Unnamed: 0 int64 0 832k | id float64 2.49B 32.1B | type stringclasses 1
value | created_at stringlengths 19 19 | repo stringlengths 5 112 | repo_url stringlengths 34 141 | action stringclasses 3
values | title stringlengths 1 1k | labels stringlengths 4 1.38k | body stringlengths 1 262k | index stringclasses 16
values | text_combine stringlengths 96 262k | label stringclasses 2
values | text stringlengths 96 252k | binary_label int64 0 1 |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
663,478 | 22,194,727,809 | IssuesEvent | 2022-06-07 05:22:54 | tourcoder/fsfg | https://api.github.com/repos/tourcoder/fsfg | opened | [iOS/macOS] There should be stronger confirmation when removing a member from family | feature high priority | Detailed description according to the following.
**The service or application that you want to submit an issue to**
iOS/macOS
**What feature and where in the system**
Family Sharing
**Current Status**
The confirmation is so weak.
**The way you want it to be**
Should be stronger, such as, need to enter the password of the Organizer's Apple account.
**Reason**
Too easy to mishandle.
**Additional context**
None | 1.0 | [iOS/macOS] There should be stronger confirmation when removing a member from family - Detailed description according to the following.
**The service or application that you want to submit an issue to**
iOS/macOS
**What feature and where in the system**
Family Sharing
**Current Status**
The confirmation is so weak.
**The way you want it to be**
Should be stronger, such as, need to enter the password of the Organizer's Apple account.
**Reason**
Too easy to mishandle.
**Additional context**
None | priority | there should be stronger confirmation when removing a member from family detailed description according to the following the service or application that you want to submit an issue to ios macos what feature and where in the system family sharing current status the confirmation is so weak the way you want it to be should be stronger such as need to enter the password of the organizer s apple account reason too easy to mishandle additional context none | 1 |
79,260 | 10,115,039,381 | IssuesEvent | 2019-07-30 20:42:38 | influxdata/influxdb | https://api.github.com/repos/influxdata/influxdb | closed | I write a simple handbook in chinese,Is it useful to influxdb? | 1.x area/documentation wontfix | is it posible to add this handbook into your readme.md?
wish help.
github: https://github.com/xtutu/influxdb-handbook
handbook : https://www.gitbook.com/read/book/xtutu/influxdb-handbook
| 1.0 | I write a simple handbook in chinese,Is it useful to influxdb? - is it posible to add this handbook into your readme.md?
wish help.
github: https://github.com/xtutu/influxdb-handbook
handbook : https://www.gitbook.com/read/book/xtutu/influxdb-handbook
| non_priority | i write a simple handbook in chinese is it useful to influxdb is it posible to add this handbook into your readme md wish help github handbook | 0 |
332,399 | 10,092,466,059 | IssuesEvent | 2019-07-26 16:45:28 | StrangeLoopGames/EcoIssues | https://api.github.com/repos/StrangeLoopGames/EcoIssues | closed | Make Bank Accounts and Registrars tooltipable | Fixed Low Priority | 
These names should be tooltipable, and if you click them it selects them as usual.
| 1.0 | Make Bank Accounts and Registrars tooltipable - 
These names should be tooltipable, and if you click them it selects them as usual.
| priority | make bank accounts and registrars tooltipable these names should be tooltipable and if you click them it selects them as usual | 1 |
610,858 | 18,926,776,525 | IssuesEvent | 2021-11-17 10:22:01 | davidvavra/duna-valka-assassinu | https://api.github.com/repos/davidvavra/duna-valka-assassinu | opened | Rozsireni modulu jednotky - armady | priority-medium | Pokud bychom rozlisovali typ jednotky podrobneji, umozni nam to vylepsit infrastrukturu v nekolika ohledech.
Lepsi prezentace parametru armad
Armady maji nasledujici parametry viditelne pro hrace:
- jmeno,
- sila,
- velikost,
- moralka,
- general,
- specialni schopnost.
Vsechny tyto hodnoty muzeme uchovavat v jednom poli v ramci komentare pro hrace. Z hlediska citelnosti pro hrace a jednoduchosti uprav pro nas by bylo fajn mit novy typ, "aktivni/armada", ktery by navic mel parametry vyse (s vyjimkou jmena, ktere nepotrebujeme duplikovat). | 1.0 | Rozsireni modulu jednotky - armady - Pokud bychom rozlisovali typ jednotky podrobneji, umozni nam to vylepsit infrastrukturu v nekolika ohledech.
Lepsi prezentace parametru armad
Armady maji nasledujici parametry viditelne pro hrace:
- jmeno,
- sila,
- velikost,
- moralka,
- general,
- specialni schopnost.
Vsechny tyto hodnoty muzeme uchovavat v jednom poli v ramci komentare pro hrace. Z hlediska citelnosti pro hrace a jednoduchosti uprav pro nas by bylo fajn mit novy typ, "aktivni/armada", ktery by navic mel parametry vyse (s vyjimkou jmena, ktere nepotrebujeme duplikovat). | priority | rozsireni modulu jednotky armady pokud bychom rozlisovali typ jednotky podrobneji umozni nam to vylepsit infrastrukturu v nekolika ohledech lepsi prezentace parametru armad armady maji nasledujici parametry viditelne pro hrace jmeno sila velikost moralka general specialni schopnost vsechny tyto hodnoty muzeme uchovavat v jednom poli v ramci komentare pro hrace z hlediska citelnosti pro hrace a jednoduchosti uprav pro nas by bylo fajn mit novy typ aktivni armada ktery by navic mel parametry vyse s vyjimkou jmena ktere nepotrebujeme duplikovat | 1 |
136,164 | 18,722,428,733 | IssuesEvent | 2021-11-03 13:16:24 | ioana-github-enterprise/simplebuild | https://api.github.com/repos/ioana-github-enterprise/simplebuild | opened | CVE-2019-17531 (High) detected in jackson-databind-2.7.9.jar | security vulnerability | ## CVE-2019-17531 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>jackson-databind-2.7.9.jar</b></p></summary>
<p>General data-binding functionality for Jackson: works on core streaming API</p>
<p>Library home page: <a href="http://github.com/FasterXML/jackson">http://github.com/FasterXML/jackson</a></p>
<p>Path to dependency file: simplebuild/build.gradle</p>
<p>Path to vulnerable library: le/caches/modules-2/files-2.1/com.fasterxml.jackson.core/jackson-databind/2.7.9/a4c0b14c7dd85bdf4d25da074e90a10fa4b9b88b/jackson-databind-2.7.9.jar</p>
<p>
Dependency Hierarchy:
- :x: **jackson-databind-2.7.9.jar** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/ioana-github-enterprise/simplebuild/commit/c99f55cc0f24d3137d4aa52ce1de8552a9d07579">c99f55cc0f24d3137d4aa52ce1de8552a9d07579</a></p>
<p>Found in base branch: <b>main</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/high_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
A Polymorphic Typing issue was discovered in FasterXML jackson-databind 2.0.0 through 2.9.10. When Default Typing is enabled (either globally or for a specific property) for an externally exposed JSON endpoint and the service has the apache-log4j-extra (version 1.2.x) jar in the classpath, and an attacker can provide a JNDI service to access, it is possible to make the service execute a malicious payload.
<p>Publish Date: 2019-10-12
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2019-17531>CVE-2019-17531</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>9.8</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: High
- Integrity Impact: High
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-17531">https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-17531</a></p>
<p>Release Date: 2019-10-12</p>
<p>Fix Resolution: 2.10</p>
</p>
</details>
<p></p>
***
:rescue_worker_helmet: Automatic Remediation is available for this issue
<!-- <REMEDIATE>{"isOpenPROnVulnerability":true,"isPackageBased":true,"isDefaultBranch":true,"packages":[{"packageType":"Java","groupId":"com.fasterxml.jackson.core","packageName":"jackson-databind","packageVersion":"2.7.9","packageFilePaths":["/build.gradle"],"isTransitiveDependency":false,"dependencyTree":"com.fasterxml.jackson.core:jackson-databind:2.7.9","isMinimumFixVersionAvailable":true,"minimumFixVersion":"2.10"}],"baseBranches":["main"],"vulnerabilityIdentifier":"CVE-2019-17531","vulnerabilityDetails":"A Polymorphic Typing issue was discovered in FasterXML jackson-databind 2.0.0 through 2.9.10. When Default Typing is enabled (either globally or for a specific property) for an externally exposed JSON endpoint and the service has the apache-log4j-extra (version 1.2.x) jar in the classpath, and an attacker can provide a JNDI service to access, it is possible to make the service execute a malicious payload.","vulnerabilityUrl":"https://vuln.whitesourcesoftware.com/vulnerability/CVE-2019-17531","cvss3Severity":"high","cvss3Score":"9.8","cvss3Metrics":{"A":"High","AC":"Low","PR":"None","S":"Unchanged","C":"High","UI":"None","AV":"Network","I":"High"},"extraData":{}}</REMEDIATE> --> | True | CVE-2019-17531 (High) detected in jackson-databind-2.7.9.jar - ## CVE-2019-17531 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>jackson-databind-2.7.9.jar</b></p></summary>
<p>General data-binding functionality for Jackson: works on core streaming API</p>
<p>Library home page: <a href="http://github.com/FasterXML/jackson">http://github.com/FasterXML/jackson</a></p>
<p>Path to dependency file: simplebuild/build.gradle</p>
<p>Path to vulnerable library: le/caches/modules-2/files-2.1/com.fasterxml.jackson.core/jackson-databind/2.7.9/a4c0b14c7dd85bdf4d25da074e90a10fa4b9b88b/jackson-databind-2.7.9.jar</p>
<p>
Dependency Hierarchy:
- :x: **jackson-databind-2.7.9.jar** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/ioana-github-enterprise/simplebuild/commit/c99f55cc0f24d3137d4aa52ce1de8552a9d07579">c99f55cc0f24d3137d4aa52ce1de8552a9d07579</a></p>
<p>Found in base branch: <b>main</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/high_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
A Polymorphic Typing issue was discovered in FasterXML jackson-databind 2.0.0 through 2.9.10. When Default Typing is enabled (either globally or for a specific property) for an externally exposed JSON endpoint and the service has the apache-log4j-extra (version 1.2.x) jar in the classpath, and an attacker can provide a JNDI service to access, it is possible to make the service execute a malicious payload.
<p>Publish Date: 2019-10-12
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2019-17531>CVE-2019-17531</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>9.8</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: High
- Integrity Impact: High
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-17531">https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-17531</a></p>
<p>Release Date: 2019-10-12</p>
<p>Fix Resolution: 2.10</p>
</p>
</details>
<p></p>
***
:rescue_worker_helmet: Automatic Remediation is available for this issue
<!-- <REMEDIATE>{"isOpenPROnVulnerability":true,"isPackageBased":true,"isDefaultBranch":true,"packages":[{"packageType":"Java","groupId":"com.fasterxml.jackson.core","packageName":"jackson-databind","packageVersion":"2.7.9","packageFilePaths":["/build.gradle"],"isTransitiveDependency":false,"dependencyTree":"com.fasterxml.jackson.core:jackson-databind:2.7.9","isMinimumFixVersionAvailable":true,"minimumFixVersion":"2.10"}],"baseBranches":["main"],"vulnerabilityIdentifier":"CVE-2019-17531","vulnerabilityDetails":"A Polymorphic Typing issue was discovered in FasterXML jackson-databind 2.0.0 through 2.9.10. When Default Typing is enabled (either globally or for a specific property) for an externally exposed JSON endpoint and the service has the apache-log4j-extra (version 1.2.x) jar in the classpath, and an attacker can provide a JNDI service to access, it is possible to make the service execute a malicious payload.","vulnerabilityUrl":"https://vuln.whitesourcesoftware.com/vulnerability/CVE-2019-17531","cvss3Severity":"high","cvss3Score":"9.8","cvss3Metrics":{"A":"High","AC":"Low","PR":"None","S":"Unchanged","C":"High","UI":"None","AV":"Network","I":"High"},"extraData":{}}</REMEDIATE> --> | non_priority | cve high detected in jackson databind jar cve high severity vulnerability vulnerable library jackson databind jar general data binding functionality for jackson works on core streaming api library home page a href path to dependency file simplebuild build gradle path to vulnerable library le caches modules files com fasterxml jackson core jackson databind jackson databind jar dependency hierarchy x jackson databind jar vulnerable library found in head commit a href found in base branch main vulnerability details a polymorphic typing issue was discovered in fasterxml jackson databind through when default typing is enabled either globally or for a specific property for an externally exposed json endpoint and the service has the apache extra version x jar in the classpath and an attacker can provide a jndi service to access it is possible to make the service execute a malicious payload publish date url a href cvss score details base score metrics exploitability metrics attack vector network attack complexity low privileges required none user interaction none scope unchanged impact metrics confidentiality impact high integrity impact high availability impact high for more information on scores click a href suggested fix type upgrade version origin a href release date fix resolution rescue worker helmet automatic remediation is available for this issue isopenpronvulnerability true ispackagebased true isdefaultbranch true packages istransitivedependency false dependencytree com fasterxml jackson core jackson databind isminimumfixversionavailable true minimumfixversion basebranches vulnerabilityidentifier cve vulnerabilitydetails a polymorphic typing issue was discovered in fasterxml jackson databind through when default typing is enabled either globally or for a specific property for an externally exposed json endpoint and the service has the apache extra version x jar in the classpath and an attacker can provide a jndi service to access it is possible to make the service execute a malicious payload vulnerabilityurl | 0 |
122,395 | 4,834,900,118 | IssuesEvent | 2016-11-08 15:32:02 | wow-mania/Redemption | https://api.github.com/repos/wow-mania/Redemption | closed | [Dungeon] Dire Maul West | Dungeon Fixed Priority | This dungeon is uncompleteable as the final boss Immol'thar http://www.wow-mania.com/armory/?npc=11496 cannot be killed by players without GM assistance. The shield surrounding him has to be lowered by players killing Mana Remnants (http://www.wow-mania.com/armory/?npc=11483) around the pylons set inside the instance.
The shield doesn't lower unless a GM right clicks it, therefore it is not working a intended.
| 1.0 | [Dungeon] Dire Maul West - This dungeon is uncompleteable as the final boss Immol'thar http://www.wow-mania.com/armory/?npc=11496 cannot be killed by players without GM assistance. The shield surrounding him has to be lowered by players killing Mana Remnants (http://www.wow-mania.com/armory/?npc=11483) around the pylons set inside the instance.
The shield doesn't lower unless a GM right clicks it, therefore it is not working a intended.
| priority | dire maul west this dungeon is uncompleteable as the final boss immol thar cannot be killed by players without gm assistance the shield surrounding him has to be lowered by players killing mana remnants around the pylons set inside the instance the shield doesn t lower unless a gm right clicks it therefore it is not working a intended | 1 |
168,781 | 13,102,766,541 | IssuesEvent | 2020-08-04 07:22:05 | QualiSystems/OpenStack-Shell | https://api.github.com/repos/QualiSystems/OpenStack-Shell | closed | Security Groups Support | F-VM Deployment Tentative Test Plan Ready | Whenever an Instance is deployed, it should be possible to connect to the instance on specified ports through Deploy Resource Inbound and Outbound ports. The security groups required by QualiX and CloudShell execution server will automatically be added. This use case is about defining custom security groups (inbound or outbound ports) specific to the application that are going to enable an external user to remotely connect to the App. Another use case would be in a scenario with an application components not in the sandbox, such as a shared directory service or a plugin.
- [ ] Support Defining Security Groups in OpenStack
- [ ] Support assigning Security Groups to Instance | 1.0 | Security Groups Support - Whenever an Instance is deployed, it should be possible to connect to the instance on specified ports through Deploy Resource Inbound and Outbound ports. The security groups required by QualiX and CloudShell execution server will automatically be added. This use case is about defining custom security groups (inbound or outbound ports) specific to the application that are going to enable an external user to remotely connect to the App. Another use case would be in a scenario with an application components not in the sandbox, such as a shared directory service or a plugin.
- [ ] Support Defining Security Groups in OpenStack
- [ ] Support assigning Security Groups to Instance | non_priority | security groups support whenever an instance is deployed it should be possible to connect to the instance on specified ports through deploy resource inbound and outbound ports the security groups required by qualix and cloudshell execution server will automatically be added this use case is about defining custom security groups inbound or outbound ports specific to the application that are going to enable an external user to remotely connect to the app another use case would be in a scenario with an application components not in the sandbox such as a shared directory service or a plugin support defining security groups in openstack support assigning security groups to instance | 0 |
253,482 | 21,685,107,439 | IssuesEvent | 2022-05-09 10:28:51 | elastic/e2e-testing | https://api.github.com/repos/elastic/e2e-testing | closed | Flaky Test [Initializing / End-To-End Tests / fleet_sles15_running_on_beats / Deploying the Elastic-Agent with enroll and then run on top of filebeat #2 – Running on top of Beats] | flaky-test ci-reported | ## Flaky Test
* **Test Name:** `Initializing / End-To-End Tests / fleet_sles15_running_on_beats / Deploying the Elastic-Agent with enroll and then run on top of filebeat #2 – Running on top of Beats`
* **Artifact Link:** https://beats-ci.elastic.co/blue/organizations/jenkins/e2e-tests%2Fe2e-testing-mbp%2F7.17/detail/7.17/443/
* **PR:** None
* **Commit:** 427848885100b0b5b88662688b2d8e4a2220e0d2
### Error details
```
Step the "elastic-agent" process is in the "started" state on the host
```
| 1.0 | Flaky Test [Initializing / End-To-End Tests / fleet_sles15_running_on_beats / Deploying the Elastic-Agent with enroll and then run on top of filebeat #2 – Running on top of Beats] - ## Flaky Test
* **Test Name:** `Initializing / End-To-End Tests / fleet_sles15_running_on_beats / Deploying the Elastic-Agent with enroll and then run on top of filebeat #2 – Running on top of Beats`
* **Artifact Link:** https://beats-ci.elastic.co/blue/organizations/jenkins/e2e-tests%2Fe2e-testing-mbp%2F7.17/detail/7.17/443/
* **PR:** None
* **Commit:** 427848885100b0b5b88662688b2d8e4a2220e0d2
### Error details
```
Step the "elastic-agent" process is in the "started" state on the host
```
| non_priority | flaky test flaky test test name initializing end to end tests fleet running on beats deploying the elastic agent with enroll and then run on top of filebeat – running on top of beats artifact link pr none commit error details step the elastic agent process is in the started state on the host | 0 |
347,925 | 10,436,589,165 | IssuesEvent | 2019-09-17 19:55:16 | mothur/mothur | https://api.github.com/repos/mothur/mothur | closed | issues with gz'd files during make.contigs | Bugs Priority Support | This may be two separate issues that involve running mothur v.1.39.5 on gzipped fastq files with very few sequences. I'm not sure if they're connected.
1) mothur segfaults using the ffastq/rfastq syntax
./mothur "#make.contigs(ffastq=test_1.fq.gz, rfastq=test_2.fq.gz)"
mO�R�0 is in your forward fastq file and not in your reverse file, please remove it using the remove.seqs command before proceeding.
Making contigs...
zsh: segmentation fault ./mothur "#make.contigs(ffastq=test_1.fq.gz, rfastq=test_2.fq.gz)"
2) mothur spits out MILLIONS of errors when run using the .files syntax.
./mothur "#make.contigs(file=test.files)"
I let it go for 5 minutes and it spit out the following error 60 million times (several Gb worth)
[WARNING]: missing sequence for , ignoring.[WARNING]: expected a name with + as a leading character, ignoring.[WARNING]: missing quality for , ignoring.[WARNING]: Blank fasta name, ignoring read.
Detected 59813656 [WARNING] messages, please review.
test.files
```test1 test_1.fq.gz test_2.fq.gz```
test_1.fq
```
@M03580:15:000000000-AHFYP:1:1107:11796:2635 1:N:0:5
ATCGGTTGTGCCAGCCGCCGCGGTAATACAGGGGATGCAAGTGTTATCCGGAATTATTGGGCGTAAAGCGTCTGCAGGTTGATATTTAAGTCTTTTGTTAAACCTCCGGGCTCAACCCGGAATCTGCAAAGGAAACTATCTATCTTGAGTATGGTAGGGGTAAAGGGAATTTCCAGTGGAGCGGTGAAATGCGTAGATATTGGAAAGAACACCAACAGCGAAGGCACTTTACTGGGCCAGTACTGACACTCAGAGACGAAAGCTAGGGGAGCAAACAGGAGTATCAACCCTTGTAGTCACC
+
CCCCCGGGGEFGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGEFFGD@FGGGGGGGGGGGGEGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGGGEEGGGGGGGGGGGGGGGGFGGGFFGDGGGGGGGGGGGGGED<FEGFEFGGGEGGAEA8DCGGGFFFF;EEEFGGG>*;E2;>FDEC;=@EGEBFGGGGGGFFGG5CE8:*/*>GC=6AFFGFGG7;9/CEFGFFF*:?B442F:==44>5(937<*))2(399>:>FF?0228:))3>F>D(.2:A4.))),
```
test_2.fq
```
@M03580:15:000000000-AHFYP:1:1107:11796:2635 2:N:0:5
ATCTGGGACTACGCGGATTTCTAATCCTGTTTGCTCCCTACACTTTCGTCCCTCAATGTCAGTTTGTACTAAAACGTCTCTTTCGCTAATGCTGTTCCTCTCCATATTTTTGGCATTTATCCCTGAATATGTGAGTGTTCCTTTCTGTGCTCAACTCAAGTATCGCCGTATTATATCGTTGTTTACAGTTTCGCTGTAAGTTTTACCATATCACTTGTCATACACTCTACCGACGTGTTTCGCCGCGTACTGCTCTCCATACGTATCTCAAGACCGCTTAACGCAGCTCCTTGATCGTAGA
+
-@,@A-,@<<8F,@FB+8B@AFFGCGGECF,C<,CE@@E<C,C,E@FE,@FEGFDFFGCC,<F9<CCFFA@,,,,+:,6BFAFFGEG,8<E,9,C<54@,,,99,C,9,;=@+,9,C@,,,99,,,+,4,4,,,,9,9+++,63+3+?*>?+++)*3*58;;*2)0*3+0*++5+3?*:6)38)***+2+,+3:0*)3*31;*;+0*13*0***1*3*5;E=*0)0)000*11)))))0)2((--().(.8).))))()))(()/)(1.1)).((((((().(((((()((-))))-))0)
``` | 1.0 | issues with gz'd files during make.contigs - This may be two separate issues that involve running mothur v.1.39.5 on gzipped fastq files with very few sequences. I'm not sure if they're connected.
1) mothur segfaults using the ffastq/rfastq syntax
./mothur "#make.contigs(ffastq=test_1.fq.gz, rfastq=test_2.fq.gz)"
mO�R�0 is in your forward fastq file and not in your reverse file, please remove it using the remove.seqs command before proceeding.
Making contigs...
zsh: segmentation fault ./mothur "#make.contigs(ffastq=test_1.fq.gz, rfastq=test_2.fq.gz)"
2) mothur spits out MILLIONS of errors when run using the .files syntax.
./mothur "#make.contigs(file=test.files)"
I let it go for 5 minutes and it spit out the following error 60 million times (several Gb worth)
[WARNING]: missing sequence for , ignoring.[WARNING]: expected a name with + as a leading character, ignoring.[WARNING]: missing quality for , ignoring.[WARNING]: Blank fasta name, ignoring read.
Detected 59813656 [WARNING] messages, please review.
test.files
```test1 test_1.fq.gz test_2.fq.gz```
test_1.fq
```
@M03580:15:000000000-AHFYP:1:1107:11796:2635 1:N:0:5
ATCGGTTGTGCCAGCCGCCGCGGTAATACAGGGGATGCAAGTGTTATCCGGAATTATTGGGCGTAAAGCGTCTGCAGGTTGATATTTAAGTCTTTTGTTAAACCTCCGGGCTCAACCCGGAATCTGCAAAGGAAACTATCTATCTTGAGTATGGTAGGGGTAAAGGGAATTTCCAGTGGAGCGGTGAAATGCGTAGATATTGGAAAGAACACCAACAGCGAAGGCACTTTACTGGGCCAGTACTGACACTCAGAGACGAAAGCTAGGGGAGCAAACAGGAGTATCAACCCTTGTAGTCACC
+
CCCCCGGGGEFGGGGGGGGGGGGGGGGGGGGGGGEGGGGGGGGGGGEFFGD@FGGGGGGGGGGGGEGGGGGGGGGGGGGGFGGGGGGGGGGGGGGGGFGGFGGGGGGGGEEGGGGGGGGGGGGGGGGFGGGFFGDGGGGGGGGGGGGGED<FEGFEFGGGEGGAEA8DCGGGFFFF;EEEFGGG>*;E2;>FDEC;=@EGEBFGGGGGGFFGG5CE8:*/*>GC=6AFFGFGG7;9/CEFGFFF*:?B442F:==44>5(937<*))2(399>:>FF?0228:))3>F>D(.2:A4.))),
```
test_2.fq
```
@M03580:15:000000000-AHFYP:1:1107:11796:2635 2:N:0:5
ATCTGGGACTACGCGGATTTCTAATCCTGTTTGCTCCCTACACTTTCGTCCCTCAATGTCAGTTTGTACTAAAACGTCTCTTTCGCTAATGCTGTTCCTCTCCATATTTTTGGCATTTATCCCTGAATATGTGAGTGTTCCTTTCTGTGCTCAACTCAAGTATCGCCGTATTATATCGTTGTTTACAGTTTCGCTGTAAGTTTTACCATATCACTTGTCATACACTCTACCGACGTGTTTCGCCGCGTACTGCTCTCCATACGTATCTCAAGACCGCTTAACGCAGCTCCTTGATCGTAGA
+
-@,@A-,@<<8F,@FB+8B@AFFGCGGECF,C<,CE@@E<C,C,E@FE,@FEGFDFFGCC,<F9<CCFFA@,,,,+:,6BFAFFGEG,8<E,9,C<54@,,,99,C,9,;=@+,9,C@,,,99,,,+,4,4,,,,9,9+++,63+3+?*>?+++)*3*58;;*2)0*3+0*++5+3?*:6)38)***+2+,+3:0*)3*31;*;+0*13*0***1*3*5;E=*0)0)000*11)))))0)2((--().(.8).))))()))(()/)(1.1)).((((((().(((((()((-))))-))0)
``` | priority | issues with gz d files during make contigs this may be two separate issues that involve running mothur v on gzipped fastq files with very few sequences i m not sure if they re connected mothur segfaults using the ffastq rfastq syntax mothur make contigs ffastq test fq gz rfastq test fq gz mo�r� is in your forward fastq file and not in your reverse file please remove it using the remove seqs command before proceeding making contigs zsh segmentation fault mothur make contigs ffastq test fq gz rfastq test fq gz mothur spits out millions of errors when run using the files syntax mothur make contigs file test files i let it go for minutes and it spit out the following error million times several gb worth missing sequence for ignoring expected a name with as a leading character ignoring missing quality for ignoring blank fasta name ignoring read detected messages please review test files test fq gz test fq gz test fq ahfyp n atcggttgtgccagccgccgcggtaatacaggggatgcaagtgttatccggaattattgggcgtaaagcgtctgcaggttgatatttaagtcttttgttaaacctccgggctcaacccggaatctgcaaaggaaactatctatcttgagtatggtaggggtaaagggaatttccagtggagcggtgaaatgcgtagatattggaaagaacaccaacagcgaaggcactttactgggccagtactgacactcagagacgaaagctaggggagcaaacaggagtatcaacccttgtagtcacc cccccggggefgggggggggggggggggggggggegggggggggggeffgd fggggggggggggeggggggggggggggfggggggggggggggggfggfggggggggeeggggggggggggggggfgggffgdggggggggggggged fdec gc cefgfff ff f d test fq ahfyp n atctgggactacgcggatttctaatcctgtttgctccctacactttcgtccctcaatgtcagtttgtactaaaacgtctctttcgctaatgctgttcctctccatatttttggcatttatccctgaatatgtgagtgttcctttctgtgctcaactcaagtatcgccgtattatatcgttgtttacagtttcgctgtaagttttaccatatcacttgtcatacactctaccgacgtgtttcgccgcgtactgctctccatacgtatctcaagaccgcttaacgcagctccttgatcgtaga a e | 1 |
345,860 | 10,374,137,445 | IssuesEvent | 2019-09-09 08:57:17 | 52North/sos4R | https://api.github.com/repos/52North/sos4R | closed | Test other xml parsing functions and add configuration parameters | priority medium | Add some unit tests for parsing responses and then try out different available xml parsing functions.
``` r
library("XML")
?xml
?xmlParse
?xmlTreeParse # try out internal nodes!
?xmlParseDoc
```
Also try out the options setting. The vector should be part of the SOS instance.
``` r
mySOS@xmlParseDocOptions
```
For available options see http://web.mit.edu/~r/current/arch/i386_linux26/lib/R/library/XML/html/xmlParseDoc.html and http://xmlsoft.org/xmllint.html
| 1.0 | Test other xml parsing functions and add configuration parameters - Add some unit tests for parsing responses and then try out different available xml parsing functions.
``` r
library("XML")
?xml
?xmlParse
?xmlTreeParse # try out internal nodes!
?xmlParseDoc
```
Also try out the options setting. The vector should be part of the SOS instance.
``` r
mySOS@xmlParseDocOptions
```
For available options see http://web.mit.edu/~r/current/arch/i386_linux26/lib/R/library/XML/html/xmlParseDoc.html and http://xmlsoft.org/xmllint.html
| priority | test other xml parsing functions and add configuration parameters add some unit tests for parsing responses and then try out different available xml parsing functions r library xml xml xmlparse xmltreeparse try out internal nodes xmlparsedoc also try out the options setting the vector should be part of the sos instance r mysos xmlparsedocoptions for available options see and | 1 |
85,254 | 3,688,510,955 | IssuesEvent | 2016-02-25 13:13:26 | leoncastillejos/sonar | https://api.github.com/repos/leoncastillejos/sonar | closed | send email on condition fixed | priority:medium type:enhancement | When an alert event is raised, it should automatically notify when the alert condition is fixed. | 1.0 | send email on condition fixed - When an alert event is raised, it should automatically notify when the alert condition is fixed. | priority | send email on condition fixed when an alert event is raised it should automatically notify when the alert condition is fixed | 1 |
337,129 | 10,210,940,549 | IssuesEvent | 2019-08-14 15:46:53 | strapi/strapi | https://api.github.com/repos/strapi/strapi | closed | WYSIWYG editor stuck prompting file uploads after user uses drag and drop with text | priority: low status: can't reproduce type: bug 🐛 | <!-- ⚠️ If you do not respect this template your issue will be closed. -->
<!-- =============================================================================== -->
<!-- ⚠️ If you are not using the current Strapi release, you will be asked to update. -->
<!-- Please see the wiki for guides on upgrading to the latest release. -->
<!-- =============================================================================== -->
<!-- ⚠️ Make sure to browse the opened and closed issues before submitting your issue. -->
<!-- ⚠️ Before writing your issue make sure you are using:-->
<!-- Node 10.x.x -->
<!-- npm 6.x.x -->
<!-- The latest version of Strapi. -->
**Informations**
- **Node.js version**: 10.13.0 <!-- Please ensure you are using the Node LTS version (v10) -->
- **NPM version**: 6.4.1
- **Strapi version**: 3.0.0-alpha.24.1 <!-- Please make sure you are on the latest version -->
- **Database**: MongoDB
- **Operating system**: Windows 10
**What is the current behavior?**
The WYSIWYG editor gets stuck prompting me to select a file to upload after using drag and drop functionality with text, ie. selecting text and dragging it into the text area. The text area gets grayed out and when clicked prompts the user to upload a file. When aborted nothing changes, when the text area is clicked you get prompted again. When a file is selected the same thing happens, the file does not get uploaded. This makes it impossible to continue writing until the page has been reloaded (potentially making you lose progress).
**Steps to reproduce the problem**
1. Select text anywhere on the web page (even selecting text within the text editor works)
2. Click on the text and drag it into the text editor
3. The text editor is now grayed out and you can no longer edit text.
**What is the expected behavior?**
Drag and drop with text should either paste in the text or do nothing at all. Should work similarly to native text inputs.
**Suggested solutions**
Fixing the bug. If there is a temporary workaround, such as disabling the drag and drop functionality, I would appreciate it. | 1.0 | WYSIWYG editor stuck prompting file uploads after user uses drag and drop with text - <!-- ⚠️ If you do not respect this template your issue will be closed. -->
<!-- =============================================================================== -->
<!-- ⚠️ If you are not using the current Strapi release, you will be asked to update. -->
<!-- Please see the wiki for guides on upgrading to the latest release. -->
<!-- =============================================================================== -->
<!-- ⚠️ Make sure to browse the opened and closed issues before submitting your issue. -->
<!-- ⚠️ Before writing your issue make sure you are using:-->
<!-- Node 10.x.x -->
<!-- npm 6.x.x -->
<!-- The latest version of Strapi. -->
**Informations**
- **Node.js version**: 10.13.0 <!-- Please ensure you are using the Node LTS version (v10) -->
- **NPM version**: 6.4.1
- **Strapi version**: 3.0.0-alpha.24.1 <!-- Please make sure you are on the latest version -->
- **Database**: MongoDB
- **Operating system**: Windows 10
**What is the current behavior?**
The WYSIWYG editor gets stuck prompting me to select a file to upload after using drag and drop functionality with text, ie. selecting text and dragging it into the text area. The text area gets grayed out and when clicked prompts the user to upload a file. When aborted nothing changes, when the text area is clicked you get prompted again. When a file is selected the same thing happens, the file does not get uploaded. This makes it impossible to continue writing until the page has been reloaded (potentially making you lose progress).
**Steps to reproduce the problem**
1. Select text anywhere on the web page (even selecting text within the text editor works)
2. Click on the text and drag it into the text editor
3. The text editor is now grayed out and you can no longer edit text.
**What is the expected behavior?**
Drag and drop with text should either paste in the text or do nothing at all. Should work similarly to native text inputs.
**Suggested solutions**
Fixing the bug. If there is a temporary workaround, such as disabling the drag and drop functionality, I would appreciate it. | priority | wysiwyg editor stuck prompting file uploads after user uses drag and drop with text informations node js version npm version strapi version alpha database mongodb operating system windows what is the current behavior the wysiwyg editor gets stuck prompting me to select a file to upload after using drag and drop functionality with text ie selecting text and dragging it into the text area the text area gets grayed out and when clicked prompts the user to upload a file when aborted nothing changes when the text area is clicked you get prompted again when a file is selected the same thing happens the file does not get uploaded this makes it impossible to continue writing until the page has been reloaded potentially making you lose progress steps to reproduce the problem select text anywhere on the web page even selecting text within the text editor works click on the text and drag it into the text editor the text editor is now grayed out and you can no longer edit text what is the expected behavior drag and drop with text should either paste in the text or do nothing at all should work similarly to native text inputs suggested solutions fixing the bug if there is a temporary workaround such as disabling the drag and drop functionality i would appreciate it | 1 |
69,481 | 14,988,854,578 | IssuesEvent | 2021-01-29 02:17:40 | MValle21/llvm-project | https://api.github.com/repos/MValle21/llvm-project | opened | CVE-2020-13091 (High) detected in pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl | security vulnerability | ## CVE-2020-13091 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl</b></p></summary>
<p>Powerful data structures for data analysis, time series, and statistics</p>
<p>Library home page: <a href="https://files.pythonhosted.org/packages/db/83/7d4008ffc2988066ff37f6a0bb6d7b60822367dcb36ba5e39aa7801fda54/pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl">https://files.pythonhosted.org/packages/db/83/7d4008ffc2988066ff37f6a0bb6d7b60822367dcb36ba5e39aa7801fda54/pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl</a></p>
<p>Path to dependency file: llvm-project/clang/utils/analyzer/requirements.txt</p>
<p>Path to vulnerable library: llvm-project/clang/utils/analyzer/requirements.txt,llvm-project/clang/utils/check_cfc,llvm-project/debuginfo-tests/dexter/dex/debugger/dbgeng</p>
<p>
Dependency Hierarchy:
- :x: **pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/MValle21/llvm-project/commit/53a7540377af5cfb21bdaf52cc4f3242c13c8301">53a7540377af5cfb21bdaf52cc4f3242c13c8301</a></p>
<p>Found in base branch: <b>apple/main</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/high_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
** DISPUTED ** pandas through 1.0.3 can unserialize and execute commands from an untrusted file that is passed to the read_pickle() function, if __reduce__ makes an os.system call. NOTE: third parties dispute this issue because the read_pickle() function is documented as unsafe and it is the user's responsibility to use the function in a secure manner.
