contestId
int64
0
1.01k
index
stringclasses
40 values
name
stringlengths
2
54
type
stringclasses
2 values
rating
int64
0
3.4k
tags
listlengths
0
7
title
stringclasses
393 values
time-limit
stringclasses
7 values
memory-limit
stringclasses
6 values
problem-description
stringlengths
0
2.97k
input-specification
stringlengths
4
1.87k
output-specification
stringlengths
4
1.12k
demo-input
listlengths
0
7
demo-output
listlengths
0
7
note
stringlengths
0
5.24k
points
float64
0
3.5k
test_cases
listlengths
0
402
creationTimeSeconds
int64
1.37B
1.7B
relativeTimeSeconds
int64
8
2.15B
programmingLanguage
stringclasses
3 values
verdict
stringclasses
1 value
testset
stringclasses
9 values
passedTestCount
int64
1
402
timeConsumedMillis
int64
15
8.06k
memoryConsumedBytes
int64
0
514M
code
stringlengths
11
61.4k
prompt
stringlengths
297
7.35k
response
stringlengths
25
61.4k
score
float64
2.82
3.99
44
A
Indian Summer
PROGRAMMING
900
[ "implementation" ]
A. Indian Summer
2
256
Indian summer is such a beautiful time of the year! A girl named Alyona is walking in the forest and picking a bouquet from fallen leaves. Alyona is very choosy β€” she doesn't take a leaf if it matches the color and the species of the tree of one of the leaves she already has. Find out how many leaves Alyona has picked.
The first line contains an integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of leaves Alyona has found. The next *n* lines contain the leaves' descriptions. Each leaf is characterized by the species of the tree it has fallen from and by the color. The species of the trees and colors are given in names, consisting of no more than 10 lowercase Latin letters. A name can not be an empty string. The species of a tree and the color are given in each line separated by a space.
Output the single number β€” the number of Alyona's leaves.
[ "5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green\n", "3\noak yellow\noak yellow\noak yellow\n" ]
[ "4\n", "1\n" ]
none
0
[ { "input": "5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green", "output": "4" }, { "input": "3\noak yellow\noak yellow\noak yellow", "output": "1" }, { "input": "5\nxbnbkzn hp\nkaqkl vrgzbvqstu\nj aqidx\nhos gyul\nwefxmh tygpluae", "output": "5" }, { "input": "1\nqvwli hz", "output": "1" }, { "input": "4\nsrhk x\nsrhk x\nqfoe vnrjuab\nqfoe vnrjuab", "output": "2" }, { "input": "4\nsddqllmmpk syded\nfprsq fnenjnaz\nn hdej\nsddqllmmpk syded", "output": "3" }, { "input": "17\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw", "output": "1" }, { "input": "18\nb d\nrfdb esp\nrfdb esp\nb d\nrfdb esp\nrfdb esp\nb d\nb d\nrfdb esp\nrfdb esp\nb d\nrfdb esp\nb d\nrfdb esp\nb d\nb d\nrfdb esp\nrfdb esp", "output": "2" }, { "input": "13\nsvpzwtwn rykzfdce\nqweiyeck jkreouy\nhk nnli\ntwxrnbbdt vtuv\nxokqjtylly sz\nesdt dbfidjslq\ng ybqgomvw\nxcpfjmf zcqvz\nifajadhj invzueip\nvdemdnxifb hckwebmi\nsdpnhipam wvowzavh\nuqdlfskhgo vunbpghae\ne dtigwnb", "output": "13" }, { "input": "20\nm vkfh\nvptikamead mvx\nitu mf\nklruxckw aqega\nekqkd enjllwol\ncc uybfdh\nimrfdngvo u\ne uh\ntwt jsslcfuogk\nbljwqsag tuqbdn\nqcv q\nasx gzhvwwmajj\nqcv q\nekqkd enjllwol\nasx gzhvwwmajj\nks vv\nkzyfi cn\ncc uybfdh\nitu mf\ncjbjhtbyvk vatwfmux", "output": "15" }, { "input": "2\nab ab\na bab", "output": "2" } ]
1,618,561,451
2,147,483,647
PyPy 3
OK
TESTS
29
216
0
n=int(input()) d={} for i in range(n): q,s=map(str,input().split()) d[q+" "+s]=0 print(len(d))
Title: Indian Summer Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Indian summer is such a beautiful time of the year! A girl named Alyona is walking in the forest and picking a bouquet from fallen leaves. Alyona is very choosy β€” she doesn't take a leaf if it matches the color and the species of the tree of one of the leaves she already has. Find out how many leaves Alyona has picked. Input Specification: The first line contains an integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of leaves Alyona has found. The next *n* lines contain the leaves' descriptions. Each leaf is characterized by the species of the tree it has fallen from and by the color. The species of the trees and colors are given in names, consisting of no more than 10 lowercase Latin letters. A name can not be an empty string. The species of a tree and the color are given in each line separated by a space. Output Specification: Output the single number β€” the number of Alyona's leaves. Demo Input: ['5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green\n', '3\noak yellow\noak yellow\noak yellow\n'] Demo Output: ['4\n', '1\n'] Note: none
```python n=int(input()) d={} for i in range(n): q,s=map(str,input().split()) d[q+" "+s]=0 print(len(d)) ```
3.946
169
A
Chores
PROGRAMMING
800
[ "sortings" ]
null
null
Petya and Vasya are brothers. Today is a special day for them as their parents left them home alone and commissioned them to do *n* chores. Each chore is characterized by a single parameter β€” its complexity. The complexity of the *i*-th chore equals *h**i*. As Petya is older, he wants to take the chores with complexity larger than some value *x* (*h**i*<=&gt;<=*x*) to leave to Vasya the chores with complexity less than or equal to *x* (*h**i*<=≀<=*x*). The brothers have already decided that Petya will do exactly *a* chores and Vasya will do exactly *b* chores (*a*<=+<=*b*<==<=*n*). In how many ways can they choose an integer *x* so that Petya got exactly *a* chores and Vasya got exactly *b* chores?
The first input line contains three integers *n*,<=*a* and *b* (2<=≀<=*n*<=≀<=2000; *a*,<=*b*<=β‰₯<=1; *a*<=+<=*b*<==<=*n*) β€” the total number of chores, the number of Petya's chores and the number of Vasya's chores. The next line contains a sequence of integers *h*1,<=*h*2,<=...,<=*h**n* (1<=≀<=*h**i*<=≀<=109), *h**i* is the complexity of the *i*-th chore. The numbers in the given sequence are not necessarily different. All numbers on the lines are separated by single spaces.
Print the required number of ways to choose an integer value of *x*. If there are no such ways, print 0.
[ "5 2 3\n6 2 3 100 1\n", "7 3 4\n1 1 9 1 1 1 1\n" ]
[ "3\n", "0\n" ]
In the first sample the possible values of *x* are 3, 4 or 5. In the second sample it is impossible to find such *x*, that Petya got 3 chores and Vasya got 4.
500
[ { "input": "5 2 3\n6 2 3 100 1", "output": "3" }, { "input": "7 3 4\n1 1 9 1 1 1 1", "output": "0" }, { "input": "2 1 1\n10 2", "output": "8" }, { "input": "2 1 1\n7 7", "output": "0" }, { "input": "2 1 1\n1 1000000000", "output": "999999999" }, { "input": "3 1 2\n6 5 5", "output": "1" }, { "input": "3 2 1\n10 10 8", "output": "2" }, { "input": "8 3 5\n42 55 61 72 83 10 22 33", "output": "6" }, { "input": "10 5 5\n1 2 3 4 5 999999999 999999998 999999997 999999996 999999995", "output": "999999990" }, { "input": "4 1 3\n10 8 7 3", "output": "2" }, { "input": "4 2 2\n402 10 10 402", "output": "392" }, { "input": "4 1 3\n10 402 402 10", "output": "0" }, { "input": "4 3 1\n100 100 200 200", "output": "0" }, { "input": "150 10 140\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "0" }, { "input": "102 101 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "0" } ]
1,575,322,983
2,147,483,647
Python 3
OK
TESTS
29
124
307,200
chores,petaya,vesaya = map(int,input().split()) order = sorted(map(int,input().split()), reverse = True) print (order[petaya-1] - order[petaya])
Title: Chores Time Limit: None seconds Memory Limit: None megabytes Problem Description: Petya and Vasya are brothers. Today is a special day for them as their parents left them home alone and commissioned them to do *n* chores. Each chore is characterized by a single parameter β€” its complexity. The complexity of the *i*-th chore equals *h**i*. As Petya is older, he wants to take the chores with complexity larger than some value *x* (*h**i*<=&gt;<=*x*) to leave to Vasya the chores with complexity less than or equal to *x* (*h**i*<=≀<=*x*). The brothers have already decided that Petya will do exactly *a* chores and Vasya will do exactly *b* chores (*a*<=+<=*b*<==<=*n*). In how many ways can they choose an integer *x* so that Petya got exactly *a* chores and Vasya got exactly *b* chores? Input Specification: The first input line contains three integers *n*,<=*a* and *b* (2<=≀<=*n*<=≀<=2000; *a*,<=*b*<=β‰₯<=1; *a*<=+<=*b*<==<=*n*) β€” the total number of chores, the number of Petya's chores and the number of Vasya's chores. The next line contains a sequence of integers *h*1,<=*h*2,<=...,<=*h**n* (1<=≀<=*h**i*<=≀<=109), *h**i* is the complexity of the *i*-th chore. The numbers in the given sequence are not necessarily different. All numbers on the lines are separated by single spaces. Output Specification: Print the required number of ways to choose an integer value of *x*. If there are no such ways, print 0. Demo Input: ['5 2 3\n6 2 3 100 1\n', '7 3 4\n1 1 9 1 1 1 1\n'] Demo Output: ['3\n', '0\n'] Note: In the first sample the possible values of *x* are 3, 4 or 5. In the second sample it is impossible to find such *x*, that Petya got 3 chores and Vasya got 4.
```python chores,petaya,vesaya = map(int,input().split()) order = sorted(map(int,input().split()), reverse = True) print (order[petaya-1] - order[petaya]) ```
3
37
A
Towers
PROGRAMMING
1,000
[ "sortings" ]
A. Towers
2
256
Little Vasya has received a young builder’s kit. The kit consists of several wooden bars, the lengths of all of them are known. The bars can be put one on the top of the other if their lengths are the same. Vasya wants to construct the minimal number of towers from the bars. Help Vasya to use the bars in the best way possible.
The first line contains an integer *N* (1<=≀<=*N*<=≀<=1000) β€” the number of bars at Vasya’s disposal. The second line contains *N* space-separated integers *l**i* β€” the lengths of the bars. All the lengths are natural numbers not exceeding 1000.
In one line output two numbers β€” the height of the largest tower and their total number. Remember that Vasya should use all the bars.
[ "3\n1 2 3\n", "4\n6 5 6 7\n" ]
[ "1 3\n", "2 3\n" ]
none
500
[ { "input": "3\n1 2 3", "output": "1 3" }, { "input": "4\n6 5 6 7", "output": "2 3" }, { "input": "4\n3 2 1 1", "output": "2 3" }, { "input": "4\n1 2 3 3", "output": "2 3" }, { "input": "3\n20 22 36", "output": "1 3" }, { "input": "25\n47 30 94 41 45 20 96 51 110 129 24 116 9 47 32 82 105 114 116 75 154 151 70 42 162", "output": "2 23" }, { "input": "45\n802 664 442 318 318 827 417 878 711 291 231 414 807 553 657 392 279 202 386 606 465 655 658 112 887 15 25 502 95 44 679 775 942 609 209 871 31 234 4 231 150 110 22 823 193", "output": "2 43" }, { "input": "63\n93 180 116 7 8 179 268 279 136 94 221 153 264 190 278 19 19 63 153 26 158 225 25 49 89 218 111 149 255 225 197 122 243 80 3 224 107 178 202 17 53 92 69 42 228 24 81 205 95 8 265 82 228 156 127 241 172 159 106 60 67 155 111", "output": "2 57" }, { "input": "83\n246 535 994 33 390 927 321 97 223 922 812 705 79 80 977 457 476 636 511 137 6 360 815 319 717 674 368 551 714 628 278 713 761 553 184 414 623 753 428 214 581 115 439 61 677 216 772 592 187 603 658 310 439 559 870 376 109 321 189 337 277 26 70 734 796 907 979 693 570 227 345 650 737 633 701 914 134 403 972 940 371 6 642", "output": "2 80" }, { "input": "105\n246 57 12 204 165 123 246 68 191 310 3 152 386 333 374 257 158 104 333 50 80 290 8 340 101 76 221 316 388 289 138 359 316 26 93 290 105 178 81 195 41 196 218 180 244 292 187 97 315 323 174 119 248 239 92 312 31 2 101 180 307 170 338 314 163 281 217 31 142 238 280 190 190 156 70 74 329 113 151 8 141 313 366 40 253 116 168 124 135 230 294 266 353 389 371 359 195 200 183 237 93 102 315 118 188", "output": "2 92" }, { "input": "123\n112 277 170 247 252 115 157 293 256 143 196 90 12 164 164 42 8 223 167 109 175 232 239 111 148 51 9 254 93 32 268 162 231 91 47 162 161 191 195 145 247 292 129 199 230 94 144 217 18 205 176 20 143 198 121 243 211 262 230 277 195 255 108 290 220 275 158 2 286 200 60 267 278 207 123 150 123 116 131 13 12 226 33 244 30 275 263 45 158 192 254 149 242 176 62 224 221 288 250 160 155 225 132 143 276 293 218 145 197 175 33 129 79 206 210 192 222 262 190 52 274 243 233", "output": "3 101" }, { "input": "5\n5 5 5 5 5", "output": "5 1" }, { "input": "3\n1000 1000 1000", "output": "3 1" }, { "input": "1\n1000", "output": "1 1" }, { "input": "1\n1", "output": "1 1" }, { "input": "5\n1 1000 1000 1000 1000", "output": "4 2" }, { "input": "5\n1000 1000 1000 8 7", "output": "3 3" } ]
1,654,589,156
2,147,483,647
PyPy 3-64
OK
TESTS
61
154
0
n = int(input()) arr = list(map(int, input().split())) MAX = 1024 towers = [0] * MAX for e in arr: towers[e] += 1 print(max(towers), MAX - towers.count(0))
Title: Towers Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Little Vasya has received a young builder’s kit. The kit consists of several wooden bars, the lengths of all of them are known. The bars can be put one on the top of the other if their lengths are the same. Vasya wants to construct the minimal number of towers from the bars. Help Vasya to use the bars in the best way possible. Input Specification: The first line contains an integer *N* (1<=≀<=*N*<=≀<=1000) β€” the number of bars at Vasya’s disposal. The second line contains *N* space-separated integers *l**i* β€” the lengths of the bars. All the lengths are natural numbers not exceeding 1000. Output Specification: In one line output two numbers β€” the height of the largest tower and their total number. Remember that Vasya should use all the bars. Demo Input: ['3\n1 2 3\n', '4\n6 5 6 7\n'] Demo Output: ['1 3\n', '2 3\n'] Note: none
```python n = int(input()) arr = list(map(int, input().split())) MAX = 1024 towers = [0] * MAX for e in arr: towers[e] += 1 print(max(towers), MAX - towers.count(0)) ```
3.9615
22
A
Second Order Statistics
PROGRAMMING
800
[ "brute force" ]
A. Second Order Statistics
2
256
Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. Help Bob solve this problem.
The first input line contains integer *n* (1<=≀<=*n*<=≀<=100) β€” amount of numbers in the sequence. The second line contains *n* space-separated integer numbers β€” elements of the sequence. These numbers don't exceed 100 in absolute value.
If the given sequence has the second order statistics, output this order statistics, otherwise output NO.
[ "4\n1 2 2 -4\n", "5\n1 2 3 1 1\n" ]
[ "1\n", "2\n" ]
none
0
[ { "input": "4\n1 2 2 -4", "output": "1" }, { "input": "5\n1 2 3 1 1", "output": "2" }, { "input": "1\n28", "output": "NO" }, { "input": "2\n-28 12", "output": "12" }, { "input": "3\n-83 40 -80", "output": "-80" }, { "input": "8\n93 77 -92 26 21 -48 53 91", "output": "-48" }, { "input": "20\n-72 -9 -86 80 7 -10 40 -27 -94 92 96 56 28 -19 79 36 -3 -73 -63 -49", "output": "-86" }, { "input": "49\n-74 -100 -80 23 -8 -83 -41 -20 48 17 46 -73 -55 67 85 4 40 -60 -69 -75 56 -74 -42 93 74 -95 64 -46 97 -47 55 0 -78 -34 -31 40 -63 -49 -76 48 21 -1 -49 -29 -98 -11 76 26 94", "output": "-98" }, { "input": "88\n63 48 1 -53 -89 -49 64 -70 -49 71 -17 -16 76 81 -26 -50 67 -59 -56 97 2 100 14 18 -91 -80 42 92 -25 -88 59 8 -56 38 48 -71 -78 24 -14 48 -1 69 73 -76 54 16 -92 44 47 33 -34 -17 -81 21 -59 -61 53 26 10 -76 67 35 -29 70 65 -13 -29 81 80 32 74 -6 34 46 57 1 -45 -55 69 79 -58 11 -2 22 -18 -16 -89 -46", "output": "-91" }, { "input": "100\n34 32 88 20 76 53 -71 -39 -98 -10 57 37 63 -3 -54 -64 -78 -82 73 20 -30 -4 22 75 51 -64 -91 29 -52 -48 83 19 18 -47 46 57 -44 95 89 89 -30 84 -83 67 58 -99 -90 -53 92 -60 -5 -56 -61 27 68 -48 52 -95 64 -48 -30 -67 66 89 14 -33 -31 -91 39 7 -94 -54 92 -96 -99 -83 -16 91 -28 -66 81 44 14 -85 -21 18 40 16 -13 -82 -33 47 -10 -40 -19 10 25 60 -34 -89", "output": "-98" }, { "input": "2\n-1 -1", "output": "NO" }, { "input": "3\n-2 -2 -2", "output": "NO" }, { "input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", "output": "NO" }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 -100 100 100 100 100 100 100 100 100 100 100 100 -100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 -100 100 100 100 100 100 100 100 100 100 100 -100 100 100 100 100 -100 100 100 100 100 100 100 100 100 100 100 100", "output": "100" }, { "input": "10\n40 71 -85 -85 40 -85 -85 64 -85 47", "output": "40" }, { "input": "23\n-90 -90 -41 -64 -64 -90 -15 10 -43 -90 -64 -64 89 -64 36 47 38 -90 -64 -90 -90 68 -90", "output": "-64" }, { "input": "39\n-97 -93 -42 -93 -97 -93 56 -97 -97 -97 76 -33 -60 91 7 82 17 47 -97 -97 -93 73 -97 12 -97 -97 -97 -97 56 -92 -83 -93 -93 49 -93 -97 -97 -17 -93", "output": "-93" }, { "input": "51\n-21 6 -35 -98 -86 -98 -86 -43 -65 32 -98 -40 96 -98 -98 -98 -98 -86 -86 -98 56 -86 -98 -98 -30 -98 -86 -31 -98 -86 -86 -86 -86 -30 96 -86 -86 -86 -60 25 88 -86 -86 58 31 -47 57 -86 37 44 -83", "output": "-86" }, { "input": "66\n-14 -95 65 -95 -95 -97 -90 -71 -97 -97 70 -95 -95 -97 -95 -27 35 -87 -95 -5 -97 -97 87 34 -49 -95 -97 -95 -97 -95 -30 -95 -97 47 -95 -17 -97 -95 -97 -69 51 -97 -97 -95 -75 87 59 21 63 56 76 -91 98 -97 6 -97 -95 -95 -97 -73 11 -97 -35 -95 -95 -43", "output": "-95" }, { "input": "77\n-67 -93 -93 -92 97 29 93 -93 -93 -5 -93 -7 60 -92 -93 44 -84 68 -92 -93 69 -92 -37 56 43 -93 35 -92 -93 19 -79 18 -92 -93 -93 -37 -93 -47 -93 -92 -92 74 67 19 40 -92 -92 -92 -92 -93 -93 -41 -93 -92 -93 -93 -92 -93 51 -80 6 -42 -92 -92 -66 -12 -92 -92 -3 93 -92 -49 -93 40 62 -92 -92", "output": "-92" }, { "input": "89\n-98 40 16 -87 -98 63 -100 55 -96 -98 -21 -100 -93 26 -98 -98 -100 -89 -98 -5 -65 -28 -100 -6 -66 67 -100 -98 -98 10 -98 -98 -70 7 -98 2 -100 -100 -98 25 -100 -100 -98 23 -68 -100 -98 3 98 -100 -98 -98 -98 -98 -24 -100 -100 -9 -98 35 -100 99 -5 -98 -100 -100 37 -100 -84 57 -98 40 -47 -100 -1 -92 -76 -98 -98 -100 -100 -100 -63 30 21 -100 -100 -100 -12", "output": "-98" }, { "input": "99\n10 -84 -100 -100 73 -64 -100 -94 33 -100 -100 -100 -100 71 64 24 7 -100 -32 -100 -100 77 -100 62 -12 55 45 -100 -100 -80 -100 -100 -100 -100 -100 -100 -100 -100 -100 -39 -48 -100 -34 47 -100 -100 -100 -100 -100 -77 -100 -100 -100 -100 -100 -100 -52 40 -55 -100 -44 -100 72 33 70 -100 -100 -78 -100 -3 100 -77 22 -100 95 -30 -100 10 -69 -100 -100 -100 -100 52 -39 -100 -100 -100 7 -100 -98 -66 95 -17 -100 52 -100 68 -100", "output": "-98" }, { "input": "100\n-99 -98 -64 89 53 57 -99 29 -78 18 -3 -54 76 -98 -99 -98 37 -98 19 -47 89 73 -98 -91 -99 -99 -98 -48 -99 22 -99 -98 -99 -99 -98 -60 84 67 -99 -98 20 -98 88 -98 46 -98 -99 -98 -99 -71 -99 -98 -98 -39 83 95 -98 63 -98 -99 32 -98 -99 -64 57 -30 -53 -83 -4 -99 58 20 -98 -10 -99 -44 -99 -99 -99 -99 75 34 -98 -52 -98 -30 -98 -99 -98 -98 51 -99 -99 -99 -98 -99 -99 -82 -90 92", "output": "-98" }, { "input": "3\n1 2 3", "output": "2" }, { "input": "3\n1 3 2", "output": "2" }, { "input": "3\n2 1 3", "output": "2" }, { "input": "3\n2 3 1", "output": "2" }, { "input": "3\n3 1 2", "output": "2" }, { "input": "3\n3 2 1", "output": "2" }, { "input": "9\n99 99 99 99 100 100 100 100 100", "output": "100" }, { "input": "5\n-100 -100 -100 -100 -100", "output": "NO" } ]
1,551,645,811
2,147,483,647
Python 3
OK
TESTS
31
218
0
n=int(input()) ch=input() l=list(map(int,ch.split())) e=set(l) if(len(e)>1): e.remove(min(e)) print(min(e)) else: print("NO")
Title: Second Order Statistics Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Once Bob needed to find the second order statistics of a sequence of integer numbers. Lets choose each number from the sequence exactly once and sort them. The value on the second position is the second order statistics of the given sequence. In other words it is the smallest element strictly greater than the minimum. Help Bob solve this problem. Input Specification: The first input line contains integer *n* (1<=≀<=*n*<=≀<=100) β€” amount of numbers in the sequence. The second line contains *n* space-separated integer numbers β€” elements of the sequence. These numbers don't exceed 100 in absolute value. Output Specification: If the given sequence has the second order statistics, output this order statistics, otherwise output NO. Demo Input: ['4\n1 2 2 -4\n', '5\n1 2 3 1 1\n'] Demo Output: ['1\n', '2\n'] Note: none
```python n=int(input()) ch=input() l=list(map(int,ch.split())) e=set(l) if(len(e)>1): e.remove(min(e)) print(min(e)) else: print("NO") ```
3.9455
208
A
Dubstep
PROGRAMMING
900
[ "strings" ]
null
null
Vasya works as a DJ in the best Berland nightclub, and he often uses dubstep music in his performance. Recently, he has decided to take a couple of old songs and make dubstep remixes from them. Let's assume that a song consists of some number of words. To make the dubstep remix of this song, Vasya inserts a certain number of words "WUB" before the first word of the song (the number may be zero), after the last word (the number may be zero), and between words (at least one between any pair of neighbouring words), and then the boy glues together all the words, including "WUB", in one string and plays the song at the club. For example, a song with words "I AM X" can transform into a dubstep remix as "WUBWUBIWUBAMWUBWUBX" and cannot transform into "WUBWUBIAMWUBX". Recently, Petya has heard Vasya's new dubstep track, but since he isn't into modern music, he decided to find out what was the initial song that Vasya remixed. Help Petya restore the original song.
The input consists of a single non-empty string, consisting only of uppercase English letters, the string's length doesn't exceed 200 characters. It is guaranteed that before Vasya remixed the song, no word contained substring "WUB" in it; Vasya didn't change the word order. It is also guaranteed that initially the song had at least one word.
Print the words of the initial song that Vasya used to make a dubsteb remix. Separate the words with a space.
[ "WUBWUBABCWUB\n", "WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB\n" ]
[ "ABC ", "WE ARE THE CHAMPIONS MY FRIEND " ]
In the first sample: "WUBWUBABCWUB" = "WUB" + "WUB" + "ABC" + "WUB". That means that the song originally consisted of a single word "ABC", and all words "WUB" were added by Vasya. In the second sample Vasya added a single word "WUB" between all neighbouring words, in the beginning and in the end, except for words "ARE" and "THE" β€” between them Vasya added two "WUB".
500
[ { "input": "WUBWUBABCWUB", "output": "ABC " }, { "input": "WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB", "output": "WE ARE THE CHAMPIONS MY FRIEND " }, { "input": "WUBWUBWUBSR", "output": "SR " }, { "input": "RWUBWUBWUBLWUB", "output": "R L " }, { "input": "ZJWUBWUBWUBJWUBWUBWUBL", "output": "ZJ J L " }, { "input": "CWUBBWUBWUBWUBEWUBWUBWUBQWUBWUBWUB", "output": "C B E Q " }, { "input": "WUBJKDWUBWUBWBIRAQKFWUBWUBYEWUBWUBWUBWVWUBWUB", "output": "JKD WBIRAQKF YE WV " }, { "input": "WUBKSDHEMIXUJWUBWUBRWUBWUBWUBSWUBWUBWUBHWUBWUBWUB", "output": "KSDHEMIXUJ R S H " }, { "input": "OGWUBWUBWUBXWUBWUBWUBIWUBWUBWUBKOWUBWUB", "output": "OG X I KO " }, { "input": "QWUBQQWUBWUBWUBIWUBWUBWWWUBWUBWUBJOPJPBRH", "output": "Q QQ I WW JOPJPBRH " }, { "input": "VSRNVEATZTLGQRFEGBFPWUBWUBWUBAJWUBWUBWUBPQCHNWUBCWUB", "output": "VSRNVEATZTLGQRFEGBFP AJ PQCHN C " }, { "input": "WUBWUBEWUBWUBWUBIQMJNIQWUBWUBWUBGZZBQZAUHYPWUBWUBWUBPMRWUBWUBWUBDCV", "output": "E IQMJNIQ GZZBQZAUHYP PMR DCV " }, { "input": "WUBWUBWUBFVWUBWUBWUBBPSWUBWUBWUBRXNETCJWUBWUBWUBJDMBHWUBWUBWUBBWUBWUBVWUBWUBB", "output": "FV BPS RXNETCJ JDMBH B V B " }, { "input": "WUBWUBWUBFBQWUBWUBWUBIDFSYWUBWUBWUBCTWDMWUBWUBWUBSXOWUBWUBWUBQIWUBWUBWUBL", "output": "FBQ IDFSY CTWDM SXO QI L " }, { "input": "IWUBWUBQLHDWUBYIIKZDFQWUBWUBWUBCXWUBWUBUWUBWUBWUBKWUBWUBWUBNL", "output": "I QLHD YIIKZDFQ CX U K NL " }, { "input": "KWUBUPDYXGOKUWUBWUBWUBAGOAHWUBIZDWUBWUBWUBIYWUBWUBWUBVWUBWUBWUBPWUBWUBWUBE", "output": "K UPDYXGOKU AGOAH IZD IY V P E " }, { "input": "WUBWUBOWUBWUBWUBIPVCQAFWYWUBWUBWUBQWUBWUBWUBXHDKCPYKCTWWYWUBWUBWUBVWUBWUBWUBFZWUBWUB", "output": "O IPVCQAFWY Q XHDKCPYKCTWWY V FZ " }, { "input": "PAMJGYWUBWUBWUBXGPQMWUBWUBWUBTKGSXUYWUBWUBWUBEWUBWUBWUBNWUBWUBWUBHWUBWUBWUBEWUBWUB", "output": "PAMJGY XGPQM TKGSXUY E N H E " }, { "input": "WUBYYRTSMNWUWUBWUBWUBCWUBWUBWUBCWUBWUBWUBFSYUINDWOBVWUBWUBWUBFWUBWUBWUBAUWUBWUBWUBVWUBWUBWUBJB", "output": "YYRTSMNWU C C FSYUINDWOBV F AU V JB " }, { "input": "WUBWUBYGPYEYBNRTFKOQCWUBWUBWUBUYGRTQEGWLFYWUBWUBWUBFVWUBHPWUBWUBWUBXZQWUBWUBWUBZDWUBWUBWUBM", "output": "YGPYEYBNRTFKOQC UYGRTQEGWLFY FV HP XZQ ZD M " }, { "input": "WUBZVMJWUBWUBWUBFOIMJQWKNZUBOFOFYCCWUBWUBWUBAUWWUBRDRADWUBWUBWUBCHQVWUBWUBWUBKFTWUBWUBWUBW", "output": "ZVMJ FOIMJQWKNZUBOFOFYCC AUW RDRAD CHQV KFT W " }, { "input": "WUBWUBZBKOKHQLGKRVIMZQMQNRWUBWUBWUBDACWUBWUBNZHFJMPEYKRVSWUBWUBWUBPPHGAVVPRZWUBWUBWUBQWUBWUBAWUBG", "output": "ZBKOKHQLGKRVIMZQMQNR DAC NZHFJMPEYKRVS PPHGAVVPRZ Q A G " }, { "input": "WUBWUBJWUBWUBWUBNFLWUBWUBWUBGECAWUBYFKBYJWTGBYHVSSNTINKWSINWSMAWUBWUBWUBFWUBWUBWUBOVWUBWUBLPWUBWUBWUBN", "output": "J NFL GECA YFKBYJWTGBYHVSSNTINKWSINWSMA F OV LP N " }, { "input": "WUBWUBLCWUBWUBWUBZGEQUEATJVIXETVTWUBWUBWUBEXMGWUBWUBWUBRSWUBWUBWUBVWUBWUBWUBTAWUBWUBWUBCWUBWUBWUBQG", "output": "LC ZGEQUEATJVIXETVT EXMG RS V TA C QG " }, { "input": "WUBMPWUBWUBWUBORWUBWUBDLGKWUBWUBWUBVVZQCAAKVJTIKWUBWUBWUBTJLUBZJCILQDIFVZWUBWUBYXWUBWUBWUBQWUBWUBWUBLWUB", "output": "MP OR DLGK VVZQCAAKVJTIK TJLUBZJCILQDIFVZ YX Q L " }, { "input": "WUBNXOLIBKEGXNWUBWUBWUBUWUBGITCNMDQFUAOVLWUBWUBWUBAIJDJZJHFMPVTPOXHPWUBWUBWUBISCIOWUBWUBWUBGWUBWUBWUBUWUB", "output": "NXOLIBKEGXN U GITCNMDQFUAOVL AIJDJZJHFMPVTPOXHP ISCIO G U " }, { "input": "WUBWUBNMMWCZOLYPNBELIYVDNHJUNINWUBWUBWUBDXLHYOWUBWUBWUBOJXUWUBWUBWUBRFHTGJCEFHCGWARGWUBWUBWUBJKWUBWUBSJWUBWUB", "output": "NMMWCZOLYPNBELIYVDNHJUNIN DXLHYO OJXU RFHTGJCEFHCGWARG JK SJ " }, { "input": "SGWLYSAUJOJBNOXNWUBWUBWUBBOSSFWKXPDPDCQEWUBWUBWUBDIRZINODWUBWUBWUBWWUBWUBWUBPPHWUBWUBWUBRWUBWUBWUBQWUBWUBWUBJWUB", "output": "SGWLYSAUJOJBNOXN BOSSFWKXPDPDCQE DIRZINOD W PPH R Q J " }, { "input": "TOWUBWUBWUBGBTBNWUBWUBWUBJVIOJBIZFUUYHUAIEBQLQXPQKZJMPTCWBKPOSAWUBWUBWUBSWUBWUBWUBTOLVXWUBWUBWUBNHWUBWUBWUBO", "output": "TO GBTBN JVIOJBIZFUUYHUAIEBQLQXPQKZJMPTCWBKPOSA S TOLVX NH O " }, { "input": "WUBWUBWSPLAYSZSAUDSWUBWUBWUBUWUBWUBWUBKRWUBWUBWUBRSOKQMZFIYZQUWUBWUBWUBELSHUWUBWUBWUBUKHWUBWUBWUBQXEUHQWUBWUBWUBBWUBWUBWUBR", "output": "WSPLAYSZSAUDS U KR RSOKQMZFIYZQU ELSHU UKH QXEUHQ B R " }, { "input": "WUBXEMWWVUHLSUUGRWUBWUBWUBAWUBXEGILZUNKWUBWUBWUBJDHHKSWUBWUBWUBDTSUYSJHWUBWUBWUBPXFWUBMOHNJWUBWUBWUBZFXVMDWUBWUBWUBZMWUBWUB", "output": "XEMWWVUHLSUUGR A XEGILZUNK JDHHKS DTSUYSJH PXF MOHNJ ZFXVMD ZM " }, { "input": "BMBWUBWUBWUBOQKWUBWUBWUBPITCIHXHCKLRQRUGXJWUBWUBWUBVWUBWUBWUBJCWUBWUBWUBQJPWUBWUBWUBBWUBWUBWUBBMYGIZOOXWUBWUBWUBTAGWUBWUBHWUB", "output": "BMB OQK PITCIHXHCKLRQRUGXJ V JC QJP B BMYGIZOOX TAG H " }, { "input": "CBZNWUBWUBWUBNHWUBWUBWUBYQSYWUBWUBWUBMWUBWUBWUBXRHBTMWUBWUBWUBPCRCWUBWUBWUBTZUYLYOWUBWUBWUBCYGCWUBWUBWUBCLJWUBWUBWUBSWUBWUBWUB", "output": "CBZN NH YQSY M XRHBTM PCRC TZUYLYO CYGC CLJ S " }, { "input": "DPDWUBWUBWUBEUQKWPUHLTLNXHAEKGWUBRRFYCAYZFJDCJLXBAWUBWUBWUBHJWUBOJWUBWUBWUBNHBJEYFWUBWUBWUBRWUBWUBWUBSWUBWWUBWUBWUBXDWUBWUBWUBJWUB", "output": "DPD EUQKWPUHLTLNXHAEKG RRFYCAYZFJDCJLXBA HJ OJ NHBJEYF R S W XD J " }, { "input": "WUBWUBWUBISERPQITVIYERSCNWUBWUBWUBQWUBWUBWUBDGSDIPWUBWUBWUBCAHKDZWEXBIBJVVSKKVQJWUBWUBWUBKIWUBWUBWUBCWUBWUBWUBAWUBWUBWUBPWUBWUBWUBHWUBWUBWUBF", "output": "ISERPQITVIYERSCN Q DGSDIP CAHKDZWEXBIBJVVSKKVQJ KI C A P H F " }, { "input": "WUBWUBWUBIWUBWUBLIKNQVWUBWUBWUBPWUBWUBWUBHWUBWUBWUBMWUBWUBWUBDPRSWUBWUBWUBBSAGYLQEENWXXVWUBWUBWUBXMHOWUBWUBWUBUWUBWUBWUBYRYWUBWUBWUBCWUBWUBWUBY", "output": "I LIKNQV P H M DPRS BSAGYLQEENWXXV XMHO U YRY C Y " }, { "input": "WUBWUBWUBMWUBWUBWUBQWUBWUBWUBITCFEYEWUBWUBWUBHEUWGNDFNZGWKLJWUBWUBWUBMZPWUBWUBWUBUWUBWUBWUBBWUBWUBWUBDTJWUBHZVIWUBWUBWUBPWUBFNHHWUBWUBWUBVTOWUB", "output": "M Q ITCFEYE HEUWGNDFNZGWKLJ MZP U B DTJ HZVI P FNHH VTO " }, { "input": "WUBWUBNDNRFHYJAAUULLHRRDEDHYFSRXJWUBWUBWUBMUJVDTIRSGYZAVWKRGIFWUBWUBWUBHMZWUBWUBWUBVAIWUBWUBWUBDDKJXPZRGWUBWUBWUBSGXWUBWUBWUBIFKWUBWUBWUBUWUBWUBWUBW", "output": "NDNRFHYJAAUULLHRRDEDHYFSRXJ MUJVDTIRSGYZAVWKRGIF HMZ VAI DDKJXPZRG SGX IFK U W " }, { "input": "WUBOJMWRSLAXXHQRTPMJNCMPGWUBWUBWUBNYGMZIXNLAKSQYWDWUBWUBWUBXNIWUBWUBWUBFWUBWUBWUBXMBWUBWUBWUBIWUBWUBWUBINWUBWUBWUBWDWUBWUBWUBDDWUBWUBWUBD", "output": "OJMWRSLAXXHQRTPMJNCMPG NYGMZIXNLAKSQYWD XNI F XMB I IN WD DD D " }, { "input": "WUBWUBWUBREHMWUBWUBWUBXWUBWUBWUBQASNWUBWUBWUBNLSMHLCMTICWUBWUBWUBVAWUBWUBWUBHNWUBWUBWUBNWUBWUBWUBUEXLSFOEULBWUBWUBWUBXWUBWUBWUBJWUBWUBWUBQWUBWUBWUBAWUBWUB", "output": "REHM X QASN NLSMHLCMTIC VA HN N UEXLSFOEULB X J Q A " }, { "input": "WUBWUBWUBSTEZTZEFFIWUBWUBWUBSWUBWUBWUBCWUBFWUBHRJPVWUBWUBWUBDYJUWUBWUBWUBPWYDKCWUBWUBWUBCWUBWUBWUBUUEOGCVHHBWUBWUBWUBEXLWUBWUBWUBVCYWUBWUBWUBMWUBWUBWUBYWUB", "output": "STEZTZEFFI S C F HRJPV DYJU PWYDKC C UUEOGCVHHB EXL VCY M Y " }, { "input": "WPPNMSQOQIWUBWUBWUBPNQXWUBWUBWUBHWUBWUBWUBNFLWUBWUBWUBGWSGAHVJFNUWUBWUBWUBFWUBWUBWUBWCMLRICFSCQQQTNBWUBWUBWUBSWUBWUBWUBKGWUBWUBWUBCWUBWUBWUBBMWUBWUBWUBRWUBWUB", "output": "WPPNMSQOQI PNQX H NFL GWSGAHVJFNU F WCMLRICFSCQQQTNB S KG C BM R " }, { "input": "YZJOOYITZRARKVFYWUBWUBRZQGWUBWUBWUBUOQWUBWUBWUBIWUBWUBWUBNKVDTBOLETKZISTWUBWUBWUBWLWUBQQFMMGSONZMAWUBZWUBWUBWUBQZUXGCWUBWUBWUBIRZWUBWUBWUBLTTVTLCWUBWUBWUBY", "output": "YZJOOYITZRARKVFY RZQG UOQ I NKVDTBOLETKZIST WL QQFMMGSONZMA Z QZUXGC IRZ LTTVTLC Y " }, { "input": "WUBCAXNCKFBVZLGCBWCOAWVWOFKZVQYLVTWUBWUBWUBNLGWUBWUBWUBAMGDZBDHZMRMQMDLIRMIWUBWUBWUBGAJSHTBSWUBWUBWUBCXWUBWUBWUBYWUBZLXAWWUBWUBWUBOHWUBWUBWUBZWUBWUBWUBGBWUBWUBWUBE", "output": "CAXNCKFBVZLGCBWCOAWVWOFKZVQYLVT NLG AMGDZBDHZMRMQMDLIRMI GAJSHTBS CX Y ZLXAW OH Z GB E " }, { "input": "WUBWUBCHXSOWTSQWUBWUBWUBCYUZBPBWUBWUBWUBSGWUBWUBWKWORLRRLQYUUFDNWUBWUBWUBYYGOJNEVEMWUBWUBWUBRWUBWUBWUBQWUBWUBWUBIHCKWUBWUBWUBKTWUBWUBWUBRGSNTGGWUBWUBWUBXCXWUBWUBWUBS", "output": "CHXSOWTSQ CYUZBPB SG WKWORLRRLQYUUFDN YYGOJNEVEM R Q IHCK KT RGSNTGG XCX S " }, { "input": "WUBWUBWUBHJHMSBURXTHXWSCHNAIJOWBHLZGJZDHEDSPWBWACCGQWUBWUBWUBXTZKGIITWUBWUBWUBAWUBWUBWUBVNCXPUBCQWUBWUBWUBIDPNAWUBWUBWUBOWUBWUBWUBYGFWUBWUBWUBMQOWUBWUBWUBKWUBWUBWUBAZVWUBWUBWUBEP", "output": "HJHMSBURXTHXWSCHNAIJOWBHLZGJZDHEDSPWBWACCGQ XTZKGIIT A VNCXPUBCQ IDPNA O YGF MQO K AZV EP " }, { "input": "WUBKYDZOYWZSNGMKJSWAXFDFLTHDHEOGTDBNZMSMKZTVWUBWUBWUBLRMIIWUBWUBWUBGWUBWUBWUBADPSWUBWUBWUBANBWUBWUBPCWUBWUBWUBPWUBWUBWUBGPVNLSWIRFORYGAABUXMWUBWUBWUBOWUBWUBWUBNWUBWUBWUBYWUBWUB", "output": "KYDZOYWZSNGMKJSWAXFDFLTHDHEOGTDBNZMSMKZTV LRMII G ADPS ANB PC P GPVNLSWIRFORYGAABUXM O N Y " }, { "input": "REWUBWUBWUBJDWUBWUBWUBNWUBWUBWUBTWWUBWUBWUBWZDOCKKWUBWUBWUBLDPOVBFRCFWUBWUBAKZIBQKEUAZEEWUBWUBWUBLQYPNPFWUBYEWUBWUBWUBFWUBWUBWUBBPWUBWUBWUBAWWUBWUBWUBQWUBWUBWUBBRWUBWUBWUBXJL", "output": "RE JD N TW WZDOCKK LDPOVBFRCF AKZIBQKEUAZEE LQYPNPF YE F BP AW Q BR XJL " }, { "input": "CUFGJDXGMWUBWUBWUBOMWUBWUBWUBSIEWUBWUBWUBJJWKNOWUBWUBWUBYBHVNRNORGYWUBWUBWUBOAGCAWUBWUBWUBSBLBKTPFKPBIWUBWUBWUBJBWUBWUBWUBRMFCJPGWUBWUBWUBDWUBWUBWUBOJOWUBWUBWUBZPWUBWUBWUBMWUBRWUBWUBWUBFXWWUBWUBWUBO", "output": "CUFGJDXGM OM SIE JJWKNO YBHVNRNORGY OAGCA SBLBKTPFKPBI JB RMFCJPG D OJO ZP M R FXW O " }, { "input": "WUBJZGAEXFMFEWMAKGQLUWUBWUBWUBICYTPQWGENELVYWANKUOJYWUBWUBWUBGWUBWUBWUBHYCJVLPHTUPNEGKCDGQWUBWUBWUBOFWUBWUBWUBCPGSOGZBRPRPVJJEWUBWUBWUBDQBCWUBWUBWUBHWUBWUBWUBMHOHYBMATWUBWUBWUBVWUBWUBWUBSWUBWUBWUBKOWU", "output": "JZGAEXFMFEWMAKGQLU ICYTPQWGENELVYWANKUOJY G HYCJVLPHTUPNEGKCDGQ OF CPGSOGZBRPRPVJJE DQBC H MHOHYBMAT V S KOWU " }, { "input": "A", "output": "A " }, { "input": "WUBA", "output": "A " }, { "input": "WUBWUBA", "output": "A " }, { "input": "AWUBWUBWUB", "output": "A " }, { "input": "AWUBBWUBCWUBD", "output": "A B C D " }, { "input": "WUBWWUBWUBWUBUWUBWUBBWUB", "output": "W U B " }, { "input": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "output": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA " }, { "input": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWUBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "output": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA " }, { "input": "WUWUBBWWUBUB", "output": "WU BW UB " }, { "input": "WUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUABWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUB", "output": "WUAB " }, { "input": "ZWUB", "output": "Z " }, { "input": "WU", "output": "WU " }, { "input": "UB", "output": "UB " }, { "input": "U", "output": "U " }, { "input": "WUBW", "output": "W " }, { "input": "WUBWU", "output": "WU " }, { "input": "WUWUB", "output": "WU " }, { "input": "UBWUB", "output": "UB " }, { "input": "WUWUBUBWUBUWUB", "output": "WU UB U " }, { "input": "WUBWWUBAWUB", "output": "W A " }, { "input": "WUUUUU", "output": "WUUUUU " } ]
1,699,108,733
2,147,483,647
Python 3
OK
TESTS
71
92
0
song = input() song = song.split("WUB") final_song = '' for i in song: if i != '': final_song += i + ' ' print(final_song)
Title: Dubstep Time Limit: None seconds Memory Limit: None megabytes Problem Description: Vasya works as a DJ in the best Berland nightclub, and he often uses dubstep music in his performance. Recently, he has decided to take a couple of old songs and make dubstep remixes from them. Let's assume that a song consists of some number of words. To make the dubstep remix of this song, Vasya inserts a certain number of words "WUB" before the first word of the song (the number may be zero), after the last word (the number may be zero), and between words (at least one between any pair of neighbouring words), and then the boy glues together all the words, including "WUB", in one string and plays the song at the club. For example, a song with words "I AM X" can transform into a dubstep remix as "WUBWUBIWUBAMWUBWUBX" and cannot transform into "WUBWUBIAMWUBX". Recently, Petya has heard Vasya's new dubstep track, but since he isn't into modern music, he decided to find out what was the initial song that Vasya remixed. Help Petya restore the original song. Input Specification: The input consists of a single non-empty string, consisting only of uppercase English letters, the string's length doesn't exceed 200 characters. It is guaranteed that before Vasya remixed the song, no word contained substring "WUB" in it; Vasya didn't change the word order. It is also guaranteed that initially the song had at least one word. Output Specification: Print the words of the initial song that Vasya used to make a dubsteb remix. Separate the words with a space. Demo Input: ['WUBWUBABCWUB\n', 'WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB\n'] Demo Output: ['ABC ', 'WE ARE THE CHAMPIONS MY FRIEND '] Note: In the first sample: "WUBWUBABCWUB" = "WUB" + "WUB" + "ABC" + "WUB". That means that the song originally consisted of a single word "ABC", and all words "WUB" were added by Vasya. In the second sample Vasya added a single word "WUB" between all neighbouring words, in the beginning and in the end, except for words "ARE" and "THE" β€” between them Vasya added two "WUB".
```python song = input() song = song.split("WUB") final_song = '' for i in song: if i != '': final_song += i + ' ' print(final_song) ```
3
200
B
Drinks
PROGRAMMING
800
[ "implementation", "math" ]
null
null
Little Vasya loves orange juice very much. That's why any food and drink in his kitchen necessarily contains orange juice. There are *n* drinks in his fridge, the volume fraction of orange juice in the *i*-th drink equals *p**i* percent. One day Vasya decided to make himself an orange cocktail. He took equal proportions of each of the *n* drinks and mixed them. Then he wondered, how much orange juice the cocktail has. Find the volume fraction of orange juice in the final drink.
The first input line contains a single integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of orange-containing drinks in Vasya's fridge. The second line contains *n* integers *p**i* (0<=≀<=*p**i*<=≀<=100) β€” the volume fraction of orange juice in the *i*-th drink, in percent. The numbers are separated by a space.
Print the volume fraction in percent of orange juice in Vasya's cocktail. The answer will be considered correct if the absolute or relative error does not exceed 10<=<=-<=4.
[ "3\n50 50 100\n", "4\n0 25 50 75\n" ]
[ "66.666666666667\n", "37.500000000000\n" ]
Note to the first sample: let's assume that Vasya takes *x* milliliters of each drink from the fridge. Then the volume of pure juice in the cocktail will equal <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/c1fac6e64d3a8ee6a5ac138cbe51e60039b22473.png" style="max-width: 100.0%;max-height: 100.0%;"/> milliliters. The total cocktail's volume equals 3Β·*x* milliliters, so the volume fraction of the juice in the cocktail equals <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/ceb0664e55a1f9f5fa1243ec74680a4665a4d58d.png" style="max-width: 100.0%;max-height: 100.0%;"/>, that is, 66.(6) percent.
500
[ { "input": "3\n50 50 100", "output": "66.666666666667" }, { "input": "4\n0 25 50 75", "output": "37.500000000000" }, { "input": "3\n0 1 8", "output": "3.000000000000" }, { "input": "5\n96 89 93 95 70", "output": "88.600000000000" }, { "input": "7\n62 41 78 4 38 39 75", "output": "48.142857142857" }, { "input": "13\n2 22 7 0 1 17 3 17 11 2 21 26 22", "output": "11.615384615385" }, { "input": "21\n5 4 11 7 0 5 45 21 0 14 51 6 0 16 10 19 8 9 7 12 18", "output": "12.761904761905" }, { "input": "26\n95 70 93 74 94 70 91 70 39 79 80 57 87 75 37 93 48 67 51 90 85 26 23 64 66 84", "output": "69.538461538462" }, { "input": "29\n84 99 72 96 83 92 95 98 97 93 76 84 99 93 81 76 93 99 99 100 95 100 96 95 97 100 71 98 94", "output": "91.551724137931" }, { "input": "33\n100 99 100 100 99 99 99 100 100 100 99 99 99 100 100 100 100 99 100 99 100 100 97 100 100 100 100 100 100 100 98 98 100", "output": "99.515151515152" }, { "input": "34\n14 9 10 5 4 26 18 23 0 1 0 20 18 15 2 2 3 5 14 1 9 4 2 15 7 1 7 19 10 0 0 11 0 2", "output": "8.147058823529" }, { "input": "38\n99 98 100 100 99 92 99 99 98 84 88 94 86 99 93 100 98 99 65 98 85 84 64 97 96 89 79 96 91 84 99 93 72 96 94 97 96 93", "output": "91.921052631579" }, { "input": "52\n100 94 99 98 99 99 99 95 97 97 98 100 100 98 97 100 98 90 100 99 97 94 90 98 100 100 90 99 100 95 98 95 94 85 97 94 96 94 99 99 99 98 100 100 94 99 99 100 98 87 100 100", "output": "97.019230769231" }, { "input": "58\n10 70 12 89 1 82 100 53 40 100 21 69 92 91 67 66 99 77 25 48 8 63 93 39 46 79 82 14 44 42 1 79 0 69 56 73 67 17 59 4 65 80 20 60 77 52 3 61 16 76 33 18 46 100 28 59 9 6", "output": "50.965517241379" }, { "input": "85\n7 8 1 16 0 15 1 7 0 11 15 6 2 12 2 8 9 8 2 0 3 7 15 7 1 8 5 7 2 26 0 3 11 1 8 10 31 0 7 6 1 8 1 0 9 14 4 8 7 16 9 1 0 16 10 9 6 1 1 4 2 7 4 5 4 1 20 6 16 16 1 1 10 17 8 12 14 19 3 8 1 7 10 23 10", "output": "7.505882352941" }, { "input": "74\n5 3 0 7 13 10 12 10 18 5 0 18 2 13 7 17 2 7 5 2 40 19 0 2 2 3 0 45 4 20 0 4 2 8 1 19 3 9 17 1 15 0 16 1 9 4 0 9 32 2 6 18 11 18 1 15 16 12 7 19 5 3 9 28 26 8 3 10 33 29 4 13 28 6", "output": "10.418918918919" }, { "input": "98\n42 9 21 11 9 11 22 12 52 20 10 6 56 9 26 27 1 29 29 14 38 17 41 21 7 45 15 5 29 4 51 20 6 8 34 17 13 53 30 45 0 10 16 41 4 5 6 4 14 2 31 6 0 11 13 3 3 43 13 36 51 0 7 16 28 23 8 36 30 22 8 54 21 45 39 4 50 15 1 30 17 8 18 10 2 20 16 50 6 68 15 6 38 7 28 8 29 41", "output": "20.928571428571" }, { "input": "99\n60 65 40 63 57 44 30 84 3 10 39 53 40 45 72 20 76 11 61 32 4 26 97 55 14 57 86 96 34 69 52 22 26 79 31 4 21 35 82 47 81 28 72 70 93 84 40 4 69 39 83 58 30 7 32 73 74 12 92 23 61 88 9 58 70 32 75 40 63 71 46 55 39 36 14 97 32 16 95 41 28 20 85 40 5 50 50 50 75 6 10 64 38 19 77 91 50 72 96", "output": "49.191919191919" }, { "input": "99\n100 88 40 30 81 80 91 98 69 73 88 96 79 58 14 100 87 84 52 91 83 88 72 83 99 35 54 80 46 79 52 72 85 32 99 39 79 79 45 83 88 50 75 75 50 59 65 75 97 63 92 58 89 46 93 80 89 33 69 86 99 99 66 85 72 74 79 98 85 95 46 63 77 97 49 81 89 39 70 76 68 91 90 56 31 93 51 87 73 95 74 69 87 95 57 68 49 95 92", "output": "73.484848484848" }, { "input": "100\n18 15 17 0 3 3 0 4 1 8 2 22 7 21 5 0 0 8 3 16 1 0 2 9 9 3 10 8 17 20 5 4 8 12 2 3 1 1 3 2 23 0 1 0 5 7 4 0 1 3 3 4 25 2 2 14 8 4 9 3 0 11 0 3 12 3 14 16 7 7 14 1 17 9 0 35 42 12 3 1 25 9 3 8 5 3 2 8 22 14 11 6 3 9 6 8 7 7 4 6", "output": "7.640000000000" }, { "input": "100\n88 77 65 87 100 63 91 96 92 89 77 95 76 80 84 83 100 71 85 98 26 54 74 78 69 59 96 86 88 91 95 26 52 88 64 70 84 81 76 84 94 82 100 66 97 98 43 94 59 94 100 80 98 73 69 83 94 70 74 79 91 31 62 88 69 55 62 97 40 64 62 83 87 85 50 90 69 72 67 49 100 51 69 96 81 90 83 91 86 34 79 69 100 66 97 98 47 97 74 100", "output": "77.660000000000" }, { "input": "100\n91 92 90 91 98 84 85 96 83 98 99 87 94 70 87 75 86 90 89 88 82 83 91 94 88 86 90 99 100 98 97 75 95 99 95 100 91 92 76 93 95 97 88 93 95 81 96 89 88 100 98 87 90 96 100 99 58 90 96 77 92 82 100 100 93 93 98 99 79 88 97 95 98 66 96 83 96 100 99 92 98 98 92 93 100 97 98 100 98 97 100 100 94 90 99 100 98 79 80 81", "output": "91.480000000000" }, { "input": "1\n0", "output": "0.000000000000" }, { "input": "1\n100", "output": "100.000000000000" }, { "input": "1\n78", "output": "78.000000000000" }, { "input": "2\n0 100", "output": "50.000000000000" }, { "input": "2\n100 100", "output": "100.000000000000" }, { "input": "5\n0 0 0 0 1", "output": "0.200000000000" }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 99", "output": "99.990000000000" }, { "input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 1", "output": "0.010000000000" }, { "input": "5\n100 100 100 100 100", "output": "100.000000000000" } ]
1,682,755,975
2,147,483,647
Python 3
OK
TESTS
31
92
0
n = int(input()) a=list(map(int,input().split())) b=0 for i in range (n): b=a[i]+b c=b/n print(c)
Title: Drinks Time Limit: None seconds Memory Limit: None megabytes Problem Description: Little Vasya loves orange juice very much. That's why any food and drink in his kitchen necessarily contains orange juice. There are *n* drinks in his fridge, the volume fraction of orange juice in the *i*-th drink equals *p**i* percent. One day Vasya decided to make himself an orange cocktail. He took equal proportions of each of the *n* drinks and mixed them. Then he wondered, how much orange juice the cocktail has. Find the volume fraction of orange juice in the final drink. Input Specification: The first input line contains a single integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of orange-containing drinks in Vasya's fridge. The second line contains *n* integers *p**i* (0<=≀<=*p**i*<=≀<=100) β€” the volume fraction of orange juice in the *i*-th drink, in percent. The numbers are separated by a space. Output Specification: Print the volume fraction in percent of orange juice in Vasya's cocktail. The answer will be considered correct if the absolute or relative error does not exceed 10<=<=-<=4. Demo Input: ['3\n50 50 100\n', '4\n0 25 50 75\n'] Demo Output: ['66.666666666667\n', '37.500000000000\n'] Note: Note to the first sample: let's assume that Vasya takes *x* milliliters of each drink from the fridge. Then the volume of pure juice in the cocktail will equal <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/c1fac6e64d3a8ee6a5ac138cbe51e60039b22473.png" style="max-width: 100.0%;max-height: 100.0%;"/> milliliters. The total cocktail's volume equals 3Β·*x* milliliters, so the volume fraction of the juice in the cocktail equals <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/ceb0664e55a1f9f5fa1243ec74680a4665a4d58d.png" style="max-width: 100.0%;max-height: 100.0%;"/>, that is, 66.(6) percent.
```python n = int(input()) a=list(map(int,input().split())) b=0 for i in range (n): b=a[i]+b c=b/n print(c) ```
3
338
D
GCD Table
PROGRAMMING
2,900
[ "chinese remainder theorem", "math", "number theory" ]
null
null
Consider a table *G* of size *n*<=Γ—<=*m* such that *G*(*i*,<=*j*)<==<=*GCD*(*i*,<=*j*) for all 1<=≀<=*i*<=≀<=*n*,<=1<=≀<=*j*<=≀<=*m*. *GCD*(*a*,<=*b*) is the greatest common divisor of numbers *a* and *b*. You have a sequence of positive integer numbers *a*1,<=*a*2,<=...,<=*a**k*. We say that this sequence occurs in table *G* if it coincides with consecutive elements in some row, starting from some position. More formally, such numbers 1<=≀<=*i*<=≀<=*n* and 1<=≀<=*j*<=≀<=*m*<=-<=*k*<=+<=1 should exist that *G*(*i*,<=*j*<=+<=*l*<=-<=1)<==<=*a**l* for all 1<=≀<=*l*<=≀<=*k*. Determine if the sequence *a* occurs in table *G*.
The first line contains three space-separated integers *n*, *m* and *k* (1<=≀<=*n*,<=*m*<=≀<=1012; 1<=≀<=*k*<=≀<=10000). The second line contains *k* space-separated integers *a*1,<=*a*2,<=...,<=*a**k* (1<=≀<=*a**i*<=≀<=1012).
Print a single word "YES", if the given sequence occurs in table *G*, otherwise print "NO".
[ "100 100 5\n5 2 1 2 1\n", "100 8 5\n5 2 1 2 1\n", "100 100 7\n1 2 3 4 5 6 7\n" ]
[ "YES\n", "NO\n", "NO\n" ]
Sample 1. The tenth row of table *G* starts from sequence {1, 2, 1, 2, 5, 2, 1, 2, 1, 10}. As you can see, elements from fifth to ninth coincide with sequence *a*. Sample 2. This time the width of table *G* equals 8. Sequence *a* doesn't occur there.
2,000
[ { "input": "100 100 5\n5 2 1 2 1", "output": "YES" }, { "input": "100 8 5\n5 2 1 2 1", "output": "NO" }, { "input": "100 100 7\n1 2 3 4 5 6 7", "output": "NO" }, { "input": "5 5 5\n1 1 1 1 1", "output": "YES" }, { "input": "11 10 1\n11", "output": "NO" }, { "input": "108 942 35\n1 1 3 1 1 3 1 1 3 1 1 3 1 1 3 1 1 3 1 1 3 1 1 3 31 1 3 1 1 3 1 1 3 1 1", "output": "YES" }, { "input": "1000000000000 1000000000000 116\n1587924000 7 2 3 4 5 6 1 56 9 10 1 12 13 2 105 16 1 18 1 620 3 14 1 24 25 26 27 4 203 30 1 32 3 2 5 252 1 2 39 40 1 6 7 4 45 2 1 48 1 350 93 52 1 54 5 8 21 58 1 60 1 2 9 224 65 6 1 4 3 10 7 72 1 2 75 4 1 546 1 80 81 62 1 12 35 2 87 8 1 90 13 28 3 2 5 96 1 2 63 100 1 6 1 104 15 14 1 108 1 10 3 16 217 6 5", "output": "YES" }, { "input": "1000000000000 1000000000000 10\n99991 99992 99993 99994 99995 99996 99997 99998 99999 31000000000", "output": "NO" }, { "input": "100 100 10\n3 5 1 1 1 1 1 1 1 9", "output": "NO" }, { "input": "54275126675 128566125 50\n1 1 3 1 1 3 7 1 9 1 11 3 13 7 3 1 1 27 1 1 21 11 1 3 1 13 9 7 1 3 1 1 33 1 7 9 37 1 39 1 1 21 1 11 27 1 1 3 7 1", "output": "YES" }, { "input": "100000 49999 2\n50000 1", "output": "NO" }, { "input": "1000000000000 1000000000000 59\n1 1 3 1 5 3 1 1 3 5 1 3 1 1 15 1 1 3 1 5 3 1 1 3 5 1 3 1 1 15 1 1 3 1 5 3 1 1 3 5 1 3 1 1 15 1 1 3 1 5 3 1 1 3 5 1 3 1 1", "output": "YES" }, { "input": "1000000000000 1000000000000 6\n8 21 2 1 12 1", "output": "YES" }, { "input": "1000000000000 1000000000000 6\n1 6 5 2 3 2", "output": "YES" }, { "input": "1000000000000 1000000000000 100\n2 9 2 1 6 1 2 3 2 1 18 1 2 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 74 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 2 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 2 111 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 2 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1", "output": "YES" }, { "input": "1000000000000 1000000000000 100\n2 9 2 1 6 1 2 3 2 1 18 1 2 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 74 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 2 3 2 1 6 1 2 9 2 1 12 1 2 3 2 1 18 1 2 111 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 2 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1", "output": "NO" }, { "input": "1000000000000 1000000000000 100\n2 9 2 1 6 1 2 3 2 1 18 1 2 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 74 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 2 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1 18 1 2 111 2 1 6 1 2 9 2 1 6 1 2 3 2 1 9 1 2 3 2 1 6 1 2 9 2 1 6 1 2 3 2 1", "output": "NO" }, { "input": "1000000000000 1000000000000 40\n2 1 8 1 10 1 4 1 2 25 16 1 2 1 20 1 2 1 8 5 2 1 4 1 10 1 128 1 2 5 4 1 2 1 1000 1 2 1 4 5", "output": "YES" }, { "input": "1000000000000 1000000000000 40\n2 1 8 1 10 1 4 1 2 5 16 1 2 1 20 1 2 1 8 5 2 1 4 1 10 1 64 1 2 5 4 1 2 1 500 1 2 1 4 5", "output": "NO" }, { "input": "1000000000000 1000000000000 2\n1 1000000000000", "output": "YES" }, { "input": "1000000000000 1000000000000 4\n1 2 1 100000000000", "output": "YES" }, { "input": "991234567890 927215128595 5\n6 11 8 3 2000000014", "output": "YES" }, { "input": "991234567890 182000001269 5\n6 11 8 3 2000000014", "output": "NO" }, { "input": "999999999999 999999999999 2\n20145182300 20145182301", "output": "NO" } ]
1,611,326,596
2,147,483,647
Python 3
OK
TESTS
32
186
921,600
from math import gcd def LCM(a, b): if min(a, b) == 0: return max(a, b) return a // gcd(a, b) * b class Eqn(): def __init__(self, r, mod): self.r = r self.mod = mod def bye(): print("NO") exit(0) def exgcd(a, b): if b == 0: return (1, 0) xp, yp = exgcd(b, a % b) x = yp y = xp - a // b * yp return (x, y) def merge(a, b): newmode = LCM(a.mod, b.mod) if (a.r - b.r) % gcd(a.mod, b.mod) != 0: bye() newr = exgcd(a.mod, b.mod)[0] * (b.r - a.r) // gcd(a.mod, b.mod) * a.mod + a.r newr %= newmode return Eqn(newr, newmode) x, y = 0, 0 n, m, k = [int(i) for i in input().split()] a = [int(i) for i in input().split()] for i in a: x = LCM(x, i) if x > n: bye() cur = Eqn(0, 1) for i in range(0, len(a)): cur = merge(cur, Eqn((-i) % a[i], a[i])) y = cur.r if y == 0: y += x for i in range(0, len(a)): if gcd(x, y + i) != a[i]: bye() if x > n or y + k - 1 > m: bye() print("YES")
Title: GCD Table Time Limit: None seconds Memory Limit: None megabytes Problem Description: Consider a table *G* of size *n*<=Γ—<=*m* such that *G*(*i*,<=*j*)<==<=*GCD*(*i*,<=*j*) for all 1<=≀<=*i*<=≀<=*n*,<=1<=≀<=*j*<=≀<=*m*. *GCD*(*a*,<=*b*) is the greatest common divisor of numbers *a* and *b*. You have a sequence of positive integer numbers *a*1,<=*a*2,<=...,<=*a**k*. We say that this sequence occurs in table *G* if it coincides with consecutive elements in some row, starting from some position. More formally, such numbers 1<=≀<=*i*<=≀<=*n* and 1<=≀<=*j*<=≀<=*m*<=-<=*k*<=+<=1 should exist that *G*(*i*,<=*j*<=+<=*l*<=-<=1)<==<=*a**l* for all 1<=≀<=*l*<=≀<=*k*. Determine if the sequence *a* occurs in table *G*. Input Specification: The first line contains three space-separated integers *n*, *m* and *k* (1<=≀<=*n*,<=*m*<=≀<=1012; 1<=≀<=*k*<=≀<=10000). The second line contains *k* space-separated integers *a*1,<=*a*2,<=...,<=*a**k* (1<=≀<=*a**i*<=≀<=1012). Output Specification: Print a single word "YES", if the given sequence occurs in table *G*, otherwise print "NO". Demo Input: ['100 100 5\n5 2 1 2 1\n', '100 8 5\n5 2 1 2 1\n', '100 100 7\n1 2 3 4 5 6 7\n'] Demo Output: ['YES\n', 'NO\n', 'NO\n'] Note: Sample 1. The tenth row of table *G* starts from sequence {1, 2, 1, 2, 5, 2, 1, 2, 1, 10}. As you can see, elements from fifth to ninth coincide with sequence *a*. Sample 2. This time the width of table *G* equals 8. Sequence *a* doesn't occur there.
```python from math import gcd def LCM(a, b): if min(a, b) == 0: return max(a, b) return a // gcd(a, b) * b class Eqn(): def __init__(self, r, mod): self.r = r self.mod = mod def bye(): print("NO") exit(0) def exgcd(a, b): if b == 0: return (1, 0) xp, yp = exgcd(b, a % b) x = yp y = xp - a // b * yp return (x, y) def merge(a, b): newmode = LCM(a.mod, b.mod) if (a.r - b.r) % gcd(a.mod, b.mod) != 0: bye() newr = exgcd(a.mod, b.mod)[0] * (b.r - a.r) // gcd(a.mod, b.mod) * a.mod + a.r newr %= newmode return Eqn(newr, newmode) x, y = 0, 0 n, m, k = [int(i) for i in input().split()] a = [int(i) for i in input().split()] for i in a: x = LCM(x, i) if x > n: bye() cur = Eqn(0, 1) for i in range(0, len(a)): cur = merge(cur, Eqn((-i) % a[i], a[i])) y = cur.r if y == 0: y += x for i in range(0, len(a)): if gcd(x, y + i) != a[i]: bye() if x > n or y + k - 1 > m: bye() print("YES") ```
3
831
A
Unimodal Array
PROGRAMMING
1,000
[ "implementation" ]
null
null
Array of integers is unimodal, if: - it is strictly increasing in the beginning; - after that it is constant; - after that it is strictly decreasing. The first block (increasing) and the last block (decreasing) may be absent. It is allowed that both of this blocks are absent. For example, the following three arrays are unimodal: [5,<=7,<=11,<=11,<=2,<=1], [4,<=4,<=2], [7], but the following three are not unimodal: [5,<=5,<=6,<=6,<=1], [1,<=2,<=1,<=2], [4,<=5,<=5,<=6]. Write a program that checks if an array is unimodal.
The first line contains integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of elements in the array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≀<=*a**i*<=≀<=1<=000) β€” the elements of the array.
Print "YES" if the given array is unimodal. Otherwise, print "NO". You can output each letter in any case (upper or lower).
[ "6\n1 5 5 5 4 2\n", "5\n10 20 30 20 10\n", "4\n1 2 1 2\n", "7\n3 3 3 3 3 3 3\n" ]
[ "YES\n", "YES\n", "NO\n", "YES\n" ]
In the first example the array is unimodal, because it is strictly increasing in the beginning (from position 1 to position 2, inclusively), that it is constant (from position 2 to position 4, inclusively) and then it is strictly decreasing (from position 4 to position 6, inclusively).
500
[ { "input": "6\n1 5 5 5 4 2", "output": "YES" }, { "input": "5\n10 20 30 20 10", "output": "YES" }, { "input": "4\n1 2 1 2", "output": "NO" }, { "input": "7\n3 3 3 3 3 3 3", "output": "YES" }, { "input": "6\n5 7 11 11 2 1", "output": "YES" }, { "input": "1\n7", "output": "YES" }, { "input": "100\n527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527", "output": "YES" }, { "input": "5\n5 5 6 6 1", "output": "NO" }, { "input": "3\n4 4 2", "output": "YES" }, { "input": "4\n4 5 5 6", "output": "NO" }, { "input": "3\n516 516 515", "output": "YES" }, { "input": "5\n502 503 508 508 507", "output": "YES" }, { "input": "10\n538 538 538 538 538 538 538 538 538 538", "output": "YES" }, { "input": "15\n452 454 455 455 450 448 443 442 439 436 433 432 431 428 426", "output": "YES" }, { "input": "20\n497 501 504 505 509 513 513 513 513 513 513 513 513 513 513 513 513 513 513 513", "output": "YES" }, { "input": "50\n462 465 465 465 463 459 454 449 444 441 436 435 430 429 426 422 421 418 417 412 408 407 406 403 402 399 395 392 387 386 382 380 379 376 374 371 370 365 363 359 358 354 350 349 348 345 342 341 338 337", "output": "YES" }, { "input": "70\n290 292 294 297 299 300 303 305 310 312 313 315 319 320 325 327 328 333 337 339 340 341 345 350 351 354 359 364 367 372 374 379 381 382 383 384 389 393 395 397 398 400 402 405 409 411 416 417 422 424 429 430 434 435 440 442 445 449 451 453 458 460 465 470 474 477 482 482 482 479", "output": "YES" }, { "input": "99\n433 435 439 444 448 452 457 459 460 464 469 470 471 476 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 480 479 478 477 476 474 469 468 465 460 457 453 452 450 445 443 440 438 433 432 431 430 428 425 421 418 414 411 406 402 397 396 393", "output": "YES" }, { "input": "100\n537 538 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543", "output": "YES" }, { "input": "100\n524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 521", "output": "YES" }, { "input": "100\n235 239 243 245 246 251 254 259 260 261 264 269 272 275 277 281 282 285 289 291 292 293 298 301 302 303 305 307 308 310 315 317 320 324 327 330 334 337 342 346 347 348 353 357 361 366 370 373 376 378 379 384 386 388 390 395 398 400 405 408 413 417 420 422 424 429 434 435 438 441 443 444 445 450 455 457 459 463 465 468 471 473 475 477 481 486 491 494 499 504 504 504 504 504 504 504 504 504 504 504", "output": "YES" }, { "input": "100\n191 196 201 202 207 212 216 219 220 222 224 227 230 231 234 235 238 242 246 250 253 254 259 260 263 267 269 272 277 280 284 287 288 290 295 297 300 305 307 312 316 320 324 326 327 332 333 334 338 343 347 351 356 358 363 368 370 374 375 380 381 386 390 391 394 396 397 399 402 403 405 410 414 419 422 427 429 433 437 442 443 447 448 451 455 459 461 462 464 468 473 478 481 484 485 488 492 494 496 496", "output": "YES" }, { "input": "100\n466 466 466 466 466 464 459 455 452 449 446 443 439 436 435 433 430 428 425 424 420 419 414 412 407 404 401 396 394 391 386 382 379 375 374 369 364 362 360 359 356 351 350 347 342 340 338 337 333 330 329 326 321 320 319 316 311 306 301 297 292 287 286 281 278 273 269 266 261 257 256 255 253 252 250 245 244 242 240 238 235 230 225 220 216 214 211 209 208 206 203 198 196 194 192 190 185 182 177 173", "output": "YES" }, { "input": "100\n360 362 367 369 374 377 382 386 389 391 396 398 399 400 405 410 413 416 419 420 423 428 431 436 441 444 445 447 451 453 457 459 463 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 465 460 455 453 448 446 443 440 436 435 430 425 420 415 410 405 404 403 402 399 394 390 387 384 382 379 378 373 372 370 369 366 361 360 355 353 349 345 344 342 339 338 335 333", "output": "YES" }, { "input": "1\n1000", "output": "YES" }, { "input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "YES" }, { "input": "100\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000", "output": "YES" }, { "input": "100\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1", "output": "YES" }, { "input": "100\n1 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000", "output": "YES" }, { "input": "100\n1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 999 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000", "output": "NO" }, { "input": "100\n998 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 999 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 1000 999", "output": "NO" }, { "input": "100\n537 538 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 691 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543 543", "output": "NO" }, { "input": "100\n527 527 527 527 527 527 527 527 872 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527 527", "output": "NO" }, { "input": "100\n524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 208 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 524 521", "output": "NO" }, { "input": "100\n235 239 243 245 246 251 254 259 260 261 264 269 272 275 277 281 282 285 289 291 292 293 298 301 302 303 305 307 308 310 315 317 320 324 327 330 334 337 342 921 347 348 353 357 361 366 370 373 376 378 379 384 386 388 390 395 398 400 405 408 413 417 420 422 424 429 434 435 438 441 443 444 445 450 455 457 459 463 465 468 471 473 475 477 481 486 491 494 499 504 504 504 504 504 504 504 504 504 504 504", "output": "NO" }, { "input": "100\n191 196 201 202 207 212 216 219 220 222 224 227 230 231 234 235 238 242 246 250 253 254 259 260 263 267 269 272 277 280 284 287 288 290 295 297 300 305 307 312 316 320 324 326 327 332 333 334 338 343 347 351 356 358 119 368 370 374 375 380 381 386 390 391 394 396 397 399 402 403 405 410 414 419 422 427 429 433 437 442 443 447 448 451 455 459 461 462 464 468 473 478 481 484 485 488 492 494 496 496", "output": "NO" }, { "input": "100\n466 466 466 466 466 464 459 455 452 449 446 443 439 436 435 433 430 428 425 424 420 419 414 412 407 404 401 396 394 391 386 382 379 375 374 369 364 362 360 359 356 335 350 347 342 340 338 337 333 330 329 326 321 320 319 316 311 306 301 297 292 287 286 281 278 273 269 266 261 257 256 255 253 252 250 245 244 242 240 238 235 230 225 220 216 214 211 209 208 206 203 198 196 194 192 190 185 182 177 173", "output": "NO" }, { "input": "100\n360 362 367 369 374 377 382 386 389 391 396 398 399 400 405 410 413 416 419 420 423 428 525 436 441 444 445 447 451 453 457 459 463 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 468 465 460 455 453 448 446 443 440 436 435 430 425 420 415 410 405 404 403 402 399 394 390 387 384 382 379 378 373 372 370 369 366 361 360 355 353 349 345 344 342 339 338 335 333", "output": "NO" }, { "input": "3\n1 2 3", "output": "YES" }, { "input": "3\n3 2 1", "output": "YES" }, { "input": "3\n1 1 2", "output": "NO" }, { "input": "3\n2 1 1", "output": "NO" }, { "input": "3\n2 1 2", "output": "NO" }, { "input": "3\n3 1 2", "output": "NO" }, { "input": "3\n1 3 2", "output": "YES" }, { "input": "100\n395 399 402 403 405 408 413 415 419 424 426 431 434 436 439 444 447 448 449 454 457 459 461 462 463 464 465 469 470 473 477 480 482 484 485 487 492 494 496 497 501 504 505 508 511 506 505 503 500 499 494 490 488 486 484 481 479 474 472 471 470 465 462 458 453 452 448 445 440 436 433 430 428 426 424 421 419 414 413 408 404 403 399 395 393 388 384 379 377 375 374 372 367 363 360 356 353 351 350 346", "output": "YES" }, { "input": "100\n263 268 273 274 276 281 282 287 288 292 294 295 296 300 304 306 308 310 311 315 319 322 326 330 333 336 339 341 342 347 351 353 356 358 363 365 369 372 374 379 383 387 389 391 392 395 396 398 403 404 407 411 412 416 419 421 424 428 429 430 434 436 440 443 444 448 453 455 458 462 463 464 469 473 477 481 486 489 492 494 499 503 506 509 510 512 514 515 511 510 507 502 499 498 494 491 486 482 477 475", "output": "YES" }, { "input": "100\n482 484 485 489 492 496 499 501 505 509 512 517 520 517 515 513 509 508 504 503 498 496 493 488 486 481 478 476 474 470 468 466 463 459 456 453 452 449 445 444 439 438 435 432 428 427 424 423 421 419 417 413 408 405 402 399 397 393 388 385 380 375 370 366 363 361 360 355 354 352 349 345 340 336 335 331 329 327 324 319 318 317 315 314 310 309 307 304 303 300 299 295 291 287 285 282 280 278 273 271", "output": "YES" }, { "input": "100\n395 399 402 403 405 408 413 415 419 424 426 431 434 436 439 444 447 448 449 454 457 459 461 462 463 464 465 469 470 473 477 480 482 484 485 487 492 494 496 32 501 504 505 508 511 506 505 503 500 499 494 490 488 486 484 481 479 474 472 471 470 465 462 458 453 452 448 445 440 436 433 430 428 426 424 421 419 414 413 408 404 403 399 395 393 388 384 379 377 375 374 372 367 363 360 356 353 351 350 346", "output": "NO" }, { "input": "100\n263 268 273 274 276 281 282 287 288 292 294 295 296 300 304 306 308 310 311 315 319 322 326 330 247 336 339 341 342 347 351 353 356 358 363 365 369 372 374 379 383 387 389 391 392 395 396 398 403 404 407 411 412 416 419 421 424 428 429 430 434 436 440 443 444 448 453 455 458 462 463 464 469 473 477 481 486 489 492 494 499 503 506 509 510 512 514 515 511 510 507 502 499 498 494 491 486 482 477 475", "output": "NO" }, { "input": "100\n482 484 485 489 492 496 499 501 505 509 512 517 520 517 515 513 509 508 504 503 497 496 493 488 486 481 478 476 474 470 468 466 463 459 456 453 452 449 445 444 439 438 435 432 428 427 424 423 421 419 417 413 408 405 402 399 397 393 388 385 380 375 370 366 363 361 360 355 354 352 349 345 340 336 335 331 329 327 324 319 318 317 315 314 310 309 307 304 303 300 299 295 291 287 285 282 280 278 273 271", "output": "YES" }, { "input": "2\n1 3", "output": "YES" }, { "input": "2\n1 2", "output": "YES" }, { "input": "5\n2 2 1 1 1", "output": "NO" }, { "input": "4\n1 3 2 2", "output": "NO" }, { "input": "6\n1 2 1 2 2 1", "output": "NO" }, { "input": "2\n4 2", "output": "YES" }, { "input": "3\n3 2 2", "output": "NO" }, { "input": "9\n1 2 2 3 3 4 3 2 1", "output": "NO" }, { "input": "4\n5 5 4 4", "output": "NO" }, { "input": "2\n2 1", "output": "YES" }, { "input": "5\n5 4 3 2 1", "output": "YES" }, { "input": "7\n4 3 3 3 3 3 3", "output": "NO" }, { "input": "5\n1 2 3 4 5", "output": "YES" }, { "input": "3\n2 2 1", "output": "YES" }, { "input": "3\n4 3 3", "output": "NO" }, { "input": "7\n1 5 5 4 3 3 1", "output": "NO" }, { "input": "6\n3 3 1 2 2 1", "output": "NO" }, { "input": "5\n1 2 1 2 1", "output": "NO" }, { "input": "2\n5 1", "output": "YES" }, { "input": "9\n1 2 3 4 4 3 2 2 1", "output": "NO" }, { "input": "3\n2 2 3", "output": "NO" }, { "input": "2\n5 4", "output": "YES" }, { "input": "5\n1 3 3 2 2", "output": "NO" }, { "input": "10\n1 2 3 4 5 6 7 8 9 99", "output": "YES" }, { "input": "4\n1 2 3 4", "output": "YES" }, { "input": "3\n5 5 2", "output": "YES" }, { "input": "4\n1 4 2 3", "output": "NO" }, { "input": "2\n3 2", "output": "YES" }, { "input": "5\n1 2 2 1 1", "output": "NO" }, { "input": "4\n3 3 2 2", "output": "NO" }, { "input": "5\n1 2 3 2 2", "output": "NO" }, { "input": "5\n5 6 6 5 5", "output": "NO" }, { "input": "4\n2 2 1 1", "output": "NO" }, { "input": "5\n5 4 3 3 2", "output": "NO" }, { "input": "7\n1 3 3 3 2 1 1", "output": "NO" }, { "input": "9\n5 6 6 5 5 4 4 3 3", "output": "NO" }, { "input": "6\n1 5 5 3 2 2", "output": "NO" }, { "input": "5\n2 1 3 3 1", "output": "NO" }, { "input": "2\n4 3", "output": "YES" }, { "input": "5\n3 2 2 1 1", "output": "NO" }, { "input": "4\n5 4 3 2", "output": "YES" }, { "input": "4\n4 4 1 1", "output": "NO" }, { "input": "4\n3 3 1 1", "output": "NO" }, { "input": "4\n4 4 2 2", "output": "NO" }, { "input": "5\n4 4 3 2 2", "output": "NO" }, { "input": "8\n4 4 4 4 5 6 7 8", "output": "NO" }, { "input": "5\n3 5 4 4 3", "output": "NO" }, { "input": "6\n2 5 3 3 2 2", "output": "NO" }, { "input": "4\n5 5 2 2", "output": "NO" }, { "input": "5\n1 2 2 3 5", "output": "NO" } ]
1,676,209,583
2,147,483,647
Python 3
OK
TESTS
101
46
0
def is_unimodal(arr): n = len(arr) i = 0 while i < n - 1 and arr[i] < arr[i + 1]: i += 1 while i < n - 1 and arr[i] == arr[i + 1]: i += 1 while i < n - 1 and arr[i] > arr[i + 1]: i += 1 return i == n - 1 n = int(input().strip()) arr = list(map(int, input().strip().split())) if is_unimodal(arr): print("YES") else: print("NO")
Title: Unimodal Array Time Limit: None seconds Memory Limit: None megabytes Problem Description: Array of integers is unimodal, if: - it is strictly increasing in the beginning; - after that it is constant; - after that it is strictly decreasing. The first block (increasing) and the last block (decreasing) may be absent. It is allowed that both of this blocks are absent. For example, the following three arrays are unimodal: [5,<=7,<=11,<=11,<=2,<=1], [4,<=4,<=2], [7], but the following three are not unimodal: [5,<=5,<=6,<=6,<=1], [1,<=2,<=1,<=2], [4,<=5,<=5,<=6]. Write a program that checks if an array is unimodal. Input Specification: The first line contains integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of elements in the array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≀<=*a**i*<=≀<=1<=000) β€” the elements of the array. Output Specification: Print "YES" if the given array is unimodal. Otherwise, print "NO". You can output each letter in any case (upper or lower). Demo Input: ['6\n1 5 5 5 4 2\n', '5\n10 20 30 20 10\n', '4\n1 2 1 2\n', '7\n3 3 3 3 3 3 3\n'] Demo Output: ['YES\n', 'YES\n', 'NO\n', 'YES\n'] Note: In the first example the array is unimodal, because it is strictly increasing in the beginning (from position 1 to position 2, inclusively), that it is constant (from position 2 to position 4, inclusively) and then it is strictly decreasing (from position 4 to position 6, inclusively).
```python def is_unimodal(arr): n = len(arr) i = 0 while i < n - 1 and arr[i] < arr[i + 1]: i += 1 while i < n - 1 and arr[i] == arr[i + 1]: i += 1 while i < n - 1 and arr[i] > arr[i + 1]: i += 1 return i == n - 1 n = int(input().strip()) arr = list(map(int, input().strip().split())) if is_unimodal(arr): print("YES") else: print("NO") ```
3
609
A
USB Flash Drives
PROGRAMMING
800
[ "greedy", "implementation", "sortings" ]
null
null
Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes. Find the minimum number of USB flash drives needed to write Sean's file, if he can split the file between drives.
The first line contains positive integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of USB flash drives. The second line contains positive integer *m* (1<=≀<=*m*<=≀<=105) β€” the size of Sean's file. Each of the next *n* lines contains positive integer *a**i* (1<=≀<=*a**i*<=≀<=1000) β€” the sizes of USB flash drives in megabytes. It is guaranteed that the answer exists, i. e. the sum of all *a**i* is not less than *m*.
Print the minimum number of USB flash drives to write Sean's file, if he can split the file between drives.
[ "3\n5\n2\n1\n3\n", "3\n6\n2\n3\n2\n", "2\n5\n5\n10\n" ]
[ "2\n", "3\n", "1\n" ]
In the first example Sean needs only two USB flash drives β€” the first and the third. In the second example Sean needs all three USB flash drives. In the third example Sean needs only one USB flash drive and he can use any available USB flash drive β€” the first or the second.
