49\n11\n36\n57\n30\n59\n3\n52\n59\n90\n82\n39\n67\n32\n8\n80\n64\n8\n65\n51\n48\n89\n90\n35\n4\n54\n66\n96\n68\n90\n30\n4\n13\n97\n41\n90\n85\n17\n45\n94\n31\n58\n4\n39\n76\n95\n92\n59\n67\n46\n96\n55\n82\n64\n20\n20\n83\n46\n37\n15\n60\n37\n79\n45\n47\n63\n73\n76\n31\n52\n36\n32\n49\n26\n61\n91\n31\n25\n62\n90\n65\n65\n5\n94\n7\n15\n97\n88\n68",
"output": "7"
},
{
"input": "100\n1756\n98\n229\n158\n281\n16\n169\n149\n239\n235\n182\n147\n215\n49\n270\n194\n242\n295\n289\n249\n19\n12\n144\n157\n92\n270\n122\n212\n97\n152\n14\n42\n12\n198\n98\n295\n154\n229\n191\n294\n5\n156\n43\n185\n184\n20\n125\n23\n10\n257\n244\n264\n79\n46\n277\n13\n22\n97\n212\n77\n293\n20\n51\n17\n109\n37\n68\n117\n51\n248\n10\n149\n179\n192\n239\n161\n13\n173\n297\n73\n43\n109\n288\n198\n81\n70\n254\n187\n277\n1\n295\n113\n95\n291\n293\n119\n205\n191\n37\n34\n116",
"output": "6"
},
{
"input": "100\n20562\n721\n452\n11\n703\n376\n183\n197\n203\n406\n642\n346\n446\n256\n760\n201\n360\n702\n707\n388\n779\n653\n610\n497\n768\n670\n134\n780\n306\n661\n180\n259\n256\n362\n6\n121\n415\n747\n170\n67\n439\n728\n193\n622\n481\n38\n225\n343\n303\n253\n436\n305\n68\n794\n247\n291\n600\n750\n188\n199\n757\n28\n776\n749\n253\n351\n53\n629\n129\n578\n209\n89\n651\n262\n638\n353\n469\n31\n144\n460\n176\n535\n562\n366\n639\n234\n577\n364\n761\n617\n303\n450\n778\n311\n289\n221\n274\n239\n626\n194\n36",
"output": "30"
},
{
"input": "100\n32630\n548\n21\n756\n138\n56\n719\n97\n86\n599\n531\n464\n137\n737\n239\n626\n179\n170\n271\n335\n178\n298\n597\n616\n104\n190\n216\n333\n606\n621\n310\n70\n286\n593\n655\n472\n556\n77\n625\n744\n395\n487\n762\n316\n469\n258\n475\n596\n651\n180\n737\n101\n511\n708\n163\n713\n475\n557\n649\n705\n583\n97\n447\n119\n91\n372\n194\n394\n667\n384\n635\n611\n746\n758\n613\n54\n508\n405\n188\n570\n254\n28\n599\n767\n115\n737\n194\n148\n686\n705\n236\n762\n613\n770\n633\n401\n773\n448\n274\n141\n718",
"output": "52"
},
{
"input": "1\n1\n1",
"output": "1"
}
] | 1,561,177,689
| 189
|
Python 3
|
OK
|
TESTS
| 34
| 124
| 0
|
n = input(); n =int(n) # n usbs
m = input(); m = int(m) # file size
caps = [] # capacities
for i in range(int(n)):
cap = input(); cap = int(cap)
caps.append(cap)
caps.sort(reverse=True)
count = 0
value = 0
for cap in caps:
count += 1
value = value + cap
if value >= m:
break
print(count)
|
Title: USB Flash Drives
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes.
Find the minimum number of USB flash drives needed to write Sean's file, if he can split the file between drives.
Input Specification:
The first line contains positive integer *n* (1<=β€<=*n*<=β€<=100) β the number of USB flash drives.
The second line contains positive integer *m* (1<=β€<=*m*<=β€<=105) β the size of Sean's file.
Each of the next *n* lines contains positive integer *a**i* (1<=β€<=*a**i*<=β€<=1000) β the sizes of USB flash drives in megabytes.
It is guaranteed that the answer exists, i. e. the sum of all *a**i* is not less than *m*.
Output Specification:
Print the minimum number of USB flash drives to write Sean's file, if he can split the file between drives.
Demo Input:
['3\n5\n2\n1\n3\n', '3\n6\n2\n3\n2\n', '2\n5\n5\n10\n']
Demo Output:
['2\n', '3\n', '1\n']
Note:
In the first example Sean needs only two USB flash drives β the first and the third.
In the second example Sean needs all three USB flash drives.
In the third example Sean needs only one USB flash drive and he can use any available USB flash drive β the first or the second.
|
```python
n = input(); n =int(n) # n usbs
m = input(); m = int(m) # file size
caps = [] # capacities
for i in range(int(n)):
cap = input(); cap = int(cap)
caps.append(cap)
caps.sort(reverse=True)
count = 0
value = 0
for cap in caps:
count += 1
value = value + cap
if value >= m:
break
print(count)
```
| 3
|
|
770
|
A
|
New Password
|
PROGRAMMING
| 800
|
[
"*special",
"implementation"
] | null | null |
Innokentiy decides to change the password in the social net "Contact!", but he is too lazy to invent a new password by himself. That is why he needs your help.
Innokentiy decides that new password should satisfy the following conditions:
- the length of the password must be equal to *n*, - the password should consist only of lowercase Latin letters, - the number of distinct symbols in the password must be equal to *k*, - any two consecutive symbols in the password must be distinct.
Your task is to help Innokentiy and to invent a new password which will satisfy all given conditions.
|
The first line contains two positive integers *n* and *k* (2<=β€<=*n*<=β€<=100, 2<=β€<=*k*<=β€<=*min*(*n*,<=26)) β the length of the password and the number of distinct symbols in it.
Pay attention that a desired new password always exists.
|
Print any password which satisfies all conditions given by Innokentiy.
|
[
"4 3\n",
"6 6\n",
"5 2\n"
] |
[
"java\n",
"python\n",
"phphp\n"
] |
In the first test there is one of the appropriate new passwords β java, because its length is equal to 4 and 3 distinct lowercase letters a, j and v are used in it.
In the second test there is one of the appropriate new passwords β python, because its length is equal to 6 and it consists of 6 distinct lowercase letters.
In the third test there is one of the appropriate new passwords β phphp, because its length is equal to 5 and 2 distinct lowercase letters p and h are used in it.
Pay attention the condition that no two identical symbols are consecutive is correct for all appropriate passwords in tests.
| 500
|
[
{
"input": "4 3",
"output": "abca"
},
{
"input": "6 6",
"output": "abcdef"
},
{
"input": "5 2",
"output": "ababa"
},
{
"input": "3 2",
"output": "aba"
},
{
"input": "10 2",
"output": "ababababab"
},
{
"input": "26 13",
"output": "abcdefghijklmabcdefghijklm"
},
{
"input": "100 2",
"output": "abababababababababababababababababababababababababababababababababababababababababababababababababab"
},
{
"input": "100 10",
"output": "abcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghij"
},
{
"input": "3 3",
"output": "abc"
},
{
"input": "6 3",
"output": "abcabc"
},
{
"input": "10 3",
"output": "abcabcabca"
},
{
"input": "50 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcab"
},
{
"input": "90 2",
"output": "ababababababababababababababababababababababababababababababababababababababababababababab"
},
{
"input": "6 2",
"output": "ababab"
},
{
"input": "99 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabc"
},
{
"input": "4 2",
"output": "abab"
},
{
"input": "100 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabca"
},
{
"input": "40 22",
"output": "abcdefghijklmnopqrstuvabcdefghijklmnopqr"
},
{
"input": "13 8",
"output": "abcdefghabcde"
},
{
"input": "16 15",
"output": "abcdefghijklmnoa"
},
{
"input": "17 17",
"output": "abcdefghijklmnopq"
},
{
"input": "19 4",
"output": "abcdabcdabcdabcdabc"
},
{
"input": "100 26",
"output": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuv"
},
{
"input": "100 25",
"output": "abcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxy"
},
{
"input": "26 26",
"output": "abcdefghijklmnopqrstuvwxyz"
},
{
"input": "27 26",
"output": "abcdefghijklmnopqrstuvwxyza"
},
{
"input": "2 2",
"output": "ab"
},
{
"input": "26 25",
"output": "abcdefghijklmnopqrstuvwxya"
},
{
"input": "99 2",
"output": "abababababababababababababababababababababababababababababababababababababababababababababababababa"
},
{
"input": "99 26",
"output": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstu"
},
{
"input": "4 4",
"output": "abcd"
},
{
"input": "5 3",
"output": "abcab"
},
{
"input": "5 4",
"output": "abcda"
},
{
"input": "5 5",
"output": "abcde"
},
{
"input": "24 22",
"output": "abcdefghijklmnopqrstuvab"
},
{
"input": "26 14",
"output": "abcdefghijklmnabcdefghijkl"
},
{
"input": "26 15",
"output": "abcdefghijklmnoabcdefghijk"
},
{
"input": "30 12",
"output": "abcdefghijklabcdefghijklabcdef"
},
{
"input": "35 4",
"output": "abcdabcdabcdabcdabcdabcdabcdabcdabc"
},
{
"input": "79 3",
"output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabca"
},
{
"input": "79 14",
"output": "abcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghi"
},
{
"input": "85 13",
"output": "abcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefg"
},
{
"input": "90 25",
"output": "abcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmno"
},
{
"input": "90 19",
"output": "abcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmn"
},
{
"input": "26 24",
"output": "abcdefghijklmnopqrstuvwxab"
},
{
"input": "100 17",
"output": "abcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmno"
},
{
"input": "26 2",
"output": "ababababababababababababab"
}
] | 1,621,407,882
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 47
| 77
| 0
|
import math
# test = int(input())
# for q in range(test):
x, y = map(int, input().split())
# n = int(input())
# s = input()
s = ""
i = 0
while i<x:
for j in range(min(y, x-i)):
s += chr(ord("a")+j)
i += j + 1
print(s)
|
Title: New Password
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Innokentiy decides to change the password in the social net "Contact!", but he is too lazy to invent a new password by himself. That is why he needs your help.
Innokentiy decides that new password should satisfy the following conditions:
- the length of the password must be equal to *n*, - the password should consist only of lowercase Latin letters, - the number of distinct symbols in the password must be equal to *k*, - any two consecutive symbols in the password must be distinct.
Your task is to help Innokentiy and to invent a new password which will satisfy all given conditions.
Input Specification:
The first line contains two positive integers *n* and *k* (2<=β€<=*n*<=β€<=100, 2<=β€<=*k*<=β€<=*min*(*n*,<=26)) β the length of the password and the number of distinct symbols in it.
Pay attention that a desired new password always exists.
Output Specification:
Print any password which satisfies all conditions given by Innokentiy.
Demo Input:
['4 3\n', '6 6\n', '5 2\n']
Demo Output:
['java\n', 'python\n', 'phphp\n']
Note:
In the first test there is one of the appropriate new passwords β java, because its length is equal to 4 and 3 distinct lowercase letters a, j and v are used in it.
In the second test there is one of the appropriate new passwords β python, because its length is equal to 6 and it consists of 6 distinct lowercase letters.
In the third test there is one of the appropriate new passwords β phphp, because its length is equal to 5 and 2 distinct lowercase letters p and h are used in it.
Pay attention the condition that no two identical symbols are consecutive is correct for all appropriate passwords in tests.
|
```python
import math
# test = int(input())
# for q in range(test):
x, y = map(int, input().split())
# n = int(input())
# s = input()
s = ""
i = 0
while i<x:
for j in range(min(y, x-i)):
s += chr(ord("a")+j)
i += j + 1
print(s)
```
| 3
|
|
459
|
A
|
Pashmak and Garden
|
PROGRAMMING
| 1,200
|
[
"implementation"
] | null | null |
Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is. But he remembers that the garden looks like a square with sides parallel to the coordinate axes. He also remembers that there is exactly one tree on each vertex of the square. Now, Pashmak knows the position of only two of the trees. Help him to find the position of two remaining ones.
|
The first line contains four space-separated *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=100<=β€<=*x*1,<=*y*1,<=*x*2,<=*y*2<=β€<=100) integers, where *x*1 and *y*1 are coordinates of the first tree and *x*2 and *y*2 are coordinates of the second tree. It's guaranteed that the given points are distinct.
|
If there is no solution to the problem, print -1. Otherwise print four space-separated integers *x*3,<=*y*3,<=*x*4,<=*y*4 that correspond to the coordinates of the two other trees. If there are several solutions you can output any of them.
Note that *x*3,<=*y*3,<=*x*4,<=*y*4 must be in the range (<=-<=1000<=β€<=*x*3,<=*y*3,<=*x*4,<=*y*4<=β€<=1000).
|
[
"0 0 0 1\n",
"0 0 1 1\n",
"0 0 1 2\n"
] |
[
"1 0 1 1\n",
"0 1 1 0\n",
"-1\n"
] |
none
| 500
|
[
{
"input": "0 0 0 1",
"output": "1 0 1 1"
},
{
"input": "0 0 1 1",
"output": "0 1 1 0"
},
{
"input": "0 0 1 2",
"output": "-1"
},
{
"input": "-100 -100 100 100",
"output": "-100 100 100 -100"
},
{
"input": "-100 -100 99 100",
"output": "-1"
},
{
"input": "0 -100 0 100",
"output": "200 -100 200 100"
},
{
"input": "27 -74 27 74",
"output": "175 -74 175 74"
},
{
"input": "0 1 2 3",
"output": "0 3 2 1"
},
{
"input": "-100 100 100 -100",
"output": "-100 -100 100 100"
},
{
"input": "-100 -100 -100 100",
"output": "100 -100 100 100"
},
{
"input": "100 100 100 -100",
"output": "300 100 300 -100"
},
{
"input": "100 -100 -100 -100",
"output": "100 100 -100 100"
},
{
"input": "-100 100 100 100",
"output": "-100 300 100 300"
},
{
"input": "0 1 0 0",
"output": "1 1 1 0"
},
{
"input": "1 1 0 0",
"output": "1 0 0 1"
},
{
"input": "0 0 1 0",
"output": "0 1 1 1"
},
{
"input": "1 0 0 1",
"output": "1 1 0 0"
},
{
"input": "1 0 1 1",
"output": "2 0 2 1"
},
{
"input": "1 1 0 1",
"output": "1 2 0 2"
},
{
"input": "15 -9 80 -9",
"output": "15 56 80 56"
},
{
"input": "51 -36 18 83",
"output": "-1"
},
{
"input": "69 -22 60 16",
"output": "-1"
},
{
"input": "-68 -78 -45 -55",
"output": "-68 -55 -45 -78"
},
{
"input": "68 -92 8 -32",
"output": "68 -32 8 -92"
},
{
"input": "95 -83 -39 -6",
"output": "-1"
},
{
"input": "54 94 53 -65",
"output": "-1"
},
{
"input": "-92 15 84 15",
"output": "-92 191 84 191"
},
{
"input": "67 77 -11 -1",
"output": "67 -1 -11 77"
},
{
"input": "91 -40 30 21",
"output": "91 21 30 -40"
},
{
"input": "66 -64 -25 -64",
"output": "66 27 -25 27"
},
{
"input": "-42 84 -67 59",
"output": "-42 59 -67 84"
},
{
"input": "73 47 -5 -77",
"output": "-1"
},
{
"input": "6 85 -54 -84",
"output": "-1"
},
{
"input": "-58 -55 40 43",
"output": "-58 43 40 -55"
},
{
"input": "56 22 48 70",
"output": "-1"
},
{
"input": "-17 -32 76 -32",
"output": "-17 61 76 61"
},
{
"input": "0 2 2 0",
"output": "0 0 2 2"
},
{
"input": "0 0 -1 1",
"output": "0 1 -1 0"
},
{
"input": "0 2 1 1",
"output": "0 1 1 2"
},
{
"input": "0 0 1 -1",
"output": "0 -1 1 0"
},
{
"input": "-1 2 -2 3",
"output": "-1 3 -2 2"
},
{
"input": "0 1 1 0",
"output": "0 0 1 1"
},
{
"input": "1 2 2 1",
"output": "1 1 2 2"
},
{
"input": "4 1 2 1",
"output": "4 3 2 3"
},
{
"input": "70 0 0 10",
"output": "-1"
},
{
"input": "2 3 4 1",
"output": "2 1 4 3"
},
{
"input": "1 3 3 1",
"output": "1 1 3 3"
},
{
"input": "-3 3 0 0",
"output": "-3 0 0 3"
},
{
"input": "2 8 7 3",
"output": "2 3 7 8"
},
{
"input": "1 2 2 3",
"output": "1 3 2 2"
},
{
"input": "0 3 3 0",
"output": "0 0 3 3"
},
{
"input": "0 0 -3 3",
"output": "0 3 -3 0"
},
{
"input": "0 2 1 2",
"output": "0 3 1 3"
},
{
"input": "1 1 2 0",
"output": "1 0 2 1"
},
{
"input": "0 0 5 0",
"output": "0 5 5 5"
},
{
"input": "3 4 7 8",
"output": "3 8 7 4"
},
{
"input": "0 5 5 0",
"output": "0 0 5 5"
},
{
"input": "5 6 8 3",
"output": "5 3 8 6"
},
{
"input": "2 2 1 1",
"output": "2 1 1 2"
},
{
"input": "0 1 3 1",
"output": "0 4 3 4"
},
{
"input": "2 4 5 4",
"output": "2 7 5 7"
},
{
"input": "0 5 1 5",
"output": "0 6 1 6"
},
{
"input": "4 0 0 4",
"output": "4 4 0 0"
},
{
"input": "0 1 1 8",
"output": "-1"
},
{
"input": "2 3 3 4",
"output": "2 4 3 3"
},
{
"input": "1 0 2 1",
"output": "1 1 2 0"
},
{
"input": "0 0 2 14",
"output": "-1"
},
{
"input": "0 0 4 3",
"output": "-1"
},
{
"input": "3 5 5 3",
"output": "3 3 5 5"
},
{
"input": "-1 1 1 -1",
"output": "-1 -1 1 1"
},
{
"input": "0 0 2 0",
"output": "0 2 2 2"
},
{
"input": "0 0 1 7",
"output": "-1"
},
{
"input": "1 2 3 2",
"output": "1 4 3 4"
},
{
"input": "1 12 3 10",
"output": "1 10 3 12"
}
] | 1,690,579,822
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 74
| 62
| 0
|
import sys
input = sys.stdin.readline
x1,y1,x2,y2 = map(int,input().split())
if x1 == x2:
print(x1 + abs(y1-y2), y2, x1 + abs(y1-y2), y1)
elif y1 == y2:
print(x1, y1+abs(x2-x1), x2, y1 + abs(x2-x1))
else:
if abs(x1-x2) != abs(y1-y2):
print(-1)
else:
print(x1, y2, x2, y1)
|
Title: Pashmak and Garden
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Pashmak has fallen in love with an attractive girl called Parmida since one year ago...
Today, Pashmak set up a meeting with his partner in a romantic garden. Unfortunately, Pashmak has forgotten where the garden is. But he remembers that the garden looks like a square with sides parallel to the coordinate axes. He also remembers that there is exactly one tree on each vertex of the square. Now, Pashmak knows the position of only two of the trees. Help him to find the position of two remaining ones.
Input Specification:
The first line contains four space-separated *x*1,<=*y*1,<=*x*2,<=*y*2 (<=-<=100<=β€<=*x*1,<=*y*1,<=*x*2,<=*y*2<=β€<=100) integers, where *x*1 and *y*1 are coordinates of the first tree and *x*2 and *y*2 are coordinates of the second tree. It's guaranteed that the given points are distinct.
Output Specification:
If there is no solution to the problem, print -1. Otherwise print four space-separated integers *x*3,<=*y*3,<=*x*4,<=*y*4 that correspond to the coordinates of the two other trees. If there are several solutions you can output any of them.
Note that *x*3,<=*y*3,<=*x*4,<=*y*4 must be in the range (<=-<=1000<=β€<=*x*3,<=*y*3,<=*x*4,<=*y*4<=β€<=1000).
Demo Input:
['0 0 0 1\n', '0 0 1 1\n', '0 0 1 2\n']
Demo Output:
['1 0 1 1\n', '0 1 1 0\n', '-1\n']
Note:
none
|
```python
import sys
input = sys.stdin.readline
x1,y1,x2,y2 = map(int,input().split())
if x1 == x2:
print(x1 + abs(y1-y2), y2, x1 + abs(y1-y2), y1)
elif y1 == y2:
print(x1, y1+abs(x2-x1), x2, y1 + abs(x2-x1))
else:
if abs(x1-x2) != abs(y1-y2):
print(-1)
else:
print(x1, y2, x2, y1)
```
| 3
|
|
378
|
A
|
Playing with Dice
|
PROGRAMMING
| 800
|
[
"brute force"
] | null | null |
Two players are playing a game. First each of them writes an integer from 1 to 6, and then a dice is thrown. The player whose written number got closer to the number on the dice wins. If both payers have the same difference, it's a draw.
The first player wrote number *a*, the second player wrote number *b*. How many ways to throw a dice are there, at which the first player wins, or there is a draw, or the second player wins?
|
The single line contains two integers *a* and *b* (1<=β€<=*a*,<=*b*<=β€<=6)Β β the numbers written on the paper by the first and second player, correspondingly.
|
Print three integers: the number of ways to throw the dice at which the first player wins, the game ends with a draw or the second player wins, correspondingly.
|
[
"2 5\n",
"2 4\n"
] |
[
"3 0 3\n",
"2 1 3\n"
] |
The dice is a standard cube-shaped six-sided object with each side containing a number from 1 to 6, and where all numbers on all sides are distinct.
You can assume that number *a* is closer to number *x* than number *b*, if |*a*β-β*x*|β<β|*b*β-β*x*|.
| 500
|
[
{
"input": "2 5",
"output": "3 0 3"
},
{
"input": "2 4",
"output": "2 1 3"
},
{
"input": "5 3",
"output": "2 1 3"
},
{
"input": "1 6",
"output": "3 0 3"
},
{
"input": "5 1",
"output": "3 1 2"
},
{
"input": "6 3",
"output": "2 0 4"
},
{
"input": "2 3",
"output": "2 0 4"
},
{
"input": "5 6",
"output": "5 0 1"
},
{
"input": "4 4",
"output": "0 6 0"
},
{
"input": "1 1",
"output": "0 6 0"
},
{
"input": "6 4",
"output": "1 1 4"
},
{
"input": "1 4",
"output": "2 0 4"
},
{
"input": "5 5",
"output": "0 6 0"
},
{
"input": "4 5",
"output": "4 0 2"
},
{
"input": "4 3",
"output": "3 0 3"
},
{
"input": "1 5",
"output": "2 1 3"
},
{
"input": "6 5",
"output": "1 0 5"
},
{
"input": "2 2",
"output": "0 6 0"
},
{
"input": "1 3",
"output": "1 1 4"
},
{
"input": "3 6",
"output": "4 0 2"
},
{
"input": "3 1",
"output": "4 1 1"
},
{
"input": "3 2",
"output": "4 0 2"
},
{
"input": "3 5",
"output": "3 1 2"
},
{
"input": "3 3",
"output": "0 6 0"
},
{
"input": "6 2",
"output": "2 1 3"
},
{
"input": "4 1",
"output": "4 0 2"
},
{
"input": "5 2",
"output": "3 0 3"
},
{
"input": "4 2",
"output": "3 1 2"
},
{
"input": "2 1",
"output": "5 0 1"
},
{
"input": "6 1",
"output": "3 0 3"
},
{
"input": "4 6",
"output": "4 1 1"
},
{
"input": "2 6",
"output": "3 1 2"
},
{
"input": "3 4",
"output": "3 0 3"
},
{
"input": "1 2",
"output": "1 0 5"
},
{
"input": "6 6",
"output": "0 6 0"
},
{
"input": "5 4",
"output": "2 0 4"
},
{
"input": "3 3",
"output": "0 6 0"
},
{
"input": "1 1",
"output": "0 6 0"
}
] | 1,588,497,812
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 38
| 109
| 0
|
a,b = list(map(int,input().split()))
x=0;y=0;z=0
for i in range(1,7):
if abs(a-i)<abs(b-i):
x = x + 1
elif abs(a-i)==abs(b-i):
y = y + 1
else:
z = z + 1
print(x,y,z)
|
Title: Playing with Dice
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Two players are playing a game. First each of them writes an integer from 1 to 6, and then a dice is thrown. The player whose written number got closer to the number on the dice wins. If both payers have the same difference, it's a draw.
The first player wrote number *a*, the second player wrote number *b*. How many ways to throw a dice are there, at which the first player wins, or there is a draw, or the second player wins?
Input Specification:
The single line contains two integers *a* and *b* (1<=β€<=*a*,<=*b*<=β€<=6)Β β the numbers written on the paper by the first and second player, correspondingly.
Output Specification:
Print three integers: the number of ways to throw the dice at which the first player wins, the game ends with a draw or the second player wins, correspondingly.
Demo Input:
['2 5\n', '2 4\n']
Demo Output:
['3 0 3\n', '2 1 3\n']
Note:
The dice is a standard cube-shaped six-sided object with each side containing a number from 1 to 6, and where all numbers on all sides are distinct.
You can assume that number *a* is closer to number *x* than number *b*, if |*a*β-β*x*|β<β|*b*β-β*x*|.
|
```python
a,b = list(map(int,input().split()))
x=0;y=0;z=0
for i in range(1,7):
if abs(a-i)<abs(b-i):
x = x + 1
elif abs(a-i)==abs(b-i):
y = y + 1
else:
z = z + 1
print(x,y,z)
```
| 3
|
|
295
|
A
|
Greg and Array
|
PROGRAMMING
| 1,400
|
[
"data structures",
"implementation"
] | null | null |
Greg has an array *a*<==<=*a*1,<=*a*2,<=...,<=*a**n* and *m* operations. Each operation looks as: *l**i*, *r**i*, *d**i*, (1<=β€<=*l**i*<=β€<=*r**i*<=β€<=*n*). To apply operation *i* to the array means to increase all array elements with numbers *l**i*,<=*l**i*<=+<=1,<=...,<=*r**i* by value *d**i*.
Greg wrote down *k* queries on a piece of paper. Each query has the following form: *x**i*, *y**i*, (1<=β€<=*x**i*<=β€<=*y**i*<=β€<=*m*). That means that one should apply operations with numbers *x**i*,<=*x**i*<=+<=1,<=...,<=*y**i* to the array.
Now Greg is wondering, what the array *a* will be after all the queries are executed. Help Greg.
|
The first line contains integers *n*, *m*, *k* (1<=β€<=*n*,<=*m*,<=*k*<=β€<=105). The second line contains *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (0<=β€<=*a**i*<=β€<=105) β the initial array.
Next *m* lines contain operations, the operation number *i* is written as three integers: *l**i*, *r**i*, *d**i*, (1<=β€<=*l**i*<=β€<=*r**i*<=β€<=*n*), (0<=β€<=*d**i*<=β€<=105).
Next *k* lines contain the queries, the query number *i* is written as two integers: *x**i*, *y**i*, (1<=β€<=*x**i*<=β€<=*y**i*<=β€<=*m*).
The numbers in the lines are separated by single spaces.
|
On a single line print *n* integers *a*1,<=*a*2,<=...,<=*a**n* β the array after executing all the queries. Separate the printed numbers by spaces.
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams of the %I64d specifier.
|
[
"3 3 3\n1 2 3\n1 2 1\n1 3 2\n2 3 4\n1 2\n1 3\n2 3\n",
"1 1 1\n1\n1 1 1\n1 1\n",
"4 3 6\n1 2 3 4\n1 2 1\n2 3 2\n3 4 4\n1 2\n1 3\n2 3\n1 2\n1 3\n2 3\n"
] |
[
"9 18 17\n",
"2\n",
"5 18 31 20\n"
] |
none
| 500
|
[
{
"input": "3 3 3\n1 2 3\n1 2 1\n1 3 2\n2 3 4\n1 2\n1 3\n2 3",
"output": "9 18 17"
},
{
"input": "1 1 1\n1\n1 1 1\n1 1",
"output": "2"
},
{
"input": "4 3 6\n1 2 3 4\n1 2 1\n2 3 2\n3 4 4\n1 2\n1 3\n2 3\n1 2\n1 3\n2 3",
"output": "5 18 31 20"
},
{
"input": "1 1 1\n0\n1 1 0\n1 1",
"output": "0"
}
] | 1,642,190,218
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 31
| 857
| 17,100,800
|
line = input().split(' ')
n, m, k = int(line[0]), int(line[1]), int(line[2])
# create arr
arr = input().split(' ')
for i in range(len(arr)):
arr[i] = int(arr[i])
arr = [0] + arr + [0]
# create operations
ops = [(0, 0, 0)]
for i in range(m):
line = input().split(' ')
l, r, d = int(line[0]), int(line[1]), int(line[2])
ops.append((l, r, d))
opsCount = [0] * (m + 2)
for i in range(k):
query = input().split(' ')
x, y = int(query[0]), int(query[1])
opsCount[x] += 1
opsCount[y + 1] -= 1
for i in range(1, len(opsCount)):
opsCount[i] += opsCount[i - 1]
dif = [0] * len(arr)
for i in range(1, m + 1):
l, r, d = ops[i]
dif[l] += opsCount[i] * d
dif[r + 1] -= opsCount[i] * d
for i in range(1, len(arr)):
dif[i] += dif[i - 1]
arr[i] += dif[i]
for i in range(1, len(arr) - 1):
print(str(arr[i]) + " ", end = '')
|
Title: Greg and Array
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Greg has an array *a*<==<=*a*1,<=*a*2,<=...,<=*a**n* and *m* operations. Each operation looks as: *l**i*, *r**i*, *d**i*, (1<=β€<=*l**i*<=β€<=*r**i*<=β€<=*n*). To apply operation *i* to the array means to increase all array elements with numbers *l**i*,<=*l**i*<=+<=1,<=...,<=*r**i* by value *d**i*.
Greg wrote down *k* queries on a piece of paper. Each query has the following form: *x**i*, *y**i*, (1<=β€<=*x**i*<=β€<=*y**i*<=β€<=*m*). That means that one should apply operations with numbers *x**i*,<=*x**i*<=+<=1,<=...,<=*y**i* to the array.
Now Greg is wondering, what the array *a* will be after all the queries are executed. Help Greg.
Input Specification:
The first line contains integers *n*, *m*, *k* (1<=β€<=*n*,<=*m*,<=*k*<=β€<=105). The second line contains *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (0<=β€<=*a**i*<=β€<=105) β the initial array.
Next *m* lines contain operations, the operation number *i* is written as three integers: *l**i*, *r**i*, *d**i*, (1<=β€<=*l**i*<=β€<=*r**i*<=β€<=*n*), (0<=β€<=*d**i*<=β€<=105).
Next *k* lines contain the queries, the query number *i* is written as two integers: *x**i*, *y**i*, (1<=β€<=*x**i*<=β€<=*y**i*<=β€<=*m*).
The numbers in the lines are separated by single spaces.
Output Specification:
On a single line print *n* integers *a*1,<=*a*2,<=...,<=*a**n* β the array after executing all the queries. Separate the printed numbers by spaces.
Please, do not use the %lld specifier to read or write 64-bit integers in C++. It is preferred to use the cin, cout streams of the %I64d specifier.
Demo Input:
['3 3 3\n1 2 3\n1 2 1\n1 3 2\n2 3 4\n1 2\n1 3\n2 3\n', '1 1 1\n1\n1 1 1\n1 1\n', '4 3 6\n1 2 3 4\n1 2 1\n2 3 2\n3 4 4\n1 2\n1 3\n2 3\n1 2\n1 3\n2 3\n']
Demo Output:
['9 18 17\n', '2\n', '5 18 31 20\n']
Note:
none
|
```python
line = input().split(' ')
n, m, k = int(line[0]), int(line[1]), int(line[2])
# create arr
arr = input().split(' ')
for i in range(len(arr)):
arr[i] = int(arr[i])
arr = [0] + arr + [0]
# create operations
ops = [(0, 0, 0)]
for i in range(m):
line = input().split(' ')
l, r, d = int(line[0]), int(line[1]), int(line[2])
ops.append((l, r, d))
opsCount = [0] * (m + 2)
for i in range(k):
query = input().split(' ')
x, y = int(query[0]), int(query[1])
opsCount[x] += 1
opsCount[y + 1] -= 1
for i in range(1, len(opsCount)):
opsCount[i] += opsCount[i - 1]
dif = [0] * len(arr)
for i in range(1, m + 1):
l, r, d = ops[i]
dif[l] += opsCount[i] * d
dif[r + 1] -= opsCount[i] * d
for i in range(1, len(arr)):
dif[i] += dif[i - 1]
arr[i] += dif[i]
for i in range(1, len(arr) - 1):
print(str(arr[i]) + " ", end = '')
```
| 3
|
|
58
|
A
|
Chat room
|
PROGRAMMING
| 1,000
|
[
"greedy",
"strings"
] |
A. Chat room
|
1
|
256
|
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
|
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
|
If Vasya managed to say hello, print "YES", otherwise print "NO".
|
[
"ahhellllloou\n",
"hlelo\n"
] |
[
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "ahhellllloou",
"output": "YES"
},
{
"input": "hlelo",
"output": "NO"
},
{
"input": "helhcludoo",
"output": "YES"
},
{
"input": "hehwelloho",
"output": "YES"
},
{
"input": "pnnepelqomhhheollvlo",
"output": "YES"
},
{
"input": "tymbzjyqhymedasloqbq",
"output": "NO"
},
{
"input": "yehluhlkwo",
"output": "NO"
},
{
"input": "hatlevhhalrohairnolsvocafgueelrqmlqlleello",
"output": "YES"
},
{
"input": "hhhtehdbllnhwmbyhvelqqyoulretpbfokflhlhreeflxeftelziclrwllrpflflbdtotvlqgoaoqldlroovbfsq",
"output": "YES"
},
{
"input": "rzlvihhghnelqtwlexmvdjjrliqllolhyewgozkuovaiezgcilelqapuoeglnwmnlftxxiigzczlouooi",
"output": "YES"
},
{
"input": "pfhhwctyqdlkrwhebfqfelhyebwllhemtrmeblgrynmvyhioesqklclocxmlffuormljszllpoo",
"output": "YES"
},
{
"input": "lqllcolohwflhfhlnaow",
"output": "NO"
},
{
"input": "heheeellollvoo",
"output": "YES"
},
{
"input": "hellooo",
"output": "YES"
},
{
"input": "o",
"output": "NO"
},
{
"input": "hhqhzeclohlehljlhtesllylrolmomvuhcxsobtsckogdv",
"output": "YES"
},
{
"input": "yoegfuzhqsihygnhpnukluutocvvwuldiighpogsifealtgkfzqbwtmgghmythcxflebrkctlldlkzlagovwlstsghbouk",
"output": "YES"
},
{
"input": "uatqtgbvrnywfacwursctpagasnhydvmlinrcnqrry",
"output": "NO"
},
{
"input": "tndtbldbllnrwmbyhvqaqqyoudrstpbfokfoclnraefuxtftmgzicorwisrpfnfpbdtatvwqgyalqtdtrjqvbfsq",
"output": "NO"
},
{
"input": "rzlvirhgemelnzdawzpaoqtxmqucnahvqnwldklrmjiiyageraijfivigvozgwngiulttxxgzczptusoi",
"output": "YES"
},
{
"input": "kgyelmchocojsnaqdsyeqgnllytbqietpdlgknwwumqkxrexgdcnwoldicwzwofpmuesjuxzrasscvyuqwspm",
"output": "YES"
},
{
"input": "pnyvrcotjvgynbeldnxieghfltmexttuxzyac",
"output": "NO"
},
{
"input": "dtwhbqoumejligbenxvzhjlhosqojetcqsynlzyhfaevbdpekgbtjrbhlltbceobcok",
"output": "YES"
},
{
"input": "crrfpfftjwhhikwzeedrlwzblckkteseofjuxjrktcjfsylmlsvogvrcxbxtffujqshslemnixoeezivksouefeqlhhokwbqjz",
"output": "YES"
},
{
"input": "jhfbndhyzdvhbvhmhmefqllujdflwdpjbehedlsqfdsqlyelwjtyloxwsvasrbqosblzbowlqjmyeilcvotdlaouxhdpoeloaovb",
"output": "YES"
},
{
"input": "hwlghueoemiqtjhhpashjsouyegdlvoyzeunlroypoprnhlyiwiuxrghekaylndhrhllllwhbebezoglydcvykllotrlaqtvmlla",
"output": "YES"
},
{
"input": "wshiaunnqnqxodholbipwhhjmyeblhgpeleblklpzwhdunmpqkbuzloetmwwxmeltkrcomulxauzlwmlklldjodozxryghsnwgcz",
"output": "YES"
},
{
"input": "shvksednttggehroewuiptvvxtrzgidravtnjwuqrlnnkxbplctzkckinpkgjopjfoxdbojtcvsuvablcbkrzajrlhgobkcxeqti",
"output": "YES"
},
{
"input": "hyyhddqhxhekehkwfhlnlsihzefwchzerevcjtokefplholrbvxlltdlafjxrfhleglrvlolojoqaolagtbeyogxlbgfolllslli",
"output": "YES"
},
{
"input": "iaagrdhhelxpdegueiulflquvlzidoprzkehthkldaytrjwhyhprwjxlltinxvuilxohqgjqcvkkdcuoliekcnlilwgqlnlzouoo",
"output": "YES"
},
{
"input": "wfluaeseldgxyvxpwuhkptdmlflnlhktwxiabsvkolsquymrmhzczzoybvlilhmvsuunggvgxzgyyffk",
"output": "NO"
},
{
"input": "loee",
"output": "NO"
},
{
"input": "izdipwylefqmjbuoznfglgcfvedeouflkeehxbasaqmiooppfsqlhprospqgxvzrcpwlfdddngoqvpwvggsnvvxhmjoslwjudjlo",
"output": "NO"
},
{
"input": "pplynflbjlseflaegzqpdxswgunhnlglqhycrbcwdfhclmcrwekkzsoosmfblljeenwfjyifcvxihhhbyhmhlkvtskeglaovjnsi",
"output": "YES"
},
{
"input": "xqjqmenkodmlhzyzmmvofdngktygbbxbzpluzcohohmalkoeuwfikblltaaigv",
"output": "NO"
},
{
"input": "hello",
"output": "YES"
},
{
"input": "oohell",
"output": "NO"
},
{
"input": "hell",
"output": "NO"
},
{
"input": "eloellohoelo",
"output": "NO"
},
{
"input": "helllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllo",
"output": "YES"
}
] | 1,646,251,667
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 40
| 62
| 0
|
b = "hello"
j = 0
pas = 0
a = input()
for i in range(len(a)):
if a[i] == b [j]:
j += 1
pas += 1
if pas == 5:
break
if pas == 5 :
print("YES")
else:
print("NO")
|
Title: Chat room
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
Input Specification:
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
Output Specification:
If Vasya managed to say hello, print "YES", otherwise print "NO".
Demo Input:
['ahhellllloou\n', 'hlelo\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none
|
```python
b = "hello"
j = 0
pas = 0
a = input()
for i in range(len(a)):
if a[i] == b [j]:
j += 1
pas += 1
if pas == 5:
break
if pas == 5 :
print("YES")
else:
print("NO")
```
| 3.969
|
287
|
A
|
IQ Test
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation"
] | null | null |
In the city of Ultima Thule job applicants are often offered an IQ test.
The test is as follows: the person gets a piece of squared paper with a 4<=Γ<=4 square painted on it. Some of the square's cells are painted black and others are painted white. Your task is to repaint at most one cell the other color so that the picture has a 2<=Γ<=2 square, completely consisting of cells of the same color. If the initial picture already has such a square, the person should just say so and the test will be completed.
Your task is to write a program that determines whether it is possible to pass the test. You cannot pass the test if either repainting any cell or no action doesn't result in a 2<=Γ<=2 square, consisting of cells of the same color.
|
Four lines contain four characters each: the *j*-th character of the *i*-th line equals "." if the cell in the *i*-th row and the *j*-th column of the square is painted white, and "#", if the cell is black.
|
Print "YES" (without the quotes), if the test can be passed and "NO" (without the quotes) otherwise.
|
[
"####\n.#..\n####\n....\n",
"####\n....\n####\n....\n"
] |
[
"YES\n",
"NO\n"
] |
In the first test sample it is enough to repaint the first cell in the second row. After such repainting the required 2βΓβ2 square is on the intersection of the 1-st and 2-nd row with the 1-st and 2-nd column.
| 500
|
[
{
"input": "###.\n...#\n###.\n...#",
"output": "NO"
},
{
"input": ".##.\n#..#\n.##.\n#..#",
"output": "NO"
},
{
"input": ".#.#\n#.#.\n.#.#\n#.#.",
"output": "NO"
},
{
"input": "##..\n..##\n##..\n..##",
"output": "NO"
},
{
"input": "#.#.\n#.#.\n.#.#\n.#.#",
"output": "NO"
},
{
"input": ".#.#\n#.#.\n#.#.\n#.#.",
"output": "NO"
},
{
"input": ".#.#\n#.#.\n#.#.\n.#.#",
"output": "NO"
},
{
"input": "#.#.\n#.#.\n#.#.\n#.#.",
"output": "NO"
},
{
"input": ".#.#\n.#.#\n.#.#\n.#.#",
"output": "NO"
},
{
"input": "#..#\n.##.\n####\n####",
"output": "YES"
},
{
"input": "#.#.\n.###\n#.#.\n.###",
"output": "YES"
},
{
"input": "#..#\n.##.\n.##.\n#..#",
"output": "YES"
},
{
"input": ".##.\n.#..\n##.#\n#..#",
"output": "YES"
},
{
"input": ".##.\n##..\n#..#\n..##",
"output": "YES"
},
{
"input": "##..\n##..\n..##\n..##",
"output": "YES"
},
{
"input": ".#..\n###.\n.#.#\n..#.",
"output": "YES"
},
{
"input": "###.\n###.\n...#\n...#",
"output": "YES"
},
{
"input": "#.##\n##.#\n#.##\n##.#",
"output": "YES"
},
{
"input": ".#.#\n#.#.\n.#.#\n#.##",
"output": "YES"
},
{
"input": "##..\n..##\n##..\n...#",
"output": "YES"
},
{
"input": ".#..\n..##\n##..\n..##",
"output": "YES"
},
{
"input": "##..\n...#\n##..\n...#",
"output": "YES"
},
{
"input": ".#..\n..#.\n.#..\n..#.",
"output": "YES"
},
{
"input": "....\n....\n....\n.#.#",
"output": "YES"
},
{
"input": "....\n....\n....\n...#",
"output": "YES"
}
] | 1,676,010,838
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 30
| 62
| 0
|
def f():
a1, a2, a3, a4 = input(), input(), input(), input()
li = []
li.append(a1[:2] + a2[:2])
li.append(a1[1:3] + a2[1:3])
li.append(a1[2:] + a2[2:])
li.append(a2[:2] + a3[:2])
li.append(a2[1:3] + a3[1:3])
li.append(a2[2:] + a3[2:])
li.append(a3[:2] + a4[:2])
li.append(a3[1:3] + a4[1:3])
li.append(a3[2:] + a4[2:])
p = 1
for i in range(9):
if li[i].count('#') == 2:
continue
else:
p = 0
break
if p:
print('NO')
else:
print('YES')
import sys
input = lambda: sys.stdin.readline().rstrip()
f()
|
Title: IQ Test
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
In the city of Ultima Thule job applicants are often offered an IQ test.
The test is as follows: the person gets a piece of squared paper with a 4<=Γ<=4 square painted on it. Some of the square's cells are painted black and others are painted white. Your task is to repaint at most one cell the other color so that the picture has a 2<=Γ<=2 square, completely consisting of cells of the same color. If the initial picture already has such a square, the person should just say so and the test will be completed.
Your task is to write a program that determines whether it is possible to pass the test. You cannot pass the test if either repainting any cell or no action doesn't result in a 2<=Γ<=2 square, consisting of cells of the same color.
Input Specification:
Four lines contain four characters each: the *j*-th character of the *i*-th line equals "." if the cell in the *i*-th row and the *j*-th column of the square is painted white, and "#", if the cell is black.
Output Specification:
Print "YES" (without the quotes), if the test can be passed and "NO" (without the quotes) otherwise.
Demo Input:
['####\n.#..\n####\n....\n', '####\n....\n####\n....\n']
Demo Output:
['YES\n', 'NO\n']
Note:
In the first test sample it is enough to repaint the first cell in the second row. After such repainting the required 2βΓβ2 square is on the intersection of the 1-st and 2-nd row with the 1-st and 2-nd column.
|
```python
def f():
a1, a2, a3, a4 = input(), input(), input(), input()
li = []
li.append(a1[:2] + a2[:2])
li.append(a1[1:3] + a2[1:3])
li.append(a1[2:] + a2[2:])
li.append(a2[:2] + a3[:2])
li.append(a2[1:3] + a3[1:3])
li.append(a2[2:] + a3[2:])
li.append(a3[:2] + a4[:2])
li.append(a3[1:3] + a4[1:3])
li.append(a3[2:] + a4[2:])
p = 1
for i in range(9):
if li[i].count('#') == 2:
continue
else:
p = 0
break
if p:
print('NO')
else:
print('YES')
import sys
input = lambda: sys.stdin.readline().rstrip()
f()
```
| 3
|
|
95
|
A
|
Hockey
|
PROGRAMMING
| 1,600
|
[
"implementation",
"strings"
] |
A. Hockey
|
2
|
256
|
Petya loves hockey very much. One day, as he was watching a hockey match, he fell asleep. Petya dreamt of being appointed to change a hockey team's name. Thus, Petya was given the original team name *w* and the collection of forbidden substrings *s*1,<=*s*2,<=...,<=*s**n*. All those strings consist of uppercase and lowercase Latin letters. String *w* has the length of |*w*|, its characters are numbered from 1 to |*w*|.
First Petya should find all the occurrences of forbidden substrings in the *w* string. During the search of substrings the case of letter shouldn't be taken into consideration. That is, strings "aBC" and "ABc" are considered equal.
After that Petya should perform the replacement of all letters covered by the occurrences. More formally: a letter in the position *i* should be replaced by any other one if for position *i* in string *w* there exist pair of indices *l*,<=*r* (1<=β€<=*l*<=β€<=*i*<=β€<=*r*<=β€<=|*w*|) such that substring *w*[*l*Β ...Β *r*] is contained in the collection *s*1,<=*s*2,<=...,<=*s**n*, when using case insensitive comparison. During the replacement the letter's case should remain the same. Petya is not allowed to replace the letters that aren't covered by any forbidden substring.
Letter *letter* (uppercase or lowercase) is considered lucky for the hockey players. That's why Petya should perform the changes so that the *letter* occurred in the resulting string as many times as possible. Help Petya to find such resulting string. If there are several such strings, find the one that comes first lexicographically.
Note that the process of replacements is not repeated, it occurs only once. That is, if after Petya's replacements the string started to contain new occurrences of bad substrings, Petya pays no attention to them.
|
The first line contains the only integer *n* (1<=β€<=*n*<=β€<=100) β the number of forbidden substrings in the collection. Next *n* lines contain these substrings. The next line contains string *w*. All those *n*<=+<=1 lines are non-empty strings consisting of uppercase and lowercase Latin letters whose length does not exceed 100. The last line contains a lowercase letter *letter*.
|
Output the only line β Petya's resulting string with the maximum number of letters *letter*. If there are several answers then output the one that comes first lexicographically.
The lexicographical comparison is performed by the standard < operator in modern programming languages. The line *a* is lexicographically smaller than the line *b*, if *a* is a prefix of *b*, or there exists such an *i* (1<=β€<=*i*<=β€<=|*a*|), that *a**i*<=<<=*b**i*, and for any *j* (1<=β€<=*j*<=<<=*i*) *a**j*<==<=*b**j*. |*a*| stands for the length of string *a*.
|
[
"3\nbers\nucky\nelu\nPetrLoveLuckyNumbers\nt\n",
"4\nhello\nparty\nabefglghjdhfgj\nIVan\npetrsmatchwin\na\n",
"2\naCa\ncba\nabAcaba\nc\n"
] |
[
"PetrLovtTttttNumtttt\n",
"petrsmatchwin\n",
"abCacba\n"
] |
none
| 500
|
[
{
"input": "3\nbers\nucky\nelu\nPetrLoveLuckyNumbers\nt",
"output": "PetrLovtTttttNumtttt"
},
{
"input": "4\nhello\nparty\nabefglghjdhfgj\nIVan\npetrsmatchwin\na",
"output": "petrsmatchwin"
},
{
"input": "2\naCa\ncba\nabAcaba\nc",
"output": "abCacba"
},
{
"input": "3\nlol\nhello\neho\nPetrUnited\nt",
"output": "PetrUnited"
},
{
"input": "2\ntrsd\ndream\nPetrsDreamOh\ny",
"output": "PeyyyYyyyyOh"
},
{
"input": "1\nPetrsDreamOh\nPetrsDreamOh\nh",
"output": "HhhhhHhhhhHa"
},
{
"input": "3\netr\ned\nied\nPetrUnited\nd",
"output": "PdddUnitda"
},
{
"input": "3\netr\ned\nied\nPetrUnited\nz",
"output": "PzzzUnitzz"
},
{
"input": "3\nab\nBa\naB\nABBA\na",
"output": "BAAB"
},
{
"input": "3\nab\nBa\naB\nABBAC\nb",
"output": "BAABC"
},
{
"input": "7\na\nb\ng\nk\ne\nt\nt\nA\na",
"output": "B"
},
{
"input": "4\nEfron\nKeyt\ncesho\ncool\nCodeForcesHockeyTeam\np",
"output": "CodeForpppPpcpppPeam"
},
{
"input": "4\nEfron\nKeyt\ncesho\ncool\nCodeForcesOldHockeyNewTeam\np",
"output": "CodeForcesOldHockeyNewTeam"
},
{
"input": "2\nA\nB\nabababBabaBBaBBBBAaaaAAAAA\na",
"output": "bababaAbabAAbAAAABbbbBBBBB"
},
{
"input": "7\nS\nT\ng\ni\nO\nr\nq\nkljpfP\nv",
"output": "kljpfP"
},
{
"input": "47\nV\nS\ng\nr\nC\nR\nB\nb\nl\nW\nJ\ni\nU\nn\nq\nq\nj\nL\nR\nu\nQ\nC\nf\nC\nU\nu\nx\nh\nq\nE\nY\nu\nK\nt\nM\nU\nA\nA\ns\ni\nV\nT\nj\nb\nk\nW\nN\nNlVwRlWzQQWoCI\nz",
"output": "ZzZzZzZzZZZoZZ"
},
{
"input": "47\njw\nL\nxIp\nW\nI\naI\nEp\nylG\nNe\nEglZ\noYkyo\nwDuZK\nDVh\nuoAoF\nGWj\nt\nP\nuNQz\nbPSg\neqru\nxvll\nO\nmb\nCM\nwnmvv\nYpFsq\nFYID\nc\nr\nrhbl\nYseyB\nRGcRj\nhDtz\nW\nQlQWB\nY\nftSl\nyPlAd\nLPgVw\nEIGOF\nTQ\nQrFcr\nspu\nK\nIJ\nfXUd\nGhpV\nDxUhKXELSLIiJMIOsbrpPQPXFwH\nw",
"output": "DxUhWXEWSWWwWMWWsbwwWQWXFaH"
},
{
"input": "74\nPjc\nZcOWk\nM\nyMyp\ncH\nTzmX\nA\nXgl\nKVB\nbljv\nIH\nu\nnu\nLdahF\nt\nO\nSv\nuzFT\nzfNd\nUM\nbXR\nUQbXk\nAA\ngVmH\nng\nF\nK\nHP\nIu\nwrH\nN\nPnTIQ\nkUY\nyabHN\nTA\nvrgl\nyxmsh\nTrQ\nX\nvIbrl\nMfu\nPfN\ni\nrH\nt\nHl\nUwst\nj\nB\nBiDCA\nJcE\nfd\nbXuI\nWWSU\nrd\nmj\nt\nIGrPe\nQl\nxfoSV\no\nWKdG\nTqeu\nE\nbZyg\nbVqR\nzY\nZD\nhHpdP\njHww\nlfU\ngVem\nt\nBD\nhUOfmkiMZhZxTuuiAyPuoutEQiPfZFSQVMMQxckAqtlRv\nx",
"output": "hXXxxxxXZhZaXxxxXyPxxxxXQxPxZXSQVXXQacxXqxlRv"
},
{
"input": "74\nULa\nn\nvq\nbybI\nfCX\nEEi\nSg\nxj\nIDz\nfsP\nM\nGGjx\nDpY\ngffu\nK\nMy\nqbtz\nk\nbLNb\nqET\nN\nBBY\nx\nKHUT\nUju\ntyXI\no\nChXY\neia\nR\nakHR\ng\nax\nKyY\nwpdl\nCZA\nsmFl\nLVDJ\nO\nxHF\nW\nTMZ\nvN\nqiT\ng\nI\nPsR\nsCJL\nN\naSCi\nJYD\nP\nA\nM\nT\nG\ngU\nk\nA\nloT\nEbP\nZ\nEoo\nQ\nGGY\nZcbG\ntvYl\nM\nczMR\nj\ne\nlLjf\nY\nzm\nqifNoaopvznANCLmPpfToShyelsYSFllyQLUDYbcQ\ng",
"output": "ggfGggggvggGGCLgGgfGgShgglsGSFllgGLUDGbcG"
},
{
"input": "74\nM\nLQ\nH\ncA\nqj\nD\nnj\nzD\njM\ns\nR\noC\nFh\nlO\nj\nc\nEn\nAB\nsw\nT\nz\nEb\nb\nu\nmj\nMI\nD\nj\nH\np\nzD\nV\nR\nvg\nH\nS\nBy\nu\nQP\nB\ndD\nrI\nJF\nnA\nsv\nz\na\nl\nI\nFJ\nK\nH\nT\nF\nl\ntC\ng\ns\nNl\nUj\nu\nA\nOO\nLd\nk\nk\nkM\nLY\nbn\nv\nfT\nC\nI\nc\naeBolOleYgGmSLkFCPJPbQZUeodomjS\nv",
"output": "vvVovVveYvVvVVvVVVVVvQVVeovovvV"
},
{
"input": "99\ns\nc\nN\nN\ni\ni\nW\nJ\nA\nW\nm\nB\nf\nO\nm\nk\nQ\nf\nx\np\nl\nH\nH\no\nn\nC\nK\nR\ns\nT\nJ\nv\nC\nZ\nd\nl\nr\no\nD\ng\na\nA\nE\nk\nN\nw\na\nb\no\nk\nv\nc\ni\nj\nE\nl\no\nf\nv\ns\nh\nx\nm\nE\nN\nt\nj\nk\ng\nk\nX\nW\ni\nX\nm\nw\nK\nL\nQ\nr\nj\nf\no\nw\nv\nS\no\nH\ne\nL\nL\nd\nP\nr\ng\nz\nz\nq\nd\nBBPVyRDLuNwdkeSYWimsIMiAPiOMQfuDQMcLEly\nq",
"output": "QQQQyQQQuQqqqqQYQqqqQQqQQqQQAquQAQqQQqy"
},
{
"input": "77\nGw\nZw\nqg\neO\nmx\nfE\nqD\nVv\nRs\nbd\nwA\nnh\nDm\nbR\nxV\nwe\nKH\nbl\nVy\naJ\nFr\nNP\nir\nxh\nFq\nDG\nNh\ndW\naG\nkm\nNS\nOm\nyC\nts\nZt\nEN\nFs\njA\nvf\nde\nDa\nAW\nBv\nmO\nDk\nYj\nfl\ndj\nJF\ndI\nhr\nzk\nam\nLT\nPJ\nAQ\nOW\nWN\nUG\nTL\nSZ\nBK\nLp\njW\nrY\nPB\nRj\nBw\ngl\nlK\nWj\nPl\nfx\nYO\nbX\nSN\nPt\nxPDCKNGWsNSlScKgBNEooOTnSuycVtvdToGmFoEfsUorvsSNcQIlaXRQqrfTZZoNvjutjhGpGXmNSQQWCzeHhMJAxclmiNnErpxH\nh",
"output": "xPDCKNHHhHHlScKgBNHhoOThHuhhVtvdToGmFoEhhUorvsHHcQIlaXRQqrfTZZoNvjutjhGpGXmHHQQWCzeHhMHHxclmiNnErphA"
},
{
"input": "100\nqn\nBE\nyN\nep\nPq\nXz\nLM\nEZ\ndb\nMn\nbn\nFe\nqA\nzc\nyq\npC\nyA\nWk\nYq\nrs\noD\nvD\nzW\nxZ\nbl\nur\nkf\ndf\nLS\nUW\nMy\nhR\nsh\nNh\nog\nCW\nor\nzo\nrO\nao\nXH\nDq\nKa\nlL\nYQ\nOh\nRZ\nAx\nta\nko\nDn\nNg\nNy\nDB\nYD\njO\nAp\nFT\noB\nNc\nwB\nHO\neW\nAc\nDr\nMt\nDf\nbF\nFP\nRa\nnF\nhF\nXC\nnG\nan\nZY\nuB\nHP\nOR\nKN\nUv\nLe\nIj\nlH\nVw\njb\nXn\nqu\nJo\nzL\nKW\nLS\naV\nLs\nBX\nMY\noK\nfh\ngP\nTB\npBWBEkqznLlZykhmPrfidzWbQMNDdBaDLykOfdvOZjKoUxCqKwJdGuhseuxaYcVyAGTSTwXYmKweRMUdbyfxssSNGLSAhckIknDj\nd",
"output": "pBDDDkqznDdDdkhmPrfiddDdQDDDaDaDLydDfdvOZjDdUdDqDdJdGuhseuxaYcVdDGTSTwXYmDdeRMUadyfxssSDDDDAhckIddDj"
},
{
"input": "3\na\nA\na\nA\na",
"output": "B"
},
{
"input": "3\na\nA\na\nA\nb",
"output": "B"
},
{
"input": "4\na\nA\ni\nA\nPetyaIsVeryCoolGuy\np",
"output": "PetypPsVeryCoolGuy"
},
{
"input": "3\njap\nthd\ndshipssinceW\nJapanisexperiencingitsgreatesthardshipssinceWorldWarIIthardshipssinceWorldWarIItesthardshixper\nc",
"output": "CccanisexperiencingitsgreatestharcccccccccacCorldWarIItharcccccccccacCorldWarIItesthardshixper"
},
{
"input": "3\njap\nthd\ndshipssinceW\nJapanisexperiencingitsgreatesthardshipssinceWorldWarIIthardshipssinceWorldWarIItesthardshixper\na",
"output": "AbaanisexperiencingitsgreatestharaaaaaaaaaaaAorldWarIItharaaaaaaaaaaaAorldWarIItesthardshixper"
},
{
"input": "7\na\nh\nu\np\nfgh\nwyz\ndefghijkl\nabcdefghijklmnopqrstuvwxyz\na",
"output": "bbcaaaaaaaaamnoaqrstavwxyz"
},
{
"input": "9\na\nh\nu\np\nz\nfgh\nwyz\ndefghijkl\nghijklmnopqrstu\nabcdefghijklmnopqrstuvwxyz\na",
"output": "bbcaaaaaaaaaaaaaaaaaavwxya"
},
{
"input": "3\nab\nBa\naB\nABBA\nl",
"output": "LLLL"
}
] | 1,699,127,011
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 49
| 248
| 1,331,200
|
s = [input().lower() for i in range(int(input()))]
u, x = input(), input()
y = 'ab'[x == 'a']
d = [(x, y), (x.upper(), y.upper())]
v = u.lower()
n = len(v)
k = [0] * (n + 1)
for q in s:
i = v.find(q)
while i != -1:
k[i] += 1
k[i + len(q)] -= 1
i = v.find(q, i + 1)
p = ''
for i in range(n):
k[i + 1] += k[i]
p += d[u[i] != v[i]][x == v[i]] if k[i] else u[i]
print(p)
|
Title: Hockey
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Petya loves hockey very much. One day, as he was watching a hockey match, he fell asleep. Petya dreamt of being appointed to change a hockey team's name. Thus, Petya was given the original team name *w* and the collection of forbidden substrings *s*1,<=*s*2,<=...,<=*s**n*. All those strings consist of uppercase and lowercase Latin letters. String *w* has the length of |*w*|, its characters are numbered from 1 to |*w*|.
First Petya should find all the occurrences of forbidden substrings in the *w* string. During the search of substrings the case of letter shouldn't be taken into consideration. That is, strings "aBC" and "ABc" are considered equal.
After that Petya should perform the replacement of all letters covered by the occurrences. More formally: a letter in the position *i* should be replaced by any other one if for position *i* in string *w* there exist pair of indices *l*,<=*r* (1<=β€<=*l*<=β€<=*i*<=β€<=*r*<=β€<=|*w*|) such that substring *w*[*l*Β ...Β *r*] is contained in the collection *s*1,<=*s*2,<=...,<=*s**n*, when using case insensitive comparison. During the replacement the letter's case should remain the same. Petya is not allowed to replace the letters that aren't covered by any forbidden substring.
Letter *letter* (uppercase or lowercase) is considered lucky for the hockey players. That's why Petya should perform the changes so that the *letter* occurred in the resulting string as many times as possible. Help Petya to find such resulting string. If there are several such strings, find the one that comes first lexicographically.
Note that the process of replacements is not repeated, it occurs only once. That is, if after Petya's replacements the string started to contain new occurrences of bad substrings, Petya pays no attention to them.
Input Specification:
The first line contains the only integer *n* (1<=β€<=*n*<=β€<=100) β the number of forbidden substrings in the collection. Next *n* lines contain these substrings. The next line contains string *w*. All those *n*<=+<=1 lines are non-empty strings consisting of uppercase and lowercase Latin letters whose length does not exceed 100. The last line contains a lowercase letter *letter*.
Output Specification:
Output the only line β Petya's resulting string with the maximum number of letters *letter*. If there are several answers then output the one that comes first lexicographically.
The lexicographical comparison is performed by the standard < operator in modern programming languages. The line *a* is lexicographically smaller than the line *b*, if *a* is a prefix of *b*, or there exists such an *i* (1<=β€<=*i*<=β€<=|*a*|), that *a**i*<=<<=*b**i*, and for any *j* (1<=β€<=*j*<=<<=*i*) *a**j*<==<=*b**j*. |*a*| stands for the length of string *a*.
Demo Input:
['3\nbers\nucky\nelu\nPetrLoveLuckyNumbers\nt\n', '4\nhello\nparty\nabefglghjdhfgj\nIVan\npetrsmatchwin\na\n', '2\naCa\ncba\nabAcaba\nc\n']
Demo Output:
['PetrLovtTttttNumtttt\n', 'petrsmatchwin\n', 'abCacba\n']
Note:
none
|
```python
s = [input().lower() for i in range(int(input()))]
u, x = input(), input()
y = 'ab'[x == 'a']
d = [(x, y), (x.upper(), y.upper())]
v = u.lower()
n = len(v)
k = [0] * (n + 1)
for q in s:
i = v.find(q)
while i != -1:
k[i] += 1
k[i + len(q)] -= 1
i = v.find(q, i + 1)
p = ''
for i in range(n):
k[i + 1] += k[i]
p += d[u[i] != v[i]][x == v[i]] if k[i] else u[i]
print(p)
```
| 3.93552
|
119
|
A
|
Epic Game
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Simon and Antisimon play a game. Initially each player receives one fixed positive integer that doesn't change throughout the game. Simon receives number *a* and Antisimon receives number *b*. They also have a heap of *n* stones. The players take turns to make a move and Simon starts. During a move a player should take from the heap the number of stones equal to the greatest common divisor of the fixed number he has received and the number of stones left in the heap. A player loses when he cannot take the required number of stones (i. e. the heap has strictly less stones left than one needs to take).
Your task is to determine by the given *a*, *b* and *n* who wins the game.
|
The only string contains space-separated integers *a*, *b* and *n* (1<=β€<=*a*,<=*b*,<=*n*<=β€<=100) β the fixed numbers Simon and Antisimon have received correspondingly and the initial number of stones in the pile.
|
If Simon wins, print "0" (without the quotes), otherwise print "1" (without the quotes).
|
[
"3 5 9\n",
"1 1 100\n"
] |
[
"0",
"1"
] |
The greatest common divisor of two non-negative integers *a* and *b* is such maximum positive integer *k*, that *a* is divisible by *k* without remainder and similarly, *b* is divisible by *k* without remainder. Let *gcd*(*a*,β*b*) represent the operation of calculating the greatest common divisor of numbers *a* and *b*. Specifically, *gcd*(*x*,β0)β=β*gcd*(0,β*x*)β=β*x*.
In the first sample the game will go like that:
- Simon should take *gcd*(3,β9)β=β3 stones from the heap. After his move the heap has 6 stones left.- Antisimon should take *gcd*(5,β6)β=β1 stone from the heap. After his move the heap has 5 stones left.- Simon should take *gcd*(3,β5)β=β1 stone from the heap. After his move the heap has 4 stones left.- Antisimon should take *gcd*(5,β4)β=β1 stone from the heap. After his move the heap has 3 stones left.- Simon should take *gcd*(3,β3)β=β3 stones from the heap. After his move the heap has 0 stones left.- Antisimon should take *gcd*(5,β0)β=β5 stones from the heap. As 0β<β5, it is impossible and Antisimon loses.
In the second sample each player during each move takes one stone from the heap. As *n* is even, Antisimon takes the last stone and Simon can't make a move after that.
| 500
|
[
{
"input": "3 5 9",
"output": "0"
},
{
"input": "1 1 100",
"output": "1"
},
{
"input": "23 12 16",
"output": "1"
},
{
"input": "95 26 29",
"output": "1"
},
{
"input": "73 32 99",
"output": "1"
},
{
"input": "1 1 1",
"output": "0"
},
{
"input": "41 12 65",
"output": "1"
},
{
"input": "13 61 100",
"output": "1"
},
{
"input": "100 100 10",
"output": "0"
},
{
"input": "12 24 26",
"output": "1"
},
{
"input": "73 21 96",
"output": "1"
},
{
"input": "17 22 81",
"output": "1"
},
{
"input": "14 88 97",
"output": "1"
},
{
"input": "42 81 17",
"output": "0"
},
{
"input": "34 36 19",
"output": "1"
},
{
"input": "21 87 12",
"output": "1"
},
{
"input": "97 92 98",
"output": "1"
},
{
"input": "49 25 62",
"output": "1"
},
{
"input": "29 17 44",
"output": "1"
},
{
"input": "10 1 10",
"output": "0"
},
{
"input": "99 98 100",
"output": "1"
},
{
"input": "100 100 1",
"output": "0"
},
{
"input": "11 99 55",
"output": "0"
},
{
"input": "8 13 21",
"output": "0"
},
{
"input": "34 55 89",
"output": "0"
},
{
"input": "21 34 55",
"output": "1"
},
{
"input": "13 21 34",
"output": "1"
},
{
"input": "34 21 55",
"output": "0"
},
{
"input": "10 20 84",
"output": "1"
},
{
"input": "4 2 5",
"output": "0"
},
{
"input": "3 2 3",
"output": "0"
},
{
"input": "31 23 1",
"output": "0"
},
{
"input": "100 100 100",
"output": "0"
},
{
"input": "100 1 100",
"output": "0"
},
{
"input": "1 100 100",
"output": "1"
},
{
"input": "1 1 100",
"output": "1"
},
{
"input": "17 23 100",
"output": "1"
},
{
"input": "99 98 100",
"output": "1"
},
{
"input": "1 1 2",
"output": "1"
},
{
"input": "2 1 1",
"output": "0"
},
{
"input": "1 2 1",
"output": "0"
},
{
"input": "2 1 2",
"output": "0"
},
{
"input": "10 10 3",
"output": "1"
},
{
"input": "2 2 1",
"output": "0"
},
{
"input": "9 5 1",
"output": "0"
}
] | 1,699,476,447
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 45
| 124
| 0
|
import math
a, b, c =map(int, input().split())
win=0
while True:
if win:
if math.gcd(c,b)<=c:
c-=math.gcd(c,b)
win=1-win
else:
break
else:
if math.gcd(c,a)<=c:
c-=math.gcd(c,a)
win=1-win
else:
break
print(1-win)
|
Title: Epic Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Simon and Antisimon play a game. Initially each player receives one fixed positive integer that doesn't change throughout the game. Simon receives number *a* and Antisimon receives number *b*. They also have a heap of *n* stones. The players take turns to make a move and Simon starts. During a move a player should take from the heap the number of stones equal to the greatest common divisor of the fixed number he has received and the number of stones left in the heap. A player loses when he cannot take the required number of stones (i. e. the heap has strictly less stones left than one needs to take).
Your task is to determine by the given *a*, *b* and *n* who wins the game.
Input Specification:
The only string contains space-separated integers *a*, *b* and *n* (1<=β€<=*a*,<=*b*,<=*n*<=β€<=100) β the fixed numbers Simon and Antisimon have received correspondingly and the initial number of stones in the pile.
Output Specification:
If Simon wins, print "0" (without the quotes), otherwise print "1" (without the quotes).
Demo Input:
['3 5 9\n', '1 1 100\n']
Demo Output:
['0', '1']
Note:
The greatest common divisor of two non-negative integers *a* and *b* is such maximum positive integer *k*, that *a* is divisible by *k* without remainder and similarly, *b* is divisible by *k* without remainder. Let *gcd*(*a*,β*b*) represent the operation of calculating the greatest common divisor of numbers *a* and *b*. Specifically, *gcd*(*x*,β0)β=β*gcd*(0,β*x*)β=β*x*.
In the first sample the game will go like that:
- Simon should take *gcd*(3,β9)β=β3 stones from the heap. After his move the heap has 6 stones left.- Antisimon should take *gcd*(5,β6)β=β1 stone from the heap. After his move the heap has 5 stones left.- Simon should take *gcd*(3,β5)β=β1 stone from the heap. After his move the heap has 4 stones left.- Antisimon should take *gcd*(5,β4)β=β1 stone from the heap. After his move the heap has 3 stones left.- Simon should take *gcd*(3,β3)β=β3 stones from the heap. After his move the heap has 0 stones left.- Antisimon should take *gcd*(5,β0)β=β5 stones from the heap. As 0β<β5, it is impossible and Antisimon loses.
In the second sample each player during each move takes one stone from the heap. As *n* is even, Antisimon takes the last stone and Simon can't make a move after that.
|
```python
import math
a, b, c =map(int, input().split())
win=0
while True:
if win:
if math.gcd(c,b)<=c:
c-=math.gcd(c,b)
win=1-win
else:
break
else:
if math.gcd(c,a)<=c:
c-=math.gcd(c,a)
win=1-win
else:
break
print(1-win)
```
| 3
|
|
510
|
A
|
Fox And Snake
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Fox Ciel starts to learn programming. The first task is drawing a fox! However, that turns out to be too hard for a beginner, so she decides to draw a snake instead.
A snake is a pattern on a *n* by *m* table. Denote *c*-th cell of *r*-th row as (*r*,<=*c*). The tail of the snake is located at (1,<=1), then it's body extends to (1,<=*m*), then goes down 2 rows to (3,<=*m*), then goes left to (3,<=1) and so on.
Your task is to draw this snake for Fox Ciel: the empty cells should be represented as dot characters ('.') and the snake cells should be filled with number signs ('#').
Consider sample tests in order to understand the snake pattern.
|
The only line contains two integers: *n* and *m* (3<=β€<=*n*,<=*m*<=β€<=50).
*n* is an odd number.
|
Output *n* lines. Each line should contain a string consisting of *m* characters. Do not output spaces.
|
[
"3 3\n",
"3 4\n",
"5 3\n",
"9 9\n"
] |
[
"###\n..#\n###\n",
"####\n...#\n####\n",
"###\n..#\n###\n#..\n###\n",
"#########\n........#\n#########\n#........\n#########\n........#\n#########\n#........\n#########\n"
] |
none
| 500
|
[
{
"input": "3 3",
"output": "###\n..#\n###"
},
{
"input": "3 4",
"output": "####\n...#\n####"
},
{
"input": "5 3",
"output": "###\n..#\n###\n#..\n###"
},
{
"input": "9 9",
"output": "#########\n........#\n#########\n#........\n#########\n........#\n#########\n#........\n#########"
},
{
"input": "3 5",
"output": "#####\n....#\n#####"
},
{
"input": "3 6",
"output": "######\n.....#\n######"
},
{
"input": "7 3",
"output": "###\n..#\n###\n#..\n###\n..#\n###"
},
{
"input": "7 4",
"output": "####\n...#\n####\n#...\n####\n...#\n####"
},
{
"input": "49 50",
"output": "##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.............................................."
},
{
"input": "43 50",
"output": "##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.............................................."
},
{
"input": "43 27",
"output": "###########################\n..........................#\n###########################\n#..........................\n###########################\n..........................#\n###########################\n#..........................\n###########################\n..........................#\n###########################\n#..........................\n###########################\n..........................#\n###########################\n#..........................\n###########################\n....................."
},
{
"input": "11 15",
"output": "###############\n..............#\n###############\n#..............\n###############\n..............#\n###############\n#..............\n###############\n..............#\n###############"
},
{
"input": "11 3",
"output": "###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###"
},
{
"input": "19 3",
"output": "###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###"
},
{
"input": "23 50",
"output": "##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.................................................#\n##################################################\n#.................................................\n##################################################\n.............................................."
},
{
"input": "49 49",
"output": "#################################################\n................................................#\n#################################################\n#................................................\n#################################################\n................................................#\n#################################################\n#................................................\n#################################################\n................................................#\n#..."
},
{
"input": "33 43",
"output": "###########################################\n..........................................#\n###########################################\n#..........................................\n###########################################\n..........................................#\n###########################################\n#..........................................\n###########################################\n..........................................#\n###########################################\n#.................."
},
{
"input": "33 44",
"output": "############################################\n...........................................#\n############################################\n#...........................................\n############################################\n...........................................#\n############################################\n#...........................................\n############################################\n...........................................#\n############################################\n#......."
},
{
"input": "45 45",
"output": "#############################################\n............................................#\n#############################################\n#............................................\n#############################################\n............................................#\n#############################################\n#............................................\n#############################################\n............................................#\n#########################################..."
},
{
"input": "45 49",
"output": "#################################################\n................................................#\n#################################################\n#................................................\n#################################################\n................................................#\n#################################################\n#................................................\n#################################################\n................................................#\n#..."
},
{
"input": "45 3",
"output": "###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###\n..#\n###\n#..\n###"
},
{
"input": "45 4",
"output": "####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####\n...#\n####\n#...\n####"
},
{
"input": "5 4",
"output": "####\n...#\n####\n#...\n####"
},
{
"input": "5 5",
"output": "#####\n....#\n#####\n#....\n#####"
},
{
"input": "5 6",
"output": "######\n.....#\n######\n#.....\n######"
},
{
"input": "7 5",
"output": "#####\n....#\n#####\n#....\n#####\n....#\n#####"
},
{
"input": "7 6",
"output": "######\n.....#\n######\n#.....\n######\n.....#\n######"
},
{
"input": "7 7",
"output": "#######\n......#\n#######\n#......\n#######\n......#\n#######"
}
] | 1,683,208,438
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 28
| 46
| 0
|
column, row = map(int, input().split())
align = 1
for i in range(1, column + 1):
if i % 2 != 0:
print("#" * row)
elif align % 2 != 0:
print("." * (row - 1), end="")
print("#")
align += 1
elif align % 2 == 0:
print("#", end="")
print("." * (row - 1))
align += 1
|
Title: Fox And Snake
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Fox Ciel starts to learn programming. The first task is drawing a fox! However, that turns out to be too hard for a beginner, so she decides to draw a snake instead.
A snake is a pattern on a *n* by *m* table. Denote *c*-th cell of *r*-th row as (*r*,<=*c*). The tail of the snake is located at (1,<=1), then it's body extends to (1,<=*m*), then goes down 2 rows to (3,<=*m*), then goes left to (3,<=1) and so on.
Your task is to draw this snake for Fox Ciel: the empty cells should be represented as dot characters ('.') and the snake cells should be filled with number signs ('#').
Consider sample tests in order to understand the snake pattern.
Input Specification:
The only line contains two integers: *n* and *m* (3<=β€<=*n*,<=*m*<=β€<=50).
*n* is an odd number.
Output Specification:
Output *n* lines. Each line should contain a string consisting of *m* characters. Do not output spaces.