<p>Publish Date: 2020-05-15
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2020-13091>CVE-2020-13091</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>9.8</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: High
- Integrity Impact: High
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<!-- <REMEDIATE>{"isOpenPROnVulnerability":true,"isPackageBased":true,"isDefaultBranch":true,"packages":[{"packageType":"Python","packageName":"pandas","packageVersion":"0.24.2","isTransitiveDependency":false,"dependencyTree":"pandas:0.24.2","isMinimumFixVersionAvailable":false}],"vulnerabilityIdentifier":"CVE-2020-13091","vulnerabilityDetails":"** DISPUTED ** pandas through 1.0.3 can unserialize and execute commands from an untrusted file that is passed to the read_pickle() function, if __reduce__ makes an os.system call. NOTE: third parties dispute this issue because the read_pickle() function is documented as unsafe and it is the user\u0027s responsibility to use the function in a secure manner.","vulnerabilityUrl":"https://vuln.whitesourcesoftware.com/vulnerability/CVE-2020-13091","cvss3Severity":"high","cvss3Score":"9.8","cvss3Metrics":{"A":"High","AC":"Low","PR":"None","S":"Unchanged","C":"High","UI":"None","AV":"Network","I":"High"},"extraData":{}}</REMEDIATE> --> | True | CVE-2020-13091 (High) detected in pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl - ## CVE-2020-13091 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl</b></p></summary>
<p>Powerful data structures for data analysis, time series, and statistics</p>
<p>Library home page: <a href="https://files.pythonhosted.org/packages/db/83/7d4008ffc2988066ff37f6a0bb6d7b60822367dcb36ba5e39aa7801fda54/pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl">https://files.pythonhosted.org/packages/db/83/7d4008ffc2988066ff37f6a0bb6d7b60822367dcb36ba5e39aa7801fda54/pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl</a></p>
<p>Path to dependency file: llvm-project/clang/utils/analyzer/requirements.txt</p>
<p>Path to vulnerable library: llvm-project/clang/utils/analyzer/requirements.txt,llvm-project/clang/utils/check_cfc,llvm-project/debuginfo-tests/dexter/dex/debugger/dbgeng</p>
<p>
Dependency Hierarchy:
- :x: **pandas-0.24.2-cp27-cp27mu-manylinux1_x86_64.whl** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/MValle21/llvm-project/commit/53a7540377af5cfb21bdaf52cc4f3242c13c8301">53a7540377af5cfb21bdaf52cc4f3242c13c8301</a></p>
<p>Found in base branch: <b>apple/main</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/high_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
** DISPUTED ** pandas through 1.0.3 can unserialize and execute commands from an untrusted file that is passed to the read_pickle() function, if __reduce__ makes an os.system call. NOTE: third parties dispute this issue because the read_pickle() function is documented as unsafe and it is the user's responsibility to use the function in a secure manner.
<p>Publish Date: 2020-05-15
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2020-13091>CVE-2020-13091</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>9.8</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: High
- Integrity Impact: High
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<!-- <REMEDIATE>{"isOpenPROnVulnerability":true,"isPackageBased":true,"isDefaultBranch":true,"packages":[{"packageType":"Python","packageName":"pandas","packageVersion":"0.24.2","isTransitiveDependency":false,"dependencyTree":"pandas:0.24.2","isMinimumFixVersionAvailable":false}],"vulnerabilityIdentifier":"CVE-2020-13091","vulnerabilityDetails":"** DISPUTED ** pandas through 1.0.3 can unserialize and execute commands from an untrusted file that is passed to the read_pickle() function, if __reduce__ makes an os.system call. NOTE: third parties dispute this issue because the read_pickle() function is documented as unsafe and it is the user\u0027s responsibility to use the function in a secure manner.","vulnerabilityUrl":"https://vuln.whitesourcesoftware.com/vulnerability/CVE-2020-13091","cvss3Severity":"high","cvss3Score":"9.8","cvss3Metrics":{"A":"High","AC":"Low","PR":"None","S":"Unchanged","C":"High","UI":"None","AV":"Network","I":"High"},"extraData":{}}</REMEDIATE> --> | non_priority | cve high detected in pandas whl cve high severity vulnerability vulnerable library pandas whl powerful data structures for data analysis time series and statistics library home page a href path to dependency file llvm project clang utils analyzer requirements txt path to vulnerable library llvm project clang utils analyzer requirements txt llvm project clang utils check cfc llvm project debuginfo tests dexter dex debugger dbgeng dependency hierarchy x pandas whl vulnerable library found in head commit a href found in base branch apple main vulnerability details disputed pandas through can unserialize and execute commands from an untrusted file that is passed to the read pickle function if reduce makes an os system call note third parties dispute this issue because the read pickle function is documented as unsafe and it is the user s responsibility to use the function in a secure manner publish date url a href cvss score details base score metrics exploitability metrics attack vector network attack complexity low privileges required none user interaction none scope unchanged impact metrics confidentiality impact high integrity impact high availability impact high for more information on scores click a href isopenpronvulnerability true ispackagebased true isdefaultbranch true packages vulnerabilityidentifier cve vulnerabilitydetails disputed pandas through can unserialize and execute commands from an untrusted file that is passed to the read pickle function if reduce makes an os system call note third parties dispute this issue because the read pickle function is documented as unsafe and it is the user responsibility to use the function in a secure manner vulnerabilityurl | 0 |
19,773 | 6,761,048,305 | IssuesEvent | 2017-10-24 23:15:35 | ca-cwds/case-management | https://api.github.com/repos/ca-cwds/case-management | opened | Clean up images after build | build | Docker images are starting to pile up on the build server:
```
docker images
REPOSITORY TAG IMAGE ID CREATED SIZE
cwds/casemanagement 57 8ca9d63de53a 17 minutes ago 1.11 GB
cwds/casemanagement latest 8ca9d63de53a 17 minutes ago 1.11 GB
cwds/casemanagement 49 cf29b47979f8 25 hours ago 1.11 GB
cwds/casemanagement 48 68c159b86086 25 hours ago 1.11 GB
cwds/casemanagement 45 dda01644accb 26 hours ago 1.11 GB
cwds/casemanagement 46 dda01644accb 26 hours ago 1.11 GB
cwds/case-management 44 fb73adf4971d 27 hours ago 1.11 GB
cwds/case-management 42 ea531ba934ad 27 hours ago 1.11 GB
cwds/case-management 41 6a4f4fd3caa4 27 hours ago 1.11 GB
<none> <none> f3220e97882b 28 hours ago 1.11 GB
cwds/casemanagement <none> 3f8b05edc737 28 hours ago 1.11 GB
cwds/casemanagement <none> e02869309518 28 hours ago 1.11 GB
cwds/case-management 38 ecc9857738ac 28 hours ago 1.11 GB
<none> <none> 1a9e0cfb3757 28 hours ago 1.11 GB
cwds/case-management 37 34bfc284e23a 28 hours ago 1.11 GB
cwds/casemanagement <none> f0761fac5947 29 hours ago 965 MB
cwds/case-management 36 c915304878bb 29 hours ago 1.11 GB
cwds/case-management 35 acef4c329813 29 hours ago 1.11 GB
<none> <none> 4353271db69b 29 hours ago 1.11 GB
cwds/case-management 34 48aba77bcc66 29 hours ago 1.11 GB
cwds/case-management 33 e2f6075a428c 29 hours ago 1.11 GB
cwds/case-management 32 27dc2e3e2d61 29 hours ago 1.11 GB
cwds/case-management 31 f3f45056b35e 30 hours ago 1.11 GB
<none> <none> 0a80791945fe 30 hours ago 1.11 GB
cwds/case-management 27 0edf4786ecc7 30 hours ago 1.11 GB
cwds/case-management 26 0289a5959acd 30 hours ago 1.11 GB
<none> <none> fd327dd5cef9 43 hours ago 1.11 GB
``` | 1.0 | Clean up images after build - Docker images are starting to pile up on the build server:
```
docker images
REPOSITORY TAG IMAGE ID CREATED SIZE
cwds/casemanagement 57 8ca9d63de53a 17 minutes ago 1.11 GB
cwds/casemanagement latest 8ca9d63de53a 17 minutes ago 1.11 GB
cwds/casemanagement 49 cf29b47979f8 25 hours ago 1.11 GB
cwds/casemanagement 48 68c159b86086 25 hours ago 1.11 GB
cwds/casemanagement 45 dda01644accb 26 hours ago 1.11 GB
cwds/casemanagement 46 dda01644accb 26 hours ago 1.11 GB
cwds/case-management 44 fb73adf4971d 27 hours ago 1.11 GB
cwds/case-management 42 ea531ba934ad 27 hours ago 1.11 GB
cwds/case-management 41 6a4f4fd3caa4 27 hours ago 1.11 GB
<none> <none> f3220e97882b 28 hours ago 1.11 GB
cwds/casemanagement <none> 3f8b05edc737 28 hours ago 1.11 GB
cwds/casemanagement <none> e02869309518 28 hours ago 1.11 GB
cwds/case-management 38 ecc9857738ac 28 hours ago 1.11 GB
<none> <none> 1a9e0cfb3757 28 hours ago 1.11 GB
cwds/case-management 37 34bfc284e23a 28 hours ago 1.11 GB
cwds/casemanagement <none> f0761fac5947 29 hours ago 965 MB
cwds/case-management 36 c915304878bb 29 hours ago 1.11 GB
cwds/case-management 35 acef4c329813 29 hours ago 1.11 GB
<none> <none> 4353271db69b 29 hours ago 1.11 GB
cwds/case-management 34 48aba77bcc66 29 hours ago 1.11 GB
cwds/case-management 33 e2f6075a428c 29 hours ago 1.11 GB
cwds/case-management 32 27dc2e3e2d61 29 hours ago 1.11 GB
cwds/case-management 31 f3f45056b35e 30 hours ago 1.11 GB
<none> <none> 0a80791945fe 30 hours ago 1.11 GB
cwds/case-management 27 0edf4786ecc7 30 hours ago 1.11 GB
cwds/case-management 26 0289a5959acd 30 hours ago 1.11 GB
<none> <none> fd327dd5cef9 43 hours ago 1.11 GB
``` | non_priority | clean up images after build docker images are starting to pile up on the build server docker images repository tag image id created size cwds casemanagement minutes ago gb cwds casemanagement latest minutes ago gb cwds casemanagement hours ago gb cwds casemanagement hours ago gb cwds casemanagement hours ago gb cwds casemanagement hours ago gb cwds case management hours ago gb cwds case management hours ago gb cwds case management hours ago gb hours ago gb cwds casemanagement hours ago gb cwds casemanagement hours ago gb cwds case management hours ago gb hours ago gb cwds case management hours ago gb cwds casemanagement hours ago mb cwds case management hours ago gb cwds case management hours ago gb hours ago gb cwds case management hours ago gb cwds case management hours ago gb cwds case management hours ago gb cwds case management hours ago gb hours ago gb cwds case management hours ago gb cwds case management hours ago gb hours ago gb | 0 |
249,131 | 7,953,878,638 | IssuesEvent | 2018-07-12 04:29:12 | StrangeLoopGames/EcoIssues | https://api.github.com/repos/StrangeLoopGames/EcoIssues | closed | Storage UI Stockpile Duplication bug | Medium Priority Respond ASAP | I have 2 stockpiles that are bugged a glass and a brick stockpile which show up as doubles in the storage ui.
when I try to consolidate the items into the stockpiles it duplicates the materials.
I'm currently trying to find a fix to remove the stockpiles that duplicate items any ideas would be appreciated | 1.0 | Storage UI Stockpile Duplication bug - I have 2 stockpiles that are bugged a glass and a brick stockpile which show up as doubles in the storage ui.
when I try to consolidate the items into the stockpiles it duplicates the materials.
I'm currently trying to find a fix to remove the stockpiles that duplicate items any ideas would be appreciated | priority | storage ui stockpile duplication bug i have stockpiles that are bugged a glass and a brick stockpile which show up as doubles in the storage ui when i try to consolidate the items into the stockpiles it duplicates the materials i m currently trying to find a fix to remove the stockpiles that duplicate items any ideas would be appreciated | 1 |
37,148 | 18,158,463,676 | IssuesEvent | 2021-09-27 06:41:19 | pytest-dev/pytest | https://api.github.com/repos/pytest-dev/pytest | closed | Py.test hangs while diffing `bytes` objects when assertion fails | type: performance topic: rewrite | My test:
```Python
def test_equality():
# original and new are bytes object
assert original == new
```
`py.test` worked correctly when the assertions were true, however instead of failing, it gets stuck on some infinite loop probably because CPU usage is quite high and sustained until I quit it manually.
When I exit out, a `KeyboardInterrupt` from `difflib.py` is emitted, which likely indicates that pytest is stuck on diffing, my bytes objects are about ~100kb size in minimum, I don't need the diff, how do I disable it? | True | Py.test hangs while diffing `bytes` objects when assertion fails - My test:
```Python
def test_equality():
# original and new are bytes object
assert original == new
```
`py.test` worked correctly when the assertions were true, however instead of failing, it gets stuck on some infinite loop probably because CPU usage is quite high and sustained until I quit it manually.
When I exit out, a `KeyboardInterrupt` from `difflib.py` is emitted, which likely indicates that pytest is stuck on diffing, my bytes objects are about ~100kb size in minimum, I don't need the diff, how do I disable it? | non_priority | py test hangs while diffing bytes objects when assertion fails my test python def test equality original and new are bytes object assert original new py test worked correctly when the assertions were true however instead of failing it gets stuck on some infinite loop probably because cpu usage is quite high and sustained until i quit it manually when i exit out a keyboardinterrupt from difflib py is emitted which likely indicates that pytest is stuck on diffing my bytes objects are about size in minimum i don t need the diff how do i disable it | 0 |
711,785 | 24,475,245,710 | IssuesEvent | 2022-10-08 04:35:17 | AY2223S1-CS2103T-T15-4/tp | https://api.github.com/repos/AY2223S1-CS2103T-T15-4/tp | closed | Edit attributes in Exercise class | priority.High type.Task | Update exercise class attributes and able to pass all tests. | 1.0 | Edit attributes in Exercise class - Update exercise class attributes and able to pass all tests. | priority | edit attributes in exercise class update exercise class attributes and able to pass all tests | 1 |
27,021 | 2,689,841,704 | IssuesEvent | 2015-03-31 13:09:47 | mbenkmann/limux-gosa-test | https://api.github.com/repos/mbenkmann/limux-gosa-test | closed | support logrotate | imported Milestone-1 Priority-Normal Type-Feature | _From [matthias...@gmail.com](https://code.google.com/u/110029356478037175549/) on October 25, 2012 15:54:39_
Currently go-susi opens its log file once and keeps it open. This means that logrotate will not work with go-susi's logfile. This should be changed.
_Original issue: http://code.google.com/p/go-susi/issues/detail?id=21_ | 1.0 | support logrotate - _From [matthias...@gmail.com](https://code.google.com/u/110029356478037175549/) on October 25, 2012 15:54:39_
Currently go-susi opens its log file once and keeps it open. This means that logrotate will not work with go-susi's logfile. This should be changed.
_Original issue: http://code.google.com/p/go-susi/issues/detail?id=21_ | priority | support logrotate from on october currently go susi opens its log file once and keeps it open this means that logrotate will not work with go susi s logfile this should be changed original issue | 1 |
139,846 | 18,858,054,728 | IssuesEvent | 2021-11-12 09:20:03 | Verseghy/website_frontend | https://api.github.com/repos/Verseghy/website_frontend | closed | CVE-2021-23362 (Medium) detected in hosted-git-info-3.0.2.tgz, hosted-git-info-2.7.1.tgz | security vulnerability | ## CVE-2021-23362 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Libraries - <b>hosted-git-info-3.0.2.tgz</b>, <b>hosted-git-info-2.7.1.tgz</b></p></summary>
<p>
<details><summary><b>hosted-git-info-3.0.2.tgz</b></p></summary>
<p>Provides metadata and conversions from repository urls for Github, Bitbucket and Gitlab</p>
<p>Library home page: <a href="https://registry.npmjs.org/hosted-git-info/-/hosted-git-info-3.0.2.tgz">https://registry.npmjs.org/hosted-git-info/-/hosted-git-info-3.0.2.tgz</a></p>
<p>Path to dependency file: website_frontend/package.json</p>
<p>Path to vulnerable library: website_frontend/node_modules/hosted-git-info/package.json</p>
<p>
Dependency Hierarchy:
- cli-12.2.8.tgz (Root Library)
- pacote-11.3.5.tgz
- npm-registry-fetch-11.0.0.tgz
- npm-package-arg-8.0.1.tgz
- :x: **hosted-git-info-3.0.2.tgz** (Vulnerable Library)
</details>
<details><summary><b>hosted-git-info-2.7.1.tgz</b></p></summary>
<p>Provides metadata and conversions from repository urls for Github, Bitbucket and Gitlab</p>
<p>Library home page: <a href="https://registry.npmjs.org/hosted-git-info/-/hosted-git-info-2.7.1.tgz">https://registry.npmjs.org/hosted-git-info/-/hosted-git-info-2.7.1.tgz</a></p>
<p>Path to dependency file: website_frontend/package.json</p>
<p>Path to vulnerable library: website_frontend/node_modules/hosted-git-info/package.json</p>
<p>
Dependency Hierarchy:
- eslint-plugin-import-2.24.2.tgz (Root Library)
- read-pkg-up-3.0.0.tgz
- read-pkg-3.0.0.tgz
- normalize-package-data-2.5.0.tgz
- :x: **hosted-git-info-2.7.1.tgz** (Vulnerable Library)
</details>
<p>Found in HEAD commit: <a href="https://github.com/Verseghy/website_frontend/commit/9aa2f4022cfc5aaab093eb3cc9c540a9bfc3eed1">9aa2f4022cfc5aaab093eb3cc9c540a9bfc3eed1</a></p>
<p>Found in base branch: <b>master</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
The package hosted-git-info before 3.0.8 are vulnerable to Regular Expression Denial of Service (ReDoS) via regular expression shortcutMatch in the fromUrl function in index.js. The affected regular expression exhibits polynomial worst-case time complexity.
<p>Publish Date: 2021-03-23
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2021-23362>CVE-2021-23362</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>5.3</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: None
- Integrity Impact: None
- Availability Impact: Low
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://github.com/advisories/GHSA-43f8-2h32-f4cj">https://github.com/advisories/GHSA-43f8-2h32-f4cj</a></p>
<p>Release Date: 2021-03-23</p>
<p>Fix Resolution: hosted-git-info - 2.8.9,3.0.8</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with WhiteSource [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | True | CVE-2021-23362 (Medium) detected in hosted-git-info-3.0.2.tgz, hosted-git-info-2.7.1.tgz - ## CVE-2021-23362 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Libraries - <b>hosted-git-info-3.0.2.tgz</b>, <b>hosted-git-info-2.7.1.tgz</b></p></summary>
<p>
<details><summary><b>hosted-git-info-3.0.2.tgz</b></p></summary>
<p>Provides metadata and conversions from repository urls for Github, Bitbucket and Gitlab</p>
<p>Library home page: <a href="https://registry.npmjs.org/hosted-git-info/-/hosted-git-info-3.0.2.tgz">https://registry.npmjs.org/hosted-git-info/-/hosted-git-info-3.0.2.tgz</a></p>
<p>Path to dependency file: website_frontend/package.json</p>
<p>Path to vulnerable library: website_frontend/node_modules/hosted-git-info/package.json</p>
<p>
Dependency Hierarchy:
- cli-12.2.8.tgz (Root Library)
- pacote-11.3.5.tgz
- npm-registry-fetch-11.0.0.tgz
- npm-package-arg-8.0.1.tgz
- :x: **hosted-git-info-3.0.2.tgz** (Vulnerable Library)
</details>
<details><summary><b>hosted-git-info-2.7.1.tgz</b></p></summary>
<p>Provides metadata and conversions from repository urls for Github, Bitbucket and Gitlab</p>
<p>Library home page: <a href="https://registry.npmjs.org/hosted-git-info/-/hosted-git-info-2.7.1.tgz">https://registry.npmjs.org/hosted-git-info/-/hosted-git-info-2.7.1.tgz</a></p>
<p>Path to dependency file: website_frontend/package.json</p>
<p>Path to vulnerable library: website_frontend/node_modules/hosted-git-info/package.json</p>
<p>
Dependency Hierarchy:
- eslint-plugin-import-2.24.2.tgz (Root Library)
- read-pkg-up-3.0.0.tgz
- read-pkg-3.0.0.tgz
- normalize-package-data-2.5.0.tgz
- :x: **hosted-git-info-2.7.1.tgz** (Vulnerable Library)
</details>
<p>Found in HEAD commit: <a href="https://github.com/Verseghy/website_frontend/commit/9aa2f4022cfc5aaab093eb3cc9c540a9bfc3eed1">9aa2f4022cfc5aaab093eb3cc9c540a9bfc3eed1</a></p>
<p>Found in base branch: <b>master</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
The package hosted-git-info before 3.0.8 are vulnerable to Regular Expression Denial of Service (ReDoS) via regular expression shortcutMatch in the fromUrl function in index.js. The affected regular expression exhibits polynomial worst-case time complexity.
<p>Publish Date: 2021-03-23
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2021-23362>CVE-2021-23362</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>5.3</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: None
- Integrity Impact: None
- Availability Impact: Low
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://github.com/advisories/GHSA-43f8-2h32-f4cj">https://github.com/advisories/GHSA-43f8-2h32-f4cj</a></p>
<p>Release Date: 2021-03-23</p>
<p>Fix Resolution: hosted-git-info - 2.8.9,3.0.8</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with WhiteSource [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | non_priority | cve medium detected in hosted git info tgz hosted git info tgz cve medium severity vulnerability vulnerable libraries hosted git info tgz hosted git info tgz hosted git info tgz provides metadata and conversions from repository urls for github bitbucket and gitlab library home page a href path to dependency file website frontend package json path to vulnerable library website frontend node modules hosted git info package json dependency hierarchy cli tgz root library pacote tgz npm registry fetch tgz npm package arg tgz x hosted git info tgz vulnerable library hosted git info tgz provides metadata and conversions from repository urls for github bitbucket and gitlab library home page a href path to dependency file website frontend package json path to vulnerable library website frontend node modules hosted git info package json dependency hierarchy eslint plugin import tgz root library read pkg up tgz read pkg tgz normalize package data tgz x hosted git info tgz vulnerable library found in head commit a href found in base branch master vulnerability details the package hosted git info before are vulnerable to regular expression denial of service redos via regular expression shortcutmatch in the fromurl function in index js the affected regular expression exhibits polynomial worst case time complexity publish date url a href cvss score details base score metrics exploitability metrics attack vector network attack complexity low privileges required none user interaction none scope unchanged impact metrics confidentiality impact none integrity impact none availability impact low for more information on scores click a href suggested fix type upgrade version origin a href release date fix resolution hosted git info step up your open source security game with whitesource | 0 |
42,051 | 17,020,065,863 | IssuesEvent | 2021-07-02 17:27:03 | ramboxapp/community-edition | https://api.github.com/repos/ramboxapp/community-edition | closed | [Feature Request] New service Discourse | investigate new service | More and more projects seem to be utilising Discourse (see https://github.com/discourse/discourse) as their forum and support platform. It is possible to add any Discourse URL as a custom service. The only problem seems to be that the tray icon is always showing a notification if a new post or comment is available, even if notifications are turned off for those services.
Therefore it would be great it Rambox could integrate Discourse natively. What do you think?
| 1.0 | [Feature Request] New service Discourse - More and more projects seem to be utilising Discourse (see https://github.com/discourse/discourse) as their forum and support platform. It is possible to add any Discourse URL as a custom service. The only problem seems to be that the tray icon is always showing a notification if a new post or comment is available, even if notifications are turned off for those services.
Therefore it would be great it Rambox could integrate Discourse natively. What do you think?
| non_priority | new service discourse more and more projects seem to be utilising discourse see as their forum and support platform it is possible to add any discourse url as a custom service the only problem seems to be that the tray icon is always showing a notification if a new post or comment is available even if notifications are turned off for those services therefore it would be great it rambox could integrate discourse natively what do you think | 0 |
11,551 | 2,657,954,866 | IssuesEvent | 2015-03-18 12:58:59 | Red5/red5-server | https://api.github.com/repos/Red5/red5-server | opened | video records have bad start time posision. | auto-migrated Priority-Medium Type-Defect | _From @GoogleCodeExporter on March 15, 2015 16:59_
```
What steps will reproduce the problem?
1. I start recording.
2. RTMP streams works great.
3. Complete records.
4. Try to preview video records.
What is the expected output? What do you see instead?
I attachment video file and stream recorder source. Try to download this file
and play with vlc or clasic media player.
This file start playing from end and have bad time posision.
I use this code:
camera.setMode(640, 480, 25);
camera.setQuality(0, 85);
camera.setKeyFrameInterval(17);
ns.attachCamera(camera);
mic.rate = 44;
ns.attachAudio(mic);
ns.publish(video_name, record);
What version of the product are you using? On what operating system?
Use linux debian server.
And http://code.google.com/p/red5-flex-streamer/
```
Original issue reported on code.google.com by `ramoai...@gmail.com` on 4 Mar 2013 at 11:42
Attachments:
* [Video1.flv](https://storage.googleapis.com/google-code-attachments/red5/issue-357/comment-0/Video1.flv)
* [streamrecorder.mxml](https://storage.googleapis.com/google-code-attachments/red5/issue-357/comment-0/streamrecorder.mxml)
_Copied from original issue: mondain/red5#357_ | 1.0 | video records have bad start time posision. - _From @GoogleCodeExporter on March 15, 2015 16:59_
```
What steps will reproduce the problem?
1. I start recording.
2. RTMP streams works great.
3. Complete records.
4. Try to preview video records.
What is the expected output? What do you see instead?
I attachment video file and stream recorder source. Try to download this file
and play with vlc or clasic media player.
This file start playing from end and have bad time posision.
I use this code:
camera.setMode(640, 480, 25);
camera.setQuality(0, 85);
camera.setKeyFrameInterval(17);
ns.attachCamera(camera);
mic.rate = 44;
ns.attachAudio(mic);
ns.publish(video_name, record);
What version of the product are you using? On what operating system?
Use linux debian server.
And http://code.google.com/p/red5-flex-streamer/
```
Original issue reported on code.google.com by `ramoai...@gmail.com` on 4 Mar 2013 at 11:42
Attachments:
* [Video1.flv](https://storage.googleapis.com/google-code-attachments/red5/issue-357/comment-0/Video1.flv)
* [streamrecorder.mxml](https://storage.googleapis.com/google-code-attachments/red5/issue-357/comment-0/streamrecorder.mxml)
_Copied from original issue: mondain/red5#357_ | non_priority | video records have bad start time posision from googlecodeexporter on march what steps will reproduce the problem i start recording rtmp streams works great complete records try to preview video records what is the expected output what do you see instead i attachment video file and stream recorder source try to download this file and play with vlc or clasic media player this file start playing from end and have bad time posision i use this code camera setmode camera setquality camera setkeyframeinterval ns attachcamera camera mic rate ns attachaudio mic ns publish video name record what version of the product are you using on what operating system use linux debian server and original issue reported on code google com by ramoai gmail com on mar at attachments copied from original issue mondain | 0 |
649,116 | 21,218,633,291 | IssuesEvent | 2022-04-11 09:45:04 | su-fit-vut/kachna-online | https://api.github.com/repos/su-fit-vut/kachna-online | opened | Custom calendar menu | enhancement frontend frontend-homepage low-priority | When right-clicking inside a cell of the homepage calendar, it would be nice to display a custom menu with options to plan a club state or an event on the corresponding day (which would be preselected in the opened planning page/form). | 1.0 | Custom calendar menu - When right-clicking inside a cell of the homepage calendar, it would be nice to display a custom menu with options to plan a club state or an event on the corresponding day (which would be preselected in the opened planning page/form). | priority | custom calendar menu when right clicking inside a cell of the homepage calendar it would be nice to display a custom menu with options to plan a club state or an event on the corresponding day which would be preselected in the opened planning page form | 1 |
389,338 | 26,809,060,744 | IssuesEvent | 2023-02-01 20:42:31 | KamranHussain05/StatScanner | https://api.github.com/repos/KamranHussain05/StatScanner | closed | Add Documentation | documentation enhancement help wanted | Currently there is virtually no documentation for the project aside from the ReadMe file. User-end tutorials, source code, and interfaces should all be documented for logging and codebase expansion purposes. This involves documenting private functions and internal classes to ensure anyone can understand the codebase and prevent misuse of certain snippets. | 1.0 | Add Documentation - Currently there is virtually no documentation for the project aside from the ReadMe file. User-end tutorials, source code, and interfaces should all be documented for logging and codebase expansion purposes. This involves documenting private functions and internal classes to ensure anyone can understand the codebase and prevent misuse of certain snippets. | non_priority | add documentation currently there is virtually no documentation for the project aside from the readme file user end tutorials source code and interfaces should all be documented for logging and codebase expansion purposes this involves documenting private functions and internal classes to ensure anyone can understand the codebase and prevent misuse of certain snippets | 0 |
69,793 | 15,034,121,160 | IssuesEvent | 2021-02-02 12:27:22 | enonic/app-contentstudio | https://api.github.com/repos/enonic/app-contentstudio | closed | LiveEditPageProxy loads component in the unsafe way | Security | `LiveEditPageProxy.loadComponent` sends a requests for the component and transforms the `string` to an HTML element, which is unsafe operation. Find a solution to completely remove this part of code or sanitize and validate the received data. | True | LiveEditPageProxy loads component in the unsafe way - `LiveEditPageProxy.loadComponent` sends a requests for the component and transforms the `string` to an HTML element, which is unsafe operation. Find a solution to completely remove this part of code or sanitize and validate the received data. | non_priority | liveeditpageproxy loads component in the unsafe way liveeditpageproxy loadcomponent sends a requests for the component and transforms the string to an html element which is unsafe operation find a solution to completely remove this part of code or sanitize and validate the received data | 0 |
310,250 | 9,487,633,964 | IssuesEvent | 2019-04-22 17:26:03 | blackbaud/skyux2 | https://api.github.com/repos/blackbaud/skyux2 | reopened | Immediately closing a modal containing a tabset causes ViewDestroyedError | From: Consumer Priority: Critical Type: Bug | ### Expected behavior
Modal closes, can be reopened, then closed again without issue.
### Actual behavior
Modal closes, reopens, then upon closing again angular is broken.
### Steps to reproduce
- Have a skyux SPA with a modal that contains a tabset
- Click the button to open the modal
- Immediately hit escape to close the modal
- Note that `ERROR Error: ViewDestroyedError: Attempt to use a destroyed view: detectChanges` and an error is printed to console.
- Reopen the modal
- Attempt to close the modal. Note that the modal backdrop/mask disappear, but the modal stays in place. Angular is now unresponsive until the page is refreshed.
This is very likely due to the setTimeout in the tabset's afterViewInit here getting called after the modal has been destroyed:
https://github.com/blackbaud/skyux-tabs/blob/e93b456d2229c695dd40d05433df25ad8f13fb6c/src/app/public/modules/tabs/tabset.component.ts#L153-L157
### Plunker
https://github.com/jeffbdye/skyux-spa-modal-tabs-issue
### Severity
Angular must be refreshed after this issue occurs, the SPA is effectively unusable. Seems pretty severe.
### Impact
Only affects SPAs which have modals with tabsets, and only if a user happens to immediately close the modal after opening it. So probably unlikely. | 1.0 | Immediately closing a modal containing a tabset causes ViewDestroyedError - ### Expected behavior
Modal closes, can be reopened, then closed again without issue.
### Actual behavior
Modal closes, reopens, then upon closing again angular is broken.
### Steps to reproduce
- Have a skyux SPA with a modal that contains a tabset
- Click the button to open the modal
- Immediately hit escape to close the modal
- Note that `ERROR Error: ViewDestroyedError: Attempt to use a destroyed view: detectChanges` and an error is printed to console.
- Reopen the modal
- Attempt to close the modal. Note that the modal backdrop/mask disappear, but the modal stays in place. Angular is now unresponsive until the page is refreshed.
This is very likely due to the setTimeout in the tabset's afterViewInit here getting called after the modal has been destroyed:
https://github.com/blackbaud/skyux-tabs/blob/e93b456d2229c695dd40d05433df25ad8f13fb6c/src/app/public/modules/tabs/tabset.component.ts#L153-L157
### Plunker
https://github.com/jeffbdye/skyux-spa-modal-tabs-issue
### Severity
Angular must be refreshed after this issue occurs, the SPA is effectively unusable. Seems pretty severe.
### Impact
Only affects SPAs which have modals with tabsets, and only if a user happens to immediately close the modal after opening it. So probably unlikely. | priority | immediately closing a modal containing a tabset causes viewdestroyederror expected behavior modal closes can be reopened then closed again without issue actual behavior modal closes reopens then upon closing again angular is broken steps to reproduce have a skyux spa with a modal that contains a tabset click the button to open the modal immediately hit escape to close the modal note that error error viewdestroyederror attempt to use a destroyed view detectchanges and an error is printed to console reopen the modal attempt to close the modal note that the modal backdrop mask disappear but the modal stays in place angular is now unresponsive until the page is refreshed this is very likely due to the settimeout in the tabset s afterviewinit here getting called after the modal has been destroyed plunker severity angular must be refreshed after this issue occurs the spa is effectively unusable seems pretty severe impact only affects spas which have modals with tabsets and only if a user happens to immediately close the modal after opening it so probably unlikely | 1 |
15,661 | 3,970,465,058 | IssuesEvent | 2016-05-04 07:25:46 | padrino/padrino-framework | https://api.github.com/repos/padrino/padrino-framework | closed | Label beginner issues | beginners documentation | Hi,
I introduced a new label for smaller tasks in a constrained scope: `beginners`. Let's see if it helps new people searching for things to do.
I'll try to apply it later today or tomorrow, but feel free to use it.
* [ ] Go through existing issues to find out which can be labeled `beginners`
Regards,
Florian | 1.0 | Label beginner issues - Hi,
I introduced a new label for smaller tasks in a constrained scope: `beginners`. Let's see if it helps new people searching for things to do.