0
[ { "input": "3\n5\n2\n1\n3", "output": "2" }, { "input": "3\n6\n2\n3\n2", "output": "3" }, { "input": "2\n5\n5\n10", "output": "1" }, { "input": "5\n16\n8\n1\n3\n4\n9", "output": "2" }, { "input": "10\n121\n10\n37\n74\n56\n42\n39\n6\n68\n8\n100", "output": "2" }, { "input": "12\n4773\n325\n377\n192\n780\n881\n816\n839\n223\n215\n125\n952\n8", "output": "7" }, { "input": "15\n7758\n182\n272\n763\n910\n24\n359\n583\n890\n735\n819\n66\n992\n440\n496\n227", "output": "15" }, { "input": "30\n70\n6\n2\n10\n4\n7\n10\n5\n1\n8\n10\n4\n3\n5\n9\n3\n6\n6\n4\n2\n6\n5\n10\n1\n9\n7\n2\n1\n10\n7\n5", "output": "8" }, { "input": "40\n15705\n702\n722\n105\n873\n417\n477\n794\n300\n869\n496\n572\n232\n456\n298\n473\n584\n486\n713\n934\n121\n303\n956\n934\n840\n358\n201\n861\n497\n131\n312\n957\n96\n914\n509\n60\n300\n722\n658\n820\n103", "output": "21" }, { "input": "50\n18239\n300\n151\n770\n9\n200\n52\n247\n753\n523\n263\n744\n463\n540\n244\n608\n569\n771\n32\n425\n777\n624\n761\n628\n124\n405\n396\n726\n626\n679\n237\n229\n49\n512\n18\n671\n290\n768\n632\n739\n18\n136\n413\n117\n83\n413\n452\n767\n664\n203\n404", "output": "31" }, { "input": "70\n149\n5\n3\n3\n4\n6\n1\n2\n9\n8\n3\n1\n8\n4\n4\n3\n6\n10\n7\n1\n10\n8\n4\n9\n3\n8\n3\n2\n5\n1\n8\n6\n9\n10\n4\n8\n6\n9\n9\n9\n3\n4\n2\n2\n5\n8\n9\n1\n10\n3\n4\n3\n1\n9\n3\n5\n1\n3\n7\n6\n9\n8\n9\n1\n7\n4\n4\n2\n3\n5\n7", "output": "17" }, { "input": "70\n2731\n26\n75\n86\n94\n37\n25\n32\n35\n92\n1\n51\n73\n53\n66\n16\n80\n15\n81\n100\n87\n55\n48\n30\n71\n39\n87\n77\n25\n70\n22\n75\n23\n97\n16\n75\n95\n61\n61\n28\n10\n78\n54\n80\n51\n25\n24\n90\n58\n4\n77\n40\n54\n53\n47\n62\n30\n38\n71\n97\n71\n60\n58\n1\n21\n15\n55\n99\n34\n88\n99", "output": "35" }, { "input": "70\n28625\n34\n132\n181\n232\n593\n413\n862\n887\n808\n18\n35\n89\n356\n640\n339\n280\n975\n82\n345\n398\n948\n372\n91\n755\n75\n153\n948\n603\n35\n694\n722\n293\n363\n884\n264\n813\n175\n169\n646\n138\n449\n488\n828\n417\n134\n84\n763\n288\n845\n801\n556\n972\n332\n564\n934\n699\n842\n942\n644\n203\n406\n140\n37\n9\n423\n546\n675\n491\n113\n587", "output": "45" }, { "input": "80\n248\n3\n9\n4\n5\n10\n7\n2\n6\n2\n2\n8\n2\n1\n3\n7\n9\n2\n8\n4\n4\n8\n5\n4\n4\n10\n2\n1\n4\n8\n4\n10\n1\n2\n10\n2\n3\n3\n1\n1\n8\n9\n5\n10\n2\n8\n10\n5\n3\n6\n1\n7\n8\n9\n10\n5\n10\n10\n2\n10\n1\n2\n4\n1\n9\n4\n7\n10\n8\n5\n8\n1\n4\n2\n2\n3\n9\n9\n9\n10\n6", "output": "27" }, { "input": "80\n2993\n18\n14\n73\n38\n14\n73\n77\n18\n81\n6\n96\n65\n77\n86\n76\n8\n16\n81\n83\n83\n34\n69\n58\n15\n19\n1\n16\n57\n95\n35\n5\n49\n8\n15\n47\n84\n99\n94\n93\n55\n43\n47\n51\n61\n57\n13\n7\n92\n14\n4\n83\n100\n60\n75\n41\n95\n74\n40\n1\n4\n95\n68\n59\n65\n15\n15\n75\n85\n46\n77\n26\n30\n51\n64\n75\n40\n22\n88\n68\n24", "output": "38" }, { "input": "80\n37947\n117\n569\n702\n272\n573\n629\n90\n337\n673\n589\n576\n205\n11\n284\n645\n719\n777\n271\n567\n466\n251\n402\n3\n97\n288\n699\n208\n173\n530\n782\n266\n395\n957\n159\n463\n43\n316\n603\n197\n386\n132\n799\n778\n905\n784\n71\n851\n963\n883\n705\n454\n275\n425\n727\n223\n4\n870\n833\n431\n463\n85\n505\n800\n41\n954\n981\n242\n578\n336\n48\n858\n702\n349\n929\n646\n528\n993\n506\n274\n227", "output": "70" }, { "input": "90\n413\n5\n8\n10\n7\n5\n7\n5\n7\n1\n7\n8\n4\n3\n9\n4\n1\n10\n3\n1\n10\n9\n3\n1\n8\n4\n7\n5\n2\n9\n3\n10\n10\n3\n6\n3\n3\n10\n7\n5\n1\n1\n2\n4\n8\n2\n5\n5\n3\n9\n5\n5\n3\n10\n2\n3\n8\n5\n9\n1\n3\n6\n5\n9\n2\n3\n7\n10\n3\n4\n4\n1\n5\n9\n2\n6\n9\n1\n1\n9\n9\n7\n7\n7\n8\n4\n5\n3\n4\n6\n9", "output": "59" }, { "input": "90\n4226\n33\n43\n83\n46\n75\n14\n88\n36\n8\n25\n47\n4\n96\n19\n33\n49\n65\n17\n59\n72\n1\n55\n94\n92\n27\n33\n39\n14\n62\n79\n12\n89\n22\n86\n13\n19\n77\n53\n96\n74\n24\n25\n17\n64\n71\n81\n87\n52\n72\n55\n49\n74\n36\n65\n86\n91\n33\n61\n97\n38\n87\n61\n14\n73\n95\n43\n67\n42\n67\n22\n12\n62\n32\n96\n24\n49\n82\n46\n89\n36\n75\n91\n11\n10\n9\n33\n86\n28\n75\n39", "output": "64" }, { "input": "90\n40579\n448\n977\n607\n745\n268\n826\n479\n59\n330\n609\n43\n301\n970\n726\n172\n632\n600\n181\n712\n195\n491\n312\n849\n722\n679\n682\n780\n131\n404\n293\n387\n567\n660\n54\n339\n111\n833\n612\n911\n869\n356\n884\n635\n126\n639\n712\n473\n663\n773\n435\n32\n973\n484\n662\n464\n699\n274\n919\n95\n904\n253\n589\n543\n454\n250\n349\n237\n829\n511\n536\n36\n45\n152\n626\n384\n199\n877\n941\n84\n781\n115\n20\n52\n726\n751\n920\n291\n571\n6\n199", "output": "64" }, { "input": "100\n66\n7\n9\n10\n5\n2\n8\n6\n5\n4\n10\n10\n6\n5\n2\n2\n1\n1\n5\n8\n7\n8\n10\n5\n6\n6\n5\n9\n9\n6\n3\n8\n7\n10\n5\n9\n6\n7\n3\n5\n8\n6\n8\n9\n1\n1\n1\n2\n4\n5\n5\n1\n1\n2\n6\n7\n1\n5\n8\n7\n2\n1\n7\n10\n9\n10\n2\n4\n10\n4\n10\n10\n5\n3\n9\n1\n2\n1\n10\n5\n1\n7\n4\n4\n5\n7\n6\n10\n4\n7\n3\n4\n3\n6\n2\n5\n2\n4\n9\n5\n3", "output": "7" }, { "input": "100\n4862\n20\n47\n85\n47\n76\n38\n48\n93\n91\n81\n31\n51\n23\n60\n59\n3\n73\n72\n57\n67\n54\n9\n42\n5\n32\n46\n72\n79\n95\n61\n79\n88\n33\n52\n97\n10\n3\n20\n79\n82\n93\n90\n38\n80\n18\n21\n43\n60\n73\n34\n75\n65\n10\n84\n100\n29\n94\n56\n22\n59\n95\n46\n22\n57\n69\n67\n90\n11\n10\n61\n27\n2\n48\n69\n86\n91\n69\n76\n36\n71\n18\n54\n90\n74\n69\n50\n46\n8\n5\n41\n96\n5\n14\n55\n85\n39\n6\n79\n75\n87", "output": "70" }, { "input": "100\n45570\n14\n881\n678\n687\n993\n413\n760\n451\n426\n787\n503\n343\n234\n530\n294\n725\n941\n524\n574\n441\n798\n399\n360\n609\n376\n525\n229\n995\n478\n347\n47\n23\n468\n525\n749\n601\n235\n89\n995\n489\n1\n239\n415\n122\n671\n128\n357\n886\n401\n964\n212\n968\n210\n130\n871\n360\n661\n844\n414\n187\n21\n824\n266\n713\n126\n496\n916\n37\n193\n755\n894\n641\n300\n170\n176\n383\n488\n627\n61\n897\n33\n242\n419\n881\n698\n107\n391\n418\n774\n905\n87\n5\n896\n835\n318\n373\n916\n393\n91\n460", "output": "78" }, { "input": "100\n522\n1\n5\n2\n4\n2\n6\n3\n4\n2\n10\n10\n6\n7\n9\n7\n1\n7\n2\n5\n3\n1\n5\n2\n3\n5\n1\n7\n10\n10\n4\n4\n10\n9\n10\n6\n2\n8\n2\n6\n10\n9\n2\n7\n5\n9\n4\n6\n10\n7\n3\n1\n1\n9\n5\n10\n9\n2\n8\n3\n7\n5\n4\n7\n5\n9\n10\n6\n2\n9\n2\n5\n10\n1\n7\n7\n10\n5\n6\n2\n9\n4\n7\n10\n10\n8\n3\n4\n9\n3\n6\n9\n10\n2\n9\n9\n3\n4\n1\n10\n2", "output": "74" }, { "input": "100\n32294\n414\n116\n131\n649\n130\n476\n630\n605\n213\n117\n757\n42\n109\n85\n127\n635\n629\n994\n410\n764\n204\n161\n231\n577\n116\n936\n537\n565\n571\n317\n722\n819\n229\n284\n487\n649\n304\n628\n727\n816\n854\n91\n111\n549\n87\n374\n417\n3\n868\n882\n168\n743\n77\n534\n781\n75\n956\n910\n734\n507\n568\n802\n946\n891\n659\n116\n678\n375\n380\n430\n627\n873\n350\n930\n285\n6\n183\n96\n517\n81\n794\n235\n360\n551\n6\n28\n799\n226\n996\n894\n981\n551\n60\n40\n460\n479\n161\n318\n952\n433", "output": "42" }, { "input": "100\n178\n71\n23\n84\n98\n8\n14\n4\n42\n56\n83\n87\n28\n22\n32\n50\n5\n96\n90\n1\n59\n74\n56\n96\n77\n88\n71\n38\n62\n36\n85\n1\n97\n98\n98\n32\n99\n42\n6\n81\n20\n49\n57\n71\n66\n9\n45\n41\n29\n28\n32\n68\n38\n29\n35\n29\n19\n27\n76\n85\n68\n68\n41\n32\n78\n72\n38\n19\n55\n83\n83\n25\n46\n62\n48\n26\n53\n14\n39\n31\n94\n84\n22\n39\n34\n96\n63\n37\n42\n6\n78\n76\n64\n16\n26\n6\n79\n53\n24\n29\n63", "output": "2" }, { "input": "100\n885\n226\n266\n321\n72\n719\n29\n121\n533\n85\n672\n225\n830\n783\n822\n30\n791\n618\n166\n487\n922\n434\n814\n473\n5\n741\n947\n910\n305\n998\n49\n945\n588\n868\n809\n803\n168\n280\n614\n434\n634\n538\n591\n437\n540\n445\n313\n177\n171\n799\n778\n55\n617\n554\n583\n611\n12\n94\n599\n182\n765\n556\n965\n542\n35\n460\n177\n313\n485\n744\n384\n21\n52\n879\n792\n411\n614\n811\n565\n695\n428\n587\n631\n794\n461\n258\n193\n696\n936\n646\n756\n267\n55\n690\n730\n742\n734\n988\n235\n762\n440", "output": "1" }, { "input": "100\n29\n9\n2\n10\n8\n6\n7\n7\n3\n3\n10\n4\n5\n2\n5\n1\n6\n3\n2\n5\n10\n10\n9\n1\n4\n5\n2\n2\n3\n1\n2\n2\n9\n6\n9\n7\n8\n8\n1\n5\n5\n3\n1\n5\n6\n1\n9\n2\n3\n8\n10\n8\n3\n2\n7\n1\n2\n1\n2\n8\n10\n5\n2\n3\n1\n10\n7\n1\n7\n4\n9\n6\n6\n4\n7\n1\n2\n7\n7\n9\n9\n7\n10\n4\n10\n8\n2\n1\n5\n5\n10\n5\n8\n1\n5\n6\n5\n1\n5\n6\n8", "output": "3" }, { "input": "100\n644\n94\n69\n43\n36\n54\n93\n30\n74\n56\n95\n70\n49\n11\n36\n57\n30\n59\n3\n52\n59\n90\n82\n39\n67\n32\n8\n80\n64\n8\n65\n51\n48\n89\n90\n35\n4\n54\n66\n96\n68\n90\n30\n4\n13\n97\n41\n90\n85\n17\n45\n94\n31\n58\n4\n39\n76\n95\n92\n59\n67\n46\n96\n55\n82\n64\n20\n20\n83\n46\n37\n15\n60\n37\n79\n45\n47\n63\n73\n76\n31\n52\n36\n32\n49\n26\n61\n91\n31\n25\n62\n90\n65\n65\n5\n94\n7\n15\n97\n88\n68", "output": "7" }, { "input": "100\n1756\n98\n229\n158\n281\n16\n169\n149\n239\n235\n182\n147\n215\n49\n270\n194\n242\n295\n289\n249\n19\n12\n144\n157\n92\n270\n122\n212\n97\n152\n14\n42\n12\n198\n98\n295\n154\n229\n191\n294\n5\n156\n43\n185\n184\n20\n125\n23\n10\n257\n244\n264\n79\n46\n277\n13\n22\n97\n212\n77\n293\n20\n51\n17\n109\n37\n68\n117\n51\n248\n10\n149\n179\n192\n239\n161\n13\n173\n297\n73\n43\n109\n288\n198\n81\n70\n254\n187\n277\n1\n295\n113\n95\n291\n293\n119\n205\n191\n37\n34\n116", "output": "6" }, { "input": "100\n20562\n721\n452\n11\n703\n376\n183\n197\n203\n406\n642\n346\n446\n256\n760\n201\n360\n702\n707\n388\n779\n653\n610\n497\n768\n670\n134\n780\n306\n661\n180\n259\n256\n362\n6\n121\n415\n747\n170\n67\n439\n728\n193\n622\n481\n38\n225\n343\n303\n253\n436\n305\n68\n794\n247\n291\n600\n750\n188\n199\n757\n28\n776\n749\n253\n351\n53\n629\n129\n578\n209\n89\n651\n262\n638\n353\n469\n31\n144\n460\n176\n535\n562\n366\n639\n234\n577\n364\n761\n617\n303\n450\n778\n311\n289\n221\n274\n239\n626\n194\n36", "output": "30" }, { "input": "100\n32630\n548\n21\n756\n138\n56\n719\n97\n86\n599\n531\n464\n137\n737\n239\n626\n179\n170\n271\n335\n178\n298\n597\n616\n104\n190\n216\n333\n606\n621\n310\n70\n286\n593\n655\n472\n556\n77\n625\n744\n395\n487\n762\n316\n469\n258\n475\n596\n651\n180\n737\n101\n511\n708\n163\n713\n475\n557\n649\n705\n583\n97\n447\n119\n91\n372\n194\n394\n667\n384\n635\n611\n746\n758\n613\n54\n508\n405\n188\n570\n254\n28\n599\n767\n115\n737\n194\n148\n686\n705\n236\n762\n613\n770\n633\n401\n773\n448\n274\n141\n718", "output": "52" }, { "input": "1\n1\n1", "output": "1" } ]
1,577,730,125
2,147,483,647
Python 3
OK
TESTS
34
109
0
n,k=int(input()),int(input());p=sorted([int(input()) for case in " "*n],reverse=True);c=0 def j(a): global k,c;k=k-a;c+=1 if k<=0:print(c);exit() [j(p[i]) for i in range(n)]
Title: USB Flash Drives Time Limit: None seconds Memory Limit: None megabytes Problem Description: Sean is trying to save a large file to a USB flash drive. He has *n* USB flash drives with capacities equal to *a*1,<=*a*2,<=...,<=*a**n* megabytes. The file size is equal to *m* megabytes. Find the minimum number of USB flash drives needed to write Sean's file, if he can split the file between drives. Input Specification: The first line contains positive integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of USB flash drives. The second line contains positive integer *m* (1<=≀<=*m*<=≀<=105) β€” the size of Sean's file. Each of the next *n* lines contains positive integer *a**i* (1<=≀<=*a**i*<=≀<=1000) β€” the sizes of USB flash drives in megabytes. It is guaranteed that the answer exists, i. e. the sum of all *a**i* is not less than *m*. Output Specification: Print the minimum number of USB flash drives to write Sean's file, if he can split the file between drives. Demo Input: ['3\n5\n2\n1\n3\n', '3\n6\n2\n3\n2\n', '2\n5\n5\n10\n'] Demo Output: ['2\n', '3\n', '1\n'] Note: In the first example Sean needs only two USB flash drives β€” the first and the third. In the second example Sean needs all three USB flash drives. In the third example Sean needs only one USB flash drive and he can use any available USB flash drive β€” the first or the second.
```python n,k=int(input()),int(input());p=sorted([int(input()) for case in " "*n],reverse=True);c=0 def j(a): global k,c;k=k-a;c+=1 if k<=0:print(c);exit() [j(p[i]) for i in range(n)] ```
3
785
A
Anton and Polyhedrons
PROGRAMMING
800
[ "implementation", "strings" ]
null
null
Anton's favourite geometric figures are regular polyhedrons. Note that there are five kinds of regular polyhedrons: - Tetrahedron. Tetrahedron has 4 triangular faces. - Cube. Cube has 6 square faces. - Octahedron. Octahedron has 8 triangular faces. - Dodecahedron. Dodecahedron has 12 pentagonal faces. - Icosahedron. Icosahedron has 20 triangular faces. All five kinds of polyhedrons are shown on the picture below: Anton has a collection of *n* polyhedrons. One day he decided to know, how many faces his polyhedrons have in total. Help Anton and find this number!
The first line of the input contains a single integer *n* (1<=≀<=*n*<=≀<=200<=000)Β β€” the number of polyhedrons in Anton's collection. Each of the following *n* lines of the input contains a string *s**i*Β β€” the name of the *i*-th polyhedron in Anton's collection. The string can look like this: - "Tetrahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is a tetrahedron. - "Cube" (without quotes), if the *i*-th polyhedron in Anton's collection is a cube. - "Octahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is an octahedron. - "Dodecahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is a dodecahedron. - "Icosahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is an icosahedron.
Output one numberΒ β€” the total number of faces in all the polyhedrons in Anton's collection.
[ "4\nIcosahedron\nCube\nTetrahedron\nDodecahedron\n", "3\nDodecahedron\nOctahedron\nOctahedron\n" ]
[ "42\n", "28\n" ]
In the first sample Anton has one icosahedron, one cube, one tetrahedron and one dodecahedron. Icosahedron has 20 faces, cube has 6 faces, tetrahedron has 4 faces and dodecahedron has 12 faces. In total, they have 20 + 6 + 4 + 12 = 42 faces.
500
[ { "input": "4\nIcosahedron\nCube\nTetrahedron\nDodecahedron", "output": "42" }, { "input": "3\nDodecahedron\nOctahedron\nOctahedron", "output": "28" }, { "input": "25\nIcosahedron\nOctahedron\nTetrahedron\nDodecahedron\nCube\nIcosahedron\nOctahedron\nCube\nTetrahedron\nIcosahedron\nIcosahedron\nTetrahedron\nOctahedron\nDodecahedron\nIcosahedron\nOctahedron\nIcosahedron\nTetrahedron\nDodecahedron\nTetrahedron\nOctahedron\nCube\nCube\nDodecahedron\nTetrahedron", "output": "256" }, { "input": "1\nTetrahedron", "output": "4" }, { "input": "1\nCube", "output": "6" }, { "input": "1\nOctahedron", "output": "8" }, { "input": "1\nDodecahedron", "output": "12" }, { "input": "1\nIcosahedron", "output": "20" }, { "input": "28\nOctahedron\nDodecahedron\nOctahedron\nOctahedron\nDodecahedron\nIcosahedron\nIcosahedron\nDodecahedron\nDodecahedron\nDodecahedron\nCube\nDodecahedron\nCube\nTetrahedron\nCube\nCube\nTetrahedron\nDodecahedron\nDodecahedron\nDodecahedron\nIcosahedron\nIcosahedron\nDodecahedron\nIcosahedron\nDodecahedron\nDodecahedron\nIcosahedron\nIcosahedron", "output": "340" } ]
1,681,445,656
2,147,483,647
Python 3
OK
TESTS
30
452
0
while True: try: a = int(input()) n = 0 for i in range(a): s = input() if(s[0] == 'T'): n += 4 elif(s[0] == 'C'): n += 6 elif(s[0] == 'O'): n += 8 elif(s[0] == 'D'): n += 12 elif(s[0] == 'I'): n += 20 print(n) except: break
Title: Anton and Polyhedrons Time Limit: None seconds Memory Limit: None megabytes Problem Description: Anton's favourite geometric figures are regular polyhedrons. Note that there are five kinds of regular polyhedrons: - Tetrahedron. Tetrahedron has 4 triangular faces. - Cube. Cube has 6 square faces. - Octahedron. Octahedron has 8 triangular faces. - Dodecahedron. Dodecahedron has 12 pentagonal faces. - Icosahedron. Icosahedron has 20 triangular faces. All five kinds of polyhedrons are shown on the picture below: Anton has a collection of *n* polyhedrons. One day he decided to know, how many faces his polyhedrons have in total. Help Anton and find this number! Input Specification: The first line of the input contains a single integer *n* (1<=≀<=*n*<=≀<=200<=000)Β β€” the number of polyhedrons in Anton's collection. Each of the following *n* lines of the input contains a string *s**i*Β β€” the name of the *i*-th polyhedron in Anton's collection. The string can look like this: - "Tetrahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is a tetrahedron. - "Cube" (without quotes), if the *i*-th polyhedron in Anton's collection is a cube. - "Octahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is an octahedron. - "Dodecahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is a dodecahedron. - "Icosahedron" (without quotes), if the *i*-th polyhedron in Anton's collection is an icosahedron. Output Specification: Output one numberΒ β€” the total number of faces in all the polyhedrons in Anton's collection. Demo Input: ['4\nIcosahedron\nCube\nTetrahedron\nDodecahedron\n', '3\nDodecahedron\nOctahedron\nOctahedron\n'] Demo Output: ['42\n', '28\n'] Note: In the first sample Anton has one icosahedron, one cube, one tetrahedron and one dodecahedron. Icosahedron has 20 faces, cube has 6 faces, tetrahedron has 4 faces and dodecahedron has 12 faces. In total, they have 20 + 6 + 4 + 12 = 42 faces.
```python while True: try: a = int(input()) n = 0 for i in range(a): s = input() if(s[0] == 'T'): n += 4 elif(s[0] == 'C'): n += 6 elif(s[0] == 'O'): n += 8 elif(s[0] == 'D'): n += 12 elif(s[0] == 'I'): n += 20 print(n) except: break ```
3
61
A
Ultra-Fast Mathematician
PROGRAMMING
800
[ "implementation" ]
A. Ultra-Fast Mathematician
2
256
Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second. One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part. In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0. Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length. Now you are going to take part in Shapur's contest. See if you are faster and more accurate.
There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100.
Write one line β€” the corresponding answer. Do not omit the leading 0s.
[ "1010100\n0100101\n", "000\n111\n", "1110\n1010\n", "01110\n01100\n" ]
[ "1110001\n", "111\n", "0100\n", "00010\n" ]
none
500
[ { "input": "1010100\n0100101", "output": "1110001" }, { "input": "000\n111", "output": "111" }, { "input": "1110\n1010", "output": "0100" }, { "input": "01110\n01100", "output": "00010" }, { "input": "011101\n000001", "output": "011100" }, { "input": "10\n01", "output": "11" }, { "input": "00111111\n11011101", "output": "11100010" }, { "input": "011001100\n101001010", "output": "110000110" }, { "input": "1100100001\n0110101100", "output": "1010001101" }, { "input": "00011101010\n10010100101", "output": "10001001111" }, { "input": "100000101101\n111010100011", "output": "011010001110" }, { "input": "1000001111010\n1101100110001", "output": "0101101001011" }, { "input": "01011111010111\n10001110111010", "output": "11010001101101" }, { "input": "110010000111100\n001100101011010", "output": "111110101100110" }, { "input": "0010010111110000\n0000000011010110", "output": "0010010100100110" }, { "input": "00111110111110000\n01111100001100000", "output": "01000010110010000" }, { "input": "101010101111010001\n001001111101111101", "output": "100011010010101100" }, { "input": "0110010101111100000\n0011000101000000110", "output": "0101010000111100110" }, { "input": "11110100011101010111\n00001000011011000000", "output": "11111100000110010111" }, { "input": "101010101111101101001\n111010010010000011111", "output": "010000111101101110110" }, { "input": "0000111111100011000010\n1110110110110000001010", "output": "1110001001010011001000" }, { "input": "10010010101000110111000\n00101110100110111000111", "output": "10111100001110001111111" }, { "input": "010010010010111100000111\n100100111111100011001110", "output": "110110101101011111001001" }, { "input": "0101110100100111011010010\n0101100011010111001010001", "output": "0000010111110000010000011" }, { "input": "10010010100011110111111011\n10000110101100000001000100", "output": "00010100001111110110111111" }, { "input": "000001111000000100001000000\n011100111101111001110110001", "output": "011101000101111101111110001" }, { "input": "0011110010001001011001011100\n0000101101000011101011001010", "output": "0011011111001010110010010110" }, { "input": "11111000000000010011001101111\n11101110011001010100010000000", "output": "00010110011001000111011101111" }, { "input": "011001110000110100001100101100\n001010000011110000001000101001", "output": "010011110011000100000100000101" }, { "input": "1011111010001100011010110101111\n1011001110010000000101100010101", "output": "0000110100011100011111010111010" }, { "input": "10111000100001000001010110000001\n10111000001100101011011001011000", "output": "00000000101101101010001111011001" }, { "input": "000001010000100001000000011011100\n111111111001010100100001100000111", "output": "111110101001110101100001111011011" }, { "input": "1101000000000010011011101100000110\n1110000001100010011010000011011110", "output": "0011000001100000000001101111011000" }, { "input": "01011011000010100001100100011110001\n01011010111000001010010100001110000", "output": "00000001111010101011110000010000001" }, { "input": "000011111000011001000110111100000100\n011011000110000111101011100111000111", "output": "011000111110011110101101011011000011" }, { "input": "1001000010101110001000000011111110010\n0010001011010111000011101001010110000", "output": "1011001001111001001011101010101000010" }, { "input": "00011101011001100101111111000000010101\n10010011011011001011111000000011101011", "output": "10001110000010101110000111000011111110" }, { "input": "111011100110001001101111110010111001010\n111111101101111001110010000101101000100", "output": "000100001011110000011101110111010001110" }, { "input": "1111001001101000001000000010010101001010\n0010111100111110001011000010111110111001", "output": "1101110101010110000011000000101011110011" }, { "input": "00100101111000000101011111110010100011010\n11101110001010010101001000111110101010100", "output": "11001011110010010000010111001100001001110" }, { "input": "101011001110110100101001000111010101101111\n100111100110101011010100111100111111010110", "output": "001100101000011111111101111011101010111001" }, { "input": "1111100001100101000111101001001010011100001\n1000110011000011110010001011001110001000001", "output": "0111010010100110110101100010000100010100000" }, { "input": "01100111011111010101000001101110000001110101\n10011001011111110000000101011001001101101100", "output": "11111110000000100101000100110111001100011001" }, { "input": "110010100111000100100101100000011100000011001\n011001111011100110000110111001110110100111011", "output": "101011011100100010100011011001101010100100010" }, { "input": "0001100111111011010110100100111000000111000110\n1100101011000000000001010010010111001100110001", "output": "1101001100111011010111110110101111001011110111" }, { "input": "00000101110110110001110010100001110100000100000\n10010000110011110001101000111111101010011010001", "output": "10010101000101000000011010011110011110011110001" }, { "input": "110000100101011100100011001111110011111110010001\n101011111001011100110110111101110011010110101100", "output": "011011011100000000010101110010000000101000111101" }, { "input": "0101111101011111010101011101000011101100000000111\n0000101010110110001110101011011110111001010100100", "output": "0101010111101001011011110110011101010101010100011" }, { "input": "11000100010101110011101000011111001010110111111100\n00001111000111001011111110000010101110111001000011", "output": "11001011010010111000010110011101100100001110111111" }, { "input": "101000001101111101101111111000001110110010101101010\n010011100111100001100000010001100101000000111011011", "output": "111011101010011100001111101001101011110010010110001" }, { "input": "0011111110010001010100010110111000110011001101010100\n0111000000100010101010000100101000000100101000111001", "output": "0100111110110011111110010010010000110111100101101101" }, { "input": "11101010000110000011011010000001111101000111011111100\n10110011110001010100010110010010101001010111100100100", "output": "01011001110111010111001100010011010100010000111011000" }, { "input": "011000100001000001101000010110100110011110100111111011\n111011001000001001110011001111011110111110110011011111", "output": "100011101001001000011011011001111000100000010100100100" }, { "input": "0111010110010100000110111011010110100000000111110110000\n1011100100010001101100000100111111101001110010000100110", "output": "1100110010000101101010111111101001001001110101110010110" }, { "input": "10101000100111000111010001011011011011110100110101100011\n11101111000000001100100011111000100100000110011001101110", "output": "01000111100111001011110010100011111111110010101100001101" }, { "input": "000000111001010001000000110001001011100010011101010011011\n110001101000010010000101000100001111101001100100001010010", "output": "110001010001000011000101110101000100001011111001011001001" }, { "input": "0101011100111010000111110010101101111111000000111100011100\n1011111110000010101110111001000011100000100111111111000111", "output": "1110100010111000101001001011101110011111100111000011011011" }, { "input": "11001000001100100111100111100100101011000101001111001001101\n10111110100010000011010100110100100011101001100000001110110", "output": "01110110101110100100110011010000001000101100101111000111011" }, { "input": "010111011011101000000110000110100110001110100001110110111011\n101011110011101011101101011111010100100001100111100100111011", "output": "111100101000000011101011011001110010101111000110010010000000" }, { "input": "1001011110110110000100011001010110000100011010010111010101110\n1101111100001000010111110011010101111010010100000001000010111", "output": "0100100010111110010011101010000011111110001110010110010111001" }, { "input": "10000010101111100111110101111000010100110111101101111111111010\n10110110101100101010011001011010100110111011101100011001100111", "output": "00110100000011001101101100100010110010001100000001100110011101" }, { "input": "011111010011111000001010101001101001000010100010111110010100001\n011111001011000011111001000001111001010110001010111101000010011", "output": "000000011000111011110011101000010000010100101000000011010110010" }, { "input": "1111000000110001011101000100100100001111011100001111001100011111\n1101100110000101100001100000001001011011111011010101000101001010", "output": "0010100110110100111100100100101101010100100111011010001001010101" }, { "input": "01100000101010010011001110100110110010000110010011011001100100011\n10110110010110111100100111000111000110010000000101101110000010111", "output": "11010110111100101111101001100001110100010110010110110111100110100" }, { "input": "001111111010000100001100001010011001111110011110010111110001100111\n110000101001011000100010101100100110000111100000001101001110010111", "output": "111111010011011100101110100110111111111001111110011010111111110000" }, { "input": "1011101011101101011110101101011101011000010011100101010101000100110\n0001000001001111010111100100111101100000000001110001000110000000110", "output": "1010101010100010001001001001100000111000010010010100010011000100000" }, { "input": "01000001011001010011011100010000100100110101111011011011110000001110\n01011110000110011011000000000011000111100001010000000011111001110000", "output": "00011111011111001000011100010011100011010100101011011000001001111110" }, { "input": "110101010100110101000001111110110100010010000100111110010100110011100\n111010010111111011100110101011001011001110110111110100000110110100111", "output": "001111000011001110100111010101111111011100110011001010010010000111011" }, { "input": "1001101011000001011111100110010010000011010001001111011100010100110001\n1111100111110101001111010001010000011001001001010110001111000000100101", "output": "0110001100110100010000110111000010011010011000011001010011010100010100" }, { "input": "00000111110010110001110110001010010101000111011001111111100110011110010\n00010111110100000100110101000010010001100001100011100000001100010100010", "output": "00010000000110110101000011001000000100100110111010011111101010001010000" }, { "input": "100101011100101101000011010001011001101110101110001100010001010111001110\n100001111100101011011111110000001111000111001011111110000010101110111001", "output": "000100100000000110011100100001010110101001100101110010010011111001110111" }, { "input": "1101100001000111001101001011101000111000011110000001001101101001111011010\n0101011101010100011011010110101000010010110010011110101100000110110001000", "output": "1000111100010011010110011101000000101010101100011111100001101111001010010" }, { "input": "01101101010011110101100001110101111011100010000010001101111000011110111111\n00101111001101001100111010000101110000100101101111100111101110010100011011", "output": "01000010011110111001011011110000001011000111101101101010010110001010100100" }, { "input": "101100101100011001101111110110110010100110110010100001110010110011001101011\n000001011010101011110011111101001110000111000010001101000010010000010001101", "output": "101101110110110010011100001011111100100001110000101100110000100011011100110" }, { "input": "0010001011001010001100000010010011110110011000100000000100110000101111001110\n1100110100111000110100001110111001011101001100001010100001010011100110110001", "output": "1110111111110010111000001100101010101011010100101010100101100011001001111111" }, { "input": "00101101010000000101011001101011001100010001100000101011101110000001111001000\n10010110010111000000101101000011101011001010000011011101101011010000000011111", "output": "10111011000111000101110100101000100111011011100011110110000101010001111010111" }, { "input": "111100000100100000101001100001001111001010001000001000000111010000010101101011\n001000100010100101111011111011010110101100001111011000010011011011100010010110", "output": "110100100110000101010010011010011001100110000111010000010100001011110111111101" }, { "input": "0110001101100100001111110101101000100101010010101010011001101001001101110000000\n0111011000000010010111011110010000000001000110001000011001101000000001110100111", "output": "0001010101100110011000101011111000100100010100100010000000000001001100000100111" }, { "input": "10001111111001000101001011110101111010100001011010101100111001010001010010001000\n10000111010010011110111000111010101100000011110001101111001000111010100000000001", "output": "00001000101011011011110011001111010110100010101011000011110001101011110010001001" }, { "input": "100110001110110000100101001110000011110110000110000000100011110100110110011001101\n110001110101110000000100101001101011111100100100001001000110000001111100011110110", "output": "010111111011000000100001100111101000001010100010001001100101110101001010000111011" }, { "input": "0000010100100000010110111100011111111010011101000000100000011001001101101100111010\n0100111110011101010110101011110110010111001111000110101100101110111100101000111111", "output": "0100101010111101000000010111101001101101010010000110001100110111110001000100000101" }, { "input": "11000111001010100001110000001001011010010010110000001110100101000001010101100110111\n11001100100100100001101010110100000111100011101110011010110100001001000011011011010", "output": "00001011101110000000011010111101011101110001011110010100010001001000010110111101101" }, { "input": "010110100010001000100010101001101010011010111110100001000100101000111011100010100001\n110000011111101101010011111000101010111010100001001100001001100101000000111000000000", "output": "100110111101100101110001010001000000100000011111101101001101001101111011011010100001" }, { "input": "0000011110101110010101110110110101100001011001101010101001000010000010000000101001101\n1100111111011100000110000111101110011111100111110001011001000010011111100001001100011", "output": "1100100001110010010011110001011011111110111110011011110000000000011101100001100101110" }, { "input": "10100000101101110001100010010010100101100011010010101000110011100000101010110010000000\n10001110011011010010111011011101101111000111110000111000011010010101001100000001010011", "output": "00101110110110100011011001001111001010100100100010010000101001110101100110110011010011" }, { "input": "001110000011111101101010011111000101010111010100001001100001001100101000000111000000000\n111010000000000000101001110011001000111011001100101010011001000011101001001011110000011", "output": "110100000011111101000011101100001101101100011000100011111000001111000001001100110000011" }, { "input": "1110111100111011010101011011001110001010010010110011110010011111000010011111010101100001\n1001010101011001001010100010101100000110111101011000100010101111111010111100001110010010", "output": "0111101001100010011111111001100010001100101111101011010000110000111000100011011011110011" }, { "input": "11100010001100010011001100001100010011010001101110011110100101110010101101011101000111111\n01110000000110111010110100001010000101011110100101010011000110101110101101110111011110001", "output": "10010010001010101001111000000110010110001111001011001101100011011100000000101010011001110" }, { "input": "001101011001100101101100110000111000101011001001100100000100101000100000110100010111111101\n101001111110000010111101111110001001111001111101111010000110111000100100110010010001011111", "output": "100100100111100111010001001110110001010010110100011110000010010000000100000110000110100010" }, { "input": "1010110110010101000110010010110101011101010100011001101011000110000000100011100100011000000\n0011011111100010001111101101000111001011101110100000110111100100101111010110101111011100011", "output": "1001101001110111001001111111110010010110111010111001011100100010101111110101001011000100011" }, { "input": "10010010000111010111011111110010100101100000001100011100111011100010000010010001011100001100\n00111010100010110010000100010111010001111110100100100011101000101111111111001101101100100100", "output": "10101000100101100101011011100101110100011110101000111111010011001101111101011100110000101000" }, { "input": "010101110001010101100000010111010000000111110011001101100011001000000011001111110000000010100\n010010111011100101010101111110110000000111000100001101101001001000001100101110001010000100001", "output": "000111001010110000110101101001100000000000110111000000001010000000001111100001111010000110101" }, { "input": "1100111110011001000111101001001011000110011010111111100010111111001100111111011101100111101011\n1100000011001000110100110111000001011001010111101000010010100011000001100100111101101000010110", "output": "0000111101010001110011011110001010011111001101010111110000011100001101011011100000001111111101" }, { "input": "00011000100100110111100101100100000000010011110111110010101110110011100001010111010011110100101\n00011011111011111011100101100111100101001110010111000010000111000100100100000001110101111011011", "output": "00000011011111001100000000000011100101011101100000110000101001110111000101010110100110001111110" }, { "input": "000101011001001100000111100010110101111011110101111101000110001101011010111110110011100100000001\n011000101010011111011000111000100000000011011000000001111110001000001111101010110000011100001111", "output": "011101110011010011011111011010010101111000101101111100111000000101010101010100000011111000001110" }, { "input": "1000101001011010000100100100010010011101011001110101111011101111111110010101001101010001010101001\n0110110010011100011111011111110111000000010001110100001010111110101011010011111011111110000110000", "output": "1110011011000110011011111011100101011101001000000001110001010001010101000110110110101111010011001" }, { "input": "01111010010101100111110111111011011010100001011101010000111100101101101110111011001100101011100111\n00001100110110100001111011000010001001001100000010111101000001111011100000010111010010000011000010", "output": "01110110100011000110001100111001010011101101011111101101111101010110001110101100011110101000100101" }, { "input": "111101011101111000001011001101111010110111001101110100100011111011011101001101010101011010111000110\n101111100101101101001100110011000001111010011101110111110110101110011011110011111100001001110101101", "output": "010010111000010101000111111110111011001101010000000011010101010101000110111110101001010011001101011" }, { "input": "1010000011010110011101001101110001110010000111011101110010110110111111001001110100101100010101010001\n0111101000111100101100000101111010100100001000011101010100110011100011010011010101000100101011100011", "output": "1101101011101010110001001000001011010110001111000000100110000101011100011010100001101000111110110010" }, { "input": "0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001\n1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111010", "output": "1111111010111111101011111110101111111010111111101011111110101111111010111111101011111110101111111011" }, { "input": "0\n0", "output": "0" }, { "input": "0\n1", "output": "1" } ]
1,647,341,064
2,147,483,647
Python 3
OK
TESTS
102
46
0
s=input() t=input() for i in range(len(s)): print(int(s[i])^int(t[i]),end='')
Title: Ultra-Fast Mathematician Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Shapur was an extremely gifted student. He was great at everything including Combinatorics, Algebra, Number Theory, Geometry, Calculus, etc. He was not only smart but extraordinarily fast! He could manage to sum 1018 numbers in a single second. One day in 230 AD Shapur was trying to find out if any one can possibly do calculations faster than him. As a result he made a very great contest and asked every one to come and take part. In his contest he gave the contestants many different pairs of numbers. Each number is made from digits 0 or 1. The contestants should write a new number corresponding to the given pair of numbers. The rule is simple: The *i*-th digit of the answer is 1 if and only if the *i*-th digit of the two given numbers differ. In the other case the *i*-th digit of the answer is 0. Shapur made many numbers and first tried his own speed. He saw that he can perform these operations on numbers of length ∞ (length of a number is number of digits in it) in a glance! He always gives correct answers so he expects the contestants to give correct answers, too. He is a good fellow so he won't give anyone very big numbers and he always gives one person numbers of same length. Now you are going to take part in Shapur's contest. See if you are faster and more accurate. Input Specification: There are two lines in each input. Each of them contains a single number. It is guaranteed that the numbers are made from 0 and 1 only and that their length is same. The numbers may start with 0. The length of each number doesn't exceed 100. Output Specification: Write one line β€” the corresponding answer. Do not omit the leading 0s. Demo Input: ['1010100\n0100101\n', '000\n111\n', '1110\n1010\n', '01110\n01100\n'] Demo Output: ['1110001\n', '111\n', '0100\n', '00010\n'] Note: none
```python s=input() t=input() for i in range(len(s)): print(int(s[i])^int(t[i]),end='') ```
3.9885
519
B
A and B and Compilation Errors
PROGRAMMING
1,100
[ "data structures", "implementation", "sortings" ]
null
null
A and B are preparing themselves for programming contests. B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code. Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake. However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared β€” the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change. Can you help B find out exactly what two errors he corrected?
The first line of the input contains integer *n* (3<=≀<=*n*<=≀<=105) β€” the initial number of compilation errors. The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≀<=*a**i*<=≀<=109) β€” the errors the compiler displayed for the first time. The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 β€” the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one. The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 β€” the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one.
Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively.
[ "5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n", "6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n" ]
[ "8\n123\n", "1\n3\n" ]
In the first test sample B first corrects the error number 8, then the error number 123. In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step.
1,000
[ { "input": "5\n1 5 8 123 7\n123 7 5 1\n5 1 7", "output": "8\n123" }, { "input": "6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5", "output": "1\n3" }, { "input": "3\n1 2 3\n3 2\n2", "output": "1\n3" }, { "input": "10\n460626451 802090732 277246428 661369649 388684428 784303821 376287098 656422756 9301599 25720377\n277246428 388684428 661369649 460626451 656422756 802090732 9301599 784303821 376287098\n376287098 802090732 388684428 9301599 656422756 784303821 460626451 277246428", "output": "25720377\n661369649" }, { "input": "3\n796067435 964699482 819602309\n964699482 796067435\n964699482", "output": "819602309\n796067435" }, { "input": "3\n374054998 726316780 902899520\n902899520 726316780\n726316780", "output": "374054998\n902899520" }, { "input": "3\n168638990 939116221 323703261\n168638990 323703261\n168638990", "output": "939116221\n323703261" }, { "input": "3\n77 77 77\n77 77\n77", "output": "77\n77" }, { "input": "3\n84 30 9\n9 84\n9", "output": "30\n84" }, { "input": "6\n5 4 3 3 5 5\n3 5 5 4 3\n3 5 4 3", "output": "5\n5" }, { "input": "4\n1 5 7 8\n1 5 7\n1 5", "output": "8\n7" } ]
1,688,509,114
2,147,483,647
PyPy 3-64
OK
TESTS
33
155
29,900,800
from copy import deepcopy n = int(input()) a = list(map(int, input().split())) b = list(map(int, input().split())) c = list(map(int, input().split())) base = 0 for a_i in a: base = base ^ a_i dummy = deepcopy(base) for b_i in b: dummy = dummy ^ b_i print(dummy) base = 0 for b_i in b: base = base ^ b_i dummy = deepcopy(base) for c_i in c: dummy = dummy ^ c_i print(dummy)
Title: A and B and Compilation Errors Time Limit: None seconds Memory Limit: None megabytes Problem Description: A and B are preparing themselves for programming contests. B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code. Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake. However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared β€” the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change. Can you help B find out exactly what two errors he corrected? Input Specification: The first line of the input contains integer *n* (3<=≀<=*n*<=≀<=105) β€” the initial number of compilation errors. The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≀<=*a**i*<=≀<=109) β€” the errors the compiler displayed for the first time. The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 β€” the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one. The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 β€” the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one. Output Specification: Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively. Demo Input: ['5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n', '6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n'] Demo Output: ['8\n123\n', '1\n3\n'] Note: In the first test sample B first corrects the error number 8, then the error number 123. In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step.
```python from copy import deepcopy n = int(input()) a = list(map(int, input().split())) b = list(map(int, input().split())) c = list(map(int, input().split())) base = 0 for a_i in a: base = base ^ a_i dummy = deepcopy(base) for b_i in b: dummy = dummy ^ b_i print(dummy) base = 0 for b_i in b: base = base ^ b_i dummy = deepcopy(base) for c_i in c: dummy = dummy ^ c_i print(dummy) ```
3
59
A
Word
PROGRAMMING
800
[ "implementation", "strings" ]
A. Word
2
256
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP β€” with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
The first line contains a word *s* β€” it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
[ "HoUse\n", "ViP\n", "maTRIx\n" ]
[ "house\n", "VIP\n", "matrix\n" ]
none
500
[ { "input": "HoUse", "output": "house" }, { "input": "ViP", "output": "VIP" }, { "input": "maTRIx", "output": "matrix" }, { "input": "BNHWpnpawg", "output": "bnhwpnpawg" }, { "input": "VTYGP", "output": "VTYGP" }, { "input": "CHNenu", "output": "chnenu" }, { "input": "ERPZGrodyu", "output": "erpzgrodyu" }, { "input": "KSXBXWpebh", "output": "KSXBXWPEBH" }, { "input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv", "output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv" }, { "input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd", "output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd" }, { "input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv", "output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv" }, { "input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg", "output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg" }, { "input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak", "output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK" }, { "input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw", "output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW" }, { "input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB", "output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB" }, { "input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge", "output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge" }, { "input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw", "output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw" }, { "input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks", "output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks" }, { "input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz", "output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ" }, { "input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg", "output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG" }, { "input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO", "output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO" }, { "input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd", "output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD" }, { "input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas", "output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas" }, { "input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm", "output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM" }, { "input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn", "output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn" }, { "input": "t", "output": "t" }, { "input": "N", "output": "N" }, { "input": "kv", "output": "kv" }, { "input": "Ur", "output": "ur" }, { "input": "CN", "output": "CN" } ]
1,668,248,158
2,147,483,647
Python 3
OK
TESTS
30
92
0
# LUOGU_RID: 93775856 string = input() uppers = 0 lowers = 0 for i in range(len(string)): if string[i].isupper() == True: uppers += 1 else: lowers += 1 if uppers > lowers: print(string.upper()) else: print(string.lower())
Title: Word Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP β€” with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word. Input Specification: The first line contains a word *s* β€” it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100. Output Specification: Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one. Demo Input: ['HoUse\n', 'ViP\n', 'maTRIx\n'] Demo Output: ['house\n', 'VIP\n', 'matrix\n'] Note: none
```python # LUOGU_RID: 93775856 string = input() uppers = 0 lowers = 0 for i in range(len(string)): if string[i].isupper() == True: uppers += 1 else: lowers += 1 if uppers > lowers: print(string.upper()) else: print(string.lower()) ```
3.977
388
A
Fox and Box Accumulation
PROGRAMMING
1,400
[ "greedy", "sortings" ]
null
null
Fox Ciel has *n* boxes in her room. They have the same size and weight, but they might have different strength. The *i*-th box can hold at most *x**i* boxes on its top (we'll call *x**i* the strength of the box). Since all the boxes have the same size, Ciel cannot put more than one box directly on the top of some box. For example, imagine Ciel has three boxes: the first has strength 2, the second has strength 1 and the third has strength 1. She cannot put the second and the third box simultaneously directly on the top of the first one. But she can put the second box directly on the top of the first one, and then the third box directly on the top of the second one. We will call such a construction of boxes a pile. Fox Ciel wants to construct piles from all the boxes. Each pile will contain some boxes from top to bottom, and there cannot be more than *x**i* boxes on the top of *i*-th box. What is the minimal number of piles she needs to construct?
The first line contains an integer *n* (1<=≀<=*n*<=≀<=100). The next line contains *n* integers *x*1,<=*x*2,<=...,<=*x**n* (0<=≀<=*x**i*<=≀<=100).
Output a single integer β€” the minimal possible number of piles.
[ "3\n0 0 10\n", "5\n0 1 2 3 4\n", "4\n0 0 0 0\n", "9\n0 1 0 2 0 1 1 2 10\n" ]
[ "2\n", "1\n", "4\n", "3\n" ]
In example 1, one optimal way is to build 2 piles: the first pile contains boxes 1 and 3 (from top to bottom), the second pile contains only box 2. In example 2, we can build only 1 pile that contains boxes 1, 2, 3, 4, 5 (from top to bottom).
500
[ { "input": "3\n0 0 10", "output": "2" }, { "input": "5\n0 1 2 3 4", "output": "1" }, { "input": "4\n0 0 0 0", "output": "4" }, { "input": "9\n0 1 0 2 0 1 1 2 10", "output": "3" }, { "input": "1\n0", "output": "1" }, { "input": "2\n0 0", "output": "2" }, { "input": "2\n0 1", "output": "1" }, { "input": "2\n100 99", "output": "1" }, { "input": "9\n0 1 1 0 2 0 3 45 4", "output": "3" }, { "input": "10\n1 1 1 1 2 2 2 2 2 2", "output": "4" }, { "input": "100\n50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50", "output": "2" }, { "input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", "output": "100" }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100", "output": "1" }, { "input": "11\n71 34 31 71 42 38 64 60 36 76 67", "output": "1" }, { "input": "39\n54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54 54", "output": "1" }, { "input": "59\n61 33 84 76 56 47 70 94 46 77 95 85 35 90 83 62 48 74 36 74 83 97 62 92 95 75 70 82 94 67 82 42 78 70 50 73 80 76 94 83 96 80 80 88 91 79 83 54 38 90 33 93 53 33 86 95 48 34 46", "output": "1" }, { "input": "87\n52 63 93 90 50 35 67 66 46 89 43 64 33 88 34 80 69 59 75 55 55 68 66 83 46 33 72 36 73 34 54 85 52 87 67 68 47 95 52 78 92 58 71 66 84 61 36 77 69 44 84 70 71 55 43 91 33 65 77 34 43 59 83 70 95 38 92 92 74 53 66 65 81 45 55 89 49 52 43 69 78 41 37 79 63 70 67", "output": "1" }, { "input": "15\n20 69 36 63 40 40 52 42 20 43 59 68 64 49 47", "output": "1" }, { "input": "39\n40 20 49 35 80 18 20 75 39 62 43 59 46 37 58 52 67 16 34 65 32 75 59 42 59 41 68 21 41 61 66 19 34 63 19 63 78 62 24", "output": "1" }, { "input": "18\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", "output": "18" }, { "input": "46\n14 13 13 10 13 15 8 8 12 9 11 15 8 10 13 8 12 13 11 8 12 15 12 15 11 13 12 9 13 12 10 8 13 15 9 15 8 13 11 8 9 9 9 8 11 8", "output": "3" }, { "input": "70\n6 1 4 1 1 6 5 2 5 1 1 5 2 1 2 4 1 1 1 2 4 5 2 1 6 6 5 2 1 4 3 1 4 3 6 5 2 1 3 4 4 1 4 5 6 2 1 2 4 4 5 3 6 1 1 2 2 1 5 6 1 6 3 1 4 4 2 3 1 4", "output": "11" }, { "input": "94\n11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11 11", "output": "8" }, { "input": "18\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "9" }, { "input": "46\n14 8 7 4 8 7 8 8 12 9 9 12 9 12 14 8 10 14 14 6 9 11 7 14 14 13 11 4 13 13 11 13 9 10 10 12 10 8 12 10 13 10 7 13 14 6", "output": "4" }, { "input": "74\n4 4 5 5 5 5 5 5 6 6 5 4 4 4 3 3 5 4 5 3 4 4 5 6 3 3 5 4 4 5 4 3 5 5 4 4 3 5 6 4 3 6 6 3 4 5 4 4 3 3 3 6 3 5 6 5 5 5 5 3 6 4 5 4 4 6 6 3 4 5 6 6 6 6", "output": "11" }, { "input": "100\n48 35 44 37 35 42 42 39 49 53 35 55 41 42 42 39 43 49 46 54 48 39 42 53 55 39 56 43 43 38 48 40 54 36 48 55 46 40 41 39 45 56 38 40 47 46 45 46 53 51 38 41 54 35 35 47 42 43 54 54 39 44 49 41 37 49 36 37 37 49 53 44 47 37 55 49 45 40 35 51 44 40 42 35 46 48 53 48 35 38 42 36 54 46 44 47 41 40 41 42", "output": "2" }, { "input": "100\n34 3 37 35 40 44 38 46 13 31 12 23 26 40 26 18 28 36 5 21 2 4 10 29 3 46 38 41 37 28 44 14 39 10 35 17 24 28 38 16 29 6 2 42 47 34 43 2 43 46 7 16 16 43 33 32 20 47 8 48 32 4 45 38 15 7 25 25 19 41 20 35 16 2 31 5 31 25 27 3 45 29 32 36 9 47 39 35 9 21 32 17 21 41 29 48 11 40 5 25", "output": "3" }, { "input": "100\n2 4 5 5 0 5 3 0 3 0 5 3 4 1 0 3 0 5 5 0 4 3 3 3 0 2 1 2 2 4 4 2 4 0 1 3 4 1 4 2 5 3 5 2 3 0 1 2 5 5 2 0 4 2 5 1 0 0 4 0 1 2 0 1 2 4 1 4 5 3 4 5 5 1 0 0 3 1 4 0 4 5 1 3 3 0 4 2 0 4 5 2 3 0 5 1 4 4 1 0", "output": "21" }, { "input": "100\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5", "output": "17" }, { "input": "100\n1 1 1 2 2 2 2 2 2 1 1 1 2 0 2 2 0 0 0 0 0 2 0 0 2 2 1 0 2 0 2 1 1 2 2 1 2 2 1 2 1 2 2 1 2 0 1 2 2 0 2 2 2 2 1 0 1 0 0 0 2 0 2 0 1 1 0 2 2 2 2 1 1 1 2 1 1 2 1 1 1 2 1 0 2 1 0 1 2 0 1 1 2 0 0 1 1 0 1 1", "output": "34" }, { "input": "100\n0 3 1 0 3 2 1 2 2 1 2 1 3 2 1 2 1 3 2 0 0 2 3 0 0 2 1 2 2 3 1 2 2 2 0 3 3 2 0 0 1 0 1 2 3 1 0 3 3 3 0 2 1 3 0 1 3 2 2 2 2 3 3 2 0 2 0 1 0 1 3 0 1 2 0 1 3 2 0 3 1 1 2 3 1 3 1 0 3 0 3 0 2 1 1 1 2 2 0 1", "output": "26" }, { "input": "100\n1 0 2 2 2 2 1 0 1 2 2 2 0 1 0 1 2 1 2 1 0 1 2 2 2 1 0 1 0 2 1 2 0 2 1 1 2 1 1 0 1 2 1 1 2 1 1 0 2 2 0 0 1 2 0 2 0 0 1 1 0 0 2 1 2 1 0 2 2 2 2 2 2 1 2 0 1 2 1 2 1 0 1 0 1 0 1 1 0 2 1 0 0 1 2 2 1 0 0 1", "output": "34" }, { "input": "100\n3 4 4 4 3 3 3 3 3 4 4 4 3 3 3 4 3 4 4 4 3 4 3 4 3 4 3 3 4 4 3 4 4 3 4 4 4 4 4 3 4 3 3 3 4 3 3 4 3 4 3 4 3 3 4 4 4 3 3 3 3 3 4 4 3 4 4 3 4 3 3 3 4 4 3 3 3 3 3 4 3 4 4 3 3 4 3 4 3 4 4 4 3 3 3 4 4 4 4 3", "output": "20" }, { "input": "100\n8 7 9 10 2 7 8 11 11 4 7 10 2 5 8 9 10 3 9 4 10 5 5 6 3 8 8 9 6 9 5 5 4 11 4 2 11 8 3 5 6 6 11 9 8 11 9 8 3 3 8 9 8 9 4 8 6 11 4 4 4 9 7 5 3 4 11 3 9 11 8 10 3 5 5 7 6 9 4 5 2 11 3 6 2 10 9 4 6 10 5 11 8 10 10 8 9 8 5 3", "output": "9" }, { "input": "5\n4 1 1 1 1", "output": "2" } ]
1,490,438,218
2,147,483,647
Python 3
OK
TESTS
36
62
4,608,000
n=int(input()) a=list(map(int,input().split())) a.sort() dp = [0] for i in a: add = False for j in range(len(dp)): if(dp[j]<=i): dp[j]+=1 add = True break if not add : dp.append(1) print(len(dp))
Title: Fox and Box Accumulation Time Limit: None seconds Memory Limit: None megabytes Problem Description: Fox Ciel has *n* boxes in her room. They have the same size and weight, but they might have different strength. The *i*-th box can hold at most *x**i* boxes on its top (we'll call *x**i* the strength of the box). Since all the boxes have the same size, Ciel cannot put more than one box directly on the top of some box. For example, imagine Ciel has three boxes: the first has strength 2, the second has strength 1 and the third has strength 1. She cannot put the second and the third box simultaneously directly on the top of the first one. But she can put the second box directly on the top of the first one, and then the third box directly on the top of the second one. We will call such a construction of boxes a pile. Fox Ciel wants to construct piles from all the boxes. Each pile will contain some boxes from top to bottom, and there cannot be more than *x**i* boxes on the top of *i*-th box. What is the minimal number of piles she needs to construct? Input Specification: The first line contains an integer *n* (1<=≀<=*n*<=≀<=100). The next line contains *n* integers *x*1,<=*x*2,<=...,<=*x**n* (0<=≀<=*x**i*<=≀<=100). Output Specification: Output a single integer β€” the minimal possible number of piles. Demo Input: ['3\n0 0 10\n', '5\n0 1 2 3 4\n', '4\n0 0 0 0\n', '9\n0 1 0 2 0 1 1 2 10\n'] Demo Output: ['2\n', '1\n', '4\n', '3\n'] Note: In example 1, one optimal way is to build 2 piles: the first pile contains boxes 1 and 3 (from top to bottom), the second pile contains only box 2. In example 2, we can build only 1 pile that contains boxes 1, 2, 3, 4, 5 (from top to bottom).
```python n=int(input()) a=list(map(int,input().split())) a.sort() dp = [0] for i in a: add = False for j in range(len(dp)): if(dp[j]<=i): dp[j]+=1 add = True break if not add : dp.append(1) print(len(dp)) ```
3
577
A
Multiplication Table
PROGRAMMING
1,000
[ "implementation", "number theory" ]
null
null
Let's consider a table consisting of *n* rows and *n* columns. The cell located at the intersection of *i*-th row and *j*-th column contains number *i*<=Γ—<=*j*. The rows and columns are numbered starting from 1. You are given a positive integer *x*. Your task is to count the number of cells in a table that contain number *x*.
The single line contains numbers *n* and *x* (1<=≀<=*n*<=≀<=105, 1<=≀<=*x*<=≀<=109) β€” the size of the table and the number that we are looking for in the table.
Print a single number: the number of times *x* occurs in the table.
[ "10 5\n", "6 12\n", "5 13\n" ]
[ "2\n", "4\n", "0\n" ]
A table for the second sample test is given below. The occurrences of number 12 are marked bold.
500
[ { "input": "10 5", "output": "2" }, { "input": "6 12", "output": "4" }, { "input": "5 13", "output": "0" }, { "input": "1 1", "output": "1" }, { "input": "2 1", "output": "1" }, { "input": "100000 1", "output": "1" }, { "input": "1 1000000000", "output": "0" }, { "input": "100000 1000000000", "output": "16" }, { "input": "100000 362880", "output": "154" }, { "input": "1 4", "output": "0" }, { "input": "9 12", "output": "4" }, { "input": "10 123", "output": "0" }, { "input": "9551 975275379", "output": "0" }, { "input": "17286 948615687", "output": "0" }, { "input": "58942 936593001", "output": "0" }, { "input": "50000 989460910", "output": "4" }, { "input": "22741 989460910", "output": "0" }, { "input": "22740 989460910", "output": "0" }, { "input": "100000 989460910", "output": "4" }, { "input": "100000 98280", "output": "128" }, { "input": "100000 997920", "output": "222" }, { "input": "100000 720720", "output": "226" }, { "input": "100000 2162160", "output": "282" }, { "input": "100000 4324320", "output": "320" }, { "input": "100000 8648640", "output": "348" }, { "input": "100000 183783600", "output": "438" }, { "input": "100000 551350800", "output": "392" }, { "input": "40000 551350800", "output": "150" }, { "input": "20000 400000000", "output": "1" }, { "input": "19999 400000000", "output": "0" }, { "input": "19999 399960001", "output": "1" }, { "input": "31621 999887641", "output": "1" }, { "input": "31622 999887641", "output": "1" }, { "input": "31620 999887641", "output": "0" }, { "input": "100000 999887641", "output": "3" }, { "input": "100000 25", "output": "3" }, { "input": "100000 1", "output": "1" }, { "input": "100000 3628800", "output": "220" }, { "input": "100000 39916800", "output": "328" }, { "input": "100000 479001600", "output": "254" }, { "input": "4 9", "output": "1" }, { "input": "2 6", "output": "0" }, { "input": "20 100", "output": "3" }, { "input": "10 3", "output": "2" }, { "input": "4 4", "output": "3" }, { "input": "2 4", "output": "1" }, { "input": "89874 1", "output": "1" } ]
1,692,807,424
2,147,483,647
Python 3
OK
TESTS
47
46
0
n, x = list(map(int, input().rstrip().split())) ans = 0 factors = [] for i in range(1, n + 1): if x % i == 0: factors.append(i) for i in factors: if x / i in factors: ans += 1 print(ans)
Title: Multiplication Table Time Limit: None seconds Memory Limit: None megabytes Problem Description: Let's consider a table consisting of *n* rows and *n* columns. The cell located at the intersection of *i*-th row and *j*-th column contains number *i*<=Γ—<=*j*. The rows and columns are numbered starting from 1. You are given a positive integer *x*. Your task is to count the number of cells in a table that contain number *x*. Input Specification: The single line contains numbers *n* and *x* (1<=≀<=*n*<=≀<=105, 1<=≀<=*x*<=≀<=109) β€” the size of the table and the number that we are looking for in the table. Output Specification: Print a single number: the number of times *x* occurs in the table. Demo Input: ['10 5\n', '6 12\n', '5 13\n'] Demo Output: ['2\n', '4\n', '0\n'] Note: A table for the second sample test is given below. The occurrences of number 12 are marked bold.
```python n, x = list(map(int, input().rstrip().split())) ans = 0 factors = [] for i in range(1, n + 1): if x % i == 0: factors.append(i) for i in factors: if x / i in factors: ans += 1 print(ans) ```
3
757
A
Gotta Catch Em' All!
PROGRAMMING
1,000
[ "implementation" ]
null
null
Bash wants to become a Pokemon master one day. Although he liked a lot of Pokemon, he has always been fascinated by Bulbasaur the most. Soon, things started getting serious and his fascination turned into an obsession. Since he is too young to go out and catch Bulbasaur, he came up with his own way of catching a Bulbasaur. Each day, he takes the front page of the newspaper. He cuts out the letters one at a time, from anywhere on the front page of the newspaper to form the word "Bulbasaur" (without quotes) and sticks it on his wall. Bash is very particular about caseΒ β€” the first letter of "Bulbasaur" must be upper case and the rest must be lower case. By doing this he thinks he has caught one Bulbasaur. He then repeats this step on the left over part of the newspaper. He keeps doing this until it is not possible to form the word "Bulbasaur" from the newspaper. Given the text on the front page of the newspaper, can you tell how many Bulbasaurs he will catch today? Note: uppercase and lowercase letters are considered different.
Input contains a single line containing a string *s* (1<=<=≀<=<=|*s*|<=<=≀<=<=105)Β β€” the text on the front page of the newspaper without spaces and punctuation marks. |*s*| is the length of the string *s*. The string *s* contains lowercase and uppercase English letters, i.e. .
Output a single integer, the answer to the problem.
[ "Bulbbasaur\n", "F\n", "aBddulbasaurrgndgbualdBdsagaurrgndbb\n" ]
[ "1\n", "0\n", "2\n" ]
In the first case, you could pick: Bulbbasaur. In the second case, there is no way to pick even a single Bulbasaur. In the third case, you can rearrange the string to BulbasaurBulbasauraddrgndgddgargndbb to get two words "Bulbasaur".
500
[ { "input": "Bulbbasaur", "output": "1" }, { "input": "F", "output": "0" }, { "input": "aBddulbasaurrgndgbualdBdsagaurrgndbb", "output": "2" }, { "input": "BBBBBBBBBBbbbbbbbbbbuuuuuuuuuullllllllllssssssssssaaaaaaaaaarrrrrrrrrr", "output": "5" }, { "input": "BBBBBBBBBBbbbbbbbbbbbbbbbbbbbbuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuussssssssssssssssssssaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa", "output": "0" }, { "input": "BBBBBBBBBBssssssssssssssssssssaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaarrrrrrrrrr", "output": "0" }, { "input": "BBBBBBBBBBbbbbbbbbbbbbbbbbbbbbuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuullllllllllllllllllllssssssssssssssssssssaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaarrrrrrrrrrrrrrrrrrrr", "output": "10" }, { "input": "BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBbbbbbbbbbbbbbbbbbbbbuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuuullllllllllllllllllllssssssssssssssssssssaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaarrrrrrrrrrrrrrrrrrrrrrrrrrrrrr", "output": "20" }, { "input": "CeSlSwec", "output": "0" }, { "input": "PnMrWPBGzVcmRcO", "output": "0" }, { "input": "hHPWBQeEmCuhdCnzrqYtuFtwxokGhdGkFtsFICVqYfJeUrSBtSxEbzMCblOgqOvjXURhSKivPcseqgiNuUgIboEYMvVeRBbpzCGCfVydDvZNFGSFidwUtNbmPSfSYdMNmHgchIsiVswzFsGQewlMVEzicOagpWMdCWrCdPmexfnM", "output": "0" }, { "input": "BBBBBBBBBBbbbbbbbbbbbbuuuuuuuuuuuullllllllllllssssssssssssaaaaaaaaaaaarrrrrrrrrrrrZBphUC", "output": "6" }, { "input": "bulsar", "output": "0" }, { "input": "Bblsar", "output": "0" }, { "input": "Bbusar", "output": "0" }, { "input": "Bbular", "output": "0" }, { "input": "Bbulsr", "output": "0" }, { "input": "Bbulsa", "output": "0" }, { "input": "Bbulsar", "output": "0" }, { "input": "Bbulsar", "output": "0" }, { "input": "CaQprCjTiQACZjUJjSmMHVTDorSUugvTtksEjptVzNLhClWaVVWszIixBlqFkvjDmbRjarQoUWhXHoCgYNNjvEgRTgKpbdEMFsmqcTyvJzupKgYiYMtrZWXIAGVhmDURtddbBZIMgIgXqQUmXpssLSaVCDGZDHimNthwiAWabjtcraAQugMCpBPQZbBGZyqUZmzDVSvJZmDWfZEUHGJVtiJANAIbvjTxtvvTbjWRpNQZlxAqpLCLRVwYWqLaHOTvzgeNGdxiBwsAVKKsewXMTwZUUfxYwrwsiaRBwEdvDDoPsQUtinvajBoRzLBUuQekhjsfDAOQzIABSVPitRuhvvqeAahsSELTGbCPh", "output": "2" }, { "input": "Bulbasaur", "output": "1" }, { "input": "BulbasaurBulbasaur", "output": "2" }, { "input": "Bulbbasar", "output": "0" }, { "input": "Bulbasur", "output": "0" }, { "input": "Bulbsaur", "output": "0" }, { "input": "BulbsurBulbsurBulbsurBulbsur", "output": "0" }, { "input": "Blbbasar", "output": "0" }, { "input": "Bulbasar", "output": "0" }, { "input": "BBullllbbaassaauurr", "output": "1" }, { "input": "BulbasaurBulbasar", "output": "1" }, { "input": "BulbasaurBulbsaur", "output": "1" }, { "input": "Bubasaur", "output": "0" }, { "input": "ulbasaurulbasaur", "output": "0" }, { "input": "Bulbasr", "output": "0" }, { "input": "BBBuuulllbbbaaasssaaauuurrr", "output": "3" }, { "input": "BBuuuullbbaaaassrr", "output": "2" }, { "input": "BBBBBBBuuuuuuuullllllllllllbbbbaaaaaassssssssssssssssaaaaauuuuuuuuuuuuurrrrrrrrrrrrrrrr", "output": "4" }, { "input": "BBuullbbaassaarr", "output": "1" }, { "input": "Bulbasau", "output": "0" }, { "input": "BBuullbbaassaauurr", "output": "2" }, { "input": "BulbasauBulbasauBulbasauBulbasauBulbasauBulbasauBulbasauBulbasau", "output": "0" }, { "input": "Blbasaur", "output": "0" }, { "input": "BulbasaurBulbasaurd", "output": "2" }, { "input": "ulbasaur", "output": "0" }, { "input": "Bulbaaur", "output": "0" }, { "input": "BBuuuullbbbbbbbbbbbbbbbaassrr", "output": "1" }, { "input": "Bulbasua", "output": "0" }, { "input": "Bubbasaur", "output": "0" }, { "input": "BulbasauBulbasauBulbasauBulbasauBulbasauBulbasaurrr", "output": "3" }, { "input": "BulbasaurBubasaur", "output": "1" }, { "input": "Baab", "output": "0" }, { "input": "BulbasaurBulbasau", "output": "1" }, { "input": "Bulbasauu", "output": "0" }, { "input": "BulbasauBulbasau", "output": "0" }, { "input": "BBBBBBBBBBB", "output": "0" }, { "input": "Bulbbasau", "output": "0" }, { "input": "BulbbasaurBulbbasar", "output": "1" }, { "input": "Bulaaaasaur", "output": "0" }, { "input": "BulbasaurBulbasauBulbasauBulbasau", "output": "1" } ]
1,493,549,259
2,147,483,647
Python 3
OK
TESTS
107
93
5,734,400
s = input() t = [0, 0, 0, 0, 0, 0, 0] for i in s: if i == 'B': t[0] += 1 elif i == 'a': t[1] += 1 elif i == 'b': t[2] += 1 elif i == 'l': t[3] += 1 elif i == 'r': t[4] += 1 elif i == 's': t[5] += 1 elif i == 'u': t[6] += 1 t[1] = t[1] // 2 t[6] = t[6] // 2 print(min(t))
Title: Gotta Catch Em' All! Time Limit: None seconds Memory Limit: None megabytes Problem Description: Bash wants to become a Pokemon master one day. Although he liked a lot of Pokemon, he has always been fascinated by Bulbasaur the most. Soon, things started getting serious and his fascination turned into an obsession. Since he is too young to go out and catch Bulbasaur, he came up with his own way of catching a Bulbasaur. Each day, he takes the front page of the newspaper. He cuts out the letters one at a time, from anywhere on the front page of the newspaper to form the word "Bulbasaur" (without quotes) and sticks it on his wall. Bash is very particular about caseΒ β€” the first letter of "Bulbasaur" must be upper case and the rest must be lower case. By doing this he thinks he has caught one Bulbasaur. He then repeats this step on the left over part of the newspaper. He keeps doing this until it is not possible to form the word "Bulbasaur" from the newspaper. Given the text on the front page of the newspaper, can you tell how many Bulbasaurs he will catch today? Note: uppercase and lowercase letters are considered different. Input Specification: Input contains a single line containing a string *s* (1<=<=≀<=<=|*s*|<=<=≀<=<=105)Β β€” the text on the front page of the newspaper without spaces and punctuation marks. |*s*| is the length of the string *s*. The string *s* contains lowercase and uppercase English letters, i.e. . Output Specification: Output a single integer, the answer to the problem. Demo Input: ['Bulbbasaur\n', 'F\n', 'aBddulbasaurrgndgbualdBdsagaurrgndbb\n'] Demo Output: ['1\n', '0\n', '2\n'] Note: In the first case, you could pick: Bulbbasaur. In the second case, there is no way to pick even a single Bulbasaur. In the third case, you can rearrange the string to BulbasaurBulbasauraddrgndgddgargndbb to get two words "Bulbasaur".
```python s = input() t = [0, 0, 0, 0, 0, 0, 0] for i in s: if i == 'B': t[0] += 1 elif i == 'a': t[1] += 1 elif i == 'b': t[2] += 1 elif i == 'l': t[3] += 1 elif i == 'r': t[4] += 1 elif i == 's': t[5] += 1 elif i == 'u': t[6] += 1 t[1] = t[1] // 2 t[6] = t[6] // 2 print(min(t)) ```
3
43
A
Football
PROGRAMMING
1,000
[ "strings" ]
A. Football
2
256
One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie.
The first line contains an integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of lines in the description. Then follow *n* lines β€” for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams.
Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner.
[ "1\nABC\n", "5\nA\nABA\nABA\nA\nA\n" ]
[ "ABC\n", "A\n" ]
none
500
[ { "input": "1\nABC", "output": "ABC" }, { "input": "5\nA\nABA\nABA\nA\nA", "output": "A" }, { "input": "2\nXTSJEP\nXTSJEP", "output": "XTSJEP" }, { "input": "3\nXZYDJAEDZ\nXZYDJAEDZ\nXZYDJAEDZ", "output": "XZYDJAEDZ" }, { "input": "3\nQCCYXL\nQCCYXL\nAXGLFQDD", "output": "QCCYXL" }, { "input": "3\nAZID\nEERWBC\nEERWBC", "output": "EERWBC" }, { "input": "3\nHNCGYL\nHNCGYL\nHNCGYL", "output": "HNCGYL" }, { "input": "4\nZZWZTG\nZZWZTG\nZZWZTG\nZZWZTG", "output": "ZZWZTG" }, { "input": "4\nA\nA\nKUDLJMXCSE\nA", "output": "A" }, { "input": "5\nPHBTW\nPHBTW\nPHBTW\nPHBTW\nPHBTW", "output": "PHBTW" }, { "input": "5\nPKUZYTFYWN\nPKUZYTFYWN\nSTC\nPKUZYTFYWN\nPKUZYTFYWN", "output": "PKUZYTFYWN" }, { "input": "5\nHH\nHH\nNTQWPA\nNTQWPA\nHH", "output": "HH" }, { "input": "10\nW\nW\nW\nW\nW\nD\nW\nD\nD\nW", "output": "W" }, { "input": "19\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nXBCP\nXBCP\nXBCP\nTGACNIH\nXBCP\nXBCP\nTGACNIH\nTGACNIH\nXBCP", "output": "XBCP" }, { "input": "33\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nOWQWCKLLF\nOWQWCKLLF\nPYPAS\nPYPAS\nOWQWCKLLF\nPYPAS\nPYPAS", "output": "PYPAS" }, { "input": "51\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC\nNC", "output": "NC" }, { "input": "89\nH\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nVOCI\nVOCI\nH\nH\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nVOCI\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI\nH\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nVOCI\nH\nH\nH\nH\nH\nVOCI\nH\nVOCI\nH\nVOCI\nVOCI", "output": "VOCI" }, { "input": "100\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nM\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA\nHA", "output": "HA" }, { "input": "100\nG\nG\nS\nS\nG\nG\nS\nS\nG\nS\nS\nS\nG\nS\nG\nG\nS\nG\nS\nS\nG\nS\nS\nS\nS\nS\nG\nS\nG\nS\nS\nG\nG\nG\nS\nS\nS\nS\nG\nS\nS\nG\nG\nG\nG\nG\nS\nG\nG\nS\nS\nS\nS\nS\nG\nG\nS\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nS\nS\nG\nS\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nG\nS\nS\nG\nS\nS\nS\nS\nG\nG\nG\nS\nG\nG\nG\nS", "output": "G" }, { "input": "100\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nOBH\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL\nWL", "output": "WL" } ]
1,621,011,647
2,147,483,647
PyPy 3
OK
TESTS
34
218
20,172,800
n=int(input()) goal_list=[] for _ in range(n): goal_list.append(input()) freq={} for team_goal in goal_list: freq[team_goal]= goal_list.count(team_goal) #print(freq) max_key=max(freq,key=freq.get) print(max_key)
Title: Football Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: One day Vasya decided to have a look at the results of Berland 1910 Football Championship’s finals. Unfortunately he didn't find the overall score of the match; however, he got hold of a profound description of the match's process. On the whole there are *n* lines in that description each of which described one goal. Every goal was marked with the name of the team that had scored it. Help Vasya, learn the name of the team that won the finals. It is guaranteed that the match did not end in a tie. Input Specification: The first line contains an integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of lines in the description. Then follow *n* lines β€” for each goal the names of the teams that scored it. The names are non-empty lines consisting of uppercase Latin letters whose lengths do not exceed 10 symbols. It is guaranteed that the match did not end in a tie and the description contains no more than two different teams. Output Specification: Print the name of the winning team. We remind you that in football the team that scores more goals is considered the winner. Demo Input: ['1\nABC\n', '5\nA\nABA\nABA\nA\nA\n'] Demo Output: ['ABC\n', 'A\n'] Note: none
```python n=int(input()) goal_list=[] for _ in range(n): goal_list.append(input()) freq={} for team_goal in goal_list: freq[team_goal]= goal_list.count(team_goal) #print(freq) max_key=max(freq,key=freq.get) print(max_key) ```
3.907925
2
A
Winner
PROGRAMMING
1,500
[ "hashing", "implementation" ]
A. Winner
1
64
The winner of the card game popular in Berland "Berlogging" is determined according to the following rules. If at the end of the game there is only one player with the maximum number of points, he is the winner. The situation becomes more difficult if the number of such players is more than one. During each round a player gains or loses a particular number of points. In the course of the game the number of points is registered in the line "name score", where name is a player's name, and score is the number of points gained in this round, which is an integer number. If score is negative, this means that the player has lost in the round. So, if two or more players have the maximum number of points (say, it equals to *m*) at the end of the game, than wins the one of them who scored at least *m* points first. Initially each player has 0 points. It's guaranteed that at the end of the game at least one player has a positive number of points.
The first line contains an integer number *n* (1<=<=≀<=<=*n*<=<=≀<=<=1000), *n* is the number of rounds played. Then follow *n* lines, containing the information about the rounds in "name score" format in chronological order, where name is a string of lower-case Latin letters with the length from 1 to 32, and score is an integer number between -1000 and 1000, inclusive.
Print the name of the winner.
[ "3\nmike 3\nandrew 5\nmike 2\n", "3\nandrew 3\nandrew 2\nmike 5\n" ]
[ "andrew\n", "andrew\n" ]
none
0
[ { "input": "3\nmike 3\nandrew 5\nmike 2", "output": "andrew" }, { "input": "3\nandrew 3\nandrew 2\nmike 5", "output": "andrew" }, { "input": "5\nkaxqybeultn -352\nmgochgrmeyieyskhuourfg -910\nkaxqybeultn 691\nmgochgrmeyieyskhuourfg -76\nkaxqybeultn -303", "output": "kaxqybeultn" }, { "input": "7\nksjuuerbnlklcfdjeyq 312\ndthjlkrvvbyahttifpdewvyslsh -983\nksjuuerbnlklcfdjeyq 268\ndthjlkrvvbyahttifpdewvyslsh 788\nksjuuerbnlklcfdjeyq -79\nksjuuerbnlklcfdjeyq -593\nksjuuerbnlklcfdjeyq 734", "output": "ksjuuerbnlklcfdjeyq" }, { "input": "12\natrtthfpcvishmqbakprquvnejr 185\natrtthfpcvishmqbakprquvnejr -699\natrtthfpcvishmqbakprquvnejr -911\natrtthfpcvishmqbakprquvnejr -220\nfcgslzkicjrpbqaifgweyzreajjfdo 132\nfcgslzkicjrpbqaifgweyzreajjfdo -242\nm 177\nm -549\natrtthfpcvishmqbakprquvnejr -242\nm 38\natrtthfpcvishmqbakprquvnejr -761\nfcgslzkicjrpbqaifgweyzreajjfdo 879", "output": "fcgslzkicjrpbqaifgweyzreajjfdo" }, { "input": "15\naawtvezfntstrcpgbzjbf 681\nzhahpvqiptvksnbjkdvmknb -74\naawtvezfntstrcpgbzjbf 661\njpdwmyke 474\naawtvezfntstrcpgbzjbf -547\naawtvezfntstrcpgbzjbf 600\nzhahpvqiptvksnbjkdvmknb -11\njpdwmyke 711\nbjmj 652\naawtvezfntstrcpgbzjbf -1000\naawtvezfntstrcpgbzjbf -171\nbjmj -302\naawtvezfntstrcpgbzjbf 961\nzhahpvqiptvksnbjkdvmknb 848\nbjmj -735", "output": "aawtvezfntstrcpgbzjbf" }, { "input": "17\nqdplghhx -649\nivhgbxiv 424\nivhgbxiv -72\nivhgbxiv 479\nugowfouebkelargxylsxn 83\nugowfouebkelargxylsxn -840\nivhgbxiv 382\nqdplghhx -904\nivhgbxiv -710\nugowfouebkelargxylsxn -838\nqdplghhx -974\nqdplghhx 571\nivhgbxiv -145\nugowfouebkelargxylsxn -788\nivhgbxiv 209\nivhgbxiv 420\nqdplghhx -158", "output": "ivhgbxiv" } ]
1,390,469,487
2,147,483,647
Python 3
OK
TESTS
20
124
409,600
s = input() count = int(s) game = [] ppl1 = {} ppl2 = {} w = "" for i in range(count): s = input() game.append(s) l = game[i].split(" ") if l[0] in ppl1 : ppl1[l[0]] += int(l[1]) else: ppl1[l[0]] = int(l[1]) m = -1001 for k in ppl1: if ppl1[k] > m: m = ppl1[k] for i in range(count): l = game[i].split(" ") if l[0] in ppl2 : ppl2[l[0]] += int(l[1]) else: ppl2[l[0]] = int(l[1]) if ppl2[l[0]] >= m and ppl1[l[0]] == m: print(l[0]) break
Title: Winner Time Limit: 1 seconds Memory Limit: 64 megabytes Problem Description: The winner of the card game popular in Berland "Berlogging" is determined according to the following rules. If at the end of the game there is only one player with the maximum number of points, he is the winner. The situation becomes more difficult if the number of such players is more than one. During each round a player gains or loses a particular number of points. In the course of the game the number of points is registered in the line "name score", where name is a player's name, and score is the number of points gained in this round, which is an integer number. If score is negative, this means that the player has lost in the round. So, if two or more players have the maximum number of points (say, it equals to *m*) at the end of the game, than wins the one of them who scored at least *m* points first. Initially each player has 0 points. It's guaranteed that at the end of the game at least one player has a positive number of points. Input Specification: The first line contains an integer number *n* (1<=<=≀<=<=*n*<=<=≀<=<=1000), *n* is the number of rounds played. Then follow *n* lines, containing the information about the rounds in "name score" format in chronological order, where name is a string of lower-case Latin letters with the length from 1 to 32, and score is an integer number between -1000 and 1000, inclusive. Output Specification: Print the name of the winner. Demo Input: ['3\nmike 3\nandrew 5\nmike 2\n', '3\nandrew 3\nandrew 2\nmike 5\n'] Demo Output: ['andrew\n', 'andrew\n'] Note: none
```python s = input() count = int(s) game = [] ppl1 = {} ppl2 = {} w = "" for i in range(count): s = input() game.append(s) l = game[i].split(" ") if l[0] in ppl1 : ppl1[l[0]] += int(l[1]) else: ppl1[l[0]] = int(l[1]) m = -1001 for k in ppl1: if ppl1[k] > m: m = ppl1[k] for i in range(count): l = game[i].split(" ") if l[0] in ppl2 : ppl2[l[0]] += int(l[1]) else: ppl2[l[0]] = int(l[1]) if ppl2[l[0]] >= m and ppl1[l[0]] == m: print(l[0]) break ```
3.934948
490
A
Team Olympiad
PROGRAMMING
800
[ "greedy", "implementation", "sortings" ]
null
null
The School β„–0 of the capital of Berland has *n* children studying in it. All the children in this school are gifted: some of them are good at programming, some are good at maths, others are good at PE (Physical Education). Hence, for each child we know value *t**i*: - *t**i*<==<=1, if the *i*-th child is good at programming, - *t**i*<==<=2, if the *i*-th child is good at maths, - *t**i*<==<=3, if the *i*-th child is good at PE Each child happens to be good at exactly one of these three subjects. The Team Scientific Decathlon Olympias requires teams of three students. The school teachers decided that the teams will be composed of three children that are good at different subjects. That is, each team must have one mathematician, one programmer and one sportsman. Of course, each child can be a member of no more than one team. What is the maximum number of teams that the school will be able to present at the Olympiad? How should the teams be formed for that?
The first line contains integer *n* (1<=≀<=*n*<=≀<=5000) β€” the number of children in the school. The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≀<=*t**i*<=≀<=3), where *t**i* describes the skill of the *i*-th child.
In the first line output integer *w* β€” the largest possible number of teams. Then print *w* lines, containing three numbers in each line. Each triple represents the indexes of the children forming the team. You can print both the teams, and the numbers in the triplets in any order. The children are numbered from 1 to *n* in the order of their appearance in the input. Each child must participate in no more than one team. If there are several solutions, print any of them. If no teams can be compiled, print the only line with value *w* equal to 0.
[ "7\n1 3 1 3 2 1 2\n", "4\n2 1 1 2\n" ]
[ "2\n3 5 2\n6 7 4\n", "0\n" ]
none
500
[ { "input": "7\n1 3 1 3 2 1 2", "output": "2\n3 5 2\n6 7 4" }, { "input": "4\n2 1 1 2", "output": "0" }, { "input": "1\n2", "output": "0" }, { "input": "2\n3 1", "output": "0" }, { "input": "3\n2 1 2", "output": "0" }, { "input": "3\n1 2 3", "output": "1\n1 2 3" }, { "input": "12\n3 3 3 3 3 3 3 3 1 3 3 2", "output": "1\n9 12 2" }, { "input": "60\n3 3 1 2 2 1 3 1 1 1 3 2 2 2 3 3 1 3 2 3 2 2 1 3 3 2 3 1 2 2 2 1 3 2 1 1 3 3 1 1 1 3 1 2 1 1 3 3 3 2 3 2 3 2 2 2 1 1 1 2", "output": "20\n6 60 1\n17 44 20\n3 5 33\n36 21 42\n59 14 2\n58 26 49\n9 29 48\n23 19 24\n10 30 37\n41 54 15\n45 31 27\n57 55 38\n39 12 25\n35 34 11\n32 52 7\n8 50 18\n43 4 53\n46 56 51\n40 22 16\n28 13 47" }, { "input": "12\n3 1 1 1 1 1 1 2 1 1 1 1", "output": "1\n3 8 1" }, { "input": "22\n2 2 2 2 2 2 2 2 2 2 3 2 2 2 2 2 2 1 2 2 2 2", "output": "1\n18 2 11" }, { "input": "138\n2 3 2 2 2 2 2 2 2 2 1 2 1 2 2 2 1 2 1 2 2 1 2 2 2 2 2 2 2 2 2 2 2 1 2 3 2 2 2 1 2 3 2 2 2 3 1 3 2 3 2 3 2 2 2 2 3 2 2 2 2 2 1 2 2 3 2 2 3 2 1 2 2 2 2 2 3 1 2 2 2 2 2 3 2 2 3 2 2 2 2 2 1 1 2 3 2 2 2 2 3 2 2 2 2 2 1 2 1 2 2 2 2 2 1 2 3 2 3 2 2 2 1 2 2 2 1 2 2 2 2 1 2 2 2 2 1 3", "output": "18\n13 91 84\n34 90 48\n11 39 77\n78 129 50\n137 68 119\n132 122 138\n19 12 96\n40 7 2\n22 88 69\n107 73 46\n115 15 52\n127 106 87\n93 92 66\n71 112 117\n63 124 42\n17 70 101\n109 121 57\n123 25 36" }, { "input": "203\n2 2 1 2 1 2 2 2 1 2 2 1 1 3 1 2 1 2 1 1 2 3 1 1 2 3 3 2 2 2 1 2 1 1 1 1 1 3 1 1 2 1 1 2 2 2 1 2 2 2 1 2 3 2 1 1 2 2 1 2 1 2 2 1 1 2 2 2 1 1 2 2 1 2 1 2 2 3 2 1 2 1 1 1 1 1 1 1 1 1 1 2 2 1 1 2 2 2 2 1 1 1 1 1 1 1 2 2 2 2 2 1 1 1 2 2 2 1 2 2 1 3 2 1 1 1 2 1 1 2 1 1 2 2 2 1 1 2 2 2 1 2 1 3 2 1 2 2 2 1 1 1 2 2 2 1 2 1 1 2 2 2 2 2 1 1 2 1 2 2 1 1 1 1 1 1 2 2 3 1 1 2 3 1 1 1 1 1 1 2 2 1 1 1 2 2 3 2 1 3 1 1 1", "output": "13\n188 72 14\n137 4 197\n158 76 122\n152 142 26\n104 119 179\n40 63 38\n12 1 78\n17 30 27\n189 60 53\n166 190 144\n129 7 183\n83 41 22\n121 81 200" }, { "input": "220\n1 1 3 1 3 1 1 3 1 3 3 3 3 1 3 3 1 3 3 3 3 3 1 1 1 3 1 1 1 3 2 3 3 3 1 1 3 3 1 1 3 3 3 3 1 3 3 1 1 1 2 3 1 1 1 2 3 3 3 2 3 1 1 3 1 1 1 3 2 1 3 2 3 1 1 3 3 3 1 3 1 1 1 3 3 2 1 3 2 1 1 3 3 1 1 1 2 1 1 3 2 1 2 1 1 1 3 1 3 3 1 2 3 3 3 3 1 3 1 1 1 1 2 3 1 1 1 1 1 1 3 2 3 1 3 1 3 1 1 3 1 3 1 3 1 3 1 3 3 2 3 1 3 3 1 3 3 3 3 1 1 3 3 3 3 1 1 3 3 3 2 1 1 1 3 3 1 3 3 3 1 1 1 3 1 3 3 1 1 1 2 3 1 1 3 1 1 1 1 2 3 1 1 2 3 3 1 3 1 3 3 3 3 1 3 2 3 1 1 3", "output": "20\n198 89 20\n141 56 131\n166 204 19\n160 132 142\n111 112 195\n45 216 92\n6 31 109\n14 150 170\n199 60 18\n173 123 140\n134 69 156\n82 191 85\n126 200 80\n24 97 46\n62 86 149\n214 101 26\n79 171 78\n125 72 118\n172 103 162\n219 51 64" }, { "input": "61\n2 3 1 3 2 2 2 3 1 3 2 3 1 2 1 1 2 2 2 2 3 2 3 1 2 1 3 1 3 2 1 1 3 2 1 3 3 3 1 3 3 1 1 3 1 3 2 2 1 2 2 2 1 3 2 3 1 3 3 1 1", "output": "20\n9 55 2\n24 34 27\n3 5 37\n35 17 41\n61 11 4\n60 19 54\n15 20 59\n26 14 29\n16 22 38\n43 50 12\n49 25 36\n57 51 40\n39 6 33\n32 30 10\n31 48 8\n13 47 23\n45 1 58\n53 52 56\n42 18 21\n28 7 44" }, { "input": "5\n1 2 2 3 3", "output": "1\n1 3 4" } ]
1,659,016,893
2,147,483,647
PyPy 3-64
OK
TESTS
41
342
19,558,400
from collections import defaultdict from email.policy import default def main(): input() students = list(map(int, input().split())) hashed_students = defaultdict(list) # O(n) for k,v in enumerate(students): hashed_students[v].append(k+1) # O(1) if len(hashed_students) != 3: print(0) return # 3 Operations --> O(1) teams_count = len(hashed_students[min(hashed_students, key=lambda item: len(hashed_students[item]))]) teams = [] for i in range(teams_count): team = [] for j in hashed_students.values(): team.append(j.pop(0)) teams.append(team) print(teams_count) for team in teams: print(*team) main()
Title: Team Olympiad Time Limit: None seconds Memory Limit: None megabytes Problem Description: The School β„–0 of the capital of Berland has *n* children studying in it. All the children in this school are gifted: some of them are good at programming, some are good at maths, others are good at PE (Physical Education). Hence, for each child we know value *t**i*: - *t**i*<==<=1, if the *i*-th child is good at programming, - *t**i*<==<=2, if the *i*-th child is good at maths, - *t**i*<==<=3, if the *i*-th child is good at PE Each child happens to be good at exactly one of these three subjects. The Team Scientific Decathlon Olympias requires teams of three students. The school teachers decided that the teams will be composed of three children that are good at different subjects. That is, each team must have one mathematician, one programmer and one sportsman. Of course, each child can be a member of no more than one team. What is the maximum number of teams that the school will be able to present at the Olympiad? How should the teams be formed for that? Input Specification: The first line contains integer *n* (1<=≀<=*n*<=≀<=5000) β€” the number of children in the school. The second line contains *n* integers *t*1,<=*t*2,<=...,<=*t**n* (1<=≀<=*t**i*<=≀<=3), where *t**i* describes the skill of the *i*-th child. Output Specification: In the first line output integer *w* β€” the largest possible number of teams. Then print *w* lines, containing three numbers in each line. Each triple represents the indexes of the children forming the team. You can print both the teams, and the numbers in the triplets in any order. The children are numbered from 1 to *n* in the order of their appearance in the input. Each child must participate in no more than one team. If there are several solutions, print any of them. If no teams can be compiled, print the only line with value *w* equal to 0. Demo Input: ['7\n1 3 1 3 2 1 2\n', '4\n2 1 1 2\n'] Demo Output: ['2\n3 5 2\n6 7 4\n', '0\n'] Note: none
```python from collections import defaultdict from email.policy import default def main(): input() students = list(map(int, input().split())) hashed_students = defaultdict(list) # O(n) for k,v in enumerate(students): hashed_students[v].append(k+1) # O(1) if len(hashed_students) != 3: print(0) return # 3 Operations --> O(1) teams_count = len(hashed_students[min(hashed_students, key=lambda item: len(hashed_students[item]))]) teams = [] for i in range(teams_count): team = [] for j in hashed_students.values(): team.append(j.pop(0)) teams.append(team) print(teams_count) for team in teams: print(*team) main() ```
3
859
A
Declined Finalists
PROGRAMMING
800
[ "greedy", "implementation" ]
null
null
This year, as in previous years, MemSQL is inviting the top 25 competitors from the Start[c]up qualification round to compete onsite for the final round. Not everyone who is eligible to compete onsite can afford to travel to the office, though. Initially the top 25 contestants are invited to come onsite. Each eligible contestant must either accept or decline the invitation. Whenever a contestant declines, the highest ranked contestant not yet invited is invited to take the place of the one that declined. This continues until 25 contestants have accepted invitations. After the qualifying round completes, you know *K* of the onsite finalists, as well as their qualifying ranks (which start at 1, there are no ties). Determine the minimum possible number of contestants that declined the invitation to compete onsite in the final round.
The first line of input contains *K* (1<=≀<=*K*<=≀<=25), the number of onsite finalists you know. The second line of input contains *r*1,<=*r*2,<=...,<=*r**K* (1<=≀<=*r**i*<=≀<=106), the qualifying ranks of the finalists you know. All these ranks are distinct.
Print the minimum possible number of contestants that declined the invitation to compete onsite.
[ "25\n2 3 4 5 6 7 8 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 28\n", "5\n16 23 8 15 4\n", "3\n14 15 92\n" ]
[ "3\n", "0\n", "67\n" ]
In the first example, you know all 25 onsite finalists. The contestants who ranked 1-st, 13-th, and 27-th must have declined, so the answer is 3.
500
[ { "input": "25\n2 3 4 5 6 7 8 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 28", "output": "3" }, { "input": "5\n16 23 8 15 4", "output": "0" }, { "input": "3\n14 15 92", "output": "67" }, { "input": "1\n1000000", "output": "999975" }, { "input": "25\n1000000 999999 999998 999997 999996 999995 999994 999993 999992 999991 999990 999989 999988 999987 999986 999985 999984 999983 999982 999981 999980 999979 999978 999977 999976", "output": "999975" }, { "input": "25\n13 15 24 2 21 18 9 4 16 6 10 25 20 11 23 17 8 3 1 12 5 19 22 14 7", "output": "0" }, { "input": "10\n17 11 7 13 18 12 14 5 16 2", "output": "0" }, { "input": "22\n22 14 23 20 11 21 4 12 3 8 7 9 19 10 13 17 15 1 5 18 16 2", "output": "0" }, { "input": "21\n6 21 24 3 10 23 14 2 26 12 8 1 15 13 9 5 19 20 4 16 22", "output": "1" }, { "input": "1\n1", "output": "0" }, { "input": "2\n100 60", "output": "75" }, { "input": "4\n999 581 787 236", "output": "974" }, { "input": "6\n198 397 732 1234 309 827", "output": "1209" }, { "input": "11\n6494 3961 1858 4351 8056 780 7720 6211 1961 8192 3621", "output": "8167" }, { "input": "14\n18809 9534 11652 6493 8929 9370 4125 23888 16403 3559 23649 19243 14289 17852", "output": "23863" }, { "input": "18\n24939 35558 47058 70307 26221 12866 3453 40422 47557 36322 40698 64060 10825 77777 48645 26124 4859 64222", "output": "77752" }, { "input": "24\n633483 654321 122445 481150 347578 37803 525083 151084 211073 358699 339420 452023 219553 119727 74852 66750 371279 405099 618894 649977 235337 607819 81649 649804", "output": "654296" }, { "input": "25\n58115 794098 753382 484882 238434 674285 690118 858677 196185 173301 349729 918792 600745 636016 122678 366783 137179 377098 917081 369620 449039 379412 503678 1000000 292099", "output": "999975" }, { "input": "2\n26 27", "output": "2" }, { "input": "3\n40 30 35", "output": "15" }, { "input": "2\n46 45", "output": "21" }, { "input": "3\n1 25 90", "output": "65" }, { "input": "5\n14 15 16 30 92", "output": "67" }, { "input": "2\n1000 1001", "output": "976" }, { "input": "25\n3 4 5 6 7 8 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 28 2", "output": "3" } ]
1,691,431,710
2,147,483,647
Python 3
OK
TESTS
25
46
0
from sys import stdin n = stdin.readline() m = max(list(map(int,stdin.readline().split()))) if m > 25:print(m-25) else:print(0)
Title: Declined Finalists Time Limit: None seconds Memory Limit: None megabytes Problem Description: This year, as in previous years, MemSQL is inviting the top 25 competitors from the Start[c]up qualification round to compete onsite for the final round. Not everyone who is eligible to compete onsite can afford to travel to the office, though. Initially the top 25 contestants are invited to come onsite. Each eligible contestant must either accept or decline the invitation. Whenever a contestant declines, the highest ranked contestant not yet invited is invited to take the place of the one that declined. This continues until 25 contestants have accepted invitations. After the qualifying round completes, you know *K* of the onsite finalists, as well as their qualifying ranks (which start at 1, there are no ties). Determine the minimum possible number of contestants that declined the invitation to compete onsite in the final round. Input Specification: The first line of input contains *K* (1<=≀<=*K*<=≀<=25), the number of onsite finalists you know. The second line of input contains *r*1,<=*r*2,<=...,<=*r**K* (1<=≀<=*r**i*<=≀<=106), the qualifying ranks of the finalists you know. All these ranks are distinct. Output Specification: Print the minimum possible number of contestants that declined the invitation to compete onsite. Demo Input: ['25\n2 3 4 5 6 7 8 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 28\n', '5\n16 23 8 15 4\n', '3\n14 15 92\n'] Demo Output: ['3\n', '0\n', '67\n'] Note: In the first example, you know all 25 onsite finalists. The contestants who ranked 1-st, 13-th, and 27-th must have declined, so the answer is 3.
```python from sys import stdin n = stdin.readline() m = max(list(map(int,stdin.readline().split()))) if m > 25:print(m-25) else:print(0) ```
3
44
A
Indian Summer
PROGRAMMING
900
[ "implementation" ]
A. Indian Summer
2
256
Indian summer is such a beautiful time of the year! A girl named Alyona is walking in the forest and picking a bouquet from fallen leaves. Alyona is very choosy β€” she doesn't take a leaf if it matches the color and the species of the tree of one of the leaves she already has. Find out how many leaves Alyona has picked.
The first line contains an integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of leaves Alyona has found. The next *n* lines contain the leaves' descriptions. Each leaf is characterized by the species of the tree it has fallen from and by the color. The species of the trees and colors are given in names, consisting of no more than 10 lowercase Latin letters. A name can not be an empty string. The species of a tree and the color are given in each line separated by a space.
Output the single number β€” the number of Alyona's leaves.