Demo Input:
['3 3\n', '3 4\n', '5 3\n', '9 9\n']
Demo Output:
['###\n..#\n###\n', '####\n...#\n####\n', '###\n..#\n###\n#..\n###\n', '#########\n........#\n#########\n#........\n#########\n........#\n#########\n#........\n#########\n']
Note:
none
|
```python
column, row = map(int, input().split())
align = 1
for i in range(1, column + 1):
if i % 2 != 0:
print("#" * row)
elif align % 2 != 0:
print("." * (row - 1), end="")
print("#")
align += 1
elif align % 2 == 0:
print("#", end="")
print("." * (row - 1))
align += 1
```
| 3
|
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
Bike is interested in permutations. A permutation of length *n* is an integer sequence such that each integer from 0 to (*n*<=-<=1) appears exactly once in it. For example, [0,<=2,<=1] is a permutation of length 3 while both [0,<=2,<=2] and [1,<=2,<=3] is not.
A permutation triple of permutations of length *n* (*a*,<=*b*,<=*c*) is called a Lucky Permutation Triple if and only if . The sign *a**i* denotes the *i*-th element of permutation *a*. The modular equality described above denotes that the remainders after dividing *a**i*<=+<=*b**i* by *n* and dividing *c**i* by *n* are equal.
Now, he has an integer *n* and wants to find a Lucky Permutation Triple. Could you please help him?
|
The first line contains a single integer *n* (1<=β€<=*n*<=β€<=105).
|
If no Lucky Permutation Triple of length *n* exists print -1.
Otherwise, you need to print three lines. Each line contains *n* space-seperated integers. The first line must contain permutation *a*, the second line β permutation *b*, the third β permutation *c*.
If there are multiple solutions, print any of them.
|
[
"5\n",
"2\n"
] |
[
"1 4 3 2 0\n1 0 2 4 3\n2 4 0 1 3\n",
"-1\n"
] |
In Sample 1, the permutation triple ([1,β4,β3,β2,β0],β[1,β0,β2,β4,β3],β[2,β4,β0,β1,β3]) is Lucky Permutation Triple, as following holds:
- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a6bf1b9b57809dbec5021f65f89616f259587c07.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/48cc13134296b68f459f69d78e0240859aaec702.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/ac44412de7b46833e90348a6b3298f9796e3977c.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/3825b0bb758208dda2ead1c5224c05d89ad9ab55.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/0a72e2da40048a507839927a211267ac01c9bf89.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In Sample 2, you can easily notice that no lucky permutation triple exists.
| 0
|
[
{
"input": "5",
"output": "1 4 3 2 0\n1 0 2 4 3\n2 4 0 1 3"
},
{
"input": "2",
"output": "-1"
},
{
"input": "8",
"output": "-1"
},
{
"input": "9",
"output": "0 1 2 3 4 5 6 7 8 \n0 1 2 3 4 5 6 7 8 \n0 2 4 6 8 1 3 5 7 "
},
{
"input": "2",
"output": "-1"
},
{
"input": "77",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 \n0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 4..."
},
{
"input": "6",
"output": "-1"
},
{
"input": "87",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 \n0 2 4..."
},
{
"input": "72",
"output": "-1"
},
{
"input": "1",
"output": "0 \n0 \n0 "
},
{
"input": "23",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 \n0 2 4 6 8 10 12 14 16 18 20 22 1 3 5 7 9 11 13 15 17 19 21 "
},
{
"input": "52",
"output": "-1"
},
{
"input": "32",
"output": "-1"
},
{
"input": "25",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 \n0 2 4 6 8 10 12 14 16 18 20 22 24 1 3 5 7 9 11 13 15 17 19 21 23 "
},
{
"input": "54",
"output": "-1"
},
{
"input": "39",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 \n0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 "
},
{
"input": "20",
"output": "-1"
},
{
"input": "53",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 \n0 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 "
},
{
"input": "34",
"output": "-1"
},
{
"input": "23",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 \n0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 \n0 2 4 6 8 10 12 14 16 18 20 22 1 3 5 7 9 11 13 15 17 19 21 "
},
{
"input": "37123",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "41904",
"output": "-1"
},
{
"input": "46684",
"output": "-1"
},
{
"input": "67817",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "72598",
"output": "-1"
},
{
"input": "85891",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "74320",
"output": "-1"
},
{
"input": "11805",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "16586",
"output": "-1"
},
{
"input": "5014",
"output": "-1"
},
{
"input": "73268",
"output": "-1"
},
{
"input": "61697",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "99182",
"output": "-1"
},
{
"input": "79771",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "68199",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "5684",
"output": "-1"
},
{
"input": "10465",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "31598",
"output": "-1"
},
{
"input": "36379",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "16968",
"output": "-1"
},
{
"input": "93061",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "73650",
"output": "-1"
},
{
"input": "94783",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "99564",
"output": "-1"
},
{
"input": "37049",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "25478",
"output": "-1"
},
{
"input": "30259",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "43551",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "31980",
"output": "-1"
},
{
"input": "69465",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "1",
"output": "0 \n0 \n0 "
},
{
"input": "100000",
"output": "-1"
},
{
"input": "99999",
"output": "0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 1..."
},
{
"input": "99998",
"output": "-1"
}
] | 1,622,810,089
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 54
| 996
| 8,192,000
|
t=int(input())
if(t%2==0):
print(-1)
else:
arr=[]
brr=[]
crr=[]
for i in range(t-1,-1,-1):
arr.append(i)
for i in range(0,t,2):
brr.append(i)
for i in range(1,t-1,2):
brr.append(i)
for i in range(t):
x=arr[i]+brr[i]
y=int(x%t)
crr.append(y)
print(*arr,sep=" ")
print(*brr,sep=" ")
print(*crr,sep=" ")
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bike is interested in permutations. A permutation of length *n* is an integer sequence such that each integer from 0 to (*n*<=-<=1) appears exactly once in it. For example, [0,<=2,<=1] is a permutation of length 3 while both [0,<=2,<=2] and [1,<=2,<=3] is not.
A permutation triple of permutations of length *n* (*a*,<=*b*,<=*c*) is called a Lucky Permutation Triple if and only if . The sign *a**i* denotes the *i*-th element of permutation *a*. The modular equality described above denotes that the remainders after dividing *a**i*<=+<=*b**i* by *n* and dividing *c**i* by *n* are equal.
Now, he has an integer *n* and wants to find a Lucky Permutation Triple. Could you please help him?
Input Specification:
The first line contains a single integer *n* (1<=β€<=*n*<=β€<=105).
Output Specification:
If no Lucky Permutation Triple of length *n* exists print -1.
Otherwise, you need to print three lines. Each line contains *n* space-seperated integers. The first line must contain permutation *a*, the second line β permutation *b*, the third β permutation *c*.
If there are multiple solutions, print any of them.
Demo Input:
['5\n', '2\n']
Demo Output:
['1 4 3 2 0\n1 0 2 4 3\n2 4 0 1 3\n', '-1\n']
Note:
In Sample 1, the permutation triple ([1,β4,β3,β2,β0],β[1,β0,β2,β4,β3],β[2,β4,β0,β1,β3]) is Lucky Permutation Triple, as following holds:
- <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/a6bf1b9b57809dbec5021f65f89616f259587c07.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/48cc13134296b68f459f69d78e0240859aaec702.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/ac44412de7b46833e90348a6b3298f9796e3977c.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/3825b0bb758208dda2ead1c5224c05d89ad9ab55.png" style="max-width: 100.0%;max-height: 100.0%;"/>; - <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/0a72e2da40048a507839927a211267ac01c9bf89.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
In Sample 2, you can easily notice that no lucky permutation triple exists.
|
```python
t=int(input())
if(t%2==0):
print(-1)
else:
arr=[]
brr=[]
crr=[]
for i in range(t-1,-1,-1):
arr.append(i)
for i in range(0,t,2):
brr.append(i)
for i in range(1,t-1,2):
brr.append(i)
for i in range(t):
x=arr[i]+brr[i]
y=int(x%t)
crr.append(y)
print(*arr,sep=" ")
print(*brr,sep=" ")
print(*crr,sep=" ")
```
| 3
|
|
11
|
A
|
Increasing Sequence
|
PROGRAMMING
| 900
|
[
"constructive algorithms",
"implementation",
"math"
] |
A. Increasing Sequence
|
1
|
64
|
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing?
|
The first line of the input contains two integer numbers *n* and *d* (2<=β€<=*n*<=β€<=2000,<=1<=β€<=*d*<=β€<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=β€<=*b**i*<=β€<=106).
|
Output the minimal number of moves needed to make the sequence increasing.
|
[
"4 2\n1 3 3 2\n"
] |
[
"3\n"
] |
none
| 0
|
[
{
"input": "4 2\n1 3 3 2",
"output": "3"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 1\n2 5",
"output": "0"
},
{
"input": "2 1\n1 2",
"output": "0"
},
{
"input": "2 1\n1 1",
"output": "1"
},
{
"input": "2 7\n10 20",
"output": "0"
},
{
"input": "2 7\n1 1",
"output": "1"
},
{
"input": "3 3\n18 1 9",
"output": "10"
},
{
"input": "3 3\n15 17 9",
"output": "3"
},
{
"input": "3 3\n10 9 12",
"output": "2"
},
{
"input": "10 3\n2 1 17 10 5 16 8 4 15 17",
"output": "31"
},
{
"input": "10 3\n6 11 4 12 22 15 23 26 24 26",
"output": "13"
},
{
"input": "10 3\n10 24 13 15 18 14 15 26 33 35",
"output": "29"
},
{
"input": "100 3\n529 178 280 403 326 531 671 427 188 866 669 646 421 804 494 609 53 1012 211 243 887 833 900 543 226 42 859 718 454 372 971 692 846 770 511 395 499 479 641 756 115 269 206 45 1039 727 400 779 859 614 146 214 196 919 702 959 380 830 535 878 859 784 316 305 782 924 536 243 236 978 564 150 291 877 808 983 537 839 490 120 168 838 267 650 900 170 211 504 326 771 895 984 994 483 776 100 471 1078 317 580",
"output": "15717"
},
{
"input": "100 3\n329 226 331 909 962 112 837 1005 194 818 506 416 125 648 367 459 400 582 989 547 329 438 234 121 272 226 821 376 834 427 718 164 834 113 654 177 737 212 169 696 744 180 89 944 233 147 667 990 809 1072 1085 1093 814 265 1067 312 833 572 303 901 1032 504 185 817 389 158 613 723 239 269 911 352 769 404 225 822 897 606 947 323 913 804 923 1084 552 901 486 249 209 898 847 610 728 1122 986 669 1116 1076 367 327",
"output": "16133"
}
] | 1,676,729,932
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 25
| 92
| 0
|
n,d=map(int,input().split())
L=[int(x) for x in input().split()]
ans=0
for i in range(n-1):
if L[i+1]<=L[i]:
x=L[i]-L[i+1]
ans+=x//d +1
L[i+1]+=d*(x//d +1)
print(ans)
|
Title: Increasing Sequence
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
A sequence *a*0,<=*a*1,<=...,<=*a**t*<=-<=1 is called increasing if *a**i*<=-<=1<=<<=*a**i* for each *i*:<=0<=<<=*i*<=<<=*t*.
You are given a sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 and a positive integer *d*. In each move you may choose one element of the given sequence and add *d* to it. What is the least number of moves required to make the given sequence increasing?
Input Specification:
The first line of the input contains two integer numbers *n* and *d* (2<=β€<=*n*<=β€<=2000,<=1<=β€<=*d*<=β€<=106). The second line contains space separated sequence *b*0,<=*b*1,<=...,<=*b**n*<=-<=1 (1<=β€<=*b**i*<=β€<=106).
Output Specification:
Output the minimal number of moves needed to make the sequence increasing.
Demo Input:
['4 2\n1 3 3 2\n']
Demo Output:
['3\n']
Note:
none
|
```python
n,d=map(int,input().split())
L=[int(x) for x in input().split()]
ans=0
for i in range(n-1):
if L[i+1]<=L[i]:
x=L[i]-L[i+1]
ans+=x//d +1
L[i+1]+=d*(x//d +1)
print(ans)
```
| 3.954
|
27
|
A
|
Next Test
|
PROGRAMMING
| 1,200
|
[
"implementation",
"sortings"
] |
A. Next Test
|
2
|
256
|
Β«PolygonΒ» is a system which allows to create programming tasks in a simple and professional way. When you add a test to the problem, the corresponding form asks you for the test index. As in most cases it is clear which index the next test will have, the system suggests the default value of the index. It is calculated as the smallest positive integer which is not used as an index for some previously added test.
You are to implement this feature. Create a program which determines the default index of the next test, given the indexes of the previously added tests.
|
The first line contains one integer *n* (1<=β€<=*n*<=β€<=3000) β the amount of previously added tests. The second line contains *n* distinct integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a**i*<=β€<=3000) β indexes of these tests.
|
Output the required default value for the next test index.
|
[
"3\n1 7 2\n"
] |
[
"3\n"
] |
none
| 500
|
[
{
"input": "1\n1",
"output": "2"
},
{
"input": "2\n2 1",
"output": "3"
},
{
"input": "3\n3 4 1",
"output": "2"
},
{
"input": "4\n6 4 3 5",
"output": "1"
},
{
"input": "5\n3 2 1 7 4",
"output": "5"
},
{
"input": "6\n4 1 2 5 3 7",
"output": "6"
},
{
"input": "7\n3 2 1 6 5 7 4",
"output": "8"
},
{
"input": "8\n2 8 3 7 6 9 1 5",
"output": "4"
},
{
"input": "9\n10 5 9 3 8 7 1 2 4",
"output": "6"
},
{
"input": "10\n7 2 3 8 9 6 5 4 1 10",
"output": "11"
},
{
"input": "1\n1",
"output": "2"
},
{
"input": "2\n1 2",
"output": "3"
},
{
"input": "3\n2 4 1",
"output": "3"
},
{
"input": "4\n4 2 3 1",
"output": "5"
},
{
"input": "5\n3 1 4 2 5",
"output": "6"
},
{
"input": "6\n1 3 6 7 2 4",
"output": "5"
},
{
"input": "7\n1 5 4 7 2 3 6",
"output": "8"
},
{
"input": "8\n12 1 6 5 2 8 3 4",
"output": "7"
},
{
"input": "9\n3 2 7 5 6 4 1 9 10",
"output": "8"
},
{
"input": "10\n1 7 13 6 5 10 3 8 2 4",
"output": "9"
},
{
"input": "1\n2",
"output": "1"
},
{
"input": "1\n3",
"output": "1"
},
{
"input": "1\n3000",
"output": "1"
},
{
"input": "2\n2 3",
"output": "1"
},
{
"input": "2\n3000 1",
"output": "2"
}
] | 1,531,851,507
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 248
| 0
|
import sys
n = input()
arr = [int(i) for i in input().split()]
arr.sort()
count =arr[0]
if count > 1:
print (1)
else:
for i in range(arr.__len__()):
if count<arr[i]and count>arr[i-1]:
break
count+=1
print (count)
|
Title: Next Test
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Β«PolygonΒ» is a system which allows to create programming tasks in a simple and professional way. When you add a test to the problem, the corresponding form asks you for the test index. As in most cases it is clear which index the next test will have, the system suggests the default value of the index. It is calculated as the smallest positive integer which is not used as an index for some previously added test.
You are to implement this feature. Create a program which determines the default index of the next test, given the indexes of the previously added tests.
Input Specification:
The first line contains one integer *n* (1<=β€<=*n*<=β€<=3000) β the amount of previously added tests. The second line contains *n* distinct integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a**i*<=β€<=3000) β indexes of these tests.
Output Specification:
Output the required default value for the next test index.
Demo Input:
['3\n1 7 2\n']
Demo Output:
['3\n']
Note:
none
|
```python
import sys
n = input()
arr = [int(i) for i in input().split()]
arr.sort()
count =arr[0]
if count > 1:
print (1)
else:
for i in range(arr.__len__()):
if count<arr[i]and count>arr[i-1]:
break
count+=1
print (count)
```
| 3.938
|
735
|
A
|
Ostap and Grasshopper
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] | null | null |
On the way to Rio de Janeiro Ostap kills time playing with a grasshopper he took with him in a special box. Ostap builds a line of length *n* such that some cells of this line are empty and some contain obstacles. Then, he places his grasshopper to one of the empty cells and a small insect in another empty cell. The grasshopper wants to eat the insect.
Ostap knows that grasshopper is able to jump to any empty cell that is exactly *k* cells away from the current (to the left or to the right). Note that it doesn't matter whether intermediate cells are empty or not as the grasshopper makes a jump over them. For example, if *k*<==<=1 the grasshopper can jump to a neighboring cell only, and if *k*<==<=2 the grasshopper can jump over a single cell.
Your goal is to determine whether there is a sequence of jumps such that grasshopper will get from his initial position to the cell with an insect.
|
The first line of the input contains two integers *n* and *k* (2<=β€<=*n*<=β€<=100, 1<=β€<=*k*<=β€<=*n*<=-<=1)Β β the number of cells in the line and the length of one grasshopper's jump.
The second line contains a string of length *n* consisting of characters '.', '#', 'G' and 'T'. Character '.' means that the corresponding cell is empty, character '#' means that the corresponding cell contains an obstacle and grasshopper can't jump there. Character 'G' means that the grasshopper starts at this position and, finally, 'T' means that the target insect is located at this cell. It's guaranteed that characters 'G' and 'T' appear in this line exactly once.
|
If there exists a sequence of jumps (each jump of length *k*), such that the grasshopper can get from his initial position to the cell with the insect, print "YES" (without quotes) in the only line of the input. Otherwise, print "NO" (without quotes).
|
[
"5 2\n#G#T#\n",
"6 1\nT....G\n",
"7 3\nT..#..G\n",
"6 2\n..GT..\n"
] |
[
"YES\n",
"YES\n",
"NO\n",
"NO\n"
] |
In the first sample, the grasshopper can make one jump to the right in order to get from cell 2 to cell 4.
In the second sample, the grasshopper is only able to jump to neighboring cells but the way to the insect is freeΒ β he can get there by jumping left 5 times.
In the third sample, the grasshopper can't make a single jump.
In the fourth sample, the grasshopper can only jump to the cells with odd indices, thus he won't be able to reach the insect.
| 500
|
[
{
"input": "5 2\n#G#T#",
"output": "YES"
},
{
"input": "6 1\nT....G",
"output": "YES"
},
{
"input": "7 3\nT..#..G",
"output": "NO"
},
{
"input": "6 2\n..GT..",
"output": "NO"
},
{
"input": "2 1\nGT",
"output": "YES"
},
{
"input": "100 5\nG####.####.####.####.####.####.####.####.####.####.####.####.####.####.####.####.####.####.####T####",
"output": "YES"
},
{
"input": "100 5\nG####.####.####.####.####.####.####.####.####.####.####.####.####.#########.####.####.####.####T####",
"output": "NO"
},
{
"input": "2 1\nTG",
"output": "YES"
},
{
"input": "99 1\n...T.............................................................................................G.",
"output": "YES"
},
{
"input": "100 2\nG............#.....#...........#....#...........##............#............#......................T.",
"output": "NO"
},
{
"input": "100 1\n#.#.#.##..#..##.#....##.##.##.#....####..##.#.##..GT..##...###.#.##.#..#..##.###..#.####..#.#.##..##",
"output": "YES"
},
{
"input": "100 2\n..#####.#.#.......#.#.#...##..####..###..#.#######GT####.#.#...##...##.#..###....##.#.#..#.###....#.",
"output": "NO"
},
{
"input": "100 3\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 3\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 3\nG..................................#......#......#.......#.#..........#........#......#..........#.T",
"output": "NO"
},
{
"input": "100 3\nG..............#..........#...#..............#.#.....................#......#........#.........#...T",
"output": "NO"
},
{
"input": "100 3\nG##################################################################################################T",
"output": "NO"
},
{
"input": "100 33\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 33\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 33\nG.........#........#..........#..............#.................#............................#.#....T",
"output": "YES"
},
{
"input": "100 33\nG.......#..................#..............................#............................#..........T.",
"output": "NO"
},
{
"input": "100 33\nG#..........##...#.#.....................#.#.#.........##..#...........#....#...........##...#..###T",
"output": "YES"
},
{
"input": "100 33\nG..#.#..#..####......#......##...##...#.##........#...#...#.##....###..#...###..##.#.....#......#.T.",
"output": "NO"
},
{
"input": "100 33\nG#....#..#..##.##..#.##.#......#.#.##..##.#.#.##.##....#.#.....####..##...#....##..##..........#...T",
"output": "NO"
},
{
"input": "100 33\nG#######.#..##.##.#...#..#.###.#.##.##.#..#.###..####.##.#.##....####...##..####.#..##.##.##.#....#T",
"output": "NO"
},
{
"input": "100 33\nG#####.#.##.###########.##..##..#######..########..###.###..#.####.######.############..####..#####T",
"output": "NO"
},
{
"input": "100 99\nT..................................................................................................G",
"output": "YES"
},
{
"input": "100 99\nT..................................................................................................G",
"output": "YES"
},
{
"input": "100 99\nT.#...............................#............#..............................##...................G",
"output": "YES"
},
{
"input": "100 99\nT..#....#.##...##########.#.#.#.#...####..#.....#..##..#######.######..#.....###..###...#.......#.#G",
"output": "YES"
},
{
"input": "100 99\nG##################################################################################################T",
"output": "YES"
},
{
"input": "100 9\nT..................................................................................................G",
"output": "YES"
},
{
"input": "100 9\nT.................................................................................................G.",
"output": "NO"
},
{
"input": "100 9\nT................................................................................................G..",
"output": "NO"
},
{
"input": "100 1\nG..................................................................................................T",
"output": "YES"
},
{
"input": "100 1\nT..................................................................................................G",
"output": "YES"
},
{
"input": "100 1\n##########G.........T###############################################################################",
"output": "YES"
},
{
"input": "100 1\n#################################################################################################G.T",
"output": "YES"
},
{
"input": "100 17\n##########G################.################.################.################T#####################",
"output": "YES"
},
{
"input": "100 17\n####.#..#.G######.#########.##..##########.#.################.################T######.####.#########",
"output": "YES"
},
{
"input": "100 17\n.########.G##.####.#.######.###############..#.###########.##.#####.##.#####.#T.###..###.########.##",
"output": "YES"
},
{
"input": "100 1\nG.............................................#....................................................T",
"output": "NO"
},
{
"input": "100 1\nT.#................................................................................................G",
"output": "NO"
},
{
"input": "100 1\n##########G....#....T###############################################################################",
"output": "NO"
},
{
"input": "100 1\n#################################################################################################G#T",
"output": "NO"
},
{
"input": "100 17\nG################.#################################.################T###############################",
"output": "NO"
},
{
"input": "100 17\nG################.###############..###.######.#######.###.#######.##T######################.###.####",
"output": "NO"
},
{
"input": "100 17\nG####.##.##.#####.####....##.####.#########.##.#..#.###############.T############.#########.#.####.#",
"output": "NO"
},
{
"input": "48 1\nT..............................................G",
"output": "YES"
},
{
"input": "23 1\nT.....................G",
"output": "YES"
},
{
"input": "49 1\nG...............................................T",
"output": "YES"
},
{
"input": "3 1\nTG#",
"output": "YES"
},
{
"input": "6 2\n..TG..",
"output": "NO"
},
{
"input": "14 3\n...G.....#..T.",
"output": "NO"
},
{
"input": "5 4\n##GT#",
"output": "NO"
},
{
"input": "6 2\nT#..G.",
"output": "YES"
},
{
"input": "5 2\nT.G.#",
"output": "YES"
},
{
"input": "6 1\nT...G#",
"output": "YES"
},
{
"input": "5 1\nTG###",
"output": "YES"
},
{
"input": "5 4\n.G..T",
"output": "NO"
},
{
"input": "7 2\nT#...#G",
"output": "YES"
},
{
"input": "7 1\n##TG###",
"output": "YES"
},
{
"input": "7 1\n###GT##",
"output": "YES"
},
{
"input": "5 2\nG..T.",
"output": "NO"
},
{
"input": "5 1\nG.T##",
"output": "YES"
},
{
"input": "6 2\nG.T###",
"output": "YES"
},
{
"input": "6 2\nG#T###",
"output": "YES"
},
{
"input": "10 2\n####T..G..",
"output": "NO"
},
{
"input": "3 1\nGT#",
"output": "YES"
},
{
"input": "4 1\nTG##",
"output": "YES"
},
{
"input": "6 1\n.G..T.",
"output": "YES"
},
{
"input": "10 3\n......G..T",
"output": "YES"
},
{
"input": "3 2\nG.T",
"output": "YES"
},
{
"input": "4 1\n#G.T",
"output": "YES"
},
{
"input": "5 2\nT#G##",
"output": "YES"
},
{
"input": "4 2\nG#.T",
"output": "NO"
},
{
"input": "4 1\nGT##",
"output": "YES"
}
] | 1,547,986,626
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 83
| 124
| 0
|
n, k = map(int, input().split())
s = input()
i = s.find("G")
ans = 0
while i < n:
if s[i] == "#":
break
if s[i] == "T":
ans = 1
break
i += k
i = s.find("G")
while i > -1:
if s[i] == "#":
break
if s[i] == "T":
ans = 1
break
i -= k
if ans == 1:
print("YES")
else:
print("NO")
|
Title: Ostap and Grasshopper
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
On the way to Rio de Janeiro Ostap kills time playing with a grasshopper he took with him in a special box. Ostap builds a line of length *n* such that some cells of this line are empty and some contain obstacles. Then, he places his grasshopper to one of the empty cells and a small insect in another empty cell. The grasshopper wants to eat the insect.
Ostap knows that grasshopper is able to jump to any empty cell that is exactly *k* cells away from the current (to the left or to the right). Note that it doesn't matter whether intermediate cells are empty or not as the grasshopper makes a jump over them. For example, if *k*<==<=1 the grasshopper can jump to a neighboring cell only, and if *k*<==<=2 the grasshopper can jump over a single cell.
Your goal is to determine whether there is a sequence of jumps such that grasshopper will get from his initial position to the cell with an insect.
Input Specification:
The first line of the input contains two integers *n* and *k* (2<=β€<=*n*<=β€<=100, 1<=β€<=*k*<=β€<=*n*<=-<=1)Β β the number of cells in the line and the length of one grasshopper's jump.
The second line contains a string of length *n* consisting of characters '.', '#', 'G' and 'T'. Character '.' means that the corresponding cell is empty, character '#' means that the corresponding cell contains an obstacle and grasshopper can't jump there. Character 'G' means that the grasshopper starts at this position and, finally, 'T' means that the target insect is located at this cell. It's guaranteed that characters 'G' and 'T' appear in this line exactly once.
Output Specification:
If there exists a sequence of jumps (each jump of length *k*), such that the grasshopper can get from his initial position to the cell with the insect, print "YES" (without quotes) in the only line of the input. Otherwise, print "NO" (without quotes).
Demo Input:
['5 2\n#G#T#\n', '6 1\nT....G\n', '7 3\nT..#..G\n', '6 2\n..GT..\n']
Demo Output:
['YES\n', 'YES\n', 'NO\n', 'NO\n']
Note:
In the first sample, the grasshopper can make one jump to the right in order to get from cell 2 to cell 4.
In the second sample, the grasshopper is only able to jump to neighboring cells but the way to the insect is freeΒ β he can get there by jumping left 5 times.
In the third sample, the grasshopper can't make a single jump.
In the fourth sample, the grasshopper can only jump to the cells with odd indices, thus he won't be able to reach the insect.
|
```python
n, k = map(int, input().split())
s = input()
i = s.find("G")
ans = 0
while i < n:
if s[i] == "#":
break
if s[i] == "T":
ans = 1
break
i += k
i = s.find("G")
while i > -1:
if s[i] == "#":
break
if s[i] == "T":
ans = 1
break
i -= k
if ans == 1:
print("YES")
else:
print("NO")
```
| 3
|
|
958
|
B1
|
Maximum Control (easy)
|
PROGRAMMING
| 1,000
|
[
"implementation"
] | null | null |
The Resistance is trying to take control over all planets in a particular solar system. This solar system is shaped like a tree. More precisely, some planets are connected by bidirectional hyperspace tunnels in such a way that there is a path between every pair of the planets, but removing any tunnel would disconnect some of them.
The Resistance already has measures in place that will, when the time is right, enable them to control every planet that is not remote. A planet is considered to be remote if it is connected to the rest of the planets only via a single hyperspace tunnel.
How much work is there left to be done: that is, how many remote planets are there?
|
The first line of the input contains an integer *N* (2<=β€<=*N*<=β€<=1000) β the number of planets in the galaxy.
The next *N*<=-<=1 lines describe the hyperspace tunnels between the planets. Each of the *N*<=-<=1 lines contains two space-separated integers *u* and *v* (1<=β€<=*u*,<=*v*<=β€<=*N*) indicating that there is a bidirectional hyperspace tunnel between the planets *u* and *v*. It is guaranteed that every two planets are connected by a path of tunnels, and that each tunnel connects a different pair of planets.
|
A single integer denoting the number of remote planets.
|
[
"5\n4 1\n4 2\n1 3\n1 5\n",
"4\n1 2\n4 3\n1 4\n"
] |
[
"3\n",
"2\n"
] |
In the first example, only planets 2, 3 and 5 are connected by a single tunnel.
In the second example, the remote planets are 2 and 3.
Note that this problem has only two versions β easy and medium.
| 0
|
[
{
"input": "5\n4 1\n4 2\n1 3\n1 5",
"output": "3"
},
{
"input": "4\n1 2\n4 3\n1 4",
"output": "2"
},
{
"input": "10\n4 3\n2 6\n10 1\n5 7\n5 8\n10 6\n5 9\n9 3\n2 9",
"output": "4"
}
] | 1,687,142,478
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 9
| 280
| 1,433,600
|
n = int(input())
l = []
s = 0
for i in range(n - 1):
u, v = map(int, input().split())
l.append(u)
l.append(v)
for i in l:
if l.count(i) == 1:
s += 1
print(s)
|
Title: Maximum Control (easy)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Resistance is trying to take control over all planets in a particular solar system. This solar system is shaped like a tree. More precisely, some planets are connected by bidirectional hyperspace tunnels in such a way that there is a path between every pair of the planets, but removing any tunnel would disconnect some of them.
The Resistance already has measures in place that will, when the time is right, enable them to control every planet that is not remote. A planet is considered to be remote if it is connected to the rest of the planets only via a single hyperspace tunnel.
How much work is there left to be done: that is, how many remote planets are there?
Input Specification:
The first line of the input contains an integer *N* (2<=β€<=*N*<=β€<=1000) β the number of planets in the galaxy.
The next *N*<=-<=1 lines describe the hyperspace tunnels between the planets. Each of the *N*<=-<=1 lines contains two space-separated integers *u* and *v* (1<=β€<=*u*,<=*v*<=β€<=*N*) indicating that there is a bidirectional hyperspace tunnel between the planets *u* and *v*. It is guaranteed that every two planets are connected by a path of tunnels, and that each tunnel connects a different pair of planets.
Output Specification:
A single integer denoting the number of remote planets.
Demo Input:
['5\n4 1\n4 2\n1 3\n1 5\n', '4\n1 2\n4 3\n1 4\n']
Demo Output:
['3\n', '2\n']
Note:
In the first example, only planets 2, 3 and 5 are connected by a single tunnel.
In the second example, the remote planets are 2 and 3.
Note that this problem has only two versions β easy and medium.
|
```python
n = int(input())
l = []
s = 0
for i in range(n - 1):
u, v = map(int, input().split())
l.append(u)
l.append(v)
for i in l:
if l.count(i) == 1:
s += 1
print(s)
```
| 3
|
|
258
|
A
|
Little Elephant and Bits
|
PROGRAMMING
| 1,100
|
[
"greedy",
"math"
] | null | null |
The Little Elephant has an integer *a*, written in the binary notation. He wants to write this number on a piece of paper.
To make sure that the number *a* fits on the piece of paper, the Little Elephant ought to delete exactly one any digit from number *a* in the binary record. At that a new number appears. It consists of the remaining binary digits, written in the corresponding order (possible, with leading zeroes).
The Little Elephant wants the number he is going to write on the paper to be as large as possible. Help him find the maximum number that he can obtain after deleting exactly one binary digit and print it in the binary notation.
|
The single line contains integer *a*, written in the binary notation without leading zeroes. This number contains more than 1 and at most 105 digits.
|
In the single line print the number that is written without leading zeroes in the binary notation β the answer to the problem.
|
[
"101\n",
"110010\n"
] |
[
"11\n",
"11010\n"
] |
In the first sample the best strategy is to delete the second digit. That results in number 11<sub class="lower-index">2</sub>β=β3<sub class="lower-index">10</sub>.
In the second sample the best strategy is to delete the third or fourth digits β that results in number 11010<sub class="lower-index">2</sub>β=β26<sub class="lower-index">10</sub>.
| 500
|
[
{
"input": "101",
"output": "11"
},
{
"input": "110010",
"output": "11010"
},
{
"input": "10000",
"output": "1000"
},
{
"input": "1111111110",
"output": "111111111"
},
{
"input": "10100101011110101",
"output": "1100101011110101"
},
{
"input": "111010010111",
"output": "11110010111"
},
{
"input": "11110111011100000000",
"output": "1111111011100000000"
},
{
"input": "11110010010100001110110101110011110110100111101",
"output": "1111010010100001110110101110011110110100111101"
},
{
"input": "1001011111010010100111111",
"output": "101011111010010100111111"
},
{
"input": "1111111111",
"output": "111111111"
},
{
"input": "1111111111111111111100111101001110110111111000001111110101001101001110011000001011001111111000110101",
"output": "111111111111111111110111101001110110111111000001111110101001101001110011000001011001111111000110101"
},
{
"input": "11010110000100100101111110111001001010011000011011000010010100111010101000111010011101101111110001111000101000001100011101110100",
"output": "1110110000100100101111110111001001010011000011011000010010100111010101000111010011101101111110001111000101000001100011101110100"
},
{
"input": "11111111111111111111111110110111001101100111010010101101101001011100011011000111010011110010101100010001011101011010010100001000011100001101101001100010100001001010010100100001111110100110011000101100001111111011010111001011111110111101000100101001001011",
"output": "1111111111111111111111111110111001101100111010010101101101001011100011011000111010011110010101100010001011101011010010100001000011100001101101001100010100001001010010100100001111110100110011000101100001111111011010111001011111110111101000100101001001011"
},
{
"input": "11100010010010000110101101101100111111001010001101101001001111010110010111001011010000001100110101000101111000001111101111110010000010101110011110101101010110001100011101111011100010011101100111110010111111100110101000000111101000000000110100100101111101000110101010101101001110001110000101011010101100011100100111100010001011010010001100011111110010011010011000111000100111100010110100011010010101011011011111110100001110000011011",
"output": "1110010010010000110101101101100111111001010001101101001001111010110010111001011010000001100110101000101111000001111101111110010000010101110011110101101010110001100011101111011100010011101100111110010111111100110101000000111101000000000110100100101111101000110101010101101001110001110000101011010101100011100100111100010001011010010001100011111110010011010011000111000100111100010110100011010010101011011011111110100001110000011011"
},
{
"input": "11",
"output": "1"
},
{
"input": "111",
"output": "11"
},
{
"input": "111111",
"output": "11111"
},
{
"input": "11111",
"output": "1111"
},
{
"input": "1111",
"output": "111"
}
] | 1,682,882,248
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 37
| 154
| 1,638,400
|
n=input();flag=True
for i in range(len(n)):
if n[i]=="0":
n=n[:i]+n[i+1:]
flag=False
break
if flag:
print(n[:-1])
else:
print(n)
|
Title: Little Elephant and Bits
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The Little Elephant has an integer *a*, written in the binary notation. He wants to write this number on a piece of paper.
To make sure that the number *a* fits on the piece of paper, the Little Elephant ought to delete exactly one any digit from number *a* in the binary record. At that a new number appears. It consists of the remaining binary digits, written in the corresponding order (possible, with leading zeroes).
The Little Elephant wants the number he is going to write on the paper to be as large as possible. Help him find the maximum number that he can obtain after deleting exactly one binary digit and print it in the binary notation.
Input Specification:
The single line contains integer *a*, written in the binary notation without leading zeroes. This number contains more than 1 and at most 105 digits.
Output Specification:
In the single line print the number that is written without leading zeroes in the binary notation β the answer to the problem.
Demo Input:
['101\n', '110010\n']
Demo Output:
['11\n', '11010\n']
Note:
In the first sample the best strategy is to delete the second digit. That results in number 11<sub class="lower-index">2</sub>β=β3<sub class="lower-index">10</sub>.
In the second sample the best strategy is to delete the third or fourth digits β that results in number 11010<sub class="lower-index">2</sub>β=β26<sub class="lower-index">10</sub>.
|
```python
n=input();flag=True
for i in range(len(n)):
if n[i]=="0":
n=n[:i]+n[i+1:]
flag=False
break
if flag:
print(n[:-1])
else:
print(n)
```
| 3
|
|
475
|
B
|
Strongly Connected City
|
PROGRAMMING
| 1,400
|
[
"brute force",
"dfs and similar",
"graphs",
"implementation"
] | null | null |
Imagine a city with *n* horizontal streets crossing *m* vertical streets, forming an (*n*<=-<=1)<=Γ<=(*m*<=-<=1) grid. In order to increase the traffic flow, mayor of the city has decided to make each street one way. This means in each horizontal street, the traffic moves only from west to east or only from east to west. Also, traffic moves only from north to south or only from south to north in each vertical street. It is possible to enter a horizontal street from a vertical street, or vice versa, at their intersection.
The mayor has received some street direction patterns. Your task is to check whether it is possible to reach any junction from any other junction in the proposed street direction pattern.
|
The first line of input contains two integers *n* and *m*, (2<=β€<=*n*,<=*m*<=β€<=20), denoting the number of horizontal streets and the number of vertical streets.
The second line contains a string of length *n*, made of characters '<' and '>', denoting direction of each horizontal street. If the *i*-th character is equal to '<', the street is directed from east to west otherwise, the street is directed from west to east. Streets are listed in order from north to south.
The third line contains a string of length *m*, made of characters '^' and 'v', denoting direction of each vertical street. If the *i*-th character is equal to '^', the street is directed from south to north, otherwise the street is directed from north to south. Streets are listed in order from west to east.
|
If the given pattern meets the mayor's criteria, print a single line containing "YES", otherwise print a single line containing "NO".
|
[
"3 3\n><>\nv^v\n",
"4 6\n<><>\nv^v^v^\n"
] |
[
"NO\n",
"YES\n"
] |
The figure above shows street directions in the second sample test case.
| 1,000
|
[
{
"input": "3 3\n><>\nv^v",
"output": "NO"
},
{
"input": "4 6\n<><>\nv^v^v^",
"output": "YES"
},
{
"input": "2 2\n<>\nv^",
"output": "YES"
},
{
"input": "2 2\n>>\n^v",
"output": "NO"
},
{
"input": "3 3\n>><\n^^v",
"output": "YES"
},
{
"input": "3 4\n>><\n^v^v",
"output": "YES"
},
{
"input": "3 8\n>><\nv^^^^^^^",
"output": "NO"
},
{
"input": "7 2\n<><<<<>\n^^",
"output": "NO"
},
{
"input": "4 5\n><<<\n^^^^v",
"output": "YES"
},
{
"input": "2 20\n><\n^v^^v^^v^^^v^vv^vv^^",
"output": "NO"
},
{
"input": "2 20\n<>\nv^vv^v^^vvv^^^v^vvv^",
"output": "YES"
},
{
"input": "20 2\n<><<><<>><<<>><><<<<\n^^",
"output": "NO"
},
{
"input": "20 2\n><>><>><>><<<><<><><\n^v",
"output": "YES"
},
{
"input": "11 12\n><<<><><<>>\nvv^^^^vvvvv^",
"output": "NO"
},
{
"input": "4 18\n<<>>\nv^v^v^^vvvv^v^^vv^",
"output": "YES"
},
{
"input": "16 11\n<<<<>><><<<<<><<\nvv^v^vvvv^v",
"output": "NO"
},
{
"input": "14 7\n><<<<>>>>>>><<\nvv^^^vv",
"output": "NO"
},
{
"input": "5 14\n<<><>\nv^vv^^vv^v^^^v",
"output": "NO"
},
{
"input": "8 18\n>>>><>>>\nv^vv^v^^^^^vvv^^vv",
"output": "NO"
},
{
"input": "18 18\n<<><>><<>><>><><<<\n^^v^v^vvvv^v^vv^vv",
"output": "NO"
},
{
"input": "4 18\n<<<>\n^^^^^vv^vv^^vv^v^v",
"output": "NO"
},
{
"input": "19 18\n><><>>><<<<<>>><<<>\n^^v^^v^^v^vv^v^vvv",
"output": "NO"
},
{
"input": "14 20\n<<<><><<>><><<\nvvvvvvv^v^vvvv^^^vv^",
"output": "NO"
},
{
"input": "18 18\n><>>><<<>><><>>>><\nvv^^^^v^v^^^^v^v^^",
"output": "NO"
},
{
"input": "8 18\n<><<<>>>\n^^^^^^v^^^vv^^vvvv",
"output": "NO"
},
{
"input": "11 12\n><><><<><><\n^^v^^^^^^^^v",
"output": "YES"
},
{
"input": "4 18\n<<>>\nv^v^v^^vvvv^v^^vv^",
"output": "YES"
},
{
"input": "16 11\n>><<><<<<>>><><<\n^^^^vvvv^vv",
"output": "YES"
},
{
"input": "14 7\n<><><<<>>>><>>\nvv^^v^^",
"output": "YES"
},
{
"input": "5 14\n>>>><\n^v^v^^^vv^vv^v",
"output": "YES"
},
{
"input": "8 18\n<<<><>>>\nv^^vvv^^v^v^vvvv^^",
"output": "YES"
},
{
"input": "18 18\n><><<><><>>><>>>><\n^^vvv^v^^^v^vv^^^v",
"output": "YES"
},
{
"input": "4 18\n<<>>\nv^v^v^^vvvv^v^^vv^",
"output": "YES"
},
{
"input": "19 18\n>>>><><<>>><<<><<<<\n^v^^^^vv^^v^^^^v^v",
"output": "YES"
},
{
"input": "14 20\n<>><<<><<>>>>>\nvv^^v^^^^v^^vv^^vvv^",
"output": "YES"
},
{
"input": "18 18\n><><<><><>>><>>>><\n^^vvv^v^^^v^vv^^^v",
"output": "YES"
},
{
"input": "8 18\n<<<><>>>\nv^^vvv^^v^v^vvvv^^",
"output": "YES"
},
{
"input": "20 19\n<><>>>>><<<<<><<>>>>\nv^vv^^vvvvvv^vvvv^v",
"output": "NO"
},
{
"input": "20 19\n<<<><<<>><<<>><><><>\nv^v^vvv^vvv^^^vvv^^",
"output": "YES"
},
{
"input": "19 20\n<><<<><><><<<<<<<<>\n^v^^^^v^^vvvv^^^^vvv",
"output": "NO"
},
{
"input": "19 20\n>>>>>>>><>>><><<<><\n^v^v^^^vvv^^^v^^vvvv",
"output": "YES"
},
{
"input": "20 20\n<<<>>>><>><<>><<>>>>\n^vvv^^^^vv^^^^^v^^vv",
"output": "NO"
},
{
"input": "20 20\n>>><><<><<<<<<<><<><\nvv^vv^vv^^^^^vv^^^^^",
"output": "NO"
},
{
"input": "20 20\n><<><<<<<<<>>><>>><<\n^^^^^^^^vvvv^vv^vvvv",
"output": "YES"
},
{
"input": "20 20\n<>>>>>>>><>>><>><<<>\nvv^^vv^^^^v^vv^v^^^^",
"output": "YES"
},
{
"input": "20 20\n><>><<>><>>>>>>>><<>\n^^v^vv^^^vvv^v^^^vv^",
"output": "NO"
},
{
"input": "20 20\n<<<<><<>><><<<>><<><\nv^^^^vvv^^^vvvv^v^vv",
"output": "NO"
},
{
"input": "20 20\n><<<><<><>>><><<<<<<\nvv^^vvv^^v^^v^vv^vvv",
"output": "NO"
},
{
"input": "20 20\n<<>>><>>>><<<<>>><<>\nv^vv^^^^^vvv^^v^^v^v",
"output": "NO"
},
{
"input": "20 20\n><<><<><<<<<<>><><>>\nv^^^v^vv^^v^^vvvv^vv",
"output": "NO"
},
{
"input": "20 20\n<<<<<<<<><>><><>><<<\n^vvv^^^v^^^vvv^^^^^v",
"output": "NO"
},
{
"input": "20 20\n>>><<<<<>>><><><<><<\n^^^vvv^^^v^^v^^v^vvv",
"output": "YES"
},
{
"input": "20 20\n<><<<><><>><><><<<<>\n^^^vvvv^vv^v^^^^v^vv",
"output": "NO"
},
{
"input": "20 20\n>>>>>>>>>><>>><>><>>\n^vvv^^^vv^^^^^^vvv^v",
"output": "NO"
},
{
"input": "20 20\n<><>><><<<<<>><<>>><\nv^^^v^v^v^vvvv^^^vv^",
"output": "NO"
},
{
"input": "20 20\n><<<><<<><<<><>>>><<\nvvvv^^^^^vv^v^^vv^v^",
"output": "NO"
},
{
"input": "20 20\n<<><<<<<<>>>>><<<>>>\nvvvvvv^v^vvv^^^^^^^^",
"output": "YES"
},
{
"input": "20 20\n><<><<>>>>><><>><>>>\nv^^^^vvv^^^^^v^v^vv^",
"output": "NO"
},
{
"input": "20 20\n<<>>><>><<>>>><<<><<\n^^vvv^^vvvv^vv^^v^v^",
"output": "NO"
},
{
"input": "20 20\n><<>><>>>><<><>><><<\n^v^^^^^^vvvv^v^v^v^^",
"output": "NO"
},
{
"input": "20 20\n<<><<<<><><<>>><>>>>\n^^vvvvv^v^^^^^^^vvv^",
"output": "NO"
},
{
"input": "20 20\n>><<<<<<><>>>><>>><>\n^^^v^v^vv^^vv^vvv^^^",
"output": "NO"
},
{
"input": "20 20\n>>>>>>>>>>>>>>>>>>>>\nvvvvvvvvvvvvvvvvvvvv",
"output": "NO"
},
{
"input": "2 2\n><\nv^",
"output": "NO"
},
{
"input": "2 2\n<>\n^v",
"output": "NO"
},
{
"input": "3 3\n>><\nvvv",
"output": "NO"
},
{
"input": "2 3\n<>\nv^^",
"output": "YES"
},
{
"input": "4 4\n>>><\nvvv^",
"output": "NO"
},
{
"input": "20 20\n<><><><><><><><><><>\nvvvvvvvvvvvvvvvvvvvv",
"output": "NO"
},
{
"input": "4 4\n<>>>\nv^^^",
"output": "YES"
},
{
"input": "20 20\n<><><><><><><><><><>\nv^v^v^v^v^v^v^v^v^v^",
"output": "YES"
},
{
"input": "2 3\n<>\n^v^",
"output": "NO"
},
{
"input": "4 3\n<><>\n^vv",
"output": "NO"
},
{
"input": "3 3\n<<>\nvv^",
"output": "YES"
},
{
"input": "2 3\n><\nvv^",
"output": "NO"
},
{
"input": "7 6\n>>><>><\n^vv^vv",
"output": "YES"
},
{
"input": "2 2\n<<\nv^",
"output": "NO"
},
{
"input": "3 3\n>><\n^^^",
"output": "NO"
},
{
"input": "3 3\n<><\nv^v",
"output": "NO"
},
{
"input": "20 20\n><><><><><><><><><><\n^v^v^v^v^v^v^v^v^v^v",
"output": "YES"
},
{
"input": "4 4\n<>>>\nvvv^",
"output": "YES"
}
] | 1,667,154,946
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 81
| 998
| 61,440,000
|
import sys
input = lambda: sys.stdin.buffer.readline().decode().strip()
# print = sys.stdout.write
inl = lambda: list(map(int, input().split()))
hs, vs = inl()
h_streets = input()
v_streets = input()
h_streets = [1 if i == ">" else -1 for i in h_streets]
v_streets = [1 if i == "v" else -1 for i in v_streets]
def dfs(i, j):
seen.add((i, j))
next_ps = [(i + v_streets[j], j), (i, j + h_streets[i])]
for p in next_ps:
if p[0] in range(hs) and p[1] in range(vs) and p not in seen:
dfs(p[0], p[1])
f = True
for i in range(hs):
for j in range(vs):
seen = set()
dfs(i, j)
if len(seen) < hs * vs:
f = False
break
if not f:
print("NO")
else:
print("YES")
|
Title: Strongly Connected City
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Imagine a city with *n* horizontal streets crossing *m* vertical streets, forming an (*n*<=-<=1)<=Γ<=(*m*<=-<=1) grid. In order to increase the traffic flow, mayor of the city has decided to make each street one way. This means in each horizontal street, the traffic moves only from west to east or only from east to west. Also, traffic moves only from north to south or only from south to north in each vertical street. It is possible to enter a horizontal street from a vertical street, or vice versa, at their intersection.
The mayor has received some street direction patterns. Your task is to check whether it is possible to reach any junction from any other junction in the proposed street direction pattern.
Input Specification:
The first line of input contains two integers *n* and *m*, (2<=β€<=*n*,<=*m*<=β€<=20), denoting the number of horizontal streets and the number of vertical streets.
The second line contains a string of length *n*, made of characters '<' and '>', denoting direction of each horizontal street. If the *i*-th character is equal to '<', the street is directed from east to west otherwise, the street is directed from west to east. Streets are listed in order from north to south.
The third line contains a string of length *m*, made of characters '^' and 'v', denoting direction of each vertical street. If the *i*-th character is equal to '^', the street is directed from south to north, otherwise the street is directed from north to south. Streets are listed in order from west to east.
Output Specification:
If the given pattern meets the mayor's criteria, print a single line containing "YES", otherwise print a single line containing "NO".
Demo Input:
['3 3\n><>\nv^v\n', '4 6\n<><>\nv^v^v^\n']
Demo Output:
['NO\n', 'YES\n']
Note:
The figure above shows street directions in the second sample test case.
|
```python
import sys
input = lambda: sys.stdin.buffer.readline().decode().strip()
# print = sys.stdout.write
inl = lambda: list(map(int, input().split()))
hs, vs = inl()
h_streets = input()
v_streets = input()
h_streets = [1 if i == ">" else -1 for i in h_streets]
v_streets = [1 if i == "v" else -1 for i in v_streets]
def dfs(i, j):
seen.add((i, j))
next_ps = [(i + v_streets[j], j), (i, j + h_streets[i])]
for p in next_ps:
if p[0] in range(hs) and p[1] in range(vs) and p not in seen:
dfs(p[0], p[1])
f = True
for i in range(hs):
for j in range(vs):
seen = set()
dfs(i, j)
if len(seen) < hs * vs:
f = False
break
if not f:
print("NO")
else:
print("YES")
```
| 3
|
|
1
|
A
|
Theatre Square
|
PROGRAMMING
| 1,000
|
[
"math"
] |
A. Theatre Square
|
1
|
256
|
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=Γ<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=Γ<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
|
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=β€<=<=*n*,<=*m*,<=*a*<=β€<=109).
|
Write the needed number of flagstones.
|
[
"6 6 4\n"
] |
[
"4\n"
] |
none
| 0
|
[
{
"input": "6 6 4",
"output": "4"
},
{
"input": "1 1 1",
"output": "1"
},
{
"input": "2 1 1",
"output": "2"
},
{
"input": "1 2 1",
"output": "2"
},
{
"input": "2 2 1",
"output": "4"
},
{
"input": "2 1 2",
"output": "1"
},
{
"input": "1 1 3",
"output": "1"
},
{
"input": "2 3 4",
"output": "1"
},
{
"input": "1000000000 1000000000 1",
"output": "1000000000000000000"
},
{
"input": "12 13 4",
"output": "12"
},
{
"input": "222 332 5",
"output": "3015"
},
{
"input": "1000 1000 10",
"output": "10000"
},
{
"input": "1001 1000 10",
"output": "10100"
},
{
"input": "100 10001 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "1000000000 1000000000 999999999",
"output": "4"
},
{
"input": "1000000000 1000000000 192",
"output": "27126743055556"
},
{
"input": "1000000000 987654321 1",
"output": "987654321000000000"
},
{
"input": "456784567 1000000000 51",
"output": "175618850864484"
},
{
"input": "39916800 134217728 40320",
"output": "3295710"
}
] | 1,665,854,447
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 20
| 46
| 0
|
from math import ceil
X,Y,Z = list(map(int,input().split()))
A = ceil(X/Z)
B = ceil(Y/Z)
print(int(A*B))
|
Title: Theatre Square
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Theatre Square in the capital city of Berland has a rectangular shape with the size *n*<=Γ<=*m* meters. On the occasion of the city's anniversary, a decision was taken to pave the Square with square granite flagstones. Each flagstone is of the size *a*<=Γ<=*a*.
What is the least number of flagstones needed to pave the Square? It's allowed to cover the surface larger than the Theatre Square, but the Square has to be covered. It's not allowed to break the flagstones. The sides of flagstones should be parallel to the sides of the Square.
Input Specification:
The input contains three positive integer numbers in the first line: *n*,<=<=*m* and *a* (1<=β€<=<=*n*,<=*m*,<=*a*<=β€<=109).
Output Specification:
Write the needed number of flagstones.
Demo Input:
['6 6 4\n']
Demo Output:
['4\n']
Note:
none
|
```python
from math import ceil
X,Y,Z = list(map(int,input().split()))
A = ceil(X/Z)
B = ceil(Y/Z)
print(int(A*B))
```
| 3.977
|
265
|
A
|
Colorful Stones (Simplified Edition)
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
|
The input contains two lines. The first line contains the string *s* (1<=β€<=|*s*|<=β€<=50). The second line contains the string *t* (1<=β€<=|*t*|<=β€<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
|
Print the final 1-based position of Liss in a single line.
|
[
"RGB\nRRR\n",
"RRRBGBRBBB\nBBBRR\n",
"BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n"
] |
[
"2\n",
"3\n",
"15\n"
] |
none
| 500
|
[
{
"input": "RGB\nRRR",
"output": "2"
},
{
"input": "RRRBGBRBBB\nBBBRR",
"output": "3"
},
{
"input": "BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB",
"output": "15"
},
{
"input": "G\nRRBBRBRRBR",
"output": "1"
},
{
"input": "RRRRRBRRBRRGRBGGRRRGRBBRBBBBBRGRBGBRRGBBBRBBGBRGBB\nB",
"output": "1"
},
{
"input": "RRGGBRGRBG\nBRRGGBBGGR",
"output": "7"
},
{
"input": "BBRRGBGGRGBRGBRBRBGR\nGGGRBGGGBRRRRGRBGBGRGRRBGRBGBG",
"output": "15"
},
{
"input": "GBRRBGBGBBBBRRRGBGRRRGBGBBBRGR\nRRGBRRGRBBBBBBGRRBBR",
"output": "8"
},
{
"input": "BRGRRGRGRRGBBGBBBRRBBRRBGBBGRGBBGGRGBRBGGGRRRBGGBB\nRGBBGRRBBBRRGRRBRBBRGBBGGGRGBGRRRRBRBGGBRBGGGRGBRR",
"output": "16"
},
{
"input": "GGRGGBRRGRGBRRGGRBBGGRRGBBBGBBBGGRBGGBRBBRGBRRRBRG\nGGRGRRRRRRRRRGBBBBRGBRGRGRRGBBRGGBRBBRBGBRGRRRRGGR",
"output": "18"
},
{
"input": "RBBRBGBBGGGBRRBGBRGRRGGRBBBBGRBGGBRRBGBBRBRGBBGGGG\nBRRGRBGRBGBRGBRBGGBBBGBBRGRBGRGRBGRBGGRRBGBRGRRBBG",
"output": "23"
},
{
"input": "RRGGRRBRGRGBRGBRGBBRGGGBRBGBRGBRGGBRBRGBGRRBBGGRBR\nBRGRBBBGRBGRRGGRRRRRRRRGGGGGGGGBGGGGGGGRGRBBRGRGBR",
"output": "14"
},
{
"input": "RBRBRRRRRGGR\nBBBBRRGGBGRBRGBBRGGGRGGBRRBRBRBGGG",
"output": "12"
},
{
"input": "GGRGGGBRGRGRBBRGGGRBGRRR\nGBBBBGBGBGBBBRGGRGGBGRRGRRRGBGB",
"output": "12"
},
{
"input": "RGRBGBRBBGBRRGGGBBGBRRBGRGBBBBBGRRRGGRBB\nBGR",
"output": "2"
},
{
"input": "R\nB",
"output": "1"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR",
"output": "50"
},
{
"input": "RRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRRR\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
},
{
"input": "R\nGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG",
"output": "1"
}
] | 1,697,041,457
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 19
| 92
| 0
|
x=input()
y=input()
c=0
for i in range(len(y)):
if y[i]==x[c]:
c+=1
else:
continue
print(c+1)
|
Title: Colorful Stones (Simplified Edition)
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
There is a sequence of colorful stones. The color of each stone is one of red, green, or blue. You are given a string *s*. The *i*-th (1-based) character of *s* represents the color of the *i*-th stone. If the character is "R", "G", or "B", the color of the corresponding stone is red, green, or blue, respectively.
Initially Squirrel Liss is standing on the first stone. You perform instructions one or more times.
Each instruction is one of the three types: "RED", "GREEN", or "BLUE". After an instruction *c*, if Liss is standing on a stone whose colors is *c*, Liss will move one stone forward, else she will not move.
You are given a string *t*. The number of instructions is equal to the length of *t*, and the *i*-th character of *t* represents the *i*-th instruction.
Calculate the final position of Liss (the number of the stone she is going to stand on in the end) after performing all the instructions, and print its 1-based position. It is guaranteed that Liss don't move out of the sequence.
Input Specification:
The input contains two lines. The first line contains the string *s* (1<=β€<=|*s*|<=β€<=50). The second line contains the string *t* (1<=β€<=|*t*|<=β€<=50). The characters of each string will be one of "R", "G", or "B". It is guaranteed that Liss don't move out of the sequence.
Output Specification:
Print the final 1-based position of Liss in a single line.
Demo Input:
['RGB\nRRR\n', 'RRRBGBRBBB\nBBBRR\n', 'BRRBGBRGRBGRGRRGGBGBGBRGBRGRGGGRBRRRBRBBBGRRRGGBBB\nBBRBGGRGRGBBBRBGRBRBBBBRBRRRBGBBGBBRRBBGGRBRRBRGRB\n']
Demo Output:
['2\n', '3\n', '15\n']
Note:
none
|
```python
x=input()
y=input()
c=0
for i in range(len(y)):
if y[i]==x[c]:
c+=1
else:
continue
print(c+1)
```
| 3
|
|
58
|
A
|
Chat room
|
PROGRAMMING
| 1,000
|
[
"greedy",
"strings"
] |
A. Chat room
|
1
|
256
|
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
|
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
|
If Vasya managed to say hello, print "YES", otherwise print "NO".
|
[
"ahhellllloou\n",
"hlelo\n"
] |
[
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "ahhellllloou",
"output": "YES"
},
{
"input": "hlelo",
"output": "NO"
},
{
"input": "helhcludoo",
"output": "YES"
},
{
"input": "hehwelloho",
"output": "YES"
},
{
"input": "pnnepelqomhhheollvlo",
"output": "YES"
},
{
"input": "tymbzjyqhymedasloqbq",
"output": "NO"
},
{
"input": "yehluhlkwo",
"output": "NO"
},
{
"input": "hatlevhhalrohairnolsvocafgueelrqmlqlleello",
"output": "YES"
},
{
"input": "hhhtehdbllnhwmbyhvelqqyoulretpbfokflhlhreeflxeftelziclrwllrpflflbdtotvlqgoaoqldlroovbfsq",
"output": "YES"
},
{
"input": "rzlvihhghnelqtwlexmvdjjrliqllolhyewgozkuovaiezgcilelqapuoeglnwmnlftxxiigzczlouooi",
"output": "YES"
},
{
"input": "pfhhwctyqdlkrwhebfqfelhyebwllhemtrmeblgrynmvyhioesqklclocxmlffuormljszllpoo",
"output": "YES"
},
{
"input": "lqllcolohwflhfhlnaow",
"output": "NO"
},
{
"input": "heheeellollvoo",
"output": "YES"
},
{
"input": "hellooo",
"output": "YES"
},
{
"input": "o",
"output": "NO"
},
{
"input": "hhqhzeclohlehljlhtesllylrolmomvuhcxsobtsckogdv",
"output": "YES"
},
{
"input": "yoegfuzhqsihygnhpnukluutocvvwuldiighpogsifealtgkfzqbwtmgghmythcxflebrkctlldlkzlagovwlstsghbouk",
"output": "YES"
},
{
"input": "uatqtgbvrnywfacwursctpagasnhydvmlinrcnqrry",
"output": "NO"
},
{
"input": "tndtbldbllnrwmbyhvqaqqyoudrstpbfokfoclnraefuxtftmgzicorwisrpfnfpbdtatvwqgyalqtdtrjqvbfsq",
"output": "NO"
},
{
"input": "rzlvirhgemelnzdawzpaoqtxmqucnahvqnwldklrmjiiyageraijfivigvozgwngiulttxxgzczptusoi",
"output": "YES"
},
{
"input": "kgyelmchocojsnaqdsyeqgnllytbqietpdlgknwwumqkxrexgdcnwoldicwzwofpmuesjuxzrasscvyuqwspm",
"output": "YES"
},
{
"input": "pnyvrcotjvgynbeldnxieghfltmexttuxzyac",
"output": "NO"
},
{
"input": "dtwhbqoumejligbenxvzhjlhosqojetcqsynlzyhfaevbdpekgbtjrbhlltbceobcok",
"output": "YES"
},
{
"input": "crrfpfftjwhhikwzeedrlwzblckkteseofjuxjrktcjfsylmlsvogvrcxbxtffujqshslemnixoeezivksouefeqlhhokwbqjz",
"output": "YES"
},
{
"input": "jhfbndhyzdvhbvhmhmefqllujdflwdpjbehedlsqfdsqlyelwjtyloxwsvasrbqosblzbowlqjmyeilcvotdlaouxhdpoeloaovb",
"output": "YES"
},
{
"input": "hwlghueoemiqtjhhpashjsouyegdlvoyzeunlroypoprnhlyiwiuxrghekaylndhrhllllwhbebezoglydcvykllotrlaqtvmlla",
"output": "YES"
},
{
"input": "wshiaunnqnqxodholbipwhhjmyeblhgpeleblklpzwhdunmpqkbuzloetmwwxmeltkrcomulxauzlwmlklldjodozxryghsnwgcz",
"output": "YES"
},
{
"input": "shvksednttggehroewuiptvvxtrzgidravtnjwuqrlnnkxbplctzkckinpkgjopjfoxdbojtcvsuvablcbkrzajrlhgobkcxeqti",
"output": "YES"
},
{
"input": "hyyhddqhxhekehkwfhlnlsihzefwchzerevcjtokefplholrbvxlltdlafjxrfhleglrvlolojoqaolagtbeyogxlbgfolllslli",
"output": "YES"
},
{
"input": "iaagrdhhelxpdegueiulflquvlzidoprzkehthkldaytrjwhyhprwjxlltinxvuilxohqgjqcvkkdcuoliekcnlilwgqlnlzouoo",
"output": "YES"
},
{
"input": "wfluaeseldgxyvxpwuhkptdmlflnlhktwxiabsvkolsquymrmhzczzoybvlilhmvsuunggvgxzgyyffk",
"output": "NO"
},
{
"input": "loee",
"output": "NO"
},
{
"input": "izdipwylefqmjbuoznfglgcfvedeouflkeehxbasaqmiooppfsqlhprospqgxvzrcpwlfdddngoqvpwvggsnvvxhmjoslwjudjlo",
"output": "NO"
},
{
"input": "pplynflbjlseflaegzqpdxswgunhnlglqhycrbcwdfhclmcrwekkzsoosmfblljeenwfjyifcvxihhhbyhmhlkvtskeglaovjnsi",
"output": "YES"
},
{
"input": "xqjqmenkodmlhzyzmmvofdngktygbbxbzpluzcohohmalkoeuwfikblltaaigv",
"output": "NO"
},
{
"input": "hello",
"output": "YES"
},
{
"input": "oohell",
"output": "NO"
},
{
"input": "hell",
"output": "NO"
},
{
"input": "eloellohoelo",
"output": "NO"
},
{
"input": "helllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllo",
"output": "YES"
}
] | 1,642,526,505
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 40
| 92
| 0
|
a = ['h', 'e', 'l', 'l', 'o']
j = 4
s = input()
i = len(s)-1
while(i >= 0 and j >= 0):
if(a[j] == s[i]):
j -= 1
i -= 1
else:
i -= 1
print("YES" if(j == -1) else "NO")
|
Title: Chat room
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
Input Specification:
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
Output Specification:
If Vasya managed to say hello, print "YES", otherwise print "NO".
Demo Input:
['ahhellllloou\n', 'hlelo\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none
|
```python
a = ['h', 'e', 'l', 'l', 'o']
j = 4
s = input()
i = len(s)-1
while(i >= 0 and j >= 0):
if(a[j] == s[i]):
j -= 1
i -= 1
else:
i -= 1
print("YES" if(j == -1) else "NO")
```
| 3.954
|
625
|
B
|
War of the Corporations
|
PROGRAMMING
| 1,200
|
[
"constructive algorithms",
"greedy",
"strings"
] | null | null |
A long time ago, in a galaxy far far away two giant IT-corporations Pineapple and Gogol continue their fierce competition. Crucial moment is just around the corner: Gogol is ready to release it's new tablet Lastus 3000.
This new device is equipped with specially designed artificial intelligence (AI). Employees of Pineapple did their best to postpone the release of Lastus 3000 as long as possible. Finally, they found out, that the name of the new artificial intelligence is similar to the name of the phone, that Pineapple released 200 years ago. As all rights on its name belong to Pineapple, they stand on changing the name of Gogol's artificial intelligence.
Pineapple insists, that the name of their phone occurs in the name of AI as a substring. Because the name of technology was already printed on all devices, the Gogol's director decided to replace some characters in AI name with "#". As this operation is pretty expensive, you should find the minimum number of characters to replace with "#", such that the name of AI doesn't contain the name of the phone as a substring.
Substring is a continuous subsequence of a string.
|
The first line of the input contains the name of AI designed by Gogol, its length doesn't exceed 100<=000 characters. Second line contains the name of the phone released by Pineapple 200 years ago, its length doesn't exceed 30. Both string are non-empty and consist of only small English letters.
|
Print the minimum number of characters that must be replaced with "#" in order to obtain that the name of the phone doesn't occur in the name of AI as a substring.
|
[
"intellect\ntell\n",
"google\napple\n",
"sirisiri\nsir\n"
] |
[
"1",
"0",
"2"
] |
In the first sample AI's name may be replaced with "int#llect".
In the second sample Gogol can just keep things as they are.
In the third sample one of the new possible names of AI may be "s#ris#ri".
| 750
|
[
{
"input": "intellect\ntell",
"output": "1"
},
{
"input": "google\napple",
"output": "0"
},
{
"input": "sirisiri\nsir",
"output": "2"
},
{
"input": "sirisiri\nsiri",
"output": "2"
},
{
"input": "aaaaaaa\naaaa",
"output": "1"
},
{
"input": "bbbbbb\nbb",
"output": "3"
},
{
"input": "abc\nabcabc",
"output": "0"
},
{
"input": "kek\nkekekek",
"output": "0"
},
{
"input": "aaaaa\naaa",
"output": "1"
},
{
"input": "abcdabcv\nabcd",
"output": "1"
},
{
"input": "abcabcabczabcabcabcz\ncab",
"output": "4"
},
{
"input": "aatopotopotopotaa\ntopot",
"output": "2"
},
{
"input": "abcabcabcabcabcabcabcabcabcabc\nabcabcabcabcabcabcabcabcabcabc",
"output": "1"
},
{
"input": "sosossosos\nsos",
"output": "2"
},
{
"input": "sosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosossosos\nsos",
"output": "20"
},
{
"input": "tatatx\ntatx",
"output": "1"
},
{
"input": "sxxsxxsxxd\nsxxsxxd",
"output": "1"
}
] | 1,604,069,611
| 1,111
|
PyPy 3
|
OK
|
TESTS
| 56
| 155
| 512,000
|
s1=str(input())
s2=str(input())
ans=s1.count(s2)
print(ans)
|
Title: War of the Corporations
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A long time ago, in a galaxy far far away two giant IT-corporations Pineapple and Gogol continue their fierce competition. Crucial moment is just around the corner: Gogol is ready to release it's new tablet Lastus 3000.
This new device is equipped with specially designed artificial intelligence (AI). Employees of Pineapple did their best to postpone the release of Lastus 3000 as long as possible. Finally, they found out, that the name of the new artificial intelligence is similar to the name of the phone, that Pineapple released 200 years ago. As all rights on its name belong to Pineapple, they stand on changing the name of Gogol's artificial intelligence.
Pineapple insists, that the name of their phone occurs in the name of AI as a substring. Because the name of technology was already printed on all devices, the Gogol's director decided to replace some characters in AI name with "#". As this operation is pretty expensive, you should find the minimum number of characters to replace with "#", such that the name of AI doesn't contain the name of the phone as a substring.
Substring is a continuous subsequence of a string.
Input Specification:
The first line of the input contains the name of AI designed by Gogol, its length doesn't exceed 100<=000 characters. Second line contains the name of the phone released by Pineapple 200 years ago, its length doesn't exceed 30. Both string are non-empty and consist of only small English letters.
Output Specification:
Print the minimum number of characters that must be replaced with "#" in order to obtain that the name of the phone doesn't occur in the name of AI as a substring.
Demo Input:
['intellect\ntell\n', 'google\napple\n', 'sirisiri\nsir\n']
Demo Output:
['1', '0', '2']
Note:
In the first sample AI's name may be replaced with "int#llect".
In the second sample Gogol can just keep things as they are.
In the third sample one of the new possible names of AI may be "s#ris#ri".
|
```python
s1=str(input())
s2=str(input())
ans=s1.count(s2)
print(ans)
```
| 3
|
|
43
|
A
|
Football
|
PROGRAMMING
| 1,000
|
[
"strings"
] |
A. Football
|
2
|
256
|
One day Vasya decided to have a look at the results of Berland 1910 Football Championshipβs finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
|
The first line contains an integer *n* (1<=β€<=*n*<=β€<=100) β the number of lines in the description. Then follow *n* lines β for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
|
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
|
[
"1\nABC\n",
"5\nA\nABA\nABA\nA\nA\n"
] |
[
"ABC\n",
"A\n"
] |
none
| 500
|
[
{
"input": "1\nABC",
"output": "ABC"
},
{
"input": "5\nA\nABA\nABA\nA\nA",
"output": "A"
},
{
"input": "2\nXTSJEP\nXTSJEP",
"output": "XTSJEP"
},
{
"input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ",
"output": "XZYDJAEDZ"
},
{
"input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD",
"output": "QCCYXL"
},
{
"input": "3\nAZID\nEERWBC\nEERWBC",
"output": "EERWBC"
},
{
"input": "3\nHNCGYL\nHNCGYL\nHNCGYL",
"output": "HNCGYL"
},
{
"input": "4\nZZWZTG\nZZWZTG\nZZWZTG\nZZWZTG",
"output": "ZZWZTG"
},
{
"input": "4\nA\nA\nKUDLJMXCSE\nA",
"output": "A"
},
{
"input": "5\nPHBTW\nPHBTW\nPHBTW\nPHBTW\nPHBTW",
"output": "PHBTW"
},
{
"input": "5\nPKUZYTFYWN\nPKUZYTFYWN\nSTC\nPKUZYTFYWN\nPKUZYTFYWN",
"output": "PKUZYTFYWN"
},
{
"input": "5\nHH\nHH\nNTQWPA\nNTQWPA\nHH",
"output": "HH"
},
{
"input": "10\nW\nW\nW\nW\nW\nD\nW\nD\nD\nW",
"output": "W"
},
{
"input": "19\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nTGACNIH\nTGACNIH\nXBCP",
"output": "XBCP"
},
{
"input": "33\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS",
"output": "PYPAS"
},
{
"input": "51\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC",
"output": "NC"
},
{
"input": "89\nH\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nVOCI\nVOCI\nH\nH\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nH\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI",
"output": "VOCI"
},
{
"input": "100\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nM\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA",
"output": "HA"
},
{
"input": "100\nG\nG\nS\nS\nG\nG\nS\nS\nG\nS\nS\nS\nG\nS\nG\nG\nS\nG\nS\nS\nG\nS\nS\nS\nS\nS\nG\nS\nG\nS\nS\nG\nG\nG\nS\nS\nS\nS\nG\nS\nS\nG\nG\nG\nG\nG\nS\nG\nG\nS\nS\nS\nS\nS\nG\nG\nS\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nS\nS\nG\nS\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nG\nG\nS\nG\nG\nG\nS",
"output": "G"
},
{
"input": "100\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nOBH\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL",
"output": "WL"
}
] | 1,554,990,286
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 218
| 0
|
num = int(input())
lst = []
for i in range(num):
komanda = input()
lst.append(komanda)
set_lst = set(lst)
spisok = list(set_lst)
if len(spisok) == 1:
print(spisok[0])
else:
if lst.count(spisok[0]) > lst.count(spisok[1]):
print(spisok[0])
else:
print(spisok[1])
|
Title: Football
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
One day Vasya decided to have a look at the results of Berland 1910 Football Championshipβs finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
Input Specification:
The first line contains an integer *n* (1<=β€<=*n*<=β€<=100) β the number of lines in the description. Then follow *n* lines β for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
Output Specification:
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
Demo Input:
['1\nABC\n', '5\nA\nABA\nABA\nA\nA\n']
Demo Output:
['ABC\n', 'A\n']
Note:
none
|
```python
num = int(input())
lst = []
for i in range(num):
komanda = input()
lst.append(komanda)
set_lst = set(lst)
spisok = list(set_lst)
if len(spisok) == 1:
print(spisok[0])
else:
if lst.count(spisok[0]) > lst.count(spisok[1]):
print(spisok[0])
else:
print(spisok[1])
```
| 3.9455
|
157
|
B
|
Trace
|
PROGRAMMING
| 1,000
|
[
"geometry",
"sortings"
] | null | null |
One day, as Sherlock Holmes was tracking down one very important criminal, he found a wonderful painting on the wall. This wall could be represented as a plane. The painting had several concentric circles that divided the wall into several parts. Some parts were painted red and all the other were painted blue. Besides, any two neighboring parts were painted different colors, that is, the red and the blue color were alternating, i. e. followed one after the other. The outer area of the wall (the area that lied outside all circles) was painted blue. Help Sherlock Holmes determine the total area of red parts of the wall.
Let us remind you that two circles are called concentric if their centers coincide. Several circles are called concentric if any two of them are concentric.
|
The first line contains the single integer *n* (1<=β€<=*n*<=β€<=100). The second line contains *n* space-separated integers *r**i* (1<=β€<=*r**i*<=β€<=1000) β the circles' radii. It is guaranteed that all circles are different.
|
Print the single real number β total area of the part of the wall that is painted red. The answer is accepted if absolute or relative error doesn't exceed 10<=-<=4.
|
[
"1\n1\n",
"3\n1 4 2\n"
] |
[
"3.1415926536\n",
"40.8407044967\n"
] |
In the first sample the picture is just one circle of radius 1. Inner part of the circle is painted red. The area of the red part equals ΟβΓβ1<sup class="upper-index">2</sup>β=βΟ.