I'll try to apply it later today or tomorrow, but feel free to use it.
* [ ] Go through existing issues to find out which can be labeled `beginners`
Regards,
Florian | non_priority | label beginner issues hi i introduced a new label for smaller tasks in a constrained scope beginners let s see if it helps new people searching for things to do i ll try to apply it later today or tomorrow but feel free to use it go through existing issues to find out which can be labeled beginners regards florian | 0 |
188,626 | 22,046,721,110 | IssuesEvent | 2022-05-30 03:11:14 | rvvergara/rails-blog-app | https://api.github.com/repos/rvvergara/rails-blog-app | opened | CVE-2022-30123 (Medium) detected in rack-2.2.3.gem | security vulnerability | ## CVE-2022-30123 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>rack-2.2.3.gem</b></p></summary>
<p>Rack provides a minimal, modular and adaptable interface for developing
web applications in Ruby. By wrapping HTTP requests and responses in
the simplest way possible, it unifies and distills the API for web
servers, web frameworks, and software in between (the so-called
middleware) into a single method call.
</p>
<p>Library home page: <a href="https://rubygems.org/gems/rack-2.2.3.gem">https://rubygems.org/gems/rack-2.2.3.gem</a></p>
<p>
Dependency Hierarchy:
- sass-rails-5.0.7.gem (Root Library)
- sprockets-rails-3.2.1.gem
- sprockets-3.7.2.gem
- :x: **rack-2.2.3.gem** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/rvvergara/rails-blog-app/commit/e8ad96ad7203d5a0dfd27a1c4049c9be82f15337">e8ad96ad7203d5a0dfd27a1c4049c9be82f15337</a></p>
<p>Found in base branch: <b>master</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
There is a possible shell escape sequence injection vulnerability in the Lint and CommonLogger components of Rack before 2.0.9.1,2.1.4.1,2.2.3.1
<p>Publish Date: 2022-05-03
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2022-30123>CVE-2022-30123</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>5.5</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Local
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: Required
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: None
- Integrity Impact: None
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://github.com/advisories/GHSA-wq4h-7r42-5hrr">https://github.com/advisories/GHSA-wq4h-7r42-5hrr</a></p>
<p>Release Date: 2022-05-03</p>
<p>Fix Resolution: rack - 2.0.9.1,2.1.4.1,2.2.3.1</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with Mend [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | True | CVE-2022-30123 (Medium) detected in rack-2.2.3.gem - ## CVE-2022-30123 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>rack-2.2.3.gem</b></p></summary>
<p>Rack provides a minimal, modular and adaptable interface for developing
web applications in Ruby. By wrapping HTTP requests and responses in
the simplest way possible, it unifies and distills the API for web
servers, web frameworks, and software in between (the so-called
middleware) into a single method call.
</p>
<p>Library home page: <a href="https://rubygems.org/gems/rack-2.2.3.gem">https://rubygems.org/gems/rack-2.2.3.gem</a></p>
<p>
Dependency Hierarchy:
- sass-rails-5.0.7.gem (Root Library)
- sprockets-rails-3.2.1.gem
- sprockets-3.7.2.gem
- :x: **rack-2.2.3.gem** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/rvvergara/rails-blog-app/commit/e8ad96ad7203d5a0dfd27a1c4049c9be82f15337">e8ad96ad7203d5a0dfd27a1c4049c9be82f15337</a></p>
<p>Found in base branch: <b>master</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
There is a possible shell escape sequence injection vulnerability in the Lint and CommonLogger components of Rack before 2.0.9.1,2.1.4.1,2.2.3.1
<p>Publish Date: 2022-05-03
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2022-30123>CVE-2022-30123</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>5.5</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Local
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: Required
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: None
- Integrity Impact: None
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://github.com/advisories/GHSA-wq4h-7r42-5hrr">https://github.com/advisories/GHSA-wq4h-7r42-5hrr</a></p>
<p>Release Date: 2022-05-03</p>
<p>Fix Resolution: rack - 2.0.9.1,2.1.4.1,2.2.3.1</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with Mend [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | non_priority | cve medium detected in rack gem cve medium severity vulnerability vulnerable library rack gem rack provides a minimal modular and adaptable interface for developing web applications in ruby by wrapping http requests and responses in the simplest way possible it unifies and distills the api for web servers web frameworks and software in between the so called middleware into a single method call library home page a href dependency hierarchy sass rails gem root library sprockets rails gem sprockets gem x rack gem vulnerable library found in head commit a href found in base branch master vulnerability details there is a possible shell escape sequence injection vulnerability in the lint and commonlogger components of rack before publish date url a href cvss score details base score metrics exploitability metrics attack vector local attack complexity low privileges required none user interaction required scope unchanged impact metrics confidentiality impact none integrity impact none availability impact high for more information on scores click a href suggested fix type upgrade version origin a href release date fix resolution rack step up your open source security game with mend | 0 |
740,323 | 25,745,089,605 | IssuesEvent | 2022-12-08 09:20:08 | leepeuker/movary | https://api.github.com/repos/leepeuker/movary | closed | TMDB sync: Errors on one movie stops sync process permanently until movie is fixed | bug priority: middle | If a movie has a persistent issue during the tmdb sync process, it will make syncing data in general impossible, because it will always fail and stop add the movie with the issue.
Broken movies should be ignored and not kill the sync process for all movies | 1.0 | TMDB sync: Errors on one movie stops sync process permanently until movie is fixed - If a movie has a persistent issue during the tmdb sync process, it will make syncing data in general impossible, because it will always fail and stop add the movie with the issue.
Broken movies should be ignored and not kill the sync process for all movies | priority | tmdb sync errors on one movie stops sync process permanently until movie is fixed if a movie has a persistent issue during the tmdb sync process it will make syncing data in general impossible because it will always fail and stop add the movie with the issue broken movies should be ignored and not kill the sync process for all movies | 1 |
605,733 | 18,739,783,808 | IssuesEvent | 2021-11-04 12:17:33 | ita-social-projects/TeachUA | https://api.github.com/repos/ita-social-projects/TeachUA | opened | [Registration] User can register with invalid password. | bug Frontend Priority: Medium Desktop | **Environment**: Windows 10, Google Chrome Version 92.0.4515.159, (64 бит)
**Reproducible**: Always
**Build found**: Last commit
**Steps to reproduce**
1. Go to https://speak-ukrainian.org.ua/dev/
2. Click on the profile drop-down list
3. Click on the 'Зареєструватися'
4. Enter the correct data in each field (except the 'Password' field)
5. In the 'Password' field enter data: '12345678'
**Actual result**
'Password' with data '12345678' are considered correct.

**Expected result**
‘Password’ **must contain** the following LATIN characters: upper/lower-case, numbers and reserved characters (~, `, !, @, #, $, %, ^, &, (, ), _, =, +, {, }, [, ], /, |, :, ;,", <, >, ?) // RUS, UKR letters are not valid. Cannot be shorter than 8 characters and longer than 20 characters
Error message appears: “Пароль не може бути коротшим, ніж 8 та довшим, ніж 20 символів.
Пароль повинен містити великі/маленькі літери латинського алфавіту, цифри та спеціальні символи”
"User story #97
| 1.0 | [Registration] User can register with invalid password. - **Environment**: Windows 10, Google Chrome Version 92.0.4515.159, (64 бит)
**Reproducible**: Always
**Build found**: Last commit
**Steps to reproduce**
1. Go to https://speak-ukrainian.org.ua/dev/
2. Click on the profile drop-down list
3. Click on the 'Зареєструватися'
4. Enter the correct data in each field (except the 'Password' field)
5. In the 'Password' field enter data: '12345678'
**Actual result**
'Password' with data '12345678' are considered correct.

**Expected result**
‘Password’ **must contain** the following LATIN characters: upper/lower-case, numbers and reserved characters (~, `, !, @, #, $, %, ^, &, (, ), _, =, +, {, }, [, ], /, |, :, ;,", <, >, ?) // RUS, UKR letters are not valid. Cannot be shorter than 8 characters and longer than 20 characters
Error message appears: “Пароль не може бути коротшим, ніж 8 та довшим, ніж 20 символів.
Пароль повинен містити великі/маленькі літери латинського алфавіту, цифри та спеціальні символи”
"User story #97
| priority | user can register with invalid password environment windows google chrome version бит reproducible always build found last commit steps to reproduce go to click on the profile drop down list click on the зареєструватися enter the correct data in each field except the password field in the password field enter data actual result password with data are considered correct expected result ‘password’ must contain the following latin characters upper lower case numbers and reserved characters rus ukr letters are not valid cannot be shorter than characters and longer than characters error message appears “пароль не може бути коротшим ніж та довшим ніж символів пароль повинен містити великі маленькі літери латинського алфавіту цифри та спеціальні символи” user story | 1 |
141,323 | 5,434,894,673 | IssuesEvent | 2017-03-05 12:10:44 | open-serious/open-serious | https://api.github.com/repos/open-serious/open-serious | closed | Projects no longer compile on Win32 after Linux port | os.win32 priority.medium | Due to certain changes made in the engine/game codebase when porting the code to Linux, the following projects no longer compile on Windows properly:
* `Shaders`
* `MakeFONT`
* `DecodeReport`
* `EngineGUI`
* `Modeler`
* `RCon`
* `SeriousSkaStudio`
* `DedicatedServer`
* `GameGUIMP`
* `WorldEditor`
All compile errors should be fixed. | 1.0 | Projects no longer compile on Win32 after Linux port - Due to certain changes made in the engine/game codebase when porting the code to Linux, the following projects no longer compile on Windows properly:
* `Shaders`
* `MakeFONT`
* `DecodeReport`
* `EngineGUI`
* `Modeler`
* `RCon`
* `SeriousSkaStudio`
* `DedicatedServer`
* `GameGUIMP`
* `WorldEditor`
All compile errors should be fixed. | priority | projects no longer compile on after linux port due to certain changes made in the engine game codebase when porting the code to linux the following projects no longer compile on windows properly shaders makefont decodereport enginegui modeler rcon seriousskastudio dedicatedserver gameguimp worldeditor all compile errors should be fixed | 1 |
69,762 | 3,314,460,624 | IssuesEvent | 2015-11-06 05:25:19 | lonh/lon-workspace | https://api.github.com/repos/lonh/lon-workspace | closed | Draft UI design | auto-migrated Priority-Critical Type-Task | ```
Draft UI design
```
Original issue reported on code.google.com by `lon...@gmail.com` on 2 Feb 2012 at 2:57 | 1.0 | Draft UI design - ```
Draft UI design
```
Original issue reported on code.google.com by `lon...@gmail.com` on 2 Feb 2012 at 2:57 | priority | draft ui design draft ui design original issue reported on code google com by lon gmail com on feb at | 1 |
66,166 | 16,552,211,776 | IssuesEvent | 2021-05-28 09:51:35 | software-mansion/react-native-gesture-handler | https://api.github.com/repos/software-mansion/react-native-gesture-handler | closed | [Android] RNGestureHandlerEnabledRootView.java line 39, java.lang.IllegalStateException: Page can only be offset by a positive amount, not by -47 | Build or config issue | ## Description
We just receive a report from Crashlytics about a crash on Android. It was for RNGestureHandlerEnabledRootView.java line 39, **java.lang.IllegalStateException: Page can only be offset by a positive amount, not by -47**
```
Fatal Exception: java.lang.IllegalStateException: Page can only be offset by a positive amount, not by -47
at androidx.viewpager2.widget.ScrollEventAdapter.updateScrollEventValues(ScrollEventAdapter.java:280)
at androidx.viewpager2.widget.ScrollEventAdapter.onScrolled(ScrollEventAdapter.java:178)
at androidx.recyclerview.widget.RecyclerView.dispatchOnScrolled(RecyclerView.java:5173)
at androidx.recyclerview.widget.RecyclerView.scrollByInternal(RecyclerView.java:1971)
at androidx.recyclerview.widget.RecyclerView.onTouchEvent(RecyclerView.java:3391)
at androidx.viewpager2.widget.ViewPager2$RecyclerViewImpl.onTouchEvent(ViewPager2.java:991)
at android.view.View.dispatchTouchEvent(View.java:14376)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3857)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3535)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at com.swmansion.gesturehandler.react.RNGestureHandlerEnabledRootView.dispatchTouchEvent(RNGestureHandlerEnabledRootView.java:39)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at com.android.internal.policy.DecorView.superDispatchTouchEvent(DecorView.java:730)
at com.android.internal.policy.PhoneWindow.superDispatchTouchEvent(PhoneWindow.java:1922)
at android.app.Activity.dispatchTouchEvent(Activity.java:4051)
at androidx.appcompat.view.WindowCallbackWrapper.dispatchTouchEvent(WindowCallbackWrapper.java:69)
...
at com.android.internal.os.RuntimeInit$MethodAndArgsCaller.run(RuntimeInit.java:493)
at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:1075)
```
### Screenshots
## Steps To Reproduce
I cannot reproduce this. This is from Crashlytics.
### Expected behavior
Not crash.
### Actual behavior
Crash in some cases (not common).
## Snack or minimal code example
## Package versions
- React: 16.11
- React Native: 0.62.3
- React Native Gesture Handler: 1.10.3
| 1.0 | [Android] RNGestureHandlerEnabledRootView.java line 39, java.lang.IllegalStateException: Page can only be offset by a positive amount, not by -47 - ## Description
We just receive a report from Crashlytics about a crash on Android. It was for RNGestureHandlerEnabledRootView.java line 39, **java.lang.IllegalStateException: Page can only be offset by a positive amount, not by -47**
```
Fatal Exception: java.lang.IllegalStateException: Page can only be offset by a positive amount, not by -47
at androidx.viewpager2.widget.ScrollEventAdapter.updateScrollEventValues(ScrollEventAdapter.java:280)
at androidx.viewpager2.widget.ScrollEventAdapter.onScrolled(ScrollEventAdapter.java:178)
at androidx.recyclerview.widget.RecyclerView.dispatchOnScrolled(RecyclerView.java:5173)
at androidx.recyclerview.widget.RecyclerView.scrollByInternal(RecyclerView.java:1971)
at androidx.recyclerview.widget.RecyclerView.onTouchEvent(RecyclerView.java:3391)
at androidx.viewpager2.widget.ViewPager2$RecyclerViewImpl.onTouchEvent(ViewPager2.java:991)
at android.view.View.dispatchTouchEvent(View.java:14376)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3857)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3535)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at com.swmansion.gesturehandler.react.RNGestureHandlerEnabledRootView.dispatchTouchEvent(RNGestureHandlerEnabledRootView.java:39)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at android.view.ViewGroup.dispatchTransformedTouchEvent(ViewGroup.java:3863)
at android.view.ViewGroup.dispatchTouchEvent(ViewGroup.java:3551)
at com.android.internal.policy.DecorView.superDispatchTouchEvent(DecorView.java:730)
at com.android.internal.policy.PhoneWindow.superDispatchTouchEvent(PhoneWindow.java:1922)
at android.app.Activity.dispatchTouchEvent(Activity.java:4051)
at androidx.appcompat.view.WindowCallbackWrapper.dispatchTouchEvent(WindowCallbackWrapper.java:69)
...
at com.android.internal.os.RuntimeInit$MethodAndArgsCaller.run(RuntimeInit.java:493)
at com.android.internal.os.ZygoteInit.main(ZygoteInit.java:1075)
```
### Screenshots
## Steps To Reproduce
I cannot reproduce this. This is from Crashlytics.
### Expected behavior
Not crash.
### Actual behavior
Crash in some cases (not common).
## Snack or minimal code example
## Package versions
- React: 16.11
- React Native: 0.62.3
- React Native Gesture Handler: 1.10.3
| non_priority | rngesturehandlerenabledrootview java line java lang illegalstateexception page can only be offset by a positive amount not by description we just receive a report from crashlytics about a crash on android it was for rngesturehandlerenabledrootview java line java lang illegalstateexception page can only be offset by a positive amount not by fatal exception java lang illegalstateexception page can only be offset by a positive amount not by at androidx widget scrolleventadapter updatescrolleventvalues scrolleventadapter java at androidx widget scrolleventadapter onscrolled scrolleventadapter java at androidx recyclerview widget recyclerview dispatchonscrolled recyclerview java at androidx recyclerview widget recyclerview scrollbyinternal recyclerview java at androidx recyclerview widget recyclerview ontouchevent recyclerview java at androidx widget recyclerviewimpl ontouchevent java at android view view dispatchtouchevent view java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at com swmansion gesturehandler react rngesturehandlerenabledrootview dispatchtouchevent rngesturehandlerenabledrootview java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at android view viewgroup dispatchtransformedtouchevent viewgroup java at android view viewgroup dispatchtouchevent viewgroup java at com android internal policy decorview superdispatchtouchevent decorview java at com android internal policy phonewindow superdispatchtouchevent phonewindow java at android app activity dispatchtouchevent activity java at androidx appcompat view windowcallbackwrapper dispatchtouchevent windowcallbackwrapper java at com android internal os runtimeinit methodandargscaller run runtimeinit java at com android internal os zygoteinit main zygoteinit java screenshots steps to reproduce i cannot reproduce this this is from crashlytics expected behavior not crash actual behavior crash in some cases not common snack or minimal code example package versions react react native react native gesture handler | 0 |
41,148 | 6,892,940,907 | IssuesEvent | 2017-11-22 23:44:08 | elastacloud/parquet-dotnet | https://api.github.com/repos/elastacloud/parquet-dotnet | closed | Document custom types | documentation | Related issue - #258. Please describe all custom types, their options and parameters. | 1.0 | Document custom types - Related issue - #258. Please describe all custom types, their options and parameters. | non_priority | document custom types related issue please describe all custom types their options and parameters | 0 |
8,874 | 10,861,477,702 | IssuesEvent | 2019-11-14 11:10:12 | cryptape/cita | https://api.github.com/repos/cryptape/cita | closed | different serde content in state account | compatibility vm & state | ## Description
CITA Account rlp content:
```rs
/// Export to RLP.
pub fn rlp(&self) -> Bytes {
let mut stream = RlpStream::new_list(4);
stream.append(&self.nonce);
stream.append(&self.balance);
stream.append(&self.storage_root);
stream.append(&self.code_hash);
stream.append(&self.abi_hash);
stream.out()
}
```
Ethereum Account rlp content:
```rs
/// Export to RLP.
pub fn rlp(&self) -> Bytes {
let mut stream = RlpStream::new_list(4);
stream.append(&self.nonce);
stream.append(&self.balance);
stream.append(&self.storage_root);
stream.append(&self.code_hash);
stream.out()
}
```
As you see, In cita rlp process, there is a entry named `abi_hash`, while not in ethereum.
This will lead to different of the whold state status. | True | different serde content in state account - ## Description
CITA Account rlp content:
```rs
/// Export to RLP.
pub fn rlp(&self) -> Bytes {
let mut stream = RlpStream::new_list(4);
stream.append(&self.nonce);
stream.append(&self.balance);
stream.append(&self.storage_root);
stream.append(&self.code_hash);
stream.append(&self.abi_hash);
stream.out()
}
```
Ethereum Account rlp content:
```rs
/// Export to RLP.
pub fn rlp(&self) -> Bytes {
let mut stream = RlpStream::new_list(4);
stream.append(&self.nonce);
stream.append(&self.balance);
stream.append(&self.storage_root);
stream.append(&self.code_hash);
stream.out()
}
```
As you see, In cita rlp process, there is a entry named `abi_hash`, while not in ethereum.
This will lead to different of the whold state status. | non_priority | different serde content in state account description cita account rlp content rs export to rlp pub fn rlp self bytes let mut stream rlpstream new list stream append self nonce stream append self balance stream append self storage root stream append self code hash stream append self abi hash stream out ethereum account rlp content rs export to rlp pub fn rlp self bytes let mut stream rlpstream new list stream append self nonce stream append self balance stream append self storage root stream append self code hash stream out as you see in cita rlp process there is a entry named abi hash while not in ethereum this will lead to different of the whold state status | 0 |
205,519 | 23,341,157,065 | IssuesEvent | 2022-08-09 14:08:06 | MatBenfield/news | https://api.github.com/repos/MatBenfield/news | closed | [SecurityWeek] US, Australian Cybersecurity Agencies Publish List of 2021's Top Malware | SecurityWeek Stale |
**The US Cybersecurity and Infrastructure Security Agency (CISA) and the Australian Cyber Security Centre (ACSC) have published a joint advisory to detail the top malware strains of 2021.**
[read more](https://www.securityweek.com/us-australian-cybersecurity-agencies-publish-list-2021s-top-malware)
<https://www.securityweek.com/us-australian-cybersecurity-agencies-publish-list-2021s-top-malware>
| True | [SecurityWeek] US, Australian Cybersecurity Agencies Publish List of 2021's Top Malware -
**The US Cybersecurity and Infrastructure Security Agency (CISA) and the Australian Cyber Security Centre (ACSC) have published a joint advisory to detail the top malware strains of 2021.**
[read more](https://www.securityweek.com/us-australian-cybersecurity-agencies-publish-list-2021s-top-malware)
<https://www.securityweek.com/us-australian-cybersecurity-agencies-publish-list-2021s-top-malware>
| non_priority | us australian cybersecurity agencies publish list of s top malware the us cybersecurity and infrastructure security agency cisa and the australian cyber security centre acsc have published a joint advisory to detail the top malware strains of | 0 |
767,661 | 26,935,504,736 | IssuesEvent | 2023-02-07 20:17:03 | pdx-blurp/blurp-frontend | https://api.github.com/repos/pdx-blurp/blurp-frontend | closed | Map Page: Node Is Created on X, Y coordinates of Mouse Click | bug high priority | The Node should render underneath the exactly mouse click XY-coordinates. | 1.0 | Map Page: Node Is Created on X, Y coordinates of Mouse Click - The Node should render underneath the exactly mouse click XY-coordinates. | priority | map page node is created on x y coordinates of mouse click the node should render underneath the exactly mouse click xy coordinates | 1 |
77,326 | 21,730,944,420 | IssuesEvent | 2022-05-11 11:57:53 | NixOS/nixpkgs | https://api.github.com/repos/NixOS/nixpkgs | opened | azure-functions-core-tools broken build | 0.kind: build failure | ### Steps To Reproduce
```
nix-shell -I nixpkgs=https://github.com/NixOS/nixpkgs/archive/c5dbc6d16165577428f03a50fad798088c5a7c58.tar.gz -p azure-functions-core-tools
```
### Build log
```
⋊> ~/r/p/nixpkgs on master ◦ nix-shell -I nixpkgs=https://github.com/NixOS/nixpkgs/archive/c5dbc6d16165577428f03a50fad798088c5a7c58.tar.gz -p azure-functions-core-tools 14:43:24
unpacking 'https://github.com/NixOS/nixpkgs/archive/c5dbc6d16165577428f03a50fad798088c5a7c58.tar.gz'...
these derivations will be built:
/nix/store/ahnb5d1i6x09n5cvhpi29i04diysv33a-dotnet-sdk-3.1.415.drv
/nix/store/yxjj9xnzhbgmk137jj73jkfqy24b9xwf-azure-functions-core-tools-3.0.3785.drv
building '/nix/store/ahnb5d1i6x09n5cvhpi29i04diysv33a-dotnet-sdk-3.1.415.drv'...
unpacking sources
unpacking source archive /nix/store/v341z9d3h8f9kxx1k84r5wh60akz3ysw-dotnet-sdk-3.1.415-linux-x64.tar.gz
source root is .
setting SOURCE_DATE_EPOCH to timestamp 1635274917 of file ./sdk/3.1.415/Sdks/NuGet.Build.Tasks.Pack/CoreCLR/NuGet.Build.Tasks.Pack.dll
patching sources
configuring
no configure script, doing nothing
building
no Makefile, doing nothing
installing
post-installation fixup
rewriting symlink /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415/bin/dotnet to be relative to /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415
strip is /nix/store/bg35nfwn6zd616facdywiysgpprfvsji-gcc-wrapper-11.3.0/bin/strip
stripping (with command strip and flags -S) in /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415/bin
patching script interpreter paths in /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415
checking for references to /build/ in /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415...
running install tests
Process terminated. Couldn't find a valid ICU package installed on the system. Set the configuration flag System.Globalization.Invariant to true if you want to run with no globalization support.
at System.Environment.FailFast(System.String)
at System.Globalization.GlobalizationMode.GetGlobalizationInvariantMode()
at System.Globalization.GlobalizationMode..cctor()
at System.Globalization.CultureData.CreateCultureWithInvariantData()
at System.Globalization.CultureData.get_Invariant()
at System.Globalization.CultureInfo..cctor()
at System.String.ToLowerInvariant()
at Microsoft.DotNet.PlatformAbstractions.RuntimeEnvironment.GetArch()
at Microsoft.DotNet.PlatformAbstractions.RuntimeEnvironment..cctor()
at Microsoft.DotNet.PlatformAbstractions.RuntimeEnvironment.GetRuntimeIdentifier()
at Microsoft.DotNet.Cli.MulticoreJitProfilePathCalculator.CalculateProfileRootPath()
at Microsoft.DotNet.Cli.MulticoreJitActivator.StartCliProfileOptimization()
at Microsoft.DotNet.Cli.MulticoreJitActivator.TryActivateMulticoreJit()
at Microsoft.DotNet.Cli.Program.Main(System.String[])
/nix/store/crpnj8ssz0va2q0p5ibv9i6k6n52gcya-stdenv-linux/setup: line 1373: 125 Aborted (core dumped) $out/bin/dotnet --info
builder for '/nix/store/ahnb5d1i6x09n5cvhpi29i04diysv33a-dotnet-sdk-3.1.415.drv' failed with exit code 134
cannot build derivation '/nix/store/yxjj9xnzhbgmk137jj73jkfqy24b9xwf-azure-functions-core-tools-3.0.3785.drv': 1 dependencies couldn't be built
error: build of '/nix/store/yxjj9xnzhbgmk137jj73jkfqy24b9xwf-azure-functions-core-tools-3.0.3785.drv' failed```
### Additional context
was working fine previously:
```
nix-shell -I nixpkgs=https://github.com/NixOS/nixpkgs/archive/263ef4cc4146c9fab808085487438c625d4426a9.tar.gz -p azure-functions-core-tools
```
### Notify maintainers
@jshcmpbll
### Metadata
Please run `nix-shell -p nix-info --run "nix-info -m"` and paste the result.
```console
[user@system:~]$ nix-shell -p nix-info --run "nix-info -m"
- system: `"x86_64-linux"`
- host os: `Linux 5.17.5, NixOS, 21.11 (Porcupine)`
- multi-user?: `yes`
- sandbox: `yes`
- version: `nix-env (Nix) 2.3.16`
- channels(root): `"nixos-21.11.337422.3c5ae9be1f1, home-manager"`
- channels(peter): `""`
- nixpkgs: `/nix/var/nix/profiles/per-user/root/channels/nixos`
```
| 1.0 | azure-functions-core-tools broken build - ### Steps To Reproduce
```
nix-shell -I nixpkgs=https://github.com/NixOS/nixpkgs/archive/c5dbc6d16165577428f03a50fad798088c5a7c58.tar.gz -p azure-functions-core-tools
```
### Build log
```
⋊> ~/r/p/nixpkgs on master ◦ nix-shell -I nixpkgs=https://github.com/NixOS/nixpkgs/archive/c5dbc6d16165577428f03a50fad798088c5a7c58.tar.gz -p azure-functions-core-tools 14:43:24
unpacking 'https://github.com/NixOS/nixpkgs/archive/c5dbc6d16165577428f03a50fad798088c5a7c58.tar.gz'...
these derivations will be built:
/nix/store/ahnb5d1i6x09n5cvhpi29i04diysv33a-dotnet-sdk-3.1.415.drv
/nix/store/yxjj9xnzhbgmk137jj73jkfqy24b9xwf-azure-functions-core-tools-3.0.3785.drv
building '/nix/store/ahnb5d1i6x09n5cvhpi29i04diysv33a-dotnet-sdk-3.1.415.drv'...
unpacking sources
unpacking source archive /nix/store/v341z9d3h8f9kxx1k84r5wh60akz3ysw-dotnet-sdk-3.1.415-linux-x64.tar.gz
source root is .
setting SOURCE_DATE_EPOCH to timestamp 1635274917 of file ./sdk/3.1.415/Sdks/NuGet.Build.Tasks.Pack/CoreCLR/NuGet.Build.Tasks.Pack.dll
patching sources
configuring
no configure script, doing nothing
building
no Makefile, doing nothing
installing
post-installation fixup
rewriting symlink /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415/bin/dotnet to be relative to /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415
strip is /nix/store/bg35nfwn6zd616facdywiysgpprfvsji-gcc-wrapper-11.3.0/bin/strip
stripping (with command strip and flags -S) in /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415/bin
patching script interpreter paths in /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415
checking for references to /build/ in /nix/store/zaak5j4w1hm1cdl4iijks8afgcb51gz0-dotnet-sdk-3.1.415...
running install tests
Process terminated. Couldn't find a valid ICU package installed on the system. Set the configuration flag System.Globalization.Invariant to true if you want to run with no globalization support.
at System.Environment.FailFast(System.String)
at System.Globalization.GlobalizationMode.GetGlobalizationInvariantMode()
at System.Globalization.GlobalizationMode..cctor()
at System.Globalization.CultureData.CreateCultureWithInvariantData()
at System.Globalization.CultureData.get_Invariant()
at System.Globalization.CultureInfo..cctor()
at System.String.ToLowerInvariant()
at Microsoft.DotNet.PlatformAbstractions.RuntimeEnvironment.GetArch()
at Microsoft.DotNet.PlatformAbstractions.RuntimeEnvironment..cctor()
at Microsoft.DotNet.PlatformAbstractions.RuntimeEnvironment.GetRuntimeIdentifier()
at Microsoft.DotNet.Cli.MulticoreJitProfilePathCalculator.CalculateProfileRootPath()
at Microsoft.DotNet.Cli.MulticoreJitActivator.StartCliProfileOptimization()
at Microsoft.DotNet.Cli.MulticoreJitActivator.TryActivateMulticoreJit()
at Microsoft.DotNet.Cli.Program.Main(System.String[])
/nix/store/crpnj8ssz0va2q0p5ibv9i6k6n52gcya-stdenv-linux/setup: line 1373: 125 Aborted (core dumped) $out/bin/dotnet --info
builder for '/nix/store/ahnb5d1i6x09n5cvhpi29i04diysv33a-dotnet-sdk-3.1.415.drv' failed with exit code 134
cannot build derivation '/nix/store/yxjj9xnzhbgmk137jj73jkfqy24b9xwf-azure-functions-core-tools-3.0.3785.drv': 1 dependencies couldn't be built
error: build of '/nix/store/yxjj9xnzhbgmk137jj73jkfqy24b9xwf-azure-functions-core-tools-3.0.3785.drv' failed```
### Additional context
was working fine previously:
```
nix-shell -I nixpkgs=https://github.com/NixOS/nixpkgs/archive/263ef4cc4146c9fab808085487438c625d4426a9.tar.gz -p azure-functions-core-tools
```
### Notify maintainers
@jshcmpbll
### Metadata
Please run `nix-shell -p nix-info --run "nix-info -m"` and paste the result.
```console
[user@system:~]$ nix-shell -p nix-info --run "nix-info -m"
- system: `"x86_64-linux"`
- host os: `Linux 5.17.5, NixOS, 21.11 (Porcupine)`
- multi-user?: `yes`
- sandbox: `yes`
- version: `nix-env (Nix) 2.3.16`
- channels(root): `"nixos-21.11.337422.3c5ae9be1f1, home-manager"`
- channels(peter): `""`
- nixpkgs: `/nix/var/nix/profiles/per-user/root/channels/nixos`
```
| non_priority | azure functions core tools broken build steps to reproduce nix shell i nixpkgs p azure functions core tools build log ⋊ r p nixpkgs on master ◦ nix shell i nixpkgs p azure functions core tools unpacking these derivations will be built nix store dotnet sdk drv nix store azure functions core tools drv building nix store dotnet sdk drv unpacking sources unpacking source archive nix store dotnet sdk linux tar gz source root is setting source date epoch to timestamp of file sdk sdks nuget build tasks pack coreclr nuget build tasks pack dll patching sources configuring no configure script doing nothing building no makefile doing nothing installing post installation fixup rewriting symlink nix store dotnet sdk bin dotnet to be relative to nix store dotnet sdk strip is nix store gcc wrapper bin strip stripping with command strip and flags s in nix store dotnet sdk bin patching script interpreter paths in nix store dotnet sdk checking for references to build in nix store dotnet sdk running install tests process terminated couldn t find a valid icu package installed on the system set the configuration flag system globalization invariant to true if you want to run with no globalization support at system environment failfast system string at system globalization globalizationmode getglobalizationinvariantmode at system globalization globalizationmode cctor at system globalization culturedata createculturewithinvariantdata at system globalization culturedata get invariant at system globalization cultureinfo cctor at system string tolowerinvariant at microsoft dotnet platformabstractions runtimeenvironment getarch at microsoft dotnet platformabstractions runtimeenvironment cctor at microsoft dotnet platformabstractions runtimeenvironment getruntimeidentifier at microsoft dotnet cli multicorejitprofilepathcalculator calculateprofilerootpath at microsoft dotnet cli multicorejitactivator startcliprofileoptimization at microsoft dotnet cli multicorejitactivator tryactivatemulticorejit at microsoft dotnet cli program main system string nix store stdenv linux setup line aborted core dumped out bin dotnet info builder for nix store dotnet sdk drv failed with exit code cannot build derivation nix store azure functions core tools drv dependencies couldn t be built error build of nix store azure functions core tools drv failed additional context was working fine previously nix shell i nixpkgs p azure functions core tools notify maintainers jshcmpbll metadata please run nix shell p nix info run nix info m and paste the result console nix shell p nix info run nix info m system linux host os linux nixos porcupine multi user yes sandbox yes version nix env nix channels root nixos home manager channels peter nixpkgs nix var nix profiles per user root channels nixos | 0 |
66,902 | 7,025,636,519 | IssuesEvent | 2017-12-23 13:50:03 | elastic/elasticsearch | https://api.github.com/repos/elastic/elasticsearch | opened | [CI] SharedClusterSnapshotRestoreIT.testAbortedSnapshotDuringInitDoesNotStart() fails | :Snapshot/Restore jenkins test | Added in #27931, this test fails regularly on CI. | 1.0 | [CI] SharedClusterSnapshotRestoreIT.testAbortedSnapshotDuringInitDoesNotStart() fails - Added in #27931, this test fails regularly on CI. | non_priority | sharedclustersnapshotrestoreit testabortedsnapshotduringinitdoesnotstart fails added in this test fails regularly on ci | 0 |
308,911 | 26,637,795,434 | IssuesEvent | 2023-01-25 00:02:40 | microsoft/vscode | https://api.github.com/repos/microsoft/vscode | closed | Test: "Commonly Used" list in the first-time-opened Command Palette | testplan-item | Refs: #169091
- [x] anyOS @DonJayamanne
- [x] anyOS @minsa110
- [x] anyOS @brettcannon (Optional)
Complexity: 3
[Create Issue](https://github.com/microsoft/vscode/issues/new?body=Testing+%23172050%0A%0A&assignees=TylerLeonhardt)
---
This milestone we have introduced a new "Commonly Used" section in the Command Palette. The goal is to help new users know what the Command Palette can do, but also not annoy existing users & keep their muscle memory in tact.