[ "5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green\n", "3\noak yellow\noak yellow\noak yellow\n" ]
[ "4\n", "1\n" ]
none
0
[ { "input": "5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green", "output": "4" }, { "input": "3\noak yellow\noak yellow\noak yellow", "output": "1" }, { "input": "5\nxbnbkzn hp\nkaqkl vrgzbvqstu\nj aqidx\nhos gyul\nwefxmh tygpluae", "output": "5" }, { "input": "1\nqvwli hz", "output": "1" }, { "input": "4\nsrhk x\nsrhk x\nqfoe vnrjuab\nqfoe vnrjuab", "output": "2" }, { "input": "4\nsddqllmmpk syded\nfprsq fnenjnaz\nn hdej\nsddqllmmpk syded", "output": "3" }, { "input": "17\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw", "output": "1" }, { "input": "18\nb d\nrfdb esp\nrfdb esp\nb d\nrfdb esp\nrfdb esp\nb d\nb d\nrfdb esp\nrfdb esp\nb d\nrfdb esp\nb d\nrfdb esp\nb d\nb d\nrfdb esp\nrfdb esp", "output": "2" }, { "input": "13\nsvpzwtwn rykzfdce\nqweiyeck jkreouy\nhk nnli\ntwxrnbbdt vtuv\nxokqjtylly sz\nesdt dbfidjslq\ng ybqgomvw\nxcpfjmf zcqvz\nifajadhj invzueip\nvdemdnxifb hckwebmi\nsdpnhipam wvowzavh\nuqdlfskhgo vunbpghae\ne dtigwnb", "output": "13" }, { "input": "20\nm vkfh\nvptikamead mvx\nitu mf\nklruxckw aqega\nekqkd enjllwol\ncc uybfdh\nimrfdngvo u\ne uh\ntwt jsslcfuogk\nbljwqsag tuqbdn\nqcv q\nasx gzhvwwmajj\nqcv q\nekqkd enjllwol\nasx gzhvwwmajj\nks vv\nkzyfi cn\ncc uybfdh\nitu mf\ncjbjhtbyvk vatwfmux", "output": "15" }, { "input": "2\nab ab\na bab", "output": "2" } ]
1,687,430,013
2,147,483,647
Python 3
OK
TESTS
29
92
0
# LUOGU_RID: 113129863 d=[] n=int(input()) for i in range(n): a=input() if a not in d: d.append(a) print(len(d))
Title: Indian Summer Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Indian summer is such a beautiful time of the year! A girl named Alyona is walking in the forest and picking a bouquet from fallen leaves. Alyona is very choosy β€” she doesn't take a leaf if it matches the color and the species of the tree of one of the leaves she already has. Find out how many leaves Alyona has picked. Input Specification: The first line contains an integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of leaves Alyona has found. The next *n* lines contain the leaves' descriptions. Each leaf is characterized by the species of the tree it has fallen from and by the color. The species of the trees and colors are given in names, consisting of no more than 10 lowercase Latin letters. A name can not be an empty string. The species of a tree and the color are given in each line separated by a space. Output Specification: Output the single number β€” the number of Alyona's leaves. Demo Input: ['5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green\n', '3\noak yellow\noak yellow\noak yellow\n'] Demo Output: ['4\n', '1\n'] Note: none
```python # LUOGU_RID: 113129863 d=[] n=int(input()) for i in range(n): a=input() if a not in d: d.append(a) print(len(d)) ```
3.977
989
A
A Blend of Springtime
PROGRAMMING
900
[ "implementation", "strings" ]
null
null
"What a pity it's already late spring," sighs Mino with regret, "one more drizzling night and they'd be gone." "But these blends are at their best, aren't they?" Absorbed in the landscape, Kanno remains optimistic. The landscape can be expressed as a row of consecutive cells, each of which either contains a flower of colour amber or buff or canary yellow, or is empty. When a flower withers, it disappears from the cell that it originally belonged to, and it spreads petals of its colour in its two neighbouring cells (or outside the field if the cell is on the side of the landscape). In case petals fall outside the given cells, they simply become invisible. You are to help Kanno determine whether it's possible that after some (possibly none or all) flowers shed their petals, at least one of the cells contains all three colours, considering both petals and flowers. Note that flowers can wither in arbitrary order.
The first and only line of input contains a non-empty string $s$ consisting of uppercase English letters 'A', 'B', 'C' and characters '.' (dots) only ($\lvert s \rvert \leq 100$)Β β€” denoting cells containing an amber flower, a buff one, a canary yellow one, and no flowers, respectively.
Output "Yes" if it's possible that all three colours appear in some cell, and "No" otherwise. You can print each letter in any case (upper or lower).
[ ".BAC.\n", "AA..CB\n" ]
[ "Yes\n", "No\n" ]
In the first example, the buff and canary yellow flowers can leave their petals in the central cell, blending all three colours in it. In the second example, it's impossible to satisfy the requirement because there is no way that amber and buff meet in any cell.
500
[ { "input": ".BAC.", "output": "Yes" }, { "input": "AA..CB", "output": "No" }, { "input": ".", "output": "No" }, { "input": "ACB.AAAAAA", "output": "Yes" }, { "input": "B.BC.BBBCA", "output": "Yes" }, { "input": "BA..CAB..B", "output": "Yes" }, { "input": "CACCBAA.BC", "output": "Yes" }, { "input": ".CAACCBBA.CBB.AC..BABCCBCCB..B.BC..CBC.CA.CC.C.CC.B.A.CC.BBCCBB..ACAACAC.CBCCB.AABAAC.CBCC.BA..CCBC.", "output": "Yes" }, { "input": "A", "output": "No" }, { "input": "..", "output": "No" }, { "input": "BC", "output": "No" }, { "input": "CAB", "output": "Yes" }, { "input": "A.CB", "output": "No" }, { "input": "B.ACAA.CA..CBCBBAA.B.CCBCB.CAC.ABC...BC.BCCC.BC.CB", "output": "Yes" }, { "input": "B.B...CC.B..CCCB.CB..CBCB..CBCC.CCBC.B.CB..CA.C.C.", "output": "No" }, { "input": "AA.CBAABABCCC..B..B.ABBABAB.B.B.CCA..CB.B...A..CBC", "output": "Yes" }, { "input": "CA.ABB.CC.B.C.BBBABAAB.BBBAACACAAA.C.AACA.AAC.C.BCCB.CCBC.C..CCACA.CBCCB.CCAABAAB.AACAA..A.AAA.", "output": "No" }, { "input": "CBC...AC.BBBB.BBABABA.CAAACC.AAABB..A.BA..BC.CBBBC.BBBBCCCAA.ACCBB.AB.C.BA..CC..AAAC...AB.A.AAABBA.A", "output": "No" }, { "input": "CC.AAAC.BA.BBB.AABABBCCAA.A.CBCCB.B.BC.ABCBCBBAA.CACA.CCCA.CB.CCB.A.BCCCB...C.A.BCCBC..B.ABABB.C.BCB", "output": "Yes" }, { "input": "CCC..A..CACACCA.CA.ABAAB.BBA..C.AAA...ACB.ACA.CA.B.AB.A..C.BC.BC.A.C....ABBCCACCCBCC.BBBAA.ACCACB.BB", "output": "Yes" }, { "input": "BC.ABACAACC..AC.A..CCCAABBCCACAC.AA.CC.BAABABABBCBB.BA..C.C.C.A.BBA.C..BC.ACACCC.AAAACCCCC.AAC.AC.AB", "output": "Yes" }, { "input": "ACAC.BAA.C..CAAC..ABBAACC..BAA...CC...ACCBBCA.BAABABAACCAC.A.BBCACCC..BCB.BABAAAACCBCB.BCAABBC.C.BBB", "output": "Yes" }, { "input": "CCAC.BCBC.A.ABBAB.C.C.BC.CCABBCBCCBC..B.AA.C.BC...B..BAA.ACCCCBBB.AAAACA.CAACCB.CCB.CC.BCCAB.BBBBABB", "output": "Yes" }, { "input": ".AACAA.AAAAC.BBBB.BC...CCACCACAAA.A..CCA..BCC.AB.ABAAB..AABA...B.C.CBAB.BAAB.A.C.AAC.BBBA.ACAAA.BB.C", "output": "Yes" }, { "input": "CC.ACCC.BCCCCAA.BBAACB.ABABAAAA.A.CBAB.CBACBBC..C.CA.AAA..AA..ABBB.A.C..CBBCAAACC.B..CC.AC..CAABACB.", "output": "Yes" }, { "input": ".BAB.", "output": "No" }, { "input": "BBBBBBBBB", "output": "No" }, { "input": "..AAC..", "output": "No" }, { "input": ".AAABBBCCC.", "output": "No" }, { "input": "AAABC", "output": "Yes" }, { "input": "BBB", "output": "No" }, { "input": "AAAAABABAAAAA", "output": "No" }, { "input": "AABBCC", "output": "No" }, { "input": ".BA", "output": "No" }, { "input": "CAAAAB", "output": "No" } ]
1,528,726,465
2,365
Python 3
OK
TESTS
37
78
0
a = input() for i in range(len(a)-2): if a[i] != a[i + 1] and a[i] != a[i + 2] and a[i + 1] != a[i + 2] and a[i] != '.' and a[i + 1] != '.' and a[i + 2] != '.': print("Yes") exit(0) print("No")
Title: A Blend of Springtime Time Limit: None seconds Memory Limit: None megabytes Problem Description: "What a pity it's already late spring," sighs Mino with regret, "one more drizzling night and they'd be gone." "But these blends are at their best, aren't they?" Absorbed in the landscape, Kanno remains optimistic. The landscape can be expressed as a row of consecutive cells, each of which either contains a flower of colour amber or buff or canary yellow, or is empty. When a flower withers, it disappears from the cell that it originally belonged to, and it spreads petals of its colour in its two neighbouring cells (or outside the field if the cell is on the side of the landscape). In case petals fall outside the given cells, they simply become invisible. You are to help Kanno determine whether it's possible that after some (possibly none or all) flowers shed their petals, at least one of the cells contains all three colours, considering both petals and flowers. Note that flowers can wither in arbitrary order. Input Specification: The first and only line of input contains a non-empty string $s$ consisting of uppercase English letters 'A', 'B', 'C' and characters '.' (dots) only ($\lvert s \rvert \leq 100$)Β β€” denoting cells containing an amber flower, a buff one, a canary yellow one, and no flowers, respectively. Output Specification: Output "Yes" if it's possible that all three colours appear in some cell, and "No" otherwise. You can print each letter in any case (upper or lower). Demo Input: ['.BAC.\n', 'AA..CB\n'] Demo Output: ['Yes\n', 'No\n'] Note: In the first example, the buff and canary yellow flowers can leave their petals in the central cell, blending all three colours in it. In the second example, it's impossible to satisfy the requirement because there is no way that amber and buff meet in any cell.
```python a = input() for i in range(len(a)-2): if a[i] != a[i + 1] and a[i] != a[i + 2] and a[i + 1] != a[i + 2] and a[i] != '.' and a[i + 1] != '.' and a[i + 2] != '.': print("Yes") exit(0) print("No") ```
3
405
A
Gravity Flip
PROGRAMMING
900
[ "greedy", "implementation", "sortings" ]
null
null
Little Chris is bored during his physics lessons (too easy), so he has built a toy box to keep himself occupied. The box is special, since it has the ability to change gravity. There are *n* columns of toy cubes in the box arranged in a line. The *i*-th column contains *a**i* cubes. At first, the gravity in the box is pulling the cubes downwards. When Chris switches the gravity, it begins to pull all the cubes to the right side of the box. The figure shows the initial and final configurations of the cubes in the box: the cubes that have changed their position are highlighted with orange. Given the initial configuration of the toy cubes in the box, find the amounts of cubes in each of the *n* columns after the gravity switch!
The first line of input contains an integer *n* (1<=≀<=*n*<=≀<=100), the number of the columns in the box. The next line contains *n* space-separated integer numbers. The *i*-th number *a**i* (1<=≀<=*a**i*<=≀<=100) denotes the number of cubes in the *i*-th column.
Output *n* integer numbers separated by spaces, where the *i*-th number is the amount of cubes in the *i*-th column after the gravity switch.
[ "4\n3 2 1 2\n", "3\n2 3 8\n" ]
[ "1 2 2 3 \n", "2 3 8 \n" ]
The first example case is shown on the figure. The top cube of the first column falls to the top of the last column; the top cube of the second column falls to the top of the third column; the middle cube of the first column falls to the top of the second column. In the second example case the gravity switch does not change the heights of the columns.
500
[ { "input": "4\n3 2 1 2", "output": "1 2 2 3 " }, { "input": "3\n2 3 8", "output": "2 3 8 " }, { "input": "5\n2 1 2 1 2", "output": "1 1 2 2 2 " }, { "input": "1\n1", "output": "1 " }, { "input": "2\n4 3", "output": "3 4 " }, { "input": "6\n100 40 60 20 1 80", "output": "1 20 40 60 80 100 " }, { "input": "10\n10 8 6 7 5 3 4 2 9 1", "output": "1 2 3 4 5 6 7 8 9 10 " }, { "input": "10\n1 2 3 4 5 6 7 8 9 10", "output": "1 2 3 4 5 6 7 8 9 10 " }, { "input": "100\n82 51 81 14 37 17 78 92 64 15 8 86 89 8 87 77 66 10 15 12 100 25 92 47 21 78 20 63 13 49 41 36 41 79 16 87 87 69 3 76 80 60 100 49 70 59 72 8 38 71 45 97 71 14 76 54 81 4 59 46 39 29 92 3 49 22 53 99 59 52 74 31 92 43 42 23 44 9 82 47 7 40 12 9 3 55 37 85 46 22 84 52 98 41 21 77 63 17 62 91", "output": "3 3 3 4 7 8 8 8 9 9 10 12 12 13 14 14 15 15 16 17 17 20 21 21 22 22 23 25 29 31 36 37 37 38 39 40 41 41 41 42 43 44 45 46 46 47 47 49 49 49 51 52 52 53 54 55 59 59 59 60 62 63 63 64 66 69 70 71 71 72 74 76 76 77 77 78 78 79 80 81 81 82 82 84 85 86 87 87 87 89 91 92 92 92 92 97 98 99 100 100 " }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100", "output": "100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 " }, { "input": "10\n1 9 7 6 2 4 7 8 1 3", "output": "1 1 2 3 4 6 7 7 8 9 " }, { "input": "20\n53 32 64 20 41 97 50 20 66 68 22 60 74 61 97 54 80 30 72 59", "output": "20 20 22 30 32 41 50 53 54 59 60 61 64 66 68 72 74 80 97 97 " }, { "input": "30\n7 17 4 18 16 12 14 10 1 13 2 16 13 17 8 16 13 14 9 17 17 5 13 5 1 7 6 20 18 12", "output": "1 1 2 4 5 5 6 7 7 8 9 10 12 12 13 13 13 13 14 14 16 16 16 17 17 17 17 18 18 20 " }, { "input": "40\n22 58 68 58 48 53 52 1 16 78 75 17 63 15 36 32 78 75 49 14 42 46 66 54 49 82 40 43 46 55 12 73 5 45 61 60 1 11 31 84", "output": "1 1 5 11 12 14 15 16 17 22 31 32 36 40 42 43 45 46 46 48 49 49 52 53 54 55 58 58 60 61 63 66 68 73 75 75 78 78 82 84 " }, { "input": "70\n1 3 3 1 3 3 1 1 1 3 3 2 3 3 1 1 1 2 3 1 3 2 3 3 3 2 2 3 1 3 3 2 1 1 2 1 2 1 2 2 1 1 1 3 3 2 3 2 3 2 3 3 2 2 2 3 2 3 3 3 1 1 3 3 1 1 1 1 3 1", "output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 " }, { "input": "90\n17 75 51 30 100 5 50 95 51 73 66 5 7 76 43 49 23 55 3 24 95 79 10 11 44 93 17 99 53 66 82 66 63 76 19 4 51 71 75 43 27 5 24 19 48 7 91 15 55 21 7 6 27 10 2 91 64 58 18 21 16 71 90 88 21 20 6 6 95 85 11 7 40 65 52 49 92 98 46 88 17 48 85 96 77 46 100 34 67 52", "output": "2 3 4 5 5 5 6 6 6 7 7 7 7 10 10 11 11 15 16 17 17 17 18 19 19 20 21 21 21 23 24 24 27 27 30 34 40 43 43 44 46 46 48 48 49 49 50 51 51 51 52 52 53 55 55 58 63 64 65 66 66 66 67 71 71 73 75 75 76 76 77 79 82 85 85 88 88 90 91 91 92 93 95 95 95 96 98 99 100 100 " }, { "input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 " }, { "input": "100\n1 1 1 1 2 1 1 1 1 1 2 2 1 1 2 1 2 1 1 1 2 1 1 2 1 2 1 1 2 2 2 1 1 2 1 1 1 2 2 2 1 1 1 2 1 2 2 1 2 1 1 2 2 1 2 1 2 1 2 2 1 1 1 2 1 1 2 1 2 1 2 2 2 1 2 1 2 2 2 1 2 2 1 1 1 1 2 2 2 2 2 2 2 1 1 1 2 1 2 1", "output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 " }, { "input": "100\n2 1 1 1 3 2 3 3 2 3 3 1 3 3 1 3 3 1 1 1 2 3 1 2 3 1 2 3 3 1 3 1 1 2 3 2 3 3 2 3 3 1 2 2 1 2 3 2 3 2 2 1 1 3 1 3 2 1 3 1 3 1 3 1 1 3 3 3 2 3 2 2 2 2 1 3 3 3 1 2 1 2 3 2 1 3 1 3 2 1 3 1 2 1 2 3 1 3 2 3", "output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 " }, { "input": "100\n7 4 5 5 10 10 5 8 5 7 4 5 4 6 8 8 2 6 3 3 10 7 10 8 6 2 7 3 9 7 7 2 4 5 2 4 9 5 10 1 10 5 10 4 1 3 4 2 6 9 9 9 10 6 2 5 6 1 8 10 4 10 3 4 10 5 5 4 10 4 5 3 7 10 2 7 3 6 9 6 1 6 5 5 4 6 6 4 4 1 5 1 6 6 6 8 8 6 2 6", "output": "1 1 1 1 1 1 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7 7 7 7 7 8 8 8 8 8 8 8 9 9 9 9 9 9 10 10 10 10 10 10 10 10 10 10 10 10 10 " }, { "input": "100\n12 10 5 11 13 12 14 13 7 15 15 12 13 19 12 18 14 10 10 3 1 10 16 11 19 8 10 15 5 10 12 16 11 13 11 15 14 12 16 8 11 8 15 2 18 2 14 13 15 20 8 8 4 12 14 7 10 3 9 1 7 19 6 7 2 14 8 20 7 17 18 20 3 18 18 9 6 10 4 1 4 19 9 13 3 3 12 11 11 20 8 2 13 6 7 12 1 4 17 3", "output": "1 1 1 1 2 2 2 2 3 3 3 3 3 3 4 4 4 4 5 5 6 6 6 7 7 7 7 7 7 8 8 8 8 8 8 8 9 9 9 10 10 10 10 10 10 10 10 11 11 11 11 11 11 11 12 12 12 12 12 12 12 12 12 13 13 13 13 13 13 13 14 14 14 14 14 14 15 15 15 15 15 15 16 16 16 17 17 18 18 18 18 18 19 19 19 19 20 20 20 20 " }, { "input": "100\n5 13 1 40 30 10 23 32 33 12 6 4 15 29 31 17 23 5 36 31 32 38 24 11 34 39 19 21 6 19 31 35 1 15 6 29 22 15 17 15 1 17 2 34 20 8 27 2 29 26 13 9 22 27 27 3 20 40 4 40 33 29 36 30 35 16 19 28 26 11 36 24 29 5 40 10 38 34 33 23 34 39 31 7 10 31 22 6 36 24 14 31 34 23 2 4 26 16 2 32", "output": "1 1 1 2 2 2 2 3 4 4 4 5 5 5 6 6 6 6 7 8 9 10 10 10 11 11 12 13 13 14 15 15 15 15 16 16 17 17 17 19 19 19 20 20 21 22 22 22 23 23 23 23 24 24 24 26 26 26 27 27 27 28 29 29 29 29 29 30 30 31 31 31 31 31 31 32 32 32 33 33 33 34 34 34 34 34 35 35 36 36 36 36 38 38 39 39 40 40 40 40 " }, { "input": "100\n72 44 34 74 9 60 26 37 55 77 74 69 28 66 54 55 8 36 57 31 31 48 32 66 40 70 77 43 64 28 37 10 21 58 51 32 60 28 51 52 28 35 7 33 1 68 38 70 57 71 8 20 42 57 59 4 58 10 17 47 22 48 16 3 76 67 32 37 64 47 33 41 75 69 2 76 39 9 27 75 20 21 52 25 71 21 11 29 38 10 3 1 45 55 63 36 27 7 59 41", "output": "1 1 2 3 3 4 7 7 8 8 9 9 10 10 10 11 16 17 20 20 21 21 21 22 25 26 27 27 28 28 28 28 29 31 31 32 32 32 33 33 34 35 36 36 37 37 37 38 38 39 40 41 41 42 43 44 45 47 47 48 48 51 51 52 52 54 55 55 55 57 57 57 58 58 59 59 60 60 63 64 64 66 66 67 68 69 69 70 70 71 71 72 74 74 75 75 76 76 77 77 " }, { "input": "100\n75 18 61 10 56 53 42 57 79 80 31 2 50 45 54 99 84 52 71 21 86 3 19 98 14 37 40 62 63 68 5 10 87 8 81 85 52 52 57 94 2 7 56 96 19 76 1 13 81 6 80 47 22 59 99 32 9 5 36 88 98 91 70 70 12 93 12 22 85 1 97 48 94 16 84 84 51 34 62 7 68 51 30 2 37 82 4 7 27 1 80 9 61 16 59 55 12 96 94 82", "output": "1 1 1 2 2 2 3 4 5 5 6 7 7 7 8 9 9 10 10 12 12 12 13 14 16 16 18 19 19 21 22 22 27 30 31 32 34 36 37 37 40 42 45 47 48 50 51 51 52 52 52 53 54 55 56 56 57 57 59 59 61 61 62 62 63 68 68 70 70 71 75 76 79 80 80 80 81 81 82 82 84 84 84 85 85 86 87 88 91 93 94 94 94 96 96 97 98 98 99 99 " }, { "input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100", "output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 " }, { "input": "100\n100 99 98 97 96 95 94 93 92 91 90 89 88 87 86 85 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1", "output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 " }, { "input": "100\n50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50", "output": "50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 50 " }, { "input": "49\n1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 83 85 87 89 91 93 95 97", "output": "1 3 5 7 9 11 13 15 17 19 21 23 25 27 29 31 33 35 37 39 41 43 45 47 49 51 53 55 57 59 61 63 65 67 69 71 73 75 77 79 81 83 85 87 89 91 93 95 97 " }, { "input": "30\n1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 61 64 67 70 73 76 79 82 85 88", "output": "1 4 7 10 13 16 19 22 25 28 31 34 37 40 43 46 49 52 55 58 61 64 67 70 73 76 79 82 85 88 " }, { "input": "100\n100 51 2 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 51 100 " }, { "input": "10\n100 90 80 70 60 50 40 30 20 10", "output": "10 20 30 40 50 60 70 80 90 100 " }, { "input": "1\n10", "output": "10 " } ]
1,691,829,777
2,147,483,647
PyPy 3
OK
TESTS
32
92
0
n=int(input()) l=[int]*n s=input().split() for i in range(n): l[i]=int(s[i]) l.sort() for element in l: print(element,end=' ')
Title: Gravity Flip Time Limit: None seconds Memory Limit: None megabytes Problem Description: Little Chris is bored during his physics lessons (too easy), so he has built a toy box to keep himself occupied. The box is special, since it has the ability to change gravity. There are *n* columns of toy cubes in the box arranged in a line. The *i*-th column contains *a**i* cubes. At first, the gravity in the box is pulling the cubes downwards. When Chris switches the gravity, it begins to pull all the cubes to the right side of the box. The figure shows the initial and final configurations of the cubes in the box: the cubes that have changed their position are highlighted with orange. Given the initial configuration of the toy cubes in the box, find the amounts of cubes in each of the *n* columns after the gravity switch! Input Specification: The first line of input contains an integer *n* (1<=≀<=*n*<=≀<=100), the number of the columns in the box. The next line contains *n* space-separated integer numbers. The *i*-th number *a**i* (1<=≀<=*a**i*<=≀<=100) denotes the number of cubes in the *i*-th column. Output Specification: Output *n* integer numbers separated by spaces, where the *i*-th number is the amount of cubes in the *i*-th column after the gravity switch. Demo Input: ['4\n3 2 1 2\n', '3\n2 3 8\n'] Demo Output: ['1 2 2 3 \n', '2 3 8 \n'] Note: The first example case is shown on the figure. The top cube of the first column falls to the top of the last column; the top cube of the second column falls to the top of the third column; the middle cube of the first column falls to the top of the second column. In the second example case the gravity switch does not change the heights of the columns.
```python n=int(input()) l=[int]*n s=input().split() for i in range(n): l[i]=int(s[i]) l.sort() for element in l: print(element,end=' ') ```
3
3
D
Least Cost Bracket Sequence
PROGRAMMING
2,600
[ "greedy" ]
D. Least Cost Bracket Sequence
1
64
This is yet another problem on regular bracket sequences. A bracket sequence is called regular, if by inserting "+" and "1" into it we get a correct mathematical expression. For example, sequences "(())()", "()" and "(()(()))" are regular, while ")(", "(()" and "(()))(" are not. You have a pattern of a bracket sequence that consists of characters "(", ")" and "?". You have to replace each character "?" with a bracket so, that you get a regular bracket sequence. For each character "?" the cost of its replacement with "(" and ")" is given. Among all the possible variants your should choose the cheapest.
The first line contains a non-empty pattern of even length, consisting of characters "(", ")" and "?". Its length doesn't exceed 5Β·104. Then there follow *m* lines, where *m* is the number of characters "?" in the pattern. Each line contains two integer numbers *a**i* and *b**i* (1<=≀<=*a**i*,<=<=*b**i*<=≀<=106), where *a**i* is the cost of replacing the *i*-th character "?" with an opening bracket, and *b**i* β€” with a closing one.
Print the cost of the optimal regular bracket sequence in the first line, and the required sequence in the second. Print -1, if there is no answer. If the answer is not unique, print any of them.
[ "(??)\n1 2\n2 8\n" ]
[ "4\n()()\n" ]
none
0
[ { "input": "(??)\n1 2\n2 8", "output": "4\n()()" }, { "input": "??\n1 1\n1 1", "output": "2\n()" }, { "input": "(???\n1 1\n1 1\n1 1", "output": "3\n(())" }, { "input": "(??)\n2 1\n1 1", "output": "2\n()()" }, { "input": "(???)?\n3 3\n3 1\n3 3\n2 3", "output": "10\n(()())" }, { "input": "((????\n3 2\n3 2\n1 1\n2 3", "output": "8\n(())()" }, { "input": "???())\n2 4\n3 3\n4 1", "output": "6\n(()())" }, { "input": "((????\n3 5\n4 1\n2 2\n1 5", "output": "11\n((()))" }, { "input": "?(?)(???\n2 3\n2 2\n3 2\n3 1\n3 1", "output": "8\n((()()))" }, { "input": "(??????)\n1 1\n3 3\n3 3\n3 2\n1 3\n3 3", "output": "13\n((())())" }, { "input": "?????)??\n2 3\n2 1\n1 3\n5 1\n3 3\n1 3\n3 2", "output": "11\n()()()()" }, { "input": "?)???(??\n1 4\n3 4\n2 4\n2 5\n3 3\n3 1", "output": "14\n()()(())" }, { "input": "???(??))\n2 1\n2 1\n2 1\n1 2\n2 1", "output": "7\n(()(()))" }, { "input": "??(()??)\n3 2\n3 3\n1 3\n2 2", "output": "9\n()(()())" }, { "input": "????(???\n2 2\n1 3\n1 3\n3 3\n4 1\n4 4\n2 4", "output": "16\n((()()))" }, { "input": "?(??????\n1 5\n2 4\n4 4\n4 3\n4 5\n5 4\n2 3", "output": "21\n((())())" }, { "input": "???????)\n6 3\n5 3\n4 1\n1 4\n4 1\n2 6\n4 3", "output": "19\n(()()())" }, { "input": "??????)?\n2 2\n4 2\n3 5\n3 2\n7 4\n6 2\n1 6", "output": "24\n(((())))" }, { "input": "?((?)?)?\n1 2\n4 2\n1 3\n1 2", "output": "6\n((())())" }, { "input": "??(????)\n3 2\n1 4\n4 4\n2 3\n2 3\n2 4", "output": "16\n((()))()" }, { "input": "???(?)??(??)?)(?(?????????(?()????)(????(?)????)???)??))(?(?????????))???(??)?????))???????(????????\n9 10\n6 3\n8 2\n9 10\n9 3\n6 2\n8 5\n6 7\n2 6\n7 8\n6 10\n1 7\n1 7\n10 7\n10 7\n8 4\n5 9\n9 3\n3 10\n1 10\n8 2\n8 8\n4 8\n6 6\n4 10\n4 5\n5 2\n5 6\n7 7\n7 3\n10 1\n1 4\n5 10\n3 2\n2 8\n8 9\n6 5\n8 6\n3 4\n8 6\n8 5\n7 7\n10 9\n5 5\n2 1\n2 7\n2 3\n5 10\n9 7\n1 9\n10 9\n4 5\n8 2\n2 5\n6 7\n3 6\n4 2\n2 5\n3 9\n4 4\n6 3\n4 9\n3 1\n5 7\n8 7\n6 9\n5 3\n6 4\n8 3\n5 8\n8 4\n7 6\n1 4", "output": "309\n(()(()))()()()(((((()))()(((())((()((()((()))(())(()))))((())))))((()))()(())((()())())()()(()))()))" }, { "input": "(?(((???))(??)?)?))))(?)????(()()???(?)????(??(??????)()(????(?)))))??(???(??)?(??)????????(????(?()\n39 78\n1 83\n2 35\n28 89\n53 53\n96 67\n16 46\n43 28\n25 73\n8 97\n57 41\n15 25\n47 49\n23 18\n97 77\n38 33\n68 80\n38 98\n62 8\n61 79\n84 50\n71 48\n12 16\n97 95\n16 70\n72 58\n55 85\n88 42\n49 56\n39 63\n51 100\n41 15\n97 17\n71 63\n21 44\n1 41\n22 14\n42 65\n88 33\n57 95\n57 28\n59 8\n56 42\n18 99\n43 6\n75 93\n34 23\n62 57\n62 71\n67 92\n91 60\n49 58\n97 14\n75 68\n20 9\n55 98\n12 3", "output": "2140\n(((((((())(())())))))(()()(((()())))(()()()()(((()()()()((())())))))((()()(()))()())())(()(())))()()" }, { "input": "(())()", "output": "0\n(())()" }, { "input": "?(?(??\n1 1\n2 2\n1 1\n1 1", "output": "5\n(()())" }, { "input": "(????(\n1 1\n2 1\n2 1\n3 3", "output": "-1" }, { "input": "(?(???\n2 3\n1 1\n3 3\n1 4", "output": "10\n((()))" }, { "input": "))))))", "output": "-1" }, { "input": ")?)??)\n4 4\n3 5\n3 6", "output": "-1" }, { "input": "((((((", "output": "-1" }, { "input": "((((((", "output": "-1" }, { "input": "()()()", "output": "0\n()()()" }, { "input": "????((\n7 6\n1 10\n9 8\n4 4", "output": "-1" }, { "input": "))))))", "output": "-1" }, { "input": "))))))", "output": "-1" }, { "input": "((((((", "output": "-1" }, { "input": "((()))", "output": "0\n((()))" }, { "input": "?))?))\n9 13\n8 11", "output": "-1" }, { "input": "))))))", "output": "-1" }, { "input": "?(?)?)\n6 14\n8 6\n4 3", "output": "16\n(())()" }, { "input": "?(?(((\n8 7\n17 15", "output": "-1" }, { "input": "))))))", "output": "-1" } ]
1,667,989,443
303
Python 3
OK
TESTS
80
404
2,048,000
s=[] cost,pre,pq=0,0,[] from heapq import heappop, heappush for i, c in enumerate(input()): if c=='?': c=')' x,y=map(int,input().split()) cost+=y heappush(pq, (x-y,i)) s.append(c) if c=='(': pre+=1 else: if pre==0: if not pq: pre=-1 break x,y=heappop(pq) cost+=x s[y]='(' pre+=1 else: pre-=1 if pre: print(-1) else: print(cost) print("".join(s))
Title: Least Cost Bracket Sequence Time Limit: 1 seconds Memory Limit: 64 megabytes Problem Description: This is yet another problem on regular bracket sequences. A bracket sequence is called regular, if by inserting "+" and "1" into it we get a correct mathematical expression. For example, sequences "(())()", "()" and "(()(()))" are regular, while ")(", "(()" and "(()))(" are not. You have a pattern of a bracket sequence that consists of characters "(", ")" and "?". You have to replace each character "?" with a bracket so, that you get a regular bracket sequence. For each character "?" the cost of its replacement with "(" and ")" is given. Among all the possible variants your should choose the cheapest. Input Specification: The first line contains a non-empty pattern of even length, consisting of characters "(", ")" and "?". Its length doesn't exceed 5Β·104. Then there follow *m* lines, where *m* is the number of characters "?" in the pattern. Each line contains two integer numbers *a**i* and *b**i* (1<=≀<=*a**i*,<=<=*b**i*<=≀<=106), where *a**i* is the cost of replacing the *i*-th character "?" with an opening bracket, and *b**i* β€” with a closing one. Output Specification: Print the cost of the optimal regular bracket sequence in the first line, and the required sequence in the second. Print -1, if there is no answer. If the answer is not unique, print any of them. Demo Input: ['(??)\n1 2\n2 8\n'] Demo Output: ['4\n()()\n'] Note: none
```python s=[] cost,pre,pq=0,0,[] from heapq import heappop, heappush for i, c in enumerate(input()): if c=='?': c=')' x,y=map(int,input().split()) cost+=y heappush(pq, (x-y,i)) s.append(c) if c=='(': pre+=1 else: if pre==0: if not pq: pre=-1 break x,y=heappop(pq) cost+=x s[y]='(' pre+=1 else: pre-=1 if pre: print(-1) else: print(cost) print("".join(s)) ```
3.782741
935
A
Fafa and his Company
PROGRAMMING
800
[ "brute force", "implementation" ]
null
null
Fafa owns a company that works on huge projects. There are *n* employees in Fafa's company. Whenever the company has a new project to start working on, Fafa has to divide the tasks of this project among all the employees. Fafa finds doing this every time is very tiring for him. So, he decided to choose the best *l* employees in his company as team leaders. Whenever there is a new project, Fafa will divide the tasks among only the team leaders and each team leader will be responsible of some positive number of employees to give them the tasks. To make this process fair for the team leaders, each one of them should be responsible for the same number of employees. Moreover, every employee, who is not a team leader, has to be under the responsibility of exactly one team leader, and no team leader is responsible for another team leader. Given the number of employees *n*, find in how many ways Fafa could choose the number of team leaders *l* in such a way that it is possible to divide employees between them evenly.
The input consists of a single line containing a positive integer *n* (2<=≀<=*n*<=≀<=105) β€” the number of employees in Fafa's company.
Print a single integer representing the answer to the problem.
[ "2\n", "10\n" ]
[ "1\n", "3\n" ]
In the second sample Fafa has 3 ways: - choose only 1 employee as a team leader with 9 employees under his responsibility. - choose 2 employees as team leaders with 4 employees under the responsibility of each of them. - choose 5 employees as team leaders with 1 employee under the responsibility of each of them.
500
[ { "input": "2", "output": "1" }, { "input": "10", "output": "3" }, { "input": "3", "output": "1" }, { "input": "4", "output": "2" }, { "input": "6", "output": "3" }, { "input": "13", "output": "1" }, { "input": "100000", "output": "35" }, { "input": "1024", "output": "10" }, { "input": "99999", "output": "11" }, { "input": "10007", "output": "1" }, { "input": "4096", "output": "12" }, { "input": "65536", "output": "16" }, { "input": "40320", "output": "95" }, { "input": "30030", "output": "63" }, { "input": "161", "output": "3" }, { "input": "1000", "output": "15" }, { "input": "10000", "output": "24" }, { "input": "777", "output": "7" }, { "input": "121", "output": "2" }, { "input": "25", "output": "2" }, { "input": "40000", "output": "34" }, { "input": "99990", "output": "47" }, { "input": "98765", "output": "3" }, { "input": "56789", "output": "3" }, { "input": "13579", "output": "3" }, { "input": "97531", "output": "3" }, { "input": "12345", "output": "7" }, { "input": "54321", "output": "7" }, { "input": "83160", "output": "127" }, { "input": "9", "output": "2" }, { "input": "21", "output": "3" }, { "input": "11", "output": "1" }, { "input": "15", "output": "3" } ]
1,698,732,740
2,147,483,647
Python 3
OK
TESTS
33
46
0
n = int(input()) c = 0 for i in range(1,int(n/2)+1): if n%i == 0: c = c + 1 print(c)
Title: Fafa and his Company Time Limit: None seconds Memory Limit: None megabytes Problem Description: Fafa owns a company that works on huge projects. There are *n* employees in Fafa's company. Whenever the company has a new project to start working on, Fafa has to divide the tasks of this project among all the employees. Fafa finds doing this every time is very tiring for him. So, he decided to choose the best *l* employees in his company as team leaders. Whenever there is a new project, Fafa will divide the tasks among only the team leaders and each team leader will be responsible of some positive number of employees to give them the tasks. To make this process fair for the team leaders, each one of them should be responsible for the same number of employees. Moreover, every employee, who is not a team leader, has to be under the responsibility of exactly one team leader, and no team leader is responsible for another team leader. Given the number of employees *n*, find in how many ways Fafa could choose the number of team leaders *l* in such a way that it is possible to divide employees between them evenly. Input Specification: The input consists of a single line containing a positive integer *n* (2<=≀<=*n*<=≀<=105) β€” the number of employees in Fafa's company. Output Specification: Print a single integer representing the answer to the problem. Demo Input: ['2\n', '10\n'] Demo Output: ['1\n', '3\n'] Note: In the second sample Fafa has 3 ways: - choose only 1 employee as a team leader with 9 employees under his responsibility. - choose 2 employees as team leaders with 4 employees under the responsibility of each of them. - choose 5 employees as team leaders with 1 employee under the responsibility of each of them.
```python n = int(input()) c = 0 for i in range(1,int(n/2)+1): if n%i == 0: c = c + 1 print(c) ```
3
940
C
Phone Numbers
PROGRAMMING
1,500
[ "constructive algorithms", "implementation", "strings" ]
null
null
And where the are the phone numbers? You are given a string *s* consisting of lowercase English letters and an integer *k*. Find the lexicographically smallest string *t* of length *k*, such that its set of letters is a subset of the set of letters of *s* and *s* is lexicographically smaller than *t*. It's guaranteed that the answer exists. Note that the set of letters is a set, not a multiset. For example, the set of letters of abadaba is {*a*,<=*b*,<=*d*}. String *p* is lexicographically smaller than string *q*, if *p* is a prefix of *q*, is not equal to *q* or there exists *i*, such that *p**i*<=&lt;<=*q**i* and for all *j*<=&lt;<=*i* it is satisfied that *p**j*<==<=*q**j*. For example, abc is lexicographically smaller than abcd , abd is lexicographically smaller than abec, afa is not lexicographically smaller than ab and a is not lexicographically smaller than a.
The first line of input contains two space separated integers *n* and *k* (1<=≀<=*n*,<=*k*<=≀<=100<=000)Β β€” the length of *s* and the required length of *t*. The second line of input contains the string *s* consisting of *n* lowercase English letters.
Output the string *t* conforming to the requirements above. It's guaranteed that the answer exists.
[ "3 3\nabc\n", "3 2\nabc\n", "3 3\nayy\n", "2 3\nba\n" ]
[ "aca\n", "ac\n", "yaa\n", "baa\n" ]
In the first example the list of strings *t* of length 3, such that the set of letters of *t* is a subset of letters of *s* is as follows: aaa, aab, aac, aba, abb, abc, aca, acb, .... Among them, those are lexicographically greater than abc: aca, acb, .... Out of those the lexicographically smallest is aca.
1,250
[ { "input": "3 3\nabc", "output": "aca" }, { "input": "3 2\nabc", "output": "ac" }, { "input": "3 3\nayy", "output": "yaa" }, { "input": "2 3\nba", "output": "baa" }, { "input": "1 3\nf", "output": "fff" }, { "input": "3 1\nazz", "output": "z" }, { "input": "3 3\nzbf", "output": "zbz" }, { "input": "2 3\ngi", "output": "gig" }, { "input": "3 2\nyzy", "output": "zy" }, { "input": "5 10\nkekff", "output": "kekffeeeee" }, { "input": "10 5\nhqqqqcdddb", "output": "qbbbb" }, { "input": "10 10\nmrfkcsxcuj", "output": "mrfkcsxcuk" }, { "input": "10 3\nggjnohlepu", "output": "ggl" }, { "input": "8 9\npppppppp", "output": "ppppppppp" }, { "input": "10 7\nffffffffyf", "output": "ffffffy" }, { "input": "10 2\nkmiejhcimj", "output": "mc" }, { "input": "10 1\ngiwekrmngf", "output": "i" }, { "input": "8 8\nlolololo", "output": "lololool" }, { "input": "10 9\nbcegikmyyy", "output": "bcegikybb" }, { "input": "7 5000\nqqqqqqq", "output": "qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq..." }, { "input": "3 99948\nttt", "output": "ttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttt..." } ]
1,593,845,431
2,147,483,647
PyPy 3
OK
TESTS
54
155
4,710,400
import sys input = lambda: sys.stdin.readline().strip("\r\n") n, k = map(int, input().split()) s = input() letters = sorted(list(set(list(s)))) if k > n: ans = s + (k-n)*letters[0] else: for i in range(k-1, -1, -1): if s[i] != letters[-1]: ans = s[:i] + letters[letters.index(s[i])+1] + (k-i-1) * letters[0] break print(ans)
Title: Phone Numbers Time Limit: None seconds Memory Limit: None megabytes Problem Description: And where the are the phone numbers? You are given a string *s* consisting of lowercase English letters and an integer *k*. Find the lexicographically smallest string *t* of length *k*, such that its set of letters is a subset of the set of letters of *s* and *s* is lexicographically smaller than *t*. It's guaranteed that the answer exists. Note that the set of letters is a set, not a multiset. For example, the set of letters of abadaba is {*a*,<=*b*,<=*d*}. String *p* is lexicographically smaller than string *q*, if *p* is a prefix of *q*, is not equal to *q* or there exists *i*, such that *p**i*<=&lt;<=*q**i* and for all *j*<=&lt;<=*i* it is satisfied that *p**j*<==<=*q**j*. For example, abc is lexicographically smaller than abcd , abd is lexicographically smaller than abec, afa is not lexicographically smaller than ab and a is not lexicographically smaller than a. Input Specification: The first line of input contains two space separated integers *n* and *k* (1<=≀<=*n*,<=*k*<=≀<=100<=000)Β β€” the length of *s* and the required length of *t*. The second line of input contains the string *s* consisting of *n* lowercase English letters. Output Specification: Output the string *t* conforming to the requirements above. It's guaranteed that the answer exists. Demo Input: ['3 3\nabc\n', '3 2\nabc\n', '3 3\nayy\n', '2 3\nba\n'] Demo Output: ['aca\n', 'ac\n', 'yaa\n', 'baa\n'] Note: In the first example the list of strings *t* of length 3, such that the set of letters of *t* is a subset of letters of *s* is as follows: aaa, aab, aac, aba, abb, abc, aca, acb, .... Among them, those are lexicographically greater than abc: aca, acb, .... Out of those the lexicographically smallest is aca.
```python import sys input = lambda: sys.stdin.readline().strip("\r\n") n, k = map(int, input().split()) s = input() letters = sorted(list(set(list(s)))) if k > n: ans = s + (k-n)*letters[0] else: for i in range(k-1, -1, -1): if s[i] != letters[-1]: ans = s[:i] + letters[letters.index(s[i])+1] + (k-i-1) * letters[0] break print(ans) ```
3
169
A
Chores
PROGRAMMING
800
[ "sortings" ]
null
null
Petya and Vasya are brothers. Today is a special day for them as their parents left them home alone and commissioned them to do *n* chores. Each chore is characterized by a single parameter β€” its complexity. The complexity of the *i*-th chore equals *h**i*. As Petya is older, he wants to take the chores with complexity larger than some value *x* (*h**i*<=&gt;<=*x*) to leave to Vasya the chores with complexity less than or equal to *x* (*h**i*<=≀<=*x*). The brothers have already decided that Petya will do exactly *a* chores and Vasya will do exactly *b* chores (*a*<=+<=*b*<==<=*n*). In how many ways can they choose an integer *x* so that Petya got exactly *a* chores and Vasya got exactly *b* chores?
The first input line contains three integers *n*,<=*a* and *b* (2<=≀<=*n*<=≀<=2000; *a*,<=*b*<=β‰₯<=1; *a*<=+<=*b*<==<=*n*) β€” the total number of chores, the number of Petya's chores and the number of Vasya's chores. The next line contains a sequence of integers *h*1,<=*h*2,<=...,<=*h**n* (1<=≀<=*h**i*<=≀<=109), *h**i* is the complexity of the *i*-th chore. The numbers in the given sequence are not necessarily different. All numbers on the lines are separated by single spaces.
Print the required number of ways to choose an integer value of *x*. If there are no such ways, print 0.
[ "5 2 3\n6 2 3 100 1\n", "7 3 4\n1 1 9 1 1 1 1\n" ]
[ "3\n", "0\n" ]
In the first sample the possible values of *x* are 3, 4 or 5. In the second sample it is impossible to find such *x*, that Petya got 3 chores and Vasya got 4.
500
[ { "input": "5 2 3\n6 2 3 100 1", "output": "3" }, { "input": "7 3 4\n1 1 9 1 1 1 1", "output": "0" }, { "input": "2 1 1\n10 2", "output": "8" }, { "input": "2 1 1\n7 7", "output": "0" }, { "input": "2 1 1\n1 1000000000", "output": "999999999" }, { "input": "3 1 2\n6 5 5", "output": "1" }, { "input": "3 2 1\n10 10 8", "output": "2" }, { "input": "8 3 5\n42 55 61 72 83 10 22 33", "output": "6" }, { "input": "10 5 5\n1 2 3 4 5 999999999 999999998 999999997 999999996 999999995", "output": "999999990" }, { "input": "4 1 3\n10 8 7 3", "output": "2" }, { "input": "4 2 2\n402 10 10 402", "output": "392" }, { "input": "4 1 3\n10 402 402 10", "output": "0" }, { "input": "4 3 1\n100 100 200 200", "output": "0" }, { "input": "150 10 140\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "0" }, { "input": "102 101 1\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "0" } ]
1,635,049,418
2,147,483,647
Python 3
OK
TESTS
29
62
4,505,600
s=input() s=s.split() n=int(s[0]) a=int(s[1]) b=int(s[2]) l=input() l=l.split() ll=[int(i) for i in l] ll.sort() print(ll[n-a]-ll[b-1])
Title: Chores Time Limit: None seconds Memory Limit: None megabytes Problem Description: Petya and Vasya are brothers. Today is a special day for them as their parents left them home alone and commissioned them to do *n* chores. Each chore is characterized by a single parameter β€” its complexity. The complexity of the *i*-th chore equals *h**i*. As Petya is older, he wants to take the chores with complexity larger than some value *x* (*h**i*<=&gt;<=*x*) to leave to Vasya the chores with complexity less than or equal to *x* (*h**i*<=≀<=*x*). The brothers have already decided that Petya will do exactly *a* chores and Vasya will do exactly *b* chores (*a*<=+<=*b*<==<=*n*). In how many ways can they choose an integer *x* so that Petya got exactly *a* chores and Vasya got exactly *b* chores? Input Specification: The first input line contains three integers *n*,<=*a* and *b* (2<=≀<=*n*<=≀<=2000; *a*,<=*b*<=β‰₯<=1; *a*<=+<=*b*<==<=*n*) β€” the total number of chores, the number of Petya's chores and the number of Vasya's chores. The next line contains a sequence of integers *h*1,<=*h*2,<=...,<=*h**n* (1<=≀<=*h**i*<=≀<=109), *h**i* is the complexity of the *i*-th chore. The numbers in the given sequence are not necessarily different. All numbers on the lines are separated by single spaces. Output Specification: Print the required number of ways to choose an integer value of *x*. If there are no such ways, print 0. Demo Input: ['5 2 3\n6 2 3 100 1\n', '7 3 4\n1 1 9 1 1 1 1\n'] Demo Output: ['3\n', '0\n'] Note: In the first sample the possible values of *x* are 3, 4 or 5. In the second sample it is impossible to find such *x*, that Petya got 3 chores and Vasya got 4.
```python s=input() s=s.split() n=int(s[0]) a=int(s[1]) b=int(s[2]) l=input() l=l.split() ll=[int(i) for i in l] ll.sort() print(ll[n-a]-ll[b-1]) ```
3
41
A
Translation
PROGRAMMING
800
[ "implementation", "strings" ]
A. Translation
2
256
The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the Β«translationΒ». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly.
The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols.
If the word *t* is a word *s*, written reversely, print YES, otherwise print NO.
[ "code\nedoc\n", "abb\naba\n", "code\ncode\n" ]
[ "YES\n", "NO\n", "NO\n" ]
none
500
[ { "input": "code\nedoc", "output": "YES" }, { "input": "abb\naba", "output": "NO" }, { "input": "code\ncode", "output": "NO" }, { "input": "abacaba\nabacaba", "output": "YES" }, { "input": "q\nq", "output": "YES" }, { "input": "asrgdfngfnmfgnhweratgjkk\nasrgdfngfnmfgnhweratgjkk", "output": "NO" }, { "input": "z\na", "output": "NO" }, { "input": "asd\ndsa", "output": "YES" }, { "input": "abcdef\nfecdba", "output": "NO" }, { "input": "ywjjbirapvskozubvxoemscfwl\ngnduubaogtfaiowjizlvjcu", "output": "NO" }, { "input": "mfrmqxtzvgaeuleubcmcxcfqyruwzenguhgrmkuhdgnhgtgkdszwqyd\nmfxufheiperjnhyczclkmzyhcxntdfskzkzdwzzujdinf", "output": "NO" }, { "input": "bnbnemvybqizywlnghlykniaxxxlkhftppbdeqpesrtgkcpoeqowjwhrylpsziiwcldodcoonpimudvrxejjo\ntiynnekmlalogyvrgptbinkoqdwzuiyjlrldxhzjmmp", "output": "NO" }, { "input": "pwlpubwyhzqvcitemnhvvwkmwcaawjvdiwtoxyhbhbxerlypelevasmelpfqwjk\nstruuzebbcenziscuoecywugxncdwzyfozhljjyizpqcgkyonyetarcpwkqhuugsqjuixsxptmbnlfupdcfigacdhhrzb", "output": "NO" }, { "input": "gdvqjoyxnkypfvdxssgrihnwxkeojmnpdeobpecytkbdwujqfjtxsqspxvxpqioyfagzjxupqqzpgnpnpxcuipweunqch\nkkqkiwwasbhezqcfeceyngcyuogrkhqecwsyerdniqiocjehrpkljiljophqhyaiefjpavoom", "output": "NO" }, { "input": "umeszdawsvgkjhlqwzents\nhxqhdungbylhnikwviuh", "output": "NO" }, { "input": "juotpscvyfmgntshcealgbsrwwksgrwnrrbyaqqsxdlzhkbugdyx\nibqvffmfktyipgiopznsqtrtxiijntdbgyy", "output": "NO" }, { "input": "zbwueheveouatecaglziqmudxemhrsozmaujrwlqmppzoumxhamwugedikvkblvmxwuofmpafdprbcftew\nulczwrqhctbtbxrhhodwbcxwimncnexosksujlisgclllxokrsbnozthajnnlilyffmsyko", "output": "NO" }, { "input": "nkgwuugukzcv\nqktnpxedwxpxkrxdvgmfgoxkdfpbzvwsduyiybynbkouonhvmzakeiruhfmvrktghadbfkmwxduoqv", "output": "NO" }, { "input": "incenvizhqpcenhjhehvjvgbsnfixbatrrjstxjzhlmdmxijztphxbrldlqwdfimweepkggzcxsrwelodpnryntepioqpvk\ndhjbjjftlvnxibkklxquwmzhjfvnmwpapdrslioxisbyhhfymyiaqhlgecpxamqnocizwxniubrmpyubvpenoukhcobkdojlybxd", "output": "NO" }, { "input": "w\nw", "output": "YES" }, { "input": "vz\nzv", "output": "YES" }, { "input": "ry\nyr", "output": "YES" }, { "input": "xou\nuox", "output": "YES" }, { "input": "axg\ngax", "output": "NO" }, { "input": "zdsl\nlsdz", "output": "YES" }, { "input": "kudl\nldku", "output": "NO" }, { "input": "zzlzwnqlcl\nlclqnwzlzz", "output": "YES" }, { "input": "vzzgicnzqooejpjzads\nsdazjpjeooqzncigzzv", "output": "YES" }, { "input": "raqhmvmzuwaykjpyxsykr\nxkysrypjkyawuzmvmhqar", "output": "NO" }, { "input": "ngedczubzdcqbxksnxuavdjaqtmdwncjnoaicvmodcqvhfezew\nwezefhvqcdomvciaonjcnwdmtqajdvauxnskxbqcdzbuzcdegn", "output": "YES" }, { "input": "muooqttvrrljcxbroizkymuidvfmhhsjtumksdkcbwwpfqdyvxtrlymofendqvznzlmim\nmimlznzvqdnefomylrtxvydqfpwwbckdskmutjshhmfvdiumykziorbxcjlrrvttqooum", "output": "YES" }, { "input": "vxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaivg\ngviayyikkitmuomcpiakhbxszgbnhvwyzkftwoagzixaearxpjacrnvpvbuzenvovehkmmxvblqyxvctroddksdsgebcmlluqpxv", "output": "YES" }, { "input": "mnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfdc\ncdfmkdgrdptkpewbsqvszipgxvgvuiuzbkkwuowbafkikgvnqdkxnayzdjygvezmtsgywnupocdntipiyiorblqkrzjpzatxahnm", "output": "NO" }, { "input": "dgxmzbqofstzcdgthbaewbwocowvhqpinehpjatnnbrijcolvsatbblsrxabzrpszoiecpwhfjmwuhqrapvtcgvikuxtzbftydkw\nwkdytfbztxukivgctvparqhuwmjfhwpceiozsprzbaxrslbbqasvlocjirbnntajphenipthvwocowbweabhtgdcztsfoqbzmxgd", "output": "NO" }, { "input": "gxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwgeh\nhegwxvocotmzstqfbmpjvijgkcyodlxyjawrpkczpmdspsuhoiruavnnnuwvtwohglkdxjetshkboalvzqbgjgthoteceixioxg", "output": "YES" }, { "input": "sihxuwvmaambplxvjfoskinghzicyfqebjtkysotattkahssumfcgrkheotdxwjckpvapbkaepqrxseyfrwtyaycmrzsrsngkh\nhkgnsrszrmcyaytwrfyesxrqpeakbpavpkcjwxdtoehkrgcfmusshakttatosyktjbeqfycizhgniksofjvxlpbmaamvwuxhis", "output": "YES" }, { "input": "ycnahksbughnonldzrhkysujmylcgcfuludjvjiahtkyzqvkopzqcnwhltbzfugzojqkjjlggmvnultascmygelkiktmfieok\nkoeifmtkiklegkmcsatlunvmggkjjlqjozgufzbtlhwncqzpokvqzykthaijvjdulufcgclymjusyyhrzdlnonhgubskhancy", "output": "NO" }, { "input": "wbqasaehtkfojruzyhrlgwmtyiovmzyfifslvlemhqheyaelzwnthrenjsbmntwaoryzwfbxmscmypvxlfmzpnkkjlvwvmtz\nztmvwvljkknpzmflxvpymcsmxbfwzyroawtnmbsjnerhtnwzleayehqhmelvlsfifyzmvoiytmwglrhyzurjofktheasaqbw", "output": "YES" }, { "input": "imippqurprbhfugngtgifelytadegwrgaefnfhbjjnmzikvjaccotqzemufqieqldgnbmviisgkynzeldlhqxuqphjfmyij\njiymfjhpquxqhldleznykgsiivmbngdlqeiqfumezqtoccajvkizmnjjbhfnfeagrwgedatylefigtgngufhbrpruqppimi", "output": "YES" }, { "input": "bikydffiuisckpvzqlteqfhegsagimodb\nbdomigasgehfqetlqzvpkcsiuiffdykib", "output": "YES" } ]
1,693,113,302
2,147,483,647
Python 3
OK
TESTS
40
92
0
str1 = input() str2 = input() n = len(str1) str1 = str1[::-1] if str1 == str2: print("YES") else: print("NO")
Title: Translation Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: The translation from the Berland language into the Birland language is not an easy task. Those languages are very similar: a berlandish word differs from a birlandish word with the same meaning a little: it is spelled (and pronounced) reversely. For example, a Berlandish word code corresponds to a Birlandish word edoc. However, it's easy to make a mistake during the Β«translationΒ». Vasya translated word *s* from Berlandish into Birlandish as *t*. Help him: find out if he translated the word correctly. Input Specification: The first line contains word *s*, the second line contains word *t*. The words consist of lowercase Latin letters. The input data do not consist unnecessary spaces. The words are not empty and their lengths do not exceed 100 symbols. Output Specification: If the word *t* is a word *s*, written reversely, print YES, otherwise print NO. Demo Input: ['code\nedoc\n', 'abb\naba\n', 'code\ncode\n'] Demo Output: ['YES\n', 'NO\n', 'NO\n'] Note: none
```python str1 = input() str2 = input() n = len(str1) str1 = str1[::-1] if str1 == str2: print("YES") else: print("NO") ```
3.977
599
A
Patrick and Shopping
PROGRAMMING
800
[ "implementation" ]
null
null
Today Patrick waits for a visit from his friend Spongebob. To prepare for the visit, Patrick needs to buy some goodies in two stores located near his house. There is a *d*1 meter long road between his house and the first shop and a *d*2 meter long road between his house and the second shop. Also, there is a road of length *d*3 directly connecting these two shops to each other. Help Patrick calculate the minimum distance that he needs to walk in order to go to both shops and return to his house. Patrick always starts at his house. He should visit both shops moving only along the three existing roads and return back to his house. He doesn't mind visiting the same shop or passing the same road multiple times. The only goal is to minimize the total distance traveled.
The first line of the input contains three integers *d*1, *d*2, *d*3 (1<=≀<=*d*1,<=*d*2,<=*d*3<=≀<=108)Β β€” the lengths of the paths. - *d*1 is the length of the path connecting Patrick's house and the first shop; - *d*2 is the length of the path connecting Patrick's house and the second shop; - *d*3 is the length of the path connecting both shops.
Print the minimum distance that Patrick will have to walk in order to visit both shops and return to his house.
[ "10 20 30\n", "1 1 5\n" ]
[ "60\n", "4\n" ]
The first sample is shown on the picture in the problem statement. One of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house. In the second sample one of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
500
[ { "input": "10 20 30", "output": "60" }, { "input": "1 1 5", "output": "4" }, { "input": "100 33 34", "output": "134" }, { "input": "777 777 777", "output": "2331" }, { "input": "2 2 8", "output": "8" }, { "input": "12 34 56", "output": "92" }, { "input": "789 101112 131415", "output": "203802" }, { "input": "27485716 99999999 35182", "output": "55041796" }, { "input": "1 293548 5", "output": "12" }, { "input": "12059 259855 5874875", "output": "543828" }, { "input": "46981 105809 585858", "output": "305580" }, { "input": "9889 1221 2442", "output": "7326" }, { "input": "100500 200600 300700", "output": "601800" }, { "input": "318476 318476 318476", "output": "955428" }, { "input": "23985 3353 75633", "output": "54676" }, { "input": "120 1298 2222", "output": "2836" }, { "input": "98437 23487 666672", "output": "243848" }, { "input": "100000000 100000000 100000000", "output": "300000000" }, { "input": "2 5 2", "output": "8" }, { "input": "1 1000 1", "output": "4" }, { "input": "1 100000000 1", "output": "4" } ]
1,618,822,182
2,147,483,647
Python 3
OK
TESTS
21
62
0
''' Author : knight_byte File : A_Patrick_and_Shopping.py Created on : 2021-04-19 14:15:35 ''' def main(): d = sorted(list(map(int, input().split()))) mi = min(2*(d[0]+d[1]), sum(d)) print(mi) if __name__ == '__main__': main()
Title: Patrick and Shopping Time Limit: None seconds Memory Limit: None megabytes Problem Description: Today Patrick waits for a visit from his friend Spongebob. To prepare for the visit, Patrick needs to buy some goodies in two stores located near his house. There is a *d*1 meter long road between his house and the first shop and a *d*2 meter long road between his house and the second shop. Also, there is a road of length *d*3 directly connecting these two shops to each other. Help Patrick calculate the minimum distance that he needs to walk in order to go to both shops and return to his house. Patrick always starts at his house. He should visit both shops moving only along the three existing roads and return back to his house. He doesn't mind visiting the same shop or passing the same road multiple times. The only goal is to minimize the total distance traveled. Input Specification: The first line of the input contains three integers *d*1, *d*2, *d*3 (1<=≀<=*d*1,<=*d*2,<=*d*3<=≀<=108)Β β€” the lengths of the paths. - *d*1 is the length of the path connecting Patrick's house and the first shop; - *d*2 is the length of the path connecting Patrick's house and the second shop; - *d*3 is the length of the path connecting both shops. Output Specification: Print the minimum distance that Patrick will have to walk in order to visit both shops and return to his house. Demo Input: ['10 20 30\n', '1 1 5\n'] Demo Output: ['60\n', '4\n'] Note: The first sample is shown on the picture in the problem statement. One of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house. In the second sample one of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
```python ''' Author : knight_byte File : A_Patrick_and_Shopping.py Created on : 2021-04-19 14:15:35 ''' def main(): d = sorted(list(map(int, input().split()))) mi = min(2*(d[0]+d[1]), sum(d)) print(mi) if __name__ == '__main__': main() ```
3
439
A
Devu, the Singer and Churu, the Joker
PROGRAMMING
900
[ "greedy", "implementation" ]
null
null
Devu is a renowned classical singer. He is invited to many big functions/festivals. Recently he was invited to "All World Classical Singing Festival". Other than Devu, comedian Churu was also invited. Devu has provided organizers a list of the songs and required time for singing them. He will sing *n* songs, *i**th* song will take *t**i* minutes exactly. The Comedian, Churu will crack jokes. All his jokes are of 5 minutes exactly. People have mainly come to listen Devu. But you know that he needs rest of 10 minutes after each song. On the other hand, Churu being a very active person, doesn't need any rest. You as one of the organizers should make an optimal sсhedule for the event. For some reasons you must follow the conditions: - The duration of the event must be no more than *d* minutes; - Devu must complete all his songs; - With satisfying the two previous conditions the number of jokes cracked by Churu should be as many as possible. If it is not possible to find a way to conduct all the songs of the Devu, output -1. Otherwise find out maximum number of jokes that Churu can crack in the grand event.
The first line contains two space separated integers *n*, *d* (1<=≀<=*n*<=≀<=100;Β 1<=≀<=*d*<=≀<=10000). The second line contains *n* space-separated integers: *t*1,<=*t*2,<=...,<=*t**n* (1<=≀<=*t**i*<=≀<=100).
If there is no way to conduct all the songs of Devu, output -1. Otherwise output the maximum number of jokes that Churu can crack in the grand event.
[ "3 30\n2 2 1\n", "3 20\n2 1 1\n" ]
[ "5\n", "-1\n" ]
Consider the first example. The duration of the event is 30 minutes. There could be maximum 5 jokes in the following way: - First Churu cracks a joke in 5 minutes. - Then Devu performs the first song for 2 minutes. - Then Churu cracks 2 jokes in 10 minutes. - Now Devu performs second song for 2 minutes. - Then Churu cracks 2 jokes in 10 minutes. - Now finally Devu will perform his last song in 1 minutes. Total time spent is 5 + 2 + 10 + 2 + 10 + 1 = 30 minutes. Consider the second example. There is no way of organizing Devu's all songs. Hence the answer is -1.
500
[ { "input": "3 30\n2 2 1", "output": "5" }, { "input": "3 20\n2 1 1", "output": "-1" }, { "input": "50 10000\n5 4 10 9 9 6 7 7 7 3 3 7 7 4 7 4 10 10 1 7 10 3 1 4 5 7 2 10 10 10 2 3 4 7 6 1 8 4 7 3 8 8 4 10 1 1 9 2 6 1", "output": "1943" }, { "input": "50 10000\n4 7 15 9 11 12 20 9 14 14 10 13 6 13 14 17 6 8 20 12 10 15 13 17 5 12 13 11 7 5 5 2 3 15 13 7 14 14 19 2 13 14 5 15 3 19 15 16 4 1", "output": "1891" }, { "input": "100 9000\n5 2 3 1 1 3 4 9 9 6 7 10 10 10 2 10 6 8 8 6 7 9 9 5 6 2 1 10 10 9 4 5 9 2 4 3 8 5 6 1 1 5 3 6 2 6 6 6 5 8 3 6 7 3 1 10 9 1 8 3 10 9 5 6 3 4 1 1 10 10 2 3 4 8 10 10 5 1 5 3 6 8 10 6 10 2 1 8 10 1 7 6 9 10 5 2 3 5 3 2", "output": "1688" }, { "input": "100 8007\n5 19 14 18 9 6 15 8 1 14 11 20 3 17 7 12 2 6 3 17 7 20 1 14 20 17 2 10 13 7 18 18 9 10 16 8 1 11 11 9 13 18 9 20 12 12 7 15 12 17 11 5 11 15 9 2 15 1 18 3 18 16 15 4 10 5 18 13 13 12 3 8 17 2 12 2 13 3 1 13 2 4 9 10 18 10 14 4 4 17 12 19 2 9 6 5 5 20 18 12", "output": "1391" }, { "input": "39 2412\n1 1 1 1 1 1 26 1 1 1 99 1 1 1 1 1 1 1 1 1 1 88 7 1 1 1 1 76 1 1 1 93 40 1 13 1 68 1 32", "output": "368" }, { "input": "39 2617\n47 1 1 1 63 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 70 1 99 63 1 1 1 1 1 1 1 1 64 1 1", "output": "435" }, { "input": "39 3681\n83 77 1 94 85 47 1 98 29 16 1 1 1 71 96 85 31 97 96 93 40 50 98 1 60 51 1 96 100 72 1 1 1 89 1 93 1 92 100", "output": "326" }, { "input": "45 894\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 28 28 1 1 1 1 1 1 1 1 1 1 1 1 1 1 99 3 1 1", "output": "139" }, { "input": "45 4534\n1 99 65 99 4 46 54 80 51 30 96 1 28 30 44 70 78 1 1 100 1 62 1 1 1 85 1 1 1 61 1 46 75 1 61 77 97 26 67 1 1 63 81 85 86", "output": "514" }, { "input": "72 3538\n52 1 8 1 1 1 7 1 1 1 1 48 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 40 1 1 38 1 1 1 1 1 1 1 1 1 1 1 35 1 93 79 1 1 1 1 1 1 1 1 1 51 1 1 1 1 1 1 1 1 1 1 1 1 96 1", "output": "586" }, { "input": "81 2200\n1 59 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 93 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 50 1 1 1 1 1 1 1 1 1 1 1", "output": "384" }, { "input": "81 2577\n85 91 1 1 2 1 1 100 1 80 1 1 17 86 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 37 1 66 24 1 1 96 49 1 66 1 44 1 1 1 1 98 1 1 1 1 35 1 37 3 35 1 1 87 64 1 24 1 58 1 1 42 83 5 1 1 1 1 1 95 1 94 1 50 1 1", "output": "174" }, { "input": "81 4131\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 16 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "807" }, { "input": "81 6315\n1 1 67 100 1 99 36 1 92 5 1 96 42 12 1 57 91 1 1 66 41 30 74 95 1 37 1 39 91 69 1 52 77 47 65 1 1 93 96 74 90 35 85 76 71 92 92 1 1 67 92 74 1 1 86 76 35 1 56 16 27 57 37 95 1 40 20 100 51 1 80 60 45 79 95 1 46 1 25 100 96", "output": "490" }, { "input": "96 1688\n1 1 1 1 1 1 1 1 1 1 1 1 1 2 1 1 45 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 25 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 71 1 1 1 30 1 1 1", "output": "284" }, { "input": "96 8889\n1 1 18 1 1 1 1 1 1 1 1 1 99 1 1 1 1 88 1 45 1 1 1 1 1 1 1 1 1 1 1 1 1 1 96 1 1 1 1 21 1 1 1 1 1 1 1 73 1 1 1 1 1 10 1 1 1 1 1 1 1 46 43 1 1 1 1 1 98 1 1 1 1 1 1 6 1 1 1 1 1 74 1 25 1 55 1 1 1 13 1 1 54 1 1 1", "output": "1589" }, { "input": "10 100\n1 1 1 1 1 1 1 1 1 1", "output": "18" }, { "input": "100 10000\n54 46 72 94 79 83 91 54 73 3 24 55 54 31 28 20 19 6 25 19 47 23 1 70 15 87 51 39 54 77 55 5 60 3 15 99 56 88 22 78 79 21 38 27 28 86 7 88 12 59 55 70 25 1 70 49 1 45 69 72 50 17 4 56 8 100 90 34 35 20 61 76 88 79 4 74 65 68 75 26 40 72 59 94 10 67 96 85 29 90 47 24 44 1 66 93 55 36 1 99", "output": "1017" }, { "input": "100 6000\n41 31 23 17 24 78 26 96 93 48 46 2 49 33 35 9 73 100 34 48 83 36 33 69 43 24 3 74 8 81 27 33 94 38 77 9 76 90 62 90 21 67 22 22 12 2 17 27 61 18 72 85 59 65 71 38 90 75 74 66 60 47 58 50 90 95 75 10 5 100 97 29 83 88 65 26 93 90 22 98 36 55 70 38 50 92 88 72 99 96 25 14 74 16 25 92 67 94 77 96", "output": "-1" }, { "input": "1 1\n1", "output": "0" }, { "input": "1 6\n1", "output": "1" }, { "input": "1 5\n1", "output": "0" }, { "input": "1 3\n4", "output": "-1" }, { "input": "3 24\n2 1 2", "output": "-1" } ]
1,576,934,787
2,147,483,647
PyPy 3
OK
TESTS
26
140
0
n,d=map(int,input().split()) l=sum(map(int,input().split())) if l+n*10-10>d: print(-1) else: print((d-l)//5)
Title: Devu, the Singer and Churu, the Joker Time Limit: None seconds Memory Limit: None megabytes Problem Description: Devu is a renowned classical singer. He is invited to many big functions/festivals. Recently he was invited to "All World Classical Singing Festival". Other than Devu, comedian Churu was also invited. Devu has provided organizers a list of the songs and required time for singing them. He will sing *n* songs, *i**th* song will take *t**i* minutes exactly. The Comedian, Churu will crack jokes. All his jokes are of 5 minutes exactly. People have mainly come to listen Devu. But you know that he needs rest of 10 minutes after each song. On the other hand, Churu being a very active person, doesn't need any rest. You as one of the organizers should make an optimal sсhedule for the event. For some reasons you must follow the conditions: - The duration of the event must be no more than *d* minutes; - Devu must complete all his songs; - With satisfying the two previous conditions the number of jokes cracked by Churu should be as many as possible. If it is not possible to find a way to conduct all the songs of the Devu, output -1. Otherwise find out maximum number of jokes that Churu can crack in the grand event. Input Specification: The first line contains two space separated integers *n*, *d* (1<=≀<=*n*<=≀<=100;Β 1<=≀<=*d*<=≀<=10000). The second line contains *n* space-separated integers: *t*1,<=*t*2,<=...,<=*t**n* (1<=≀<=*t**i*<=≀<=100). Output Specification: If there is no way to conduct all the songs of Devu, output -1. Otherwise output the maximum number of jokes that Churu can crack in the grand event. Demo Input: ['3 30\n2 2 1\n', '3 20\n2 1 1\n'] Demo Output: ['5\n', '-1\n'] Note: Consider the first example. The duration of the event is 30 minutes. There could be maximum 5 jokes in the following way: - First Churu cracks a joke in 5 minutes. - Then Devu performs the first song for 2 minutes. - Then Churu cracks 2 jokes in 10 minutes. - Now Devu performs second song for 2 minutes. - Then Churu cracks 2 jokes in 10 minutes. - Now finally Devu will perform his last song in 1 minutes. Total time spent is 5 + 2 + 10 + 2 + 10 + 1 = 30 minutes. Consider the second example. There is no way of organizing Devu's all songs. Hence the answer is -1.
```python n,d=map(int,input().split()) l=sum(map(int,input().split())) if l+n*10-10>d: print(-1) else: print((d-l)//5) ```
3
698
A
Vacations
PROGRAMMING
1,400
[ "dp" ]
null
null
Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet on that day. For the *i*-th day there are four options: 1. on this day the gym is closed and the contest is not carried out; 1. on this day the gym is closed and the contest is carried out; 1. on this day the gym is open and the contest is not carried out; 1. on this day the gym is open and the contest is carried out. On each of days Vasya can either have a rest or write the contest (if it is carried out on this day), or do sport (if the gym is open on this day). Find the minimum number of days on which Vasya will have a rest (it means, he will not do sport and write the contest at the same time). The only limitation that Vasya has β€” he does not want to do the same activity on two consecutive days: it means, he will not do sport on two consecutive days, and write the contest on two consecutive days.
The first line contains a positive integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of days of Vasya's vacations. The second line contains the sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≀<=*a**i*<=≀<=3) separated by space, where: - *a**i* equals 0, if on the *i*-th day of vacations the gym is closed and the contest is not carried out; - *a**i* equals 1, if on the *i*-th day of vacations the gym is closed, but the contest is carried out; - *a**i* equals 2, if on the *i*-th day of vacations the gym is open and the contest is not carried out; - *a**i* equals 3, if on the *i*-th day of vacations the gym is open and the contest is carried out.
Print the minimum possible number of days on which Vasya will have a rest. Remember that Vasya refuses: - to do sport on any two consecutive days, - to write the contest on any two consecutive days.
[ "4\n1 3 2 0\n", "7\n1 3 3 2 1 2 3\n", "2\n2 2\n" ]
[ "2\n", "0\n", "1\n" ]
In the first test Vasya can write the contest on the day number 1 and do sport on the day number 3. Thus, he will have a rest for only 2 days. In the second test Vasya should write contests on days number 1, 3, 5 and 7, in other days do sport. Thus, he will not have a rest for a single day. In the third test Vasya can do sport either on a day number 1 or number 2. He can not do sport in two days, because it will be contrary to the his limitation. Thus, he will have a rest for only one day.
500
[ { "input": "4\n1 3 2 0", "output": "2" }, { "input": "7\n1 3 3 2 1 2 3", "output": "0" }, { "input": "2\n2 2", "output": "1" }, { "input": "1\n0", "output": "1" }, { "input": "10\n0 0 1 1 0 0 0 0 1 0", "output": "8" }, { "input": "100\n3 2 3 3 3 2 3 1 3 2 2 3 2 3 3 3 3 3 3 1 2 2 3 1 3 3 2 2 2 3 1 0 3 3 3 2 3 3 1 1 3 1 3 3 3 1 3 1 3 0 1 3 2 3 2 1 1 3 2 3 3 3 2 3 1 3 3 3 3 2 2 2 1 3 1 3 3 3 3 1 3 2 3 3 0 3 3 3 3 3 1 0 2 1 3 3 0 2 3 3", "output": "16" }, { "input": "10\n2 3 0 1 3 1 2 2 1 0", "output": "3" }, { "input": "45\n3 3 2 3 2 3 3 3 0 3 3 3 3 3 3 3 1 3 2 3 2 3 2 2 2 3 2 3 3 3 3 3 1 2 3 3 2 2 2 3 3 3 3 1 3", "output": "6" }, { "input": "1\n1", "output": "0" }, { "input": "1\n2", "output": "0" }, { "input": "1\n3", "output": "0" }, { "input": "2\n1 1", "output": "1" }, { "input": "2\n1 3", "output": "0" }, { "input": "2\n0 1", "output": "1" }, { "input": "2\n0 0", "output": "2" }, { "input": "2\n3 3", "output": "0" }, { "input": "3\n3 3 3", "output": "0" }, { "input": "2\n3 2", "output": "0" }, { "input": "2\n0 2", "output": "1" }, { "input": "10\n2 2 3 3 3 3 2 1 3 2", "output": "2" }, { "input": "15\n0 1 0 0 0 2 0 1 0 0 0 2 0 0 0", "output": "11" }, { "input": "15\n1 3 2 2 2 3 3 3 3 2 3 2 2 1 1", "output": "4" }, { "input": "15\n3 1 3 2 3 2 2 2 3 3 3 3 2 3 2", "output": "3" }, { "input": "20\n0 2 0 1 0 0 0 1 2 0 1 1 1 0 1 1 0 1 1 0", "output": "12" }, { "input": "20\n2 3 2 3 3 3 3 2 0 3 1 1 2 3 0 3 2 3 0 3", "output": "5" }, { "input": "20\n3 3 3 3 2 3 3 2 1 3 3 2 2 2 3 2 2 2 2 2", "output": "4" }, { "input": "25\n0 0 1 0 0 1 0 0 1 0 0 1 0 2 0 0 2 0 0 1 0 2 0 1 1", "output": "16" }, { "input": "25\n1 3 3 2 2 3 3 3 3 3 1 2 2 3 2 0 2 1 0 1 3 2 2 3 3", "output": "5" }, { "input": "25\n2 3 1 3 3 2 1 3 3 3 1 3 3 1 3 2 3 3 1 3 3 3 2 3 3", "output": "3" }, { "input": "30\n0 0 1 0 1 0 1 1 0 0 0 0 0 0 1 0 0 1 1 0 0 2 0 0 1 1 2 0 0 0", "output": "22" }, { "input": "30\n1 1 3 2 2 0 3 2 3 3 1 2 0 1 1 2 3 3 2 3 1 3 2 3 0 2 0 3 3 2", "output": "9" }, { "input": "30\n1 2 3 2 2 3 3 3 3 3 3 3 3 3 3 1 2 2 3 2 3 3 3 2 1 3 3 3 1 3", "output": "2" }, { "input": "35\n0 1 1 0 0 2 0 0 1 0 0 0 1 0 1 0 1 0 0 0 1 2 1 0 2 2 1 0 1 0 1 1 1 0 0", "output": "21" }, { "input": "35\n2 2 0 3 2 2 0 3 3 1 1 3 3 1 2 2 0 2 2 2 2 3 1 0 2 1 3 2 2 3 2 3 3 1 2", "output": "11" }, { "input": "35\n1 2 2 3 3 3 3 3 2 2 3 3 2 3 3 2 3 2 3 3 2 2 2 3 3 2 3 3 3 1 3 3 2 2 2", "output": "7" }, { "input": "40\n2 0 1 1 0 0 0 0 2 0 1 1 1 0 0 1 0 0 0 0 0 2 0 0 0 2 1 1 1 3 0 0 0 0 0 0 0 1 1 0", "output": "28" }, { "input": "40\n2 2 3 2 0 2 3 2 1 2 3 0 2 3 2 1 1 3 1 1 0 2 3 1 3 3 1 1 3 3 2 2 1 3 3 3 2 3 3 1", "output": "10" }, { "input": "40\n1 3 2 3 3 2 3 3 2 2 3 1 2 1 2 2 3 1 2 2 1 2 2 2 1 2 2 3 2 3 2 3 2 3 3 3 1 3 2 3", "output": "8" }, { "input": "45\n2 1 0 0 0 2 1 0 1 0 0 2 2 1 1 0 0 2 0 0 0 0 0 0 1 0 0 2 0 0 1 1 0 0 1 0 0 1 1 2 0 0 2 0 2", "output": "29" }, { "input": "45\n3 3 2 3 3 3 2 2 3 2 3 1 3 2 3 2 2 1 1 3 2 3 2 1 3 1 2 3 2 2 0 3 3 2 3 2 3 2 3 2 0 3 1 1 3", "output": "8" }, { "input": "50\n3 0 0 0 2 0 0 0 0 0 0 0 2 1 0 2 0 1 0 1 3 0 2 1 1 0 0 1 1 0 0 1 2 1 1 2 1 1 0 0 0 0 0 0 0 1 2 2 0 0", "output": "32" }, { "input": "50\n3 3 3 3 1 0 3 3 0 2 3 1 1 1 3 2 3 3 3 3 3 1 0 1 2 2 3 3 2 3 0 0 0 2 1 0 1 2 2 2 2 0 2 2 2 1 2 3 3 2", "output": "16" }, { "input": "50\n3 2 3 1 2 1 2 3 3 2 3 3 2 1 3 3 3 3 3 3 2 3 2 3 2 2 3 3 3 2 3 3 3 3 2 3 1 2 3 3 2 3 3 1 2 2 1 1 3 3", "output": "7" }, { "input": "55\n0 0 1 1 0 1 0 0 1 0 1 0 0 0 2 0 0 1 0 0 0 1 0 0 0 0 3 1 0 0 0 1 0 0 0 0 2 0 0 0 2 0 2 1 0 0 0 0 0 0 0 0 2 0 0", "output": "40" }, { "input": "55\n3 0 3 3 3 2 0 2 3 0 3 2 3 3 0 3 3 1 3 3 1 2 3 2 0 3 3 2 1 2 3 2 3 0 3 2 2 1 2 3 2 2 1 3 2 2 3 1 3 2 2 3 3 2 2", "output": "13" }, { "input": "55\n3 3 1 3 2 3 2 3 2 2 3 3 3 3 3 1 1 3 3 2 3 2 3 2 0 1 3 3 3 3 2 3 2 3 1 1 2 2 2 3 3 3 3 3 2 2 2 3 2 3 3 3 3 1 3", "output": "7" }, { "input": "60\n0 1 0 0 0 0 0 0 0 2 1 1 3 0 0 0 0 0 1 0 1 1 0 0 0 3 0 1 0 1 0 2 0 0 0 0 0 1 0 0 0 0 1 1 0 1 0 0 0 0 0 1 0 0 1 0 1 0 0 0", "output": "44" }, { "input": "60\n3 2 1 3 2 2 3 3 3 1 1 3 2 2 3 3 1 3 2 2 3 3 2 2 2 2 0 2 2 3 2 3 0 3 3 3 2 3 3 0 1 3 2 1 3 1 1 2 1 3 1 1 2 2 1 3 3 3 2 2", "output": "15" }, { "input": "60\n3 2 2 3 2 3 2 3 3 2 3 2 3 3 2 3 3 3 3 3 3 2 3 3 1 2 3 3 3 2 1 3 3 1 3 1 3 0 3 3 3 2 3 2 3 2 3 3 1 1 2 3 3 3 3 2 1 3 2 3", "output": "8" }, { "input": "65\n1 0 2 1 1 0 1 0 0 0 0 0 0 0 0 1 1 1 1 1 1 1 0 1 2 0 2 1 0 2 1 0 1 0 1 1 0 1 1 1 2 1 0 1 0 0 0 0 1 2 2 1 0 0 1 2 1 2 0 2 0 0 0 1 1", "output": "35" }, { "input": "65\n2 2 2 3 0 2 1 2 3 3 1 3 1 2 1 3 2 3 2 2 2 1 2 0 3 1 3 1 1 3 1 3 3 3 3 3 1 3 0 3 1 3 1 2 2 3 2 0 3 1 3 2 1 2 2 2 3 3 2 3 3 3 2 2 3", "output": "13" }, { "input": "65\n3 2 3 3 3 2 3 2 3 3 3 3 3 3 3 3 3 2 3 2 3 2 2 3 3 3 3 3 2 2 2 3 3 2 3 3 2 3 3 3 3 2 3 3 3 2 2 3 3 3 3 3 3 2 2 3 3 2 3 3 1 3 3 3 3", "output": "6" }, { "input": "70\n1 0 0 0 1 0 1 0 0 0 1 1 0 1 0 0 1 1 1 0 1 1 0 0 1 1 1 3 1 1 0 1 2 0 2 1 0 0 0 1 1 1 1 1 0 0 1 0 0 0 1 1 1 3 0 0 1 0 0 0 1 0 0 0 0 0 1 0 1 1", "output": "43" }, { "input": "70\n2 3 3 3 1 3 3 1 2 1 1 2 2 3 0 2 3 3 1 3 3 2 2 3 3 3 2 2 2 2 1 3 3 0 2 1 1 3 2 3 3 2 2 3 1 3 1 2 3 2 3 3 2 2 2 3 1 1 2 1 3 3 2 2 3 3 3 1 1 1", "output": "16" }, { "input": "70\n3 3 2 2 1 2 1 2 2 2 2 2 3 3 2 3 3 3 3 2 2 2 2 3 3 3 1 3 3 3 2 3 3 3 3 2 3 3 1 3 1 3 2 3 3 2 3 3 3 2 3 2 3 3 1 2 3 3 2 2 2 3 2 3 3 3 3 3 3 1", "output": "10" }, { "input": "75\n1 0 0 1 1 0 0 1 0 1 2 0 0 2 1 1 0 0 0 0 0 0 2 1 1 0 0 0 0 1 0 1 0 1 1 1 0 1 0 0 1 0 0 0 0 0 0 1 1 0 0 1 2 1 0 0 0 0 0 0 0 1 0 0 0 1 0 0 0 1 1 1 0 1 0", "output": "51" }, { "input": "75\n1 3 3 3 1 1 3 2 3 3 1 3 3 3 2 1 3 2 2 3 1 1 1 1 1 1 2 3 3 3 3 3 3 2 3 3 3 3 3 2 3 3 2 2 2 1 2 3 3 2 2 3 0 1 1 3 3 0 0 1 1 3 2 3 3 3 3 1 2 2 3 3 3 3 1", "output": "16" }, { "input": "75\n3 3 3 3 2 2 3 2 2 3 2 2 1 2 3 3 2 2 3 3 1 2 2 2 1 3 3 3 1 2 2 3 3 3 2 3 2 2 2 3 3 1 3 2 2 3 3 3 0 3 2 1 3 3 2 3 3 3 3 1 2 3 3 3 2 2 3 3 3 3 2 2 3 3 1", "output": "11" }, { "input": "80\n0 0 0 0 2 0 1 1 1 1 1 0 0 0 0 2 0 0 1 0 0 0 0 1 1 0 2 2 1 1 0 1 0 1 0 1 1 1 0 1 2 1 1 0 0 0 1 1 0 1 1 0 1 0 0 1 0 0 1 0 0 0 0 0 0 0 2 2 0 1 1 0 0 0 0 0 0 0 0 1", "output": "56" }, { "input": "80\n2 2 3 3 2 1 0 1 0 3 2 2 3 2 1 3 1 3 3 2 3 3 3 2 3 3 3 2 1 3 3 1 3 3 3 3 3 3 2 2 2 1 3 2 1 3 2 1 1 0 1 1 2 1 3 0 1 2 3 2 2 3 2 3 1 3 3 2 1 1 0 3 3 3 3 1 2 1 2 0", "output": "17" }, { "input": "80\n2 3 3 2 2 2 3 3 2 3 3 3 3 3 2 3 2 3 2 3 3 3 3 3 3 3 3 3 2 3 1 3 2 3 3 0 3 1 2 3 3 1 2 3 2 3 3 2 3 3 3 3 3 2 2 3 0 3 3 3 3 3 2 2 3 2 3 3 3 3 3 2 3 2 3 3 3 3 2 3", "output": "9" }, { "input": "85\n0 1 1 0 0 0 0 0 0 1 0 0 0 1 0 0 0 0 2 0 1 0 0 2 0 1 1 0 0 0 0 2 2 0 0 0 1 0 0 0 1 2 0 1 0 0 0 2 1 1 2 0 3 1 0 2 2 1 0 0 1 1 0 0 0 0 1 0 2 1 1 2 1 0 0 1 2 1 2 0 0 1 0 1 0", "output": "54" }, { "input": "85\n2 3 1 3 2 3 1 3 3 2 1 2 1 2 2 3 2 2 3 2 0 3 3 2 1 2 2 2 3 3 2 3 3 3 2 1 1 3 1 3 2 2 2 3 3 2 3 2 3 1 1 3 2 3 1 3 3 2 3 3 2 2 3 0 1 1 2 2 2 2 1 2 3 1 3 3 1 3 2 2 3 2 3 3 3", "output": "19" }, { "input": "85\n1 2 1 2 3 2 3 3 3 3 3 3 3 2 1 3 2 3 3 3 3 2 3 3 3 1 3 3 3 3 2 3 3 3 3 3 3 2 2 1 3 3 3 3 2 2 3 1 1 2 3 3 3 2 3 3 3 3 3 2 3 3 3 2 2 3 3 1 1 1 3 3 3 3 1 3 3 3 1 3 3 1 3 2 3", "output": "9" }, { "input": "90\n2 0 1 0 0 0 0 0 0 1 1 2 0 0 0 0 0 0 0 2 2 0 2 0 0 2 1 0 2 0 1 0 1 0 0 1 2 2 0 0 1 0 0 1 0 1 0 2 0 1 1 1 0 1 1 0 1 0 2 0 1 0 1 0 0 0 1 0 0 1 2 0 0 0 1 0 0 2 2 0 0 0 0 0 1 3 1 1 0 1", "output": "57" }, { "input": "90\n2 3 3 3 2 3 2 1 3 0 3 2 3 3 2 1 3 3 2 3 2 3 3 2 1 3 1 3 3 1 2 2 3 3 2 1 2 3 2 3 0 3 3 2 2 3 1 0 3 3 1 3 3 3 3 2 1 2 2 1 3 2 1 3 3 1 2 0 2 2 3 2 2 3 3 3 1 3 2 1 2 3 3 2 3 2 3 3 2 1", "output": "17" }, { "input": "90\n2 3 2 3 2 2 3 3 2 3 2 1 2 3 3 3 2 3 2 3 3 2 3 3 3 1 3 3 1 3 2 3 2 2 1 3 3 3 3 3 3 3 3 3 3 2 3 2 3 2 1 3 3 3 3 2 2 3 3 3 3 3 3 3 3 3 3 3 3 2 2 3 3 3 3 1 3 2 3 3 3 2 2 3 2 3 2 1 3 2", "output": "9" }, { "input": "95\n0 0 3 0 2 0 1 0 0 2 0 0 0 0 0 0 0 1 0 0 0 2 0 0 0 0 0 1 0 0 2 1 0 0 1 0 0 0 1 0 0 0 0 1 0 1 0 0 1 0 1 2 0 1 2 2 0 0 1 0 2 0 0 0 1 0 2 1 2 1 0 1 0 0 0 1 0 0 1 1 2 1 1 1 1 2 0 0 0 0 0 1 1 0 1", "output": "61" }, { "input": "95\n2 3 3 2 1 1 3 3 3 2 3 3 3 2 3 2 3 3 3 2 3 2 2 3 3 2 1 2 3 3 3 1 3 0 3 3 1 3 3 1 0 1 3 3 3 0 2 1 3 3 3 3 0 1 3 2 3 3 2 1 3 1 2 1 1 2 3 0 3 3 2 1 3 2 1 3 3 3 2 2 3 2 3 3 3 2 1 3 3 3 2 3 3 1 2", "output": "15" }, { "input": "95\n2 3 3 2 3 2 2 1 3 1 2 1 2 3 1 2 3 3 1 3 3 3 1 2 3 2 2 2 2 3 3 3 2 2 3 3 3 3 3 1 2 2 3 3 3 3 2 3 2 2 2 3 3 2 3 3 3 3 3 3 3 0 3 2 0 3 3 1 3 3 3 2 3 2 3 2 3 3 3 3 2 2 1 1 3 3 3 3 3 1 3 3 3 3 2", "output": "14" }, { "input": "100\n1 0 2 0 0 0 0 2 0 0 0 1 0 1 0 0 1 0 1 2 0 1 1 0 0 1 0 1 1 0 0 0 2 0 1 0 0 2 0 0 0 0 0 1 1 1 0 0 1 0 2 0 0 0 0 1 0 1 0 1 0 1 0 1 2 2 0 0 2 0 1 0 1 0 1 0 0 0 1 0 0 2 1 1 1 0 0 1 0 0 0 2 0 0 2 1 1 0 0 2", "output": "63" }, { "input": "100\n3 2 1 3 2 3 2 3 2 2 3 1 3 3 3 3 3 2 2 3 2 2 3 2 3 3 3 2 3 1 2 1 3 3 3 3 1 3 3 3 3 3 2 3 2 1 3 3 1 2 2 3 1 3 3 1 2 2 1 3 1 3 2 2 3 3 1 3 2 3 1 2 1 2 3 3 2 2 1 2 3 3 3 3 3 1 3 3 3 3 2 1 3 0 3 3 3 2 3 3", "output": "15" }, { "input": "100\n1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2", "output": "0" }, { "input": "100\n3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3", "output": "0" }, { "input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "50" }, { "input": "100\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2", "output": "50" }, { "input": "99\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "49" }, { "input": "100\n2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1 2 1", "output": "0" }, { "input": "100\n0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0", "output": "100" }, { "input": "2\n0 3", "output": "1" }, { "input": "2\n1 0", "output": "1" }, { "input": "2\n1 2", "output": "0" }, { "input": "2\n2 0", "output": "1" }, { "input": "2\n2 1", "output": "0" }, { "input": "2\n2 3", "output": "0" }, { "input": "2\n3 0", "output": "1" }, { "input": "2\n3 1", "output": "0" }, { "input": "100\n3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0 3 0", "output": "50" } ]
1,651,869,976
2,147,483,647
Python 3
OK
TESTS
88
46
0
n = int(input()) a = list(map(int, input().split())) dp = [[0,0,0] for _ in range(n)] for i in range(n): dp[i][0] = max(dp[i-1]) dp[i][1] = max(dp[i-1][0], dp[i-1][2]) dp[i][2] = max(dp[i-1][0], dp[i-1][1]) if a[i] == 1: dp[i][2]+=1 elif a[i] == 2: dp[i][1]+=1 elif a[i] == 3: dp[i][1]+=1 dp[i][2]+=1 print(n-max(dp[-1]))
Title: Vacations Time Limit: None seconds Memory Limit: None megabytes Problem Description: Vasya has *n* days of vacations! So he decided to improve his IT skills and do sport. Vasya knows the following information about each of this *n* days: whether that gym opened and whether a contest was carried out in the Internet on that day. For the *i*-th day there are four options: 1. on this day the gym is closed and the contest is not carried out; 1. on this day the gym is closed and the contest is carried out; 1. on this day the gym is open and the contest is not carried out; 1. on this day the gym is open and the contest is carried out. On each of days Vasya can either have a rest or write the contest (if it is carried out on this day), or do sport (if the gym is open on this day). Find the minimum number of days on which Vasya will have a rest (it means, he will not do sport and write the contest at the same time). The only limitation that Vasya has β€” he does not want to do the same activity on two consecutive days: it means, he will not do sport on two consecutive days, and write the contest on two consecutive days. Input Specification: The first line contains a positive integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of days of Vasya's vacations. The second line contains the sequence of integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≀<=*a**i*<=≀<=3) separated by space, where: - *a**i* equals 0, if on the *i*-th day of vacations the gym is closed and the contest is not carried out; - *a**i* equals 1, if on the *i*-th day of vacations the gym is closed, but the contest is carried out; - *a**i* equals 2, if on the *i*-th day of vacations the gym is open and the contest is not carried out; - *a**i* equals 3, if on the *i*-th day of vacations the gym is open and the contest is carried out. Output Specification: Print the minimum possible number of days on which Vasya will have a rest. Remember that Vasya refuses: - to do sport on any two consecutive days, - to write the contest on any two consecutive days. Demo Input: ['4\n1 3 2 0\n', '7\n1 3 3 2 1 2 3\n', '2\n2 2\n'] Demo Output: ['2\n', '0\n', '1\n'] Note: In the first test Vasya can write the contest on the day number 1 and do sport on the day number 3. Thus, he will have a rest for only 2 days. In the second test Vasya should write contests on days number 1, 3, 5 and 7, in other days do sport. Thus, he will not have a rest for a single day. In the third test Vasya can do sport either on a day number 1 or number 2. He can not do sport in two days, because it will be contrary to the his limitation. Thus, he will have a rest for only one day.