In the second sample there are three circles of radii 1, 4 and 2. Outside part of the second circle is painted blue. Part between the second and the third circles is painted red. Part between the first and the third is painted blue. And, finally, the inner part of the first circle is painted red. Overall there are two red parts: the ring between the second and the third circles and the inner part of the first circle. Total area of the red parts is equal (ΟβΓβ4<sup class="upper-index">2</sup>β-βΟβΓβ2<sup class="upper-index">2</sup>)β+βΟβΓβ1<sup class="upper-index">2</sup>β=βΟβΓβ12β+βΟβ=β13Ο
| 1,000
|
[
{
"input": "1\n1",
"output": "3.1415926536"
},
{
"input": "3\n1 4 2",
"output": "40.8407044967"
},
{
"input": "4\n4 1 3 2",
"output": "31.4159265359"
},
{
"input": "4\n100 10 2 1",
"output": "31111.1920484997"
},
{
"input": "10\n10 9 8 7 6 5 4 3 2 1",
"output": "172.7875959474"
},
{
"input": "1\n1000",
"output": "3141592.6535897931"
},
{
"input": "8\n8 1 7 2 6 3 5 4",
"output": "113.0973355292"
},
{
"input": "100\n1000 999 998 997 996 995 994 993 992 991 990 989 988 987 986 985 984 983 982 981 980 979 978 977 976 975 974 973 972 971 970 969 968 967 966 965 964 963 962 961 960 959 958 957 956 955 954 953 952 951 950 949 948 947 946 945 944 943 942 941 940 939 938 937 936 935 934 933 932 931 930 929 928 927 926 925 924 923 922 921 920 919 918 917 916 915 914 913 912 911 910 909 908 907 906 905 904 903 902 901",
"output": "298608.3817237098"
},
{
"input": "6\n109 683 214 392 678 10",
"output": "397266.9574170437"
},
{
"input": "2\n151 400",
"output": "431023.3704798660"
},
{
"input": "6\n258 877 696 425 663 934",
"output": "823521.3902487604"
},
{
"input": "9\n635 707 108 234 52 180 910 203 782",
"output": "1100144.9065826489"
},
{
"input": "8\n885 879 891 428 522 176 135 983",
"output": "895488.9947571954"
},
{
"input": "3\n269 918 721",
"output": "1241695.6467754442"
},
{
"input": "7\n920 570 681 428 866 935 795",
"output": "1469640.1849419588"
},
{
"input": "2\n517 331",
"output": "495517.1260654109"
},
{
"input": "2\n457 898",
"output": "1877274.3981158488"
},
{
"input": "8\n872 704 973 612 183 274 739 253",
"output": "1780774.0965755312"
},
{
"input": "74\n652 446 173 457 760 847 670 25 196 775 998 279 656 809 883 148 969 884 792 502 641 800 663 938 362 339 545 608 107 184 834 666 149 458 864 72 199 658 618 987 126 723 806 643 689 958 626 904 944 415 427 498 628 331 636 261 281 276 478 220 513 595 510 384 354 561 469 462 799 449 747 109 903 456",
"output": "1510006.5089479341"
},
{
"input": "76\n986 504 673 158 87 332 124 218 714 235 212 122 878 370 938 81 686 323 386 348 410 468 875 107 50 960 82 834 234 663 651 422 794 633 294 771 945 607 146 913 950 858 297 88 882 725 247 872 645 749 799 987 115 394 380 382 971 429 593 426 652 353 351 233 868 598 889 116 71 376 916 464 414 976 138 903",
"output": "1528494.7817143100"
},
{
"input": "70\n12 347 748 962 514 686 192 159 990 4 10 788 602 542 946 215 523 727 799 717 955 796 529 465 897 103 181 515 495 153 710 179 747 145 16 585 943 998 923 708 156 399 770 547 775 285 9 68 713 722 570 143 913 416 663 624 925 218 64 237 797 138 942 213 188 818 780 840 480 758",
"output": "1741821.4892636713"
},
{
"input": "26\n656 508 45 189 561 366 96 486 547 386 703 570 780 689 264 26 11 74 466 76 421 48 982 886 215 650",
"output": "1818821.9252031571"
},
{
"input": "52\n270 658 808 249 293 707 700 78 791 167 92 772 807 502 830 991 945 102 968 376 556 578 326 980 688 368 280 853 646 256 666 638 424 737 321 996 925 405 199 680 953 541 716 481 727 143 577 919 892 355 346 298",
"output": "1272941.9273080483"
},
{
"input": "77\n482 532 200 748 692 697 171 863 586 547 301 149 326 812 147 698 303 691 527 805 681 387 619 947 598 453 167 799 840 508 893 688 643 974 998 341 804 230 538 669 271 404 477 759 943 596 949 235 880 160 151 660 832 82 969 539 708 889 258 81 224 655 790 144 462 582 646 256 445 52 456 920 67 819 631 484 534",
"output": "2045673.1891262225"
},
{
"input": "27\n167 464 924 575 775 97 944 390 297 315 668 296 533 829 851 406 702 366 848 512 71 197 321 900 544 529 116",
"output": "1573959.9105970615"
},
{
"input": "38\n488 830 887 566 720 267 583 102 65 200 884 220 263 858 510 481 316 804 754 568 412 166 374 869 356 977 145 421 500 58 664 252 745 70 381 927 670 772",
"output": "1479184.3434235646"
},
{
"input": "64\n591 387 732 260 840 397 563 136 571 876 831 953 799 493 579 13 559 872 53 678 256 232 969 993 847 14 837 365 547 997 604 199 834 529 306 443 739 49 19 276 343 835 904 588 900 870 439 576 975 955 518 117 131 347 800 83 432 882 869 709 32 950 314 450",
"output": "1258248.6984672088"
},
{
"input": "37\n280 281 169 68 249 389 977 101 360 43 448 447 368 496 125 507 747 392 338 270 916 150 929 428 118 266 589 470 774 852 263 644 187 817 808 58 637",
"output": "1495219.0323274869"
},
{
"input": "97\n768 569 306 968 437 779 227 561 412 60 44 807 234 645 169 858 580 396 343 145 842 723 416 80 456 247 81 150 297 116 760 964 312 558 101 850 549 650 299 868 121 435 579 705 118 424 302 812 970 397 659 565 916 183 933 459 6 593 518 717 326 305 744 470 75 981 824 221 294 324 194 293 251 446 481 215 338 861 528 829 921 945 540 89 450 178 24 460 990 392 148 219 934 615 932 340 937",
"output": "1577239.7333274092"
},
{
"input": "94\n145 703 874 425 277 652 239 496 458 658 339 842 564 699 893 352 625 980 432 121 798 872 499 859 850 721 414 825 543 843 304 111 342 45 219 311 50 748 465 902 781 822 504 985 919 656 280 310 917 438 464 527 491 713 906 329 635 777 223 810 501 535 156 252 806 112 971 719 103 443 165 98 579 554 244 996 221 560 301 51 977 422 314 858 528 772 448 626 185 194 536 66 577 677",
"output": "1624269.3753516484"
},
{
"input": "97\n976 166 649 81 611 927 480 231 998 711 874 91 969 521 531 414 993 790 317 981 9 261 437 332 173 573 904 777 882 990 658 878 965 64 870 896 271 732 431 53 761 943 418 602 708 949 930 130 512 240 363 458 673 319 131 784 224 48 919 126 208 212 911 59 677 535 450 273 479 423 79 807 336 18 72 290 724 28 123 605 287 228 350 897 250 392 885 655 746 417 643 114 813 378 355 635 905",
"output": "1615601.7212203942"
},
{
"input": "91\n493 996 842 9 748 178 1 807 841 519 796 998 84 670 778 143 707 208 165 893 154 943 336 150 761 881 434 112 833 55 412 682 552 945 758 189 209 600 354 325 440 844 410 20 136 665 88 791 688 17 539 821 133 236 94 606 483 446 429 60 960 476 915 134 137 852 754 908 276 482 117 252 297 903 981 203 829 811 471 135 188 667 710 393 370 302 874 872 551 457 692",
"output": "1806742.5014501044"
},
{
"input": "95\n936 736 17 967 229 607 589 291 242 244 29 698 800 566 630 667 90 416 11 94 812 838 668 520 678 111 490 823 199 973 681 676 683 721 262 896 682 713 402 691 874 44 95 704 56 322 822 887 639 433 406 35 988 61 176 496 501 947 440 384 372 959 577 370 754 802 1 945 427 116 746 408 308 391 397 730 493 183 203 871 831 862 461 565 310 344 504 378 785 137 279 123 475 138 415",
"output": "1611115.5269110680"
},
{
"input": "90\n643 197 42 218 582 27 66 704 195 445 641 675 285 639 503 686 242 327 57 955 848 287 819 992 756 749 363 48 648 736 580 117 752 921 923 372 114 313 202 337 64 497 399 25 883 331 24 871 917 8 517 486 323 529 325 92 891 406 864 402 263 773 931 253 625 31 17 271 140 131 232 586 893 525 846 54 294 562 600 801 214 55 768 683 389 738 314 284 328 804",
"output": "1569819.2914796301"
},
{
"input": "98\n29 211 984 75 333 96 840 21 352 168 332 433 130 944 215 210 620 442 363 877 91 491 513 955 53 82 351 19 998 706 702 738 770 453 344 117 893 590 723 662 757 16 87 546 312 669 568 931 224 374 927 225 751 962 651 587 361 250 256 240 282 600 95 64 384 589 813 783 39 918 412 648 506 283 886 926 443 173 946 241 310 33 622 565 261 360 547 339 943 367 354 25 479 743 385 485 896 741",
"output": "2042921.1539616778"
},
{
"input": "93\n957 395 826 67 185 4 455 880 683 654 463 84 258 878 553 592 124 585 9 133 20 609 43 452 725 125 801 537 700 685 771 155 566 376 19 690 383 352 174 208 177 416 304 1000 533 481 87 509 358 233 681 22 507 659 36 859 952 259 138 271 594 779 576 782 119 69 608 758 283 616 640 523 710 751 34 106 774 92 874 568 864 660 998 992 474 679 180 409 15 297 990 689 501",
"output": "1310703.8710041976"
},
{
"input": "97\n70 611 20 30 904 636 583 262 255 501 604 660 212 128 199 138 545 576 506 528 12 410 77 888 783 972 431 188 338 485 148 793 907 678 281 922 976 680 252 724 253 920 177 361 721 798 960 572 99 622 712 466 608 49 612 345 266 751 63 594 40 695 532 789 520 930 825 929 48 59 405 135 109 735 508 186 495 772 375 587 201 324 447 610 230 947 855 318 856 956 313 810 931 175 668 183 688",
"output": "1686117.9099228707"
},
{
"input": "96\n292 235 391 180 840 172 218 997 166 287 329 20 886 325 400 471 182 356 448 337 417 319 58 106 366 764 393 614 90 831 924 314 667 532 64 874 3 434 350 352 733 795 78 640 967 63 47 879 635 272 145 569 468 792 153 761 770 878 281 467 209 208 298 37 700 18 334 93 5 750 412 779 523 517 360 649 447 328 311 653 57 578 767 460 647 663 50 670 151 13 511 580 625 907 227 89",
"output": "1419726.5608617242"
},
{
"input": "100\n469 399 735 925 62 153 707 723 819 529 200 624 57 708 245 384 889 11 639 638 260 419 8 142 403 298 204 169 887 388 241 983 885 267 643 943 417 237 452 562 6 839 149 742 832 896 100 831 712 754 679 743 135 222 445 680 210 955 220 63 960 487 514 824 481 584 441 997 795 290 10 45 510 678 844 503 407 945 850 84 858 934 500 320 936 663 736 592 161 670 606 465 864 969 293 863 868 393 899 744",
"output": "1556458.0979239127"
},
{
"input": "100\n321 200 758 415 190 710 920 992 873 898 814 259 359 66 971 210 838 545 663 652 684 277 36 756 963 459 335 484 462 982 532 423 131 703 307 229 391 938 253 847 542 975 635 928 220 980 222 567 557 181 366 824 900 180 107 979 112 564 525 413 300 422 876 615 737 343 902 8 654 628 469 913 967 785 893 314 909 215 912 262 20 709 363 915 997 954 986 454 596 124 74 159 660 550 787 418 895 786 293 50",
"output": "1775109.8050211088"
},
{
"input": "100\n859 113 290 762 701 63 188 431 810 485 671 673 99 658 194 227 511 435 941 212 551 124 89 222 42 321 657 815 898 171 216 482 707 567 724 491 414 942 820 351 48 653 685 312 586 24 20 627 602 498 533 173 463 262 621 466 119 299 580 964 510 987 40 698 521 998 847 651 746 215 808 563 785 837 631 772 404 923 682 244 232 214 390 350 968 771 517 900 70 543 934 554 681 368 642 575 891 728 478 317",
"output": "1447969.4788174964"
},
{
"input": "100\n941 283 349 457 52 837 299 284 796 305 893 624 101 972 738 204 121 70 17 704 836 791 95 111 162 952 472 724 733 580 878 177 705 804 11 211 463 417 288 409 410 485 896 755 921 267 164 656 505 765 539 439 535 19 991 689 220 474 114 944 884 144 926 849 486 566 117 35 749 499 797 303 362 905 690 890 976 66 590 183 234 683 39 297 769 787 376 541 571 759 495 200 261 352 73 493 831 442 273 339",
"output": "1597889.4218394549"
},
{
"input": "100\n110 868 147 888 291 282 916 542 917 337 235 595 498 621 814 249 261 713 445 666 142 275 319 49 900 543 333 606 487 670 620 769 852 258 230 867 603 491 714 839 879 37 21 74 590 190 397 506 499 967 152 862 200 107 145 23 614 167 857 475 79 598 270 906 626 116 89 59 651 846 723 201 50 699 522 408 634 132 226 414 824 764 513 586 526 238 556 162 667 173 684 415 527 743 10 442 552 274 350 822",
"output": "1567230.6191330721"
},
{
"input": "100\n901 902 903 904 905 906 907 908 909 910 911 912 913 914 915 916 917 918 919 920 921 922 923 924 925 926 927 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943 944 945 946 947 948 949 950 951 952 953 954 955 956 957 958 959 960 961 962 963 964 965 966 967 968 969 970 971 972 973 974 975 976 977 978 979 980 981 982 983 984 985 986 987 988 989 990 991 992 993 994 995 996 997 998 999 1000",
"output": "298608.3817237098"
}
] | 1,629,811,328
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 44
| 154
| 6,963,200
|
n=int(input())
l=list(map(int,input().split()))
l.sort()
pi=3.1415926536
area=[l[0]**2]
for i in range(1,n):
area.append(l[i]**2-l[i-1]**2)
ans=0
#print(l,area)
if n%2==1:
for i in range(0,n,2):
ans+=area[i]
#print(ans,area[i])
else:
for i in range(1,n,2):
ans+=area[i]
print(ans*pi)
|
Title: Trace
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
One day, as Sherlock Holmes was tracking down one very important criminal, he found a wonderful painting on the wall. This wall could be represented as a plane. The painting had several concentric circles that divided the wall into several parts. Some parts were painted red and all the other were painted blue. Besides, any two neighboring parts were painted different colors, that is, the red and the blue color were alternating, i. e. followed one after the other. The outer area of the wall (the area that lied outside all circles) was painted blue. Help Sherlock Holmes determine the total area of red parts of the wall.
Let us remind you that two circles are called concentric if their centers coincide. Several circles are called concentric if any two of them are concentric.
Input Specification:
The first line contains the single integer *n* (1<=β€<=*n*<=β€<=100). The second line contains *n* space-separated integers *r**i* (1<=β€<=*r**i*<=β€<=1000) β the circles' radii. It is guaranteed that all circles are different.
Output Specification:
Print the single real number β total area of the part of the wall that is painted red. The answer is accepted if absolute or relative error doesn't exceed 10<=-<=4.
Demo Input:
['1\n1\n', '3\n1 4 2\n']
Demo Output:
['3.1415926536\n', '40.8407044967\n']
Note:
In the first sample the picture is just one circle of radius 1. Inner part of the circle is painted red. The area of the red part equals ΟβΓβ1<sup class="upper-index">2</sup>β=βΟ.
In the second sample there are three circles of radii 1, 4 and 2. Outside part of the second circle is painted blue. Part between the second and the third circles is painted red. Part between the first and the third is painted blue. And, finally, the inner part of the first circle is painted red. Overall there are two red parts: the ring between the second and the third circles and the inner part of the first circle. Total area of the red parts is equal (ΟβΓβ4<sup class="upper-index">2</sup>β-βΟβΓβ2<sup class="upper-index">2</sup>)β+βΟβΓβ1<sup class="upper-index">2</sup>β=βΟβΓβ12β+βΟβ=β13Ο
|
```python
n=int(input())
l=list(map(int,input().split()))
l.sort()
pi=3.1415926536
area=[l[0]**2]
for i in range(1,n):
area.append(l[i]**2-l[i-1]**2)
ans=0
#print(l,area)
if n%2==1:
for i in range(0,n,2):
ans+=area[i]
#print(ans,area[i])
else:
for i in range(1,n,2):
ans+=area[i]
print(ans*pi)
```
| 3
|
|
689
|
C
|
Mike and Chocolate Thieves
|
PROGRAMMING
| 1,700
|
[
"binary search",
"combinatorics",
"math"
] | null | null |
Bad news came to Mike's village, some thieves stole a bunch of chocolates from the local factory! Horrible!
Aside from loving sweet things, thieves from this area are known to be very greedy. So after a thief takes his number of chocolates for himself, the next thief will take exactly *k* times more than the previous one. The value of *k* (*k*<=><=1) is a secret integer known only to them. It is also known that each thief's bag can carry at most *n* chocolates (if they intend to take more, the deal is cancelled) and that there were exactly four thieves involved.
Sadly, only the thieves know the value of *n*, but rumours say that the numbers of ways they could have taken the chocolates (for a fixed *n*, but not fixed *k*) is *m*. Two ways are considered different if one of the thieves (they should be numbered in the order they take chocolates) took different number of chocolates in them.
Mike want to track the thieves down, so he wants to know what their bags are and value of *n* will help him in that. Please find the smallest possible value of *n* or tell him that the rumors are false and there is no such *n*.
|
The single line of input contains the integer *m* (1<=β€<=*m*<=β€<=1015)Β β the number of ways the thieves might steal the chocolates, as rumours say.
|
Print the only integer *n*Β β the maximum amount of chocolates that thieves' bags can carry. If there are more than one *n* satisfying the rumors, print the smallest one.
If there is no such *n* for a false-rumoured *m*, print <=-<=1.
|
[
"1\n",
"8\n",
"10\n"
] |
[
"8\n",
"54\n",
"-1\n"
] |
In the first sample case the smallest *n* that leads to exactly one way of stealing chocolates is *n*β=β8, whereas the amounts of stealed chocolates are (1,β2,β4,β8) (the number of chocolates stolen by each of the thieves).
In the second sample case the smallest *n* that leads to exactly 8 ways is *n*β=β54 with the possibilities: (1,β2,β4,β8),ββ(1,β3,β9,β27),ββ(2,β4,β8,β16),ββ(2,β6,β18,β54),ββ(3,β6,β12,β24),ββ(4,β8,β16,β32),ββ(5,β10,β20,β40),ββ(6,β12,β24,β48).
There is no *n* leading to exactly 10 ways of stealing chocolates in the third sample case.
| 1,500
|
[
{
"input": "1",
"output": "8"
},
{
"input": "8",
"output": "54"
},
{
"input": "10",
"output": "-1"
},
{
"input": "27",
"output": "152"
},
{
"input": "28206",
"output": "139840"
},
{
"input": "32",
"output": "184"
},
{
"input": "115",
"output": "608"
},
{
"input": "81258",
"output": "402496"
},
{
"input": "116003",
"output": "574506"
},
{
"input": "149344197",
"output": "739123875"
},
{
"input": "57857854",
"output": "286347520"
},
{
"input": "999999999999999",
"output": "-1"
},
{
"input": "181023403153",
"output": "895903132760"
},
{
"input": "196071196742",
"output": "970376182648"
},
{
"input": "49729446417673",
"output": "246116048009288"
},
{
"input": "14821870173923",
"output": "73354931125416"
},
{
"input": "29031595887308",
"output": "143680297402952"
},
{
"input": "195980601490039",
"output": "969927770453672"
},
{
"input": "181076658641313",
"output": "896166653569800"
},
{
"input": "166173583620704",
"output": "822409831653228"
},
{
"input": "151269640772354",
"output": "748648714769352"
},
{
"input": "136366565751970",
"output": "674891892852776"
},
{
"input": "121463490731834",
"output": "601135070936200"
},
{
"input": "106559547884220",
"output": "527373954052328"
},
{
"input": "91656472864718",
"output": "453617132135750"
},
{
"input": "184061307002930",
"output": "910937979445720"
},
{
"input": "57857853",
"output": "-1"
},
{
"input": "1000000000000000",
"output": "4949100894494448"
},
{
"input": "375402146575334",
"output": "-1"
},
{
"input": "550368702711851",
"output": "-1"
},
{
"input": "645093839227897",
"output": "-1"
},
{
"input": "431",
"output": "-1"
},
{
"input": "99999",
"output": "-1"
},
{
"input": "2",
"output": "16"
},
{
"input": "3",
"output": "24"
},
{
"input": "4",
"output": "27"
},
{
"input": "5",
"output": "32"
},
{
"input": "6",
"output": "40"
},
{
"input": "7",
"output": "48"
},
{
"input": "13",
"output": "80"
},
{
"input": "999999999999998",
"output": "-1"
},
{
"input": "999999999999997",
"output": "4949100894494440"
},
{
"input": "999999999999996",
"output": "4949100894494432"
},
{
"input": "999999999999995",
"output": "4949100894494424"
},
{
"input": "999999999999993",
"output": "4949100894494416"
},
{
"input": "999999999999991",
"output": "4949100894494400"
},
{
"input": "999999999999992",
"output": "4949100894494408"
},
{
"input": "999999999999994",
"output": "4949100894494421"
},
{
"input": "4235246",
"output": "-1"
},
{
"input": "34",
"output": "-1"
},
{
"input": "998749999999991",
"output": "4942914518376840"
},
{
"input": "999999874999991",
"output": "4949100275856792"
},
{
"input": "987654129875642",
"output": "4887999937625136"
},
{
"input": "237648237648000",
"output": "1176145105832192"
}
] | 1,678,376,921
| 1,421
|
PyPy 3-64
|
OK
|
TESTS
| 54
| 811
| 10,035,200
|
import sys, os, io
input = io.BytesIO(os.read(0, os.fstat(0).st_size)).readline
def binary_search(c1, c2):
c = (c1 + c2 + 1) // 2
while abs(c1 - c2) > 1:
c = (c1 + c2 + 1) // 2
if ok(c):
c2 = c
else:
c1 = c
c = max(c - 1, 0)
while not ok(c):
c += 1
return c
def ok(c):
u = 0
for i in p:
u += c // i
return True if u >= m else False
m = int(input())
p = [pow(i, 3) for i in range(2, pow(10, 6) + 5)]
n = binary_search(0, pow(10, 18) + 5)
u = 0
for i in p:
u += n // i
if u ^ m:
n = -1
print(n)
|
Title: Mike and Chocolate Thieves
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bad news came to Mike's village, some thieves stole a bunch of chocolates from the local factory! Horrible!
Aside from loving sweet things, thieves from this area are known to be very greedy. So after a thief takes his number of chocolates for himself, the next thief will take exactly *k* times more than the previous one. The value of *k* (*k*<=><=1) is a secret integer known only to them. It is also known that each thief's bag can carry at most *n* chocolates (if they intend to take more, the deal is cancelled) and that there were exactly four thieves involved.
Sadly, only the thieves know the value of *n*, but rumours say that the numbers of ways they could have taken the chocolates (for a fixed *n*, but not fixed *k*) is *m*. Two ways are considered different if one of the thieves (they should be numbered in the order they take chocolates) took different number of chocolates in them.
Mike want to track the thieves down, so he wants to know what their bags are and value of *n* will help him in that. Please find the smallest possible value of *n* or tell him that the rumors are false and there is no such *n*.
Input Specification:
The single line of input contains the integer *m* (1<=β€<=*m*<=β€<=1015)Β β the number of ways the thieves might steal the chocolates, as rumours say.
Output Specification:
Print the only integer *n*Β β the maximum amount of chocolates that thieves' bags can carry. If there are more than one *n* satisfying the rumors, print the smallest one.
If there is no such *n* for a false-rumoured *m*, print <=-<=1.
Demo Input:
['1\n', '8\n', '10\n']
Demo Output:
['8\n', '54\n', '-1\n']
Note:
In the first sample case the smallest *n* that leads to exactly one way of stealing chocolates is *n*β=β8, whereas the amounts of stealed chocolates are (1,β2,β4,β8) (the number of chocolates stolen by each of the thieves).
In the second sample case the smallest *n* that leads to exactly 8 ways is *n*β=β54 with the possibilities: (1,β2,β4,β8),ββ(1,β3,β9,β27),ββ(2,β4,β8,β16),ββ(2,β6,β18,β54),ββ(3,β6,β12,β24),ββ(4,β8,β16,β32),ββ(5,β10,β20,β40),ββ(6,β12,β24,β48).
There is no *n* leading to exactly 10 ways of stealing chocolates in the third sample case.
|
```python
import sys, os, io
input = io.BytesIO(os.read(0, os.fstat(0).st_size)).readline
def binary_search(c1, c2):
c = (c1 + c2 + 1) // 2
while abs(c1 - c2) > 1:
c = (c1 + c2 + 1) // 2
if ok(c):
c2 = c
else:
c1 = c
c = max(c - 1, 0)
while not ok(c):
c += 1
return c
def ok(c):
u = 0
for i in p:
u += c // i
return True if u >= m else False
m = int(input())
p = [pow(i, 3) for i in range(2, pow(10, 6) + 5)]
n = binary_search(0, pow(10, 18) + 5)
u = 0
for i in p:
u += n // i
if u ^ m:
n = -1
print(n)
```
| 3
|
|
844
|
A
|
Diversity
|
PROGRAMMING
| 1,000
|
[
"greedy",
"implementation",
"strings"
] | null | null |
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
|
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=β€<=|*s*|<=β€<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=β€<=*k*<=β€<=26).
|
Print single line with a minimum number of necessary changes, or the word Β«impossibleΒ» (without quotes) if it is impossible.
|
[
"yandex\n6\n",
"yahoo\n5\n",
"google\n7\n"
] |
[
"0\n",
"1\n",
"impossible\n"
] |
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*',β'*h*',β'*o*',β'*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
| 500
|
[
{
"input": "yandex\n6",
"output": "0"
},
{
"input": "yahoo\n5",
"output": "1"
},
{
"input": "google\n7",
"output": "impossible"
},
{
"input": "a\n1",
"output": "0"
},
{
"input": "z\n2",
"output": "impossible"
},
{
"input": "fwgfrwgkuwghfiruhewgirueguhergiqrbvgrgf\n26",
"output": "14"
},
{
"input": "nfevghreuoghrueighoqghbnebvnejbvnbgneluqe\n26",
"output": "12"
},
{
"input": "a\n3",
"output": "impossible"
},
{
"input": "smaxpqplaqqbxuqxalqmbmmgubbpspxhawbxsuqhhegpmmpebqmqpbbeplwaepxmsahuepuhuhwxeqmmlgqubuaxehwuwasgxpqmugbmuawuhwqlswllssueglbxepbmwgs\n1",
"output": "0"
},
{
"input": "cuguccgcugcugucgggggcgcgucgucugcuuuccccuugccg\n4",
"output": "1"
},
{
"input": "fcfccfcfccfcfcffcffffffcfccfccfcffccccfcffffccfccfcffcfcccccffcfffcccffcfccfffffcccfccffffffccfccccf\n20",
"output": "18"
},
{
"input": "swmkwaruyv\n5",
"output": "0"
},
{
"input": "tnbqpsuhkczmejirvyfdolxwga\n22",
"output": "0"
},
{
"input": "abcde\n3",
"output": "0"
},
{
"input": "abb\n1",
"output": "0"
},
{
"input": "aaaa\n1",
"output": "0"
},
{
"input": "abcde\n2",
"output": "0"
},
{
"input": "yandex\n4",
"output": "0"
},
{
"input": "aaabbbccc\n1",
"output": "0"
},
{
"input": "abcd\n2",
"output": "0"
},
{
"input": "asdfgh\n2",
"output": "0"
},
{
"input": "aab\n1",
"output": "0"
},
{
"input": "mynameissako\n5",
"output": "0"
},
{
"input": "abcde\n1",
"output": "0"
},
{
"input": "abcd\n3",
"output": "0"
},
{
"input": "abcdef\n2",
"output": "0"
},
{
"input": "abcdefg\n4",
"output": "0"
},
{
"input": "abc\n1",
"output": "0"
},
{
"input": "asdafjsgljdllgjdgkl\n5",
"output": "0"
},
{
"input": "yaay\n3",
"output": "1"
},
{
"input": "yaay\n4",
"output": "2"
},
{
"input": "zzzzzz\n2",
"output": "1"
}
] | 1,567,835,533
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 41
| 109
| 0
|
def Diversity(s,k):
if len(s)<k:
return "impossible"
charCnt = [0] * 26
for c in s:
charCnt[ord(c)-97]+=1
numberOfUniqueCharacters = 26 - charCnt.count(0)
if(numberOfUniqueCharacters>=k):
return 0
return k - numberOfUniqueCharacters
s = input()
k = int(input())
print(Diversity(s,k))
|
Title: Diversity
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible.
String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
Input Specification:
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=β€<=|*s*|<=β€<=1000, |*s*| denotes the length of *s*).
Second line of input contains integer *k* (1<=β€<=*k*<=β€<=26).
Output Specification:
Print single line with a minimum number of necessary changes, or the word Β«impossibleΒ» (without quotes) if it is impossible.
Demo Input:
['yandex\n6\n', 'yahoo\n5\n', 'google\n7\n']
Demo Output:
['0\n', '1\n', 'impossible\n']
Note:
In the first test case string contains 6 different letters, so we don't need to change anything.
In the second test case string contains 4 different letters: {'*a*',β'*h*',β'*o*',β'*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}.
In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
|
```python
def Diversity(s,k):
if len(s)<k:
return "impossible"
charCnt = [0] * 26
for c in s:
charCnt[ord(c)-97]+=1
numberOfUniqueCharacters = 26 - charCnt.count(0)
if(numberOfUniqueCharacters>=k):
return 0
return k - numberOfUniqueCharacters
s = input()
k = int(input())
print(Diversity(s,k))
```
| 3
|
|
766
|
B
|
Mahmoud and a Triangle
|
PROGRAMMING
| 1,000
|
[
"constructive algorithms",
"geometry",
"greedy",
"math",
"number theory",
"sortings"
] | null | null |
Mahmoud has *n* line segments, the *i*-th of them has length *a**i*. Ehab challenged him to use exactly 3 line segments to form a non-degenerate triangle. Mahmoud doesn't accept challenges unless he is sure he can win, so he asked you to tell him if he should accept the challenge. Given the lengths of the line segments, check if he can choose exactly 3 of them to form a non-degenerate triangle.
Mahmoud should use exactly 3 line segments, he can't concatenate two line segments or change any length. A non-degenerate triangle is a triangle with positive area.
|
The first line contains single integer *n* (3<=β€<=*n*<=β€<=105)Β β the number of line segments Mahmoud has.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a**i*<=β€<=109)Β β the lengths of line segments Mahmoud has.
|
In the only line print "YES" if he can choose exactly three line segments and form a non-degenerate triangle with them, and "NO" otherwise.
|
[
"5\n1 5 3 2 4\n",
"3\n4 1 2\n"
] |
[
"YES\n",
"NO\n"
] |
For the first example, he can use line segments with lengths 2, 4 and 5 to form a non-degenerate triangle.
| 1,000
|
[
{
"input": "5\n1 5 3 2 4",
"output": "YES"
},
{
"input": "3\n4 1 2",
"output": "NO"
},
{
"input": "30\n197 75 517 39724 7906061 1153471 3 15166 168284 3019844 272293 316 16 24548 42 118 5792 5 9373 1866366 4886214 24 2206 712886 104005 1363 836 64273 440585 3576",
"output": "NO"
},
{
"input": "30\n229017064 335281886 247217656 670601882 743442492 615491486 544941439 911270108 474843964 803323771 177115397 62179276 390270885 754889875 881720571 902691435 154083299 328505383 761264351 182674686 94104683 357622370 573909964 320060691 33548810 247029007 812823597 946798893 813659359 710111761",
"output": "YES"
},
{
"input": "40\n740553458 532562042 138583675 75471987 487348843 476240280 972115023 103690894 546736371 915774563 35356828 819948191 138721993 24257926 761587264 767176616 608310208 78275645 386063134 227581756 672567198 177797611 87579917 941781518 274774331 843623616 981221615 630282032 118843963 749160513 354134861 132333165 405839062 522698334 29698277 541005920 856214146 167344951 398332403 68622974",
"output": "YES"
},
{
"input": "40\n155 1470176 7384 765965701 1075 4 561554 6227772 93 16304522 1744 662 3 292572860 19335 908613 42685804 347058 20 132560 3848974 69067081 58 2819 111752888 408 81925 30 11951 4564 251 26381275 473392832 50628 180819969 2378797 10076746 9 214492 31291",
"output": "NO"
},
{
"input": "3\n1 1000000000 1000000000",
"output": "YES"
},
{
"input": "4\n1 1000000000 1000000000 1000000000",
"output": "YES"
},
{
"input": "3\n1 1000000000 1",
"output": "NO"
},
{
"input": "5\n1 2 3 5 2",
"output": "YES"
},
{
"input": "41\n19 161 4090221 118757367 2 45361275 1562319 596751 140871 97 1844 310910829 10708344 6618115 698 1 87059 33 2527892 12703 73396090 17326460 3 368811 20550 813975131 10 53804 28034805 7847 2992 33254 1139 227930 965568 261 4846 503064297 192153458 57 431",
"output": "NO"
},
{
"input": "42\n4317083 530966905 202811311 104 389267 35 1203 18287479 125344279 21690 859122498 65 859122508 56790 1951 148683 457 1 22 2668100 8283 2 77467028 13405 11302280 47877251 328155592 35095 29589769 240574 4 10 1019123 6985189 629846 5118 169 1648973 91891 741 282 3159",
"output": "YES"
},
{
"input": "43\n729551585 11379 5931704 330557 1653 15529406 729551578 278663905 1 729551584 2683 40656510 29802 147 1400284 2 126260 865419 51 17 172223763 86 1 534861 450887671 32 234 25127103 9597697 48226 7034 389 204294 2265706 65783617 4343 3665990 626 78034 106440137 5 18421 1023",
"output": "YES"
},
{
"input": "44\n719528276 2 235 444692918 24781885 169857576 18164 47558 15316043 9465834 64879816 2234575 1631 853530 8 1001 621 719528259 84 6933 31 1 3615623 719528266 40097928 274835337 1381044 11225 2642 5850203 6 527506 18 104977753 76959 29393 49 4283 141 201482 380 1 124523 326015",
"output": "YES"
},
{
"input": "45\n28237 82 62327732 506757 691225170 5 970 4118 264024506 313192 367 14713577 73933 691225154 6660 599 691225145 3473403 51 427200630 1326718 2146678 100848386 1569 27 163176119 193562 10784 45687 819951 38520653 225 119620 1 3 691225169 691225164 17445 23807072 1 9093493 5620082 2542 139 14",
"output": "YES"
},
{
"input": "44\n165580141 21 34 55 1 89 144 17711 2 377 610 987 2584 13 5 4181 6765 10946 1597 8 28657 3 233 75025 121393 196418 317811 9227465 832040 1346269 2178309 3524578 5702887 1 14930352 102334155 24157817 39088169 63245986 701408733 267914296 433494437 514229 46368",
"output": "NO"
},
{
"input": "3\n1 1000000000 999999999",
"output": "NO"
},
{
"input": "5\n1 1 1 1 1",
"output": "YES"
},
{
"input": "10\n1 10 100 1000 10000 100000 1000000 10000000 100000000 1000000000",
"output": "NO"
},
{
"input": "5\n2 3 4 10 20",
"output": "YES"
},
{
"input": "6\n18 23 40 80 160 161",
"output": "YES"
},
{
"input": "4\n5 6 7 888",
"output": "YES"
},
{
"input": "9\n1 1 2 2 4 5 10 10 20",
"output": "YES"
},
{
"input": "7\n3 150 900 4 500 1500 5",
"output": "YES"
},
{
"input": "3\n2 2 3",
"output": "YES"
},
{
"input": "7\n1 2 100 200 250 1000000 2000000",
"output": "YES"
},
{
"input": "8\n2 3 5 5 5 6 6 13",
"output": "YES"
},
{
"input": "3\n2 3 4",
"output": "YES"
},
{
"input": "6\n1 1 1 4 5 100",
"output": "YES"
},
{
"input": "13\n1 2 3 5 8 13 22 34 55 89 144 233 377",
"output": "YES"
},
{
"input": "4\n2 3 4 8",
"output": "YES"
},
{
"input": "3\n5 6 7",
"output": "YES"
},
{
"input": "5\n1 4 5 6 1000000",
"output": "YES"
},
{
"input": "4\n5 6 7 20",
"output": "YES"
},
{
"input": "6\n1 1 1 1 1 65",
"output": "YES"
},
{
"input": "4\n3 4 5 100",
"output": "YES"
},
{
"input": "3\n2 4 5",
"output": "YES"
},
{
"input": "7\n1 1 1 1 1 10 1000",
"output": "YES"
},
{
"input": "4\n1 1 2 3",
"output": "NO"
},
{
"input": "11\n1 2 5 6 7 8 9 17 18 19 100",
"output": "YES"
},
{
"input": "4\n5 16 20 200",
"output": "YES"
},
{
"input": "5\n17 6 3 3 1",
"output": "YES"
},
{
"input": "3\n1 1 1",
"output": "YES"
},
{
"input": "6\n1 1 1 2 3 5",
"output": "YES"
},
{
"input": "4\n2 4 6 6",
"output": "YES"
},
{
"input": "9\n1 2 4 4 4 4 7 8 20",
"output": "YES"
},
{
"input": "9\n1 1 2 5 5 5 10 10 20",
"output": "YES"
},
{
"input": "7\n3 150 600 4 1700 6000 5",
"output": "YES"
},
{
"input": "5\n5761 20966 27841 28800 29399",
"output": "YES"
},
{
"input": "9\n1 2 3 6 7 10 11 12 24",
"output": "YES"
},
{
"input": "4\n1 2 1 1",
"output": "YES"
},
{
"input": "5\n1 1 2 3 4",
"output": "YES"
}
] | 1,685,388,672
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 87
| 78
| 13,619,200
|
n = int(input())
lens = list(map(int, input().split()))
lens.sort()
triangle = False
for i in range(n - 2):
if lens[i] + lens[i + 1] > lens[i + 2]:
triangle = True
break
if triangle:
print("YES")
else:
print("NO")
|
Title: Mahmoud and a Triangle
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Mahmoud has *n* line segments, the *i*-th of them has length *a**i*. Ehab challenged him to use exactly 3 line segments to form a non-degenerate triangle. Mahmoud doesn't accept challenges unless he is sure he can win, so he asked you to tell him if he should accept the challenge. Given the lengths of the line segments, check if he can choose exactly 3 of them to form a non-degenerate triangle.
Mahmoud should use exactly 3 line segments, he can't concatenate two line segments or change any length. A non-degenerate triangle is a triangle with positive area.
Input Specification:
The first line contains single integer *n* (3<=β€<=*n*<=β€<=105)Β β the number of line segments Mahmoud has.
The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a**i*<=β€<=109)Β β the lengths of line segments Mahmoud has.
Output Specification:
In the only line print "YES" if he can choose exactly three line segments and form a non-degenerate triangle with them, and "NO" otherwise.
Demo Input:
['5\n1 5 3 2 4\n', '3\n4 1 2\n']
Demo Output:
['YES\n', 'NO\n']
Note:
For the first example, he can use line segments with lengths 2, 4 and 5 to form a non-degenerate triangle.
|
```python
n = int(input())
lens = list(map(int, input().split()))
lens.sort()
triangle = False
for i in range(n - 2):
if lens[i] + lens[i + 1] > lens[i + 2]:
triangle = True
break
if triangle:
print("YES")
else:
print("NO")
```
| 3
|
|
534
|
B
|
Covered Path
|
PROGRAMMING
| 1,400
|
[
"dp",
"greedy",
"math"
] | null | null |
The on-board computer on Polycarp's car measured that the car speed at the beginning of some section of the path equals *v*1 meters per second, and in the end it is *v*2 meters per second. We know that this section of the route took exactly *t* seconds to pass.
Assuming that at each of the seconds the speed is constant, and between seconds the speed can change at most by *d* meters per second in absolute value (i.e., the difference in the speed of any two adjacent seconds does not exceed *d* in absolute value), find the maximum possible length of the path section in meters.
|
The first line contains two integers *v*1 and *v*2 (1<=β€<=*v*1,<=*v*2<=β€<=100) β the speeds in meters per second at the beginning of the segment and at the end of the segment, respectively.
The second line contains two integers *t* (2<=β€<=*t*<=β€<=100) β the time when the car moves along the segment in seconds, *d* (0<=β€<=*d*<=β€<=10) β the maximum value of the speed change between adjacent seconds.
It is guaranteed that there is a way to complete the segment so that:
- the speed in the first second equals *v*1, - the speed in the last second equals *v*2, - the absolute value of difference of speeds between any two adjacent seconds doesn't exceed *d*.
|
Print the maximum possible length of the path segment in meters.
|
[
"5 6\n4 2\n",
"10 10\n10 0\n"
] |
[
"26",
"100"
] |
In the first sample the sequence of speeds of Polycarpus' car can look as follows: 5, 7, 8, 6. Thus, the total path is 5β+β7β+β8β+β6β=β26 meters.
In the second sample, as *d*β=β0, the car covers the whole segment at constant speed *v*β=β10. In *t*β=β10 seconds it covers the distance of 100 meters.
| 1,000
|
[
{
"input": "5 6\n4 2",
"output": "26"
},
{
"input": "10 10\n10 0",
"output": "100"
},
{
"input": "87 87\n2 10",
"output": "174"
},
{
"input": "1 11\n6 2",
"output": "36"
},
{
"input": "100 10\n10 10",
"output": "550"
},
{
"input": "1 1\n100 10",
"output": "24600"
},
{
"input": "1 1\n5 1",
"output": "9"
},
{
"input": "1 1\n5 2",
"output": "13"
},
{
"input": "100 100\n100 0",
"output": "10000"
},
{
"input": "100 100\n100 10",
"output": "34500"
},
{
"input": "1 100\n100 1",
"output": "5050"
},
{
"input": "1 100\n100 10",
"output": "29305"
},
{
"input": "100 1\n100 1",
"output": "5050"
},
{
"input": "100 1\n100 10",
"output": "29305"
},
{
"input": "1 10\n2 10",
"output": "11"
},
{
"input": "1 1\n2 1",
"output": "2"
},
{
"input": "1 1\n2 10",
"output": "2"
},
{
"input": "1 2\n2 1",
"output": "3"
},
{
"input": "1 2\n2 10",
"output": "3"
},
{
"input": "1 5\n3 2",
"output": "9"
},
{
"input": "2 1\n2 2",
"output": "3"
},
{
"input": "2 1\n2 10",
"output": "3"
},
{
"input": "1 11\n2 10",
"output": "12"
},
{
"input": "11 1\n2 10",
"output": "12"
},
{
"input": "1 1\n3 5",
"output": "8"
},
{
"input": "1 10\n3 5",
"output": "17"
},
{
"input": "1 21\n3 10",
"output": "33"
},
{
"input": "21 1\n3 10",
"output": "33"
},
{
"input": "100 100\n99 1",
"output": "12301"
},
{
"input": "100 100\n100 1",
"output": "12450"
},
{
"input": "99 99\n99 1",
"output": "12202"
},
{
"input": "99 99\n99 10",
"output": "33811"
},
{
"input": "1 100\n99 10",
"output": "28764"
},
{
"input": "13 31\n7 5",
"output": "182"
},
{
"input": "88 78\n8 5",
"output": "719"
},
{
"input": "34 48\n47 4",
"output": "4030"
},
{
"input": "91 29\n78 3",
"output": "8806"
},
{
"input": "90 81\n21 6",
"output": "2391"
},
{
"input": "95 89\n45 3",
"output": "5589"
},
{
"input": "48 54\n84 2",
"output": "7724"
},
{
"input": "72 31\n59 7",
"output": "8865"
},
{
"input": "51 13\n47 3",
"output": "2970"
},
{
"input": "97 91\n82 2",
"output": "10984"
},
{
"input": "71 71\n9 5",
"output": "719"
},
{
"input": "16 49\n40 3",
"output": "2350"
},
{
"input": "22 41\n68 4",
"output": "6608"
},
{
"input": "13 71\n72 6",
"output": "10444"
},
{
"input": "77 78\n46 3",
"output": "5083"
},
{
"input": "36 60\n54 2",
"output": "3924"
},
{
"input": "55 39\n93 2",
"output": "8571"
},
{
"input": "34 7\n48 6",
"output": "4266"
},
{
"input": "80 88\n79 3",
"output": "11193"
},
{
"input": "34 62\n15 4",
"output": "866"
},
{
"input": "81 40\n73 2",
"output": "6798"
},
{
"input": "13 38\n97 6",
"output": "16271"
},
{
"input": "84 87\n45 2",
"output": "4814"
},
{
"input": "42 65\n76 3",
"output": "8240"
},
{
"input": "55 6\n24 4",
"output": "1110"
},
{
"input": "41 16\n43 2",
"output": "2029"
},
{
"input": "99 93\n78 1",
"output": "8961"
},
{
"input": "10 7\n44 2",
"output": "1297"
},
{
"input": "72 54\n91 3",
"output": "11781"
},
{
"input": "48 34\n80 2",
"output": "6376"
},
{
"input": "92 85\n70 1",
"output": "7373"
}
] | 1,621,661,567
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 64
| 170
| 4,403,200
|
def f(start,end,time,dif):
dp=[[-float("inf") for j in range(1000) ]for i in range(time+1)]
dp[0][start]=start
for i in range(time):
for val in range(1000):
for d in range(-dif,dif+1):
if val+d>=0 and val+d<1000:
dp[i+1][val+d]=max(dp[i][val]+val+d,dp[i+1][val+d])
return dp[time-1][end]
start,end=map(int,input().strip().split())
time,dif=map(int,input().strip().split())
print(f(start,end,time,dif))
'''
βββββββββ ββ ββ ββ ββ ββ βββββββββ βββββββββ ββ
βββ βββ βββ βββ βββ βββ βββ βββ βββ βββ βββ βββ
βββ ββ βββ βββ ββββ βββ βββ βββ βββ βββ βββ βββ
βββ βββββββββββββ ββββ βββ βββ βββββββββββ βββ βββ βββ
ββββββββββββ βββββββββββββ ββββ βββ βββ ββββββββββ ββββββββββββ βββ
βββ βββ βββ βββ βββ βββ ββββββββββββ βββ βββ βββ
ββ βββ βββ βββ βββ βββ βββ βββ βββ βββ βββ ββββ β
ββββββββββ βββ ββ ββ ββββββββ βββ βββ βββ ββ βββββββββ
βββ βββ β
'''
|
Title: Covered Path
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The on-board computer on Polycarp's car measured that the car speed at the beginning of some section of the path equals *v*1 meters per second, and in the end it is *v*2 meters per second. We know that this section of the route took exactly *t* seconds to pass.
Assuming that at each of the seconds the speed is constant, and between seconds the speed can change at most by *d* meters per second in absolute value (i.e., the difference in the speed of any two adjacent seconds does not exceed *d* in absolute value), find the maximum possible length of the path section in meters.
Input Specification:
The first line contains two integers *v*1 and *v*2 (1<=β€<=*v*1,<=*v*2<=β€<=100) β the speeds in meters per second at the beginning of the segment and at the end of the segment, respectively.
The second line contains two integers *t* (2<=β€<=*t*<=β€<=100) β the time when the car moves along the segment in seconds, *d* (0<=β€<=*d*<=β€<=10) β the maximum value of the speed change between adjacent seconds.
It is guaranteed that there is a way to complete the segment so that:
- the speed in the first second equals *v*1, - the speed in the last second equals *v*2, - the absolute value of difference of speeds between any two adjacent seconds doesn't exceed *d*.
Output Specification:
Print the maximum possible length of the path segment in meters.
Demo Input:
['5 6\n4 2\n', '10 10\n10 0\n']
Demo Output:
['26', '100']
Note:
In the first sample the sequence of speeds of Polycarpus' car can look as follows: 5, 7, 8, 6. Thus, the total path is 5β+β7β+β8β+β6β=β26 meters.
In the second sample, as *d*β=β0, the car covers the whole segment at constant speed *v*β=β10. In *t*β=β10 seconds it covers the distance of 100 meters.
|
```python
def f(start,end,time,dif):
dp=[[-float("inf") for j in range(1000) ]for i in range(time+1)]
dp[0][start]=start
for i in range(time):
for val in range(1000):
for d in range(-dif,dif+1):
if val+d>=0 and val+d<1000:
dp[i+1][val+d]=max(dp[i][val]+val+d,dp[i+1][val+d])
return dp[time-1][end]
start,end=map(int,input().strip().split())
time,dif=map(int,input().strip().split())
print(f(start,end,time,dif))
'''
βββββββββ ββ ββ ββ ββ ββ βββββββββ βββββββββ ββ
βββ βββ βββ βββ βββ βββ βββ βββ βββ βββ βββ βββ
βββ ββ βββ βββ ββββ βββ βββ βββ βββ βββ βββ βββ
βββ βββββββββββββ ββββ βββ βββ βββββββββββ βββ βββ βββ
ββββββββββββ βββββββββββββ ββββ βββ βββ ββββββββββ ββββββββββββ βββ
βββ βββ βββ βββ βββ βββ ββββββββββββ βββ βββ βββ
ββ βββ βββ βββ βββ βββ βββ βββ βββ βββ βββ ββββ β
ββββββββββ βββ ββ ββ ββββββββ βββ βββ βββ ββ βββββββββ
βββ βββ β
'''
```
| 3
|
|
499
|
B
|
Lecture
|
PROGRAMMING
| 1,000
|
[
"implementation",
"strings"
] | null | null |
You have a new professor of graph theory and he speaks very quickly. You come up with the following plan to keep up with his lecture and make notes.
You know two languages, and the professor is giving the lecture in the first one. The words in both languages consist of lowercase English characters, each language consists of several words. For each language, all words are distinct, i.e. they are spelled differently. Moreover, the words of these languages have a one-to-one correspondence, that is, for each word in each language, there exists exactly one word in the other language having has the same meaning.
You can write down every word the professor says in either the first language or the second language. Of course, during the lecture you write down each word in the language in which the word is shorter. In case of equal lengths of the corresponding words you prefer the word of the first language.
You are given the text of the lecture the professor is going to read. Find out how the lecture will be recorded in your notes.
|
The first line contains two integers, *n* and *m* (1<=β€<=*n*<=β€<=3000, 1<=β€<=*m*<=β€<=3000) β the number of words in the professor's lecture and the number of words in each of these languages.
The following *m* lines contain the words. The *i*-th line contains two strings *a**i*, *b**i* meaning that the word *a**i* belongs to the first language, the word *b**i* belongs to the second language, and these two words have the same meaning. It is guaranteed that no word occurs in both languages, and each word occurs in its language exactly once.
The next line contains *n* space-separated strings *c*1,<=*c*2,<=...,<=*c**n* β the text of the lecture. It is guaranteed that each of the strings *c**i* belongs to the set of strings {*a*1,<=*a*2,<=... *a**m*}.
All the strings in the input are non-empty, each consisting of no more than 10 lowercase English letters.
|
Output exactly *n* words: how you will record the lecture in your notebook. Output the words of the lecture in the same order as in the input.
|
[
"4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest\n",
"5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll\n"
] |
[
"codeforces round letter round\n",
"hbnyiyc joll joll un joll\n"
] |
none
| 500
|
[
{
"input": "4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest",
"output": "codeforces round letter round"
},
{
"input": "5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll",
"output": "hbnyiyc joll joll un joll"
},
{
"input": "5 5\nqueyqj f\nb vn\ntabzvk qpfzoqx\nytnyonoc hnxsd\njpggvr lchinjmt\nqueyqj jpggvr b ytnyonoc b",
"output": "f jpggvr b hnxsd b"
},
{
"input": "10 22\nazbrll oen\ngh vdyayei\njphveblohx vfglv\nmfyxib jepnvhcuwo\nrpikazqj uam\nl rx\nokjenof qpnyi\nj tixqrno\nod itozmfct\nikkdxmirx ev\nqexftojc p\nkdazb zjs\nmbk ykvqjrxaxu\nhbcwhouzq pwt\nmirpsz zfaegpl\nuhkkvcj rlvwj\nef iqnnwtolrc\npjzfcpmeag ecdayth\nsa qcthz\ncbfhfxi qrnbvdryz\nwqel tj\natx smkbid\nef hbcwhouzq cbfhfxi hbcwhouzq mirpsz cbfhfxi cbfhfxi okjenof pjzfcpmeag kdazb",
"output": "ef pwt cbfhfxi pwt mirpsz cbfhfxi cbfhfxi qpnyi ecdayth zjs"
},
{
"input": "1 1\namit am\namit",
"output": "am"
},
{
"input": "1 1\na c\na",
"output": "a"
}
] | 1,684,824,587
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 37
| 61
| 921,600
|
dictionary = {}
n, m = map(int, input().split())
for i in range(m):
a, b = input().split()
dictionary[a] = b
#print(dictionary)
for i in input().split():
print(min(i, dictionary[i], key=len), "", end="")
|
Title: Lecture
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have a new professor of graph theory and he speaks very quickly. You come up with the following plan to keep up with his lecture and make notes.
You know two languages, and the professor is giving the lecture in the first one. The words in both languages consist of lowercase English characters, each language consists of several words. For each language, all words are distinct, i.e. they are spelled differently. Moreover, the words of these languages have a one-to-one correspondence, that is, for each word in each language, there exists exactly one word in the other language having has the same meaning.
You can write down every word the professor says in either the first language or the second language. Of course, during the lecture you write down each word in the language in which the word is shorter. In case of equal lengths of the corresponding words you prefer the word of the first language.
You are given the text of the lecture the professor is going to read. Find out how the lecture will be recorded in your notes.
Input Specification:
The first line contains two integers, *n* and *m* (1<=β€<=*n*<=β€<=3000, 1<=β€<=*m*<=β€<=3000) β the number of words in the professor's lecture and the number of words in each of these languages.
The following *m* lines contain the words. The *i*-th line contains two strings *a**i*, *b**i* meaning that the word *a**i* belongs to the first language, the word *b**i* belongs to the second language, and these two words have the same meaning. It is guaranteed that no word occurs in both languages, and each word occurs in its language exactly once.
The next line contains *n* space-separated strings *c*1,<=*c*2,<=...,<=*c**n* β the text of the lecture. It is guaranteed that each of the strings *c**i* belongs to the set of strings {*a*1,<=*a*2,<=... *a**m*}.
All the strings in the input are non-empty, each consisting of no more than 10 lowercase English letters.
Output Specification:
Output exactly *n* words: how you will record the lecture in your notebook. Output the words of the lecture in the same order as in the input.
Demo Input:
['4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest\n', '5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll\n']
Demo Output:
['codeforces round letter round\n', 'hbnyiyc joll joll un joll\n']
Note:
none
|
```python
dictionary = {}
n, m = map(int, input().split())
for i in range(m):
a, b = input().split()
dictionary[a] = b
#print(dictionary)
for i in input().split():
print(min(i, dictionary[i], key=len), "", end="")
```
| 3
|
|
676
|
C
|
Vasya and String
|
PROGRAMMING
| 1,500
|
[
"binary search",
"dp",
"strings",
"two pointers"
] | null | null |
High school student Vasya got a string of length *n* as a birthday present. This string consists of letters 'a' and 'b' only. Vasya denotes beauty of the string as the maximum length of a substring (consecutive subsequence) consisting of equal letters.
Vasya can change no more than *k* characters of the original string. What is the maximum beauty of the string he can achieve?
|
The first line of the input contains two integers *n* and *k* (1<=β€<=*n*<=β€<=100<=000,<=0<=β€<=*k*<=β€<=*n*)Β β the length of the string and the maximum number of characters to change.
The second line contains the string, consisting of letters 'a' and 'b' only.
|
Print the only integerΒ β the maximum beauty of the string Vasya can achieve by changing no more than *k* characters.
|
[
"4 2\nabba\n",
"8 1\naabaabaa\n"
] |
[
"4\n",
"5\n"
] |
In the first sample, Vasya can obtain both strings "aaaa" and "bbbb".
In the second sample, the optimal answer is obtained with the string "aaaaabaa" or with the string "aabaaaaa".
| 1,500
|
[
{
"input": "4 2\nabba",
"output": "4"
},
{
"input": "8 1\naabaabaa",
"output": "5"
},
{
"input": "1 0\na",
"output": "1"
},
{
"input": "1 1\nb",
"output": "1"
},
{
"input": "1 0\nb",
"output": "1"
},
{
"input": "1 1\na",
"output": "1"
},
{
"input": "10 10\nbbbbbbbbbb",
"output": "10"
},
{
"input": "10 2\nbbbbbbbbbb",
"output": "10"
},
{
"input": "10 1\nbbabbabbba",
"output": "6"
},
{
"input": "10 10\nbbabbbaabb",
"output": "10"
},
{
"input": "10 9\nbabababbba",
"output": "10"
},
{
"input": "10 4\nbababbaaab",
"output": "9"
},
{
"input": "10 10\naabaaabaaa",
"output": "10"
},
{
"input": "10 10\naaaabbbaaa",
"output": "10"
},
{
"input": "10 1\nbaaaaaaaab",
"output": "9"
},
{
"input": "10 5\naaaaabaaaa",
"output": "10"
},
{
"input": "10 4\naaaaaaaaaa",
"output": "10"
},
{
"input": "100 10\nbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "100"
},
{
"input": "100 7\nbbbbabbbbbaabbbabbbbbbbbbbbabbbbbbbbbbbbbbbbbbbbbbbbbabbbbbbbbbbbabbabbbbbbbbbbbbbbbbbbbbbbbbbbbbbab",
"output": "93"
},
{
"input": "100 30\nbbaabaaabbbbbbbbbbaababababbbbbbaabaabbbbbbbbabbbbbabbbbabbbbbbbbaabbbbbbbbbabbbbbabbbbbbbbbaaaaabba",
"output": "100"
},
{
"input": "100 6\nbaababbbaabbabbaaabbabbaabbbbbbbbaabbbabbbbaabbabbbbbabababbbbabbbbbbabbbbbbbbbaaaabbabbbbaabbabaabb",
"output": "34"
},
{
"input": "100 45\naabababbabbbaaabbbbbbaabbbabbaabbbbbabbbbbbbbabbbbbbabbaababbaabbababbbbbbababbbbbaabbbbbbbaaaababab",
"output": "100"
},
{
"input": "100 2\nababaabababaaababbaaaabbaabbbababbbaaabbbbabababbbabababaababaaabaabbbbaaabbbabbbbbabbbbbbbaabbabbba",
"output": "17"
},
{
"input": "100 25\nbabbbaaababaaabbbaabaabaabbbabbabbbbaaaaaaabaaabaaaaaaaaaabaaaabaaabbbaaabaaababaaabaabbbbaaaaaaaaaa",
"output": "80"
},
{
"input": "100 14\naabaaaaabababbabbabaaaabbaaaabaaabbbaaabaaaaaaaabaaaaabbaaaaaaaaabaaaaaaabbaababaaaababbbbbabaaaabaa",
"output": "61"
},
{
"input": "100 8\naaaaabaaaabaabaaaaaaaabaaaabaaaaaaaaaaaaaabaaaaabaaaaaaaaaaaaaaaaabaaaababaabaaaaaaaaaaaaabbabaaaaaa",
"output": "76"
},
{
"input": "100 12\naaaaaaaaaaaaaaaabaaabaaaaaaaaaabbaaaabbabaaaaaaaaaaaaaaaaaaaaabbaaabaaaaaaaaaaaabaaaaaaaabaaaaaaaaaa",
"output": "100"
},
{
"input": "100 65\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "100"
},
{
"input": "10 0\nbbbbbbbbbb",
"output": "10"
},
{
"input": "10 0\nbbbbabbbbb",
"output": "5"
},
{
"input": "10 0\nbbabbbabba",
"output": "3"
},
{
"input": "10 0\nbaabbbbaba",
"output": "4"
},
{
"input": "10 0\naababbbbaa",
"output": "4"
},
{
"input": "10 2\nabbbbbaaba",
"output": "8"
},
{
"input": "10 0\nabbaaabaaa",
"output": "3"
},
{
"input": "10 0\naabbaaabaa",
"output": "3"
},
{
"input": "10 1\naaaaaababa",
"output": "8"
},
{
"input": "10 0\nbaaaaaaaaa",
"output": "9"
},
{
"input": "10 0\naaaaaaaaaa",
"output": "10"
},
{
"input": "100 0\nbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "100"
},
{
"input": "100 0\nbbbbbbbbbbabbbbaaabbbbbbbbbbbabbbabbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbabbbbbbbbbabbbbbbbbbbbbbab",
"output": "40"
},
{
"input": "100 11\nbaabbbbbababbbbabbbbbbbabbbbbbbbbbbbbbabbbbbbababbbbababbbbaaabbbbabbbbbabbbbbbbbabababbbabbbbbbbabb",
"output": "65"
},
{
"input": "100 8\nbbababbbbbaabbbaaababbbbababababbbbababbabbbabbbbbaabbbabbbababbabbbbabbbabbbbaabbbbabbbaabbbbaaaabb",
"output": "33"
},
{
"input": "100 21\nabbaaaabbbababaabbbababbbbbbbbabbaababababbbabbbaaabbaaabbbbabbabbbabbbabaababbbabbbbbabbbbbbabbbbab",
"output": "65"
},
{
"input": "100 9\nabbbaabaabaaaaaaabbabbbababbaaabbbaaabbaabaaaaabbbbbabbaabaabbbbbaaaaababbaaabbabaabaaabababbaababbb",
"output": "26"
},
{
"input": "100 5\naababababbaaaaaaaabbbabaaaabbabaaaabbaabaaaaabababbabaabaaabaaaaaaaabaababbabbaaabaabbabbaaaaabbabba",
"output": "22"
},
{
"input": "100 9\naababaabaaaaaaaaabbbaabaaaaaaabaaaaaaaaaaaaabaaabaabaabbbbabbaababbabbaaaabbababaabaababaabaaaaaaaaa",
"output": "49"
},
{
"input": "100 6\naaaaabbaaaaaaaaaaabaaaabaaaaaaaaabaaabaaaaaabaaaaaaaaaaabaabaaaabaaaaaaaaaaaaaaabaabbaaaaaaaaaaaaaaa",
"output": "56"
},
{
"input": "100 7\nabaaabaabaabaaaaaabaaaaaaaaaaaaaaaaaaaaaaaaaaaaabaaabaaaaaaabbabaaaaaaaaaaaaaaaaabaaaaaaaaaaaaaaaaba",
"output": "86"
},
{
"input": "100 0\naaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "100"
}
] | 1,646,616,394
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 117
| 124
| 102,400
|
n, k = map(int, input().split())
s = input()
a, b = 0, 0
j = 0
ans = 0
for i in s:
if i == 'a':
a += 1
else:
b += 1
if min(a, b) > k:
if s[j] == 'a':
a -= 1
else:
b -= 1
j += 1
else:
ans += 1
print(ans)
|
Title: Vasya and String
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
High school student Vasya got a string of length *n* as a birthday present. This string consists of letters 'a' and 'b' only. Vasya denotes beauty of the string as the maximum length of a substring (consecutive subsequence) consisting of equal letters.
Vasya can change no more than *k* characters of the original string. What is the maximum beauty of the string he can achieve?
Input Specification:
The first line of the input contains two integers *n* and *k* (1<=β€<=*n*<=β€<=100<=000,<=0<=β€<=*k*<=β€<=*n*)Β β the length of the string and the maximum number of characters to change.
The second line contains the string, consisting of letters 'a' and 'b' only.
Output Specification:
Print the only integerΒ β the maximum beauty of the string Vasya can achieve by changing no more than *k* characters.
Demo Input:
['4 2\nabba\n', '8 1\naabaabaa\n']
Demo Output:
['4\n', '5\n']
Note:
In the first sample, Vasya can obtain both strings "aaaa" and "bbbb".
In the second sample, the optimal answer is obtained with the string "aaaaabaa" or with the string "aabaaaaa".
|
```python
n, k = map(int, input().split())
s = input()
a, b = 0, 0
j = 0
ans = 0
for i in s:
if i == 'a':
a += 1
else:
b += 1
if min(a, b) > k:
if s[j] == 'a':
a -= 1
else:
b -= 1
j += 1
else:
ans += 1
print(ans)
```
| 3
|
|
365
|
A
|
Good Number
|
PROGRAMMING
| 1,100
|
[
"implementation"
] | null | null |
Let's call a number *k*-good if it contains all digits not exceeding *k* (0,<=...,<=*k*). You've got a number *k* and an array *a* containing *n* numbers. Find out how many *k*-good numbers are in *a* (count each number every time it occurs in array *a*).
|
The first line contains integers *n* and *k* (1<=β€<=*n*<=β€<=100, 0<=β€<=*k*<=β€<=9). The *i*-th of the following *n* lines contains integer *a**i* without leading zeroes (1<=β€<=*a**i*<=β€<=109).
|
Print a single integer β the number of *k*-good numbers in *a*.
|
[
"10 6\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n",
"2 1\n1\n10\n"
] |
[
"10\n",
"1\n"
] |
none
| 500
|
[
{
"input": "10 6\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560",
"output": "10"
},
{
"input": "2 1\n1\n10",
"output": "1"
},
{
"input": "1 0\n1000000000",
"output": "1"
},
{
"input": "1 1\n1000000000",
"output": "1"
},
{
"input": "6 0\n10\n102\n120\n1032\n1212103\n1999999",
"output": "5"
},
{
"input": "1 3\n1000000000",
"output": "0"
},
{
"input": "1 9\n1000000000",
"output": "0"
},
{
"input": "1 0\n1",
"output": "0"
},
{
"input": "1 1\n1",
"output": "0"
},
{
"input": "1 3\n1",
"output": "0"
},
{
"input": "1 9\n1",
"output": "0"
},
{
"input": "2 8\n123456780\n123",
"output": "1"
},
{
"input": "2 8\n12345678\n1230",
"output": "0"
},
{
"input": "6 1\n10\n102\n120\n1032\n1212103\n1999999",
"output": "5"
},
{
"input": "6 2\n10\n102\n120\n1032\n1212103\n1999999",
"output": "4"
},
{
"input": "6 3\n10\n102\n120\n1032\n1212103\n1999999",
"output": "2"
},
{
"input": "6 9\n10\n102\n120\n1032\n1212103\n1999999",
"output": "0"
},
{
"input": "1 2\n2220",
"output": "0"
}
] | 1,695,833,538
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 37
| 46
| 0
|
def main():
inp = input().split()
n = int(inp[0])
k = int(inp[1])
numbers = [input() for i in range(n)]
for i in range(n):
number = numbers[i]
numbers[i] = []
for letter in number:
numbers[i].append(int(letter))
counter = 0
for element in numbers:
flag = True
for i in range(0, k+1):
if i not in element:
flag = False
continue
if flag:
counter += 1
print(counter)
return 0
if __name__ == "__main__":
main()
|
Title: Good Number
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Let's call a number *k*-good if it contains all digits not exceeding *k* (0,<=...,<=*k*). You've got a number *k* and an array *a* containing *n* numbers. Find out how many *k*-good numbers are in *a* (count each number every time it occurs in array *a*).
Input Specification:
The first line contains integers *n* and *k* (1<=β€<=*n*<=β€<=100, 0<=β€<=*k*<=β€<=9). The *i*-th of the following *n* lines contains integer *a**i* without leading zeroes (1<=β€<=*a**i*<=β€<=109).
Output Specification:
Print a single integer β the number of *k*-good numbers in *a*.
Demo Input:
['10 6\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n1234560\n', '2 1\n1\n10\n']
Demo Output:
['10\n', '1\n']
Note:
none
|
```python
def main():
inp = input().split()
n = int(inp[0])
k = int(inp[1])
numbers = [input() for i in range(n)]
for i in range(n):
number = numbers[i]
numbers[i] = []
for letter in number:
numbers[i].append(int(letter))
counter = 0
for element in numbers:
flag = True
for i in range(0, k+1):
if i not in element:
flag = False
continue
if flag:
counter += 1
print(counter)
return 0
if __name__ == "__main__":
main()
```
| 3
|
|
618
|
A
|
Slime Combining
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Your friend recently gave you some slimes for your birthday. You have *n* slimes all initially with value 1.
You are going to play a game with these slimes. Initially, you put a single slime by itself in a row. Then, you will add the other *n*<=-<=1 slimes one by one. When you add a slime, you place it at the right of all already placed slimes. Then, while the last two slimes in the row have the same value *v*, you combine them together to create a slime with value *v*<=+<=1.
You would like to see what the final state of the row is after you've added all *n* slimes. Please print the values of the slimes in the row from left to right.
|
The first line of the input will contain a single integer, *n* (1<=β€<=*n*<=β€<=100<=000).
|
Output a single line with *k* integers, where *k* is the number of slimes in the row after you've finished the procedure described in the problem statement. The *i*-th of these numbers should be the value of the *i*-th slime from the left.
|
[
"1\n",
"2\n",
"3\n",
"8\n"
] |
[
"1\n",
"2\n",
"2 1\n",
"4\n"
] |
In the first sample, we only have a single slime with value 1. The final state of the board is just a single slime with value 1.
In the second sample, we perform the following steps:
Initially we place a single slime in a row by itself. Thus, row is initially 1.
Then, we will add another slime. The row is now 1 1. Since two rightmost slimes have the same values, we should replace these slimes with one with value 2. Thus, the final state of the board is 2.
In the third sample, after adding the first two slimes, our row is 2. After adding one more slime, the row becomes 2 1.
In the last sample, the steps look as follows:
1. 1 1. 2 1. 2 1 1. 3 1. 3 1 1. 3 2 1. 3 2 1 1. 4
| 500
|
[
{
"input": "1",
"output": "1"
},
{
"input": "2",
"output": "2"
},
{
"input": "3",
"output": "2 1"
},
{
"input": "8",
"output": "4"
},
{
"input": "100000",
"output": "17 16 11 10 8 6"
},
{
"input": "12345",
"output": "14 13 6 5 4 1"
},
{
"input": "32",
"output": "6"
},
{
"input": "70958",
"output": "17 13 11 9 6 4 3 2"
},
{
"input": "97593",
"output": "17 15 14 13 12 11 9 6 5 4 1"
},
{
"input": "91706",
"output": "17 15 14 11 10 6 5 4 2"
},
{
"input": "85371",
"output": "17 15 12 11 9 7 6 5 4 2 1"
},
{
"input": "97205",
"output": "17 15 14 13 12 10 9 8 6 5 3 1"
},
{
"input": "34768",
"output": "16 11 10 9 8 7 5"
},
{
"input": "12705",
"output": "14 13 9 8 6 1"
},
{
"input": "30151",
"output": "15 14 13 11 9 8 7 3 2 1"
},
{
"input": "4974",
"output": "13 10 9 7 6 4 3 2"
},
{
"input": "32728",
"output": "15 14 13 12 11 10 9 8 7 5 4"
},
{
"input": "8192",
"output": "14"
},
{
"input": "65536",
"output": "17"
},
{
"input": "32",
"output": "6"
},
{
"input": "256",
"output": "9"
},
{
"input": "4096",
"output": "13"
},
{
"input": "33301",
"output": "16 10 5 3 1"
},
{
"input": "16725",
"output": "15 9 7 5 3 1"
},
{
"input": "149",
"output": "8 5 3 1"
},
{
"input": "16277",
"output": "14 13 12 11 10 9 8 5 3 1"
},
{
"input": "99701",
"output": "17 16 11 9 7 6 5 3 1"
}
] | 1,661,453,526
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 27
| 109
| 921,600
|
n=int(input())
s=[1]*n
while not len(set(s))==len(s):
sc=[]
i=0
while i <(len(s)):
if i==(len(s)-1):
sc.append(s[i])
break
if s[i]==s[i+1]:
sc.append(s[i]+1)
i+=1
else:
sc.append(s[i])
i+=1
s=sc
print(*s)
|
Title: Slime Combining
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Your friend recently gave you some slimes for your birthday. You have *n* slimes all initially with value 1.
You are going to play a game with these slimes. Initially, you put a single slime by itself in a row. Then, you will add the other *n*<=-<=1 slimes one by one. When you add a slime, you place it at the right of all already placed slimes. Then, while the last two slimes in the row have the same value *v*, you combine them together to create a slime with value *v*<=+<=1.
You would like to see what the final state of the row is after you've added all *n* slimes. Please print the values of the slimes in the row from left to right.
Input Specification:
The first line of the input will contain a single integer, *n* (1<=β€<=*n*<=β€<=100<=000).
Output Specification:
Output a single line with *k* integers, where *k* is the number of slimes in the row after you've finished the procedure described in the problem statement. The *i*-th of these numbers should be the value of the *i*-th slime from the left.
Demo Input:
['1\n', '2\n', '3\n', '8\n']
Demo Output:
['1\n', '2\n', '2 1\n', '4\n']
Note:
In the first sample, we only have a single slime with value 1. The final state of the board is just a single slime with value 1.
In the second sample, we perform the following steps:
Initially we place a single slime in a row by itself. Thus, row is initially 1.
Then, we will add another slime. The row is now 1 1. Since two rightmost slimes have the same values, we should replace these slimes with one with value 2. Thus, the final state of the board is 2.
In the third sample, after adding the first two slimes, our row is 2. After adding one more slime, the row becomes 2 1.
In the last sample, the steps look as follows:
1. 1 1. 2 1. 2 1 1. 3 1. 3 1 1. 3 2 1. 3 2 1 1. 4
|
```python
n=int(input())
s=[1]*n
while not len(set(s))==len(s):
sc=[]
i=0
while i <(len(s)):
if i==(len(s)-1):
sc.append(s[i])
break
if s[i]==s[i+1]:
sc.append(s[i]+1)
i+=1
else:
sc.append(s[i])
i+=1
s=sc
print(*s)
```
| 3
|
|
596
|
B
|
Wilbur and Array
|
PROGRAMMING
| 1,100
|
[
"greedy",
"implementation"
] | null | null |
Wilbur the pig is tinkering with arrays again. He has the array *a*1,<=*a*2,<=...,<=*a**n* initially consisting of *n* zeros. At one step, he can choose any index *i* and either add 1 to all elements *a**i*,<=*a**i*<=+<=1,<=... ,<=*a**n* or subtract 1 from all elements *a**i*,<=*a**i*<=+<=1,<=...,<=*a**n*. His goal is to end up with the array *b*1,<=*b*2,<=...,<=*b**n*.
Of course, Wilbur wants to achieve this goal in the minimum number of steps and asks you to compute this value.
|
The first line of the input contains a single integer *n* (1<=β€<=*n*<=β€<=200<=000)Β β the length of the array *a**i*. Initially *a**i*<==<=0 for every position *i*, so this array is not given in the input.
The second line of the input contains *n* integers *b*1,<=*b*2,<=...,<=*b**n* (<=-<=109<=β€<=*b**i*<=β€<=109).
|
Print the minimum number of steps that Wilbur needs to make in order to achieve *a**i*<==<=*b**i* for all *i*.
|
[
"5\n1 2 3 4 5\n",
"4\n1 2 2 1\n"
] |
[
"5",
"3"
] |
In the first sample, Wilbur may successively choose indices 1, 2, 3, 4, and 5, and add 1 to corresponding suffixes.
In the second sample, Wilbur first chooses indices 1 and 2 and adds 1 to corresponding suffixes, then he chooses index 4 and subtract 1.
| 1,000
|
[
{
"input": "5\n1 2 3 4 5",
"output": "5"
},
{
"input": "4\n1 2 2 1",
"output": "3"
},
{
"input": "3\n1 2 4",
"output": "4"
},
{
"input": "6\n1 2 3 6 5 4",
"output": "8"
},
{
"input": "10\n2 1 4 3 6 5 8 7 10 9",
"output": "19"
},
{
"input": "7\n12 6 12 13 4 3 2",
"output": "36"
},
{
"input": "15\n15 14 13 1 2 3 12 11 10 4 5 6 9 8 7",
"output": "55"
},
{
"input": "16\n1 2 3 4 13 14 15 16 9 10 11 12 5 6 7 8",
"output": "36"
},
{
"input": "6\n1000 1 2000 1 3000 1",
"output": "11995"
},
{
"input": "1\n0",
"output": "0"
},
{
"input": "5\n1000000000 1 1000000000 1 1000000000",
"output": "4999999996"
},
{
"input": "5\n1000000000 0 1000000000 0 1000000000",
"output": "5000000000"
},
{
"input": "10\n1000000000 0 1000000000 0 1000000000 0 1000000000 0 1000000000 0",
"output": "10000000000"
},
{
"input": "10\n1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000",
"output": "19000000000"
},
{
"input": "7\n0 1000000000 0 1000000000 0 1000000000 0",
"output": "6000000000"
},
{
"input": "4\n1000000000 -1000000000 1000000000 -1000000000",
"output": "7000000000"
},
{
"input": "20\n1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000",
"output": "39000000000"
},
{
"input": "11\n1000000000 0 1000000000 0 1000000000 0 1000000000 0 1000000000 0 1000000000",
"output": "11000000000"
},
{
"input": "5\n1000000000 -1000000000 1000000000 -1000000000 1000000000",
"output": "9000000000"
},
{
"input": "22\n1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000",
"output": "43000000000"
}
] | 1,685,169,578
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 76
| 140
| 27,238,400
|
n = int(input())
b = list(map(int, input().split()))
steps = abs(b[0])
for i in range(1, n):
steps += abs(b[i] - b[i-1])
print(steps)
|
Title: Wilbur and Array
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Wilbur the pig is tinkering with arrays again. He has the array *a*1,<=*a*2,<=...,<=*a**n* initially consisting of *n* zeros. At one step, he can choose any index *i* and either add 1 to all elements *a**i*,<=*a**i*<=+<=1,<=... ,<=*a**n* or subtract 1 from all elements *a**i*,<=*a**i*<=+<=1,<=...,<=*a**n*. His goal is to end up with the array *b*1,<=*b*2,<=...,<=*b**n*.