To see the new user experience, run `>Clear Previous Session Command History` and then also set the setting:
`workbench.commandPalette.experimental.suggestCommands`.
After this, when you open the Command Palette, you should be greeted with a new "Commonly Used" section.
Things to test out:
* If you run a command, `recently used` commands should appear above `Commonly Used`.
* If you run a command that is in the `Commonly Used` section, it should be moved into the `Recently Used` section and no longer show up in `Commonly Used` (to prevent duplication)
* If you run all the commands in the `Commonly Used`, the section should disappear
* If you run a bunch of commands that _aren't_ in `Commonly Used`, that section should eventually be pushed below the fold.
`>Clear Previous Session Command History` is your best friend for this TPI. | 1.0 | Test: "Commonly Used" list in the first-time-opened Command Palette - Refs: #169091
- [x] anyOS @DonJayamanne
- [x] anyOS @minsa110
- [x] anyOS @brettcannon (Optional)
Complexity: 3
[Create Issue](https://github.com/microsoft/vscode/issues/new?body=Testing+%23172050%0A%0A&assignees=TylerLeonhardt)
---
This milestone we have introduced a new "Commonly Used" section in the Command Palette. The goal is to help new users know what the Command Palette can do, but also not annoy existing users & keep their muscle memory in tact.
To see the new user experience, run `>Clear Previous Session Command History` and then also set the setting:
`workbench.commandPalette.experimental.suggestCommands`.
After this, when you open the Command Palette, you should be greeted with a new "Commonly Used" section.
Things to test out:
* If you run a command, `recently used` commands should appear above `Commonly Used`.
* If you run a command that is in the `Commonly Used` section, it should be moved into the `Recently Used` section and no longer show up in `Commonly Used` (to prevent duplication)
* If you run all the commands in the `Commonly Used`, the section should disappear
* If you run a bunch of commands that _aren't_ in `Commonly Used`, that section should eventually be pushed below the fold.
`>Clear Previous Session Command History` is your best friend for this TPI. | non_priority | test commonly used list in the first time opened command palette refs anyos donjayamanne anyos anyos brettcannon optional complexity this milestone we have introduced a new commonly used section in the command palette the goal is to help new users know what the command palette can do but also not annoy existing users keep their muscle memory in tact to see the new user experience run clear previous session command history and then also set the setting workbench commandpalette experimental suggestcommands after this when you open the command palette you should be greeted with a new commonly used section things to test out if you run a command recently used commands should appear above commonly used if you run a command that is in the commonly used section it should be moved into the recently used section and no longer show up in commonly used to prevent duplication if you run all the commands in the commonly used the section should disappear if you run a bunch of commands that aren t in commonly used that section should eventually be pushed below the fold clear previous session command history is your best friend for this tpi | 0 |
462,006 | 13,239,675,538 | IssuesEvent | 2020-08-19 04:11:20 | reizuseharu/Diana | https://api.github.com/repos/reizuseharu/Diana | opened | Add Service | [priority] medium [type] enhancement | ### Description
Add Service class
### Details
Service class needed to separate business logic from client
### Acceptance Criteria
- Service capable of accessing SRC endpoint
### Tasks
- [ ] Add Service class
- [ ] Add Unit Tests | 1.0 | Add Service - ### Description
Add Service class
### Details
Service class needed to separate business logic from client
### Acceptance Criteria
- Service capable of accessing SRC endpoint
### Tasks
- [ ] Add Service class
- [ ] Add Unit Tests | priority | add service description add service class details service class needed to separate business logic from client acceptance criteria service capable of accessing src endpoint tasks add service class add unit tests | 1 |
214,604 | 7,274,749,818 | IssuesEvent | 2018-02-21 11:04:36 | STEP-tw/battleship-phoenix | https://api.github.com/repos/STEP-tw/battleship-phoenix | closed | Target grid is fireable on your turn. | High Priority small | As an _attacker_
I want to _have a fireable target grid_
So that I can _attack my opponent_
**Additional Details**
Assumption :-
1. Players has placed all their ships.
2. It's my turn.
3. Game has started.
**Acceptance Criteria**
- [x] Criteria 1
- Given _it's my turn to attack_
- When _i click on a position of target grid_
- Then _that specific position should be highlighted_
| 1.0 | Target grid is fireable on your turn. - As an _attacker_
I want to _have a fireable target grid_
So that I can _attack my opponent_
**Additional Details**
Assumption :-
1. Players has placed all their ships.
2. It's my turn.
3. Game has started.
**Acceptance Criteria**
- [x] Criteria 1
- Given _it's my turn to attack_
- When _i click on a position of target grid_
- Then _that specific position should be highlighted_
| priority | target grid is fireable on your turn as an attacker i want to have a fireable target grid so that i can attack my opponent additional details assumption players has placed all their ships it s my turn game has started acceptance criteria criteria given it s my turn to attack when i click on a position of target grid then that specific position should be highlighted | 1 |
411,638 | 12,026,945,465 | IssuesEvent | 2020-04-12 16:15:36 | TzahiM/NeuroNet | https://api.github.com/repos/TzahiM/NeuroNet | closed | Multilanguage support | Priority1 enhancement | Currently all the messages are in hebrew.
So the code and templates should be done in english and translated into hebrew.
And when there is a need - also for other languages
| 1.0 | Multilanguage support - Currently all the messages are in hebrew.
So the code and templates should be done in english and translated into hebrew.
And when there is a need - also for other languages
| priority | multilanguage support currently all the messages are in hebrew so the code and templates should be done in english and translated into hebrew and when there is a need also for other languages | 1 |
54,396 | 13,644,361,454 | IssuesEvent | 2020-09-25 18:45:31 | Reckue/post-api | https://api.github.com/repos/Reckue/post-api | opened | fix the binding nodes | type:defect | Try:
>curl -X POST "http://localhost:9002/posts" -H "accept: */*" -H "Content-Type: application/json" -d "{ \"nodes\": [ { \"node\": { \"type\": \"TEXT\" }, \"parentId\": \"string\", \"parentType\": \"COMMENT\", \"source\": \"string\", \"type\": \"TEXT\", \"userId\": \"string\" } ], \"source\": \"string\", \"status\": \"DRAFT\", \"tags\": [ { \"id\": \"string\", \"name\": \"string\" } ], \"title\": \"First post\", \"userId\": \"string\"}"
Example value:

| 1.0 | fix the binding nodes - Try:
>curl -X POST "http://localhost:9002/posts" -H "accept: */*" -H "Content-Type: application/json" -d "{ \"nodes\": [ { \"node\": { \"type\": \"TEXT\" }, \"parentId\": \"string\", \"parentType\": \"COMMENT\", \"source\": \"string\", \"type\": \"TEXT\", \"userId\": \"string\" } ], \"source\": \"string\", \"status\": \"DRAFT\", \"tags\": [ { \"id\": \"string\", \"name\": \"string\" } ], \"title\": \"First post\", \"userId\": \"string\"}"
Example value:

| non_priority | fix the binding nodes try curl x post h accept h content type application json d nodes source string status draft tags title first post userid string example value | 0 |
450,511 | 13,012,665,412 | IssuesEvent | 2020-07-25 07:04:27 | alanqchen/Bear-Post | https://api.github.com/repos/alanqchen/Bear-Post | closed | Change Go UUID module | High Priority backend bug enhancement | Right now the backend uses https://github.com/satori/go.uuid, which has some security flaws. Instead, https://github.com/gofrs/uuid should be used which is better maintained. | 1.0 | Change Go UUID module - Right now the backend uses https://github.com/satori/go.uuid, which has some security flaws. Instead, https://github.com/gofrs/uuid should be used which is better maintained. | priority | change go uuid module right now the backend uses which has some security flaws instead should be used which is better maintained | 1 |
388,536 | 11,488,907,253 | IssuesEvent | 2020-02-11 14:41:06 | code-ready/crc | https://api.github.com/repos/code-ready/crc | closed | Documentation structure | kind/task priority/major size/L | Since we know we will release alongside of OpenShift our release schedule is known, however at this point it is not clear what kind of documentation is expected and where this is published. I would suggest to focus first on a getting started guide and then follow-up with detailed documentation.
* [ ] Getting started guide #65
* [ ] contribution guidelines
* [ ] test strategy (needs input from @tsedmik @jsliacan)
* [ ] ...
Note: It is best to split this out in several expected tasks. @robin-owen, please do so where you see fit. | 1.0 | Documentation structure - Since we know we will release alongside of OpenShift our release schedule is known, however at this point it is not clear what kind of documentation is expected and where this is published. I would suggest to focus first on a getting started guide and then follow-up with detailed documentation.
* [ ] Getting started guide #65
* [ ] contribution guidelines
* [ ] test strategy (needs input from @tsedmik @jsliacan)
* [ ] ...
Note: It is best to split this out in several expected tasks. @robin-owen, please do so where you see fit. | priority | documentation structure since we know we will release alongside of openshift our release schedule is known however at this point it is not clear what kind of documentation is expected and where this is published i would suggest to focus first on a getting started guide and then follow up with detailed documentation getting started guide contribution guidelines test strategy needs input from tsedmik jsliacan note it is best to split this out in several expected tasks robin owen please do so where you see fit | 1 |
572,624 | 17,023,508,320 | IssuesEvent | 2021-07-03 02:23:16 | tomhughes/trac-tickets | https://api.github.com/repos/tomhughes/trac-tickets | closed | render barrier=lift_gate in mapnik | Component: mapnik Priority: major Resolution: fixed Type: enhancement | **[Submitted to the original trac issue database at 3.09am, Sunday, 15th November 2009]**
render barrier=lift_gate in mapnik. It is as important as barrier=gate and barrier=bollard (which are rendered). | 1.0 | render barrier=lift_gate in mapnik - **[Submitted to the original trac issue database at 3.09am, Sunday, 15th November 2009]**
render barrier=lift_gate in mapnik. It is as important as barrier=gate and barrier=bollard (which are rendered). | priority | render barrier lift gate in mapnik render barrier lift gate in mapnik it is as important as barrier gate and barrier bollard which are rendered | 1 |
365,241 | 10,779,906,199 | IssuesEvent | 2019-11-04 11:42:55 | emsec/hal | https://api.github.com/repos/emsec/hal | closed | Crash on gate removal via Python | Priority: High Status: In Progress Type: Bug | **Describe the bug**
Removing a gate via Python causes a segmentation fault. The `event_log::handle_submodule_event` callback is triggered by the `netlist_internal_manager` and attempts to access the gate by its ID. However, the gate's ID has already been deleted before the event is triggered:
https://github.com/emsec/hal/blob/25094f4e0d4befd52139851c8a164bd73d68bc9c/src/netlist/netlist_internal_manager.cpp#L100
The gate access fails and returns a `nullptr`, on which the event log method then attempts to call several functions. This ultimately crashes HAL with a null pointer dereference.
**To Reproduce**
Steps to reproduce the behavior:
1. Open a netlist
2. Run this code in the Python editor:
```python
g = netlist.create_gate("FDRE", "foobar")
netlist.delete_gate(g)
```
3. HAL crashes
**Expected behavior**
A log entry should be generated, but HAL must not crash. | 1.0 | Crash on gate removal via Python - **Describe the bug**
Removing a gate via Python causes a segmentation fault. The `event_log::handle_submodule_event` callback is triggered by the `netlist_internal_manager` and attempts to access the gate by its ID. However, the gate's ID has already been deleted before the event is triggered:
https://github.com/emsec/hal/blob/25094f4e0d4befd52139851c8a164bd73d68bc9c/src/netlist/netlist_internal_manager.cpp#L100
The gate access fails and returns a `nullptr`, on which the event log method then attempts to call several functions. This ultimately crashes HAL with a null pointer dereference.
**To Reproduce**
Steps to reproduce the behavior:
1. Open a netlist
2. Run this code in the Python editor:
```python
g = netlist.create_gate("FDRE", "foobar")
netlist.delete_gate(g)
```
3. HAL crashes
**Expected behavior**
A log entry should be generated, but HAL must not crash. | priority | crash on gate removal via python describe the bug removing a gate via python causes a segmentation fault the event log handle submodule event callback is triggered by the netlist internal manager and attempts to access the gate by its id however the gate s id has already been deleted before the event is triggered the gate access fails and returns a nullptr on which the event log method then attempts to call several functions this ultimately crashes hal with a null pointer dereference to reproduce steps to reproduce the behavior open a netlist run this code in the python editor python g netlist create gate fdre foobar netlist delete gate g hal crashes expected behavior a log entry should be generated but hal must not crash | 1 |
18,759 | 2,616,004,885 | IssuesEvent | 2015-03-02 00:49:27 | jasonhall/bwapi | https://api.github.com/repos/jasonhall/bwapi | closed | New Build Task Recognition System | auto-migrated Priority-Critical Type-Enhancement | ```
Protoss does not clear the build task when it starts to build, it's onnly
set to recognize Terran construction.
```
Original issue reported on code.google.com by `AHeinerm` on 29 Sep 2008 at 7:32 | 1.0 | New Build Task Recognition System - ```
Protoss does not clear the build task when it starts to build, it's onnly
set to recognize Terran construction.
```
Original issue reported on code.google.com by `AHeinerm` on 29 Sep 2008 at 7:32 | priority | new build task recognition system protoss does not clear the build task when it starts to build it s onnly set to recognize terran construction original issue reported on code google com by aheinerm on sep at | 1 |
178,926 | 6,620,215,363 | IssuesEvent | 2017-09-21 14:52:06 | spring-projects/spring-boot | https://api.github.com/repos/spring-projects/spring-boot | closed | Add a generic to `DataSourceBuilder` | priority: normal theme: datasource type: enhancement | To be able to derive the actual type of the `DataSource` rather than a raw `DataSource`. | 1.0 | Add a generic to `DataSourceBuilder` - To be able to derive the actual type of the `DataSource` rather than a raw `DataSource`. | priority | add a generic to datasourcebuilder to be able to derive the actual type of the datasource rather than a raw datasource | 1 |
194,343 | 6,893,906,110 | IssuesEvent | 2017-11-23 07:36:09 | anonim-legivon/dvach.api | https://api.github.com/repos/anonim-legivon/dvach.api | closed | Анонимность: поддержка proxy и случайные заголовки | enhancement low priority todo | Добавить поддержку запросов через прокси и передавать случайные заголовки http запросов. | 1.0 | Анонимность: поддержка proxy и случайные заголовки - Добавить поддержку запросов через прокси и передавать случайные заголовки http запросов. | priority | анонимность поддержка proxy и случайные заголовки добавить поддержку запросов через прокси и передавать случайные заголовки http запросов | 1 |
648,036 | 21,163,461,961 | IssuesEvent | 2022-04-07 11:32:56 | renovatebot/renovate | https://api.github.com/repos/renovatebot/renovate | closed | Refactor gitlabci manager to use yaml parser | priority-3-normal type:refactor manager:gitlab-ci status:ready | ### Describe the proposed change(s).
Refactor the existing implementation - which uses custom line-based parsing with regex - to instead use YAML parsing. | 1.0 | Refactor gitlabci manager to use yaml parser - ### Describe the proposed change(s).
Refactor the existing implementation - which uses custom line-based parsing with regex - to instead use YAML parsing. | priority | refactor gitlabci manager to use yaml parser describe the proposed change s refactor the existing implementation which uses custom line based parsing with regex to instead use yaml parsing | 1 |
254,180 | 8,070,892,684 | IssuesEvent | 2018-08-06 11:19:06 | prometheus/prombench | https://api.github.com/repos/prometheus/prombench | opened | In a prow job creating deployment doesn't check statuse before continuing to next deployment. | priority: urgent | see difference in the logs running from cli vs running in a prow job.
in local the deployment waits until it is ready before continuing to the next one where in prow it just continues.
```
Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
```
```
./prombench gke resource apply -a $AUTH_FILE \
-v ZONE:europe-west3-a -v PROJECT_ID:macro-mile-203600 -v CLUSTER_NAME:prow \
-v PR_NUMBER:4448 -v RELEASE:v2.3.2 \
-f components/prombench/manifests/benchmark
```
## From local cli.
```
2018/08/06 13:46:33 resource created - kind: Namespace, name: prombench-4448
2018/08/06 13:46:33 resource created - kind: ServiceAccount, name: loadgen-scaler
2018/08/06 13:46:33 resource created - kind: ServiceAccount, name: prometheus
2018/08/06 13:46:33 resource created - kind: ClusterRoleBinding, name: loadgen-scaler
2018/08/06 13:46:33 resource created - kind: ClusterRoleBinding, name: prometheus-4448
2018/08/06 13:46:34 resource created - kind: Deployment, name: fake-webserver
2018/08/06 13:46:34 Request for 'applying deployment:fake-webserver' is done!
2018/08/06 13:46:34 resource created - kind: Service, name: fake-webserver
2018/08/06 13:46:34 Request for 'applying service:fake-webserver' is done!
2018/08/06 13:46:34 resource created - kind: ConfigMap, name: prometheus-loadgen
2018/08/06 13:46:34 resource created - kind: Deployment, name: prometheus-loadgen-scaler
2018/08/06 13:46:34 Request for 'applying deployment:prometheus-loadgen-scaler' is in progress. Checking in 10s
2018/08/06 13:46:44 Request for 'applying deployment:prometheus-loadgen-scaler' is done!
2018/08/06 13:46:45 resource created - kind: Deployment, name: prometheus-loadgen-querier
2018/08/06 13:46:45 Request for 'applying deployment:prometheus-loadgen-querier' is in progress. Checking in 10s
2018/08/06 13:46:55 Request for 'applying deployment:prometheus-loadgen-querier' is done!
2018/08/06 13:46:55 resource created - kind: Service, name: prometheus-loadgen-querier
2018/08/06 13:46:55 Request for 'applying service:prometheus-loadgen-querier' is done!
2018/08/06 13:46:55 resource created - kind: ConfigMap, name: prometheus-test
2018/08/06 13:46:55 resource created - kind: Deployment, name: prometheus-test-pr-44482018/08/06 13:46:55 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:05 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:15 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:25 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:35 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:46 Request for 'applying deployment:prometheus-test-pr-4448' is done!
2018/08/06 13:47:46 resource created - kind: Service, name: prometheus-test-pr-4448
2018/08/06 13:47:46 Request for 'applying service:prometheus-test-pr-4448' is done!
2018/08/06 13:47:46 resource created - kind: Deployment, name: prometheus-test-v2-3-2
2018/08/06 13:47:46 Request for 'applying deployment:prometheus-test-v2-3-2' is in progress. Checking in 10s
2018/08/06 13:47:56 Request for 'applying deployment:prometheus-test-v2-3-2' is done!
2018/08/06 13:47:56 resource created - kind: Service, name: prometheus-test-v2-3-2
2018/08/06 13:47:57 Request for 'applying service:prometheus-test-v2-3-2' is done!
2018/08/06 13:47:57 resource created - kind: Deployment, name: node-exporter-prometheus-test-v2-3-2
2018/08/06 13:47:57 Request for 'applying deployment:node-exporter-prometheus-test-v2-3-2' is in progress. Checking in 10s
2018/08/06 13:48:07 Request for 'applying deployment:node-exporter-prometheus-test-v2-3-2' is done!
2018/08/06 13:48:07 resource created - kind: Deployment, name: node-exporter-prometheus-test-pr-4448
2018/08/06 13:48:07 Request for 'applying deployment:node-exporter-prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:48:17 Request for 'applying deployment:node-exporter-prometheus-test-pr-4448' is done!
2018/08/06 13:48:17 resource created - kind: DaemonSet, name: node-exporter-nodes
2018/08/06 13:48:17 resource created - kind: Service, name: node-exporter
2018/08/06 13:48:17 Request for 'applying service:node-exporter' is done!
```
## From a prow job
```
2018/08/06 10:21:40 resource created - kind: Namespace, name: prombench-4448
2018/08/06 10:21:40 resource created - kind: ServiceAccount, name: loadgen-scaler
2018/08/06 10:21:40 resource created - kind: ServiceAccount, name: prometheus
2018/08/06 10:21:41 resource created - kind: ClusterRoleBinding, name: loadgen-scaler
2018/08/06 10:21:41 resource created - kind: ClusterRoleBinding, name: prometheus-4448
2018/08/06 10:21:41 resource created - kind: Deployment, name: fake-webserver
2018/08/06 10:21:41 Request for 'applying deployment:fake-webserver' is done!
2018/08/06 10:21:41 resource created - kind: Service, name: fake-webserver
2018/08/06 10:21:41 Request for 'applying service:fake-webserver' is done!
2018/08/06 10:21:41 resource created - kind: ConfigMap, name: prometheus-loadgen
2018/08/06 10:21:41 resource created - kind: Deployment, name: prometheus-loadgen-scaler
2018/08/06 10:21:41 Request for 'applying deployment:prometheus-loadgen-scaler' is done!
2018/08/06 10:21:41 resource created - kind: Deployment, name: prometheus-loadgen-querier
2018/08/06 10:21:41 Request for 'applying deployment:prometheus-loadgen-querier' is done!
2018/08/06 10:21:41 resource created - kind: Service, name: prometheus-loadgen-querier
2018/08/06 10:21:41 Request for 'applying service:prometheus-loadgen-querier' is done!
2018/08/06 10:21:42 resource created - kind: ConfigMap, name: prometheus-test
2018/08/06 10:21:42 resource created - kind: Deployment, name: prometheus-test-pr-4448
2018/08/06 10:21:42 Request for 'applying deployment:prometheus-test-pr-4448' is done!
2018/08/06 10:21:42 resource created - kind: Service, name: prometheus-test-pr-4448
2018/08/06 10:21:42 Request for 'applying service:prometheus-test-pr-4448' is done!
2018/08/06 10:21:42 resource created - kind: Deployment, name: prometheus-test-v2-3-2
2018/08/06 10:21:42 Request for 'applying deployment:prometheus-test-v2-3-2' is done!
2018/08/06 10:21:43 resource created - kind: Service, name: prometheus-test-v2-3-2
2018/08/06 10:21:43 Request for 'applying service:prometheus-test-v2-3-2' is done!
2018/08/06 10:21:43 resource created - kind: Deployment, name: node-exporter-prometheus-test-v2-3-2
2018/08/06 10:21:43 Request for 'applying deployment:node-exporter-prometheus-test-v2-3-2' is done!
2018/08/06 10:21:43 resource created - kind: Deployment, name: node-exporter-prometheus-test-pr-4448
2018/08/06 10:21:43 Request for 'applying deployment:node-exporter-prometheus-test-pr-4448' is done!
2018/08/06 10:21:43 resource created - kind: DaemonSet, name: node-exporter-nodes
2018/08/06 10:21:43 resource created - kind: Service, name: node-exporter
2018/08/06 10:21:43 Request for 'applying service:node-exporter' is done!
``` | 1.0 | In a prow job creating deployment doesn't check statuse before continuing to next deployment. - see difference in the logs running from cli vs running in a prow job.
in local the deployment waits until it is ready before continuing to the next one where in prow it just continues.
```
Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
```
```
./prombench gke resource apply -a $AUTH_FILE \
-v ZONE:europe-west3-a -v PROJECT_ID:macro-mile-203600 -v CLUSTER_NAME:prow \
-v PR_NUMBER:4448 -v RELEASE:v2.3.2 \
-f components/prombench/manifests/benchmark
```
## From local cli.
```
2018/08/06 13:46:33 resource created - kind: Namespace, name: prombench-4448
2018/08/06 13:46:33 resource created - kind: ServiceAccount, name: loadgen-scaler
2018/08/06 13:46:33 resource created - kind: ServiceAccount, name: prometheus
2018/08/06 13:46:33 resource created - kind: ClusterRoleBinding, name: loadgen-scaler
2018/08/06 13:46:33 resource created - kind: ClusterRoleBinding, name: prometheus-4448
2018/08/06 13:46:34 resource created - kind: Deployment, name: fake-webserver
2018/08/06 13:46:34 Request for 'applying deployment:fake-webserver' is done!
2018/08/06 13:46:34 resource created - kind: Service, name: fake-webserver
2018/08/06 13:46:34 Request for 'applying service:fake-webserver' is done!
2018/08/06 13:46:34 resource created - kind: ConfigMap, name: prometheus-loadgen
2018/08/06 13:46:34 resource created - kind: Deployment, name: prometheus-loadgen-scaler
2018/08/06 13:46:34 Request for 'applying deployment:prometheus-loadgen-scaler' is in progress. Checking in 10s
2018/08/06 13:46:44 Request for 'applying deployment:prometheus-loadgen-scaler' is done!
2018/08/06 13:46:45 resource created - kind: Deployment, name: prometheus-loadgen-querier
2018/08/06 13:46:45 Request for 'applying deployment:prometheus-loadgen-querier' is in progress. Checking in 10s
2018/08/06 13:46:55 Request for 'applying deployment:prometheus-loadgen-querier' is done!
2018/08/06 13:46:55 resource created - kind: Service, name: prometheus-loadgen-querier
2018/08/06 13:46:55 Request for 'applying service:prometheus-loadgen-querier' is done!
2018/08/06 13:46:55 resource created - kind: ConfigMap, name: prometheus-test
2018/08/06 13:46:55 resource created - kind: Deployment, name: prometheus-test-pr-44482018/08/06 13:46:55 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:05 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:15 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:25 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:35 Request for 'applying deployment:prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:47:46 Request for 'applying deployment:prometheus-test-pr-4448' is done!
2018/08/06 13:47:46 resource created - kind: Service, name: prometheus-test-pr-4448
2018/08/06 13:47:46 Request for 'applying service:prometheus-test-pr-4448' is done!
2018/08/06 13:47:46 resource created - kind: Deployment, name: prometheus-test-v2-3-2
2018/08/06 13:47:46 Request for 'applying deployment:prometheus-test-v2-3-2' is in progress. Checking in 10s
2018/08/06 13:47:56 Request for 'applying deployment:prometheus-test-v2-3-2' is done!
2018/08/06 13:47:56 resource created - kind: Service, name: prometheus-test-v2-3-2
2018/08/06 13:47:57 Request for 'applying service:prometheus-test-v2-3-2' is done!
2018/08/06 13:47:57 resource created - kind: Deployment, name: node-exporter-prometheus-test-v2-3-2
2018/08/06 13:47:57 Request for 'applying deployment:node-exporter-prometheus-test-v2-3-2' is in progress. Checking in 10s
2018/08/06 13:48:07 Request for 'applying deployment:node-exporter-prometheus-test-v2-3-2' is done!
2018/08/06 13:48:07 resource created - kind: Deployment, name: node-exporter-prometheus-test-pr-4448
2018/08/06 13:48:07 Request for 'applying deployment:node-exporter-prometheus-test-pr-4448' is in progress. Checking in 10s
2018/08/06 13:48:17 Request for 'applying deployment:node-exporter-prometheus-test-pr-4448' is done!
2018/08/06 13:48:17 resource created - kind: DaemonSet, name: node-exporter-nodes
2018/08/06 13:48:17 resource created - kind: Service, name: node-exporter
2018/08/06 13:48:17 Request for 'applying service:node-exporter' is done!
```
## From a prow job
```
2018/08/06 10:21:40 resource created - kind: Namespace, name: prombench-4448
2018/08/06 10:21:40 resource created - kind: ServiceAccount, name: loadgen-scaler
2018/08/06 10:21:40 resource created - kind: ServiceAccount, name: prometheus
2018/08/06 10:21:41 resource created - kind: ClusterRoleBinding, name: loadgen-scaler
2018/08/06 10:21:41 resource created - kind: ClusterRoleBinding, name: prometheus-4448
2018/08/06 10:21:41 resource created - kind: Deployment, name: fake-webserver
2018/08/06 10:21:41 Request for 'applying deployment:fake-webserver' is done!
2018/08/06 10:21:41 resource created - kind: Service, name: fake-webserver
2018/08/06 10:21:41 Request for 'applying service:fake-webserver' is done!
2018/08/06 10:21:41 resource created - kind: ConfigMap, name: prometheus-loadgen
2018/08/06 10:21:41 resource created - kind: Deployment, name: prometheus-loadgen-scaler
2018/08/06 10:21:41 Request for 'applying deployment:prometheus-loadgen-scaler' is done!
2018/08/06 10:21:41 resource created - kind: Deployment, name: prometheus-loadgen-querier
2018/08/06 10:21:41 Request for 'applying deployment:prometheus-loadgen-querier' is done!
2018/08/06 10:21:41 resource created - kind: Service, name: prometheus-loadgen-querier
2018/08/06 10:21:41 Request for 'applying service:prometheus-loadgen-querier' is done!
2018/08/06 10:21:42 resource created - kind: ConfigMap, name: prometheus-test
2018/08/06 10:21:42 resource created - kind: Deployment, name: prometheus-test-pr-4448
2018/08/06 10:21:42 Request for 'applying deployment:prometheus-test-pr-4448' is done!
2018/08/06 10:21:42 resource created - kind: Service, name: prometheus-test-pr-4448
2018/08/06 10:21:42 Request for 'applying service:prometheus-test-pr-4448' is done!
2018/08/06 10:21:42 resource created - kind: Deployment, name: prometheus-test-v2-3-2
2018/08/06 10:21:42 Request for 'applying deployment:prometheus-test-v2-3-2' is done!
2018/08/06 10:21:43 resource created - kind: Service, name: prometheus-test-v2-3-2
2018/08/06 10:21:43 Request for 'applying service:prometheus-test-v2-3-2' is done!
2018/08/06 10:21:43 resource created - kind: Deployment, name: node-exporter-prometheus-test-v2-3-2
2018/08/06 10:21:43 Request for 'applying deployment:node-exporter-prometheus-test-v2-3-2' is done!
2018/08/06 10:21:43 resource created - kind: Deployment, name: node-exporter-prometheus-test-pr-4448
2018/08/06 10:21:43 Request for 'applying deployment:node-exporter-prometheus-test-pr-4448' is done!
2018/08/06 10:21:43 resource created - kind: DaemonSet, name: node-exporter-nodes
2018/08/06 10:21:43 resource created - kind: Service, name: node-exporter
2018/08/06 10:21:43 Request for 'applying service:node-exporter' is done!
``` | priority | in a prow job creating deployment doesn t check statuse before continuing to next deployment see difference in the logs running from cli vs running in a prow job in local the deployment waits until it is ready before continuing to the next one where in prow it just continues request for applying deployment prometheus test pr is in progress checking in prombench gke resource apply a auth file v zone europe a v project id macro mile v cluster name prow v pr number v release f components prombench manifests benchmark from local cli resource created kind namespace name prombench resource created kind serviceaccount name loadgen scaler resource created kind serviceaccount name prometheus resource created kind clusterrolebinding name loadgen scaler resource created kind clusterrolebinding name prometheus resource created kind deployment name fake webserver request for applying deployment fake webserver is done resource created kind service name fake webserver request for applying service fake webserver is done resource created kind configmap name prometheus loadgen resource created kind deployment name prometheus loadgen scaler request for applying deployment prometheus loadgen scaler is in progress checking in request for applying deployment prometheus loadgen scaler is done resource created kind deployment name prometheus loadgen querier request for applying deployment prometheus loadgen querier is in progress checking in request for applying deployment prometheus loadgen querier is done resource created kind service name prometheus loadgen querier request for applying service prometheus loadgen querier is done resource created kind configmap name prometheus test resource created kind deployment name prometheus test pr request for applying deployment prometheus test pr is in progress checking in request for applying deployment prometheus test pr is in progress checking in request for applying deployment prometheus test pr is in progress checking in request for applying deployment prometheus test pr is in progress checking in request for applying deployment prometheus test pr is in progress checking in request for applying deployment prometheus test pr is done resource created kind service name prometheus test pr request for applying service prometheus test pr is done resource created kind deployment name prometheus test request for applying deployment prometheus test is in progress checking in request for applying deployment prometheus test is done resource created kind service name prometheus test request for applying service prometheus test is done resource created kind deployment name node exporter prometheus test request for applying deployment node exporter prometheus test is in progress checking in request for applying deployment node exporter prometheus test is done resource created kind deployment name node exporter prometheus test pr request for applying deployment node exporter prometheus test pr is in progress checking in request for applying deployment node exporter prometheus test pr is done resource created kind daemonset name node exporter nodes resource created kind service name node exporter request for applying service node exporter is done from a prow job resource created kind namespace name prombench resource created kind serviceaccount name loadgen scaler resource created kind serviceaccount name prometheus resource created kind clusterrolebinding name loadgen scaler resource created kind clusterrolebinding name prometheus resource created kind deployment name fake webserver request for applying deployment fake webserver is done resource created kind service name fake webserver request for applying service fake webserver is done resource created kind configmap name prometheus loadgen resource created kind deployment name prometheus loadgen scaler request for applying deployment prometheus loadgen scaler is done resource created kind deployment name prometheus loadgen querier request for applying deployment prometheus loadgen querier is done resource created kind service name prometheus loadgen querier request for applying service prometheus loadgen querier is done resource created kind configmap name prometheus test resource created kind deployment name prometheus test pr request for applying deployment prometheus test pr is done resource created kind service name prometheus test pr request for applying service prometheus test pr is done resource created kind deployment name prometheus test request for applying deployment prometheus test is done resource created kind service name prometheus test request for applying service prometheus test is done resource created kind deployment name node exporter prometheus test request for applying deployment node exporter prometheus test is done resource created kind deployment name node exporter prometheus test pr request for applying deployment node exporter prometheus test pr is done resource created kind daemonset name node exporter nodes resource created kind service name node exporter request for applying service node exporter is done | 1 |
68,556 | 14,936,773,508 | IssuesEvent | 2021-01-25 13:49:35 | RG4421/vue-fusioncharts | https://api.github.com/repos/RG4421/vue-fusioncharts | opened | WS-2020-0042 (High) detected in acorn-5.7.1.tgz | security vulnerability | ## WS-2020-0042 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>acorn-5.7.1.tgz</b></p></summary>
<p>ECMAScript parser</p>
<p>Library home page: <a href="https://registry.npmjs.org/acorn/-/acorn-5.7.1.tgz">https://registry.npmjs.org/acorn/-/acorn-5.7.1.tgz</a></p>
<p>Path to dependency file: vue-fusioncharts/package.json</p>
<p>Path to vulnerable library: vue-fusioncharts/node_modules/acorn/package.json</p>
<p>
Dependency Hierarchy:
- rollup-plugin-commonjs-8.4.1.tgz (Root Library)
- :x: **acorn-5.7.1.tgz** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/RG4421/vue-fusioncharts/commit/c54b67c7817684fab6164e4bca450b1a786ce139">c54b67c7817684fab6164e4bca450b1a786ce139</a></p>
<p>Found in base branch: <b>master</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/high_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
acorn is vulnerable to REGEX DoS. A regex of the form /[x-\ud800]/u causes the parser to enter an infinite loop. attackers may leverage the vulnerability leading to a Denial of Service since the string is not valid UTF16 and it results in it being sanitized before reaching the parser.