```python n = int(input()) a = list(map(int, input().split())) dp = [[0,0,0] for _ in range(n)] for i in range(n): dp[i][0] = max(dp[i-1]) dp[i][1] = max(dp[i-1][0], dp[i-1][2]) dp[i][2] = max(dp[i-1][0], dp[i-1][1]) if a[i] == 1: dp[i][2]+=1 elif a[i] == 2: dp[i][1]+=1 elif a[i] == 3: dp[i][1]+=1 dp[i][2]+=1 print(n-max(dp[-1])) ```
3
599
A
Patrick and Shopping
PROGRAMMING
800
[ "implementation" ]
null
null
Today Patrick waits for a visit from his friend Spongebob. To prepare for the visit, Patrick needs to buy some goodies in two stores located near his house. There is a *d*1 meter long road between his house and the first shop and a *d*2 meter long road between his house and the second shop. Also, there is a road of length *d*3 directly connecting these two shops to each other. Help Patrick calculate the minimum distance that he needs to walk in order to go to both shops and return to his house. Patrick always starts at his house. He should visit both shops moving only along the three existing roads and return back to his house. He doesn't mind visiting the same shop or passing the same road multiple times. The only goal is to minimize the total distance traveled.
The first line of the input contains three integers *d*1, *d*2, *d*3 (1<=≀<=*d*1,<=*d*2,<=*d*3<=≀<=108)Β β€” the lengths of the paths. - *d*1 is the length of the path connecting Patrick's house and the first shop; - *d*2 is the length of the path connecting Patrick's house and the second shop; - *d*3 is the length of the path connecting both shops.
Print the minimum distance that Patrick will have to walk in order to visit both shops and return to his house.
[ "10 20 30\n", "1 1 5\n" ]
[ "60\n", "4\n" ]
The first sample is shown on the picture in the problem statement. One of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house. In the second sample one of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
500
[ { "input": "10 20 30", "output": "60" }, { "input": "1 1 5", "output": "4" }, { "input": "100 33 34", "output": "134" }, { "input": "777 777 777", "output": "2331" }, { "input": "2 2 8", "output": "8" }, { "input": "12 34 56", "output": "92" }, { "input": "789 101112 131415", "output": "203802" }, { "input": "27485716 99999999 35182", "output": "55041796" }, { "input": "1 293548 5", "output": "12" }, { "input": "12059 259855 5874875", "output": "543828" }, { "input": "46981 105809 585858", "output": "305580" }, { "input": "9889 1221 2442", "output": "7326" }, { "input": "100500 200600 300700", "output": "601800" }, { "input": "318476 318476 318476", "output": "955428" }, { "input": "23985 3353 75633", "output": "54676" }, { "input": "120 1298 2222", "output": "2836" }, { "input": "98437 23487 666672", "output": "243848" }, { "input": "100000000 100000000 100000000", "output": "300000000" }, { "input": "2 5 2", "output": "8" }, { "input": "1 1000 1", "output": "4" }, { "input": "1 100000000 1", "output": "4" } ]
1,674,158,221
2,147,483,647
Python 3
OK
TESTS
21
46
0
d1, d2, d3 = map(int, input().split()) path1 = d1 + d2 + d3 path2 = (d1 + d2) * 2 path3 = (d1 + d3) * 2 path4 = (d2 + d3) * 2 print(min(path1, path2, path3, path4))
Title: Patrick and Shopping Time Limit: None seconds Memory Limit: None megabytes Problem Description: Today Patrick waits for a visit from his friend Spongebob. To prepare for the visit, Patrick needs to buy some goodies in two stores located near his house. There is a *d*1 meter long road between his house and the first shop and a *d*2 meter long road between his house and the second shop. Also, there is a road of length *d*3 directly connecting these two shops to each other. Help Patrick calculate the minimum distance that he needs to walk in order to go to both shops and return to his house. Patrick always starts at his house. He should visit both shops moving only along the three existing roads and return back to his house. He doesn't mind visiting the same shop or passing the same road multiple times. The only goal is to minimize the total distance traveled. Input Specification: The first line of the input contains three integers *d*1, *d*2, *d*3 (1<=≀<=*d*1,<=*d*2,<=*d*3<=≀<=108)Β β€” the lengths of the paths. - *d*1 is the length of the path connecting Patrick's house and the first shop; - *d*2 is the length of the path connecting Patrick's house and the second shop; - *d*3 is the length of the path connecting both shops. Output Specification: Print the minimum distance that Patrick will have to walk in order to visit both shops and return to his house. Demo Input: ['10 20 30\n', '1 1 5\n'] Demo Output: ['60\n', '4\n'] Note: The first sample is shown on the picture in the problem statement. One of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house. In the second sample one of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
```python d1, d2, d3 = map(int, input().split()) path1 = d1 + d2 + d3 path2 = (d1 + d2) * 2 path3 = (d1 + d3) * 2 path4 = (d2 + d3) * 2 print(min(path1, path2, path3, path4)) ```
3
6
C
Alice, Bob and Chocolate
PROGRAMMING
1,200
[ "greedy", "two pointers" ]
C. Alice, Bob and Chocolate
2
64
Alice and Bob like games. And now they are ready to start a new game. They have placed *n* chocolate bars in a line. Alice starts to eat chocolate bars one by one from left to right, and Bob β€” from right to left. For each chocololate bar the time, needed for the player to consume it, is known (Alice and Bob eat them with equal speed). When the player consumes a chocolate bar, he immediately starts with another. It is not allowed to eat two chocolate bars at the same time, to leave the bar unfinished and to make pauses. If both players start to eat the same bar simultaneously, Bob leaves it to Alice as a true gentleman. How many bars each of the players will consume?
The first line contains one integer *n* (1<=≀<=*n*<=≀<=105) β€” the amount of bars on the table. The second line contains a sequence *t*1,<=*t*2,<=...,<=*t**n* (1<=≀<=*t**i*<=≀<=1000), where *t**i* is the time (in seconds) needed to consume the *i*-th bar (in the order from left to right).
Print two numbers *a* and *b*, where *a* is the amount of bars consumed by Alice, and *b* is the amount of bars consumed by Bob.
[ "5\n2 9 8 2 7\n" ]
[ "2 3\n" ]
none
0
[ { "input": "5\n2 9 8 2 7", "output": "2 3" }, { "input": "1\n1", "output": "1 0" }, { "input": "2\n1 1", "output": "1 1" }, { "input": "3\n1 1 1", "output": "2 1" }, { "input": "4\n1 1 1 1", "output": "2 2" }, { "input": "1\n6", "output": "1 0" }, { "input": "2\n8 2", "output": "1 1" }, { "input": "3\n6 8 4", "output": "1 2" }, { "input": "4\n4 3 2 8", "output": "3 1" }, { "input": "5\n1 9 8 2 7", "output": "2 3" }, { "input": "6\n1 4 7 3 2 1", "output": "3 3" }, { "input": "11\n7 9 1 8 7 1 7 1 4 8 1", "output": "4 7" }, { "input": "12\n4 2 7 1 9 5 6 2 7 8 5 7", "output": "7 5" }, { "input": "13\n9 9 9 9 9 9 9 9 9 9 9 9 9", "output": "7 6" } ]
1,611,675,671
2,147,483,647
Python 3
OK
TESTS
40
280
7,270,400
n=int(input()) choco=list(map(int,input().split())) i,j=0,n-1 if(n==1): print(1,0) else: a,b=0,0 sumA,sumB=0,0 while(i<=j): if(i==j and sumA<=sumB): sumA+=choco[i] a+=1 i+=1 elif((sumA==0 or sumA<=sumB) ): sumA+=choco[i] a+=1 i+=1 elif((sumB==0 or sumB<=sumA)): sumB+=choco[j] j-=1 b+=1 print(a,b)
Title: Alice, Bob and Chocolate Time Limit: 2 seconds Memory Limit: 64 megabytes Problem Description: Alice and Bob like games. And now they are ready to start a new game. They have placed *n* chocolate bars in a line. Alice starts to eat chocolate bars one by one from left to right, and Bob β€” from right to left. For each chocololate bar the time, needed for the player to consume it, is known (Alice and Bob eat them with equal speed). When the player consumes a chocolate bar, he immediately starts with another. It is not allowed to eat two chocolate bars at the same time, to leave the bar unfinished and to make pauses. If both players start to eat the same bar simultaneously, Bob leaves it to Alice as a true gentleman. How many bars each of the players will consume? Input Specification: The first line contains one integer *n* (1<=≀<=*n*<=≀<=105) β€” the amount of bars on the table. The second line contains a sequence *t*1,<=*t*2,<=...,<=*t**n* (1<=≀<=*t**i*<=≀<=1000), where *t**i* is the time (in seconds) needed to consume the *i*-th bar (in the order from left to right). Output Specification: Print two numbers *a* and *b*, where *a* is the amount of bars consumed by Alice, and *b* is the amount of bars consumed by Bob. Demo Input: ['5\n2 9 8 2 7\n'] Demo Output: ['2 3\n'] Note: none
```python n=int(input()) choco=list(map(int,input().split())) i,j=0,n-1 if(n==1): print(1,0) else: a,b=0,0 sumA,sumB=0,0 while(i<=j): if(i==j and sumA<=sumB): sumA+=choco[i] a+=1 i+=1 elif((sumA==0 or sumA<=sumB) ): sumA+=choco[i] a+=1 i+=1 elif((sumB==0 or sumB<=sumA)): sumB+=choco[j] j-=1 b+=1 print(a,b) ```
3.875831
622
B
The Time
PROGRAMMING
900
[ "implementation" ]
null
null
You are given the current time in 24-hour format hh:mm. Find and print the time after *a* minutes. Note that you should find only the time after *a* minutes, see the examples to clarify the problem statement. You can read more about 24-hour format here [https://en.wikipedia.org/wiki/24-hour_clock](https://en.wikipedia.org/wiki/24-hour_clock).
The first line contains the current time in the format hh:mm (0<=≀<=*hh*<=&lt;<=24,<=0<=≀<=*mm*<=&lt;<=60). The hours and the minutes are given with two digits (the hours or the minutes less than 10 are given with the leading zeroes). The second line contains integer *a* (0<=≀<=*a*<=≀<=104) β€” the number of the minutes passed.
The only line should contain the time after *a* minutes in the format described in the input. Note that you should print exactly two digits for the hours and the minutes (add leading zeroes to the numbers if needed). See the examples to check the input/output format.
[ "23:59\n10\n", "20:20\n121\n", "10:10\n0\n" ]
[ "00:09\n", "22:21\n", "10:10\n" ]
none
0
[ { "input": "23:59\n10", "output": "00:09" }, { "input": "20:20\n121", "output": "22:21" }, { "input": "10:10\n0", "output": "10:10" }, { "input": "12:34\n10000", "output": "11:14" }, { "input": "00:00\n10000", "output": "22:40" }, { "input": "00:00\n1440", "output": "00:00" }, { "input": "23:59\n8640", "output": "23:59" }, { "input": "10:01\n0", "output": "10:01" }, { "input": "04:05\n0", "output": "04:05" }, { "input": "02:59\n1", "output": "03:00" }, { "input": "05:15\n10", "output": "05:25" }, { "input": "03:10\n20", "output": "03:30" }, { "input": "09:11\n0", "output": "09:11" }, { "input": "19:00\n0", "output": "19:00" }, { "input": "23:59\n1", "output": "00:00" }, { "input": "11:59\n1", "output": "12:00" }, { "input": "19:34\n566", "output": "05:00" }, { "input": "00:01\n59", "output": "01:00" }, { "input": "03:30\n0", "output": "03:30" }, { "input": "22:30\n30", "output": "23:00" }, { "input": "22:50\n70", "output": "00:00" }, { "input": "05:12\n0", "output": "05:12" }, { "input": "09:20\n40", "output": "10:00" }, { "input": "15:04\n36", "output": "15:40" }, { "input": "05:37\n23", "output": "06:00" }, { "input": "23:59\n59", "output": "00:58" }, { "input": "21:09\n9997", "output": "19:46" }, { "input": "11:00\n1", "output": "11:01" }, { "input": "20:01\n2699", "output": "17:00" }, { "input": "01:00\n59", "output": "01:59" }, { "input": "07:09\n6538", "output": "20:07" }, { "input": "00:00\n10", "output": "00:10" }, { "input": "02:09\n2074", "output": "12:43" }, { "input": "01:10\n1", "output": "01:11" }, { "input": "23:01\n59", "output": "00:00" }, { "input": "08:50\n20", "output": "09:10" }, { "input": "13:18\n5121", "output": "02:39" }, { "input": "18:31\n2677", "output": "15:08" }, { "input": "14:17\n108", "output": "16:05" }, { "input": "02:45\n5617", "output": "00:22" }, { "input": "00:00\n3600", "output": "12:00" }, { "input": "19:01\n59", "output": "20:00" }, { "input": "19:02\n59", "output": "20:01" }, { "input": "14:00\n2880", "output": "14:00" }, { "input": "01:10\n44", "output": "01:54" }, { "input": "02:01\n59", "output": "03:00" }, { "input": "07:02\n121", "output": "09:03" }, { "input": "10:00\n61", "output": "11:01" }, { "input": "23:59\n61", "output": "01:00" }, { "input": "00:00\n0", "output": "00:00" }, { "input": "23:59\n121", "output": "02:00" }, { "input": "00:00\n60", "output": "01:00" }, { "input": "15:52\n60", "output": "16:52" }, { "input": "00:39\n6525", "output": "13:24" }, { "input": "00:30\n30", "output": "01:00" }, { "input": "00:59\n1", "output": "01:00" }, { "input": "00:55\n4321", "output": "00:56" }, { "input": "10:05\n1", "output": "10:06" }, { "input": "23:00\n60", "output": "00:00" } ]
1,551,201,095
2,495
PyPy 3
OK
TESTS
59
124
0
import sys def get_array(): return list(map(int, sys.stdin.readline().split())) def get_ints(): return map(int, sys.stdin.readline().split()) def input(): return sys.stdin.readline().strip('\n') s = input() hr = int(s[0:2]) mn = int(s[3:5]) t = int(input()) mn += t add = 0 if mn >= 60: add = mn//60 mn %= 60 hr += add if hr >= 24: hr %= 24 if len(str(hr)) == 2: print(hr,':',sep='',end='') if len(str(mn)) == 2: print(mn) else: print(0,mn,sep='') else: print(0,hr,':',sep='',end='') if len(str(mn)) == 2: print(mn) else: print(0,mn,sep='')
Title: The Time Time Limit: None seconds Memory Limit: None megabytes Problem Description: You are given the current time in 24-hour format hh:mm. Find and print the time after *a* minutes. Note that you should find only the time after *a* minutes, see the examples to clarify the problem statement. You can read more about 24-hour format here [https://en.wikipedia.org/wiki/24-hour_clock](https://en.wikipedia.org/wiki/24-hour_clock). Input Specification: The first line contains the current time in the format hh:mm (0<=≀<=*hh*<=&lt;<=24,<=0<=≀<=*mm*<=&lt;<=60). The hours and the minutes are given with two digits (the hours or the minutes less than 10 are given with the leading zeroes). The second line contains integer *a* (0<=≀<=*a*<=≀<=104) β€” the number of the minutes passed. Output Specification: The only line should contain the time after *a* minutes in the format described in the input. Note that you should print exactly two digits for the hours and the minutes (add leading zeroes to the numbers if needed). See the examples to check the input/output format. Demo Input: ['23:59\n10\n', '20:20\n121\n', '10:10\n0\n'] Demo Output: ['00:09\n', '22:21\n', '10:10\n'] Note: none
```python import sys def get_array(): return list(map(int, sys.stdin.readline().split())) def get_ints(): return map(int, sys.stdin.readline().split()) def input(): return sys.stdin.readline().strip('\n') s = input() hr = int(s[0:2]) mn = int(s[3:5]) t = int(input()) mn += t add = 0 if mn >= 60: add = mn//60 mn %= 60 hr += add if hr >= 24: hr %= 24 if len(str(hr)) == 2: print(hr,':',sep='',end='') if len(str(mn)) == 2: print(mn) else: print(0,mn,sep='') else: print(0,hr,':',sep='',end='') if len(str(mn)) == 2: print(mn) else: print(0,mn,sep='') ```
3
637
B
Chat Order
PROGRAMMING
1,200
[ "*special", "binary search", "constructive algorithms", "data structures", "sortings" ]
null
null
Polycarp is a big lover of killing time in social networks. A page with a chatlist in his favourite network is made so that when a message is sent to some friend, his friend's chat rises to the very top of the page. The relative order of the other chats doesn't change. If there was no chat with this friend before, then a new chat is simply inserted to the top of the list. Assuming that the chat list is initially empty, given the sequence of Polycaprus' messages make a list of chats after all of his messages are processed. Assume that no friend wrote any message to Polycarpus.
The first line contains integer *n* (1<=≀<=*n*<=≀<=200<=000)Β β€” the number of Polycarpus' messages. Next *n* lines enlist the message recipients in the order in which the messages were sent. The name of each participant is a non-empty sequence of lowercase English letters of length at most 10.
Print all the recipients to who Polycarp talked to in the order of chats with them, from top to bottom.
[ "4\nalex\nivan\nroman\nivan\n", "8\nalina\nmaria\nekaterina\ndarya\ndarya\nekaterina\nmaria\nalina\n" ]
[ "ivan\nroman\nalex\n", "alina\nmaria\nekaterina\ndarya\n" ]
In the first test case Polycarpus first writes to friend by name "alex", and the list looks as follows: 1. alex Then Polycarpus writes to friend by name "ivan" and the list looks as follows: 1. ivan 1. alex Polycarpus writes the third message to friend by name "roman" and the list looks as follows: 1. roman 1. ivan 1. alex Polycarpus writes the fourth message to friend by name "ivan", to who he has already sent a message, so the list of chats changes as follows: 1. ivan 1. roman 1. alex
1,000
[ { "input": "4\nalex\nivan\nroman\nivan", "output": "ivan\nroman\nalex" }, { "input": "8\nalina\nmaria\nekaterina\ndarya\ndarya\nekaterina\nmaria\nalina", "output": "alina\nmaria\nekaterina\ndarya" }, { "input": "1\nwdi", "output": "wdi" }, { "input": "2\nypg\nypg", "output": "ypg" }, { "input": "3\nexhll\nexhll\narruapexj", "output": "arruapexj\nexhll" }, { "input": "3\nfv\nle\nle", "output": "le\nfv" }, { "input": "8\nm\nm\nm\nm\nm\nm\nm\nm", "output": "m" }, { "input": "10\nr\nr\ni\nw\nk\nr\nb\nu\nu\nr", "output": "r\nu\nb\nk\nw\ni" }, { "input": "7\ne\nfau\ncmk\nnzs\nby\nwx\ntjmok", "output": "tjmok\nwx\nby\nnzs\ncmk\nfau\ne" }, { "input": "6\nklrj\nwe\nklrj\nwe\nwe\nwe", "output": "we\nklrj" }, { "input": "8\nzncybqmh\naeebef\nzncybqmh\nn\naeebef\nzncybqmh\nzncybqmh\nzncybqmh", "output": "zncybqmh\naeebef\nn" }, { "input": "30\nkqqcbs\nvap\nkymomn\nj\nkqqcbs\nfuzlzoum\nkymomn\ndbh\nfuzlzoum\nkymomn\nvap\nvlgzs\ndbh\nvlgzs\nbvy\ndbh\nkymomn\nkymomn\neoqql\nkymomn\nkymomn\nkqqcbs\nvlgzs\nkqqcbs\nkqqcbs\nfuzlzoum\nvlgzs\nrylgdoo\nvlgzs\nrylgdoo", "output": "rylgdoo\nvlgzs\nfuzlzoum\nkqqcbs\nkymomn\neoqql\ndbh\nbvy\nvap\nj" }, { "input": "40\nji\nv\nv\nns\nji\nn\nji\nv\nfvy\nvje\nns\nvje\nv\nhas\nv\nusm\nhas\nfvy\nvje\nkdb\nn\nv\nji\nji\nn\nhas\nv\nji\nkdb\nr\nvje\nns\nv\nusm\nn\nvje\nhas\nns\nhas\nn", "output": "n\nhas\nns\nvje\nusm\nv\nr\nkdb\nji\nfvy" }, { "input": "50\njcg\nvle\njopb\nepdb\nnkef\nfv\nxj\nufe\nfuy\noqta\ngbc\nyuz\nec\nyji\nkuux\ncwm\ntq\nnno\nhp\nzry\nxxpp\ntjvo\ngyz\nkwo\nvwqz\nyaqc\njnj\nwoav\nqcv\ndcu\ngc\nhovn\nop\nevy\ndc\ntrpu\nyb\nuzfa\npca\noq\nnhxy\nsiqu\nde\nhphy\nc\nwovu\nf\nbvv\ndsik\nlwyg", "output": "lwyg\ndsik\nbvv\nf\nwovu\nc\nhphy\nde\nsiqu\nnhxy\noq\npca\nuzfa\nyb\ntrpu\ndc\nevy\nop\nhovn\ngc\ndcu\nqcv\nwoav\njnj\nyaqc\nvwqz\nkwo\ngyz\ntjvo\nxxpp\nzry\nhp\nnno\ntq\ncwm\nkuux\nyji\nec\nyuz\ngbc\noqta\nfuy\nufe\nxj\nfv\nnkef\nepdb\njopb\nvle\njcg" }, { "input": "100\nvhh\nvhh\nvhh\nfa\nfa\nvhh\nvhh\nvhh\nfa\nfa\nfa\nvhh\nfa\nvhh\nvhh\nvhh\nfa\nvhh\nvhh\nfa\nfa\nfa\nfa\nfa\nfa\nvhh\nfa\nfa\nvhh\nvhh\nvhh\nfa\nfa\nfa\nvhh\nfa\nvhh\nfa\nvhh\nvhh\nfa\nvhh\nfa\nvhh\nvhh\nvhh\nfa\nvhh\nfa\nfa\nvhh\nfa\nvhh\nvhh\nvhh\nvhh\nfa\nvhh\nvhh\nvhh\nvhh\nfa\nvhh\nvhh\nvhh\nvhh\nvhh\nfa\nvhh\nvhh\nfa\nfa\nfa\nvhh\nfa\nfa\nvhh\nfa\nvhh\nfa\nfa\nfa\nfa\nfa\nfa\nvhh\nvhh\nfa\nvhh\nfa\nfa\nvhh\nfa\nfa\nvhh\nfa\nvhh\nvhh\nfa\nvhh", "output": "vhh\nfa" }, { "input": "2\naa\nbb", "output": "bb\naa" }, { "input": "2\naa\na", "output": "a\naa" }, { "input": "3\naa\naa\naa", "output": "aa" }, { "input": "5\naa\na\naa\na\naa", "output": "aa\na" }, { "input": "7\naaaa\naaaa\naaa\na\naa\naaaaaaa\naaa", "output": "aaa\naaaaaaa\naa\na\naaaa" }, { "input": "5\na\naa\naaa\naaaa\na", "output": "a\naaaa\naaa\naa" }, { "input": "12\naaaaa\naaaaaa\naaaa\naaaaaa\naa\naaaa\naaaa\naaaaaa\na\naaa\naaaaaaaa\naa", "output": "aa\naaaaaaaa\naaa\na\naaaaaa\naaaa\naaaaa" }, { "input": "3\na\naa\naaa", "output": "aaa\naa\na" }, { "input": "9\nzzz\nzzzzz\nzzz\nzzzz\nzz\nzzzz\nzzzzz\nzzzz\nzzzzzzz", "output": "zzzzzzz\nzzzz\nzzzzz\nzz\nzzz" } ]
1,605,097,909
2,147,483,647
Python 3
OK
TESTS
95
670
18,124,800
I , d = input, {} for i in [I() for i in range(int(I()))][::-1]: if i not in d : print(i) d[i] = 1
Title: Chat Order Time Limit: None seconds Memory Limit: None megabytes Problem Description: Polycarp is a big lover of killing time in social networks. A page with a chatlist in his favourite network is made so that when a message is sent to some friend, his friend's chat rises to the very top of the page. The relative order of the other chats doesn't change. If there was no chat with this friend before, then a new chat is simply inserted to the top of the list. Assuming that the chat list is initially empty, given the sequence of Polycaprus' messages make a list of chats after all of his messages are processed. Assume that no friend wrote any message to Polycarpus. Input Specification: The first line contains integer *n* (1<=≀<=*n*<=≀<=200<=000)Β β€” the number of Polycarpus' messages. Next *n* lines enlist the message recipients in the order in which the messages were sent. The name of each participant is a non-empty sequence of lowercase English letters of length at most 10. Output Specification: Print all the recipients to who Polycarp talked to in the order of chats with them, from top to bottom. Demo Input: ['4\nalex\nivan\nroman\nivan\n', '8\nalina\nmaria\nekaterina\ndarya\ndarya\nekaterina\nmaria\nalina\n'] Demo Output: ['ivan\nroman\nalex\n', 'alina\nmaria\nekaterina\ndarya\n'] Note: In the first test case Polycarpus first writes to friend by name "alex", and the list looks as follows: 1. alex Then Polycarpus writes to friend by name "ivan" and the list looks as follows: 1. ivan 1. alex Polycarpus writes the third message to friend by name "roman" and the list looks as follows: 1. roman 1. ivan 1. alex Polycarpus writes the fourth message to friend by name "ivan", to who he has already sent a message, so the list of chats changes as follows: 1. ivan 1. roman 1. alex
```python I , d = input, {} for i in [I() for i in range(int(I()))][::-1]: if i not in d : print(i) d[i] = 1 ```
3
151
A
Soft Drinking
PROGRAMMING
800
[ "implementation", "math" ]
null
null
This winter is so cold in Nvodsk! A group of *n* friends decided to buy *k* bottles of a soft drink called "Take-It-Light" to warm up a bit. Each bottle has *l* milliliters of the drink. Also they bought *c* limes and cut each of them into *d* slices. After that they found *p* grams of salt. To make a toast, each friend needs *nl* milliliters of the drink, a slice of lime and *np* grams of salt. The friends want to make as many toasts as they can, provided they all drink the same amount. How many toasts can each friend make?
The first and only line contains positive integers *n*, *k*, *l*, *c*, *d*, *p*, *nl*, *np*, not exceeding 1000 and no less than 1. The numbers are separated by exactly one space.
Print a single integer β€” the number of toasts each friend can make.
[ "3 4 5 10 8 100 3 1\n", "5 100 10 1 19 90 4 3\n", "10 1000 1000 25 23 1 50 1\n" ]
[ "2\n", "3\n", "0\n" ]
A comment to the first sample: Overall the friends have 4 * 5 = 20 milliliters of the drink, it is enough to make 20 / 3 = 6 toasts. The limes are enough for 10 * 8 = 80 toasts and the salt is enough for 100 / 1 = 100 toasts. However, there are 3 friends in the group, so the answer is *min*(6, 80, 100) / 3 = 2.
500
[ { "input": "3 4 5 10 8 100 3 1", "output": "2" }, { "input": "5 100 10 1 19 90 4 3", "output": "3" }, { "input": "10 1000 1000 25 23 1 50 1", "output": "0" }, { "input": "1 7 4 5 5 8 3 2", "output": "4" }, { "input": "2 3 3 5 5 10 1 3", "output": "1" }, { "input": "2 6 4 5 6 5 1 3", "output": "0" }, { "input": "1 7 3 5 3 6 2 1", "output": "6" }, { "input": "2 4 5 4 5 7 3 2", "output": "1" }, { "input": "2 3 6 5 7 8 2 1", "output": "4" }, { "input": "1 4 5 5 3 10 3 1", "output": "6" }, { "input": "1 4 6 7 3 5 1 3", "output": "1" }, { "input": "1 6 5 5 5 8 3 1", "output": "8" }, { "input": "1 7 5 3 3 9 2 1", "output": "9" }, { "input": "3 5 3 7 6 10 3 1", "output": "1" }, { "input": "3 6 3 5 3 6 3 1", "output": "2" }, { "input": "1 7 5 5 5 5 2 2", "output": "2" }, { "input": "2 5 3 5 6 9 2 1", "output": "3" }, { "input": "3 4 3 5 3 6 2 1", "output": "2" }, { "input": "1 5 5 4 7 6 3 1", "output": "6" }, { "input": "2 3 7 6 5 9 3 1", "output": "3" }, { "input": "2 6 5 3 3 8 1 1", "output": "4" }, { "input": "2 4 7 3 4 10 2 1", "output": "5" }, { "input": "1 1000 1000 1000 1000 1000 1 1", "output": "1000" }, { "input": "17 1000 1000 1000 1000 1000 3 7", "output": "8" }, { "input": "115 1000 1000 1000 1000 1000 17 15", "output": "0" }, { "input": "1 587 981 1 2 1 1 1", "output": "1" }, { "input": "1 1 2 1 2 2 1 1", "output": "2" } ]
1,698,005,683
2,147,483,647
Python 3
OK
TESTS
27
62
0
inp = [int(i) for i in input().split()] n,k,l,c,d,p,nl,np=inp[0],inp[1],inp[2],inp[3],inp[4],inp[5],inp[6],inp[7] print(min(k*l//nl,c*d, p//np)//n)
Title: Soft Drinking Time Limit: None seconds Memory Limit: None megabytes Problem Description: This winter is so cold in Nvodsk! A group of *n* friends decided to buy *k* bottles of a soft drink called "Take-It-Light" to warm up a bit. Each bottle has *l* milliliters of the drink. Also they bought *c* limes and cut each of them into *d* slices. After that they found *p* grams of salt. To make a toast, each friend needs *nl* milliliters of the drink, a slice of lime and *np* grams of salt. The friends want to make as many toasts as they can, provided they all drink the same amount. How many toasts can each friend make? Input Specification: The first and only line contains positive integers *n*, *k*, *l*, *c*, *d*, *p*, *nl*, *np*, not exceeding 1000 and no less than 1. The numbers are separated by exactly one space. Output Specification: Print a single integer β€” the number of toasts each friend can make. Demo Input: ['3 4 5 10 8 100 3 1\n', '5 100 10 1 19 90 4 3\n', '10 1000 1000 25 23 1 50 1\n'] Demo Output: ['2\n', '3\n', '0\n'] Note: A comment to the first sample: Overall the friends have 4 * 5 = 20 milliliters of the drink, it is enough to make 20 / 3 = 6 toasts. The limes are enough for 10 * 8 = 80 toasts and the salt is enough for 100 / 1 = 100 toasts. However, there are 3 friends in the group, so the answer is *min*(6, 80, 100) / 3 = 2.
```python inp = [int(i) for i in input().split()] n,k,l,c,d,p,nl,np=inp[0],inp[1],inp[2],inp[3],inp[4],inp[5],inp[6],inp[7] print(min(k*l//nl,c*d, p//np)//n) ```
3
352
A
Jeff and Digits
PROGRAMMING
1,000
[ "brute force", "implementation", "math" ]
null
null
Jeff's got *n* cards, each card contains either digit 0, or digit 5. Jeff can choose several cards and put them in a line so that he gets some number. What is the largest possible number divisible by 90 Jeff can make from the cards he's got? Jeff must make the number without leading zero. At that, we assume that number 0 doesn't contain any leading zeroes. Jeff doesn't have to use all the cards.
The first line contains integer *n* (1<=≀<=*n*<=≀<=103). The next line contains *n* integers *a*1, *a*2, ..., *a**n* (*a**i*<==<=0 or *a**i*<==<=5). Number *a**i* represents the digit that is written on the *i*-th card.
In a single line print the answer to the problem β€” the maximum number, divisible by 90. If you can't make any divisible by 90 number from the cards, print -1.
[ "4\n5 0 5 0\n", "11\n5 5 5 5 5 5 5 5 0 5 5\n" ]
[ "0\n", "5555555550\n" ]
In the first test you can make only one number that is a multiple of 90 β€” 0. In the second test you can make number 5555555550, it is a multiple of 90.
500
[ { "input": "4\n5 0 5 0", "output": "0" }, { "input": "11\n5 5 5 5 5 5 5 5 0 5 5", "output": "5555555550" }, { "input": "7\n5 5 5 5 5 5 5", "output": "-1" }, { "input": "1\n5", "output": "-1" }, { "input": "1\n0", "output": "0" }, { "input": "11\n5 0 5 5 5 0 0 5 5 5 5", "output": "0" }, { "input": "23\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 0 0 0 0 0", "output": "55555555555555555500000" }, { "input": "9\n5 5 5 5 5 5 5 5 5", "output": "-1" }, { "input": "24\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 0 0 0 0 0", "output": "55555555555555555500000" }, { "input": "10\n0 0 0 0 0 0 0 0 0 0", "output": "0" }, { "input": "10\n5 5 5 5 5 0 0 5 0 5", "output": "0" }, { "input": "3\n5 5 0", "output": "0" }, { "input": "5\n5 5 0 5 5", "output": "0" }, { "input": "14\n0 5 5 0 0 0 0 0 0 5 5 5 5 5", "output": "0" }, { "input": "3\n5 5 5", "output": "-1" }, { "input": "3\n0 5 5", "output": "0" }, { "input": "13\n0 0 5 0 5 0 5 5 0 0 0 0 0", "output": "0" }, { "input": "9\n5 5 0 5 5 5 5 5 5", "output": "0" }, { "input": "8\n0 0 0 0 0 0 0 0", "output": "0" }, { "input": "101\n5 0 0 0 0 0 0 0 5 0 0 0 0 5 0 0 5 0 0 0 0 0 5 0 0 0 0 0 0 0 0 5 0 0 5 0 0 0 0 0 0 0 5 0 0 5 0 0 0 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 0 0 0 0 0 0 5 0 0 0 0 5 0 0 0 0 0 0 0 0 0 5 0 0 5 0 0 0 0 5 0 0", "output": "5555555550000000000000000000000000000000000000000000000000000000000000000000000000000000000000" }, { "input": "214\n5 0 5 0 5 0 0 0 5 5 0 5 0 5 5 0 5 0 0 0 0 5 5 0 0 5 5 0 0 0 0 5 5 5 5 0 5 0 0 0 0 0 0 5 0 0 0 5 0 0 5 0 0 5 5 0 0 5 5 0 0 0 0 0 5 0 5 0 5 5 0 5 0 0 5 5 5 0 5 0 5 0 5 5 0 5 0 0 0 5 5 0 5 0 5 5 5 5 5 0 0 0 0 0 0 5 0 5 5 0 5 0 5 0 5 5 0 0 0 0 5 0 5 0 5 0 0 5 0 0 5 5 5 5 5 0 0 5 0 0 5 0 0 5 0 0 5 0 0 5 0 5 0 0 0 5 0 0 5 5 5 0 0 5 5 5 0 0 5 5 0 0 0 5 0 0 5 5 5 5 5 5 0 5 0 0 5 5 5 5 0 5 5 0 0 0 5 5 5 5 0 0 0 0 5 0 0 5 0 0 5 5 0 0", "output": "5555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555555550000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000" }, { "input": "80\n0 0 0 0 5 0 5 5 5 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 5 0 0 5 0 0 0 0 0 0 0 0 0 5 5 0 5 0 0 0 0 0 0 5 0 0 0 0 0 0 0 5 0 0 0 0 5 0 5 5 0 0 0", "output": "555555555000000000000000000000000000000000000000000000000000000000000000000" }, { "input": "2\n0 0", "output": "0" }, { "input": "3\n5 0 0", "output": "0" }, { "input": "4\n5 5 5 5", "output": "-1" }, { "input": "2\n0 5", "output": "0" }, { "input": "14\n5 5 5 5 5 5 5 5 5 5 5 5 5 0", "output": "5555555550" }, { "input": "18\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5", "output": "-1" }, { "input": "10\n5 5 5 5 5 5 5 5 5 0", "output": "5555555550" }, { "input": "10\n5 5 5 5 5 5 5 5 5 5", "output": "-1" }, { "input": "20\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5", "output": "-1" } ]
1,683,559,099
2,147,483,647
Python 3
OK
TESTS
42
92
0
n=int(input()) a=list(map(int,input().split())) s=sum(a) _5=a.count(5) _0=a.count(0) if _0!=0: ans='5'*(_5)+'0'*(_0) while s/9!=s//9: s-=5 _5-=1 ans='5'*(_5)+'0'*(_0) print(int(ans)) else: print(-1)
Title: Jeff and Digits Time Limit: None seconds Memory Limit: None megabytes Problem Description: Jeff's got *n* cards, each card contains either digit 0, or digit 5. Jeff can choose several cards and put them in a line so that he gets some number. What is the largest possible number divisible by 90 Jeff can make from the cards he's got? Jeff must make the number without leading zero. At that, we assume that number 0 doesn't contain any leading zeroes. Jeff doesn't have to use all the cards. Input Specification: The first line contains integer *n* (1<=≀<=*n*<=≀<=103). The next line contains *n* integers *a*1, *a*2, ..., *a**n* (*a**i*<==<=0 or *a**i*<==<=5). Number *a**i* represents the digit that is written on the *i*-th card. Output Specification: In a single line print the answer to the problem β€” the maximum number, divisible by 90. If you can't make any divisible by 90 number from the cards, print -1. Demo Input: ['4\n5 0 5 0\n', '11\n5 5 5 5 5 5 5 5 0 5 5\n'] Demo Output: ['0\n', '5555555550\n'] Note: In the first test you can make only one number that is a multiple of 90 β€” 0. In the second test you can make number 5555555550, it is a multiple of 90.
```python n=int(input()) a=list(map(int,input().split())) s=sum(a) _5=a.count(5) _0=a.count(0) if _0!=0: ans='5'*(_5)+'0'*(_0) while s/9!=s//9: s-=5 _5-=1 ans='5'*(_5)+'0'*(_0) print(int(ans)) else: print(-1) ```
3
412
B
Network Configuration
PROGRAMMING
900
[ "greedy", "sortings" ]
null
null
The R1 company wants to hold a web search championship. There were *n* computers given for the competition, each of them is connected to the Internet. The organizers believe that the data transfer speed directly affects the result. The higher the speed of the Internet is, the faster the participant will find the necessary information. Therefore, before the competition started, each computer had its maximum possible data transfer speed measured. On the *i*-th computer it was *a**i* kilobits per second. There will be *k* participants competing in the championship, each should get a separate computer. The organizing company does not want any of the participants to have an advantage over the others, so they want to provide the same data transfer speed to each participant's computer. Also, the organizers want to create the most comfortable conditions for the participants, so the data transfer speed on the participants' computers should be as large as possible. The network settings of the R1 company has a special option that lets you to cut the initial maximum data transfer speed of any computer to any lower speed. How should the R1 company configure the network using the described option so that at least *k* of *n* computers had the same data transfer speed and the data transfer speed on these computers was as large as possible?
The first line contains two space-separated integers *n* and *k* (1<=≀<=*k*<=≀<=*n*<=≀<=100) β€” the number of computers and the number of participants, respectively. In the second line you have a space-separated sequence consisting of *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (16<=≀<=*a**i*<=≀<=32768); number *a**i* denotes the maximum data transfer speed on the *i*-th computer.
Print a single integer β€” the maximum Internet speed value. It is guaranteed that the answer to the problem is always an integer.
[ "3 2\n40 20 30\n", "6 4\n100 20 40 20 50 50\n" ]
[ "30\n", "40\n" ]
In the first test case the organizers can cut the first computer's speed to 30 kilobits. Then two computers (the first and the third one) will have the same speed of 30 kilobits. They should be used as the participants' computers. This answer is optimal.
1,000
[ { "input": "3 2\n40 20 30", "output": "30" }, { "input": "6 4\n100 20 40 20 50 50", "output": "40" }, { "input": "1 1\n16", "output": "16" }, { "input": "2 1\n10000 17", "output": "10000" }, { "input": "2 2\n200 300", "output": "200" }, { "input": "3 1\n21 25 16", "output": "25" }, { "input": "3 2\n23 20 26", "output": "23" }, { "input": "3 3\n19 29 28", "output": "19" }, { "input": "100 2\n82 37 88 28 98 30 38 76 90 68 79 29 67 93 19 71 122 103 110 79 20 75 68 101 16 120 114 68 73 71 103 114 99 70 73 18 36 31 32 87 32 79 44 72 58 25 44 72 106 38 47 17 83 41 75 23 49 30 73 67 117 52 22 117 109 89 66 88 75 62 17 35 83 69 63 60 23 120 93 18 112 93 39 72 116 109 106 72 27 123 117 119 87 72 33 73 70 110 43 43", "output": "122" }, { "input": "30 13\n36 82 93 91 48 62 59 96 72 40 45 68 97 70 26 22 35 98 92 83 72 49 70 39 53 94 97 65 37 28", "output": "70" }, { "input": "50 49\n20 77 31 40 18 87 44 64 70 48 29 59 98 33 95 17 69 84 81 17 24 66 37 54 97 55 77 79 42 21 23 42 36 55 81 83 94 45 25 84 20 97 37 95 46 92 73 39 90 71", "output": "17" }, { "input": "40 40\n110 674 669 146 882 590 650 844 427 187 380 711 122 94 38 216 414 874 380 31 895 390 414 557 913 68 665 964 895 708 594 17 24 621 780 509 837 550 630 568", "output": "17" }, { "input": "40 1\n851 110 1523 1572 945 4966 4560 756 2373 4760 144 2579 4022 220 1924 1042 160 2792 2425 4483 2154 4120 319 4617 4686 2502 4797 4941 4590 4478 4705 4355 695 684 1560 684 2780 1090 4995 3113", "output": "4995" }, { "input": "70 12\n6321 2502 557 2734 16524 10133 13931 5045 3897 18993 5745 8687 12344 1724 12071 2345 3852 9312 14432 8615 7461 2439 4751 19872 12266 12997 8276 8155 9502 3047 7226 12754 9447 17349 1888 14564 18257 18099 8924 14199 738 13693 10917 15554 15773 17859 13391 13176 10567 19658 16494 3968 13977 14694 10537 4044 16402 9714 4425 13599 19660 2426 19687 2455 2382 3413 5754 113 7542 8353", "output": "16402" }, { "input": "80 60\n6159 26457 23753 27073 9877 4492 11957 10989 27151 6552 1646 7773 23924 27554 10517 8788 31160 455 12625 22009 22133 15657 14968 31871 15344 16550 27414 876 31213 10895 21508 17516 12747 59 11786 10497 30143 25548 22003 2809 11694 30395 8122 31248 23075 19013 31614 9133 27942 27346 15969 19415 10367 8424 29355 18903 3396 6327 4201 24124 24266 22586 724 1595 3972 17526 2843 20982 23655 12714 18050 15225 2658 7236 27555 13023 729 9022 17386 2585", "output": "8122" }, { "input": "100 1\n199 348 489 76 638 579 982 125 28 401 228 117 195 337 80 914 752 98 679 417 47 225 357 413 849 622 477 620 487 223 321 240 439 393 733 660 652 500 877 40 788 246 376 723 952 601 912 316 598 809 476 932 384 147 982 271 202 695 129 303 304 712 49 306 598 141 833 730 946 708 724 788 202 465 951 118 279 706 214 655 152 976 998 231 487 311 342 317 243 554 977 232 365 643 336 501 761 400 600 528", "output": "998" }, { "input": "80 50\n15160 6853 20254 11358 19535 27691 2983 31650 9219 11833 32053 31695 21511 4320 4384 24843 1454 31543 18796 13815 1546 27926 16276 14315 12542 25370 24890 29647 3584 17867 12446 15072 19852 30207 16361 7964 5343 398 10837 31114 9252 12767 15098 22562 32637 31823 8160 12658 6422 19142 12448 6765 7373 868 31712 24856 23251 29200 8159 16144 27165 4308 13652 12502 4183 7961 3032 26855 8687 12263 24319 7722 19460 30700 29806 1280 21141 25965 25550 26881", "output": "12448" }, { "input": "50 16\n16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16", "output": "16" }, { "input": "100 1\n16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16", "output": "16" }, { "input": "100 2\n16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16", "output": "16" }, { "input": "100 100\n16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16", "output": "16" }, { "input": "100 99\n16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16 16", "output": "16" } ]
1,688,173,941
2,147,483,647
Python 3
OK
TESTS
34
46
0
# LUOGU_RID: 113633863 def r():return list(map(int,input().split())) a,b=r();a=r();a.sort();print(a[-b])
Title: Network Configuration Time Limit: None seconds Memory Limit: None megabytes Problem Description: The R1 company wants to hold a web search championship. There were *n* computers given for the competition, each of them is connected to the Internet. The organizers believe that the data transfer speed directly affects the result. The higher the speed of the Internet is, the faster the participant will find the necessary information. Therefore, before the competition started, each computer had its maximum possible data transfer speed measured. On the *i*-th computer it was *a**i* kilobits per second. There will be *k* participants competing in the championship, each should get a separate computer. The organizing company does not want any of the participants to have an advantage over the others, so they want to provide the same data transfer speed to each participant's computer. Also, the organizers want to create the most comfortable conditions for the participants, so the data transfer speed on the participants' computers should be as large as possible. The network settings of the R1 company has a special option that lets you to cut the initial maximum data transfer speed of any computer to any lower speed. How should the R1 company configure the network using the described option so that at least *k* of *n* computers had the same data transfer speed and the data transfer speed on these computers was as large as possible? Input Specification: The first line contains two space-separated integers *n* and *k* (1<=≀<=*k*<=≀<=*n*<=≀<=100) β€” the number of computers and the number of participants, respectively. In the second line you have a space-separated sequence consisting of *n* integers: *a*1,<=*a*2,<=...,<=*a**n* (16<=≀<=*a**i*<=≀<=32768); number *a**i* denotes the maximum data transfer speed on the *i*-th computer. Output Specification: Print a single integer β€” the maximum Internet speed value. It is guaranteed that the answer to the problem is always an integer. Demo Input: ['3 2\n40 20 30\n', '6 4\n100 20 40 20 50 50\n'] Demo Output: ['30\n', '40\n'] Note: In the first test case the organizers can cut the first computer's speed to 30 kilobits. Then two computers (the first and the third one) will have the same speed of 30 kilobits. They should be used as the participants' computers. This answer is optimal.
```python # LUOGU_RID: 113633863 def r():return list(map(int,input().split())) a,b=r();a=r();a.sort();print(a[-b]) ```
3
271
A
Beautiful Year
PROGRAMMING
800
[ "brute force" ]
null
null
It seems like the year of 2013 came only yesterday. Do you know a curious fact? The year of 2013 is the first year after the old 1987 with only distinct digits. Now you are suggested to solve the following problem: given a year number, find the minimum year number which is strictly larger than the given one and has only distinct digits.
The single line contains integer *y* (1000<=≀<=*y*<=≀<=9000) β€” the year number.
Print a single integer β€” the minimum year number that is strictly larger than *y* and all it's digits are distinct. It is guaranteed that the answer exists.
[ "1987\n", "2013\n" ]
[ "2013\n", "2014\n" ]
none
500
[ { "input": "1987", "output": "2013" }, { "input": "2013", "output": "2014" }, { "input": "1000", "output": "1023" }, { "input": "1001", "output": "1023" }, { "input": "1234", "output": "1235" }, { "input": "5555", "output": "5601" }, { "input": "9000", "output": "9012" }, { "input": "1111", "output": "1203" }, { "input": "8999", "output": "9012" }, { "input": "4572", "output": "4573" }, { "input": "6666", "output": "6701" }, { "input": "2001", "output": "2013" }, { "input": "3000", "output": "3012" }, { "input": "7712", "output": "7801" }, { "input": "8088", "output": "8091" }, { "input": "1594", "output": "1596" }, { "input": "6016", "output": "6017" }, { "input": "8800", "output": "8901" }, { "input": "3331", "output": "3401" }, { "input": "5090", "output": "5091" }, { "input": "2342", "output": "2345" }, { "input": "2334", "output": "2340" }, { "input": "1123", "output": "1203" }, { "input": "8989", "output": "9012" }, { "input": "8977", "output": "9012" }, { "input": "6869", "output": "6870" }, { "input": "8999", "output": "9012" } ]
1,697,739,993
2,147,483,647
PyPy 3-64
OK
TESTS
27
124
0
y = int(input()) i = y while True: if i > y and len(set(str(i))) == 4: break i += 1 print(i)
Title: Beautiful Year Time Limit: None seconds Memory Limit: None megabytes Problem Description: It seems like the year of 2013 came only yesterday. Do you know a curious fact? The year of 2013 is the first year after the old 1987 with only distinct digits. Now you are suggested to solve the following problem: given a year number, find the minimum year number which is strictly larger than the given one and has only distinct digits. Input Specification: The single line contains integer *y* (1000<=≀<=*y*<=≀<=9000) β€” the year number. Output Specification: Print a single integer β€” the minimum year number that is strictly larger than *y* and all it's digits are distinct. It is guaranteed that the answer exists. Demo Input: ['1987\n', '2013\n'] Demo Output: ['2013\n', '2014\n'] Note: none
```python y = int(input()) i = y while True: if i > y and len(set(str(i))) == 4: break i += 1 print(i) ```
3
9
C
Hexadecimal's Numbers
PROGRAMMING
1,200
[ "brute force", "implementation", "math" ]
C. Hexadecimal's Numbers
1
64
One beautiful July morning a terrible thing happened in Mainframe: a mean virus Megabyte somehow got access to the memory of his not less mean sister Hexadecimal. He loaded there a huge amount of *n* different natural numbers from 1 to *n* to obtain total control over her energy. But his plan failed. The reason for this was very simple: Hexadecimal didn't perceive any information, apart from numbers written in binary format. This means that if a number in a decimal representation contained characters apart from 0 and 1, it was not stored in the memory. Now Megabyte wants to know, how many numbers were loaded successfully.
Input data contains the only number *n* (1<=≀<=*n*<=≀<=109).
Output the only number β€” answer to the problem.
[ "10\n" ]
[ "2" ]
For *n* = 10 the answer includes numbers 1 and 10.
0
[ { "input": "10", "output": "2" }, { "input": "20", "output": "3" }, { "input": "72", "output": "3" }, { "input": "99", "output": "3" }, { "input": "100", "output": "4" }, { "input": "101", "output": "5" }, { "input": "102", "output": "5" }, { "input": "111", "output": "7" }, { "input": "112", "output": "7" }, { "input": "745", "output": "7" }, { "input": "23536", "output": "31" }, { "input": "1", "output": "1" }, { "input": "1010011", "output": "83" }, { "input": "312410141", "output": "511" }, { "input": "1000000000", "output": "512" }, { "input": "999999999", "output": "511" }, { "input": "111111111", "output": "511" }, { "input": "101010101", "output": "341" }, { "input": "121212121", "output": "511" }, { "input": "106341103", "output": "383" }, { "input": "901556123", "output": "511" }, { "input": "832513432", "output": "511" }, { "input": "3", "output": "1" }, { "input": "732875234", "output": "511" }, { "input": "7", "output": "1" }, { "input": "9", "output": "1" }, { "input": "2", "output": "1" }, { "input": "11", "output": "3" }, { "input": "12", "output": "3" }, { "input": "13", "output": "3" }, { "input": "101020101", "output": "351" }, { "input": "111100100", "output": "484" }, { "input": "110110101", "output": "437" }, { "input": "100111001", "output": "313" }, { "input": "100100", "output": "36" }, { "input": "110100102", "output": "421" } ]
1,591,076,759
2,147,483,647
PyPy 3
OK
TESTS
36
280
0
import math n = int(input()) ans = 1 while int(bin(ans)[2:]) <= n: ans += 1 print(ans-1)
Title: Hexadecimal's Numbers Time Limit: 1 seconds Memory Limit: 64 megabytes Problem Description: One beautiful July morning a terrible thing happened in Mainframe: a mean virus Megabyte somehow got access to the memory of his not less mean sister Hexadecimal. He loaded there a huge amount of *n* different natural numbers from 1 to *n* to obtain total control over her energy. But his plan failed. The reason for this was very simple: Hexadecimal didn't perceive any information, apart from numbers written in binary format. This means that if a number in a decimal representation contained characters apart from 0 and 1, it was not stored in the memory. Now Megabyte wants to know, how many numbers were loaded successfully. Input Specification: Input data contains the only number *n* (1<=≀<=*n*<=≀<=109). Output Specification: Output the only number β€” answer to the problem. Demo Input: ['10\n'] Demo Output: ['2'] Note: For *n* = 10 the answer includes numbers 1 and 10.
```python import math n = int(input()) ans = 1 while int(bin(ans)[2:]) <= n: ans += 1 print(ans-1) ```
3.86
975
C
Valhalla Siege
PROGRAMMING
1,400
[ "binary search" ]
null
null
Ivar the Boneless is a great leader. He is trying to capture Kattegat from Lagertha. The war has begun and wave after wave Ivar's warriors are falling in battle. Ivar has $n$ warriors, he places them on a straight line in front of the main gate, in a way that the $i$-th warrior stands right after $(i-1)$-th warrior. The first warrior leads the attack. Each attacker can take up to $a_i$ arrows before he falls to the ground, where $a_i$ is the $i$-th warrior's strength. Lagertha orders her warriors to shoot $k_i$ arrows during the $i$-th minute, the arrows one by one hit the first still standing warrior. After all Ivar's warriors fall and all the currently flying arrows fly by, Thor smashes his hammer and all Ivar's warriors get their previous strengths back and stand up to fight again. In other words, if all warriors die in minute $t$, they will all be standing to fight at the end of minute $t$. The battle will last for $q$ minutes, after each minute you should tell Ivar what is the number of his standing warriors.
The first line contains two integers $n$ and $q$ ($1 \le n, q \leq 200\,000$)Β β€” the number of warriors and the number of minutes in the battle. The second line contains $n$ integers $a_1, a_2, \ldots, a_n$ ($1 \leq a_i \leq 10^9$) that represent the warriors' strengths. The third line contains $q$ integers $k_1, k_2, \ldots, k_q$ ($1 \leq k_i \leq 10^{14}$), the $i$-th of them represents Lagertha's order at the $i$-th minute: $k_i$ arrows will attack the warriors.
Output $q$ lines, the $i$-th of them is the number of standing warriors after the $i$-th minute.
[ "5 5\n1 2 1 2 1\n3 10 1 1 1\n", "4 4\n1 2 3 4\n9 1 10 6\n" ]
[ "3\n5\n4\n4\n3\n", "1\n4\n4\n1\n" ]
In the first example: - after the 1-st minute, the 1-st and 2-nd warriors die. - after the 2-nd minute all warriors die (and all arrows left over are wasted), then they will be revived thus answer is 5Β β€” all warriors are alive. - after the 3-rd minute, the 1-st warrior dies. - after the 4-th minute, the 2-nd warrior takes a hit and his strength decreases by 1. - after the 5-th minute, the 2-nd warrior dies.
1,500
[ { "input": "5 5\n1 2 1 2 1\n3 10 1 1 1", "output": "3\n5\n4\n4\n3" }, { "input": "4 4\n1 2 3 4\n9 1 10 6", "output": "1\n4\n4\n1" }, { "input": "10 3\n1 1 1 1 1 1 1 1 1 1\n10 10 5", "output": "10\n10\n5" }, { "input": "1 1\n56563128\n897699770", "output": "1" }, { "input": "100 55\n1 2 4 4 3 5 5 2 3 4 2 1 1 2 3 5 1 5 4 2 5 4 4 3 3 5 3 4 4 5 5 2 3 3 4 4 3 4 5 5 5 5 3 5 1 2 4 3 4 5 3 3 2 1 4 5 3 4 4 1 5 1 5 2 2 1 4 5 3 3 1 4 2 5 4 5 3 2 5 5 2 3 2 3 2 2 3 4 4 4 1 4 2 4 5 3 1 3 3 1\n5 2 1 4 3 4 3 1 4 4 1 2 3 2 1 5 5 4 5 4 2 5 2 1 5 1 4 4 3 5 4 5 1 4 4 1 5 3 1 5 2 4 1 3 2 5 4 5 4 3 4 2 2 4 3", "output": "98\n97\n97\n96\n95\n94\n94\n94\n92\n91\n91\n90\n87\n86\n86\n85\n83\n82\n80\n80\n79\n78\n77\n77\n75\n75\n74\n73\n72\n71\n70\n69\n69\n67\n66\n66\n65\n64\n63\n62\n62\n61\n61\n60\n60\n59\n58\n57\n54\n54\n52\n52\n51\n51\n50" } ]
1,619,186,743
2,147,483,647
Python 3
OK
TESTS
35
997
21,913,600
from bisect import bisect_right def bs(s,x): return bisect_right(s,x) n,q=map(int,input().split()) l=list(map(int,input().split())) k=list(map(int,input().split())) s=[0] for i in range(n): s.append(s[i]+l[i]) p=0 for i in range(q): x=bs(s,(k[i]+p)) p=p+k[i] if x==n+1: print(n) p=0 else: print(n-x+1)
Title: Valhalla Siege Time Limit: None seconds Memory Limit: None megabytes Problem Description: Ivar the Boneless is a great leader. He is trying to capture Kattegat from Lagertha. The war has begun and wave after wave Ivar's warriors are falling in battle. Ivar has $n$ warriors, he places them on a straight line in front of the main gate, in a way that the $i$-th warrior stands right after $(i-1)$-th warrior. The first warrior leads the attack. Each attacker can take up to $a_i$ arrows before he falls to the ground, where $a_i$ is the $i$-th warrior's strength. Lagertha orders her warriors to shoot $k_i$ arrows during the $i$-th minute, the arrows one by one hit the first still standing warrior. After all Ivar's warriors fall and all the currently flying arrows fly by, Thor smashes his hammer and all Ivar's warriors get their previous strengths back and stand up to fight again. In other words, if all warriors die in minute $t$, they will all be standing to fight at the end of minute $t$. The battle will last for $q$ minutes, after each minute you should tell Ivar what is the number of his standing warriors. Input Specification: The first line contains two integers $n$ and $q$ ($1 \le n, q \leq 200\,000$)Β β€” the number of warriors and the number of minutes in the battle. The second line contains $n$ integers $a_1, a_2, \ldots, a_n$ ($1 \leq a_i \leq 10^9$) that represent the warriors' strengths. The third line contains $q$ integers $k_1, k_2, \ldots, k_q$ ($1 \leq k_i \leq 10^{14}$), the $i$-th of them represents Lagertha's order at the $i$-th minute: $k_i$ arrows will attack the warriors. Output Specification: Output $q$ lines, the $i$-th of them is the number of standing warriors after the $i$-th minute. Demo Input: ['5 5\n1 2 1 2 1\n3 10 1 1 1\n', '4 4\n1 2 3 4\n9 1 10 6\n'] Demo Output: ['3\n5\n4\n4\n3\n', '1\n4\n4\n1\n'] Note: In the first example: - after the 1-st minute, the 1-st and 2-nd warriors die. - after the 2-nd minute all warriors die (and all arrows left over are wasted), then they will be revived thus answer is 5Β β€” all warriors are alive. - after the 3-rd minute, the 1-st warrior dies. - after the 4-th minute, the 2-nd warrior takes a hit and his strength decreases by 1. - after the 5-th minute, the 2-nd warrior dies.
```python from bisect import bisect_right def bs(s,x): return bisect_right(s,x) n,q=map(int,input().split()) l=list(map(int,input().split())) k=list(map(int,input().split())) s=[0] for i in range(n): s.append(s[i]+l[i]) p=0 for i in range(q): x=bs(s,(k[i]+p)) p=p+k[i] if x==n+1: print(n) p=0 else: print(n-x+1) ```
3
859
A
Declined Finalists
PROGRAMMING
800
[ "greedy", "implementation" ]
null
null
This year, as in previous years, MemSQL is inviting the top 25 competitors from the Start[c]up qualification round to compete onsite for the final round. Not everyone who is eligible to compete onsite can afford to travel to the office, though. Initially the top 25 contestants are invited to come onsite. Each eligible contestant must either accept or decline the invitation. Whenever a contestant declines, the highest ranked contestant not yet invited is invited to take the place of the one that declined. This continues until 25 contestants have accepted invitations. After the qualifying round completes, you know *K* of the onsite finalists, as well as their qualifying ranks (which start at 1, there are no ties). Determine the minimum possible number of contestants that declined the invitation to compete onsite in the final round.
The first line of input contains *K* (1<=≀<=*K*<=≀<=25), the number of onsite finalists you know. The second line of input contains *r*1,<=*r*2,<=...,<=*r**K* (1<=≀<=*r**i*<=≀<=106), the qualifying ranks of the finalists you know. All these ranks are distinct.
Print the minimum possible number of contestants that declined the invitation to compete onsite.
[ "25\n2 3 4 5 6 7 8 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 28\n", "5\n16 23 8 15 4\n", "3\n14 15 92\n" ]
[ "3\n", "0\n", "67\n" ]
In the first example, you know all 25 onsite finalists. The contestants who ranked 1-st, 13-th, and 27-th must have declined, so the answer is 3.
500
[ { "input": "25\n2 3 4 5 6 7 8 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 28", "output": "3" }, { "input": "5\n16 23 8 15 4", "output": "0" }, { "input": "3\n14 15 92", "output": "67" }, { "input": "1\n1000000", "output": "999975" }, { "input": "25\n1000000 999999 999998 999997 999996 999995 999994 999993 999992 999991 999990 999989 999988 999987 999986 999985 999984 999983 999982 999981 999980 999979 999978 999977 999976", "output": "999975" }, { "input": "25\n13 15 24 2 21 18 9 4 16 6 10 25 20 11 23 17 8 3 1 12 5 19 22 14 7", "output": "0" }, { "input": "10\n17 11 7 13 18 12 14 5 16 2", "output": "0" }, { "input": "22\n22 14 23 20 11 21 4 12 3 8 7 9 19 10 13 17 15 1 5 18 16 2", "output": "0" }, { "input": "21\n6 21 24 3 10 23 14 2 26 12 8 1 15 13 9 5 19 20 4 16 22", "output": "1" }, { "input": "1\n1", "output": "0" }, { "input": "2\n100 60", "output": "75" }, { "input": "4\n999 581 787 236", "output": "974" }, { "input": "6\n198 397 732 1234 309 827", "output": "1209" }, { "input": "11\n6494 3961 1858 4351 8056 780 7720 6211 1961 8192 3621", "output": "8167" }, { "input": "14\n18809 9534 11652 6493 8929 9370 4125 23888 16403 3559 23649 19243 14289 17852", "output": "23863" }, { "input": "18\n24939 35558 47058 70307 26221 12866 3453 40422 47557 36322 40698 64060 10825 77777 48645 26124 4859 64222", "output": "77752" }, { "input": "24\n633483 654321 122445 481150 347578 37803 525083 151084 211073 358699 339420 452023 219553 119727 74852 66750 371279 405099 618894 649977 235337 607819 81649 649804", "output": "654296" }, { "input": "25\n58115 794098 753382 484882 238434 674285 690118 858677 196185 173301 349729 918792 600745 636016 122678 366783 137179 377098 917081 369620 449039 379412 503678 1000000 292099", "output": "999975" }, { "input": "2\n26 27", "output": "2" }, { "input": "3\n40 30 35", "output": "15" }, { "input": "2\n46 45", "output": "21" }, { "input": "3\n1 25 90", "output": "65" }, { "input": "5\n14 15 16 30 92", "output": "67" }, { "input": "2\n1000 1001", "output": "976" }, { "input": "25\n3 4 5 6 7 8 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 28 2", "output": "3" } ]
1,587,277,178
2,147,483,647
Python 3
OK
TESTS
25
124
0
T = int(input()) A = [int(x) for x in input().split()] print(0 if max(A) <= 25 else max(A) - 25)
Title: Declined Finalists Time Limit: None seconds Memory Limit: None megabytes Problem Description: This year, as in previous years, MemSQL is inviting the top 25 competitors from the Start[c]up qualification round to compete onsite for the final round. Not everyone who is eligible to compete onsite can afford to travel to the office, though. Initially the top 25 contestants are invited to come onsite. Each eligible contestant must either accept or decline the invitation. Whenever a contestant declines, the highest ranked contestant not yet invited is invited to take the place of the one that declined. This continues until 25 contestants have accepted invitations. After the qualifying round completes, you know *K* of the onsite finalists, as well as their qualifying ranks (which start at 1, there are no ties). Determine the minimum possible number of contestants that declined the invitation to compete onsite in the final round. Input Specification: The first line of input contains *K* (1<=≀<=*K*<=≀<=25), the number of onsite finalists you know. The second line of input contains *r*1,<=*r*2,<=...,<=*r**K* (1<=≀<=*r**i*<=≀<=106), the qualifying ranks of the finalists you know. All these ranks are distinct. Output Specification: Print the minimum possible number of contestants that declined the invitation to compete onsite. Demo Input: ['25\n2 3 4 5 6 7 8 9 10 11 12 14 15 16 17 18 19 20 21 22 23 24 25 26 28\n', '5\n16 23 8 15 4\n', '3\n14 15 92\n'] Demo Output: ['3\n', '0\n', '67\n'] Note: In the first example, you know all 25 onsite finalists. The contestants who ranked 1-st, 13-th, and 27-th must have declined, so the answer is 3.
```python T = int(input()) A = [int(x) for x in input().split()] print(0 if max(A) <= 25 else max(A) - 25) ```
3
935
A
Fafa and his Company
PROGRAMMING
800
[ "brute force", "implementation" ]
null
null
Fafa owns a company that works on huge projects. There are *n* employees in Fafa's company. Whenever the company has a new project to start working on, Fafa has to divide the tasks of this project among all the employees. Fafa finds doing this every time is very tiring for him. So, he decided to choose the best *l* employees in his company as team leaders. Whenever there is a new project, Fafa will divide the tasks among only the team leaders and each team leader will be responsible of some positive number of employees to give them the tasks. To make this process fair for the team leaders, each one of them should be responsible for the same number of employees. Moreover, every employee, who is not a team leader, has to be under the responsibility of exactly one team leader, and no team leader is responsible for another team leader. Given the number of employees *n*, find in how many ways Fafa could choose the number of team leaders *l* in such a way that it is possible to divide employees between them evenly.
The input consists of a single line containing a positive integer *n* (2<=≀<=*n*<=≀<=105) β€” the number of employees in Fafa's company.
Print a single integer representing the answer to the problem.
[ "2\n", "10\n" ]
[ "1\n", "3\n" ]
In the second sample Fafa has 3 ways: - choose only 1 employee as a team leader with 9 employees under his responsibility. - choose 2 employees as team leaders with 4 employees under the responsibility of each of them. - choose 5 employees as team leaders with 1 employee under the responsibility of each of them.
500
[ { "input": "2", "output": "1" }, { "input": "10", "output": "3" }, { "input": "3", "output": "1" }, { "input": "4", "output": "2" }, { "input": "6", "output": "3" }, { "input": "13", "output": "1" }, { "input": "100000", "output": "35" }, { "input": "1024", "output": "10" }, { "input": "99999", "output": "11" }, { "input": "10007", "output": "1" }, { "input": "4096", "output": "12" }, { "input": "65536", "output": "16" }, { "input": "40320", "output": "95" }, { "input": "30030", "output": "63" }, { "input": "161", "output": "3" }, { "input": "1000", "output": "15" }, { "input": "10000", "output": "24" }, { "input": "777", "output": "7" }, { "input": "121", "output": "2" }, { "input": "25", "output": "2" }, { "input": "40000", "output": "34" }, { "input": "99990", "output": "47" }, { "input": "98765", "output": "3" }, { "input": "56789", "output": "3" }, { "input": "13579", "output": "3" }, { "input": "97531", "output": "3" }, { "input": "12345", "output": "7" }, { "input": "54321", "output": "7" }, { "input": "83160", "output": "127" }, { "input": "9", "output": "2" }, { "input": "21", "output": "3" }, { "input": "11", "output": "1" }, { "input": "15", "output": "3" } ]
1,679,477,627
2,147,483,647
PyPy 3-64
OK
TESTS
33
62
1,331,200
n = int(input()) cnt=0 for i in range(1,n//2+1): if n%i==0: cnt += 1 print(cnt)
Title: Fafa and his Company Time Limit: None seconds Memory Limit: None megabytes Problem Description: Fafa owns a company that works on huge projects. There are *n* employees in Fafa's company. Whenever the company has a new project to start working on, Fafa has to divide the tasks of this project among all the employees. Fafa finds doing this every time is very tiring for him. So, he decided to choose the best *l* employees in his company as team leaders. Whenever there is a new project, Fafa will divide the tasks among only the team leaders and each team leader will be responsible of some positive number of employees to give them the tasks. To make this process fair for the team leaders, each one of them should be responsible for the same number of employees. Moreover, every employee, who is not a team leader, has to be under the responsibility of exactly one team leader, and no team leader is responsible for another team leader. Given the number of employees *n*, find in how many ways Fafa could choose the number of team leaders *l* in such a way that it is possible to divide employees between them evenly. Input Specification: The input consists of a single line containing a positive integer *n* (2<=≀<=*n*<=≀<=105) β€” the number of employees in Fafa's company. Output Specification: Print a single integer representing the answer to the problem. Demo Input: ['2\n', '10\n'] Demo Output: ['1\n', '3\n'] Note: In the second sample Fafa has 3 ways: - choose only 1 employee as a team leader with 9 employees under his responsibility. - choose 2 employees as team leaders with 4 employees under the responsibility of each of them. - choose 5 employees as team leaders with 1 employee under the responsibility of each of them.
```python n = int(input()) cnt=0 for i in range(1,n//2+1): if n%i==0: cnt += 1 print(cnt) ```
3
1,003
A
Polycarp's Pockets
PROGRAMMING
800
[ "implementation" ]
null
null
Polycarp has $n$ coins, the value of the $i$-th coin is $a_i$. Polycarp wants to distribute all the coins between his pockets, but he cannot put two coins with the same value into the same pocket. For example, if Polycarp has got six coins represented as an array $a = [1, 2, 4, 3, 3, 2]$, he can distribute the coins into two pockets as follows: $[1, 2, 3], [2, 3, 4]$. Polycarp wants to distribute all the coins with the minimum number of used pockets. Help him to do that.
The first line of the input contains one integer $n$ ($1 \le n \le 100$) β€” the number of coins. The second line of the input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$) β€” values of coins.
Print only one integer β€” the minimum number of pockets Polycarp needs to distribute all the coins so no two coins with the same value are put into the same pocket.
[ "6\n1 2 4 3 3 2\n", "1\n100\n" ]
[ "2\n", "1\n" ]
none
0
[ { "input": "6\n1 2 4 3 3 2", "output": "2" }, { "input": "1\n100", "output": "1" }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100", "output": "100" }, { "input": "100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "100" }, { "input": "100\n59 47 39 47 47 71 47 28 58 47 35 79 58 47 38 47 47 47 47 27 47 43 29 95 47 49 46 71 47 74 79 47 47 32 45 67 47 47 30 37 47 47 16 67 22 76 47 86 84 10 5 47 47 47 47 47 1 51 47 54 47 8 47 47 9 47 47 47 47 28 47 47 26 47 47 47 47 47 47 92 47 47 77 47 47 24 45 47 10 47 47 89 47 27 47 89 47 67 24 71", "output": "51" }, { "input": "100\n45 99 10 27 16 85 39 38 17 32 15 23 67 48 50 97 42 70 62 30 44 81 64 73 34 22 46 5 83 52 58 60 33 74 47 88 18 61 78 53 25 95 94 31 3 75 1 57 20 54 59 9 68 7 77 43 21 87 86 24 4 80 11 49 2 72 36 84 71 8 65 55 79 100 41 14 35 89 66 69 93 37 56 82 90 91 51 19 26 92 6 96 13 98 12 28 76 40 63 29", "output": "1" }, { "input": "100\n45 29 5 2 6 50 22 36 14 15 9 48 46 20 8 37 7 47 12 50 21 38 18 27 33 19 40 10 5 49 38 42 34 37 27 30 35 24 10 3 40 49 41 3 4 44 13 25 28 31 46 36 23 1 1 23 7 22 35 26 21 16 48 42 32 8 11 16 34 11 39 32 47 28 43 41 39 4 14 19 26 45 13 18 15 25 2 44 17 29 17 33 43 6 12 30 9 20 31 24", "output": "2" }, { "input": "50\n7 7 3 3 7 4 5 6 4 3 7 5 6 4 5 4 4 5 6 7 7 7 4 5 5 5 3 7 6 3 4 6 3 6 4 4 5 4 6 6 3 5 6 3 5 3 3 7 7 6", "output": "10" }, { "input": "100\n100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 99 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100 100", "output": "99" }, { "input": "7\n1 2 3 3 3 1 2", "output": "3" }, { "input": "5\n1 2 3 4 5", "output": "1" }, { "input": "7\n1 2 3 4 5 6 7", "output": "1" }, { "input": "8\n1 2 3 4 5 6 7 8", "output": "1" }, { "input": "9\n1 2 3 4 5 6 7 8 9", "output": "1" }, { "input": "10\n1 2 3 4 5 6 7 8 9 10", "output": "1" }, { "input": "3\n2 1 1", "output": "2" }, { "input": "11\n1 2 3 4 5 6 7 8 9 1 1", "output": "3" }, { "input": "12\n1 2 1 1 1 1 1 1 1 1 1 1", "output": "11" }, { "input": "13\n1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "13" }, { "input": "14\n1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "14" }, { "input": "15\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "15" }, { "input": "16\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "16" }, { "input": "3\n1 1 1", "output": "3" }, { "input": "3\n1 2 3", "output": "1" }, { "input": "10\n1 1 1 1 2 2 1 1 9 10", "output": "6" }, { "input": "2\n1 1", "output": "2" }, { "input": "56\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "56" }, { "input": "99\n35 96 73 72 70 83 22 93 98 75 45 32 81 82 45 54 25 7 53 72 29 2 94 19 21 98 34 28 39 99 55 85 44 23 6 47 98 2 33 34 19 57 49 35 67 4 60 4 4 23 55 6 57 66 16 68 34 45 84 79 48 63 4 9 46 88 98 13 19 27 83 12 4 63 57 22 44 77 44 62 28 52 44 64 9 24 55 22 48 4 2 9 80 76 45 1 56 22 92", "output": "6" }, { "input": "10\n1 2 2 3 3 3 4 4 4 4", "output": "4" }, { "input": "99\n97 44 33 56 42 10 61 85 64 26 40 39 82 34 75 9 51 51 39 73 58 38 74 31 13 99 58 1 28 89 76 19 52 7 40 56 12 27 72 72 67 75 62 46 22 55 35 16 18 39 60 63 92 42 85 69 34 61 73 50 57 95 30 4 45 63 76 58 32 35 48 81 10 78 95 79 55 97 21 21 22 94 30 17 78 57 89 93 100 44 16 89 68 55 19 46 42 73 21", "output": "3" }, { "input": "5\n5 5 5 5 1", "output": "4" }, { "input": "6\n2 3 2 5 2 6", "output": "3" }, { "input": "3\n58 59 58", "output": "2" }, { "input": "9\n1 2 3 4 5 6 7 8 8", "output": "2" }, { "input": "97\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "97" }, { "input": "3\n95 95 4", "output": "2" }, { "input": "3\n2 2 5", "output": "2" } ]
1,654,464,062
2,147,483,647
Python 3
OK
TESTS
37
46
0
n=int(input()) a=[int(_) for _ in input().split()] max=0 for ele in set(a): if a.count(ele)>max: max=a.count(ele) print(max)
Title: Polycarp's Pockets Time Limit: None seconds Memory Limit: None megabytes Problem Description: Polycarp has $n$ coins, the value of the $i$-th coin is $a_i$. Polycarp wants to distribute all the coins between his pockets, but he cannot put two coins with the same value into the same pocket. For example, if Polycarp has got six coins represented as an array $a = [1, 2, 4, 3, 3, 2]$, he can distribute the coins into two pockets as follows: $[1, 2, 3], [2, 3, 4]$. Polycarp wants to distribute all the coins with the minimum number of used pockets. Help him to do that. Input Specification: The first line of the input contains one integer $n$ ($1 \le n \le 100$) β€” the number of coins. The second line of the input contains $n$ integers $a_1, a_2, \dots, a_n$ ($1 \le a_i \le 100$) β€” values of coins. Output Specification: Print only one integer β€” the minimum number of pockets Polycarp needs to distribute all the coins so no two coins with the same value are put into the same pocket. Demo Input: ['6\n1 2 4 3 3 2\n', '1\n100\n'] Demo Output: ['2\n', '1\n'] Note: none
```python n=int(input()) a=[int(_) for _ in input().split()] max=0 for ele in set(a): if a.count(ele)>max: max=a.count(ele) print(max) ```
3
208
A
Dubstep
PROGRAMMING
900
[ "strings" ]
null
null
Vasya works as a DJ in the best Berland nightclub, and he often uses dubstep music in his performance. Recently, he has decided to take a couple of old songs and make dubstep remixes from them. Let's assume that a song consists of some number of words. To make the dubstep remix of this song, Vasya inserts a certain number of words "WUB" before the first word of the song (the number may be zero), after the last word (the number may be zero), and between words (at least one between any pair of neighbouring words), and then the boy glues together all the words, including "WUB", in one string and plays the song at the club. For example, a song with words "I AM X" can transform into a dubstep remix as "WUBWUBIWUBAMWUBWUBX" and cannot transform into "WUBWUBIAMWUBX". Recently, Petya has heard Vasya's new dubstep track, but since he isn't into modern music, he decided to find out what was the initial song that Vasya remixed. Help Petya restore the original song.
The input consists of a single non-empty string, consisting only of uppercase English letters, the string's length doesn't exceed 200 characters. It is guaranteed that before Vasya remixed the song, no word contained substring "WUB" in it; Vasya didn't change the word order. It is also guaranteed that initially the song had at least one word.
Print the words of the initial song that Vasya used to make a dubsteb remix. Separate the words with a space.
[ "WUBWUBABCWUB\n", "WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB\n" ]
[ "ABC ", "WE ARE THE CHAMPIONS MY FRIEND " ]
In the first sample: "WUBWUBABCWUB" = "WUB" + "WUB" + "ABC" + "WUB". That means that the song originally consisted of a single word "ABC", and all words "WUB" were added by Vasya. In the second sample Vasya added a single word "WUB" between all neighbouring words, in the beginning and in the end, except for words "ARE" and "THE" β€” between them Vasya added two "WUB".
500
[ { "input": "WUBWUBABCWUB", "output": "ABC " }, { "input": "WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB", "output": "WE ARE THE CHAMPIONS MY FRIEND " }, { "input": "WUBWUBWUBSR", "output": "SR " }, { "input": "RWUBWUBWUBLWUB", "output": "R L " }, { "input": "ZJWUBWUBWUBJWUBWUBWUBL", "output": "ZJ J L " }, { "input": "CWUBBWUBWUBWUBEWUBWUBWUBQWUBWUBWUB", "output": "C B E Q " }, { "input": "WUBJKDWUBWUBWBIRAQKFWUBWUBYEWUBWUBWUBWVWUBWUB", "output": "JKD WBIRAQKF YE WV " }, { "input": "WUBKSDHEMIXUJWUBWUBRWUBWUBWUBSWUBWUBWUBHWUBWUBWUB", "output": "KSDHEMIXUJ R S H " }, { "input": "OGWUBWUBWUBXWUBWUBWUBIWUBWUBWUBKOWUBWUB", "output": "OG X I KO " }, { "input": "QWUBQQWUBWUBWUBIWUBWUBWWWUBWUBWUBJOPJPBRH", "output": "Q QQ I WW JOPJPBRH " }, { "input": "VSRNVEATZTLGQRFEGBFPWUBWUBWUBAJWUBWUBWUBPQCHNWUBCWUB", "output": "VSRNVEATZTLGQRFEGBFP AJ PQCHN C " }, { "input": "WUBWUBEWUBWUBWUBIQMJNIQWUBWUBWUBGZZBQZAUHYPWUBWUBWUBPMRWUBWUBWUBDCV", "output": "E IQMJNIQ GZZBQZAUHYP PMR DCV " }, { "input": "WUBWUBWUBFVWUBWUBWUBBPSWUBWUBWUBRXNETCJWUBWUBWUBJDMBHWUBWUBWUBBWUBWUBVWUBWUBB", "output": "FV BPS RXNETCJ JDMBH B V B " }, { "input": "WUBWUBWUBFBQWUBWUBWUBIDFSYWUBWUBWUBCTWDMWUBWUBWUBSXOWUBWUBWUBQIWUBWUBWUBL", "output": "FBQ IDFSY CTWDM SXO QI L " }, { "input": "IWUBWUBQLHDWUBYIIKZDFQWUBWUBWUBCXWUBWUBUWUBWUBWUBKWUBWUBWUBNL", "output": "I QLHD YIIKZDFQ CX U K NL " }, { "input": "KWUBUPDYXGOKUWUBWUBWUBAGOAHWUBIZDWUBWUBWUBIYWUBWUBWUBVWUBWUBWUBPWUBWUBWUBE", "output": "K UPDYXGOKU AGOAH IZD IY V P E " }, { "input": "WUBWUBOWUBWUBWUBIPVCQAFWYWUBWUBWUBQWUBWUBWUBXHDKCPYKCTWWYWUBWUBWUBVWUBWUBWUBFZWUBWUB", "output": "O IPVCQAFWY Q XHDKCPYKCTWWY V FZ " }, { "input": "PAMJGYWUBWUBWUBXGPQMWUBWUBWUBTKGSXUYWUBWUBWUBEWUBWUBWUBNWUBWUBWUBHWUBWUBWUBEWUBWUB", "output": "PAMJGY XGPQM TKGSXUY E N H E " }, { "input": "WUBYYRTSMNWUWUBWUBWUBCWUBWUBWUBCWUBWUBWUBFSYUINDWOBVWUBWUBWUBFWUBWUBWUBAUWUBWUBWUBVWUBWUBWUBJB", "output": "YYRTSMNWU C C FSYUINDWOBV F AU V JB " }, { "input": "WUBWUBYGPYEYBNRTFKOQCWUBWUBWUBUYGRTQEGWLFYWUBWUBWUBFVWUBHPWUBWUBWUBXZQWUBWUBWUBZDWUBWUBWUBM", "output": "YGPYEYBNRTFKOQC UYGRTQEGWLFY FV HP XZQ ZD M " }, { "input": "WUBZVMJWUBWUBWUBFOIMJQWKNZUBOFOFYCCWUBWUBWUBAUWWUBRDRADWUBWUBWUBCHQVWUBWUBWUBKFTWUBWUBWUBW", "output": "ZVMJ FOIMJQWKNZUBOFOFYCC AUW RDRAD CHQV KFT W " }, { "input": "WUBWUBZBKOKHQLGKRVIMZQMQNRWUBWUBWUBDACWUBWUBNZHFJMPEYKRVSWUBWUBWUBPPHGAVVPRZWUBWUBWUBQWUBWUBAWUBG", "output": "ZBKOKHQLGKRVIMZQMQNR DAC NZHFJMPEYKRVS PPHGAVVPRZ Q A G " }, { "input": "WUBWUBJWUBWUBWUBNFLWUBWUBWUBGECAWUBYFKBYJWTGBYHVSSNTINKWSINWSMAWUBWUBWUBFWUBWUBWUBOVWUBWUBLPWUBWUBWUBN", "output": "J NFL GECA YFKBYJWTGBYHVSSNTINKWSINWSMA F OV LP N " }, { "input": "WUBWUBLCWUBWUBWUBZGEQUEATJVIXETVTWUBWUBWUBEXMGWUBWUBWUBRSWUBWUBWUBVWUBWUBWUBTAWUBWUBWUBCWUBWUBWUBQG", "output": "LC ZGEQUEATJVIXETVT EXMG RS V TA C QG " }, { "input": "WUBMPWUBWUBWUBORWUBWUBDLGKWUBWUBWUBVVZQCAAKVJTIKWUBWUBWUBTJLUBZJCILQDIFVZWUBWUBYXWUBWUBWUBQWUBWUBWUBLWUB", "output": "MP OR DLGK VVZQCAAKVJTIK TJLUBZJCILQDIFVZ YX Q L " }, { "input": "WUBNXOLIBKEGXNWUBWUBWUBUWUBGITCNMDQFUAOVLWUBWUBWUBAIJDJZJHFMPVTPOXHPWUBWUBWUBISCIOWUBWUBWUBGWUBWUBWUBUWUB", "output": "NXOLIBKEGXN U GITCNMDQFUAOVL AIJDJZJHFMPVTPOXHP ISCIO G U " }, { "input": "WUBWUBNMMWCZOLYPNBELIYVDNHJUNINWUBWUBWUBDXLHYOWUBWUBWUBOJXUWUBWUBWUBRFHTGJCEFHCGWARGWUBWUBWUBJKWUBWUBSJWUBWUB", "output": "NMMWCZOLYPNBELIYVDNHJUNIN DXLHYO OJXU RFHTGJCEFHCGWARG JK SJ " }, { "input": "SGWLYSAUJOJBNOXNWUBWUBWUBBOSSFWKXPDPDCQEWUBWUBWUBDIRZINODWUBWUBWUBWWUBWUBWUBPPHWUBWUBWUBRWUBWUBWUBQWUBWUBWUBJWUB", "output": "SGWLYSAUJOJBNOXN BOSSFWKXPDPDCQE DIRZINOD W PPH R Q J " }, { "input": "TOWUBWUBWUBGBTBNWUBWUBWUBJVIOJBIZFUUYHUAIEBQLQXPQKZJMPTCWBKPOSAWUBWUBWUBSWUBWUBWUBTOLVXWUBWUBWUBNHWUBWUBWUBO", "output": "TO GBTBN JVIOJBIZFUUYHUAIEBQLQXPQKZJMPTCWBKPOSA S TOLVX NH O " }, { "input": "WUBWUBWSPLAYSZSAUDSWUBWUBWUBUWUBWUBWUBKRWUBWUBWUBRSOKQMZFIYZQUWUBWUBWUBELSHUWUBWUBWUBUKHWUBWUBWUBQXEUHQWUBWUBWUBBWUBWUBWUBR", "output": "WSPLAYSZSAUDS U KR RSOKQMZFIYZQU ELSHU UKH QXEUHQ B R " }, { "input": "WUBXEMWWVUHLSUUGRWUBWUBWUBAWUBXEGILZUNKWUBWUBWUBJDHHKSWUBWUBWUBDTSUYSJHWUBWUBWUBPXFWUBMOHNJWUBWUBWUBZFXVMDWUBWUBWUBZMWUBWUB", "output": "XEMWWVUHLSUUGR A XEGILZUNK JDHHKS DTSUYSJH PXF MOHNJ ZFXVMD ZM " }, { "input": "BMBWUBWUBWUBOQKWUBWUBWUBPITCIHXHCKLRQRUGXJWUBWUBWUBVWUBWUBWUBJCWUBWUBWUBQJPWUBWUBWUBBWUBWUBWUBBMYGIZOOXWUBWUBWUBTAGWUBWUBHWUB", "output": "BMB OQK PITCIHXHCKLRQRUGXJ V JC QJP B BMYGIZOOX TAG H " }, { "input": "CBZNWUBWUBWUBNHWUBWUBWUBYQSYWUBWUBWUBMWUBWUBWUBXRHBTMWUBWUBWUBPCRCWUBWUBWUBTZUYLYOWUBWUBWUBCYGCWUBWUBWUBCLJWUBWUBWUBSWUBWUBWUB", "output": "CBZN NH YQSY M XRHBTM PCRC TZUYLYO CYGC CLJ S " }, { "input": "DPDWUBWUBWUBEUQKWPUHLTLNXHAEKGWUBRRFYCAYZFJDCJLXBAWUBWUBWUBHJWUBOJWUBWUBWUBNHBJEYFWUBWUBWUBRWUBWUBWUBSWUBWWUBWUBWUBXDWUBWUBWUBJWUB", "output": "DPD EUQKWPUHLTLNXHAEKG RRFYCAYZFJDCJLXBA HJ OJ NHBJEYF R S W XD J " }, { "input": "WUBWUBWUBISERPQITVIYERSCNWUBWUBWUBQWUBWUBWUBDGSDIPWUBWUBWUBCAHKDZWEXBIBJVVSKKVQJWUBWUBWUBKIWUBWUBWUBCWUBWUBWUBAWUBWUBWUBPWUBWUBWUBHWUBWUBWUBF", "output": "ISERPQITVIYERSCN Q DGSDIP CAHKDZWEXBIBJVVSKKVQJ KI C A P H F " }, { "input": "WUBWUBWUBIWUBWUBLIKNQVWUBWUBWUBPWUBWUBWUBHWUBWUBWUBMWUBWUBWUBDPRSWUBWUBWUBBSAGYLQEENWXXVWUBWUBWUBXMHOWUBWUBWUBUWUBWUBWUBYRYWUBWUBWUBCWUBWUBWUBY", "output": "I LIKNQV P H M DPRS BSAGYLQEENWXXV XMHO U YRY C Y " }, { "input": "WUBWUBWUBMWUBWUBWUBQWUBWUBWUBITCFEYEWUBWUBWUBHEUWGNDFNZGWKLJWUBWUBWUBMZPWUBWUBWUBUWUBWUBWUBBWUBWUBWUBDTJWUBHZVIWUBWUBWUBPWUBFNHHWUBWUBWUBVTOWUB", "output": "M Q ITCFEYE HEUWGNDFNZGWKLJ MZP U B DTJ HZVI P FNHH VTO " }, { "input": "WUBWUBNDNRFHYJAAUULLHRRDEDHYFSRXJWUBWUBWUBMUJVDTIRSGYZAVWKRGIFWUBWUBWUBHMZWUBWUBWUBVAIWUBWUBWUBDDKJXPZRGWUBWUBWUBSGXWUBWUBWUBIFKWUBWUBWUBUWUBWUBWUBW", "output": "NDNRFHYJAAUULLHRRDEDHYFSRXJ MUJVDTIRSGYZAVWKRGIF HMZ VAI DDKJXPZRG SGX IFK U W " }, { "input": "WUBOJMWRSLAXXHQRTPMJNCMPGWUBWUBWUBNYGMZIXNLAKSQYWDWUBWUBWUBXNIWUBWUBWUBFWUBWUBWUBXMBWUBWUBWUBIWUBWUBWUBINWUBWUBWUBWDWUBWUBWUBDDWUBWUBWUBD", "output": "OJMWRSLAXXHQRTPMJNCMPG NYGMZIXNLAKSQYWD XNI F XMB I IN WD DD D " }, { "input": "WUBWUBWUBREHMWUBWUBWUBXWUBWUBWUBQASNWUBWUBWUBNLSMHLCMTICWUBWUBWUBVAWUBWUBWUBHNWUBWUBWUBNWUBWUBWUBUEXLSFOEULBWUBWUBWUBXWUBWUBWUBJWUBWUBWUBQWUBWUBWUBAWUBWUB", "output": "REHM X QASN NLSMHLCMTIC VA HN N UEXLSFOEULB X J Q A " }, { "input": "WUBWUBWUBSTEZTZEFFIWUBWUBWUBSWUBWUBWUBCWUBFWUBHRJPVWUBWUBWUBDYJUWUBWUBWUBPWYDKCWUBWUBWUBCWUBWUBWUBUUEOGCVHHBWUBWUBWUBEXLWUBWUBWUBVCYWUBWUBWUBMWUBWUBWUBYWUB", "output": "STEZTZEFFI S C F HRJPV DYJU PWYDKC C UUEOGCVHHB EXL VCY M Y " }, { "input": "WPPNMSQOQIWUBWUBWUBPNQXWUBWUBWUBHWUBWUBWUBNFLWUBWUBWUBGWSGAHVJFNUWUBWUBWUBFWUBWUBWUBWCMLRICFSCQQQTNBWUBWUBWUBSWUBWUBWUBKGWUBWUBWUBCWUBWUBWUBBMWUBWUBWUBRWUBWUB", "output": "WPPNMSQOQI PNQX H NFL GWSGAHVJFNU F WCMLRICFSCQQQTNB S KG C BM R " }, { "input": "YZJOOYITZRARKVFYWUBWUBRZQGWUBWUBWUBUOQWUBWUBWUBIWUBWUBWUBNKVDTBOLETKZISTWUBWUBWUBWLWUBQQFMMGSONZMAWUBZWUBWUBWUBQZUXGCWUBWUBWUBIRZWUBWUBWUBLTTVTLCWUBWUBWUBY", "output": "YZJOOYITZRARKVFY RZQG UOQ I NKVDTBOLETKZIST WL QQFMMGSONZMA Z QZUXGC IRZ LTTVTLC Y " }, { "input": "WUBCAXNCKFBVZLGCBWCOAWVWOFKZVQYLVTWUBWUBWUBNLGWUBWUBWUBAMGDZBDHZMRMQMDLIRMIWUBWUBWUBGAJSHTBSWUBWUBWUBCXWUBWUBWUBYWUBZLXAWWUBWUBWUBOHWUBWUBWUBZWUBWUBWUBGBWUBWUBWUBE", "output": "CAXNCKFBVZLGCBWCOAWVWOFKZVQYLVT NLG AMGDZBDHZMRMQMDLIRMI GAJSHTBS CX Y ZLXAW OH Z GB E " }, { "input": "WUBWUBCHXSOWTSQWUBWUBWUBCYUZBPBWUBWUBWUBSGWUBWUBWKWORLRRLQYUUFDNWUBWUBWUBYYGOJNEVEMWUBWUBWUBRWUBWUBWUBQWUBWUBWUBIHCKWUBWUBWUBKTWUBWUBWUBRGSNTGGWUBWUBWUBXCXWUBWUBWUBS", "output": "CHXSOWTSQ CYUZBPB SG WKWORLRRLQYUUFDN YYGOJNEVEM R Q IHCK KT RGSNTGG XCX S " }, { "input": "WUBWUBWUBHJHMSBURXTHXWSCHNAIJOWBHLZGJZDHEDSPWBWACCGQWUBWUBWUBXTZKGIITWUBWUBWUBAWUBWUBWUBVNCXPUBCQWUBWUBWUBIDPNAWUBWUBWUBOWUBWUBWUBYGFWUBWUBWUBMQOWUBWUBWUBKWUBWUBWUBAZVWUBWUBWUBEP", "output": "HJHMSBURXTHXWSCHNAIJOWBHLZGJZDHEDSPWBWACCGQ XTZKGIIT A VNCXPUBCQ IDPNA O YGF MQO K AZV EP " }, { "input": "WUBKYDZOYWZSNGMKJSWAXFDFLTHDHEOGTDBNZMSMKZTVWUBWUBWUBLRMIIWUBWUBWUBGWUBWUBWUBADPSWUBWUBWUBANBWUBWUBPCWUBWUBWUBPWUBWUBWUBGPVNLSWIRFORYGAABUXMWUBWUBWUBOWUBWUBWUBNWUBWUBWUBYWUBWUB", "output": "KYDZOYWZSNGMKJSWAXFDFLTHDHEOGTDBNZMSMKZTV LRMII G ADPS ANB PC P GPVNLSWIRFORYGAABUXM O N Y " }, { "input": "REWUBWUBWUBJDWUBWUBWUBNWUBWUBWUBTWWUBWUBWUBWZDOCKKWUBWUBWUBLDPOVBFRCFWUBWUBAKZIBQKEUAZEEWUBWUBWUBLQYPNPFWUBYEWUBWUBWUBFWUBWUBWUBBPWUBWUBWUBAWWUBWUBWUBQWUBWUBWUBBRWUBWUBWUBXJL", "output": "RE JD N TW WZDOCKK LDPOVBFRCF AKZIBQKEUAZEE LQYPNPF YE F BP AW Q BR XJL " }, { "input": "CUFGJDXGMWUBWUBWUBOMWUBWUBWUBSIEWUBWUBWUBJJWKNOWUBWUBWUBYBHVNRNORGYWUBWUBWUBOAGCAWUBWUBWUBSBLBKTPFKPBIWUBWUBWUBJBWUBWUBWUBRMFCJPGWUBWUBWUBDWUBWUBWUBOJOWUBWUBWUBZPWUBWUBWUBMWUBRWUBWUBWUBFXWWUBWUBWUBO", "output": "CUFGJDXGM OM SIE JJWKNO YBHVNRNORGY OAGCA SBLBKTPFKPBI JB RMFCJPG D OJO ZP M R FXW O " }, { "input": "WUBJZGAEXFMFEWMAKGQLUWUBWUBWUBICYTPQWGENELVYWANKUOJYWUBWUBWUBGWUBWUBWUBHYCJVLPHTUPNEGKCDGQWUBWUBWUBOFWUBWUBWUBCPGSOGZBRPRPVJJEWUBWUBWUBDQBCWUBWUBWUBHWUBWUBWUBMHOHYBMATWUBWUBWUBVWUBWUBWUBSWUBWUBWUBKOWU", "output": "JZGAEXFMFEWMAKGQLU ICYTPQWGENELVYWANKUOJY G HYCJVLPHTUPNEGKCDGQ OF CPGSOGZBRPRPVJJE DQBC H MHOHYBMAT V S KOWU " }, { "input": "A", "output": "A " }, { "input": "WUBA", "output": "A " }, { "input": "WUBWUBA", "output": "A " }, { "input": "AWUBWUBWUB", "output": "A " }, { "input": "AWUBBWUBCWUBD", "output": "A B C D " }, { "input": "WUBWWUBWUBWUBUWUBWUBBWUB", "output": "W U B " }, { "input": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "output": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA " }, { "input": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAWUBAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA", "output": "AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA " }, { "input": "WUWUBBWWUBUB", "output": "WU BW UB " }, { "input": "WUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUABWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUBWUB", "output": "WUAB " }, { "input": "ZWUB", "output": "Z " }, { "input": "WU", "output": "WU " }, { "input": "UB", "output": "UB " }, { "input": "U", "output": "U " }, { "input": "WUBW", "output": "W " }, { "input": "WUBWU", "output": "WU " }, { "input": "WUWUB", "output": "WU " }, { "input": "UBWUB", "output": "UB " }, { "input": "WUWUBUBWUBUWUB", "output": "WU UB U " }, { "input": "WUBWWUBAWUB", "output": "W A " }, { "input": "WUUUUU", "output": "WUUUUU " } ]
1,699,392,102
2,147,483,647
Python 3
OK
TESTS
71
92
0
song = input() # Replace "WUB" with a space and split the string by spaces decoded_song = song.replace("WUB", " ").split() # Join the words to reconstruct the original song original_song = " ".join(decoded_song) print(original_song)
Title: Dubstep Time Limit: None seconds Memory Limit: None megabytes Problem Description: Vasya works as a DJ in the best Berland nightclub, and he often uses dubstep music in his performance. Recently, he has decided to take a couple of old songs and make dubstep remixes from them. Let's assume that a song consists of some number of words. To make the dubstep remix of this song, Vasya inserts a certain number of words "WUB" before the first word of the song (the number may be zero), after the last word (the number may be zero), and between words (at least one between any pair of neighbouring words), and then the boy glues together all the words, including "WUB", in one string and plays the song at the club. For example, a song with words "I AM X" can transform into a dubstep remix as "WUBWUBIWUBAMWUBWUBX" and cannot transform into "WUBWUBIAMWUBX". Recently, Petya has heard Vasya's new dubstep track, but since he isn't into modern music, he decided to find out what was the initial song that Vasya remixed. Help Petya restore the original song. Input Specification: The input consists of a single non-empty string, consisting only of uppercase English letters, the string's length doesn't exceed 200 characters. It is guaranteed that before Vasya remixed the song, no word contained substring "WUB" in it; Vasya didn't change the word order. It is also guaranteed that initially the song had at least one word. Output Specification: Print the words of the initial song that Vasya used to make a dubsteb remix. Separate the words with a space. Demo Input: ['WUBWUBABCWUB\n', 'WUBWEWUBAREWUBWUBTHEWUBCHAMPIONSWUBMYWUBFRIENDWUB\n'] Demo Output: ['ABC ', 'WE ARE THE CHAMPIONS MY FRIEND '] Note: In the first sample: "WUBWUBABCWUB" = "WUB" + "WUB" + "ABC" + "WUB". That means that the song originally consisted of a single word "ABC", and all words "WUB" were added by Vasya. In the second sample Vasya added a single word "WUB" between all neighbouring words, in the beginning and in the end, except for words "ARE" and "THE" β€” between them Vasya added two "WUB".