Of course, Wilbur wants to achieve this goal in the minimum number of steps and asks you to compute this value.
Input Specification:
The first line of the input contains a single integer *n* (1<=β€<=*n*<=β€<=200<=000)Β β the length of the array *a**i*. Initially *a**i*<==<=0 for every position *i*, so this array is not given in the input.
The second line of the input contains *n* integers *b*1,<=*b*2,<=...,<=*b**n* (<=-<=109<=β€<=*b**i*<=β€<=109).
Output Specification:
Print the minimum number of steps that Wilbur needs to make in order to achieve *a**i*<==<=*b**i* for all *i*.
Demo Input:
['5\n1 2 3 4 5\n', '4\n1 2 2 1\n']
Demo Output:
['5', '3']
Note:
In the first sample, Wilbur may successively choose indices 1, 2, 3, 4, and 5, and add 1 to corresponding suffixes.
In the second sample, Wilbur first chooses indices 1 and 2 and adds 1 to corresponding suffixes, then he chooses index 4 and subtract 1.
|
```python
n = int(input())
b = list(map(int, input().split()))
steps = abs(b[0])
for i in range(1, n):
steps += abs(b[i] - b[i-1])
print(steps)
```
| 3
|
|
867
|
A
|
Between the Offices
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
As you may know, MemSQL has American offices in both San Francisco and Seattle. Being a manager in the company, you travel a lot between the two cities, always by plane.
You prefer flying from Seattle to San Francisco than in the other direction, because it's warmer in San Francisco. You are so busy that you don't remember the number of flights you have made in either direction. However, for each of the last *n* days you know whether you were in San Francisco office or in Seattle office. You always fly at nights, so you never were at both offices on the same day. Given this information, determine if you flew more times from Seattle to San Francisco during the last *n* days, or not.
|
The first line of input contains single integer *n* (2<=β€<=*n*<=β€<=100)Β β the number of days.
The second line contains a string of length *n* consisting of only capital 'S' and 'F' letters. If the *i*-th letter is 'S', then you were in Seattle office on that day. Otherwise you were in San Francisco. The days are given in chronological order, i.e. today is the last day in this sequence.
|
Print "YES" if you flew more times from Seattle to San Francisco, and "NO" otherwise.
You can print each letter in any case (upper or lower).
|
[
"4\nFSSF\n",
"2\nSF\n",
"10\nFFFFFFFFFF\n",
"10\nSSFFSFFSFF\n"
] |
[
"NO\n",
"YES\n",
"NO\n",
"YES\n"
] |
In the first example you were initially at San Francisco, then flew to Seattle, were there for two days and returned to San Francisco. You made one flight in each direction, so the answer is "NO".
In the second example you just flew from Seattle to San Francisco, so the answer is "YES".
In the third example you stayed the whole period in San Francisco, so the answer is "NO".
In the fourth example if you replace 'S' with ones, and 'F' with zeros, you'll get the first few digits of Ο in binary representation. Not very useful information though.
| 500
|
[
{
"input": "4\nFSSF",
"output": "NO"
},
{
"input": "2\nSF",
"output": "YES"
},
{
"input": "10\nFFFFFFFFFF",
"output": "NO"
},
{
"input": "10\nSSFFSFFSFF",
"output": "YES"
},
{
"input": "20\nSFSFFFFSSFFFFSSSSFSS",
"output": "NO"
},
{
"input": "20\nSSFFFFFSFFFFFFFFFFFF",
"output": "YES"
},
{
"input": "20\nSSFSFSFSFSFSFSFSSFSF",
"output": "YES"
},
{
"input": "20\nSSSSFSFSSFSFSSSSSSFS",
"output": "NO"
},
{
"input": "100\nFFFSFSFSFSSFSFFSSFFFFFSSSSFSSFFFFSFFFFFSFFFSSFSSSFFFFSSFFSSFSFFSSFSSSFSFFSFSFFSFSFFSSFFSFSSSSFSFSFSS",
"output": "NO"
},
{
"input": "100\nFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF",
"output": "NO"
},
{
"input": "100\nFFFFFFFFFFFFFFFFFFFFFFFFFFSFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFSFFFFFFFFFFFFFFFFFSS",
"output": "NO"
},
{
"input": "100\nFFFFFFFFFFFFFSFFFFFFFFFSFSSFFFFFFFFFFFFFFFFFFFFFFSFFSFFFFFSFFFFFFFFSFFFFFFFFFFFFFSFFFFFFFFSFFFFFFFSF",
"output": "NO"
},
{
"input": "100\nSFFSSFFFFFFSSFFFSSFSFFFFFSSFFFSFFFFFFSFSSSFSFSFFFFSFSSFFFFFFFFSFFFFFSFFFFFSSFFFSFFSFSFFFFSFFSFFFFFFF",
"output": "YES"
},
{
"input": "100\nFFFFSSSSSFFSSSFFFSFFFFFSFSSFSFFSFFSSFFSSFSFFFFFSFSFSFSFFFFFFFFFSFSFFSFFFFSFSFFFFFFFFFFFFSFSSFFSSSSFF",
"output": "NO"
},
{
"input": "100\nFFFFFFFFFFFFSSFFFFSFSFFFSFSSSFSSSSSFSSSSFFSSFFFSFSFSSFFFSSSFFSFSFSSFSFSSFSFFFSFFFFFSSFSFFFSSSFSSSFFS",
"output": "NO"
},
{
"input": "100\nFFFSSSFSFSSSSFSSFSFFSSSFFSSFSSFFSSFFSFSSSSFFFSFFFSFSFSSSFSSFSFSFSFFSSSSSFSSSFSFSFFSSFSFSSFFSSFSFFSFS",
"output": "NO"
},
{
"input": "100\nFFSSSSFSSSFSSSSFSSSFFSFSSFFSSFSSSFSSSFFSFFSSSSSSSSSSSSFSSFSSSSFSFFFSSFFFFFFSFSFSSSSSSFSSSFSFSSFSSFSS",
"output": "NO"
},
{
"input": "100\nSSSFFFSSSSFFSSSSSFSSSSFSSSFSSSSSFSSSSSSSSFSFFSSSFFSSFSSSSFFSSSSSSFFSSSSFSSSSSSFSSSFSSSSSSSFSSSSFSSSS",
"output": "NO"
},
{
"input": "100\nFSSSSSSSSSSSFSSSSSSSSSSSSSSSSFSSSSSSFSSSSSSSSSSSSSFSSFSSSSSFSSFSSSSSSSSSFFSSSSSFSFSSSFFSSSSSSSSSSSSS",
"output": "NO"
},
{
"input": "100\nSSSSSSSSSSSSSFSSSSSSSSSSSSFSSSFSSSSSSSSSSSSSSSSSSSSSSSSSSSSSFSSSSSSSSSSSSSSSSFSFSSSSSSSSSSSSSSSSSSFS",
"output": "NO"
},
{
"input": "100\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS",
"output": "NO"
},
{
"input": "100\nSFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF",
"output": "YES"
},
{
"input": "100\nSFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFSFSFFFFFFFFFFFSFSFFFFFFFFFFFFFSFFFFFFFFFFFFFFFFFFFFFFFFF",
"output": "YES"
},
{
"input": "100\nSFFFFFFFFFFFFSSFFFFSFFFFFFFFFFFFFFFFFFFSFFFSSFFFFSFSFFFSFFFFFFFFFFFFFFFSSFFFFFFFFSSFFFFFFFFFFFFFFSFF",
"output": "YES"
},
{
"input": "100\nSFFSSSFFSFSFSFFFFSSFFFFSFFFFFFFFSFSFFFSFFFSFFFSFFFFSFSFFFFFFFSFFFFFFFFFFSFFSSSFFSSFFFFSFFFFSFFFFSFFF",
"output": "YES"
},
{
"input": "100\nSFFFSFFFFSFFFSSFFFSFSFFFSFFFSSFSFFFFFSFFFFFFFFSFSFSFFSFFFSFSSFSFFFSFSFFSSFSFSSSFFFFFFSSFSFFSFFFFFFFF",
"output": "YES"
},
{
"input": "100\nSSSSFFFFSFFFFFFFSFFFFSFSFFFFSSFFFFFFFFFSFFSSFFFFFFSFSFSSFSSSFFFFFFFSFSFFFSSSFFFFFFFSFFFSSFFFFSSFFFSF",
"output": "YES"
},
{
"input": "100\nSSSFSSFFFSFSSSSFSSFSSSSFSSFFFFFSFFSSSSFFSSSFSSSFSSSSFSSSSFSSSSSSSFSFSSFFFSSFFSFFSSSSFSSFFSFSSFSFFFSF",
"output": "YES"
},
{
"input": "100\nSFFSFSSSSSSSFFSSSFSSSSFSFSSFFFSSSSSSFSSSSFSSFSSSFSSSSSSSFSSFSFFFSSFSSFSFSFSSSSSSSSSSSSFFFFSSSSSFSFFF",
"output": "YES"
},
{
"input": "100\nSSSFSFFSFSFFSSSSSFSSSFSSSFFFSSSSSSSSSFSFSFSSSSFSFSSFFFFFSSSSSSSSSSSSSSSSSSSFFSSSSSFSFSSSSFFSSSSFSSSF",
"output": "YES"
},
{
"input": "100\nSSSFSSSSSSSSSSFSSSSFSSSSSSFSSSSSSFSSSSSSSSSSSSSSFSSSFSSSFSSSSSSSSSSSFSSSSSSFSFSSSSFSSSSSSFSSSSSSSSFF",
"output": "YES"
},
{
"input": "100\nSSSSSSSSSSSSSSSFSFSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSFFSSSSSSSSSFSSSSSSSSSSSSSSSSSF",
"output": "YES"
},
{
"input": "100\nSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSF",
"output": "YES"
},
{
"input": "2\nSS",
"output": "NO"
}
] | 1,582,389,489
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 124
| 0
|
n=int(input())
f=list(input())
a=0
b=0
for i in range(n-1):
if(f[i]=="S" and f[i+1]=="F"):
a+=1
if(f[i]=="F" and f[i+1]=="S"):
b+=1
if(a>b):
print("YES")
else:
print("NO")
|
Title: Between the Offices
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
As you may know, MemSQL has American offices in both San Francisco and Seattle. Being a manager in the company, you travel a lot between the two cities, always by plane.
You prefer flying from Seattle to San Francisco than in the other direction, because it's warmer in San Francisco. You are so busy that you don't remember the number of flights you have made in either direction. However, for each of the last *n* days you know whether you were in San Francisco office or in Seattle office. You always fly at nights, so you never were at both offices on the same day. Given this information, determine if you flew more times from Seattle to San Francisco during the last *n* days, or not.
Input Specification:
The first line of input contains single integer *n* (2<=β€<=*n*<=β€<=100)Β β the number of days.
The second line contains a string of length *n* consisting of only capital 'S' and 'F' letters. If the *i*-th letter is 'S', then you were in Seattle office on that day. Otherwise you were in San Francisco. The days are given in chronological order, i.e. today is the last day in this sequence.
Output Specification:
Print "YES" if you flew more times from Seattle to San Francisco, and "NO" otherwise.
You can print each letter in any case (upper or lower).
Demo Input:
['4\nFSSF\n', '2\nSF\n', '10\nFFFFFFFFFF\n', '10\nSSFFSFFSFF\n']
Demo Output:
['NO\n', 'YES\n', 'NO\n', 'YES\n']
Note:
In the first example you were initially at San Francisco, then flew to Seattle, were there for two days and returned to San Francisco. You made one flight in each direction, so the answer is "NO".
In the second example you just flew from Seattle to San Francisco, so the answer is "YES".
In the third example you stayed the whole period in San Francisco, so the answer is "NO".
In the fourth example if you replace 'S' with ones, and 'F' with zeros, you'll get the first few digits of Ο in binary representation. Not very useful information though.
|
```python
n=int(input())
f=list(input())
a=0
b=0
for i in range(n-1):
if(f[i]=="S" and f[i+1]=="F"):
a+=1
if(f[i]=="F" and f[i+1]=="S"):
b+=1
if(a>b):
print("YES")
else:
print("NO")
```
| 3
|
|
23
|
A
|
You're Given a String...
|
PROGRAMMING
| 1,200
|
[
"brute force",
"greedy"
] |
A. You're Given a String...
|
2
|
256
|
You're given a string of lower-case Latin letters. Your task is to find the length of its longest substring that can be met in the string at least twice. These occurrences can overlap (see sample test 2).
|
The first input line contains the string. It's guaranteed, that the string is non-empty, consists of lower-case Latin letters, and its length doesn't exceed 100.
|
Output one number β length of the longest substring that can be met in the string at least twice.
|
[
"abcd\n",
"ababa\n",
"zzz\n"
] |
[
"0",
"3",
"2"
] |
none
| 0
|
[
{
"input": "abcd",
"output": "0"
},
{
"input": "ababa",
"output": "3"
},
{
"input": "zzz",
"output": "2"
},
{
"input": "kmmm",
"output": "2"
},
{
"input": "wzznz",
"output": "1"
},
{
"input": "qlzazaaqll",
"output": "2"
},
{
"input": "lzggglgpep",
"output": "2"
},
{
"input": "iegdlraaidefgegiagrdfhihe",
"output": "2"
},
{
"input": "esxpqmdrtidgtkxojuxyrcwxlycywtzbjzpxvbngnlepgzcaeg",
"output": "1"
},
{
"input": "garvpaimjdjiivamusjdwfcaoswuhxyyxvrxzajoyihggvuxumaadycfphrzbprraicvjjlsdhojihaw",
"output": "2"
},
{
"input": "ckvfndqgkmhcyojaqgdkenmbexufryhqejdhctxujmtrwkpbqxufxamgoeigzfyzbhevpbkvviwntdhqscvkmphnkkljizndnbjt",
"output": "3"
},
{
"input": "bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbb",
"output": "99"
},
{
"input": "ikiikiikikiiikkkkkikkkkiiiiikkiiikkiikiikkkkikkkikikkikiiikkikikiiikikkkiiikkkikkikkikkkkiiikkiiiiii",
"output": "10"
},
{
"input": "ovovhoovvhohhhvhhvhhvhovoohovhhoooooovohvooooohvvoooohvvovhhvhovhhvoovhvhvoovovvhooovhhooovohvhhovhv",
"output": "8"
},
{
"input": "ccwckkkycccccckwckwkwkwkkkkyycykcccycyckwywcckwykcycykkkwcycwwcykcwkwkwwykwkwcykywwwyyykckkyycckwcwk",
"output": "5"
},
{
"input": "ttketfkefktfztezzkzfkkeetkkfktftzktezekkeezkeeetteeteefetefkzzzetekfftkeffzkktffzkzzeftfeezfefzffeef",
"output": "4"
},
{
"input": "rtharczpfznrgdnkltchafduydgbgkdjqrmjqyfmpwjwphrtsjbmswkanjlprbnduaqbcjqxlxmkspkhkcnzbqwxonzxxdmoigti",
"output": "2"
},
{
"input": "fplrkfklvwdeiynbjgaypekambmbjfnoknlhczhkdmljicookdywdgpnlnqlpunnkebnikgcgcjefeqhknvlynmvjcegvcdgvvdb",
"output": "2"
},
{
"input": "txbciieycswqpniwvzipwlottivvnfsysgzvzxwbctcchfpvlbcjikdofhpvsknptpjdbxemtmjcimetkemdbettqnbvzzbdyxxb",
"output": "2"
},
{
"input": "fmubmfwefikoxtqvmaavwjxmoqltapexkqxcsztpezfcltqavuicefxovuswmqimuikoppgqpiapqutkczgcvxzutavkujxvpklv",
"output": "3"
},
{
"input": "ipsrjylhpkjvlzncfixipstwcicxqygqcfrawpzzvckoveyqhathglblhpkjvlzncfixipfajaqobtzvthmhgbuawoxoknirclxg",
"output": "15"
},
{
"input": "kcnjsntjzcbgzjscrsrjkrbytqsrptzspzctjrorsyggrtkcnjsntjzcbgzjscrsrjyqbrtpcgqirsrrjbbbrnyqstnrozcoztt",
"output": "20"
},
{
"input": "unhcfnrhsqetuerjqcetrhlsqgfnqfntvkgxsscquolxxroqgtchffyccetrhlsqgfnqfntvkgxsscquolxxroqgtchffhfqvx",
"output": "37"
},
{
"input": "kkcckkccckkcckcccckcckkkkcckkkkckkkcckckkkkkckkkkkcckkccckkcckcccckcckkkkcckkkkckkkcckckkkkkckckckkc",
"output": "46"
},
{
"input": "mlhsyijxeydqxhtkmpdeqwzogjvxahmssyhfhqessbxzvydbrxdmlhsyijxeydqxhtkmpdeqwzogjvxahmssyhfhqessbxzvydik",
"output": "47"
},
{
"input": "abcdefghijklmnopqrstuvwxyz",
"output": "0"
},
{
"input": "tttttbttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttmttttttt",
"output": "85"
},
{
"input": "ffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffbfffffffffffffffffffffffffffffffffffff",
"output": "61"
},
{
"input": "cccccccccccccccccccccccwcccccccccccccccccccccuccccccccccccccnccccccccccccccccccccccccccccccccccccccc",
"output": "38"
},
{
"input": "ffffffffffffffffffffffffffufffgfffffffffffffffffffffffffffffffffffffffgffffffftffffffgffffffffffffff",
"output": "38"
},
{
"input": "rrrrrrrrrrrrrrrrrrrlhbrrrrrrrrurrrrrrrfrrqrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrrewrrrrrrryrrxrrrrrrrrrrr",
"output": "33"
},
{
"input": "vyvvvvvvvvzvvvvvzvvvwvvvvrvvvvvvvvvvvvvvvrvvvvvvvvvpkvvpvgvvvvvvvvvvvvvgvvvvvvvvvvvvvvvvvvysvvvbvvvv",
"output": "17"
},
{
"input": "cbubbbbbbbbbbfbbbbbbbbjbobbbbbbbbbbibbubbbbjbbbnzgbbzbbfbbbbbbbbbbbfbpbbbbbbbbbbygbbbgbabbbbbbbhibbb",
"output": "12"
},
{
"input": "lrqrrrrrrrjrrrrrcdrrgrrmwvrrrrrrrrrxfzrmrmrryrrrurrrdrrrrrrrrrrererrrsrrrrrrrrrrrqrrrrcrrwjsrrlrrrrr",
"output": "10"
},
{
"input": "ssssusisisosscssssztzessssyspskjssvosiissussszsosssslsssdsssvssvsssslsssmsfjasjsssssowscsjsssszsspss",
"output": "8"
},
{
"input": "uukuuuumueuuuujuukgdhbztuuuubbguuocuozfaunqufjujuguyuuvkuuauubuubuucuvtjuuuuuusduduuuuuuuueunuuuuuzu",
"output": "7"
},
{
"input": "jpkkgwklngwqcfzmwkkpcwkkkkkekkkekkkdsykqwjkkkhkkkxdnukkkkkkmkqykkkxqklkskkrkkkkkqqjikkkkkkpknkkkkkoh",
"output": "7"
},
{
"input": "bmzbbfbbhqxwthtbbisbbbbbtbbfbbpbfbbpbkbjfbcbbbbzbbbdwmbbbrnvqdbbtbbuglrnbbbbvmbyblebbabibrevaxbbjbqb",
"output": "6"
},
{
"input": "qqqmqqqsbteqqopsuqiqumrqzpqnqgqeniqqkyqqyqqqpxzqeqqquhdqquhqqqfqjirqaqqaquxqoqqjqqqqbjbgqcqqqqicnkqc",
"output": "4"
},
{
"input": "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaasaaaavaaaaaaauaaeaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "44"
},
{
"input": "a",
"output": "0"
},
{
"input": "fg",
"output": "0"
},
{
"input": "yy",
"output": "1"
},
{
"input": "abcabcabc",
"output": "6"
},
{
"input": "qwerqwedqwes",
"output": "3"
}
] | 1,681,384,209
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 45
| 154
| 2,150,400
|
strg = input().strip()
n = len(strg)
result = 0
for i in range(n):
for j in range(i + 1, n):
k = 0
while j + k < n and strg[i + k] == strg[j + k]:
k += 1
result = max(result, k)
print(result)
|
Title: You're Given a String...
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
You're given a string of lower-case Latin letters. Your task is to find the length of its longest substring that can be met in the string at least twice. These occurrences can overlap (see sample test 2).
Input Specification:
The first input line contains the string. It's guaranteed, that the string is non-empty, consists of lower-case Latin letters, and its length doesn't exceed 100.
Output Specification:
Output one number β length of the longest substring that can be met in the string at least twice.
Demo Input:
['abcd\n', 'ababa\n', 'zzz\n']
Demo Output:
['0', '3', '2']
Note:
none
|
```python
strg = input().strip()
n = len(strg)
result = 0
for i in range(n):
for j in range(i + 1, n):
k = 0
while j + k < n and strg[i + k] == strg[j + k]:
k += 1
result = max(result, k)
print(result)
```
| 3.957495
|
916
|
A
|
Jamie and Alarm Snooze
|
PROGRAMMING
| 900
|
[
"brute force",
"implementation",
"math"
] | null | null |
Jamie loves sleeping. One day, he decides that he needs to wake up at exactly *hh*:<=*mm*. However, he hates waking up, so he wants to make waking up less painful by setting the alarm at a lucky time. He will then press the snooze button every *x* minutes until *hh*:<=*mm* is reached, and only then he will wake up. He wants to know what is the smallest number of times he needs to press the snooze button.
A time is considered lucky if it contains a digit '7'. For example, 13:<=07 and 17:<=27 are lucky, while 00:<=48 and 21:<=34 are not lucky.
Note that it is not necessary that the time set for the alarm and the wake-up time are on the same day. It is guaranteed that there is a lucky time Jamie can set so that he can wake at *hh*:<=*mm*.
Formally, find the smallest possible non-negative integer *y* such that the time representation of the time *x*Β·*y* minutes before *hh*:<=*mm* contains the digit '7'.
Jamie uses 24-hours clock, so after 23:<=59 comes 00:<=00.
|
The first line contains a single integer *x* (1<=β€<=*x*<=β€<=60).
The second line contains two two-digit integers, *hh* and *mm* (00<=β€<=*hh*<=β€<=23,<=00<=β€<=*mm*<=β€<=59).
|
Print the minimum number of times he needs to press the button.
|
[
"3\n11 23\n",
"5\n01 07\n"
] |
[
"2\n",
"0\n"
] |
In the first sample, Jamie needs to wake up at 11:23. So, he can set his alarm at 11:17. He would press the snooze button when the alarm rings at 11:17 and at 11:20.
In the second sample, Jamie can set his alarm at exactly at 01:07 which is lucky.
| 500
|
[
{
"input": "3\n11 23",
"output": "2"
},
{
"input": "5\n01 07",
"output": "0"
},
{
"input": "34\n09 24",
"output": "3"
},
{
"input": "2\n14 37",
"output": "0"
},
{
"input": "14\n19 54",
"output": "9"
},
{
"input": "42\n15 44",
"output": "12"
},
{
"input": "46\n02 43",
"output": "1"
},
{
"input": "14\n06 41",
"output": "1"
},
{
"input": "26\n04 58",
"output": "26"
},
{
"input": "54\n16 47",
"output": "0"
},
{
"input": "38\n20 01",
"output": "3"
},
{
"input": "11\n02 05",
"output": "8"
},
{
"input": "55\n22 10",
"output": "5"
},
{
"input": "23\n10 08",
"output": "6"
},
{
"input": "23\n23 14",
"output": "9"
},
{
"input": "51\n03 27",
"output": "0"
},
{
"input": "35\n15 25",
"output": "13"
},
{
"input": "3\n12 15",
"output": "6"
},
{
"input": "47\n00 28",
"output": "3"
},
{
"input": "31\n13 34",
"output": "7"
},
{
"input": "59\n17 32",
"output": "0"
},
{
"input": "25\n11 03",
"output": "8"
},
{
"input": "9\n16 53",
"output": "4"
},
{
"input": "53\n04 06",
"output": "3"
},
{
"input": "37\n00 12",
"output": "5"
},
{
"input": "5\n13 10",
"output": "63"
},
{
"input": "50\n01 59",
"output": "10"
},
{
"input": "34\n06 13",
"output": "4"
},
{
"input": "2\n18 19",
"output": "1"
},
{
"input": "46\n06 16",
"output": "17"
},
{
"input": "14\n03 30",
"output": "41"
},
{
"input": "40\n13 37",
"output": "0"
},
{
"input": "24\n17 51",
"output": "0"
},
{
"input": "8\n14 57",
"output": "0"
},
{
"input": "52\n18 54",
"output": "2"
},
{
"input": "20\n15 52",
"output": "24"
},
{
"input": "20\n03 58",
"output": "30"
},
{
"input": "48\n07 11",
"output": "0"
},
{
"input": "32\n04 01",
"output": "2"
},
{
"input": "60\n08 15",
"output": "1"
},
{
"input": "44\n20 20",
"output": "4"
},
{
"input": "55\n15 35",
"output": "9"
},
{
"input": "55\n03 49",
"output": "11"
},
{
"input": "23\n16 39",
"output": "4"
},
{
"input": "7\n20 36",
"output": "7"
},
{
"input": "35\n16 42",
"output": "1"
},
{
"input": "35\n05 56",
"output": "21"
},
{
"input": "3\n17 45",
"output": "0"
},
{
"input": "47\n05 59",
"output": "6"
},
{
"input": "15\n10 13",
"output": "9"
},
{
"input": "59\n06 18",
"output": "9"
},
{
"input": "34\n17 18",
"output": "0"
},
{
"input": "18\n05 23",
"output": "2"
},
{
"input": "46\n17 21",
"output": "0"
},
{
"input": "30\n06 27",
"output": "0"
},
{
"input": "14\n18 40",
"output": "3"
},
{
"input": "58\n22 54",
"output": "6"
},
{
"input": "26\n19 44",
"output": "5"
},
{
"input": "10\n15 57",
"output": "0"
},
{
"input": "54\n20 47",
"output": "0"
},
{
"input": "22\n08 45",
"output": "3"
},
{
"input": "48\n18 08",
"output": "1"
},
{
"input": "32\n07 06",
"output": "0"
},
{
"input": "60\n19 19",
"output": "2"
},
{
"input": "45\n07 25",
"output": "0"
},
{
"input": "29\n12 39",
"output": "8"
},
{
"input": "13\n08 28",
"output": "3"
},
{
"input": "41\n21 42",
"output": "5"
},
{
"input": "41\n09 32",
"output": "3"
},
{
"input": "9\n21 45",
"output": "2"
},
{
"input": "37\n10 43",
"output": "5"
},
{
"input": "3\n20 50",
"output": "1"
},
{
"input": "47\n00 04",
"output": "1"
},
{
"input": "15\n13 10",
"output": "21"
},
{
"input": "15\n17 23",
"output": "0"
},
{
"input": "43\n22 13",
"output": "2"
},
{
"input": "27\n10 26",
"output": "6"
},
{
"input": "55\n22 24",
"output": "5"
},
{
"input": "55\n03 30",
"output": "11"
},
{
"input": "24\n23 27",
"output": "0"
},
{
"input": "52\n11 33",
"output": "3"
},
{
"input": "18\n22 48",
"output": "17"
},
{
"input": "1\n12 55",
"output": "8"
},
{
"input": "1\n04 27",
"output": "0"
},
{
"input": "1\n12 52",
"output": "5"
},
{
"input": "1\n20 16",
"output": "9"
},
{
"input": "1\n04 41",
"output": "4"
},
{
"input": "1\n20 21",
"output": "4"
},
{
"input": "1\n04 45",
"output": "8"
},
{
"input": "1\n12 18",
"output": "1"
},
{
"input": "1\n04 42",
"output": "5"
},
{
"input": "1\n02 59",
"output": "2"
},
{
"input": "1\n18 24",
"output": "7"
},
{
"input": "1\n02 04",
"output": "7"
},
{
"input": "1\n18 28",
"output": "1"
},
{
"input": "1\n18 01",
"output": "2"
},
{
"input": "1\n10 25",
"output": "8"
},
{
"input": "1\n02 49",
"output": "2"
},
{
"input": "1\n02 30",
"output": "3"
},
{
"input": "1\n18 54",
"output": "7"
},
{
"input": "1\n02 19",
"output": "2"
},
{
"input": "1\n05 25",
"output": "8"
},
{
"input": "60\n23 55",
"output": "6"
},
{
"input": "60\n08 19",
"output": "1"
},
{
"input": "60\n00 00",
"output": "7"
},
{
"input": "60\n08 24",
"output": "1"
},
{
"input": "60\n16 13",
"output": "9"
},
{
"input": "60\n08 21",
"output": "1"
},
{
"input": "60\n16 45",
"output": "9"
},
{
"input": "60\n08 26",
"output": "1"
},
{
"input": "60\n08 50",
"output": "1"
},
{
"input": "60\n05 21",
"output": "12"
},
{
"input": "60\n13 29",
"output": "6"
},
{
"input": "60\n05 18",
"output": "12"
},
{
"input": "60\n13 42",
"output": "6"
},
{
"input": "60\n05 07",
"output": "0"
},
{
"input": "60\n05 47",
"output": "0"
},
{
"input": "60\n21 55",
"output": "4"
},
{
"input": "60\n05 36",
"output": "12"
},
{
"input": "60\n21 08",
"output": "4"
},
{
"input": "60\n21 32",
"output": "4"
},
{
"input": "60\n16 31",
"output": "9"
},
{
"input": "5\n00 00",
"output": "73"
},
{
"input": "2\n06 58",
"output": "390"
},
{
"input": "60\n00 00",
"output": "7"
},
{
"input": "2\n00 00",
"output": "181"
},
{
"input": "10\n00 00",
"output": "37"
},
{
"input": "60\n01 00",
"output": "8"
},
{
"input": "12\n00 06",
"output": "31"
},
{
"input": "1\n00 01",
"output": "4"
},
{
"input": "5\n00 05",
"output": "74"
},
{
"input": "60\n01 01",
"output": "8"
},
{
"input": "11\n18 11",
"output": "2"
},
{
"input": "60\n01 15",
"output": "8"
},
{
"input": "10\n00 16",
"output": "38"
},
{
"input": "60\n00 59",
"output": "7"
},
{
"input": "30\n00 00",
"output": "13"
},
{
"input": "60\n01 05",
"output": "8"
},
{
"input": "4\n00 03",
"output": "4"
},
{
"input": "4\n00 00",
"output": "91"
},
{
"input": "60\n00 01",
"output": "7"
},
{
"input": "6\n00 03",
"output": "1"
},
{
"input": "13\n00 00",
"output": "1"
},
{
"input": "1\n18 01",
"output": "2"
},
{
"input": "5\n06 00",
"output": "145"
},
{
"input": "60\n04 08",
"output": "11"
},
{
"input": "5\n01 55",
"output": "96"
},
{
"input": "8\n00 08",
"output": "47"
},
{
"input": "23\n18 23",
"output": "2"
},
{
"input": "6\n00 06",
"output": "62"
},
{
"input": "59\n18 59",
"output": "2"
},
{
"input": "11\n00 10",
"output": "3"
},
{
"input": "10\n00 01",
"output": "37"
},
{
"input": "59\n00 00",
"output": "7"
},
{
"input": "10\n18 10",
"output": "2"
},
{
"input": "5\n00 01",
"output": "73"
},
{
"input": "1\n00 00",
"output": "3"
},
{
"input": "8\n00 14",
"output": "47"
},
{
"input": "60\n03 00",
"output": "10"
},
{
"input": "60\n00 10",
"output": "7"
},
{
"input": "5\n01 13",
"output": "87"
},
{
"input": "30\n02 43",
"output": "18"
},
{
"input": "17\n00 08",
"output": "3"
},
{
"input": "3\n00 00",
"output": "1"
},
{
"input": "60\n00 05",
"output": "7"
},
{
"input": "5\n18 05",
"output": "2"
},
{
"input": "30\n00 30",
"output": "14"
},
{
"input": "1\n00 06",
"output": "9"
},
{
"input": "55\n00 00",
"output": "7"
},
{
"input": "8\n02 08",
"output": "62"
},
{
"input": "7\n00 00",
"output": "9"
},
{
"input": "6\n08 06",
"output": "2"
},
{
"input": "48\n06 24",
"output": "16"
},
{
"input": "8\n06 58",
"output": "98"
},
{
"input": "3\n12 00",
"output": "1"
},
{
"input": "5\n01 06",
"output": "86"
},
{
"input": "2\n00 08",
"output": "185"
},
{
"input": "3\n18 03",
"output": "2"
},
{
"input": "1\n17 00",
"output": "0"
},
{
"input": "59\n00 48",
"output": "7"
},
{
"input": "5\n12 01",
"output": "49"
},
{
"input": "55\n01 25",
"output": "9"
},
{
"input": "2\n07 23",
"output": "0"
},
{
"input": "10\n01 10",
"output": "44"
},
{
"input": "2\n00 01",
"output": "2"
},
{
"input": "59\n00 01",
"output": "6"
},
{
"input": "5\n00 02",
"output": "1"
},
{
"input": "4\n01 02",
"output": "106"
},
{
"input": "5\n00 06",
"output": "74"
},
{
"input": "42\n00 08",
"output": "9"
},
{
"input": "60\n01 20",
"output": "8"
},
{
"input": "3\n06 00",
"output": "1"
},
{
"input": "4\n00 01",
"output": "1"
},
{
"input": "2\n00 06",
"output": "184"
},
{
"input": "1\n00 57",
"output": "0"
},
{
"input": "6\n00 00",
"output": "61"
},
{
"input": "5\n08 40",
"output": "9"
},
{
"input": "58\n00 55",
"output": "1"
},
{
"input": "2\n00 02",
"output": "182"
},
{
"input": "1\n08 01",
"output": "2"
},
{
"input": "10\n10 10",
"output": "14"
},
{
"input": "60\n01 11",
"output": "8"
},
{
"input": "2\n07 00",
"output": "0"
},
{
"input": "15\n00 03",
"output": "25"
},
{
"input": "6\n04 34",
"output": "106"
},
{
"input": "16\n00 16",
"output": "24"
},
{
"input": "2\n00 59",
"output": "1"
},
{
"input": "59\n00 08",
"output": "7"
},
{
"input": "10\n03 10",
"output": "56"
},
{
"input": "3\n08 03",
"output": "2"
},
{
"input": "20\n06 11",
"output": "37"
},
{
"input": "4\n01 00",
"output": "106"
},
{
"input": "38\n01 08",
"output": "12"
},
{
"input": "60\n00 06",
"output": "7"
},
{
"input": "5\n12 00",
"output": "49"
},
{
"input": "6\n01 42",
"output": "78"
},
{
"input": "4\n00 04",
"output": "92"
},
{
"input": "60\n04 05",
"output": "11"
},
{
"input": "1\n00 53",
"output": "6"
},
{
"input": "5\n08 05",
"output": "2"
},
{
"input": "60\n18 45",
"output": "1"
},
{
"input": "60\n06 23",
"output": "13"
},
{
"input": "6\n00 15",
"output": "3"
},
{
"input": "58\n00 06",
"output": "7"
},
{
"input": "2\n06 44",
"output": "383"
},
{
"input": "1\n08 00",
"output": "1"
},
{
"input": "10\n06 58",
"output": "78"
},
{
"input": "59\n00 58",
"output": "8"
},
{
"input": "1\n18 00",
"output": "1"
},
{
"input": "50\n00 42",
"output": "9"
},
{
"input": "30\n18 30",
"output": "2"
},
{
"input": "60\n21 59",
"output": "4"
},
{
"input": "2\n10 52",
"output": "87"
},
{
"input": "56\n00 00",
"output": "7"
},
{
"input": "16\n18 16",
"output": "2"
},
{
"input": "5\n01 05",
"output": "86"
},
{
"input": "5\n05 00",
"output": "133"
},
{
"input": "5\n23 59",
"output": "72"
},
{
"input": "7\n17 13",
"output": "0"
},
{
"input": "58\n00 00",
"output": "7"
},
{
"input": "15\n00 07",
"output": "0"
},
{
"input": "59\n08 00",
"output": "1"
},
{
"input": "46\n00 00",
"output": "8"
},
{
"input": "59\n01 05",
"output": "2"
},
{
"input": "2\n01 00",
"output": "211"
},
{
"input": "60\n00 24",
"output": "7"
},
{
"input": "10\n00 08",
"output": "37"
},
{
"input": "10\n00 06",
"output": "37"
},
{
"input": "60\n01 24",
"output": "8"
},
{
"input": "50\n00 10",
"output": "8"
},
{
"input": "2\n03 00",
"output": "271"
},
{
"input": "4\n19 04",
"output": "17"
},
{
"input": "25\n00 23",
"output": "16"
},
{
"input": "10\n01 01",
"output": "43"
}
] | 1,536,003,498
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 254
| 124
| 0
|
x=int(input())
hh,mm=map(str,input().split())
flag=0
count=0
while(flag==0):
if('7' in hh or '7' in mm):
flag=1
break
else:
mm=str(int(mm)-x)
if(int(mm)<0):
mm=str(60+int(mm))
hh=str(int(hh)-1)
if(int(hh)<0):
hh=str(23)
count+=1
print(count)
|
Title: Jamie and Alarm Snooze
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Jamie loves sleeping. One day, he decides that he needs to wake up at exactly *hh*:<=*mm*. However, he hates waking up, so he wants to make waking up less painful by setting the alarm at a lucky time. He will then press the snooze button every *x* minutes until *hh*:<=*mm* is reached, and only then he will wake up. He wants to know what is the smallest number of times he needs to press the snooze button.
A time is considered lucky if it contains a digit '7'. For example, 13:<=07 and 17:<=27 are lucky, while 00:<=48 and 21:<=34 are not lucky.
Note that it is not necessary that the time set for the alarm and the wake-up time are on the same day. It is guaranteed that there is a lucky time Jamie can set so that he can wake at *hh*:<=*mm*.
Formally, find the smallest possible non-negative integer *y* such that the time representation of the time *x*Β·*y* minutes before *hh*:<=*mm* contains the digit '7'.
Jamie uses 24-hours clock, so after 23:<=59 comes 00:<=00.
Input Specification:
The first line contains a single integer *x* (1<=β€<=*x*<=β€<=60).
The second line contains two two-digit integers, *hh* and *mm* (00<=β€<=*hh*<=β€<=23,<=00<=β€<=*mm*<=β€<=59).
Output Specification:
Print the minimum number of times he needs to press the button.
Demo Input:
['3\n11 23\n', '5\n01 07\n']
Demo Output:
['2\n', '0\n']
Note:
In the first sample, Jamie needs to wake up at 11:23. So, he can set his alarm at 11:17. He would press the snooze button when the alarm rings at 11:17 and at 11:20.
In the second sample, Jamie can set his alarm at exactly at 01:07 which is lucky.
|
```python
x=int(input())
hh,mm=map(str,input().split())
flag=0
count=0
while(flag==0):
if('7' in hh or '7' in mm):
flag=1
break
else:
mm=str(int(mm)-x)
if(int(mm)<0):
mm=str(60+int(mm))
hh=str(int(hh)-1)
if(int(hh)<0):
hh=str(23)
count+=1
print(count)
```
| 3
|
|
779
|
C
|
Dishonest Sellers
|
PROGRAMMING
| 1,200
|
[
"constructive algorithms",
"greedy",
"sortings"
] | null | null |
Igor found out discounts in a shop and decided to buy *n* items. Discounts at the store will last for a week and Igor knows about each item that its price now is *a**i*, and after a week of discounts its price will be *b**i*.
Not all of sellers are honest, so now some products could be more expensive than after a week of discounts.
Igor decided that buy at least *k* of items now, but wait with the rest of the week in order to save money as much as possible. Your task is to determine the minimum money that Igor can spend to buy all *n* items.
|
In the first line there are two positive integer numbers *n* and *k* (1<=β€<=*n*<=β€<=2Β·105, 0<=β€<=*k*<=β€<=*n*) β total number of items to buy and minimal number of items Igor wants to by right now.
The second line contains sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a**i*<=β€<=104) β prices of items during discounts (i.e. right now).
The third line contains sequence of integers *b*1,<=*b*2,<=...,<=*b**n* (1<=β€<=*b**i*<=β€<=104) β prices of items after discounts (i.e. after a week).
|
Print the minimal amount of money Igor will spend to buy all *n* items. Remember, he should buy at least *k* items right now.
|
[
"3 1\n5 4 6\n3 1 5\n",
"5 3\n3 4 7 10 3\n4 5 5 12 5\n"
] |
[
"10\n",
"25\n"
] |
In the first example Igor should buy item 3 paying 6. But items 1 and 2 he should buy after a week. He will pay 3 and 1 for them. So in total he will pay 6β+β3β+β1β=β10.
In the second example Igor should buy right now items 1, 2, 4 and 5, paying for them 3, 4, 10 and 3, respectively. Item 3 he should buy after a week of discounts, he will pay 5 for it. In total he will spend 3β+β4β+β10β+β3β+β5β=β25.
| 1,000
|
[
{
"input": "3 1\n5 4 6\n3 1 5",
"output": "10"
},
{
"input": "5 3\n3 4 7 10 3\n4 5 5 12 5",
"output": "25"
},
{
"input": "1 0\n9\n8",
"output": "8"
},
{
"input": "2 0\n4 10\n1 2",
"output": "3"
},
{
"input": "4 2\n19 5 17 13\n3 18 8 10",
"output": "29"
},
{
"input": "5 3\n28 17 20 45 45\n39 12 41 27 9",
"output": "101"
},
{
"input": "10 5\n87 96 19 81 10 88 7 49 36 21\n11 75 28 28 74 17 64 19 81 31",
"output": "243"
},
{
"input": "50 45\n80 125 152 122 85 62 123 195 157 73 8 127 47 193 70 132 131 38 98 97 185 98 68 166 114 53 144 106 141 106 191 123 44 199 35 18 84 169 46 52 129 102 155 130 63 169 116 145 154 41\n155 187 79 106 136 173 17 146 9 47 173 21 37 183 110 74 185 14 82 156 147 25 162 195 26 25 22 80 171 180 7 92 53 18 100 17 159 184 37 127 116 192 163 49 94 95 118 102 8 30",
"output": "4680"
},
{
"input": "5 2\n1 1 1 1 1\n2 2 2 2 2",
"output": "5"
},
{
"input": "5 2\n2 4 4 4 4\n3 1 1 1 1",
"output": "9"
},
{
"input": "6 3\n9 9 9 2 2 2\n6 6 6 1 1 1",
"output": "24"
},
{
"input": "5 3\n10 17 23 26 35\n7 18 18 29 32",
"output": "103"
},
{
"input": "2 1\n10 12\n5 6",
"output": "16"
}
] | 1,488,102,381
| 6,081
|
Python 3
|
OK
|
TESTS
| 67
| 1,013
| 30,003,200
|
n,m=map(int,input().split())
a=input().split()
b=input().split()
for i in range(n):
a[i]=int(a[i])
b[i]=int(b[i])
a[i]=[a[i]-b[i],a[i]]
a=sorted(a)
f=0
suum=0
for i in range(n):
if f<m or a[i][0]<0:
suum+=a[i][1]
else:
break
f+=1
for i in range(f,n):
suum+=a[i][1]-a[i][0]
print(suum)
|
Title: Dishonest Sellers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Igor found out discounts in a shop and decided to buy *n* items. Discounts at the store will last for a week and Igor knows about each item that its price now is *a**i*, and after a week of discounts its price will be *b**i*.
Not all of sellers are honest, so now some products could be more expensive than after a week of discounts.
Igor decided that buy at least *k* of items now, but wait with the rest of the week in order to save money as much as possible. Your task is to determine the minimum money that Igor can spend to buy all *n* items.
Input Specification:
In the first line there are two positive integer numbers *n* and *k* (1<=β€<=*n*<=β€<=2Β·105, 0<=β€<=*k*<=β€<=*n*) β total number of items to buy and minimal number of items Igor wants to by right now.
The second line contains sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a**i*<=β€<=104) β prices of items during discounts (i.e. right now).
The third line contains sequence of integers *b*1,<=*b*2,<=...,<=*b**n* (1<=β€<=*b**i*<=β€<=104) β prices of items after discounts (i.e. after a week).
Output Specification:
Print the minimal amount of money Igor will spend to buy all *n* items. Remember, he should buy at least *k* items right now.
Demo Input:
['3 1\n5 4 6\n3 1 5\n', '5 3\n3 4 7 10 3\n4 5 5 12 5\n']
Demo Output:
['10\n', '25\n']
Note:
In the first example Igor should buy item 3 paying 6. But items 1 and 2 he should buy after a week. He will pay 3 and 1 for them. So in total he will pay 6β+β3β+β1β=β10.
In the second example Igor should buy right now items 1, 2, 4 and 5, paying for them 3, 4, 10 and 3, respectively. Item 3 he should buy after a week of discounts, he will pay 5 for it. In total he will spend 3β+β4β+β10β+β3β+β5β=β25.
|
```python
n,m=map(int,input().split())
a=input().split()
b=input().split()
for i in range(n):
a[i]=int(a[i])
b[i]=int(b[i])
a[i]=[a[i]-b[i],a[i]]
a=sorted(a)
f=0
suum=0
for i in range(n):
if f<m or a[i][0]<0:
suum+=a[i][1]
else:
break
f+=1
for i in range(f,n):
suum+=a[i][1]-a[i][0]
print(suum)
```
| 3
|
|
474
|
A
|
Keyboard
|
PROGRAMMING
| 900
|
[
"implementation"
] | null | null |
Our good friend Mole is trying to code a big message. He is typing on an unusual keyboard with characters arranged in following way:
Unfortunately Mole is blind, so sometimes it is problem for him to put his hands accurately. He accidentally moved both his hands with one position to the left or to the right. That means that now he presses not a button he wants, but one neighboring button (left or right, as specified in input).
We have a sequence of characters he has typed and we want to find the original message.
|
First line of the input contains one letter describing direction of shifting ('L' or 'R' respectively for left or right).
Second line contains a sequence of characters written by Mole. The size of this sequence will be no more than 100. Sequence contains only symbols that appear on Mole's keyboard. It doesn't contain spaces as there is no space on Mole's keyboard.
It is guaranteed that even though Mole hands are moved, he is still pressing buttons on keyboard and not hitting outside it.
|
Print a line that contains the original message.
|
[
"R\ns;;upimrrfod;pbr\n"
] |
[
"allyouneedislove\n"
] |
none
| 500
|
[
{
"input": "R\ns;;upimrrfod;pbr",
"output": "allyouneedislove"
},
{
"input": "R\nwertyuiop;lkjhgfdsxcvbnm,.",
"output": "qwertyuiolkjhgfdsazxcvbnm,"
},
{
"input": "L\nzxcvbnm,kjhgfdsaqwertyuio",
"output": "xcvbnm,.lkjhgfdswertyuiop"
},
{
"input": "R\nbubbuduppudup",
"output": "vyvvysyooysyo"
},
{
"input": "L\ngggggggggggggggggggggggggggggggggggggggggg",
"output": "hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh"
},
{
"input": "R\ngggggggggggggggggggggggggggggggggggggggggg",
"output": "ffffffffffffffffffffffffffffffffffffffffff"
},
{
"input": "L\nggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggg",
"output": "hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh"
},
{
"input": "R\nggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggg",
"output": "fffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff"
},
{
"input": "L\nxgwurenkxkiau,c,vonei.zltazmnkhqtwuogkgvgckvja,z.rhanuy.ybebmzcfwozkwvuuiolaqlgvvvewnbuinrncgjwjdsfw",
"output": "cheitrmlclosi.v.bpmro/x;ysx,mljwyeiphlhbhvlbks.x/tjsmiu/unrn,xvgepxlebiiop;sw;hbbbremniomtmvhkekfdge"
},
{
"input": "L\nuoz.vmks,wxrb,nwcvdzh.m,hwsios.lvu,ktes,,ythddhm.sh,d,c,cfj.wqam,bowofbyx,jathqayhreqvixvbmgdokofmym",
"output": "ipx/b,ld.ectn.mevbfxj/,.jedopd/;bi.lyrd..uyjffj,/dj.f.v.vgk/ews,.npepgnuc.ksyjwsujtrwbocbn,hfplpg,u,"
},
{
"input": "R\noedjyrvuw/rn.v.hdwndbiposiewgsn.pnyf;/tsdohp,hrtd/mx,;coj./billd..mwbneohcikrdes/ucjr,wspthleyp,..f,",
"output": "iwshtecyq.eb,c,gsqbsvuoiauwqfab,obtdl.rasigomgers.nzmlxih,.vukks,,nqvbwigxujeswa.yxhemqaorgkwtom,,dm"
},
{
"input": "R\nvgj;o;ijrtfyck,dthccioltcx,crub;oceooognsuvfx/kgo.fbsudv,yod.erdrxhbeiyltxhnrobbb;ydrgroefcr/f;uvdjd",
"output": "cfhliluherdtxjmsrgxxuikrxzmxeyvlixwiiifbaycdz.jfi,dvayscmtis,wesezgvwutkrzgbeivvvltsefeiwdxe.dlycshs"
},
{
"input": "L\nqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq",
"output": "wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww"
},
{
"input": "L\noooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo",
"output": "pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp"
},
{
"input": "L\n,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,",
"output": "...................................................................................................."
},
{
"input": "L\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz",
"output": "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx"
},
{
"input": "R\noooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo",
"output": "iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii"
},
{
"input": "R\nwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww",
"output": "qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq"
},
{
"input": "R\nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx",
"output": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz"
},
{
"input": "L\nq",
"output": "w"
},
{
"input": "L\no",
"output": "p"
},
{
"input": "L\n,",
"output": "."
},
{
"input": "L\nz",
"output": "x"
},
{
"input": "R\n.",
"output": ","
},
{
"input": "R\no",
"output": "i"
},
{
"input": "R\nw",
"output": "q"
},
{
"input": "R\nx",
"output": "z"
},
{
"input": "R\n,./",
"output": "m,."
},
{
"input": "R\nwertuk;;/",
"output": "qweryjll."
},
{
"input": "L\n..",
"output": "//"
}
] | 1,686,069,589
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 31
| 46
| 0
|
def org_msg(msg, add=1):
for char in msg:
print(keys[keys.index(char) - add], end='')
keys = 'qwertyuiopasdfghjkl;zxcvbnm,./'
pos = input()
msg = input()
if pos == 'R':
org_msg(msg)
else:
org_msg(msg, -1)
|
Title: Keyboard
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Our good friend Mole is trying to code a big message. He is typing on an unusual keyboard with characters arranged in following way:
Unfortunately Mole is blind, so sometimes it is problem for him to put his hands accurately. He accidentally moved both his hands with one position to the left or to the right. That means that now he presses not a button he wants, but one neighboring button (left or right, as specified in input).
We have a sequence of characters he has typed and we want to find the original message.
Input Specification:
First line of the input contains one letter describing direction of shifting ('L' or 'R' respectively for left or right).
Second line contains a sequence of characters written by Mole. The size of this sequence will be no more than 100. Sequence contains only symbols that appear on Mole's keyboard. It doesn't contain spaces as there is no space on Mole's keyboard.
It is guaranteed that even though Mole hands are moved, he is still pressing buttons on keyboard and not hitting outside it.
Output Specification:
Print a line that contains the original message.
Demo Input:
['R\ns;;upimrrfod;pbr\n']
Demo Output:
['allyouneedislove\n']
Note:
none
|
```python
def org_msg(msg, add=1):
for char in msg:
print(keys[keys.index(char) - add], end='')
keys = 'qwertyuiopasdfghjkl;zxcvbnm,./'
pos = input()
msg = input()
if pos == 'R':
org_msg(msg)
else:
org_msg(msg, -1)
```
| 3
|
|
78
|
A
|
Haiku
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Haiku
|
2
|
256
|
Haiku is a genre of Japanese traditional poetry.
A haiku poem consists of 17 syllables split into three phrases, containing 5, 7 and 5 syllables correspondingly (the first phrase should contain exactly 5 syllables, the second phrase should contain exactly 7 syllables, and the third phrase should contain exactly 5 syllables). A haiku masterpiece contains a description of a moment in those three phrases. Every word is important in a small poem, which is why haiku are rich with symbols. Each word has a special meaning, a special role. The main principle of haiku is to say much using a few words.
To simplify the matter, in the given problem we will consider that the number of syllable in the phrase is equal to the number of vowel letters there. Only the following letters are regarded as vowel letters: "a", "e", "i", "o" and "u".
Three phases from a certain poem are given. Determine whether it is haiku or not.
|
The input data consists of three lines. The length of each line is between 1 and 100, inclusive. The *i*-th line contains the *i*-th phrase of the poem. Each phrase consists of one or more words, which are separated by one or more spaces. A word is a non-empty sequence of lowercase Latin letters. Leading and/or trailing spaces in phrases are allowed. Every phrase has at least one non-space character. See the example for clarification.
|
Print "YES" (without the quotes) if the poem is a haiku. Otherwise, print "NO" (also without the quotes).
|
[
"on codeforces \nbeta round is running\n a rustling of keys \n",
"how many gallons\nof edo s rain did you drink\n cuckoo\n"
] |
[
"YES",
"NO"
] |
none
| 500
|
[
{
"input": "on codeforces \nbeta round is running\n a rustling of keys ",
"output": "YES"
},
{
"input": "how many gallons\nof edo s rain did you drink\n cuckoo",
"output": "NO"
},
{
"input": " hatsu shigure\n saru mo komino wo\nhoshige nari",
"output": "YES"
},
{
"input": "o vetus stagnum\n rana de ripa salit\n ac sonant aquae",
"output": "NO"
},
{
"input": " furuike ya\nkawazu tobikomu\nmizu no oto ",
"output": "YES"
},
{
"input": " noch da leich\na stamperl zum aufwaerma\n da pfarrer kimmt a ",
"output": "NO"
},
{
"input": " sommerfuglene \n hvorfor bruge mange ord\n et kan gore det",
"output": "YES"
},
{
"input": " ab der mittagszeit\n ist es etwas schattiger\n ein wolkenhimmel",
"output": "NO"
},
{
"input": "tornando a vederli\ni fiori di ciliegio la sera\nson divenuti frutti",
"output": "NO"
},
{
"input": "kutaburete\nyado karu koro ya\nfuji no hana",
"output": "YES"
},
{
"input": " beginnings of poetry\n the rice planting songs \n of the interior",
"output": "NO"
},
{
"input": " door zomerregens\n zijn de kraanvogelpoten\n korter geworden",
"output": "NO"
},
{
"input": " derevo na srub\na ptitsi bezzabotno\n gnezdishko tam vyut",
"output": "YES"
},
{
"input": "writing in the dark\nunaware that my pen\nhas run out of ink",
"output": "NO"
},
{
"input": "kusaaiu\nuieueua\nuo efaa",
"output": "YES"
},
{
"input": "v\nh\np",
"output": "NO"
},
{
"input": "i\ni\nu",
"output": "NO"
},
{
"input": "awmio eoj\nabdoolceegood\nwaadeuoy",
"output": "YES"
},
{
"input": "xzpnhhnqsjpxdboqojixmofawhdjcfbscq\nfoparnxnbzbveycoltwdrfbwwsuobyoz hfbrszy\nimtqryscsahrxpic agfjh wvpmczjjdrnwj mcggxcdo",
"output": "YES"
},
{
"input": "wxjcvccp cppwsjpzbd dhizbcnnllckybrnfyamhgkvkjtxxfzzzuyczmhedhztugpbgpvgh\nmdewztdoycbpxtp bsiw hknggnggykdkrlihvsaykzfiiw\ndewdztnngpsnn lfwfbvnwwmxoojknygqb hfe ibsrxsxr",
"output": "YES"
},
{
"input": "nbmtgyyfuxdvrhuhuhpcfywzrbclp znvxw synxmzymyxcntmhrjriqgdjh xkjckydbzjbvtjurnf\nhhnhxdknvamywhsrkprofnyzlcgtdyzzjdsfxyddvilnzjziz qmwfdvzckgcbrrxplxnxf mpxwxyrpesnewjrx ajxlfj\nvcczq hddzd cvefmhxwxxyqcwkr fdsndckmesqeq zyjbwbnbyhybd cta nsxzidl jpcvtzkldwd",
"output": "YES"
},
{
"input": "rvwdsgdsrutgjwscxz pkd qtpmfbqsmctuevxdj kjzknzghdvxzlaljcntg jxhvzn yciktbsbyscfypx x xhkxnfpdp\nwdfhvqgxbcts mnrwbr iqttsvigwdgvlxwhsmnyxnttedonxcfrtmdjjmacvqtkbmsnwwvvrlxwvtggeowtgsqld qj\nvsxcdhbzktrxbywpdvstr meykarwtkbm pkkbhvwvelclfmpngzxdmblhcvf qmabmweldplmczgbqgzbqnhvcdpnpjtch ",
"output": "YES"
},
{
"input": "brydyfsmtzzkpdsqvvztmprhqzbzqvgsblnz naait tdtiprjsttwusdykndwcccxfmzmrmfmzjywkpgbfnjpypgcbcfpsyfj k\nucwdfkfyxxxht lxvnovqnnsqutjsyagrplb jhvtwdptrwcqrovncdvqljjlrpxcfbxqgsfylbgmcjpvpl ccbcybmigpmjrxpu\nfgwtpcjeywgnxgbttgx htntpbk tkkpwbgxwtbxvcpkqbzetjdkcwad tftnjdxxjdvbpfibvxuglvx llyhgjvggtw jtjyphs",
"output": "YES"
},
{
"input": "nyc aqgqzjjlj mswgmjfcxlqdscheskchlzljlsbhyn iobxymwzykrsnljj\nnnebeaoiraga\nqpjximoqzswhyyszhzzrhfwhf iyxysdtcpmikkwpugwlxlhqfkn",
"output": "NO"
},
{
"input": "lzrkztgfe mlcnq ay ydmdzxh cdgcghxnkdgmgfzgahdjjmqkpdbskreswpnblnrc fmkwziiqrbskp\np oukeaz gvvy kghtrjlczyl qeqhgfgfej\nwfolhkmktvsjnrpzfxcxzqmfidtlzmuhxac wsncjgmkckrywvxmnjdpjpfydhk qlmdwphcvyngansqhl",
"output": "NO"
},
{
"input": "yxcboqmpwoevrdhvpxfzqmammak\njmhphkxppkqkszhqqtkvflarsxzla pbxlnnnafqbsnmznfj qmhoktgzix qpmrgzxqvmjxhskkksrtryehfnmrt dtzcvnvwp\nscwymuecjxhw rdgsffqywwhjpjbfcvcrnisfqllnbplpadfklayjguyvtrzhwblftclfmsr",
"output": "NO"
},
{
"input": "qfdwsr jsbrpfmn znplcx nhlselflytndzmgxqpgwhpi ghvbbxrkjdirfghcybhkkqdzmyacvrrcgsneyjlgzfvdmxyjmph\nylxlyrzs drbktzsniwcbahjkgohcghoaczsmtzhuwdryjwdijmxkmbmxv yyfrokdnsx\nyw xtwyzqlfxwxghugoyscqlx pljtz aldfskvxlsxqgbihzndhxkswkxqpwnfcxzfyvncstfpqf",
"output": "NO"
},
{
"input": "g rguhqhcrzmuqthtmwzhfyhpmqzzosa\nmhjimzvchkhejh irvzejhtjgaujkqfxhpdqjnxr dvqallgssktqvsxi\npcwbliftjcvuzrsqiswohi",
"output": "NO"
},
{
"input": " ngxtlq iehiise vgffqcpnmsoqzyseuqqtggokymol zn\nvjdjljazeujwoubkcvtsbepooxqzrueaauokhepiquuopfild\ngoabauauaeotoieufueeknudiilupouaiaexcoapapu",
"output": "NO"
},
{
"input": "ycnvnnqk mhrmhctpkfbc qbyvtjznmndqjzgbcxmvrpkfcll zwspfptmbxgrdv dsgkk nfytsqjrnfbhh pzdldzymvkdxxwh\nvnhjfwgdnyjptsmblyxmpzylsbjlmtkkwjcbqwjctqvrlqqkdsrktxlnslspvnn mdgsmzblhbnvpczmqkcffwhwljqkzmk hxcm\nrghnjvzcpprrgmtgytpkzyc mrdnnhpkwypwqbtzjyfwvrdwyjltbzxtbstzs xdjzdmx yjsqtzlrnvyssvglsdjrmsrfrcdpqt",
"output": "NO"
},
{
"input": "ioeeaioeiuoeaeieuuieooaouiuouiioaueeaiaiuoaoiioeeaauooiuuieeuaeeoauieeaiuoieiaieuoauaaoioooieueueuai\nuooaoeeaoiuuoeioaoouaououoeioiaeueoioaiouaeaoioiuuaueeuaiuoiueoiuaoeeieeouaeeaeeieioeoiiieuuueuuieuo\naeeouieeieoueaioeoioooiouaeeeiaaioueauaueiouuuaieuuioiaeiueauueaoieauauoeueuaiueuuaueeoueauaeaoieeoo",
"output": "NO"
},
{
"input": "mkgycgmrqtmlwj vddlbsgdptyfrcj nmrddjchydvbsyhgzytfzvwbhqmmhkpsyrcnknpsqrr wcnf wfvgskrnsmnrcqgcnc q\npn cclcyjjdp rqkpgyrvyyd hhynrochfa pthyffqvskazfshvzcmvhmsrxvquzkdvivlbfypwbgltfbjmhzljvgzmxjlrjdjq\nauuouieuaaauoooeoiuoaueuueauiuuuiaeuwuoiaeoeaieauieouoaeiiieiioiuuuiuauioiiuoeauueieaueiaioeuaoaaau",
"output": "NO"
},
{
"input": "ab\na\na",
"output": "NO"
},
{
"input": "on codeforcs\nbeta round is runnineg\na rustling of keys",
"output": "NO"
},
{
"input": "coooooooooooooooood\nd\nd",
"output": "NO"
},
{
"input": "on codeforces \nbeta round is runninog\n a rustling of keys",
"output": "NO"
},
{
"input": "aaaaaaaaaaaaaaa\na\na",
"output": "NO"
},
{
"input": "aaaaaccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc\naaaaaaaccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc\naaaaaccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc",
"output": "YES"
},
{
"input": "cccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc\ncccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc\ncccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccccc",
"output": "NO"
},
{
"input": "aaaaaa\naaaaaa\naaaaa",
"output": "NO"
}
] | 1,652,439,457
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 92
| 0
|
s1 = input()
s2 = input()
s3 = input()
sum = s1.count('a') + s1.count('e') + s1.count('i') + s1.count('o') + s1.count('u')
sum2 = s2.count('a') + s2.count('e') + s2.count('i') + s2.count('o') + s2.count('u')
sum3 = s3.count('a') + s3.count('e') + s3.count('i') + s3.count('o') + s3.count('u')
if sum == 5 and sum2 == 7 and sum3 == 5:
print("YES")
else:
print("NO")
|
Title: Haiku
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Haiku is a genre of Japanese traditional poetry.
A haiku poem consists of 17 syllables split into three phrases, containing 5, 7 and 5 syllables correspondingly (the first phrase should contain exactly 5 syllables, the second phrase should contain exactly 7 syllables, and the third phrase should contain exactly 5 syllables). A haiku masterpiece contains a description of a moment in those three phrases. Every word is important in a small poem, which is why haiku are rich with symbols. Each word has a special meaning, a special role. The main principle of haiku is to say much using a few words.
To simplify the matter, in the given problem we will consider that the number of syllable in the phrase is equal to the number of vowel letters there. Only the following letters are regarded as vowel letters: "a", "e", "i", "o" and "u".
Three phases from a certain poem are given. Determine whether it is haiku or not.
Input Specification:
The input data consists of three lines. The length of each line is between 1 and 100, inclusive. The *i*-th line contains the *i*-th phrase of the poem. Each phrase consists of one or more words, which are separated by one or more spaces. A word is a non-empty sequence of lowercase Latin letters. Leading and/or trailing spaces in phrases are allowed. Every phrase has at least one non-space character. See the example for clarification.
Output Specification:
Print "YES" (without the quotes) if the poem is a haiku. Otherwise, print "NO" (also without the quotes).
Demo Input:
['on codeforces \nbeta round is running\n a rustling of keys \n', 'how many gallons\nof edo s rain did you drink\n cuckoo\n']
Demo Output:
['YES', 'NO']
Note:
none
|
```python
s1 = input()
s2 = input()
s3 = input()
sum = s1.count('a') + s1.count('e') + s1.count('i') + s1.count('o') + s1.count('u')
sum2 = s2.count('a') + s2.count('e') + s2.count('i') + s2.count('o') + s2.count('u')
sum3 = s3.count('a') + s3.count('e') + s3.count('i') + s3.count('o') + s3.count('u')
if sum == 5 and sum2 == 7 and sum3 == 5:
print("YES")
else:
print("NO")
```
| 3.977
|
740
|
B
|
Alyona and flowers
|
PROGRAMMING
| 1,200
|
[
"constructive algorithms"
] | null | null |
Little Alyona is celebrating Happy Birthday! Her mother has an array of *n* flowers. Each flower has some mood, the mood of *i*-th flower is *a**i*. The mood can be positive, zero or negative.
Let's define a subarray as a segment of consecutive flowers. The mother suggested some set of subarrays. Alyona wants to choose several of the subarrays suggested by her mother. After that, each of the flowers will add to the girl's happiness its mood multiplied by the number of chosen subarrays the flower is in.
For example, consider the case when the mother has 5 flowers, and their moods are equal to 1,<=<=-<=2,<=1,<=3,<=<=-<=4. Suppose the mother suggested subarrays (1,<=<=-<=2), (3,<=<=-<=4), (1,<=3), (1,<=<=-<=2,<=1,<=3). Then if the girl chooses the third and the fourth subarrays then:
- the first flower adds 1Β·1<==<=1 to the girl's happiness, because he is in one of chosen subarrays, - the second flower adds (<=-<=2)Β·1<==<=<=-<=2, because he is in one of chosen subarrays, - the third flower adds 1Β·2<==<=2, because he is in two of chosen subarrays, - the fourth flower adds 3Β·2<==<=6, because he is in two of chosen subarrays, - the fifth flower adds (<=-<=4)Β·0<==<=0, because he is in no chosen subarrays.
Thus, in total 1<=+<=(<=-<=2)<=+<=2<=+<=6<=+<=0<==<=7 is added to the girl's happiness. Alyona wants to choose such subarrays from those suggested by the mother that the value added to her happiness would be as large as possible. Help her do this!
Alyona can choose any number of the subarrays, even 0 or all suggested by her mother.
|
The first line contains two integers *n* and *m* (1<=β€<=*n*,<=*m*<=β€<=100)Β β the number of flowers and the number of subarrays suggested by the mother.
The second line contains the flowers moodsΒ β *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=100<=β€<=*a**i*<=β€<=100).
The next *m* lines contain the description of the subarrays suggested by the mother. The *i*-th of these lines contain two integers *l**i* and *r**i* (1<=β€<=*l**i*<=β€<=*r**i*<=β€<=*n*) denoting the subarray *a*[*l**i*],<=*a*[*l**i*<=+<=1],<=...,<=*a*[*r**i*].
Each subarray can encounter more than once.
|
Print single integerΒ β the maximum possible value added to the Alyona's happiness.
|
[
"5 4\n1 -2 1 3 -4\n1 2\n4 5\n3 4\n1 4\n",
"4 3\n1 2 3 4\n1 3\n2 4\n1 1\n",
"2 2\n-1 -2\n1 1\n1 2\n"
] |
[
"7\n",
"16\n",
"0\n"
] |
The first example is the situation described in the statements.
In the second example Alyona should choose all subarrays.
The third example has answer 0 because Alyona can choose none of the subarrays.
| 1,000
|
[
{
"input": "5 4\n1 -2 1 3 -4\n1 2\n4 5\n3 4\n1 4",
"output": "7"
},
{
"input": "4 3\n1 2 3 4\n1 3\n2 4\n1 1",
"output": "16"
},
{
"input": "2 2\n-1 -2\n1 1\n1 2",
"output": "0"
},
{
"input": "5 6\n1 1 1 -1 0\n2 4\n1 3\n4 5\n1 5\n1 4\n4 5",
"output": "8"
},
{
"input": "8 3\n5 -4 -2 5 3 -4 -2 6\n3 8\n4 6\n2 3",
"output": "10"
},
{
"input": "10 10\n0 0 0 0 0 0 0 0 0 0\n5 9\n1 9\n5 7\n3 8\n1 6\n1 9\n1 6\n6 9\n1 10\n3 8",
"output": "0"
},
{
"input": "3 6\n0 0 0\n1 1\n1 1\n1 3\n3 3\n2 3\n1 2",
"output": "0"
},
{
"input": "3 3\n1 -1 3\n1 2\n2 3\n1 3",
"output": "5"
},
{
"input": "6 8\n0 6 -5 8 -3 -2\n6 6\n2 3\n5 6\n4 6\n3 4\n2 5\n3 3\n5 6",
"output": "13"
},
{
"input": "10 4\n6 5 5 -1 0 5 0 -3 5 -4\n3 6\n4 9\n1 6\n1 4",
"output": "50"
},
{
"input": "9 1\n-1 -1 -1 -1 2 -1 2 0 0\n2 5",
"output": "0"
},
{
"input": "3 8\n3 4 4\n1 2\n1 3\n2 3\n1 2\n2 2\n1 1\n2 3\n1 3",
"output": "59"
},
{
"input": "3 8\n6 7 -1\n1 1\n1 3\n2 2\n1 3\n1 3\n1 1\n2 3\n2 3",
"output": "67"
},
{
"input": "53 7\n-43 57 92 97 85 -29 28 -8 -37 -47 51 -53 -95 -50 -39 -87 43 36 60 -95 93 8 67 -22 -78 -46 99 93 27 -72 -84 77 96 -47 1 -12 21 -98 -34 -88 57 -43 5 -15 20 -66 61 -29 30 -85 52 53 82\n15 26\n34 43\n37 41\n22 34\n19 43\n2 15\n13 35",
"output": "170"
},
{
"input": "20 42\n61 86 5 -87 -33 51 -79 17 -3 65 -42 74 -94 40 -35 22 58 81 -75 5\n3 6\n12 13\n3 16\n3 16\n5 7\n5 16\n2 15\n6 18\n4 18\n10 17\n14 16\n4 15\n4 11\n13 20\n5 6\n5 15\n16 17\n3 14\n9 10\n5 19\n5 14\n2 4\n17 20\n10 11\n5 18\n10 11\n1 14\n1 6\n1 10\n8 16\n11 14\n12 20\n11 13\n4 5\n2 13\n1 5\n11 15\n1 18\n3 8\n8 20\n1 4\n10 13",
"output": "1502"
},
{
"input": "64 19\n-47 13 19 51 -25 72 38 32 54 7 -49 -50 -59 73 45 -87 -15 -72 -32 -10 -7 47 -34 35 48 -73 79 25 -80 -34 4 77 60 30 61 -25 23 17 -73 -73 69 29 -50 -55 53 15 -33 7 -46 -5 85 -86 77 -51 87 -69 -64 -24 -64 29 -20 -58 11 -26\n6 53\n13 28\n15 47\n20 52\n12 22\n6 49\n31 54\n2 39\n32 49\n27 64\n22 63\n33 48\n49 58\n39 47\n6 29\n21 44\n24 59\n20 24\n39 54",
"output": "804"
},
{
"input": "1 10\n-46\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1\n1 1",
"output": "0"
},
{
"input": "10 7\n44 18 9 -22 -23 7 -25 -2 15 35\n6 8\n6 7\n3 3\n2 6\n9 10\n2 2\n1 5",
"output": "103"
},
{
"input": "4 3\n10 -2 68 35\n4 4\n1 1\n1 3",
"output": "121"
},
{
"input": "3 6\n27 -31 -81\n2 3\n2 3\n1 1\n1 2\n1 2\n2 2",
"output": "27"
},
{
"input": "7 3\n-24 -12 16 -43 -30 31 16\n3 6\n3 4\n1 7",
"output": "0"
},
{
"input": "10 7\n-33 -24 -86 -20 5 -91 38 -12 -90 -67\n7 8\n7 10\n4 7\n1 3\n6 10\n6 6\n3 5",
"output": "26"
},
{
"input": "4 4\n95 35 96 -27\n3 4\n3 3\n4 4\n3 3",
"output": "261"
},
{
"input": "7 7\n-33 26 -25 44 -20 -50 33\n4 6\n4 4\n3 7\n5 7\n1 4\n2 5\n4 6",
"output": "81"
},
{
"input": "5 3\n-35 -39 93 59 -4\n2 2\n2 3\n2 5",
"output": "163"
},
{
"input": "3 7\n0 0 0\n1 2\n1 2\n2 3\n3 3\n1 3\n1 2\n2 3",
"output": "0"
},
{
"input": "8 2\n17 32 30 -6 -39 -15 33 74\n6 6\n8 8",
"output": "74"
},
{
"input": "8 1\n-20 -15 21 -21 1 -12 -7 9\n4 7",
"output": "0"
},
{
"input": "7 9\n-23 -4 -44 -47 -35 47 25\n1 6\n3 5\n4 7\n6 7\n2 4\n2 3\n2 7\n1 2\n5 5",
"output": "72"
},
{
"input": "8 8\n0 6 -25 -15 29 -24 31 23\n2 8\n5 5\n3 3\n2 8\n6 6\n3 6\n3 4\n2 4",
"output": "79"
},
{
"input": "4 3\n-39 -63 9 -16\n1 4\n1 3\n2 4",
"output": "0"
},
{
"input": "9 1\n-3 -13 -13 -19 -4 -11 8 -11 -3\n9 9",
"output": "0"
},
{
"input": "9 6\n25 18 -62 0 33 62 -23 4 -15\n7 9\n2 3\n1 4\n2 6\n1 6\n2 3",
"output": "127"
},
{
"input": "4 5\n-12 39 8 -12\n1 4\n3 4\n1 3\n1 3\n2 3",
"output": "140"
},
{
"input": "3 9\n-9 7 3\n1 2\n1 1\n1 3\n1 2\n2 3\n1 3\n2 2\n1 2\n3 3",
"output": "22"
},
{
"input": "10 7\n0 4 3 3 -2 -2 -4 -2 -3 -2\n5 6\n1 10\n2 10\n7 10\n1 1\n6 7\n3 4",
"output": "6"
},
{
"input": "86 30\n16 -12 11 16 8 14 7 -29 18 30 -32 -10 20 29 -14 -21 23 -19 -15 17 -2 25 -22 2 26 15 -7 -12 -4 -28 21 -4 -2 22 28 -32 9 -20 23 38 -21 21 37 -13 -30 25 31 6 18 29 29 29 27 38 -15 -32 32 -7 -8 -33 -11 24 23 -19 -36 -36 -18 9 -1 32 -34 -26 1 -1 -16 -14 17 -17 15 -24 38 5 -27 -12 8 -38\n60 66\n29 48\n32 51\n38 77\n17 79\n23 74\n39 50\n14 29\n26 76\n9 76\n2 67\n23 48\n17 68\n33 75\n59 78\n46 78\n9 69\n16 83\n18 21\n17 34\n24 61\n15 79\n4 31\n62 63\n46 76\n79 82\n25 39\n5 81\n19 77\n26 71",
"output": "3076"
},
{
"input": "33 17\n11 6 -19 14 23 -23 21 15 29 19 13 -18 -19 20 16 -10 26 -22 3 17 13 -10 19 22 -5 21 12 6 28 -13 -27 25 6\n4 17\n12 16\n9 17\n25 30\n31 32\n4 28\n11 24\n16 19\n3 27\n7 17\n1 16\n15 28\n30 33\n9 31\n14 30\n13 23\n27 27",
"output": "1366"
},
{
"input": "16 44\n32 23 -27 -2 -10 -42 32 -14 -13 4 9 -2 19 35 16 22\n6 12\n8 11\n13 15\n12 12\n3 10\n9 13\n7 15\n2 11\n1 13\n5 6\n9 14\n3 16\n10 13\n3 15\n6 10\n14 16\n4 5\n7 10\n5 14\n1 16\n2 5\n1 6\n9 10\n4 7\n4 12\n2 5\n7 10\n7 9\n2 8\n9 10\n4 10\n7 12\n10 11\n6 6\n15 15\n8 12\n9 10\n3 3\n4 15\n10 12\n7 16\n4 14\n14 16\n5 6",
"output": "777"
},
{
"input": "63 24\n-23 -46 0 33 24 13 39 -6 -4 49 19 -18 -11 -38 0 -3 -33 -17 -4 -44 -22 -12 -16 42 16 -10 7 37 -6 16 -41 -18 -20 51 -49 28 -14 -22 -37 -7 -50 31 -41 -47 18 -8 -39 -29 35 -32 14 -29 44 -29 -19 -25 -47 -8 16 11 20 12 38\n21 61\n35 61\n29 61\n21 34\n12 48\n32 33\n9 27\n4 42\n4 60\n37 61\n19 44\n46 60\n51 53\n31 34\n23 32\n5 29\n43 59\n7 31\n29 48\n15 50\n19 51\n7 28\n17 41\n1 62",
"output": "82"
},
{
"input": "6 51\n45 -33 -17 -48 2 2\n2 5\n1 1\n1 3\n5 5\n4 6\n1 2\n2 3\n3 4\n1 6\n4 6\n3 5\n1 5\n2 2\n2 6\n4 6\n1 5\n1 5\n1 5\n1 6\n6 6\n3 5\n6 6\n1 6\n3 4\n3 3\n2 4\n3 3\n1 4\n2 4\n5 6\n4 5\n2 4\n1 5\n1 2\n4 5\n1 5\n5 6\n2 2\n3 4\n1 3\n1 2\n2 5\n3 6\n4 6\n3 4\n2 4\n1 4\n1 1\n4 6\n3 5\n1 4",
"output": "140"
},
{
"input": "3 5\n2 -1 3\n2 3\n2 3\n2 3\n2 3\n1 2",
"output": "9"
},
{
"input": "4 30\n1 1 1 1\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4\n1 4",
"output": "120"
}
] | 1,678,880,492
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 53
| 77
| 1,638,400
|
I=lambda:map(int,input().split())
R=range
ans=0
n,m=I()
a=list(I())
for _ in R(m):l,r=I();ans+=max(0,sum(a[i]for i in R(l-1,r)))
print(ans)
|
Title: Alyona and flowers
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Alyona is celebrating Happy Birthday! Her mother has an array of *n* flowers. Each flower has some mood, the mood of *i*-th flower is *a**i*. The mood can be positive, zero or negative.