<p>Publish Date: 2020-03-01
<p>URL: <a href=https://github.com/acornjs/acorn/commit/b5c17877ac0511e31579ea31e7650ba1a5871e51>WS-2020-0042</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>7.5</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: None
- Integrity Impact: None
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://www.npmjs.com/advisories/1488">https://www.npmjs.com/advisories/1488</a></p>
<p>Release Date: 2020-03-08</p>
<p>Fix Resolution: 7.1.1</p>
</p>
</details>
<p></p>
<!-- <REMEDIATE>{"isOpenPROnVulnerability":true,"isPackageBased":true,"isDefaultBranch":true,"packages":[{"packageType":"javascript/Node.js","packageName":"acorn","packageVersion":"5.7.1","isTransitiveDependency":true,"dependencyTree":"rollup-plugin-commonjs:8.4.1;acorn:5.7.1","isMinimumFixVersionAvailable":true,"minimumFixVersion":"7.1.1"}],"vulnerabilityIdentifier":"WS-2020-0042","vulnerabilityDetails":"acorn is vulnerable to REGEX DoS. A regex of the form /[x-\\ud800]/u causes the parser to enter an infinite loop. attackers may leverage the vulnerability leading to a Denial of Service since the string is not valid UTF16 and it results in it being sanitized before reaching the parser.","vulnerabilityUrl":"https://github.com/acornjs/acorn/commit/b5c17877ac0511e31579ea31e7650ba1a5871e51","cvss3Severity":"high","cvss3Score":"7.5","cvss3Metrics":{"A":"High","AC":"Low","PR":"None","S":"Unchanged","C":"None","UI":"None","AV":"Network","I":"None"},"extraData":{}}</REMEDIATE> --> | True | WS-2020-0042 (High) detected in acorn-5.7.1.tgz - ## WS-2020-0042 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>acorn-5.7.1.tgz</b></p></summary>
<p>ECMAScript parser</p>
<p>Library home page: <a href="https://registry.npmjs.org/acorn/-/acorn-5.7.1.tgz">https://registry.npmjs.org/acorn/-/acorn-5.7.1.tgz</a></p>
<p>Path to dependency file: vue-fusioncharts/package.json</p>
<p>Path to vulnerable library: vue-fusioncharts/node_modules/acorn/package.json</p>
<p>
Dependency Hierarchy:
- rollup-plugin-commonjs-8.4.1.tgz (Root Library)
- :x: **acorn-5.7.1.tgz** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/RG4421/vue-fusioncharts/commit/c54b67c7817684fab6164e4bca450b1a786ce139">c54b67c7817684fab6164e4bca450b1a786ce139</a></p>
<p>Found in base branch: <b>master</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/high_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
acorn is vulnerable to REGEX DoS. A regex of the form /[x-\ud800]/u causes the parser to enter an infinite loop. attackers may leverage the vulnerability leading to a Denial of Service since the string is not valid UTF16 and it results in it being sanitized before reaching the parser.
<p>Publish Date: 2020-03-01
<p>URL: <a href=https://github.com/acornjs/acorn/commit/b5c17877ac0511e31579ea31e7650ba1a5871e51>WS-2020-0042</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>7.5</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: None
- Integrity Impact: None
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://www.npmjs.com/advisories/1488">https://www.npmjs.com/advisories/1488</a></p>
<p>Release Date: 2020-03-08</p>
<p>Fix Resolution: 7.1.1</p>
</p>
</details>
<p></p>
<!-- <REMEDIATE>{"isOpenPROnVulnerability":true,"isPackageBased":true,"isDefaultBranch":true,"packages":[{"packageType":"javascript/Node.js","packageName":"acorn","packageVersion":"5.7.1","isTransitiveDependency":true,"dependencyTree":"rollup-plugin-commonjs:8.4.1;acorn:5.7.1","isMinimumFixVersionAvailable":true,"minimumFixVersion":"7.1.1"}],"vulnerabilityIdentifier":"WS-2020-0042","vulnerabilityDetails":"acorn is vulnerable to REGEX DoS. A regex of the form /[x-\\ud800]/u causes the parser to enter an infinite loop. attackers may leverage the vulnerability leading to a Denial of Service since the string is not valid UTF16 and it results in it being sanitized before reaching the parser.","vulnerabilityUrl":"https://github.com/acornjs/acorn/commit/b5c17877ac0511e31579ea31e7650ba1a5871e51","cvss3Severity":"high","cvss3Score":"7.5","cvss3Metrics":{"A":"High","AC":"Low","PR":"None","S":"Unchanged","C":"None","UI":"None","AV":"Network","I":"None"},"extraData":{}}</REMEDIATE> --> | non_priority | ws high detected in acorn tgz ws high severity vulnerability vulnerable library acorn tgz ecmascript parser library home page a href path to dependency file vue fusioncharts package json path to vulnerable library vue fusioncharts node modules acorn package json dependency hierarchy rollup plugin commonjs tgz root library x acorn tgz vulnerable library found in head commit a href found in base branch master vulnerability details acorn is vulnerable to regex dos a regex of the form u causes the parser to enter an infinite loop attackers may leverage the vulnerability leading to a denial of service since the string is not valid and it results in it being sanitized before reaching the parser publish date url a href cvss score details base score metrics exploitability metrics attack vector network attack complexity low privileges required none user interaction none scope unchanged impact metrics confidentiality impact none integrity impact none availability impact high for more information on scores click a href suggested fix type upgrade version origin a href release date fix resolution isopenpronvulnerability true ispackagebased true isdefaultbranch true packages vulnerabilityidentifier ws vulnerabilitydetails acorn is vulnerable to regex dos a regex of the form u causes the parser to enter an infinite loop attackers may leverage the vulnerability leading to a denial of service since the string is not valid and it results in it being sanitized before reaching the parser vulnerabilityurl | 0 |
80,353 | 30,246,051,472 | IssuesEvent | 2023-07-06 16:33:06 | dotCMS/core | https://api.github.com/repos/dotCMS/core | opened | [UI] Fix missing done() in tests at Experiment Lib | Type : Defect Team : Falcon dotCMS : Experiments Triage | ### Parent Issue
_No response_
### Problem Statement
If you don't add done() inside a subscribed observable, the assertion show a false positive.
### Steps to Reproduce
- Find all the tests in Experiments to add the done(), inside all the subscription.
### Acceptance Criteria
- All passed test.
### dotCMS Version
master
### Proposed Objective
Quality Assurance
### Proposed Priority
Priority 3 - Average
### External Links... Slack Conversations, Support Tickets, Figma Designs, etc.
_No response_
### Assumptions & Initiation Needs
_No response_
### Quality Assurance Notes & Workarounds
_No response_
### Sub-Tasks & Estimates
_No response_ | 1.0 | [UI] Fix missing done() in tests at Experiment Lib - ### Parent Issue
_No response_
### Problem Statement
If you don't add done() inside a subscribed observable, the assertion show a false positive.
### Steps to Reproduce
- Find all the tests in Experiments to add the done(), inside all the subscription.
### Acceptance Criteria
- All passed test.
### dotCMS Version
master
### Proposed Objective
Quality Assurance
### Proposed Priority
Priority 3 - Average
### External Links... Slack Conversations, Support Tickets, Figma Designs, etc.
_No response_
### Assumptions & Initiation Needs
_No response_
### Quality Assurance Notes & Workarounds
_No response_
### Sub-Tasks & Estimates
_No response_ | non_priority | fix missing done in tests at experiment lib parent issue no response problem statement if you don t add done inside a subscribed observable the assertion show a false positive steps to reproduce find all the tests in experiments to add the done inside all the subscription acceptance criteria all passed test dotcms version master proposed objective quality assurance proposed priority priority average external links slack conversations support tickets figma designs etc no response assumptions initiation needs no response quality assurance notes workarounds no response sub tasks estimates no response | 0 |
354,648 | 10,570,857,931 | IssuesEvent | 2019-10-07 04:45:46 | danielcaldas/react-d3-graph | https://api.github.com/repos/danielcaldas/react-d3-graph | closed | Make link end marker's width and height configurable | Hacktoberfest enhancement feature request in progress priority low | **Is your feature request related to a problem? Please describe.**
Currently there is no way for users to specify the width and the height of link's [marker[(https://developer.mozilla.org/en-US/docs/Web/SVG/Element/marker)'s elements. As you can see in our codebase, this values are hardcoded, see for yourself in [src/components/marker/Marker.jsx](https://github.com/danielcaldas/react-d3-graph/blob/220c5ca121a828ec9ca08ad10c1b679cb540c4fe/src/components/marker/Marker.jsx#L19).
```javascript
<marker
className="marker"
id={this.props.id}
viewBox="0 -5 10 10"
refX={this.props.refX}
refY="0"
markerWidth="6" // width
markerHeight="6" // height
orient="auto"
fill={this.props.fill}
>
```
**Describe the solution you'd like**
The propriate solution here would be for the library to expose this as a [link-level](https://goodguydaniel.com/react-d3-graph/docs/index.html#config-link) configurable value.
So basically, extend the existent functionalities in [src/components/graph/graph.config.js](https://github.com/danielcaldas/react-d3-graph/blob/master/src/components/graph/graph.config.js#L254) adding two new properties:
```javascript
// ...
link: {
// ...
markerWidth: 6,
markerHeight: 6,
// ...
}
// ...
```
**Additional context**
Changing marker's width and height, impact.

| 1.0 | Make link end marker's width and height configurable - **Is your feature request related to a problem? Please describe.**
Currently there is no way for users to specify the width and the height of link's [marker[(https://developer.mozilla.org/en-US/docs/Web/SVG/Element/marker)'s elements. As you can see in our codebase, this values are hardcoded, see for yourself in [src/components/marker/Marker.jsx](https://github.com/danielcaldas/react-d3-graph/blob/220c5ca121a828ec9ca08ad10c1b679cb540c4fe/src/components/marker/Marker.jsx#L19).
```javascript
<marker
className="marker"
id={this.props.id}
viewBox="0 -5 10 10"
refX={this.props.refX}
refY="0"
markerWidth="6" // width
markerHeight="6" // height
orient="auto"
fill={this.props.fill}
>
```
**Describe the solution you'd like**
The propriate solution here would be for the library to expose this as a [link-level](https://goodguydaniel.com/react-d3-graph/docs/index.html#config-link) configurable value.
So basically, extend the existent functionalities in [src/components/graph/graph.config.js](https://github.com/danielcaldas/react-d3-graph/blob/master/src/components/graph/graph.config.js#L254) adding two new properties:
```javascript
// ...
link: {
// ...
markerWidth: 6,
markerHeight: 6,
// ...
}
// ...
```
**Additional context**
Changing marker's width and height, impact.

| priority | make link end marker s width and height configurable is your feature request related to a problem please describe currently there is no way for users to specify the width and the height of link s javascript marker classname marker id this props id viewbox refx this props refx refy markerwidth width markerheight height orient auto fill this props fill describe the solution you d like the propriate solution here would be for the library to expose this as a configurable value so basically extend the existent functionalities in adding two new properties javascript link markerwidth markerheight additional context changing marker s width and height impact | 1 |
37,544 | 18,508,377,242 | IssuesEvent | 2021-10-19 21:43:45 | iansantagata/jamms | https://api.github.com/repos/iansantagata/jamms | closed | Parallelize Spotify Calls on Home Page for Efficient Loading | performance | ## User Report
<!-- A clear and concise description of what is happening or what you want to happen. -->
Home page currently does not parallelize Spotify calls.
It calls each endpoint in series, waiting on the results of the first (even though it is not dependent on the data) before going to the next. It does this to get playlist data, top artist data, top track data, and some more.
These calls should be parallelized and then awaited all at once for better performance loading the home page. | True | Parallelize Spotify Calls on Home Page for Efficient Loading - ## User Report
<!-- A clear and concise description of what is happening or what you want to happen. -->
Home page currently does not parallelize Spotify calls.
It calls each endpoint in series, waiting on the results of the first (even though it is not dependent on the data) before going to the next. It does this to get playlist data, top artist data, top track data, and some more.
These calls should be parallelized and then awaited all at once for better performance loading the home page. | non_priority | parallelize spotify calls on home page for efficient loading user report home page currently does not parallelize spotify calls it calls each endpoint in series waiting on the results of the first even though it is not dependent on the data before going to the next it does this to get playlist data top artist data top track data and some more these calls should be parallelized and then awaited all at once for better performance loading the home page | 0 |
697,556 | 23,943,533,470 | IssuesEvent | 2022-09-12 04:01:53 | Maia-Cochran/habitual | https://api.github.com/repos/Maia-Cochran/habitual | opened | Create ModalTemplate component | enhancement styling high-priority UI/UX Modal | - Create modal template to create the same style for all the modals
- Linear gradient install below will give us exact match to wireframe
- https://www.npmjs.com/package/react-native-linear-gradient | 1.0 | Create ModalTemplate component - - Create modal template to create the same style for all the modals
- Linear gradient install below will give us exact match to wireframe
- https://www.npmjs.com/package/react-native-linear-gradient | priority | create modaltemplate component create modal template to create the same style for all the modals linear gradient install below will give us exact match to wireframe | 1 |
274,759 | 23,863,768,735 | IssuesEvent | 2022-09-07 09:16:53 | input-output-hk/cardano-ledger | https://api.github.com/repos/input-output-hk/cardano-ledger | closed | Arbitrary instances with alternate, valid, serializations. | :detective: testing | The ledger is very careful to never re-serialize any data structures that will be hashed. This is important since there are multiple valid ways to encode many data structures in CBOR. Developers who use reuse some of the ledger code, however, are not always as aware of how important this is. In particular, sometimes projects will mix and match the ledger code and other third party serialization libraries, leading to confusion about why hashes do not match. See #2943 as an example.
[Section 3.9 of the CBOR RFC](https://datatracker.ietf.org/doc/html/rfc7049#section-3.9) describes the various choices allowed in CBOR (in the context of describing which choice to make if you want to be canonical).
The ledger itself, however, has to make specific choices about how to serialize, even though the deserializers are flexible.
In order to make it more transparent that some of the ledger serialization is arbitrary (using definite vs indefinite lists, etc), we can write our `Arbitrary` generators such that they vary these choices.
The structure that seems to lead to the most confusion seems to be `Datum`. We could address `Datum`s directly, or perhaps write a general way of "twiddling" all of our CBOR encodings. | 1.0 | Arbitrary instances with alternate, valid, serializations. - The ledger is very careful to never re-serialize any data structures that will be hashed. This is important since there are multiple valid ways to encode many data structures in CBOR. Developers who use reuse some of the ledger code, however, are not always as aware of how important this is. In particular, sometimes projects will mix and match the ledger code and other third party serialization libraries, leading to confusion about why hashes do not match. See #2943 as an example.
[Section 3.9 of the CBOR RFC](https://datatracker.ietf.org/doc/html/rfc7049#section-3.9) describes the various choices allowed in CBOR (in the context of describing which choice to make if you want to be canonical).
The ledger itself, however, has to make specific choices about how to serialize, even though the deserializers are flexible.
In order to make it more transparent that some of the ledger serialization is arbitrary (using definite vs indefinite lists, etc), we can write our `Arbitrary` generators such that they vary these choices.
The structure that seems to lead to the most confusion seems to be `Datum`. We could address `Datum`s directly, or perhaps write a general way of "twiddling" all of our CBOR encodings. | non_priority | arbitrary instances with alternate valid serializations the ledger is very careful to never re serialize any data structures that will be hashed this is important since there are multiple valid ways to encode many data structures in cbor developers who use reuse some of the ledger code however are not always as aware of how important this is in particular sometimes projects will mix and match the ledger code and other third party serialization libraries leading to confusion about why hashes do not match see as an example describes the various choices allowed in cbor in the context of describing which choice to make if you want to be canonical the ledger itself however has to make specific choices about how to serialize even though the deserializers are flexible in order to make it more transparent that some of the ledger serialization is arbitrary using definite vs indefinite lists etc we can write our arbitrary generators such that they vary these choices the structure that seems to lead to the most confusion seems to be datum we could address datum s directly or perhaps write a general way of twiddling all of our cbor encodings | 0 |
668,532 | 22,588,577,188 | IssuesEvent | 2022-06-28 17:27:45 | Soldann/MORB_SLAM | https://api.github.com/repos/Soldann/MORB_SLAM | opened | sort() in DistributeOctTree resulting in unpredictable behavior | detective work low priority | ## Description:
See https://github.com/UZ-SLAMLab/ORB_SLAM3/issues/355. Effectively, the sorting uses the address of a pointer, which makes the entire thing not reproducible. Need to see if this is even necessary in the first place.
| 1.0 | sort() in DistributeOctTree resulting in unpredictable behavior - ## Description:
See https://github.com/UZ-SLAMLab/ORB_SLAM3/issues/355. Effectively, the sorting uses the address of a pointer, which makes the entire thing not reproducible. Need to see if this is even necessary in the first place.
| priority | sort in distributeocttree resulting in unpredictable behavior description see effectively the sorting uses the address of a pointer which makes the entire thing not reproducible need to see if this is even necessary in the first place | 1 |
55,036 | 3,071,846,365 | IssuesEvent | 2015-08-19 14:17:59 | RobotiumTech/robotium | https://api.github.com/repos/RobotiumTech/robotium | closed | solo.searchButton(String text, boolean onlyVisible) is not working properly. | bug imported Priority-Medium wontfix | _From [anandpai...@gmail.com](https://code.google.com/u/116639303515044083042/) on April 07, 2011 22:33:16_
What steps will reproduce the problem? 1.Launch the contacts.
2.From menu-> manage contacts-> select an account which has no contacts
3.call the solo.searchButton(String text, boolean onlyVisible) api. What is the expected output? What do you see instead? Actual:
======
Returns true even though the button is not present.
Expected:
========
Should return false when button is not available. What version of the product are you using? On what operating system? Android2.3 and robotium 2.2 Please provide any additional information below.
_Original issue: http://code.google.com/p/robotium/issues/detail?id=99_ | 1.0 | solo.searchButton(String text, boolean onlyVisible) is not working properly. - _From [anandpai...@gmail.com](https://code.google.com/u/116639303515044083042/) on April 07, 2011 22:33:16_
What steps will reproduce the problem? 1.Launch the contacts.
2.From menu-> manage contacts-> select an account which has no contacts
3.call the solo.searchButton(String text, boolean onlyVisible) api. What is the expected output? What do you see instead? Actual:
======
Returns true even though the button is not present.
Expected:
========
Should return false when button is not available. What version of the product are you using? On what operating system? Android2.3 and robotium 2.2 Please provide any additional information below.
_Original issue: http://code.google.com/p/robotium/issues/detail?id=99_ | priority | solo searchbutton string text boolean onlyvisible is not working properly from on april what steps will reproduce the problem launch the contacts from menu manage contacts select an account which has no contacts call the solo searchbutton string text boolean onlyvisible api what is the expected output what do you see instead actual returns true even though the button is not present expected should return false when button is not available what version of the product are you using on what operating system and robotium please provide any additional information below original issue | 1 |
28,589 | 8,181,719,910 | IssuesEvent | 2018-08-29 00:40:48 | Iridescent-CM/technovation-app | https://api.github.com/repos/Iridescent-CM/technovation-app | closed | Color code the student dashboard available action flags | 1 - Icebox [sprint topic] registration [sprint topic] team building added during sprint | In the center column of the student dashboard, different boxes are flagged with registration, team formation, submission, etc. Those flags could be color coded for a little more visual clarity.
<!---
@huboard:{"order":4.814118893190999e-31,"milestone_order":8.127865495761838e-45,"custom_state":""}
-->
| 1.0 | Color code the student dashboard available action flags - In the center column of the student dashboard, different boxes are flagged with registration, team formation, submission, etc. Those flags could be color coded for a little more visual clarity.
<!---
@huboard:{"order":4.814118893190999e-31,"milestone_order":8.127865495761838e-45,"custom_state":""}
-->
| non_priority | color code the student dashboard available action flags in the center column of the student dashboard different boxes are flagged with registration team formation submission etc those flags could be color coded for a little more visual clarity huboard order milestone order custom state | 0 |
200,607 | 7,009,539,985 | IssuesEvent | 2017-12-19 19:32:17 | minio/minio | https://api.github.com/repos/minio/minio | closed | Need a way to specify logging on command line | priority: low | For rc scripts, we need a way to specify logging config on command line.
## Expected Behavior
Would be nice if I could specify logging config on command line, so that rc scripts can rely on that instead of redirecting stdout/stderr with default config.
## Current Behavior
Right now, when you start minio without config, it creates a default config file which logs to stdout/stderr. For the rc script, this means that in order to avoid output showing up after the process is daemonized, I have to redirect stdout/stderr somewhere. Currently this goes to /dev/null, but this can cause issues for users, so I'm looking at changing it to redirect them to a log file. See:
https://bugs.freebsd.org/bugzilla/show_bug.cgi?id=218957
for background. This redirect does however run the risk that the user would edit the log file and setup logging to the same file, causing double logging.
## Possible Solution
It would be ideal if the script could specify a log file on command line and have minio log to that. Or even better, specify a log file and possibly other settings and have minio write the default config with those settings and then exit.
(While I'm asking for unicorns, would also be nice if minio had a flag to daemonize itself.)
One possible solution was to include a default config file, but that would have to include credentials, unless minio was changed to generate credentials and add them if they were missing.
## Steps to Reproduce (for bugs)
See above
## Context
See above
## Your Environment
I'm using 2017-04-29T00:40:27Z on FreeBSD
| 1.0 | Need a way to specify logging on command line - For rc scripts, we need a way to specify logging config on command line.
## Expected Behavior
Would be nice if I could specify logging config on command line, so that rc scripts can rely on that instead of redirecting stdout/stderr with default config.
## Current Behavior
Right now, when you start minio without config, it creates a default config file which logs to stdout/stderr. For the rc script, this means that in order to avoid output showing up after the process is daemonized, I have to redirect stdout/stderr somewhere. Currently this goes to /dev/null, but this can cause issues for users, so I'm looking at changing it to redirect them to a log file. See:
https://bugs.freebsd.org/bugzilla/show_bug.cgi?id=218957
for background. This redirect does however run the risk that the user would edit the log file and setup logging to the same file, causing double logging.
## Possible Solution
It would be ideal if the script could specify a log file on command line and have minio log to that. Or even better, specify a log file and possibly other settings and have minio write the default config with those settings and then exit.
(While I'm asking for unicorns, would also be nice if minio had a flag to daemonize itself.)
One possible solution was to include a default config file, but that would have to include credentials, unless minio was changed to generate credentials and add them if they were missing.
## Steps to Reproduce (for bugs)
See above
## Context
See above
## Your Environment
I'm using 2017-04-29T00:40:27Z on FreeBSD
| priority | need a way to specify logging on command line for rc scripts we need a way to specify logging config on command line expected behavior would be nice if i could specify logging config on command line so that rc scripts can rely on that instead of redirecting stdout stderr with default config current behavior right now when you start minio without config it creates a default config file which logs to stdout stderr for the rc script this means that in order to avoid output showing up after the process is daemonized i have to redirect stdout stderr somewhere currently this goes to dev null but this can cause issues for users so i m looking at changing it to redirect them to a log file see for background this redirect does however run the risk that the user would edit the log file and setup logging to the same file causing double logging possible solution it would be ideal if the script could specify a log file on command line and have minio log to that or even better specify a log file and possibly other settings and have minio write the default config with those settings and then exit while i m asking for unicorns would also be nice if minio had a flag to daemonize itself one possible solution was to include a default config file but that would have to include credentials unless minio was changed to generate credentials and add them if they were missing steps to reproduce for bugs see above context see above your environment i m using on freebsd | 1 |
806,355 | 29,812,955,116 | IssuesEvent | 2023-06-16 16:30:29 | Auerbach-Lab/Behavior-autoanalysis | https://api.github.com/repos/Auerbach-Lab/Behavior-autoanalysis | opened | Uneven odds name change | enhancement high priority | We are going to have multiple uneven odds files. To specify them, we are going to have the most frequent position included in the name. The total probabilities are already there in summary as odds.odds and odds.position.
Thus, main Oddball_Filename will need to be modified. Old files will be left as is and this change will only affect things moving forward. | 1.0 | Uneven odds name change - We are going to have multiple uneven odds files. To specify them, we are going to have the most frequent position included in the name. The total probabilities are already there in summary as odds.odds and odds.position.
Thus, main Oddball_Filename will need to be modified. Old files will be left as is and this change will only affect things moving forward. | priority | uneven odds name change we are going to have multiple uneven odds files to specify them we are going to have the most frequent position included in the name the total probabilities are already there in summary as odds odds and odds position thus main oddball filename will need to be modified old files will be left as is and this change will only affect things moving forward | 1 |
275,255 | 8,575,523,596 | IssuesEvent | 2018-11-12 17:30:40 | aowen87/TicketTester | https://api.github.com/repos/aowen87/TicketTester | closed | segv in Silo reader with specific data. | Bug Likelihood: 3 - Occasional Priority: Normal Severity: 4 - Crash / Wrong Results | Gave the reproducing data to Mark.
2.7.x VisIt does not have the error.
Crash is in avtSiloFileFormat::GetUnstructuredMesh
At this point:
if (rv->GetNumberOfPoints() > um-nnodes)
rv is NULL, so the dereference causes the segv.
-----------------------REDMINE MIGRATION-----------------------
This ticket was migrated from Redmine. As such, not all
information was able to be captured in the transition. Below is
a complete record of the original redmine ticket.
Ticket number: 2111
Status: Resolved
Project: VisIt
Tracker: Bug
Priority: Normal
Subject: segv in Silo reader with specific data.
Assigned to: Mark Miller
Category:
Target version: 2.9
Author: Kathleen Biagas
Start: 01/09/2015
Due date:
% Done: 90
Estimated time:
Created: 01/09/2015 01:58 pm
Updated: 02/11/2015 09:50 pm
Likelihood: 3 - Occasional
Severity: 4 - Crash / Wrong Results
Found in version: 2.8.0
Impact:
Expected Use:
OS: All
Support Group: Any
Description:
Gave the reproducing data to Mark.
2.7.x VisIt does not have the error.
Crash is in avtSiloFileFormat::GetUnstructuredMesh
At this point:
if (rv->GetNumberOfPoints() > um-nnodes)
rv is NULL, so the dereference causes the segv.
Comments:
I have this fixed in a 2.8RC. I just need to put changes on 2.9 and merge them to trunk.
| 1.0 | segv in Silo reader with specific data. - Gave the reproducing data to Mark.
2.7.x VisIt does not have the error.
Crash is in avtSiloFileFormat::GetUnstructuredMesh
At this point:
if (rv->GetNumberOfPoints() > um-nnodes)
rv is NULL, so the dereference causes the segv.
-----------------------REDMINE MIGRATION-----------------------
This ticket was migrated from Redmine. As such, not all
information was able to be captured in the transition. Below is
a complete record of the original redmine ticket.
Ticket number: 2111
Status: Resolved
Project: VisIt
Tracker: Bug
Priority: Normal
Subject: segv in Silo reader with specific data.
Assigned to: Mark Miller
Category:
Target version: 2.9
Author: Kathleen Biagas
Start: 01/09/2015
Due date:
% Done: 90
Estimated time:
Created: 01/09/2015 01:58 pm
Updated: 02/11/2015 09:50 pm
Likelihood: 3 - Occasional
Severity: 4 - Crash / Wrong Results
Found in version: 2.8.0
Impact:
Expected Use:
OS: All
Support Group: Any
Description:
Gave the reproducing data to Mark.
2.7.x VisIt does not have the error.
Crash is in avtSiloFileFormat::GetUnstructuredMesh
At this point:
if (rv->GetNumberOfPoints() > um-nnodes)
rv is NULL, so the dereference causes the segv.
Comments:
I have this fixed in a 2.8RC. I just need to put changes on 2.9 and merge them to trunk.
| priority | segv in silo reader with specific data gave the reproducing data to mark x visit does not have the error crash is in avtsilofileformat getunstructuredmesh at this point if rv getnumberofpoints um nnodes rv is null so the dereference causes the segv redmine migration this ticket was migrated from redmine as such not all information was able to be captured in the transition below is a complete record of the original redmine ticket ticket number status resolved project visit tracker bug priority normal subject segv in silo reader with specific data assigned to mark miller category target version author kathleen biagas start due date done estimated time created pm updated pm likelihood occasional severity crash wrong results found in version impact expected use os all support group any description gave the reproducing data to mark x visit does not have the error crash is in avtsilofileformat getunstructuredmesh at this point if rv getnumberofpoints um nnodes rv is null so the dereference causes the segv comments i have this fixed in a i just need to put changes on and merge them to trunk | 1 |
318,554 | 9,694,162,942 | IssuesEvent | 2019-05-24 18:08:44 | DrylandEcology/STEPWAT2 | https://api.github.com/repos/DrylandEcology/STEPWAT2 | closed | Several missing functions within the gridded code flow in ST_grid.c | highpriority invalid | Conceptually, the core code (and its flow) of the gridded version of STEPWAT2 should be identical to the non-gridded verision. This is not the case in master branch. Several important functions have been added to the non-gridded code in ST_main.c, but were not added to the gridded code within ST_grid.c. These include:
`save_annual_species_relsize()`
`mort_EndOfYear()` *although this may be partially implemented by `do_grid_grazing_EndOfYear() `and `_do_grid_disturbances`, although I do not think all of the functionality within mort_EndofYear is being implemented there.
These functions need to be added to ST_grid.c and carefully tested. Furthemore, the code flow of the non-gridded and gridded versions need to be carefully compared to ensure that no additional functionality is missing from the gridded version. | 1.0 | Several missing functions within the gridded code flow in ST_grid.c - Conceptually, the core code (and its flow) of the gridded version of STEPWAT2 should be identical to the non-gridded verision. This is not the case in master branch. Several important functions have been added to the non-gridded code in ST_main.c, but were not added to the gridded code within ST_grid.c. These include:
`save_annual_species_relsize()`
`mort_EndOfYear()` *although this may be partially implemented by `do_grid_grazing_EndOfYear() `and `_do_grid_disturbances`, although I do not think all of the functionality within mort_EndofYear is being implemented there.
These functions need to be added to ST_grid.c and carefully tested. Furthemore, the code flow of the non-gridded and gridded versions need to be carefully compared to ensure that no additional functionality is missing from the gridded version. | priority | several missing functions within the gridded code flow in st grid c conceptually the core code and its flow of the gridded version of should be identical to the non gridded verision this is not the case in master branch several important functions have been added to the non gridded code in st main c but were not added to the gridded code within st grid c these include save annual species relsize mort endofyear although this may be partially implemented by do grid grazing endofyear and do grid disturbances although i do not think all of the functionality within mort endofyear is being implemented there these functions need to be added to st grid c and carefully tested furthemore the code flow of the non gridded and gridded versions need to be carefully compared to ensure that no additional functionality is missing from the gridded version | 1 |
215,603 | 7,295,776,220 | IssuesEvent | 2018-02-26 08:28:39 | webcompat/web-bugs | https://api.github.com/repos/webcompat/web-bugs | closed | trello.com - see bug description | browser-firefox priority-important status-needsinfo | <!-- @browser: Firefox 58.0 -->
<!-- @ua_header: Mozilla/5.0 (X11; Linux x86_64; rv:58.0) Gecko/20100101 Firefox/58.0 -->
<!-- @reported_with: web -->
**URL**: https://trello.com
**Browser / Version**: Firefox 58.0
**Operating System**: Linux
**Tested Another Browser**: Yes
**Problem type**: Something else
**Description**: Fill in of credentials doesn't work enter
**Steps to Reproduce**:
1. Create account at trello
2. Login with your credentials the first time
3. Logout
4. Login again: when you give in the Email you can choose between the suggestion with arrow keys. After hitting enter you end up in the password field and your choice wasn't entered in the Email field.
This works as intended (hitting enter fills the Email field) in Chromium 64, Linux.
_From [webcompat.com](https://webcompat.com/) with ❤️_ | 1.0 | trello.com - see bug description - <!-- @browser: Firefox 58.0 -->
<!-- @ua_header: Mozilla/5.0 (X11; Linux x86_64; rv:58.0) Gecko/20100101 Firefox/58.0 -->
<!-- @reported_with: web -->
**URL**: https://trello.com
**Browser / Version**: Firefox 58.0
**Operating System**: Linux
**Tested Another Browser**: Yes
**Problem type**: Something else
**Description**: Fill in of credentials doesn't work enter
**Steps to Reproduce**:
1. Create account at trello
2. Login with your credentials the first time
3. Logout
4. Login again: when you give in the Email you can choose between the suggestion with arrow keys. After hitting enter you end up in the password field and your choice wasn't entered in the Email field.
This works as intended (hitting enter fills the Email field) in Chromium 64, Linux.
_From [webcompat.com](https://webcompat.com/) with ❤️_ | priority | trello com see bug description url browser version firefox operating system linux tested another browser yes problem type something else description fill in of credentials doesn t work enter steps to reproduce create account at trello login with your credentials the first time logout login again when you give in the email you can choose between the suggestion with arrow keys after hitting enter you end up in the password field and your choice wasn t entered in the email field this works as intended hitting enter fills the email field in chromium linux from with ❤️ | 1 |
477,959 | 13,770,784,740 | IssuesEvent | 2020-10-07 20:48:50 | aces/cbrain | https://api.github.com/repos/aces/cbrain | closed | The persistent file selection feature is broken in incognito mode, and in Chrome | Bug Priority: High User Interface | It seems the persistent selection mechanism is broken and doesn't work at all
1) in incognito/private mode
2) in Chrome in general
Probably JS API changes? | 1.0 | The persistent file selection feature is broken in incognito mode, and in Chrome - It seems the persistent selection mechanism is broken and doesn't work at all
1) in incognito/private mode
2) in Chrome in general
Probably JS API changes? | priority | the persistent file selection feature is broken in incognito mode and in chrome it seems the persistent selection mechanism is broken and doesn t work at all in incognito private mode in chrome in general probably js api changes | 1 |
730,158 | 25,162,428,822 | IssuesEvent | 2022-11-10 17:49:47 | CDCgov/prime-reportstream | https://api.github.com/repos/CDCgov/prime-reportstream | closed | HHS Protect Data Issue - Blanks for MSH-3.1 and MSH-3.2 | onboarding-ops support Medium Priority Needs refinement | ## Problem statement
NIH user Krishna, found some data quality issues in HHS Protect from ReportStream Data.
For all test results coming from Intrivo, the MSH-3 segments are being left blank:
MSH-3.1 (Sending system namespace)
MSH-3.2 (Sending system OID)
The MARS specifications requires that these be populated.
## What you need to know
I reviewed 1 Intrivo HL7 file dated 10/6/2022 and it looks like there's data in those fields.
MSH
^~\&
Intrivo^2.16.840.1.113434.6.2.2.1.1.2^ISO
Intrivo^2.16.840.1.113434.6.2.10411^CLIA
CDC PRIME^2.16.840.1.114222.4.1.237821^ISO
CDC PRIME^2.16.840.1.114222.4.1.237821^ISO
20221006165232+0000
ORU^R01^ORU_R01
`b8c4a9ff-53fe-4746-8602-03092cc3dbbf`
P
2.5.1
NE
NE
USA
UNICODE UTF-8
PHLabReport-NoAck^ELR251R1_Rcvr_Prof^2.16.840.1.113883.9.11^ISO
## Acceptance criteria
- Confirm whether the MSH-3.1 and MSH-3.2 fields are blank on ReportStream side.
-Figure out a way to send that over to HHS Protect with no blanks
## To do
- [ ] ...
| 1.0 | HHS Protect Data Issue - Blanks for MSH-3.1 and MSH-3.2 - ## Problem statement
NIH user Krishna, found some data quality issues in HHS Protect from ReportStream Data.