```python song = input() # Replace "WUB" with a space and split the string by spaces decoded_song = song.replace("WUB", " ").split() # Join the words to reconstruct the original song original_song = " ".join(decoded_song) print(original_song) ```
3
707
A
Brain's Photos
PROGRAMMING
800
[ "implementation" ]
null
null
Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead. As you may know, the coolest photos are on the film (because you can specify the hashtag #film for such). Brain took a lot of colourful pictures on colored and black-and-white film. Then he developed and translated it into a digital form. But now, color and black-and-white photos are in one folder, and to sort them, one needs to spend more than one hour! As soon as Brain is a photographer not programmer now, he asks you to help him determine for a single photo whether it is colored or black-and-white. Photo can be represented as a matrix sized *n*<=Γ—<=*m*, and each element of the matrix stores a symbol indicating corresponding pixel color. There are only 6 colors: - 'C' (cyan)- 'M' (magenta)- 'Y' (yellow)- 'W' (white)- 'G' (grey)- 'B' (black) The photo is considered black-and-white if it has only white, black and grey pixels in it. If there are any of cyan, magenta or yellow pixels in the photo then it is considered colored.
The first line of the input contains two integers *n* and *m* (1<=≀<=*n*,<=*m*<=≀<=100)Β β€” the number of photo pixel matrix rows and columns respectively. Then *n* lines describing matrix rows follow. Each of them contains *m* space-separated characters describing colors of pixels in a row. Each character in the line is one of the 'C', 'M', 'Y', 'W', 'G' or 'B'.
Print the "#Black&amp;White" (without quotes), if the photo is black-and-white and "#Color" (without quotes), if it is colored, in the only line.
[ "2 2\nC M\nY Y\n", "3 2\nW W\nW W\nB B\n", "1 1\nW\n" ]
[ "#Color", "#Black&amp;White", "#Black&amp;White" ]
none
500
[ { "input": "2 2\nC M\nY Y", "output": "#Color" }, { "input": "3 2\nW W\nW W\nB B", "output": "#Black&White" }, { "input": "1 1\nW", "output": "#Black&White" }, { "input": "2 3\nW W W\nB G Y", "output": "#Color" }, { "input": "1 1\nW", "output": "#Black&White" }, { "input": "5 5\nW G B Y M\nG B Y M C\nB Y M C W\nY M C W G\nM C W G B", "output": "#Color" }, { "input": "1 6\nC M Y W G B", "output": "#Color" }, { "input": "1 3\nW G B", "output": "#Black&White" }, { "input": "1 1\nW", "output": "#Black&White" }, { "input": "5 5\nW G B W G\nG B W G B\nB W G B W\nW G B W G\nG B W G B", "output": "#Black&White" }, { "input": "2 3\nW W W\nB G C", "output": "#Color" }, { "input": "2 3\nW W W\nB G M", "output": "#Color" }, { "input": "3 3\nC B W\nB Y M\nB B W", "output": "#Color" }, { "input": "1 3\nW C W", "output": "#Color" }, { "input": "3 3\nB W B\nB C W\nB W W", "output": "#Color" }, { "input": "1 2\nW Y", "output": "#Color" }, { "input": "1 1\nG", "output": "#Black&White" }, { "input": "1 3\nB G W", "output": "#Black&White" }, { "input": "2 2\nW W\nB C", "output": "#Color" }, { "input": "1 1\nM", "output": "#Color" }, { "input": "1 2\nW C", "output": "#Color" }, { "input": "2 3\nW W M\nW W M", "output": "#Color" }, { "input": "3 2\nW W\nW W\nB C", "output": "#Color" }, { "input": "2 3\nW W C\nW W W", "output": "#Color" }, { "input": "1 3\nG G G", "output": "#Black&White" }, { "input": "1 1\nC", "output": "#Color" }, { "input": "1 2\nC W", "output": "#Color" }, { "input": "1 3\nW W C", "output": "#Color" }, { "input": "2 2\nW B\nB G", "output": "#Black&White" }, { "input": "2 2\nB B\nY Y", "output": "#Color" }, { "input": "2 2\nG G\nC C", "output": "#Color" }, { "input": "1 2\nB C", "output": "#Color" }, { "input": "1 4\nG G G C", "output": "#Color" }, { "input": "1 1\nB", "output": "#Black&White" }, { "input": "2 1\nY\nB", "output": "#Color" } ]
1,665,199,323
2,147,483,647
Python 3
OK
TESTS
50
46
0
l=[] x,y=(map(int,input().split())) for i in range(x): l+=input().split() if ('C' in l) or ('M' in l) or ('Y' in l): print("#Color") else: print('#Black&White')
Title: Brain's Photos Time Limit: None seconds Memory Limit: None megabytes Problem Description: Small, but very brave, mouse Brain was not accepted to summer school of young villains. He was upset and decided to postpone his plans of taking over the world, but to become a photographer instead. As you may know, the coolest photos are on the film (because you can specify the hashtag #film for such). Brain took a lot of colourful pictures on colored and black-and-white film. Then he developed and translated it into a digital form. But now, color and black-and-white photos are in one folder, and to sort them, one needs to spend more than one hour! As soon as Brain is a photographer not programmer now, he asks you to help him determine for a single photo whether it is colored or black-and-white. Photo can be represented as a matrix sized *n*<=Γ—<=*m*, and each element of the matrix stores a symbol indicating corresponding pixel color. There are only 6 colors: - 'C' (cyan)- 'M' (magenta)- 'Y' (yellow)- 'W' (white)- 'G' (grey)- 'B' (black) The photo is considered black-and-white if it has only white, black and grey pixels in it. If there are any of cyan, magenta or yellow pixels in the photo then it is considered colored. Input Specification: The first line of the input contains two integers *n* and *m* (1<=≀<=*n*,<=*m*<=≀<=100)Β β€” the number of photo pixel matrix rows and columns respectively. Then *n* lines describing matrix rows follow. Each of them contains *m* space-separated characters describing colors of pixels in a row. Each character in the line is one of the 'C', 'M', 'Y', 'W', 'G' or 'B'. Output Specification: Print the "#Black&amp;White" (without quotes), if the photo is black-and-white and "#Color" (without quotes), if it is colored, in the only line. Demo Input: ['2 2\nC M\nY Y\n', '3 2\nW W\nW W\nB B\n', '1 1\nW\n'] Demo Output: ['#Color', '#Black&amp;White', '#Black&amp;White'] Note: none
```python l=[] x,y=(map(int,input().split())) for i in range(x): l+=input().split() if ('C' in l) or ('M' in l) or ('Y' in l): print("#Color") else: print('#Black&White') ```
3
886
B
Vlad and Cafes
PROGRAMMING
1,000
[]
null
null
Vlad likes to eat in cafes very much. During his life, he has visited cafes *n* times. Unfortunately, Vlad started to feel that his last visits are not any different from each other. To fix that Vlad had a small research. First of all, Vlad assigned individual indices to all cafes. Then, he wrote down indices of cafes he visited in a row, in order of visiting them. Now, Vlad wants to find such a cafe that his last visit to that cafe was before his last visits to every other cafe. In other words, he wants to find such a cafe that he hasn't been there for as long as possible. Help Vlad to find that cafe.
In first line there is one integer *n* (1<=≀<=*n*<=≀<=2Β·105)Β β€” number of cafes indices written by Vlad. In second line, *n* numbers *a*1,<=*a*2,<=...,<=*a**n* (0<=≀<=*a**i*<=≀<=2Β·105) are writtenΒ β€” indices of cafes in order of being visited by Vlad. Vlad could visit some cafes more than once. Note that in numeration, some indices could be omitted.
Print one integerΒ β€” index of the cafe that Vlad hasn't visited for as long as possible.
[ "5\n1 3 2 1 2\n", "6\n2 1 2 2 4 1\n" ]
[ "3\n", "2\n" ]
In first test, there are three cafes, and the last visits to cafes with indices 1 and 2 were after the last visit to cafe with index 3; so this cafe is the answer. In second test case, there are also three cafes, but with indices 1, 2 and 4. Cafes with indices 1 and 4 were visited after the last visit of cafe with index 2, so the answer is 2. Note that Vlad could omit some numbers while numerating the cafes.
1,000
[ { "input": "5\n1 3 2 1 2", "output": "3" }, { "input": "6\n2 1 2 2 4 1", "output": "2" }, { "input": "1\n0", "output": "0" }, { "input": "1\n200000", "output": "200000" }, { "input": "2\n2018 2017", "output": "2018" }, { "input": "5\n100 1000 1000 1000 1000", "output": "100" }, { "input": "8\n200000 1 200000 1 200000 1 200000 2", "output": "1" }, { "input": "5\n20000 1 2 3 4", "output": "20000" }, { "input": "2\n200000 1", "output": "200000" }, { "input": "3\n2 100 2", "output": "100" }, { "input": "2\n10 1", "output": "10" }, { "input": "11\n1 1 1 1 1 1 1 1 1 1 1", "output": "1" }, { "input": "3\n5 5 5", "output": "5" }, { "input": "2\n5 1", "output": "5" } ]
1,512,685,940
2,147,483,647
Python 3
OK
TESTS
33
451
30,105,600
from functools import reduce n = int(input()) dic = {} a = list(map(int, input().split())) for i in range(n): dic[a[i]] = i arr = [] for i in dic: arr.append((dic[i], i)) arr.sort() print(arr[0][1])
Title: Vlad and Cafes Time Limit: None seconds Memory Limit: None megabytes Problem Description: Vlad likes to eat in cafes very much. During his life, he has visited cafes *n* times. Unfortunately, Vlad started to feel that his last visits are not any different from each other. To fix that Vlad had a small research. First of all, Vlad assigned individual indices to all cafes. Then, he wrote down indices of cafes he visited in a row, in order of visiting them. Now, Vlad wants to find such a cafe that his last visit to that cafe was before his last visits to every other cafe. In other words, he wants to find such a cafe that he hasn't been there for as long as possible. Help Vlad to find that cafe. Input Specification: In first line there is one integer *n* (1<=≀<=*n*<=≀<=2Β·105)Β β€” number of cafes indices written by Vlad. In second line, *n* numbers *a*1,<=*a*2,<=...,<=*a**n* (0<=≀<=*a**i*<=≀<=2Β·105) are writtenΒ β€” indices of cafes in order of being visited by Vlad. Vlad could visit some cafes more than once. Note that in numeration, some indices could be omitted. Output Specification: Print one integerΒ β€” index of the cafe that Vlad hasn't visited for as long as possible. Demo Input: ['5\n1 3 2 1 2\n', '6\n2 1 2 2 4 1\n'] Demo Output: ['3\n', '2\n'] Note: In first test, there are three cafes, and the last visits to cafes with indices 1 and 2 were after the last visit to cafe with index 3; so this cafe is the answer. In second test case, there are also three cafes, but with indices 1, 2 and 4. Cafes with indices 1 and 4 were visited after the last visit of cafe with index 2, so the answer is 2. Note that Vlad could omit some numbers while numerating the cafes.
```python from functools import reduce n = int(input()) dic = {} a = list(map(int, input().split())) for i in range(n): dic[a[i]] = i arr = [] for i in dic: arr.append((dic[i], i)) arr.sort() print(arr[0][1]) ```
3
768
B
Code For 1
PROGRAMMING
1,600
[ "constructive algorithms", "dfs and similar", "divide and conquer" ]
null
null
Jon fought bravely to rescue the wildlings who were attacked by the white-walkers at Hardhome. On his arrival, Sam tells him that he wants to go to Oldtown to train at the Citadel to become a maester, so he can return and take the deceased Aemon's place as maester of Castle Black. Jon agrees to Sam's proposal and Sam sets off his journey to the Citadel. However becoming a trainee at the Citadel is not a cakewalk and hence the maesters at the Citadel gave Sam a problem to test his eligibility. Initially Sam has a list with a single element *n*. Then he has to perform certain operations on this list. In each operation Sam must remove any element *x*, such that *x*<=&gt;<=1, from the list and insert at the same position , , sequentially. He must continue with these operations until all the elements in the list are either 0 or 1. Now the masters want the total number of 1s in the range *l* to *r* (1-indexed). Sam wants to become a maester but unfortunately he cannot solve this problem. Can you help Sam to pass the eligibility test?
The first line contains three integers *n*, *l*, *r* (0<=≀<=*n*<=&lt;<=250, 0<=≀<=*r*<=-<=*l*<=≀<=105, *r*<=β‰₯<=1, *l*<=β‰₯<=1) – initial element and the range *l* to *r*. It is guaranteed that *r* is not greater than the length of the final list.
Output the total number of 1s in the range *l* to *r* in the final sequence.
[ "7 2 5\n", "10 3 10\n" ]
[ "4\n", "5\n" ]
Consider first example: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/288fbb682a6fa1934a47b763d6851f9d32a06150.png" style="max-width: 100.0%;max-height: 100.0%;"/> Elements on positions from 2-nd to 5-th in list is [1, 1, 1, 1]. The number of ones is 4. For the second example: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/52e9bc51ef858cacc27fc274c7ba9419d5c1ded9.png" style="max-width: 100.0%;max-height: 100.0%;"/> Elements on positions from 3-rd to 10-th in list is [1, 1, 1, 0, 1, 0, 1, 0]. The number of ones is 5.
1,000
[ { "input": "7 2 5", "output": "4" }, { "input": "10 3 10", "output": "5" }, { "input": "56 18 40", "output": "20" }, { "input": "203 40 124", "output": "67" }, { "input": "903316762502 354723010040 354723105411", "output": "78355" }, { "input": "33534354842198 32529564319236 32529564342569", "output": "22239" }, { "input": "62518534961045 50734311240112 50734311287877", "output": "42439" }, { "input": "95173251245550 106288351347530 106288351372022", "output": "16565" }, { "input": "542 321 956", "output": "336" }, { "input": "3621 237 2637", "output": "2124" }, { "input": "9056 336 896", "output": "311" }, { "input": "36007 368 24490", "output": "13253" }, { "input": "244269 149154 244246", "output": "88609" }, { "input": "880234 669493 757150", "output": "73585" }, { "input": "3740160 1031384 1104236", "output": "64965" }, { "input": "11586121 15337246 15397874", "output": "41868" }, { "input": "38658997 35923164 35985664", "output": "36004" }, { "input": "192308932 207804787 207866400", "output": "44142" }, { "input": "950099012 175922161 176000556", "output": "69369" }, { "input": "2787326787 3799676481 3799680514", "output": "2618" }, { "input": "14417262581 8527979363 8528075536", "output": "80707" }, { "input": "39889373539 7747197212 7747278363", "output": "47105" }, { "input": "251772781087 70597428577 70597479816", "output": "46933" }, { "input": "0 1 1", "output": "0" }, { "input": "1 1 1", "output": "1" }, { "input": "3 2 3", "output": "2" }, { "input": "14 7 12", "output": "5" }, { "input": "1125899906842623 1 100001", "output": "100001" }, { "input": "1125899906842623 1125899906742623 1125899906842623", "output": "100001" }, { "input": "1000 1 1023", "output": "1000" }, { "input": "281474976710656 17179869184 17179869186", "output": "1" }, { "input": "2 2 2", "output": "0" }, { "input": "3 2 2", "output": "1" } ]
1,697,434,211
2,147,483,647
Python 3
OK
TESTS
33
93
9,625,600
mp = {0: 1, 1: 1} vec = [] def getLen(n): if n == 0 or n == 1: return 1 m = n // 2 mp[m] = getLen(m) mp[n] = 2 * mp[m] + 1 return mp[n] def getAns(n, interval): if n == 1: return len(interval) elif n == 0: return 0 else: length = mp[n // 2] cnt = 0 interv = [] for v in interval: u = [v[0], v[1]] if v[1] <= length: interv.append(u) elif v[0] > length + 1: u[0] -= length + 1 u[1] -= length + 1 interv.append(u) else: if n % 2 == 1: cnt += 1 if v[0] <= length: u[1] = length interv.append([u[0], u[1]]) if v[1] > length + 1: u[0] = 1 u[1] = v[1] - length - 1 interv.append([u[0], u[1]]) return getAns(n // 2, interv) + cnt if __name__ == '__main__': n, l, r = map(int, input().split()) vec.append([l, r]) getLen(n) print(getAns(n, vec))
Title: Code For 1 Time Limit: None seconds Memory Limit: None megabytes Problem Description: Jon fought bravely to rescue the wildlings who were attacked by the white-walkers at Hardhome. On his arrival, Sam tells him that he wants to go to Oldtown to train at the Citadel to become a maester, so he can return and take the deceased Aemon's place as maester of Castle Black. Jon agrees to Sam's proposal and Sam sets off his journey to the Citadel. However becoming a trainee at the Citadel is not a cakewalk and hence the maesters at the Citadel gave Sam a problem to test his eligibility. Initially Sam has a list with a single element *n*. Then he has to perform certain operations on this list. In each operation Sam must remove any element *x*, such that *x*<=&gt;<=1, from the list and insert at the same position , , sequentially. He must continue with these operations until all the elements in the list are either 0 or 1. Now the masters want the total number of 1s in the range *l* to *r* (1-indexed). Sam wants to become a maester but unfortunately he cannot solve this problem. Can you help Sam to pass the eligibility test? Input Specification: The first line contains three integers *n*, *l*, *r* (0<=≀<=*n*<=&lt;<=250, 0<=≀<=*r*<=-<=*l*<=≀<=105, *r*<=β‰₯<=1, *l*<=β‰₯<=1) – initial element and the range *l* to *r*. It is guaranteed that *r* is not greater than the length of the final list. Output Specification: Output the total number of 1s in the range *l* to *r* in the final sequence. Demo Input: ['7 2 5\n', '10 3 10\n'] Demo Output: ['4\n', '5\n'] Note: Consider first example: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/288fbb682a6fa1934a47b763d6851f9d32a06150.png" style="max-width: 100.0%;max-height: 100.0%;"/> Elements on positions from 2-nd to 5-th in list is [1, 1, 1, 1]. The number of ones is 4. For the second example: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/52e9bc51ef858cacc27fc274c7ba9419d5c1ded9.png" style="max-width: 100.0%;max-height: 100.0%;"/> Elements on positions from 3-rd to 10-th in list is [1, 1, 1, 0, 1, 0, 1, 0]. The number of ones is 5.
```python mp = {0: 1, 1: 1} vec = [] def getLen(n): if n == 0 or n == 1: return 1 m = n // 2 mp[m] = getLen(m) mp[n] = 2 * mp[m] + 1 return mp[n] def getAns(n, interval): if n == 1: return len(interval) elif n == 0: return 0 else: length = mp[n // 2] cnt = 0 interv = [] for v in interval: u = [v[0], v[1]] if v[1] <= length: interv.append(u) elif v[0] > length + 1: u[0] -= length + 1 u[1] -= length + 1 interv.append(u) else: if n % 2 == 1: cnt += 1 if v[0] <= length: u[1] = length interv.append([u[0], u[1]]) if v[1] > length + 1: u[0] = 1 u[1] = v[1] - length - 1 interv.append([u[0], u[1]]) return getAns(n // 2, interv) + cnt if __name__ == '__main__': n, l, r = map(int, input().split()) vec.append([l, r]) getLen(n) print(getAns(n, vec)) ```
3
347
B
Fixed Points
PROGRAMMING
1,100
[ "brute force", "implementation", "math" ]
null
null
A permutation of length *n* is an integer sequence such that each integer from 0 to (*n*<=-<=1) appears exactly once in it. For example, sequence [0,<=2,<=1] is a permutation of length 3 while both [0,<=2,<=2] and [1,<=2,<=3] are not. A fixed point of a function is a point that is mapped to itself by the function. A permutation can be regarded as a bijective function. We'll get a definition of a fixed point in a permutation. An integer *i* is a fixed point of permutation *a*0,<=*a*1,<=...,<=*a**n*<=-<=1 if and only if *a**i*<==<=*i*. For example, permutation [0,<=2,<=1] has 1 fixed point and permutation [0,<=1,<=2] has 3 fixed points. You are given permutation *a*. You are allowed to swap two elements of the permutation at most once. Your task is to maximize the number of fixed points in the resulting permutation. Note that you are allowed to make at most one swap operation.
The first line contains a single integer *n* (1<=≀<=*n*<=≀<=105). The second line contains *n* integers *a*0,<=*a*1,<=...,<=*a**n*<=-<=1 β€” the given permutation.
Print a single integer β€” the maximum possible number of fixed points in the permutation after at most one swap operation.
[ "5\n0 1 3 4 2\n" ]
[ "3\n" ]
none
1,000
[ { "input": "5\n0 1 3 4 2", "output": "3" }, { "input": "10\n6 9 4 7 8 2 3 5 0 1", "output": "2" }, { "input": "100\n99 5 40 32 4 31 38 57 94 47 26 16 89 72 9 80 55 86 78 90 42 41 46 74 56 97 21 48 66 27 93 85 88 59 64 95 10 45 12 22 84 60 8 98 62 51 14 65 39 30 11 71 92 19 76 43 87 54 15 53 37 6 25 18 96 35 13 91 2 3 0 23 1 7 49 75 81 33 50 52 63 44 69 36 17 61 24 20 68 34 73 29 70 83 58 79 82 28 77 67", "output": "3" }, { "input": "3\n0 1 2", "output": "3" }, { "input": "3\n2 1 0", "output": "3" }, { "input": "3\n1 2 0", "output": "1" }, { "input": "1\n0", "output": "1" }, { "input": "5\n0 1 2 3 4", "output": "5" }, { "input": "4\n0 1 2 3", "output": "4" }, { "input": "7\n0 1 2 4 3 6 5", "output": "5" }, { "input": "6\n0 1 2 3 5 4", "output": "6" } ]
1,597,041,481
2,147,483,647
PyPy 3
OK
TESTS
19
404
30,515,200
n=int(input()) l=list(map(int,input().split())) c=0 f=1 for i in range(n): if(l[i]==i): c=c+1 elif(f==1 and l[l[i]]==i): c=c+2 f=0 if(f==1 and c<n): c=c+1 print(c)
Title: Fixed Points Time Limit: None seconds Memory Limit: None megabytes Problem Description: A permutation of length *n* is an integer sequence such that each integer from 0 to (*n*<=-<=1) appears exactly once in it. For example, sequence [0,<=2,<=1] is a permutation of length 3 while both [0,<=2,<=2] and [1,<=2,<=3] are not. A fixed point of a function is a point that is mapped to itself by the function. A permutation can be regarded as a bijective function. We'll get a definition of a fixed point in a permutation. An integer *i* is a fixed point of permutation *a*0,<=*a*1,<=...,<=*a**n*<=-<=1 if and only if *a**i*<==<=*i*. For example, permutation [0,<=2,<=1] has 1 fixed point and permutation [0,<=1,<=2] has 3 fixed points. You are given permutation *a*. You are allowed to swap two elements of the permutation at most once. Your task is to maximize the number of fixed points in the resulting permutation. Note that you are allowed to make at most one swap operation. Input Specification: The first line contains a single integer *n* (1<=≀<=*n*<=≀<=105). The second line contains *n* integers *a*0,<=*a*1,<=...,<=*a**n*<=-<=1 β€” the given permutation. Output Specification: Print a single integer β€” the maximum possible number of fixed points in the permutation after at most one swap operation. Demo Input: ['5\n0 1 3 4 2\n'] Demo Output: ['3\n'] Note: none
```python n=int(input()) l=list(map(int,input().split())) c=0 f=1 for i in range(n): if(l[i]==i): c=c+1 elif(f==1 and l[l[i]]==i): c=c+2 f=0 if(f==1 and c<n): c=c+1 print(c) ```
3
712
A
Memory and Crow
PROGRAMMING
800
[ "implementation", "math" ]
null
null
There are *n* integers *b*1,<=*b*2,<=...,<=*b**n* written in a row. For all *i* from 1 to *n*, values *a**i* are defined by the crows performing the following procedure: - The crow sets *a**i* initially 0. - The crow then adds *b**i* to *a**i*, subtracts *b**i*<=+<=1, adds the *b**i*<=+<=2 number, and so on until the *n*'th number. Thus, *a**i*<==<=*b**i*<=-<=*b**i*<=+<=1<=+<=*b**i*<=+<=2<=-<=*b**i*<=+<=3.... Memory gives you the values *a*1,<=*a*2,<=...,<=*a**n*, and he now wants you to find the initial numbers *b*1,<=*b*2,<=...,<=*b**n* written in the row? Can you do it?
The first line of the input contains a single integer *n* (2<=≀<=*n*<=≀<=100<=000)Β β€” the number of integers written in the row. The next line contains *n*, the *i*'th of which is *a**i* (<=-<=109<=≀<=*a**i*<=≀<=109)Β β€” the value of the *i*'th number.
Print *n* integers corresponding to the sequence *b*1,<=*b*2,<=...,<=*b**n*. It's guaranteed that the answer is unique and fits in 32-bit integer type.
[ "5\n6 -4 8 -2 3\n", "5\n3 -2 -1 5 6\n" ]
[ "2 4 6 1 3 \n", "1 -3 4 11 6 \n" ]
In the first sample test, the crows report the numbers 6, - 4, 8, - 2, and 3 when he starts at indices 1, 2, 3, 4 and 5 respectively. It is easy to check that the sequence 2 4 6 1 3 satisfies the reports. For example, 6 = 2 - 4 + 6 - 1 + 3, and  - 4 = 4 - 6 + 1 - 3. In the second sample test, the sequence 1,  - 3, 4, 11, 6 satisfies the reports. For example, 5 = 11 - 6 and 6 = 6.
500
[ { "input": "5\n6 -4 8 -2 3", "output": "2 4 6 1 3 " }, { "input": "5\n3 -2 -1 5 6", "output": "1 -3 4 11 6 " }, { "input": "10\n13 -2 532 -63 -23 -63 -64 -23 12 10", "output": "11 530 469 -86 -86 -127 -87 -11 22 10 " }, { "input": "10\n0 0 0 0 0 0 0 0 0 0", "output": "0 0 0 0 0 0 0 0 0 0 " }, { "input": "10\n1 -1 1 -1 1 -1 1 -1 1 -1", "output": "0 0 0 0 0 0 0 0 0 -1 " }, { "input": "10\n-1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000 -1000000000 1000000000", "output": "0 0 0 0 0 0 0 0 0 1000000000 " }, { "input": "10\n124 532 -642 6482 -124 952 -235 7594 34 -12", "output": "656 -110 5840 6358 828 717 7359 7628 22 -12 " }, { "input": "10\n1294 35852 32749 537295 12048 53729 29357 58320 64739 1240", "output": "37146 68601 570044 549343 65777 83086 87677 123059 65979 1240 " } ]
1,628,897,902
2,147,483,647
Python 3
OK
TESTS
49
186
15,155,200
n = int(input()) A = list(map(int, input().split())) def solve(n,A): ans = '' B = [0]*n for i in range(n-1): B[i] = A[i] + A[i+1] B[n-1] = A[n-1] for b in B: ans += str(b) + ' ' print(ans) solve(n,A)
Title: Memory and Crow Time Limit: None seconds Memory Limit: None megabytes Problem Description: There are *n* integers *b*1,<=*b*2,<=...,<=*b**n* written in a row. For all *i* from 1 to *n*, values *a**i* are defined by the crows performing the following procedure: - The crow sets *a**i* initially 0. - The crow then adds *b**i* to *a**i*, subtracts *b**i*<=+<=1, adds the *b**i*<=+<=2 number, and so on until the *n*'th number. Thus, *a**i*<==<=*b**i*<=-<=*b**i*<=+<=1<=+<=*b**i*<=+<=2<=-<=*b**i*<=+<=3.... Memory gives you the values *a*1,<=*a*2,<=...,<=*a**n*, and he now wants you to find the initial numbers *b*1,<=*b*2,<=...,<=*b**n* written in the row? Can you do it? Input Specification: The first line of the input contains a single integer *n* (2<=≀<=*n*<=≀<=100<=000)Β β€” the number of integers written in the row. The next line contains *n*, the *i*'th of which is *a**i* (<=-<=109<=≀<=*a**i*<=≀<=109)Β β€” the value of the *i*'th number. Output Specification: Print *n* integers corresponding to the sequence *b*1,<=*b*2,<=...,<=*b**n*. It's guaranteed that the answer is unique and fits in 32-bit integer type. Demo Input: ['5\n6 -4 8 -2 3\n', '5\n3 -2 -1 5 6\n'] Demo Output: ['2 4 6 1 3 \n', '1 -3 4 11 6 \n'] Note: In the first sample test, the crows report the numbers 6, - 4, 8, - 2, and 3 when he starts at indices 1, 2, 3, 4 and 5 respectively. It is easy to check that the sequence 2 4 6 1 3 satisfies the reports. For example, 6 = 2 - 4 + 6 - 1 + 3, and  - 4 = 4 - 6 + 1 - 3. In the second sample test, the sequence 1,  - 3, 4, 11, 6 satisfies the reports. For example, 5 = 11 - 6 and 6 = 6.
```python n = int(input()) A = list(map(int, input().split())) def solve(n,A): ans = '' B = [0]*n for i in range(n-1): B[i] = A[i] + A[i+1] B[n-1] = A[n-1] for b in B: ans += str(b) + ' ' print(ans) solve(n,A) ```
3
599
A
Patrick and Shopping
PROGRAMMING
800
[ "implementation" ]
null
null
Today Patrick waits for a visit from his friend Spongebob. To prepare for the visit, Patrick needs to buy some goodies in two stores located near his house. There is a *d*1 meter long road between his house and the first shop and a *d*2 meter long road between his house and the second shop. Also, there is a road of length *d*3 directly connecting these two shops to each other. Help Patrick calculate the minimum distance that he needs to walk in order to go to both shops and return to his house. Patrick always starts at his house. He should visit both shops moving only along the three existing roads and return back to his house. He doesn't mind visiting the same shop or passing the same road multiple times. The only goal is to minimize the total distance traveled.
The first line of the input contains three integers *d*1, *d*2, *d*3 (1<=≀<=*d*1,<=*d*2,<=*d*3<=≀<=108)Β β€” the lengths of the paths. - *d*1 is the length of the path connecting Patrick's house and the first shop; - *d*2 is the length of the path connecting Patrick's house and the second shop; - *d*3 is the length of the path connecting both shops.
Print the minimum distance that Patrick will have to walk in order to visit both shops and return to his house.
[ "10 20 30\n", "1 1 5\n" ]
[ "60\n", "4\n" ]
The first sample is shown on the picture in the problem statement. One of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house. In the second sample one of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
500
[ { "input": "10 20 30", "output": "60" }, { "input": "1 1 5", "output": "4" }, { "input": "100 33 34", "output": "134" }, { "input": "777 777 777", "output": "2331" }, { "input": "2 2 8", "output": "8" }, { "input": "12 34 56", "output": "92" }, { "input": "789 101112 131415", "output": "203802" }, { "input": "27485716 99999999 35182", "output": "55041796" }, { "input": "1 293548 5", "output": "12" }, { "input": "12059 259855 5874875", "output": "543828" }, { "input": "46981 105809 585858", "output": "305580" }, { "input": "9889 1221 2442", "output": "7326" }, { "input": "100500 200600 300700", "output": "601800" }, { "input": "318476 318476 318476", "output": "955428" }, { "input": "23985 3353 75633", "output": "54676" }, { "input": "120 1298 2222", "output": "2836" }, { "input": "98437 23487 666672", "output": "243848" }, { "input": "100000000 100000000 100000000", "output": "300000000" }, { "input": "2 5 2", "output": "8" }, { "input": "1 1000 1", "output": "4" }, { "input": "1 100000000 1", "output": "4" } ]
1,595,472,114
2,147,483,647
Python 3
OK
TESTS
21
109
6,656,000
a,b,c=map(int,input().split()) m=a+b+a+b n=b+c+c+b p=a+c+c+a q=a+c+b print(min(m,n,p,q))
Title: Patrick and Shopping Time Limit: None seconds Memory Limit: None megabytes Problem Description: Today Patrick waits for a visit from his friend Spongebob. To prepare for the visit, Patrick needs to buy some goodies in two stores located near his house. There is a *d*1 meter long road between his house and the first shop and a *d*2 meter long road between his house and the second shop. Also, there is a road of length *d*3 directly connecting these two shops to each other. Help Patrick calculate the minimum distance that he needs to walk in order to go to both shops and return to his house. Patrick always starts at his house. He should visit both shops moving only along the three existing roads and return back to his house. He doesn't mind visiting the same shop or passing the same road multiple times. The only goal is to minimize the total distance traveled. Input Specification: The first line of the input contains three integers *d*1, *d*2, *d*3 (1<=≀<=*d*1,<=*d*2,<=*d*3<=≀<=108)Β β€” the lengths of the paths. - *d*1 is the length of the path connecting Patrick's house and the first shop; - *d*2 is the length of the path connecting Patrick's house and the second shop; - *d*3 is the length of the path connecting both shops. Output Specification: Print the minimum distance that Patrick will have to walk in order to visit both shops and return to his house. Demo Input: ['10 20 30\n', '1 1 5\n'] Demo Output: ['60\n', '4\n'] Note: The first sample is shown on the picture in the problem statement. One of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house. In the second sample one of the optimal routes is: house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> first shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> second shop <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/70a0795f45d32287dba0eb83fc4a3f470c6e5537.png" style="max-width: 100.0%;max-height: 100.0%;"/> house.
```python a,b,c=map(int,input().split()) m=a+b+a+b n=b+c+c+b p=a+c+c+a q=a+c+b print(min(m,n,p,q)) ```
3
1,006
C
Three Parts of the Array
PROGRAMMING
1,200
[ "binary search", "data structures", "two pointers" ]
null
null
You are given an array $d_1, d_2, \dots, d_n$ consisting of $n$ integer numbers. Your task is to split this array into three parts (some of which may be empty) in such a way that each element of the array belongs to exactly one of the three parts, and each of the parts forms a consecutive contiguous subsegment (possibly, empty) of the original array. Let the sum of elements of the first part be $sum_1$, the sum of elements of the second part be $sum_2$ and the sum of elements of the third part be $sum_3$. Among all possible ways to split the array you have to choose a way such that $sum_1 = sum_3$ and $sum_1$ is maximum possible. More formally, if the first part of the array contains $a$ elements, the second part of the array contains $b$ elements and the third part contains $c$ elements, then: $$sum_1 = \sum\limits_{1 \le i \le a}d_i,$$ $$sum_2 = \sum\limits_{a + 1 \le i \le a + b}d_i,$$ $$sum_3 = \sum\limits_{a + b + 1 \le i \le a + b + c}d_i.$$ The sum of an empty array is $0$. Your task is to find a way to split the array such that $sum_1 = sum_3$ and $sum_1$ is maximum possible.
The first line of the input contains one integer $n$ ($1 \le n \le 2 \cdot 10^5$) β€” the number of elements in the array $d$. The second line of the input contains $n$ integers $d_1, d_2, \dots, d_n$ ($1 \le d_i \le 10^9$) β€” the elements of the array $d$.
Print a single integer β€” the maximum possible value of $sum_1$, considering that the condition $sum_1 = sum_3$ must be met. Obviously, at least one valid way to split the array exists (use $a=c=0$ and $b=n$).
[ "5\n1 3 1 1 4\n", "5\n1 3 2 1 4\n", "3\n4 1 2\n" ]
[ "5\n", "4\n", "0\n" ]
In the first example there is only one possible splitting which maximizes $sum_1$: $[1, 3, 1], [~], [1, 4]$. In the second example the only way to have $sum_1=4$ is: $[1, 3], [2, 1], [4]$. In the third example there is only one way to split the array: $[~], [4, 1, 2], [~]$.
0
[ { "input": "5\n1 3 1 1 4", "output": "5" }, { "input": "5\n1 3 2 1 4", "output": "4" }, { "input": "3\n4 1 2", "output": "0" }, { "input": "1\n1000000000", "output": "0" }, { "input": "2\n1 1", "output": "1" }, { "input": "5\n1 3 5 4 5", "output": "9" } ]
1,665,191,335
2,147,483,647
Python 3
OK
TESTS
27
202
18,227,200
input() elementos = list(map(int, input().split())) maior_soma = 0 soma_esquerda = 0 soma_direita = 0 esquerda = 0 direita = len(elementos) - 1 controle_incremento = 0 while esquerda < direita: if controle_incremento == 0: soma_esquerda += elementos[esquerda] soma_direita += elementos[direita] elif controle_incremento == 1: soma_esquerda += elementos[esquerda] else: soma_direita += elementos[direita] if soma_esquerda < soma_direita: esquerda += 1 controle_incremento = 1 elif soma_esquerda > soma_direita: direita -= 1 controle_incremento = 2 else: maior_soma = soma_esquerda esquerda += 1 direita -= 1 controle_incremento = 0 print(maior_soma)
Title: Three Parts of the Array Time Limit: None seconds Memory Limit: None megabytes Problem Description: You are given an array $d_1, d_2, \dots, d_n$ consisting of $n$ integer numbers. Your task is to split this array into three parts (some of which may be empty) in such a way that each element of the array belongs to exactly one of the three parts, and each of the parts forms a consecutive contiguous subsegment (possibly, empty) of the original array. Let the sum of elements of the first part be $sum_1$, the sum of elements of the second part be $sum_2$ and the sum of elements of the third part be $sum_3$. Among all possible ways to split the array you have to choose a way such that $sum_1 = sum_3$ and $sum_1$ is maximum possible. More formally, if the first part of the array contains $a$ elements, the second part of the array contains $b$ elements and the third part contains $c$ elements, then: $$sum_1 = \sum\limits_{1 \le i \le a}d_i,$$ $$sum_2 = \sum\limits_{a + 1 \le i \le a + b}d_i,$$ $$sum_3 = \sum\limits_{a + b + 1 \le i \le a + b + c}d_i.$$ The sum of an empty array is $0$. Your task is to find a way to split the array such that $sum_1 = sum_3$ and $sum_1$ is maximum possible. Input Specification: The first line of the input contains one integer $n$ ($1 \le n \le 2 \cdot 10^5$) β€” the number of elements in the array $d$. The second line of the input contains $n$ integers $d_1, d_2, \dots, d_n$ ($1 \le d_i \le 10^9$) β€” the elements of the array $d$. Output Specification: Print a single integer β€” the maximum possible value of $sum_1$, considering that the condition $sum_1 = sum_3$ must be met. Obviously, at least one valid way to split the array exists (use $a=c=0$ and $b=n$). Demo Input: ['5\n1 3 1 1 4\n', '5\n1 3 2 1 4\n', '3\n4 1 2\n'] Demo Output: ['5\n', '4\n', '0\n'] Note: In the first example there is only one possible splitting which maximizes $sum_1$: $[1, 3, 1], [~], [1, 4]$. In the second example the only way to have $sum_1=4$ is: $[1, 3], [2, 1], [4]$. In the third example there is only one way to split the array: $[~], [4, 1, 2], [~]$.
```python input() elementos = list(map(int, input().split())) maior_soma = 0 soma_esquerda = 0 soma_direita = 0 esquerda = 0 direita = len(elementos) - 1 controle_incremento = 0 while esquerda < direita: if controle_incremento == 0: soma_esquerda += elementos[esquerda] soma_direita += elementos[direita] elif controle_incremento == 1: soma_esquerda += elementos[esquerda] else: soma_direita += elementos[direita] if soma_esquerda < soma_direita: esquerda += 1 controle_incremento = 1 elif soma_esquerda > soma_direita: direita -= 1 controle_incremento = 2 else: maior_soma = soma_esquerda esquerda += 1 direita -= 1 controle_incremento = 0 print(maior_soma) ```
3
898
C
Phone Numbers
PROGRAMMING
1,400
[ "implementation", "strings" ]
null
null
Vasya has several phone books, in which he recorded the telephone numbers of his friends. Each of his friends can have one or several phone numbers. Vasya decided to organize information about the phone numbers of friends. You will be given *n* strings β€” all entries from Vasya's phone books. Each entry starts with a friend's name. Then follows the number of phone numbers in the current entry, and then the phone numbers themselves. It is possible that several identical phones are recorded in the same record. Vasya also believes that if the phone number *a* is a suffix of the phone number *b* (that is, the number *b* ends up with *a*), and both numbers are written by Vasya as the phone numbers of the same person, then *a* is recorded without the city code and it should not be taken into account. The task is to print organized information about the phone numbers of Vasya's friends. It is possible that two different people have the same number. If one person has two numbers *x* and *y*, and *x* is a suffix of *y* (that is, *y* ends in *x*), then you shouldn't print number *x*. If the number of a friend in the Vasya's phone books is recorded several times in the same format, it is necessary to take it into account exactly once. Read the examples to understand statement and format of the output better.
First line contains the integer *n* (1<=≀<=*n*<=≀<=20)Β β€” number of entries in Vasya's phone books. The following *n* lines are followed by descriptions of the records in the format described in statement. Names of Vasya's friends are non-empty strings whose length does not exceed 10. They consists only of lowercase English letters. Number of phone numbers in one entry is not less than 1 is not more than 10. The telephone numbers consist of digits only. If you represent a phone number as a string, then its length will be in range from 1 to 10. Phone numbers can contain leading zeros.
Print out the ordered information about the phone numbers of Vasya's friends. First output *m*Β β€” number of friends that are found in Vasya's phone books. The following *m* lines must contain entries in the following format "name number_of_phone_numbers phone_numbers". Phone numbers should be separated by a space. Each record must contain all the phone numbers of current friend. Entries can be displayed in arbitrary order, phone numbers for one record can also be printed in arbitrary order.
[ "2\nivan 1 00123\nmasha 1 00123\n", "3\nkarl 2 612 12\npetr 1 12\nkatya 1 612\n", "4\nivan 3 123 123 456\nivan 2 456 456\nivan 8 789 3 23 6 56 9 89 2\ndasha 2 23 789\n" ]
[ "2\nmasha 1 00123 \nivan 1 00123 \n", "3\nkatya 1 612 \npetr 1 12 \nkarl 1 612 \n", "2\ndasha 2 23 789 \nivan 4 789 123 2 456 \n" ]
none
1,500
[ { "input": "2\nivan 1 00123\nmasha 1 00123", "output": "2\nmasha 1 00123 \nivan 1 00123 " }, { "input": "3\nkarl 2 612 12\npetr 1 12\nkatya 1 612", "output": "3\nkatya 1 612 \npetr 1 12 \nkarl 1 612 " }, { "input": "4\nivan 3 123 123 456\nivan 2 456 456\nivan 8 789 3 23 6 56 9 89 2\ndasha 2 23 789", "output": "2\ndasha 2 789 23 \nivan 4 2 123 456 789 " }, { "input": "20\nnxj 6 7 6 6 7 7 7\nnxj 10 8 5 1 7 6 1 0 7 0 6\nnxj 2 6 5\nnxj 10 6 7 6 6 5 8 3 6 6 8\nnxj 10 6 1 7 6 7 1 8 7 8 6\nnxj 10 8 5 8 6 5 6 1 9 6 3\nnxj 10 8 1 6 4 8 0 4 6 0 1\nnxj 9 2 6 6 8 1 1 3 6 6\nnxj 10 8 9 0 9 1 3 2 3 2 3\nnxj 6 6 7 0 8 1 2\nnxj 7 7 7 8 1 3 6 9\nnxj 10 2 7 0 1 5 1 9 1 2 6\nnxj 6 9 6 9 6 3 7\nnxj 9 0 1 7 8 2 6 6 5 6\nnxj 4 0 2 3 7\nnxj 10 0 4 0 6 1 1 8 8 4 7\nnxj 8 4 6 2 6 6 1 2 7\nnxj 10 5 3 4 2 1 0 7 0 7 6\nnxj 10 9 6 0 6 1 6 2 1 9 6\nnxj 4 2 9 0 1", "output": "1\nnxj 10 4 1 8 7 5 3 6 9 0 2 " }, { "input": "20\nl 6 02 02 2 02 02 2\nl 8 8 8 8 2 62 13 31 3\ne 9 0 91 0 0 60 91 60 2 44\ne 9 69 2 1 44 2 91 66 1 70\nl 9 7 27 27 3 1 3 7 80 81\nl 9 2 1 13 7 2 10 02 3 92\ne 9 0 15 3 5 5 15 91 09 44\nl 7 2 50 4 5 98 31 98\nl 3 26 7 3\ne 6 7 5 0 62 65 91\nl 8 80 0 4 0 2 2 0 13\nl 9 19 13 02 2 1 4 19 26 02\nl 10 7 39 7 9 22 22 26 2 90 4\ne 7 65 2 36 0 34 57 9\ne 8 13 02 09 91 73 5 36 62\nl 9 75 0 10 8 76 7 82 8 34\nl 7 34 0 19 80 6 4 7\ne 5 4 2 5 7 2\ne 7 4 02 69 7 07 20 2\nl 4 8 2 1 63", "output": "2\ne 18 70 07 62 36 20 69 66 57 02 65 34 44 73 60 91 15 09 13 \nl 21 02 80 27 63 19 50 81 76 34 90 98 92 31 26 22 75 39 13 10 82 62 " }, { "input": "20\no 10 6 6 97 45 6 6 6 6 5 6\nl 8 5 5 5 19 59 5 8 5\nj 9 2 30 58 2 2 1 0 30 4\nc 10 1 1 7 51 7 7 51 1 1 1\no 9 7 97 87 70 2 19 2 14 6\ne 6 26 6 6 6 26 5\ng 9 3 3 3 3 3 78 69 8 9\nl 8 8 01 1 5 8 41 72 3\nz 10 1 2 2 2 9 1 9 1 6 7\ng 8 7 78 05 36 7 3 67 9\no 5 6 9 9 7 7\ne 10 30 2 1 1 2 5 04 0 6 6\ne 9 30 30 2 2 0 26 30 79 8\nt 10 2 2 9 29 7 7 7 9 2 9\nc 7 7 51 1 31 2 7 4\nc 9 83 1 6 78 94 74 54 8 32\ng 8 4 1 01 9 39 28 6 6\nt 7 9 2 01 4 4 9 58\nj 5 0 1 58 02 4\nw 10 80 0 91 91 06 91 9 9 27 7", "output": "9\nw 5 91 06 27 9 80 \nt 6 01 29 4 58 2 7 \ne 8 2 8 30 04 26 5 79 1 \nl 8 8 41 72 01 19 59 3 5 \nj 5 58 02 1 4 30 \nz 5 7 9 6 2 1 \ng 10 39 67 3 01 36 4 05 69 78 28 \no 8 19 2 45 6 87 14 97 70 \nc 10 7 94 32 6 78 74 31 83 51 54 " }, { "input": "1\negew 5 3 123 23 1234 134", "output": "1\negew 3 134 123 1234 " } ]
1,551,265,164
2,064
Python 3
OK
TESTS
59
109
0
n = int(input()) book = {} for _ in range(n): toks = input().strip().split() name = toks[0] numbers = toks[2:] book.setdefault(name,[]) book[name].extend(numbers) print(len(book)) for k, v in book.items(): v.sort(key=lambda x: len(x)) new_v = [] for i in range(len(v)): if any(v[j].endswith(v[i]) for j in range(i+1,len(v))): continue new_v.append(v[i]) v = new_v print(k,len(v),*v)
Title: Phone Numbers Time Limit: None seconds Memory Limit: None megabytes Problem Description: Vasya has several phone books, in which he recorded the telephone numbers of his friends. Each of his friends can have one or several phone numbers. Vasya decided to organize information about the phone numbers of friends. You will be given *n* strings β€” all entries from Vasya's phone books. Each entry starts with a friend's name. Then follows the number of phone numbers in the current entry, and then the phone numbers themselves. It is possible that several identical phones are recorded in the same record. Vasya also believes that if the phone number *a* is a suffix of the phone number *b* (that is, the number *b* ends up with *a*), and both numbers are written by Vasya as the phone numbers of the same person, then *a* is recorded without the city code and it should not be taken into account. The task is to print organized information about the phone numbers of Vasya's friends. It is possible that two different people have the same number. If one person has two numbers *x* and *y*, and *x* is a suffix of *y* (that is, *y* ends in *x*), then you shouldn't print number *x*. If the number of a friend in the Vasya's phone books is recorded several times in the same format, it is necessary to take it into account exactly once. Read the examples to understand statement and format of the output better. Input Specification: First line contains the integer *n* (1<=≀<=*n*<=≀<=20)Β β€” number of entries in Vasya's phone books. The following *n* lines are followed by descriptions of the records in the format described in statement. Names of Vasya's friends are non-empty strings whose length does not exceed 10. They consists only of lowercase English letters. Number of phone numbers in one entry is not less than 1 is not more than 10. The telephone numbers consist of digits only. If you represent a phone number as a string, then its length will be in range from 1 to 10. Phone numbers can contain leading zeros. Output Specification: Print out the ordered information about the phone numbers of Vasya's friends. First output *m*Β β€” number of friends that are found in Vasya's phone books. The following *m* lines must contain entries in the following format "name number_of_phone_numbers phone_numbers". Phone numbers should be separated by a space. Each record must contain all the phone numbers of current friend. Entries can be displayed in arbitrary order, phone numbers for one record can also be printed in arbitrary order. Demo Input: ['2\nivan 1 00123\nmasha 1 00123\n', '3\nkarl 2 612 12\npetr 1 12\nkatya 1 612\n', '4\nivan 3 123 123 456\nivan 2 456 456\nivan 8 789 3 23 6 56 9 89 2\ndasha 2 23 789\n'] Demo Output: ['2\nmasha 1 00123 \nivan 1 00123 \n', '3\nkatya 1 612 \npetr 1 12 \nkarl 1 612 \n', '2\ndasha 2 23 789 \nivan 4 789 123 2 456 \n'] Note: none
```python n = int(input()) book = {} for _ in range(n): toks = input().strip().split() name = toks[0] numbers = toks[2:] book.setdefault(name,[]) book[name].extend(numbers) print(len(book)) for k, v in book.items(): v.sort(key=lambda x: len(x)) new_v = [] for i in range(len(v)): if any(v[j].endswith(v[i]) for j in range(i+1,len(v))): continue new_v.append(v[i]) v = new_v print(k,len(v),*v) ```
3
144
A
Arrival of the General
PROGRAMMING
800
[ "implementation" ]
null
null
A Ministry for Defense sent a general to inspect the Super Secret Military Squad under the command of the Colonel SuperDuper. Having learned the news, the colonel ordered to all *n* squad soldiers to line up on the parade ground. By the military charter the soldiers should stand in the order of non-increasing of their height. But as there's virtually no time to do that, the soldiers lined up in the arbitrary order. However, the general is rather short-sighted and he thinks that the soldiers lined up correctly if the first soldier in the line has the maximum height and the last soldier has the minimum height. Please note that the way other solders are positioned does not matter, including the case when there are several soldiers whose height is maximum or minimum. Only the heights of the first and the last soldier are important. For example, the general considers the sequence of heights (4, 3, 4, 2, 1, 1) correct and the sequence (4, 3, 1, 2, 2) wrong. Within one second the colonel can swap any two neighboring soldiers. Help him count the minimum time needed to form a line-up which the general will consider correct.
The first input line contains the only integer *n* (2<=≀<=*n*<=≀<=100) which represents the number of soldiers in the line. The second line contains integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≀<=*a**i*<=≀<=100) the values of the soldiers' heights in the order of soldiers' heights' increasing in the order from the beginning of the line to its end. The numbers are space-separated. Numbers *a*1,<=*a*2,<=...,<=*a**n* are not necessarily different.
Print the only integer β€” the minimum number of seconds the colonel will need to form a line-up the general will like.
[ "4\n33 44 11 22\n", "7\n10 10 58 31 63 40 76\n" ]
[ "2\n", "10\n" ]
In the first sample the colonel will need to swap the first and second soldier and then the third and fourth soldier. That will take 2 seconds. The resulting position of the soldiers is (44, 33, 22, 11). In the second sample the colonel may swap the soldiers in the following sequence: 1. (10, 10, 58, 31, 63, 40, 76) 1. (10, 58, 10, 31, 63, 40, 76) 1. (10, 58, 10, 31, 63, 76, 40) 1. (10, 58, 10, 31, 76, 63, 40) 1. (10, 58, 31, 10, 76, 63, 40) 1. (10, 58, 31, 76, 10, 63, 40) 1. (10, 58, 31, 76, 63, 10, 40) 1. (10, 58, 76, 31, 63, 10, 40) 1. (10, 76, 58, 31, 63, 10, 40) 1. (76, 10, 58, 31, 63, 10, 40) 1. (76, 10, 58, 31, 63, 40, 10)
500
[ { "input": "4\n33 44 11 22", "output": "2" }, { "input": "7\n10 10 58 31 63 40 76", "output": "10" }, { "input": "2\n88 89", "output": "1" }, { "input": "5\n100 95 100 100 88", "output": "0" }, { "input": "7\n48 48 48 48 45 45 45", "output": "0" }, { "input": "10\n68 47 67 29 63 71 71 65 54 56", "output": "10" }, { "input": "15\n77 68 96 60 92 75 61 60 66 79 80 65 60 95 92", "output": "4" }, { "input": "3\n1 2 1", "output": "1" }, { "input": "20\n30 30 30 14 30 14 30 30 30 14 30 14 14 30 14 14 30 14 14 14", "output": "0" }, { "input": "35\n37 41 46 39 47 39 44 47 44 42 44 43 47 39 46 39 38 42 39 37 40 44 41 42 41 42 39 42 36 36 42 36 42 42 42", "output": "7" }, { "input": "40\n99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 99 98 99 99 99 99 99 99 99 99 100 99 99 99 99 99 99", "output": "47" }, { "input": "50\n48 52 44 54 53 56 62 49 39 41 53 39 40 64 53 50 62 48 40 52 51 48 40 52 61 62 62 61 48 64 55 57 56 40 48 58 41 60 60 56 64 50 64 45 48 45 46 63 59 57", "output": "50" }, { "input": "57\n7 24 17 19 6 19 10 11 12 22 14 5 5 11 13 10 24 19 24 24 24 11 21 20 4 14 24 24 18 13 24 3 20 3 3 3 3 9 3 9 22 22 16 3 3 3 15 11 3 3 8 17 10 13 3 14 13", "output": "3" }, { "input": "65\n58 50 35 44 35 37 36 58 38 36 58 56 56 49 48 56 58 43 40 44 52 44 58 58 57 50 43 35 55 39 38 49 53 56 50 42 41 56 34 57 49 38 34 51 56 38 58 40 53 46 48 34 38 43 49 49 58 56 41 43 44 34 38 48 36", "output": "3" }, { "input": "69\n70 48 49 48 49 71 48 53 55 69 48 53 54 58 53 63 48 48 69 67 72 75 71 75 74 74 57 63 65 60 48 48 65 48 48 51 50 49 62 53 76 68 76 56 76 76 64 76 76 57 61 76 73 51 59 76 65 50 69 50 76 67 76 63 62 74 74 58 73", "output": "73" }, { "input": "75\n70 65 64 71 71 64 71 64 68 71 65 64 65 68 71 66 66 69 68 63 69 65 71 69 68 68 71 67 71 65 65 65 71 71 65 69 63 66 62 67 64 63 62 64 67 65 62 69 62 64 69 62 67 64 67 70 64 63 64 64 69 62 62 64 70 62 62 68 67 69 62 64 66 70 68", "output": "7" }, { "input": "84\n92 95 84 85 94 80 90 86 80 92 95 84 86 83 86 83 93 91 95 92 84 88 82 84 84 84 80 94 93 80 94 80 95 83 85 80 95 95 80 84 86 92 83 81 90 87 81 89 92 93 80 87 90 85 93 85 93 94 93 89 94 83 93 91 80 83 90 94 95 80 95 92 85 84 93 94 94 82 91 95 95 89 85 94", "output": "15" }, { "input": "90\n86 87 72 77 82 71 75 78 61 67 79 90 64 94 94 74 85 87 73 76 71 71 60 69 77 73 76 80 82 57 62 57 57 83 76 72 75 87 72 94 77 85 59 82 86 69 62 80 95 73 83 94 79 85 91 68 85 74 93 95 68 75 89 93 83 78 95 78 83 77 81 85 66 92 63 65 75 78 67 91 77 74 59 86 77 76 90 67 70 64", "output": "104" }, { "input": "91\n94 98 96 94 95 98 98 95 98 94 94 98 95 95 99 97 97 94 95 98 94 98 96 98 96 98 97 95 94 94 94 97 94 96 98 98 98 94 96 95 94 95 97 97 97 98 94 98 96 95 98 96 96 98 94 97 96 98 97 95 97 98 94 95 94 94 97 94 96 97 97 93 94 95 95 94 96 98 97 96 94 98 98 96 96 96 96 96 94 96 97", "output": "33" }, { "input": "92\n44 28 32 29 41 41 36 39 40 39 41 35 41 28 35 27 41 34 28 38 43 43 41 38 27 26 28 36 30 29 39 32 35 35 32 30 39 30 37 27 41 41 28 30 43 31 35 33 36 28 44 40 41 35 31 42 37 38 37 34 39 40 27 40 33 33 44 43 34 33 34 34 35 38 38 37 30 39 35 41 45 42 41 32 33 33 31 30 43 41 43 43", "output": "145" }, { "input": "93\n46 32 52 36 39 30 57 63 63 30 32 44 27 59 46 38 40 45 44 62 35 36 51 48 39 58 36 51 51 51 48 58 59 36 29 35 31 49 64 60 34 38 42 56 33 42 52 31 63 34 45 51 35 45 33 53 33 62 31 38 66 29 51 54 28 61 32 45 57 41 36 34 47 36 31 28 67 48 52 46 32 40 64 58 27 53 43 57 34 66 43 39 26", "output": "76" }, { "input": "94\n56 55 54 31 32 42 46 29 24 54 40 40 20 45 35 56 32 33 51 39 26 56 21 56 51 27 29 39 56 52 54 43 43 55 48 51 44 49 52 49 23 19 19 28 20 26 45 33 35 51 42 36 25 25 38 23 21 35 54 50 41 20 37 28 42 20 22 43 37 34 55 21 24 38 19 41 45 34 19 33 44 54 38 31 23 53 35 32 47 40 39 31 20 34", "output": "15" }, { "input": "95\n57 71 70 77 64 64 76 81 81 58 63 75 81 77 71 71 71 60 70 70 69 67 62 64 78 64 69 62 76 76 57 70 68 77 70 68 73 77 79 73 60 57 69 60 74 65 58 75 75 74 73 73 65 75 72 57 81 62 62 70 67 58 76 57 79 81 68 64 58 77 70 59 79 64 80 58 71 59 81 71 80 64 78 80 78 65 70 68 78 80 57 63 64 76 81", "output": "11" }, { "input": "96\n96 95 95 95 96 97 95 97 96 95 98 96 97 95 98 96 98 96 98 96 98 95 96 95 95 95 97 97 95 95 98 98 95 96 96 95 97 96 98 96 95 97 97 95 97 97 95 94 96 96 97 96 97 97 96 94 94 97 95 95 95 96 95 96 95 97 97 95 97 96 95 94 97 97 97 96 97 95 96 94 94 95 97 94 94 97 97 97 95 97 97 95 94 96 95 95", "output": "13" }, { "input": "97\n14 15 12 12 13 15 12 15 12 12 12 12 12 14 15 15 13 12 15 15 12 12 12 13 14 15 15 13 14 15 14 14 14 14 12 13 12 13 13 12 15 12 13 13 15 12 15 13 12 13 13 13 14 13 12 15 14 13 14 15 13 14 14 13 14 12 15 12 14 12 13 14 15 14 13 15 13 12 15 15 15 13 15 15 13 14 16 16 16 13 15 13 15 14 15 15 15", "output": "104" }, { "input": "98\n37 69 35 70 58 69 36 47 41 63 60 54 49 35 55 50 35 53 52 43 35 41 40 49 38 35 48 70 42 35 35 65 56 54 44 59 59 48 51 49 59 67 35 60 69 35 58 50 35 44 48 69 41 58 44 45 35 47 70 61 49 47 37 39 35 51 44 70 72 65 36 41 63 63 48 66 45 50 50 71 37 52 72 67 72 39 72 39 36 64 48 72 69 49 45 72 72 67", "output": "100" }, { "input": "99\n31 31 16 15 19 31 19 22 29 27 12 22 28 30 25 33 26 25 19 22 34 21 17 33 31 22 16 26 22 30 31 17 13 33 13 17 28 25 18 33 27 22 31 22 13 27 20 22 23 15 24 32 29 13 16 20 32 33 14 33 19 27 16 28 25 17 17 28 18 26 32 33 19 23 30 13 14 23 24 28 14 28 22 20 30 14 24 23 17 29 18 28 29 21 28 18 16 24 32", "output": "107" }, { "input": "100\n37 54 39 29 32 49 21 13 34 21 16 42 34 27 16 26 7 34 51 9 11 27 16 40 36 7 48 52 30 42 42 52 51 11 32 26 6 7 28 54 48 51 6 54 42 20 51 48 46 4 4 31 47 6 9 16 8 23 36 50 49 30 47 37 45 24 48 26 8 50 18 24 27 13 39 7 37 34 5 43 42 19 34 23 52 38 35 6 29 11 53 49 21 29 36 22 45 33 51 22", "output": "50" }, { "input": "100\n41 5 20 23 5 47 28 28 64 5 12 14 34 56 22 48 6 52 39 55 62 40 24 54 39 28 56 27 35 51 14 24 38 10 55 20 39 62 52 2 30 55 49 48 15 23 59 44 31 28 66 29 62 59 31 13 28 12 50 45 41 47 29 27 64 66 14 39 62 22 44 63 24 5 63 17 42 7 25 41 49 33 31 51 63 3 37 66 19 9 2 40 16 45 56 21 34 29 39 61", "output": "59" }, { "input": "100\n66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 66 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95 95", "output": "99" }, { "input": "100\n81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 81 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10 10", "output": "0" }, { "input": "3\n2 1 2", "output": "1" }, { "input": "2\n100 99", "output": "0" }, { "input": "100\n1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100", "output": "197" }, { "input": "100\n87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87 87", "output": "0" }, { "input": "100\n100 99 98 97 96 95 94 93 92 91 90 89 88 87 86 85 84 83 82 81 80 79 78 77 76 75 74 73 72 71 70 69 68 67 66 65 64 63 62 61 60 59 58 57 56 55 54 53 52 51 50 49 48 47 46 45 44 43 42 41 40 39 38 37 36 35 34 33 32 31 30 29 28 27 26 25 24 23 22 21 20 19 18 17 16 15 14 13 12 11 10 9 8 7 6 5 4 3 2 1", "output": "0" }, { "input": "2\n1 1", "output": "0" }, { "input": "3\n2 2 2", "output": "0" }, { "input": "3\n1 3 2", "output": "2" } ]
1,695,039,665
2,147,483,647
Python 3
OK
TESTS
39
92
0
n = int(input()) l = list(map(int, input().split())) a = l.index(max(l)) + l[::-1].index(min(l)) swaps = a - (a >= n) print(swaps)
Title: Arrival of the General Time Limit: None seconds Memory Limit: None megabytes Problem Description: A Ministry for Defense sent a general to inspect the Super Secret Military Squad under the command of the Colonel SuperDuper. Having learned the news, the colonel ordered to all *n* squad soldiers to line up on the parade ground. By the military charter the soldiers should stand in the order of non-increasing of their height. But as there's virtually no time to do that, the soldiers lined up in the arbitrary order. However, the general is rather short-sighted and he thinks that the soldiers lined up correctly if the first soldier in the line has the maximum height and the last soldier has the minimum height. Please note that the way other solders are positioned does not matter, including the case when there are several soldiers whose height is maximum or minimum. Only the heights of the first and the last soldier are important. For example, the general considers the sequence of heights (4, 3, 4, 2, 1, 1) correct and the sequence (4, 3, 1, 2, 2) wrong. Within one second the colonel can swap any two neighboring soldiers. Help him count the minimum time needed to form a line-up which the general will consider correct. Input Specification: The first input line contains the only integer *n* (2<=≀<=*n*<=≀<=100) which represents the number of soldiers in the line. The second line contains integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≀<=*a**i*<=≀<=100) the values of the soldiers' heights in the order of soldiers' heights' increasing in the order from the beginning of the line to its end. The numbers are space-separated. Numbers *a*1,<=*a*2,<=...,<=*a**n* are not necessarily different. Output Specification: Print the only integer β€” the minimum number of seconds the colonel will need to form a line-up the general will like. Demo Input: ['4\n33 44 11 22\n', '7\n10 10 58 31 63 40 76\n'] Demo Output: ['2\n', '10\n'] Note: In the first sample the colonel will need to swap the first and second soldier and then the third and fourth soldier. That will take 2 seconds. The resulting position of the soldiers is (44, 33, 22, 11). In the second sample the colonel may swap the soldiers in the following sequence: 1. (10, 10, 58, 31, 63, 40, 76) 1. (10, 58, 10, 31, 63, 40, 76) 1. (10, 58, 10, 31, 63, 76, 40) 1. (10, 58, 10, 31, 76, 63, 40) 1. (10, 58, 31, 10, 76, 63, 40) 1. (10, 58, 31, 76, 10, 63, 40) 1. (10, 58, 31, 76, 63, 10, 40) 1. (10, 58, 76, 31, 63, 10, 40) 1. (10, 76, 58, 31, 63, 10, 40) 1. (76, 10, 58, 31, 63, 10, 40) 1. (76, 10, 58, 31, 63, 40, 10)
```python n = int(input()) l = list(map(int, input().split())) a = l.index(max(l)) + l[::-1].index(min(l)) swaps = a - (a >= n) print(swaps) ```
3
617
A
Elephant
PROGRAMMING
800
[ "math" ]
null
null
An elephant decided to visit his friend. It turned out that the elephant's house is located at point 0 and his friend's house is located at point *x*(*x*<=&gt;<=0) of the coordinate line. In one step the elephant can move 1, 2, 3, 4 or 5 positions forward. Determine, what is the minimum number of steps he need to make in order to get to his friend's house.
The first line of the input contains an integer *x* (1<=≀<=*x*<=≀<=1<=000<=000)Β β€” The coordinate of the friend's house.
Print the minimum number of steps that elephant needs to make to get from point 0 to point *x*.
[ "5\n", "12\n" ]
[ "1\n", "3\n" ]
In the first sample the elephant needs to make one step of length 5 to reach the point *x*. In the second sample the elephant can get to point *x* if he moves by 3, 5 and 4. There are other ways to get the optimal answer but the elephant cannot reach *x* in less than three moves.
500
[ { "input": "5", "output": "1" }, { "input": "12", "output": "3" }, { "input": "999999", "output": "200000" }, { "input": "41", "output": "9" }, { "input": "1000000", "output": "200000" }, { "input": "1", "output": "1" }, { "input": "2", "output": "1" }, { "input": "3", "output": "1" }, { "input": "4", "output": "1" }, { "input": "534204", "output": "106841" }, { "input": "469569", "output": "93914" }, { "input": "502877", "output": "100576" }, { "input": "942212", "output": "188443" }, { "input": "97", "output": "20" }, { "input": "53", "output": "11" }, { "input": "89", "output": "18" }, { "input": "574", "output": "115" }, { "input": "716", "output": "144" }, { "input": "729", "output": "146" }, { "input": "8901", "output": "1781" }, { "input": "3645", "output": "729" }, { "input": "4426", "output": "886" }, { "input": "46573", "output": "9315" }, { "input": "86380", "output": "17276" }, { "input": "94190", "output": "18838" }, { "input": "999990", "output": "199998" }, { "input": "999991", "output": "199999" }, { "input": "999992", "output": "199999" }, { "input": "999993", "output": "199999" }, { "input": "999994", "output": "199999" }, { "input": "999995", "output": "199999" }, { "input": "999996", "output": "200000" }, { "input": "999997", "output": "200000" }, { "input": "999998", "output": "200000" } ]
1,695,740,286
2,147,483,647
PyPy 3-64
OK
TESTS
34
62
28,262,400
from math import ceil a = int(input()) b = ceil(a / 5) print(b)
Title: Elephant Time Limit: None seconds Memory Limit: None megabytes Problem Description: An elephant decided to visit his friend. It turned out that the elephant's house is located at point 0 and his friend's house is located at point *x*(*x*<=&gt;<=0) of the coordinate line. In one step the elephant can move 1, 2, 3, 4 or 5 positions forward. Determine, what is the minimum number of steps he need to make in order to get to his friend's house. Input Specification: The first line of the input contains an integer *x* (1<=≀<=*x*<=≀<=1<=000<=000)Β β€” The coordinate of the friend's house. Output Specification: Print the minimum number of steps that elephant needs to make to get from point 0 to point *x*. Demo Input: ['5\n', '12\n'] Demo Output: ['1\n', '3\n'] Note: In the first sample the elephant needs to make one step of length 5 to reach the point *x*. In the second sample the elephant can get to point *x* if he moves by 3, 5 and 4. There are other ways to get the optimal answer but the elephant cannot reach *x* in less than three moves.
```python from math import ceil a = int(input()) b = ceil(a / 5) print(b) ```
3
233
A
Perfect Permutation
PROGRAMMING
800
[ "implementation", "math" ]
null
null
A permutation is a sequence of integers *p*1,<=*p*2,<=...,<=*p**n*, consisting of *n* distinct positive integers, each of them doesn't exceed *n*. Let's denote the *i*-th element of permutation *p* as *p**i*. We'll call number *n* the size of permutation *p*1,<=*p*2,<=...,<=*p**n*. Nickolas adores permutations. He likes some permutations more than the others. He calls such permutations perfect. A perfect permutation is such permutation *p* that for any *i* (1<=≀<=*i*<=≀<=*n*) (*n* is the permutation size) the following equations hold *p**p**i*<==<=*i* and *p**i*<=β‰ <=*i*. Nickolas asks you to print any perfect permutation of size *n* for the given *n*.
A single line contains a single integer *n* (1<=≀<=*n*<=≀<=100) β€” the permutation size.
If a perfect permutation of size *n* doesn't exist, print a single integer -1. Otherwise print *n* distinct integers from 1 to *n*, *p*1,<=*p*2,<=...,<=*p**n* β€” permutation *p*, that is perfect. Separate printed numbers by whitespaces.
[ "1\n", "2\n", "4\n" ]
[ "-1\n", "2 1 \n", "2 1 4 3 \n" ]
none
500
[ { "input": "1", "output": "-1" }, { "input": "2", "output": "2 1 " }, { "input": "4", "output": "2 1 4 3 " }, { "input": "3", "output": "-1" }, { "input": "5", "output": "-1" }, { "input": "6", "output": "2 1 4 3 6 5 " }, { "input": "7", "output": "-1" }, { "input": "20", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 " }, { "input": "8", "output": "2 1 4 3 6 5 8 7 " }, { "input": "9", "output": "-1" }, { "input": "10", "output": "2 1 4 3 6 5 8 7 10 9 " }, { "input": "11", "output": "-1" }, { "input": "21", "output": "-1" }, { "input": "50", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 46 45 48 47 50 49 " }, { "input": "51", "output": "-1" }, { "input": "52", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 46 45 48 47 50 49 52 51 " }, { "input": "84", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 46 45 48 47 50 49 52 51 54 53 56 55 58 57 60 59 62 61 64 63 66 65 68 67 70 69 72 71 74 73 76 75 78 77 80 79 82 81 84 83 " }, { "input": "86", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 46 45 48 47 50 49 52 51 54 53 56 55 58 57 60 59 62 61 64 63 66 65 68 67 70 69 72 71 74 73 76 75 78 77 80 79 82 81 84 83 86 85 " }, { "input": "100", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 46 45 48 47 50 49 52 51 54 53 56 55 58 57 60 59 62 61 64 63 66 65 68 67 70 69 72 71 74 73 76 75 78 77 80 79 82 81 84 83 86 85 88 87 90 89 92 91 94 93 96 95 98 97 100 99 " }, { "input": "98", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 46 45 48 47 50 49 52 51 54 53 56 55 58 57 60 59 62 61 64 63 66 65 68 67 70 69 72 71 74 73 76 75 78 77 80 79 82 81 84 83 86 85 88 87 90 89 92 91 94 93 96 95 98 97 " }, { "input": "96", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 46 45 48 47 50 49 52 51 54 53 56 55 58 57 60 59 62 61 64 63 66 65 68 67 70 69 72 71 74 73 76 75 78 77 80 79 82 81 84 83 86 85 88 87 90 89 92 91 94 93 96 95 " }, { "input": "33", "output": "-1" }, { "input": "34", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 " }, { "input": "36", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 " }, { "input": "38", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 " }, { "input": "40", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 " }, { "input": "42", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 " }, { "input": "44", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 " }, { "input": "46", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 46 45 " }, { "input": "48", "output": "2 1 4 3 6 5 8 7 10 9 12 11 14 13 16 15 18 17 20 19 22 21 24 23 26 25 28 27 30 29 32 31 34 33 36 35 38 37 40 39 42 41 44 43 46 45 48 47 " } ]
1,676,729,466
2,147,483,647
Python 3
OK
TESTS
30
92
0
n=int(input()) l=[] if n%2==1: print(-1) else: for i in range(n-1): l.append(i+2) l=l[::-1] l.append(1) print(*l)
Title: Perfect Permutation Time Limit: None seconds Memory Limit: None megabytes Problem Description: A permutation is a sequence of integers *p*1,<=*p*2,<=...,<=*p**n*, consisting of *n* distinct positive integers, each of them doesn't exceed *n*. Let's denote the *i*-th element of permutation *p* as *p**i*. We'll call number *n* the size of permutation *p*1,<=*p*2,<=...,<=*p**n*. Nickolas adores permutations. He likes some permutations more than the others. He calls such permutations perfect. A perfect permutation is such permutation *p* that for any *i* (1<=≀<=*i*<=≀<=*n*) (*n* is the permutation size) the following equations hold *p**p**i*<==<=*i* and *p**i*<=β‰ <=*i*. Nickolas asks you to print any perfect permutation of size *n* for the given *n*. Input Specification: A single line contains a single integer *n* (1<=≀<=*n*<=≀<=100) β€” the permutation size. Output Specification: If a perfect permutation of size *n* doesn't exist, print a single integer -1. Otherwise print *n* distinct integers from 1 to *n*, *p*1,<=*p*2,<=...,<=*p**n* β€” permutation *p*, that is perfect. Separate printed numbers by whitespaces. Demo Input: ['1\n', '2\n', '4\n'] Demo Output: ['-1\n', '2 1 \n', '2 1 4 3 \n'] Note: none
```python n=int(input()) l=[] if n%2==1: print(-1) else: for i in range(n-1): l.append(i+2) l=l[::-1] l.append(1) print(*l) ```
3
399
A
Pages
PROGRAMMING
0
[ "implementation" ]
null
null
User ainta is making a web site. This time he is going to make a navigation of the pages. In his site, there are *n* pages numbered by integers from 1 to *n*. Assume that somebody is on the *p*-th page now. The navigation will look like this: When someone clicks the button "&lt;&lt;" he is redirected to page 1, and when someone clicks the button "&gt;&gt;" he is redirected to page *n*. Of course if someone clicks on a number, he is redirected to the corresponding page. There are some conditions in the navigation: - If page 1 is in the navigation, the button "&lt;&lt;" must not be printed. - If page *n* is in the navigation, the button "&gt;&gt;" must not be printed. - If the page number is smaller than 1 or greater than *n*, it must not be printed. You can see some examples of the navigations. Make a program that prints the navigation.
The first and the only line contains three integers *n*, *p*, *k* (3<=≀<=*n*<=≀<=100; 1<=≀<=*p*<=≀<=*n*; 1<=≀<=*k*<=≀<=*n*)
Print the proper navigation. Follow the format of the output from the test samples.
[ "17 5 2\n", "6 5 2\n", "6 1 2\n", "6 2 2\n", "9 6 3\n", "10 6 3\n", "8 5 4\n" ]
[ "&lt;&lt; 3 4 (5) 6 7 &gt;&gt; ", "&lt;&lt; 3 4 (5) 6 ", "(1) 2 3 &gt;&gt; ", "1 (2) 3 4 &gt;&gt;", "&lt;&lt; 3 4 5 (6) 7 8 9", "&lt;&lt; 3 4 5 (6) 7 8 9 &gt;&gt;", "1 2 3 4 (5) 6 7 8 " ]
none
500
[ { "input": "17 5 2", "output": "<< 3 4 (5) 6 7 >> " }, { "input": "6 5 2", "output": "<< 3 4 (5) 6 " }, { "input": "6 1 2", "output": "(1) 2 3 >> " }, { "input": "6 2 2", "output": "1 (2) 3 4 >> " }, { "input": "9 6 3", "output": "<< 3 4 5 (6) 7 8 9 " }, { "input": "10 6 3", "output": "<< 3 4 5 (6) 7 8 9 >> " }, { "input": "8 5 4", "output": "1 2 3 4 (5) 6 7 8 " }, { "input": "100 10 20", "output": "1 2 3 4 5 6 7 8 9 (10) 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 >> " }, { "input": "100 25 11", "output": "<< 14 15 16 17 18 19 20 21 22 23 24 (25) 26 27 28 29 30 31 32 33 34 35 36 >> " }, { "input": "5 2 1", "output": "1 (2) 3 >> " }, { "input": "5 3 1", "output": "<< 2 (3) 4 >> " }, { "input": "79 35 12", "output": "<< 23 24 25 26 27 28 29 30 31 32 33 34 (35) 36 37 38 39 40 41 42 43 44 45 46 47 >> " }, { "input": "100 99 5", "output": "<< 94 95 96 97 98 (99) 100 " }, { "input": "100 99 15", "output": "<< 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 (99) 100 " }, { "input": "100 100 17", "output": "<< 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 (100) " }, { "input": "100 35 28", "output": "<< 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 (35) 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 >> " }, { "input": "100 46 38", "output": "<< 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 (46) 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 >> " }, { "input": "100 46 48", "output": "1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 (46) 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 >> " }, { "input": "100 10 100", "output": "1 2 3 4 5 6 7 8 9 (10) 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 " }, { "input": "3 1 1", "output": "(1) 2 >> " }, { "input": "3 2 1", "output": "1 (2) 3 " }, { "input": "17 5 3", "output": "<< 2 3 4 (5) 6 7 8 >> " }, { "input": "3 1 3", "output": "(1) 2 3 " }, { "input": "7 5 1", "output": "<< 4 (5) 6 >> " }, { "input": "5 5 5", "output": "1 2 3 4 (5) " }, { "input": "5 3 5", "output": "1 2 (3) 4 5 " } ]
1,544,690,321
2,147,483,647
Python 3
OK
TESTS
26
124
0
n,p,k=map(int,input().split()) s='' for i in range(max(1,p-k),min(p+k+1,n+1)): if i==p: s=s+'('+str(i)+')'+' ' else: s=s+str(i)+' ' if p-k>1: s='<< '+s if p+k<n: s=s+'>>' print(s)
Title: Pages Time Limit: None seconds Memory Limit: None megabytes Problem Description: User ainta is making a web site. This time he is going to make a navigation of the pages. In his site, there are *n* pages numbered by integers from 1 to *n*. Assume that somebody is on the *p*-th page now. The navigation will look like this: When someone clicks the button "&lt;&lt;" he is redirected to page 1, and when someone clicks the button "&gt;&gt;" he is redirected to page *n*. Of course if someone clicks on a number, he is redirected to the corresponding page. There are some conditions in the navigation: - If page 1 is in the navigation, the button "&lt;&lt;" must not be printed. - If page *n* is in the navigation, the button "&gt;&gt;" must not be printed. - If the page number is smaller than 1 or greater than *n*, it must not be printed. You can see some examples of the navigations. Make a program that prints the navigation. Input Specification: The first and the only line contains three integers *n*, *p*, *k* (3<=≀<=*n*<=≀<=100; 1<=≀<=*p*<=≀<=*n*; 1<=≀<=*k*<=≀<=*n*) Output Specification: Print the proper navigation. Follow the format of the output from the test samples. Demo Input: ['17 5 2\n', '6 5 2\n', '6 1 2\n', '6 2 2\n', '9 6 3\n', '10 6 3\n', '8 5 4\n'] Demo Output: ['&lt;&lt; 3 4 (5) 6 7 &gt;&gt; ', '&lt;&lt; 3 4 (5) 6 ', '(1) 2 3 &gt;&gt; ', '1 (2) 3 4 &gt;&gt;', '&lt;&lt; 3 4 5 (6) 7 8 9', '&lt;&lt; 3 4 5 (6) 7 8 9 &gt;&gt;', '1 2 3 4 (5) 6 7 8 '] Note: none
```python n,p,k=map(int,input().split()) s='' for i in range(max(1,p-k),min(p+k+1,n+1)): if i==p: s=s+'('+str(i)+')'+' ' else: s=s+str(i)+' ' if p-k>1: s='<< '+s if p+k<n: s=s+'>>' print(s) ```
3
312
B
Archer
PROGRAMMING
1,300
[ "math", "probabilities" ]
null
null
SmallR is an archer. SmallR is taking a match of archer with Zanoes. They try to shoot in the target in turns, and SmallR shoots first. The probability of shooting the target each time is for SmallR while for Zanoes. The one who shoots in the target first should be the winner. Output the probability that SmallR will win the match.
A single line contains four integers .
Print a single real number, the probability that SmallR will win the match. The answer will be considered correct if the absolute or relative error doesn't exceed 10<=-<=6.
[ "1 2 1 2\n" ]
[ "0.666666666667" ]
none
1,000
[ { "input": "1 2 1 2", "output": "0.666666666667" }, { "input": "1 3 1 3", "output": "0.600000000000" }, { "input": "1 3 2 3", "output": "0.428571428571" }, { "input": "3 4 3 4", "output": "0.800000000000" }, { "input": "1 2 10 11", "output": "0.523809523810" }, { "input": "4 5 4 5", "output": "0.833333333333" }, { "input": "466 701 95 721", "output": "0.937693791148" }, { "input": "268 470 444 885", "output": "0.725614009325" }, { "input": "632 916 713 821", "output": "0.719292895126" }, { "input": "269 656 918 992", "output": "0.428937461623" }, { "input": "71 657 187 695", "output": "0.310488463257" }, { "input": "435 852 973 978", "output": "0.511844133157" }, { "input": "518 816 243 359", "output": "0.719734031025" }, { "input": "882 962 311 811", "output": "0.966386645447" }, { "input": "684 774 580 736", "output": "0.906051574446" }, { "input": "486 868 929 999", "output": "0.577723252958" }, { "input": "132 359 996 998", "output": "0.368154532345" }, { "input": "933 977 266 450", "output": "0.972879407907" }, { "input": "298 833 615 872", "output": "0.441270817024" }, { "input": "34 554 14 958", "output": "0.817324099167" }, { "input": "836 934 800 905", "output": "0.906105535462" }, { "input": "482 815 69 509", "output": "0.914365577772" }, { "input": "284 423 137 521", "output": "0.885974839378" }, { "input": "648 881 486 703", "output": "0.800911421248" }, { "input": "450 885 755 836", "output": "0.533901011176" }, { "input": "533 773 823 998", "output": "0.729222130525" }, { "input": "897 957 92 898", "output": "0.993193806364" }, { "input": "699 925 441 928", "output": "0.866816866175" }, { "input": "64 704 148 603", "output": "0.289486317811" }, { "input": "719 735 626 990", "output": "0.986124079764" }, { "input": "1 1000 1 1000", "output": "0.500250125063" } ]
1,607,664,005
2,147,483,647
Python 3
OK
TESTS
31
108
0
a,b,c,d=list(map(int,input().split())) awin=a/b aloss=1-(a/b) bloss=1-(c/d) ans=awin*(1/(1-(aloss*bloss))) print("%.12f" % ans)
Title: Archer Time Limit: None seconds Memory Limit: None megabytes Problem Description: SmallR is an archer. SmallR is taking a match of archer with Zanoes. They try to shoot in the target in turns, and SmallR shoots first. The probability of shooting the target each time is for SmallR while for Zanoes. The one who shoots in the target first should be the winner. Output the probability that SmallR will win the match. Input Specification: A single line contains four integers . Output Specification: Print a single real number, the probability that SmallR will win the match. The answer will be considered correct if the absolute or relative error doesn't exceed 10<=-<=6. Demo Input: ['1 2 1 2\n'] Demo Output: ['0.666666666667'] Note: none
```python a,b,c,d=list(map(int,input().split())) awin=a/b aloss=1-(a/b) bloss=1-(c/d) ans=awin*(1/(1-(aloss*bloss))) print("%.12f" % ans) ```
3
152
B
Steps
PROGRAMMING
1,300
[ "binary search", "implementation" ]
null
null
One day Vasya went out for a walk in the yard but there weren't any of his friends outside and he had no one to play touch and run. But the boy didn't lose the high spirits and decided to play touch and run with himself. You may ask: "How did he do that?" The answer is simple. Vasya noticed that the yard is a rectangular *n*<=Γ—<=*m* field. The squares have coordinates (*x*,<=*y*) (1<=≀<=*x*<=≀<=*n*,<=1<=≀<=*y*<=≀<=*m*), where *x* is the index of the row and *y* is the index of the column. Initially Vasya stands in the square with coordinates (*x**c*,<=*y**c*). To play, he has got a list of *k* vectors (*dx**i*,<=*dy**i*) of non-zero length. The game goes like this. The boy considers all vectors in the order from 1 to *k*, and consecutively chooses each vector as the current one. After the boy has chosen a current vector, he makes the maximally possible number of valid steps in the vector's direction (it is possible that he makes zero steps). A step is defined as one movement from the square where the boy is standing now, in the direction of the current vector. That is, if Vasya is positioned in square (*x*,<=*y*), and the current vector is (*dx*,<=*dy*), one step moves Vasya to square (*x*<=+<=*dx*,<=*y*<=+<=*dy*). A step is considered valid, if the boy does not go out of the yard if he performs the step. Vasya stepped on and on, on and on until he ran out of vectors in his list. Ha had been stepping for so long that he completely forgot how many steps he had made. Help the boy and count how many steps he had made.
The first input line contains two integers *n* and *m* (1<=≀<=*n*,<=*m*<=≀<=109) β€” the yard's sizes. The second line contains integers *x**c* and *y**c* β€” the initial square's coordinates (1<=≀<=*x**c*<=≀<=*n*,<=1<=≀<=*y**c*<=≀<=*m*). The third line contains an integer *k* (1<=≀<=*k*<=≀<=104) β€” the number of vectors. Then follow *k* lines, each of them contains two integers *dx**i* and *dy**i* (|*dx**i*|,<=|*dy**i*|<=≀<=109,<=|*dx*|<=+<=|*dy*|<=β‰₯<=1).
Print the single number β€” the number of steps Vasya had made. Please do not use the %lld specificator to read or write 64-bit integers in Π‘++. It is preferred to use the cin, cout streams or the %I64d specificator.
[ "4 5\n1 1\n3\n1 1\n1 1\n0 -2\n", "10 10\n1 2\n1\n-1 0\n" ]
[ "4\n", "0\n" ]
In the first sample Vasya is initially positioned at square (1, 1) and makes 3 steps by the first vector (1, 1). So, he consecutively visits the squares (2, 2), (3, 3), (4, 4). Then he makes 0 steps by the second vector (1, 1). He makes 1 more step by the third vector (0,  - 2) and he ends up in square (4, 2). Overall, Vasya makes 4 steps. In the second sample Vasya is initially positioned in square (1, 2) and makes 0 steps by vector ( - 1, 0), as the square with coordinates (0, 2) is located outside the yard.
1,000
[ { "input": "4 5\n1 1\n3\n1 1\n1 1\n0 -2", "output": "4" }, { "input": "10 10\n1 2\n1\n-1 0", "output": "0" }, { "input": "10 20\n10 3\n10\n-2 -6\n-1 0\n-8 0\n0 5\n-1 3\n16 -16\n-1 9\n0 -18\n9 -1\n-9 5", "output": "13" }, { "input": "20 10\n14 4\n10\n6 0\n-7 -7\n12 -2\n-4 9\n20 3\n-1 -16\n0 2\n-1 1\n20 0\n-1 1", "output": "4" }, { "input": "1000 2000\n226 566\n20\n0 -100\n-100 100\n100 0\n42 0\n-100 -79\n-66 -16\n0 -7\n-1 0\n0 100\n100 91\n99 0\n1 0\n-100 0\n70 -100\n-100 100\n100 1\n66 0\n-100 1\n-47 -100\n-42 0", "output": "708" }, { "input": "1 1\n1 1\n1\n1 1", "output": "0" }, { "input": "3 3\n2 2\n1\n2 0", "output": "0" } ]
1,635,265,201
2,147,483,647
Python 3
OK
TESTS
34
156
4,608,000
n, m = map(int, input().split()) x, y = map(int, input().split()) e = 0 for i in range(int(input())): dx, dy = map(int, input().split()) a, b = n, m op1=(m - y) op2=(y - 1) op3=(n - x) op4=(x - 1) if dy > 0: a = op1 // dy elif dy < 0: a = op2 // (- dy) if dx > 0: b = op3 // dx elif dx < 0: b = op4 // (- dx) result = min(a, b) x += result * dx y += result * dy e += result print(e)
Title: Steps Time Limit: None seconds Memory Limit: None megabytes Problem Description: One day Vasya went out for a walk in the yard but there weren't any of his friends outside and he had no one to play touch and run. But the boy didn't lose the high spirits and decided to play touch and run with himself. You may ask: "How did he do that?" The answer is simple. Vasya noticed that the yard is a rectangular *n*<=Γ—<=*m* field. The squares have coordinates (*x*,<=*y*) (1<=≀<=*x*<=≀<=*n*,<=1<=≀<=*y*<=≀<=*m*), where *x* is the index of the row and *y* is the index of the column. Initially Vasya stands in the square with coordinates (*x**c*,<=*y**c*). To play, he has got a list of *k* vectors (*dx**i*,<=*dy**i*) of non-zero length. The game goes like this. The boy considers all vectors in the order from 1 to *k*, and consecutively chooses each vector as the current one. After the boy has chosen a current vector, he makes the maximally possible number of valid steps in the vector's direction (it is possible that he makes zero steps). A step is defined as one movement from the square where the boy is standing now, in the direction of the current vector. That is, if Vasya is positioned in square (*x*,<=*y*), and the current vector is (*dx*,<=*dy*), one step moves Vasya to square (*x*<=+<=*dx*,<=*y*<=+<=*dy*). A step is considered valid, if the boy does not go out of the yard if he performs the step. Vasya stepped on and on, on and on until he ran out of vectors in his list. Ha had been stepping for so long that he completely forgot how many steps he had made. Help the boy and count how many steps he had made. Input Specification: The first input line contains two integers *n* and *m* (1<=≀<=*n*,<=*m*<=≀<=109) β€” the yard's sizes. The second line contains integers *x**c* and *y**c* β€” the initial square's coordinates (1<=≀<=*x**c*<=≀<=*n*,<=1<=≀<=*y**c*<=≀<=*m*). The third line contains an integer *k* (1<=≀<=*k*<=≀<=104) β€” the number of vectors. Then follow *k* lines, each of them contains two integers *dx**i* and *dy**i* (|*dx**i*|,<=|*dy**i*|<=≀<=109,<=|*dx*|<=+<=|*dy*|<=β‰₯<=1). Output Specification: Print the single number β€” the number of steps Vasya had made. Please do not use the %lld specificator to read or write 64-bit integers in Π‘++. It is preferred to use the cin, cout streams or the %I64d specificator. Demo Input: ['4 5\n1 1\n3\n1 1\n1 1\n0 -2\n', '10 10\n1 2\n1\n-1 0\n'] Demo Output: ['4\n', '0\n'] Note: In the first sample Vasya is initially positioned at square (1, 1) and makes 3 steps by the first vector (1, 1). So, he consecutively visits the squares (2, 2), (3, 3), (4, 4). Then he makes 0 steps by the second vector (1, 1). He makes 1 more step by the third vector (0,  - 2) and he ends up in square (4, 2). Overall, Vasya makes 4 steps. In the second sample Vasya is initially positioned in square (1, 2) and makes 0 steps by vector ( - 1, 0), as the square with coordinates (0, 2) is located outside the yard.