Let's define a subarray as a segment of consecutive flowers. The mother suggested some set of subarrays. Alyona wants to choose several of the subarrays suggested by her mother. After that, each of the flowers will add to the girl's happiness its mood multiplied by the number of chosen subarrays the flower is in.
For example, consider the case when the mother has 5 flowers, and their moods are equal to 1,<=<=-<=2,<=1,<=3,<=<=-<=4. Suppose the mother suggested subarrays (1,<=<=-<=2), (3,<=<=-<=4), (1,<=3), (1,<=<=-<=2,<=1,<=3). Then if the girl chooses the third and the fourth subarrays then:
- the first flower adds 1Β·1<==<=1 to the girl's happiness, because he is in one of chosen subarrays, - the second flower adds (<=-<=2)Β·1<==<=<=-<=2, because he is in one of chosen subarrays, - the third flower adds 1Β·2<==<=2, because he is in two of chosen subarrays, - the fourth flower adds 3Β·2<==<=6, because he is in two of chosen subarrays, - the fifth flower adds (<=-<=4)Β·0<==<=0, because he is in no chosen subarrays.
Thus, in total 1<=+<=(<=-<=2)<=+<=2<=+<=6<=+<=0<==<=7 is added to the girl's happiness. Alyona wants to choose such subarrays from those suggested by the mother that the value added to her happiness would be as large as possible. Help her do this!
Alyona can choose any number of the subarrays, even 0 or all suggested by her mother.
Input Specification:
The first line contains two integers *n* and *m* (1<=β€<=*n*,<=*m*<=β€<=100)Β β the number of flowers and the number of subarrays suggested by the mother.
The second line contains the flowers moodsΒ β *n* integers *a*1,<=*a*2,<=...,<=*a**n* (<=-<=100<=β€<=*a**i*<=β€<=100).
The next *m* lines contain the description of the subarrays suggested by the mother. The *i*-th of these lines contain two integers *l**i* and *r**i* (1<=β€<=*l**i*<=β€<=*r**i*<=β€<=*n*) denoting the subarray *a*[*l**i*],<=*a*[*l**i*<=+<=1],<=...,<=*a*[*r**i*].
Each subarray can encounter more than once.
Output Specification:
Print single integerΒ β the maximum possible value added to the Alyona's happiness.
Demo Input:
['5 4\n1 -2 1 3 -4\n1 2\n4 5\n3 4\n1 4\n', '4 3\n1 2 3 4\n1 3\n2 4\n1 1\n', '2 2\n-1 -2\n1 1\n1 2\n']
Demo Output:
['7\n', '16\n', '0\n']
Note:
The first example is the situation described in the statements.
In the second example Alyona should choose all subarrays.
The third example has answer 0 because Alyona can choose none of the subarrays.
|
```python
I=lambda:map(int,input().split())
R=range
ans=0
n,m=I()
a=list(I())
for _ in R(m):l,r=I();ans+=max(0,sum(a[i]for i in R(l-1,r)))
print(ans)
```
| 3
|
|
6
|
C
|
Alice, Bob and Chocolate
|
PROGRAMMING
| 1,200
|
[
"greedy",
"two pointers"
] |
C. Alice, Bob and Chocolate
|
2
|
64
|
Alice and Bob like games. And now they are ready to start a new game. They have placed *n* chocolate bars in a line. Alice starts to eat chocolate bars one by one from left to right, and Bob β from right to left. For each chocololate bar the time, needed for the player to consume it, is known (Alice and Bob eat them with equal speed). When the player consumes a chocolate bar, he immediately starts with another. It is not allowed to eat two chocolate bars at the same time, to leave the bar unfinished and to make pauses. If both players start to eat the same bar simultaneously, Bob leaves it to Alice as a true gentleman.
How many bars each of the players will consume?
|
The first line contains one integer *n* (1<=β€<=*n*<=β€<=105) β the amount of bars on the table. The second line contains a sequence *t*1,<=*t*2,<=...,<=*t**n* (1<=β€<=*t**i*<=β€<=1000), where *t**i* is the time (in seconds) needed to consume the *i*-th bar (in the order from left to right).
|
Print two numbers *a* and *b*, where *a* is the amount of bars consumed by Alice, and *b* is the amount of bars consumed by Bob.
|
[
"5\n2 9 8 2 7\n"
] |
[
"2 3\n"
] |
none
| 0
|
[
{
"input": "5\n2 9 8 2 7",
"output": "2 3"
},
{
"input": "1\n1",
"output": "1 0"
},
{
"input": "2\n1 1",
"output": "1 1"
},
{
"input": "3\n1 1 1",
"output": "2 1"
},
{
"input": "4\n1 1 1 1",
"output": "2 2"
},
{
"input": "1\n6",
"output": "1 0"
},
{
"input": "2\n8 2",
"output": "1 1"
},
{
"input": "3\n6 8 4",
"output": "1 2"
},
{
"input": "4\n4 3 2 8",
"output": "3 1"
},
{
"input": "5\n1 9 8 2 7",
"output": "2 3"
},
{
"input": "6\n1 4 7 3 2 1",
"output": "3 3"
},
{
"input": "11\n7 9 1 8 7 1 7 1 4 8 1",
"output": "4 7"
},
{
"input": "12\n4 2 7 1 9 5 6 2 7 8 5 7",
"output": "7 5"
},
{
"input": "13\n9 9 9 9 9 9 9 9 9 9 9 9 9",
"output": "7 6"
}
] | 1,430,561,643
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 374
| 11,776,000
|
f, l = 0, int(input()) - 1
ts = [int(x) for x in input().split()]
a, b, bc = 0, 0, False
while l - f > 0:
if ts[f] < ts[l]:
ts[l], a, f, bc = ts[l] - ts[f], a + 1, f + 1, True
elif ts[l] < ts[f]:
ts[f], b, l, bc = ts[f] - ts[l], b + 1, l - 1, False
else:
a, f, b, l, bc = a + 1, f + 1, b + 1, l - 1, False
if l - f == 0:
if bc:
b += 1
else:
a += 1
print(a, b)
|
Title: Alice, Bob and Chocolate
Time Limit: 2 seconds
Memory Limit: 64 megabytes
Problem Description:
Alice and Bob like games. And now they are ready to start a new game. They have placed *n* chocolate bars in a line. Alice starts to eat chocolate bars one by one from left to right, and Bob β from right to left. For each chocololate bar the time, needed for the player to consume it, is known (Alice and Bob eat them with equal speed). When the player consumes a chocolate bar, he immediately starts with another. It is not allowed to eat two chocolate bars at the same time, to leave the bar unfinished and to make pauses. If both players start to eat the same bar simultaneously, Bob leaves it to Alice as a true gentleman.
How many bars each of the players will consume?
Input Specification:
The first line contains one integer *n* (1<=β€<=*n*<=β€<=105) β the amount of bars on the table. The second line contains a sequence *t*1,<=*t*2,<=...,<=*t**n* (1<=β€<=*t**i*<=β€<=1000), where *t**i* is the time (in seconds) needed to consume the *i*-th bar (in the order from left to right).
Output Specification:
Print two numbers *a* and *b*, where *a* is the amount of bars consumed by Alice, and *b* is the amount of bars consumed by Bob.
Demo Input:
['5\n2 9 8 2 7\n']
Demo Output:
['2 3\n']
Note:
none
|
```python
f, l = 0, int(input()) - 1
ts = [int(x) for x in input().split()]
a, b, bc = 0, 0, False
while l - f > 0:
if ts[f] < ts[l]:
ts[l], a, f, bc = ts[l] - ts[f], a + 1, f + 1, True
elif ts[l] < ts[f]:
ts[f], b, l, bc = ts[f] - ts[l], b + 1, l - 1, False
else:
a, f, b, l, bc = a + 1, f + 1, b + 1, l - 1, False
if l - f == 0:
if bc:
b += 1
else:
a += 1
print(a, b)
```
| 3.818762
|
780
|
A
|
Andryusha and Socks
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Andryusha is an orderly boy and likes to keep things in their place.
Today he faced a problem to put his socks in the wardrobe. He has *n* distinct pairs of socks which are initially in a bag. The pairs are numbered from 1 to *n*. Andryusha wants to put paired socks together and put them in the wardrobe. He takes the socks one by one from the bag, and for each sock he looks whether the pair of this sock has been already took out of the bag, or not. If not (that means the pair of this sock is still in the bag), he puts the current socks on the table in front of him. Otherwise, he puts both socks from the pair to the wardrobe.
Andryusha remembers the order in which he took the socks from the bag. Can you tell him what is the maximum number of socks that were on the table at the same time?
|
The first line contains the single integer *n* (1<=β€<=*n*<=β€<=105)Β β the number of sock pairs.
The second line contains 2*n* integers *x*1,<=*x*2,<=...,<=*x*2*n* (1<=β€<=*x**i*<=β€<=*n*), which describe the order in which Andryusha took the socks from the bag. More precisely, *x**i* means that the *i*-th sock Andryusha took out was from pair *x**i*.
It is guaranteed that Andryusha took exactly two socks of each pair.
|
Print single integerΒ β the maximum number of socks that were on the table at the same time.
|
[
"1\n1 1\n",
"3\n2 1 1 3 2 3\n"
] |
[
"1\n",
"2\n"
] |
In the first example Andryusha took a sock from the first pair and put it on the table. Then he took the next sock which is from the first pair as well, so he immediately puts both socks to the wardrobe. Thus, at most one sock was on the table at the same time.
In the second example Andryusha behaved as follows:
- Initially the table was empty, he took out a sock from pair 2 and put it on the table. - Sock (2) was on the table. Andryusha took out a sock from pair 1 and put it on the table. - Socks (1,β2) were on the table. Andryusha took out a sock from pair 1, and put this pair into the wardrobe. - Sock (2) was on the table. Andryusha took out a sock from pair 3 and put it on the table. - Socks (2,β3) were on the table. Andryusha took out a sock from pair 2, and put this pair into the wardrobe. - Sock (3) was on the table. Andryusha took out a sock from pair 3 and put this pair into the wardrobe.
| 500
|
[
{
"input": "1\n1 1",
"output": "1"
},
{
"input": "3\n2 1 1 3 2 3",
"output": "2"
},
{
"input": "5\n5 1 3 2 4 3 1 2 4 5",
"output": "5"
},
{
"input": "10\n4 2 6 3 4 8 7 1 1 5 2 10 6 8 3 5 10 9 9 7",
"output": "6"
},
{
"input": "50\n30 47 31 38 37 50 36 43 9 23 2 2 15 31 14 49 9 16 6 44 27 14 5 6 3 47 25 26 1 35 3 15 24 19 8 46 49 41 4 26 40 28 42 11 34 35 46 18 7 28 18 40 19 42 4 41 38 48 50 12 29 39 33 17 25 22 22 21 36 45 27 30 20 7 13 29 39 44 21 8 37 45 34 1 20 10 11 17 33 12 43 13 10 16 48 24 32 5 23 32",
"output": "25"
},
{
"input": "50\n1 1 2 2 3 3 4 4 5 5 6 6 7 7 8 8 9 9 10 10 11 11 12 12 13 13 14 14 15 15 16 16 17 17 18 18 19 19 20 20 21 21 22 22 23 23 24 24 25 25 26 26 27 27 28 28 29 29 30 30 31 31 32 32 33 33 34 34 35 35 36 36 37 37 38 38 39 39 40 40 41 41 42 42 43 43 44 44 45 45 46 46 47 47 48 48 49 49 50 50",
"output": "1"
},
{
"input": "50\n50 50 49 49 48 48 47 47 46 46 45 45 44 44 43 43 42 42 41 41 40 40 39 39 38 38 37 37 36 36 35 35 34 34 33 33 32 32 31 31 30 30 29 29 28 28 27 27 26 26 25 25 24 24 23 23 22 22 21 21 20 20 19 19 18 18 17 17 16 16 15 15 14 14 13 13 12 12 11 11 10 10 9 9 8 8 7 7 6 6 5 5 4 4 3 3 2 2 1 1",
"output": "1"
},
{
"input": "50\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50",
"output": "50"
},
{
"input": "50\n50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "50"
},
{
"input": "10\n2 9 4 1 6 7 10 3 1 5 8 6 2 3 10 7 4 8 5 9",
"output": "9"
}
] | 1,694,705,079
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 56
| 109
| 19,660,800
|
n=int(input())
b=list(map(int,input().split()))
c=0
z=0
v=[0]*100001
for i in b:
v[i]+=1
if v[i]!=2:
c+=1
z=max(z,c)
elif v[i]==2:
c-=1
print(z)
|
Title: Andryusha and Socks
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Andryusha is an orderly boy and likes to keep things in their place.
Today he faced a problem to put his socks in the wardrobe. He has *n* distinct pairs of socks which are initially in a bag. The pairs are numbered from 1 to *n*. Andryusha wants to put paired socks together and put them in the wardrobe. He takes the socks one by one from the bag, and for each sock he looks whether the pair of this sock has been already took out of the bag, or not. If not (that means the pair of this sock is still in the bag), he puts the current socks on the table in front of him. Otherwise, he puts both socks from the pair to the wardrobe.
Andryusha remembers the order in which he took the socks from the bag. Can you tell him what is the maximum number of socks that were on the table at the same time?
Input Specification:
The first line contains the single integer *n* (1<=β€<=*n*<=β€<=105)Β β the number of sock pairs.
The second line contains 2*n* integers *x*1,<=*x*2,<=...,<=*x*2*n* (1<=β€<=*x**i*<=β€<=*n*), which describe the order in which Andryusha took the socks from the bag. More precisely, *x**i* means that the *i*-th sock Andryusha took out was from pair *x**i*.
It is guaranteed that Andryusha took exactly two socks of each pair.
Output Specification:
Print single integerΒ β the maximum number of socks that were on the table at the same time.
Demo Input:
['1\n1 1\n', '3\n2 1 1 3 2 3\n']
Demo Output:
['1\n', '2\n']
Note:
In the first example Andryusha took a sock from the first pair and put it on the table. Then he took the next sock which is from the first pair as well, so he immediately puts both socks to the wardrobe. Thus, at most one sock was on the table at the same time.
In the second example Andryusha behaved as follows:
- Initially the table was empty, he took out a sock from pair 2 and put it on the table. - Sock (2) was on the table. Andryusha took out a sock from pair 1 and put it on the table. - Socks (1,β2) were on the table. Andryusha took out a sock from pair 1, and put this pair into the wardrobe. - Sock (2) was on the table. Andryusha took out a sock from pair 3 and put it on the table. - Socks (2,β3) were on the table. Andryusha took out a sock from pair 2, and put this pair into the wardrobe. - Sock (3) was on the table. Andryusha took out a sock from pair 3 and put this pair into the wardrobe.
|
```python
n=int(input())
b=list(map(int,input().split()))
c=0
z=0
v=[0]*100001
for i in b:
v[i]+=1
if v[i]!=2:
c+=1
z=max(z,c)
elif v[i]==2:
c-=1
print(z)
```
| 3
|
|
61
|
A
|
Ultra-Fast Mathematician
|
PROGRAMMING
| 800
|
[
"implementation"
] |
A. Ultra-Fast Mathematician
|
2
|
256
|
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length β (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
|
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
|
Write one line β the corresponding answer. Do not omit the leading 0s.
|
[
"1010100\n0100101\n",
"000\n111\n",
"1110\n1010\n",
"01110\n01100\n"
] |
[
"1110001\n",
"111\n",
"0100\n",
"00010\n"
] |
none
| 500
|
[
{
"input": "1010100\n0100101",
"output": "1110001"
},
{
"input": "000\n111",
"output": "111"
},
{
"input": "1110\n1010",
"output": "0100"
},
{
"input": "01110\n01100",
"output": "00010"
},
{
"input": "011101\n000001",
"output": "011100"
},
{
"input": "10\n01",
"output": "11"
},
{
"input": "00111111\n11011101",
"output": "11100010"
},
{
"input": "011001100\n101001010",
"output": "110000110"
},
{
"input": "1100100001\n0110101100",
"output": "1010001101"
},
{
"input": "00011101010\n10010100101",
"output": "10001001111"
},
{
"input": "100000101101\n111010100011",
"output": "011010001110"
},
{
"input": "1000001111010\n1101100110001",
"output": "0101101001011"
},
{
"input": "01011111010111\n10001110111010",
"output": "11010001101101"
},
{
"input": "110010000111100\n001100101011010",
"output": "111110101100110"
},
{
"input": "0010010111110000\n0000000011010110",
"output": "0010010100100110"
},
{
"input": "00111110111110000\n01111100001100000",
"output": "01000010110010000"
},
{
"input": "101010101111010001\n001001111101111101",
"output": "100011010010101100"
},
{
"input": "0110010101111100000\n0011000101000000110",
"output": "0101010000111100110"
},
{
"input": "11110100011101010111\n00001000011011000000",
"output": "11111100000110010111"
},
{
"input": "101010101111101101001\n111010010010000011111",
"output": "010000111101101110110"
},
{
"input": "0000111111100011000010\n1110110110110000001010",
"output": "1110001001010011001000"
},
{
"input": "10010010101000110111000\n00101110100110111000111",
"output": "10111100001110001111111"
},
{
"input": "010010010010111100000111\n100100111111100011001110",
"output": "110110101101011111001001"
},
{
"input": "0101110100100111011010010\n0101100011010111001010001",
"output": "0000010111110000010000011"
},
{
"input": "10010010100011110111111011\n10000110101100000001000100",
"output": "00010100001111110110111111"
},
{
"input": "000001111000000100001000000\n011100111101111001110110001",
"output": "011101000101111101111110001"
},
{
"input": "0011110010001001011001011100\n0000101101000011101011001010",
"output": "0011011111001010110010010110"
},
{
"input": "11111000000000010011001101111\n11101110011001010100010000000",
"output": "00010110011001000111011101111"
},
{
"input": "011001110000110100001100101100\n001010000011110000001000101001",
"output": "010011110011000100000100000101"
},
{
"input": "1011111010001100011010110101111\n1011001110010000000101100010101",
"output": "0000110100011100011111010111010"
},
{
"input": "10111000100001000001010110000001\n10111000001100101011011001011000",
"output": "00000000101101101010001111011001"
},
{
"input": "000001010000100001000000011011100\n111111111001010100100001100000111",
"output": "111110101001110101100001111011011"
},
{
"input": "1101000000000010011011101100000110\n1110000001100010011010000011011110",
"output": "0011000001100000000001101111011000"
},
{
"input": "01011011000010100001100100011110001\n01011010111000001010010100001110000",
"output": "00000001111010101011110000010000001"
},
{
"input": "000011111000011001000110111100000100\n011011000110000111101011100111000111",
"output": "011000111110011110101101011011000011"
},
{
"input": "1001000010101110001000000011111110010\n0010001011010111000011101001010110000",
"output": "1011001001111001001011101010101000010"
},
{
"input": "00011101011001100101111111000000010101\n10010011011011001011111000000011101011",
"output": "10001110000010101110000111000011111110"
},
{
"input": "111011100110001001101111110010111001010\n111111101101111001110010000101101000100",
"output": "000100001011110000011101110111010001110"
},
{
"input": "1111001001101000001000000010010101001010\n0010111100111110001011000010111110111001",
"output": "1101110101010110000011000000101011110011"
},
{
"input": "00100101111000000101011111110010100011010\n11101110001010010101001000111110101010100",
"output": "11001011110010010000010111001100001001110"
},
{
"input": "101011001110110100101001000111010101101111\n100111100110101011010100111100111111010110",
"output": "001100101000011111111101111011101010111001"
},
{
"input": "1111100001100101000111101001001010011100001\n1000110011000011110010001011001110001000001",
"output": "0111010010100110110101100010000100010100000"
},
{
"input": "01100111011111010101000001101110000001110101\n10011001011111110000000101011001001101101100",
"output": "11111110000000100101000100110111001100011001"
},
{
"input": "110010100111000100100101100000011100000011001\n011001111011100110000110111001110110100111011",
"output": "101011011100100010100011011001101010100100010"
},
{
"input": "0001100111111011010110100100111000000111000110\n1100101011000000000001010010010111001100110001",
"output": "1101001100111011010111110110101111001011110111"
},
{
"input": "00000101110110110001110010100001110100000100000\n10010000110011110001101000111111101010011010001",
"output": "10010101000101000000011010011110011110011110001"
},
{
"input": "110000100101011100100011001111110011111110010001\n101011111001011100110110111101110011010110101100",
"output": "011011011100000000010101110010000000101000111101"
},
{
"input": "0101111101011111010101011101000011101100000000111\n0000101010110110001110101011011110111001010100100",
"output": "0101010111101001011011110110011101010101010100011"
},
{
"input": "11000100010101110011101000011111001010110111111100\n00001111000111001011111110000010101110111001000011",
"output": "11001011010010111000010110011101100100001110111111"
},
{
"input": "101000001101111101101111111000001110110010101101010\n010011100111100001100000010001100101000000111011011",
"output": "111011101010011100001111101001101011110010010110001"
},
{
"input": "0011111110010001010100010110111000110011001101010100\n0111000000100010101010000100101000000100101000111001",
"output": "0100111110110011111110010010010000110111100101101101"
},
{
"input": "11101010000110000011011010000001111101000111011111100\n10110011110001010100010110010010101001010111100100100",
"output": "01011001110111010111001100010011010100010000111011000"
},
{
"input": "011000100001000001101000010110100110011110100111111011\n111011001000001001110011001111011110111110110011011111",
"output": "100011101001001000011011011001111000100000010100100100"
},
{
"input": "0111010110010100000110111011010110100000000111110110000\n1011100100010001101100000100111111101001110010000100110",
"output": "1100110010000101101010111111101001001001110101110010110"
},
{
"input": "10101000100111000111010001011011011011110100110101100011\n11101111000000001100100011111000100100000110011001101110",
"output": "01000111100111001011110010100011111111110010101100001101"
},
{
"input": "000000111001010001000000110001001011100010011101010011011\n110001101000010010000101000100001111101001100100001010010",
"output": "110001010001000011000101110101000100001011111001011001001"
},
{
"input": "0101011100111010000111110010101101111111000000111100011100\n1011111110000010101110111001000011100000100111111111000111",
"output": "1110100010111000101001001011101110011111100111000011011011"
},
{
"input": "11001000001100100111100111100100101011000101001111001001101\n10111110100010000011010100110100100011101001100000001110110",
"output": "01110110101110100100110011010000001000101100101111000111011"
},
{
"input": "010111011011101000000110000110100110001110100001110110111011\n101011110011101011101101011111010100100001100111100100111011",
"output": "111100101000000011101011011001110010101111000110010010000000"
},
{
"input": "1001011110110110000100011001010110000100011010010111010101110\n1101111100001000010111110011010101111010010100000001000010111",
"output": "0100100010111110010011101010000011111110001110010110010111001"
},
{
"input": "10000010101111100111110101111000010100110111101101111111111010\n10110110101100101010011001011010100110111011101100011001100111",
"output": "00110100000011001101101100100010110010001100000001100110011101"
},
{
"input": "011111010011111000001010101001101001000010100010111110010100001\n011111001011000011111001000001111001010110001010111101000010011",
"output": "000000011000111011110011101000010000010100101000000011010110010"
},
{
"input": "1111000000110001011101000100100100001111011100001111001100011111\n1101100110000101100001100000001001011011111011010101000101001010",
"output": "0010100110110100111100100100101101010100100111011010001001010101"
},
{
"input": "01100000101010010011001110100110110010000110010011011001100100011\n10110110010110111100100111000111000110010000000101101110000010111",
"output": "11010110111100101111101001100001110100010110010110110111100110100"
},
{
"input": "001111111010000100001100001010011001111110011110010111110001100111\n110000101001011000100010101100100110000111100000001101001110010111",
"output": "111111010011011100101110100110111111111001111110011010111111110000"
},
{
"input": "1011101011101101011110101101011101011000010011100101010101000100110\n0001000001001111010111100100111101100000000001110001000110000000110",
"output": "1010101010100010001001001001100000111000010010010100010011000100000"
},
{
"input": "01000001011001010011011100010000100100110101111011011011110000001110\n01011110000110011011000000000011000111100001010000000011111001110000",
"output": "00011111011111001000011100010011100011010100101011011000001001111110"
},
{
"input": "110101010100110101000001111110110100010010000100111110010100110011100\n111010010111111011100110101011001011001110110111110100000110110100111",
"output": "001111000011001110100111010101111111011100110011001010010010000111011"
},
{
"input": "1001101011000001011111100110010010000011010001001111011100010100110001\n1111100111110101001111010001010000011001001001010110001111000000100101",
"output": "0110001100110100010000110111000010011010011000011001010011010100010100"
},
{
"input": "00000111110010110001110110001010010101000111011001111111100110011110010\n00010111110100000100110101000010010001100001100011100000001100010100010",
"output": "00010000000110110101000011001000000100100110111010011111101010001010000"
},
{
"input": "100101011100101101000011010001011001101110101110001100010001010111001110\n100001111100101011011111110000001111000111001011111110000010101110111001",
"output": "000100100000000110011100100001010110101001100101110010010011111001110111"
},
{
"input": "1101100001000111001101001011101000111000011110000001001101101001111011010\n0101011101010100011011010110101000010010110010011110101100000110110001000",
"output": "1000111100010011010110011101000000101010101100011111100001101111001010010"
},
{
"input": "01101101010011110101100001110101111011100010000010001101111000011110111111\n00101111001101001100111010000101110000100101101111100111101110010100011011",
"output": "01000010011110111001011011110000001011000111101101101010010110001010100100"
},
{
"input": "101100101100011001101111110110110010100110110010100001110010110011001101011\n000001011010101011110011111101001110000111000010001101000010010000010001101",
"output": "101101110110110010011100001011111100100001110000101100110000100011011100110"
},
{
"input": "0010001011001010001100000010010011110110011000100000000100110000101111001110\n1100110100111000110100001110111001011101001100001010100001010011100110110001",
"output": "1110111111110010111000001100101010101011010100101010100101100011001001111111"
},
{
"input": "00101101010000000101011001101011001100010001100000101011101110000001111001000\n10010110010111000000101101000011101011001010000011011101101011010000000011111",
"output": "10111011000111000101110100101000100111011011100011110110000101010001111010111"
},
{
"input": "111100000100100000101001100001001111001010001000001000000111010000010101101011\n001000100010100101111011111011010110101100001111011000010011011011100010010110",
"output": "110100100110000101010010011010011001100110000111010000010100001011110111111101"
},
{
"input": "0110001101100100001111110101101000100101010010101010011001101001001101110000000\n0111011000000010010111011110010000000001000110001000011001101000000001110100111",
"output": "0001010101100110011000101011111000100100010100100010000000000001001100000100111"
},
{
"input": "10001111111001000101001011110101111010100001011010101100111001010001010010001000\n10000111010010011110111000111010101100000011110001101111001000111010100000000001",
"output": "00001000101011011011110011001111010110100010101011000011110001101011110010001001"
},
{
"input": "100110001110110000100101001110000011110110000110000000100011110100110110011001101\n110001110101110000000100101001101011111100100100001001000110000001111100011110110",
"output": "010111111011000000100001100111101000001010100010001001100101110101001010000111011"
},
{
"input": "0000010100100000010110111100011111111010011101000000100000011001001101101100111010\n0100111110011101010110101011110110010111001111000110101100101110111100101000111111",
"output": "0100101010111101000000010111101001101101010010000110001100110111110001000100000101"
},
{
"input": "11000111001010100001110000001001011010010010110000001110100101000001010101100110111\n11001100100100100001101010110100000111100011101110011010110100001001000011011011010",
"output": "00001011101110000000011010111101011101110001011110010100010001001000010110111101101"
},
{
"input": "010110100010001000100010101001101010011010111110100001000100101000111011100010100001\n110000011111101101010011111000101010111010100001001100001001100101000000111000000000",
"output": "100110111101100101110001010001000000100000011111101101001101001101111011011010100001"
},
{
"input": "0000011110101110010101110110110101100001011001101010101001000010000010000000101001101\n1100111111011100000110000111101110011111100111110001011001000010011111100001001100011",
"output": "1100100001110010010011110001011011111110111110011011110000000000011101100001100101110"
},
{
"input": "10100000101101110001100010010010100101100011010010101000110011100000101010110010000000\n10001110011011010010111011011101101111000111110000111000011010010101001100000001010011",
"output": "00101110110110100011011001001111001010100100100010010000101001110101100110110011010011"
},
{
"input": "001110000011111101101010011111000101010111010100001001100001001100101000000111000000000\n111010000000000000101001110011001000111011001100101010011001000011101001001011110000011",
"output": "110100000011111101000011101100001101101100011000100011111000001111000001001100110000011"
},
{
"input": "1110111100111011010101011011001110001010010010110011110010011111000010011111010101100001\n1001010101011001001010100010101100000110111101011000100010101111111010111100001110010010",
"output": "0111101001100010011111111001100010001100101111101011010000110000111000100011011011110011"
},
{
"input": "11100010001100010011001100001100010011010001101110011110100101110010101101011101000111111\n01110000000110111010110100001010000101011110100101010011000110101110101101110111011110001",
"output": "10010010001010101001111000000110010110001111001011001101100011011100000000101010011001110"
},
{
"input": "001101011001100101101100110000111000101011001001100100000100101000100000110100010111111101\n101001111110000010111101111110001001111001111101111010000110111000100100110010010001011111",
"output": "100100100111100111010001001110110001010010110100011110000010010000000100000110000110100010"
},
{
"input": "1010110110010101000110010010110101011101010100011001101011000110000000100011100100011000000\n0011011111100010001111101101000111001011101110100000110111100100101111010110101111011100011",
"output": "1001101001110111001001111111110010010110111010111001011100100010101111110101001011000100011"
},
{
"input": "10010010000111010111011111110010100101100000001100011100111011100010000010010001011100001100\n00111010100010110010000100010111010001111110100100100011101000101111111111001101101100100100",
"output": "10101000100101100101011011100101110100011110101000111111010011001101111101011100110000101000"
},
{
"input": "010101110001010101100000010111010000000111110011001101100011001000000011001111110000000010100\n010010111011100101010101111110110000000111000100001101101001001000001100101110001010000100001",
"output": "000111001010110000110101101001100000000000110111000000001010000000001111100001111010000110101"
},
{
"input": "1100111110011001000111101001001011000110011010111111100010111111001100111111011101100111101011\n1100000011001000110100110111000001011001010111101000010010100011000001100100111101101000010110",
"output": "0000111101010001110011011110001010011111001101010111110000011100001101011011100000001111111101"
},
{
"input": "00011000100100110111100101100100000000010011110111110010101110110011100001010111010011110100101\n00011011111011111011100101100111100101001110010111000010000111000100100100000001110101111011011",
"output": "00000011011111001100000000000011100101011101100000110000101001110111000101010110100110001111110"
},
{
"input": "000101011001001100000111100010110101111011110101111101000110001101011010111110110011100100000001\n011000101010011111011000111000100000000011011000000001111110001000001111101010110000011100001111",
"output": "011101110011010011011111011010010101111000101101111100111000000101010101010100000011111000001110"
},
{
"input": "1000101001011010000100100100010010011101011001110101111011101111111110010101001101010001010101001\n0110110010011100011111011111110111000000010001110100001010111110101011010011111011111110000110000",
"output": "1110011011000110011011111011100101011101001000000001110001010001010101000110110110101111010011001"
},
{
"input": "01111010010101100111110111111011011010100001011101010000111100101101101110111011001100101011100111\n00001100110110100001111011000010001001001100000010111101000001111011100000010111010010000011000010",
"output": "01110110100011000110001100111001010011101101011111101101111101010110001110101100011110101000100101"
},
{
"input": "111101011101111000001011001101111010110111001101110100100011111011011101001101010101011010111000110\n101111100101101101001100110011000001111010011101110111110110101110011011110011111100001001110101101",
"output": "010010111000010101000111111110111011001101010000000011010101010101000110111110101001010011001101011"
},
{
"input": "1010000011010110011101001101110001110010000111011101110010110110111111001001110100101100010101010001\n0111101000111100101100000101111010100100001000011101010100110011100011010011010101000100101011100011",
"output": "1101101011101010110001001000001011010110001111000000100110000101011100011010100001101000111110110010"
},
{
"input": "0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001\n1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111010",
"output": "1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111011"
},
{
"input": "0\n0",
"output": "0"
},
{
"input": "0\n1",
"output": "1"
}
] | 1,680,453,720
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 102
| 46
| 0
|
a=input()
b=input()
lst=[]
for i in range(len(a)):
if a[i]==b[i]:
lst.append(0)
else:
lst.append(1)
for i in range(len(lst)):
print(lst[i],end='')
|
Title: Ultra-Fast Mathematician
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second.
One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part.
In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0.
Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length β (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length.
Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
Input Specification:
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
Output Specification:
Write one line β the corresponding answer. Do not omit the leading 0s.
Demo Input:
['1010100\n0100101\n', '000\n111\n', '1110\n1010\n', '01110\n01100\n']
Demo Output:
['1110001\n', '111\n', '0100\n', '00010\n']
Note:
none
|
```python
a=input()
b=input()
lst=[]
for i in range(len(a)):
if a[i]==b[i]:
lst.append(0)
else:
lst.append(1)
for i in range(len(lst)):
print(lst[i],end='')
```
| 3.9885
|
41
|
A
|
Translation
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Translation
|
2
|
256
|
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the Β«translationΒ». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
|
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
|
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
|
[
"code\nedoc\n",
"abb\naba\n",
"code\ncode\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "code\nedoc",
"output": "YES"
},
{
"input": "abb\naba",
"output": "NO"
},
{
"input": "code\ncode",
"output": "NO"
},
{
"input": "abacaba\nabacaba",
"output": "YES"
},
{
"input": "q\nq",
"output": "YES"
},
{
"input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk",
"output": "NO"
},
{
"input": "z\na",
"output": "NO"
},
{
"input": "asd\ndsa",
"output": "YES"
},
{
"input": "abcdef\nfecdba",
"output": "NO"
},
{
"input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu",
"output": "NO"
},
{
"input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf",
"output": "NO"
},
{
"input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp",
"output": "NO"
},
{
"input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb",
"output": "NO"
},
{
"input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom",
"output": "NO"
},
{
"input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh",
"output": "NO"
},
{
"input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy",
"output": "NO"
},
{
"input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko",
"output": "NO"
},
{
"input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv",
"output": "NO"
},
{
"input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd",
"output": "NO"
},
{
"input": "w\nw",
"output": "YES"
},
{
"input": "vz\nzv",
"output": "YES"
},
{
"input": "ry\nyr",
"output": "YES"
},
{
"input": "xou\nuox",
"output": "YES"
},
{
"input": "axg\ngax",
"output": "NO"
},
{
"input": "zdsl\nlsdz",
"output": "YES"
},
{
"input": "kudl\nldku",
"output": "NO"
},
{
"input": "zzlzwnqlcl\nlclqnwzlzz",
"output": "YES"
},
{
"input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv",
"output": "YES"
},
{
"input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar",
"output": "NO"
},
{
"input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn",
"output": "YES"
},
{
"input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum",
"output": "YES"
},
{
"input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv",
"output": "YES"
},
{
"input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm",
"output": "NO"
},
{
"input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd",
"output": "NO"
},
{
"input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg",
"output": "YES"
},
{
"input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis",
"output": "YES"
},
{
"input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy",
"output": "NO"
},
{
"input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw",
"output": "YES"
},
{
"input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi",
"output": "YES"
},
{
"input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib",
"output": "YES"
}
] | 1,641,623,776
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 92
| 0
|
print(["YES","NO"][input()!=input()[::-1]])
|
Title: Translation
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the Β«translationΒ». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
Input Specification:
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
Output Specification:
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
Demo Input:
['code\nedoc\n', 'abb\naba\n', 'code\ncode\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
none
|
```python
print(["YES","NO"][input()!=input()[::-1]])
```
| 3.977
|
0
|
none
|
none
|
none
| 0
|
[
"none"
] | null | null |
The mobile application store has a new game called "Subway Roller".
The protagonist of the game Philip is located in one end of the tunnel and wants to get out of the other one. The tunnel is a rectangular field consisting of three rows and *n* columns. At the beginning of the game the hero is in some cell of the leftmost column. Some number of trains rides towards the hero. Each train consists of two or more neighbouring cells in some row of the field.
All trains are moving from right to left at a speed of two cells per second, and the hero runs from left to right at the speed of one cell per second. For simplicity, the game is implemented so that the hero and the trains move in turns. First, the hero moves one cell to the right, then one square up or down, or stays idle. Then all the trains move twice simultaneously one cell to the left. Thus, in one move, Philip definitely makes a move to the right and can move up or down. If at any point, Philip is in the same cell with a train, he loses. If the train reaches the left column, it continues to move as before, leaving the tunnel.
Your task is to answer the question whether there is a sequence of movements of Philip, such that he would be able to get to the rightmost column.
|
Each test contains from one to ten sets of the input data. The first line of the test contains a single integer *t* (1<=β€<=*t*<=β€<=10 for pretests and tests or *t*<==<=1 for hacks; see the Notes section for details) β the number of sets.
Then follows the description of *t* sets of the input data.
The first line of the description of each set contains two integers *n*,<=*k* (2<=β€<=*n*<=β€<=100,<=1<=β€<=*k*<=β€<=26) β the number of columns on the field and the number of trains. Each of the following three lines contains the sequence of *n* character, representing the row of the field where the game is on. Philip's initial position is marked as 's', he is in the leftmost column. Each of the *k* trains is marked by some sequence of identical uppercase letters of the English alphabet, located in one line. Distinct trains are represented by distinct letters. Character '.' represents an empty cell, that is, the cell that doesn't contain either Philip or the trains.
|
For each set of the input data print on a single line word YES, if it is possible to win the game and word NO otherwise.
|
[
"2\n16 4\n...AAAAA........\ns.BBB......CCCCC\n........DDDDD...\n16 4\n...AAAAA........\ns.BBB....CCCCC..\n.......DDDDD....\n",
"2\n10 4\ns.ZZ......\n.....AAABB\n.YYYYYY...\n10 4\ns.ZZ......\n....AAAABB\n.YYYYYY...\n"
] |
[
"YES\nNO\n",
"YES\nNO\n"
] |
In the first set of the input of the first sample Philip must first go forward and go down to the third row of the field, then go only forward, then go forward and climb to the second row, go forward again and go up to the first row. After that way no train blocks Philip's path, so he can go straight to the end of the tunnel.
Note that in this problem the challenges are restricted to tests that contain only one testset.
| 0
|
[] | 1,538,283,407
| 5,387
|
Python 3
|
OK
|
TESTS
| 40
| 202
| 1,126,400
|
import sys
import time
import traceback
from contextlib import contextmanager
from io import StringIO
def trains(n, k, field):
pos = [row[0] == 's' for row in field]
def advance(p):
npos = [False for r in range(3)]
for r in range(3):
if pos[r] and field[r][c] == '.':
npos[r] = True
if p:
if r > 0 and field[r-1][c] == '.':
npos[r-1] = True
if r < 2 and field[r+1][c] == '.':
npos[r+1] = True
return npos
for c in range(1, n):
pos = advance(c % 3 == 1)
return any(pos)
def pl(k):
l = list(map(int, input().split()))
assert len(l) == k
return l
def main():
t = int(input())
for _ in range(t):
n, k = map(int, input().split())
field = [input(), input(), input()]
print('YES' if trains(n, k, field) else 'NO')
def log(*args, **kwargs):
print(*args, **kwargs, file=sys.stderr)
@contextmanager
def patchio(i):
try:
sys.stdin = StringIO(i)
sys.stdout = StringIO()
yield sys.stdout
finally:
sys.stdin = sys.__stdin__
sys.stdout = sys.__stdout__
def do_test(k, test):
try:
log(f"TEST {k}")
i, o = test
with patchio(i) as r:
t0 = time.time()
main()
t1 = time.time()
if r.getvalue() == o:
log(f"OK ({int((t1-t0)*1000000)/1000:0.3f} ms)\n")
else:
log(f"Expected:\n{o}Got:\n{r.getvalue()}")
except Exception:
traceback.print_exc()
log()
def test(ts):
for k in ts or range(len(tests)):
do_test(k, tests[k])
tests = [("""\
2
16 4
...AAAAA........
s.BBB......CCCCC
........DDDDD...
16 4
...AAAAA........
s.BBB....CCCCC..
.......DDDDD....
""", """\
YES
NO
"""), ("""\
2
10 4
s.ZZ......
.....AAABB
.YYYYYY...
10 4
s.ZZ......
....AAAABB
.YYYYYY...
""", """\
YES
NO
""")]
if __name__ == '__main__':
from argparse import ArgumentParser
parser = ArgumentParser()
parser.add_argument('--test', '-t', type=int, nargs='*')
args = parser.parse_args()
main() if args.test is None else test(args.test)
|
Title: none
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
The mobile application store has a new game called "Subway Roller".
The protagonist of the game Philip is located in one end of the tunnel and wants to get out of the other one. The tunnel is a rectangular field consisting of three rows and *n* columns. At the beginning of the game the hero is in some cell of the leftmost column. Some number of trains rides towards the hero. Each train consists of two or more neighbouring cells in some row of the field.
All trains are moving from right to left at a speed of two cells per second, and the hero runs from left to right at the speed of one cell per second. For simplicity, the game is implemented so that the hero and the trains move in turns. First, the hero moves one cell to the right, then one square up or down, or stays idle. Then all the trains move twice simultaneously one cell to the left. Thus, in one move, Philip definitely makes a move to the right and can move up or down. If at any point, Philip is in the same cell with a train, he loses. If the train reaches the left column, it continues to move as before, leaving the tunnel.
Your task is to answer the question whether there is a sequence of movements of Philip, such that he would be able to get to the rightmost column.
Input Specification:
Each test contains from one to ten sets of the input data. The first line of the test contains a single integer *t* (1<=β€<=*t*<=β€<=10 for pretests and tests or *t*<==<=1 for hacks; see the Notes section for details) β the number of sets.
Then follows the description of *t* sets of the input data.
The first line of the description of each set contains two integers *n*,<=*k* (2<=β€<=*n*<=β€<=100,<=1<=β€<=*k*<=β€<=26) β the number of columns on the field and the number of trains. Each of the following three lines contains the sequence of *n* character, representing the row of the field where the game is on. Philip's initial position is marked as 's', he is in the leftmost column. Each of the *k* trains is marked by some sequence of identical uppercase letters of the English alphabet, located in one line. Distinct trains are represented by distinct letters. Character '.' represents an empty cell, that is, the cell that doesn't contain either Philip or the trains.
Output Specification:
For each set of the input data print on a single line word YES, if it is possible to win the game and word NO otherwise.
Demo Input:
['2\n16 4\n...AAAAA........\ns.BBB......CCCCC\n........DDDDD...\n16 4\n...AAAAA........\ns.BBB....CCCCC..\n.......DDDDD....\n', '2\n10 4\ns.ZZ......\n.....AAABB\n.YYYYYY...\n10 4\ns.ZZ......\n....AAAABB\n.YYYYYY...\n']
Demo Output:
['YES\nNO\n', 'YES\nNO\n']
Note:
In the first set of the input of the first sample Philip must first go forward and go down to the third row of the field, then go only forward, then go forward and climb to the second row, go forward again and go up to the first row. After that way no train blocks Philip's path, so he can go straight to the end of the tunnel.
Note that in this problem the challenges are restricted to tests that contain only one testset.
|
```python
import sys
import time
import traceback
from contextlib import contextmanager
from io import StringIO
def trains(n, k, field):
pos = [row[0] == 's' for row in field]
def advance(p):
npos = [False for r in range(3)]
for r in range(3):
if pos[r] and field[r][c] == '.':
npos[r] = True
if p:
if r > 0 and field[r-1][c] == '.':
npos[r-1] = True
if r < 2 and field[r+1][c] == '.':
npos[r+1] = True
return npos
for c in range(1, n):
pos = advance(c % 3 == 1)
return any(pos)
def pl(k):
l = list(map(int, input().split()))
assert len(l) == k
return l
def main():
t = int(input())
for _ in range(t):
n, k = map(int, input().split())
field = [input(), input(), input()]
print('YES' if trains(n, k, field) else 'NO')
def log(*args, **kwargs):
print(*args, **kwargs, file=sys.stderr)
@contextmanager
def patchio(i):
try:
sys.stdin = StringIO(i)
sys.stdout = StringIO()
yield sys.stdout
finally:
sys.stdin = sys.__stdin__
sys.stdout = sys.__stdout__
def do_test(k, test):
try:
log(f"TEST {k}")
i, o = test
with patchio(i) as r:
t0 = time.time()
main()
t1 = time.time()
if r.getvalue() == o:
log(f"OK ({int((t1-t0)*1000000)/1000:0.3f} ms)\n")
else:
log(f"Expected:\n{o}Got:\n{r.getvalue()}")
except Exception:
traceback.print_exc()
log()
def test(ts):
for k in ts or range(len(tests)):
do_test(k, tests[k])
tests = [("""\
2
16 4
...AAAAA........
s.BBB......CCCCC
........DDDDD...
16 4
...AAAAA........
s.BBB....CCCCC..
.......DDDDD....
""", """\
YES
NO
"""), ("""\
2
10 4
s.ZZ......
.....AAABB
.YYYYYY...
10 4
s.ZZ......
....AAAABB
.YYYYYY...
""", """\
YES
NO
""")]
if __name__ == '__main__':
from argparse import ArgumentParser
parser = ArgumentParser()
parser.add_argument('--test', '-t', type=int, nargs='*')
args = parser.parse_args()
main() if args.test is None else test(args.test)
```
| 3
|
|
612
|
C
|
Replace To Make Regular Bracket Sequence
|
PROGRAMMING
| 1,400
|
[
"data structures",
"expression parsing",
"math"
] | null | null |
You are given string *s* consists of opening and closing brackets of four kinds <>, {}, [], (). There are two types of brackets: opening and closing. You can replace any bracket by another of the same type. For example, you can replace < by the bracket {, but you can't replace it by ) or >.
The following definition of a regular bracket sequence is well-known, so you can be familiar with it.
Let's define a regular bracket sequence (RBS). Empty string is RBS. Let *s*1 and *s*2 be a RBS then the strings <*s*1>*s*2, {*s*1}*s*2, [*s*1]*s*2, (*s*1)*s*2 are also RBS.
For example the string "[[(){}]<>]" is RBS, but the strings "[)()" and "][()()" are not.
Determine the least number of replaces to make the string *s* RBS.
|
The only line contains a non empty string *s*, consisting of only opening and closing brackets of four kinds. The length of *s* does not exceed 106.
|
If it's impossible to get RBS from *s* print Impossible.
Otherwise print the least number of replaces needed to get RBS from *s*.
|
[
"[<}){}\n",
"{()}[]\n",
"]]\n"
] |
[
"2",
"0",
"Impossible"
] |
none
| 0
|
[
{
"input": "[<}){}",
"output": "2"
},
{
"input": "{()}[]",
"output": "0"
},
{
"input": "]]",
"output": "Impossible"
},
{
"input": ">",
"output": "Impossible"
},
{
"input": "{}",
"output": "0"
},
{
"input": "{}",
"output": "0"
},
{
"input": "{]",
"output": "1"
},
{
"input": "{]",
"output": "1"
},
{
"input": "{]",
"output": "1"
},
{
"input": "[]{[]({)([",
"output": "Impossible"
},
{
"input": "(([{>}{[{[)]]>>]",
"output": "7"
},
{
"input": "((<>)[]<]><]",
"output": "3"
},
{
"input": "[[([[(>]>)))[<)>",
"output": "6"
},
{
"input": "({)[}<)](}",
"output": "5"
},
{
"input": "(}{)[<][)(]}",
"output": "6"
},
{
"input": ">}({>]{[}<{<{{)[]]{)]>]]]<(][{)<<<{<<)>)()[>{<]]{}<>}}}}(>}<})(][>{((<{<)]}>)))][>[}[])<]){]]][<[)([",
"output": "Impossible"
},
{
"input": "<<[<{{<([({<<[)<>(]]){})>[](])[)))[[}>]<)>[[>{>>>[<]}<>>)[>]<{)<[><(<]][>(>]>][(<][{]}(()<[()[>><<])<]})]<]}{)",
"output": "45"
},
{
"input": "[<<{{((}[}<<)<)>})(][{>}})((>)<[)[>}[})[)>()[()[((}<<(>)<>](<>(}[>})[[[{)<}<<(}{>>}[<([[])<><)]<{>}[>>>{({>)}]})>)",
"output": "42"
},
{
"input": "(<[([(<({>(}{]>[(})])}])()<<}{]{[>]>(>>[(>>}[){(}<[{(()]{{<(<{][[{<><{<{)<>>]}}}{)(}{})}[<))>>}((({>){({}{{]}]>>}})>))",
"output": "43"
},
{
"input": "{(]}<([]<]{>]<{<({{{<>))}[({(}{)[}({>]}}<<)}<]))(<>(>{>{{{)<}({<]<>{)(>[)>{({}<([<[[)]><>{]}}(>]{}<)[})]}]]}]}>}",
"output": "40"
},
{
"input": "<(([)]<[}>{)>][[(<()({{{>>((]<}<{{<>}><<[)}[[)([[)[)}<]<{(<>){([)><{[([[][({])})<][(}]}>>[){)[({>){(}[}})>}>]>)]}))})>}]",
"output": "45"
},
{
"input": ")(",
"output": "Impossible"
},
{
"input": "[[[[[[[[",
"output": "Impossible"
}
] | 1,567,008,370
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 52
| 280
| 47,616,000
|
import io, os
input = io.StringIO(os.read(0, os.fstat(0).st_size).decode()).readline
stack = []
c=0
opts = {'(':0,')':1,'<':2,'>':3,'[':4,']':5,'{':6,'}':7}
for s in input():
if s not in opts:break
v = opts[s]
if v&1:
if not stack:
print("Impossible")
exit()
x = stack.pop()
if x != v: c+=1
else:
stack.append(v+1)
if stack:
print("Impossible")
exit()
print(c)
|
Title: Replace To Make Regular Bracket Sequence
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You are given string *s* consists of opening and closing brackets of four kinds <>, {}, [], (). There are two types of brackets: opening and closing. You can replace any bracket by another of the same type. For example, you can replace < by the bracket {, but you can't replace it by ) or >.
The following definition of a regular bracket sequence is well-known, so you can be familiar with it.
Let's define a regular bracket sequence (RBS). Empty string is RBS. Let *s*1 and *s*2 be a RBS then the strings <*s*1>*s*2, {*s*1}*s*2, [*s*1]*s*2, (*s*1)*s*2 are also RBS.
For example the string "[[(){}]<>]" is RBS, but the strings "[)()" and "][()()" are not.
Determine the least number of replaces to make the string *s* RBS.
Input Specification:
The only line contains a non empty string *s*, consisting of only opening and closing brackets of four kinds. The length of *s* does not exceed 106.
Output Specification:
If it's impossible to get RBS from *s* print Impossible.
Otherwise print the least number of replaces needed to get RBS from *s*.
Demo Input:
['[<}){}\n', '{()}[]\n', ']]\n']
Demo Output:
['2', '0', 'Impossible']
Note:
none
|
```python
import io, os
input = io.StringIO(os.read(0, os.fstat(0).st_size).decode()).readline
stack = []
c=0
opts = {'(':0,')':1,'<':2,'>':3,'[':4,']':5,'{':6,'}':7}
for s in input():
if s not in opts:break
v = opts[s]
if v&1:
if not stack:
print("Impossible")
exit()
x = stack.pop()
if x != v: c+=1
else:
stack.append(v+1)
if stack:
print("Impossible")
exit()
print(c)
```
| 3
|
|
814
|
B
|
An express train to reveries
|
PROGRAMMING
| 1,300
|
[
"constructive algorithms"
] | null | null |
Sengoku still remembers the mysterious "colourful meteoroids" she discovered with Lala-chan when they were little. In particular, one of the nights impressed her deeply, giving her the illusion that all her fancies would be realized.
On that night, Sengoku constructed a permutation *p*1,<=*p*2,<=...,<=*p**n* of integers from 1 to *n* inclusive, with each integer representing a colour, wishing for the colours to see in the coming meteor outburst. Two incredible outbursts then arrived, each with *n* meteorids, colours of which being integer sequences *a*1,<=*a*2,<=...,<=*a**n* and *b*1,<=*b*2,<=...,<=*b**n* respectively. Meteoroids' colours were also between 1 and *n* inclusive, and the two sequences were not identical, that is, at least one *i* (1<=β€<=*i*<=β€<=*n*) exists, such that *a**i*<=β <=*b**i* holds.
Well, she almost had it all β each of the sequences *a* and *b* matched exactly *n*<=-<=1 elements in Sengoku's permutation. In other words, there is exactly one *i* (1<=β€<=*i*<=β€<=*n*) such that *a**i*<=β <=*p**i*, and exactly one *j* (1<=β€<=*j*<=β€<=*n*) such that *b**j*<=β <=*p**j*.
For now, Sengoku is able to recover the actual colour sequences *a* and *b* through astronomical records, but her wishes have been long forgotten. You are to reconstruct any possible permutation Sengoku could have had on that night.
|
The first line of input contains a positive integer *n* (2<=β€<=*n*<=β€<=1<=000) β the length of Sengoku's permutation, being the length of both meteor outbursts at the same time.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a**i*<=β€<=*n*) β the sequence of colours in the first meteor outburst.
The third line contains *n* space-separated integers *b*1,<=*b*2,<=...,<=*b**n* (1<=β€<=*b**i*<=β€<=*n*) β the sequence of colours in the second meteor outburst. At least one *i* (1<=β€<=*i*<=β€<=*n*) exists, such that *a**i*<=β <=*b**i* holds.
|
Output *n* space-separated integers *p*1,<=*p*2,<=...,<=*p**n*, denoting a possible permutation Sengoku could have had. If there are more than one possible answer, output any one of them.
Input guarantees that such permutation exists.
|
[
"5\n1 2 3 4 3\n1 2 5 4 5\n",
"5\n4 4 2 3 1\n5 4 5 3 1\n",
"4\n1 1 3 4\n1 4 3 4\n"
] |
[
"1 2 5 4 3\n",
"5 4 2 3 1\n",
"1 2 3 4\n"
] |
In the first sample, both 1,β2,β5,β4,β3 and 1,β2,β3,β4,β5 are acceptable outputs.
In the second sample, 5,β4,β2,β3,β1 is the only permutation to satisfy the constraints.
| 1,000
|
[
{
"input": "5\n1 2 3 4 3\n1 2 5 4 5",
"output": "1 2 5 4 3"
},
{
"input": "5\n4 4 2 3 1\n5 4 5 3 1",
"output": "5 4 2 3 1"
},
{
"input": "4\n1 1 3 4\n1 4 3 4",
"output": "1 2 3 4"
},
{
"input": "10\n1 2 3 4 7 6 7 8 9 10\n1 2 3 4 5 6 5 8 9 10",
"output": "1 2 3 4 5 6 7 8 9 10"
},
{
"input": "10\n1 2 3 4 5 6 7 8 7 10\n1 2 3 4 5 6 7 8 9 9",
"output": "1 2 3 4 5 6 7 8 9 10"
},
{
"input": "10\n1 2 3 4 5 6 7 8 4 10\n1 2 3 4 5 6 7 6 9 10",
"output": "1 2 3 4 5 6 7 8 9 10"
},
{
"input": "10\n8 6 1 7 9 3 5 2 10 9\n8 6 1 7 4 3 5 2 10 4",
"output": "8 6 1 7 4 3 5 2 10 9"
},
{
"input": "10\n2 9 7 7 8 5 4 10 6 1\n2 8 7 3 8 5 4 10 6 1",
"output": "2 9 7 3 8 5 4 10 6 1"
},
{
"input": "2\n2 2\n1 1",
"output": "1 2"
},
{
"input": "3\n1 2 2\n1 3 3",
"output": "1 3 2"
},
{
"input": "3\n2 2 3\n1 2 1",
"output": "1 2 3"
},
{
"input": "3\n1 3 3\n1 1 3",
"output": "1 2 3"
},
{
"input": "3\n2 1 1\n2 3 3",
"output": "2 3 1"
},
{
"input": "3\n3 3 2\n1 1 2",
"output": "1 3 2"
},
{
"input": "3\n1 3 3\n3 3 2",
"output": "1 3 2"
},
{
"input": "4\n3 2 3 4\n1 2 1 4",
"output": "1 2 3 4"
},
{
"input": "4\n2 2 3 4\n1 2 3 2",
"output": "1 2 3 4"
},
{
"input": "4\n1 2 4 4\n2 2 3 4",
"output": "1 2 3 4"
},
{
"input": "4\n4 1 3 4\n2 1 3 2",
"output": "2 1 3 4"
},
{
"input": "4\n3 2 1 3\n4 2 1 2",
"output": "4 2 1 3"
},
{
"input": "4\n1 4 1 3\n2 4 1 4",
"output": "2 4 1 3"
},
{
"input": "4\n1 3 4 4\n3 3 2 4",
"output": "1 3 2 4"
},
{
"input": "5\n5 4 5 3 1\n4 4 2 3 1",
"output": "5 4 2 3 1"
},
{
"input": "5\n4 1 2 4 5\n3 1 2 5 5",
"output": "3 1 2 4 5"
},
{
"input": "3\n2 2 3\n1 3 3",
"output": "1 2 3"
},
{
"input": "3\n1 1 3\n2 3 3",
"output": "2 1 3"
},
{
"input": "5\n5 4 5 3 1\n2 4 4 3 1",
"output": "2 4 5 3 1"
},
{
"input": "3\n3 3 1\n2 1 1",
"output": "2 3 1"
},
{
"input": "5\n5 4 3 5 2\n5 4 1 1 2",
"output": "5 4 3 1 2"
},
{
"input": "6\n1 2 3 4 2 5\n1 6 3 4 4 5",
"output": "1 6 3 4 2 5"
},
{
"input": "4\n1 3 2 1\n2 3 2 1",
"output": "4 3 2 1"
},
{
"input": "4\n1 3 3 4\n1 4 3 4",
"output": "1 2 3 4"
},
{
"input": "11\n1 2 3 4 5 6 7 8 9 10 10\n1 2 3 4 5 6 7 8 9 10 3",
"output": "1 2 3 4 5 6 7 8 9 10 11"
},
{
"input": "5\n1 2 3 2 5\n1 4 3 3 5",
"output": "1 4 3 2 5"
},
{
"input": "5\n1 2 3 4 3\n1 2 5 4 2",
"output": "1 2 5 4 3"
},
{
"input": "5\n1 2 3 4 4\n1 2 3 4 3",
"output": "1 2 3 4 5"
},
{
"input": "4\n1 3 1 4\n1 3 4 4",
"output": "1 3 2 4"
},
{
"input": "5\n2 5 3 2 1\n4 5 3 3 1",
"output": "4 5 3 2 1"
},
{
"input": "5\n1 2 3 2 5\n1 3 3 4 5",
"output": "1 2 3 4 5"
},
{
"input": "5\n5 2 3 4 5\n2 2 3 4 5",
"output": "1 2 3 4 5"
},
{
"input": "5\n5 4 1 1 2\n5 4 3 5 2",
"output": "5 4 3 1 2"
},
{
"input": "4\n1 4 3 4\n1 3 3 4",
"output": "1 2 3 4"
},
{
"input": "4\n1 2 3 1\n1 2 3 2",
"output": "1 2 3 4"
},
{
"input": "5\n4 5 3 3 1\n2 5 3 2 1",
"output": "4 5 3 2 1"
},
{
"input": "5\n1 2 3 5 5\n1 2 3 4 3",
"output": "1 2 3 4 5"
},
{
"input": "4\n2 3 3 4\n2 4 3 4",
"output": "2 1 3 4"
}
] | 1,497,394,082
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 54
| 62
| 307,200
|
'''input
5
1 2 3 4 3
1 2 5 4 5
'''
n = int(input())
d, u, ans = [], [], ""
a, b = input().split(), input().split()
for x in range(n):
if a[x] != b[x]:
d.append(x)
else:
u.append(a[x])
u = [str(i) for i in range(1, n+1) if str(i) not in u]
if len(d) == 1:
ans = a[:d[0]] + [u[0]] + a[d[0]+1:]
else:
ans = a[:d[0]] + [u[0]] + a[d[0]+1:d[1]] + [u[1]] + b[d[1]+1:]
s1, s2 = 0, 0
for i in range(n):
if ans[i] != a[i]:
s1 += 1
for j in range(n):
if ans[j] != b[j]:
s2 += 1
if s1 >= 2 or s2 >= 2:
u = u[::-1]
ans = a[:d[0]] + [u[0]] + a[d[0]+1:d[1]] + [u[1]] + b[d[1]+1:]
print(" ".join(ans))
|
Title: An express train to reveries
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Sengoku still remembers the mysterious "colourful meteoroids" she discovered with Lala-chan when they were little. In particular, one of the nights impressed her deeply, giving her the illusion that all her fancies would be realized.
On that night, Sengoku constructed a permutation *p*1,<=*p*2,<=...,<=*p**n* of integers from 1 to *n* inclusive, with each integer representing a colour, wishing for the colours to see in the coming meteor outburst. Two incredible outbursts then arrived, each with *n* meteorids, colours of which being integer sequences *a*1,<=*a*2,<=...,<=*a**n* and *b*1,<=*b*2,<=...,<=*b**n* respectively. Meteoroids' colours were also between 1 and *n* inclusive, and the two sequences were not identical, that is, at least one *i* (1<=β€<=*i*<=β€<=*n*) exists, such that *a**i*<=β <=*b**i* holds.
Well, she almost had it all β each of the sequences *a* and *b* matched exactly *n*<=-<=1 elements in Sengoku's permutation. In other words, there is exactly one *i* (1<=β€<=*i*<=β€<=*n*) such that *a**i*<=β <=*p**i*, and exactly one *j* (1<=β€<=*j*<=β€<=*n*) such that *b**j*<=β <=*p**j*.
For now, Sengoku is able to recover the actual colour sequences *a* and *b* through astronomical records, but her wishes have been long forgotten. You are to reconstruct any possible permutation Sengoku could have had on that night.
Input Specification:
The first line of input contains a positive integer *n* (2<=β€<=*n*<=β€<=1<=000) β the length of Sengoku's permutation, being the length of both meteor outbursts at the same time.
The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=β€<=*a**i*<=β€<=*n*) β the sequence of colours in the first meteor outburst.
The third line contains *n* space-separated integers *b*1,<=*b*2,<=...,<=*b**n* (1<=β€<=*b**i*<=β€<=*n*) β the sequence of colours in the second meteor outburst. At least one *i* (1<=β€<=*i*<=β€<=*n*) exists, such that *a**i*<=β <=*b**i* holds.
Output Specification:
Output *n* space-separated integers *p*1,<=*p*2,<=...,<=*p**n*, denoting a possible permutation Sengoku could have had. If there are more than one possible answer, output any one of them.
Input guarantees that such permutation exists.
Demo Input:
['5\n1 2 3 4 3\n1 2 5 4 5\n', '5\n4 4 2 3 1\n5 4 5 3 1\n', '4\n1 1 3 4\n1 4 3 4\n']
Demo Output:
['1 2 5 4 3\n', '5 4 2 3 1\n', '1 2 3 4\n']
Note:
In the first sample, both 1,β2,β5,β4,β3 and 1,β2,β3,β4,β5 are acceptable outputs.
In the second sample, 5,β4,β2,β3,β1 is the only permutation to satisfy the constraints.
|
```python
'''input
5
1 2 3 4 3
1 2 5 4 5
'''
n = int(input())
d, u, ans = [], [], ""
a, b = input().split(), input().split()
for x in range(n):
if a[x] != b[x]:
d.append(x)
else:
u.append(a[x])
u = [str(i) for i in range(1, n+1) if str(i) not in u]
if len(d) == 1:
ans = a[:d[0]] + [u[0]] + a[d[0]+1:]
else:
ans = a[:d[0]] + [u[0]] + a[d[0]+1:d[1]] + [u[1]] + b[d[1]+1:]
s1, s2 = 0, 0
for i in range(n):
if ans[i] != a[i]:
s1 += 1
for j in range(n):
if ans[j] != b[j]:
s2 += 1
if s1 >= 2 or s2 >= 2:
u = u[::-1]
ans = a[:d[0]] + [u[0]] + a[d[0]+1:d[1]] + [u[1]] + b[d[1]+1:]
print(" ".join(ans))
```
| 3
|
|
732
|
A
|
Buy a Shovel
|
PROGRAMMING
| 800
|
[
"brute force",
"constructive algorithms",
"implementation",
"math"
] | null | null |
Polycarp urgently needs a shovel! He comes to the shop and chooses an appropriate one. The shovel that Policarp chooses is sold for *k* burles. Assume that there is an unlimited number of such shovels in the shop.
In his pocket Polycarp has an unlimited number of "10-burle coins" and exactly one coin of *r* burles (1<=β€<=*r*<=β€<=9).
What is the minimum number of shovels Polycarp has to buy so that he can pay for the purchase without any change? It is obvious that he can pay for 10 shovels without any change (by paying the requied amount of 10-burle coins and not using the coin of *r* burles). But perhaps he can buy fewer shovels and pay without any change. Note that Polycarp should buy at least one shovel.
|
The single line of input contains two integers *k* and *r* (1<=β€<=*k*<=β€<=1000, 1<=β€<=*r*<=β€<=9)Β β the price of one shovel and the denomination of the coin in Polycarp's pocket that is different from "10-burle coins".
Remember that he has an unlimited number of coins in the denomination of 10, that is, Polycarp has enough money to buy any number of shovels.
|
Print the required minimum number of shovels Polycarp has to buy so that he can pay for them without any change.
|
[
"117 3\n",
"237 7\n",
"15 2\n"
] |
[
"9\n",
"1\n",
"2\n"
] |
In the first example Polycarp can buy 9 shovels and pay 9Β·117β=β1053 burles. Indeed, he can pay this sum by using 10-burle coins and one 3-burle coin. He can't buy fewer shovels without any change.
In the second example it is enough for Polycarp to buy one shovel.
In the third example Polycarp should buy two shovels and pay 2Β·15β=β30 burles. It is obvious that he can pay this sum without any change.
| 500
|
[
{
"input": "117 3",
"output": "9"
},
{
"input": "237 7",
"output": "1"
},
{
"input": "15 2",
"output": "2"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "1 9",
"output": "9"
},
{
"input": "1000 3",
"output": "1"
},
{
"input": "1000 1",
"output": "1"
},
{
"input": "1000 9",
"output": "1"
},
{
"input": "1 2",
"output": "2"
},
{
"input": "999 9",
"output": "1"
},
{
"input": "999 8",
"output": "2"
},
{
"input": "105 6",
"output": "2"
},
{
"input": "403 9",
"output": "3"
},
{
"input": "546 4",
"output": "4"
},
{
"input": "228 9",
"output": "5"
},
{
"input": "57 2",
"output": "6"
},
{
"input": "437 9",
"output": "7"
},
{
"input": "997 6",
"output": "8"
},
{
"input": "109 1",
"output": "9"
},
{
"input": "998 9",
"output": "5"
},
{
"input": "4 2",
"output": "3"
},
{
"input": "9 3",
"output": "7"
},
{
"input": "8 2",
"output": "4"
},
{
"input": "1 3",
"output": "3"
},
{
"input": "1 4",
"output": "4"
},
{
"input": "1 5",
"output": "5"
},
{
"input": "1 6",
"output": "6"
},
{
"input": "1 7",
"output": "7"
},
{
"input": "1 8",
"output": "8"
},
{
"input": "100 3",
"output": "1"
},
{
"input": "1000 2",
"output": "1"
},
{
"input": "1000 4",
"output": "1"
},
{
"input": "1000 5",
"output": "1"
},
{
"input": "1000 6",
"output": "1"
},
{
"input": "1000 7",
"output": "1"
},
{
"input": "1000 8",
"output": "1"
},
{
"input": "23 4",
"output": "8"
},
{
"input": "33 1",
"output": "7"
},
{
"input": "33 2",
"output": "4"
},
{
"input": "666 5",
"output": "5"
},
{
"input": "2 3",
"output": "5"
},
{
"input": "5 5",
"output": "1"
},
{
"input": "3 6",
"output": "2"
},
{
"input": "12 4",
"output": "2"
},
{
"input": "15 5",
"output": "1"
},
{
"input": "2 5",
"output": "5"
},
{
"input": "25 5",
"output": "1"
},
{
"input": "2 9",
"output": "5"
},
{
"input": "6 7",
"output": "5"
},
{
"input": "8 9",
"output": "5"
},
{
"input": "2 7",
"output": "5"
},
{
"input": "4 7",
"output": "5"
},
{
"input": "2 1",
"output": "5"
},
{
"input": "261 1",
"output": "1"
}
] | 1,691,177,990
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 54
| 46
| 0
|
n,k=input("").split()
n=int(n)
t=n
k=int(k)
m=2
count=1
while(True):
if (n%10==0 or n%10==k):
break
else:
count+=1
n=t*(count)
print(count)
|
Title: Buy a Shovel
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Polycarp urgently needs a shovel! He comes to the shop and chooses an appropriate one. The shovel that Policarp chooses is sold for *k* burles. Assume that there is an unlimited number of such shovels in the shop.
In his pocket Polycarp has an unlimited number of "10-burle coins" and exactly one coin of *r* burles (1<=β€<=*r*<=β€<=9).
What is the minimum number of shovels Polycarp has to buy so that he can pay for the purchase without any change? It is obvious that he can pay for 10 shovels without any change (by paying the requied amount of 10-burle coins and not using the coin of *r* burles). But perhaps he can buy fewer shovels and pay without any change. Note that Polycarp should buy at least one shovel.
Input Specification:
The single line of input contains two integers *k* and *r* (1<=β€<=*k*<=β€<=1000, 1<=β€<=*r*<=β€<=9)Β β the price of one shovel and the denomination of the coin in Polycarp's pocket that is different from "10-burle coins".
Remember that he has an unlimited number of coins in the denomination of 10, that is, Polycarp has enough money to buy any number of shovels.
Output Specification:
Print the required minimum number of shovels Polycarp has to buy so that he can pay for them without any change.
Demo Input:
['117 3\n', '237 7\n', '15 2\n']
Demo Output:
['9\n', '1\n', '2\n']
Note:
In the first example Polycarp can buy 9 shovels and pay 9Β·117β=β1053 burles. Indeed, he can pay this sum by using 10-burle coins and one 3-burle coin. He can't buy fewer shovels without any change.
In the second example it is enough for Polycarp to buy one shovel.
In the third example Polycarp should buy two shovels and pay 2Β·15β=β30 burles. It is obvious that he can pay this sum without any change.
|
```python
n,k=input("").split()
n=int(n)
t=n
k=int(k)
m=2
count=1
while(True):
if (n%10==0 or n%10==k):
break
else:
count+=1
n=t*(count)
print(count)
```
| 3
|
|
900
|
A
|
Find Extra One
|
PROGRAMMING
| 800
|
[
"geometry",
"implementation"
] | null | null |
You have *n* distinct points on a plane, none of them lie on *OY* axis. Check that there is a point after removal of which the remaining points are located on one side of the *OY* axis.
|
The first line contains a single positive integer *n* (2<=β€<=*n*<=β€<=105).
The following *n* lines contain coordinates of the points. The *i*-th of these lines contains two single integers *x**i* and *y**i* (|*x**i*|,<=|*y**i*|<=β€<=109, *x**i*<=β <=0). No two points coincide.
|
Print "Yes" if there is such a point, "No" β otherwise.
You can print every letter in any case (upper or lower).
|
[
"3\n1 1\n-1 -1\n2 -1\n",
"4\n1 1\n2 2\n-1 1\n-2 2\n",
"3\n1 2\n2 1\n4 60\n"
] |
[
"Yes",
"No",
"Yes"
] |
In the first example the second point can be removed.
In the second example there is no suitable for the condition point.