For all test results coming from Intrivo, the MSH-3 segments are being left blank:
MSH-3.1 (Sending system namespace)
MSH-3.2 (Sending system OID)
The MARS specifications requires that these be populated.
## What you need to know
I reviewed 1 Intrivo HL7 file dated 10/6/2022 and it looks like there's data in those fields.
MSH
^~\&
Intrivo^2.16.840.1.113434.6.2.2.1.1.2^ISO
Intrivo^2.16.840.1.113434.6.2.10411^CLIA
CDC PRIME^2.16.840.1.114222.4.1.237821^ISO
CDC PRIME^2.16.840.1.114222.4.1.237821^ISO
20221006165232+0000
ORU^R01^ORU_R01
`b8c4a9ff-53fe-4746-8602-03092cc3dbbf`
P
2.5.1
NE
NE
USA
UNICODE UTF-8
PHLabReport-NoAck^ELR251R1_Rcvr_Prof^2.16.840.1.113883.9.11^ISO
## Acceptance criteria
- Confirm whether the MSH-3.1 and MSH-3.2 fields are blank on ReportStream side.
-Figure out a way to send that over to HHS Protect with no blanks
## To do
- [ ] ...
| priority | hhs protect data issue blanks for msh and msh problem statement nih user krishna found some data quality issues in hhs protect from reportstream data for all test results coming from intrivo the msh segments are being left blank msh sending system namespace msh sending system oid the mars specifications requires that these be populated what you need to know i reviewed intrivo file dated and it looks like there s data in those fields msh intrivo iso intrivo clia cdc prime iso cdc prime iso oru oru p ne ne usa unicode utf phlabreport noack rcvr prof iso acceptance criteria confirm whether the msh and msh fields are blank on reportstream side figure out a way to send that over to hhs protect with no blanks to do | 1 |
481,730 | 13,890,726,189 | IssuesEvent | 2020-10-19 09:39:58 | AY2021S1-CS2103T-W16-4/tp | https://api.github.com/repos/AY2021S1-CS2103T-W16-4/tp | closed | Add key binding to switch tabs | priority.High type.Story | As a tutor I would want to have keyboard shortcuts to switch between tabs to update the class details more efficiently. | 1.0 | Add key binding to switch tabs - As a tutor I would want to have keyboard shortcuts to switch between tabs to update the class details more efficiently. | priority | add key binding to switch tabs as a tutor i would want to have keyboard shortcuts to switch between tabs to update the class details more efficiently | 1 |
464,688 | 13,338,000,268 | IssuesEvent | 2020-08-28 10:12:54 | kubernetes-sigs/cluster-api-provider-aws | https://api.github.com/repos/kubernetes-sigs/cluster-api-provider-aws | closed | EKS Control Plane Implementation | area/provider/eks kind/feature lifecycle/active priority/important-soon | /kind feature
**Describe the solution you'd like**
Implement a new EKS control plane to help with the EKS implementation (#1534). This will handle the provisioning and management of a AWS EKS Cluster. Nodegroup support will be added via other issues.
It needs to support the following:
- EKS Cluster Creation
- EKS Cluster update
- EKS version update
**Anything else you would like to add:**
The parent tracking issue for full EKS support is #1534
### Tasks
- [x] IAM Roles Creation
- [x] IAM Roles Update (including trust profiles)
- [x] IAM Roles Deletion
- [x] EKS Cluster Creation
- [x] EKS Cluster Update (for example enabling logging)
- [x] EKS Cluster version update (this may be handled by the item above)
- [x] Security groups need investigating and scope updating
- [x] EKS Cluster Deletion
- [x] AWSManagedCluster Support
- [x] Kubeconfig creation
- [ ] Unit tests
- [ ] Start implementation of e2e tests
- [x] Tags only update to AWSManagedControlPlane (will use change from issue #1843) | 1.0 | EKS Control Plane Implementation - /kind feature
**Describe the solution you'd like**
Implement a new EKS control plane to help with the EKS implementation (#1534). This will handle the provisioning and management of a AWS EKS Cluster. Nodegroup support will be added via other issues.
It needs to support the following:
- EKS Cluster Creation
- EKS Cluster update
- EKS version update
**Anything else you would like to add:**
The parent tracking issue for full EKS support is #1534
### Tasks
- [x] IAM Roles Creation
- [x] IAM Roles Update (including trust profiles)
- [x] IAM Roles Deletion
- [x] EKS Cluster Creation
- [x] EKS Cluster Update (for example enabling logging)
- [x] EKS Cluster version update (this may be handled by the item above)
- [x] Security groups need investigating and scope updating
- [x] EKS Cluster Deletion
- [x] AWSManagedCluster Support
- [x] Kubeconfig creation
- [ ] Unit tests
- [ ] Start implementation of e2e tests
- [x] Tags only update to AWSManagedControlPlane (will use change from issue #1843) | priority | eks control plane implementation kind feature describe the solution you d like implement a new eks control plane to help with the eks implementation this will handle the provisioning and management of a aws eks cluster nodegroup support will be added via other issues it needs to support the following eks cluster creation eks cluster update eks version update anything else you would like to add the parent tracking issue for full eks support is tasks iam roles creation iam roles update including trust profiles iam roles deletion eks cluster creation eks cluster update for example enabling logging eks cluster version update this may be handled by the item above security groups need investigating and scope updating eks cluster deletion awsmanagedcluster support kubeconfig creation unit tests start implementation of tests tags only update to awsmanagedcontrolplane will use change from issue | 1 |
84,131 | 16,455,457,022 | IssuesEvent | 2021-05-21 11:56:36 | kreghek/Zilon_Roguelike | https://api.github.com/repos/kreghek/Zilon_Roguelike | closed | Rename IPersonEffect to IPersonCondition | code improvement core good first issue | It is more representable and reduce confusion. Monogame has effects as shader wrapper.
Types to rename:
- `IPersonEffect` to `IPersonCondition`.
- `IEffectsModule` to `IConditionModule`.
- some else
This changes must be done in the `master` branch. | 1.0 | Rename IPersonEffect to IPersonCondition - It is more representable and reduce confusion. Monogame has effects as shader wrapper.
Types to rename:
- `IPersonEffect` to `IPersonCondition`.
- `IEffectsModule` to `IConditionModule`.
- some else
This changes must be done in the `master` branch. | non_priority | rename ipersoneffect to ipersoncondition it is more representable and reduce confusion monogame has effects as shader wrapper types to rename ipersoneffect to ipersoncondition ieffectsmodule to iconditionmodule some else this changes must be done in the master branch | 0 |
220,414 | 7,359,811,979 | IssuesEvent | 2018-03-10 11:40:14 | Cloud-CV/EvalAI | https://api.github.com/repos/Cloud-CV/EvalAI | opened | UI Improvements in Leaderboard Entry | GSOC enhancement frontend medium-difficulty new-feature priority-high | - [ ] Show the meta data fields (**Team Members** and **Method Description**) in each leaderboard entry.
Hint: Please refer the screenshot.

- [ ] The user should be able to edit the **Method Description** field if the entry is created by the same user.
| 1.0 | UI Improvements in Leaderboard Entry - - [ ] Show the meta data fields (**Team Members** and **Method Description**) in each leaderboard entry.
Hint: Please refer the screenshot.

- [ ] The user should be able to edit the **Method Description** field if the entry is created by the same user.
| priority | ui improvements in leaderboard entry show the meta data fields team members and method description in each leaderboard entry hint please refer the screenshot the user should be able to edit the method description field if the entry is created by the same user | 1 |
45,767 | 7,200,172,138 | IssuesEvent | 2018-02-05 18:09:49 | CORE-GATECH-GROUP/serpent-tools | https://api.github.com/repos/CORE-GATECH-GROUP/serpent-tools | closed | [Doc] Better Detector example | documentation priority:low | The current detector file is pretty small and doesn't show a lot of the power, and the plots are bad. Let's add a larger detector, with a lot of dimensions, and show off the slicing power!
## Requests
- Finer spatial mesh
- Fine to super fine [>100] energy groups
- Multiple reactions tallied | 1.0 | [Doc] Better Detector example - The current detector file is pretty small and doesn't show a lot of the power, and the plots are bad. Let's add a larger detector, with a lot of dimensions, and show off the slicing power!
## Requests
- Finer spatial mesh
- Fine to super fine [>100] energy groups
- Multiple reactions tallied | non_priority | better detector example the current detector file is pretty small and doesn t show a lot of the power and the plots are bad let s add a larger detector with a lot of dimensions and show off the slicing power requests finer spatial mesh fine to super fine energy groups multiple reactions tallied | 0 |
351,643 | 10,521,697,610 | IssuesEvent | 2019-09-30 06:53:07 | AY1920S1-CS2103T-T09-2/main | https://api.github.com/repos/AY1920S1-CS2103T-T09-2/main | opened | As a student who is impatient i want to have simple commands | priority.Medium type.Story | so that i can input new entries quickly | 1.0 | As a student who is impatient i want to have simple commands - so that i can input new entries quickly | priority | as a student who is impatient i want to have simple commands so that i can input new entries quickly | 1 |
773,468 | 27,158,860,877 | IssuesEvent | 2023-02-17 10:10:29 | leancodepl/corelibrary | https://api.github.com/repos/leancodepl/corelibrary | closed | Make `DateOnly` and `TimeOnly` JSON convertes lax by default | priority: high | After robustness principle. Plus, we are now not compatible with our contractsgenerator. | 1.0 | Make `DateOnly` and `TimeOnly` JSON convertes lax by default - After robustness principle. Plus, we are now not compatible with our contractsgenerator. | priority | make dateonly and timeonly json convertes lax by default after robustness principle plus we are now not compatible with our contractsgenerator | 1 |
66,689 | 16,676,928,828 | IssuesEvent | 2021-06-07 17:23:16 | cockroachdb/cockroach | https://api.github.com/repos/cockroachdb/cockroach | closed | build: post issues from failures in the nightly sql logic test runs | A-build-system C-enhancement no-issue-activity | We should be posting issues whenever the nightly sql logic test runs fail. A recent failure was ignored for a week. This could either be done by having `build/teamcity-sqllogictest.sh` use `github-post` (similar to what `build/teamcity-stress.sh` does), or have use `build/teamcity-post-failures.py` in the same manner as merge-to-master PRs. | 1.0 | build: post issues from failures in the nightly sql logic test runs - We should be posting issues whenever the nightly sql logic test runs fail. A recent failure was ignored for a week. This could either be done by having `build/teamcity-sqllogictest.sh` use `github-post` (similar to what `build/teamcity-stress.sh` does), or have use `build/teamcity-post-failures.py` in the same manner as merge-to-master PRs. | non_priority | build post issues from failures in the nightly sql logic test runs we should be posting issues whenever the nightly sql logic test runs fail a recent failure was ignored for a week this could either be done by having build teamcity sqllogictest sh use github post similar to what build teamcity stress sh does or have use build teamcity post failures py in the same manner as merge to master prs | 0 |
75,461 | 15,415,476,122 | IssuesEvent | 2021-03-05 02:41:53 | ZcashFoundation/zebra | https://api.github.com/repos/ZcashFoundation/zebra | opened | Zebra should eventually stop trying to contact peers that always fail | A-rust C-bug C-security I-heavy I-slow I-unbounded-growth NU-5-TBC P-High S-needs-triage | **Is your feature request related to a problem? Please describe.**
Zebra will keep trying individual `Failed` peers, even if they have never succeeded. This is a distributed denial of service risk, and it places extra load on the network.
**Describe the solution you'd like**
Zebra should stop trying to contact peers that haven't had a successful connection for 4 months.
Zebra should track the following times for each peer:
- [ ] `untrusted_last_seen` remote time gossiped by the peer that told us about this address
- [ ] `address_book_time` local time when we added this peer to our address book through a gossip or inbound connection
- [ ] `last_success_time` local time when we last saw a message from this peer
- [ ] `last_failed_time` local time when we last failed connecting to this peer
Zebra should delete peers where the:
- [ ] `last_success_time` is older than 4 months
- [ ] `last_success_time` is `None`, and the `address_book_time` is older than 4 months
To avoid sending old peers from other nodes, Zebra should:
- [ ] stop gossiping peers that are older than 1 week
- this time period is a network health / network view leakage design tradeoff
- [x] avoid updating timestamps based on new gossips from other peers
To avoid accepting old peers from other nodes, Zebra should:
- [ ] limit the number of peers it accepts in response to each peer request, using the newest ones first (this is a follow-up ticket)
The reconnection rate limit should be refactored to be based on:
- [ ] `last_success_time`
- [ ] `last_failed_time`
- [ ] skip peers in the `AttemptPending` state
For testing:
- [ ] add a `debug_peer_deletion_age` config
- [ ] add an acceptance test that sets it to `10` seconds
- [ ] add a log when all the peers are deleted, and check for that log - "hint: upgrade or restart Zebra"
**Describe alternatives you've considered**
This is a critical security issue, so we must do something.
We could keep a failure count for each peer. This design has usability issues on unreliable networks, because all the peers can fail at the same time. (Our reconnection rate limit and peer deletion timeout already limit us to ~80,000 failed connections per peer over 4 months.)
**Additional context**
`zcashd` does not have this issue.
As a follow-up, we should review this design, and make sure we're minimising the network view metadata leaks in Zebra. | True | Zebra should eventually stop trying to contact peers that always fail - **Is your feature request related to a problem? Please describe.**
Zebra will keep trying individual `Failed` peers, even if they have never succeeded. This is a distributed denial of service risk, and it places extra load on the network.
**Describe the solution you'd like**
Zebra should stop trying to contact peers that haven't had a successful connection for 4 months.
Zebra should track the following times for each peer:
- [ ] `untrusted_last_seen` remote time gossiped by the peer that told us about this address
- [ ] `address_book_time` local time when we added this peer to our address book through a gossip or inbound connection
- [ ] `last_success_time` local time when we last saw a message from this peer
- [ ] `last_failed_time` local time when we last failed connecting to this peer
Zebra should delete peers where the:
- [ ] `last_success_time` is older than 4 months
- [ ] `last_success_time` is `None`, and the `address_book_time` is older than 4 months
To avoid sending old peers from other nodes, Zebra should:
- [ ] stop gossiping peers that are older than 1 week
- this time period is a network health / network view leakage design tradeoff
- [x] avoid updating timestamps based on new gossips from other peers
To avoid accepting old peers from other nodes, Zebra should:
- [ ] limit the number of peers it accepts in response to each peer request, using the newest ones first (this is a follow-up ticket)
The reconnection rate limit should be refactored to be based on:
- [ ] `last_success_time`
- [ ] `last_failed_time`
- [ ] skip peers in the `AttemptPending` state
For testing:
- [ ] add a `debug_peer_deletion_age` config
- [ ] add an acceptance test that sets it to `10` seconds
- [ ] add a log when all the peers are deleted, and check for that log - "hint: upgrade or restart Zebra"
**Describe alternatives you've considered**
This is a critical security issue, so we must do something.
We could keep a failure count for each peer. This design has usability issues on unreliable networks, because all the peers can fail at the same time. (Our reconnection rate limit and peer deletion timeout already limit us to ~80,000 failed connections per peer over 4 months.)
**Additional context**
`zcashd` does not have this issue.
As a follow-up, we should review this design, and make sure we're minimising the network view metadata leaks in Zebra. | non_priority | zebra should eventually stop trying to contact peers that always fail is your feature request related to a problem please describe zebra will keep trying individual failed peers even if they have never succeeded this is a distributed denial of service risk and it places extra load on the network describe the solution you d like zebra should stop trying to contact peers that haven t had a successful connection for months zebra should track the following times for each peer untrusted last seen remote time gossiped by the peer that told us about this address address book time local time when we added this peer to our address book through a gossip or inbound connection last success time local time when we last saw a message from this peer last failed time local time when we last failed connecting to this peer zebra should delete peers where the last success time is older than months last success time is none and the address book time is older than months to avoid sending old peers from other nodes zebra should stop gossiping peers that are older than week this time period is a network health network view leakage design tradeoff avoid updating timestamps based on new gossips from other peers to avoid accepting old peers from other nodes zebra should limit the number of peers it accepts in response to each peer request using the newest ones first this is a follow up ticket the reconnection rate limit should be refactored to be based on last success time last failed time skip peers in the attemptpending state for testing add a debug peer deletion age config add an acceptance test that sets it to seconds add a log when all the peers are deleted and check for that log hint upgrade or restart zebra describe alternatives you ve considered this is a critical security issue so we must do something we could keep a failure count for each peer this design has usability issues on unreliable networks because all the peers can fail at the same time our reconnection rate limit and peer deletion timeout already limit us to failed connections per peer over months additional context zcashd does not have this issue as a follow up we should review this design and make sure we re minimising the network view metadata leaks in zebra | 0 |
766,202 | 26,874,279,599 | IssuesEvent | 2023-02-04 21:12:54 | amosproj/amos2022ws03-software-oscilloscope | https://api.github.com/repos/amosproj/amos2022ws03-software-oscilloscope | closed | Common Slider - Time sweep speed | user story real size 2 Priority High est. size 2 | ## User story
1. As a user
2. I want an option for time sweep
3. So that I can change the speed at which the plotting occurs for all channels together at the same time.
## Acceptance criteria
- [x] Control UI (slider) visible clearly.
- [x] Proper change in time sweep speed (time per division) when user changes.
- [x] Moving left slows down the sweep speed and moving right speeds up the sweep.
- [x] The change should be applicable to all the channels.
- [x] The time scale (horizontal) should change according to the settings and should be shown to user.
## Definition of done (DoD)
- [ ] Feature/Bug/Change has been implemented
- [ ] Application compiles successfully
- [ ] Code is documented
- [ ] Feature/Bug/Change is tested by at least one unit or e2e test
- [ ] Tests have been passed without warnings (except "deprecated" warnings)
- [ ] Changes have been reviewed
- [ ] PR has been merged to dev branch
- [ ] New dependencies have been added to bill of materials
- [ ] Software archticture diagram has been updated
- [ ] All acceptance criteria are fullfilled
- [ ] Screenshot is attached to issue
## DoD general criteria
* Feature has been fully implemented
* Feature has been merged into the mainline
* All acceptance criteria were met
* Product owner approved features
* All tests are passing
* Developers agreed to release
| 1.0 | Common Slider - Time sweep speed - ## User story
1. As a user
2. I want an option for time sweep
3. So that I can change the speed at which the plotting occurs for all channels together at the same time.
## Acceptance criteria
- [x] Control UI (slider) visible clearly.
- [x] Proper change in time sweep speed (time per division) when user changes.
- [x] Moving left slows down the sweep speed and moving right speeds up the sweep.
- [x] The change should be applicable to all the channels.
- [x] The time scale (horizontal) should change according to the settings and should be shown to user.
## Definition of done (DoD)
- [ ] Feature/Bug/Change has been implemented
- [ ] Application compiles successfully
- [ ] Code is documented
- [ ] Feature/Bug/Change is tested by at least one unit or e2e test
- [ ] Tests have been passed without warnings (except "deprecated" warnings)
- [ ] Changes have been reviewed
- [ ] PR has been merged to dev branch
- [ ] New dependencies have been added to bill of materials
- [ ] Software archticture diagram has been updated
- [ ] All acceptance criteria are fullfilled
- [ ] Screenshot is attached to issue
## DoD general criteria
* Feature has been fully implemented
* Feature has been merged into the mainline
* All acceptance criteria were met
* Product owner approved features
* All tests are passing
* Developers agreed to release
| priority | common slider time sweep speed user story as a user i want an option for time sweep so that i can change the speed at which the plotting occurs for all channels together at the same time acceptance criteria control ui slider visible clearly proper change in time sweep speed time per division when user changes moving left slows down the sweep speed and moving right speeds up the sweep the change should be applicable to all the channels the time scale horizontal should change according to the settings and should be shown to user definition of done dod feature bug change has been implemented application compiles successfully code is documented feature bug change is tested by at least one unit or test tests have been passed without warnings except deprecated warnings changes have been reviewed pr has been merged to dev branch new dependencies have been added to bill of materials software archticture diagram has been updated all acceptance criteria are fullfilled screenshot is attached to issue dod general criteria feature has been fully implemented feature has been merged into the mainline all acceptance criteria were met product owner approved features all tests are passing developers agreed to release | 1 |
288,515 | 21,708,500,947 | IssuesEvent | 2022-05-10 11:54:54 | icerockdev/moko-resources | https://api.github.com/repos/icerockdev/moko-resources | closed | Value of type 'ResourcesStringResource' has no member 'desc' | documentation | Hi there!
I'm trying to integrate the library in a KMM project and I'm facing some issues with the usage on the iOS app (integrated via "iOS framework distribution": "Regular framework").
Here's the error:
`Value of type 'ResourcesStringResource' has no member 'desc'`
<img width="867" alt="Screenshot 2022-05-07 at 03 06 34" src="https://user-images.githubusercontent.com/531755/167231883-6c197a10-91b9-40bb-89d6-547fb2c956f0.png">
I'm attaching the empty project generated by AS with the only addition of moko-resources that demonstrates the issue:
[ABC.zip](https://github.com/icerockdev/moko-resources/files/8644175/ABC.zip)
Are there any other steps needed?
If I also apply what's mentioned in https://github.com/icerockdev/moko-resources#static-kotlin-frameworks-support (which I believe it's necessary) then I get another error during that build phase:
`Task 'copyFrameworkResourcesToApp' not found in project ':shared'.`
Hence I suspect that the readme might be missing some crucial information.
Thanks in advance | 1.0 | Value of type 'ResourcesStringResource' has no member 'desc' - Hi there!
I'm trying to integrate the library in a KMM project and I'm facing some issues with the usage on the iOS app (integrated via "iOS framework distribution": "Regular framework").
Here's the error:
`Value of type 'ResourcesStringResource' has no member 'desc'`
<img width="867" alt="Screenshot 2022-05-07 at 03 06 34" src="https://user-images.githubusercontent.com/531755/167231883-6c197a10-91b9-40bb-89d6-547fb2c956f0.png">
I'm attaching the empty project generated by AS with the only addition of moko-resources that demonstrates the issue:
[ABC.zip](https://github.com/icerockdev/moko-resources/files/8644175/ABC.zip)
Are there any other steps needed?
If I also apply what's mentioned in https://github.com/icerockdev/moko-resources#static-kotlin-frameworks-support (which I believe it's necessary) then I get another error during that build phase:
`Task 'copyFrameworkResourcesToApp' not found in project ':shared'.`
Hence I suspect that the readme might be missing some crucial information.
Thanks in advance | non_priority | value of type resourcesstringresource has no member desc hi there i m trying to integrate the library in a kmm project and i m facing some issues with the usage on the ios app integrated via ios framework distribution regular framework here s the error value of type resourcesstringresource has no member desc img width alt screenshot at src i m attaching the empty project generated by as with the only addition of moko resources that demonstrates the issue are there any other steps needed if i also apply what s mentioned in which i believe it s necessary then i get another error during that build phase task copyframeworkresourcestoapp not found in project shared hence i suspect that the readme might be missing some crucial information thanks in advance | 0 |
97,316 | 8,652,215,420 | IssuesEvent | 2018-11-27 07:10:51 | ethersphere/go-ethereum | https://api.github.com/repos/ethersphere/go-ethereum | opened | Swarm nodes don't find each other | area:stability bug network testing | #18182
#### System information
Swarm
Version: 0.3.7-unstable
Go Version: go1.10.3
OS: darwin
#### Expected behaviour
Swarm nodes with the same network id find each other.
#### Actual behaviour
Sometimes nodes find each other. Sometimes they don't. In that case, sometimes they find each other in a few minutes. Sometimes they don't.
This is a behaviour that is challenging to replicate, even on my own machine.
#### Steps to reproduce the behaviour
To demonstrate the isue, I used the [swarm test network](https://github.com/janos/swarm-test-cluster) which builds a network in docker using terraform.
But I'm sure I've seen this issue come up (a) outside this setup (b) outside docker.
```
echo 'did it connect?' > diditconnect.txt
terraform apply -var 'swarm_count=2'
yes
sleep 30
docker exec -it swarm1 geth --exec 'admin.peers' attach /data/bzzd.ipc | wc -l >> diditconnect.txt
terraform destroy
yes
```
I repeated lines 3-8 a bunch of times (because terraform </3 loops). The resulting file `diditconnect.txt` looks sg like this: `1,3,1,1,23,22,1,1,1`
So no connection the 1st-4th time and so `admin.peers` returns `[]` (I have no idea what `3` is!). And then connection the 5th-6th time (so `admin.peers' returns node info on node 2) and then again no connection for 7th-9th. | 1.0 | Swarm nodes don't find each other - #18182
#### System information
Swarm
Version: 0.3.7-unstable
Go Version: go1.10.3
OS: darwin
#### Expected behaviour
Swarm nodes with the same network id find each other.
#### Actual behaviour
Sometimes nodes find each other. Sometimes they don't. In that case, sometimes they find each other in a few minutes. Sometimes they don't.
This is a behaviour that is challenging to replicate, even on my own machine.
#### Steps to reproduce the behaviour
To demonstrate the isue, I used the [swarm test network](https://github.com/janos/swarm-test-cluster) which builds a network in docker using terraform.
But I'm sure I've seen this issue come up (a) outside this setup (b) outside docker.
```
echo 'did it connect?' > diditconnect.txt
terraform apply -var 'swarm_count=2'
yes
sleep 30
docker exec -it swarm1 geth --exec 'admin.peers' attach /data/bzzd.ipc | wc -l >> diditconnect.txt
terraform destroy
yes
```
I repeated lines 3-8 a bunch of times (because terraform </3 loops). The resulting file `diditconnect.txt` looks sg like this: `1,3,1,1,23,22,1,1,1`
So no connection the 1st-4th time and so `admin.peers` returns `[]` (I have no idea what `3` is!). And then connection the 5th-6th time (so `admin.peers' returns node info on node 2) and then again no connection for 7th-9th. | non_priority | swarm nodes don t find each other system information swarm version unstable go version os darwin expected behaviour swarm nodes with the same network id find each other actual behaviour sometimes nodes find each other sometimes they don t in that case sometimes they find each other in a few minutes sometimes they don t this is a behaviour that is challenging to replicate even on my own machine steps to reproduce the behaviour to demonstrate the isue i used the which builds a network in docker using terraform but i m sure i ve seen this issue come up a outside this setup b outside docker echo did it connect diditconnect txt terraform apply var swarm count yes sleep docker exec it geth exec admin peers attach data bzzd ipc wc l diditconnect txt terraform destroy yes i repeated lines a bunch of times because terraform loops the resulting file diditconnect txt looks sg like this so no connection the time and so admin peers returns i have no idea what is and then connection the time so admin peers returns node info on node and then again no connection for | 0 |
714,521 | 24,564,829,504 | IssuesEvent | 2022-10-13 01:16:46 | AY2223S1-CS2103T-T13-2/tp | https://api.github.com/repos/AY2223S1-CS2103T-T13-2/tp | closed | Tag clients | type.Story priority.High | ### User story
As a financial advisor, I want to classify my clients with different tags so that I know who to prioritise.
### Acceptance criteria
- [x] Implement creating tags
- [x] Implement assigning tags to clients
- [x] Implement removing tags from clients
- [x] Show tags in client information | 1.0 | Tag clients - ### User story
As a financial advisor, I want to classify my clients with different tags so that I know who to prioritise.
### Acceptance criteria
- [x] Implement creating tags
- [x] Implement assigning tags to clients
- [x] Implement removing tags from clients
- [x] Show tags in client information | priority | tag clients user story as a financial advisor i want to classify my clients with different tags so that i know who to prioritise acceptance criteria implement creating tags implement assigning tags to clients implement removing tags from clients show tags in client information | 1 |
217,562 | 7,324,962,766 | IssuesEvent | 2018-03-03 02:36:06 | NCEAS/metacat | https://api.github.com/repos/NCEAS/metacat | closed | Transform for eml2 documents | Category: metacat Component: Bugzilla-Id Priority: Normal Status: Resolved Tracker: Bug | ---
Author Name: **Jing Tao** (Jing Tao)
Original Redmine Issue: 966, https://projects.ecoinformatics.org/ecoinfo/issues/966
Original Date: 2003-01-23
Original Assignee: Jing Tao
---
In order to transfrom eml2 documents to html or another xml file, metacat
should recongize the namespace. The namespace should be register into
xml_catalog table.
Probably, some new style sheets: should be created for eml2.
| 1.0 | Transform for eml2 documents - ---
Author Name: **Jing Tao** (Jing Tao)
Original Redmine Issue: 966, https://projects.ecoinformatics.org/ecoinfo/issues/966
Original Date: 2003-01-23
Original Assignee: Jing Tao
---
In order to transfrom eml2 documents to html or another xml file, metacat
should recongize the namespace. The namespace should be register into
xml_catalog table.
Probably, some new style sheets: should be created for eml2.
| priority | transform for documents author name jing tao jing tao original redmine issue original date original assignee jing tao in order to transfrom documents to html or another xml file metacat should recongize the namespace the namespace should be register into xml catalog table probably some new style sheets should be created for | 1 |
166,050 | 6,290,257,145 | IssuesEvent | 2017-07-19 21:05:20 | benvenutti/hasm | https://api.github.com/repos/benvenutti/hasm | opened | Refactor CMake scripts | priority: low status: on hold type: maintenance | Refactor the CMakeLists with a more *"modern"* approach. Examples [here](https://rix0r.nl/blog/2015/08/13/cmake-guide/).
1. add more warnings flags;
2. bundle all tests in one single executable;
3. reorganize folder structure. | 1.0 | Refactor CMake scripts - Refactor the CMakeLists with a more *"modern"* approach. Examples [here](https://rix0r.nl/blog/2015/08/13/cmake-guide/).
1. add more warnings flags;
2. bundle all tests in one single executable;
3. reorganize folder structure. | priority | refactor cmake scripts refactor the cmakelists with a more modern approach examples add more warnings flags bundle all tests in one single executable reorganize folder structure | 1 |
830,953 | 32,032,517,851 | IssuesEvent | 2023-09-22 13:16:41 | bivashy/MC-Auth-with-Link | https://api.github.com/repos/bivashy/MC-Auth-with-Link | closed | [Bug] Delay for commands | type: bug priority: high | Currently players can spam commands such like as: `/changepassword`, `/restore`, which will lead into issues with performance.
First and simplest solution that comes into the mind is just adding delay into the commands with any database query. | 1.0 | [Bug] Delay for commands - Currently players can spam commands such like as: `/changepassword`, `/restore`, which will lead into issues with performance.
First and simplest solution that comes into the mind is just adding delay into the commands with any database query. | priority | delay for commands currently players can spam commands such like as changepassword restore which will lead into issues with performance first and simplest solution that comes into the mind is just adding delay into the commands with any database query | 1 |
267,145 | 8,379,525,009 | IssuesEvent | 2018-10-07 03:08:41 | Baystation12/Baystation12 | https://api.github.com/repos/Baystation12/Baystation12 | closed | [Suspected subsystem bug] Pipe devices will mysteriously just stop working. | Atmos BINGO! priority: high ⚠ | <!--
If a specific field doesn't apply, remove it!
Anything inside tags like these is a comment and will not be displayed in the final issue.
Be careful not to write inside them!
Joke or spammed issues can and will result in punishment.
PUT YOUR ANSWERS ON THE BLANK LINES BELOW THE HEADERS
(The lines with four #'s)
Don't edit them or delete them it's part of the formatting
-->
#### Description of issue
Pumps, regulators, and just about anything dictating flow (I notice that non-cutoff valves don't seem to mind) will stop working randomly on the new subsystems. Gas heaters and coolers also stop working after some time.
#### Difference between expected and actual behavior
They shouldn't do this.
They do.
#### Steps to reproduce
Not sure yet. They seem to just break after a bit.
#### Specific information for locating
<!-- e.g. an object name, paste specific message outputs... -->
#### Length of time in which bug has been known to occur
<!--
Be specific if you approximately know the time it's been occurring
for—this can speed up finding the source. If you're not sure
about it, tell us too!
-->
Since subsystems.
#### Client version, Server revision & Game ID
<!-- Found with the "Show server revision" verb in the OOC tab in game. -->
Server Revision: 0270cf95dbafa4b3a283409b9b570d7371746da7 - dev -
the round **BEFORE** Game ID: bOq-dndx
Current map: SEV Torch
#### Issue bingo
Please check whatever applies. More checkboxes checked increase your chances of the issue being looked at sooner.
<!-- Check these by writing an x inside the [ ] (like this: [x])-->
<!-- Don't forget to remove the space between the brackets, or it won't work! -->
- [x] Issue could be reproduced at least once
- [x] Issue could be reproduced by different players
- [x] Issue could be reproduced in multiple rounds
- [x] Issue happened in a recent (less than 7 days ago) round
- [x] [Couldn't find an existing issue about this](https://github.com/Baystation12/Baystation12/issues)
| 1.0 | [Suspected subsystem bug] Pipe devices will mysteriously just stop working. - <!--
If a specific field doesn't apply, remove it!
Anything inside tags like these is a comment and will not be displayed in the final issue.
Be careful not to write inside them!
Joke or spammed issues can and will result in punishment.
PUT YOUR ANSWERS ON THE BLANK LINES BELOW THE HEADERS
(The lines with four #'s)
Don't edit them or delete them it's part of the formatting
-->
#### Description of issue
Pumps, regulators, and just about anything dictating flow (I notice that non-cutoff valves don't seem to mind) will stop working randomly on the new subsystems. Gas heaters and coolers also stop working after some time.
#### Difference between expected and actual behavior
They shouldn't do this.
They do.
#### Steps to reproduce
Not sure yet. They seem to just break after a bit.
#### Specific information for locating
<!-- e.g. an object name, paste specific message outputs... -->
#### Length of time in which bug has been known to occur
<!--
Be specific if you approximately know the time it's been occurring
for—this can speed up finding the source. If you're not sure
about it, tell us too!
-->
Since subsystems.
#### Client version, Server revision & Game ID
<!-- Found with the "Show server revision" verb in the OOC tab in game. -->
Server Revision: 0270cf95dbafa4b3a283409b9b570d7371746da7 - dev -
the round **BEFORE** Game ID: bOq-dndx
Current map: SEV Torch
#### Issue bingo
Please check whatever applies. More checkboxes checked increase your chances of the issue being looked at sooner.