```python n, m = map(int, input().split()) x, y = map(int, input().split()) e = 0 for i in range(int(input())): dx, dy = map(int, input().split()) a, b = n, m op1=(m - y) op2=(y - 1) op3=(n - x) op4=(x - 1) if dy > 0: a = op1 // dy elif dy < 0: a = op2 // (- dy) if dx > 0: b = op3 // dx elif dx < 0: b = op4 // (- dx) result = min(a, b) x += result * dx y += result * dy e += result print(e) ```
3
556
A
Case of the Zeros and Ones
PROGRAMMING
900
[ "greedy" ]
null
null
Andrewid the Android is a galaxy-famous detective. In his free time he likes to think about strings containing zeros and ones. Once he thought about a string of length *n* consisting of zeroes and ones. Consider the following operation: we choose any two adjacent positions in the string, and if one them contains 0, and the other contains 1, then we are allowed to remove these two digits from the string, obtaining a string of length *n*<=-<=2 as a result. Now Andreid thinks about what is the minimum length of the string that can remain after applying the described operation several times (possibly, zero)? Help him to calculate this number.
First line of the input contains a single integer *n* (1<=≀<=*n*<=≀<=2Β·105), the length of the string that Andreid has. The second line contains the string of length *n* consisting only from zeros and ones.
Output the minimum length of the string that may remain after applying the described operations several times.
[ "4\n1100\n", "5\n01010\n", "8\n11101111\n" ]
[ "0\n", "1\n", "6\n" ]
In the first sample test it is possible to change the string like the following: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/10df55364c21c6e8d5da31b6ab6f6294c4fc26b3.png" style="max-width: 100.0%;max-height: 100.0%;"/>. In the second sample test it is possible to change the string like the following: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/19ec5dcd85f0b5cf757aa076ace72df39634de2d.png" style="max-width: 100.0%;max-height: 100.0%;"/>. In the third sample test it is possible to change the string like the following: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/dc34a159e4230375fa325555527ebc748811f188.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
250
[ { "input": "4\n1100", "output": "0" }, { "input": "5\n01010", "output": "1" }, { "input": "8\n11101111", "output": "6" }, { "input": "1\n0", "output": "1" }, { "input": "1\n1", "output": "1" }, { "input": "2\n00", "output": "2" }, { "input": "2\n01", "output": "0" }, { "input": "2\n10", "output": "0" }, { "input": "2\n11", "output": "2" }, { "input": "3\n001", "output": "1" }, { "input": "6\n110110", "output": "2" }, { "input": "7\n0000011", "output": "3" }, { "input": "6\n110010", "output": "0" }, { "input": "6\n110100", "output": "0" }, { "input": "3\n100", "output": "1" }, { "input": "6\n010111", "output": "2" }, { "input": "8\n01011100", "output": "0" }, { "input": "6\n001011", "output": "0" }, { "input": "7\n1110000", "output": "1" }, { "input": "9\n011111101", "output": "5" } ]
1,667,052,132
2,147,483,647
Python 3
OK
TESTS
49
46
512,000
s=int(input()) s1=input() o=s1.count("0") o2=s1.count("1") print(abs(o-o2))
Title: Case of the Zeros and Ones Time Limit: None seconds Memory Limit: None megabytes Problem Description: Andrewid the Android is a galaxy-famous detective. In his free time he likes to think about strings containing zeros and ones. Once he thought about a string of length *n* consisting of zeroes and ones. Consider the following operation: we choose any two adjacent positions in the string, and if one them contains 0, and the other contains 1, then we are allowed to remove these two digits from the string, obtaining a string of length *n*<=-<=2 as a result. Now Andreid thinks about what is the minimum length of the string that can remain after applying the described operation several times (possibly, zero)? Help him to calculate this number. Input Specification: First line of the input contains a single integer *n* (1<=≀<=*n*<=≀<=2Β·105), the length of the string that Andreid has. The second line contains the string of length *n* consisting only from zeros and ones. Output Specification: Output the minimum length of the string that may remain after applying the described operations several times. Demo Input: ['4\n1100\n', '5\n01010\n', '8\n11101111\n'] Demo Output: ['0\n', '1\n', '6\n'] Note: In the first sample test it is possible to change the string like the following: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/10df55364c21c6e8d5da31b6ab6f6294c4fc26b3.png" style="max-width: 100.0%;max-height: 100.0%;"/>. In the second sample test it is possible to change the string like the following: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/19ec5dcd85f0b5cf757aa076ace72df39634de2d.png" style="max-width: 100.0%;max-height: 100.0%;"/>. In the third sample test it is possible to change the string like the following: <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/dc34a159e4230375fa325555527ebc748811f188.png" style="max-width: 100.0%;max-height: 100.0%;"/>.
```python s=int(input()) s1=input() o=s1.count("0") o2=s1.count("1") print(abs(o-o2)) ```
3
472
A
Design Tutorial: Learn from Math
PROGRAMMING
800
[ "math", "number theory" ]
null
null
One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that. For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem. You are given an integer *n* no less than 12, express it as a sum of two composite numbers.
The only line contains an integer *n* (12<=≀<=*n*<=≀<=106).
Output two composite integers *x* and *y* (1<=&lt;<=*x*,<=*y*<=&lt;<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them.
[ "12\n", "15\n", "23\n", "1000000\n" ]
[ "4 8\n", "6 9\n", "8 15\n", "500000 500000\n" ]
In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well. In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number.
500
[ { "input": "12", "output": "4 8" }, { "input": "15", "output": "6 9" }, { "input": "23", "output": "8 15" }, { "input": "1000000", "output": "500000 500000" }, { "input": "63874", "output": "4 63870" }, { "input": "14568", "output": "4 14564" }, { "input": "192", "output": "4 188" }, { "input": "86", "output": "4 82" }, { "input": "46220", "output": "4 46216" }, { "input": "57114", "output": "4 57110" }, { "input": "869", "output": "4 865" }, { "input": "738457", "output": "4 738453" }, { "input": "58113", "output": "6 58107" }, { "input": "4864", "output": "4 4860" }, { "input": "15", "output": "6 9" }, { "input": "74752", "output": "4 74748" }, { "input": "6073", "output": "4 6069" }, { "input": "1289", "output": "4 1285" }, { "input": "20", "output": "4 16" }, { "input": "58134", "output": "4 58130" }, { "input": "57756", "output": "4 57752" }, { "input": "765", "output": "6 759" }, { "input": "59", "output": "4 55" }, { "input": "991666", "output": "4 991662" }, { "input": "70761", "output": "4 70757" }, { "input": "13", "output": "4 9" }, { "input": "999999", "output": "4 999995" }, { "input": "17", "output": "8 9" }, { "input": "21", "output": "6 15" }, { "input": "19", "output": "4 15" }, { "input": "100007", "output": "6 100001" }, { "input": "999987", "output": "6 999981" }, { "input": "22", "output": "4 18" } ]
1,671,907,804
2,147,483,647
Python 3
OK
TESTS
33
46
0
n = int(input()) if n%2==0: print(n-4, 4) else: print(n-9, 9)
Title: Design Tutorial: Learn from Math Time Limit: None seconds Memory Limit: None megabytes Problem Description: One way to create a task is to learn from math. You can generate some random math statement or modify some theorems to get something new and build a new task from that. For example, there is a statement called the "Goldbach's conjecture". It says: "each even number no less than four can be expressed as the sum of two primes". Let's modify it. How about a statement like that: "each integer no less than 12 can be expressed as the sum of two composite numbers." Not like the Goldbach's conjecture, I can prove this theorem. You are given an integer *n* no less than 12, express it as a sum of two composite numbers. Input Specification: The only line contains an integer *n* (12<=≀<=*n*<=≀<=106). Output Specification: Output two composite integers *x* and *y* (1<=&lt;<=*x*,<=*y*<=&lt;<=*n*) such that *x*<=+<=*y*<==<=*n*. If there are multiple solutions, you can output any of them. Demo Input: ['12\n', '15\n', '23\n', '1000000\n'] Demo Output: ['4 8\n', '6 9\n', '8 15\n', '500000 500000\n'] Note: In the first example, 12 = 4 + 8 and both 4, 8 are composite numbers. You can output "6 6" or "8 4" as well. In the second example, 15 = 6 + 9. Note that you can't output "1 14" because 1 is not a composite number.
```python n = int(input()) if n%2==0: print(n-4, 4) else: print(n-9, 9) ```
3
986
D
Perfect Encoding
PROGRAMMING
3,100
[ "fft", "math" ]
null
null
You are working as an analyst in a company working on a new system for big data storage. This system will store $n$ different objects. Each object should have a unique ID. To create the system, you choose the parameters of the systemΒ β€” integers $m \ge 1$ and $b_{1}, b_{2}, \ldots, b_{m}$. With these parameters an ID of some object in the system is an array of integers $[a_{1}, a_{2}, \ldots, a_{m}]$ where $1 \le a_{i} \le b_{i}$ holds for every $1 \le i \le m$. Developers say that production costs are proportional to $\sum_{i=1}^{m} b_{i}$. You are asked to choose parameters $m$ and $b_{i}$ so that the system will be able to assign unique IDs to $n$ different objects and production costs are minimized. Note that you don't have to use all available IDs.
In the only line of input there is one positive integer $n$. The length of the decimal representation of $n$ is no greater than $1.5 \cdot 10^{6}$. The integer does not contain leading zeros.
Print one numberΒ β€” minimal value of $\sum_{i=1}^{m} b_{i}$.
[ "36\n", "37\n", "12345678901234567890123456789\n" ]
[ "10\n", "11\n", "177\n" ]
none
2,500
[ { "input": "36", "output": "10" }, { "input": "37", "output": "11" }, { "input": "12345678901234567890123456789", "output": "177" }, { "input": "1", "output": "1" }, { "input": "2", "output": "2" }, { "input": "3", "output": "3" }, { "input": "4", "output": "4" }, { "input": "7421902501252475186372406731932548506197390793597574544727433297197476846519276598727359617092494798", "output": "629" }, { "input": "71057885893313745806894531138592341136175030511382512555364579061229040750815096670263802546201989828165866147027119861863385397179695224216202346062872417111920113483747119385957051753101263769591892062039112567316036455789217245754461225443096439906225767290690128677713047690686004149082311677134836383178262318973298581951974863511315252485252083010690948164456205330279738760034861583874764199950445592461479109814313530332776429627014232776723160331462731018692207739471347664936326394313671025", "output": "3144" }, { "input": "515377520732011331036461129765621272702107522001", "output": "300" }, { "input": "515377520732011331036461129765621272702107522002", "output": "301" }, { "input": "515377520732011331036461129765621272702107522000", "output": "300" }, { "input": "2644141638961613273780910519504288731930844065504296335329840736453657194693409799081556627701216123927819555393745164711901909164201237823730685450515907348055240450396641607756029548457929682548780800235177236082257895631246188876123132346108173348981012356250960688811094108794077791634930736509832272441660537127557164580456832796615775793837112808169797875218746484343692719877391033530037881176218120852179342877728205628700771297494331664021228732264346205537805710440002", "output": "3002" } ]
1,696,936,794
2,147,483,647
Python 3
OK
TESTS
51
249
5,939,200
import decimal from math import ceil, floor, inf, log n = input() if n=='1': print(1) exit() decimal.getcontext().prec = len(n)+6 decimal.getcontext().Emax = len(n)+6 log3 = log(10)*(len(n)-1)/log(3) pref = n if len(pref)>20: pref = pref[:20] pref = pref[0] + '.' + pref[1:] log3 += log(float(pref))/log(3) log3+=1e-8 full = max(0, floor(log3)) small=0 if full>=1 and log3-full<=log(2)/log(3)*2-1: small=2 full-=1 elif log3-full<=log(2)/log(3): small = 1 else: full+=1 n = decimal.Decimal(n) ans = full*3 + small*2 def check(f,s): global ans res = decimal.Decimal(3)**f * (2**s) if res>=n: ans = min(ans,f*3+s*2) if small==0 and full>=1: full-=1 small+=1 check(full,small) elif small==1 and full>=1: full-=1 small+=1 check(full,small) elif small==2: small-=2 full+=1 check(full,small) print(ans)
Title: Perfect Encoding Time Limit: None seconds Memory Limit: None megabytes Problem Description: You are working as an analyst in a company working on a new system for big data storage. This system will store $n$ different objects. Each object should have a unique ID. To create the system, you choose the parameters of the systemΒ β€” integers $m \ge 1$ and $b_{1}, b_{2}, \ldots, b_{m}$. With these parameters an ID of some object in the system is an array of integers $[a_{1}, a_{2}, \ldots, a_{m}]$ where $1 \le a_{i} \le b_{i}$ holds for every $1 \le i \le m$. Developers say that production costs are proportional to $\sum_{i=1}^{m} b_{i}$. You are asked to choose parameters $m$ and $b_{i}$ so that the system will be able to assign unique IDs to $n$ different objects and production costs are minimized. Note that you don't have to use all available IDs. Input Specification: In the only line of input there is one positive integer $n$. The length of the decimal representation of $n$ is no greater than $1.5 \cdot 10^{6}$. The integer does not contain leading zeros. Output Specification: Print one numberΒ β€” minimal value of $\sum_{i=1}^{m} b_{i}$. Demo Input: ['36\n', '37\n', '12345678901234567890123456789\n'] Demo Output: ['10\n', '11\n', '177\n'] Note: none
```python import decimal from math import ceil, floor, inf, log n = input() if n=='1': print(1) exit() decimal.getcontext().prec = len(n)+6 decimal.getcontext().Emax = len(n)+6 log3 = log(10)*(len(n)-1)/log(3) pref = n if len(pref)>20: pref = pref[:20] pref = pref[0] + '.' + pref[1:] log3 += log(float(pref))/log(3) log3+=1e-8 full = max(0, floor(log3)) small=0 if full>=1 and log3-full<=log(2)/log(3)*2-1: small=2 full-=1 elif log3-full<=log(2)/log(3): small = 1 else: full+=1 n = decimal.Decimal(n) ans = full*3 + small*2 def check(f,s): global ans res = decimal.Decimal(3)**f * (2**s) if res>=n: ans = min(ans,f*3+s*2) if small==0 and full>=1: full-=1 small+=1 check(full,small) elif small==1 and full>=1: full-=1 small+=1 check(full,small) elif small==2: small-=2 full+=1 check(full,small) print(ans) ```
3
182
B
Vasya's Calendar
PROGRAMMING
1,000
[ "implementation" ]
null
null
Vasya lives in a strange world. The year has *n* months and the *i*-th month has *a**i* days. Vasya got a New Year present β€” the clock that shows not only the time, but also the date. The clock's face can display any number from 1 to *d*. It is guaranteed that *a**i*<=≀<=*d* for all *i* from 1 to *n*. The clock does not keep information about the current month, so when a new day comes, it simply increases the current day number by one. The clock cannot display number *d*<=+<=1, so after day number *d* it shows day 1 (the current day counter resets). The mechanism of the clock allows you to increase the day number by one manually. When you execute this operation, day *d* is also followed by day 1. Vasya begins each day checking the day number on the clock. If the day number on the clock does not match the actual day number in the current month, then Vasya manually increases it by one. Vasya is persistent and repeats this operation until the day number on the clock matches the actual number of the current day in the current month. A year passed and Vasya wonders how many times he manually increased the day number by one, from the first day of the first month to the last day of the *n*-th month inclusive, considering that on the first day of the first month the clock display showed day 1.
The first line contains the single number *d* β€” the maximum number of the day that Vasya's clock can show (1<=≀<=*d*<=≀<=106). The second line contains a single integer *n* β€” the number of months in the year (1<=≀<=*n*<=≀<=2000). The third line contains *n* space-separated integers: *a**i* (1<=≀<=*a**i*<=≀<=*d*) β€” the number of days in each month in the order in which they follow, starting from the first one.
Print a single number β€” the number of times Vasya manually increased the day number by one throughout the last year.
[ "4\n2\n2 2\n", "5\n3\n3 4 3\n", "31\n12\n31 28 31 30 31 30 31 31 30 31 30 31\n" ]
[ "2\n", "3\n", "7\n" ]
In the first sample the situation is like this: - Day 1. Month 1. The clock shows 1. Vasya changes nothing. - Day 2. Month 1. The clock shows 2. Vasya changes nothing. - Day 1. Month 2. The clock shows 3. Vasya manually increases the day number by 1. After that the clock shows 4. Vasya increases the day number by 1 manually. After that the clock shows 1. - Day 2. Month 2. The clock shows 2. Vasya changes nothing.
500
[ { "input": "4\n2\n2 2", "output": "2" }, { "input": "5\n3\n3 4 3", "output": "3" }, { "input": "31\n12\n31 28 31 30 31 30 31 31 30 31 30 31", "output": "7" }, { "input": "1\n1\n1", "output": "0" }, { "input": "1\n2\n1 1", "output": "0" }, { "input": "2\n2\n1 1", "output": "1" }, { "input": "10\n2\n10 2", "output": "0" }, { "input": "10\n3\n6 3 6", "output": "11" }, { "input": "10\n4\n8 7 1 5", "output": "14" }, { "input": "10\n5\n2 7 8 4 4", "output": "19" }, { "input": "10\n6\n8 3 4 9 6 1", "output": "20" }, { "input": "10\n7\n10 5 3 1 1 9 1", "output": "31" }, { "input": "10\n8\n6 5 10 6 8 1 3 2", "output": "31" }, { "input": "10\n9\n6 2 7 5 5 4 8 6 2", "output": "37" }, { "input": "10\n10\n1 10 1 10 1 1 7 8 6 7", "output": "45" }, { "input": "100\n100\n85 50 17 89 65 89 5 20 86 26 16 21 85 14 44 31 87 31 6 2 48 67 8 80 79 1 48 36 97 1 5 30 79 50 78 12 2 55 76 100 54 40 26 81 97 96 68 56 87 14 51 17 54 37 52 33 69 62 38 63 74 15 62 78 9 19 67 2 60 58 93 60 18 96 55 48 34 7 79 82 32 58 90 67 20 50 27 15 7 89 98 10 11 15 99 49 4 51 77 52", "output": "5099" }, { "input": "101\n100\n19 17 15 16 28 69 41 47 75 42 19 98 16 90 92 47 21 4 98 17 27 31 90 10 14 92 62 73 56 55 6 60 62 22 78 1 3 86 18 59 92 41 21 34 67 9 92 78 77 45 50 92 57 61 11 98 89 72 57 93 100 12 61 48 5 48 38 9 65 64 77 29 18 55 94 42 10 77 43 46 7 89 8 13 5 53 80 59 23 100 30 28 29 24 85 56 10 22 24 16", "output": "5301" }, { "input": "102\n100\n31 22 59 16 11 56 81 4 19 31 8 72 4 92 18 7 13 12 62 40 34 67 40 23 96 4 90 28 3 18 54 49 10 71 73 79 69 7 41 75 59 13 2 78 72 6 95 33 52 97 7 86 57 94 12 93 19 94 59 28 5 96 46 102 2 101 57 85 53 69 72 39 14 75 8 16 10 57 26 4 85 18 89 84 48 93 54 21 78 6 67 35 11 78 91 91 97 15 8 32", "output": "5447" }, { "input": "103\n100\n68 38 41 54 37 11 35 26 43 97 70 3 13 11 64 83 3 95 99 16 4 13 22 27 64 20 95 38 40 87 6 17 95 67 31 24 85 33 98 24 89 101 66 38 42 5 95 18 95 13 103 85 72 73 68 93 22 59 48 59 72 46 5 41 54 32 48 69 3 76 2 26 102 44 39 58 55 85 40 16 81 78 92 63 25 97 83 2 54 16 20 63 19 8 84 34 1 22 43 93", "output": "5358" }, { "input": "104\n100\n65 74 94 71 98 38 88 67 71 84 45 79 55 86 55 51 27 89 14 66 29 63 8 103 98 94 87 81 58 68 24 96 60 36 48 95 28 72 95 42 87 7 14 23 99 77 34 14 90 31 8 99 29 30 9 88 42 1 77 61 55 85 17 98 62 78 27 1 58 69 82 62 62 81 56 104 66 8 17 23 7 61 59 70 79 64 78 16 32 11 59 4 24 73 55 2 95 39 62 13", "output": "4773" } ]
1,660,210,694
2,147,483,647
Python 3
OK
TESTS
40
92
0
d = int(input()) n = int(input()) przhm = list(map(int, input().split())) slv = dict() amn = 0 for i in range (len(przhm) - 1): if przhm[i] == d: continue if przhm[i] not in slv: slv[przhm[i]] = 1 else: slv[przhm[i]] += 1 sps = slv.items() for j in sps: n_d = j[0] * j[1] d_d = d * j[1] amn = amn + (d_d - n_d) print (amn) # print (slv) # print (sps) # print (przhm)
Title: Vasya's Calendar Time Limit: None seconds Memory Limit: None megabytes Problem Description: Vasya lives in a strange world. The year has *n* months and the *i*-th month has *a**i* days. Vasya got a New Year present β€” the clock that shows not only the time, but also the date. The clock's face can display any number from 1 to *d*. It is guaranteed that *a**i*<=≀<=*d* for all *i* from 1 to *n*. The clock does not keep information about the current month, so when a new day comes, it simply increases the current day number by one. The clock cannot display number *d*<=+<=1, so after day number *d* it shows day 1 (the current day counter resets). The mechanism of the clock allows you to increase the day number by one manually. When you execute this operation, day *d* is also followed by day 1. Vasya begins each day checking the day number on the clock. If the day number on the clock does not match the actual day number in the current month, then Vasya manually increases it by one. Vasya is persistent and repeats this operation until the day number on the clock matches the actual number of the current day in the current month. A year passed and Vasya wonders how many times he manually increased the day number by one, from the first day of the first month to the last day of the *n*-th month inclusive, considering that on the first day of the first month the clock display showed day 1. Input Specification: The first line contains the single number *d* β€” the maximum number of the day that Vasya's clock can show (1<=≀<=*d*<=≀<=106). The second line contains a single integer *n* β€” the number of months in the year (1<=≀<=*n*<=≀<=2000). The third line contains *n* space-separated integers: *a**i* (1<=≀<=*a**i*<=≀<=*d*) β€” the number of days in each month in the order in which they follow, starting from the first one. Output Specification: Print a single number β€” the number of times Vasya manually increased the day number by one throughout the last year. Demo Input: ['4\n2\n2 2\n', '5\n3\n3 4 3\n', '31\n12\n31 28 31 30 31 30 31 31 30 31 30 31\n'] Demo Output: ['2\n', '3\n', '7\n'] Note: In the first sample the situation is like this: - Day 1. Month 1. The clock shows 1. Vasya changes nothing. - Day 2. Month 1. The clock shows 2. Vasya changes nothing. - Day 1. Month 2. The clock shows 3. Vasya manually increases the day number by 1. After that the clock shows 4. Vasya increases the day number by 1 manually. After that the clock shows 1. - Day 2. Month 2. The clock shows 2. Vasya changes nothing.
```python d = int(input()) n = int(input()) przhm = list(map(int, input().split())) slv = dict() amn = 0 for i in range (len(przhm) - 1): if przhm[i] == d: continue if przhm[i] not in slv: slv[przhm[i]] = 1 else: slv[przhm[i]] += 1 sps = slv.items() for j in sps: n_d = j[0] * j[1] d_d = d * j[1] amn = amn + (d_d - n_d) print (amn) # print (slv) # print (sps) # print (przhm) ```
3
1,011
B
Planning The Expedition
PROGRAMMING
1,200
[ "binary search", "brute force", "implementation" ]
null
null
Natasha is planning an expedition to Mars for $n$ people. One of the important tasks is to provide food for each participant. The warehouse has $m$ daily food packages. Each package has some food type $a_i$. Each participant must eat exactly one food package each day. Due to extreme loads, each participant must eat the same food type throughout the expedition. Different participants may eat different (or the same) types of food. Formally, for each participant $j$ Natasha should select his food type $b_j$ and each day $j$-th participant will eat one food package of type $b_j$. The values $b_j$ for different participants may be different. What is the maximum possible number of days the expedition can last, following the requirements above?
The first line contains two integers $n$ and $m$ ($1 \le n \le 100$, $1 \le m \le 100$)Β β€” the number of the expedition participants and the number of the daily food packages available. The second line contains sequence of integers $a_1, a_2, \dots, a_m$ ($1 \le a_i \le 100$), where $a_i$ is the type of $i$-th food package.
Print the single integerΒ β€” the number of days the expedition can last. If it is not possible to plan the expedition for even one day, print 0.
[ "4 10\n1 5 2 1 1 1 2 5 7 2\n", "100 1\n1\n", "2 5\n5 4 3 2 1\n", "3 9\n42 42 42 42 42 42 42 42 42\n" ]
[ "2\n", "0\n", "1\n", "3\n" ]
In the first example, Natasha can assign type $1$ food to the first participant, the same type $1$ to the second, type $5$ to the third and type $2$ to the fourth. In this case, the expedition can last for $2$ days, since each participant can get two food packages of his food type (there will be used $4$ packages of type $1$, two packages of type $2$ and two packages of type $5$). In the second example, there are $100$ participants and only $1$ food package. In this case, the expedition can't last even $1$ day.
1,000
[ { "input": "4 10\n1 5 2 1 1 1 2 5 7 2", "output": "2" }, { "input": "100 1\n1", "output": "0" }, { "input": "2 5\n5 4 3 2 1", "output": "1" }, { "input": "3 9\n42 42 42 42 42 42 42 42 42", "output": "3" }, { "input": "1 1\n100", "output": "1" }, { "input": "4 100\n84 99 66 69 86 94 89 96 98 93 93 82 87 93 91 100 69 99 93 81 99 84 75 100 86 88 98 100 84 96 44 70 94 91 85 78 86 79 45 88 91 78 98 94 81 87 93 72 96 88 96 97 96 62 86 72 94 84 80 98 88 90 93 73 73 98 78 50 91 96 97 82 85 90 87 41 97 82 97 77 100 100 92 83 98 81 70 81 74 78 84 79 98 98 55 99 97 99 79 98", "output": "5" }, { "input": "100 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "1" }, { "input": "1 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "100" }, { "input": "6 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4", "output": "15" }, { "input": "1 1\n59", "output": "1" }, { "input": "1 50\n39 1 46 21 23 28 100 32 63 63 18 15 40 29 34 49 56 74 47 42 96 97 59 62 76 62 69 61 36 21 66 18 92 58 63 85 5 6 77 75 91 66 38 10 66 43 20 74 37 83", "output": "3" }, { "input": "1 100\n83 72 21 55 49 5 61 60 87 21 89 88 3 75 49 81 36 25 50 61 96 19 36 55 48 8 97 69 50 24 23 39 26 25 41 90 69 20 19 62 38 52 60 6 66 31 9 45 36 12 69 94 22 60 91 65 35 58 13 85 33 87 83 11 95 20 20 85 13 21 57 69 17 94 78 37 59 45 60 7 64 51 60 89 91 22 6 58 95 96 51 53 89 22 28 16 27 56 1 54", "output": "5" }, { "input": "50 1\n75", "output": "0" }, { "input": "50 50\n85 20 12 73 52 78 70 95 88 43 31 88 81 41 80 99 16 11 97 11 21 44 2 34 47 38 87 2 32 47 97 93 52 14 35 37 97 48 58 19 52 55 97 72 17 25 16 85 90 58", "output": "1" }, { "input": "50 100\n2 37 74 32 99 75 73 86 67 33 62 30 15 21 51 41 73 75 67 39 90 10 56 74 72 26 38 65 75 55 46 99 34 49 92 82 11 100 15 71 75 12 22 56 47 74 20 98 59 65 14 76 1 40 89 36 43 93 83 73 75 100 50 95 27 10 72 51 25 69 15 3 57 60 84 99 31 44 12 61 69 95 51 31 28 36 57 35 31 52 44 19 79 12 27 27 7 81 68 1", "output": "1" }, { "input": "100 1\n26", "output": "0" }, { "input": "100 50\n8 82 62 11 85 57 5 32 99 92 77 2 61 86 8 88 10 28 83 4 68 79 8 64 56 98 4 88 22 54 30 60 62 79 72 38 17 28 32 16 62 26 56 44 72 33 22 84 77 45", "output": "0" }, { "input": "100 100\n13 88 64 65 78 10 61 97 16 32 76 9 60 1 40 35 90 61 60 85 26 16 38 36 33 95 24 55 82 88 13 9 47 34 94 2 90 74 11 81 46 70 94 11 55 32 19 36 97 16 17 35 38 82 89 16 74 94 97 79 9 94 88 12 28 2 4 25 72 95 49 31 88 82 6 77 70 98 90 57 57 33 38 61 26 75 2 66 22 44 13 35 16 4 33 16 12 66 32 86", "output": "1" }, { "input": "34 64\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "1" }, { "input": "53 98\n1 1 2 2 2 2 2 1 2 2 2 1 1 2 2 2 1 1 2 1 1 2 2 1 1 2 1 1 1 2 1 2 1 1 1 2 2 1 2 1 1 1 2 2 1 2 1 1 2 1 2 2 1 2 2 2 2 2 2 2 2 2 1 1 2 2 1 2 1 2 1 2 1 1 2 2 2 1 1 2 1 2 1 1 1 1 2 2 2 2 2 1 1 2 2 2 1 1", "output": "1" }, { "input": "17 8\n2 5 3 4 3 2 2 2", "output": "0" }, { "input": "24 77\n8 6 10 4 6 6 4 10 9 7 7 5 5 4 6 7 10 6 3 4 6 6 4 9 4 6 2 5 3 4 4 1 4 6 6 8 1 1 6 4 6 2 5 7 7 2 4 4 10 1 10 9 2 3 8 1 10 4 3 9 3 8 3 5 6 3 4 9 5 3 4 1 1 6 1 2 1", "output": "2" }, { "input": "65 74\n7 19 2 38 28 44 34 49 14 13 30 22 11 4 4 12 8 1 40 8 34 31 44 38 21 35 13 7 19 32 37 5 36 26 7 2 15 11 47 45 48 2 49 10 10 42 42 31 50 24 29 34 31 38 39 48 43 47 32 46 10 1 33 21 12 50 13 44 38 11 41 41 10 7", "output": "1" }, { "input": "37 71\n50 93 15 80 82 23 35 90 70 73 55 23 23 6 86 63 38 70 38 52 88 34 25 75 32 19 6 98 31 38 21 8 66 8 59 71 7 80 69 23 17 70 6 40 72 5 48 59 18 1 48 91 17 41 11 27 53 95 87 31 62 94 94 60 38 99 70 50 81 86 44", "output": "1" }, { "input": "35 4\n100 100 100 100", "output": "0" }, { "input": "68 12\n100 100 100 99 99 100 100 100 99 99 99 99", "output": "0" }, { "input": "91 33\n97 100 96 96 97 100 97 97 96 96 99 99 98 97 97 99 99 98 100 96 96 99 100 96 97 100 97 97 99 98 96 98 97", "output": "0" }, { "input": "59 72\n99 96 96 93 94 97 93 96 100 99 93 99 96 92 92 97 93 100 92 100 91 96 99 100 97 98 93 93 96 100 97 99 100 100 91 93 96 91 93 100 95 96 92 97 91 91 99 100 91 95 95 100 92 93 98 93 95 92 95 100 91 95 99 95 92 91 100 93 98 98 96 99", "output": "1" }, { "input": "9 35\n95 54 78 94 56 63 68 73 61 85 73 62 61 94 67 91 66 54 89 69 92 60 91 87 63 62 85 70 62 68 97 88 96 55 62", "output": "2" }, { "input": "99 100\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "1" }, { "input": "1 50\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1", "output": "50" } ]
1,579,381,871
2,147,483,647
PyPy 3
OK
TESTS
31
155
1,228,800
n,m=map(int,input().split()) a=input().split() ls=[0 for i in range(100)] for i in range(m): ls[int(a[i])-1]+=1 a.sort(reverse=True) ans=m//n while ans: count=0 for i in range(100): count+=ls[i]//ans if(count>=n): break ans-=1 print(max(ans,0))
Title: Planning The Expedition Time Limit: None seconds Memory Limit: None megabytes Problem Description: Natasha is planning an expedition to Mars for $n$ people. One of the important tasks is to provide food for each participant. The warehouse has $m$ daily food packages. Each package has some food type $a_i$. Each participant must eat exactly one food package each day. Due to extreme loads, each participant must eat the same food type throughout the expedition. Different participants may eat different (or the same) types of food. Formally, for each participant $j$ Natasha should select his food type $b_j$ and each day $j$-th participant will eat one food package of type $b_j$. The values $b_j$ for different participants may be different. What is the maximum possible number of days the expedition can last, following the requirements above? Input Specification: The first line contains two integers $n$ and $m$ ($1 \le n \le 100$, $1 \le m \le 100$)Β β€” the number of the expedition participants and the number of the daily food packages available. The second line contains sequence of integers $a_1, a_2, \dots, a_m$ ($1 \le a_i \le 100$), where $a_i$ is the type of $i$-th food package. Output Specification: Print the single integerΒ β€” the number of days the expedition can last. If it is not possible to plan the expedition for even one day, print 0. Demo Input: ['4 10\n1 5 2 1 1 1 2 5 7 2\n', '100 1\n1\n', '2 5\n5 4 3 2 1\n', '3 9\n42 42 42 42 42 42 42 42 42\n'] Demo Output: ['2\n', '0\n', '1\n', '3\n'] Note: In the first example, Natasha can assign type $1$ food to the first participant, the same type $1$ to the second, type $5$ to the third and type $2$ to the fourth. In this case, the expedition can last for $2$ days, since each participant can get two food packages of his food type (there will be used $4$ packages of type $1$, two packages of type $2$ and two packages of type $5$). In the second example, there are $100$ participants and only $1$ food package. In this case, the expedition can't last even $1$ day.
```python n,m=map(int,input().split()) a=input().split() ls=[0 for i in range(100)] for i in range(m): ls[int(a[i])-1]+=1 a.sort(reverse=True) ans=m//n while ans: count=0 for i in range(100): count+=ls[i]//ans if(count>=n): break ans-=1 print(max(ans,0)) ```
3
681
C
Heap Operations
PROGRAMMING
1,600
[ "constructive algorithms", "data structures", "greedy" ]
null
null
Petya has recently learned data structure named "Binary heap". The heap he is now operating with allows the following operations: - put the given number into the heap; - get the value of the minimum element in the heap; - extract the minimum element from the heap; Thus, at any moment of time the heap contains several integers (possibly none), some of them might be equal. In order to better learn this data structure Petya took an empty heap and applied some operations above to it. Also, he carefully wrote down all the operations and their results to his event log, following the format: - insert *x*Β β€” put the element with value *x* in the heap; - getMin *x*Β β€” the value of the minimum element contained in the heap was equal to *x*; - removeMinΒ β€” the minimum element was extracted from the heap (only one instance, if there were many). All the operations were correct, i.e. there was at least one element in the heap each time getMin or removeMin operations were applied. While Petya was away for a lunch, his little brother Vova came to the room, took away some of the pages from Petya's log and used them to make paper boats. Now Vova is worried, if he made Petya's sequence of operations inconsistent. For example, if one apply operations one-by-one in the order they are written in the event log, results of getMin operations might differ from the results recorded by Petya, and some of getMin or removeMin operations may be incorrect, as the heap is empty at the moment they are applied. Now Vova wants to add some new operation records to the event log in order to make the resulting sequence of operations correct. That is, the result of each getMin operation is equal to the result in the record, and the heap is non-empty when getMin ad removeMin are applied. Vova wants to complete this as fast as possible, as the Petya may get back at any moment. He asks you to add the least possible number of operation records to the current log. Note that arbitrary number of operations may be added at the beginning, between any two other operations, or at the end of the log.
The first line of the input contains the only integer *n* (1<=≀<=*n*<=≀<=100<=000)Β β€” the number of the records left in Petya's journal. Each of the following *n* lines describe the records in the current log in the order they are applied. Format described in the statement is used. All numbers in the input are integers not exceeding 109 by their absolute value.
The first line of the output should contain a single integer *m*Β β€” the minimum possible number of records in the modified sequence of operations. Next *m* lines should contain the corrected sequence of records following the format of the input (described in the statement), one per line and in the order they are applied. All the numbers in the output should be integers not exceeding 109 by their absolute value. Note that the input sequence of operations must be the subsequence of the output sequence. It's guaranteed that there exists the correct answer consisting of no more than 1<=000<=000 operations.
[ "2\ninsert 3\ngetMin 4\n", "4\ninsert 1\ninsert 1\nremoveMin\ngetMin 2\n" ]
[ "4\ninsert 3\nremoveMin\ninsert 4\ngetMin 4\n", "6\ninsert 1\ninsert 1\nremoveMin\nremoveMin\ninsert 2\ngetMin 2\n" ]
In the first sample, after number 3 is inserted into the heap, the minimum number is 3. To make the result of the first getMin equal to 4 one should firstly remove number 3 from the heap and then add number 4 into the heap. In the second sample case number 1 is inserted two times, so should be similarly removed twice.
1,500
[ { "input": "2\ninsert 3\ngetMin 4", "output": "4\ninsert 3\nremoveMin\ninsert 4\ngetMin 4" }, { "input": "4\ninsert 1\ninsert 1\nremoveMin\ngetMin 2", "output": "6\ninsert 1\ninsert 1\nremoveMin\nremoveMin\ninsert 2\ngetMin 2" }, { "input": "1\ninsert 1", "output": "1\ninsert 1" }, { "input": "1\ngetMin 31", "output": "2\ninsert 31\ngetMin 31" }, { "input": "1\nremoveMin", "output": "2\ninsert 0\nremoveMin" }, { "input": "2\ninsert 2\ngetMin 2", "output": "2\ninsert 2\ngetMin 2" }, { "input": "2\ninsert 31\nremoveMin", "output": "2\ninsert 31\nremoveMin" }, { "input": "2\ngetMin 31\nremoveMin", "output": "3\ninsert 31\ngetMin 31\nremoveMin" }, { "input": "2\nremoveMin\ngetMin 31", "output": "4\ninsert 0\nremoveMin\ninsert 31\ngetMin 31" }, { "input": "8\ninsert 219147240\nremoveMin\ngetMin 923854124\nremoveMin\ngetMin -876779400\nremoveMin\ninsert 387686853\ngetMin 749998368", "output": "12\ninsert 219147240\nremoveMin\ninsert 923854124\ngetMin 923854124\nremoveMin\ninsert -876779400\ngetMin -876779400\nremoveMin\ninsert 387686853\nremoveMin\ninsert 749998368\ngetMin 749998368" }, { "input": "2\nremoveMin\ninsert 450653162", "output": "3\ninsert 0\nremoveMin\ninsert 450653162" }, { "input": "6\ninsert -799688192\ngetMin 491561656\nremoveMin\ninsert -805250162\ninsert -945439443\nremoveMin", "output": "8\ninsert -799688192\nremoveMin\ninsert 491561656\ngetMin 491561656\nremoveMin\ninsert -805250162\ninsert -945439443\nremoveMin" }, { "input": "30\ninsert 62350949\ngetMin -928976719\nremoveMin\ngetMin 766590157\ngetMin -276914351\ninsert 858958907\ngetMin -794653029\ngetMin 505812710\ngetMin -181182543\ninsert -805198995\nremoveMin\ninsert -200361579\nremoveMin\ninsert 988531216\ninsert -474257426\ninsert 579296921\nremoveMin\ninsert -410043658\ngetMin 716684155\nremoveMin\ngetMin -850837161\ngetMin 368670814\ninsert 579000842\nremoveMin\ngetMin -169833018\ninsert 313148949\nremoveMin\nremoveMin\ngetMin 228901059\ngetMin 599172503", "output": "52\ninsert 62350949\ninsert -928976719\ngetMin -928976719\nremoveMin\nremoveMin\ninsert 766590157\ngetMin 766590157\ninsert -276914351\ngetMin -276914351\ninsert 858958907\ninsert -794653029\ngetMin -794653029\nremoveMin\nremoveMin\ninsert 505812710\ngetMin 505812710\ninsert -181182543\ngetMin -181182543\ninsert -805198995\nremoveMin\ninsert -200361579\nremoveMin\ninsert 988531216\ninsert -474257426\ninsert 579296921\nremoveMin\ninsert -410043658\nremoveMin\nremoveMin\nremoveMin\nremoveMin\ninsert 71668415..." }, { "input": "9\ninsert 3\ninsert 4\ninsert 5\nremoveMin\ngetMin 3\nremoveMin\ngetMin 4\nremoveMin\ngetMin 5", "output": "10\ninsert 3\ninsert 4\ninsert 5\nremoveMin\ninsert 3\ngetMin 3\nremoveMin\ngetMin 4\nremoveMin\ngetMin 5" }, { "input": "9\ninsert 3\ninsert 4\ninsert 5\nremoveMin\ngetMin 5\nremoveMin\ngetMin 4\nremoveMin\ngetMin 3", "output": "12\ninsert 3\ninsert 4\ninsert 5\nremoveMin\nremoveMin\ngetMin 5\nremoveMin\ninsert 4\ngetMin 4\nremoveMin\ninsert 3\ngetMin 3" }, { "input": "1\ngetMin 0", "output": "2\ninsert 0\ngetMin 0" }, { "input": "3\ninsert 3\ninsert 4\ngetMin 4", "output": "4\ninsert 3\ninsert 4\nremoveMin\ngetMin 4" }, { "input": "3\ninsert 1\ninsert 2\ngetMin 2", "output": "4\ninsert 1\ninsert 2\nremoveMin\ngetMin 2" }, { "input": "3\ninsert -1\ninsert 0\ngetMin 0", "output": "4\ninsert -1\ninsert 0\nremoveMin\ngetMin 0" }, { "input": "2\ninsert 0\ngetMin 0", "output": "2\ninsert 0\ngetMin 0" }, { "input": "1\ninsert -1", "output": "1\ninsert -1" }, { "input": "3\ninsert 1\ninsert 0\ngetMin 1", "output": "4\ninsert 1\ninsert 0\nremoveMin\ngetMin 1" } ]
1,680,720,631
2,147,483,647
PyPy 3-64
OK
TESTS
39
327
30,720,000
import sys input = lambda: sys.stdin.readline().rstrip() from heapq import * ans = [] v = [] for _ in range(int(input())): A = input().split() a = A[0] if a=='insert': b = int(A[1]) ans.append(a+' ' +str(b)) heappush(v,b) elif a=='getMin': b = int(A[1]) while v and v[0]<b: heappop(v) ans.append('removeMin') if not v or (v and v[0]>b): heappush(v,b) ans.append('insert ' + str(b)) ans.append('getMin ' + str(b)) else: if not v: heappush(v,1) ans.append('insert 1') ans.append('removeMin') heappop(v) print(len(ans)) for a in ans: print(a)
Title: Heap Operations Time Limit: None seconds Memory Limit: None megabytes Problem Description: Petya has recently learned data structure named "Binary heap". The heap he is now operating with allows the following operations: - put the given number into the heap; - get the value of the minimum element in the heap; - extract the minimum element from the heap; Thus, at any moment of time the heap contains several integers (possibly none), some of them might be equal. In order to better learn this data structure Petya took an empty heap and applied some operations above to it. Also, he carefully wrote down all the operations and their results to his event log, following the format: - insert *x*Β β€” put the element with value *x* in the heap; - getMin *x*Β β€” the value of the minimum element contained in the heap was equal to *x*; - removeMinΒ β€” the minimum element was extracted from the heap (only one instance, if there were many). All the operations were correct, i.e. there was at least one element in the heap each time getMin or removeMin operations were applied. While Petya was away for a lunch, his little brother Vova came to the room, took away some of the pages from Petya's log and used them to make paper boats. Now Vova is worried, if he made Petya's sequence of operations inconsistent. For example, if one apply operations one-by-one in the order they are written in the event log, results of getMin operations might differ from the results recorded by Petya, and some of getMin or removeMin operations may be incorrect, as the heap is empty at the moment they are applied. Now Vova wants to add some new operation records to the event log in order to make the resulting sequence of operations correct. That is, the result of each getMin operation is equal to the result in the record, and the heap is non-empty when getMin ad removeMin are applied. Vova wants to complete this as fast as possible, as the Petya may get back at any moment. He asks you to add the least possible number of operation records to the current log. Note that arbitrary number of operations may be added at the beginning, between any two other operations, or at the end of the log. Input Specification: The first line of the input contains the only integer *n* (1<=≀<=*n*<=≀<=100<=000)Β β€” the number of the records left in Petya's journal. Each of the following *n* lines describe the records in the current log in the order they are applied. Format described in the statement is used. All numbers in the input are integers not exceeding 109 by their absolute value. Output Specification: The first line of the output should contain a single integer *m*Β β€” the minimum possible number of records in the modified sequence of operations. Next *m* lines should contain the corrected sequence of records following the format of the input (described in the statement), one per line and in the order they are applied. All the numbers in the output should be integers not exceeding 109 by their absolute value. Note that the input sequence of operations must be the subsequence of the output sequence. It's guaranteed that there exists the correct answer consisting of no more than 1<=000<=000 operations. Demo Input: ['2\ninsert 3\ngetMin 4\n', '4\ninsert 1\ninsert 1\nremoveMin\ngetMin 2\n'] Demo Output: ['4\ninsert 3\nremoveMin\ninsert 4\ngetMin 4\n', '6\ninsert 1\ninsert 1\nremoveMin\nremoveMin\ninsert 2\ngetMin 2\n'] Note: In the first sample, after number 3 is inserted into the heap, the minimum number is 3. To make the result of the first getMin equal to 4 one should firstly remove number 3 from the heap and then add number 4 into the heap. In the second sample case number 1 is inserted two times, so should be similarly removed twice.
```python import sys input = lambda: sys.stdin.readline().rstrip() from heapq import * ans = [] v = [] for _ in range(int(input())): A = input().split() a = A[0] if a=='insert': b = int(A[1]) ans.append(a+' ' +str(b)) heappush(v,b) elif a=='getMin': b = int(A[1]) while v and v[0]<b: heappop(v) ans.append('removeMin') if not v or (v and v[0]>b): heappush(v,b) ans.append('insert ' + str(b)) ans.append('getMin ' + str(b)) else: if not v: heappush(v,1) ans.append('insert 1') ans.append('removeMin') heappop(v) print(len(ans)) for a in ans: print(a) ```
3
818
A
Diplomas and Certificates
PROGRAMMING
800
[ "implementation", "math" ]
null
null
There are *n* students who have taken part in an olympiad. Now it's time to award the students. Some of them will receive diplomas, some wiil get certificates, and others won't receive anything. Students with diplomas and certificates are called winners. But there are some rules of counting the number of diplomas and certificates. The number of certificates must be exactly *k* times greater than the number of diplomas. The number of winners must not be greater than half of the number of all students (i.e. not be greater than half of *n*). It's possible that there are no winners. You have to identify the maximum possible number of winners, according to these rules. Also for this case you have to calculate the number of students with diplomas, the number of students with certificates and the number of students who are not winners.
The first (and the only) line of input contains two integers *n* and *k* (1<=≀<=*n*,<=*k*<=≀<=1012), where *n* is the number of students and *k* is the ratio between the number of certificates and the number of diplomas.
Output three numbers: the number of students with diplomas, the number of students with certificates and the number of students who are not winners in case when the number of winners is maximum possible. It's possible that there are no winners.
[ "18 2\n", "9 10\n", "1000000000000 5\n", "1000000000000 499999999999\n" ]
[ "3 6 9\n", "0 0 9\n", "83333333333 416666666665 500000000002\n", "1 499999999999 500000000000\n" ]
none
0
[ { "input": "18 2", "output": "3 6 9" }, { "input": "9 10", "output": "0 0 9" }, { "input": "1000000000000 5", "output": "83333333333 416666666665 500000000002" }, { "input": "1000000000000 499999999999", "output": "1 499999999999 500000000000" }, { "input": "1 1", "output": "0 0 1" }, { "input": "5 3", "output": "0 0 5" }, { "input": "42 6", "output": "3 18 21" }, { "input": "1000000000000 1000", "output": "499500499 499500499000 500000000501" }, { "input": "999999999999 999999", "output": "499999 499998500001 500000999999" }, { "input": "732577309725 132613", "output": "2762066 366285858458 366288689201" }, { "input": "152326362626 15", "output": "4760198832 71402982480 76163181314" }, { "input": "2 1", "output": "0 0 2" }, { "input": "1000000000000 500000000000", "output": "0 0 1000000000000" }, { "input": "100000000000 50000000011", "output": "0 0 100000000000" }, { "input": "1000000000000 32416187567", "output": "15 486242813505 513757186480" }, { "input": "1000000000000 7777777777", "output": "64 497777777728 502222222208" }, { "input": "1000000000000 77777777777", "output": "6 466666666662 533333333332" }, { "input": "100000000000 578485652", "output": "86 49749766072 50250233842" }, { "input": "999999999999 10000000000", "output": "49 490000000000 509999999950" }, { "input": "7 2", "output": "1 2 4" }, { "input": "420506530901 752346673804", "output": "0 0 420506530901" }, { "input": "960375521135 321688347872", "output": "1 321688347872 638687173262" }, { "input": "1000000000000 1000000000000", "output": "0 0 1000000000000" }, { "input": "99999999999 15253636363", "output": "3 45760909089 54239090907" }, { "input": "19 2", "output": "3 6 10" }, { "input": "999999999999 1000000000000", "output": "0 0 999999999999" }, { "input": "1000000000000 5915587276", "output": "84 496909331184 503090668732" }, { "input": "1000000000000 1000000006", "output": "499 499000002994 500999996507" }, { "input": "549755813888 134217728", "output": "2047 274743689216 275012122625" }, { "input": "99999999999 3333333", "output": "14999 49996661667 50003323333" }, { "input": "9 1", "output": "2 2 5" }, { "input": "1000000000000 250000000001", "output": "1 250000000001 749999999998" }, { "input": "5 1", "output": "1 1 3" }, { "input": "3107038133 596040207", "output": "2 1192080414 1914957717" }, { "input": "1000000000000 73786977", "output": "6776 499980556152 500019437072" }, { "input": "1000000000000 73786976", "output": "6776 499980549376 500019443848" }, { "input": "1000000000000 25000000000", "output": "19 475000000000 524999999981" }, { "input": "216929598879 768233755932", "output": "0 0 216929598879" }, { "input": "1000000000000 250000000000", "output": "1 250000000000 749999999999" }, { "input": "1000000000000 100000000001", "output": "4 400000000004 599999999992" }, { "input": "100000000000 100000000001", "output": "0 0 100000000000" }, { "input": "900000000000 100281800001", "output": "4 401127200004 498872799992" }, { "input": "906028900004 109123020071", "output": "4 436492080284 469536819716" }, { "input": "1000000000000 1", "output": "250000000000 250000000000 500000000000" } ]
1,516,853,535
675
Python 3
OK
TESTS
44
62
5,632,000
def f(m): global n,k if(2*(m*k+m)<=n): return True else: return False n, k = [int(x) for x in input().split()] l = -1 r = n while( l+1!= r): mid = (l+r) // 2 if(f(mid)): l =mid else: r = mid print(l,l*k,n-(l+l*k),sep = " ")
Title: Diplomas and Certificates Time Limit: None seconds Memory Limit: None megabytes Problem Description: There are *n* students who have taken part in an olympiad. Now it's time to award the students. Some of them will receive diplomas, some wiil get certificates, and others won't receive anything. Students with diplomas and certificates are called winners. But there are some rules of counting the number of diplomas and certificates. The number of certificates must be exactly *k* times greater than the number of diplomas. The number of winners must not be greater than half of the number of all students (i.e. not be greater than half of *n*). It's possible that there are no winners. You have to identify the maximum possible number of winners, according to these rules. Also for this case you have to calculate the number of students with diplomas, the number of students with certificates and the number of students who are not winners. Input Specification: The first (and the only) line of input contains two integers *n* and *k* (1<=≀<=*n*,<=*k*<=≀<=1012), where *n* is the number of students and *k* is the ratio between the number of certificates and the number of diplomas. Output Specification: Output three numbers: the number of students with diplomas, the number of students with certificates and the number of students who are not winners in case when the number of winners is maximum possible. It's possible that there are no winners. Demo Input: ['18 2\n', '9 10\n', '1000000000000 5\n', '1000000000000 499999999999\n'] Demo Output: ['3 6 9\n', '0 0 9\n', '83333333333 416666666665 500000000002\n', '1 499999999999 500000000000\n'] Note: none
```python def f(m): global n,k if(2*(m*k+m)<=n): return True else: return False n, k = [int(x) for x in input().split()] l = -1 r = n while( l+1!= r): mid = (l+r) // 2 if(f(mid)): l =mid else: r = mid print(l,l*k,n-(l+l*k),sep = " ") ```
3
991
B
Getting an A
PROGRAMMING
900
[ "greedy", "sortings" ]
null
null
Translator's note: in Russia's most widespread grading system, there are four grades: 5, 4, 3, 2, the higher the better, roughly corresponding to A, B, C and F respectively in American grading system. The term is coming to an end and students start thinking about their grades. Today, a professor told his students that the grades for his course would be given out automatically Β β€” he would calculate the simple average (arithmetic mean) of all grades given out for lab works this term and round to the nearest integer. The rounding would be done in favour of the studentΒ β€” $4.5$ would be rounded up to $5$ (as in example 3), but $4.4$ would be rounded down to $4$. This does not bode well for Vasya who didn't think those lab works would influence anything, so he may receive a grade worse than $5$ (maybe even the dreaded $2$). However, the professor allowed him to redo some of his works of Vasya's choosing to increase his average grade. Vasya wants to redo as as few lab works as possible in order to get $5$ for the course. Of course, Vasya will get $5$ for the lab works he chooses to redo. Help VasyaΒ β€” calculate the minimum amount of lab works Vasya has to redo.
The first line contains a single integer $n$Β β€” the number of Vasya's grades ($1 \leq n \leq 100$). The second line contains $n$ integers from $2$ to $5$Β β€” Vasya's grades for his lab works.
Output a single integerΒ β€” the minimum amount of lab works that Vasya has to redo. It can be shown that Vasya can always redo enough lab works to get a $5$.
[ "3\n4 4 4\n", "4\n5 4 5 5\n", "4\n5 3 3 5\n" ]
[ "2\n", "0\n", "1\n" ]
In the first sample, it is enough to redo two lab works to make two $4$s into $5$s. In the second sample, Vasya's average is already $4.75$ so he doesn't have to redo anything to get a $5$. In the second sample Vasya has to redo one lab work to get rid of one of the $3$s, that will make the average exactly $4.5$ so the final grade would be $5$.
1,000
[ { "input": "3\n4 4 4", "output": "2" }, { "input": "4\n5 4 5 5", "output": "0" }, { "input": "4\n5 3 3 5", "output": "1" }, { "input": "1\n5", "output": "0" }, { "input": "4\n3 2 5 4", "output": "2" }, { "input": "5\n5 4 3 2 5", "output": "2" }, { "input": "8\n5 4 2 5 5 2 5 5", "output": "1" }, { "input": "5\n5 5 2 5 5", "output": "1" }, { "input": "6\n5 5 5 5 5 2", "output": "0" }, { "input": "6\n2 2 2 2 2 2", "output": "5" }, { "input": "100\n3 2 4 3 3 3 4 2 3 5 5 2 5 2 3 2 4 4 4 5 5 4 2 5 4 3 2 5 3 4 3 4 2 4 5 4 2 4 3 4 5 2 5 3 3 4 2 2 4 4 4 5 4 3 3 3 2 5 2 2 2 3 5 4 3 2 4 5 5 5 2 2 4 2 3 3 3 5 3 2 2 4 5 5 4 5 5 4 2 3 2 2 2 2 5 3 5 2 3 4", "output": "40" }, { "input": "1\n2", "output": "1" }, { "input": "1\n3", "output": "1" }, { "input": "1\n4", "output": "1" }, { "input": "4\n3 2 5 5", "output": "1" }, { "input": "6\n4 3 3 3 3 4", "output": "4" }, { "input": "8\n3 3 5 3 3 3 5 5", "output": "3" }, { "input": "10\n2 4 5 5 5 5 2 3 3 2", "output": "3" }, { "input": "20\n5 2 5 2 2 2 2 2 5 2 2 5 2 5 5 2 2 5 2 2", "output": "10" }, { "input": "25\n4 4 4 4 3 4 3 3 3 3 3 4 4 3 4 4 4 4 4 3 3 3 4 3 4", "output": "13" }, { "input": "30\n4 2 4 2 4 2 2 4 4 4 4 2 4 4 4 2 2 2 2 4 2 4 4 4 2 4 2 4 2 2", "output": "15" }, { "input": "52\n5 3 4 4 4 3 5 3 4 5 3 4 4 3 5 5 4 3 3 3 4 5 4 4 5 3 5 3 5 4 5 5 4 3 4 5 3 4 3 3 4 4 4 3 5 3 4 5 3 5 4 5", "output": "14" }, { "input": "77\n5 3 2 3 2 3 2 3 5 2 2 3 3 3 3 5 3 3 2 2 2 5 5 5 5 3 2 2 5 2 3 2 2 5 2 5 3 3 2 2 5 5 2 3 3 2 3 3 3 2 5 5 2 2 3 3 5 5 2 2 5 5 3 3 5 5 2 2 5 2 2 5 5 5 2 5 2", "output": "33" }, { "input": "55\n3 4 2 3 3 2 4 4 3 3 4 2 4 4 3 3 2 3 2 2 3 3 2 3 2 3 2 4 4 3 2 3 2 3 3 2 2 4 2 4 4 3 4 3 2 4 3 2 4 2 2 3 2 3 4", "output": "34" }, { "input": "66\n5 4 5 5 4 4 4 4 4 2 5 5 2 4 2 2 2 5 4 4 4 4 5 2 2 5 5 2 2 4 4 2 4 2 2 5 2 5 4 5 4 5 4 4 2 5 2 4 4 4 2 2 5 5 5 5 4 4 4 4 4 2 4 5 5 5", "output": "16" }, { "input": "99\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2", "output": "83" }, { "input": "100\n2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2", "output": "84" }, { "input": "99\n3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3", "output": "75" }, { "input": "100\n3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3 3", "output": "75" }, { "input": "99\n2 2 3 3 3 3 3 2 2 3 2 3 2 3 2 2 3 2 3 2 3 3 3 3 2 2 2 2 3 2 3 3 3 3 3 2 3 3 3 3 2 3 2 3 3 3 2 3 2 3 3 3 3 2 2 3 2 3 2 3 2 3 2 2 2 3 3 2 3 2 2 2 2 2 2 2 2 3 3 3 3 2 3 2 3 3 2 3 2 3 2 3 3 2 2 2 3 2 3", "output": "75" }, { "input": "100\n3 2 3 3 2 2 3 2 2 3 3 2 3 2 2 2 2 2 3 2 2 2 3 2 3 3 2 2 3 2 2 2 2 3 2 3 3 2 2 3 2 2 3 2 3 2 2 3 2 3 2 2 3 2 2 3 3 3 3 3 2 2 3 2 3 3 2 2 3 2 2 2 3 2 2 3 3 2 2 3 3 3 3 2 3 2 2 2 3 3 2 2 3 2 2 2 2 3 2 2", "output": "75" }, { "input": "99\n4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4", "output": "50" }, { "input": "100\n4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4", "output": "50" }, { "input": "99\n2 2 2 2 4 2 2 2 2 4 4 4 4 2 4 4 2 2 4 4 2 2 2 4 4 2 4 4 2 4 4 2 2 2 4 4 2 2 2 2 4 4 4 2 2 2 4 4 2 4 2 4 2 2 4 2 4 4 4 4 4 2 2 4 4 4 2 2 2 2 4 2 4 2 2 2 2 2 2 4 4 2 4 2 2 4 2 2 2 2 2 4 2 4 2 2 4 4 4", "output": "54" }, { "input": "100\n4 2 4 4 2 4 2 2 4 4 4 4 4 4 4 4 4 2 4 4 2 2 4 4 2 2 4 4 2 2 2 4 4 2 4 4 2 4 2 2 4 4 2 4 2 4 4 4 2 2 2 2 2 2 2 4 2 2 2 4 4 4 2 2 2 2 4 2 2 2 2 2 2 2 4 4 4 4 4 4 4 4 4 2 2 2 2 2 2 2 2 4 4 4 4 2 4 2 2 4", "output": "50" }, { "input": "99\n4 3 4 4 4 4 4 3 4 3 3 4 3 3 4 4 3 3 3 4 3 4 3 3 4 3 3 3 3 4 3 4 4 3 4 4 3 3 4 4 4 3 3 3 4 4 3 3 4 3 4 3 4 3 4 3 3 3 3 4 3 4 4 4 4 4 4 3 4 4 3 3 3 3 3 3 3 3 4 3 3 3 4 4 4 4 4 4 3 3 3 3 4 4 4 3 3 4 3", "output": "51" }, { "input": "100\n3 3 4 4 4 4 4 3 4 4 3 3 3 3 4 4 4 4 4 4 3 3 3 4 3 4 3 4 3 3 4 3 3 3 3 3 3 3 3 4 3 4 3 3 4 3 3 3 4 4 3 4 4 3 3 4 4 4 4 4 4 3 4 4 3 4 3 3 3 4 4 3 3 4 4 3 4 4 4 3 3 4 3 3 4 3 4 3 4 3 3 4 4 4 3 3 4 3 3 4", "output": "51" }, { "input": "99\n3 3 4 4 4 2 4 4 3 2 3 4 4 4 2 2 2 3 2 4 4 2 4 3 2 2 2 4 2 3 4 3 4 2 3 3 4 2 3 3 2 3 4 4 3 2 4 3 4 3 3 3 3 3 4 4 3 3 4 4 2 4 3 4 3 2 3 3 3 4 4 2 4 4 2 3 4 2 3 3 3 4 2 2 3 2 4 3 2 3 3 2 3 4 2 3 3 2 3", "output": "58" }, { "input": "100\n2 2 4 2 2 3 2 3 4 4 3 3 4 4 4 2 3 2 2 3 4 2 3 2 4 3 4 2 3 3 3 2 4 3 3 2 2 3 2 4 4 2 4 3 4 4 3 3 3 2 4 2 2 2 2 2 2 3 2 3 2 3 4 4 4 2 2 3 4 4 3 4 3 3 2 3 3 3 4 3 2 3 3 2 4 2 3 3 4 4 3 3 4 3 4 3 3 4 3 3", "output": "61" }, { "input": "99\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5", "output": "0" }, { "input": "100\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5", "output": "0" }, { "input": "99\n2 2 2 2 2 5 2 2 5 2 5 2 5 2 2 2 2 2 5 2 2 2 5 2 2 5 2 2 2 5 5 2 5 2 2 5 2 5 2 2 5 5 2 2 2 2 5 5 2 2 2 5 2 2 5 2 2 2 2 2 5 5 5 5 2 2 5 2 5 2 2 2 2 2 5 2 2 5 5 2 2 2 2 2 5 5 2 2 5 5 2 2 2 2 5 5 5 2 5", "output": "48" }, { "input": "100\n5 5 2 2 2 2 2 2 5 5 2 5 2 2 2 2 5 2 5 2 5 5 2 5 5 2 2 2 2 2 2 5 2 2 2 5 2 2 5 2 2 5 5 5 2 5 5 5 5 5 5 2 2 5 2 2 5 5 5 5 5 2 5 2 5 2 2 2 5 2 5 2 5 5 2 5 5 2 2 5 2 5 5 2 5 2 2 5 2 2 2 5 2 2 2 2 5 5 2 5", "output": "38" }, { "input": "99\n5 3 3 3 5 3 3 3 3 3 3 3 3 5 3 3 3 3 3 3 3 3 5 3 3 3 5 5 3 5 5 3 3 5 5 5 3 5 3 3 3 3 5 3 3 5 5 3 5 5 5 3 5 3 5 3 5 5 5 5 3 3 3 5 3 5 3 3 3 5 5 5 5 5 3 5 5 3 3 5 5 3 5 5 3 5 5 3 3 5 5 5 3 3 3 5 3 3 3", "output": "32" }, { "input": "100\n3 3 3 5 3 3 3 3 3 3 5 5 5 5 3 3 3 3 5 3 3 3 3 3 5 3 5 3 3 5 5 5 5 5 5 3 3 5 3 3 5 3 5 5 5 3 5 3 3 3 3 3 3 3 3 3 3 3 5 5 3 5 3 5 5 3 5 3 3 5 3 5 5 5 5 3 5 3 3 3 5 5 5 3 3 3 5 3 5 5 5 3 3 3 5 3 5 5 3 5", "output": "32" }, { "input": "99\n5 3 5 5 3 3 3 2 2 5 2 5 3 2 5 2 5 2 3 5 3 2 3 2 5 5 2 2 3 3 5 5 3 5 5 2 3 3 5 2 2 5 3 2 5 2 3 5 5 2 5 2 2 5 3 3 5 3 3 5 3 2 3 5 3 2 3 2 3 2 2 2 2 5 2 2 3 2 5 5 5 3 3 2 5 3 5 5 5 2 3 2 5 5 2 5 2 5 3", "output": "39" }, { "input": "100\n3 5 3 3 5 5 3 3 2 5 5 3 3 3 2 2 3 2 5 3 2 2 3 3 3 3 2 5 3 2 3 3 5 2 2 2 3 2 3 5 5 3 2 5 2 2 5 5 3 5 5 5 2 2 5 5 3 3 2 2 2 5 3 3 2 2 3 5 3 2 3 5 5 3 2 3 5 5 3 3 2 3 5 2 5 5 5 5 5 5 3 5 3 2 3 3 2 5 2 2", "output": "42" }, { "input": "99\n4 4 4 5 4 4 5 5 4 4 5 5 5 4 5 4 5 5 5 4 4 5 5 5 5 4 5 5 5 4 4 5 5 4 5 4 4 4 5 5 5 5 4 4 5 4 4 5 4 4 4 4 5 5 5 4 5 4 5 5 5 5 5 4 5 4 5 4 4 4 4 5 5 5 4 5 5 4 4 5 5 5 4 5 4 4 5 5 4 5 5 5 5 4 5 5 4 4 4", "output": "0" }, { "input": "100\n4 4 5 5 5 5 5 5 4 4 5 5 4 4 5 5 4 5 4 4 4 4 4 4 4 4 5 5 5 5 5 4 4 4 4 4 5 4 4 5 4 4 4 5 5 5 4 5 5 5 5 5 5 4 4 4 4 4 4 5 5 4 5 4 4 5 4 4 4 4 5 5 4 5 5 4 4 4 5 5 5 5 4 5 5 5 4 4 5 5 5 4 5 4 5 4 4 5 5 4", "output": "1" }, { "input": "99\n2 2 2 5 2 2 2 2 2 4 4 5 5 2 2 4 2 5 2 2 2 5 2 2 5 5 5 4 5 5 4 4 2 2 5 2 2 2 2 5 5 2 2 4 4 4 2 2 2 5 2 4 4 2 4 2 4 2 5 4 2 2 5 2 4 4 4 2 5 2 2 5 4 2 2 5 5 5 2 4 5 4 5 5 4 4 4 5 4 5 4 5 4 2 5 2 2 2 4", "output": "37" }, { "input": "100\n4 4 5 2 2 5 4 5 2 2 2 4 2 5 4 4 2 2 4 5 2 4 2 5 5 4 2 4 4 2 2 5 4 2 5 4 5 2 5 2 4 2 5 4 5 2 2 2 5 2 5 2 5 2 2 4 4 5 5 5 5 5 5 5 4 2 2 2 4 2 2 4 5 5 4 5 4 2 2 2 2 4 2 2 5 5 4 2 2 5 4 5 5 5 4 5 5 5 2 2", "output": "31" }, { "input": "99\n5 3 4 4 5 4 4 4 3 5 4 3 3 4 3 5 5 5 5 4 3 3 5 3 4 5 3 5 4 4 3 5 5 4 4 4 4 3 5 3 3 5 5 5 5 5 4 3 4 4 3 5 5 3 3 4 4 4 5 4 4 5 4 4 4 4 5 5 4 3 3 4 3 5 3 3 3 3 4 4 4 4 3 4 5 4 4 5 5 5 3 4 5 3 4 5 4 3 3", "output": "24" }, { "input": "100\n5 4 4 4 5 5 5 4 5 4 4 3 3 4 4 4 5 4 5 5 3 5 5 4 5 5 5 4 4 5 3 5 3 5 3 3 5 4 4 5 5 4 5 5 3 4 5 4 4 3 4 4 3 3 5 4 5 4 5 3 4 5 3 4 5 4 3 5 4 5 4 4 4 3 4 5 3 4 3 5 3 4 4 4 3 4 4 5 3 3 4 4 5 5 4 3 4 4 3 5", "output": "19" }, { "input": "99\n2 2 5 2 5 3 4 2 3 5 4 3 4 2 5 3 2 2 4 2 4 4 5 4 4 5 2 5 5 3 2 3 2 2 3 4 5 3 5 2 5 4 4 5 4 2 2 3 2 3 3 3 4 4 3 2 2 4 4 2 5 3 5 3 5 4 4 4 5 4 5 2 2 5 4 4 4 3 3 2 5 2 5 2 3 2 5 2 2 5 5 3 4 5 3 4 4 4 4", "output": "37" }, { "input": "2\n5 2", "output": "1" }, { "input": "5\n2 2 2 2 2", "output": "5" }, { "input": "100\n2 3 2 2 2 3 2 3 3 3 3 3 2 3 3 2 2 3 3 2 3 2 3 2 3 4 4 4 3 3 3 3 3 4 4 3 3 4 3 2 3 4 3 3 3 3 2 3 4 3 4 3 3 2 4 4 2 4 4 3 3 3 3 4 3 2 3 4 3 4 4 4 4 4 3 2 2 3 4 2 4 4 4 2 2 4 2 2 3 2 2 4 4 3 4 2 3 3 2 2", "output": "61" }, { "input": "100\n5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 5 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4", "output": "1" }, { "input": "100\n5 4 3 5 3 5 4 2 3 3 4 5 4 5 5 4 2 4 2 2 5 2 5 3 4 4 4 5 5 5 3 4 4 4 3 5 3 2 5 4 3 3 3 5 2 3 4 2 5 4 3 4 5 2 2 3 4 4 2 3 3 3 2 5 2 3 4 3 3 3 2 5 4 3 4 5 4 2 5 4 5 2 2 4 2 2 5 5 4 5 2 2 2 2 5 2 4 4 4 5", "output": "35" }, { "input": "2\n2 2", "output": "2" }, { "input": "20\n4 4 4 4 4 4 4 4 4 4 4 5 5 5 5 5 5 5 5 5", "output": "1" } ]
1,698,243,881
2,147,483,647
Python 3
OK
TESTS
61
46
0
n = int(input()) a = list(map(int,input().split())) counter = 0 a.sort() while True: if (sum(a))/n >= 4.5: break else: a[0] = 5 a.sort() counter += 1 print(counter)
Title: Getting an A Time Limit: None seconds Memory Limit: None megabytes Problem Description: Translator's note: in Russia's most widespread grading system, there are four grades: 5, 4, 3, 2, the higher the better, roughly corresponding to A, B, C and F respectively in American grading system. The term is coming to an end and students start thinking about their grades. Today, a professor told his students that the grades for his course would be given out automatically Β β€” he would calculate the simple average (arithmetic mean) of all grades given out for lab works this term and round to the nearest integer. The rounding would be done in favour of the studentΒ β€” $4.5$ would be rounded up to $5$ (as in example 3), but $4.4$ would be rounded down to $4$. This does not bode well for Vasya who didn't think those lab works would influence anything, so he may receive a grade worse than $5$ (maybe even the dreaded $2$). However, the professor allowed him to redo some of his works of Vasya's choosing to increase his average grade. Vasya wants to redo as as few lab works as possible in order to get $5$ for the course. Of course, Vasya will get $5$ for the lab works he chooses to redo. Help VasyaΒ β€” calculate the minimum amount of lab works Vasya has to redo. Input Specification: The first line contains a single integer $n$Β β€” the number of Vasya's grades ($1 \leq n \leq 100$). The second line contains $n$ integers from $2$ to $5$Β β€” Vasya's grades for his lab works. Output Specification: Output a single integerΒ β€” the minimum amount of lab works that Vasya has to redo. It can be shown that Vasya can always redo enough lab works to get a $5$. Demo Input: ['3\n4 4 4\n', '4\n5 4 5 5\n', '4\n5 3 3 5\n'] Demo Output: ['2\n', '0\n', '1\n'] Note: In the first sample, it is enough to redo two lab works to make two $4$s into $5$s. In the second sample, Vasya's average is already $4.75$ so he doesn't have to redo anything to get a $5$. In the second sample Vasya has to redo one lab work to get rid of one of the $3$s, that will make the average exactly $4.5$ so the final grade would be $5$.
```python n = int(input()) a = list(map(int,input().split())) counter = 0 a.sort() while True: if (sum(a))/n >= 4.5: break else: a[0] = 5 a.sort() counter += 1 print(counter) ```
3
567
A
Lineland Mail
PROGRAMMING
900
[ "greedy", "implementation" ]
null
null
All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* β€” a coordinate on the *Ox* axis. No two cities are located at a single point. Lineland residents love to send letters to each other. A person may send a letter only if the recipient lives in another city (because if they live in the same city, then it is easier to drop in). Strange but true, the cost of sending the letter is exactly equal to the distance between the sender's city and the recipient's city. For each city calculate two values ​​*min**i* and *max**i*, where *min**i* is the minimum cost of sending a letter from the *i*-th city to some other city, and *max**i* is the the maximum cost of sending a letter from the *i*-th city to some other city
The first line of the input contains integer *n* (2<=≀<=*n*<=≀<=105) β€” the number of cities in Lineland. The second line contains the sequence of *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≀<=*x**i*<=≀<=109), where *x**i* is the *x*-coordinate of the *i*-th city. All the *x**i*'s are distinct and follow in ascending order.
Print *n* lines, the *i*-th line must contain two integers *min**i*,<=*max**i*, separated by a space, where *min**i* is the minimum cost of sending a letter from the *i*-th city, and *max**i* is the maximum cost of sending a letter from the *i*-th city.
[ "4\n-5 -2 2 7\n", "2\n-1 1\n" ]
[ "3 12\n3 9\n4 7\n5 12\n", "2 2\n2 2\n" ]
none
500
[ { "input": "4\n-5 -2 2 7", "output": "3 12\n3 9\n4 7\n5 12" }, { "input": "2\n-1 1", "output": "2 2\n2 2" }, { "input": "3\n-1 0 1", "output": "1 2\n1 1\n1 2" }, { "input": "4\n-1 0 1 3", "output": "1 4\n1 3\n1 2\n2 4" }, { "input": "3\n-1000000000 0 1000000000", "output": "1000000000 2000000000\n1000000000 1000000000\n1000000000 2000000000" }, { "input": "2\n-1000000000 1000000000", "output": "2000000000 2000000000\n2000000000 2000000000" }, { "input": "10\n1 10 12 15 59 68 130 912 1239 9123", "output": "9 9122\n2 9113\n2 9111\n3 9108\n9 9064\n9 9055\n62 8993\n327 8211\n327 7884\n7884 9122" }, { "input": "5\n-2 -1 0 1 2", "output": "1 4\n1 3\n1 2\n1 3\n1 4" }, { "input": "5\n-2 -1 0 1 3", "output": "1 5\n1 4\n1 3\n1 3\n2 5" }, { "input": "3\n-10000 1 10000", "output": "10001 20000\n9999 10001\n9999 20000" }, { "input": "5\n-1000000000 -999999999 -999999998 -999999997 -999999996", "output": "1 4\n1 3\n1 2\n1 3\n1 4" }, { "input": "10\n-857422304 -529223472 82412729 145077145 188538640 265299215 527377039 588634631 592896147 702473706", "output": "328198832 1559896010\n328198832 1231697178\n62664416 939835033\n43461495 1002499449\n43461495 1045960944\n76760575 1122721519\n61257592 1384799343\n4261516 1446056935\n4261516 1450318451\n109577559 1559896010" }, { "input": "10\n-876779400 -829849659 -781819137 -570920213 18428128 25280705 121178189 219147240 528386329 923854124", "output": "46929741 1800633524\n46929741 1753703783\n48030522 1705673261\n210898924 1494774337\n6852577 905425996\n6852577 902060105\n95897484 997957589\n97969051 1095926640\n309239089 1405165729\n395467795 1800633524" }, { "input": "30\n-15 1 21 25 30 40 59 60 77 81 97 100 103 123 139 141 157 158 173 183 200 215 226 231 244 256 267 279 289 292", "output": "16 307\n16 291\n4 271\n4 267\n5 262\n10 252\n1 233\n1 232\n4 215\n4 211\n3 195\n3 192\n3 189\n16 169\n2 154\n2 156\n1 172\n1 173\n10 188\n10 198\n15 215\n11 230\n5 241\n5 246\n12 259\n11 271\n11 282\n10 294\n3 304\n3 307" }, { "input": "10\n-1000000000 -999999999 -999999997 -999999996 -999999995 -999999994 -999999992 -999999990 -999999988 -999999986", "output": "1 14\n1 13\n1 11\n1 10\n1 9\n1 8\n2 8\n2 10\n2 12\n2 14" }, { "input": "50\n-50000 -49459 -48875 -48456 -48411 -48096 -47901 -47500 -47150 -46808 -46687 -46679 -46337 -45747 -45604 -45194 -44752 -44242 -44231 -44122 -43636 -43274 -42916 -42881 -42386 -42095 -41830 -41618 -41145 -40897 -40534 -40007 -39761 -39389 -39104 -38909 -38630 -38561 -38364 -38255 -38214 -38084 -37959 -37607 -37202 -36890 -36681 -36136 -36123 -35886", "output": "541 14114\n541 13573\n419 12989\n45 12570\n45 12525\n195 12210\n195 12015\n350 11614\n342 11264\n121 10922\n8 10801\n8 10793\n342 10451\n143 9861\n143 9718\n410 9308\n442 8866\n11 8356\n11 8345\n109 8236\n362 7750\n358 7388\n35 7084\n35 7119\n291 7614\n265 7905\n212 8170\n212 8382\n248 8855\n248 9103\n363 9466\n246 9993\n246 10239\n285 10611\n195 10896\n195 11091\n69 11370\n69 11439\n109 11636\n41 11745\n41 11786\n125 11916\n125 12041\n352 12393\n312 12798\n209 13110\n209 13319\n13 13864\n13 13877\n237 141..." }, { "input": "3\n-1000000000 999999999 1000000000", "output": "1999999999 2000000000\n1 1999999999\n1 2000000000" } ]
1,648,645,225
2,147,483,647
Python 3
OK
TESTS
54
451
8,294,400
n = int(input()) l = input().split() cities = [int(i) for i in l] left, right = cities[0], cities[-1] last = float('inf') m = max(cities[0] - left, right - cities[0]) for i in range(1, len(cities)): diff = cities[i] - cities[i-1] print(min(last, diff), end=" ") last = diff print(m) m = max(cities[i] - left, right - cities[i]) print(cities[-1] - cities[-2], end=" ") print(max(cities[-1] - left, right - cities[-1]))
Title: Lineland Mail Time Limit: None seconds Memory Limit: None megabytes Problem Description: All cities of Lineland are located on the *Ox* coordinate axis. Thus, each city is associated with its position *x**i* β€” a coordinate on the *Ox* axis. No two cities are located at a single point. Lineland residents love to send letters to each other. A person may send a letter only if the recipient lives in another city (because if they live in the same city, then it is easier to drop in). Strange but true, the cost of sending the letter is exactly equal to the distance between the sender's city and the recipient's city. For each city calculate two values ​​*min**i* and *max**i*, where *min**i* is the minimum cost of sending a letter from the *i*-th city to some other city, and *max**i* is the the maximum cost of sending a letter from the *i*-th city to some other city Input Specification: The first line of the input contains integer *n* (2<=≀<=*n*<=≀<=105) β€” the number of cities in Lineland. The second line contains the sequence of *n* distinct integers *x*1,<=*x*2,<=...,<=*x**n* (<=-<=109<=≀<=*x**i*<=≀<=109), where *x**i* is the *x*-coordinate of the *i*-th city. All the *x**i*'s are distinct and follow in ascending order. Output Specification: Print *n* lines, the *i*-th line must contain two integers *min**i*,<=*max**i*, separated by a space, where *min**i* is the minimum cost of sending a letter from the *i*-th city, and *max**i* is the maximum cost of sending a letter from the *i*-th city. Demo Input: ['4\n-5 -2 2 7\n', '2\n-1 1\n'] Demo Output: ['3 12\n3 9\n4 7\n5 12\n', '2 2\n2 2\n'] Note: none
```python n = int(input()) l = input().split() cities = [int(i) for i in l] left, right = cities[0], cities[-1] last = float('inf') m = max(cities[0] - left, right - cities[0]) for i in range(1, len(cities)): diff = cities[i] - cities[i-1] print(min(last, diff), end=" ") last = diff print(m) m = max(cities[i] - left, right - cities[i]) print(cities[-1] - cities[-2], end=" ") print(max(cities[-1] - left, right - cities[-1])) ```
3
202
A
LLPS
PROGRAMMING
800
[ "binary search", "bitmasks", "brute force", "greedy", "implementation", "strings" ]
null
null
This problem's actual name, "Lexicographically Largest Palindromic Subsequence" is too long to fit into the page headline. You are given string *s* consisting of lowercase English letters only. Find its lexicographically largest palindromic subsequence. We'll call a non-empty string *s*[*p*1*p*2... *p**k*] = *s**p*1*s**p*2... *s**p**k* (1 <=≀<= *p*1<=&lt;<=*p*2<=&lt;<=...<=&lt;<=*p**k* <=≀<= |*s*|) a subsequence of string *s* = *s*1*s*2... *s*|*s*|, where |*s*| is the length of string *s*. For example, strings "abcb", "b" and "abacaba" are subsequences of string "abacaba". String *x* = *x*1*x*2... *x*|*x*| is lexicographically larger than string *y* = *y*1*y*2... *y*|*y*| if either |*x*| &gt; |*y*| and *x*1<==<=*y*1, *x*2<==<=*y*2, ...,<=*x*|*y*|<==<=*y*|*y*|, or there exists such number *r* (*r*<=&lt;<=|*x*|, *r*<=&lt;<=|*y*|) that *x*1<==<=*y*1, *x*2<==<=*y*2, ..., *x**r*<==<=*y**r* and *x**r*<=<=+<=<=1<=&gt;<=*y**r*<=<=+<=<=1. Characters in the strings are compared according to their ASCII codes. For example, string "ranger" is lexicographically larger than string "racecar" and string "poster" is lexicographically larger than string "post". String *s* = *s*1*s*2... *s*|*s*| is a palindrome if it matches string *rev*(*s*) = *s*|*s*|*s*|*s*|<=-<=1... *s*1. In other words, a string is a palindrome if it reads the same way from left to right and from right to left. For example, palindromic strings are "racecar", "refer" and "z".
The only input line contains a non-empty string *s* consisting of lowercase English letters only. Its length does not exceed 10.
Print the lexicographically largest palindromic subsequence of string *s*.
[ "radar\n", "bowwowwow\n", "codeforces\n", "mississipp\n" ]
[ "rr\n", "wwwww\n", "s\n", "ssss\n" ]
Among all distinct subsequences of string "radar" the following ones are palindromes: "a", "d", "r", "aa", "rr", "ada", "rar", "rdr", "raar" and "radar". The lexicographically largest of them is "rr".
500
[ { "input": "radar", "output": "rr" }, { "input": "bowwowwow", "output": "wwwww" }, { "input": "codeforces", "output": "s" }, { "input": "mississipp", "output": "ssss" }, { "input": "tourist", "output": "u" }, { "input": "romka", "output": "r" }, { "input": "helloworld", "output": "w" }, { "input": "zzzzzzzazz", "output": "zzzzzzzzz" }, { "input": "testcase", "output": "tt" }, { "input": "hahahahaha", "output": "hhhhh" }, { "input": "abbbbbbbbb", "output": "bbbbbbbbb" }, { "input": "zaz", "output": "zz" }, { "input": "aza", "output": "z" }, { "input": "dcbaedcba", "output": "e" }, { "input": "abcdeabcd", "output": "e" }, { "input": "edcbabcde", "output": "ee" }, { "input": "aaaaaaaaab", "output": "b" }, { "input": "testzzzzzz", "output": "zzzzzz" }, { "input": "zzzzzzwait", "output": "zzzzzz" }, { "input": "rrrrrqponm", "output": "rrrrr" }, { "input": "zzyzyy", "output": "zzz" }, { "input": "aababb", "output": "bbb" }, { "input": "zanzibar", "output": "zz" }, { "input": "hhgfedcbaa", "output": "hh" }, { "input": "aabcdefghh", "output": "hh" }, { "input": "aruaru", "output": "uu" }, { "input": "uraura", "output": "uu" }, { "input": "aru", "output": "u" }, { "input": "aburvabur", "output": "v" }, { "input": "ura", "output": "u" }, { "input": "eurottat", "output": "u" }, { "input": "referee", "output": "rr" }, { "input": "joking", "output": "o" }, { "input": "seriously", "output": "y" }, { "input": "sets", "output": "t" }, { "input": "test", "output": "tt" }, { "input": "klmgameklm", "output": "mmm" }, { "input": "dfkjafdkdd", "output": "kk" }, { "input": "zzzzzzzzzz", "output": "zzzzzzzzzz" }, { "input": "aaaaaaaaaa", "output": "aaaaaaaaaa" }, { "input": "buzz", "output": "zz" }, { "input": "b", "output": "b" }, { "input": "y", "output": "y" }, { "input": "yy", "output": "yy" }, { "input": "zz", "output": "zz" }, { "input": "bb", "output": "bb" }, { "input": "aa", "output": "aa" }, { "input": "a", "output": "a" }, { "input": "z", "output": "z" }, { "input": "zz", "output": "zz" }, { "input": "zzazazzzaz", "output": "zzzzzzz" }, { "input": "hellhellhe", "output": "llll" }, { "input": "hellohello", "output": "oo" }, { "input": "refer", "output": "rr" } ]
1,566,852,362
2,147,483,647
Python 3
OK
TESTS
54
218
0
st = input() l = [ i for i in st] l.sort() n = len(st) stc = l[n-1] n1 = l.index(l[n-1]) n2 = n - n1 if n2 == 0: print(stc) else: print(stc * n2)
Title: LLPS Time Limit: None seconds Memory Limit: None megabytes Problem Description: This problem's actual name, "Lexicographically Largest Palindromic Subsequence" is too long to fit into the page headline. You are given string *s* consisting of lowercase English letters only. Find its lexicographically largest palindromic subsequence. We'll call a non-empty string *s*[*p*1*p*2... *p**k*] = *s**p*1*s**p*2... *s**p**k* (1 <=≀<= *p*1<=&lt;<=*p*2<=&lt;<=...<=&lt;<=*p**k* <=≀<= |*s*|) a subsequence of string *s* = *s*1*s*2... *s*|*s*|, where |*s*| is the length of string *s*. For example, strings "abcb", "b" and "abacaba" are subsequences of string "abacaba". String *x* = *x*1*x*2... *x*|*x*| is lexicographically larger than string *y* = *y*1*y*2... *y*|*y*| if either |*x*| &gt; |*y*| and *x*1<==<=*y*1, *x*2<==<=*y*2, ...,<=*x*|*y*|<==<=*y*|*y*|, or there exists such number *r* (*r*<=&lt;<=|*x*|, *r*<=&lt;<=|*y*|) that *x*1<==<=*y*1, *x*2<==<=*y*2, ..., *x**r*<==<=*y**r* and *x**r*<=<=+<=<=1<=&gt;<=*y**r*<=<=+<=<=1. Characters in the strings are compared according to their ASCII codes. For example, string "ranger" is lexicographically larger than string "racecar" and string "poster" is lexicographically larger than string "post". String *s* = *s*1*s*2... *s*|*s*| is a palindrome if it matches string *rev*(*s*) = *s*|*s*|*s*|*s*|<=-<=1... *s*1. In other words, a string is a palindrome if it reads the same way from left to right and from right to left. For example, palindromic strings are "racecar", "refer" and "z". Input Specification: The only input line contains a non-empty string *s* consisting of lowercase English letters only. Its length does not exceed 10. Output Specification: Print the lexicographically largest palindromic subsequence of string *s*. Demo Input: ['radar\n', 'bowwowwow\n', 'codeforces\n', 'mississipp\n'] Demo Output: ['rr\n', 'wwwww\n', 's\n', 'ssss\n'] Note: Among all distinct subsequences of string "radar" the following ones are palindromes: "a", "d", "r", "aa", "rr", "ada", "rar", "rdr", "raar" and "radar". The lexicographically largest of them is "rr".
```python st = input() l = [ i for i in st] l.sort() n = len(st) stc = l[n-1] n1 = l.index(l[n-1]) n2 = n - n1 if n2 == 0: print(stc) else: print(stc * n2) ```
3
474
A
Keyboard
PROGRAMMING
900
[ "implementation" ]
null
null
Our good friend Mole is trying to code a big message. He is typing on an unusual keyboard with characters arranged in following way: Unfortunately Mole is blind, so sometimes it is problem for him to put his hands accurately. He accidentally moved both his hands with one position to the left or to the right. That means that now he presses not a button he wants, but one neighboring button (left or right, as specified in input). We have a sequence of characters he has typed and we want to find the original message.
First line of the input contains one letter describing direction of shifting ('L' or 'R' respectively for left or right). Second line contains a sequence of characters written by Mole. The size of this sequence will be no more than 100. Sequence contains only symbols that appear on Mole's keyboard. It doesn't contain spaces as there is no space on Mole's keyboard. It is guaranteed that even though Mole hands are moved, he is still pressing buttons on keyboard and not hitting outside it.
Print a line that contains the original message.
[ "R\ns;;upimrrfod;pbr\n" ]
[ "allyouneedislove\n" ]
none
500
[ { "input": "R\ns;;upimrrfod;pbr", "output": "allyouneedislove" }, { "input": "R\nwertyuiop;lkjhgfdsxcvbnm,.", "output": "qwertyuiolkjhgfdsazxcvbnm," }, { "input": "L\nzxcvbnm,kjhgfdsaqwertyuio", "output": "xcvbnm,.lkjhgfdswertyuiop" }, { "input": "R\nbubbuduppudup", "output": "vyvvysyooysyo" }, { "input": "L\ngggggggggggggggggggggggggggggggggggggggggg", "output": "hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh" }, { "input": "R\ngggggggggggggggggggggggggggggggggggggggggg", "output": "ffffffffffffffffffffffffffffffffffffffffff" }, { "input": "L\nggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggg", "output": "hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh" }, { "input": "R\nggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggggg", "output": "fffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffffff" }, { "input": "L\nxgwurenkxkiau,c,vonei.zltazmnkhqtwuogkgvgckvja,z.rhanuy.ybebmzcfwozkwvuuiolaqlgvvvewnbuinrncgjwjdsfw", "output": "cheitrmlclosi.v.bpmro/x;ysx,mljwyeiphlhbhvlbks.x/tjsmiu/unrn,xvgepxlebiiop;sw;hbbbremniomtmvhkekfdge" }, { "input": "L\nuoz.vmks,wxrb,nwcvdzh.m,hwsios.lvu,ktes,,ythddhm.sh,d,c,cfj.wqam,bowofbyx,jathqayhreqvixvbmgdokofmym", "output": "ipx/b,ld.ectn.mevbfxj/,.jedopd/;bi.lyrd..uyjffj,/dj.f.v.vgk/ews,.npepgnuc.ksyjwsujtrwbocbn,hfplpg,u," }, { "input": "R\noedjyrvuw/rn.v.hdwndbiposiewgsn.pnyf;/tsdohp,hrtd/mx,;coj./billd..mwbneohcikrdes/ucjr,wspthleyp,..f,", "output": "iwshtecyq.eb,c,gsqbsvuoiauwqfab,obtdl.rasigomgers.nzmlxih,.vukks,,nqvbwigxujeswa.yxhemqaorgkwtom,,dm" }, { "input": "R\nvgj;o;ijrtfyck,dthccioltcx,crub;oceooognsuvfx/kgo.fbsudv,yod.erdrxhbeiyltxhnrobbb;ydrgroefcr/f;uvdjd", "output": "cfhliluherdtxjmsrgxxuikrxzmxeyvlixwiiifbaycdz.jfi,dvayscmtis,wesezgvwutkrzgbeivvvltsefeiwdxe.dlycshs" }, { "input": "L\nqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq", "output": "wwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww" }, { "input": "L\noooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo", "output": "pppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppppp" }, { "input": "L\n,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,", "output": "...................................................................................................." }, { "input": "L\nzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz", "output": "xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx" }, { "input": "R\noooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooooo", "output": "iiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiiii" }, { "input": "R\nwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwwww", "output": "qqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqqq" }, { "input": "R\nxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx", "output": "zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz" }, { "input": "L\nq", "output": "w" }, { "input": "L\no", "output": "p" }, { "input": "L\n,", "output": "." }, { "input": "L\nz", "output": "x" }, { "input": "R\n.", "output": "," }, { "input": "R\no", "output": "i" }, { "input": "R\nw", "output": "q" }, { "input": "R\nx", "output": "z" }, { "input": "R\n,./", "output": "m,." }, { "input": "R\nwertuk;;/", "output": "qweryjll." }, { "input": "L\n..", "output": "//" } ]
1,694,567,430
2,147,483,647
Python 3
OK
TESTS
31
46
0
ll='qwertyuiopasdfghjkl;zxcvbnm,./' #b='s;;upimrrfod;pbr' if input()=='R': b=input() c='' for x in b: if ll.find(x)==0: c+=ll[len(ll)-1] else: c+=ll[ll.find(x)%len(ll)-1] print(c) else: b=input() c='' for x in b: if ll.find(x)==29: c+=ll[0] else: c+=ll[ll.find(x)%len(ll)+1] print(c)
Title: Keyboard Time Limit: None seconds Memory Limit: None megabytes Problem Description: Our good friend Mole is trying to code a big message. He is typing on an unusual keyboard with characters arranged in following way: Unfortunately Mole is blind, so sometimes it is problem for him to put his hands accurately. He accidentally moved both his hands with one position to the left or to the right. That means that now he presses not a button he wants, but one neighboring button (left or right, as specified in input). We have a sequence of characters he has typed and we want to find the original message. Input Specification: First line of the input contains one letter describing direction of shifting ('L' or 'R' respectively for left or right). Second line contains a sequence of characters written by Mole. The size of this sequence will be no more than 100. Sequence contains only symbols that appear on Mole's keyboard. It doesn't contain spaces as there is no space on Mole's keyboard. It is guaranteed that even though Mole hands are moved, he is still pressing buttons on keyboard and not hitting outside it. Output Specification: Print a line that contains the original message. Demo Input: ['R\ns;;upimrrfod;pbr\n'] Demo Output: ['allyouneedislove\n'] Note: none
```python ll='qwertyuiopasdfghjkl;zxcvbnm,./' #b='s;;upimrrfod;pbr' if input()=='R': b=input() c='' for x in b: if ll.find(x)==0: c+=ll[len(ll)-1] else: c+=ll[ll.find(x)%len(ll)-1] print(c) else: b=input() c='' for x in b: if ll.find(x)==29: c+=ll[0] else: c+=ll[ll.find(x)%len(ll)+1] print(c) ```
3
224
A
Parallelepiped
PROGRAMMING
1,100
[ "brute force", "geometry", "math" ]
null
null
You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped.