In the third example any point can be removed.
| 500
|
[
{
"input": "3\n1 1\n-1 -1\n2 -1",
"output": "Yes"
},
{
"input": "4\n1 1\n2 2\n-1 1\n-2 2",
"output": "No"
},
{
"input": "3\n1 2\n2 1\n4 60",
"output": "Yes"
},
{
"input": "10\n1 1\n2 2\n3 3\n4 4\n5 5\n6 6\n7 7\n8 8\n9 9\n-1 -1",
"output": "Yes"
},
{
"input": "2\n1000000000 -1000000000\n1000000000 1000000000",
"output": "Yes"
},
{
"input": "23\n-1 1\n-1 2\n-2 4\n-7 -8\n-3 3\n-9 -14\n-5 3\n-6 2\n-7 11\n-4 4\n-8 5\n1 1\n-1 -1\n-1 -2\n-2 -4\n-7 8\n-3 -3\n-9 14\n-5 -3\n-6 -2\n-7 -11\n-4 -4\n-8 -5",
"output": "Yes"
},
{
"input": "4\n-1000000000 -1000000000\n1000000000 1000000000\n-1000000000 1000000000\n1000000000 -1000000000",
"output": "No"
},
{
"input": "2\n-1000000000 1000000000\n-1000000000 -1000000000",
"output": "Yes"
},
{
"input": "5\n-1 -1\n-2 2\n2 2\n2 -2\n3 2",
"output": "No"
},
{
"input": "2\n1 0\n-1 0",
"output": "Yes"
},
{
"input": "4\n-1 1\n-1 2\n-1 3\n-1 4",
"output": "Yes"
},
{
"input": "2\n-1 0\n1 0",
"output": "Yes"
},
{
"input": "2\n1 2\n-1 2",
"output": "Yes"
},
{
"input": "2\n8 0\n7 0",
"output": "Yes"
},
{
"input": "6\n-1 0\n-2 0\n-1 -1\n-1 5\n1 0\n1 1",
"output": "No"
},
{
"input": "4\n1 0\n2 0\n-1 0\n-2 0",
"output": "No"
},
{
"input": "4\n-2 0\n-1 0\n1 0\n2 0",
"output": "No"
},
{
"input": "2\n1 1\n-1 1",
"output": "Yes"
},
{
"input": "4\n-1 0\n-2 0\n1 0\n2 0",
"output": "No"
},
{
"input": "2\n4 3\n-4 -2",
"output": "Yes"
},
{
"input": "4\n1 0\n2 0\n-1 1\n-1 2",
"output": "No"
},
{
"input": "5\n1 1\n2 1\n3 1\n-1 1\n-2 1",
"output": "No"
},
{
"input": "2\n1 1\n-1 -1",
"output": "Yes"
},
{
"input": "4\n1 2\n1 0\n1 -2\n-1 2",
"output": "Yes"
},
{
"input": "5\n-2 3\n-3 3\n4 2\n3 2\n1 2",
"output": "No"
},
{
"input": "3\n2 0\n3 0\n4 0",
"output": "Yes"
},
{
"input": "5\n-3 1\n-2 1\n-1 1\n1 1\n2 1",
"output": "No"
},
{
"input": "4\n-3 0\n1 0\n2 0\n3 0",
"output": "Yes"
},
{
"input": "2\n1 0\n-1 1",
"output": "Yes"
},
{
"input": "3\n-1 0\n1 0\n2 0",
"output": "Yes"
},
{
"input": "5\n1 0\n3 0\n-1 0\n-6 0\n-4 1",
"output": "No"
},
{
"input": "5\n-1 2\n-2 2\n-3 1\n1 2\n2 3",
"output": "No"
},
{
"input": "3\n1 0\n-1 0\n-2 0",
"output": "Yes"
},
{
"input": "4\n1 0\n2 0\n3 1\n4 1",
"output": "Yes"
},
{
"input": "4\n1 0\n1 2\n1 3\n-1 5",
"output": "Yes"
},
{
"input": "4\n2 2\n2 5\n-2 3\n-2 0",
"output": "No"
},
{
"input": "4\n1 1\n-1 1\n-1 0\n-1 -1",
"output": "Yes"
},
{
"input": "4\n2 0\n3 0\n-3 -3\n-3 -4",
"output": "No"
},
{
"input": "4\n-1 0\n-2 0\n-3 0\n-4 0",
"output": "Yes"
},
{
"input": "2\n-1 1\n1 1",
"output": "Yes"
},
{
"input": "5\n1 1\n2 2\n3 3\n-4 -4\n-5 -5",
"output": "No"
},
{
"input": "5\n2 0\n3 0\n4 0\n5 0\n6 0",
"output": "Yes"
},
{
"input": "2\n-1 2\n1 2",
"output": "Yes"
},
{
"input": "4\n1 1\n2 1\n-3 0\n-4 0",
"output": "No"
},
{
"input": "4\n-1 0\n-2 0\n3 0\n4 0",
"output": "No"
},
{
"input": "3\n3 0\n2 0\n1 0",
"output": "Yes"
},
{
"input": "4\n-2 0\n-3 0\n1 -1\n3 1",
"output": "No"
},
{
"input": "3\n-1 -1\n1 1\n2 2",
"output": "Yes"
},
{
"input": "4\n-2 0\n-1 0\n2 0\n1 0",
"output": "No"
},
{
"input": "2\n-3 5\n3 5",
"output": "Yes"
},
{
"input": "2\n-1 5\n1 5",
"output": "Yes"
},
{
"input": "4\n2 0\n3 0\n-2 0\n-3 0",
"output": "No"
},
{
"input": "3\n-1 1\n1 1\n1 -1",
"output": "Yes"
},
{
"input": "2\n1 0\n2 0",
"output": "Yes"
},
{
"input": "4\n-1 1\n-2 1\n2 -1\n3 -1",
"output": "No"
},
{
"input": "5\n1 0\n2 0\n3 0\n-1 0\n-2 0",
"output": "No"
},
{
"input": "4\n-3 0\n-4 0\n-5 0\n-6 0",
"output": "Yes"
},
{
"input": "6\n-3 0\n-2 0\n-1 0\n1 0\n2 0\n3 0",
"output": "No"
},
{
"input": "4\n5 0\n5 1\n6 0\n6 1",
"output": "Yes"
}
] | 1,670,521,684
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 71
| 638
| 9,932,800
|
n = int(input())
pozitive = 0
negative = 0
for i in range(n):
x, y = map(int, input().split())
if x > 0:
pozitive += 1
else:
negative += 1
if pozitive == 0 or pozitive == 1 or negative == 0 or negative == 1:
print("Yes")
else:
print("No")
|
Title: Find Extra One
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You have *n* distinct points on a plane, none of them lie on *OY* axis. Check that there is a point after removal of which the remaining points are located on one side of the *OY* axis.
Input Specification:
The first line contains a single positive integer *n* (2<=β€<=*n*<=β€<=105).
The following *n* lines contain coordinates of the points. The *i*-th of these lines contains two single integers *x**i* and *y**i* (|*x**i*|,<=|*y**i*|<=β€<=109, *x**i*<=β <=0). No two points coincide.
Output Specification:
Print "Yes" if there is such a point, "No" β otherwise.
You can print every letter in any case (upper or lower).
Demo Input:
['3\n1 1\n-1 -1\n2 -1\n', '4\n1 1\n2 2\n-1 1\n-2 2\n', '3\n1 2\n2 1\n4 60\n']
Demo Output:
['Yes', 'No', 'Yes']
Note:
In the first example the second point can be removed.
In the second example there is no suitable for the condition point.
In the third example any point can be removed.
|
```python
n = int(input())
pozitive = 0
negative = 0
for i in range(n):
x, y = map(int, input().split())
if x > 0:
pozitive += 1
else:
negative += 1
if pozitive == 0 or pozitive == 1 or negative == 0 or negative == 1:
print("Yes")
else:
print("No")
```
| 3
|
|
136
|
A
|
Presents
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Little Petya very much likes gifts. Recently he has received a new laptop as a New Year gift from his mother. He immediately decided to give it to somebody else as what can be more pleasant than giving somebody gifts. And on this occasion he organized a New Year party at his place and invited *n* his friends there.
If there's one thing Petya likes more that receiving gifts, that's watching others giving gifts to somebody else. Thus, he safely hid the laptop until the next New Year and made up his mind to watch his friends exchanging gifts while he does not participate in the process. He numbered all his friends with integers from 1 to *n*. Petya remembered that a friend number *i* gave a gift to a friend number *p**i*. He also remembered that each of his friends received exactly one gift.
Now Petya wants to know for each friend *i* the number of a friend who has given him a gift.
|
The first line contains one integer *n* (1<=β€<=*n*<=β€<=100) β the quantity of friends Petya invited to the party. The second line contains *n* space-separated integers: the *i*-th number is *p**i* β the number of a friend who gave a gift to friend number *i*. It is guaranteed that each friend received exactly one gift. It is possible that some friends do not share Petya's ideas of giving gifts to somebody else. Those friends gave the gifts to themselves.
|
Print *n* space-separated integers: the *i*-th number should equal the number of the friend who gave a gift to friend number *i*.
|
[
"4\n2 3 4 1\n",
"3\n1 3 2\n",
"2\n1 2\n"
] |
[
"4 1 2 3\n",
"1 3 2\n",
"1 2\n"
] |
none
| 500
|
[
{
"input": "4\n2 3 4 1",
"output": "4 1 2 3"
},
{
"input": "3\n1 3 2",
"output": "1 3 2"
},
{
"input": "2\n1 2",
"output": "1 2"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "10\n1 3 2 6 4 5 7 9 8 10",
"output": "1 3 2 5 6 4 7 9 8 10"
},
{
"input": "5\n5 4 3 2 1",
"output": "5 4 3 2 1"
},
{
"input": "20\n2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19",
"output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19"
},
{
"input": "21\n3 2 1 6 5 4 9 8 7 12 11 10 15 14 13 18 17 16 21 20 19",
"output": "3 2 1 6 5 4 9 8 7 12 11 10 15 14 13 18 17 16 21 20 19"
},
{
"input": "10\n3 4 5 6 7 8 9 10 1 2",
"output": "9 10 1 2 3 4 5 6 7 8"
},
{
"input": "8\n1 5 3 7 2 6 4 8",
"output": "1 5 3 7 2 6 4 8"
},
{
"input": "50\n49 22 4 2 20 46 7 32 5 19 48 24 26 15 45 21 44 11 50 43 39 17 31 1 42 34 3 27 36 25 12 30 13 33 28 35 18 6 8 37 38 14 10 9 29 16 40 23 41 47",
"output": "24 4 27 3 9 38 7 39 44 43 18 31 33 42 14 46 22 37 10 5 16 2 48 12 30 13 28 35 45 32 23 8 34 26 36 29 40 41 21 47 49 25 20 17 15 6 50 11 1 19"
},
{
"input": "34\n13 20 33 30 15 11 27 4 8 2 29 25 24 7 3 22 18 10 26 16 5 1 32 9 34 6 12 14 28 19 31 21 23 17",
"output": "22 10 15 8 21 26 14 9 24 18 6 27 1 28 5 20 34 17 30 2 32 16 33 13 12 19 7 29 11 4 31 23 3 25"
},
{
"input": "92\n23 1 6 4 84 54 44 76 63 34 61 20 48 13 28 78 26 46 90 72 24 55 91 89 53 38 82 5 79 92 29 32 15 64 11 88 60 70 7 66 18 59 8 57 19 16 42 21 80 71 62 27 75 86 36 9 83 73 74 50 43 31 56 30 17 33 40 81 49 12 10 41 22 77 25 68 51 2 47 3 58 69 87 67 39 37 35 65 14 45 52 85",
"output": "2 78 80 4 28 3 39 43 56 71 35 70 14 89 33 46 65 41 45 12 48 73 1 21 75 17 52 15 31 64 62 32 66 10 87 55 86 26 85 67 72 47 61 7 90 18 79 13 69 60 77 91 25 6 22 63 44 81 42 37 11 51 9 34 88 40 84 76 82 38 50 20 58 59 53 8 74 16 29 49 68 27 57 5 92 54 83 36 24 19 23 30"
},
{
"input": "49\n30 24 33 48 7 3 17 2 8 35 10 39 23 40 46 32 18 21 26 22 1 16 47 45 41 28 31 6 12 43 27 11 13 37 19 15 44 5 29 42 4 38 20 34 14 9 25 36 49",
"output": "21 8 6 41 38 28 5 9 46 11 32 29 33 45 36 22 7 17 35 43 18 20 13 2 47 19 31 26 39 1 27 16 3 44 10 48 34 42 12 14 25 40 30 37 24 15 23 4 49"
},
{
"input": "12\n3 8 7 4 6 5 2 1 11 9 10 12",
"output": "8 7 1 4 6 5 3 2 10 11 9 12"
},
{
"input": "78\n16 56 36 78 21 14 9 77 26 57 70 61 41 47 18 44 5 31 50 74 65 52 6 39 22 62 67 69 43 7 64 29 24 40 48 51 73 54 72 12 19 34 4 25 55 33 17 35 23 53 10 8 27 32 42 68 20 63 3 2 1 71 58 46 13 30 49 11 37 66 38 60 28 75 15 59 45 76",
"output": "61 60 59 43 17 23 30 52 7 51 68 40 65 6 75 1 47 15 41 57 5 25 49 33 44 9 53 73 32 66 18 54 46 42 48 3 69 71 24 34 13 55 29 16 77 64 14 35 67 19 36 22 50 38 45 2 10 63 76 72 12 26 58 31 21 70 27 56 28 11 62 39 37 20 74 78 8 4"
},
{
"input": "64\n64 57 40 3 15 8 62 18 33 59 51 19 22 13 4 37 47 45 50 35 63 11 58 42 46 21 7 2 41 48 32 23 28 38 17 12 24 27 49 31 60 6 30 25 61 52 26 54 9 14 29 20 44 39 55 10 34 16 5 56 1 36 53 43",
"output": "61 28 4 15 59 42 27 6 49 56 22 36 14 50 5 58 35 8 12 52 26 13 32 37 44 47 38 33 51 43 40 31 9 57 20 62 16 34 54 3 29 24 64 53 18 25 17 30 39 19 11 46 63 48 55 60 2 23 10 41 45 7 21 1"
},
{
"input": "49\n38 20 49 32 14 41 39 45 25 48 40 19 26 43 34 12 10 3 35 42 5 7 46 47 4 2 13 22 16 24 33 15 11 18 29 31 23 9 44 36 6 17 37 1 30 28 8 21 27",
"output": "44 26 18 25 21 41 22 47 38 17 33 16 27 5 32 29 42 34 12 2 48 28 37 30 9 13 49 46 35 45 36 4 31 15 19 40 43 1 7 11 6 20 14 39 8 23 24 10 3"
},
{
"input": "78\n17 50 30 48 33 12 42 4 18 53 76 67 38 3 20 72 51 55 60 63 46 10 57 45 54 32 24 62 8 11 35 44 65 74 58 28 2 6 56 52 39 23 47 49 61 1 66 41 15 77 7 27 78 13 14 34 5 31 37 21 40 16 29 69 59 43 64 36 70 19 25 73 71 75 9 68 26 22",
"output": "46 37 14 8 57 38 51 29 75 22 30 6 54 55 49 62 1 9 70 15 60 78 42 27 71 77 52 36 63 3 58 26 5 56 31 68 59 13 41 61 48 7 66 32 24 21 43 4 44 2 17 40 10 25 18 39 23 35 65 19 45 28 20 67 33 47 12 76 64 69 73 16 72 34 74 11 50 53"
},
{
"input": "29\n14 21 27 1 4 18 10 17 20 23 2 24 7 9 28 22 8 25 12 15 11 6 16 29 3 26 19 5 13",
"output": "4 11 25 5 28 22 13 17 14 7 21 19 29 1 20 23 8 6 27 9 2 16 10 12 18 26 3 15 24"
},
{
"input": "82\n6 1 10 75 28 66 61 81 78 63 17 19 58 34 49 12 67 50 41 44 3 15 59 38 51 72 36 11 46 29 18 64 27 23 13 53 56 68 2 25 47 40 69 54 42 5 60 55 4 16 24 79 57 20 7 73 32 80 76 52 82 37 26 31 65 8 39 62 33 71 30 9 77 43 48 74 70 22 14 45 35 21",
"output": "2 39 21 49 46 1 55 66 72 3 28 16 35 79 22 50 11 31 12 54 82 78 34 51 40 63 33 5 30 71 64 57 69 14 81 27 62 24 67 42 19 45 74 20 80 29 41 75 15 18 25 60 36 44 48 37 53 13 23 47 7 68 10 32 65 6 17 38 43 77 70 26 56 76 4 59 73 9 52 58 8 61"
},
{
"input": "82\n74 18 15 69 71 77 19 26 80 20 66 7 30 82 22 48 21 44 52 65 64 61 35 49 12 8 53 81 54 16 11 9 40 46 13 1 29 58 5 41 55 4 78 60 6 51 56 2 38 36 34 62 63 25 17 67 45 14 32 37 75 79 10 47 27 39 31 68 59 24 50 43 72 70 42 28 76 23 57 3 73 33",
"output": "36 48 80 42 39 45 12 26 32 63 31 25 35 58 3 30 55 2 7 10 17 15 78 70 54 8 65 76 37 13 67 59 82 51 23 50 60 49 66 33 40 75 72 18 57 34 64 16 24 71 46 19 27 29 41 47 79 38 69 44 22 52 53 21 20 11 56 68 4 74 5 73 81 1 61 77 6 43 62 9 28 14"
},
{
"input": "45\n2 32 34 13 3 15 16 33 22 12 31 38 42 14 27 7 36 8 4 19 45 41 5 35 10 11 39 20 29 44 17 9 6 40 37 28 25 21 1 30 24 18 43 26 23",
"output": "39 1 5 19 23 33 16 18 32 25 26 10 4 14 6 7 31 42 20 28 38 9 45 41 37 44 15 36 29 40 11 2 8 3 24 17 35 12 27 34 22 13 43 30 21"
},
{
"input": "45\n4 32 33 39 43 21 22 35 45 7 14 5 16 9 42 31 24 36 17 29 41 25 37 34 27 20 11 44 3 13 19 2 1 10 26 30 38 18 6 8 15 23 40 28 12",
"output": "33 32 29 1 12 39 10 40 14 34 27 45 30 11 41 13 19 38 31 26 6 7 42 17 22 35 25 44 20 36 16 2 3 24 8 18 23 37 4 43 21 15 5 28 9"
},
{
"input": "74\n48 72 40 67 17 4 27 53 11 32 25 9 74 2 41 24 56 22 14 21 33 5 18 55 20 7 29 36 69 13 52 19 38 30 68 59 66 34 63 6 47 45 54 44 62 12 50 71 16 10 8 64 57 73 46 26 49 42 3 23 35 1 61 39 70 60 65 43 15 28 37 51 58 31",
"output": "62 14 59 6 22 40 26 51 12 50 9 46 30 19 69 49 5 23 32 25 20 18 60 16 11 56 7 70 27 34 74 10 21 38 61 28 71 33 64 3 15 58 68 44 42 55 41 1 57 47 72 31 8 43 24 17 53 73 36 66 63 45 39 52 67 37 4 35 29 65 48 2 54 13"
},
{
"input": "47\n9 26 27 10 6 34 28 42 39 22 45 21 11 43 14 47 38 15 40 32 46 1 36 29 17 25 2 23 31 5 24 4 7 8 12 19 16 44 37 20 18 33 30 13 35 41 3",
"output": "22 27 47 32 30 5 33 34 1 4 13 35 44 15 18 37 25 41 36 40 12 10 28 31 26 2 3 7 24 43 29 20 42 6 45 23 39 17 9 19 46 8 14 38 11 21 16"
},
{
"input": "49\n14 38 6 29 9 49 36 43 47 3 44 20 34 15 7 11 1 28 12 40 16 37 31 10 42 41 33 21 18 30 5 27 17 35 25 26 45 19 2 13 23 32 4 22 46 48 24 39 8",
"output": "17 39 10 43 31 3 15 49 5 24 16 19 40 1 14 21 33 29 38 12 28 44 41 47 35 36 32 18 4 30 23 42 27 13 34 7 22 2 48 20 26 25 8 11 37 45 9 46 6"
},
{
"input": "100\n78 56 31 91 90 95 16 65 58 77 37 89 33 61 10 76 62 47 35 67 69 7 63 83 22 25 49 8 12 30 39 44 57 64 48 42 32 11 70 43 55 50 99 24 85 73 45 14 54 21 98 84 74 2 26 18 9 36 80 53 75 46 66 86 59 93 87 68 94 13 72 28 79 88 92 29 52 82 34 97 19 38 1 41 27 4 40 5 96 100 51 6 20 23 81 15 17 3 60 71",
"output": "83 54 98 86 88 92 22 28 57 15 38 29 70 48 96 7 97 56 81 93 50 25 94 44 26 55 85 72 76 30 3 37 13 79 19 58 11 82 31 87 84 36 40 32 47 62 18 35 27 42 91 77 60 49 41 2 33 9 65 99 14 17 23 34 8 63 20 68 21 39 100 71 46 53 61 16 10 1 73 59 95 78 24 52 45 64 67 74 12 5 4 75 66 69 6 89 80 51 43 90"
},
{
"input": "22\n12 8 11 2 16 7 13 6 22 21 20 10 4 14 18 1 5 15 3 19 17 9",
"output": "16 4 19 13 17 8 6 2 22 12 3 1 7 14 18 5 21 15 20 11 10 9"
},
{
"input": "72\n16 11 49 51 3 27 60 55 23 40 66 7 53 70 13 5 15 32 18 72 33 30 8 31 46 12 28 67 25 38 50 22 69 34 71 52 58 39 24 35 42 9 41 26 62 1 63 65 36 64 68 61 37 14 45 47 6 57 54 20 17 2 56 59 29 10 4 48 21 43 19 44",
"output": "46 62 5 67 16 57 12 23 42 66 2 26 15 54 17 1 61 19 71 60 69 32 9 39 29 44 6 27 65 22 24 18 21 34 40 49 53 30 38 10 43 41 70 72 55 25 56 68 3 31 4 36 13 59 8 63 58 37 64 7 52 45 47 50 48 11 28 51 33 14 35 20"
},
{
"input": "63\n21 56 11 10 62 24 20 42 28 52 38 2 37 43 48 22 7 8 40 14 13 46 53 1 23 4 60 63 51 36 25 12 39 32 49 16 58 44 31 61 33 50 55 54 45 6 47 41 9 57 30 29 26 18 19 27 15 34 3 35 59 5 17",
"output": "24 12 59 26 62 46 17 18 49 4 3 32 21 20 57 36 63 54 55 7 1 16 25 6 31 53 56 9 52 51 39 34 41 58 60 30 13 11 33 19 48 8 14 38 45 22 47 15 35 42 29 10 23 44 43 2 50 37 61 27 40 5 28"
},
{
"input": "18\n2 16 8 4 18 12 3 6 5 9 10 15 11 17 14 13 1 7",
"output": "17 1 7 4 9 8 18 3 10 11 13 6 16 15 12 2 14 5"
},
{
"input": "47\n6 9 10 41 25 3 4 37 20 1 36 22 29 27 11 24 43 31 12 17 34 42 38 39 13 2 7 21 18 5 15 35 44 26 33 46 19 40 30 14 28 23 47 32 45 8 16",
"output": "10 26 6 7 30 1 27 46 2 3 15 19 25 40 31 47 20 29 37 9 28 12 42 16 5 34 14 41 13 39 18 44 35 21 32 11 8 23 24 38 4 22 17 33 45 36 43"
},
{
"input": "96\n41 91 48 88 29 57 1 19 44 43 37 5 10 75 25 63 30 78 76 53 8 92 18 70 39 17 49 60 9 16 3 34 86 59 23 79 55 45 72 51 28 33 96 40 26 54 6 32 89 61 85 74 7 82 52 31 64 66 94 95 11 22 2 73 35 13 42 71 14 47 84 69 50 67 58 12 77 46 38 68 15 36 20 93 27 90 83 56 87 4 21 24 81 62 80 65",
"output": "7 63 31 90 12 47 53 21 29 13 61 76 66 69 81 30 26 23 8 83 91 62 35 92 15 45 85 41 5 17 56 48 42 32 65 82 11 79 25 44 1 67 10 9 38 78 70 3 27 73 40 55 20 46 37 88 6 75 34 28 50 94 16 57 96 58 74 80 72 24 68 39 64 52 14 19 77 18 36 95 93 54 87 71 51 33 89 4 49 86 2 22 84 59 60 43"
},
{
"input": "73\n67 24 39 22 23 20 48 34 42 40 19 70 65 69 64 21 53 11 59 15 26 10 30 33 72 29 55 25 56 71 8 9 57 49 41 61 13 12 6 27 66 36 47 50 73 60 2 37 7 4 51 17 1 46 14 62 35 3 45 63 43 58 54 32 31 5 28 44 18 52 68 38 16",
"output": "53 47 58 50 66 39 49 31 32 22 18 38 37 55 20 73 52 69 11 6 16 4 5 2 28 21 40 67 26 23 65 64 24 8 57 42 48 72 3 10 35 9 61 68 59 54 43 7 34 44 51 70 17 63 27 29 33 62 19 46 36 56 60 15 13 41 1 71 14 12 30 25 45"
},
{
"input": "81\n25 2 78 40 12 80 69 13 49 43 17 33 23 54 32 61 77 66 27 71 24 26 42 55 60 9 5 30 7 37 45 63 53 11 38 44 68 34 28 52 67 22 57 46 47 50 8 16 79 62 4 36 20 14 73 64 6 76 35 74 58 10 29 81 59 31 19 1 75 39 70 18 41 21 72 65 3 48 15 56 51",
"output": "68 2 77 51 27 57 29 47 26 62 34 5 8 54 79 48 11 72 67 53 74 42 13 21 1 22 19 39 63 28 66 15 12 38 59 52 30 35 70 4 73 23 10 36 31 44 45 78 9 46 81 40 33 14 24 80 43 61 65 25 16 50 32 56 76 18 41 37 7 71 20 75 55 60 69 58 17 3 49 6 64"
},
{
"input": "12\n12 3 1 5 11 6 7 10 2 8 9 4",
"output": "3 9 2 12 4 6 7 10 11 8 5 1"
},
{
"input": "47\n7 21 41 18 40 31 12 28 24 14 43 23 33 10 19 38 26 8 34 15 29 44 5 13 39 25 3 27 20 42 35 9 2 1 30 46 36 32 4 22 37 45 6 47 11 16 17",
"output": "34 33 27 39 23 43 1 18 32 14 45 7 24 10 20 46 47 4 15 29 2 40 12 9 26 17 28 8 21 35 6 38 13 19 31 37 41 16 25 5 3 30 11 22 42 36 44"
},
{
"input": "8\n1 3 5 2 4 8 6 7",
"output": "1 4 2 5 3 7 8 6"
},
{
"input": "38\n28 8 2 33 20 32 26 29 23 31 15 38 11 37 18 21 22 19 4 34 1 35 16 7 17 6 27 30 36 12 9 24 25 13 5 3 10 14",
"output": "21 3 36 19 35 26 24 2 31 37 13 30 34 38 11 23 25 15 18 5 16 17 9 32 33 7 27 1 8 28 10 6 4 20 22 29 14 12"
},
{
"input": "10\n2 9 4 6 10 1 7 5 3 8",
"output": "6 1 9 3 8 4 7 10 2 5"
},
{
"input": "23\n20 11 15 1 5 12 23 9 2 22 13 19 16 14 7 4 8 21 6 17 18 10 3",
"output": "4 9 23 16 5 19 15 17 8 22 2 6 11 14 3 13 20 21 12 1 18 10 7"
},
{
"input": "10\n2 4 9 3 6 8 10 5 1 7",
"output": "9 1 4 2 8 5 10 6 3 7"
},
{
"input": "55\n9 48 23 49 11 24 4 22 34 32 17 45 39 13 14 21 19 25 2 31 37 7 55 36 20 51 5 12 54 10 35 40 43 1 46 18 53 41 38 26 29 50 3 42 52 27 8 28 47 33 6 16 30 44 15",
"output": "34 19 43 7 27 51 22 47 1 30 5 28 14 15 55 52 11 36 17 25 16 8 3 6 18 40 46 48 41 53 20 10 50 9 31 24 21 39 13 32 38 44 33 54 12 35 49 2 4 42 26 45 37 29 23"
},
{
"input": "58\n49 13 12 54 2 38 56 11 33 25 26 19 28 8 23 41 20 36 46 55 15 35 9 7 32 37 58 6 3 14 47 31 40 30 53 44 4 50 29 34 10 43 39 57 5 22 27 45 51 42 24 16 18 21 52 17 48 1",
"output": "58 5 29 37 45 28 24 14 23 41 8 3 2 30 21 52 56 53 12 17 54 46 15 51 10 11 47 13 39 34 32 25 9 40 22 18 26 6 43 33 16 50 42 36 48 19 31 57 1 38 49 55 35 4 20 7 44 27"
},
{
"input": "34\n20 25 2 3 33 29 1 16 14 7 21 9 32 31 6 26 22 4 27 23 24 10 34 12 19 15 5 18 28 17 13 8 11 30",
"output": "7 3 4 18 27 15 10 32 12 22 33 24 31 9 26 8 30 28 25 1 11 17 20 21 2 16 19 29 6 34 14 13 5 23"
},
{
"input": "53\n47 29 46 25 23 13 7 31 33 4 38 11 35 16 42 14 15 43 34 39 28 18 6 45 30 1 40 20 2 37 5 32 24 12 44 26 27 3 19 51 36 21 22 9 10 50 41 48 49 53 8 17 52",
"output": "26 29 38 10 31 23 7 51 44 45 12 34 6 16 17 14 52 22 39 28 42 43 5 33 4 36 37 21 2 25 8 32 9 19 13 41 30 11 20 27 47 15 18 35 24 3 1 48 49 46 40 53 50"
},
{
"input": "99\n77 87 90 48 53 38 68 6 28 57 35 82 63 71 60 41 3 12 86 65 10 59 22 67 33 74 93 27 24 1 61 43 25 4 51 52 15 88 9 31 30 42 89 49 23 21 29 32 46 73 37 16 5 69 56 26 92 64 20 54 75 14 98 13 94 2 95 7 36 66 58 8 50 78 84 45 11 96 76 62 97 80 40 39 47 85 34 79 83 17 91 72 19 44 70 81 55 99 18",
"output": "30 66 17 34 53 8 68 72 39 21 77 18 64 62 37 52 90 99 93 59 46 23 45 29 33 56 28 9 47 41 40 48 25 87 11 69 51 6 84 83 16 42 32 94 76 49 85 4 44 73 35 36 5 60 97 55 10 71 22 15 31 80 13 58 20 70 24 7 54 95 14 92 50 26 61 79 1 74 88 82 96 12 89 75 86 19 2 38 43 3 91 57 27 65 67 78 81 63 98"
},
{
"input": "32\n17 29 2 6 30 8 26 7 1 27 10 9 13 24 31 21 15 19 22 18 4 11 25 28 32 3 23 12 5 14 20 16",
"output": "9 3 26 21 29 4 8 6 12 11 22 28 13 30 17 32 1 20 18 31 16 19 27 14 23 7 10 24 2 5 15 25"
},
{
"input": "65\n18 40 1 60 17 19 4 6 12 49 28 58 2 25 13 14 64 56 61 34 62 30 59 51 26 8 33 63 36 48 46 7 43 21 31 27 11 44 29 5 32 23 35 9 53 57 52 50 15 38 42 3 54 65 55 41 20 24 22 47 45 10 39 16 37",
"output": "3 13 52 7 40 8 32 26 44 62 37 9 15 16 49 64 5 1 6 57 34 59 42 58 14 25 36 11 39 22 35 41 27 20 43 29 65 50 63 2 56 51 33 38 61 31 60 30 10 48 24 47 45 53 55 18 46 12 23 4 19 21 28 17 54"
},
{
"input": "71\n35 50 55 58 25 32 26 40 63 34 44 53 24 18 37 7 64 27 56 65 1 19 2 43 42 14 57 47 22 13 59 61 39 67 30 45 54 38 33 48 6 5 3 69 36 21 41 4 16 46 20 17 15 12 10 70 68 23 60 31 52 29 66 28 51 49 62 11 8 9 71",
"output": "21 23 43 48 42 41 16 69 70 55 68 54 30 26 53 49 52 14 22 51 46 29 58 13 5 7 18 64 62 35 60 6 39 10 1 45 15 38 33 8 47 25 24 11 36 50 28 40 66 2 65 61 12 37 3 19 27 4 31 59 32 67 9 17 20 63 34 57 44 56 71"
},
{
"input": "74\n33 8 42 63 64 61 31 74 11 50 68 14 36 25 57 30 7 44 21 15 6 9 23 59 46 3 73 16 62 51 40 60 41 54 5 39 35 28 48 4 58 12 66 69 13 26 71 1 24 19 29 52 37 2 20 43 18 72 17 56 34 38 65 67 27 10 47 70 53 32 45 55 49 22",
"output": "48 54 26 40 35 21 17 2 22 66 9 42 45 12 20 28 59 57 50 55 19 74 23 49 14 46 65 38 51 16 7 70 1 61 37 13 53 62 36 31 33 3 56 18 71 25 67 39 73 10 30 52 69 34 72 60 15 41 24 32 6 29 4 5 63 43 64 11 44 68 47 58 27 8"
},
{
"input": "96\n78 10 82 46 38 91 77 69 2 27 58 80 79 44 59 41 6 31 76 11 42 48 51 37 19 87 43 25 52 32 1 39 63 29 21 65 53 74 92 16 15 95 90 83 30 73 71 5 50 17 96 33 86 60 67 64 20 26 61 40 55 88 94 93 9 72 47 57 14 45 22 3 54 68 13 24 4 7 56 81 89 70 49 8 84 28 18 62 35 36 75 23 66 85 34 12",
"output": "31 9 72 77 48 17 78 84 65 2 20 96 75 69 41 40 50 87 25 57 35 71 92 76 28 58 10 86 34 45 18 30 52 95 89 90 24 5 32 60 16 21 27 14 70 4 67 22 83 49 23 29 37 73 61 79 68 11 15 54 59 88 33 56 36 93 55 74 8 82 47 66 46 38 91 19 7 1 13 12 80 3 44 85 94 53 26 62 81 43 6 39 64 63 42 51"
},
{
"input": "7\n2 1 5 7 3 4 6",
"output": "2 1 5 6 3 7 4"
},
{
"input": "51\n8 33 37 2 16 22 24 30 4 9 5 15 27 3 18 39 31 26 10 17 46 41 25 14 6 1 29 48 36 20 51 49 21 43 19 13 38 50 47 34 11 23 28 12 42 7 32 40 44 45 35",
"output": "26 4 14 9 11 25 46 1 10 19 41 44 36 24 12 5 20 15 35 30 33 6 42 7 23 18 13 43 27 8 17 47 2 40 51 29 3 37 16 48 22 45 34 49 50 21 39 28 32 38 31"
},
{
"input": "27\n12 14 7 3 20 21 25 13 22 15 23 4 2 24 10 17 19 8 26 11 27 18 9 5 6 1 16",
"output": "26 13 4 12 24 25 3 18 23 15 20 1 8 2 10 27 16 22 17 5 6 9 11 14 7 19 21"
},
{
"input": "71\n51 13 20 48 54 23 24 64 14 62 71 67 57 53 3 30 55 43 33 25 39 40 66 6 46 18 5 19 61 16 32 68 70 41 60 44 29 49 27 69 50 38 10 17 45 56 9 21 26 63 28 35 7 59 1 65 2 15 8 11 12 34 37 47 58 22 31 4 36 42 52",
"output": "55 57 15 68 27 24 53 59 47 43 60 61 2 9 58 30 44 26 28 3 48 66 6 7 20 49 39 51 37 16 67 31 19 62 52 69 63 42 21 22 34 70 18 36 45 25 64 4 38 41 1 71 14 5 17 46 13 65 54 35 29 10 50 8 56 23 12 32 40 33 11"
},
{
"input": "9\n8 5 2 6 1 9 4 7 3",
"output": "5 3 9 7 2 4 8 1 6"
},
{
"input": "29\n10 24 11 5 26 25 2 9 22 15 8 14 29 21 4 1 23 17 3 12 13 16 18 28 19 20 7 6 27",
"output": "16 7 19 15 4 28 27 11 8 1 3 20 21 12 10 22 18 23 25 26 14 9 17 2 6 5 29 24 13"
},
{
"input": "60\n39 25 42 4 55 60 16 18 47 1 11 40 7 50 19 35 49 54 12 3 30 38 2 58 17 26 45 6 33 43 37 32 52 36 15 23 27 59 24 20 28 14 8 9 13 29 44 46 41 21 5 48 51 22 31 56 57 53 10 34",
"output": "10 23 20 4 51 28 13 43 44 59 11 19 45 42 35 7 25 8 15 40 50 54 36 39 2 26 37 41 46 21 55 32 29 60 16 34 31 22 1 12 49 3 30 47 27 48 9 52 17 14 53 33 58 18 5 56 57 24 38 6"
},
{
"input": "50\n37 45 22 5 12 21 28 24 18 47 20 25 8 50 14 2 34 43 11 16 49 41 48 1 19 31 39 46 32 23 15 42 3 35 38 30 44 26 10 9 40 36 7 17 33 4 27 6 13 29",
"output": "24 16 33 46 4 48 43 13 40 39 19 5 49 15 31 20 44 9 25 11 6 3 30 8 12 38 47 7 50 36 26 29 45 17 34 42 1 35 27 41 22 32 18 37 2 28 10 23 21 14"
},
{
"input": "30\n8 29 28 16 17 25 27 15 21 11 6 20 2 13 1 30 5 4 24 10 14 3 23 18 26 9 12 22 19 7",
"output": "15 13 22 18 17 11 30 1 26 20 10 27 14 21 8 4 5 24 29 12 9 28 23 19 6 25 7 3 2 16"
},
{
"input": "46\n15 2 44 43 38 19 31 42 4 37 29 30 24 45 27 41 8 20 33 7 35 3 18 46 36 26 1 28 21 40 16 22 32 11 14 13 12 9 25 39 10 6 23 17 5 34",
"output": "27 2 22 9 45 42 20 17 38 41 34 37 36 35 1 31 44 23 6 18 29 32 43 13 39 26 15 28 11 12 7 33 19 46 21 25 10 5 40 30 16 8 4 3 14 24"
},
{
"input": "9\n4 8 6 5 3 9 2 7 1",
"output": "9 7 5 1 4 3 8 2 6"
},
{
"input": "46\n31 30 33 23 45 7 36 8 11 3 32 39 41 20 1 28 6 27 18 24 17 5 16 37 26 13 22 14 2 38 15 46 9 4 19 21 12 44 10 35 25 34 42 43 40 29",
"output": "15 29 10 34 22 17 6 8 33 39 9 37 26 28 31 23 21 19 35 14 36 27 4 20 41 25 18 16 46 2 1 11 3 42 40 7 24 30 12 45 13 43 44 38 5 32"
},
{
"input": "66\n27 12 37 48 46 21 34 58 38 28 66 2 64 32 44 31 13 36 40 15 19 11 22 5 30 29 6 7 61 39 20 42 23 54 51 33 50 9 60 8 57 45 49 10 62 41 59 3 55 63 52 24 25 26 43 56 65 4 16 14 1 35 18 17 53 47",
"output": "61 12 48 58 24 27 28 40 38 44 22 2 17 60 20 59 64 63 21 31 6 23 33 52 53 54 1 10 26 25 16 14 36 7 62 18 3 9 30 19 46 32 55 15 42 5 66 4 43 37 35 51 65 34 49 56 41 8 47 39 29 45 50 13 57 11"
},
{
"input": "13\n3 12 9 2 8 5 13 4 11 1 10 7 6",
"output": "10 4 1 8 6 13 12 5 3 11 9 2 7"
},
{
"input": "80\n21 25 56 50 20 61 7 74 51 69 8 2 46 57 45 71 14 52 17 43 9 30 70 78 31 10 38 13 23 15 37 79 6 16 77 73 80 4 49 48 18 28 26 58 33 41 64 22 54 72 59 60 40 63 53 27 1 5 75 67 62 34 19 39 68 65 44 55 3 32 11 42 76 12 35 47 66 36 24 29",
"output": "57 12 69 38 58 33 7 11 21 26 71 74 28 17 30 34 19 41 63 5 1 48 29 79 2 43 56 42 80 22 25 70 45 62 75 78 31 27 64 53 46 72 20 67 15 13 76 40 39 4 9 18 55 49 68 3 14 44 51 52 6 61 54 47 66 77 60 65 10 23 16 50 36 8 59 73 35 24 32 37"
},
{
"input": "63\n9 49 53 25 40 46 43 51 54 22 58 16 23 26 10 47 5 27 2 8 61 59 19 35 63 56 28 20 34 4 62 38 6 55 36 31 57 15 29 33 1 48 50 37 7 30 18 42 32 52 12 41 14 21 45 11 24 17 39 13 44 60 3",
"output": "41 19 63 30 17 33 45 20 1 15 56 51 60 53 38 12 58 47 23 28 54 10 13 57 4 14 18 27 39 46 36 49 40 29 24 35 44 32 59 5 52 48 7 61 55 6 16 42 2 43 8 50 3 9 34 26 37 11 22 62 21 31 25"
},
{
"input": "26\n11 4 19 13 17 9 2 24 6 5 22 23 14 15 3 25 16 8 18 10 21 1 12 26 7 20",
"output": "22 7 15 2 10 9 25 18 6 20 1 23 4 13 14 17 5 19 3 26 21 11 12 8 16 24"
},
{
"input": "69\n40 22 11 66 4 27 31 29 64 53 37 55 51 2 7 36 18 52 6 1 30 21 17 20 14 9 59 62 49 68 3 50 65 57 44 5 67 46 33 13 34 15 24 48 63 58 38 25 41 35 16 54 32 10 60 61 39 12 69 8 23 45 26 47 56 43 28 19 42",
"output": "20 14 31 5 36 19 15 60 26 54 3 58 40 25 42 51 23 17 68 24 22 2 61 43 48 63 6 67 8 21 7 53 39 41 50 16 11 47 57 1 49 69 66 35 62 38 64 44 29 32 13 18 10 52 12 65 34 46 27 55 56 28 45 9 33 4 37 30 59"
},
{
"input": "6\n4 3 6 5 1 2",
"output": "5 6 2 1 4 3"
},
{
"input": "9\n7 8 5 3 1 4 2 9 6",
"output": "5 7 4 6 3 9 1 2 8"
},
{
"input": "41\n27 24 16 30 25 8 32 2 26 20 39 33 41 22 40 14 36 9 28 4 34 11 31 23 19 18 17 35 3 10 6 13 5 15 29 38 7 21 1 12 37",
"output": "39 8 29 20 33 31 37 6 18 30 22 40 32 16 34 3 27 26 25 10 38 14 24 2 5 9 1 19 35 4 23 7 12 21 28 17 41 36 11 15 13"
},
{
"input": "1\n1",
"output": "1"
},
{
"input": "20\n2 6 4 18 7 10 17 13 16 8 14 9 20 5 19 12 1 3 15 11",
"output": "17 1 18 3 14 2 5 10 12 6 20 16 8 11 19 9 7 4 15 13"
},
{
"input": "2\n2 1",
"output": "2 1"
},
{
"input": "60\n2 4 31 51 11 7 34 20 3 14 18 23 48 54 15 36 38 60 49 40 5 33 41 26 55 58 10 8 13 9 27 30 37 1 21 59 44 57 35 19 46 43 42 45 12 22 39 32 24 16 6 56 53 52 25 17 47 29 50 28",
"output": "34 1 9 2 21 51 6 28 30 27 5 45 29 10 15 50 56 11 40 8 35 46 12 49 55 24 31 60 58 32 3 48 22 7 39 16 33 17 47 20 23 43 42 37 44 41 57 13 19 59 4 54 53 14 25 52 38 26 36 18"
},
{
"input": "14\n14 6 3 12 11 2 7 1 10 9 8 5 4 13",
"output": "8 6 3 13 12 2 7 11 10 9 5 4 14 1"
},
{
"input": "81\n13 43 79 8 7 21 73 46 63 4 62 78 56 11 70 68 61 53 60 49 16 27 59 47 69 5 22 44 77 57 52 48 1 9 72 81 28 55 58 33 51 18 31 17 41 20 42 3 32 54 19 2 75 34 64 10 65 50 30 29 67 12 71 66 74 15 26 23 6 38 25 35 37 24 80 76 40 45 39 36 14",
"output": "33 52 48 10 26 69 5 4 34 56 14 62 1 81 66 21 44 42 51 46 6 27 68 74 71 67 22 37 60 59 43 49 40 54 72 80 73 70 79 77 45 47 2 28 78 8 24 32 20 58 41 31 18 50 38 13 30 39 23 19 17 11 9 55 57 64 61 16 25 15 63 35 7 65 53 76 29 12 3 75 36"
},
{
"input": "42\n41 11 10 8 21 37 32 19 31 25 1 15 36 5 6 27 4 3 13 7 16 17 2 23 34 24 38 28 12 20 30 42 18 26 39 35 33 40 9 14 22 29",
"output": "11 23 18 17 14 15 20 4 39 3 2 29 19 40 12 21 22 33 8 30 5 41 24 26 10 34 16 28 42 31 9 7 37 25 36 13 6 27 35 38 1 32"
},
{
"input": "97\n20 6 76 42 4 18 35 59 39 63 27 7 66 47 61 52 15 36 88 93 19 33 10 92 1 34 46 86 78 57 51 94 77 29 26 73 41 2 58 97 43 65 17 74 21 49 25 3 91 82 95 12 96 13 84 90 69 24 72 37 16 55 54 71 64 62 48 89 11 70 80 67 30 40 44 85 53 83 79 9 56 45 75 87 22 14 81 68 8 38 60 50 28 23 31 32 5",
"output": "25 38 48 5 97 2 12 89 80 23 69 52 54 86 17 61 43 6 21 1 45 85 94 58 47 35 11 93 34 73 95 96 22 26 7 18 60 90 9 74 37 4 41 75 82 27 14 67 46 92 31 16 77 63 62 81 30 39 8 91 15 66 10 65 42 13 72 88 57 70 64 59 36 44 83 3 33 29 79 71 87 50 78 55 76 28 84 19 68 56 49 24 20 32 51 53 40"
},
{
"input": "62\n15 27 46 6 8 51 14 56 23 48 42 49 52 22 20 31 29 12 47 3 62 34 37 35 32 57 19 25 5 60 61 38 18 10 11 55 45 53 17 30 9 36 4 50 41 16 44 28 40 59 24 1 13 39 26 7 33 58 2 43 21 54",
"output": "52 59 20 43 29 4 56 5 41 34 35 18 53 7 1 46 39 33 27 15 61 14 9 51 28 55 2 48 17 40 16 25 57 22 24 42 23 32 54 49 45 11 60 47 37 3 19 10 12 44 6 13 38 62 36 8 26 58 50 30 31 21"
},
{
"input": "61\n35 27 4 61 52 32 41 46 14 37 17 54 55 31 11 26 44 49 15 30 9 50 45 39 7 38 53 3 58 40 13 56 18 19 28 6 43 5 21 42 20 34 2 25 36 12 33 57 16 60 1 8 59 10 22 23 24 48 51 47 29",
"output": "51 43 28 3 38 36 25 52 21 54 15 46 31 9 19 49 11 33 34 41 39 55 56 57 44 16 2 35 61 20 14 6 47 42 1 45 10 26 24 30 7 40 37 17 23 8 60 58 18 22 59 5 27 12 13 32 48 29 53 50 4"
},
{
"input": "59\n31 26 36 15 17 19 10 53 11 34 13 46 55 9 44 7 8 37 32 52 47 25 51 22 35 39 41 4 43 24 5 27 20 57 6 38 3 28 21 40 50 18 14 56 33 45 12 2 49 59 54 29 16 48 42 58 1 30 23",
"output": "57 48 37 28 31 35 16 17 14 7 9 47 11 43 4 53 5 42 6 33 39 24 59 30 22 2 32 38 52 58 1 19 45 10 25 3 18 36 26 40 27 55 29 15 46 12 21 54 49 41 23 20 8 51 13 44 34 56 50"
},
{
"input": "10\n2 10 7 4 1 5 8 6 3 9",
"output": "5 1 9 4 6 8 3 7 10 2"
},
{
"input": "14\n14 2 1 8 6 12 11 10 9 7 3 4 5 13",
"output": "3 2 11 12 13 5 10 4 9 8 7 6 14 1"
},
{
"input": "43\n28 38 15 14 31 42 27 30 19 33 43 26 22 29 18 32 3 13 1 8 35 34 4 12 11 17 41 21 5 25 39 37 20 23 7 24 16 10 40 9 6 36 2",
"output": "19 43 17 23 29 41 35 20 40 38 25 24 18 4 3 37 26 15 9 33 28 13 34 36 30 12 7 1 14 8 5 16 10 22 21 42 32 2 31 39 27 6 11"
},
{
"input": "86\n39 11 20 31 28 76 29 64 35 21 41 71 12 82 5 37 80 73 38 26 79 75 23 15 59 45 47 6 3 62 50 49 51 22 2 65 86 60 70 42 74 17 1 30 55 44 8 66 81 27 57 77 43 13 54 32 72 46 48 56 14 34 78 52 36 85 24 19 69 83 25 61 7 4 84 33 63 58 18 40 68 10 67 9 16 53",
"output": "43 35 29 74 15 28 73 47 84 82 2 13 54 61 24 85 42 79 68 3 10 34 23 67 71 20 50 5 7 44 4 56 76 62 9 65 16 19 1 80 11 40 53 46 26 58 27 59 32 31 33 64 86 55 45 60 51 78 25 38 72 30 77 8 36 48 83 81 69 39 12 57 18 41 22 6 52 63 21 17 49 14 70 75 66 37"
},
{
"input": "99\n65 78 56 98 33 24 61 40 29 93 1 64 57 22 25 52 67 95 50 3 31 15 90 68 71 83 38 36 6 46 89 26 4 87 14 88 72 37 23 43 63 12 80 96 5 34 73 86 9 48 92 62 99 10 16 20 66 27 28 2 82 70 30 94 49 8 84 69 18 60 58 59 44 39 21 7 91 76 54 19 75 85 74 47 55 32 97 77 51 13 35 79 45 42 11 41 17 81 53",
"output": "11 60 20 33 45 29 76 66 49 54 95 42 90 35 22 55 97 69 80 56 75 14 39 6 15 32 58 59 9 63 21 86 5 46 91 28 38 27 74 8 96 94 40 73 93 30 84 50 65 19 89 16 99 79 85 3 13 71 72 70 7 52 41 12 1 57 17 24 68 62 25 37 47 83 81 78 88 2 92 43 98 61 26 67 82 48 34 36 31 23 77 51 10 64 18 44 87 4 53"
},
{
"input": "100\n42 23 48 88 36 6 18 70 96 1 34 40 46 22 39 55 85 93 45 67 71 75 59 9 21 3 86 63 65 68 20 38 73 31 84 90 50 51 56 95 72 33 49 19 83 76 54 74 100 30 17 98 15 94 4 97 5 99 81 27 92 32 89 12 13 91 87 29 60 11 52 43 35 58 10 25 16 80 28 2 44 61 8 82 66 69 41 24 57 62 78 37 79 77 53 7 14 47 26 64",
"output": "10 80 26 55 57 6 96 83 24 75 70 64 65 97 53 77 51 7 44 31 25 14 2 88 76 99 60 79 68 50 34 62 42 11 73 5 92 32 15 12 87 1 72 81 19 13 98 3 43 37 38 71 95 47 16 39 89 74 23 69 82 90 28 100 29 85 20 30 86 8 21 41 33 48 22 46 94 91 93 78 59 84 45 35 17 27 67 4 63 36 66 61 18 54 40 9 56 52 58 49"
},
{
"input": "99\n8 68 94 75 71 60 57 58 6 11 5 48 65 41 49 12 46 72 95 59 13 70 74 7 84 62 17 36 55 76 38 79 2 85 23 10 32 99 87 50 83 28 54 91 53 51 1 3 97 81 21 89 93 78 61 26 82 96 4 98 25 40 31 44 24 47 30 52 14 16 39 27 9 29 45 18 67 63 37 43 90 66 19 69 88 22 92 77 34 42 73 80 56 64 20 35 15 33 86",
"output": "47 33 48 59 11 9 24 1 73 36 10 16 21 69 97 70 27 76 83 95 51 86 35 65 61 56 72 42 74 67 63 37 98 89 96 28 79 31 71 62 14 90 80 64 75 17 66 12 15 40 46 68 45 43 29 93 7 8 20 6 55 26 78 94 13 82 77 2 84 22 5 18 91 23 4 30 88 54 32 92 50 57 41 25 34 99 39 85 52 81 44 87 53 3 19 58 49 60 38"
},
{
"input": "99\n12 99 88 13 7 19 74 47 23 90 16 29 26 11 58 60 64 98 37 18 82 67 72 46 51 85 17 92 87 20 77 36 78 71 57 35 80 54 73 15 14 62 97 45 31 79 94 56 76 96 28 63 8 44 38 86 49 2 52 66 61 59 10 43 55 50 22 34 83 53 95 40 81 21 30 42 27 3 5 41 1 70 69 25 93 48 65 6 24 89 91 33 39 68 9 4 32 84 75",
"output": "81 58 78 96 79 88 5 53 95 63 14 1 4 41 40 11 27 20 6 30 74 67 9 89 84 13 77 51 12 75 45 97 92 68 36 32 19 55 93 72 80 76 64 54 44 24 8 86 57 66 25 59 70 38 65 48 35 15 62 16 61 42 52 17 87 60 22 94 83 82 34 23 39 7 99 49 31 33 46 37 73 21 69 98 26 56 29 3 90 10 91 28 85 47 71 50 43 18 2"
},
{
"input": "99\n20 79 26 75 99 69 98 47 93 62 18 42 43 38 90 66 67 8 13 84 76 58 81 60 64 46 56 23 78 17 86 36 19 52 85 39 48 27 96 49 37 95 5 31 10 24 12 1 80 35 92 33 16 68 57 54 32 29 45 88 72 77 4 87 97 89 59 3 21 22 61 94 83 15 44 34 70 91 55 9 51 50 73 11 14 6 40 7 63 25 2 82 41 65 28 74 71 30 53",
"output": "48 91 68 63 43 86 88 18 80 45 84 47 19 85 74 53 30 11 33 1 69 70 28 46 90 3 38 95 58 98 44 57 52 76 50 32 41 14 36 87 93 12 13 75 59 26 8 37 40 82 81 34 99 56 79 27 55 22 67 24 71 10 89 25 94 16 17 54 6 77 97 61 83 96 4 21 62 29 2 49 23 92 73 20 35 31 64 60 66 15 78 51 9 72 42 39 65 7 5"
},
{
"input": "99\n74 20 9 1 60 85 65 13 4 25 40 99 5 53 64 3 36 31 73 44 55 50 45 63 98 51 68 6 47 37 71 82 88 34 84 18 19 12 93 58 86 7 11 46 90 17 33 27 81 69 42 59 56 32 95 52 76 61 96 62 78 43 66 21 49 97 75 14 41 72 89 16 30 79 22 23 15 83 91 38 48 2 87 26 28 80 94 70 54 92 57 10 8 35 67 77 29 24 39",
"output": "4 82 16 9 13 28 42 93 3 92 43 38 8 68 77 72 46 36 37 2 64 75 76 98 10 84 48 85 97 73 18 54 47 34 94 17 30 80 99 11 69 51 62 20 23 44 29 81 65 22 26 56 14 89 21 53 91 40 52 5 58 60 24 15 7 63 95 27 50 88 31 70 19 1 67 57 96 61 74 86 49 32 78 35 6 41 83 33 71 45 79 90 39 87 55 59 66 25 12"
},
{
"input": "99\n50 94 2 18 69 90 59 83 75 68 77 97 39 78 25 7 16 9 49 4 42 89 44 48 17 96 61 70 3 10 5 81 56 57 88 6 98 1 46 67 92 37 11 30 85 41 8 36 51 29 20 71 19 79 74 93 43 34 55 40 38 21 64 63 32 24 72 14 12 86 82 15 65 23 66 22 28 53 13 26 95 99 91 52 76 27 60 45 47 33 73 84 31 35 54 80 58 62 87",
"output": "38 3 29 20 31 36 16 47 18 30 43 69 79 68 72 17 25 4 53 51 62 76 74 66 15 80 86 77 50 44 93 65 90 58 94 48 42 61 13 60 46 21 57 23 88 39 89 24 19 1 49 84 78 95 59 33 34 97 7 87 27 98 64 63 73 75 40 10 5 28 52 67 91 55 9 85 11 14 54 96 32 71 8 92 45 70 99 35 22 6 83 41 56 2 81 26 12 37 82"
},
{
"input": "99\n19 93 14 34 39 37 33 15 52 88 7 43 69 27 9 77 94 31 48 22 63 70 79 17 50 6 81 8 76 58 23 74 86 11 57 62 41 87 75 51 12 18 68 56 95 3 80 83 84 29 24 61 71 78 59 96 20 85 90 28 45 36 38 97 1 49 40 98 44 67 13 73 72 91 47 10 30 54 35 42 4 2 92 26 64 60 53 21 5 82 46 32 55 66 16 89 99 65 25",
"output": "65 82 46 81 89 26 11 28 15 76 34 41 71 3 8 95 24 42 1 57 88 20 31 51 99 84 14 60 50 77 18 92 7 4 79 62 6 63 5 67 37 80 12 69 61 91 75 19 66 25 40 9 87 78 93 44 35 30 55 86 52 36 21 85 98 94 70 43 13 22 53 73 72 32 39 29 16 54 23 47 27 90 48 49 58 33 38 10 96 59 74 83 2 17 45 56 64 68 97"
},
{
"input": "99\n86 25 50 51 62 39 41 67 44 20 45 14 80 88 66 7 36 59 13 84 78 58 96 75 2 43 48 47 69 12 19 98 22 38 28 55 11 76 68 46 53 70 85 34 16 33 91 30 8 40 74 60 94 82 87 32 37 4 5 10 89 73 90 29 35 26 23 57 27 65 24 3 9 83 77 72 6 31 15 92 93 79 64 18 63 42 56 1 52 97 17 81 71 21 49 99 54 95 61",
"output": "88 25 72 58 59 77 16 49 73 60 37 30 19 12 79 45 91 84 31 10 94 33 67 71 2 66 69 35 64 48 78 56 46 44 65 17 57 34 6 50 7 86 26 9 11 40 28 27 95 3 4 89 41 97 36 87 68 22 18 52 99 5 85 83 70 15 8 39 29 42 93 76 62 51 24 38 75 21 82 13 92 54 74 20 43 1 55 14 61 63 47 80 81 53 98 23 90 32 96"
},
{
"input": "100\n66 44 99 15 43 79 28 33 88 90 49 68 82 38 9 74 4 58 29 81 31 94 10 42 89 21 63 40 62 61 18 6 84 72 48 25 67 69 71 85 98 34 83 70 65 78 91 77 93 41 23 24 87 11 55 12 59 73 36 97 7 14 26 39 30 27 45 20 50 17 53 2 57 47 95 56 75 19 37 96 16 35 8 3 76 60 13 86 5 32 64 80 46 51 54 100 1 22 52 92",
"output": "97 72 84 17 89 32 61 83 15 23 54 56 87 62 4 81 70 31 78 68 26 98 51 52 36 63 66 7 19 65 21 90 8 42 82 59 79 14 64 28 50 24 5 2 67 93 74 35 11 69 94 99 71 95 55 76 73 18 57 86 30 29 27 91 45 1 37 12 38 44 39 34 58 16 77 85 48 46 6 92 20 13 43 33 40 88 53 9 25 10 47 100 49 22 75 80 60 41 3 96"
},
{
"input": "99\n3 73 32 37 25 15 93 63 85 8 91 78 80 5 39 48 46 7 83 70 23 96 9 29 77 53 30 20 56 50 13 45 21 76 87 99 65 31 16 18 14 72 51 28 43 2 81 34 38 40 66 54 74 26 71 4 61 17 58 24 22 33 49 36 42 11 12 55 60 27 62 90 79 92 94 68 1 52 84 41 86 35 69 75 47 10 64 88 97 98 67 19 89 95 59 82 57 44 6",
"output": "77 46 1 56 14 99 18 10 23 86 66 67 31 41 6 39 58 40 92 28 33 61 21 60 5 54 70 44 24 27 38 3 62 48 82 64 4 49 15 50 80 65 45 98 32 17 85 16 63 30 43 78 26 52 68 29 97 59 95 69 57 71 8 87 37 51 91 76 83 20 55 42 2 53 84 34 25 12 73 13 47 96 19 79 9 81 35 88 93 72 11 74 7 75 94 22 89 90 36"
},
{
"input": "100\n100 99 98 97 96 95 94 93 92 91 90 89 88 87 86 85 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "100 99 98 97 96 95 94 93 92 91 90 89 88 87 86 85 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1"
}
] | 1,680,962,034
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 101
| 124
| 0
|
n = int(input())
array = list(map(int, input().split()))
for i in range(1, n+1):
print(array.index(i) + 1, end=' ')
|
Title: Presents
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Petya very much likes gifts. Recently he has received a new laptop as a New Year gift from his mother. He immediately decided to give it to somebody else as what can be more pleasant than giving somebody gifts. And on this occasion he organized a New Year party at his place and invited *n* his friends there.
If there's one thing Petya likes more that receiving gifts, that's watching others giving gifts to somebody else. Thus, he safely hid the laptop until the next New Year and made up his mind to watch his friends exchanging gifts while he does not participate in the process. He numbered all his friends with integers from 1 to *n*. Petya remembered that a friend number *i* gave a gift to a friend number *p**i*. He also remembered that each of his friends received exactly one gift.
Now Petya wants to know for each friend *i* the number of a friend who has given him a gift.
Input Specification:
The first line contains one integer *n* (1<=β€<=*n*<=β€<=100) β the quantity of friends Petya invited to the party. The second line contains *n* space-separated integers: the *i*-th number is *p**i* β the number of a friend who gave a gift to friend number *i*. It is guaranteed that each friend received exactly one gift. It is possible that some friends do not share Petya's ideas of giving gifts to somebody else. Those friends gave the gifts to themselves.
Output Specification:
Print *n* space-separated integers: the *i*-th number should equal the number of the friend who gave a gift to friend number *i*.
Demo Input:
['4\n2 3 4 1\n', '3\n1 3 2\n', '2\n1 2\n']
Demo Output:
['4 1 2 3\n', '1 3 2\n', '1 2\n']
Note:
none
|
```python
n = int(input())
array = list(map(int, input().split()))
for i in range(1, n+1):
print(array.index(i) + 1, end=' ')
```
| 3
|
|
7
|
C
|
Line
|
PROGRAMMING
| 1,800
|
[
"math",
"number theory"
] |
C. Line
|
1
|
256
|
A line on the plane is described by an equation *Ax*<=+<=*By*<=+<=*C*<==<=0. You are to find any point on this line, whose coordinates are integer numbers from <=-<=5Β·1018 to 5Β·1018 inclusive, or to find out that such points do not exist.
|
The first line contains three integers *A*, *B* and *C* (<=-<=2Β·109<=β€<=*A*,<=*B*,<=*C*<=β€<=2Β·109) β corresponding coefficients of the line equation. It is guaranteed that *A*2<=+<=*B*2<=><=0.
|
If the required point exists, output its coordinates, otherwise output -1.
|
[
"2 5 3\n"
] |
[
"6 -3\n"
] |
none
| 0
|
[
{
"input": "2 5 3",
"output": "6 -3"
},
{
"input": "0 2 3",
"output": "-1"
},
{
"input": "931480234 -1767614767 -320146190",
"output": "-98880374013340920 -52107006370101410"
},
{
"input": "-1548994394 -1586527767 -1203252104",
"output": "-878123061596147680 857348814150663048"
},
{
"input": "296038088 887120955 1338330394",
"output": "2114412129515872 -705593211994286"
},
{
"input": "1906842444 749552572 -1693767003",
"output": "-1"
},
{
"input": "-1638453107 317016895 -430897103",
"output": "-23538272620589909 -121653945000687008"
},
{
"input": "-1183748658 875864960 -1315510852",
"output": "-97498198168399474 -131770725522871624"
},
{
"input": "427055698 738296578 -52640953",
"output": "-1"
},
{
"input": "-1516373701 -584304312 -746376800",
"output": "202167007852295200 -524659372900676000"
},
{
"input": "200000003 200000001 1",
"output": "100000000 -100000001"
},
{
"input": "0 -1 -2",
"output": "0 -2"
},
{
"input": "0 15 -17",
"output": "-1"
},
{
"input": "-13 0 0",
"output": "0 0"
},
{
"input": "-1000 0 -6",
"output": "-1"
},
{
"input": "1233978557 804808375 539283626",
"output": "3168196851074932 -4857661898189602"
},
{
"input": "532430220 -2899704 -328786059",
"output": "-1"
},
{
"input": "546348890 -29226055 -341135185",
"output": "50549411713300 944965544604433"
},
{
"input": "-1061610169 583743042 1503847115",
"output": "-333340893817405 -606222356685680"
},
{
"input": "10273743 174653631 -628469658",
"output": "-1"
},
{
"input": "1 2000000000 -1",
"output": "1 0"
},
{
"input": "592707810 829317963 -753392742",
"output": "-15849808632976 11327748563154"
},
{
"input": "1300000013 0 -800000008",
"output": "-1"
},
{
"input": "853072 -269205 -1778980",
"output": "7238140 22936620"
},
{
"input": "3162 56 674",
"output": "-4381 247358"
},
{
"input": "19 -5 115",
"output": "115 460"
},
{
"input": "7 5 -17",
"output": "-34 51"
},
{
"input": "-1 1 -2",
"output": "-2 0"
},
{
"input": "12453630 -163142553 -74721780",
"output": "-780 -60"
},
{
"input": "-3416750 528845750 -93743375",
"output": "-1"
},
{
"input": "701408733 1134903170 1836311903",
"output": "-796030994547383611 491974210728665288"
},
{
"input": "1000000013 -1 135",
"output": "0 135"
},
{
"input": "-2000000000 1 2000000000",
"output": "0 -2000000000"
},
{
"input": "2000000000 -2000000000 2000000000",
"output": "-1 0"
},
{
"input": "610684570 628836350 933504357",
"output": "-1"
},
{
"input": "827797728 -613880705 854959653",
"output": "60828197453915544 82024802605070757"
},
{
"input": "1044910887 -700497854 -1772517851",
"output": "572270531415215165 853638173436907976"
},
{
"input": "1663473197 -1943214909 -399995353",
"output": "90913128604458086 77825438652462521"
},
{
"input": "1880586355 -177315705 -478540057",
"output": "-1"
},
{
"input": "-957757861 308710346 45337024",
"output": "587450634832960 1822535171726016"
},
{
"input": "19999 -20000 10000",
"output": "10000 10000"
},
{
"input": "1999999 -2000000 1000000",
"output": "1000000 1000000"
},
{
"input": "999999999 -1000000000 500000000",
"output": "500000000 500000000"
},
{
"input": "999999999 -2 1",
"output": "-1 -499999999"
},
{
"input": "999999993 999999991 1",
"output": "499999995 -499999996"
},
{
"input": "999999993 -999999997 1",
"output": "-249999999 -249999998"
},
{
"input": "1999999993 1999999991 -1",
"output": "-999999995 999999996"
},
{
"input": "1999999993 1999999991 -1999999997",
"output": "-1999999987000000015 1999999989000000012"
}
] | 1,687,287,756
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 48
| 62
| 0
|
def gcd(a,b):
if b==0:
return (1,0,a)
else:
x,y,g=gcd(b, a%b)
return (y,x-(a//b)*y,g)
a,b,c=map(int,input().split())
if a>b:
x,y,g=gcd(max(a,b),min(a,b))
else:
y,x,g=gcd(max(a,b),min(a,b))
if abs(c)%g!=0:
print(-1)
else:
print(-x*(c//g),-y*(c//g))
|
Title: Line
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
A line on the plane is described by an equation *Ax*<=+<=*By*<=+<=*C*<==<=0. You are to find any point on this line, whose coordinates are integer numbers from <=-<=5Β·1018 to 5Β·1018 inclusive, or to find out that such points do not exist.
Input Specification:
The first line contains three integers *A*, *B* and *C* (<=-<=2Β·109<=β€<=*A*,<=*B*,<=*C*<=β€<=2Β·109) β corresponding coefficients of the line equation. It is guaranteed that *A*2<=+<=*B*2<=><=0.
Output Specification:
If the required point exists, output its coordinates, otherwise output -1.
Demo Input:
['2 5 3\n']
Demo Output:
['6 -3\n']
Note:
none
|
```python
def gcd(a,b):
if b==0:
return (1,0,a)
else:
x,y,g=gcd(b, a%b)
return (y,x-(a//b)*y,g)
a,b,c=map(int,input().split())
if a>b:
x,y,g=gcd(max(a,b),min(a,b))
else:
y,x,g=gcd(max(a,b),min(a,b))
if abs(c)%g!=0:
print(-1)
else:
print(-x*(c//g),-y*(c//g))
```
| 3.969
|
483
|
A
|
Counterexample
|
PROGRAMMING
| 1,100
|
[
"brute force",
"implementation",
"math",
"number theory"
] | null | null |
Your friend has recently learned about coprime numbers. A pair of numbers {*a*,<=*b*} is called coprime if the maximum number that divides both *a* and *b* is equal to one.
Your friend often comes up with different statements. He has recently supposed that if the pair (*a*,<=*b*) is coprime and the pair (*b*,<=*c*) is coprime, then the pair (*a*,<=*c*) is coprime.
You want to find a counterexample for your friend's statement. Therefore, your task is to find three distinct numbers (*a*,<=*b*,<=*c*), for which the statement is false, and the numbers meet the condition *l*<=β€<=*a*<=<<=*b*<=<<=*c*<=β€<=*r*.
More specifically, you need to find three numbers (*a*,<=*b*,<=*c*), such that *l*<=β€<=*a*<=<<=*b*<=<<=*c*<=β€<=*r*, pairs (*a*,<=*b*) and (*b*,<=*c*) are coprime, and pair (*a*,<=*c*) is not coprime.
|
The single line contains two positive space-separated integers *l*, *r* (1<=β€<=*l*<=β€<=*r*<=β€<=1018; *r*<=-<=*l*<=β€<=50).
|
Print three positive space-separated integers *a*, *b*, *c*Β β three distinct numbers (*a*,<=*b*,<=*c*) that form the counterexample. If there are several solutions, you are allowed to print any of them. The numbers must be printed in ascending order.
If the counterexample does not exist, print the single number -1.
|
[
"2 4\n",
"10 11\n",
"900000000000000009 900000000000000029\n"
] |
[
"2 3 4\n",
"-1\n",
"900000000000000009 900000000000000010 900000000000000021\n"
] |
In the first sample pair (2,β4) is not coprime and pairs (2,β3) and (3,β4) are.
In the second sample you cannot form a group of three distinct integers, so the answer is -1.
In the third sample it is easy to see that numbers 900000000000000009 and 900000000000000021 are divisible by three.
| 500
|
[
{
"input": "2 4",
"output": "2 3 4"
},
{
"input": "10 11",
"output": "-1"
},
{
"input": "900000000000000009 900000000000000029",
"output": "900000000000000009 900000000000000010 900000000000000021"
},
{
"input": "640097987171091791 640097987171091835",
"output": "640097987171091792 640097987171091793 640097987171091794"
},
{
"input": "19534350415104721 19534350415104725",
"output": "19534350415104722 19534350415104723 19534350415104724"
},
{
"input": "933700505788726243 933700505788726280",
"output": "933700505788726244 933700505788726245 933700505788726246"
},
{
"input": "1 3",
"output": "-1"
},
{
"input": "1 4",
"output": "2 3 4"
},
{
"input": "1 1",
"output": "-1"
},
{
"input": "266540997167959130 266540997167959164",
"output": "266540997167959130 266540997167959131 266540997167959132"
},
{
"input": "267367244641009850 267367244641009899",
"output": "267367244641009850 267367244641009851 267367244641009852"
},
{
"input": "268193483524125978 268193483524125993",
"output": "268193483524125978 268193483524125979 268193483524125980"
},
{
"input": "269019726702209402 269019726702209432",
"output": "269019726702209402 269019726702209403 269019726702209404"
},
{
"input": "269845965585325530 269845965585325576",
"output": "269845965585325530 269845965585325531 269845965585325532"
},
{
"input": "270672213058376250 270672213058376260",
"output": "270672213058376250 270672213058376251 270672213058376252"
},
{
"input": "271498451941492378 271498451941492378",
"output": "-1"
},
{
"input": "272324690824608506 272324690824608523",
"output": "272324690824608506 272324690824608507 272324690824608508"
},
{
"input": "273150934002691930 273150934002691962",
"output": "273150934002691930 273150934002691931 273150934002691932"
},
{
"input": "996517375802030516 996517375802030524",
"output": "996517375802030516 996517375802030517 996517375802030518"
},
{
"input": "997343614685146644 997343614685146694",
"output": "997343614685146644 997343614685146645 997343614685146646"
},
{
"input": "998169857863230068 998169857863230083",
"output": "998169857863230068 998169857863230069 998169857863230070"
},
{
"input": "998996101041313492 998996101041313522",
"output": "998996101041313492 998996101041313493 998996101041313494"
},
{
"input": "999822344219396916 999822344219396961",
"output": "999822344219396916 999822344219396917 999822344219396918"
},
{
"input": "648583102513043 648583102513053",
"output": "648583102513044 648583102513045 648583102513046"
},
{
"input": "266540997167959130 266540997167959131",
"output": "-1"
},
{
"input": "267367244641009850 267367244641009850",
"output": "-1"
},
{
"input": "268193483524125978 268193483524125979",
"output": "-1"
},
{
"input": "269019726702209402 269019726702209402",
"output": "-1"
},
{
"input": "269845965585325530 269845965585325530",
"output": "-1"
},
{
"input": "270672213058376250 270672213058376254",
"output": "270672213058376250 270672213058376251 270672213058376252"
},
{
"input": "271498451941492378 271498451941492379",
"output": "-1"
},
{
"input": "272324690824608506 272324690824608508",
"output": "272324690824608506 272324690824608507 272324690824608508"
},
{
"input": "273150934002691930 273150934002691931",
"output": "-1"
},
{
"input": "996517375802030516 996517375802030518",
"output": "996517375802030516 996517375802030517 996517375802030518"
},
{
"input": "997343614685146644 997343614685146644",
"output": "-1"
},
{
"input": "2147483647 2147483649",
"output": "-1"
},
{
"input": "3 5",
"output": "-1"
},
{
"input": "1 7",
"output": "2 3 4"
},
{
"input": "9 12",
"output": "9 11 12"
},
{
"input": "4 4",
"output": "-1"
},
{
"input": "11 13",
"output": "-1"
},
{
"input": "2 2",
"output": "-1"
}
] | 1,563,780,752
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 42
| 124
| 0
|
X = list(map(int, input().split()))
if (X[0] % 2 == 0 and X[1] - X[0] < 2) or (X[0] % 2 != 0 and X[1] - X[0] < 3):
print(-1)
exit()
if X[0] % 2 == 0:
print(X[0], X[0] + 1, X[0] + 2)
else:
print(X[0] + 1, X[0] + 2, X[0] + 3)
# UB_CodeForces
# Advice: Everyone deserves the second chance, but not for the same mistake
# Location: Behind my desk
# Caption: Contest Problem
# CodeNumber: 529
|
Title: Counterexample
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Your friend has recently learned about coprime numbers. A pair of numbers {*a*,<=*b*} is called coprime if the maximum number that divides both *a* and *b* is equal to one.
Your friend often comes up with different statements. He has recently supposed that if the pair (*a*,<=*b*) is coprime and the pair (*b*,<=*c*) is coprime, then the pair (*a*,<=*c*) is coprime.
You want to find a counterexample for your friend's statement. Therefore, your task is to find three distinct numbers (*a*,<=*b*,<=*c*), for which the statement is false, and the numbers meet the condition *l*<=β€<=*a*<=<<=*b*<=<<=*c*<=β€<=*r*.
More specifically, you need to find three numbers (*a*,<=*b*,<=*c*), such that *l*<=β€<=*a*<=<<=*b*<=<<=*c*<=β€<=*r*, pairs (*a*,<=*b*) and (*b*,<=*c*) are coprime, and pair (*a*,<=*c*) is not coprime.
Input Specification:
The single line contains two positive space-separated integers *l*, *r* (1<=β€<=*l*<=β€<=*r*<=β€<=1018; *r*<=-<=*l*<=β€<=50).
Output Specification:
Print three positive space-separated integers *a*, *b*, *c*Β β three distinct numbers (*a*,<=*b*,<=*c*) that form the counterexample. If there are several solutions, you are allowed to print any of them. The numbers must be printed in ascending order.
If the counterexample does not exist, print the single number -1.
Demo Input:
['2 4\n', '10 11\n', '900000000000000009 900000000000000029\n']
Demo Output:
['2 3 4\n', '-1\n', '900000000000000009 900000000000000010 900000000000000021\n']
Note:
In the first sample pair (2,β4) is not coprime and pairs (2,β3) and (3,β4) are.
In the second sample you cannot form a group of three distinct integers, so the answer is -1.
In the third sample it is easy to see that numbers 900000000000000009 and 900000000000000021 are divisible by three.
|
```python
X = list(map(int, input().split()))
if (X[0] % 2 == 0 and X[1] - X[0] < 2) or (X[0] % 2 != 0 and X[1] - X[0] < 3):
print(-1)
exit()
if X[0] % 2 == 0:
print(X[0], X[0] + 1, X[0] + 2)
else:
print(X[0] + 1, X[0] + 2, X[0] + 3)
# UB_CodeForces
# Advice: Everyone deserves the second chance, but not for the same mistake
# Location: Behind my desk
# Caption: Contest Problem
# CodeNumber: 529
```
| 3
|
|
673
|
A
|
Bear and Game
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Bear Limak likes watching sports on TV. He is going to watch a game today. The game lasts 90 minutes and there are no breaks.