<!-- Check these by writing an x inside the [ ] (like this: [x])-->
<!-- Don't forget to remove the space between the brackets, or it won't work! -->
- [x] Issue could be reproduced at least once
- [x] Issue could be reproduced by different players
- [x] Issue could be reproduced in multiple rounds
- [x] Issue happened in a recent (less than 7 days ago) round
- [x] [Couldn't find an existing issue about this](https://github.com/Baystation12/Baystation12/issues)
| priority | pipe devices will mysteriously just stop working if a specific field doesn t apply remove it anything inside tags like these is a comment and will not be displayed in the final issue be careful not to write inside them joke or spammed issues can and will result in punishment put your answers on the blank lines below the headers the lines with four s don t edit them or delete them it s part of the formatting description of issue pumps regulators and just about anything dictating flow i notice that non cutoff valves don t seem to mind will stop working randomly on the new subsystems gas heaters and coolers also stop working after some time difference between expected and actual behavior they shouldn t do this they do steps to reproduce not sure yet they seem to just break after a bit specific information for locating length of time in which bug has been known to occur be specific if you approximately know the time it s been occurring for—this can speed up finding the source if you re not sure about it tell us too since subsystems client version server revision game id server revision dev the round before game id boq dndx current map sev torch issue bingo please check whatever applies more checkboxes checked increase your chances of the issue being looked at sooner issue could be reproduced at least once issue could be reproduced by different players issue could be reproduced in multiple rounds issue happened in a recent less than days ago round | 1 |
479,928 | 13,807,716,161 | IssuesEvent | 2020-10-11 23:31:06 | NikolaiVChr/f16 | https://api.github.com/repos/NikolaiVChr/f16 | closed | Add PFL switch position on DED DATA switch to display F-ACK on HUD. | Enhancement Low priority | Should work on Block 40+ which are equipped with the PFL. | 1.0 | Add PFL switch position on DED DATA switch to display F-ACK on HUD. - Should work on Block 40+ which are equipped with the PFL. | priority | add pfl switch position on ded data switch to display f ack on hud should work on block which are equipped with the pfl | 1 |
176,919 | 21,464,433,616 | IssuesEvent | 2022-04-26 01:08:52 | turkdevops/vue-cli | https://api.github.com/repos/turkdevops/vue-cli | opened | CVE-2022-1365 (Medium) detected in cross-fetch-2.2.2.tgz | security vulnerability | ## CVE-2022-1365 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>cross-fetch-2.2.2.tgz</b></p></summary>
<p>Universal WHATWG Fetch API for Node, Browsers and React Native</p>
<p>Library home page: <a href="https://registry.npmjs.org/cross-fetch/-/cross-fetch-2.2.2.tgz">https://registry.npmjs.org/cross-fetch/-/cross-fetch-2.2.2.tgz</a></p>
<p>Path to dependency file: /package.json</p>
<p>Path to vulnerable library: /node_modules/cross-fetch</p>
<p>
Dependency Hierarchy:
- eslint-plugin-graphql-3.0.3.tgz (Root Library)
- graphql-config-2.2.1.tgz
- graphql-request-1.8.2.tgz
- :x: **cross-fetch-2.2.2.tgz** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/turkdevops/vue-cli/commit/b9888ec61e269386b4fab790d7d16670ad49b548">b9888ec61e269386b4fab790d7d16670ad49b548</a></p>
<p>Found in base branch: <b>fix-babel-core-js</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
Exposure of Private Personal Information to an Unauthorized Actor in GitHub repository lquixada/cross-fetch prior to 3.1.5.
<p>Publish Date: 2022-04-15
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2022-1365>CVE-2022-1365</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>6.1</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: Required
- Scope: Changed
- Impact Metrics:
- Confidentiality Impact: Low
- Integrity Impact: Low
- Availability Impact: None
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2022-1365">https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2022-1365</a></p>
<p>Release Date: 2022-04-15</p>
<p>Fix Resolution (cross-fetch): 2.2.6</p>
<p>Direct dependency fix Resolution (eslint-plugin-graphql): 4.0.0</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with WhiteSource [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | True | CVE-2022-1365 (Medium) detected in cross-fetch-2.2.2.tgz - ## CVE-2022-1365 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>cross-fetch-2.2.2.tgz</b></p></summary>
<p>Universal WHATWG Fetch API for Node, Browsers and React Native</p>
<p>Library home page: <a href="https://registry.npmjs.org/cross-fetch/-/cross-fetch-2.2.2.tgz">https://registry.npmjs.org/cross-fetch/-/cross-fetch-2.2.2.tgz</a></p>
<p>Path to dependency file: /package.json</p>
<p>Path to vulnerable library: /node_modules/cross-fetch</p>
<p>
Dependency Hierarchy:
- eslint-plugin-graphql-3.0.3.tgz (Root Library)
- graphql-config-2.2.1.tgz
- graphql-request-1.8.2.tgz
- :x: **cross-fetch-2.2.2.tgz** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/turkdevops/vue-cli/commit/b9888ec61e269386b4fab790d7d16670ad49b548">b9888ec61e269386b4fab790d7d16670ad49b548</a></p>
<p>Found in base branch: <b>fix-babel-core-js</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
Exposure of Private Personal Information to an Unauthorized Actor in GitHub repository lquixada/cross-fetch prior to 3.1.5.
<p>Publish Date: 2022-04-15
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2022-1365>CVE-2022-1365</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>6.1</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: Required
- Scope: Changed
- Impact Metrics:
- Confidentiality Impact: Low
- Integrity Impact: Low
- Availability Impact: None
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2022-1365">https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2022-1365</a></p>
<p>Release Date: 2022-04-15</p>
<p>Fix Resolution (cross-fetch): 2.2.6</p>
<p>Direct dependency fix Resolution (eslint-plugin-graphql): 4.0.0</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with WhiteSource [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | non_priority | cve medium detected in cross fetch tgz cve medium severity vulnerability vulnerable library cross fetch tgz universal whatwg fetch api for node browsers and react native library home page a href path to dependency file package json path to vulnerable library node modules cross fetch dependency hierarchy eslint plugin graphql tgz root library graphql config tgz graphql request tgz x cross fetch tgz vulnerable library found in head commit a href found in base branch fix babel core js vulnerability details exposure of private personal information to an unauthorized actor in github repository lquixada cross fetch prior to publish date url a href cvss score details base score metrics exploitability metrics attack vector network attack complexity low privileges required none user interaction required scope changed impact metrics confidentiality impact low integrity impact low availability impact none for more information on scores click a href suggested fix type upgrade version origin a href release date fix resolution cross fetch direct dependency fix resolution eslint plugin graphql step up your open source security game with whitesource | 0 |
631,335 | 20,150,776,050 | IssuesEvent | 2022-02-09 12:10:12 | avneesh0612/React-Next.js-snippets | https://api.github.com/repos/avneesh0612/React-Next.js-snippets | closed | [FEATURE] page component with NextPage type | enhancement good first issue 🏁 status: ready for dev ⭐ goal: addition 🟧 priority: high | ### Description
Add a new snippet for the page component with `NextPage` type
### Screenshots
_No response_
### Additional information
_No response_ | 1.0 | [FEATURE] page component with NextPage type - ### Description
Add a new snippet for the page component with `NextPage` type
### Screenshots
_No response_
### Additional information
_No response_ | priority | page component with nextpage type description add a new snippet for the page component with nextpage type screenshots no response additional information no response | 1 |
443,687 | 12,797,818,480 | IssuesEvent | 2020-07-02 12:58:51 | googleapis/python-firestore | https://api.github.com/repos/googleapis/python-firestore | closed | Synthesis failed for python-firestore | :rotating_light: api: firestore autosynth failure priority: p1 type: bug | Hello! Autosynth couldn't regenerate python-firestore. :broken_heart:
Here's the output from running `synth.py`:
```
08348d6080a0f118402219a0accf16e671
2020-06-20 08:07:30,702 autosynth [DEBUG] > Running: git log -1 --pretty=%at 84f8ec7ff1885e00582b32a21cd21a481d25e591
2020-06-20 08:07:30,707 autosynth [DEBUG] > Running: git log -1 --pretty=%at 3e6fed750653a8f41a5efeca0bc16b756a9532bb
2020-06-20 08:07:30,712 autosynth [DEBUG] > Running: git log -1 --pretty=%at ee18e132856bd1ef486249fc9fedd74b3e75f957
2020-06-20 08:07:30,717 autosynth [DEBUG] > Running: git log -1 --pretty=%at 483f18635c3af10031435535268abe001ad69e7c
2020-06-20 08:07:30,722 autosynth [DEBUG] > Running: git log -1 --pretty=%at 873bd44c32e57f22d7afe082aa11c8d456ff2072
2020-06-20 08:07:30,727 autosynth [DEBUG] > Running: git log -1 --pretty=%at 4f2c9f752a94042472fc03c5bd9e06e89817d2bd
2020-06-20 08:07:30,733 autosynth [DEBUG] > Running: git branch -f autosynth-self
2020-06-20 08:07:30,739 autosynth [DEBUG] > Running: git branch -f autosynth-googleapis
2020-06-20 08:07:30,745 autosynth [DEBUG] > Running: git branch -f autosynth-synthtool
2020-06-20 08:07:31,115 autosynth [DEBUG] > Running: git checkout autosynth-self
Switched to branch 'autosynth-self'
2020-06-20 08:07:31,123 autosynth [DEBUG] > Running: git checkout b1c5987c606a14874b412e70f93015e161e278d6
Note: checking out 'b1c5987c606a14874b412e70f93015e161e278d6'.
You are in 'detached HEAD' state. You can look around, make experimental
changes and commit them, and you can discard any commits you make in this
state without impacting any branches by performing another checkout.
If you want to create a new branch to retain commits you create, you may
do so (now or later) by using -b with the checkout command again. Example:
git checkout -b <new-branch-name>
HEAD is now at b1c5987 fix: Support more Python sequence types when encoding to Protobuf (#21)
2020-06-20 08:07:31,132 autosynth [DEBUG] > Running: git checkout 01b6f23d24b27878b48667ce597876d66b59780e
Note: checking out '01b6f23d24b27878b48667ce597876d66b59780e'.
You are in 'detached HEAD' state. You can look around, make experimental
changes and commit them, and you can discard any commits you make in this
state without impacting any branches by performing another checkout.
If you want to create a new branch to retain commits you create, you may
do so (now or later) by using -b with the checkout command again. Example:
git checkout -b <new-branch-name>
HEAD is now at 01b6f23 fix(python): install testutils from pypi (#503)
2020-06-20 08:07:31,146 autosynth [DEBUG] > Running: git checkout 756b174de4a122461993c1c583345533d819936d
Note: checking out '756b174de4a122461993c1c583345533d819936d'.
You are in 'detached HEAD' state. You can look around, make experimental
changes and commit them, and you can discard any commits you make in this
state without impacting any branches by performing another checkout.
If you want to create a new branch to retain commits you create, you may
do so (now or later) by using -b with the checkout command again. Example:
git checkout -b <new-branch-name>
HEAD is now at 756b174d fix: Add missing method_signature annotations for BigTable Admin Backup RPCs
2020-06-20 08:07:31,261 autosynth [DEBUG] > Running: git branch -f autosynth-self-2
2020-06-20 08:07:31,266 autosynth [DEBUG] > Running: git checkout autosynth-self-2
Switched to branch 'autosynth-self-2'
2020-06-20 08:07:31,274 autosynth [INFO] > Running synthtool
2020-06-20 08:07:31,275 autosynth [INFO] > ['/tmpfs/src/github/synthtool/env/bin/python3', '-m', 'synthtool', '--metadata', 'synth.metadata', 'synth.py', '--']
2020-06-20 08:07:31,275 autosynth [DEBUG] > log_file_path: /tmpfs/src/github/synthtool/logs/googleapis/python-firestore/self/2/sponge_log.log
2020-06-20 08:07:31,278 autosynth [DEBUG] > Running: /tmpfs/src/github/synthtool/env/bin/python3 -m synthtool --metadata synth.metadata synth.py --
2020-06-20 08:07:31,518 synthtool [DEBUG] > Executing /home/kbuilder/.cache/synthtool/python-firestore/synth.py.
On branch autosynth-self-2
nothing to commit, working tree clean
2020-06-20 08:07:31,671 synthtool [DEBUG] > Ensuring dependencies.
2020-06-20 08:07:31,686 synthtool [DEBUG] > Using precloned repo /home/kbuilder/.cache/synthtool/synthtool
2020-06-20 08:07:31,693 synthtool [DEBUG] > Cloning googleapis.
2020-06-20 08:07:31,693 synthtool [DEBUG] > Using precloned repo /home/kbuilder/.cache/synthtool/googleapis
2020-06-20 08:07:31,698 synthtool [DEBUG] > Generating code for: //google/firestore/v1beta1:firestore-v1beta1-py.
2020-06-20 08:07:32,359 synthtool [ERROR] > Failed executing bazel --max_idle_secs=60 build //google/firestore/v1beta1:firestore-v1beta1-py:
Loading:
Loading: 0 packages loaded
Analyzing: target //google/firestore/v1beta1:firestore-v1beta1-py (1 packages loaded, 0 targets configured)
ERROR: While resolving toolchains for target @pypi_black//:black: invalid registered toolchain '@gapic_generator_python//:pyenv3_toolchain': no such package '@gapic_generator_python//': The repository '@gapic_generator_python' could not be resolved
ERROR: Analysis of target '//google/firestore/v1beta1:firestore-v1beta1-py' failed; build aborted: invalid registered toolchain '@gapic_generator_python//:pyenv3_toolchain': no such package '@gapic_generator_python//': The repository '@gapic_generator_python' could not be resolved
INFO: Elapsed time: 0.648s
INFO: 0 processes.
FAILED: Build did NOT complete successfully (16 packages loaded, 14 targets configured)
FAILED: Build did NOT complete successfully (16 packages loaded, 14 targets configured)
2020-06-20 08:07:32,360 synthtool [DEBUG] > Wrote metadata to synth.metadata.
Traceback (most recent call last):
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/runpy.py", line 193, in _run_module_as_main
"__main__", mod_spec)
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/runpy.py", line 85, in _run_code
exec(code, run_globals)
File "/tmpfs/src/github/synthtool/synthtool/__main__.py", line 102, in <module>
main()
File "/tmpfs/src/github/synthtool/env/lib/python3.6/site-packages/click/core.py", line 829, in __call__
return self.main(*args, **kwargs)
File "/tmpfs/src/github/synthtool/env/lib/python3.6/site-packages/click/core.py", line 782, in main
rv = self.invoke(ctx)
File "/tmpfs/src/github/synthtool/env/lib/python3.6/site-packages/click/core.py", line 1066, in invoke
return ctx.invoke(self.callback, **ctx.params)
File "/tmpfs/src/github/synthtool/env/lib/python3.6/site-packages/click/core.py", line 610, in invoke
return callback(*args, **kwargs)
File "/tmpfs/src/github/synthtool/synthtool/__main__.py", line 94, in main
spec.loader.exec_module(synth_module) # type: ignore
File "<frozen importlib._bootstrap_external>", line 678, in exec_module
File "<frozen importlib._bootstrap>", line 219, in _call_with_frames_removed
File "/home/kbuilder/.cache/synthtool/python-firestore/synth.py", line 36, in <module>
include_protos=True,
File "/tmpfs/src/github/synthtool/synthtool/gcp/gapic_bazel.py", line 46, in py_library
return self._generate_code(service, version, "python", **kwargs)
File "/tmpfs/src/github/synthtool/synthtool/gcp/gapic_bazel.py", line 180, in _generate_code
shell.run(bazel_run_args)
File "/tmpfs/src/github/synthtool/synthtool/shell.py", line 39, in run
raise exc
File "/tmpfs/src/github/synthtool/synthtool/shell.py", line 33, in run
encoding="utf-8",
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/subprocess.py", line 438, in run
output=stdout, stderr=stderr)
subprocess.CalledProcessError: Command '['bazel', '--max_idle_secs=60', 'build', '//google/firestore/v1beta1:firestore-v1beta1-py']' returned non-zero exit status 1.
2020-06-20 08:07:32,422 autosynth [ERROR] > Synthesis failed
2020-06-20 08:07:32,422 autosynth [DEBUG] > Running: git reset --hard HEAD
HEAD is now at b1c5987 fix: Support more Python sequence types when encoding to Protobuf (#21)
2020-06-20 08:07:32,431 autosynth [DEBUG] > Running: git checkout autosynth-self
Switched to branch 'autosynth-self'
2020-06-20 08:07:32,439 autosynth [ERROR] > Command '['/tmpfs/src/github/synthtool/env/bin/python3', '-m', 'synthtool', '--metadata', 'synth.metadata', 'synth.py', '--']' returned non-zero exit status 1.
2020-06-20 08:07:32,606 autosynth [INFO] > PR already exists: https://github.com/googleapis/python-firestore/pull/54
2020-06-20 08:07:32,606 autosynth [DEBUG] > Running: git clean -fdx
Removing __pycache__/
Removing google/__pycache__/
Traceback (most recent call last):
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/runpy.py", line 193, in _run_module_as_main
"__main__", mod_spec)
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/runpy.py", line 85, in _run_code
exec(code, run_globals)
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 649, in <module>
main()
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 506, in main
return _inner_main(temp_dir)
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 629, in _inner_main
commit_count = synthesize_loop(x, multiple_prs, change_pusher, synthesizer)
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 367, in synthesize_loop
synthesize_inner_loop(fork, synthesizer)
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 411, in synthesize_inner_loop
synthesizer, len(toolbox.versions) - 1
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 266, in synthesize_version_in_new_branch
synthesizer.synthesize(synth_log_path, self.environ)
File "/tmpfs/src/github/synthtool/autosynth/synthesizer.py", line 120, in synthesize
synth_proc.check_returncode() # Raise an exception.
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/subprocess.py", line 389, in check_returncode
self.stderr)
subprocess.CalledProcessError: Command '['/tmpfs/src/github/synthtool/env/bin/python3', '-m', 'synthtool', '--metadata', 'synth.metadata', 'synth.py', '--']' returned non-zero exit status 1.
```
Google internal developers can see the full log [here](http://sponge2/results/invocations/e93a3b66-0b9d-4731-8049-5d33389af1dc/targets/github%2Fsynthtool;config=default/tests;query=python-firestore;failed=false).
| 1.0 | Synthesis failed for python-firestore - Hello! Autosynth couldn't regenerate python-firestore. :broken_heart:
Here's the output from running `synth.py`:
```
08348d6080a0f118402219a0accf16e671
2020-06-20 08:07:30,702 autosynth [DEBUG] > Running: git log -1 --pretty=%at 84f8ec7ff1885e00582b32a21cd21a481d25e591
2020-06-20 08:07:30,707 autosynth [DEBUG] > Running: git log -1 --pretty=%at 3e6fed750653a8f41a5efeca0bc16b756a9532bb
2020-06-20 08:07:30,712 autosynth [DEBUG] > Running: git log -1 --pretty=%at ee18e132856bd1ef486249fc9fedd74b3e75f957
2020-06-20 08:07:30,717 autosynth [DEBUG] > Running: git log -1 --pretty=%at 483f18635c3af10031435535268abe001ad69e7c
2020-06-20 08:07:30,722 autosynth [DEBUG] > Running: git log -1 --pretty=%at 873bd44c32e57f22d7afe082aa11c8d456ff2072
2020-06-20 08:07:30,727 autosynth [DEBUG] > Running: git log -1 --pretty=%at 4f2c9f752a94042472fc03c5bd9e06e89817d2bd
2020-06-20 08:07:30,733 autosynth [DEBUG] > Running: git branch -f autosynth-self
2020-06-20 08:07:30,739 autosynth [DEBUG] > Running: git branch -f autosynth-googleapis
2020-06-20 08:07:30,745 autosynth [DEBUG] > Running: git branch -f autosynth-synthtool
2020-06-20 08:07:31,115 autosynth [DEBUG] > Running: git checkout autosynth-self
Switched to branch 'autosynth-self'
2020-06-20 08:07:31,123 autosynth [DEBUG] > Running: git checkout b1c5987c606a14874b412e70f93015e161e278d6
Note: checking out 'b1c5987c606a14874b412e70f93015e161e278d6'.
You are in 'detached HEAD' state. You can look around, make experimental
changes and commit them, and you can discard any commits you make in this
state without impacting any branches by performing another checkout.
If you want to create a new branch to retain commits you create, you may
do so (now or later) by using -b with the checkout command again. Example:
git checkout -b <new-branch-name>
HEAD is now at b1c5987 fix: Support more Python sequence types when encoding to Protobuf (#21)
2020-06-20 08:07:31,132 autosynth [DEBUG] > Running: git checkout 01b6f23d24b27878b48667ce597876d66b59780e
Note: checking out '01b6f23d24b27878b48667ce597876d66b59780e'.
You are in 'detached HEAD' state. You can look around, make experimental
changes and commit them, and you can discard any commits you make in this
state without impacting any branches by performing another checkout.
If you want to create a new branch to retain commits you create, you may
do so (now or later) by using -b with the checkout command again. Example:
git checkout -b <new-branch-name>
HEAD is now at 01b6f23 fix(python): install testutils from pypi (#503)
2020-06-20 08:07:31,146 autosynth [DEBUG] > Running: git checkout 756b174de4a122461993c1c583345533d819936d
Note: checking out '756b174de4a122461993c1c583345533d819936d'.
You are in 'detached HEAD' state. You can look around, make experimental
changes and commit them, and you can discard any commits you make in this
state without impacting any branches by performing another checkout.
If you want to create a new branch to retain commits you create, you may
do so (now or later) by using -b with the checkout command again. Example:
git checkout -b <new-branch-name>
HEAD is now at 756b174d fix: Add missing method_signature annotations for BigTable Admin Backup RPCs
2020-06-20 08:07:31,261 autosynth [DEBUG] > Running: git branch -f autosynth-self-2
2020-06-20 08:07:31,266 autosynth [DEBUG] > Running: git checkout autosynth-self-2
Switched to branch 'autosynth-self-2'
2020-06-20 08:07:31,274 autosynth [INFO] > Running synthtool
2020-06-20 08:07:31,275 autosynth [INFO] > ['/tmpfs/src/github/synthtool/env/bin/python3', '-m', 'synthtool', '--metadata', 'synth.metadata', 'synth.py', '--']
2020-06-20 08:07:31,275 autosynth [DEBUG] > log_file_path: /tmpfs/src/github/synthtool/logs/googleapis/python-firestore/self/2/sponge_log.log
2020-06-20 08:07:31,278 autosynth [DEBUG] > Running: /tmpfs/src/github/synthtool/env/bin/python3 -m synthtool --metadata synth.metadata synth.py --
2020-06-20 08:07:31,518 synthtool [DEBUG] > Executing /home/kbuilder/.cache/synthtool/python-firestore/synth.py.
On branch autosynth-self-2
nothing to commit, working tree clean
2020-06-20 08:07:31,671 synthtool [DEBUG] > Ensuring dependencies.
2020-06-20 08:07:31,686 synthtool [DEBUG] > Using precloned repo /home/kbuilder/.cache/synthtool/synthtool
2020-06-20 08:07:31,693 synthtool [DEBUG] > Cloning googleapis.
2020-06-20 08:07:31,693 synthtool [DEBUG] > Using precloned repo /home/kbuilder/.cache/synthtool/googleapis
2020-06-20 08:07:31,698 synthtool [DEBUG] > Generating code for: //google/firestore/v1beta1:firestore-v1beta1-py.
2020-06-20 08:07:32,359 synthtool [ERROR] > Failed executing bazel --max_idle_secs=60 build //google/firestore/v1beta1:firestore-v1beta1-py:
Loading:
Loading: 0 packages loaded
Analyzing: target //google/firestore/v1beta1:firestore-v1beta1-py (1 packages loaded, 0 targets configured)
ERROR: While resolving toolchains for target @pypi_black//:black: invalid registered toolchain '@gapic_generator_python//:pyenv3_toolchain': no such package '@gapic_generator_python//': The repository '@gapic_generator_python' could not be resolved
ERROR: Analysis of target '//google/firestore/v1beta1:firestore-v1beta1-py' failed; build aborted: invalid registered toolchain '@gapic_generator_python//:pyenv3_toolchain': no such package '@gapic_generator_python//': The repository '@gapic_generator_python' could not be resolved
INFO: Elapsed time: 0.648s
INFO: 0 processes.
FAILED: Build did NOT complete successfully (16 packages loaded, 14 targets configured)
FAILED: Build did NOT complete successfully (16 packages loaded, 14 targets configured)
2020-06-20 08:07:32,360 synthtool [DEBUG] > Wrote metadata to synth.metadata.
Traceback (most recent call last):
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/runpy.py", line 193, in _run_module_as_main
"__main__", mod_spec)
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/runpy.py", line 85, in _run_code
exec(code, run_globals)
File "/tmpfs/src/github/synthtool/synthtool/__main__.py", line 102, in <module>
main()
File "/tmpfs/src/github/synthtool/env/lib/python3.6/site-packages/click/core.py", line 829, in __call__
return self.main(*args, **kwargs)
File "/tmpfs/src/github/synthtool/env/lib/python3.6/site-packages/click/core.py", line 782, in main
rv = self.invoke(ctx)
File "/tmpfs/src/github/synthtool/env/lib/python3.6/site-packages/click/core.py", line 1066, in invoke
return ctx.invoke(self.callback, **ctx.params)
File "/tmpfs/src/github/synthtool/env/lib/python3.6/site-packages/click/core.py", line 610, in invoke
return callback(*args, **kwargs)
File "/tmpfs/src/github/synthtool/synthtool/__main__.py", line 94, in main
spec.loader.exec_module(synth_module) # type: ignore
File "<frozen importlib._bootstrap_external>", line 678, in exec_module
File "<frozen importlib._bootstrap>", line 219, in _call_with_frames_removed
File "/home/kbuilder/.cache/synthtool/python-firestore/synth.py", line 36, in <module>
include_protos=True,
File "/tmpfs/src/github/synthtool/synthtool/gcp/gapic_bazel.py", line 46, in py_library
return self._generate_code(service, version, "python", **kwargs)
File "/tmpfs/src/github/synthtool/synthtool/gcp/gapic_bazel.py", line 180, in _generate_code
shell.run(bazel_run_args)
File "/tmpfs/src/github/synthtool/synthtool/shell.py", line 39, in run
raise exc
File "/tmpfs/src/github/synthtool/synthtool/shell.py", line 33, in run
encoding="utf-8",
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/subprocess.py", line 438, in run
output=stdout, stderr=stderr)
subprocess.CalledProcessError: Command '['bazel', '--max_idle_secs=60', 'build', '//google/firestore/v1beta1:firestore-v1beta1-py']' returned non-zero exit status 1.
2020-06-20 08:07:32,422 autosynth [ERROR] > Synthesis failed
2020-06-20 08:07:32,422 autosynth [DEBUG] > Running: git reset --hard HEAD
HEAD is now at b1c5987 fix: Support more Python sequence types when encoding to Protobuf (#21)
2020-06-20 08:07:32,431 autosynth [DEBUG] > Running: git checkout autosynth-self
Switched to branch 'autosynth-self'
2020-06-20 08:07:32,439 autosynth [ERROR] > Command '['/tmpfs/src/github/synthtool/env/bin/python3', '-m', 'synthtool', '--metadata', 'synth.metadata', 'synth.py', '--']' returned non-zero exit status 1.
2020-06-20 08:07:32,606 autosynth [INFO] > PR already exists: https://github.com/googleapis/python-firestore/pull/54
2020-06-20 08:07:32,606 autosynth [DEBUG] > Running: git clean -fdx
Removing __pycache__/
Removing google/__pycache__/
Traceback (most recent call last):
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/runpy.py", line 193, in _run_module_as_main
"__main__", mod_spec)
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/runpy.py", line 85, in _run_code
exec(code, run_globals)
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 649, in <module>
main()
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 506, in main
return _inner_main(temp_dir)
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 629, in _inner_main
commit_count = synthesize_loop(x, multiple_prs, change_pusher, synthesizer)
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 367, in synthesize_loop
synthesize_inner_loop(fork, synthesizer)
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 411, in synthesize_inner_loop
synthesizer, len(toolbox.versions) - 1
File "/tmpfs/src/github/synthtool/autosynth/synth.py", line 266, in synthesize_version_in_new_branch
synthesizer.synthesize(synth_log_path, self.environ)
File "/tmpfs/src/github/synthtool/autosynth/synthesizer.py", line 120, in synthesize
synth_proc.check_returncode() # Raise an exception.
File "/home/kbuilder/.pyenv/versions/3.6.9/lib/python3.6/subprocess.py", line 389, in check_returncode
self.stderr)
subprocess.CalledProcessError: Command '['/tmpfs/src/github/synthtool/env/bin/python3', '-m', 'synthtool', '--metadata', 'synth.metadata', 'synth.py', '--']' returned non-zero exit status 1.
```
Google internal developers can see the full log [here](http://sponge2/results/invocations/e93a3b66-0b9d-4731-8049-5d33389af1dc/targets/github%2Fsynthtool;config=default/tests;query=python-firestore;failed=false).
| priority | synthesis failed for python firestore hello autosynth couldn t regenerate python firestore broken heart here s the output from running synth py autosynth running git log pretty at autosynth running git log pretty at autosynth running git log pretty at autosynth running git log pretty at autosynth running git log pretty at autosynth running git log pretty at autosynth running git branch f autosynth self autosynth running git branch f autosynth googleapis autosynth running git branch f autosynth synthtool autosynth running git checkout autosynth self switched to branch autosynth self autosynth running git checkout note checking out you are in detached head state you can look around make experimental changes and commit them and you can discard any commits you make in this state without impacting any branches by performing another checkout if you want to create a new branch to retain commits you create you may do so now or later by using b with the checkout command again example git checkout b head is now at fix support more python sequence types when encoding to protobuf autosynth running git checkout note checking out you are in detached head state you can look around make experimental changes and commit them and you can discard any commits you make in this state without impacting any branches by performing another checkout if you want to create a new branch to retain commits you create you may do so now or later by using b with the checkout command again example git checkout b head is now at fix python install testutils from pypi autosynth running git checkout note checking out you are in detached head state you can look around make experimental changes and commit them and you can discard any commits you make in this state without impacting any branches by performing another checkout if you want to create a new branch to retain commits you create you may do so now or later by using b with the checkout command again example git checkout b head is now at fix add missing method signature annotations for bigtable admin backup rpcs autosynth running git branch f autosynth self autosynth running git checkout autosynth self switched to branch autosynth self autosynth running synthtool autosynth autosynth log file path tmpfs src github synthtool logs googleapis python firestore self sponge log log autosynth running tmpfs src github synthtool env bin m synthtool metadata synth metadata synth py synthtool executing home kbuilder cache synthtool python firestore synth py on branch autosynth self nothing to commit working tree clean synthtool ensuring dependencies synthtool using precloned repo home kbuilder cache synthtool synthtool synthtool cloning googleapis synthtool using precloned repo home kbuilder cache synthtool googleapis synthtool generating code for google firestore firestore py synthtool failed executing bazel max idle secs build google firestore firestore py loading loading packages loaded analyzing target google firestore firestore py packages loaded targets configured error while resolving toolchains for target pypi black black invalid registered toolchain gapic generator python toolchain no such package gapic generator python the repository gapic generator python could not be resolved error analysis of target google firestore firestore py failed build aborted invalid registered toolchain gapic generator python toolchain no such package gapic generator python the repository gapic generator python could not be resolved info elapsed time info processes failed build did not complete successfully packages loaded targets configured failed build did not complete successfully packages loaded targets configured synthtool wrote metadata to synth metadata traceback most recent call last file home kbuilder pyenv versions lib runpy py line in run module as main main mod spec file home kbuilder pyenv versions lib runpy py line in run code exec code run globals file tmpfs src github synthtool synthtool main py line in main file tmpfs src github synthtool env lib site packages click core py line in call return self main args kwargs file tmpfs src github synthtool env lib site packages click core py line in main rv self invoke ctx file tmpfs src github synthtool env lib site packages click core py line in invoke return ctx invoke self callback ctx params file tmpfs src github synthtool env lib site packages click core py line in invoke return callback args kwargs file tmpfs src github synthtool synthtool main py line in main spec loader exec module synth module type ignore file line in exec module file line in call with frames removed file home kbuilder cache synthtool python firestore synth py line in include protos true file tmpfs src github synthtool synthtool gcp gapic bazel py line in py library return self generate code service version python kwargs file tmpfs src github synthtool synthtool gcp gapic bazel py line in generate code shell run bazel run args file tmpfs src github synthtool synthtool shell py line in run raise exc file tmpfs src github synthtool synthtool shell py line in run encoding utf file home kbuilder pyenv versions lib subprocess py line in run output stdout stderr stderr subprocess calledprocesserror command returned non zero exit status autosynth synthesis failed autosynth running git reset hard head head is now at fix support more python sequence types when encoding to protobuf autosynth running git checkout autosynth self switched to branch autosynth self autosynth command returned non zero exit status autosynth pr already exists autosynth running git clean fdx removing pycache removing google pycache traceback most recent call last file home kbuilder pyenv versions lib runpy py line in run module as main main mod spec file home kbuilder pyenv versions lib runpy py line in run code exec code run globals file tmpfs src github synthtool autosynth synth py line in main file tmpfs src github synthtool autosynth synth py line in main return inner main temp dir file tmpfs src github synthtool autosynth synth py line in inner main commit count synthesize loop x multiple prs change pusher synthesizer file tmpfs src github synthtool autosynth synth py line in synthesize loop synthesize inner loop fork synthesizer file tmpfs src github synthtool autosynth synth py line in synthesize inner loop synthesizer len toolbox versions file tmpfs src github synthtool autosynth synth py line in synthesize version in new branch synthesizer synthesize synth log path self environ file tmpfs src github synthtool autosynth synthesizer py line in synthesize synth proc check returncode raise an exception file home kbuilder pyenv versions lib subprocess py line in check returncode self stderr subprocess calledprocesserror command returned non zero exit status google internal developers can see the full log | 1 |
193,141 | 6,881,933,343 | IssuesEvent | 2017-11-21 00:52:20 | webcompat/web-bugs | https://api.github.com/repos/webcompat/web-bugs | closed | buyertrade.taobao.com - see bug description | browser-firefox priority-critical | <!-- @browser: Firefox 57.0 -->
<!-- @ua_header: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:57.0) Gecko/20100101 Firefox/57.0 -->
<!-- @reported_with: desktop-reporter -->
**URL**: https://buyertrade.taobao.com/trade/itemlist/list_bought_items.htm?spm=a21bo.2017.1997525045.2.56efdea8KkvjZc
**Browser / Version**: Firefox 57.0
**Operating System**: Windows 10
**Tested Another Browser**: Yes
**Problem type**: Something else
**Description**: can't load the content
**Steps to Reproduce**:
layout.css.servo.enabled: true
[](https://webcompat.com/uploads/2017/11/af2226aa-ae0f-4b08-9a0d-c73ae9580fee.jpg)
_From [webcompat.com](https://webcompat.com/) with ❤️_ | 1.0 | buyertrade.taobao.com - see bug description - <!-- @browser: Firefox 57.0 -->
<!-- @ua_header: Mozilla/5.0 (Windows NT 10.0; Win64; x64; rv:57.0) Gecko/20100101 Firefox/57.0 -->
<!-- @reported_with: desktop-reporter -->
**URL**: https://buyertrade.taobao.com/trade/itemlist/list_bought_items.htm?spm=a21bo.2017.1997525045.2.56efdea8KkvjZc
**Browser / Version**: Firefox 57.0
**Operating System**: Windows 10
**Tested Another Browser**: Yes
**Problem type**: Something else
**Description**: can't load the content
**Steps to Reproduce**:
layout.css.servo.enabled: true
[](https://webcompat.com/uploads/2017/11/af2226aa-ae0f-4b08-9a0d-c73ae9580fee.jpg)
_From [webcompat.com](https://webcompat.com/) with ❤️_ | priority | buyertrade taobao com see bug description url browser version firefox operating system windows tested another browser yes problem type something else description can t load the content steps to reproduce layout css servo enabled true from with ❤️ | 1 |
131,783 | 18,249,485,146 | IssuesEvent | 2021-10-02 01:14:32 | praneethpanasala/linux | https://api.github.com/repos/praneethpanasala/linux | opened | WS-2021-0336 (Medium) detected in linuxlinux-4.19.6 | security vulnerability | ## WS-2021-0336 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>linuxlinux-4.19.6</b></p></summary>
<p>
<p>Apache Software Foundation (ASF)</p>
<p>Library home page: <a href=https://mirrors.edge.kernel.org/pub/linux/kernel/v4.x/?wsslib=linux>https://mirrors.edge.kernel.org/pub/linux/kernel/v4.x/?wsslib=linux</a></p>
<p>Found in base branch: <b>master</b></p></p>
</details>
</p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Source Files (1)</summary>
<p></p>
<p>
</p>
</details>
<p></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
Linux Kernel in versions from v5.8 to before v5.12.10 contains a free of unallocated memory at p2pmem.