The first and the single line contains three space-separated integers β€” the areas of the parallelepiped's faces. The area's values are positive (<=&gt;<=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement.
Print a single number β€” the sum of all edges of the parallelepiped.
[ "1 1 1\n", "4 6 6\n" ]
[ "12\n", "28\n" ]
In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second oneΒ β€” 2 × 2 × 3.
500
[ { "input": "1 1 1", "output": "12" }, { "input": "4 6 6", "output": "28" }, { "input": "20 10 50", "output": "68" }, { "input": "9 4 36", "output": "56" }, { "input": "324 9 36", "output": "184" }, { "input": "1333 93 129", "output": "308" }, { "input": "1022 584 112", "output": "380" }, { "input": "66 174 319", "output": "184" }, { "input": "912 276 1748", "output": "444" }, { "input": "65 156 60", "output": "120" }, { "input": "1 10000 10000", "output": "40008" }, { "input": "1485 55 27", "output": "332" }, { "input": "152 108 4104", "output": "528" }, { "input": "1656 6900 1350", "output": "740" }, { "input": "12 14 42", "output": "60" }, { "input": "615 18 1230", "output": "856" }, { "input": "680 60 408", "output": "336" }, { "input": "644 966 6", "output": "1308" }, { "input": "1 432 432", "output": "1736" }, { "input": "2239 2239 1", "output": "8964" }, { "input": "4106 8212 2", "output": "16436" }, { "input": "10000 10000 10000", "output": "1200" }, { "input": "3623 3623 1", "output": "14500" }, { "input": "9801 9801 9801", "output": "1188" }, { "input": "10000 1 10000", "output": "40008" }, { "input": "9 9 9", "output": "36" }, { "input": "9801 9702 9702", "output": "1184" } ]
1,569,553,229
2,147,483,647
Python 3
OK
TESTS
27
218
0
xz,xy,yz = map(int,input().split()) x = ((xz*xy)/yz)**0.5 print(int(4*(x+xy/x+xz/x)))
Title: Parallelepiped Time Limit: None seconds Memory Limit: None megabytes Problem Description: You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped. Input Specification: The first and the single line contains three space-separated integers β€” the areas of the parallelepiped's faces. The area's values are positive (<=&gt;<=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement. Output Specification: Print a single number β€” the sum of all edges of the parallelepiped. Demo Input: ['1 1 1\n', '4 6 6\n'] Demo Output: ['12\n', '28\n'] Note: In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second oneΒ β€” 2 × 2 × 3.
```python xz,xy,yz = map(int,input().split()) x = ((xz*xy)/yz)**0.5 print(int(4*(x+xy/x+xz/x))) ```
3
46
A
Ball Game
PROGRAMMING
800
[ "brute force", "implementation" ]
A. Ball Game
2
256
A kindergarten teacher Natalia Pavlovna has invented a new ball game. This game not only develops the children's physique, but also teaches them how to count. The game goes as follows. Kids stand in circle. Let's agree to think of the children as numbered with numbers from 1 to *n* clockwise and the child number 1 is holding the ball. First the first child throws the ball to the next one clockwise, i.e. to the child number 2. Then the child number 2 throws the ball to the next but one child, i.e. to the child number 4, then the fourth child throws the ball to the child that stands two children away from him, i.e. to the child number 7, then the ball is thrown to the child who stands 3 children away from the child number 7, then the ball is thrown to the child who stands 4 children away from the last one, and so on. It should be mentioned that when a ball is thrown it may pass the beginning of the circle. For example, if *n*<==<=5, then after the third throw the child number 2 has the ball again. Overall, *n*<=-<=1 throws are made, and the game ends. The problem is that not all the children get the ball during the game. If a child doesn't get the ball, he gets very upset and cries until Natalia Pavlovna gives him a candy. That's why Natalia Pavlovna asks you to help her to identify the numbers of the children who will get the ball after each throw.
The first line contains integer *n* (2<=≀<=*n*<=≀<=100) which indicates the number of kids in the circle.
In the single line print *n*<=-<=1 numbers which are the numbers of children who will get the ball after each throw. Separate the numbers by spaces.
[ "10\n", "3\n" ]
[ "2 4 7 1 6 2 9 7 6\n", "2 1\n" ]
none
0
[ { "input": "10", "output": "2 4 7 1 6 2 9 7 6" }, { "input": "3", "output": "2 1" }, { "input": "4", "output": "2 4 3" }, { "input": "5", "output": "2 4 2 1" }, { "input": "6", "output": "2 4 1 5 4" }, { "input": "7", "output": "2 4 7 4 2 1" }, { "input": "8", "output": "2 4 7 3 8 6 5" }, { "input": "9", "output": "2 4 7 2 7 4 2 1" }, { "input": "2", "output": "2" }, { "input": "11", "output": "2 4 7 11 5 11 7 4 2 1" }, { "input": "12", "output": "2 4 7 11 4 10 5 1 10 8 7" }, { "input": "13", "output": "2 4 7 11 3 9 3 11 7 4 2 1" }, { "input": "20", "output": "2 4 7 11 16 2 9 17 6 16 7 19 12 6 1 17 14 12 11" }, { "input": "25", "output": "2 4 7 11 16 22 4 12 21 6 17 4 17 6 21 12 4 22 16 11 7 4 2 1" }, { "input": "30", "output": "2 4 7 11 16 22 29 7 16 26 7 19 2 16 1 17 4 22 11 1 22 14 7 1 26 22 19 17 16" }, { "input": "35", "output": "2 4 7 11 16 22 29 2 11 21 32 9 22 1 16 32 14 32 16 1 22 9 32 21 11 2 29 22 16 11 7 4 2 1" }, { "input": "40", "output": "2 4 7 11 16 22 29 37 6 16 27 39 12 26 1 17 34 12 31 11 32 14 37 21 6 32 19 7 36 26 17 9 2 36 31 27 24 22 21" }, { "input": "45", "output": "2 4 7 11 16 22 29 37 1 11 22 34 2 16 31 2 19 37 11 31 7 29 7 31 11 37 19 2 31 16 2 34 22 11 1 37 29 22 16 11 7 4 2 1" }, { "input": "50", "output": "2 4 7 11 16 22 29 37 46 6 17 29 42 6 21 37 4 22 41 11 32 4 27 1 26 2 29 7 36 16 47 29 12 46 31 17 4 42 31 21 12 4 47 41 36 32 29 27 26" }, { "input": "55", "output": "2 4 7 11 16 22 29 37 46 1 12 24 37 51 11 27 44 7 26 46 12 34 2 26 51 22 49 22 51 26 2 34 12 46 26 7 44 27 11 51 37 24 12 1 46 37 29 22 16 11 7 4 2 1" }, { "input": "60", "output": "2 4 7 11 16 22 29 37 46 56 7 19 32 46 1 17 34 52 11 31 52 14 37 1 26 52 19 47 16 46 17 49 22 56 31 7 44 22 1 41 22 4 47 31 16 2 49 37 26 16 7 59 52 46 41 37 34 32 31" }, { "input": "65", "output": "2 4 7 11 16 22 29 37 46 56 2 14 27 41 56 7 24 42 61 16 37 59 17 41 1 27 54 17 46 11 42 9 42 11 46 17 54 27 1 41 17 59 37 16 61 42 24 7 56 41 27 14 2 56 46 37 29 22 16 11 7 4 2 1" }, { "input": "70", "output": "2 4 7 11 16 22 29 37 46 56 67 9 22 36 51 67 14 32 51 1 22 44 67 21 46 2 29 57 16 46 7 39 2 36 1 37 4 42 11 51 22 64 37 11 56 32 9 57 36 16 67 49 32 16 1 57 44 32 21 11 2 64 57 51 46 42 39 37 36" }, { "input": "75", "output": "2 4 7 11 16 22 29 37 46 56 67 4 17 31 46 62 4 22 41 61 7 29 52 1 26 52 4 32 61 16 47 4 37 71 31 67 29 67 31 71 37 4 47 16 61 32 4 52 26 1 52 29 7 61 41 22 4 62 46 31 17 4 67 56 46 37 29 22 16 11 7 4 2 1" }, { "input": "80", "output": "2 4 7 11 16 22 29 37 46 56 67 79 12 26 41 57 74 12 31 51 72 14 37 61 6 32 59 7 36 66 17 49 2 36 71 27 64 22 61 21 62 24 67 31 76 42 9 57 26 76 47 19 72 46 21 77 54 32 11 71 52 34 17 1 66 52 39 27 16 6 77 69 62 56 51 47 44 42 41" }, { "input": "85", "output": "2 4 7 11 16 22 29 37 46 56 67 79 7 21 36 52 69 2 21 41 62 84 22 46 71 12 39 67 11 41 72 19 52 1 36 72 24 62 16 56 12 54 12 56 16 62 24 72 36 1 52 19 72 41 11 67 39 12 71 46 22 84 62 41 21 2 69 52 36 21 7 79 67 56 46 37 29 22 16 11 7 4 2 1" }, { "input": "90", "output": "2 4 7 11 16 22 29 37 46 56 67 79 2 16 31 47 64 82 11 31 52 74 7 31 56 82 19 47 76 16 47 79 22 56 1 37 74 22 61 11 52 4 47 1 46 2 49 7 56 16 67 29 82 46 11 67 34 2 61 31 2 64 37 11 76 52 29 7 76 56 37 19 2 76 61 47 34 22 11 1 82 74 67 61 56 52 49 47 46" }, { "input": "95", "output": "2 4 7 11 16 22 29 37 46 56 67 79 92 11 26 42 59 77 1 21 42 64 87 16 41 67 94 27 56 86 22 54 87 26 61 2 39 77 21 61 7 49 92 41 86 37 84 37 86 41 92 49 7 61 21 77 39 2 61 26 87 54 22 86 56 27 94 67 41 16 87 64 42 21 1 77 59 42 26 11 92 79 67 56 46 37 29 22 16 11 7 4 2 1" }, { "input": "96", "output": "2 4 7 11 16 22 29 37 46 56 67 79 92 10 25 41 58 76 95 19 40 62 85 13 38 64 91 23 52 82 17 49 82 20 55 91 32 70 13 53 94 40 83 31 76 26 73 25 74 28 79 35 88 46 5 61 22 80 43 7 68 34 1 65 34 4 71 43 16 86 61 37 14 88 67 47 28 10 89 73 58 44 31 19 8 94 85 77 70 64 59 55 52 50 49" }, { "input": "97", "output": "2 4 7 11 16 22 29 37 46 56 67 79 92 9 24 40 57 75 94 17 38 60 83 10 35 61 88 19 48 78 12 44 77 14 49 85 25 63 5 45 86 31 74 21 66 15 62 13 62 15 66 21 74 31 86 45 5 63 25 85 49 14 77 44 12 78 48 19 88 61 35 10 83 60 38 17 94 75 57 40 24 9 92 79 67 56 46 37 29 22 16 11 7 4 2 1" }, { "input": "98", "output": "2 4 7 11 16 22 29 37 46 56 67 79 92 8 23 39 56 74 93 15 36 58 81 7 32 58 85 15 44 74 7 39 72 8 43 79 18 56 95 37 78 22 65 11 56 4 51 1 50 2 53 7 60 16 71 29 86 46 7 67 30 92 57 23 88 56 25 93 64 36 9 81 56 32 9 85 64 44 25 7 88 72 57 43 30 18 7 95 86 78 71 65 60 56 53 51 50" }, { "input": "99", "output": "2 4 7 11 16 22 29 37 46 56 67 79 92 7 22 38 55 73 92 13 34 56 79 4 29 55 82 11 40 70 2 34 67 2 37 73 11 49 88 29 70 13 56 1 46 92 40 88 38 88 40 92 46 1 56 13 70 29 88 49 11 73 37 2 67 34 2 70 40 11 82 55 29 4 79 56 34 13 92 73 55 38 22 7 92 79 67 56 46 37 29 22 16 11 7 4 2 1" }, { "input": "100", "output": "2 4 7 11 16 22 29 37 46 56 67 79 92 6 21 37 54 72 91 11 32 54 77 1 26 52 79 7 36 66 97 29 62 96 31 67 4 42 81 21 62 4 47 91 36 82 29 77 26 76 27 79 32 86 41 97 54 12 71 31 92 54 17 81 46 12 79 47 16 86 57 29 2 76 51 27 4 82 61 41 22 4 87 71 56 42 29 17 6 96 87 79 72 66 61 57 54 52 51" } ]
1,619,602,069
2,147,483,647
Python 3
OK
TESTS
33
124
0
''' n = int(input()) holder, cycle, br, m = n, 2, 1, 2 if n > 2: while n - 2: if br == 1: print(m, end=" ") m += cycle if m > holder: m -= holder print(m, end=" ") n -= 1 br += 1 cycle += 1 elif n == 2: print(2) ''' n, ball, skip = int(input()), 1, 1 for i in range(n - 1): ball = (ball + skip) % n if ball == 0: ball = n print(ball, end=' ') skip += 1 ''' 10 1 2 3 4 5 6 7 8 9 10 '''
Title: Ball Game Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: A kindergarten teacher Natalia Pavlovna has invented a new ball game. This game not only develops the children's physique, but also teaches them how to count. The game goes as follows. Kids stand in circle. Let's agree to think of the children as numbered with numbers from 1 to *n* clockwise and the child number 1 is holding the ball. First the first child throws the ball to the next one clockwise, i.e. to the child number 2. Then the child number 2 throws the ball to the next but one child, i.e. to the child number 4, then the fourth child throws the ball to the child that stands two children away from him, i.e. to the child number 7, then the ball is thrown to the child who stands 3 children away from the child number 7, then the ball is thrown to the child who stands 4 children away from the last one, and so on. It should be mentioned that when a ball is thrown it may pass the beginning of the circle. For example, if *n*<==<=5, then after the third throw the child number 2 has the ball again. Overall, *n*<=-<=1 throws are made, and the game ends. The problem is that not all the children get the ball during the game. If a child doesn't get the ball, he gets very upset and cries until Natalia Pavlovna gives him a candy. That's why Natalia Pavlovna asks you to help her to identify the numbers of the children who will get the ball after each throw. Input Specification: The first line contains integer *n* (2<=≀<=*n*<=≀<=100) which indicates the number of kids in the circle. Output Specification: In the single line print *n*<=-<=1 numbers which are the numbers of children who will get the ball after each throw. Separate the numbers by spaces. Demo Input: ['10\n', '3\n'] Demo Output: ['2 4 7 1 6 2 9 7 6\n', '2 1\n'] Note: none
```python ''' n = int(input()) holder, cycle, br, m = n, 2, 1, 2 if n > 2: while n - 2: if br == 1: print(m, end=" ") m += cycle if m > holder: m -= holder print(m, end=" ") n -= 1 br += 1 cycle += 1 elif n == 2: print(2) ''' n, ball, skip = int(input()), 1, 1 for i in range(n - 1): ball = (ball + skip) % n if ball == 0: ball = n print(ball, end=' ') skip += 1 ''' 10 1 2 3 4 5 6 7 8 9 10 ''' ```
3.969
714
B
Filya and Homework
PROGRAMMING
1,200
[ "implementation", "sortings" ]
null
null
Today, hedgehog Filya went to school for the very first time! Teacher gave him a homework which Filya was unable to complete without your help. Filya is given an array of non-negative integers *a*1,<=*a*2,<=...,<=*a**n*. First, he pick an integer *x* and then he adds *x* to some elements of the array (no more than once), subtract *x* from some other elements (also, no more than once) and do no change other elements. He wants all elements of the array to be equal. Now he wonders if it's possible to pick such integer *x* and change some elements of the array using this *x* in order to make all elements equal.
The first line of the input contains an integer *n* (1<=≀<=*n*<=≀<=100<=000)Β β€” the number of integers in the Filya's array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≀<=*a**i*<=≀<=109)Β β€” elements of the array.
If it's impossible to make all elements of the array equal using the process given in the problem statement, then print "NO" (without quotes) in the only line of the output. Otherwise print "YES" (without quotes).
[ "5\n1 3 3 2 1\n", "5\n1 2 3 4 5\n" ]
[ "YES\n", "NO\n" ]
In the first sample Filya should select *x* = 1, then add it to the first and the last elements of the array and subtract from the second and the third elements.
1,000
[ { "input": "5\n1 3 3 2 1", "output": "YES" }, { "input": "5\n1 2 3 4 5", "output": "NO" }, { "input": "2\n1 2", "output": "YES" }, { "input": "3\n1 2 3", "output": "YES" }, { "input": "3\n1 1 1", "output": "YES" }, { "input": "2\n1 1000000000", "output": "YES" }, { "input": "4\n1 2 3 4", "output": "NO" }, { "input": "10\n1 1 1 1 1 2 2 2 2 2", "output": "YES" }, { "input": "2\n4 2", "output": "YES" }, { "input": "4\n1 1 4 7", "output": "YES" }, { "input": "3\n99999999 1 50000000", "output": "YES" }, { "input": "1\n0", "output": "YES" }, { "input": "5\n0 0 0 0 0", "output": "YES" }, { "input": "4\n4 2 2 1", "output": "NO" }, { "input": "3\n1 4 2", "output": "NO" }, { "input": "3\n1 4 100", "output": "NO" }, { "input": "3\n2 5 11", "output": "NO" }, { "input": "3\n1 4 6", "output": "NO" }, { "input": "3\n1 2 4", "output": "NO" }, { "input": "3\n1 2 7", "output": "NO" }, { "input": "5\n1 1 1 4 5", "output": "NO" }, { "input": "2\n100000001 100000003", "output": "YES" }, { "input": "3\n7 4 5", "output": "NO" }, { "input": "3\n2 3 5", "output": "NO" }, { "input": "3\n1 2 5", "output": "NO" }, { "input": "2\n2 3", "output": "YES" }, { "input": "3\n2 100 29", "output": "NO" }, { "input": "3\n0 1 5", "output": "NO" }, { "input": "3\n1 3 6", "output": "NO" }, { "input": "3\n2 1 3", "output": "YES" }, { "input": "3\n1 5 100", "output": "NO" }, { "input": "3\n1 4 8", "output": "NO" }, { "input": "3\n1 7 10", "output": "NO" }, { "input": "3\n5 4 1", "output": "NO" }, { "input": "3\n1 6 10", "output": "NO" }, { "input": "4\n1 3 4 5", "output": "NO" }, { "input": "3\n1 5 4", "output": "NO" }, { "input": "5\n1 2 3 3 5", "output": "NO" }, { "input": "3\n2 3 1", "output": "YES" }, { "input": "3\n2 3 8", "output": "NO" }, { "input": "3\n0 3 5", "output": "NO" }, { "input": "3\n1 5 10", "output": "NO" }, { "input": "3\n1 7 2", "output": "NO" }, { "input": "3\n1 3 9", "output": "NO" }, { "input": "3\n1 1 2", "output": "YES" }, { "input": "7\n1 1 1 1 1 2 4", "output": "NO" }, { "input": "5\n1 4 4 4 6", "output": "NO" }, { "input": "5\n1 2 2 4 4", "output": "NO" }, { "input": "3\n1 9 10", "output": "NO" }, { "input": "8\n1 1 1 1 1 1 2 3", "output": "YES" }, { "input": "3\n1 2 100", "output": "NO" }, { "input": "3\n1 3 4", "output": "NO" }, { "input": "3\n1 15 14", "output": "NO" }, { "input": "3\n1 3 8", "output": "NO" }, { "input": "3\n1 2 10", "output": "NO" }, { "input": "4\n2 2 4 5", "output": "NO" }, { "input": "3\n1 3 5", "output": "YES" }, { "input": "5\n3 6 7 8 9", "output": "NO" }, { "input": "3\n7 6 8", "output": "YES" }, { "input": "3\n3 2 1", "output": "YES" }, { "input": "5\n1 2 2 2 3", "output": "YES" }, { "input": "3\n4 6 7", "output": "NO" }, { "input": "3\n2 0 4", "output": "YES" }, { "input": "4\n10 20 21 30", "output": "NO" }, { "input": "4\n0 2 3 4", "output": "NO" }, { "input": "3\n3 6 12", "output": "NO" }, { "input": "5\n0 0 1 3 5", "output": "NO" }, { "input": "3\n3 5 8", "output": "NO" }, { "input": "3\n1 4 4", "output": "YES" }, { "input": "4\n2 4 5 6", "output": "NO" } ]
1,592,774,682
2,147,483,647
Python 3
OK
TESTS
79
202
9,523,200
n = int(input()) lista = list(map(int,input().split())) lista.sort() countDiff = 1 diff = [] for i in range(n-1): if(lista[i] != lista[i + 1]): countDiff +=1 value = lista[i + 1] - lista[i] diff.append(value) if(countDiff < 3): print("YES") elif(countDiff > 3): print("NO") else: if(diff[0] == diff[1]): print("YES") else: print("NO")
Title: Filya and Homework Time Limit: None seconds Memory Limit: None megabytes Problem Description: Today, hedgehog Filya went to school for the very first time! Teacher gave him a homework which Filya was unable to complete without your help. Filya is given an array of non-negative integers *a*1,<=*a*2,<=...,<=*a**n*. First, he pick an integer *x* and then he adds *x* to some elements of the array (no more than once), subtract *x* from some other elements (also, no more than once) and do no change other elements. He wants all elements of the array to be equal. Now he wonders if it's possible to pick such integer *x* and change some elements of the array using this *x* in order to make all elements equal. Input Specification: The first line of the input contains an integer *n* (1<=≀<=*n*<=≀<=100<=000)Β β€” the number of integers in the Filya's array. The second line contains *n* integers *a*1,<=*a*2,<=...,<=*a**n* (0<=≀<=*a**i*<=≀<=109)Β β€” elements of the array. Output Specification: If it's impossible to make all elements of the array equal using the process given in the problem statement, then print "NO" (without quotes) in the only line of the output. Otherwise print "YES" (without quotes). Demo Input: ['5\n1 3 3 2 1\n', '5\n1 2 3 4 5\n'] Demo Output: ['YES\n', 'NO\n'] Note: In the first sample Filya should select *x* = 1, then add it to the first and the last elements of the array and subtract from the second and the third elements.
```python n = int(input()) lista = list(map(int,input().split())) lista.sort() countDiff = 1 diff = [] for i in range(n-1): if(lista[i] != lista[i + 1]): countDiff +=1 value = lista[i + 1] - lista[i] diff.append(value) if(countDiff < 3): print("YES") elif(countDiff > 3): print("NO") else: if(diff[0] == diff[1]): print("YES") else: print("NO") ```
3
519
B
A and B and Compilation Errors
PROGRAMMING
1,100
[ "data structures", "implementation", "sortings" ]
null
null
A and B are preparing themselves for programming contests. B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code. Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake. However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared β€” the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change. Can you help B find out exactly what two errors he corrected?
The first line of the input contains integer *n* (3<=≀<=*n*<=≀<=105) β€” the initial number of compilation errors. The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≀<=*a**i*<=≀<=109) β€” the errors the compiler displayed for the first time. The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 β€” the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one. The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 β€” the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one.
Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively.
[ "5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n", "6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n" ]
[ "8\n123\n", "1\n3\n" ]
In the first test sample B first corrects the error number 8, then the error number 123. In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step.
1,000
[ { "input": "5\n1 5 8 123 7\n123 7 5 1\n5 1 7", "output": "8\n123" }, { "input": "6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5", "output": "1\n3" }, { "input": "3\n1 2 3\n3 2\n2", "output": "1\n3" }, { "input": "10\n460626451 802090732 277246428 661369649 388684428 784303821 376287098 656422756 9301599 25720377\n277246428 388684428 661369649 460626451 656422756 802090732 9301599 784303821 376287098\n376287098 802090732 388684428 9301599 656422756 784303821 460626451 277246428", "output": "25720377\n661369649" }, { "input": "3\n796067435 964699482 819602309\n964699482 796067435\n964699482", "output": "819602309\n796067435" }, { "input": "3\n374054998 726316780 902899520\n902899520 726316780\n726316780", "output": "374054998\n902899520" }, { "input": "3\n168638990 939116221 323703261\n168638990 323703261\n168638990", "output": "939116221\n323703261" }, { "input": "3\n77 77 77\n77 77\n77", "output": "77\n77" }, { "input": "3\n84 30 9\n9 84\n9", "output": "30\n84" }, { "input": "6\n5 4 3 3 5 5\n3 5 5 4 3\n3 5 4 3", "output": "5\n5" }, { "input": "4\n1 5 7 8\n1 5 7\n1 5", "output": "8\n7" } ]
1,630,412,810
2,147,483,647
PyPy 3
OK
TESTS
33
374
33,792,000
n = int(input()) ans = [] base = sum(list(map(int, input().split()))) for _ in range(2): new = sum(list(map(int, input().split()))) ans.append(base - new) base = new for answer in ans: print(answer)
Title: A and B and Compilation Errors Time Limit: None seconds Memory Limit: None megabytes Problem Description: A and B are preparing themselves for programming contests. B loves to debug his code. But before he runs the solution and starts debugging, he has to first compile the code. Initially, the compiler displayed *n* compilation errors, each of them is represented as a positive integer. After some effort, B managed to fix some mistake and then another one mistake. However, despite the fact that B is sure that he corrected the two errors, he can not understand exactly what compilation errors disappeared β€” the compiler of the language which B uses shows errors in the new order every time! B is sure that unlike many other programming languages, compilation errors for his programming language do not depend on each other, that is, if you correct one error, the set of other error does not change. Can you help B find out exactly what two errors he corrected? Input Specification: The first line of the input contains integer *n* (3<=≀<=*n*<=≀<=105) β€” the initial number of compilation errors. The second line contains *n* space-separated integers *a*1,<=*a*2,<=...,<=*a**n* (1<=≀<=*a**i*<=≀<=109) β€” the errors the compiler displayed for the first time. The third line contains *n*<=-<=1 space-separated integers *b*1,<=*b*2,<=...,<=*b**n*<=-<=1 β€” the errors displayed at the second compilation. It is guaranteed that the sequence in the third line contains all numbers of the second string except for exactly one. The fourth line contains *n*<=-<=2 space-separated integers *с*1,<=*с*2,<=...,<=*с**n*<=-<=2 β€” the errors displayed at the third compilation. It is guaranteed that the sequence in the fourth line contains all numbers of the third line except for exactly one. Output Specification: Print two numbers on a single line: the numbers of the compilation errors that disappeared after B made the first and the second correction, respectively. Demo Input: ['5\n1 5 8 123 7\n123 7 5 1\n5 1 7\n', '6\n1 4 3 3 5 7\n3 7 5 4 3\n4 3 7 5\n'] Demo Output: ['8\n123\n', '1\n3\n'] Note: In the first test sample B first corrects the error number 8, then the error number 123. In the second test sample B first corrects the error number 1, then the error number 3. Note that if there are multiple errors with the same number, B can correct only one of them in one step.
```python n = int(input()) ans = [] base = sum(list(map(int, input().split()))) for _ in range(2): new = sum(list(map(int, input().split()))) ans.append(base - new) base = new for answer in ans: print(answer) ```
3
47
B
Coins
PROGRAMMING
1,200
[ "implementation" ]
B. Coins
2
256
One day Vasya came across three Berland coins. They didn't have any numbers that's why Vasya didn't understand how their denominations differ. He supposed that if one coin is heavier than the other one, then it should be worth more. Vasya weighed all the three pairs of coins on pan balance scales and told you the results. Find out how the deminations of the coins differ or if Vasya has a mistake in the weighting results. No two coins are equal.
The input data contains the results of all the weighting, one result on each line. It is guaranteed that every coin pair was weighted exactly once. Vasya labelled the coins with letters Β«AΒ», Β«BΒ» and Β«CΒ». Each result is a line that appears as (letter)(&gt; or &lt; sign)(letter). For example, if coin "A" proved lighter than coin "B", the result of the weighting is A&lt;B.
It the results are contradictory, print Impossible. Otherwise, print without spaces the rearrangement of letters Β«AΒ», Β«BΒ» and Β«CΒ» which represent the coins in the increasing order of their weights.
[ "A&gt;B\nC&lt;B\nA&gt;C\n", "A&lt;B\nB&gt;C\nC&gt;A\n" ]
[ "CBA", "ACB" ]
none
1,000
[ { "input": "A>B\nC<B\nA>C", "output": "CBA" }, { "input": "A<B\nB>C\nC>A", "output": "ACB" }, { "input": "A<C\nB<A\nB>C", "output": "Impossible" }, { "input": "A<B\nA<C\nB>C", "output": "ACB" }, { "input": "B>A\nC<B\nC>A", "output": "ACB" }, { "input": "A>B\nB>C\nC<A", "output": "CBA" }, { "input": "A>C\nA>B\nB<C", "output": "BCA" }, { "input": "C<B\nB>A\nA<C", "output": "ACB" }, { "input": "C<B\nA>B\nC<A", "output": "CBA" }, { "input": "C>B\nB>A\nA<C", "output": "ABC" }, { "input": "C<B\nB<A\nC>A", "output": "Impossible" }, { "input": "B<C\nC<A\nA>B", "output": "BCA" }, { "input": "A>B\nC<B\nC<A", "output": "CBA" }, { "input": "B>A\nC>B\nA>C", "output": "Impossible" }, { "input": "B<A\nC>B\nC>A", "output": "BAC" }, { "input": "A<B\nC>B\nA<C", "output": "ABC" }, { "input": "A<B\nC<A\nB<C", "output": "Impossible" }, { "input": "A>C\nC<B\nB>A", "output": "CAB" }, { "input": "C>A\nA<B\nB>C", "output": "ACB" }, { "input": "C>A\nC<B\nB>A", "output": "ACB" }, { "input": "B>C\nB>A\nA<C", "output": "ACB" }, { "input": "C<B\nC<A\nB<A", "output": "CBA" }, { "input": "A<C\nA<B\nB>C", "output": "ACB" }, { "input": "B>A\nA>C\nB>C", "output": "CAB" }, { "input": "B<A\nA<C\nC<B", "output": "Impossible" }, { "input": "A<C\nB>C\nA>B", "output": "Impossible" }, { "input": "B>A\nC<A\nC>B", "output": "Impossible" }, { "input": "A>C\nC>B\nB<A", "output": "BCA" }, { "input": "B<C\nB<A\nA>C", "output": "BCA" }, { "input": "A>B\nC>B\nA<C", "output": "BAC" }, { "input": "C<B\nC<A\nB<A", "output": "CBA" }, { "input": "A<C\nA>B\nB>C", "output": "Impossible" }, { "input": "B>A\nB>C\nA<C", "output": "ACB" }, { "input": "B>C\nC<A\nB<A", "output": "CBA" }, { "input": "C>A\nB>A\nB>C", "output": "ACB" }, { "input": "B<A\nB>C\nA<C", "output": "Impossible" }, { "input": "B<C\nA<B\nC>A", "output": "ABC" }, { "input": "C<B\nB>A\nA>C", "output": "CAB" }, { "input": "A>B\nC>A\nB<C", "output": "BAC" }, { "input": "A>B\nB>C\nC<A", "output": "CBA" }, { "input": "B>C\nC>A\nA>B", "output": "Impossible" }, { "input": "B<A\nB>C\nC<A", "output": "CBA" }, { "input": "C>B\nB>A\nC>A", "output": "ABC" }, { "input": "A>C\nA>B\nB>C", "output": "CBA" }, { "input": "B<C\nA>B\nA<C", "output": "BAC" }, { "input": "C>A\nC<B\nB>A", "output": "ACB" }, { "input": "C>B\nA<B\nC<A", "output": "Impossible" }, { "input": "A<C\nC<B\nA>B", "output": "Impossible" }, { "input": "B>C\nA<B\nA<C", "output": "ACB" }, { "input": "C>A\nA<B\nC>B", "output": "ABC" } ]
1,680,999,825
2,147,483,647
Python 3
OK
TESTS
50
92
0
a={'A':1,'B':1,'C':1} b=[] for i in range(3): x=input() b.append(x) if x[1]=='>': a[x[0]]+=1 else : a[x[2]]+=1 if b[1]==b[0] or b[1]==b[2] or b[0]==b[2]: print('Impossible') else : c=[a['A'],a['B'],a['C']] if c.count(2)>1: print('Impossible') else : for i in a.keys(): if a[i]==1: print(i,end='') for i in a.keys(): if a[i]==2: print(i,end='') for i in a.keys(): if a[i]==3: print(i)
Title: Coins Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: One day Vasya came across three Berland coins. They didn't have any numbers that's why Vasya didn't understand how their denominations differ. He supposed that if one coin is heavier than the other one, then it should be worth more. Vasya weighed all the three pairs of coins on pan balance scales and told you the results. Find out how the deminations of the coins differ or if Vasya has a mistake in the weighting results. No two coins are equal. Input Specification: The input data contains the results of all the weighting, one result on each line. It is guaranteed that every coin pair was weighted exactly once. Vasya labelled the coins with letters Β«AΒ», Β«BΒ» and Β«CΒ». Each result is a line that appears as (letter)(&gt; or &lt; sign)(letter). For example, if coin "A" proved lighter than coin "B", the result of the weighting is A&lt;B. Output Specification: It the results are contradictory, print Impossible. Otherwise, print without spaces the rearrangement of letters Β«AΒ», Β«BΒ» and Β«CΒ» which represent the coins in the increasing order of their weights. Demo Input: ['A&gt;B\nC&lt;B\nA&gt;C\n', 'A&lt;B\nB&gt;C\nC&gt;A\n'] Demo Output: ['CBA', 'ACB'] Note: none
```python a={'A':1,'B':1,'C':1} b=[] for i in range(3): x=input() b.append(x) if x[1]=='>': a[x[0]]+=1 else : a[x[2]]+=1 if b[1]==b[0] or b[1]==b[2] or b[0]==b[2]: print('Impossible') else : c=[a['A'],a['B'],a['C']] if c.count(2)>1: print('Impossible') else : for i in a.keys(): if a[i]==1: print(i,end='') for i in a.keys(): if a[i]==2: print(i,end='') for i in a.keys(): if a[i]==3: print(i) ```
3.977
427
A
Police Recruits
PROGRAMMING
800
[ "implementation" ]
null
null
The police department of your city has just started its journey. Initially, they don’t have any manpower. So, they started hiring new recruits in groups. Meanwhile, crimes keeps occurring within the city. One member of the police force can investigate only one crime during his/her lifetime. If there is no police officer free (isn't busy with crime) during the occurrence of a crime, it will go untreated. Given the chronological order of crime occurrences and recruit hirings, find the number of crimes which will go untreated.
The first line of input will contain an integer *n*Β (1<=≀<=*n*<=≀<=105), the number of events. The next line will contain *n* space-separated integers. If the integer is -1 then it means a crime has occurred. Otherwise, the integer will be positive, the number of officers recruited together at that time. No more than 10 officers will be recruited at a time.
Print a single integer, the number of crimes which will go untreated.
[ "3\n-1 -1 1\n", "8\n1 -1 1 -1 -1 1 1 1\n", "11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1\n" ]
[ "2\n", "1\n", "8\n" ]
Lets consider the second example: 1. Firstly one person is hired. 1. Then crime appears, the last hired person will investigate this crime. 1. One more person is hired. 1. One more crime appears, the last hired person will investigate this crime. 1. Crime appears. There is no free policeman at the time, so this crime will go untreated. 1. One more person is hired. 1. One more person is hired. 1. One more person is hired. The answer is one, as one crime (on step 5) will go untreated.
500
[ { "input": "3\n-1 -1 1", "output": "2" }, { "input": "8\n1 -1 1 -1 -1 1 1 1", "output": "1" }, { "input": "11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1", "output": "8" }, { "input": "7\n-1 -1 1 1 -1 -1 1", "output": "2" }, { "input": "21\n-1 -1 -1 -1 -1 3 2 -1 6 -1 -1 2 1 -1 2 2 1 6 5 -1 5", "output": "5" }, { "input": "98\n-1 -1 1 -1 -1 -1 -1 1 -1 -1 1 -1 -1 1 -1 1 1 1 -1 1 1 1 1 1 -1 1 -1 -1 -1 -1 1 -1 -1 1 1 -1 1 1 1 -1 -1 -1 -1 -1 -1 1 -1 -1 -1 1 -1 1 -1 1 -1 1 1 1 1 1 1 1 -1 -1 1 1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 1 -1 1 1 1 -1 1 1 -1 -1 -1 1 1 1 -1 -1 -1 1 -1 1 1", "output": "13" }, { "input": "3\n-1 5 4", "output": "1" }, { "input": "146\n4 -1 -1 -1 -1 -1 -1 -1 -1 -1 4 -1 3 -1 3 -1 -1 1 4 -1 2 -1 -1 3 -1 -1 -1 4 1 -1 -1 -1 4 -1 -1 -1 -1 -1 -1 3 2 -1 3 2 4 5 2 4 1 5 -1 -1 2 -1 -1 1 -1 5 3 -1 1 2 2 3 5 3 -1 -1 3 -1 -1 3 5 5 -1 -1 5 -1 4 4 1 -1 -1 -1 2 1 -1 -1 -1 2 5 3 -1 -1 -1 3 -1 5 4 -1 1 -1 -1 3 -1 -1 3 1 1 2 -1 -1 -1 1 3 1 -1 2 -1 -1 5 5 -1 -1 3 4 5 1 -1 2 -1 -1 -1 3 -1 5 3 2 -1 2 -1 -1 5 -1 3 -1", "output": "5" }, { "input": "1\n2", "output": "0" }, { "input": "1\n-1", "output": "1" }, { "input": "2\n1 -1", "output": "0" }, { "input": "2\n-1 1", "output": "1" }, { "input": "2\n1 1", "output": "0" }, { "input": "2\n-1 -1", "output": "2" }, { "input": "4\n10 -1 -1 -1", "output": "0" }, { "input": "1\n1", "output": "0" }, { "input": "4\n-1 -1 1 1", "output": "2" } ]
1,699,106,243
2,147,483,647
PyPy 3-64
OK
TESTS
63
92
9,830,400
n = int(input()) a = [int(i) for i in input().split()] ans = 0 p = 0 for i in range(n): if a[i] > 0: p += a[i] else: if p == 0: ans += 1 else: p -= 1 print(ans)
Title: Police Recruits Time Limit: None seconds Memory Limit: None megabytes Problem Description: The police department of your city has just started its journey. Initially, they don’t have any manpower. So, they started hiring new recruits in groups. Meanwhile, crimes keeps occurring within the city. One member of the police force can investigate only one crime during his/her lifetime. If there is no police officer free (isn't busy with crime) during the occurrence of a crime, it will go untreated. Given the chronological order of crime occurrences and recruit hirings, find the number of crimes which will go untreated. Input Specification: The first line of input will contain an integer *n*Β (1<=≀<=*n*<=≀<=105), the number of events. The next line will contain *n* space-separated integers. If the integer is -1 then it means a crime has occurred. Otherwise, the integer will be positive, the number of officers recruited together at that time. No more than 10 officers will be recruited at a time. Output Specification: Print a single integer, the number of crimes which will go untreated. Demo Input: ['3\n-1 -1 1\n', '8\n1 -1 1 -1 -1 1 1 1\n', '11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1\n'] Demo Output: ['2\n', '1\n', '8\n'] Note: Lets consider the second example: 1. Firstly one person is hired. 1. Then crime appears, the last hired person will investigate this crime. 1. One more person is hired. 1. One more crime appears, the last hired person will investigate this crime. 1. Crime appears. There is no free policeman at the time, so this crime will go untreated. 1. One more person is hired. 1. One more person is hired. 1. One more person is hired. The answer is one, as one crime (on step 5) will go untreated.
```python n = int(input()) a = [int(i) for i in input().split()] ans = 0 p = 0 for i in range(n): if a[i] > 0: p += a[i] else: if p == 0: ans += 1 else: p -= 1 print(ans) ```
3
230
A
Dragons
PROGRAMMING
1,000
[ "greedy", "sortings" ]
null
null
Kirito is stuck on a level of the MMORPG he is playing now. To move on in the game, he's got to defeat all *n* dragons that live on this level. Kirito and the dragons have strength, which is represented by an integer. In the duel between two opponents the duel's outcome is determined by their strength. Initially, Kirito's strength equals *s*. If Kirito starts duelling with the *i*-th (1<=≀<=*i*<=≀<=*n*) dragon and Kirito's strength is not greater than the dragon's strength *x**i*, then Kirito loses the duel and dies. But if Kirito's strength is greater than the dragon's strength, then he defeats the dragon and gets a bonus strength increase by *y**i*. Kirito can fight the dragons in any order. Determine whether he can move on to the next level of the game, that is, defeat all dragons without a single loss.
The first line contains two space-separated integers *s* and *n* (1<=≀<=*s*<=≀<=104, 1<=≀<=*n*<=≀<=103). Then *n* lines follow: the *i*-th line contains space-separated integers *x**i* and *y**i* (1<=≀<=*x**i*<=≀<=104, 0<=≀<=*y**i*<=≀<=104) β€” the *i*-th dragon's strength and the bonus for defeating it.
On a single line print "YES" (without the quotes), if Kirito can move on to the next level and print "NO" (without the quotes), if he can't.
[ "2 2\n1 99\n100 0\n", "10 1\n100 100\n" ]
[ "YES\n", "NO\n" ]
In the first sample Kirito's strength initially equals 2. As the first dragon's strength is less than 2, Kirito can fight it and defeat it. After that he gets the bonus and his strength increases to 2 + 99 = 101. Now he can defeat the second dragon and move on to the next level. In the second sample Kirito's strength is too small to defeat the only dragon and win.
500
[ { "input": "2 2\n1 99\n100 0", "output": "YES" }, { "input": "10 1\n100 100", "output": "NO" }, { "input": "123 2\n78 10\n130 0", "output": "YES" }, { "input": "999 2\n1010 10\n67 89", "output": "YES" }, { "input": "2 5\n5 1\n2 1\n3 1\n1 1\n4 1", "output": "YES" }, { "input": "2 2\n3 5\n1 2", "output": "YES" }, { "input": "1 2\n1 0\n1 0", "output": "NO" }, { "input": "5 10\n20 1\n4 3\n5 1\n100 1\n4 2\n101 1\n10 0\n10 2\n17 3\n12 84", "output": "YES" }, { "input": "2 2\n1 98\n100 0", "output": "NO" }, { "input": "2 2\n1 2\n3 5", "output": "YES" }, { "input": "5 3\n13 20\n3 10\n15 5", "output": "YES" }, { "input": "2 5\n1 1\n2 1\n3 1\n4 1\n5 1", "output": "YES" }, { "input": "3 3\n1 1\n1 2\n4 0", "output": "YES" }, { "input": "10 4\n20 1\n3 5\n2 4\n1 3", "output": "YES" }, { "input": "10 1\n1 1", "output": "YES" }, { "input": "4 1\n100 1000", "output": "NO" }, { "input": "5 1\n6 7", "output": "NO" }, { "input": "10 1\n10 10", "output": "NO" }, { "input": "6 2\n496 0\n28 8128", "output": "NO" }, { "input": "4 2\n2 1\n10 3", "output": "NO" }, { "input": "11 2\n22 0\n33 0", "output": "NO" }, { "input": "1 2\n100 1\n100 1", "output": "NO" }, { "input": "10 3\n12 0\n13 0\n14 0", "output": "NO" }, { "input": "50 3\n39 0\n38 0\n37 0", "output": "YES" }, { "input": "14 3\n1 5\n1 6\n1 7", "output": "YES" }, { "input": "1 3\n1 10\n1 11\n1 9", "output": "NO" }, { "input": "10 10\n2 10\n3 10\n4 10\n2 20\n3 20\n3 20\n100 50\n100 30\n150 30\n200 10", "output": "NO" }, { "input": "9983 34\n6626 5976\n4448 3568\n2794 2309\n3741 8806\n4754 129\n2780 9275\n5785 9243\n3915 6159\n2609 4331\n238 6756\n6987 3887\n3384 5711\n4349 5563\n1135 4483\n9151 1584\n1500 766\n1608 4440\n7768 5005\n7205 2360\n9088 2933\n3923 7814\n7538 9372\n7504 165\n5277 1636\n2061 4384\n7668 1422\n9582 2121\n5483 7967\n487 2944\n7432 5794\n8208 8970\n5747 3800\n4322 3920\n8261 9319", "output": "YES" }, { "input": "1 10\n8 8\n54 3\n1 8\n26 3\n16 1\n29 9\n38 10\n57 8\n48 6\n17 9", "output": "NO" }, { "input": "5 10\n7 0\n7 0\n10 0\n10 0\n7 2\n4 2\n9 0\n6 1\n7 0\n7 0", "output": "NO" }, { "input": "2 3\n1 1\n1 10\n17 2", "output": "NO" }, { "input": "100 5\n99 100\n199 1\n199 1\n199 1\n202 1", "output": "YES" }, { "input": "1 1\n10000 1", "output": "NO" } ]
1,698,157,954
2,147,483,647
Python 3
OK
TESTS
54
92
0
s, n = map(int, input().split()) data = [] for i in range(n): dragonStrength, gain = map(int, input().split()) data.append((dragonStrength, gain)) data = sorted(data) Won = True for i in data: if s > i[0]: s += i[1] else: print("NO") Won = False break if Won: print("YES")
Title: Dragons Time Limit: None seconds Memory Limit: None megabytes Problem Description: Kirito is stuck on a level of the MMORPG he is playing now. To move on in the game, he's got to defeat all *n* dragons that live on this level. Kirito and the dragons have strength, which is represented by an integer. In the duel between two opponents the duel's outcome is determined by their strength. Initially, Kirito's strength equals *s*. If Kirito starts duelling with the *i*-th (1<=≀<=*i*<=≀<=*n*) dragon and Kirito's strength is not greater than the dragon's strength *x**i*, then Kirito loses the duel and dies. But if Kirito's strength is greater than the dragon's strength, then he defeats the dragon and gets a bonus strength increase by *y**i*. Kirito can fight the dragons in any order. Determine whether he can move on to the next level of the game, that is, defeat all dragons without a single loss. Input Specification: The first line contains two space-separated integers *s* and *n* (1<=≀<=*s*<=≀<=104, 1<=≀<=*n*<=≀<=103). Then *n* lines follow: the *i*-th line contains space-separated integers *x**i* and *y**i* (1<=≀<=*x**i*<=≀<=104, 0<=≀<=*y**i*<=≀<=104) β€” the *i*-th dragon's strength and the bonus for defeating it. Output Specification: On a single line print "YES" (without the quotes), if Kirito can move on to the next level and print "NO" (without the quotes), if he can't. Demo Input: ['2 2\n1 99\n100 0\n', '10 1\n100 100\n'] Demo Output: ['YES\n', 'NO\n'] Note: In the first sample Kirito's strength initially equals 2. As the first dragon's strength is less than 2, Kirito can fight it and defeat it. After that he gets the bonus and his strength increases to 2 + 99 = 101. Now he can defeat the second dragon and move on to the next level. In the second sample Kirito's strength is too small to defeat the only dragon and win.
```python s, n = map(int, input().split()) data = [] for i in range(n): dragonStrength, gain = map(int, input().split()) data.append((dragonStrength, gain)) data = sorted(data) Won = True for i in data: if s > i[0]: s += i[1] else: print("NO") Won = False break if Won: print("YES") ```
3
96
A
Football
PROGRAMMING
900
[ "implementation", "strings" ]
A. Football
2
256
Petya loves football very much. One day, as he was watching a football match, he was writing the players' current positions on a piece of paper. To simplify the situation he depicted it as a string consisting of zeroes and ones. A zero corresponds to players of one team; a one corresponds to players of another team. If there are at least 7 players of some team standing one after another, then the situation is considered dangerous. For example, the situation 00100110111111101 is dangerous and 11110111011101 is not. You are given the current situation. Determine whether it is dangerous or not.
The first input line contains a non-empty string consisting of characters "0" and "1", which represents players. The length of the string does not exceed 100 characters. There's at least one player from each team present on the field.
Print "YES" if the situation is dangerous. Otherwise, print "NO".
[ "001001\n", "1000000001\n" ]
[ "NO\n", "YES\n" ]
none
500
[ { "input": "001001", "output": "NO" }, { "input": "1000000001", "output": "YES" }, { "input": "00100110111111101", "output": "YES" }, { "input": "11110111111111111", "output": "YES" }, { "input": "01", "output": "NO" }, { "input": "10100101", "output": "NO" }, { "input": "1010010100000000010", "output": "YES" }, { "input": "101010101", "output": "NO" }, { "input": "000000000100000000000110101100000", "output": "YES" }, { "input": "100001000000110101100000", "output": "NO" }, { "input": "100001000011010110000", "output": "NO" }, { "input": "010", "output": "NO" }, { "input": "10101011111111111111111111111100", "output": "YES" }, { "input": "1001101100", "output": "NO" }, { "input": "1001101010", "output": "NO" }, { "input": "1111100111", "output": "NO" }, { "input": "00110110001110001111", "output": "NO" }, { "input": "11110001001111110001", "output": "NO" }, { "input": "10001111001011111101", "output": "NO" }, { "input": "10000010100000001000110001010100001001001010011", "output": "YES" }, { "input": "01111011111010111100101100001011001010111110000010", "output": "NO" }, { "input": "00100000100100101110011001011011101110110110010100", "output": "NO" }, { "input": "10110100110001001011110101110010100010000000000100101010111110111110100011", "output": "YES" }, { "input": "00011101010101111001011011001101101011111101000010100000111000011100101011", "output": "NO" }, { "input": "01110000110100110101110100111000101101011101011110110100100111100001110111", "output": "NO" }, { "input": "11110110011000100111100111101101011111110100010101011011111101110110110111", "output": "YES" }, { "input": "100100010101110010001011001110100011100010011110100101100011010001001010001001101111001100", "output": "NO" }, { "input": "111110010001011010010011111100110110001111000010100011011100111101111101110010101111011110000001010", "output": "NO" }, { "input": "111110111100010100000100001010111011101011000111011011011010110010100010000101011111000011010011110", "output": "NO" }, { "input": "1011110110111010110111111010010010100011111011110000011000110010011110111010110100011010100010111000", "output": "NO" }, { "input": "0010100111100010110110000011100111110100111110001010000100111111111010111100101101010101001011010110", "output": "YES" }, { "input": "1111010100010100101011101100101101110011000010100010000001111100010011100101010001101111000001011000", "output": "NO" }, { "input": "0101100011001110001110100111100011010101011000000000110110010010111100101111010111100011101100100101", "output": "YES" }, { "input": "0001101110011101110000000010011111101001101111100001001010110000110001100000010001111011011110001101", "output": "YES" }, { "input": "1000010000100000100010000100001000010000100001000010000100001000010000100001000010000100001000010000", "output": "NO" }, { "input": "1000000000100000000010000000001000000000100000000010000000001000000000100000000010000000001000000000", "output": "YES" }, { "input": "0000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000001", "output": "YES" }, { "input": "1111111111111111111111111111111111111111011111111111111111111111111111111111111111111111111111111111", "output": "YES" }, { "input": "10100101000", "output": "NO" }, { "input": "11110111011101", "output": "NO" }, { "input": "10000000", "output": "YES" }, { "input": "00000001", "output": "YES" }, { "input": "01111111", "output": "YES" }, { "input": "11111110", "output": "YES" } ]
1,692,987,511
2,147,483,647
Python 3
OK
TESTS
44
92
0
a = input() zero = one = 0 for i in a: if int(i) == 0: zero += 1 one = 0 else: one += 1 zero = 0 if zero == 7 or one == 7: print('YES') break else: print('NO')
Title: Football Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Petya loves football very much. One day, as he was watching a football match, he was writing the players' current positions on a piece of paper. To simplify the situation he depicted it as a string consisting of zeroes and ones. A zero corresponds to players of one team; a one corresponds to players of another team. If there are at least 7 players of some team standing one after another, then the situation is considered dangerous. For example, the situation 00100110111111101 is dangerous and 11110111011101 is not. You are given the current situation. Determine whether it is dangerous or not. Input Specification: The first input line contains a non-empty string consisting of characters "0" and "1", which represents players. The length of the string does not exceed 100 characters. There's at least one player from each team present on the field. Output Specification: Print "YES" if the situation is dangerous. Otherwise, print "NO". Demo Input: ['001001\n', '1000000001\n'] Demo Output: ['NO\n', 'YES\n'] Note: none
```python a = input() zero = one = 0 for i in a: if int(i) == 0: zero += 1 one = 0 else: one += 1 zero = 0 if zero == 7 or one == 7: print('YES') break else: print('NO') ```
3.977
499
B
Lecture
PROGRAMMING
1,000
[ "implementation", "strings" ]
null
null
You have a new professor of graph theory and he speaks very quickly. You come up with the following plan to keep up with his lecture and make notes. You know two languages, and the professor is giving the lecture in the first one. The words in both languages consist of lowercase English characters, each language consists of several words. For each language, all words are distinct, i.e. they are spelled differently. Moreover, the words of these languages have a one-to-one correspondence, that is, for each word in each language, there exists exactly one word in the other language having has the same meaning. You can write down every word the professor says in either the first language or the second language. Of course, during the lecture you write down each word in the language in which the word is shorter. In case of equal lengths of the corresponding words you prefer the word of the first language. You are given the text of the lecture the professor is going to read. Find out how the lecture will be recorded in your notes.
The first line contains two integers, *n* and *m* (1<=≀<=*n*<=≀<=3000, 1<=≀<=*m*<=≀<=3000) β€” the number of words in the professor's lecture and the number of words in each of these languages. The following *m* lines contain the words. The *i*-th line contains two strings *a**i*, *b**i* meaning that the word *a**i* belongs to the first language, the word *b**i* belongs to the second language, and these two words have the same meaning. It is guaranteed that no word occurs in both languages, and each word occurs in its language exactly once. The next line contains *n* space-separated strings *c*1,<=*c*2,<=...,<=*c**n* β€” the text of the lecture. It is guaranteed that each of the strings *c**i* belongs to the set of strings {*a*1,<=*a*2,<=... *a**m*}. All the strings in the input are non-empty, each consisting of no more than 10 lowercase English letters.
Output exactly *n* words: how you will record the lecture in your notebook. Output the words of the lecture in the same order as in the input.
[ "4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest\n", "5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll\n" ]
[ "codeforces round letter round\n", "hbnyiyc joll joll un joll\n" ]
none
500
[ { "input": "4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest", "output": "codeforces round letter round" }, { "input": "5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll", "output": "hbnyiyc joll joll un joll" }, { "input": "5 5\nqueyqj f\nb vn\ntabzvk qpfzoqx\nytnyonoc hnxsd\njpggvr lchinjmt\nqueyqj jpggvr b ytnyonoc b", "output": "f jpggvr b hnxsd b" }, { "input": "10 22\nazbrll oen\ngh vdyayei\njphveblohx vfglv\nmfyxib jepnvhcuwo\nrpikazqj uam\nl rx\nokjenof qpnyi\nj tixqrno\nod itozmfct\nikkdxmirx ev\nqexftojc p\nkdazb zjs\nmbk ykvqjrxaxu\nhbcwhouzq pwt\nmirpsz zfaegpl\nuhkkvcj rlvwj\nef iqnnwtolrc\npjzfcpmeag ecdayth\nsa qcthz\ncbfhfxi qrnbvdryz\nwqel tj\natx smkbid\nef hbcwhouzq cbfhfxi hbcwhouzq mirpsz cbfhfxi cbfhfxi okjenof pjzfcpmeag kdazb", "output": "ef pwt cbfhfxi pwt mirpsz cbfhfxi cbfhfxi qpnyi ecdayth zjs" }, { "input": "1 1\namit am\namit", "output": "am" }, { "input": "1 1\na c\na", "output": "a" } ]
1,601,915,628
2,147,483,647
PyPy 3
OK
TESTS
37
202
4,505,600
n, m = map(int, input().split()) dict = {} for i in range(m): str1, str2 = input().split() dict[str1] = str2 prof = input().split() res = [] for i in prof: if len(dict[i]) < len(i): res.append(dict[i]) else: res.append(i) res = " ".join(res) print(res)
Title: Lecture Time Limit: None seconds Memory Limit: None megabytes Problem Description: You have a new professor of graph theory and he speaks very quickly. You come up with the following plan to keep up with his lecture and make notes. You know two languages, and the professor is giving the lecture in the first one. The words in both languages consist of lowercase English characters, each language consists of several words. For each language, all words are distinct, i.e. they are spelled differently. Moreover, the words of these languages have a one-to-one correspondence, that is, for each word in each language, there exists exactly one word in the other language having has the same meaning. You can write down every word the professor says in either the first language or the second language. Of course, during the lecture you write down each word in the language in which the word is shorter. In case of equal lengths of the corresponding words you prefer the word of the first language. You are given the text of the lecture the professor is going to read. Find out how the lecture will be recorded in your notes. Input Specification: The first line contains two integers, *n* and *m* (1<=≀<=*n*<=≀<=3000, 1<=≀<=*m*<=≀<=3000) β€” the number of words in the professor's lecture and the number of words in each of these languages. The following *m* lines contain the words. The *i*-th line contains two strings *a**i*, *b**i* meaning that the word *a**i* belongs to the first language, the word *b**i* belongs to the second language, and these two words have the same meaning. It is guaranteed that no word occurs in both languages, and each word occurs in its language exactly once. The next line contains *n* space-separated strings *c*1,<=*c*2,<=...,<=*c**n* β€” the text of the lecture. It is guaranteed that each of the strings *c**i* belongs to the set of strings {*a*1,<=*a*2,<=... *a**m*}. All the strings in the input are non-empty, each consisting of no more than 10 lowercase English letters. Output Specification: Output exactly *n* words: how you will record the lecture in your notebook. Output the words of the lecture in the same order as in the input. Demo Input: ['4 3\ncodeforces codesecrof\ncontest round\nletter message\ncodeforces contest letter contest\n', '5 3\njoll wuqrd\neuzf un\nhbnyiyc rsoqqveh\nhbnyiyc joll joll euzf joll\n'] Demo Output: ['codeforces round letter round\n', 'hbnyiyc joll joll un joll\n'] Note: none
```python n, m = map(int, input().split()) dict = {} for i in range(m): str1, str2 = input().split() dict[str1] = str2 prof = input().split() res = [] for i in prof: if len(dict[i]) < len(i): res.append(dict[i]) else: res.append(i) res = " ".join(res) print(res) ```
3
427
A
Police Recruits
PROGRAMMING
800
[ "implementation" ]
null
null
The police department of your city has just started its journey. Initially, they don’t have any manpower. So, they started hiring new recruits in groups. Meanwhile, crimes keeps occurring within the city. One member of the police force can investigate only one crime during his/her lifetime. If there is no police officer free (isn't busy with crime) during the occurrence of a crime, it will go untreated. Given the chronological order of crime occurrences and recruit hirings, find the number of crimes which will go untreated.
The first line of input will contain an integer *n*Β (1<=≀<=*n*<=≀<=105), the number of events. The next line will contain *n* space-separated integers. If the integer is -1 then it means a crime has occurred. Otherwise, the integer will be positive, the number of officers recruited together at that time. No more than 10 officers will be recruited at a time.
Print a single integer, the number of crimes which will go untreated.
[ "3\n-1 -1 1\n", "8\n1 -1 1 -1 -1 1 1 1\n", "11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1\n" ]
[ "2\n", "1\n", "8\n" ]
Lets consider the second example: 1. Firstly one person is hired. 1. Then crime appears, the last hired person will investigate this crime. 1. One more person is hired. 1. One more crime appears, the last hired person will investigate this crime. 1. Crime appears. There is no free policeman at the time, so this crime will go untreated. 1. One more person is hired. 1. One more person is hired. 1. One more person is hired. The answer is one, as one crime (on step 5) will go untreated.
500
[ { "input": "3\n-1 -1 1", "output": "2" }, { "input": "8\n1 -1 1 -1 -1 1 1 1", "output": "1" }, { "input": "11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1", "output": "8" }, { "input": "7\n-1 -1 1 1 -1 -1 1", "output": "2" }, { "input": "21\n-1 -1 -1 -1 -1 3 2 -1 6 -1 -1 2 1 -1 2 2 1 6 5 -1 5", "output": "5" }, { "input": "98\n-1 -1 1 -1 -1 -1 -1 1 -1 -1 1 -1 -1 1 -1 1 1 1 -1 1 1 1 1 1 -1 1 -1 -1 -1 -1 1 -1 -1 1 1 -1 1 1 1 -1 -1 -1 -1 -1 -1 1 -1 -1 -1 1 -1 1 -1 1 -1 1 1 1 1 1 1 1 -1 -1 1 1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 -1 1 -1 1 1 1 -1 1 1 -1 -1 -1 1 1 1 -1 -1 -1 1 -1 1 1", "output": "13" }, { "input": "3\n-1 5 4", "output": "1" }, { "input": "146\n4 -1 -1 -1 -1 -1 -1 -1 -1 -1 4 -1 3 -1 3 -1 -1 1 4 -1 2 -1 -1 3 -1 -1 -1 4 1 -1 -1 -1 4 -1 -1 -1 -1 -1 -1 3 2 -1 3 2 4 5 2 4 1 5 -1 -1 2 -1 -1 1 -1 5 3 -1 1 2 2 3 5 3 -1 -1 3 -1 -1 3 5 5 -1 -1 5 -1 4 4 1 -1 -1 -1 2 1 -1 -1 -1 2 5 3 -1 -1 -1 3 -1 5 4 -1 1 -1 -1 3 -1 -1 3 1 1 2 -1 -1 -1 1 3 1 -1 2 -1 -1 5 5 -1 -1 3 4 5 1 -1 2 -1 -1 -1 3 -1 5 3 2 -1 2 -1 -1 5 -1 3 -1", "output": "5" }, { "input": "1\n2", "output": "0" }, { "input": "1\n-1", "output": "1" }, { "input": "2\n1 -1", "output": "0" }, { "input": "2\n-1 1", "output": "1" }, { "input": "2\n1 1", "output": "0" }, { "input": "2\n-1 -1", "output": "2" }, { "input": "4\n10 -1 -1 -1", "output": "0" }, { "input": "1\n1", "output": "0" }, { "input": "4\n-1 -1 1 1", "output": "2" } ]
1,681,845,865
2,147,483,647
PyPy 3-64
OK
TESTS
63
140
13,516,800
n = int(input()) a = list(map(int,input().split())) p = 0 c = 0 for i in a: if i!=-1: p+=i else: if p==0: c+=1 else: p-=1 print(c)
Title: Police Recruits Time Limit: None seconds Memory Limit: None megabytes Problem Description: The police department of your city has just started its journey. Initially, they don’t have any manpower. So, they started hiring new recruits in groups. Meanwhile, crimes keeps occurring within the city. One member of the police force can investigate only one crime during his/her lifetime. If there is no police officer free (isn't busy with crime) during the occurrence of a crime, it will go untreated. Given the chronological order of crime occurrences and recruit hirings, find the number of crimes which will go untreated. Input Specification: The first line of input will contain an integer *n*Β (1<=≀<=*n*<=≀<=105), the number of events. The next line will contain *n* space-separated integers. If the integer is -1 then it means a crime has occurred. Otherwise, the integer will be positive, the number of officers recruited together at that time. No more than 10 officers will be recruited at a time. Output Specification: Print a single integer, the number of crimes which will go untreated. Demo Input: ['3\n-1 -1 1\n', '8\n1 -1 1 -1 -1 1 1 1\n', '11\n-1 -1 2 -1 -1 -1 -1 -1 -1 -1 -1\n'] Demo Output: ['2\n', '1\n', '8\n'] Note: Lets consider the second example: 1. Firstly one person is hired. 1. Then crime appears, the last hired person will investigate this crime. 1. One more person is hired. 1. One more crime appears, the last hired person will investigate this crime. 1. Crime appears. There is no free policeman at the time, so this crime will go untreated. 1. One more person is hired. 1. One more person is hired. 1. One more person is hired. The answer is one, as one crime (on step 5) will go untreated.
```python n = int(input()) a = list(map(int,input().split())) p = 0 c = 0 for i in a: if i!=-1: p+=i else: if p==0: c+=1 else: p-=1 print(c) ```
3
71
A
Way Too Long Words
PROGRAMMING
800
[ "strings" ]
A. Way Too Long Words
1
256
Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome. Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation. This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes. Thus, "localization" will be spelt as "l10n", and "internationalizationΒ» will be spelt as "i18n". You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes.
The first line contains an integer *n* (1<=≀<=*n*<=≀<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters.
Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data.
[ "4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n" ]
[ "word\nl10n\ni18n\np43s\n" ]
none
500
[ { "input": "4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis", "output": "word\nl10n\ni18n\np43s" }, { "input": "5\nabcdefgh\nabcdefghi\nabcdefghij\nabcdefghijk\nabcdefghijklm", "output": "abcdefgh\nabcdefghi\nabcdefghij\na9k\na11m" }, { "input": "3\nnjfngnrurunrgunrunvurn\njfvnjfdnvjdbfvsbdubruvbubvkdb\nksdnvidnviudbvibd", "output": "n20n\nj27b\nk15d" }, { "input": "1\ntcyctkktcctrcyvbyiuhihhhgyvyvyvyvjvytchjckt", "output": "t41t" }, { "input": "24\nyou\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nunofficially\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings", "output": "you\nare\nregistered\nfor\npractice\nyou\ncan\nsolve\nproblems\nu10y\nresults\ncan\nbe\nfound\nin\nthe\ncontest\nstatus\nand\nin\nthe\nbottom\nof\nstandings" }, { "input": "1\na", "output": "a" }, { "input": "26\na\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz", "output": "a\nb\nc\nd\ne\nf\ng\nh\ni\nj\nk\nl\nm\nn\no\np\nq\nr\ns\nt\nu\nv\nw\nx\ny\nz" }, { "input": "1\nabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghij", "output": "a98j" }, { "input": "10\ngyartjdxxlcl\nfzsck\nuidwu\nxbymclornemdmtj\nilppyoapitawgje\ncibzc\ndrgbeu\nhezplmsdekhhbo\nfeuzlrimbqbytdu\nkgdco", "output": "g10l\nfzsck\nuidwu\nx13j\ni13e\ncibzc\ndrgbeu\nh12o\nf13u\nkgdco" }, { "input": "20\nlkpmx\nkovxmxorlgwaomlswjxlpnbvltfv\nhykasjxqyjrmybejnmeumzha\ntuevlumpqbbhbww\nqgqsphvrmupxxc\ntrissbaf\nqfgrlinkzvzqdryckaizutd\nzzqtoaxkvwoscyx\noswytrlnhpjvvnwookx\nlpuzqgec\ngyzqfwxggtvpjhzmzmdw\nrlxjgmvdftvrmvbdwudra\nvsntnjpepnvdaxiporggmglhagv\nxlvcqkqgcrbgtgglj\nlyxwxbiszyhlsrgzeedzprbmcpduvq\nyrmqqvrkqskqukzqrwukpsifgtdc\nxpuohcsjhhuhvr\nvvlfrlxpvqejngwrbfbpmqeirxlw\nsvmasocxdvadmaxtrpakysmeaympy\nyuflqboqfdt", "output": "lkpmx\nk26v\nh22a\nt13w\nq12c\ntrissbaf\nq21d\nz13x\no17x\nlpuzqgec\ng18w\nr19a\nv25v\nx15j\nl28q\ny26c\nx12r\nv26w\ns27y\ny9t" }, { "input": "100\nm\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr", "output": "m\nz\ns\nv\nd\nr\nv\ny\ny\ne\np\nt\nc\na\nn\nm\np\ng\ni\nj\nc\na\nb\nq\ne\nn\nv\no\nk\nx\nf\ni\nl\na\nq\nr\nu\nb\ns\nl\nc\nl\ne\nv\nj\nm\nx\nb\na\nq\nb\na\nf\nj\nv\nm\nq\nc\nt\nt\nn\nx\no\ny\nr\nu\nh\nm\nj\np\nj\nq\nz\ns\nj\no\ng\nc\nm\nn\no\nm\nr\no\ns\nt\nh\nr\np\nk\nb\nz\ng\no\nc\nc\nz\nz\ng\nr" } ]
1,697,004,143
2,147,483,647
Python 3
OK
TESTS
20
46
0
#program def abbreviate_words(n, words): abbreviated_words = [] for word in words: if len(word) > 10: abbreviation = word[0] + str(len(word) - 2) + word[-1] abbreviated_words.append(abbreviation) else: abbreviated_words.append(word) for abbreviation in abbreviated_words: print(abbreviation) n = int(input()) words = [] for _ in range(n): word = input() words.append(word) abbreviate_words(n, words)
Title: Way Too Long Words Time Limit: 1 seconds Memory Limit: 256 megabytes Problem Description: Sometimes some words like "localization" or "internationalization" are so long that writing them many times in one text is quite tiresome. Let's consider a word too long, if its length is strictly more than 10 characters. All too long words should be replaced with a special abbreviation. This abbreviation is made like this: we write down the first and the last letter of a word and between them we write the number of letters between the first and the last letters. That number is in decimal system and doesn't contain any leading zeroes. Thus, "localization" will be spelt as "l10n", and "internationalizationΒ» will be spelt as "i18n". You are suggested to automatize the process of changing the words with abbreviations. At that all too long words should be replaced by the abbreviation and the words that are not too long should not undergo any changes. Input Specification: The first line contains an integer *n* (1<=≀<=*n*<=≀<=100). Each of the following *n* lines contains one word. All the words consist of lowercase Latin letters and possess the lengths of from 1 to 100 characters. Output Specification: Print *n* lines. The *i*-th line should contain the result of replacing of the *i*-th word from the input data. Demo Input: ['4\nword\nlocalization\ninternationalization\npneumonoultramicroscopicsilicovolcanoconiosis\n'] Demo Output: ['word\nl10n\ni18n\np43s\n'] Note: none
```python #program def abbreviate_words(n, words): abbreviated_words = [] for word in words: if len(word) > 10: abbreviation = word[0] + str(len(word) - 2) + word[-1] abbreviated_words.append(abbreviation) else: abbreviated_words.append(word) for abbreviation in abbreviated_words: print(abbreviation) n = int(input()) words = [] for _ in range(n): word = input() words.append(word) abbreviate_words(n, words) ```
3.977
791
A
Bear and Big Brother
PROGRAMMING
800
[ "implementation" ]
null
null
Bear Limak wants to become the largest of bears, or at least to become larger than his brother Bob. Right now, Limak and Bob weigh *a* and *b* respectively. It's guaranteed that Limak's weight is smaller than or equal to his brother's weight. Limak eats a lot and his weight is tripled after every year, while Bob's weight is doubled after every year. After how many full years will Limak become strictly larger (strictly heavier) than Bob?
The only line of the input contains two integers *a* and *b* (1<=≀<=*a*<=≀<=*b*<=≀<=10)Β β€” the weight of Limak and the weight of Bob respectively.
Print one integer, denoting the integer number of years after which Limak will become strictly larger than Bob.
[ "4 7\n", "4 9\n", "1 1\n" ]
[ "2\n", "3\n", "1\n" ]
In the first sample, Limak weighs 4 and Bob weighs 7 initially. After one year their weights are 4Β·3 = 12 and 7Β·2 = 14 respectively (one weight is tripled while the other one is doubled). Limak isn't larger than Bob yet. After the second year weights are 36 and 28, so the first weight is greater than the second one. Limak became larger than Bob after two years so you should print 2. In the second sample, Limak's and Bob's weights in next years are: 12 and 18, then 36 and 36, and finally 108 and 72 (after three years). The answer is 3. Remember that Limak wants to be larger than Bob and he won't be satisfied with equal weights. In the third sample, Limak becomes larger than Bob after the first year. Their weights will be 3 and 2 then.
500
[ { "input": "4 7", "output": "2" }, { "input": "4 9", "output": "3" }, { "input": "1 1", "output": "1" }, { "input": "4 6", "output": "2" }, { "input": "1 10", "output": "6" }, { "input": "1 1", "output": "1" }, { "input": "1 2", "output": "2" }, { "input": "1 3", "output": "3" }, { "input": "1 4", "output": "4" }, { "input": "1 5", "output": "4" }, { "input": "1 6", "output": "5" }, { "input": "1 7", "output": "5" }, { "input": "1 8", "output": "6" }, { "input": "1 9", "output": "6" }, { "input": "1 10", "output": "6" }, { "input": "2 2", "output": "1" }, { "input": "2 3", "output": "2" }, { "input": "2 4", "output": "2" }, { "input": "2 5", "output": "3" }, { "input": "2 6", "output": "3" }, { "input": "2 7", "output": "4" }, { "input": "2 8", "output": "4" }, { "input": "2 9", "output": "4" }, { "input": "2 10", "output": "4" }, { "input": "3 3", "output": "1" }, { "input": "3 4", "output": "1" }, { "input": "3 5", "output": "2" }, { "input": "3 6", "output": "2" }, { "input": "3 7", "output": "3" }, { "input": "3 8", "output": "3" }, { "input": "3 9", "output": "3" }, { "input": "3 10", "output": "3" }, { "input": "4 4", "output": "1" }, { "input": "4 5", "output": "1" }, { "input": "4 6", "output": "2" }, { "input": "4 7", "output": "2" }, { "input": "4 8", "output": "2" }, { "input": "4 9", "output": "3" }, { "input": "4 10", "output": "3" }, { "input": "5 5", "output": "1" }, { "input": "5 6", "output": "1" }, { "input": "5 7", "output": "1" }, { "input": "5 8", "output": "2" }, { "input": "5 9", "output": "2" }, { "input": "5 10", "output": "2" }, { "input": "6 6", "output": "1" }, { "input": "6 7", "output": "1" }, { "input": "6 8", "output": "1" }, { "input": "6 9", "output": "2" }, { "input": "6 10", "output": "2" }, { "input": "7 7", "output": "1" }, { "input": "7 8", "output": "1" }, { "input": "7 9", "output": "1" }, { "input": "7 10", "output": "1" }, { "input": "8 8", "output": "1" }, { "input": "8 9", "output": "1" }, { "input": "8 10", "output": "1" }, { "input": "9 9", "output": "1" }, { "input": "9 10", "output": "1" }, { "input": "10 10", "output": "1" }, { "input": "10 10", "output": "1" }, { "input": "1 2", "output": "2" } ]
1,694,696,492
2,147,483,647
Python 3
OK
TESTS
62
46
0
Limak, Bob = map(int, input().split()) t = 0 while True: Limak = Limak*3 Bob = Bob*2 t += 1 if Limak > Bob: print(t) break
Title: Bear and Big Brother Time Limit: None seconds Memory Limit: None megabytes Problem Description: Bear Limak wants to become the largest of bears, or at least to become larger than his brother Bob. Right now, Limak and Bob weigh *a* and *b* respectively. It's guaranteed that Limak's weight is smaller than or equal to his brother's weight. Limak eats a lot and his weight is tripled after every year, while Bob's weight is doubled after every year. After how many full years will Limak become strictly larger (strictly heavier) than Bob? Input Specification: The only line of the input contains two integers *a* and *b* (1<=≀<=*a*<=≀<=*b*<=≀<=10)Β β€” the weight of Limak and the weight of Bob respectively. Output Specification: Print one integer, denoting the integer number of years after which Limak will become strictly larger than Bob. Demo Input: ['4 7\n', '4 9\n', '1 1\n'] Demo Output: ['2\n', '3\n', '1\n'] Note: In the first sample, Limak weighs 4 and Bob weighs 7 initially. After one year their weights are 4Β·3 = 12 and 7Β·2 = 14 respectively (one weight is tripled while the other one is doubled). Limak isn't larger than Bob yet. After the second year weights are 36 and 28, so the first weight is greater than the second one. Limak became larger than Bob after two years so you should print 2. In the second sample, Limak's and Bob's weights in next years are: 12 and 18, then 36 and 36, and finally 108 and 72 (after three years). The answer is 3. Remember that Limak wants to be larger than Bob and he won't be satisfied with equal weights. In the third sample, Limak becomes larger than Bob after the first year. Their weights will be 3 and 2 then.
```python Limak, Bob = map(int, input().split()) t = 0 while True: Limak = Limak*3 Bob = Bob*2 t += 1 if Limak > Bob: print(t) break ```
3
224
A
Parallelepiped
PROGRAMMING
1,100
[ "brute force", "geometry", "math" ]
null
null
You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped.
The first and the single line contains three space-separated integers β€” the areas of the parallelepiped's faces. The area's values are positive (<=&gt;<=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement.
Print a single number β€” the sum of all edges of the parallelepiped.
[ "1 1 1\n", "4 6 6\n" ]
[ "12\n", "28\n" ]
In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second oneΒ β€” 2 × 2 × 3.
500
[ { "input": "1 1 1", "output": "12" }, { "input": "4 6 6", "output": "28" }, { "input": "20 10 50", "output": "68" }, { "input": "9 4 36", "output": "56" }, { "input": "324 9 36", "output": "184" }, { "input": "1333 93 129", "output": "308" }, { "input": "1022 584 112", "output": "380" }, { "input": "66 174 319", "output": "184" }, { "input": "912 276 1748", "output": "444" }, { "input": "65 156 60", "output": "120" }, { "input": "1 10000 10000", "output": "40008" }, { "input": "1485 55 27", "output": "332" }, { "input": "152 108 4104", "output": "528" }, { "input": "1656 6900 1350", "output": "740" }, { "input": "12 14 42", "output": "60" }, { "input": "615 18 1230", "output": "856" }, { "input": "680 60 408", "output": "336" }, { "input": "644 966 6", "output": "1308" }, { "input": "1 432 432", "output": "1736" }, { "input": "2239 2239 1", "output": "8964" }, { "input": "4106 8212 2", "output": "16436" }, { "input": "10000 10000 10000", "output": "1200" }, { "input": "3623 3623 1", "output": "14500" }, { "input": "9801 9801 9801", "output": "1188" }, { "input": "10000 1 10000", "output": "40008" }, { "input": "9 9 9", "output": "36" }, { "input": "9801 9702 9702", "output": "1184" } ]
1,679,419,739
2,147,483,647
PyPy 3-64
OK
TESTS
27
124
0
import math ins = [int(x) for x in input().split()] x = round(math.sqrt(ins[0] * ins[2] // ins[1])) z = ins[2]//x y = ins[1]//z # print(x , y ,z) print(4*(x + y + z))
Title: Parallelepiped Time Limit: None seconds Memory Limit: None megabytes Problem Description: You've got a rectangular parallelepiped with integer edge lengths. You know the areas of its three faces that have a common vertex. Your task is to find the sum of lengths of all 12 edges of this parallelepiped. Input Specification: The first and the single line contains three space-separated integers β€” the areas of the parallelepiped's faces. The area's values are positive (<=&gt;<=0) and do not exceed 104. It is guaranteed that there exists at least one parallelepiped that satisfies the problem statement. Output Specification: Print a single number β€” the sum of all edges of the parallelepiped. Demo Input: ['1 1 1\n', '4 6 6\n'] Demo Output: ['12\n', '28\n'] Note: In the first sample the parallelepiped has sizes 1 × 1 × 1, in the second oneΒ β€” 2 × 2 × 3.
```python import math ins = [int(x) for x in input().split()] x = round(math.sqrt(ins[0] * ins[2] // ins[1])) z = ins[2]//x y = ins[1]//z # print(x , y ,z) print(4*(x + y + z)) ```
3
445
A
DZY Loves Chessboard
PROGRAMMING
1,200
[ "dfs and similar", "implementation" ]
null
null
DZY loves chessboard, and he enjoys playing with it. He has a chessboard of *n* rows and *m* columns. Some cells of the chessboard are bad, others are good. For every good cell, DZY wants to put a chessman on it. Each chessman is either white or black. After putting all chessmen, DZY wants that no two chessmen with the same color are on two adjacent cells. Two cells are adjacent if and only if they share a common edge. You task is to find any suitable placement of chessmen on the given chessboard.
The first line contains two space-separated integers *n* and *m* (1<=≀<=*n*,<=*m*<=≀<=100). Each of the next *n* lines contains a string of *m* characters: the *j*-th character of the *i*-th string is either "." or "-". A "." means that the corresponding cell (in the *i*-th row and the *j*-th column) is good, while a "-" means it is bad.
Output must contain *n* lines, each line must contain a string of *m* characters. The *j*-th character of the *i*-th string should be either "W", "B" or "-". Character "W" means the chessman on the cell is white, "B" means it is black, "-" means the cell is a bad cell. If multiple answers exist, print any of them. It is guaranteed that at least one answer exists.
[ "1 1\n.\n", "2 2\n..\n..\n", "3 3\n.-.\n---\n--." ]
[ "B\n", "BW\nWB\n", "B-B\n---\n--B" ]
In the first sample, DZY puts a single black chessman. Of course putting a white one is also OK. In the second sample, all 4 cells are good. No two same chessmen share an edge in the sample output. In the third sample, no good cells are adjacent. So you can just put 3 chessmen, no matter what their colors are.
500
[ { "input": "1 1\n.", "output": "B" }, { "input": "2 2\n..\n..", "output": "BW\nWB" }, { "input": "3 3\n.-.\n---\n--.", "output": "B-B\n---\n--B" }, { "input": "3 1\n-\n.\n.", "output": "-\nW\nB" }, { "input": "11 11\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------", "output": "-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------\n-----------" }, { "input": "1 1\n-", "output": "-" }, { "input": "4 2\n..\n..\n..\n..", "output": "BW\nWB\nBW\nWB" }, { "input": "5 1\n.\n.\n.\n.\n.", "output": "B\nW\nB\nW\nB" } ]
1,628,207,698
2,147,483,647
Python 3
OK
TESTS
37
77
6,963,200
n_m = input().split() cells_array = [] A=['B','W'] for i in range(int(n_m[0])): cells = input() cells_list = list(cells) cells_array.append(cells_list) for j in range(len(cells_array)): for k in range(int(n_m[1])): if cells_array[j][k] == '.': cells_array[j][k]=A[(j+k)%2] for i in range(int(n_m[0])): print (''.join(cells_array[i]))
Title: DZY Loves Chessboard Time Limit: None seconds Memory Limit: None megabytes Problem Description: DZY loves chessboard, and he enjoys playing with it. He has a chessboard of *n* rows and *m* columns. Some cells of the chessboard are bad, others are good. For every good cell, DZY wants to put a chessman on it. Each chessman is either white or black. After putting all chessmen, DZY wants that no two chessmen with the same color are on two adjacent cells. Two cells are adjacent if and only if they share a common edge. You task is to find any suitable placement of chessmen on the given chessboard. Input Specification: The first line contains two space-separated integers *n* and *m* (1<=≀<=*n*,<=*m*<=≀<=100). Each of the next *n* lines contains a string of *m* characters: the *j*-th character of the *i*-th string is either "." or "-". A "." means that the corresponding cell (in the *i*-th row and the *j*-th column) is good, while a "-" means it is bad. Output Specification: Output must contain *n* lines, each line must contain a string of *m* characters. The *j*-th character of the *i*-th string should be either "W", "B" or "-". Character "W" means the chessman on the cell is white, "B" means it is black, "-" means the cell is a bad cell. If multiple answers exist, print any of them. It is guaranteed that at least one answer exists. Demo Input: ['1 1\n.\n', '2 2\n..\n..\n', '3 3\n.-.\n---\n--.'] Demo Output: ['B\n', 'BW\nWB\n', 'B-B\n---\n--B'] Note: In the first sample, DZY puts a single black chessman. Of course putting a white one is also OK. In the second sample, all 4 cells are good. No two same chessmen share an edge in the sample output. In the third sample, no good cells are adjacent. So you can just put 3 chessmen, no matter what their colors are.
```python n_m = input().split() cells_array = [] A=['B','W'] for i in range(int(n_m[0])): cells = input() cells_list = list(cells) cells_array.append(cells_list) for j in range(len(cells_array)): for k in range(int(n_m[1])): if cells_array[j][k] == '.': cells_array[j][k]=A[(j+k)%2] for i in range(int(n_m[0])): print (''.join(cells_array[i])) ```
3
770
A
New Password
PROGRAMMING
800
[ "*special", "implementation" ]
null
null
Innokentiy decides to change the password in the social net "Contact!", but he is too lazy to invent a new password by himself. That is why he needs your help. Innokentiy decides that new password should satisfy the following conditions: - the length of the password must be equal to *n*, - the password should consist only of lowercase Latin letters, - the number of distinct symbols in the password must be equal to *k*, - any two consecutive symbols in the password must be distinct. Your task is to help Innokentiy and to invent a new password which will satisfy all given conditions.
The first line contains two positive integers *n* and *k* (2<=≀<=*n*<=≀<=100, 2<=≀<=*k*<=≀<=*min*(*n*,<=26)) β€” the length of the password and the number of distinct symbols in it. Pay attention that a desired new password always exists.
Print any password which satisfies all conditions given by Innokentiy.
[ "4 3\n", "6 6\n", "5 2\n" ]
[ "java\n", "python\n", "phphp\n" ]
In the first test there is one of the appropriate new passwords β€” java, because its length is equal to 4 and 3 distinct lowercase letters a, j and v are used in it. In the second test there is one of the appropriate new passwords β€” python, because its length is equal to 6 and it consists of 6 distinct lowercase letters. In the third test there is one of the appropriate new passwords β€” phphp, because its length is equal to 5 and 2 distinct lowercase letters p and h are used in it. Pay attention the condition that no two identical symbols are consecutive is correct for all appropriate passwords in tests.
500
[ { "input": "4 3", "output": "abca" }, { "input": "6 6", "output": "abcdef" }, { "input": "5 2", "output": "ababa" }, { "input": "3 2", "output": "aba" }, { "input": "10 2", "output": "ababababab" }, { "input": "26 13", "output": "abcdefghijklmabcdefghijklm" }, { "input": "100 2", "output": "abababababababababababababababababababababababababababababababababababababababababababababababababab" }, { "input": "100 10", "output": "abcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghijabcdefghij" }, { "input": "3 3", "output": "abc" }, { "input": "6 3", "output": "abcabc" }, { "input": "10 3", "output": "abcabcabca" }, { "input": "50 3", "output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcab" }, { "input": "90 2", "output": "ababababababababababababababababababababababababababababababababababababababababababababab" }, { "input": "6 2", "output": "ababab" }, { "input": "99 3", "output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabc" }, { "input": "4 2", "output": "abab" }, { "input": "100 3", "output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabca" }, { "input": "40 22", "output": "abcdefghijklmnopqrstuvabcdefghijklmnopqr" }, { "input": "13 8", "output": "abcdefghabcde" }, { "input": "16 15", "output": "abcdefghijklmnoa" }, { "input": "17 17", "output": "abcdefghijklmnopq" }, { "input": "19 4", "output": "abcdabcdabcdabcdabc" }, { "input": "100 26", "output": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuv" }, { "input": "100 25", "output": "abcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxy" }, { "input": "26 26", "output": "abcdefghijklmnopqrstuvwxyz" }, { "input": "27 26", "output": "abcdefghijklmnopqrstuvwxyza" }, { "input": "2 2", "output": "ab" }, { "input": "26 25", "output": "abcdefghijklmnopqrstuvwxya" }, { "input": "99 2", "output": "abababababababababababababababababababababababababababababababababababababababababababababababababa" }, { "input": "99 26", "output": "abcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstuvwxyzabcdefghijklmnopqrstu" }, { "input": "4 4", "output": "abcd" }, { "input": "5 3", "output": "abcab" }, { "input": "5 4", "output": "abcda" }, { "input": "5 5", "output": "abcde" }, { "input": "24 22", "output": "abcdefghijklmnopqrstuvab" }, { "input": "26 14", "output": "abcdefghijklmnabcdefghijkl" }, { "input": "26 15", "output": "abcdefghijklmnoabcdefghijk" }, { "input": "30 12", "output": "abcdefghijklabcdefghijklabcdef" }, { "input": "35 4", "output": "abcdabcdabcdabcdabcdabcdabcdabcdabc" }, { "input": "79 3", "output": "abcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabcabca" }, { "input": "79 14", "output": "abcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghijklmnabcdefghi" }, { "input": "85 13", "output": "abcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefghijklmabcdefg" }, { "input": "90 25", "output": "abcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmnopqrstuvwxyabcdefghijklmno" }, { "input": "90 19", "output": "abcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmnopqrsabcdefghijklmn" }, { "input": "26 24", "output": "abcdefghijklmnopqrstuvwxab" }, { "input": "100 17", "output": "abcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmnopqabcdefghijklmno" }, { "input": "26 2", "output": "ababababababababababababab" } ]
1,609,921,084
2,147,483,647
Python 3
OK
TESTS
47
109
0
n, k = [int(x) for x in input().split()] origk = k res = "" while n>0: k = origk o = 97 while k>0 and n>0: res = res+ chr(o) o+=1 k-=1 n-=1 print(res)
Title: New Password Time Limit: None seconds Memory Limit: None megabytes Problem Description: Innokentiy decides to change the password in the social net "Contact!", but he is too lazy to invent a new password by himself. That is why he needs your help. Innokentiy decides that new password should satisfy the following conditions: - the length of the password must be equal to *n*, - the password should consist only of lowercase Latin letters, - the number of distinct symbols in the password must be equal to *k*, - any two consecutive symbols in the password must be distinct. Your task is to help Innokentiy and to invent a new password which will satisfy all given conditions. Input Specification: The first line contains two positive integers *n* and *k* (2<=≀<=*n*<=≀<=100, 2<=≀<=*k*<=≀<=*min*(*n*,<=26)) β€” the length of the password and the number of distinct symbols in it. Pay attention that a desired new password always exists. Output Specification: Print any password which satisfies all conditions given by Innokentiy. Demo Input: ['4 3\n', '6 6\n', '5 2\n'] Demo Output: ['java\n', 'python\n', 'phphp\n'] Note: In the first test there is one of the appropriate new passwords β€” java, because its length is equal to 4 and 3 distinct lowercase letters a, j and v are used in it. In the second test there is one of the appropriate new passwords β€” python, because its length is equal to 6 and it consists of 6 distinct lowercase letters. In the third test there is one of the appropriate new passwords β€” phphp, because its length is equal to 5 and 2 distinct lowercase letters p and h are used in it. Pay attention the condition that no two identical symbols are consecutive is correct for all appropriate passwords in tests.
```python n, k = [int(x) for x in input().split()] origk = k res = "" while n>0: k = origk o = 97 while k>0 and n>0: res = res+ chr(o) o+=1 k-=1 n-=1 print(res) ```
3
987
A
Infinity Gauntlet
PROGRAMMING
800
[ "implementation" ]
null
null
You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems: - the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the Soul Gem of orange color, - the Reality Gem of red color, - the Mind Gem of yellow color. Using colors of Gems you saw in the Gauntlet determine the names of absent Gems.
In the first line of input there is one integer $n$ ($0 \le n \le 6$)Β β€” the number of Gems in Infinity Gauntlet. In next $n$ lines there are colors of Gems you saw. Words used for colors are: purple, green, blue, orange, red, yellow. It is guaranteed that all the colors are distinct. All colors are given in lowercase English letters.
In the first line output one integer $m$ ($0 \le m \le 6$)Β β€” the number of absent Gems. Then in $m$ lines print the names of absent Gems, each on its own line. Words used for names are: Power, Time, Space, Soul, Reality, Mind. Names can be printed in any order. Keep the first letter uppercase, others lowercase.
[ "4\nred\npurple\nyellow\norange\n", "0\n" ]
[ "2\nSpace\nTime\n", "6\nTime\nMind\nSoul\nPower\nReality\nSpace\n" ]
In the first sample Thanos already has Reality, Power, Mind and Soul Gems, so he needs two more: Time and Space. In the second sample Thanos doesn't have any Gems, so he needs all six.