Each minute can be either interesting or boring. If 15 consecutive minutes are boring then Limak immediately turns TV off.
You know that there will be *n* interesting minutes *t*1,<=*t*2,<=...,<=*t**n*. Your task is to calculate for how many minutes Limak will watch the game.
|
The first line of the input contains one integer *n* (1<=β€<=*n*<=β€<=90)Β β the number of interesting minutes.
The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=β€<=*t*1<=<<=*t*2<=<<=... *t**n*<=β€<=90), given in the increasing order.
|
Print the number of minutes Limak will watch the game.
|
[
"3\n7 20 88\n",
"9\n16 20 30 40 50 60 70 80 90\n",
"9\n15 20 30 40 50 60 70 80 90\n"
] |
[
"35\n",
"15\n",
"90\n"
] |
In the first sample, minutes 21,β22,β...,β35 are all boring and thus Limak will turn TV off immediately after the 35-th minute. So, he would watch the game for 35 minutes.
In the second sample, the first 15 minutes are boring.
In the third sample, there are no consecutive 15 boring minutes. So, Limak will watch the whole game.
| 500
|
[
{
"input": "3\n7 20 88",
"output": "35"
},
{
"input": "9\n16 20 30 40 50 60 70 80 90",
"output": "15"
},
{
"input": "9\n15 20 30 40 50 60 70 80 90",
"output": "90"
},
{
"input": "30\n6 11 12 15 22 24 30 31 32 33 34 35 40 42 44 45 47 50 53 54 57 58 63 67 75 77 79 81 83 88",
"output": "90"
},
{
"input": "60\n1 2 4 5 6 7 11 14 16 18 20 21 22 23 24 25 26 33 34 35 36 37 38 39 41 42 43 44 46 47 48 49 52 55 56 57 58 59 60 61 63 64 65 67 68 70 71 72 73 74 75 77 78 80 82 83 84 85 86 88",
"output": "90"
},
{
"input": "90\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90",
"output": "90"
},
{
"input": "1\n1",
"output": "16"
},
{
"input": "5\n15 30 45 60 75",
"output": "90"
},
{
"input": "6\n14 29 43 59 70 74",
"output": "58"
},
{
"input": "1\n15",
"output": "30"
},
{
"input": "1\n16",
"output": "15"
},
{
"input": "14\n14 22 27 31 35 44 46 61 62 69 74 79 88 89",
"output": "90"
},
{
"input": "76\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90",
"output": "90"
},
{
"input": "1\n90",
"output": "15"
},
{
"input": "6\n13 17 32 47 60 66",
"output": "81"
},
{
"input": "84\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84",
"output": "90"
},
{
"input": "9\n6 20 27 28 40 53 59 70 85",
"output": "90"
},
{
"input": "12\n14 22 27 31 35 44 62 69 74 79 88 89",
"output": "59"
},
{
"input": "5\n15 30 45 60 74",
"output": "89"
},
{
"input": "72\n3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89",
"output": "54"
},
{
"input": "8\n1 16 30 31 32 33 34 50",
"output": "49"
},
{
"input": "12\n1 3 6 10 15 21 28 36 45 55 66 78",
"output": "90"
},
{
"input": "25\n1 2 3 4 5 6 7 8 9 10 11 23 36 50 65 81 82 83 84 85 86 87 88 89 90",
"output": "80"
},
{
"input": "8\n5 17 20 35 42 53 67 76",
"output": "90"
},
{
"input": "9\n15 28 39 48 55 60 63 64 74",
"output": "89"
},
{
"input": "10\n15 28 39 48 55 60 63 64 74 82",
"output": "90"
},
{
"input": "2\n1 18",
"output": "16"
},
{
"input": "9\n10 20 30 40 50 60 70 80 84",
"output": "90"
},
{
"input": "2\n16 50",
"output": "15"
},
{
"input": "6\n15 30 45 60 75 84",
"output": "90"
},
{
"input": "8\n15 20 30 40 50 60 73 83",
"output": "90"
},
{
"input": "8\n10 20 30 40 50 60 70 80",
"output": "90"
},
{
"input": "3\n1 20 90",
"output": "16"
},
{
"input": "6\n15 30 45 60 74 89",
"output": "90"
}
] | 1,598,393,222
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 34
| 109
| 0
|
def game_watched(interesting_list,n):
time = 0
for i in range(n):
if interesting_list[i+1] - 15 <= interesting_list[i]:
time = interesting_list[i + 1]
else:
break
return time + 15
n = int(input())
lista = [0]
input_list = list(map(int,input().split()))
lista = lista + input_list
time = game_watched(lista,n)
if time > 90:
print(90)
else:
print(time)
|
Title: Bear and Game
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Bear Limak likes watching sports on TV. He is going to watch a game today. The game lasts 90 minutes and there are no breaks.
Each minute can be either interesting or boring. If 15 consecutive minutes are boring then Limak immediately turns TV off.
You know that there will be *n* interesting minutes *t*1,<=*t*2,<=...,<=*t**n*. Your task is to calculate for how many minutes Limak will watch the game.
Input Specification:
The first line of the input contains one integer *n* (1<=β€<=*n*<=β€<=90)Β β the number of interesting minutes.
The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=β€<=*t*1<=<<=*t*2<=<<=... *t**n*<=β€<=90), given in the increasing order.
Output Specification:
Print the number of minutes Limak will watch the game.
Demo Input:
['3\n7 20 88\n', '9\n16 20 30 40 50 60 70 80 90\n', '9\n15 20 30 40 50 60 70 80 90\n']
Demo Output:
['35\n', '15\n', '90\n']
Note:
In the first sample, minutes 21,β22,β...,β35 are all boring and thus Limak will turn TV off immediately after the 35-th minute. So, he would watch the game for 35 minutes.
In the second sample, the first 15 minutes are boring.
In the third sample, there are no consecutive 15 boring minutes. So, Limak will watch the whole game.
|
```python
def game_watched(interesting_list,n):
time = 0
for i in range(n):
if interesting_list[i+1] - 15 <= interesting_list[i]:
time = interesting_list[i + 1]
else:
break
return time + 15
n = int(input())
lista = [0]
input_list = list(map(int,input().split()))
lista = lista + input_list
time = game_watched(lista,n)
if time > 90:
print(90)
else:
print(time)
```
| 3
|
|
38
|
C
|
Blinds
|
PROGRAMMING
| 1,400
|
[
"brute force"
] |
C. Blinds
|
2
|
256
|
The blinds are known to consist of opaque horizontal stripes that can be rotated thus regulating the amount of light flowing in the room. There are *n* blind stripes with the width of 1 in the factory warehouse for blind production. The problem is that all of them are spare details from different orders, that is, they may not have the same length (it is even possible for them to have different lengths)
Every stripe can be cut into two or more parts. The cuttings are made perpendicularly to the side along which the length is measured. Thus the cuttings do not change the width of a stripe but each of the resulting pieces has a lesser length (the sum of which is equal to the length of the initial stripe)
After all the cuttings the blinds are constructed through consecutive joining of several parts, similar in length, along sides, along which length is measured. Also, apart from the resulting pieces an initial stripe can be used as a blind if it hasn't been cut. It is forbidden to construct blinds in any other way.
Thus, if the blinds consist of *k* pieces each *d* in length, then they are of form of a rectangle of *k*<=Γ<=*d* bourlemeters.
Your task is to find for what window possessing the largest possible area the blinds can be made from the given stripes if on technical grounds it is forbidden to use pieces shorter than *l* bourlemeter. The window is of form of a rectangle with side lengths as positive integers.
|
The first output line contains two space-separated integers *n* and *l* (1<=β€<=*n*,<=*l*<=β€<=100). They are the number of stripes in the warehouse and the minimal acceptable length of a blind stripe in bourlemeters. The second line contains space-separated *n* integers *a**i*. They are the lengths of initial stripes in bourlemeters (1<=β€<=*a**i*<=β€<=100).
|
Print the single number β the maximal area of the window in square bourlemeters that can be completely covered. If no window with a positive area that can be covered completely without breaking any of the given rules exist, then print the single number 0.
|
[
"4 2\n1 2 3 4\n",
"5 3\n5 5 7 3 1\n",
"2 3\n1 2\n"
] |
[
"8\n",
"15\n",
"0\n"
] |
In the first sample test the required window is 2βΓβ4 in size and the blinds for it consist of 4 parts, each 2 bourlemeters long. One of the parts is the initial stripe with the length of 2, the other one is a part of a cut stripe with the length of 3 and the two remaining stripes are parts of a stripe with the length of 4 cut in halves.
| 0
|
[
{
"input": "4 2\n1 2 3 4",
"output": "8"
},
{
"input": "5 3\n5 5 7 3 1",
"output": "15"
},
{
"input": "2 3\n1 2",
"output": "0"
},
{
"input": "2 2\n3 3",
"output": "6"
},
{
"input": "5 2\n2 4 1 1 3",
"output": "8"
},
{
"input": "7 4\n3 2 1 1 1 3 2",
"output": "0"
},
{
"input": "10 1\n1 2 2 6 6 1 2 5 5 6",
"output": "36"
},
{
"input": "10 2\n6 3 1 1 6 4 6 1 6 3",
"output": "33"
},
{
"input": "15 6\n1 6 6 5 2 10 4 4 7 8 7 3 5 1 2",
"output": "36"
},
{
"input": "20 2\n13 3 6 11 6 11 9 1 1 2 5 2 9 15 14 10 3 12 3 13",
"output": "136"
},
{
"input": "25 20\n10 8 4 6 12 14 19 18 19 9 21 16 16 15 10 15 12 12 18 18 9 22 12 14 14",
"output": "42"
},
{
"input": "30 15\n93 99 77 69 43 86 56 15 9 9 75 84 56 1 42 45 10 23 83 87 86 99 46 48 40 69 95 10 61 47",
"output": "1455"
},
{
"input": "35 3\n13 12 38 45 71 61 42 75 58 40 50 70 27 38 16 37 21 12 36 7 39 4 65 12 32 26 1 21 66 63 29 56 32 29 26",
"output": "1236"
},
{
"input": "40 33\n33 52 83 32 59 90 25 90 38 31 60 30 76 77 9 13 48 1 55 39 84 28 58 83 12 3 77 34 33 73 15 35 29 8 3 21 63 4 21 75",
"output": "1089"
},
{
"input": "45 1\n1 1 2 3 1 2 3 1 1 1 1 2 2 2 2 3 1 1 2 2 3 3 2 3 3 1 3 3 3 1 2 3 2 1 2 1 1 2 1 2 1 1 2 2 2",
"output": "84"
},
{
"input": "50 70\n60 21 1 35 20 10 35 59 27 12 57 67 76 49 27 72 39 47 56 36 36 13 62 16 6 16 39 46 35 9 67 59 61 52 1 44 70 40 60 3 5 2 14 29 56 32 4 28 35 73",
"output": "280"
},
{
"input": "55 12\n15 5 11 16 17 3 5 28 19 15 1 9 5 26 25 3 14 14 33 12 3 21 16 30 22 18 7 16 24 28 2 17 24 25 16 16 31 9 11 9 6 13 25 23 32 18 4 21 10 32 11 5 4 32 14",
"output": "588"
},
{
"input": "60 10\n42 89 35 19 51 41 31 77 10 8 73 27 47 26 66 91 43 33 74 62 77 23 5 44 18 23 74 6 51 21 30 17 31 39 74 4 55 39 3 34 21 3 18 41 61 37 31 91 69 55 75 67 77 30 11 16 35 68 62 19",
"output": "2240"
},
{
"input": "65 7\n1 5 4 1 4 11 9 1 11 7 6 11 9 4 2 6 10 11 10 12 4 6 1 12 12 5 1 11 7 9 11 6 10 10 7 8 4 1 3 5 2 3 2 10 11 10 5 8 7 10 12 5 11 6 8 6 2 9 9 7 2 4 12 7 7",
"output": "245"
},
{
"input": "70 12\n6 8 11 13 11 30 4 26 16 24 8 12 14 25 7 26 1 24 1 9 7 19 25 11 18 23 27 26 27 19 8 10 9 20 23 2 14 27 24 24 14 21 31 5 1 14 24 20 2 1 11 17 12 7 17 20 8 21 16 17 31 25 9 25 5 18 6 19 22 27",
"output": "756"
},
{
"input": "75 19\n3 35 38 25 5 17 12 37 26 34 20 3 30 33 16 26 16 31 17 5 13 40 4 40 16 4 24 31 39 13 12 3 25 40 21 2 27 26 21 2 18 24 24 25 18 3 15 20 5 6 23 10 16 37 20 13 39 4 6 28 9 25 14 7 6 15 34 9 4 16 36 19 17 30 33",
"output": "817"
},
{
"input": "80 1\n7 13 38 24 17 20 11 3 25 23 36 16 41 36 18 9 33 10 37 20 8 7 42 8 17 1 39 30 39 24 36 17 8 11 3 33 23 42 36 16 36 3 30 20 29 35 43 17 32 26 33 4 41 34 9 37 14 26 6 40 16 24 8 26 16 31 11 12 18 24 42 34 24 37 5 23 32 13 8 14",
"output": "1810"
},
{
"input": "85 2\n26 5 48 55 22 22 43 29 55 29 6 53 48 35 58 22 44 7 14 26 48 17 66 44 2 10 50 4 19 35 29 61 55 57 25 5 54 64 18 17 43 16 14 63 46 22 55 23 8 52 65 30 10 13 24 18 7 44 65 7 42 63 29 54 32 23 55 17 3 11 67 14 45 31 33 22 36 28 27 54 46 45 15 40 55",
"output": "2796"
},
{
"input": "90 3\n44 16 62 40 33 17 53 32 66 18 68 33 18 76 14 66 41 8 18 57 39 63 9 41 30 39 30 35 46 12 27 33 6 4 21 26 32 24 18 25 35 39 14 49 65 32 54 38 55 64 75 2 53 21 72 11 46 47 63 60 33 62 13 35 40 21 26 15 66 74 55 48 24 26 76 69 65 68 62 12 74 58 21 13 53 5 40 56 66 67",
"output": "3492"
},
{
"input": "91 6\n4 2 4 2 6 2 4 1 2 6 5 3 3 3 3 2 5 4 2 5 3 2 1 3 5 2 4 5 1 3 3 3 6 6 5 3 4 1 5 6 2 5 2 2 5 4 1 5 4 1 2 6 1 2 3 4 3 3 3 3 2 1 4 5 1 6 5 1 6 5 3 5 6 3 3 5 4 4 5 4 5 2 5 2 3 1 5 6 6 4 2",
"output": "66"
},
{
"input": "92 8\n3 4 6 9 7 9 12 12 7 4 9 1 3 9 2 12 4 5 12 2 6 5 9 9 5 2 7 5 12 2 1 7 7 11 11 1 4 10 11 7 5 6 3 5 12 2 9 1 11 1 9 11 1 9 7 9 7 8 1 5 8 8 1 8 6 6 4 5 6 10 7 9 7 1 6 2 12 11 7 6 12 11 5 11 6 10 1 9 3 9 11 9",
"output": "306"
},
{
"input": "93 10\n6 47 6 89 21 91 51 72 32 48 54 89 36 12 25 38 58 62 54 16 5 52 52 85 67 33 81 72 6 42 91 16 29 78 56 62 75 48 69 12 89 34 27 15 7 80 14 57 29 6 80 46 64 94 83 96 1 42 11 41 15 26 17 36 44 11 68 73 93 45 73 35 91 14 84 48 7 8 63 84 59 68 87 26 91 10 54 41 74 71 74 62 24",
"output": "4110"
},
{
"input": "94 12\n40 66 66 35 43 23 77 6 55 44 68 90 20 59 11 95 78 13 75 98 30 22 40 29 2 23 82 26 53 48 16 100 97 100 74 96 73 30 35 72 23 38 25 86 7 45 53 20 18 77 68 95 41 45 1 94 42 94 54 9 33 84 53 71 6 68 98 94 35 78 58 34 84 78 28 65 58 11 2 78 96 5 8 36 34 26 76 10 69 49 25 9 77 30",
"output": "4173"
},
{
"input": "95 17\n1 24 17 9 41 5 39 30 6 32 17 30 27 11 13 25 22 23 12 31 19 31 35 43 8 23 39 23 39 41 10 17 25 17 38 39 37 23 37 11 6 15 43 4 15 44 44 42 29 2 14 6 1 6 31 45 26 21 14 18 15 17 23 11 39 12 16 6 11 19 15 31 18 10 33 10 2 8 21 4 26 3 42 45 16 1 11 28 43 24 18 45 25 39 9",
"output": "1360"
},
{
"input": "96 9\n4 5 1 10 2 6 1 9 2 6 3 2 9 4 1 1 3 10 10 4 6 8 6 4 4 6 4 6 2 9 1 9 3 6 9 10 4 3 7 2 7 4 4 4 6 4 1 7 9 4 9 2 1 7 7 3 4 10 10 5 1 3 10 5 1 9 8 4 10 4 7 2 9 6 9 4 2 3 6 9 8 1 1 2 9 4 10 4 9 7 7 5 1 10 9 10",
"output": "225"
},
{
"input": "97 28\n13 12 30 2 17 29 28 28 26 10 27 27 20 14 8 28 10 5 33 19 17 31 15 4 8 13 21 23 32 3 20 9 33 17 11 13 11 9 19 30 19 25 1 18 1 13 1 20 19 9 17 31 32 26 1 34 7 34 6 22 7 13 29 6 29 3 13 28 3 6 7 29 17 34 28 32 14 33 23 25 23 11 19 19 27 27 3 20 17 13 24 2 8 25 10 31 34",
"output": "672"
},
{
"input": "98 14\n23 3 39 39 6 35 2 35 38 9 11 24 42 35 35 46 23 46 20 36 25 46 23 9 21 24 21 38 43 9 9 38 38 46 3 28 17 31 30 14 29 12 37 15 5 45 46 32 35 39 39 27 25 15 42 40 19 19 11 6 32 16 25 29 46 2 45 44 5 36 21 11 14 18 39 1 39 26 18 14 1 23 38 24 10 38 14 42 15 3 8 8 23 46 40 19 14 29",
"output": "1876"
},
{
"input": "99 57\n69 27 70 70 16 66 64 35 44 1 51 38 69 17 19 35 83 7 47 4 10 22 60 64 64 56 80 54 83 34 51 42 46 51 41 75 54 10 13 44 66 46 27 79 55 13 13 40 18 12 2 33 20 13 75 45 70 75 51 39 80 25 22 27 77 52 41 83 40 33 23 76 81 21 23 59 27 74 45 68 42 20 83 50 66 58 5 8 55 62 76 81 27 52 55 67 28 65 71",
"output": "2030"
},
{
"input": "100 2\n2 2 1 1 1 1 1 1 1 2 2 1 1 2 2 1 1 2 1 1 1 1 1 1 2 2 2 1 1 2 1 2 1 2 2 1 1 1 1 2 1 1 1 2 2 1 1 2 1 1 2 2 2 2 2 1 2 1 2 1 1 2 1 2 2 2 2 1 2 1 2 1 2 1 2 2 2 1 1 2 2 1 2 1 1 1 1 2 1 2 2 2 1 2 1 1 1 2 2 1",
"output": "92"
},
{
"input": "100 2\n79 84 2 24 18 95 57 79 67 60 78 85 75 23 68 68 76 30 39 31 32 81 42 90 50 33 49 9 63 18 74 46 34 55 48 41 7 75 74 90 14 90 2 49 20 29 33 65 43 7 11 12 58 45 17 100 1 28 3 12 26 94 45 5 45 19 3 28 95 11 71 68 89 47 59 5 74 92 43 100 15 63 78 85 70 38 62 100 78 76 29 69 64 2 32 68 48 61 82 100",
"output": "4978"
},
{
"input": "100 17\n20 61 7 74 87 84 87 35 64 7 36 5 72 20 62 29 29 58 67 51 50 45 82 20 76 79 39 21 5 39 94 13 65 11 3 21 26 2 15 56 20 75 49 27 64 48 51 96 32 80 57 10 57 48 36 83 51 25 45 65 24 22 3 92 45 52 52 58 15 90 23 43 56 88 46 50 72 70 60 47 91 68 40 24 16 44 82 90 17 17 51 71 25 94 13 42 26 25 53 95",
"output": "3961"
}
] | 1,696,161,561
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 36
| 154
| 1,638,400
|
def main():
n, l = map(int, input().split())
a = list(map(int, input().split()))
result = 0
for x in range(l, 101):
s = sum([a[i] // x for i in range(n)])
result = max(result, s * x)
print(result)
main()
|
Title: Blinds
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The blinds are known to consist of opaque horizontal stripes that can be rotated thus regulating the amount of light flowing in the room. There are *n* blind stripes with the width of 1 in the factory warehouse for blind production. The problem is that all of them are spare details from different orders, that is, they may not have the same length (it is even possible for them to have different lengths)
Every stripe can be cut into two or more parts. The cuttings are made perpendicularly to the side along which the length is measured. Thus the cuttings do not change the width of a stripe but each of the resulting pieces has a lesser length (the sum of which is equal to the length of the initial stripe)
After all the cuttings the blinds are constructed through consecutive joining of several parts, similar in length, along sides, along which length is measured. Also, apart from the resulting pieces an initial stripe can be used as a blind if it hasn't been cut. It is forbidden to construct blinds in any other way.
Thus, if the blinds consist of *k* pieces each *d* in length, then they are of form of a rectangle of *k*<=Γ<=*d* bourlemeters.
Your task is to find for what window possessing the largest possible area the blinds can be made from the given stripes if on technical grounds it is forbidden to use pieces shorter than *l* bourlemeter. The window is of form of a rectangle with side lengths as positive integers.
Input Specification:
The first output line contains two space-separated integers *n* and *l* (1<=β€<=*n*,<=*l*<=β€<=100). They are the number of stripes in the warehouse and the minimal acceptable length of a blind stripe in bourlemeters. The second line contains space-separated *n* integers *a**i*. They are the lengths of initial stripes in bourlemeters (1<=β€<=*a**i*<=β€<=100).
Output Specification:
Print the single number β the maximal area of the window in square bourlemeters that can be completely covered. If no window with a positive area that can be covered completely without breaking any of the given rules exist, then print the single number 0.
Demo Input:
['4 2\n1 2 3 4\n', '5 3\n5 5 7 3 1\n', '2 3\n1 2\n']
Demo Output:
['8\n', '15\n', '0\n']
Note:
In the first sample test the required window is 2βΓβ4 in size and the blinds for it consist of 4 parts, each 2 bourlemeters long. One of the parts is the initial stripe with the length of 2, the other one is a part of a cut stripe with the length of 3 and the two remaining stripes are parts of a stripe with the length of 4 cut in halves.
|
```python
def main():
n, l = map(int, input().split())
a = list(map(int, input().split()))
result = 0
for x in range(l, 101):
s = sum([a[i] // x for i in range(n)])
result = max(result, s * x)
print(result)
main()
```
| 3.958448
|
43
|
B
|
Letter
|
PROGRAMMING
| 1,100
|
[
"implementation",
"strings"
] |
B. Letter
|
2
|
256
|
Vasya decided to write an anonymous letter cutting the letters out of a newspaper heading. He knows heading *s*1 and text *s*2 that he wants to send. Vasya can use every single heading letter no more than once. Vasya doesn't have to cut the spaces out of the heading β he just leaves some blank space to mark them. Help him; find out if he will manage to compose the needed text.
|
The first line contains a newspaper heading *s*1. The second line contains the letter text *s*2. *s*1 ΠΈ *s*2 are non-empty lines consisting of spaces, uppercase and lowercase Latin letters, whose lengths do not exceed 200 symbols. The uppercase and lowercase letters should be differentiated. Vasya does not cut spaces out of the heading.
|
If Vasya can write the given anonymous letter, print YES, otherwise print NO
|
[
"Instead of dogging Your footsteps it disappears but you dont notice anything\nwhere is your dog\n",
"Instead of dogging Your footsteps it disappears but you dont notice anything\nYour dog is upstears\n",
"Instead of dogging your footsteps it disappears but you dont notice anything\nYour dog is upstears\n",
"abcdefg hijk\nk j i h g f e d c b a\n"
] |
[
"NO\n",
"YES\n",
"NO\n",
"YES\n"
] |
none
| 1,000
|
[
{
"input": "Instead of dogging Your footsteps it disappears but you dont notice anything\nwhere is your dog",
"output": "NO"
},
{
"input": "Instead of dogging Your footsteps it disappears but you dont notice anything\nYour dog is upstears",
"output": "YES"
},
{
"input": "Instead of dogging your footsteps it disappears but you dont notice anything\nYour dog is upstears",
"output": "NO"
},
{
"input": "abcdefg hijk\nk j i h g f e d c b a",
"output": "YES"
},
{
"input": "HpOKgo\neAtAVB",
"output": "NO"
},
{
"input": "GRZGc\nLPzD",
"output": "NO"
},
{
"input": "GtPXu\nd",
"output": "NO"
},
{
"input": "FVF\nr ",
"output": "NO"
},
{
"input": "HpOKgo\nogK",
"output": "YES"
},
{
"input": "GRZGc\nZG",
"output": "YES"
},
{
"input": "HpOKgoueAtAVBdGffvQheJDejNDHhhwyKJisugiRAH OseK yUwqPPNuThUxTfthqIUeb wS jChGOdFDarNrKRT MlwKecxWNoKEeD BbiHAruE XMlvKYVsJGPP\nAHN XvoaNwV AVBKwKjr u U K wKE D K Jy KiHsR h d W Js IHyMPK Br iSqe E fDA g H",
"output": "YES"
},
{
"input": "GRZGcsLPzDrCSXhhNTaibJqVphhjbcPoZhCDUlzAbDnRWjHvxLKtpGiFWiGbfeDxBwCrdJmJGCGv GebAOinUsFrlqKTILOmxrFjSpEoVGoTdSSstJWVgMLKMPettxHASaQZNdOIObcTxtF qTHWBdNIKwj\nWqrxze Ji x q aT GllLrRV jMpGiMDTwwS JDsPGpAZKACmsFCOS CD Sj bCDgKF jJxa RddtLFAi VGLHH SecObzG q hPF ",
"output": "YES"
},
{
"input": "GtPXuwdAxNhODQbjRslDDKciOALJrCifTjDQurQEBeFUUSZWwCZQPdYwZkYbrduMijFjgodAOrKIuUKwSXageZuOWMIhAMexyLRzFuzuXqBDTEaWMzVdbzhxDGSJC SsIYuYILwpiwwcObEHWpFvHeBkWYNitqYrxqgHReHcKnHbtjcWZuaxPBVPb\nTQIKyqFaewOkY lZUOOuxEw EwuKcArxRQGFYkvVWIAe SuanPeHuDjquurJu aSxwgOSw jYMwjxItNUUArQjO BIujAhSwttLWp",
"output": "YES"
},
{
"input": "FVFSr unvtXbpKWF vPaAgNaoTqklzVqiGYcUcBIcattzBrRuNSnKUtmdGKbjcE\nUzrU K an GFGR Wc zt iBa P c T K v p V In b B c",
"output": "YES"
},
{
"input": "lSwjnYLYtDNIZjxHiTawdh ntSzggZogcIZTuiTMWVgwyloMtEhqkrOxgIcFvwvsboXUPILPIymFAEXnhApewJXJNtFyZ\nAoxe jWZ u yImg o AZ FNI w lpj tNhT g y ZYcb rc J w Dlv",
"output": "YES"
},
{
"input": "kvlekcdJqODUKdsJlXkRaileTmdGwUHWWgvgUokQxRzzbpFnswvNKiDnjfOFGvFcnaaiRnBGQmqoPxDHepgYasLhzjDgmvaFfVNEcSPVQCJKAbSyTGpXsAjIHr\nGjzUllNaGGKXUdYmDFpqFAKIwvTpjmqnyswWRTnxlBnavAGvavxJemrjvRJc",
"output": "YES"
},
{
"input": "kWbvhgvvoYOhwXmgTwOSCDXrtFHhqwvMlCvsuuAUXMmWaYXiqHplFZZemhgkTuvsUtIaUxtyYauBIpjdbyYxjZ ZkaBPzwqPfqF kCqGRmXvWuabnQognnkvdNDtRUsSUvSzgBuxCMBWJifbxWegsknp\nBsH bWHJD n Ca T xq PRCv tatn Wjy sm I q s WCjFqdWe t W XUs Do eb Pfh ii hTbF O Fll",
"output": "YES"
},
{
"input": "OTmLdkMhmDEOMQMiW ZpzEIjyElHFrNCfFQDp SZyoZaEIUIpyCHfwOUqiSkKtFHggrTBGkqfOxkChPztmPrsHoxVwAdrxbZLKxPXHlMnrkgMgiaHFopiFFiUEtKwCjpJtwdwkbJCgA bxeDIscFdmHQJLAMNhWlrZisQrHQpvbALWTwpf jnx\nDbZwrQbydCdkJMCrftiwtPFfpMiwwrfIrKidEChKECxQUBVUEfFirbGWiLkFQkdJiFtkrtkbIAEXCEDkwLpK",
"output": "YES"
},
{
"input": "NwcGaIeSkOva\naIa",
"output": "YES"
},
{
"input": "gSrAcVYgAdbdayzbKGhIzLDjyznLRIJH KyvilAaEddmgkBPCNzpmPNeGEbmmpAyHvUSoPvnaORrPUuafpReEGoDOQsAYnUHYfBqhdcopQfxJuGXgKnbdVMQNhJYkyjiJDKlShqBTtnnDQQzEijOMcYRGMgPGVhfIReYennKBLwDTVvcHMIHMgVpJkvzTrezxqS\nHJerIVvRyfrPgAQMTI AqGNO mQDfDwQHKgeeYmuRmozKHILvehMPOJNMRtPTAfvKvsoGKi xHEeKqDAYmQJPUXRJbIbHrgVOMGMTdvYiLui",
"output": "YES"
},
{
"input": "ReB hksbHqQXxUgpvoNK bFqmNVCEiOyKdKcAJQRkpeohpfuqZabvrLfmpZOMcfyFBJGZwVMxiUPP pbZZtJjxhEwvrAba\nJTCpQnIViIGIdQtLnmkVzmcbBZR CoxAdTtWSYpbOglDFifqIVQ vfGKGtLpxpJHiHSWCMeRcrVOXBGBhoEnVhNTPWGTOErNtSvokcGdgZXbgTEtISUyTwaXUEIlJMmutsdCbiyrPZPJyRdOjnSuAGttLy",
"output": "NO"
},
{
"input": "hrLzRegCuDGxTrhDgVvM KowwyYuXGzIpcXdSMgeQVfVOtJZdkhNYSegwFWWoPqcZoeapbQnyCtojgkcyezUNHGGIZrhzsKrvvcrtokIdcnqXXkCNKjrOjrnEAKBNxyDdiMVeyLvXxUYMZQRFdlcdlcxzKTeYzBlmpNiwWbNAAhWkMoGpRxkCuyqkzXdKWwGH\nJESKDOfnFdxPvUOCkrgSBEPQHJtJHzuNGstRbTCcchRWJvCcveSEAtwtOmZZiW",
"output": "NO"
},
{
"input": "yDBxCtUygQwWqONxQCcuAvVCkMGlqgC zvkfEkwqbhMCQxnkwQIUhucCbVUyOBUcXvTNEGriTBwMDMfdsPZgWRgIUDqM\neptVnORTTyixxmWIBpSTEwOXqGZllBgSxPenYCDlFwckJlWsoVwWLAIbPOmFqcKcTcoQqahetl KLfVSyaLVebzsGwPSVbtQAeUdZAaJtfxlCEvvaRhLlVvRJhKat IaB awdqcDlrrhTbRxjEbzGwcdmdavkhcjHjzmwbxAgw",
"output": "NO"
},
{
"input": "jlMwnnotSdlQMluKWkJwAeCetcqbIEnKeNyLWoKCGONDRBQOjbkGpUvDlmSFUJ bWhohqmmIUWTlDsvelUArAcZJBipMDwUvRfBsYzMdQnPDPAuBaeJmAxVKwUMJrwMDxNtlrtAowVWqWiwFGtmquZAcrpFsLHCrvMSMMlvQUqypAihQWrFMNoaqfs IBg\nNzeWQ bafrmDsYlpNHSGTBBgPl WIcuNhyNaNOEFvL",
"output": "NO"
},
{
"input": "zyWvXBcUZqGqjHwZHQryBtFliLYnweXAoMKNpLaunaOlzaauWmLtywsEvWPiwxJapocAFRMjrqWJXYqfKEbBKnzLO\npsbi bsXpSeJaCkIuPWfSRADXdIClxcDCowwJzGCDTyAl",
"output": "NO"
},
{
"input": "kKhuIwRPLCwPFfcnsyCfBdnsraGeOCcLTfXuGjqFSGPSAeDZJSS bXKFanNqWjpFnvRpWxHJspvisDlADJBioxXNbVoXeUedoPcNEpUyEeYxdJXhGzFAmpAiHotSVwbZQsuWjIVhVaEGgqbZHIoDpiEmjTtFylCwCkWWzUOoUfOHxEZvDwNpXhBWamHn\nK VpJjGhNbwCRhcfmNGVjewBFpEmPlIKeTuWiukDtEWpjgqciqglkyNfWrBLbGAKvlNWxaUelJmSlSoakSpRzePvJsshOsTYrMPXdxKpaShjyVIXGhRIAdtiGpNwtiRmGTBZhkJqIMdxMHX RMxCMYcWjcjhtCHyFnCvjjezGbkRDRiVxkbh",
"output": "NO"
},
{
"input": "AXssNpFKyQmJcBdBdfkhhMUzfqJVgcLBddkwtnFSzSRUCjiDcdtmkzIGkCKSxWUEGhmHmciktJyGMkgCductyHx\nI nYhmJfPnvoKUiXYUBIPIcxNYTtvwPUoXERZvY ahlDpQFNMmVZqEBiYqYlHNqcpSCmhFczBlOAhsYFeqMGfqL EJsDNOgwoJfBzqijKOFcYQ",
"output": "NO"
},
{
"input": "lkhrzDZmkdbjzYKPNMRkiwCFoZsMzBQMnxxdKKVJezSBjnLjPpUYtabcPTIaDJeDEobbWHdKOdVfMQwDXzDDcSrwVenDEYpMqfiOQ xSsqApWnAMoyhQXCKFzHvvzvUvkWwmwZrvZz\nsUzGspYpRFsHRbRgTQuCBgnFgPkisTUfFNwyEEWWRiweWWgjRkVQxgTwxOzdsOwfrGIH O gCXpzvHzfItuEHaihmugEyymSJIogYwX qAwcwIItidfnzZDhZgQHi eRjMAeVkJHceDZuJkmxGowOsmcGYYvk Ajtgi TxwihvjLViNZjvscTWvsaQUelTSivLShhEl",
"output": "NO"
},
{
"input": "BRsVjyNhrqRHVwrJzuzRigEhdpbDmaACSPfed\nlWqKTjlrqOCUbgBBZdZDGCeQJDXawPnnDkQdZDgwrEQk",
"output": "NO"
},
{
"input": "KRmINuyBYPwiTsdlyiNVuylToysJKmOpcLovAtwGPqrgFJQNAYvuAiyQRkeFMECVZvkDEmTauXlyjAaYRnTJXORMZRnTakBaUzSelMilejySDIZjQjzcOIrwXdvDvpeRIkoBgreyFXIyyIZutjiEBtwrmzQtPVUhvvdEtDMbXjBpoPVjGdM EXTAK JbCnw\nXZZqlJvzKKtvdNlzFPDTYxidqlsgufVzyEmO FZuLQ vVQsJESNviUCovCK NwwlbxsmPtOJNmAonCqrOZ bZ LVKAsQGmoLnYjeekvEIECFk",
"output": "NO"
}
] | 1,623,923,833
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 154
| 102,400
|
from collections import Counter
def solve():
s1=input()
s2=input()
d1=Counter(s1)
d2=Counter(s2)
# print(d1)
# print(d2)
for i in d2:
if i!=" ":
if i not in d1:
print("NO")
return
if d1[i]<d2[i]:
print("NO")
return
print("YES")
solve()
|
Title: Letter
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya decided to write an anonymous letter cutting the letters out of a newspaper heading. He knows heading *s*1 and text *s*2 that he wants to send. Vasya can use every single heading letter no more than once. Vasya doesn't have to cut the spaces out of the heading β he just leaves some blank space to mark them. Help him; find out if he will manage to compose the needed text.
Input Specification:
The first line contains a newspaper heading *s*1. The second line contains the letter text *s*2. *s*1 ΠΈ *s*2 are non-empty lines consisting of spaces, uppercase and lowercase Latin letters, whose lengths do not exceed 200 symbols. The uppercase and lowercase letters should be differentiated. Vasya does not cut spaces out of the heading.
Output Specification:
If Vasya can write the given anonymous letter, print YES, otherwise print NO
Demo Input:
['Instead of dogging Your footsteps it disappears but you dont notice anything\nwhere is your dog\n', 'Instead of dogging Your footsteps it disappears but you dont notice anything\nYour dog is upstears\n', 'Instead of dogging your footsteps it disappears but you dont notice anything\nYour dog is upstears\n', 'abcdefg hijk\nk j i h g f e d c b a\n']
Demo Output:
['NO\n', 'YES\n', 'NO\n', 'YES\n']
Note:
none
|
```python
from collections import Counter
def solve():
s1=input()
s2=input()
d1=Counter(s1)
d2=Counter(s2)
# print(d1)
# print(d2)
for i in d2:
if i!=" ":
if i not in d1:
print("NO")
return
if d1[i]<d2[i]:
print("NO")
return
print("YES")
solve()
```
| 3.961309
|
58
|
A
|
Chat room
|
PROGRAMMING
| 1,000
|
[
"greedy",
"strings"
] |
A. Chat room
|
1
|
256
|
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
|
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
|
If Vasya managed to say hello, print "YES", otherwise print "NO".
|
[
"ahhellllloou\n",
"hlelo\n"
] |
[
"YES\n",
"NO\n"
] |
none
| 500
|
[
{
"input": "ahhellllloou",
"output": "YES"
},
{
"input": "hlelo",
"output": "NO"
},
{
"input": "helhcludoo",
"output": "YES"
},
{
"input": "hehwelloho",
"output": "YES"
},
{
"input": "pnnepelqomhhheollvlo",
"output": "YES"
},
{
"input": "tymbzjyqhymedasloqbq",
"output": "NO"
},
{
"input": "yehluhlkwo",
"output": "NO"
},
{
"input": "hatlevhhalrohairnolsvocafgueelrqmlqlleello",
"output": "YES"
},
{
"input": "hhhtehdbllnhwmbyhvelqqyoulretpbfokflhlhreeflxeftelziclrwllrpflflbdtotvlqgoaoqldlroovbfsq",
"output": "YES"
},
{
"input": "rzlvihhghnelqtwlexmvdjjrliqllolhyewgozkuovaiezgcilelqapuoeglnwmnlftxxiigzczlouooi",
"output": "YES"
},
{
"input": "pfhhwctyqdlkrwhebfqfelhyebwllhemtrmeblgrynmvyhioesqklclocxmlffuormljszllpoo",
"output": "YES"
},
{
"input": "lqllcolohwflhfhlnaow",
"output": "NO"
},
{
"input": "heheeellollvoo",
"output": "YES"
},
{
"input": "hellooo",
"output": "YES"
},
{
"input": "o",
"output": "NO"
},
{
"input": "hhqhzeclohlehljlhtesllylrolmomvuhcxsobtsckogdv",
"output": "YES"
},
{
"input": "yoegfuzhqsihygnhpnukluutocvvwuldiighpogsifealtgkfzqbwtmgghmythcxflebrkctlldlkzlagovwlstsghbouk",
"output": "YES"
},
{
"input": "uatqtgbvrnywfacwursctpagasnhydvmlinrcnqrry",
"output": "NO"
},
{
"input": "tndtbldbllnrwmbyhvqaqqyoudrstpbfokfoclnraefuxtftmgzicorwisrpfnfpbdtatvwqgyalqtdtrjqvbfsq",
"output": "NO"
},
{
"input": "rzlvirhgemelnzdawzpaoqtxmqucnahvqnwldklrmjiiyageraijfivigvozgwngiulttxxgzczptusoi",
"output": "YES"
},
{
"input": "kgyelmchocojsnaqdsyeqgnllytbqietpdlgknwwumqkxrexgdcnwoldicwzwofpmuesjuxzrasscvyuqwspm",
"output": "YES"
},
{
"input": "pnyvrcotjvgynbeldnxieghfltmexttuxzyac",
"output": "NO"
},
{
"input": "dtwhbqoumejligbenxvzhjlhosqojetcqsynlzyhfaevbdpekgbtjrbhlltbceobcok",
"output": "YES"
},
{
"input": "crrfpfftjwhhikwzeedrlwzblckkteseofjuxjrktcjfsylmlsvogvrcxbxtffujqshslemnixoeezivksouefeqlhhokwbqjz",
"output": "YES"
},
{
"input": "jhfbndhyzdvhbvhmhmefqllujdflwdpjbehedlsqfdsqlyelwjtyloxwsvasrbqosblzbowlqjmyeilcvotdlaouxhdpoeloaovb",
"output": "YES"
},
{
"input": "hwlghueoemiqtjhhpashjsouyegdlvoyzeunlroypoprnhlyiwiuxrghekaylndhrhllllwhbebezoglydcvykllotrlaqtvmlla",
"output": "YES"
},
{
"input": "wshiaunnqnqxodholbipwhhjmyeblhgpeleblklpzwhdunmpqkbuzloetmwwxmeltkrcomulxauzlwmlklldjodozxryghsnwgcz",
"output": "YES"
},
{
"input": "shvksednttggehroewuiptvvxtrzgidravtnjwuqrlnnkxbplctzkckinpkgjopjfoxdbojtcvsuvablcbkrzajrlhgobkcxeqti",
"output": "YES"
},
{
"input": "hyyhddqhxhekehkwfhlnlsihzefwchzerevcjtokefplholrbvxlltdlafjxrfhleglrvlolojoqaolagtbeyogxlbgfolllslli",
"output": "YES"
},
{
"input": "iaagrdhhelxpdegueiulflquvlzidoprzkehthkldaytrjwhyhprwjxlltinxvuilxohqgjqcvkkdcuoliekcnlilwgqlnlzouoo",
"output": "YES"
},
{
"input": "wfluaeseldgxyvxpwuhkptdmlflnlhktwxiabsvkolsquymrmhzczzoybvlilhmvsuunggvgxzgyyffk",
"output": "NO"
},
{
"input": "loee",
"output": "NO"
},
{
"input": "izdipwylefqmjbuoznfglgcfvedeouflkeehxbasaqmiooppfsqlhprospqgxvzrcpwlfdddngoqvpwvggsnvvxhmjoslwjudjlo",
"output": "NO"
},
{
"input": "pplynflbjlseflaegzqpdxswgunhnlglqhycrbcwdfhclmcrwekkzsoosmfblljeenwfjyifcvxihhhbyhmhlkvtskeglaovjnsi",
"output": "YES"
},
{
"input": "xqjqmenkodmlhzyzmmvofdngktygbbxbzpluzcohohmalkoeuwfikblltaaigv",
"output": "NO"
},
{
"input": "hello",
"output": "YES"
},
{
"input": "oohell",
"output": "NO"
},
{
"input": "hell",
"output": "NO"
},
{
"input": "eloellohoelo",
"output": "NO"
},
{
"input": "helllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllo",
"output": "YES"
}
] | 1,687,943,187
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 40
| 46
| 0
|
def can_say_hello(s):
target = "hello"
i = 0
for letter in s:
if letter == target[i]:
i += 1
if i == len(target):
return "YES"
return "NO"
s = str(input())
result = can_say_hello(s)
print(result)
|
Title: Chat room
Time Limit: 1 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya has recently learned to type and log on to the Internet. He immediately entered a chat room and decided to say hello to everybody. Vasya typed the word *s*. It is considered that Vasya managed to say hello if several letters can be deleted from the typed word so that it resulted in the word "hello". For example, if Vasya types the word "ahhellllloou", it will be considered that he said hello, and if he types "hlelo", it will be considered that Vasya got misunderstood and he didn't manage to say hello. Determine whether Vasya managed to say hello by the given word *s*.
Input Specification:
The first and only line contains the word *s*, which Vasya typed. This word consisits of small Latin letters, its length is no less that 1 and no more than 100 letters.
Output Specification:
If Vasya managed to say hello, print "YES", otherwise print "NO".
Demo Input:
['ahhellllloou\n', 'hlelo\n']
Demo Output:
['YES\n', 'NO\n']
Note:
none
|
```python
def can_say_hello(s):
target = "hello"
i = 0
for letter in s:
if letter == target[i]:
i += 1
if i == len(target):
return "YES"
return "NO"
s = str(input())
result = can_say_hello(s)
print(result)
```
| 3.977
|
39
|
D
|
Cubical Planet
|
PROGRAMMING
| 1,100
|
[
"math"
] |
D. Cubical Planet
|
2
|
64
|
You can find anything whatsoever in our Galaxy! A cubical planet goes round an icosahedral star. Let us introduce a system of axes so that the edges of the cubical planet are parallel to the coordinate axes and two opposite vertices lay in the points (0,<=0,<=0) and (1,<=1,<=1). Two flies live on the planet. At the moment they are sitting on two different vertices of the cubical planet. Your task is to determine whether they see each other or not. The flies see each other when the vertices they occupy lie on the same face of the cube.
|
The first line contains three space-separated integers (0 or 1) β the coordinates of the first fly, the second line analogously contains the coordinates of the second fly.
|
Output "YES" (without quotes) if the flies see each other. Otherwise, output "NO".
|
[
"0 0 0\n0 1 0\n",
"1 1 0\n0 1 0\n",
"0 0 0\n1 1 1\n"
] |
[
"YES\n",
"YES\n",
"NO\n"
] |
none
| 0
|
[
{
"input": "0 0 0\n0 1 0",
"output": "YES"
},
{
"input": "1 1 0\n0 1 0",
"output": "YES"
},
{
"input": "0 0 0\n1 1 1",
"output": "NO"
},
{
"input": "0 0 0\n1 0 0",
"output": "YES"
},
{
"input": "0 0 0\n0 1 0",
"output": "YES"
},
{
"input": "0 0 0\n1 1 0",
"output": "YES"
},
{
"input": "0 0 0\n0 0 1",
"output": "YES"
},
{
"input": "0 0 0\n1 0 1",
"output": "YES"
},
{
"input": "0 0 0\n0 1 1",
"output": "YES"
},
{
"input": "0 0 0\n1 1 1",
"output": "NO"
},
{
"input": "1 0 0\n0 0 0",
"output": "YES"
},
{
"input": "1 0 0\n0 1 0",
"output": "YES"
},
{
"input": "1 0 0\n1 1 0",
"output": "YES"
},
{
"input": "1 0 0\n0 0 1",
"output": "YES"
},
{
"input": "1 0 0\n1 0 1",
"output": "YES"
},
{
"input": "1 0 0\n0 1 1",
"output": "NO"
},
{
"input": "1 0 0\n1 1 1",
"output": "YES"
},
{
"input": "0 1 0\n0 0 0",
"output": "YES"
},
{
"input": "0 1 0\n1 0 0",
"output": "YES"
},
{
"input": "0 1 0\n1 1 0",
"output": "YES"
},
{
"input": "0 1 0\n0 0 1",
"output": "YES"
},
{
"input": "0 1 0\n1 0 1",
"output": "NO"
},
{
"input": "0 1 0\n0 1 1",
"output": "YES"
},
{
"input": "0 1 0\n1 1 1",
"output": "YES"
},
{
"input": "1 1 0\n0 0 0",
"output": "YES"
},
{
"input": "1 1 0\n1 0 0",
"output": "YES"
},
{
"input": "1 1 0\n0 1 0",
"output": "YES"
},
{
"input": "1 1 0\n0 0 1",
"output": "NO"
},
{
"input": "1 1 0\n1 0 1",
"output": "YES"
},
{
"input": "1 1 0\n0 1 1",
"output": "YES"
},
{
"input": "1 1 0\n1 1 1",
"output": "YES"
},
{
"input": "0 0 1\n0 0 0",
"output": "YES"
},
{
"input": "0 0 1\n1 0 0",
"output": "YES"
},
{
"input": "0 0 1\n0 1 0",
"output": "YES"
},
{
"input": "0 0 1\n1 1 0",
"output": "NO"
},
{
"input": "0 0 1\n1 0 1",
"output": "YES"
},
{
"input": "0 0 1\n0 1 1",
"output": "YES"
},
{
"input": "0 0 1\n1 1 1",
"output": "YES"
},
{
"input": "1 0 1\n0 0 0",
"output": "YES"
},
{
"input": "1 0 1\n1 0 0",
"output": "YES"
},
{
"input": "1 0 1\n0 1 0",
"output": "NO"
},
{
"input": "1 0 1\n1 1 0",
"output": "YES"
},
{
"input": "1 0 1\n0 0 1",
"output": "YES"
},
{
"input": "1 0 1\n0 1 1",
"output": "YES"
},
{
"input": "1 0 1\n1 1 1",
"output": "YES"
},
{
"input": "0 1 1\n0 0 0",
"output": "YES"
},
{
"input": "0 1 1\n1 0 0",
"output": "NO"
},
{
"input": "0 1 1\n0 1 0",
"output": "YES"
},
{
"input": "0 1 1\n1 1 0",
"output": "YES"
},
{
"input": "0 1 1\n0 0 1",
"output": "YES"
},
{
"input": "0 1 1\n1 0 1",
"output": "YES"
},
{
"input": "0 1 1\n1 1 1",
"output": "YES"
},
{
"input": "1 1 1\n0 0 0",
"output": "NO"
},
{
"input": "1 1 1\n1 0 0",
"output": "YES"
},
{
"input": "1 1 1\n0 1 0",
"output": "YES"
},
{
"input": "1 1 1\n1 1 0",
"output": "YES"
},
{
"input": "1 1 1\n0 0 1",
"output": "YES"
},
{
"input": "1 1 1\n1 0 1",
"output": "YES"
},
{
"input": "1 1 1\n0 1 1",
"output": "YES"
}
] | 1,695,301,310
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 59
| 92
| 0
|
# LUOGU_RID: 125479243
i=0
a,b,c=map(int,input().split())
d,e,f=map(int,input().split())
if(a==d):
i=i+1
if(b==e):
i=i+1
if(c==f):
i=i+1
if(i>=1):
print("YES")
else:
print("NO")
|
Title: Cubical Planet
Time Limit: 2 seconds
Memory Limit: 64 megabytes
Problem Description:
You can find anything whatsoever in our Galaxy! A cubical planet goes round an icosahedral star. Let us introduce a system of axes so that the edges of the cubical planet are parallel to the coordinate axes and two opposite vertices lay in the points (0,<=0,<=0) and (1,<=1,<=1). Two flies live on the planet. At the moment they are sitting on two different vertices of the cubical planet. Your task is to determine whether they see each other or not. The flies see each other when the vertices they occupy lie on the same face of the cube.
Input Specification:
The first line contains three space-separated integers (0 or 1) β the coordinates of the first fly, the second line analogously contains the coordinates of the second fly.
Output Specification:
Output "YES" (without quotes) if the flies see each other. Otherwise, output "NO".
Demo Input:
['0 0 0\n0 1 0\n', '1 1 0\n0 1 0\n', '0 0 0\n1 1 1\n']
Demo Output:
['YES\n', 'YES\n', 'NO\n']
Note:
none
|
```python
# LUOGU_RID: 125479243
i=0
a,b,c=map(int,input().split())
d,e,f=map(int,input().split())
if(a==d):
i=i+1
if(b==e):
i=i+1
if(c==f):
i=i+1
if(i>=1):
print("YES")
else:
print("NO")
```
| 3.977
|
59
|
A
|
Word
|
PROGRAMMING
| 800
|
[
"implementation",
"strings"
] |
A. Word
|
2
|
256
|
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP β with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
|
The first line contains a word *s* β it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
|
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
|
[
"HoUse\n",
"ViP\n",
"maTRIx\n"
] |
[
"house\n",
"VIP\n",
"matrix\n"
] |
none
| 500
|
[
{
"input": "HoUse",
"output": "house"
},
{
"input": "ViP",
"output": "VIP"
},
{
"input": "maTRIx",
"output": "matrix"
},
{
"input": "BNHWpnpawg",
"output": "bnhwpnpawg"
},
{
"input": "VTYGP",
"output": "VTYGP"
},
{
"input": "CHNenu",
"output": "chnenu"
},
{
"input": "ERPZGrodyu",
"output": "erpzgrodyu"
},
{
"input": "KSXBXWpebh",
"output": "KSXBXWPEBH"
},
{
"input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv",
"output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv"
},
{
"input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd",
"output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd"
},
{
"input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv",
"output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv"
},
{
"input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg",
"output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg"
},
{
"input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak",
"output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK"
},
{
"input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw",
"output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW"
},
{
"input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB",
"output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB"
},
{
"input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge",
"output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge"
},
{
"input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw",
"output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw"
},
{
"input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks",
"output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks"
},
{
"input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz",
"output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ"
},
{
"input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg",
"output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG"
},
{
"input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO",
"output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO"
},
{
"input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd",
"output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD"
},
{
"input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas",
"output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas"
},
{
"input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm",
"output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM"
},
{
"input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn",
"output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn"
},
{
"input": "t",
"output": "t"
},
{
"input": "N",
"output": "N"
},
{
"input": "kv",
"output": "kv"
},
{
"input": "Ur",
"output": "ur"
},
{
"input": "CN",
"output": "CN"
}
] | 1,612,459,059
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 154
| 0
|
h = input()
t = 0
b = 0
for i in h:
o = i
o1 = i.lower()
o2 = i.upper()
if i == o1:
t += 1
elif i == o2:
b += 1
if t >= b:
print(h.lower())
else:
print(h.upper())
|
Title: Word
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP β with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
Input Specification:
The first line contains a word *s* β it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Output Specification:
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
Demo Input:
['HoUse\n', 'ViP\n', 'maTRIx\n']
Demo Output:
['house\n', 'VIP\n', 'matrix\n']
Note:
none
|
```python
h = input()
t = 0
b = 0
for i in h:
o = i
o1 = i.lower()
o2 = i.upper()
if i == o1:
t += 1
elif i == o2:
b += 1
if t >= b:
print(h.lower())
else:
print(h.upper())
```
| 3.9615
|
405
|
A
|
Gravity Flip
|
PROGRAMMING
| 900
|
[
"greedy",
"implementation",
"sortings"
] | null | null |
Little Chris is bored during his physics lessons (too easy), so he has built a toy box to keep himself occupied. The box is special, since it has the ability to change gravity.
There are *n* columns of toy cubes in the box arranged in a line. The *i*-th column contains *a**i* cubes. At first, the gravity in the box is pulling the cubes downwards. When Chris switches the gravity, it begins to pull all the cubes to the right side of the box. The figure shows the initial and final configurations of the cubes in the box: the cubes that have changed their position are highlighted with orange.
Given the initial configuration of the toy cubes in the box, find the amounts of cubes in each of the *n* columns after the gravity switch!
|
The first line of input contains an integer *n* (1<=β€<=*n*<=β€<=100), the number of the columns in the box. The next line contains *n* space-separated integer numbers. The *i*-th number *a**i* (1<=β€<=*a**i*<=β€<=100) denotes the number of cubes in the *i*-th column.
|
Output *n* integer numbers separated by spaces, where the *i*-th number is the amount of cubes in the *i*-th column after the gravity switch.
|
[
"4\n3 2 1 2\n",
"3\n2 3 8\n"
] |
[
"1 2 2 3 \n",
"2 3 8 \n"
] |
The first example case is shown on the figure. The top cube of the first column falls to the top of the last column; the top cube of the second column falls to the top of the third column; the middle cube of the first column falls to the top of the second column.
In the second example case the gravity switch does not change the heights of the columns.
| 500
|
[
{
"input": "4\n3 2 1 2",
"output": "1 2 2 3 "
},
{
"input": "3\n2 3 8",
"output": "2 3 8 "
},
{
"input": "5\n2 1 2 1 2",
"output": "1 1 2 2 2 "
},
{
"input": "1\n1",
"output": "1 "
},
{
"input": "2\n4 3",
"output": "3 4 "
},
{
"input": "6\n100 40 60 20 1 80",
"output": "1 20 40 60 80 100 "
},
{
"input": "10\n10 8 6 7 5 3 4 2 9 1",
"output": "1 2 3 4 5 6 7 8 9 10 "
},
{
"input": "10\n1 2 3 4 5 6 7 8 9 10",
"output": "1 2 3 4 5 6 7 8 9 10 "
},
{
"input": "100\n82 51 81 14 37 17 78 92 64 15 8 86 89 8 87 77 66 10 15 12 100 25 92 47 21 78 20 63 13 49 41 36 41 79 16 87 87 69 3 76 80 60 100 49 70 59 72 8 38 71 45 97 71 14 76 54 81 4 59 46 39 29 92 3 49 22 53 99 59 52 74 31 92 43 42 23 44 9 82 47 7 40 12 9 3 55 37 85 46 22 84 52 98 41 21 77 63 17 62 91",
"output": "3 3 3 4 7 8 8 8 9 9 10 12 12 13 14 14 15 15 16 17 17 20 21 21 22 22 23 25 29 31 36 37 37 38 39 40 41 41 41 42 43 44 45 46 46 47 47 49 49 49 51 52 52 53 54 55 59 59 59 60 62 63 63 64 66 69 70 71 71 72 74 76 76 77 77 78 78 79 80 81 81 82 82 84 85 86 87 87 87 89 91 92 92 92 92 97 98 99 100 100 "
},
{
"input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100",
"output": "100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 "
},
{
"input": "10\n1 9 7 6 2 4 7 8 1 3",
"output": "1 1 2 3 4 6 7 7 8 9 "
},
{
"input": "20\n53 32 64 20 41 97 50 20 66 68 22 60 74 61 97 54 80 30 72 59",
"output": "20 20 22 30 32 41 50 53 54 59 60 61 64 66 68 72 74 80 97 97 "
},
{
"input": "30\n7 17 4 18 16 12 14 10 1 13 2 16 13 17 8 16 13 14 9 17 17 5 13 5 1 7 6 20 18 12",
"output": "1 1 2 4 5 5 6 7 7 8 9 10 12 12 13 13 13 13 14 14 16 16 16 17 17 17 17 18 18 20 "
},
{
"input": "40\n22 58 68 58 48 53 52 1 16 78 75 17 63 15 36 32 78 75 49 14 42 46 66 54 49 82 40 43 46 55 12 73 5 45 61 60 1 11 31 84",
"output": "1 1 5 11 12 14 15 16 17 22 31 32 36 40 42 43 45 46 46 48 49 49 52 53 54 55 58 58 60 61 63 66 68 73 75 75 78 78 82 84 "
},
{
"input": "70\n1 3 3 1 3 3 1 1 1 3 3 2 3 3 1 1 1 2 3 1 3 2 3 3 3 2 2 3 1 3 3 2 1 1 2 1 2 1 2 2 1 1 1 3 3 2 3 2 3 2 3 3 2 2 2 3 2 3 3 3 1 1 3 3 1 1 1 1 3 1",
"output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 "
},
{
"input": "90\n17 75 51 30 100 5 50 95 51 73 66 5 7 76 43 49 23 55 3 24 95 79 10 11 44 93 17 99 53 66 82 66 63 76 19 4 51 71 75 43 27 5 24 19 48 7 91 15 55 21 7 6 27 10 2 91 64 58 18 21 16 71 90 88 21 20 6 6 95 85 11 7 40 65 52 49 92 98 46 88 17 48 85 96 77 46 100 34 67 52",
"output": "2 3 4 5 5 5 6 6 6 7 7 7 7 10 10 11 11 15 16 17 17 17 18 19 19 20 21 21 21 23 24 24 27 27 30 34 40 43 43 44 46 46 48 48 49 49 50 51 51 51 52 52 53 55 55 58 63 64 65 66 66 66 67 71 71 73 75 75 76 76 77 79 82 85 85 88 88 90 91 91 92 93 95 95 95 96 98 99 100 100 "
},
{
"input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 "
},
{
"input": "100\n1 1 1 1 2 1 1 1 1 1 2 2 1 1 2 1 2 1 1 1 2 1 1 2 1 2 1 1 2 2 2 1 1 2 1 1 1 2 2 2 1 1 1 2 1 2 2 1 2 1 1 2 2 1 2 1 2 1 2 2 1 1 1 2 1 1 2 1 2 1 2 2 2 1 2 1 2 2 2 1 2 2 1 1 1 1 2 2 2 2 2 2 2 1 1 1 2 1 2 1",
"output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 "
},
{
"input": "100\n2 1 1 1 3 2 3 3 2 3 3 1 3 3 1 3 3 1 1 1 2 3 1 2 3 1 2 3 3 1 3 1 1 2 3 2 3 3 2 3 3 1 2 2 1 2 3 2 3 2 2 1 1 3 1 3 2 1 3 1 3 1 3 1 1 3 3 3 2 3 2 2 2 2 1 3 3 3 1 2 1 2 3 2 1 3 1 3 2 1 3 1 2 1 2 3 1 3 2 3",
"output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 "
},
{
"input": "100\n7 4 5 5 10 10 5 8 5 7 4 5 4 6 8 8 2 6 3 3 10 7 10 8 6 2 7 3 9 7 7 2 4 5 2 4 9 5 10 1 10 5 10 4 1 3 4 2 6 9 9 9 10 6 2 5 6 1 8 10 4 10 3 4 10 5 5 4 10 4 5 3 7 10 2 7 3 6 9 6 1 6 5 5 4 6 6 4 4 1 5 1 6 6 6 8 8 6 2 6",
"output": "1 1 1 1 1 1 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7 7 7 7 7 8 8 8 8 8 8 8 9 9 9 9 9 9 10 10 10 10 10 10 10 10 10 10 10 10 10 "
},
{
"input": "100\n12 10 5 11 13 12 14 13 7 15 15 12 13 19 12 18 14 10 10 3 1 10 16 11 19 8 10 15 5 10 12 16 11 13 11 15 14 12 16 8 11 8 15 2 18 2 14 13 15 20 8 8 4 12 14 7 10 3 9 1 7 19 6 7 2 14 8 20 7 17 18 20 3 18 18 9 6 10 4 1 4 19 9 13 3 3 12 11 11 20 8 2 13 6 7 12 1 4 17 3",
"output": "1 1 1 1 2 2 2 2 3 3 3 3 3 3 4 4 4 4 5 5 6 6 6 7 7 7 7 7 7 8 8 8 8 8 8 8 9 9 9 10 10 10 10 10 10 10 10 11 11 11 11 11 11 11 12 12 12 12 12 12 12 12 12 13 13 13 13 13 13 13 14 14 14 14 14 14 15 15 15 15 15 15 16 16 16 17 17 18 18 18 18 18 19 19 19 19 20 20 20 20 "
},
{
"input": "100\n5 13 1 40 30 10 23 32 33 12 6 4 15 29 31 17 23 5 36 31 32 38 24 11 34 39 19 21 6 19 31 35 1 15 6 29 22 15 17 15 1 17 2 34 20 8 27 2 29 26 13 9 22 27 27 3 20 40 4 40 33 29 36 30 35 16 19 28 26 11 36 24 29 5 40 10 38 34 33 23 34 39 31 7 10 31 22 6 36 24 14 31 34 23 2 4 26 16 2 32",
"output": "1 1 1 2 2 2 2 3 4 4 4 5 5 5 6 6 6 6 7 8 9 10 10 10 11 11 12 13 13 14 15 15 15 15 16 16 17 17 17 19 19 19 20 20 21 22 22 22 23 23 23 23 24 24 24 26 26 26 27 27 27 28 29 29 29 29 29 30 30 31 31 31 31 31 31 32 32 32 33 33 33 34 34 34 34 34 35 35 36 36 36 36 38 38 39 39 40 40 40 40 "
},
{
"input": "100\n72 44 34 74 9 60 26 37 55 77 74 69 28 66 54 55 8 36 57 31 31 48 32 66 40 70 77 43 64 28 37 10 21 58 51 32 60 28 51 52 28 35 7 33 1 68 38 70 57 71 8 20 42 57 59 4 58 10 17 47 22 48 16 3 76 67 32 37 64 47 33 41 75 69 2 76 39 9 27 75 20 21 52 25 71 21 11 29 38 10 3 1 45 55 63 36 27 7 59 41",
"output": "1 1 2 3 3 4 7 7 8 8 9 9 10 10 10 11 16 17 20 20 21 21 21 22 25 26 27 27 28 28 28 28 29 31 31 32 32 32 33 33 34 35 36 36 37 37 37 38 38 39 40 41 41 42 43 44 45 47 47 48 48 51 51 52 52 54 55 55 55 57 57 57 58 58 59 59 60 60 63 64 64 66 66 67 68 69 69 70 70 71 71 72 74 74 75 75 76 76 77 77 "
},
{
"input": "100\n75 18 61 10 56 53 42 57 79 80 31 2 50 45 54 99 84 52 71 21 86 3 19 98 14 37 40 62 63 68 5 10 87 8 81 85 52 52 57 94 2 7 56 96 19 76 1 13 81 6 80 47 22 59 99 32 9 5 36 88 98 91 70 70 12 93 12 22 85 1 97 48 94 16 84 84 51 34 62 7 68 51 30 2 37 82 4 7 27 1 80 9 61 16 59 55 12 96 94 82",
"output": "1 1 1 2 2 2 3 4 5 5 6 7 7 7 8 9 9 10 10 12 12 12 13 14 16 16 18 19 19 21 22 22 27 30 31 32 34 36 37 37 40 42 45 47 48 50 51 51 52 52 52 53 54 55 56 56 57 57 59 59 61 61 62 62 63 68 68 70 70 71 75 76 79 80 80 80 81 81 82 82 84 84 84 85 85 86 87 88 91 93 94 94 94 96 96 97 98 98 99 99 "
},
{
"input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100\n100 99 98 97 96 95 94 93 92 91 90 89 88 87 86 85 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1",
"output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 "
},
{
"input": "100\n50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50",
"output": "50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 "
},
{
"input": "49\n1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 83 85 87 89 91 93 95 97",
"output": "1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 83 85 87 89 91 93 95 97 "
},
{
"input": "30\n1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 61 64 67 70 73 76 79 82 85 88",
"output": "1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 61 64 67 70 73 76 79 82 85 88 "
},
{
"input": "100\n100 51 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1",
"output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 51 100 "
},
{
"input": "10\n100 90 80 70 60 50 40 30 20 10",
"output": "10 20 30 40 50 60 70 80 90 100 "
},
{
"input": "1\n10",
"output": "10 "
}
] | 1,688,720,453
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 32
| 31
| 0
|
def gravity_switch(columns):
columns.sort()
return columns
n = int(input())
columns = list(map(int, input().split()))
result = gravity_switch(columns)
print(*result)
|
Title: Gravity Flip
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Little Chris is bored during his physics lessons (too easy), so he has built a toy box to keep himself occupied. The box is special, since it has the ability to change gravity.
There are *n* columns of toy cubes in the box arranged in a line. The *i*-th column contains *a**i* cubes. At first, the gravity in the box is pulling the cubes downwards. When Chris switches the gravity, it begins to pull all the cubes to the right side of the box. The figure shows the initial and final configurations of the cubes in the box: the cubes that have changed their position are highlighted with orange.
Given the initial configuration of the toy cubes in the box, find the amounts of cubes in each of the *n* columns after the gravity switch!
Input Specification:
The first line of input contains an integer *n* (1<=β€<=*n*<=β€<=100), the number of the columns in the box. The next line contains *n* space-separated integer numbers. The *i*-th number *a**i* (1<=β€<=*a**i*<=β€<=100) denotes the number of cubes in the *i*-th column.
Output Specification:
Output *n* integer numbers separated by spaces, where the *i*-th number is the amount of cubes in the *i*-th column after the gravity switch.
Demo Input:
['4\n3 2 1 2\n', '3\n2 3 8\n']
Demo Output:
['1 2 2 3 \n', '2 3 8 \n']
Note:
The first example case is shown on the figure. The top cube of the first column falls to the top of the last column; the top cube of the second column falls to the top of the third column; the middle cube of the first column falls to the top of the second column.
In the second example case the gravity switch does not change the heights of the columns.
|
```python
def gravity_switch(columns):
columns.sort()
return columns
n = int(input())
columns = list(map(int, input().split()))
result = gravity_switch(columns)
print(*result)
```
| 3
|
|
931
|
A
|
Friends Meeting
|
PROGRAMMING
| 800
|
[
"brute force",
"greedy",
"implementation",
"math"
] | null | null |
Two friends are on the coordinate axis *Ox* in points with integer coordinates. One of them is in the point *x*1<==<=*a*, another one is in the point *x*2<==<=*b*.
Each of the friends can move by one along the line in any direction unlimited number of times. When a friend moves, the tiredness of a friend changes according to the following rules: the first move increases the tiredness by 1, the second move increases the tiredness by 2, the thirdΒ β by 3 and so on. For example, if a friend moves first to the left, then to the right (returning to the same point), and then again to the left his tiredness becomes equal to 1<=+<=2<=+<=3<==<=6.
The friends want to meet in a integer point. Determine the minimum total tiredness they should gain, if they meet in the same point.
|
The first line contains a single integer *a* (1<=β€<=*a*<=β€<=1000) β the initial position of the first friend.
The second line contains a single integer *b* (1<=β€<=*b*<=β€<=1000) β the initial position of the second friend.
It is guaranteed that *a*<=β <=*b*.
|
Print the minimum possible total tiredness if the friends meet in the same point.
|
[
"3\n4\n",
"101\n99\n",
"5\n10\n"
] |
[
"1\n",
"2\n",
"9\n"
] |
In the first example the first friend should move by one to the right (then the meeting happens at point 4), or the second friend should move by one to the left (then the meeting happens at point 3). In both cases, the total tiredness becomes 1.
In the second example the first friend should move by one to the left, and the second friend should move by one to the right. Then they meet in the point 100, and the total tiredness becomes 1β+β1β=β2.
In the third example one of the optimal ways is the following. The first friend should move three times to the right, and the second friend β two times to the left. Thus the friends meet in the point 8, and the total tiredness becomes 1β+β2β+β3β+β1β+β2β=β9.
| 500
|
[
{
"input": "3\n4",
"output": "1"
},
{
"input": "101\n99",
"output": "2"
},
{
"input": "5\n10",
"output": "9"
},
{
"input": "1\n2",
"output": "1"
},
{
"input": "1\n1000",
"output": "250000"
},
{
"input": "999\n1000",
"output": "1"
},
{
"input": "1000\n999",
"output": "1"
},
{
"input": "1000\n1",
"output": "250000"
},
{
"input": "2\n1",
"output": "1"
},
{
"input": "2\n999",
"output": "249001"
},
{
"input": "2\n998",
"output": "248502"
},
{
"input": "999\n2",
"output": "249001"
},
{
"input": "998\n2",
"output": "248502"
},
{
"input": "2\n1000",
"output": "249500"
},
{
"input": "1000\n2",
"output": "249500"
},
{
"input": "1\n999",
"output": "249500"
},
{
"input": "999\n1",
"output": "249500"
},
{
"input": "188\n762",
"output": "82656"
},
{
"input": "596\n777",
"output": "8281"
},
{
"input": "773\n70",
"output": "123904"
},
{
"input": "825\n729",
"output": "2352"
},
{
"input": "944\n348",
"output": "89102"
},
{
"input": "352\n445",
"output": "2209"
},
{
"input": "529\n656",
"output": "4096"
},
{
"input": "19\n315",
"output": "22052"
},
{
"input": "138\n370",
"output": "13572"
},
{
"input": "546\n593",
"output": "576"
},
{
"input": "285\n242",
"output": "484"
},
{
"input": "773\n901",
"output": "4160"
},
{
"input": "892\n520",
"output": "34782"
},
{
"input": "864\n179",
"output": "117649"
},
{
"input": "479\n470",
"output": "25"
},
{
"input": "967\n487",
"output": "57840"
},
{
"input": "648\n106",
"output": "73712"
},
{
"input": "58\n765",
"output": "125316"
},
{
"input": "235\n56",
"output": "8100"
},
{
"input": "285\n153",
"output": "4422"
},
{
"input": "943\n13",
"output": "216690"
},
{
"input": "675\n541",
"output": "4556"
},
{
"input": "4\n912",
"output": "206570"
}
] | 1,655,892,138
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 40
| 62
| 0
|
a=int(input())
b=int(input())
s=abs(a-b)
t=0
i=1
while s>0:
if s==1:
t+=i
s-=1
else:
s-=2
t+=i*2
i+=1
print(t)
|
Title: Friends Meeting
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Two friends are on the coordinate axis *Ox* in points with integer coordinates. One of them is in the point *x*1<==<=*a*, another one is in the point *x*2<==<=*b*.
Each of the friends can move by one along the line in any direction unlimited number of times. When a friend moves, the tiredness of a friend changes according to the following rules: the first move increases the tiredness by 1, the second move increases the tiredness by 2, the thirdΒ β by 3 and so on. For example, if a friend moves first to the left, then to the right (returning to the same point), and then again to the left his tiredness becomes equal to 1<=+<=2<=+<=3<==<=6.
The friends want to meet in a integer point. Determine the minimum total tiredness they should gain, if they meet in the same point.
Input Specification:
The first line contains a single integer *a* (1<=β€<=*a*<=β€<=1000) β the initial position of the first friend.
The second line contains a single integer *b* (1<=β€<=*b*<=β€<=1000) β the initial position of the second friend.
It is guaranteed that *a*<=β <=*b*.
Output Specification:
Print the minimum possible total tiredness if the friends meet in the same point.
Demo Input:
['3\n4\n', '101\n99\n', '5\n10\n']
Demo Output:
['1\n', '2\n', '9\n']
Note:
In the first example the first friend should move by one to the right (then the meeting happens at point 4), or the second friend should move by one to the left (then the meeting happens at point 3). In both cases, the total tiredness becomes 1.
In the second example the first friend should move by one to the left, and the second friend should move by one to the right. Then they meet in the point 100, and the total tiredness becomes 1β+β1β=β2.
In the third example one of the optimal ways is the following. The first friend should move three times to the right, and the second friend β two times to the left. Thus the friends meet in the point 8, and the total tiredness becomes 1β+β2β+β3β+β1β+β2β=β9.
|
```python
a=int(input())
b=int(input())
s=abs(a-b)
t=0
i=1
while s>0:
if s==1:
t+=i
s-=1
else:
s-=2
t+=i*2
i+=1
print(t)
```
| 3
|
|
22
|
B
|
Bargaining Table
|
PROGRAMMING
| 1,500
|
[
"brute force",
"dp"
] |
B. Bargaining Table
|
2
|
256
|
Bob wants to put a new bargaining table in his office. To do so he measured the office room thoroughly and drew its plan: Bob's office room is a rectangular room *n*<=Γ<=*m* meters. Each square meter of the room is either occupied by some furniture, or free. A bargaining table is rectangular, and should be placed so, that its sides are parallel to the office walls. Bob doesn't want to change or rearrange anything, that's why all the squares that will be occupied by the table should be initially free. Bob wants the new table to sit as many people as possible, thus its perimeter should be maximal. Help Bob find out the maximum possible perimeter of a bargaining table for his office.
|
The first line contains 2 space-separated numbers *n* and *m* (1<=β€<=*n*,<=*m*<=β€<=25) β the office room dimensions. Then there follow *n* lines with *m* characters 0 or 1 each. 0 stands for a free square meter of the office room. 1 stands for an occupied square meter. It's guaranteed that at least one square meter in the room is free.
|
Output one number β the maximum possible perimeter of a bargaining table for Bob's office room.
|
[
"3 3\n000\n010\n000\n",
"5 4\n1100\n0000\n0000\n0000\n0000\n"
] |
[
"8\n",
"16\n"
] |
none
| 0
|
[
{
"input": "3 3\n000\n010\n000",
"output": "8"
},
{
"input": "5 4\n1100\n0000\n0000\n0000\n0000",
"output": "16"
},
{
"input": "3 3\n000\n110\n000",
"output": "8"
},
{
"input": "4 2\n00\n10\n11\n00",
"output": "6"
},
{
"input": "3 5\n00001\n00000\n10100",
"output": "12"
},
{
"input": "1 1\n0",
"output": "4"
},
{
"input": "10 11\n11111111101\n01111111111\n11101111111\n01111110111\n11111111111\n11111111111\n11111111111\n11110111111\n11111111111\n11111111111",
"output": "4"
},
{
"input": "7 7\n1110111\n1111111\n1111101\n1111101\n1111111\n1100111\n1011111",
"output": "6"
},
{
"input": "10 10\n0110001011\n0101010111\n0010110100\n1010000110\n0111100011\n1010100100\n1010010000\n1011100011\n1110011000\n0010100101",
"output": "16"
},
{
"input": "20 20\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000\n00000000000000000000",
"output": "80"
},
{
"input": "25 1\n1\n1\n1\n0\n1\n1\n1\n1\n1\n1\n0\n1\n1\n1\n1\n1\n0\n1\n1\n1\n0\n1\n1\n1\n1",
"output": "4"
},
{
"input": "25 1\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0\n0",
"output": "52"
},
{
"input": "1 25\n1111111111111111011010110",
"output": "4"
},
{
"input": "1 25\n0000000000000000000000000",
"output": "52"
},
{
"input": "3 4\n1111\n1101\n1011",
"output": "4"
}
] | 1,580,511,082
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 23
| 592
| 6,348,800
|
n,m = [int(i) for i in input().split()]
matriz = []
for i in range(n):
matriz.append(input())
ans = 4
for i in range(n):
for j in range(m):
for k in range(i,n):
for l in range(j,m):
#print(i,j,k,l)
block = False
for x in range(i,k+1):
for y in range(j,l+1):
if matriz[x][y] == '1':
block = True
if not block:
ans = max(ans, (k+1-i)*2 + (l+1-j)*2)
print(ans)
|
Title: Bargaining Table
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
Bob wants to put a new bargaining table in his office. To do so he measured the office room thoroughly and drew its plan: Bob's office room is a rectangular room *n*<=Γ<=*m* meters. Each square meter of the room is either occupied by some furniture, or free. A bargaining table is rectangular, and should be placed so, that its sides are parallel to the office walls. Bob doesn't want to change or rearrange anything, that's why all the squares that will be occupied by the table should be initially free. Bob wants the new table to sit as many people as possible, thus its perimeter should be maximal. Help Bob find out the maximum possible perimeter of a bargaining table for his office.
Input Specification:
The first line contains 2 space-separated numbers *n* and *m* (1<=β€<=*n*,<=*m*<=β€<=25) β the office room dimensions. Then there follow *n* lines with *m* characters 0 or 1 each. 0 stands for a free square meter of the office room. 1 stands for an occupied square meter. It's guaranteed that at least one square meter in the room is free.
Output Specification:
Output one number β the maximum possible perimeter of a bargaining table for Bob's office room.
Demo Input:
['3 3\n000\n010\n000\n', '5 4\n1100\n0000\n0000\n0000\n0000\n']
Demo Output:
['8\n', '16\n']
Note:
none
|
```python
n,m = [int(i) for i in input().split()]
matriz = []
for i in range(n):
matriz.append(input())
ans = 4
for i in range(n):
for j in range(m):
for k in range(i,n):
for l in range(j,m):
#print(i,j,k,l)
block = False
for x in range(i,k+1):
for y in range(j,l+1):
if matriz[x][y] == '1':
block = True
if not block:
ans = max(ans, (k+1-i)*2 + (l+1-j)*2)
print(ans)
```
| 3.840174
|
721
|
A
|
One-dimensional Japanese Crossword
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Recently Adaltik discovered japanese crosswords. Japanese crossword is a picture, represented as a table sized *a*<=Γ<=*b* squares, and each square is colored white or black. There are integers to the left of the rows and to the top of the columns, encrypting the corresponding row or column. The number of integers represents how many groups of black squares there are in corresponding row or column, and the integers themselves represents the number of consecutive black squares in corresponding group (you can find more detailed explanation in Wikipedia [https://en.wikipedia.org/wiki/Japanese_crossword](https://en.wikipedia.org/wiki/Japanese_crossword)).
Adaltik decided that the general case of japanese crossword is too complicated and drew a row consisting of *n* squares (e.g. japanese crossword sized 1<=Γ<=*n*), which he wants to encrypt in the same way as in japanese crossword.
Help Adaltik find the numbers encrypting the row he drew.
|
The first line of the input contains a single integer *n* (1<=β€<=*n*<=β€<=100)Β β the length of the row. The second line of the input contains a single string consisting of *n* characters 'B' or 'W', ('B' corresponds to black square, 'W'Β β to white square in the row that Adaltik drew).
|
The first line should contain a single integer *k*Β β the number of integers encrypting the row, e.g. the number of groups of black squares in the row.
The second line should contain *k* integers, encrypting the row, e.g. corresponding to sizes of groups of consecutive black squares in the order from left to right.
|
[
"3\nBBW\n",
"5\nBWBWB\n",
"4\nWWWW\n",
"4\nBBBB\n",
"13\nWBBBBWWBWBBBW\n"
] |
[
"1\n2 ",
"3\n1 1 1 ",
"0\n",
"1\n4 ",
"3\n4 1 3 "
] |
The last sample case correspond to the picture in the statement.
| 500
|
[
{
"input": "3\nBBW",
"output": "1\n2 "
},
{
"input": "5\nBWBWB",
"output": "3\n1 1 1 "
},
{
"input": "4\nWWWW",
"output": "0"
},
{
"input": "4\nBBBB",
"output": "1\n4 "
},
{
"input": "13\nWBBBBWWBWBBBW",
"output": "3\n4 1 3 "
},
{
"input": "1\nB",
"output": "1\n1 "
},
{
"input": "2\nBB",
"output": "1\n2 "
},
{
"input": "100\nWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWBWB",
"output": "50\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 "
},
{
"input": "1\nW",
"output": "0"
},
{
"input": "2\nWW",
"output": "0"
},
{
"input": "2\nWB",
"output": "1\n1 "
},
{
"input": "2\nBW",
"output": "1\n1 "
},
{
"input": "3\nBBB",
"output": "1\n3 "
},
{
"input": "3\nBWB",
"output": "2\n1 1 "
},
{
"input": "3\nWBB",
"output": "1\n2 "
},
{
"input": "3\nWWB",
"output": "1\n1 "
},
{
"input": "3\nWBW",
"output": "1\n1 "
},
{
"input": "3\nBWW",
"output": "1\n1 "
},
{
"input": "3\nWWW",
"output": "0"
},
{
"input": "100\nBBBWWWWWWBBWWBBWWWBBWBBBBBBBBBBBWBBBWBBWWWBBWWBBBWBWWBBBWWBBBWBBBBBWWWBWWBBWWWWWWBWBBWWBWWWBWBWWWWWB",
"output": "21\n3 2 2 2 11 3 2 2 3 1 3 3 5 1 2 1 2 1 1 1 1 "
},
{
"input": "5\nBBBWB",
"output": "2\n3 1 "
},
{
"input": "5\nBWWWB",
"output": "2\n1 1 "
},
{
"input": "5\nWWWWB",
"output": "1\n1 "
},
{
"input": "5\nBWWWW",
"output": "1\n1 "
},
{
"input": "5\nBBBWW",
"output": "1\n3 "
},
{
"input": "5\nWWBBB",
"output": "1\n3 "
},
{
"input": "10\nBBBBBWWBBB",
"output": "2\n5 3 "
},
{
"input": "10\nBBBBWBBWBB",
"output": "3\n4 2 2 "
},
{
"input": "20\nBBBBBWWBWBBWBWWBWBBB",
"output": "6\n5 1 2 1 1 3 "
},
{
"input": "20\nBBBWWWWBBWWWBWBWWBBB",
"output": "5\n3 2 1 1 3 "
},
{
"input": "20\nBBBBBBBBWBBBWBWBWBBB",
"output": "5\n8 3 1 1 3 "
},
{
"input": "20\nBBBWBWBWWWBBWWWWBWBB",
"output": "6\n3 1 1 2 1 2 "
},
{
"input": "40\nBBBBBBWWWWBWBWWWBWWWWWWWWWWWBBBBBBBBBBBB",
"output": "5\n6 1 1 1 12 "
},
{
"input": "40\nBBBBBWBWWWBBWWWBWBWWBBBBWWWWBWBWBBBBBBBB",
"output": "9\n5 1 2 1 1 4 1 1 8 "
},
{
"input": "50\nBBBBBBBBBBBWWWWBWBWWWWBBBBBBBBWWWWWWWBWWWWBWBBBBBB",
"output": "7\n11 1 1 8 1 1 6 "
},
{
"input": "50\nWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWW",
"output": "0"
},
{
"input": "50\nBBBBBWWWWWBWWWBWWWWWBWWWBWWWWWWBBWBBWWWWBWWWWWWWBW",
"output": "9\n5 1 1 1 1 2 2 1 1 "
},
{
"input": "50\nWWWWBWWBWWWWWWWWWWWWWWWWWWWWWWWWWBWBWBWWWWWWWBBBBB",
"output": "6\n1 1 1 1 1 5 "
},
{
"input": "50\nBBBBBWBWBWWBWBWWWWWWBWBWBWWWWWWWWWWWWWBWBWWWWBWWWB",
"output": "12\n5 1 1 1 1 1 1 1 1 1 1 1 "
},
{
"input": "50\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB",
"output": "1\n50 "
},
{
"input": "100\nBBBBBBBBBBBWBWWWWBWWBBWBBWWWWWWWWWWBWBWWBWWWWWWWWWWWBBBWWBBWWWWWBWBWWWWBWWWWWWWWWWWBWWWWWBBBBBBBBBBB",
"output": "15\n11 1 1 2 2 1 1 1 3 2 1 1 1 1 11 "
},
{
"input": "100\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB",
"output": "1\n100 "
},
{
"input": "100\nBBBBBBBBBBBBBBBBBBBBWBWBWWWWWBWWWWWWWWWWWWWWBBWWWBWWWWBWWBWWWWWWBWWWWWWWWWWWWWBWBBBBBBBBBBBBBBBBBBBB",
"output": "11\n20 1 1 1 2 1 1 1 1 1 20 "
},
{
"input": "100\nBBBBWWWWWWWWWWWWWWWWWWWWWWWWWBWBWWWWWBWBWWWWWWBBWWWWWWWWWWWWBWWWWBWWWWWWWWWWWWBWWWWWWWBWWWWWWWBBBBBB",
"output": "11\n4 1 1 1 1 2 1 1 1 1 6 "
},
{
"input": "5\nBWBWB",
"output": "3\n1 1 1 "
},
{
"input": "10\nWWBWWWBWBB",
"output": "3\n1 1 2 "
},
{
"input": "50\nBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB",
"output": "1\n50 "
},
{
"input": "50\nBBBBBBBBBBBBBBBBBWWBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB",
"output": "2\n17 31 "
},
{
"input": "100\nBBBBBBBBBBBBBBBBBBBBBBBBWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWWBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB",
"output": "2\n24 42 "
},
{
"input": "90\nWWBWWBWBBWBBWWBWBWBBBWBWBBBWBWBWBWBWBWBWBWBBBBBWBBWWWWBWBBWBWWBBBWBWBWWBWBWBWBWWWWWWBWBBBB",
"output": "30\n1 1 2 2 1 1 3 1 3 1 1 1 1 1 1 1 5 2 1 2 1 3 1 1 1 1 1 1 1 4 "
},
{
"input": "100\nBWWWBWBWBBBBBWBWWBWBWWWBWBWBWWBBWWBBBWBBBWWBWBWWBBBBWBWBBBWBWBBWWWWWWBWWBBBBWBWBWWBWBWWWBWBWWBWBWWWB",
"output": "31\n1 1 1 5 1 1 1 1 1 1 2 3 3 1 1 4 1 3 1 2 1 4 1 1 1 1 1 1 1 1 1 "
},
{
"input": "90\nWBWBBBBBBWWWBBWWBWWWBBWWBWWWBWBBWBWBBWWWWBWBWBBWBBWBWWWBBWBBWWWWBWBBWWWBBBWBBWBWBBBBWWBWWB",
"output": "25\n1 6 2 1 2 1 1 2 1 2 1 1 2 2 1 2 2 1 2 3 2 1 4 1 1 "
},
{
"input": "80\nBBWWBBBWBBWWWWBBWBWBBWWWWWBWBBWWBWBWBWBWBWWBWWBWWWBWBBWBBWBBWBBBWWBBBBBBBWBBBWBB",
"output": "23\n2 3 2 2 1 2 1 2 1 1 1 1 1 1 1 1 2 2 2 3 7 3 2 "
},
{
"input": "65\nWWWWBWWWBBBBBWWWWWWBBBWWBBBBWWWWWWWWBBBWWWWBWBWWBBWWWWBWWWBBWBBBB",
"output": "11\n1 5 3 4 3 1 1 2 1 2 4 "
}
] | 1,660,948,051
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 54
| 46
| 0
|
# -*- coding: utf-8 -*-
_ = int(input())
squares = input()
blocks = []
block_size = 0
last_char = 'W'
for square in squares:
if square == 'B':
block_size += 1
elif square == 'W' and last_char == 'B':
blocks.append(str(block_size))
block_size = 0
last_char = square
if block_size != 0:
blocks.append(str(block_size))
print(len(blocks))
print(" ".join(blocks))
|
Title: One-dimensional Japanese Crossword
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Recently Adaltik discovered japanese crosswords. Japanese crossword is a picture, represented as a table sized *a*<=Γ<=*b* squares, and each square is colored white or black. There are integers to the left of the rows and to the top of the columns, encrypting the corresponding row or column. The number of integers represents how many groups of black squares there are in corresponding row or column, and the integers themselves represents the number of consecutive black squares in corresponding group (you can find more detailed explanation in Wikipedia [https://en.wikipedia.org/wiki/Japanese_crossword](https://en.wikipedia.org/wiki/Japanese_crossword)).
Adaltik decided that the general case of japanese crossword is too complicated and drew a row consisting of *n* squares (e.g. japanese crossword sized 1<=Γ<=*n*), which he wants to encrypt in the same way as in japanese crossword.
Help Adaltik find the numbers encrypting the row he drew.
Input Specification:
The first line of the input contains a single integer *n* (1<=β€<=*n*<=β€<=100)Β β the length of the row. The second line of the input contains a single string consisting of *n* characters 'B' or 'W', ('B' corresponds to black square, 'W'Β β to white square in the row that Adaltik drew).
Output Specification:
The first line should contain a single integer *k*Β β the number of integers encrypting the row, e.g. the number of groups of black squares in the row.
The second line should contain *k* integers, encrypting the row, e.g. corresponding to sizes of groups of consecutive black squares in the order from left to right.
Demo Input:
['3\nBBW\n', '5\nBWBWB\n', '4\nWWWW\n', '4\nBBBB\n', '13\nWBBBBWWBWBBBW\n']
Demo Output:
['1\n2 ', '3\n1 1 1 ', '0\n', '1\n4 ', '3\n4 1 3 ']
Note:
The last sample case correspond to the picture in the statement.
|
```python
# -*- coding: utf-8 -*-
_ = int(input())
squares = input()
blocks = []
block_size = 0
last_char = 'W'
for square in squares:
if square == 'B':
block_size += 1
elif square == 'W' and last_char == 'B':
blocks.append(str(block_size))
block_size = 0
last_char = square
if block_size != 0:
blocks.append(str(block_size))
print(len(blocks))
print(" ".join(blocks))
```
| 3
|
|
707
|
A
|
Brain's Photos
|
PROGRAMMING
| 800
|
[
"implementation"
] | null | null |
Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead.
As you may know, the coolest photos are on the film (because you can specify the hashtag #film for such).
Brain took a lot of colourful pictures on colored and black-and-white film. Then he developed and translated it into a digital form. But now, color and black-and-white photos are in one folder, and to sort them, one needs to spend more than one hour!
As soon as Brain is a photographer not programmer now, he asks you to help him determine for a single photo whether it is colored or black-and-white.
Photo can be represented as a matrix sized *n*<=Γ<=*m*, and each element of the matrix stores a symbol indicating corresponding pixel color. There are only 6 colors:
- 'C' (cyan)- 'M' (magenta)- 'Y' (yellow)- 'W' (white)- 'G' (grey)- 'B' (black)
The photo is considered black-and-white if it has only white, black and grey pixels in it. If there are any of cyan, magenta or yellow pixels in the photo then it is considered colored.
|
The first line of the input contains two integers *n* and *m* (1<=β€<=*n*,<=*m*<=β€<=100)Β β the number of photo pixel matrix rows and columns respectively.
Then *n* lines describing matrix rows follow. Each of them contains *m* space-separated characters describing colors of pixels in a row. Each character in the line is one of the 'C', 'M', 'Y', 'W', 'G' or 'B'.
|
Print the "#Black&White" (without quotes), if the photo is black-and-white and "#Color" (without quotes), if it is colored, in the only line.
|
[
"2 2\nC M\nY Y\n",
"3 2\nW W\nW W\nB B\n",
"1 1\nW\n"
] |
[
"#Color",
"#Black&White",
"#Black&White"
] |
none
| 500
|
[
{
"input": "2 2\nC M\nY Y",
"output": "#Color"
},
{
"input": "3 2\nW W\nW W\nB B",
"output": "#Black&White"
},
{
"input": "1 1\nW",
"output": "#Black&White"
},
{
"input": "2 3\nW W W\nB G Y",
"output": "#Color"
},
{
"input": "1 1\nW",
"output": "#Black&White"
},
{
"input": "5 5\nW G B Y M\nG B Y M C\nB Y M C W\nY M C W G\nM C W G B",
"output": "#Color"
},
{
"input": "1 6\nC M Y W G B",
"output": "#Color"
},
{
"input": "1 3\nW G B",
"output": "#Black&White"
},
{
"input": "1 1\nW",
"output": "#Black&White"
},
{
"input": "5 5\nW G B W G\nG B W G B\nB W G B W\nW G B W G\nG B W G B",
"output": "#Black&White"
},
{
"input": "2 3\nW W W\nB G C",
"output": "#Color"
},
{
"input": "2 3\nW W W\nB G M",
"output": "#Color"
},
{
"input": "3 3\nC B W\nB Y M\nB B W",
"output": "#Color"
},
{
"input": "1 3\nW C W",
"output": "#Color"
},
{
"input": "3 3\nB W B\nB C W\nB W W",
"output": "#Color"
},
{
"input": "1 2\nW Y",
"output": "#Color"
},
{
"input": "1 1\nG",
"output": "#Black&White"
},
{
"input": "1 3\nB G W",
"output": "#Black&White"
},
{
"input": "2 2\nW W\nB C",
"output": "#Color"
},
{
"input": "1 1\nM",
"output": "#Color"
},
{
"input": "1 2\nW C",
"output": "#Color"
},
{
"input": "2 3\nW W M\nW W M",
"output": "#Color"
},
{
"input": "3 2\nW W\nW W\nB C",
"output": "#Color"
},
{
"input": "2 3\nW W C\nW W W",
"output": "#Color"
},
{
"input": "1 3\nG G G",
"output": "#Black&White"
},
{
"input": "1 1\nC",
"output": "#Color"
},
{
"input": "1 2\nC W",
"output": "#Color"
},
{
"input": "1 3\nW W C",
"output": "#Color"
},
{
"input": "2 2\nW B\nB G",
"output": "#Black&White"
},
{
"input": "2 2\nB B\nY Y",
"output": "#Color"
},
{
"input": "2 2\nG G\nC C",
"output": "#Color"
},
{
"input": "1 2\nB C",
"output": "#Color"
},
{
"input": "1 4\nG G G C",
"output": "#Color"
},
{
"input": "1 1\nB",
"output": "#Black&White"
},
{
"input": "2 1\nY\nB",
"output": "#Color"
}
] | 1,655,958,351
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 50
| 46
| 0
|
n, m = map(int, input().split())
for _ in range(n):
line = input().split()
if "C" in line or "M" in line or "Y" in line:
print("#Color")
break
else:
print("#Black&White")
|
Title: Brain's Photos
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead.
As you may know, the coolest photos are on the film (because you can specify the hashtag #film for such).
Brain took a lot of colourful pictures on colored and black-and-white film. Then he developed and translated it into a digital form. But now, color and black-and-white photos are in one folder, and to sort them, one needs to spend more than one hour!
As soon as Brain is a photographer not programmer now, he asks you to help him determine for a single photo whether it is colored or black-and-white.
Photo can be represented as a matrix sized *n*<=Γ<=*m*, and each element of the matrix stores a symbol indicating corresponding pixel color. There are only 6 colors:
- 'C' (cyan)- 'M' (magenta)- 'Y' (yellow)- 'W' (white)- 'G' (grey)- 'B' (black)
The photo is considered black-and-white if it has only white, black and grey pixels in it. If there are any of cyan, magenta or yellow pixels in the photo then it is considered colored.
Input Specification:
The first line of the input contains two integers *n* and *m* (1<=β€<=*n*,<=*m*<=β€<=100)Β β the number of photo pixel matrix rows and columns respectively.
Then *n* lines describing matrix rows follow. Each of them contains *m* space-separated characters describing colors of pixels in a row. Each character in the line is one of the 'C', 'M', 'Y', 'W', 'G' or 'B'.
Output Specification:
Print the "#Black&White" (without quotes), if the photo is black-and-white and "#Color" (without quotes), if it is colored, in the only line.
Demo Input:
['2 2\nC M\nY Y\n', '3 2\nW W\nW W\nB B\n', '1 1\nW\n']
Demo Output:
['#Color', '#Black&White', '#Black&White']
Note:
none
|
```python
n, m = map(int, input().split())
for _ in range(n):
line = input().split()
if "C" in line or "M" in line or "Y" in line:
print("#Color")
break
else:
print("#Black&White")
```
| 3
|
|
750
|
A
|
New Year and Hurry
|
PROGRAMMING
| 800
|
[
"binary search",
"brute force",
"implementation",
"math"
] | null | null |
Limak is going to participate in a contest on the last day of the 2016. The contest will start at 20:00 and will last four hours, exactly until midnight. There will be *n* problems, sorted by difficulty, i.e. problem 1 is the easiest and problem *n* is the hardest. Limak knows it will take him 5Β·*i* minutes to solve the *i*-th problem.
Limak's friends organize a New Year's Eve party and Limak wants to be there at midnight or earlier. He needs *k* minutes to get there from his house, where he will participate in the contest first.
How many problems can Limak solve if he wants to make it to the party?
|
The only line of the input contains two integers *n* and *k* (1<=β€<=*n*<=β€<=10, 1<=β€<=*k*<=β€<=240)Β β the number of the problems in the contest and the number of minutes Limak needs to get to the party from his house.
|
Print one integer, denoting the maximum possible number of problems Limak can solve so that he could get to the party at midnight or earlier.
|
[
"3 222\n",
"4 190\n",
"7 1\n"
] |
[
"2\n",
"4\n",
"7\n"
] |
In the first sample, there are 3 problems and Limak needs 222 minutes to get to the party. The three problems require 5, 10 and 15 minutes respectively. Limak can spend 5β+β10β=β15 minutes to solve first two problems. Then, at 20:15 he can leave his house to get to the party at 23:57 (after 222 minutes). In this scenario Limak would solve 2 problems. He doesn't have enough time to solve 3 problems so the answer is 2.
In the second sample, Limak can solve all 4 problems in 5β+β10β+β15β+β20β=β50 minutes. At 20:50 he will leave the house and go to the party. He will get there exactly at midnight.
In the third sample, Limak needs only 1 minute to get to the party. He has enough time to solve all 7 problems.
| 500
|
[
{
"input": "3 222",
"output": "2"
},
{
"input": "4 190",
"output": "4"
},
{
"input": "7 1",
"output": "7"
},
{
"input": "10 135",
"output": "6"
},
{
"input": "10 136",
"output": "5"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "1 240",
"output": "0"
},
{
"input": "10 1",
"output": "9"
},
{
"input": "10 240",
"output": "0"
},
{
"input": "9 240",
"output": "0"
},
{
"input": "9 1",
"output": "9"
},
{
"input": "9 235",
"output": "1"
},
{
"input": "9 236",
"output": "0"
},
{
"input": "5 225",
"output": "2"
},
{
"input": "5 226",
"output": "1"
},
{
"input": "4 210",
"output": "3"
},
{
"input": "4 211",
"output": "2"
},
{
"input": "4 191",
"output": "3"
},
{
"input": "10 165",
"output": "5"
},
{
"input": "10 166",
"output": "4"
},
{
"input": "8 100",
"output": "7"
},
{
"input": "8 101",
"output": "6"
},
{
"input": "8 60",
"output": "8"
},
{
"input": "8 61",
"output": "7"
},
{
"input": "10 15",
"output": "9"
},
{
"input": "10 16",
"output": "8"
},
{
"input": "4 100",
"output": "4"
},
{
"input": "4 101",
"output": "4"
},
{
"input": "7 167",
"output": "4"
},
{
"input": "10 164",
"output": "5"
},
{
"input": "9 170",
"output": "4"
},
{
"input": "8 160",
"output": "5"
},
{
"input": "1 100",
"output": "1"
},
{
"input": "8 123",
"output": "6"
},
{
"input": "2 99",
"output": "2"
},
{
"input": "10 88",
"output": "7"
},
{
"input": "1 235",
"output": "1"
},
{
"input": "1 1",
"output": "1"
},
{
"input": "4 240",
"output": "0"
},
{
"input": "1 55",
"output": "1"
},
{
"input": "1 240",
"output": "0"
},
{
"input": "3 240",
"output": "0"
},
{
"input": "10 240",
"output": "0"
},
{
"input": "2 240",
"output": "0"
},
{
"input": "10 1",
"output": "9"
},
{
"input": "9 1",
"output": "9"
},
{
"input": "2 236",
"output": "0"
},
{
"input": "10 2",
"output": "9"
},
{
"input": "3 239",
"output": "0"
},
{
"input": "1 237",
"output": "0"
},
{
"input": "7 8",
"output": "7"
},
{
"input": "10 235",
"output": "1"
}
] | 1,695,510,652
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 52
| 62
| 0
|
p, m = map(int, input().strip().split()); count, org = 0, 4*60
for i in range(1, p+1):
dn = 5*i
if (org - dn) < m:
break
else:
count += 1
org -= dn
print (count)
|
Title: New Year and Hurry
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Limak is going to participate in a contest on the last day of the 2016. The contest will start at 20:00 and will last four hours, exactly until midnight. There will be *n* problems, sorted by difficulty, i.e. problem 1 is the easiest and problem *n* is the hardest. Limak knows it will take him 5Β·*i* minutes to solve the *i*-th problem.
Limak's friends organize a New Year's Eve party and Limak wants to be there at midnight or earlier. He needs *k* minutes to get there from his house, where he will participate in the contest first.
How many problems can Limak solve if he wants to make it to the party?
Input Specification:
The only line of the input contains two integers *n* and *k* (1<=β€<=*n*<=β€<=10, 1<=β€<=*k*<=β€<=240)Β β the number of the problems in the contest and the number of minutes Limak needs to get to the party from his house.
Output Specification:
Print one integer, denoting the maximum possible number of problems Limak can solve so that he could get to the party at midnight or earlier.
Demo Input:
['3 222\n', '4 190\n', '7 1\n']
Demo Output:
['2\n', '4\n', '7\n']
Note:
In the first sample, there are 3 problems and Limak needs 222 minutes to get to the party. The three problems require 5, 10 and 15 minutes respectively. Limak can spend 5β+β10β=β15 minutes to solve first two problems. Then, at 20:15 he can leave his house to get to the party at 23:57 (after 222 minutes). In this scenario Limak would solve 2 problems. He doesn't have enough time to solve 3 problems so the answer is 2.
In the second sample, Limak can solve all 4 problems in 5β+β10β+β15β+β20β=β50 minutes. At 20:50 he will leave the house and go to the party. He will get there exactly at midnight.
In the third sample, Limak needs only 1 minute to get to the party. He has enough time to solve all 7 problems.
|
```python
p, m = map(int, input().strip().split()); count, org = 0, 4*60
for i in range(1, p+1):
dn = 5*i
if (org - dn) < m:
break
else:
count += 1
org -= dn
print (count)
```
| 3
|
|
78
|
B
|
Easter Eggs
|
PROGRAMMING
| 1,200
|
[
"constructive algorithms",
"implementation"
] |
B. Easter Eggs
|
2
|
256
|
The Easter Rabbit laid *n* eggs in a circle and is about to paint them.
Each egg should be painted one color out of 7: red, orange, yellow, green, blue, indigo or violet. Also, the following conditions should be satisfied:
- Each of the seven colors should be used to paint at least one egg. - Any four eggs lying sequentially should be painted different colors.
Help the Easter Rabbit paint the eggs in the required manner. We know that it is always possible.
|
The only line contains an integer *n* β the amount of eggs (7<=β€<=*n*<=β€<=100).
|
Print one line consisting of *n* characters. The *i*-th character should describe the color of the *i*-th egg in the order they lie in the circle. The colors should be represented as follows: "R" stands for red, "O" stands for orange, "Y" stands for yellow, "G" stands for green, "B" stands for blue, "I" stands for indigo, "V" stands for violet.
If there are several answers, print any of them.
|
[
"8\n",
"13\n"
] |
[
"ROYGRBIV\n",
"ROYGBIVGBIVYG\n"
] |
The way the eggs will be painted in the first sample is shown on the picture:
| 1,000
|
[
{
"input": "8",
"output": "ROYGBIVG"
},
{
"input": "13",
"output": "ROYGBIVOYGBIV"
},
{
"input": "7",
"output": "ROYGBIV"
},
{
"input": "10",
"output": "ROYGBIVYGB"
},
{
"input": "14",
"output": "ROYGBIVROYGBIV"
},
{
"input": "50",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVG"
},
{
"input": "9",
"output": "ROYGBIVGB"
},
{
"input": "11",
"output": "ROYGBIVYGBI"
},
{
"input": "12",
"output": "ROYGBIVOYGBI"
},
{
"input": "15",
"output": "ROYGBIVROYGBIVG"
},
{
"input": "16",
"output": "ROYGBIVROYGBIVGB"
},
{
"input": "17",
"output": "ROYGBIVROYGBIVYGB"
},
{
"input": "18",
"output": "ROYGBIVROYGBIVYGBI"
},
{
"input": "19",
"output": "ROYGBIVROYGBIVOYGBI"
},
{
"input": "20",
"output": "ROYGBIVROYGBIVOYGBIV"
},
{
"input": "21",
"output": "ROYGBIVROYGBIVROYGBIV"
},
{
"input": "22",
"output": "ROYGBIVROYGBIVROYGBIVG"
},
{
"input": "23",
"output": "ROYGBIVROYGBIVROYGBIVGB"
},
{
"input": "24",
"output": "ROYGBIVROYGBIVROYGBIVYGB"
},
{
"input": "25",
"output": "ROYGBIVROYGBIVROYGBIVYGBI"
},
{
"input": "28",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIV"
},
{
"input": "29",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVG"
},
{
"input": "34",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVOYGBIV"
},
{
"input": "43",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVG"
},
{
"input": "61",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVOYGBI"
},
{
"input": "79",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVGB"
},
{
"input": "81",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVYGBI"
},
{
"input": "92",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVG"
},
{
"input": "95",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVYGBI"
},
{
"input": "96",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVOYGBI"
},
{
"input": "97",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVOYGBIV"
},
{
"input": "98",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIV"
},
{
"input": "99",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVG"
},
{
"input": "100",
"output": "ROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVROYGBIVGB"
}
] | 1,621,875,260
| 2,147,483,647
|
PyPy 3
|
OK
|
TESTS
| 34
| 280
| 2,355,200
|
import sys
import string
from collections import Counter, defaultdict
from math import fsum, sqrt, gcd, ceil, factorial
from operator import *
from itertools import accumulate
inf = float("inf")
# input = sys.stdin.readline
flush = lambda: sys.stdout.flush
comb = lambda x, y: (factorial(x) // factorial(y)) // factorial(x - y)
# inputs
# ip = lambda : input().rstrip()
ip = lambda: input()
ii = lambda: int(input())
r = lambda: map(int, input().split())
rr = lambda: list(r())
n = ii()
a = n // 7
b = n % 7
s = "VIBGYOR"
ans = list(s * a + "-" * b + s)
i = 7 * a
for j in range(i, i + b):
x = list(s)
for k in range(max(0, j - 3), j + 4):
if ans[k] in x:
x.remove(ans[k])
ans[j] = x[0]
ans = (ans[:-7])
print(''.join(ans))
|
Title: Easter Eggs
Time Limit: 2 seconds
Memory Limit: 256 megabytes
Problem Description:
The Easter Rabbit laid *n* eggs in a circle and is about to paint them.
Each egg should be painted one color out of 7: red, orange, yellow, green, blue, indigo or violet. Also, the following conditions should be satisfied:
- Each of the seven colors should be used to paint at least one egg. - Any four eggs lying sequentially should be painted different colors.
Help the Easter Rabbit paint the eggs in the required manner. We know that it is always possible.
Input Specification:
The only line contains an integer *n* β the amount of eggs (7<=β€<=*n*<=β€<=100).
Output Specification:
Print one line consisting of *n* characters. The *i*-th character should describe the color of the *i*-th egg in the order they lie in the circle. The colors should be represented as follows: "R" stands for red, "O" stands for orange, "Y" stands for yellow, "G" stands for green, "B" stands for blue, "I" stands for indigo, "V" stands for violet.
If there are several answers, print any of them.
Demo Input:
['8\n', '13\n']
Demo Output:
['ROYGRBIV\n', 'ROYGBIVGBIVYG\n']
Note:
The way the eggs will be painted in the first sample is shown on the picture:
|
```python
import sys
import string
from collections import Counter, defaultdict
from math import fsum, sqrt, gcd, ceil, factorial
from operator import *
from itertools import accumulate
inf = float("inf")
# input = sys.stdin.readline
flush = lambda: sys.stdout.flush
comb = lambda x, y: (factorial(x) // factorial(y)) // factorial(x - y)
# inputs
# ip = lambda : input().rstrip()
ip = lambda: input()
ii = lambda: int(input())
r = lambda: map(int, input().split())
rr = lambda: list(r())
n = ii()
a = n // 7
b = n % 7
s = "VIBGYOR"
ans = list(s * a + "-" * b + s)
i = 7 * a
for j in range(i, i + b):
x = list(s)
for k in range(max(0, j - 3), j + 4):
if ans[k] in x:
x.remove(ans[k])
ans[j] = x[0]
ans = (ans[:-7])
print(''.join(ans))
```
| 3.925613
|
672
|
B
|
Different is Good
|
PROGRAMMING
| 1,000
|
[
"constructive algorithms",
"implementation",
"strings"
] | null | null |
A wise man told Kerem "Different is good" once, so Kerem wants all things in his life to be different.
Kerem recently got a string *s* consisting of lowercase English letters. Since Kerem likes it when things are different, he wants all substrings of his string *s* to be distinct. Substring is a string formed by some number of consecutive characters of the string. For example, string "aba" has substrings "" (empty substring), "a", "b", "a", "ab", "ba", "aba".
If string *s* has at least two equal substrings then Kerem will change characters at some positions to some other lowercase English letters. Changing characters is a very tiring job, so Kerem want to perform as few changes as possible.
Your task is to find the minimum number of changes needed to make all the substrings of the given string distinct, or determine that it is impossible.
|
The first line of the input contains an integer *n* (1<=β€<=*n*<=β€<=100<=000)Β β the length of the string *s*.
The second line contains the string *s* of length *n* consisting of only lowercase English letters.
|
If it's impossible to change the string *s* such that all its substring are distinct print -1. Otherwise print the minimum required number of changes.
|
[
"2\naa\n",
"4\nkoko\n",
"5\nmurat\n"
] |
[
"1\n",
"2\n",
"0\n"
] |
In the first sample one of the possible solutions is to change the first character to 'b'.
In the second sample, one may change the first character to 'a' and second character to 'b', so the string becomes "abko".
| 1,000
|
[
{
"input": "2\naa",
"output": "1"
},
{
"input": "4\nkoko",
"output": "2"
},
{
"input": "5\nmurat",
"output": "0"
},
{
"input": "6\nacbead",
"output": "1"
},
{
"input": "7\ncdaadad",
"output": "4"
},
{
"input": "25\npeoaicnbisdocqofsqdpgobpn",
"output": "12"
},
{
"input": "25\ntcqpchnqskqjacruoaqilgebu",
"output": "7"
},
{
"input": "13\naebaecedabbee",
"output": "8"
},
{
"input": "27\naaaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "-1"
},
{
"input": "10\nbababbdaee",
"output": "6"
},
{
"input": "11\ndbadcdbdbca",
"output": "7"
},
{
"input": "12\nacceaabddaaa",
"output": "7"
},
{
"input": "13\nabddfbfaeecfa",
"output": "7"
},
{
"input": "14\neeceecacdbcbbb",
"output": "9"
},
{
"input": "15\ndcbceaaggabaheb",
"output": "8"
},
{
"input": "16\nhgiegfbadgcicbhd",
"output": "7"
},
{
"input": "17\nabhfibbdddfghgfdi",
"output": "10"
},
{
"input": "26\nbbbbbabbaababaaabaaababbaa",
"output": "24"
},
{
"input": "26\nahnxdnbfbcrirerssyzydihuee",
"output": "11"
},
{
"input": "26\nhwqeqhkpxwulbsiwmnlfyhgknc",
"output": "8"
},
{
"input": "26\nrvxmulriorilidecqwmfaemifj",
"output": "10"
},
{
"input": "26\naowpmreooavnmamogdoopuisge",
"output": "12"
},
{
"input": "26\ninimevtuefhvuefirdehmmfudh",
"output": "15"
},
{
"input": "26\naaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "25"
},
{
"input": "27\nqdcfjtblgglnilgassirrjekcjt",
"output": "-1"
},
{
"input": "27\nabcdefghijklmnopqrstuvwxyza",
"output": "-1"
},
{
"input": "26\nqwertyuiopasdfghjklzxcvbnm",
"output": "0"
},
{
"input": "5\nzzzzz",
"output": "4"
},
{
"input": "27\naaaaaaaaaaaaaaaaabaaaaaaaaa",
"output": "-1"
},
{
"input": "1\nq",
"output": "0"
},
{
"input": "27\nqwertyuioplkjhgfdsazxcvbnmm",
"output": "-1"
},
{
"input": "9\nxxxyyyzzz",
"output": "6"
},
{
"input": "45\naaabbbcccdddeeefffgghhiijjkkkkkkkkkkkkkkkkkkk",
"output": "-1"
},
{
"input": "27\nqwertyuiopasdfghjklzxcvbnmm",
"output": "-1"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxyz",
"output": "0"
},
{
"input": "26\nabcdefghijklmnopqrstuvwxya",
"output": "1"
},
{
"input": "27\nabcdefghijklmnopqrstuvwxyzz",
"output": "-1"
},
{
"input": "26\naaaaaaaaaaaaaaaaaaaaaaaaaa",
"output": "25"
},
{
"input": "26\nqwertyuioplkjhgfdsazxcvbnm",
"output": "0"
},
{
"input": "10\nzzzzzzzzzz",
"output": "9"
},
{
"input": "1\na",
"output": "0"
},
{
"input": "30\nabcdefghtyabcdefghtyabcdefghty",
"output": "-1"
}
] | 1,577,289,082
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 47
| 109
| 307,200
|
t=int(input())
a=input()
l=[]
f=list(set(a))
for i in f:
l.append(a.count(i))
if len(a)<27:
print(sum(l)-len(f))
else:
print(-1)
|
Title: Different is Good
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
A wise man told Kerem "Different is good" once, so Kerem wants all things in his life to be different.
Kerem recently got a string *s* consisting of lowercase English letters. Since Kerem likes it when things are different, he wants all substrings of his string *s* to be distinct. Substring is a string formed by some number of consecutive characters of the string. For example, string "aba" has substrings "" (empty substring), "a", "b", "a", "ab", "ba", "aba".
If string *s* has at least two equal substrings then Kerem will change characters at some positions to some other lowercase English letters. Changing characters is a very tiring job, so Kerem want to perform as few changes as possible.
Your task is to find the minimum number of changes needed to make all the substrings of the given string distinct, or determine that it is impossible.
Input Specification:
The first line of the input contains an integer *n* (1<=β€<=*n*<=β€<=100<=000)Β β the length of the string *s*.
The second line contains the string *s* of length *n* consisting of only lowercase English letters.
Output Specification:
If it's impossible to change the string *s* such that all its substring are distinct print -1. Otherwise print the minimum required number of changes.
Demo Input:
['2\naa\n', '4\nkoko\n', '5\nmurat\n']
Demo Output:
['1\n', '2\n', '0\n']
Note:
In the first sample one of the possible solutions is to change the first character to 'b'.
In the second sample, one may change the first character to 'a' and second character to 'b', so the string becomes "abko".
|
```python
t=int(input())
a=input()
l=[]
f=list(set(a))
for i in f:
l.append(a.count(i))
if len(a)<27:
print(sum(l)-len(f))
else:
print(-1)
```
| 3
|
|
141
|
A
|
Amusing Joke
|
PROGRAMMING
| 800
|
[
"implementation",
"sortings",
"strings"
] | null | null |
So, the New Year holidays are over. Santa Claus and his colleagues can take a rest and have guests at last. When two "New Year and Christmas Men" meet, thear assistants cut out of cardboard the letters from the guest's name and the host's name in honor of this event. Then the hung the letters above the main entrance. One night, when everyone went to bed, someone took all the letters of our characters' names. Then he may have shuffled the letters and put them in one pile in front of the door.
The next morning it was impossible to find the culprit who had made the disorder. But everybody wondered whether it is possible to restore the names of the host and his guests from the letters lying at the door? That is, we need to verify that there are no extra letters, and that nobody will need to cut more letters.
Help the "New Year and Christmas Men" and their friends to cope with this problem. You are given both inscriptions that hung over the front door the previous night, and a pile of letters that were found at the front door next morning.
|
The input file consists of three lines: the first line contains the guest's name, the second line contains the name of the residence host and the third line contains letters in a pile that were found at the door in the morning. All lines are not empty and contain only uppercase Latin letters. The length of each line does not exceed 100.
|
Print "YES" without the quotes, if the letters in the pile could be permuted to make the names of the "New Year and Christmas Men". Otherwise, print "NO" without the quotes.
|
[
"SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS\n",
"PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI\n",
"BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER\n"
] |
[
"YES\n",
"NO\n",
"NO\n"
] |
In the first sample the letters written in the last line can be used to write the names and there won't be any extra letters left.
In the second sample letter "P" is missing from the pile and there's an extra letter "L".
In the third sample there's an extra letter "L".
| 500
|
[
{
"input": "SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS",
"output": "YES"
},
{
"input": "PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI",
"output": "NO"
},
{
"input": "BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER",
"output": "NO"
},
{
"input": "B\nA\nAB",
"output": "YES"
},
{
"input": "ONDOL\nJNPB\nONLNJBODP",
"output": "YES"
},
{
"input": "Y\nW\nYW",
"output": "YES"
},
{
"input": "OI\nM\nIMO",
"output": "YES"
},
{
"input": "VFQRWWWACX\nGHZJPOQUSXRAQDGOGMR\nOPAWDOUSGWWCGQXXQAZJRQRGHRMVF",
"output": "YES"
},
{
"input": "JUTCN\nPIGMZOPMEUFADQBW\nNWQGZMAIPUPOMCDUB",
"output": "NO"
},
{
"input": "Z\nO\nZOCNDOLTBZKQLTBOLDEGXRHZGTTPBJBLSJCVSVXISQZCSFDEBXRCSGBGTHWOVIXYHACAGBRYBKBJAEPIQZHVEGLYH",
"output": "NO"
},
{
"input": "IQ\nOQ\nQOQIGGKFNHJSGCGM",
"output": "NO"
},
{
"input": "ROUWANOPNIGTVMIITVMZ\nOQTUPZMTKUGY\nVTVNGZITGPUNPMQOOATUUIYIWMMKZOTR",
"output": "YES"
},
{
"input": "OVQELLOGFIOLEHXMEMBJDIGBPGEYFG\nJNKFPFFIJOFHRIFHXEWYZOPDJBZTJZKBWQTECNHRFSJPJOAPQT\nYAIPFFFEXJJNEJPLREIGODEGQZVMCOBDFKWTMWJSBEBTOFFQOHIQJLHFNXIGOHEZRZLFOKJBJPTPHPGY",
"output": "YES"
},
{
"input": "NBJGVNGUISUXQTBOBKYHQCOOVQWUXWPXBUDLXPKX\nNSFQDFUMQDQWQ\nWXKKVNTDQQFXCUQBIMQGQHSLVGWSBFYBUPOWPBDUUJUXQNOQDNXOX",
"output": "YES"
},
{
"input": "IJHHGKCXWDBRWJUPRDBZJLNTTNWKXLUGJSBWBOAUKWRAQWGFNL\nNJMWRMBCNPHXTDQQNZ\nWDNJRCLILNQRHWBANLTXWMJBPKUPGKJDJZAQWKTZFBRCTXHHBNXRGUQUNBNMWODGSJWW",
"output": "YES"
},
{
"input": "SRROWANGUGZHCIEFYMQVTWVOMDWPUZJFRDUMVFHYNHNTTGNXCJ\nDJYWGLBFCCECXFHOLORDGDCNRHPWXNHXFCXQCEZUHRRNAEKUIX\nWCUJDNYHNHYOPWMHLDCDYRWBVOGHFFUKOZTXJRXJHRGWICCMRNEVNEGQWTZPNFCSHDRFCFQDCXMHTLUGZAXOFNXNVGUEXIACRERU",
"output": "YES"
},
{
"input": "H\nJKFGHMIAHNDBMFXWYQLZRSVNOTEGCQSVUBYUOZBTNKTXPFQDCMKAGFITEUGOYDFIYQIORMFJEOJDNTFVIQEBICSNGKOSNLNXJWC\nBQSVDOGIHCHXSYNYTQFCHNJGYFIXTSOQINZOKSVQJMTKNTGFNXAVTUYEONMBQMGJLEWJOFGEARIOPKFUFCEMUBRBDNIIDFZDCLWK",
"output": "YES"
},
{
"input": "DSWNZRFVXQ\nPVULCZGOOU\nUOLVZXNUPOQRZGWFVDSCANQTCLEIE",
"output": "NO"
},
{
"input": "EUHTSCENIPXLTSBMLFHD\nIZAVSZPDLXOAGESUSE\nLXAELAZ",
"output": "NO"
},
{
"input": "WYSJFEREGELSKRQRXDXCGBODEFZVSI\nPEJKMGFLBFFDWRCRFSHVEFLEBTJCVCHRJTLDTISHPOGFWPLEWNYJLMXWIAOTYOXMV\nHXERTZWLEXTPIOTFRVMEJVYFFJLRPFMXDEBNSGCEOFFCWTKIDDGCFYSJKGLHBORWEPLDRXRSJYBGASSVCMHEEJFLVI",
"output": "NO"
},
{
"input": "EPBMDIUQAAUGLBIETKOKFLMTCVEPETWJRHHYKCKU\nHGMAETVPCFZYNNKDQXVXUALHYLOTCHM\nECGXACVKEYMCEDOTMKAUFHLHOMT",
"output": "NO"
},
{
"input": "NUBKQEJHALANSHEIFUZHYEZKKDRFHQKAJHLAOWTZIMOCWOVVDW\nEFVOBIGAUAUSQGVSNBKNOBDMINODMFSHDL\nKLAMKNTHBFFOHVKWICHBKNDDQNEISODUSDNLUSIOAVWY",
"output": "NO"
},
{
"input": "VXINHOMEQCATZUGAJEIUIZZLPYFGUTVLNBNWCUVMEENUXKBWBGZTMRJJVJDLVSLBABVCEUDDSQFHOYPYQTWVAGTWOLKYISAGHBMC\nZMRGXPZSHOGCSAECAPGVOIGCWEOWWOJXLGYRDMPXBLOKZVRACPYQLEQGFQCVYXAGBEBELUTDAYEAGPFKXRULZCKFHZCHVCWIRGPK\nRCVUXGQVNWFGRUDLLENNDQEJHYYVWMKTLOVIPELKPWCLSQPTAXAYEMGWCBXEVAIZGGDDRBRT",
"output": "NO"
},
{
"input": "PHBDHHWUUTZAHELGSGGOPOQXSXEZIXHZTOKYFBQLBDYWPVCNQSXHEAXRRPVHFJBVBYCJIFOTQTWSUOWXLKMVJJBNLGTVITWTCZZ\nFUPDLNVIHRWTEEEHOOEC\nLOUSUUSZCHJBPEWIILUOXEXRQNCJEGTOBRVZLTTZAHTKVEJSNGHFTAYGY",
"output": "NO"
},
{
"input": "GDSLNIIKTO\nJF\nPDQYFKDTNOLI",
"output": "NO"
},
{
"input": "AHOKHEKKPJLJIIWJRCGY\nORELJCSIX\nZVWPXVFWFSWOXXLIHJKPXIOKRELYE",
"output": "NO"
},
{
"input": "ZWCOJFORBPHXCOVJIDPKVECMHVHCOC\nTEV\nJVGTBFTLFVIEPCCHODOFOMCVZHWXVCPEH",
"output": "NO"
},
{
"input": "AGFIGYWJLVMYZGNQHEHWKJIAWBPUAQFERMCDROFN\nPMJNHMVNRGCYZAVRWNDSMLSZHFNYIUWFPUSKKIGU\nMCDVPPRXGUAYLSDRHRURZASXUWZSIIEZCPXUVEONKNGNWRYGOSFMCKESMVJZHWWUCHWDQMLASLNNMHAU",
"output": "NO"
},
{
"input": "XLOWVFCZSSXCSYQTIIDKHNTKNKEEDFMDZKXSPVLBIDIREDUAIN\nZKIWNDGBISDB\nSLPKLYFYSRNRMOSWYLJJDGFFENPOXYLPZFTQDANKBDNZDIIEWSUTTKYBKVICLG",
"output": "NO"
},
{
"input": "PMUKBTRKFIAYVGBKHZHUSJYSSEPEOEWPOSPJLWLOCTUYZODLTUAFCMVKGQKRRUSOMPAYOTBTFPXYAZXLOADDEJBDLYOTXJCJYTHA\nTWRRAJLCQJTKOKWCGUH\nEWDPNXVCXWCDQCOYKKSOYTFSZTOOPKPRDKFJDETKSRAJRVCPDOBWUGPYRJPUWJYWCBLKOOTUPBESTOFXZHTYLLMCAXDYAEBUTAHM",
"output": "NO"
},
{
"input": "QMIMGQRQDMJDPNFEFXSXQMCHEJKTWCTCVZPUAYICOIRYOWKUSIWXJLHDYWSBOITHTMINXFKBKAWZTXXBJIVYCRWKXNKIYKLDDXL\nV\nFWACCXBVDOJFIUAVYRALBYJKXXWIIFORRUHKHCXLDBZMXIYJWISFEAWTIQFIZSBXMKNOCQKVKRWDNDAMQSTKYLDNYVTUCGOJXJTW",
"output": "NO"
},
{
"input": "XJXPVOOQODELPPWUISSYVVXRJTYBPDHJNENQEVQNVFIXSESKXVYPVVHPMOSX\nLEXOPFPVPSZK\nZVXVPYEYOYXVOISVLXPOVHEQVXPNQJIOPFDTXEUNMPEPPHELNXKKWSVSOXSBPSJDPVJVSRFQ",
"output": "YES"
},
{
"input": "OSKFHGYNQLSRFSAHPXKGPXUHXTRBJNAQRBSSWJVEENLJCDDHFXVCUNPZAIVVO\nFNUOCXAGRRHNDJAHVVLGGEZQHWARYHENBKHP\nUOEFNWVXCUNERLKVTHAGPSHKHDYFPYWZHJKHQLSNFBJHVJANRXCNSDUGVDABGHVAOVHBJZXGRACHRXEGNRPQEAPORQSILNXFS",
"output": "YES"
},
{
"input": "VYXYVVACMLPDHONBUTQFZTRREERBLKUJYKAHZRCTRLRCLOZYWVPBRGDQPFPQIF\nFE\nRNRPEVDRLYUQFYRZBCQLCYZEABKLRXCJLKVZBVFUEYRATOMDRTHFPGOWQVTIFPPH",
"output": "YES"
},
{
"input": "WYXUZQJQNLASEGLHPMSARWMTTQMQLVAZLGHPIZTRVTCXDXBOLNXZPOFCTEHCXBZ\nBLQZRRWP\nGIQZXPLTTMNHQVWPPEAPLOCDMBSTHRCFLCQRRZXLVAOQEGZBRUZJXXZTMAWLZHSLWNQTYXB",
"output": "YES"
},
{
"input": "MKVJTSSTDGKPVVDPYSRJJYEVGKBMSIOKHLZQAEWLRIBINVRDAJIBCEITKDHUCCVY\nPUJJQFHOGZKTAVNUGKQUHMKTNHCCTI\nQVJKUSIGTSVYUMOMLEGHWYKSKQTGATTKBNTKCJKJPCAIRJIRMHKBIZISEGFHVUVQZBDERJCVAKDLNTHUDCHONDCVVJIYPP",
"output": "YES"
},
{
"input": "OKNJOEYVMZXJMLVJHCSPLUCNYGTDASKSGKKCRVIDGEIBEWRVBVRVZZTLMCJLXHJIA\nDJBFVRTARTFZOWN\nAGHNVUNJVCPLWSVYBJKZSVTFGLELZASLWTIXDDJXCZDICTVIJOTMVEYOVRNMJGRKKHRMEBORAKFCZJBR",
"output": "YES"
},
{
"input": "OQZACLPSAGYDWHFXDFYFRRXWGIEJGSXWUONAFWNFXDTGVNDEWNQPHUXUJNZWWLBPYL\nOHBKWRFDRQUAFRCMT\nWIQRYXRJQWWRUWCYXNXALKFZGXFTLOODWRDPGURFUFUQOHPWBASZNVWXNCAGHWEHFYESJNFBMNFDDAPLDGT",
"output": "YES"
},
{
"input": "OVIRQRFQOOWVDEPLCJETWQSINIOPLTLXHSQWUYUJNFBMKDNOSHNJQQCDHZOJVPRYVSV\nMYYDQKOOYPOOUELCRIT\nNZSOTVLJTTVQLFHDQEJONEOUOFOLYVSOIYUDNOSIQVIRMVOERCLMYSHPCQKIDRDOQPCUPQBWWRYYOXJWJQPNKH",
"output": "YES"
},
{
"input": "WGMBZWNMSJXNGDUQUJTCNXDSJJLYRDOPEGPQXYUGBESDLFTJRZDDCAAFGCOCYCQMDBWK\nYOBMOVYTUATTFGJLYUQD\nDYXVTLQCYFJUNJTUXPUYOPCBCLBWNSDUJRJGWDOJDSQAAMUOJWSYERDYDXYTMTOTMQCGQZDCGNFBALGGDFKZMEBG",
"output": "YES"
},
{
"input": "CWLRBPMEZCXAPUUQFXCUHAQTLPBTXUUKWVXKBHKNSSJFEXLZMXGVFHHVTPYAQYTIKXJJE\nMUFOSEUEXEQTOVLGDSCWM\nJUKEQCXOXWEHCGKFPBIGMWVJLXUONFXBYTUAXERYTXKCESKLXAEHVPZMMUFTHLXTTZSDMBJLQPEUWCVUHSQQVUASPF",
"output": "YES"
},
{
"input": "IDQRX\nWETHO\nODPDGBHVUVSSISROHQJTUKPUCLXABIZQQPPBPKOSEWGEHRSRRNBAVLYEMZISMWWGKHVTXKUGUXEFBSWOIWUHRJGMWBMHQLDZHBWA",
"output": "NO"
},
{
"input": "IXFDY\nJRMOU\nDF",
"output": "NO"
},
{
"input": "JPSPZ\nUGCUB\nJMZZZZZZZZ",
"output": "NO"
},
{
"input": "AC\nA\nBBA",
"output": "NO"
},
{
"input": "UIKWWKXLSHTOOZOVGXKYSOJEHAUEEG\nKZXQDWJJWRXFHKJDQHJK\nXMZHTFOGEXAUJXXJUYVJIFOTKLZHDKELJWERHMGAWGKWAQKEKHIDWGGZVYOHKXRPWSJDPESFJUMKQYWBYUTHQYEFZUGKQOBHYDWB",
"output": "NO"
},
{
"input": "PXWRXRPFLR\nPJRWWXIVHODV\nXW",
"output": "NO"
},
{
"input": "CHTAZVHGSHCVIBK\nEQINEBKXEPYJSAZIMLDF\nZCZZZZDZMCZZEZDZZEZZZZQZZBZZZOZZCZE",
"output": "NO"
},
{
"input": "GXPZFSELJJNDAXYRV\nUYBKPMVBSOVOJWMONLTJOJCNQKMTAHEWLHOWIIBH\nHCWNFWJPEJIWOVPTBMVCRJLSISSVNOHCKLBFMIUAIMASQWPXEYXBOXQGFEMYJLBKDCZIMJNHOJEDGGANIVYKQTUOSOVOPWHVJGXH",
"output": "NO"
},
{
"input": "LFGJCJJDUTUP\nOVSBILTIYCJCRHKCIXCETJQJJ\nGIJJTJCLTJJJ",
"output": "NO"
},
{
"input": "GIO\nPRL\nPRL",
"output": "NO"
},
{
"input": "A\nB\nABC",
"output": "NO"
},
{
"input": "KKK\nKKK\nZZZZZ",
"output": "NO"
},
{
"input": "ZMYGQLDBLAPN\nZFJBKWHROVNPSJQUDFTHOCGREUFLYIWYICD\nZMJZZEDAZANKZZZZZZEZZBZDZZZZZZKHZZFZZZDZNZMDZZA",
"output": "NO"
}
] | 1,687,785,237
| 2,147,483,647
|
PyPy 3-64
|
OK
|
TESTS
| 54
| 124
| 0
|
from collections import Counter
s1=input()
s2=input()
s3=input()
name=s1+s2
'''name_counter=Counter(name)
s3_counter=Counter(s3)'''
if Counter(name)==Counter(s3):
print('YES')
else:
print('NO')
|
Title: Amusing Joke
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
So, the New Year holidays are over. Santa Claus and his colleagues can take a rest and have guests at last. When two "New Year and Christmas Men" meet, thear assistants cut out of cardboard the letters from the guest's name and the host's name in honor of this event. Then the hung the letters above the main entrance. One night, when everyone went to bed, someone took all the letters of our characters' names. Then he may have shuffled the letters and put them in one pile in front of the door.
The next morning it was impossible to find the culprit who had made the disorder. But everybody wondered whether it is possible to restore the names of the host and his guests from the letters lying at the door? That is, we need to verify that there are no extra letters, and that nobody will need to cut more letters.
Help the "New Year and Christmas Men" and their friends to cope with this problem. You are given both inscriptions that hung over the front door the previous night, and a pile of letters that were found at the front door next morning.
Input Specification:
The input file consists of three lines: the first line contains the guest's name, the second line contains the name of the residence host and the third line contains letters in a pile that were found at the door in the morning. All lines are not empty and contain only uppercase Latin letters. The length of each line does not exceed 100.
Output Specification:
Print "YES" without the quotes, if the letters in the pile could be permuted to make the names of the "New Year and Christmas Men". Otherwise, print "NO" without the quotes.
Demo Input:
['SANTACLAUS\nDEDMOROZ\nSANTAMOROZDEDCLAUS\n', 'PAPAINOEL\nJOULUPUKKI\nJOULNAPAOILELUPUKKI\n', 'BABBONATALE\nFATHERCHRISTMAS\nBABCHRISTMASBONATALLEFATHER\n']
Demo Output:
['YES\n', 'NO\n', 'NO\n']
Note:
In the first sample the letters written in the last line can be used to write the names and there won't be any extra letters left.
In the second sample letter "P" is missing from the pile and there's an extra letter "L".
In the third sample there's an extra letter "L".
|
```python
from collections import Counter
s1=input()
s2=input()
s3=input()
name=s1+s2
'''name_counter=Counter(name)
s3_counter=Counter(s3)'''
if Counter(name)==Counter(s3):
print('YES')
else:
print('NO')
```
| 3
|
|
466
|
C
|
Number of Ways
|
PROGRAMMING
| 1,700
|
[
"binary search",
"brute force",
"data structures",
"dp",
"two pointers"
] | null | null |
You've got array *a*[1],<=*a*[2],<=...,<=*a*[*n*], consisting of *n* integers. Count the number of ways to split all the elements of the array into three contiguous parts so that the sum of elements in each part is the same.
More formally, you need to find the number of such pairs of indices *i*,<=*j* (2<=β€<=*i*<=β€<=*j*<=β€<=*n*<=-<=1), that .
|
The first line contains integer *n* (1<=β€<=*n*<=β€<=5Β·105), showing how many numbers are in the array. The second line contains *n* integers *a*[1], *a*[2], ..., *a*[*n*] (|*a*[*i*]|<=β€<=<=109) β the elements of array *a*.
|
Print a single integer β the number of ways to split the array into three parts with the same sum.
|
[
"5\n1 2 3 0 3\n",
"4\n0 1 -1 0\n",
"2\n4 1\n"
] |
[
"2\n",
"1\n",
"0\n"
] |
none
| 1,500
|
[
{
"input": "5\n1 2 3 0 3",
"output": "2"
},
{
"input": "4\n0 1 -1 0",
"output": "1"
},
{
"input": "2\n4 1",
"output": "0"
},
{
"input": "9\n0 0 0 0 0 0 0 0 0",
"output": "28"
},
{
"input": "10\n2 5 -2 2 -3 -2 3 5 -5 -2",
"output": "0"
},
{
"input": "1\n1",
"output": "0"
},
{
"input": "3\n1 2 3",
"output": "0"
},
{
"input": "100\n1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1",
"output": "2030"
},
{
"input": "6\n1000000000 1000000000 1000000000 1000000000 1000000000 1000000000",
"output": "1"
},
{
"input": "10\n1 0 0 0 1 1 1 0 1 1",
"output": "2"
},
{
"input": "10\n-2 2 -2 0 -2 -1 1 -1 2 0",
"output": "0"
},
{
"input": "4\n0 2 -1 2",
"output": "0"
},
{
"input": "5\n3 3 -3 3 3",
"output": "3"
},
{
"input": "5\n1 1 1 1 1",
"output": "0"
},
{
"input": "8\n-1 -1 -1 -1 -1 -1 -1 -1",
"output": "0"
},
{
"input": "2\n0 0",
"output": "0"
},
{
"input": "4\n1 -1 0 0",
"output": "1"
},
{
"input": "3\n6 -3 6",
"output": "0"
}
] | 1,699,349,292
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 30
| 342
| 61,440,000
|
n=int(input())
nums=list(map(int,input().split()))
s=sum(nums)
if s%3!=0:
print(0)
exit()
s=s//3
ans,cnt,pre_sum=0,0,0
for i in range(n-1):
pre_sum+=nums[i]
if pre_sum==s*2:
ans+=cnt
if pre_sum==s:
cnt+=1
print(ans)
|
Title: Number of Ways
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
You've got array *a*[1],<=*a*[2],<=...,<=*a*[*n*], consisting of *n* integers. Count the number of ways to split all the elements of the array into three contiguous parts so that the sum of elements in each part is the same.
More formally, you need to find the number of such pairs of indices *i*,<=*j* (2<=β€<=*i*<=β€<=*j*<=β€<=*n*<=-<=1), that .
Input Specification:
The first line contains integer *n* (1<=β€<=*n*<=β€<=5Β·105), showing how many numbers are in the array. The second line contains *n* integers *a*[1], *a*[2], ..., *a*[*n*] (|*a*[*i*]|<=β€<=<=109) β the elements of array *a*.
Output Specification:
Print a single integer β the number of ways to split the array into three parts with the same sum.
Demo Input:
['5\n1 2 3 0 3\n', '4\n0 1 -1 0\n', '2\n4 1\n']
Demo Output:
['2\n', '1\n', '0\n']
Note:
none
|
```python
n=int(input())
nums=list(map(int,input().split()))
s=sum(nums)
if s%3!=0:
print(0)
exit()
s=s//3
ans,cnt,pre_sum=0,0,0
for i in range(n-1):
pre_sum+=nums[i]
if pre_sum==s*2:
ans+=cnt
if pre_sum==s:
cnt+=1
print(ans)
```
| 3
|
|
9
|
A
|
Die Roll
|
PROGRAMMING
| 800
|
[
"math",
"probabilities"
] |
A. Die Roll
|
1
|
64
|
Yakko, Wakko and Dot, world-famous animaniacs, decided to rest from acting in cartoons, and take a leave to travel a bit. Yakko dreamt to go to Pennsylvania, his Motherland and the Motherland of his ancestors. Wakko thought about Tasmania, its beaches, sun and sea. Dot chose Transylvania as the most mysterious and unpredictable place.
But to their great regret, the leave turned to be very short, so it will be enough to visit one of the three above named places. That's why Yakko, as the cleverest, came up with a truly genius idea: let each of the three roll an ordinary six-sided die, and the one with the highest amount of points will be the winner, and will take the other two to the place of his/her dreams.
Yakko thrown a die and got Y points, Wakko β W points. It was Dot's turn. But she didn't hurry. Dot wanted to know for sure what were her chances to visit Transylvania.
It is known that Yakko and Wakko are true gentlemen, that's why if they have the same amount of points with Dot, they will let Dot win.
|
The only line of the input file contains two natural numbers Y and W β the results of Yakko's and Wakko's die rolls.
|
Output the required probability in the form of irreducible fraction in format Β«A/BΒ», where A β the numerator, and B β the denominator. If the required probability equals to zero, output Β«0/1Β». If the required probability equals to 1, output Β«1/1Β».
|
[
"4 2\n"
] |
[
"1/2\n"
] |
Dot will go to Transylvania, if she is lucky to roll 4, 5 or 6 points.
| 0
|
[
{
"input": "4 2",
"output": "1/2"
},
{
"input": "1 1",
"output": "1/1"
},
{
"input": "1 2",
"output": "5/6"
},
{
"input": "1 3",
"output": "2/3"
},
{
"input": "1 4",
"output": "1/2"
},
{
"input": "1 5",
"output": "1/3"
},
{
"input": "1 6",
"output": "1/6"
},
{
"input": "2 1",
"output": "5/6"
},
{
"input": "2 2",
"output": "5/6"
},
{
"input": "2 3",
"output": "2/3"
},
{
"input": "2 4",
"output": "1/2"
},
{
"input": "2 5",
"output": "1/3"
},
{
"input": "2 6",
"output": "1/6"
},
{
"input": "3 1",
"output": "2/3"
},
{
"input": "3 2",
"output": "2/3"
},
{
"input": "3 3",
"output": "2/3"
},
{
"input": "3 4",
"output": "1/2"
},
{
"input": "3 5",
"output": "1/3"
},
{
"input": "3 6",
"output": "1/6"
},
{
"input": "4 1",
"output": "1/2"
},
{
"input": "4 3",
"output": "1/2"
},
{
"input": "4 4",
"output": "1/2"
},
{
"input": "4 5",
"output": "1/3"
},
{
"input": "4 6",
"output": "1/6"
},
{
"input": "5 1",
"output": "1/3"
},
{
"input": "5 2",
"output": "1/3"
},
{
"input": "5 3",
"output": "1/3"
},
{
"input": "5 4",
"output": "1/3"
},
{
"input": "5 5",
"output": "1/3"
},
{
"input": "5 6",
"output": "1/6"
},
{
"input": "6 1",
"output": "1/6"
},
{
"input": "6 2",
"output": "1/6"
},
{
"input": "6 3",
"output": "1/6"
},
{
"input": "6 4",
"output": "1/6"
},
{
"input": "6 5",
"output": "1/6"
},
{
"input": "6 6",
"output": "1/6"
}
] | 1,683,063,935
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 36
| 92
| 0
|
w = 7 - max(map(int, input().split()))
d = {1:"1/6", 2:"1/3", 3:"1/2", 4:"2/3", 5:"5/6", 6:"1/1"}
print(d[w])
|
Title: Die Roll
Time Limit: 1 seconds
Memory Limit: 64 megabytes
Problem Description:
Yakko, Wakko and Dot, world-famous animaniacs, decided to rest from acting in cartoons, and take a leave to travel a bit. Yakko dreamt to go to Pennsylvania, his Motherland and the Motherland of his ancestors. Wakko thought about Tasmania, its beaches, sun and sea. Dot chose Transylvania as the most mysterious and unpredictable place.
But to their great regret, the leave turned to be very short, so it will be enough to visit one of the three above named places. That's why Yakko, as the cleverest, came up with a truly genius idea: let each of the three roll an ordinary six-sided die, and the one with the highest amount of points will be the winner, and will take the other two to the place of his/her dreams.
Yakko thrown a die and got Y points, Wakko β W points. It was Dot's turn. But she didn't hurry. Dot wanted to know for sure what were her chances to visit Transylvania.
It is known that Yakko and Wakko are true gentlemen, that's why if they have the same amount of points with Dot, they will let Dot win.
Input Specification:
The only line of the input file contains two natural numbers Y and W β the results of Yakko's and Wakko's die rolls.
Output Specification:
Output the required probability in the form of irreducible fraction in format Β«A/BΒ», where A β the numerator, and B β the denominator. If the required probability equals to zero, output Β«0/1Β». If the required probability equals to 1, output Β«1/1Β».
Demo Input:
['4 2\n']
Demo Output:
['1/2\n']
Note:
Dot will go to Transylvania, if she is lucky to roll 4, 5 or 6 points.
|
```python
w = 7 - max(map(int, input().split()))
d = {1:"1/6", 2:"1/3", 3:"1/2", 4:"2/3", 5:"5/6", 6:"1/1"}
print(d[w])
```
| 3.954
|
235
|
A
|
LCM Challenge
|
PROGRAMMING
| 1,600
|
[
"number theory"
] | null | null |
Some days ago, I learned the concept of LCM (least common multiple). I've played with it for several times and I want to make a big number with it.
But I also don't want to use many numbers, so I'll choose three positive integers (they don't have to be distinct) which are not greater than *n*. Can you help me to find the maximum possible least common multiple of these three integers?
|
The first line contains an integer *n* (1<=β€<=*n*<=β€<=106) β the *n* mentioned in the statement.
|
Print a single integer β the maximum possible LCM of three not necessarily distinct positive integers that are not greater than *n*.
|
[
"9\n",
"7\n"
] |
[
"504\n",
"210\n"
] |
The least common multiple of some positive integers is the least positive integer which is multiple for each of them.
The result may become very large, 32-bit integer won't be enough. So using 64-bit integers is recommended.
For the last example, we can chose numbers 7, 6, 5 and the LCM of them is 7Β·6Β·5β=β210. It is the maximum value we can get.
| 500
|
[
{
"input": "9",
"output": "504"
},
{
"input": "7",
"output": "210"
},
{
"input": "1",
"output": "1"
},
{
"input": "5",
"output": "60"
},
{
"input": "6",
"output": "60"
},
{
"input": "33",
"output": "32736"
},
{
"input": "21",
"output": "7980"
},
{
"input": "2",
"output": "2"
},
{
"input": "41",
"output": "63960"
},
{
"input": "29",
"output": "21924"
},
{
"input": "117",
"output": "1560780"
},
{
"input": "149",
"output": "3241644"
},
{
"input": "733",
"output": "392222436"
},
{
"input": "925",
"output": "788888100"
},
{
"input": "509",
"output": "131096004"
},
{
"input": "829",
"output": "567662724"
},
{
"input": "117",
"output": "1560780"
},
{
"input": "605",
"output": "220348260"
},
{
"input": "245",
"output": "14526540"
},
{
"input": "925",
"output": "788888100"
},
{
"input": "213",
"output": "9527916"
},
{
"input": "53",
"output": "140556"
},
{
"input": "341",
"output": "39303660"
},
{
"input": "21",
"output": "7980"
},
{
"input": "605",
"output": "220348260"
},
{
"input": "149",
"output": "3241644"
},
{
"input": "733",
"output": "392222436"
},
{
"input": "117",
"output": "1560780"
},
{
"input": "53",
"output": "140556"
},
{
"input": "245",
"output": "14526540"
},
{
"input": "829",
"output": "567662724"
},
{
"input": "924",
"output": "783776526"
},
{
"input": "508",
"output": "130065780"
},
{
"input": "700",
"output": "341042100"
},
{
"input": "636",
"output": "254839470"
},
{
"input": "20",
"output": "6460"
},
{
"input": "604",
"output": "218891412"
},
{
"input": "796",
"output": "501826260"
},
{
"input": "732",
"output": "389016270"
},
{
"input": "412",
"output": "69256788"
},
{
"input": "700",
"output": "341042100"
},
{
"input": "244",
"output": "14289372"
},
{
"input": "828",
"output": "563559150"
},
{
"input": "508",
"output": "130065780"
},
{
"input": "796",
"output": "501826260"
},
{
"input": "636",
"output": "254839470"
},
{
"input": "924",
"output": "783776526"
},
{
"input": "245",
"output": "14526540"
},
{
"input": "828",
"output": "563559150"
},
{
"input": "21",
"output": "7980"
},
{
"input": "605",
"output": "220348260"
},
{
"input": "636",
"output": "254839470"
},
{
"input": "924",
"output": "783776526"
},
{
"input": "116",
"output": "1507420"
},
{
"input": "700",
"output": "341042100"
},
{
"input": "732",
"output": "389016270"
},
{
"input": "20",
"output": "6460"
},
{
"input": "508",
"output": "130065780"
},
{
"input": "148",
"output": "3154620"
},
{
"input": "828",
"output": "563559150"
},
{
"input": "763116",
"output": "444394078546562430"
},
{
"input": "756604",
"output": "433115377058855412"
},
{
"input": "447244",
"output": "89460162932862372"
},
{
"input": "372636",
"output": "51742503205363470"
},
{
"input": "546924",
"output": "163597318076822526"
},
{
"input": "540412",
"output": "157823524476316788"
},
{
"input": "714700",
"output": "365063922340784100"
},
{
"input": "520731",
"output": "141201007712496270"
},
{
"input": "695019",
"output": "335728459024850814"
},
{
"input": "688507",
"output": "326379736779169710"
},
{
"input": "862795",
"output": "642275489615199390"
},
{
"input": "668827",
"output": "299184742915995150"
},
{
"input": "810411",
"output": "532248411551110590"
},
{
"input": "836603",
"output": "585540171302562606"
},
{
"input": "978187",
"output": "935975171582120670"
},
{
"input": "816923",
"output": "545182335484592526"
},
{
"input": "958507",
"output": "880611813728059710"
},
{
"input": "984699",
"output": "954792870629291694"
},
{
"input": "642635",
"output": "265393998349453470"
},
{
"input": "296604",
"output": "26092892528622606"
},
{
"input": "1000000",
"output": "999996000003000000"
},
{
"input": "8",
"output": "280"
},
{
"input": "3",
"output": "6"
},
{
"input": "4",
"output": "12"
},
{
"input": "30",
"output": "21924"
},
{
"input": "18",
"output": "4080"
},
{
"input": "12",
"output": "990"
}
] | 1,689,343,390
| 2,147,483,647
|
Python 3
|
OK
|
TESTS
| 87
| 92
| 307,200
|
import sys
sys.setrecursionlimit(2000000)
from collections import defaultdict
import math
def clc():
n = int(input())
if n<=2:print(n)
elif n%2:print(n*(n-1)*(n-2))
else:print(max((n-1)*(n-2)*(n-3),(n*(n-1)*(n-3))//math.gcd(n,n-3)))
return True
cc = clc()
if not cc :
print(-1)
|
Title: LCM Challenge
Time Limit: None seconds
Memory Limit: None megabytes
Problem Description:
Some days ago, I learned the concept of LCM (least common multiple). I've played with it for several times and I want to make a big number with it.
But I also don't want to use many numbers, so I'll choose three positive integers (they don't have to be distinct) which are not greater than *n*. Can you help me to find the maximum possible least common multiple of these three integers?
Input Specification:
The first line contains an integer *n* (1<=β€<=*n*<=β€<=106) β the *n* mentioned in the statement.
Output Specification:
Print a single integer β the maximum possible LCM of three not necessarily distinct positive integers that are not greater than *n*.
Demo Input:
['9\n', '7\n']
Demo Output:
['504\n', '210\n']
Note:
The least common multiple of some positive integers is the least positive integer which is multiple for each of them.
The result may become very large, 32-bit integer won't be enough. So using 64-bit integers is recommended.
For the last example, we can chose numbers 7, 6, 5 and the LCM of them is 7Β·6Β·5β=β210. It is the maximum value we can get.
|
```python
import sys
sys.setrecursionlimit(2000000)
from collections import defaultdict
import math
def clc():
n = int(input())
if n<=2:print(n)
elif n%2:print(n*(n-1)*(n-2))
else:print(max((n-1)*(n-2)*(n-3),(n*(n-1)*(n-3))//math.gcd(n,n-3)))
return True
cc = clc()
if not cc :
print(-1)
```
| 3
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.