500
[ { "input": "4\nred\npurple\nyellow\norange", "output": "2\nSpace\nTime" }, { "input": "0", "output": "6\nMind\nSpace\nPower\nTime\nReality\nSoul" }, { "input": "6\npurple\nblue\nyellow\nred\ngreen\norange", "output": "0" }, { "input": "1\npurple", "output": "5\nTime\nReality\nSoul\nSpace\nMind" }, { "input": "3\nblue\norange\npurple", "output": "3\nTime\nReality\nMind" }, { "input": "2\nyellow\nred", "output": "4\nPower\nSoul\nSpace\nTime" }, { "input": "1\ngreen", "output": "5\nReality\nSpace\nPower\nSoul\nMind" }, { "input": "2\npurple\ngreen", "output": "4\nReality\nMind\nSpace\nSoul" }, { "input": "1\nblue", "output": "5\nPower\nReality\nSoul\nTime\nMind" }, { "input": "2\npurple\nblue", "output": "4\nMind\nSoul\nTime\nReality" }, { "input": "2\ngreen\nblue", "output": "4\nReality\nMind\nPower\nSoul" }, { "input": "3\npurple\ngreen\nblue", "output": "3\nMind\nReality\nSoul" }, { "input": "1\norange", "output": "5\nReality\nTime\nPower\nSpace\nMind" }, { "input": "2\npurple\norange", "output": "4\nReality\nMind\nTime\nSpace" }, { "input": "2\norange\ngreen", "output": "4\nSpace\nMind\nReality\nPower" }, { "input": "3\norange\npurple\ngreen", "output": "3\nReality\nSpace\nMind" }, { "input": "2\norange\nblue", "output": "4\nTime\nMind\nReality\nPower" }, { "input": "3\nblue\ngreen\norange", "output": "3\nPower\nMind\nReality" }, { "input": "4\nblue\norange\ngreen\npurple", "output": "2\nMind\nReality" }, { "input": "1\nred", "output": "5\nTime\nSoul\nMind\nPower\nSpace" }, { "input": "2\nred\npurple", "output": "4\nMind\nSpace\nTime\nSoul" }, { "input": "2\nred\ngreen", "output": "4\nMind\nSpace\nPower\nSoul" }, { "input": "3\nred\npurple\ngreen", "output": "3\nSoul\nSpace\nMind" }, { "input": "2\nblue\nred", "output": "4\nMind\nTime\nPower\nSoul" }, { "input": "3\nred\nblue\npurple", "output": "3\nTime\nMind\nSoul" }, { "input": "3\nred\nblue\ngreen", "output": "3\nSoul\nPower\nMind" }, { "input": "4\npurple\nblue\ngreen\nred", "output": "2\nMind\nSoul" }, { "input": "2\norange\nred", "output": "4\nPower\nMind\nTime\nSpace" }, { "input": "3\nred\norange\npurple", "output": "3\nMind\nSpace\nTime" }, { "input": "3\nred\norange\ngreen", "output": "3\nMind\nSpace\nPower" }, { "input": "4\nred\norange\ngreen\npurple", "output": "2\nSpace\nMind" }, { "input": "3\nblue\norange\nred", "output": "3\nPower\nMind\nTime" }, { "input": "4\norange\nblue\npurple\nred", "output": "2\nTime\nMind" }, { "input": "4\ngreen\norange\nred\nblue", "output": "2\nMind\nPower" }, { "input": "5\npurple\norange\nblue\nred\ngreen", "output": "1\nMind" }, { "input": "1\nyellow", "output": "5\nPower\nSoul\nReality\nSpace\nTime" }, { "input": "2\npurple\nyellow", "output": "4\nTime\nReality\nSpace\nSoul" }, { "input": "2\ngreen\nyellow", "output": "4\nSpace\nReality\nPower\nSoul" }, { "input": "3\npurple\nyellow\ngreen", "output": "3\nSoul\nReality\nSpace" }, { "input": "2\nblue\nyellow", "output": "4\nTime\nReality\nPower\nSoul" }, { "input": "3\nyellow\nblue\npurple", "output": "3\nSoul\nReality\nTime" }, { "input": "3\ngreen\nyellow\nblue", "output": "3\nSoul\nReality\nPower" }, { "input": "4\nyellow\nblue\ngreen\npurple", "output": "2\nReality\nSoul" }, { "input": "2\nyellow\norange", "output": "4\nTime\nSpace\nReality\nPower" }, { "input": "3\nyellow\npurple\norange", "output": "3\nSpace\nReality\nTime" }, { "input": "3\norange\nyellow\ngreen", "output": "3\nSpace\nReality\nPower" }, { "input": "4\ngreen\nyellow\norange\npurple", "output": "2\nSpace\nReality" }, { "input": "3\nyellow\nblue\norange", "output": "3\nTime\nReality\nPower" }, { "input": "4\norange\npurple\nblue\nyellow", "output": "2\nReality\nTime" }, { "input": "4\nblue\norange\nyellow\ngreen", "output": "2\nReality\nPower" }, { "input": "5\ngreen\nyellow\norange\nblue\npurple", "output": "1\nReality" }, { "input": "3\nyellow\npurple\nred", "output": "3\nTime\nSoul\nSpace" }, { "input": "3\nred\ngreen\nyellow", "output": "3\nPower\nSoul\nSpace" }, { "input": "4\nred\npurple\ngreen\nyellow", "output": "2\nSpace\nSoul" }, { "input": "3\nred\nyellow\nblue", "output": "3\nPower\nSoul\nTime" }, { "input": "4\nblue\nyellow\nred\npurple", "output": "2\nTime\nSoul" }, { "input": "4\nblue\nyellow\nred\ngreen", "output": "2\nSoul\nPower" }, { "input": "5\nred\nyellow\ngreen\nblue\npurple", "output": "1\nSoul" }, { "input": "3\nred\nyellow\norange", "output": "3\nPower\nSpace\nTime" }, { "input": "4\norange\ngreen\nyellow\nred", "output": "2\nPower\nSpace" }, { "input": "5\norange\nred\ngreen\nyellow\npurple", "output": "1\nSpace" }, { "input": "4\nyellow\nred\norange\nblue", "output": "2\nTime\nPower" }, { "input": "5\npurple\nblue\norange\nyellow\nred", "output": "1\nTime" }, { "input": "5\norange\nblue\nyellow\nred\ngreen", "output": "1\nPower" } ]
1,622,906,107
2,147,483,647
Python 3
OK
TESTS
64
109
0
# -*- coding: utf-8 -*- """ Created on Sat Jun 5 23:05:06 2021 @author: nagan """ n = int(input()) d = {'purple':'Power', 'green':'Time', 'blue':'Space', 'orange':'Soul', 'red':'Reality', 'yellow':'Mind'} for i in range(n): a = input() d.pop(a) print(len(d)) for i in d: print(d[i])
Title: Infinity Gauntlet Time Limit: None seconds Memory Limit: None megabytes Problem Description: You took a peek on Thanos wearing Infinity Gauntlet. In the Gauntlet there is a place for six Infinity Gems: - the Power Gem of purple color, - the Time Gem of green color, - the Space Gem of blue color, - the Soul Gem of orange color, - the Reality Gem of red color, - the Mind Gem of yellow color. Using colors of Gems you saw in the Gauntlet determine the names of absent Gems. Input Specification: In the first line of input there is one integer $n$ ($0 \le n \le 6$)Β β€” the number of Gems in Infinity Gauntlet. In next $n$ lines there are colors of Gems you saw. Words used for colors are: purple, green, blue, orange, red, yellow. It is guaranteed that all the colors are distinct. All colors are given in lowercase English letters. Output Specification: In the first line output one integer $m$ ($0 \le m \le 6$)Β β€” the number of absent Gems. Then in $m$ lines print the names of absent Gems, each on its own line. Words used for names are: Power, Time, Space, Soul, Reality, Mind. Names can be printed in any order. Keep the first letter uppercase, others lowercase. Demo Input: ['4\nred\npurple\nyellow\norange\n', '0\n'] Demo Output: ['2\nSpace\nTime\n', '6\nTime\nMind\nSoul\nPower\nReality\nSpace\n'] Note: In the first sample Thanos already has Reality, Power, Mind and Soul Gems, so he needs two more: Time and Space. In the second sample Thanos doesn't have any Gems, so he needs all six.
```python # -*- coding: utf-8 -*- """ Created on Sat Jun 5 23:05:06 2021 @author: nagan """ n = int(input()) d = {'purple':'Power', 'green':'Time', 'blue':'Space', 'orange':'Soul', 'red':'Reality', 'yellow':'Mind'} for i in range(n): a = input() d.pop(a) print(len(d)) for i in d: print(d[i]) ```
3
119
A
Epic Game
PROGRAMMING
800
[ "implementation" ]
null
null
Simon and Antisimon play a game. Initially each player receives one fixed positive integer that doesn't change throughout the game. Simon receives number *a* and Antisimon receives number *b*. They also have a heap of *n* stones. The players take turns to make a move and Simon starts. During a move a player should take from the heap the number of stones equal to the greatest common divisor of the fixed number he has received and the number of stones left in the heap. A player loses when he cannot take the required number of stones (i. e. the heap has strictly less stones left than one needs to take). Your task is to determine by the given *a*, *b* and *n* who wins the game.
The only string contains space-separated integers *a*, *b* and *n* (1<=≀<=*a*,<=*b*,<=*n*<=≀<=100) β€” the fixed numbers Simon and Antisimon have received correspondingly and the initial number of stones in the pile.
If Simon wins, print "0" (without the quotes), otherwise print "1" (without the quotes).
[ "3 5 9\n", "1 1 100\n" ]
[ "0", "1" ]
The greatest common divisor of two non-negative integers *a* and *b* is such maximum positive integer *k*, that *a* is divisible by *k* without remainder and similarly, *b* is divisible by *k* without remainder. Let *gcd*(*a*, *b*) represent the operation of calculating the greatest common divisor of numbers *a* and *b*. Specifically, *gcd*(*x*, 0) = *gcd*(0, *x*) = *x*. In the first sample the game will go like that: - Simon should take *gcd*(3, 9) = 3 stones from the heap. After his move the heap has 6 stones left.- Antisimon should take *gcd*(5, 6) = 1 stone from the heap. After his move the heap has 5 stones left.- Simon should take *gcd*(3, 5) = 1 stone from the heap. After his move the heap has 4 stones left.- Antisimon should take *gcd*(5, 4) = 1 stone from the heap. After his move the heap has 3 stones left.- Simon should take *gcd*(3, 3) = 3 stones from the heap. After his move the heap has 0 stones left.- Antisimon should take *gcd*(5, 0) = 5 stones from the heap. As 0 &lt; 5, it is impossible and Antisimon loses. In the second sample each player during each move takes one stone from the heap. As *n* is even, Antisimon takes the last stone and Simon can't make a move after that.
500
[ { "input": "3 5 9", "output": "0" }, { "input": "1 1 100", "output": "1" }, { "input": "23 12 16", "output": "1" }, { "input": "95 26 29", "output": "1" }, { "input": "73 32 99", "output": "1" }, { "input": "1 1 1", "output": "0" }, { "input": "41 12 65", "output": "1" }, { "input": "13 61 100", "output": "1" }, { "input": "100 100 10", "output": "0" }, { "input": "12 24 26", "output": "1" }, { "input": "73 21 96", "output": "1" }, { "input": "17 22 81", "output": "1" }, { "input": "14 88 97", "output": "1" }, { "input": "42 81 17", "output": "0" }, { "input": "34 36 19", "output": "1" }, { "input": "21 87 12", "output": "1" }, { "input": "97 92 98", "output": "1" }, { "input": "49 25 62", "output": "1" }, { "input": "29 17 44", "output": "1" }, { "input": "10 1 10", "output": "0" }, { "input": "99 98 100", "output": "1" }, { "input": "100 100 1", "output": "0" }, { "input": "11 99 55", "output": "0" }, { "input": "8 13 21", "output": "0" }, { "input": "34 55 89", "output": "0" }, { "input": "21 34 55", "output": "1" }, { "input": "13 21 34", "output": "1" }, { "input": "34 21 55", "output": "0" }, { "input": "10 20 84", "output": "1" }, { "input": "4 2 5", "output": "0" }, { "input": "3 2 3", "output": "0" }, { "input": "31 23 1", "output": "0" }, { "input": "100 100 100", "output": "0" }, { "input": "100 1 100", "output": "0" }, { "input": "1 100 100", "output": "1" }, { "input": "1 1 100", "output": "1" }, { "input": "17 23 100", "output": "1" }, { "input": "99 98 100", "output": "1" }, { "input": "1 1 2", "output": "1" }, { "input": "2 1 1", "output": "0" }, { "input": "1 2 1", "output": "0" }, { "input": "2 1 2", "output": "0" }, { "input": "10 10 3", "output": "1" }, { "input": "2 2 1", "output": "0" }, { "input": "9 5 1", "output": "0" } ]
1,590,509,171
2,147,483,647
PyPy 3
OK
TESTS
45
280
0
a, b, c = map(int, input().split()) e = 1 def gcd(x, y): if y == 0: return x else: return gcd(y, x % y) while True: if e % 2 != 0: s = gcd(a, c) else: s = gcd(b, c) if s > c: break else: c -= s e += 1 if e % 2 == 0: print(0) else: print(1)
Title: Epic Game Time Limit: None seconds Memory Limit: None megabytes Problem Description: Simon and Antisimon play a game. Initially each player receives one fixed positive integer that doesn't change throughout the game. Simon receives number *a* and Antisimon receives number *b*. They also have a heap of *n* stones. The players take turns to make a move and Simon starts. During a move a player should take from the heap the number of stones equal to the greatest common divisor of the fixed number he has received and the number of stones left in the heap. A player loses when he cannot take the required number of stones (i. e. the heap has strictly less stones left than one needs to take). Your task is to determine by the given *a*, *b* and *n* who wins the game. Input Specification: The only string contains space-separated integers *a*, *b* and *n* (1<=≀<=*a*,<=*b*,<=*n*<=≀<=100) β€” the fixed numbers Simon and Antisimon have received correspondingly and the initial number of stones in the pile. Output Specification: If Simon wins, print "0" (without the quotes), otherwise print "1" (without the quotes). Demo Input: ['3 5 9\n', '1 1 100\n'] Demo Output: ['0', '1'] Note: The greatest common divisor of two non-negative integers *a* and *b* is such maximum positive integer *k*, that *a* is divisible by *k* without remainder and similarly, *b* is divisible by *k* without remainder. Let *gcd*(*a*, *b*) represent the operation of calculating the greatest common divisor of numbers *a* and *b*. Specifically, *gcd*(*x*, 0) = *gcd*(0, *x*) = *x*. In the first sample the game will go like that: - Simon should take *gcd*(3, 9) = 3 stones from the heap. After his move the heap has 6 stones left.- Antisimon should take *gcd*(5, 6) = 1 stone from the heap. After his move the heap has 5 stones left.- Simon should take *gcd*(3, 5) = 1 stone from the heap. After his move the heap has 4 stones left.- Antisimon should take *gcd*(5, 4) = 1 stone from the heap. After his move the heap has 3 stones left.- Simon should take *gcd*(3, 3) = 3 stones from the heap. After his move the heap has 0 stones left.- Antisimon should take *gcd*(5, 0) = 5 stones from the heap. As 0 &lt; 5, it is impossible and Antisimon loses. In the second sample each player during each move takes one stone from the heap. As *n* is even, Antisimon takes the last stone and Simon can't make a move after that.
```python a, b, c = map(int, input().split()) e = 1 def gcd(x, y): if y == 0: return x else: return gcd(y, x % y) while True: if e % 2 != 0: s = gcd(a, c) else: s = gcd(b, c) if s > c: break else: c -= s e += 1 if e % 2 == 0: print(0) else: print(1) ```
3
764
A
Taymyr is calling you
PROGRAMMING
800
[ "brute force", "implementation", "math" ]
null
null
Comrade Dujikov is busy choosing artists for Timofey's birthday and is recieving calls from Taymyr from Ilia-alpinist. Ilia-alpinist calls every *n* minutes, i.e. in minutes *n*, 2*n*, 3*n* and so on. Artists come to the comrade every *m* minutes, i.e. in minutes *m*, 2*m*, 3*m* and so on. The day is *z* minutes long, i.e. the day consists of minutes 1,<=2,<=...,<=*z*. How many artists should be killed so that there are no artists in the room when Ilia calls? Consider that a call and a talk with an artist take exactly one minute.
The only string contains three integersΒ β€” *n*, *m* and *z* (1<=≀<=*n*,<=*m*,<=*z*<=≀<=104).
Print single integerΒ β€” the minimum number of artists that should be killed so that there are no artists in the room when Ilia calls.
[ "1 1 10\n", "1 2 5\n", "2 3 9\n" ]
[ "10\n", "2\n", "1\n" ]
Taymyr is a place in the north of Russia. In the first test the artists come each minute, as well as the calls, so we need to kill all of them. In the second test we need to kill artists which come on the second and the fourth minutes. In the third testΒ β€” only the artist which comes on the sixth minute.
500
[ { "input": "1 1 10", "output": "10" }, { "input": "1 2 5", "output": "2" }, { "input": "2 3 9", "output": "1" }, { "input": "4 8 9", "output": "1" }, { "input": "7 9 2", "output": "0" }, { "input": "10000 10000 10000", "output": "1" }, { "input": "24 22 9235", "output": "34" }, { "input": "74 8 417", "output": "1" }, { "input": "972 1 203", "output": "0" }, { "input": "550 1 754", "output": "1" }, { "input": "860 1 884", "output": "1" }, { "input": "358 2 809", "output": "2" }, { "input": "33 27 216", "output": "0" }, { "input": "2940 1 9311", "output": "3" }, { "input": "4624 1 1953", "output": "0" }, { "input": "2696 2 7345", "output": "2" }, { "input": "3443 2 6701", "output": "0" }, { "input": "3 613 2275", "output": "1" }, { "input": "1 10000 10000", "output": "1" }, { "input": "10000 1 10000", "output": "1" }, { "input": "1 1 1", "output": "1" }, { "input": "1 1 10000", "output": "10000" }, { "input": "34 27 10000", "output": "10" }, { "input": "2 2 9999", "output": "4999" }, { "input": "2 2 1", "output": "0" }, { "input": "6 4 36", "output": "3" }, { "input": "33 6 3005", "output": "45" }, { "input": "5 1 20", "output": "4" }, { "input": "1 2 10", "output": "5" }, { "input": "2 1 100", "output": "50" }, { "input": "10 20 10000", "output": "500" }, { "input": "8 12 12", "output": "0" } ]
1,583,289,489
2,147,483,647
PyPy 3
OK
TESTS
32
155
2,150,400
n,m,z=map(int,input().split()) x,y=[],[] for i in range(1,z//n+1): x.append(n*i) for i in range(1,z//m+1): y.append(m*i) l=set(x)&set(y) print(len(l))
Title: Taymyr is calling you Time Limit: None seconds Memory Limit: None megabytes Problem Description: Comrade Dujikov is busy choosing artists for Timofey's birthday and is recieving calls from Taymyr from Ilia-alpinist. Ilia-alpinist calls every *n* minutes, i.e. in minutes *n*, 2*n*, 3*n* and so on. Artists come to the comrade every *m* minutes, i.e. in minutes *m*, 2*m*, 3*m* and so on. The day is *z* minutes long, i.e. the day consists of minutes 1,<=2,<=...,<=*z*. How many artists should be killed so that there are no artists in the room when Ilia calls? Consider that a call and a talk with an artist take exactly one minute. Input Specification: The only string contains three integersΒ β€” *n*, *m* and *z* (1<=≀<=*n*,<=*m*,<=*z*<=≀<=104). Output Specification: Print single integerΒ β€” the minimum number of artists that should be killed so that there are no artists in the room when Ilia calls. Demo Input: ['1 1 10\n', '1 2 5\n', '2 3 9\n'] Demo Output: ['10\n', '2\n', '1\n'] Note: Taymyr is a place in the north of Russia. In the first test the artists come each minute, as well as the calls, so we need to kill all of them. In the second test we need to kill artists which come on the second and the fourth minutes. In the third testΒ β€” only the artist which comes on the sixth minute.
```python n,m,z=map(int,input().split()) x,y=[],[] for i in range(1,z//n+1): x.append(n*i) for i in range(1,z//m+1): y.append(m*i) l=set(x)&set(y) print(len(l)) ```
3
44
A
Indian Summer
PROGRAMMING
900
[ "implementation" ]
A. Indian Summer
2
256
Indian summer is such a beautiful time of the year! A girl named Alyona is walking in the forest and picking a bouquet from fallen leaves. Alyona is very choosy β€” she doesn't take a leaf if it matches the color and the species of the tree of one of the leaves she already has. Find out how many leaves Alyona has picked.
The first line contains an integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of leaves Alyona has found. The next *n* lines contain the leaves' descriptions. Each leaf is characterized by the species of the tree it has fallen from and by the color. The species of the trees and colors are given in names, consisting of no more than 10 lowercase Latin letters. A name can not be an empty string. The species of a tree and the color are given in each line separated by a space.
Output the single number β€” the number of Alyona's leaves.
[ "5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green\n", "3\noak yellow\noak yellow\noak yellow\n" ]
[ "4\n", "1\n" ]
none
0
[ { "input": "5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green", "output": "4" }, { "input": "3\noak yellow\noak yellow\noak yellow", "output": "1" }, { "input": "5\nxbnbkzn hp\nkaqkl vrgzbvqstu\nj aqidx\nhos gyul\nwefxmh tygpluae", "output": "5" }, { "input": "1\nqvwli hz", "output": "1" }, { "input": "4\nsrhk x\nsrhk x\nqfoe vnrjuab\nqfoe vnrjuab", "output": "2" }, { "input": "4\nsddqllmmpk syded\nfprsq fnenjnaz\nn hdej\nsddqllmmpk syded", "output": "3" }, { "input": "17\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw\njtbctslqq tosqzw", "output": "1" }, { "input": "18\nb d\nrfdb esp\nrfdb esp\nb d\nrfdb esp\nrfdb esp\nb d\nb d\nrfdb esp\nrfdb esp\nb d\nrfdb esp\nb d\nrfdb esp\nb d\nb d\nrfdb esp\nrfdb esp", "output": "2" }, { "input": "13\nsvpzwtwn rykzfdce\nqweiyeck jkreouy\nhk nnli\ntwxrnbbdt vtuv\nxokqjtylly sz\nesdt dbfidjslq\ng ybqgomvw\nxcpfjmf zcqvz\nifajadhj invzueip\nvdemdnxifb hckwebmi\nsdpnhipam wvowzavh\nuqdlfskhgo vunbpghae\ne dtigwnb", "output": "13" }, { "input": "20\nm vkfh\nvptikamead mvx\nitu mf\nklruxckw aqega\nekqkd enjllwol\ncc uybfdh\nimrfdngvo u\ne uh\ntwt jsslcfuogk\nbljwqsag tuqbdn\nqcv q\nasx gzhvwwmajj\nqcv q\nekqkd enjllwol\nasx gzhvwwmajj\nks vv\nkzyfi cn\ncc uybfdh\nitu mf\ncjbjhtbyvk vatwfmux", "output": "15" }, { "input": "2\nab ab\na bab", "output": "2" } ]
1,651,940,084
2,147,483,647
Python 3
OK
TESTS
29
92
0
# your code goes here n=int(input()) lst1=set() for i in range(n): s=input() lst1.add(s) print(len(lst1))
Title: Indian Summer Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Indian summer is such a beautiful time of the year! A girl named Alyona is walking in the forest and picking a bouquet from fallen leaves. Alyona is very choosy β€” she doesn't take a leaf if it matches the color and the species of the tree of one of the leaves she already has. Find out how many leaves Alyona has picked. Input Specification: The first line contains an integer *n* (1<=≀<=*n*<=≀<=100) β€” the number of leaves Alyona has found. The next *n* lines contain the leaves' descriptions. Each leaf is characterized by the species of the tree it has fallen from and by the color. The species of the trees and colors are given in names, consisting of no more than 10 lowercase Latin letters. A name can not be an empty string. The species of a tree and the color are given in each line separated by a space. Output Specification: Output the single number β€” the number of Alyona's leaves. Demo Input: ['5\nbirch yellow\nmaple red\nbirch yellow\nmaple yellow\nmaple green\n', '3\noak yellow\noak yellow\noak yellow\n'] Demo Output: ['4\n', '1\n'] Note: none
```python # your code goes here n=int(input()) lst1=set() for i in range(n): s=input() lst1.add(s) print(len(lst1)) ```
3.977
264
A
Escape from Stones
PROGRAMMING
1,200
[ "constructive algorithms", "data structures", "implementation", "two pointers" ]
null
null
Squirrel Liss lived in a forest peacefully, but unexpected trouble happens. Stones fall from a mountain. Initially Squirrel Liss occupies an interval [0,<=1]. Next, *n* stones will fall and Liss will escape from the stones. The stones are numbered from 1 to *n* in order. The stones always fall to the center of Liss's interval. When Liss occupies the interval [*k*<=-<=*d*,<=*k*<=+<=*d*] and a stone falls to *k*, she will escape to the left or to the right. If she escapes to the left, her new interval will be [*k*<=-<=*d*,<=*k*]. If she escapes to the right, her new interval will be [*k*,<=*k*<=+<=*d*]. You are given a string *s* of length *n*. If the *i*-th character of *s* is "l" or "r", when the *i*-th stone falls Liss will escape to the left or to the right, respectively. Find the sequence of stones' numbers from left to right after all the *n* stones falls.
The input consists of only one line. The only line contains the string *s* (1<=≀<=|*s*|<=≀<=106). Each character in *s* will be either "l" or "r".
Output *n* lines β€” on the *i*-th line you should print the *i*-th stone's number from the left.
[ "llrlr\n", "rrlll\n", "lrlrr\n" ]
[ "3\n5\n4\n2\n1\n", "1\n2\n5\n4\n3\n", "2\n4\n5\n3\n1\n" ]
In the first example, the positions of stones 1, 2, 3, 4, 5 will be <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/58fdb5684df807bfcb705a9da9ce175613362b7d.png" style="max-width: 100.0%;max-height: 100.0%;"/>, respectively. So you should print the sequence: 3, 5, 4, 2, 1.
500
[ { "input": "llrlr", "output": "3\n5\n4\n2\n1" }, { "input": "rrlll", "output": "1\n2\n5\n4\n3" }, { "input": "lrlrr", "output": "2\n4\n5\n3\n1" }, { "input": "lllrlrllrl", "output": "4\n6\n9\n10\n8\n7\n5\n3\n2\n1" }, { "input": "llrlrrrlrr", "output": "3\n5\n6\n7\n9\n10\n8\n4\n2\n1" }, { "input": "rlrrrllrrr", "output": "1\n3\n4\n5\n8\n9\n10\n7\n6\n2" }, { "input": "lrrlrrllrrrrllllllrr", "output": "2\n3\n5\n6\n9\n10\n11\n12\n19\n20\n18\n17\n16\n15\n14\n13\n8\n7\n4\n1" }, { "input": "rlrrrlrrrllrrllrlrll", "output": "1\n3\n4\n5\n7\n8\n9\n12\n13\n16\n18\n20\n19\n17\n15\n14\n11\n10\n6\n2" }, { "input": "lllrrlrlrllrrrrrllrl", "output": "4\n5\n7\n9\n12\n13\n14\n15\n16\n19\n20\n18\n17\n11\n10\n8\n6\n3\n2\n1" }, { "input": "rrrllrrrlllrlllrlrrr", "output": "1\n2\n3\n6\n7\n8\n12\n16\n18\n19\n20\n17\n15\n14\n13\n11\n10\n9\n5\n4" }, { "input": "rrlllrrrlrrlrrrlllrlrlrrrlllrllrrllrllrrlrlrrllllrlrrrrlrlllrlrrrlrlrllrlrlrrlrrllrrrlrlrlllrrllllrl", "output": "1\n2\n6\n7\n8\n10\n11\n13\n14\n15\n19\n21\n23\n24\n25\n29\n32\n33\n36\n39\n40\n42\n44\n45\n50\n52\n53\n54\n55\n57\n61\n63\n64\n65\n67\n69\n72\n74\n76\n77\n79\n80\n83\n84\n85\n87\n89\n93\n94\n99\n100\n98\n97\n96\n95\n92\n91\n90\n88\n86\n82\n81\n78\n75\n73\n71\n70\n68\n66\n62\n60\n59\n58\n56\n51\n49\n48\n47\n46\n43\n41\n38\n37\n35\n34\n31\n30\n28\n27\n26\n22\n20\n18\n17\n16\n12\n9\n5\n4\n3" }, { "input": "llrlrlllrrllrllllrlrrlrlrrllrlrlrrlrrrrrrlllrrlrrrrrlrrrlrlrlrrlllllrrrrllrrlrlrrrllllrlrrlrrlrlrrll", "output": "3\n5\n9\n10\n13\n18\n20\n21\n23\n25\n26\n29\n31\n33\n34\n36\n37\n38\n39\n40\n41\n45\n46\n48\n49\n50\n51\n52\n54\n55\n56\n58\n60\n62\n63\n69\n70\n71\n72\n75\n76\n78\n80\n81\n82\n87\n89\n90\n92\n93\n95\n97\n98\n100\n99\n96\n94\n91\n88\n86\n85\n84\n83\n79\n77\n74\n73\n68\n67\n66\n65\n64\n61\n59\n57\n53\n47\n44\n43\n42\n35\n32\n30\n28\n27\n24\n22\n19\n17\n16\n15\n14\n12\n11\n8\n7\n6\n4\n2\n1" }, { "input": "llrrrrllrrlllrlrllrlrllllllrrrrrrrrllrrrrrrllrlrrrlllrrrrrrlllllllrrlrrllrrrllllrrlllrrrlrlrrlrlrllr", "output": "3\n4\n5\n6\n9\n10\n14\n16\n19\n21\n28\n29\n30\n31\n32\n33\n34\n35\n38\n39\n40\n41\n42\n43\n46\n48\n49\n50\n54\n55\n56\n57\n58\n59\n67\n68\n70\n71\n74\n75\n76\n81\n82\n86\n87\n88\n90\n92\n93\n95\n97\n100\n99\n98\n96\n94\n91\n89\n85\n84\n83\n80\n79\n78\n77\n73\n72\n69\n66\n65\n64\n63\n62\n61\n60\n53\n52\n51\n47\n45\n44\n37\n36\n27\n26\n25\n24\n23\n22\n20\n18\n17\n15\n13\n12\n11\n8\n7\n2\n1" }, { "input": "lllllrllrrlllrrrllrrrrlrrlrllllrrrrrllrlrllllllrrlrllrlrllrlrrlrlrrlrrrlrrrrllrlrrrrrrrllrllrrlrllrl", "output": "6\n9\n10\n14\n15\n16\n19\n20\n21\n22\n24\n25\n27\n32\n33\n34\n35\n36\n39\n41\n48\n49\n51\n54\n56\n59\n61\n62\n64\n66\n67\n69\n70\n71\n73\n74\n75\n76\n79\n81\n82\n83\n84\n85\n86\n87\n90\n93\n94\n96\n99\n100\n98\n97\n95\n92\n91\n89\n88\n80\n78\n77\n72\n68\n65\n63\n60\n58\n57\n55\n53\n52\n50\n47\n46\n45\n44\n43\n42\n40\n38\n37\n31\n30\n29\n28\n26\n23\n18\n17\n13\n12\n11\n8\n7\n5\n4\n3\n2\n1" }, { "input": "llrlrlrlrlrlrrlllllllrllllrllrrrlllrrllrllrrlllrrlllrlrrllllrrlllrrllrrllllrrlllrlllrrrllrrrrrrllrrl", "output": "3\n5\n7\n9\n11\n13\n14\n22\n27\n30\n31\n32\n36\n37\n40\n43\n44\n48\n49\n53\n55\n56\n61\n62\n66\n67\n70\n71\n76\n77\n81\n85\n86\n87\n90\n91\n92\n93\n94\n95\n98\n99\n100\n97\n96\n89\n88\n84\n83\n82\n80\n79\n78\n75\n74\n73\n72\n69\n68\n65\n64\n63\n60\n59\n58\n57\n54\n52\n51\n50\n47\n46\n45\n42\n41\n39\n38\n35\n34\n33\n29\n28\n26\n25\n24\n23\n21\n20\n19\n18\n17\n16\n15\n12\n10\n8\n6\n4\n2\n1" }, { "input": "l", "output": "1" }, { "input": "r", "output": "1" } ]
1,694,624,103
2,147,483,647
Python 3
OK
TESTS
57
1,528
50,995,200
s = input() l, r = [], [] for i in range(len(s)): if s[i] == 'l': l.append(i+1) else: r.append(i+1) for n in r: print(n) for i in range(len(l)-1,-1,-1): print(l[i])
Title: Escape from Stones Time Limit: None seconds Memory Limit: None megabytes Problem Description: Squirrel Liss lived in a forest peacefully, but unexpected trouble happens. Stones fall from a mountain. Initially Squirrel Liss occupies an interval [0,<=1]. Next, *n* stones will fall and Liss will escape from the stones. The stones are numbered from 1 to *n* in order. The stones always fall to the center of Liss's interval. When Liss occupies the interval [*k*<=-<=*d*,<=*k*<=+<=*d*] and a stone falls to *k*, she will escape to the left or to the right. If she escapes to the left, her new interval will be [*k*<=-<=*d*,<=*k*]. If she escapes to the right, her new interval will be [*k*,<=*k*<=+<=*d*]. You are given a string *s* of length *n*. If the *i*-th character of *s* is "l" or "r", when the *i*-th stone falls Liss will escape to the left or to the right, respectively. Find the sequence of stones' numbers from left to right after all the *n* stones falls. Input Specification: The input consists of only one line. The only line contains the string *s* (1<=≀<=|*s*|<=≀<=106). Each character in *s* will be either "l" or "r". Output Specification: Output *n* lines β€” on the *i*-th line you should print the *i*-th stone's number from the left. Demo Input: ['llrlr\n', 'rrlll\n', 'lrlrr\n'] Demo Output: ['3\n5\n4\n2\n1\n', '1\n2\n5\n4\n3\n', '2\n4\n5\n3\n1\n'] Note: In the first example, the positions of stones 1, 2, 3, 4, 5 will be <img align="middle" class="tex-formula" src="https://espresso.codeforces.com/58fdb5684df807bfcb705a9da9ce175613362b7d.png" style="max-width: 100.0%;max-height: 100.0%;"/>, respectively. So you should print the sequence: 3, 5, 4, 2, 1.
```python s = input() l, r = [], [] for i in range(len(s)): if s[i] == 'l': l.append(i+1) else: r.append(i+1) for n in r: print(n) for i in range(len(l)-1,-1,-1): print(l[i]) ```
3
50
A
Domino piling
PROGRAMMING
800
[ "greedy", "math" ]
A. Domino piling
2
256
You are given a rectangular board of *M*<=Γ—<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=Γ—<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions: 1. Each domino completely covers two squares. 2. No two dominoes overlap. 3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board. Find the maximum number of dominoes, which can be placed under these restrictions.
In a single line you are given two integers *M* and *N* β€” board sizes in squares (1<=≀<=*M*<=≀<=*N*<=≀<=16).
Output one number β€” the maximal number of dominoes, which can be placed.
[ "2 4\n", "3 3\n" ]
[ "4\n", "4\n" ]
none
500
[ { "input": "2 4", "output": "4" }, { "input": "3 3", "output": "4" }, { "input": "1 5", "output": "2" }, { "input": "1 6", "output": "3" }, { "input": "1 15", "output": "7" }, { "input": "1 16", "output": "8" }, { "input": "2 5", "output": "5" }, { "input": "2 6", "output": "6" }, { "input": "2 7", "output": "7" }, { "input": "2 14", "output": "14" }, { "input": "2 15", "output": "15" }, { "input": "1 4", "output": "2" }, { "input": "2 16", "output": "16" }, { "input": "3 5", "output": "7" }, { "input": "3 6", "output": "9" }, { "input": "3 10", "output": "15" }, { "input": "3 14", "output": "21" }, { "input": "3 15", "output": "22" }, { "input": "3 16", "output": "24" }, { "input": "5 7", "output": "17" }, { "input": "16 16", "output": "128" }, { "input": "15 16", "output": "120" }, { "input": "2 3", "output": "3" }, { "input": "15 15", "output": "112" }, { "input": "14 16", "output": "112" }, { "input": "11 13", "output": "71" }, { "input": "5 16", "output": "40" }, { "input": "8 15", "output": "60" }, { "input": "2 2", "output": "2" }, { "input": "3 4", "output": "6" }, { "input": "4 4", "output": "8" }, { "input": "1 1", "output": "0" }, { "input": "1 2", "output": "1" }, { "input": "1 3", "output": "1" }, { "input": "14 15", "output": "105" } ]
1,631,573,855
2,147,483,647
Python 3
OK
TESTS
35
124
6,758,400
from math import floor m,n=map(int,input().split()) area=m*n print(floor(area/2))
Title: Domino piling Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: You are given a rectangular board of *M*<=Γ—<=*N* squares. Also you are given an unlimited number of standard domino pieces of 2<=Γ—<=1 squares. You are allowed to rotate the pieces. You are asked to place as many dominoes as possible on the board so as to meet the following conditions: 1. Each domino completely covers two squares. 2. No two dominoes overlap. 3. Each domino lies entirely inside the board. It is allowed to touch the edges of the board. Find the maximum number of dominoes, which can be placed under these restrictions. Input Specification: In a single line you are given two integers *M* and *N* β€” board sizes in squares (1<=≀<=*M*<=≀<=*N*<=≀<=16). Output Specification: Output one number β€” the maximal number of dominoes, which can be placed. Demo Input: ['2 4\n', '3 3\n'] Demo Output: ['4\n', '4\n'] Note: none
```python from math import floor m,n=map(int,input().split()) area=m*n print(floor(area/2)) ```
3.956411
592
A
PawnChess
PROGRAMMING
1,200
[ "implementation" ]
null
null
Galois is one of the strongest chess players of Byteforces. He has even invented a new variant of chess, which he named Β«PawnChessΒ». This new game is played on a board consisting of 8 rows and 8 columns. At the beginning of every game some black and white pawns are placed on the board. The number of black pawns placed is not necessarily equal to the number of white pawns placed. Lets enumerate rows and columns with integers from 1 to 8. Rows are numbered from top to bottom, while columns are numbered from left to right. Now we denote as (*r*,<=*c*) the cell located at the row *r* and at the column *c*. There are always two players A and B playing the game. Player A plays with white pawns, while player B plays with black ones. The goal of player A is to put any of his pawns to the row 1, while player B tries to put any of his pawns to the row 8. As soon as any of the players completes his goal the game finishes immediately and the succeeded player is declared a winner. Player A moves first and then they alternate turns. On his move player A must choose exactly one white pawn and move it one step upward and player B (at his turn) must choose exactly one black pawn and move it one step down. Any move is possible only if the targeted cell is empty. It's guaranteed that for any scenario of the game there will always be at least one move available for any of the players. Moving upward means that the pawn located in (*r*,<=*c*) will go to the cell (*r*<=-<=1,<=*c*), while moving down means the pawn located in (*r*,<=*c*) will go to the cell (*r*<=+<=1,<=*c*). Again, the corresponding cell must be empty, i.e. not occupied by any other pawn of any color. Given the initial disposition of the board, determine who wins the game if both players play optimally. Note that there will always be a winner due to the restriction that for any game scenario both players will have some moves available.
The input consists of the board description given in eight lines, each line contains eight characters. Character 'B' is used to denote a black pawn, and character 'W' represents a white pawn. Empty cell is marked with '.'. It's guaranteed that there will not be white pawns on the first row neither black pawns on the last row.
Print 'A' if player A wins the game on the given board, and 'B' if player B will claim the victory. Again, it's guaranteed that there will always be a winner on the given board.
[ "........\n........\n.B....B.\n....W...\n........\n..W.....\n........\n........\n", "..B.....\n..W.....\n......B.\n........\n.....W..\n......B.\n........\n........\n" ]
[ "A\n", "B\n" ]
In the first sample player A is able to complete his goal in 3 steps by always moving a pawn initially located at (4, 5). Player B needs at least 5 steps for any of his pawns to reach the row 8. Hence, player A will be the winner.
500
[ { "input": ".BB.B.B.\nB..B..B.\n.B.BB...\nBB.....B\nBBB....B\nB..BB...\nBB.B...B\n....WWW.", "output": "B" }, { "input": "B.B.BB.B\nW.WWW.WW\n.WWWWW.W\nW.BB.WBW\n.W..BBWB\nBB.WWBBB\n.W.W.WWB\nWWW..WW.", "output": "A" }, { "input": "BB..BB..\nBW.W.W.B\n..B.....\n.....BB.\n.B..B..B\n........\n...BB.B.\nW.WWWW.W", "output": "A" }, { "input": "BB......\nW....BBW\n........\n.B.B.BBB\n....BB..\nB....BB.\n...WWWW.\n....WW..", "output": "A" }, { "input": ".B.B..B.\nB.B....B\n...B.B.B\n..B.W..B\n.BBB.B.B\nB.BB.B.B\nBB..BBBB\nW.W.W.WW", "output": "B" }, { "input": "..BB....\n.B.B.B.B\n..B.B...\n..B..B.B\nWWWBWWB.\n.BB...B.\n..BBB...\n......W.", "output": "B" }, { "input": "..BB....\n.WBWBWBB\n.....BBB\n..WW....\n.W.W...W\nWWW...W.\n.W....W.\nW...W.W.", "output": "A" }, { "input": "....BB..\nBB......\n.B.....B\nWW..WWW.\n...BB.B.\nB...BB..\n..W..WWW\n...W...W", "output": "B" }, { "input": "B...BBBB\n...BBB..\nBBWBWW.W\n.B..BB.B\nW..W..WW\nW.WW....\n........\nWW.....W", "output": "A" }, { "input": ".B......\n.B....B.\n...W....\n......W.\nW.WWWW.W\nW.WW....\n..WWW...\n..W...WW", "output": "A" }, { "input": "B.......\nBBB.....\n.B....B.\n.W.BWB.W\n......B.\nW..WW...\n...W....\nW...W..W", "output": "A" }, { "input": ".....B..\n........\n........\n.BB..B..\n..BB....\n........\n....WWW.\n......W.", "output": "B" }, { "input": "B.B...B.\n...BBBBB\n....B...\n...B...B\nB.B.B..B\n........\n........\nWWW..WW.", "output": "B" }, { "input": "B.B...B.\n........\n.......B\n.BB....B\n.....W..\n.W.WW.W.\n...W.WW.\nW..WW..W", "output": "A" }, { "input": "......B.\nB....B..\n...B.BB.\n...B....\n........\n..W....W\nWW......\n.W....W.", "output": "B" }, { "input": ".BBB....\nB.B.B...\nB.BB.B..\nB.BB.B.B\n........\n........\nW.....W.\n..WW..W.", "output": "B" }, { "input": "..B..BBB\n........\n........\n........\n...W.W..\n...W..W.\nW.......\n..W...W.", "output": "A" }, { "input": "........\n.B.B....\n...B..BB\n........\n........\nW...W...\nW...W...\nW.WW.W..", "output": "A" }, { "input": "B....BB.\n...B...B\n.B......\n........\n........\n........\n........\n....W..W", "output": "B" }, { "input": "...BB.BB\nBB...B..\n........\n........\n........\n........\n..W..W..\n......W.", "output": "A" }, { "input": "...BB...\n........\n........\n........\n........\n........\n......W.\nWW...WW.", "output": "A" }, { "input": "...B.B..\n........\n........\n........\n........\n........\n........\nWWW...WW", "output": "A" }, { "input": "BBBBBBB.\n........\n........\n........\n........\n........\n........\n.WWWWWWW", "output": "A" }, { "input": ".BBBBBB.\nB.......\n........\n........\n........\n........\n........\n.WWWWWWW", "output": "B" }, { "input": ".BBBBBBB\n........\n........\n........\n........\n........\n........\nWWWWWWW.", "output": "A" }, { "input": ".BBBBBB.\n.......B\n........\n........\n........\n........\n........\nWWWWWWW.", "output": "B" }, { "input": "B..BB...\n..B...B.\n.WBB...B\nBW......\nW.B...W.\n..BBW.B.\nBW..BB..\n......W.", "output": "B" }, { "input": "B.BBBBBB\nB..BBB.B\nW.BB.W.B\nB.BWBB.B\nBWBWBBBB\n...BBBBB\nB.B...BB\nWW..WW.W", "output": "B" }, { "input": "BBBB.BBB\nBBBB.B.B\nB.B..BBB\nB.BB.BWW\nB.BB.BBB\nB.BB.BBB\n..BW.BB.\nW.WWWWWW", "output": "B" }, { "input": "BBBB.BBB\n.B....WB\nBB.B...B\nWWWW.WWB\nBB...BWW\nWWW..BBB\nW.BW.BB.\nWWWWWWW.", "output": "B" }, { "input": "B.BBBBBB\nW.WWBBBW\nW.BB.WBB\nW.W.BBBW\nW.BWW.WB\nB..B..BB\nB.B.W.BB\nWWWWW.WW", "output": "B" }, { "input": "BBBBBB.B\n.BBWBB.B\nWWW..B.W\n..WW.W.W\nBWB..W.W\n..BW.B.W\nB..B....\nWWWW.WWW", "output": "B" }, { "input": ".B...BB.\nWBB.BWBB\n.BWBW...\n..W...B.\nWB.BWW..\nWBW.....\n.W..W.B.\n.W.W.WW.", "output": "A" }, { "input": ".B..BBBB\nBB...WWB\nB..B.W.B\nWB.W...B\n...W.WW.\nW.....W.\nWB.W.W.W\n.WW...WW", "output": "A" }, { "input": "B.BBBBBB\nW.BB.W.B\nW.BBW...\n..WWWW.B\n....W..B\n.WW.W..W\n.W..WW.W\nW.W....W", "output": "A" }, { "input": "........\n.B......\n.W......\n........\n....B...\n........\n........\n.......W", "output": "B" } ]
1,678,882,399
2,147,483,647
PyPy 3
OK
TESTS
56
93
0
a = [input() for i in range(8)] ra, rb = 8, 8 for j in range(8) : for i in range(8) : if a[i][j] == 'W' : ra = min(ra, i) if a[i][j] != '.' : break for j in range(8) : for i in range(7,-1,-1) : if a[i][j] == 'B' : rb = min(rb, 7 - i) if a[i][j] != '.' : break print ('A' if ra <= rb else 'B')
Title: PawnChess Time Limit: None seconds Memory Limit: None megabytes Problem Description: Galois is one of the strongest chess players of Byteforces. He has even invented a new variant of chess, which he named Β«PawnChessΒ». This new game is played on a board consisting of 8 rows and 8 columns. At the beginning of every game some black and white pawns are placed on the board. The number of black pawns placed is not necessarily equal to the number of white pawns placed. Lets enumerate rows and columns with integers from 1 to 8. Rows are numbered from top to bottom, while columns are numbered from left to right. Now we denote as (*r*,<=*c*) the cell located at the row *r* and at the column *c*. There are always two players A and B playing the game. Player A plays with white pawns, while player B plays with black ones. The goal of player A is to put any of his pawns to the row 1, while player B tries to put any of his pawns to the row 8. As soon as any of the players completes his goal the game finishes immediately and the succeeded player is declared a winner. Player A moves first and then they alternate turns. On his move player A must choose exactly one white pawn and move it one step upward and player B (at his turn) must choose exactly one black pawn and move it one step down. Any move is possible only if the targeted cell is empty. It's guaranteed that for any scenario of the game there will always be at least one move available for any of the players. Moving upward means that the pawn located in (*r*,<=*c*) will go to the cell (*r*<=-<=1,<=*c*), while moving down means the pawn located in (*r*,<=*c*) will go to the cell (*r*<=+<=1,<=*c*). Again, the corresponding cell must be empty, i.e. not occupied by any other pawn of any color. Given the initial disposition of the board, determine who wins the game if both players play optimally. Note that there will always be a winner due to the restriction that for any game scenario both players will have some moves available. Input Specification: The input consists of the board description given in eight lines, each line contains eight characters. Character 'B' is used to denote a black pawn, and character 'W' represents a white pawn. Empty cell is marked with '.'. It's guaranteed that there will not be white pawns on the first row neither black pawns on the last row. Output Specification: Print 'A' if player A wins the game on the given board, and 'B' if player B will claim the victory. Again, it's guaranteed that there will always be a winner on the given board. Demo Input: ['........\n........\n.B....B.\n....W...\n........\n..W.....\n........\n........\n', '..B.....\n..W.....\n......B.\n........\n.....W..\n......B.\n........\n........\n'] Demo Output: ['A\n', 'B\n'] Note: In the first sample player A is able to complete his goal in 3 steps by always moving a pawn initially located at (4, 5). Player B needs at least 5 steps for any of his pawns to reach the row 8. Hence, player A will be the winner.
```python a = [input() for i in range(8)] ra, rb = 8, 8 for j in range(8) : for i in range(8) : if a[i][j] == 'W' : ra = min(ra, i) if a[i][j] != '.' : break for j in range(8) : for i in range(7,-1,-1) : if a[i][j] == 'B' : rb = min(rb, 7 - i) if a[i][j] != '.' : break print ('A' if ra <= rb else 'B') ```
3
844
A
Diversity
PROGRAMMING
1,000
[ "greedy", "implementation", "strings" ]
null
null
Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible. String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too.
First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≀<=|*s*|<=≀<=1000, |*s*| denotes the length of *s*). Second line of input contains integer *k* (1<=≀<=*k*<=≀<=26).
Print single line with a minimum number of necessary changes, or the word Β«impossibleΒ» (without quotes) if it is impossible.
[ "yandex\n6\n", "yahoo\n5\n", "google\n7\n" ]
[ "0\n", "1\n", "impossible\n" ]
In the first test case string contains 6 different letters, so we don't need to change anything. In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}. In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
500
[ { "input": "yandex\n6", "output": "0" }, { "input": "yahoo\n5", "output": "1" }, { "input": "google\n7", "output": "impossible" }, { "input": "a\n1", "output": "0" }, { "input": "z\n2", "output": "impossible" }, { "input": "fwgfrwgkuwghfiruhewgirueguhergiqrbvgrgf\n26", "output": "14" }, { "input": "nfevghreuoghrueighoqghbnebvnejbvnbgneluqe\n26", "output": "12" }, { "input": "a\n3", "output": "impossible" }, { "input": "smaxpqplaqqbxuqxalqmbmmgubbpspxhawbxsuqhhegpmmpebqmqpbbeplwaepxmsahuepuhuhwxeqmmlgqubuaxehwuwasgxpqmugbmuawuhwqlswllssueglbxepbmwgs\n1", "output": "0" }, { "input": "cuguccgcugcugucgggggcgcgucgucugcuuuccccuugccg\n4", "output": "1" }, { "input": "fcfccfcfccfcfcffcffffffcfccfccfcffccccfcffffccfccfcffcfcccccffcfffcccffcfccfffffcccfccffffffccfccccf\n20", "output": "18" }, { "input": "swmkwaruyv\n5", "output": "0" }, { "input": "tnbqpsuhkczmejirvyfdolxwga\n22", "output": "0" }, { "input": "abcde\n3", "output": "0" }, { "input": "abb\n1", "output": "0" }, { "input": "aaaa\n1", "output": "0" }, { "input": "abcde\n2", "output": "0" }, { "input": "yandex\n4", "output": "0" }, { "input": "aaabbbccc\n1", "output": "0" }, { "input": "abcd\n2", "output": "0" }, { "input": "asdfgh\n2", "output": "0" }, { "input": "aab\n1", "output": "0" }, { "input": "mynameissako\n5", "output": "0" }, { "input": "abcde\n1", "output": "0" }, { "input": "abcd\n3", "output": "0" }, { "input": "abcdef\n2", "output": "0" }, { "input": "abcdefg\n4", "output": "0" }, { "input": "abc\n1", "output": "0" }, { "input": "asdafjsgljdllgjdgkl\n5", "output": "0" }, { "input": "yaay\n3", "output": "1" }, { "input": "yaay\n4", "output": "2" }, { "input": "zzzzzz\n2", "output": "1" } ]
1,504,013,348
2,147,483,647
Python 3
OK
TESTS
41
61
0
# encoding: utf-8 string = input().strip() k = int(input()) print('impossible' if len(string) < k else max(0, k - len(set(string))))
Title: Diversity Time Limit: None seconds Memory Limit: None megabytes Problem Description: Calculate the minimum number of characters you need to change in the string *s*, so that it contains at least *k* different letters, or print that it is impossible. String *s* consists only of lowercase Latin letters, and it is allowed to change characters only to lowercase Latin letters too. Input Specification: First line of input contains string *s*, consisting only of lowercase Latin letters (1<=≀<=|*s*|<=≀<=1000, |*s*| denotes the length of *s*). Second line of input contains integer *k* (1<=≀<=*k*<=≀<=26). Output Specification: Print single line with a minimum number of necessary changes, or the word Β«impossibleΒ» (without quotes) if it is impossible. Demo Input: ['yandex\n6\n', 'yahoo\n5\n', 'google\n7\n'] Demo Output: ['0\n', '1\n', 'impossible\n'] Note: In the first test case string contains 6 different letters, so we don't need to change anything. In the second test case string contains 4 different letters: {'*a*', '*h*', '*o*', '*y*'}. To get 5 different letters it is necessary to change one occurrence of '*o*' to some letter, which doesn't occur in the string, for example, {'*b*'}. In the third test case, it is impossible to make 7 different letters because the length of the string is 6.
```python # encoding: utf-8 string = input().strip() k = int(input()) print('impossible' if len(string) < k else max(0, k - len(set(string)))) ```
3
38
A
Army
PROGRAMMING
800
[ "implementation" ]
A. Army
2
256
The Berland Armed Forces System consists of *n* ranks that are numbered using natural numbers from 1 to *n*, where 1 is the lowest rank and *n* is the highest rank. One needs exactly *d**i* years to rise from rank *i* to rank *i*<=+<=1. Reaching a certain rank *i* having not reached all the previous *i*<=-<=1 ranks is impossible. Vasya has just reached a new rank of *a*, but he dreams of holding the rank of *b*. Find for how many more years Vasya should serve in the army until he can finally realize his dream.
The first input line contains an integer *n* (2<=≀<=*n*<=≀<=100). The second line contains *n*<=-<=1 integers *d**i* (1<=≀<=*d**i*<=≀<=100). The third input line contains two integers *a* and *b* (1<=≀<=*a*<=&lt;<=*b*<=≀<=*n*). The numbers on the lines are space-separated.
Print the single number which is the number of years that Vasya needs to rise from rank *a* to rank *b*.
[ "3\n5 6\n1 2\n", "3\n5 6\n1 3\n" ]
[ "5\n", "11\n" ]
none
0
[ { "input": "3\n5 6\n1 2", "output": "5" }, { "input": "3\n5 6\n1 3", "output": "11" }, { "input": "2\n55\n1 2", "output": "55" }, { "input": "3\n85 78\n1 3", "output": "163" }, { "input": "4\n63 4 49\n2 3", "output": "4" }, { "input": "5\n93 83 42 56\n2 5", "output": "181" }, { "input": "6\n22 9 87 89 57\n1 6", "output": "264" }, { "input": "7\n52 36 31 23 74 78\n2 7", "output": "242" }, { "input": "8\n82 14 24 5 91 49 94\n3 8", "output": "263" }, { "input": "9\n12 40 69 39 59 21 59 5\n4 6", "output": "98" }, { "input": "10\n95 81 32 59 71 30 50 61 100\n1 6", "output": "338" }, { "input": "15\n89 55 94 4 15 69 19 60 91 77 3 94 91 62\n3 14", "output": "617" }, { "input": "20\n91 1 41 51 95 67 92 35 23 70 44 91 57 50 21 8 9 71 40\n8 17", "output": "399" }, { "input": "25\n70 95 21 84 97 39 12 98 53 24 78 29 84 65 70 22 100 17 69 27 62 48 35 80\n8 23", "output": "846" }, { "input": "30\n35 69 50 44 19 56 86 56 98 24 21 2 61 24 85 30 2 22 57 35 59 84 12 77 92 53 50 92 9\n1 16", "output": "730" }, { "input": "35\n2 34 47 15 27 61 6 88 67 20 53 65 29 68 77 5 78 86 44 98 32 81 91 79 54 84 95 23 65 97 22 33 42 87\n8 35", "output": "1663" }, { "input": "40\n32 88 59 36 95 45 28 78 73 30 97 13 13 47 48 100 43 21 22 45 88 25 15 13 63 25 72 92 29 5 25 11 50 5 54 51 48 84 23\n7 26", "output": "862" }, { "input": "45\n83 74 73 95 10 31 100 26 29 15 80 100 22 70 31 88 9 56 19 70 2 62 48 30 27 47 52 50 94 44 21 94 23 85 15 3 95 72 43 62 94 89 68 88\n17 40", "output": "1061" }, { "input": "50\n28 8 16 29 19 82 70 51 96 84 74 72 17 69 12 21 37 21 39 3 18 66 19 49 86 96 94 93 2 90 96 84 59 88 58 15 61 33 55 22 35 54 51 29 64 68 29 38 40\n23 28", "output": "344" }, { "input": "60\n24 28 25 21 43 71 64 73 71 90 51 83 69 43 75 43 78 72 56 61 99 7 23 86 9 16 16 94 23 74 18 56 20 72 13 31 75 34 35 86 61 49 4 72 84 7 65 70 66 52 21 38 6 43 69 40 73 46 5\n28 60", "output": "1502" }, { "input": "70\n69 95 34 14 67 61 6 95 94 44 28 94 73 66 39 13 19 71 73 71 28 48 26 22 32 88 38 95 43 59 88 77 80 55 17 95 40 83 67 1 38 95 58 63 56 98 49 2 41 4 73 8 78 41 64 71 60 71 41 61 67 4 4 19 97 14 39 20 27\n9 41", "output": "1767" }, { "input": "80\n65 15 43 6 43 98 100 16 69 98 4 54 25 40 2 35 12 23 38 29 10 89 30 6 4 8 7 96 64 43 11 49 89 38 20 59 54 85 46 16 16 89 60 54 28 37 32 34 67 9 78 30 50 87 58 53 99 48 77 3 5 6 19 99 16 20 31 10 80 76 82 56 56 83 72 81 84 60 28\n18 24", "output": "219" }, { "input": "90\n61 35 100 99 67 87 42 90 44 4 81 65 29 63 66 56 53 22 55 87 39 30 34 42 27 80 29 97 85 28 81 22 50 22 24 75 67 86 78 79 94 35 13 97 48 76 68 66 94 13 82 1 22 85 5 36 86 73 65 97 43 56 35 26 87 25 74 47 81 67 73 75 99 75 53 38 70 21 66 78 38 17 57 40 93 57 68 55 1\n12 44", "output": "1713" }, { "input": "95\n37 74 53 96 65 84 65 72 95 45 6 77 91 35 58 50 51 51 97 30 51 20 79 81 92 10 89 34 40 76 71 54 26 34 73 72 72 28 53 19 95 64 97 10 44 15 12 38 5 63 96 95 86 8 36 96 45 53 81 5 18 18 47 97 65 9 33 53 41 86 37 53 5 40 15 76 83 45 33 18 26 5 19 90 46 40 100 42 10 90 13 81 40 53\n6 15", "output": "570" }, { "input": "96\n51 32 95 75 23 54 70 89 67 3 1 51 4 100 97 30 9 35 56 38 54 77 56 98 43 17 60 43 72 46 87 61 100 65 81 22 74 38 16 96 5 10 54 22 23 22 10 91 9 54 49 82 29 73 33 98 75 8 4 26 24 90 71 42 90 24 94 74 94 10 41 98 56 63 18 43 56 21 26 64 74 33 22 38 67 66 38 60 64 76 53 10 4 65 76\n21 26", "output": "328" }, { "input": "97\n18 90 84 7 33 24 75 55 86 10 96 72 16 64 37 9 19 71 62 97 5 34 85 15 46 72 82 51 52 16 55 68 27 97 42 72 76 97 32 73 14 56 11 86 2 81 59 95 60 93 1 22 71 37 77 100 6 16 78 47 78 62 94 86 16 91 56 46 47 35 93 44 7 86 70 10 29 45 67 62 71 61 74 39 36 92 24 26 65 14 93 92 15 28 79 59\n6 68", "output": "3385" }, { "input": "98\n32 47 26 86 43 42 79 72 6 68 40 46 29 80 24 89 29 7 21 56 8 92 13 33 50 79 5 7 84 85 24 23 1 80 51 21 26 55 96 51 24 2 68 98 81 88 57 100 64 84 54 10 14 2 74 1 89 71 1 20 84 85 17 31 42 58 69 67 48 60 97 90 58 10 21 29 2 21 60 61 68 89 77 39 57 18 61 44 67 100 33 74 27 40 83 29 6\n8 77", "output": "3319" }, { "input": "99\n46 5 16 66 53 12 84 89 26 27 35 68 41 44 63 17 88 43 80 15 59 1 42 50 53 34 75 16 16 55 92 30 28 11 12 71 27 65 11 28 86 47 24 10 60 47 7 53 16 75 6 49 56 66 70 3 20 78 75 41 38 57 89 23 16 74 30 39 1 32 49 84 9 33 25 95 75 45 54 59 17 17 29 40 79 96 47 11 69 86 73 56 91 4 87 47 31 24\n23 36", "output": "514" }, { "input": "100\n63 65 21 41 95 23 3 4 12 23 95 50 75 63 58 34 71 27 75 31 23 94 96 74 69 34 43 25 25 55 44 19 43 86 68 17 52 65 36 29 72 96 84 25 84 23 71 54 6 7 71 7 21 100 99 58 93 35 62 47 36 70 68 9 75 13 35 70 76 36 62 22 52 51 2 87 66 41 54 35 78 62 30 35 65 44 74 93 78 37 96 70 26 32 71 27 85 85 63\n43 92", "output": "2599" }, { "input": "51\n85 38 22 38 42 36 55 24 36 80 49 15 66 91 88 61 46 82 1 61 89 92 6 56 28 8 46 80 56 90 91 38 38 17 69 64 57 68 13 44 45 38 8 72 61 39 87 2 73 88\n15 27", "output": "618" }, { "input": "2\n3\n1 2", "output": "3" }, { "input": "5\n6 8 22 22\n2 3", "output": "8" }, { "input": "6\n3 12 27 28 28\n3 4", "output": "27" }, { "input": "9\n1 2 2 2 2 3 3 5\n3 7", "output": "9" }, { "input": "10\n1 1 1 1 1 1 1 1 1\n6 8", "output": "2" }, { "input": "20\n1 1 1 1 1 1 1 1 2 2 2 2 2 3 3 3 3 3 3\n5 17", "output": "23" }, { "input": "25\n1 1 1 4 5 6 8 11 11 11 11 12 13 14 14 14 15 16 16 17 17 17 19 19\n4 8", "output": "23" }, { "input": "35\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2\n30 31", "output": "2" }, { "input": "45\n1 1 1 1 2 2 2 2 2 2 2 3 3 3 3 3 3 4 5 5 5 5 6 6 6 6 6 6 6 7 7 7 7 8 8 8 9 9 9 9 9 10 10 10\n42 45", "output": "30" }, { "input": "50\n1 8 8 13 14 15 15 16 19 21 22 24 26 31 32 37 45 47 47 47 50 50 51 54 55 56 58 61 61 61 63 63 64 66 66 67 67 70 71 80 83 84 85 92 92 94 95 95 100\n4 17", "output": "285" }, { "input": "60\n1 2 4 4 4 6 6 8 9 10 10 13 14 18 20 20 21 22 23 23 26 29 30 32 33 34 35 38 40 42 44 44 46 48 52 54 56 56 60 60 66 67 68 68 69 73 73 74 80 80 81 81 82 84 86 86 87 89 89\n56 58", "output": "173" }, { "input": "70\n1 2 3 3 4 5 5 7 7 7 8 8 8 8 9 9 10 12 12 12 12 13 16 16 16 16 16 16 17 17 18 18 20 20 21 23 24 25 25 26 29 29 29 29 31 32 32 34 35 36 36 37 37 38 39 39 40 40 40 40 41 41 42 43 44 44 44 45 45\n62 65", "output": "126" }, { "input": "80\n1 1 1 1 1 1 1 1 2 2 2 2 2 2 3 3 3 3 3 3 3 3 3 3 4 4 4 4 5 5 5 5 5 5 5 6 7 7 7 7 7 7 8 8 8 8 9 9 9 9 9 9 9 9 9 10 10 10 10 10 10 10 10 10 11 11 11 11 11 11 11 12 12 12 12 12 12 12 12\n17 65", "output": "326" }, { "input": "90\n1 1 3 5 8 9 10 11 11 11 11 12 13 14 15 15 15 16 16 19 19 20 22 23 24 25 25 28 29 29 30 31 33 34 35 37 37 38 41 43 43 44 45 47 51 54 55 56 58 58 59 59 60 62 66 67 67 67 68 68 69 70 71 72 73 73 76 77 77 78 78 78 79 79 79 82 83 84 85 85 87 87 89 93 93 93 95 99 99\n28 48", "output": "784" }, { "input": "95\n2 2 3 3 4 6 6 7 7 7 9 10 12 12 12 12 13 14 15 16 17 18 20 20 20 20 21 21 21 21 22 22 22 22 22 23 23 23 25 26 26 27 27 27 28 29 29 30 30 31 32 33 34 36 37 37 38 39 39 39 42 43 43 43 45 47 48 50 50 51 52 53 54 54 54 55 55 55 58 59 60 61 61 61 61 62 62 63 64 65 66 67 67 67\n64 93", "output": "1636" }, { "input": "96\n1 1 2 3 3 5 8 9 9 10 10 10 11 11 11 11 11 12 13 13 13 14 15 15 16 16 17 17 17 17 18 18 20 20 20 21 21 21 23 24 24 25 25 26 27 27 27 27 29 29 29 30 30 30 32 32 32 32 32 32 33 33 34 34 34 35 35 35 36 36 37 37 37 38 39 40 41 41 41 41 42 42 43 43 45 45 45 46 46 47 47 49 50 52 52\n76 96", "output": "898" }, { "input": "98\n2 3 4 4 5 7 8 10 10 10 11 11 12 12 12 12 13 14 15 15 16 16 18 19 19 20 21 21 21 21 22 23 24 25 26 26 27 27 27 27 29 29 30 30 31 31 37 40 40 40 41 41 41 42 43 44 44 44 46 46 47 49 49 50 50 50 51 53 55 55 56 56 56 56 56 57 57 58 59 60 60 60 62 62 63 64 64 64 65 66 66 67 68 70 70 71 71\n8 90", "output": "3016" }, { "input": "99\n1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1\n66 95", "output": "29" }, { "input": "100\n1 1 1 1 1 1 1 1 2 2 2 2 2 2 2 2 3 3 3 4 4 4 4 4 4 4 4 4 4 5 5 5 5 5 5 6 6 6 6 6 6 6 6 6 6 6 6 7 7 7 7 7 7 8 8 8 8 9 9 9 9 10 10 10 10 11 11 11 11 12 12 12 13 13 13 13 13 13 13 13 13 13 14 14 14 14 14 14 15 15 15 15 15 15 16 16 16 17 17\n39 52", "output": "82" }, { "input": "51\n5 7 9 16 19 25 26 29 29 30 31 32 32 41 43 44 47 49 50 50 51 52 54 55 56 63 64 66 67 70 74 74 77 78 79 80 80 85 86 87 89 89 90 92 93 94 94 95 95 97\n3 44", "output": "2268" } ]
1,588,832,419
2,147,483,647
Python 3
OK
TESTS
50
218
6,656,000
n = int(input()) grades = [int(i) for i in input().split()] a, b = map(int, input().split()) k = 0 for i in range(a, b): k += grades[i-1] print(k)
Title: Army Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: The Berland Armed Forces System consists of *n* ranks that are numbered using natural numbers from 1 to *n*, where 1 is the lowest rank and *n* is the highest rank. One needs exactly *d**i* years to rise from rank *i* to rank *i*<=+<=1. Reaching a certain rank *i* having not reached all the previous *i*<=-<=1 ranks is impossible. Vasya has just reached a new rank of *a*, but he dreams of holding the rank of *b*. Find for how many more years Vasya should serve in the army until he can finally realize his dream. Input Specification: The first input line contains an integer *n* (2<=≀<=*n*<=≀<=100). The second line contains *n*<=-<=1 integers *d**i* (1<=≀<=*d**i*<=≀<=100). The third input line contains two integers *a* and *b* (1<=≀<=*a*<=&lt;<=*b*<=≀<=*n*). The numbers on the lines are space-separated. Output Specification: Print the single number which is the number of years that Vasya needs to rise from rank *a* to rank *b*. Demo Input: ['3\n5 6\n1 2\n', '3\n5 6\n1 3\n'] Demo Output: ['5\n', '11\n'] Note: none
```python n = int(input()) grades = [int(i) for i in input().split()] a, b = map(int, input().split()) k = 0 for i in range(a, b): k += grades[i-1] print(k) ```
3.933102
59
A
Word
PROGRAMMING
800
[ "implementation", "strings" ]
A. Word
2
256
Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP β€” with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word.
The first line contains a word *s* β€” it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100.
Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one.
[ "HoUse\n", "ViP\n", "maTRIx\n" ]
[ "house\n", "VIP\n", "matrix\n" ]
none
500
[ { "input": "HoUse", "output": "house" }, { "input": "ViP", "output": "VIP" }, { "input": "maTRIx", "output": "matrix" }, { "input": "BNHWpnpawg", "output": "bnhwpnpawg" }, { "input": "VTYGP", "output": "VTYGP" }, { "input": "CHNenu", "output": "chnenu" }, { "input": "ERPZGrodyu", "output": "erpzgrodyu" }, { "input": "KSXBXWpebh", "output": "KSXBXWPEBH" }, { "input": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv", "output": "qvxpqullmcbegsdskddortcvxyqlbvxmmkhevovnezubvpvnrcajpxraeaxizgaowtfkzywvhnbgzsxbhkaipcmoumtikkiyyaiv" }, { "input": "Amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd", "output": "amnhaxtaopjzrkqlbroiyipitndczpunwygstmzevgyjdzyanxkdqnvgkikfabwouwkkbzuiuvgvxgpizsvqsbwepktpdrgdkmfd" }, { "input": "ISAGFJFARYFBLOPQDSHWGMCNKMFTLVFUGNJEWGWNBLXUIATXEkqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv", "output": "isagfjfaryfblopqdshwgmcnkmftlvfugnjewgwnblxuiatxekqiettmmjgydwcpafqrppdsrrrtguinqbgmzzfqwonkpgpcwenv" }, { "input": "XHRPXZEGHSOCJPICUIXSKFUZUPYTSGJSDIYBCMNMNBPNDBXLXBzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg", "output": "xhrpxzeghsocjpicuixskfuzupytsgjsdiybcmnmnbpndbxlxbzhbfnqvwcffvrdhtickyqhupmcehlsyvncqmfhautvxudqdhgg" }, { "input": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGAdkcetqjljtmttlonpekcovdzebzdkzggwfsxhapmjkdbuceak", "output": "RJIQZMJCIMSNDBOHBRAWIENODSALETAKGKPYUFGVEFGCBRENZGADKCETQJLJTMTTLONPEKCOVDZEBZDKZGGWFSXHAPMJKDBUCEAK" }, { "input": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFw", "output": "DWLWOBHNMMGTFOLFAECKBRNNGLYLYDXTGTVRLMEESZOIUATZZZXUFUZDLSJXMEVRTESSFBWLNZZCLCQWEVNNUCXYVHNGNXHCBDFW" }, { "input": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB", "output": "NYCNHJWGBOCOTSPETKKHVWFGAQYNHOVJWJHCIEFOUQZXOYUIEQDZALFKTEHTVDBVJMEUBJUBCMNVPWGDPNCHQHZJRCHYRFPVIGUB" }, { "input": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge", "output": "igxoixiecetohtgjgbqzvlaobkhstejxdklghowtvwunnnvauriohuspsdmpzckprwajyxldoyckgjivjpmbfqtszmtocovxwge" }, { "input": "Ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw", "output": "ykkekrsqolzryiwsmdlnbmfautxxxauoojrddvwklgnlyrfcvhorrzbmtcrvpaypqhcffdqhwziipyyskcmztjprjqvmzzqhqnw" }, { "input": "YQOMLKYAORUQQUCQZCDYMIVDHGWZFFRMUVTAWCHERFPMNRYRIkgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks", "output": "yqomlkyaoruqqucqzcdymivdhgwzffrmuvtawcherfpmnryrikgqrciokgajamehmcxgerpudvsqyonjonsxgbnefftzmygncks" }, { "input": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJcuusigdqfkumewjtdyitveeiaybwrhomrwmpdipjwiuxfnwuz", "output": "CDOZDPBVVVHNBJVBYHEOXWFLJKRWJCAJMIFCOZWWYFKVWOGTVJCUUSIGDQFKUMEWJTDYITVEEIAYBWRHOMRWMPDIPJWIUXFNWUZ" }, { "input": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWuckzcpxosodcjaaakvlxpbiigsiauviilylnnqlyucziihqg", "output": "WHIUVEXHVOOIJIDVJVPQUBJMEVPMPDKQWJKFBZSGSKUXMIPPMJWUCKZCPXOSODCJAAAKVLXPBIIGSIAUVIILYLNNQLYUCZIIHQG" }, { "input": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO", "output": "VGHUNFOXKETUYMZDJNGTAOIOANYXSGYNFOGOFFLDAWEUKYFOZXCJTCAFXZYLQZERYZLRSQXYQGAPCSUDPMEYTNCTTTMFAGVDWBO" }, { "input": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDd", "output": "EDUANHCQDOCJHFONTTSWBUJSTTIXBIXMAIUFSGFLXWAYIURTVAVZPYQDLAWIGCLMPHXCEFCJPFAAHXVNGQUFNHADAIUAZIDMHDD" }, { "input": "EBWOVSNLYTWWXrnovgugogtjahnmatomubebyxakas", "output": "ebwovsnlytwwxrnovgugogtjahnmatomubebyxakas" }, { "input": "AORNNDKTRLRVGDPXJKXFTPFpopuzrlqumrxssskvbm", "output": "AORNNDKTRLRVGDPXJKXFTPFPOPUZRLQUMRXSSSKVBM" }, { "input": "DBBZJCWQEVGYHEEUHJAWRHBDPsnplijbwtdibqrrheebfxqcvn", "output": "dbbzjcwqevgyheeuhjawrhbdpsnplijbwtdibqrrheebfxqcvn" }, { "input": "t", "output": "t" }, { "input": "N", "output": "N" }, { "input": "kv", "output": "kv" }, { "input": "Ur", "output": "ur" }, { "input": "CN", "output": "CN" } ]
1,604,393,272
2,147,483,647
PyPy 3
OK
TESTS
30
280
0
s = input() ts = 0 tz = 0 for i in range(len(s)): if 'z'>=s[i]>='a': ts += 1 else: tz += 1 if ts>=tz: print(s.lower()) else: print(s.upper())
Title: Word Time Limit: 2 seconds Memory Limit: 256 megabytes Problem Description: Vasya is very upset that many people on the Net mix uppercase and lowercase letters in one word. That's why he decided to invent an extension for his favorite browser that would change the letters' register in every word so that it either only consisted of lowercase letters or, vice versa, only of uppercase ones. At that as little as possible letters should be changed in the word. For example, the word HoUse must be replaced with house, and the word ViP β€” with VIP. If a word contains an equal number of uppercase and lowercase letters, you should replace all the letters with lowercase ones. For example, maTRIx should be replaced by matrix. Your task is to use the given method on one given word. Input Specification: The first line contains a word *s* β€” it consists of uppercase and lowercase Latin letters and possesses the length from 1 to 100. Output Specification: Print the corrected word *s*. If the given word *s* has strictly more uppercase letters, make the word written in the uppercase register, otherwise - in the lowercase one. Demo Input: ['HoUse\n', 'ViP\n', 'maTRIx\n'] Demo Output: ['house\n', 'VIP\n', 'matrix\n'] Note: none
```python s = input() ts = 0 tz = 0 for i in range(len(s)): if 'z'>=s[i]>='a': ts += 1 else: tz += 1 if ts>=tz: print(s.lower()) else: print(s.upper()) ```
3.93
965
A
Paper Airplanes
PROGRAMMING
800
[ "math" ]
null
null
To make a paper airplane, one has to use a rectangular piece of paper. From a sheet of standard size you can make $s$ airplanes. A group of $k$ people decided to make $n$ airplanes each. They are going to buy several packs of paper, each of them containing $p$ sheets, and then distribute the sheets between the people. Each person should have enough sheets to make $n$ airplanes. How many packs should they buy?
The only line contains four integers $k$, $n$, $s$, $p$ ($1 \le k, n, s, p \le 10^4$)Β β€” the number of people, the number of airplanes each should make, the number of airplanes that can be made using one sheet and the number of sheets in one pack, respectively.
Print a single integerΒ β€” the minimum number of packs they should buy.
[ "5 3 2 3\n", "5 3 100 1\n" ]
[ "4\n", "5\n" ]
In the first sample they have to buy $4$ packs of paper: there will be $12$ sheets in total, and giving $2$ sheets to each person is enough to suit everyone's needs. In the second sample they have to buy a pack for each person as they can't share sheets.
500
[ { "input": "5 3 2 3", "output": "4" }, { "input": "5 3 100 1", "output": "5" }, { "input": "10000 10000 1 1", "output": "100000000" }, { "input": "1 1 10000 10000", "output": "1" }, { "input": "300 300 21 23", "output": "196" }, { "input": "300 2 37 51", "output": "6" }, { "input": "2 400 23 57", "output": "1" }, { "input": "1 1 1 1", "output": "1" }, { "input": "10000 10000 3 2", "output": "16670000" }, { "input": "1 2 1 2", "output": "1" }, { "input": "1 1 2 2", "output": "1" }, { "input": "1 1 10 10", "output": "1" }, { "input": "5324 5439 32 13", "output": "69622" }, { "input": "9000 1 2432 1", "output": "9000" }, { "input": "230 1234 9124 23", "output": "10" }, { "input": "11 1 1 1", "output": "11" }, { "input": "6246 8489 1227 9", "output": "4858" }, { "input": "9 20 5 7", "output": "6" } ]
1,525,352,025
2,147,483,647
Python 3
OK
TESTS
18
93
7,065,600
k, n, s, p = input().split()[:4] k, n, s, p = int(k), int(n), int(s), int(p) tmp = n / s if not tmp.is_integer(): tmp = int(tmp) + 1 else: tmp = int(tmp) tmp *= k res = tmp / p if not res.is_integer(): res = int(res) + 1 else: res = int(res) print(res)
Title: Paper Airplanes Time Limit: None seconds Memory Limit: None megabytes Problem Description: To make a paper airplane, one has to use a rectangular piece of paper. From a sheet of standard size you can make $s$ airplanes. A group of $k$ people decided to make $n$ airplanes each. They are going to buy several packs of paper, each of them containing $p$ sheets, and then distribute the sheets between the people. Each person should have enough sheets to make $n$ airplanes. How many packs should they buy? Input Specification: The only line contains four integers $k$, $n$, $s$, $p$ ($1 \le k, n, s, p \le 10^4$)Β β€” the number of people, the number of airplanes each should make, the number of airplanes that can be made using one sheet and the number of sheets in one pack, respectively. Output Specification: Print a single integerΒ β€” the minimum number of packs they should buy. Demo Input: ['5 3 2 3\n', '5 3 100 1\n'] Demo Output: ['4\n', '5\n'] Note: In the first sample they have to buy $4$ packs of paper: there will be $12$ sheets in total, and giving $2$ sheets to each person is enough to suit everyone's needs. In the second sample they have to buy a pack for each person as they can't share sheets.
```python k, n, s, p = input().split()[:4] k, n, s, p = int(k), int(n), int(s), int(p) tmp = n / s if not tmp.is_integer(): tmp = int(tmp) + 1 else: tmp = int(tmp) tmp *= k res = tmp / p if not res.is_integer(): res = int(res) + 1 else: res = int(res) print(res) ```
3
271
A
Beautiful Year
PROGRAMMING
800
[ "brute force" ]
null
null
It seems like the year of 2013 came only yesterday. Do you know a curious fact? The year of 2013 is the first year after the old 1987 with only distinct digits. Now you are suggested to solve the following problem: given a year number, find the minimum year number which is strictly larger than the given one and has only distinct digits.
The single line contains integer *y* (1000<=≀<=*y*<=≀<=9000) β€” the year number.
Print a single integer β€” the minimum year number that is strictly larger than *y* and all it's digits are distinct. It is guaranteed that the answer exists.
[ "1987\n", "2013\n" ]
[ "2013\n", "2014\n" ]
none
500
[ { "input": "1987", "output": "2013" }, { "input": "2013", "output": "2014" }, { "input": "1000", "output": "1023" }, { "input": "1001", "output": "1023" }, { "input": "1234", "output": "1235" }, { "input": "5555", "output": "5601" }, { "input": "9000", "output": "9012" }, { "input": "1111", "output": "1203" }, { "input": "8999", "output": "9012" }, { "input": "4572", "output": "4573" }, { "input": "6666", "output": "6701" }, { "input": "2001", "output": "2013" }, { "input": "3000", "output": "3012" }, { "input": "7712", "output": "7801" }, { "input": "8088", "output": "8091" }, { "input": "1594", "output": "1596" }, { "input": "6016", "output": "6017" }, { "input": "8800", "output": "8901" }, { "input": "3331", "output": "3401" }, { "input": "5090", "output": "5091" }, { "input": "2342", "output": "2345" }, { "input": "2334", "output": "2340" }, { "input": "1123", "output": "1203" }, { "input": "8989", "output": "9012" }, { "input": "8977", "output": "9012" }, { "input": "6869", "output": "6870" }, { "input": "8999", "output": "9012" } ]
1,691,516,922
2,147,483,647
Python 3
OK
TESTS
27
92
0
y = int(input()) while True: y += 1 flag = True for i in str(y): if str(y).count(i) > 1: flag = False; if flag: print(y) break
Title: Beautiful Year Time Limit: None seconds Memory Limit: None megabytes Problem Description: It seems like the year of 2013 came only yesterday. Do you know a curious fact? The year of 2013 is the first year after the old 1987 with only distinct digits. Now you are suggested to solve the following problem: given a year number, find the minimum year number which is strictly larger than the given one and has only distinct digits. Input Specification: The single line contains integer *y* (1000<=≀<=*y*<=≀<=9000) β€” the year number. Output Specification: Print a single integer β€” the minimum year number that is strictly larger than *y* and all it's digits are distinct. It is guaranteed that the answer exists. Demo Input: ['1987\n', '2013\n'] Demo Output: ['2013\n', '2014\n'] Note: none
```python y = int(input()) while True: y += 1 flag = True for i in str(y): if str(y).count(i) > 1: flag = False; if flag: print(y) break ```
3
617
A
Elephant
PROGRAMMING
800
[ "math" ]
null
null
An elephant decided to visit his friend. It turned out that the elephant's house is located at point 0 and his friend's house is located at point *x*(*x*<=&gt;<=0) of the coordinate line. In one step the elephant can move 1, 2, 3, 4 or 5 positions forward. Determine, what is the minimum number of steps he need to make in order to get to his friend's house.
The first line of the input contains an integer *x* (1<=≀<=*x*<=≀<=1<=000<=000)Β β€” The coordinate of the friend's house.
Print the minimum number of steps that elephant needs to make to get from point 0 to point *x*.
[ "5\n", "12\n" ]
[ "1\n", "3\n" ]
In the first sample the elephant needs to make one step of length 5 to reach the point *x*. In the second sample the elephant can get to point *x* if he moves by 3, 5 and 4. There are other ways to get the optimal answer but the elephant cannot reach *x* in less than three moves.
500
[ { "input": "5", "output": "1" }, { "input": "12", "output": "3" }, { "input": "999999", "output": "200000" }, { "input": "41", "output": "9" }, { "input": "1000000", "output": "200000" }, { "input": "1", "output": "1" }, { "input": "2", "output": "1" }, { "input": "3", "output": "1" }, { "input": "4", "output": "1" }, { "input": "534204", "output": "106841" }, { "input": "469569", "output": "93914" }, { "input": "502877", "output": "100576" }, { "input": "942212", "output": "188443" }, { "input": "97", "output": "20" }, { "input": "53", "output": "11" }, { "input": "89", "output": "18" }, { "input": "574", "output": "115" }, { "input": "716", "output": "144" }, { "input": "729", "output": "146" }, { "input": "8901", "output": "1781" }, { "input": "3645", "output": "729" }, { "input": "4426", "output": "886" }, { "input": "46573", "output": "9315" }, { "input": "86380", "output": "17276" }, { "input": "94190", "output": "18838" }, { "input": "999990", "output": "199998" }, { "input": "999991", "output": "199999" }, { "input": "999992", "output": "199999" }, { "input": "999993", "output": "199999" }, { "input": "999994", "output": "199999" }, { "input": "999995", "output": "199999" }, { "input": "999996", "output": "200000" }, { "input": "999997", "output": "200000" }, { "input": "999998", "output": "200000" } ]
1,699,241,879
2,147,483,647
Python 3
OK
TESTS
34
77
0
def ex(n): chod = [1, 2, 3, 4, 5] if n in chod: return 1 k = 4 final = 0 while True: if n - chod[k] == 0: return final + 1 elif n - chod[k] > 0: final += 1 n = n - chod[k] else: k -= 1 n = int(input()) print(ex(n))
Title: Elephant Time Limit: None seconds Memory Limit: None megabytes Problem Description: An elephant decided to visit his friend. It turned out that the elephant's house is located at point 0 and his friend's house is located at point *x*(*x*<=&gt;<=0) of the coordinate line. In one step the elephant can move 1, 2, 3, 4 or 5 positions forward. Determine, what is the minimum number of steps he need to make in order to get to his friend's house. Input Specification: The first line of the input contains an integer *x* (1<=≀<=*x*<=≀<=1<=000<=000)Β β€” The coordinate of the friend's house. Output Specification: Print the minimum number of steps that elephant needs to make to get from point 0 to point *x*. Demo Input: ['5\n', '12\n'] Demo Output: ['1\n', '3\n'] Note: In the first sample the elephant needs to make one step of length 5 to reach the point *x*. In the second sample the elephant can get to point *x* if he moves by 3, 5 and 4. There are other ways to get the optimal answer but the elephant cannot reach *x* in less than three moves.
```python def ex(n): chod = [1, 2, 3, 4, 5] if n in chod: return 1 k = 4 final = 0 while True: if n - chod[k] == 0: return final + 1 elif n - chod[k] > 0: final += 1 n = n - chod[k] else: k -= 1 n = int(input()) print(ex(n)) ```
3
478
A
Initial Bet
PROGRAMMING
1,100
[ "implementation" ]
null
null
There are five people playing a game called "Generosity". Each person gives some non-zero number of coins *b* as an initial bet. After all players make their bets of *b* coins, the following operation is repeated for several times: a coin is passed from one player to some other player. Your task is to write a program that can, given the number of coins each player has at the end of the game, determine the size *b* of the initial bet or find out that such outcome of the game cannot be obtained for any positive number of coins *b* in the initial bet.
The input consists of a single line containing five integers *c*1,<=*c*2,<=*c*3,<=*c*4 and *c*5 β€” the number of coins that the first, second, third, fourth and fifth players respectively have at the end of the game (0<=≀<=*c*1,<=*c*2,<=*c*3,<=*c*4,<=*c*5<=≀<=100).
Print the only line containing a single positive integer *b* β€” the number of coins in the initial bet of each player. If there is no such value of *b*, then print the only value "-1" (quotes for clarity).
[ "2 5 4 0 4\n", "4 5 9 2 1\n" ]
[ "3\n", "-1\n" ]
In the first sample the following sequence of operations is possible: 1. One coin is passed from the fourth player to the second player; 1. One coin is passed from the fourth player to the fifth player; 1. One coin is passed from the first player to the third player; 1. One coin is passed from the fourth player to the second player.
500
[ { "input": "2 5 4 0 4", "output": "3" }, { "input": "4 5 9 2 1", "output": "-1" }, { "input": "0 0 0 0 0", "output": "-1" }, { "input": "1 2 1 2 3", "output": "-1" }, { "input": "100 0 0 0 0", "output": "20" }, { "input": "2 3 4 5 6", "output": "4" }, { "input": "1 1 1 1 1", "output": "1" }, { "input": "0 1 2 3 4", "output": "2" }, { "input": "100 100 100 100 100", "output": "100" }, { "input": "93 100 99 90 98", "output": "96" }, { "input": "99 99 99 99 99", "output": "99" }, { "input": "99 98 98 99 100", "output": "-1" }, { "input": "43 83 1 0 23", "output": "30" }, { "input": "43 83 1 100 23", "output": "50" }, { "input": "57 83 11 4 93", "output": "-1" }, { "input": "87 38 19 33 100", "output": "-1" }, { "input": "56 0 0 0 4", "output": "12" }, { "input": "0 0 0 0 1", "output": "-1" }, { "input": "99 100 100 100 100", "output": "-1" } ]
1,664,992,109
2,147,483,647
PyPy 3-64
OK
TESTS
19
61
0
def main(): v = [int(i) for i in input().split()] s = sum(v) if s % 5 == 0 and s != 0: print(s // 5) else: print(-1) if __name__ == "__main__": main()
Title: Initial Bet Time Limit: None seconds Memory Limit: None megabytes Problem Description: There are five people playing a game called "Generosity". Each person gives some non-zero number of coins *b* as an initial bet. After all players make their bets of *b* coins, the following operation is repeated for several times: a coin is passed from one player to some other player. Your task is to write a program that can, given the number of coins each player has at the end of the game, determine the size *b* of the initial bet or find out that such outcome of the game cannot be obtained for any positive number of coins *b* in the initial bet. Input Specification: The input consists of a single line containing five integers *c*1,<=*c*2,<=*c*3,<=*c*4 and *c*5 β€” the number of coins that the first, second, third, fourth and fifth players respectively have at the end of the game (0<=≀<=*c*1,<=*c*2,<=*c*3,<=*c*4,<=*c*5<=≀<=100). Output Specification: Print the only line containing a single positive integer *b* β€” the number of coins in the initial bet of each player. If there is no such value of *b*, then print the only value "-1" (quotes for clarity). Demo Input: ['2 5 4 0 4\n', '4 5 9 2 1\n'] Demo Output: ['3\n', '-1\n'] Note: In the first sample the following sequence of operations is possible: 1. One coin is passed from the fourth player to the second player; 1. One coin is passed from the fourth player to the fifth player; 1. One coin is passed from the first player to the third player; 1. One coin is passed from the fourth player to the second player.
```python def main(): v = [int(i) for i in input().split()] s = sum(v) if s % 5 == 0 and s != 0: print(s // 5) else: print(-1) if __name__ == "__main__": main() ```
3
313
A
Ilya and Bank Account
PROGRAMMING
900
[ "implementation", "number theory" ]
null
null
Ilya is a very clever lion, he lives in an unusual city ZooVille. In this city all the animals have their rights and obligations. Moreover, they even have their own bank accounts. The state of a bank account is an integer. The state of a bank account can be a negative number. This means that the owner of the account owes the bank money. Ilya the Lion has recently had a birthday, so he got a lot of gifts. One of them (the gift of the main ZooVille bank) is the opportunity to delete the last digit or the digit before last from the state of his bank account no more than once. For example, if the state of Ilya's bank account is -123, then Ilya can delete the last digit and get his account balance equal to -12, also he can remove its digit before last and get the account balance equal to -13. Of course, Ilya is permitted not to use the opportunity to delete a digit from the balance. Ilya is not very good at math, and that's why he asks you to help him maximize his bank account. Find the maximum state of the bank account that can be obtained using the bank's gift.
The single line contains integer *n* (10<=≀<=|*n*|<=≀<=109) β€” the state of Ilya's bank account.
In a single line print an integer β€” the maximum state of the bank account that Ilya can get.
[ "2230\n", "-10\n", "-100003\n" ]
[ "2230\n", "0\n", "-10000\n" ]
In the first test sample Ilya doesn't profit from using the present. In the second test sample you can delete digit 1 and get the state of the account equal to 0.
500
[ { "input": "2230", "output": "2230" }, { "input": "-10", "output": "0" }, { "input": "-100003", "output": "-10000" }, { "input": "544883178", "output": "544883178" }, { "input": "-847251738", "output": "-84725173" }, { "input": "423654797", "output": "423654797" }, { "input": "-623563697", "output": "-62356367" }, { "input": "645894116", "output": "645894116" }, { "input": "-384381709", "output": "-38438170" }, { "input": "437587210", "output": "437587210" }, { "input": "-297534606", "output": "-29753460" }, { "input": "891773002", "output": "891773002" }, { "input": "-56712976", "output": "-5671296" }, { "input": "963662765", "output": "963662765" }, { "input": "-272656295", "output": "-27265625" }, { "input": "383441522", "output": "383441522" }, { "input": "-477665112", "output": "-47766511" }, { "input": "791725034", "output": "791725034" }, { "input": "-812168727", "output": "-81216872" }, { "input": "528894922", "output": "528894922" }, { "input": "-479977172", "output": "-47997712" }, { "input": "568044564", "output": "568044564" }, { "input": "-392784794", "output": "-39278474" }, { "input": "925596634", "output": "925596634" }, { "input": "-836078769", "output": "-83607876" }, { "input": "71036059", "output": "71036059" }, { "input": "-337396162", "output": "-33739612" }, { "input": "87129297", "output": "87129297" }, { "input": "-648171877", "output": "-64817187" }, { "input": "20218400", "output": "20218400" }, { "input": "10", "output": "10" }, { "input": "1000000000", "output": "1000000000" }, { "input": "-1000000000", "output": "-100000000" }, { "input": "-102", "output": "-10" }, { "input": "-120", "output": "-10" }, { "input": "-20", "output": "0" }, { "input": "-15", "output": "-1" }, { "input": "-5575533", "output": "-557553" }, { "input": "-50", "output": "0" }, { "input": "-31", "output": "-1" }, { "input": "-55", "output": "-5" }, { "input": "-81", "output": "-1" }, { "input": "-99", "output": "-9" }, { "input": "-23", "output": "-2" }, { "input": "-41", "output": "-1" }, { "input": "-24", "output": "-2" }, { "input": "46", "output": "46" } ]
1,688,998,694
2,147,483,647
PyPy 3-64
OK
TESTS
47
122
0
n=int(input()) if n<0: ld=(-1*n)%10 a_ld=(-1*n)//10 lbd= (a_ld)%10 lbd_n=(a_ld)//10 lbd_n=((lbd_n*10)+ld) ans1=a_ld*-1 ans2=lbd_n*-1 if ans1>ans2: print(ans1) else: print(ans2) else: print(n)
Title: Ilya and Bank Account Time Limit: None seconds Memory Limit: None megabytes Problem Description: Ilya is a very clever lion, he lives in an unusual city ZooVille. In this city all the animals have their rights and obligations. Moreover, they even have their own bank accounts. The state of a bank account is an integer. The state of a bank account can be a negative number. This means that the owner of the account owes the bank money. Ilya the Lion has recently had a birthday, so he got a lot of gifts. One of them (the gift of the main ZooVille bank) is the opportunity to delete the last digit or the digit before last from the state of his bank account no more than once. For example, if the state of Ilya's bank account is -123, then Ilya can delete the last digit and get his account balance equal to -12, also he can remove its digit before last and get the account balance equal to -13. Of course, Ilya is permitted not to use the opportunity to delete a digit from the balance. Ilya is not very good at math, and that's why he asks you to help him maximize his bank account. Find the maximum state of the bank account that can be obtained using the bank's gift. Input Specification: The single line contains integer *n* (10<=≀<=|*n*|<=≀<=109) β€” the state of Ilya's bank account. Output Specification: In a single line print an integer β€” the maximum state of the bank account that Ilya can get. Demo Input: ['2230\n', '-10\n', '-100003\n'] Demo Output: ['2230\n', '0\n', '-10000\n'] Note: In the first test sample Ilya doesn't profit from using the present. In the second test sample you can delete digit 1 and get the state of the account equal to 0.
```python n=int(input()) if n<0: ld=(-1*n)%10 a_ld=(-1*n)//10 lbd= (a_ld)%10 lbd_n=(a_ld)//10 lbd_n=((lbd_n*10)+ld) ans1=a_ld*-1 ans2=lbd_n*-1 if ans1>ans2: print(ans1) else: print(ans2) else: print(n) ```
3