<p>Publish Date: 2021-06-25
<p>URL: <a href=https://github.com/gregkh/linux/commit/8a452d62e7cea3c8a2676a3b89a9118755a1a271>WS-2021-0336</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>4.9</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: N/A
- Attack Complexity: N/A
- Privileges Required: N/A
- User Interaction: N/A
- Scope: N/A
- Impact Metrics:
- Confidentiality Impact: N/A
- Integrity Impact: N/A
- Availability Impact: N/A
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://osv.dev/vulnerability/UVI-2021-1000797/">https://osv.dev/vulnerability/UVI-2021-1000797/</a></p>
<p>Release Date: 2021-06-25</p>
<p>Fix Resolution: v5.12.10</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with WhiteSource [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | True | WS-2021-0336 (Medium) detected in linuxlinux-4.19.6 - ## WS-2021-0336 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>linuxlinux-4.19.6</b></p></summary>
<p>
<p>Apache Software Foundation (ASF)</p>
<p>Library home page: <a href=https://mirrors.edge.kernel.org/pub/linux/kernel/v4.x/?wsslib=linux>https://mirrors.edge.kernel.org/pub/linux/kernel/v4.x/?wsslib=linux</a></p>
<p>Found in base branch: <b>master</b></p></p>
</details>
</p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Source Files (1)</summary>
<p></p>
<p>
</p>
</details>
<p></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
Linux Kernel in versions from v5.8 to before v5.12.10 contains a free of unallocated memory at p2pmem.
<p>Publish Date: 2021-06-25
<p>URL: <a href=https://github.com/gregkh/linux/commit/8a452d62e7cea3c8a2676a3b89a9118755a1a271>WS-2021-0336</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>4.9</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: N/A
- Attack Complexity: N/A
- Privileges Required: N/A
- User Interaction: N/A
- Scope: N/A
- Impact Metrics:
- Confidentiality Impact: N/A
- Integrity Impact: N/A
- Availability Impact: N/A
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://osv.dev/vulnerability/UVI-2021-1000797/">https://osv.dev/vulnerability/UVI-2021-1000797/</a></p>
<p>Release Date: 2021-06-25</p>
<p>Fix Resolution: v5.12.10</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with WhiteSource [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | non_priority | ws medium detected in linuxlinux ws medium severity vulnerability vulnerable library linuxlinux apache software foundation asf library home page a href found in base branch master vulnerable source files vulnerability details linux kernel in versions from to before contains a free of unallocated memory at publish date url a href cvss score details base score metrics exploitability metrics attack vector n a attack complexity n a privileges required n a user interaction n a scope n a impact metrics confidentiality impact n a integrity impact n a availability impact n a for more information on scores click a href suggested fix type upgrade version origin a href release date fix resolution step up your open source security game with whitesource | 0 |
295,852 | 9,101,518,113 | IssuesEvent | 2019-02-20 11:18:51 | webcompat/web-bugs | https://api.github.com/repos/webcompat/web-bugs | closed | twitter.com - site is not usable | browser-firefox-mobile priority-critical | <!-- @browser: Firefox Mobile 64.0 -->
<!-- @ua_header: Mozilla/5.0 (Android 8.1.0; Mobile; rv:64.0) Gecko/64.0 Firefox/64.0 -->
<!-- @reported_with: mobile-reporter -->
**URL**: https://twitter.com/xplodingunicorn/status/1092217901350834177
**Browser / Version**: Firefox Mobile 64.0
**Operating System**: Android 8.1.0
**Tested Another Browser**: Unknown
**Problem type**: Site is not usable
**Description**: 80% of the time I get rate limited (no tweets displayed) if I access Twitter in mobile view (default view, and defaults back to it always)
**Steps to Reproduce**:
<details>
<summary>Browser Configuration</summary>
<ul>
<li>None</li>
</ul>
</details>
_From [webcompat.com](https://webcompat.com/) with ❤️_ | 1.0 | twitter.com - site is not usable - <!-- @browser: Firefox Mobile 64.0 -->
<!-- @ua_header: Mozilla/5.0 (Android 8.1.0; Mobile; rv:64.0) Gecko/64.0 Firefox/64.0 -->
<!-- @reported_with: mobile-reporter -->
**URL**: https://twitter.com/xplodingunicorn/status/1092217901350834177
**Browser / Version**: Firefox Mobile 64.0
**Operating System**: Android 8.1.0
**Tested Another Browser**: Unknown
**Problem type**: Site is not usable
**Description**: 80% of the time I get rate limited (no tweets displayed) if I access Twitter in mobile view (default view, and defaults back to it always)
**Steps to Reproduce**:
<details>
<summary>Browser Configuration</summary>
<ul>
<li>None</li>
</ul>
</details>
_From [webcompat.com](https://webcompat.com/) with ❤️_ | priority | twitter com site is not usable url browser version firefox mobile operating system android tested another browser unknown problem type site is not usable description of the time i get rate limited no tweets displayed if i access twitter in mobile view default view and defaults back to it always steps to reproduce browser configuration none from with ❤️ | 1 |
27,927 | 11,579,314,401 | IssuesEvent | 2020-02-21 17:39:07 | mwilliams7197/blueocean-environments | https://api.github.com/repos/mwilliams7197/blueocean-environments | opened | CVE-2019-1010266 (Medium) detected in multiple libraries | security vulnerability | ## CVE-2019-1010266 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Libraries - <b>lodash-1.0.2.tgz</b>, <b>lodash-4.17.10.tgz</b>, <b>lodash-3.7.0.tgz</b></p></summary>
<p>
<details><summary><b>lodash-1.0.2.tgz</b></p></summary>
<p>A utility library delivering consistency, customization, performance, and extras.</p>
<p>Library home page: <a href="https://registry.npmjs.org/lodash/-/lodash-1.0.2.tgz">https://registry.npmjs.org/lodash/-/lodash-1.0.2.tgz</a></p>
<p>Path to dependency file: /tmp/ws-scm/blueocean-environments/package.json</p>
<p>Path to vulnerable library: /tmp/ws-scm/blueocean-environments/node_modules/globule/node_modules/lodash/package.json</p>
<p>
Dependency Hierarchy:
- js-builder-0.0.62.tgz (Root Library)
- gulp-3.9.1.tgz
- vinyl-fs-0.3.14.tgz
- glob-watcher-0.0.6.tgz
- gaze-0.5.2.tgz
- globule-0.1.0.tgz
- :x: **lodash-1.0.2.tgz** (Vulnerable Library)
</details>
<details><summary><b>lodash-4.17.10.tgz</b></p></summary>
<p>Lodash modular utilities.</p>
<p>Library home page: <a href="https://registry.npmjs.org/lodash/-/lodash-4.17.10.tgz">https://registry.npmjs.org/lodash/-/lodash-4.17.10.tgz</a></p>
<p>Path to dependency file: /tmp/ws-scm/blueocean-environments/package.json</p>
<p>Path to vulnerable library: /tmp/ws-scm/blueocean-environments/node_modules/lodash/package.json</p>
<p>
Dependency Hierarchy:
- babel-core-6.17.0.tgz (Root Library)
- :x: **lodash-4.17.10.tgz** (Vulnerable Library)
</details>
<details><summary><b>lodash-3.7.0.tgz</b></p></summary>
<p>The modern build of lodash modular utilities.</p>
<p>Library home page: <a href="https://registry.npmjs.org/lodash/-/lodash-3.7.0.tgz">https://registry.npmjs.org/lodash/-/lodash-3.7.0.tgz</a></p>
<p>Path to dependency file: /tmp/ws-scm/blueocean-environments/package.json</p>
<p>Path to vulnerable library: /tmp/ws-scm/blueocean-environments/node_modules/jshint/node_modules/lodash/package.json</p>
<p>
Dependency Hierarchy:
- js-builder-0.0.62.tgz (Root Library)
- jshint-2.9.5.tgz
- :x: **lodash-3.7.0.tgz** (Vulnerable Library)
</details>
<p>Found in HEAD commit: <a href="https://api.github.com/repos/mwilliams7197/blueocean-environments/commits/c666e5baa0f1985382ee2444427d1bbcda9254b7">c666e5baa0f1985382ee2444427d1bbcda9254b7</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
lodash prior to 4.17.11 is affected by: CWE-400: Uncontrolled Resource Consumption. The impact is: Denial of service. The component is: Date handler. The attack vector is: Attacker provides very long strings, which the library attempts to match using a regular expression. The fixed version is: 4.17.11.
<p>Publish Date: 2019-07-17
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2019-1010266>CVE-2019-1010266</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>6.5</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: Low
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: None
- Integrity Impact: None
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-1010266">https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-1010266</a></p>
<p>Release Date: 2019-07-17</p>
<p>Fix Resolution: 4.17.11</p>
</p>
</details>
<p></p>
<!-- <REMEDIATE>{"isOpenPROnVulnerability":false,"isPackageBased":true,"isDefaultBranch":true,"packages":[{"packageType":"javascript/Node.js","packageName":"lodash","packageVersion":"1.0.2","isTransitiveDependency":true,"dependencyTree":"@jenkins-cd/js-builder:0.0.62;gulp:3.9.1;vinyl-fs:0.3.14;glob-watcher:0.0.6;gaze:0.5.2;globule:0.1.0;lodash:1.0.2","isMinimumFixVersionAvailable":true,"minimumFixVersion":"4.17.11"},{"packageType":"javascript/Node.js","packageName":"lodash","packageVersion":"4.17.10","isTransitiveDependency":true,"dependencyTree":"babel-core:6.17.0;lodash:4.17.10","isMinimumFixVersionAvailable":true,"minimumFixVersion":"4.17.11"},{"packageType":"javascript/Node.js","packageName":"lodash","packageVersion":"3.7.0","isTransitiveDependency":true,"dependencyTree":"@jenkins-cd/js-builder:0.0.62;jshint:2.9.5;lodash:3.7.0","isMinimumFixVersionAvailable":true,"minimumFixVersion":"4.17.11"}],"vulnerabilityIdentifier":"CVE-2019-1010266","vulnerabilityDetails":"lodash prior to 4.17.11 is affected by: CWE-400: Uncontrolled Resource Consumption. The impact is: Denial of service. The component is: Date handler. The attack vector is: Attacker provides very long strings, which the library attempts to match using a regular expression. The fixed version is: 4.17.11.","vulnerabilityUrl":"https://vuln.whitesourcesoftware.com/vulnerability/CVE-2019-1010266","cvss3Severity":"medium","cvss3Score":"6.5","cvss3Metrics":{"A":"High","AC":"Low","PR":"Low","S":"Unchanged","C":"None","UI":"None","AV":"Network","I":"None"},"extraData":{}}</REMEDIATE> --> | True | CVE-2019-1010266 (Medium) detected in multiple libraries - ## CVE-2019-1010266 - Medium Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Libraries - <b>lodash-1.0.2.tgz</b>, <b>lodash-4.17.10.tgz</b>, <b>lodash-3.7.0.tgz</b></p></summary>
<p>
<details><summary><b>lodash-1.0.2.tgz</b></p></summary>
<p>A utility library delivering consistency, customization, performance, and extras.</p>
<p>Library home page: <a href="https://registry.npmjs.org/lodash/-/lodash-1.0.2.tgz">https://registry.npmjs.org/lodash/-/lodash-1.0.2.tgz</a></p>
<p>Path to dependency file: /tmp/ws-scm/blueocean-environments/package.json</p>
<p>Path to vulnerable library: /tmp/ws-scm/blueocean-environments/node_modules/globule/node_modules/lodash/package.json</p>
<p>
Dependency Hierarchy:
- js-builder-0.0.62.tgz (Root Library)
- gulp-3.9.1.tgz
- vinyl-fs-0.3.14.tgz
- glob-watcher-0.0.6.tgz
- gaze-0.5.2.tgz
- globule-0.1.0.tgz
- :x: **lodash-1.0.2.tgz** (Vulnerable Library)
</details>
<details><summary><b>lodash-4.17.10.tgz</b></p></summary>
<p>Lodash modular utilities.</p>
<p>Library home page: <a href="https://registry.npmjs.org/lodash/-/lodash-4.17.10.tgz">https://registry.npmjs.org/lodash/-/lodash-4.17.10.tgz</a></p>
<p>Path to dependency file: /tmp/ws-scm/blueocean-environments/package.json</p>
<p>Path to vulnerable library: /tmp/ws-scm/blueocean-environments/node_modules/lodash/package.json</p>
<p>
Dependency Hierarchy:
- babel-core-6.17.0.tgz (Root Library)
- :x: **lodash-4.17.10.tgz** (Vulnerable Library)
</details>
<details><summary><b>lodash-3.7.0.tgz</b></p></summary>
<p>The modern build of lodash modular utilities.</p>
<p>Library home page: <a href="https://registry.npmjs.org/lodash/-/lodash-3.7.0.tgz">https://registry.npmjs.org/lodash/-/lodash-3.7.0.tgz</a></p>
<p>Path to dependency file: /tmp/ws-scm/blueocean-environments/package.json</p>
<p>Path to vulnerable library: /tmp/ws-scm/blueocean-environments/node_modules/jshint/node_modules/lodash/package.json</p>
<p>
Dependency Hierarchy:
- js-builder-0.0.62.tgz (Root Library)
- jshint-2.9.5.tgz
- :x: **lodash-3.7.0.tgz** (Vulnerable Library)
</details>
<p>Found in HEAD commit: <a href="https://api.github.com/repos/mwilliams7197/blueocean-environments/commits/c666e5baa0f1985382ee2444427d1bbcda9254b7">c666e5baa0f1985382ee2444427d1bbcda9254b7</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/medium_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
lodash prior to 4.17.11 is affected by: CWE-400: Uncontrolled Resource Consumption. The impact is: Denial of service. The component is: Date handler. The attack vector is: Attacker provides very long strings, which the library attempts to match using a regular expression. The fixed version is: 4.17.11.
<p>Publish Date: 2019-07-17
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2019-1010266>CVE-2019-1010266</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>6.5</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Network
- Attack Complexity: Low
- Privileges Required: Low
- User Interaction: None
- Scope: Unchanged
- Impact Metrics:
- Confidentiality Impact: None
- Integrity Impact: None
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-1010266">https://cve.mitre.org/cgi-bin/cvename.cgi?name=CVE-2019-1010266</a></p>
<p>Release Date: 2019-07-17</p>
<p>Fix Resolution: 4.17.11</p>
</p>
</details>
<p></p>
<!-- <REMEDIATE>{"isOpenPROnVulnerability":false,"isPackageBased":true,"isDefaultBranch":true,"packages":[{"packageType":"javascript/Node.js","packageName":"lodash","packageVersion":"1.0.2","isTransitiveDependency":true,"dependencyTree":"@jenkins-cd/js-builder:0.0.62;gulp:3.9.1;vinyl-fs:0.3.14;glob-watcher:0.0.6;gaze:0.5.2;globule:0.1.0;lodash:1.0.2","isMinimumFixVersionAvailable":true,"minimumFixVersion":"4.17.11"},{"packageType":"javascript/Node.js","packageName":"lodash","packageVersion":"4.17.10","isTransitiveDependency":true,"dependencyTree":"babel-core:6.17.0;lodash:4.17.10","isMinimumFixVersionAvailable":true,"minimumFixVersion":"4.17.11"},{"packageType":"javascript/Node.js","packageName":"lodash","packageVersion":"3.7.0","isTransitiveDependency":true,"dependencyTree":"@jenkins-cd/js-builder:0.0.62;jshint:2.9.5;lodash:3.7.0","isMinimumFixVersionAvailable":true,"minimumFixVersion":"4.17.11"}],"vulnerabilityIdentifier":"CVE-2019-1010266","vulnerabilityDetails":"lodash prior to 4.17.11 is affected by: CWE-400: Uncontrolled Resource Consumption. The impact is: Denial of service. The component is: Date handler. The attack vector is: Attacker provides very long strings, which the library attempts to match using a regular expression. The fixed version is: 4.17.11.","vulnerabilityUrl":"https://vuln.whitesourcesoftware.com/vulnerability/CVE-2019-1010266","cvss3Severity":"medium","cvss3Score":"6.5","cvss3Metrics":{"A":"High","AC":"Low","PR":"Low","S":"Unchanged","C":"None","UI":"None","AV":"Network","I":"None"},"extraData":{}}</REMEDIATE> --> | non_priority | cve medium detected in multiple libraries cve medium severity vulnerability vulnerable libraries lodash tgz lodash tgz lodash tgz lodash tgz a utility library delivering consistency customization performance and extras library home page a href path to dependency file tmp ws scm blueocean environments package json path to vulnerable library tmp ws scm blueocean environments node modules globule node modules lodash package json dependency hierarchy js builder tgz root library gulp tgz vinyl fs tgz glob watcher tgz gaze tgz globule tgz x lodash tgz vulnerable library lodash tgz lodash modular utilities library home page a href path to dependency file tmp ws scm blueocean environments package json path to vulnerable library tmp ws scm blueocean environments node modules lodash package json dependency hierarchy babel core tgz root library x lodash tgz vulnerable library lodash tgz the modern build of lodash modular utilities library home page a href path to dependency file tmp ws scm blueocean environments package json path to vulnerable library tmp ws scm blueocean environments node modules jshint node modules lodash package json dependency hierarchy js builder tgz root library jshint tgz x lodash tgz vulnerable library found in head commit a href vulnerability details lodash prior to is affected by cwe uncontrolled resource consumption the impact is denial of service the component is date handler the attack vector is attacker provides very long strings which the library attempts to match using a regular expression the fixed version is publish date url a href cvss score details base score metrics exploitability metrics attack vector network attack complexity low privileges required low user interaction none scope unchanged impact metrics confidentiality impact none integrity impact none availability impact high for more information on scores click a href suggested fix type upgrade version origin a href release date fix resolution isopenpronvulnerability false ispackagebased true isdefaultbranch true packages vulnerabilityidentifier cve vulnerabilitydetails lodash prior to is affected by cwe uncontrolled resource consumption the impact is denial of service the component is date handler the attack vector is attacker provides very long strings which the library attempts to match using a regular expression the fixed version is vulnerabilityurl | 0 |
341,889 | 10,309,283,814 | IssuesEvent | 2019-08-29 12:58:51 | CodeGra-de/CodeGra.de | https://api.github.com/repos/CodeGra-de/CodeGra.de | closed | Divide submissions UI inconsistency | discussion needed enhancement frontend priority-2-low | # Feature request
After dividing submissions the finished grading section reloads, which makes sense, but in the UI it does seem weird that divide submissions does nothing.
| 1.0 | Divide submissions UI inconsistency - # Feature request
After dividing submissions the finished grading section reloads, which makes sense, but in the UI it does seem weird that divide submissions does nothing.
| priority | divide submissions ui inconsistency feature request after dividing submissions the finished grading section reloads which makes sense but in the ui it does seem weird that divide submissions does nothing | 1 |
177,041 | 28,313,196,025 | IssuesEvent | 2023-04-10 17:14:03 | grafana/grafana | https://api.github.com/repos/grafana/grafana | closed | Saga DS - Border Radius [epic] | design-system design-system: pattern design-system: dev work | Border-radius across the Grafana product needs to be aligned
```[tasklist]
### Tasks
- [ ] https://github.com/grafana/grafana/issues/63342
```
This was created retroactively so we can better track the work that is associated with this. | 3.0 | Saga DS - Border Radius [epic] - Border-radius across the Grafana product needs to be aligned
```[tasklist]
### Tasks
- [ ] https://github.com/grafana/grafana/issues/63342
```
This was created retroactively so we can better track the work that is associated with this. | non_priority | saga ds border radius border radius across the grafana product needs to be aligned tasks this was created retroactively so we can better track the work that is associated with this | 0 |
241,240 | 7,810,368,984 | IssuesEvent | 2018-06-12 06:27:31 | tine20/Tine-2.0-Open-Source-Groupware-and-CRM | https://api.github.com/repos/tine20/Tine-2.0-Open-Source-Groupware-and-CRM | closed | 0003218:
The defined custom field size doesn't match the displayed fiield size | Addressbook Mantis low priority | **Reported by Vertex on 23 Oct 2010 14:50**
**Version:** Mialena (2010-03-7)
If you define a custom field e.g. customer no. with 6 digits, the displayed field will be as wide as the window - it looks not very nice.
| 1.0 | 0003218:
The defined custom field size doesn't match the displayed fiield size - **Reported by Vertex on 23 Oct 2010 14:50**
**Version:** Mialena (2010-03-7)
If you define a custom field e.g. customer no. with 6 digits, the displayed field will be as wide as the window - it looks not very nice.
| priority | the defined custom field size doesn t match the displayed fiield size reported by vertex on oct version mialena if you define a custom field e g customer no with digits the displayed field will be as wide as the window it looks not very nice | 1 |
176,199 | 21,390,745,179 | IssuesEvent | 2022-04-21 06:48:42 | turkdevops/update-electron-app | https://api.github.com/repos/turkdevops/update-electron-app | opened | CVE-2021-37713 (High) detected in tar-4.4.13.tgz | security vulnerability | ## CVE-2021-37713 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>tar-4.4.13.tgz</b></p></summary>
<p>tar for node</p>
<p>Library home page: <a href="https://registry.npmjs.org/tar/-/tar-4.4.13.tgz">https://registry.npmjs.org/tar/-/tar-4.4.13.tgz</a></p>
<p>Path to dependency file: /package.json</p>
<p>Path to vulnerable library: /node_modules/npm/node_modules/tar/package.json,/node_modules/tar/package.json</p>
<p>
Dependency Hierarchy:
- semantic-release-17.2.3.tgz (Root Library)
- npm-7.0.10.tgz
- npm-6.14.11.tgz
- :x: **tar-4.4.13.tgz** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/turkdevops/update-electron-app/commit/1f829f24bbba287747c00a7861b5f4b687f8c054">1f829f24bbba287747c00a7861b5f4b687f8c054</a></p>
<p>Found in base branch: <b>master</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/high_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
The npm package "tar" (aka node-tar) before versions 4.4.18, 5.0.10, and 6.1.9 has an arbitrary file creation/overwrite and arbitrary code execution vulnerability. node-tar aims to guarantee that any file whose location would be outside of the extraction target directory is not extracted. This is, in part, accomplished by sanitizing absolute paths of entries within the archive, skipping archive entries that contain `..` path portions, and resolving the sanitized paths against the extraction target directory. This logic was insufficient on Windows systems when extracting tar files that contained a path that was not an absolute path, but specified a drive letter different from the extraction target, such as `C:some\path`. If the drive letter does not match the extraction target, for example `D:\extraction\dir`, then the result of `path.resolve(extractionDirectory, entryPath)` would resolve against the current working directory on the `C:` drive, rather than the extraction target directory. Additionally, a `..` portion of the path could occur immediately after the drive letter, such as `C:../foo`, and was not properly sanitized by the logic that checked for `..` within the normalized and split portions of the path. This only affects users of `node-tar` on Windows systems. These issues were addressed in releases 4.4.18, 5.0.10 and 6.1.9. The v3 branch of node-tar has been deprecated and did not receive patches for these issues. If you are still using a v3 release we recommend you update to a more recent version of node-tar. There is no reasonable way to work around this issue without performing the same path normalization procedures that node-tar now does. Users are encouraged to upgrade to the latest patched versions of node-tar, rather than attempt to sanitize paths themselves.
<p>Publish Date: 2021-08-31
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2021-37713>CVE-2021-37713</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>8.6</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Local
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: Required
- Scope: Changed
- Impact Metrics:
- Confidentiality Impact: High
- Integrity Impact: High
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://github.com/npm/node-tar/security/advisories/GHSA-5955-9wpr-37jh">https://github.com/npm/node-tar/security/advisories/GHSA-5955-9wpr-37jh</a></p>
<p>Release Date: 2021-08-31</p>
<p>Fix Resolution (tar): 4.4.18</p>
<p>Direct dependency fix Resolution (semantic-release): 17.2.4</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with WhiteSource [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | True | CVE-2021-37713 (High) detected in tar-4.4.13.tgz - ## CVE-2021-37713 - High Severity Vulnerability
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/vulnerability_details.png' width=19 height=20> Vulnerable Library - <b>tar-4.4.13.tgz</b></p></summary>
<p>tar for node</p>
<p>Library home page: <a href="https://registry.npmjs.org/tar/-/tar-4.4.13.tgz">https://registry.npmjs.org/tar/-/tar-4.4.13.tgz</a></p>
<p>Path to dependency file: /package.json</p>
<p>Path to vulnerable library: /node_modules/npm/node_modules/tar/package.json,/node_modules/tar/package.json</p>
<p>
Dependency Hierarchy:
- semantic-release-17.2.3.tgz (Root Library)
- npm-7.0.10.tgz
- npm-6.14.11.tgz
- :x: **tar-4.4.13.tgz** (Vulnerable Library)
<p>Found in HEAD commit: <a href="https://github.com/turkdevops/update-electron-app/commit/1f829f24bbba287747c00a7861b5f4b687f8c054">1f829f24bbba287747c00a7861b5f4b687f8c054</a></p>
<p>Found in base branch: <b>master</b></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/high_vul.png' width=19 height=20> Vulnerability Details</summary>
<p>
The npm package "tar" (aka node-tar) before versions 4.4.18, 5.0.10, and 6.1.9 has an arbitrary file creation/overwrite and arbitrary code execution vulnerability. node-tar aims to guarantee that any file whose location would be outside of the extraction target directory is not extracted. This is, in part, accomplished by sanitizing absolute paths of entries within the archive, skipping archive entries that contain `..` path portions, and resolving the sanitized paths against the extraction target directory. This logic was insufficient on Windows systems when extracting tar files that contained a path that was not an absolute path, but specified a drive letter different from the extraction target, such as `C:some\path`. If the drive letter does not match the extraction target, for example `D:\extraction\dir`, then the result of `path.resolve(extractionDirectory, entryPath)` would resolve against the current working directory on the `C:` drive, rather than the extraction target directory. Additionally, a `..` portion of the path could occur immediately after the drive letter, such as `C:../foo`, and was not properly sanitized by the logic that checked for `..` within the normalized and split portions of the path. This only affects users of `node-tar` on Windows systems. These issues were addressed in releases 4.4.18, 5.0.10 and 6.1.9. The v3 branch of node-tar has been deprecated and did not receive patches for these issues. If you are still using a v3 release we recommend you update to a more recent version of node-tar. There is no reasonable way to work around this issue without performing the same path normalization procedures that node-tar now does. Users are encouraged to upgrade to the latest patched versions of node-tar, rather than attempt to sanitize paths themselves.
<p>Publish Date: 2021-08-31
<p>URL: <a href=https://vuln.whitesourcesoftware.com/vulnerability/CVE-2021-37713>CVE-2021-37713</a></p>
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/cvss3.png' width=19 height=20> CVSS 3 Score Details (<b>8.6</b>)</summary>
<p>
Base Score Metrics:
- Exploitability Metrics:
- Attack Vector: Local
- Attack Complexity: Low
- Privileges Required: None
- User Interaction: Required
- Scope: Changed
- Impact Metrics:
- Confidentiality Impact: High
- Integrity Impact: High
- Availability Impact: High
</p>
For more information on CVSS3 Scores, click <a href="https://www.first.org/cvss/calculator/3.0">here</a>.
</p>
</details>
<p></p>
<details><summary><img src='https://whitesource-resources.whitesourcesoftware.com/suggested_fix.png' width=19 height=20> Suggested Fix</summary>
<p>
<p>Type: Upgrade version</p>
<p>Origin: <a href="https://github.com/npm/node-tar/security/advisories/GHSA-5955-9wpr-37jh">https://github.com/npm/node-tar/security/advisories/GHSA-5955-9wpr-37jh</a></p>
<p>Release Date: 2021-08-31</p>
<p>Fix Resolution (tar): 4.4.18</p>
<p>Direct dependency fix Resolution (semantic-release): 17.2.4</p>
</p>
</details>
<p></p>
***
Step up your Open Source Security Game with WhiteSource [here](https://www.whitesourcesoftware.com/full_solution_bolt_github) | non_priority | cve high detected in tar tgz cve high severity vulnerability vulnerable library tar tgz tar for node library home page a href path to dependency file package json path to vulnerable library node modules npm node modules tar package json node modules tar package json dependency hierarchy semantic release tgz root library npm tgz npm tgz x tar tgz vulnerable library found in head commit a href found in base branch master vulnerability details the npm package tar aka node tar before versions and has an arbitrary file creation overwrite and arbitrary code execution vulnerability node tar aims to guarantee that any file whose location would be outside of the extraction target directory is not extracted this is in part accomplished by sanitizing absolute paths of entries within the archive skipping archive entries that contain path portions and resolving the sanitized paths against the extraction target directory this logic was insufficient on windows systems when extracting tar files that contained a path that was not an absolute path but specified a drive letter different from the extraction target such as c some path if the drive letter does not match the extraction target for example d extraction dir then the result of path resolve extractiondirectory entrypath would resolve against the current working directory on the c drive rather than the extraction target directory additionally a portion of the path could occur immediately after the drive letter such as c foo and was not properly sanitized by the logic that checked for within the normalized and split portions of the path this only affects users of node tar on windows systems these issues were addressed in releases and the branch of node tar has been deprecated and did not receive patches for these issues if you are still using a release we recommend you update to a more recent version of node tar there is no reasonable way to work around this issue without performing the same path normalization procedures that node tar now does users are encouraged to upgrade to the latest patched versions of node tar rather than attempt to sanitize paths themselves publish date url a href cvss score details base score metrics exploitability metrics attack vector local attack complexity low privileges required none user interaction required scope changed impact metrics confidentiality impact high integrity impact high availability impact high for more information on scores click a href suggested fix type upgrade version origin a href release date fix resolution tar direct dependency fix resolution semantic release step up your open source security game with whitesource | 0 |
730,572 | 25,179,783,775 | IssuesEvent | 2022-11-11 12:36:31 | YangCatalog/backend | https://api.github.com/repos/YangCatalog/backend | closed | Remove unused scripts from the sandbox directory | Priority: Low maintenance | As of writing, the sandbox directory contains 18 script files. Some of these were written as single use, others may no longer be needed. Each script needs to be checked for relevancy and scripts that are no longer relevant should be removed. | 1.0 | Remove unused scripts from the sandbox directory - As of writing, the sandbox directory contains 18 script files. Some of these were written as single use, others may no longer be needed. Each script needs to be checked for relevancy and scripts that are no longer relevant should be removed. | priority | remove unused scripts from the sandbox directory as of writing the sandbox directory contains script files some of these were written as single use others may no longer be needed each script needs to be checked for relevancy and scripts that are no longer relevant should be removed | 1 |
37,868 | 8,556,661,370 | IssuesEvent | 2018-11-08 13:49:54 | cakephp/cakephp | https://api.github.com/repos/cakephp/cakephp | closed | Regression with extensions and routing | Defect routing | This is a (multiple allowed):
* [x] bug
* [ ] enhancement
* [ ] feature-discussion (RFC)
* CakePHP Version: dev-master (3.x)
### What you did
Updating core:
```
- Updating zendframework/zend-diactoros (1.8.1 => 1.8.6): Checking out 20da13beba
- Updating cakephp/cakephp (3.6.4 => 3.6.11): Checking out ddbfcdb479
- Updating friendsofcake/bootstrap-ui (dev-develop b46d01e => dev-master b8e17bb): Checking out b8e17bbb40
- Updating cakephp/debug_kit dev-master (0e29ced => d5cd818): Checking out d5cd81818b
- Updating dereuromark/cakephp-geo dev-master (f6dae59 => 192517e): Checking out 192517e70d
- Updating dereuromark/cakephp-ide-helper dev-master (2731cc6 => a481a29): Checking out a481a29fe1
- Updating dereuromark/cakephp-setup dev-master (6336740 => 12adf45): Checking out 12adf45c4b
- Updating dereuromark/cakephp-test-helper dev-master (96339fe => 82e714c): Checking out 82e714c940
- Updating dereuromark/cakephp-tinyauth dev-master (9d5d22e => 479adb7): Checking out 479adb7bdb
- Updating dereuromark/cakephp-tools dev-master (0fce0f3 => 1fac073): Checking out 1fac073732
- Updating friendsofcake/search dev-master (7c14e0c => cc2decf): Checking out cc2decf52c
```
### What happened
Integration tests around `_ext` now fail. See travis: https://travis-ci.org/dereuromark/cakephp-sandbox/jobs/431208574
### What you expected to happen
There should be no regression from 3.6.4 to 3.6.11
It seems it happened in 3.6.5: https://github.com/cakephp/cakephp/compare/3.6.4...3.6.5
Most likely around the legacy router part - and might only be relevant for tests.
But there is also no indication how tests would need to be refactored to work in the patch(es) after 3.6.4.
Tests are using
```php
/**
* @return void
*/
public function setUp() {
parent::setUp();
Router::extensions(['rss']);
}
```
which worked fine so far. | 1.0 | Regression with extensions and routing - This is a (multiple allowed):
* [x] bug
* [ ] enhancement
* [ ] feature-discussion (RFC)
* CakePHP Version: dev-master (3.x)
### What you did
Updating core:
```
- Updating zendframework/zend-diactoros (1.8.1 => 1.8.6): Checking out 20da13beba
- Updating cakephp/cakephp (3.6.4 => 3.6.11): Checking out ddbfcdb479
- Updating friendsofcake/bootstrap-ui (dev-develop b46d01e => dev-master b8e17bb): Checking out b8e17bbb40
- Updating cakephp/debug_kit dev-master (0e29ced => d5cd818): Checking out d5cd81818b
- Updating dereuromark/cakephp-geo dev-master (f6dae59 => 192517e): Checking out 192517e70d
- Updating dereuromark/cakephp-ide-helper dev-master (2731cc6 => a481a29): Checking out a481a29fe1
- Updating dereuromark/cakephp-setup dev-master (6336740 => 12adf45): Checking out 12adf45c4b
- Updating dereuromark/cakephp-test-helper dev-master (96339fe => 82e714c): Checking out 82e714c940
- Updating dereuromark/cakephp-tinyauth dev-master (9d5d22e => 479adb7): Checking out 479adb7bdb
- Updating dereuromark/cakephp-tools dev-master (0fce0f3 => 1fac073): Checking out 1fac073732
- Updating friendsofcake/search dev-master (7c14e0c => cc2decf): Checking out cc2decf52c
```
### What happened
Integration tests around `_ext` now fail. See travis: https://travis-ci.org/dereuromark/cakephp-sandbox/jobs/431208574
### What you expected to happen
There should be no regression from 3.6.4 to 3.6.11
It seems it happened in 3.6.5: https://github.com/cakephp/cakephp/compare/3.6.4...3.6.5
Most likely around the legacy router part - and might only be relevant for tests.
But there is also no indication how tests would need to be refactored to work in the patch(es) after 3.6.4.
Tests are using
```php
/**
* @return void
*/
public function setUp() {
parent::setUp();
Router::extensions(['rss']);
}
```
which worked fine so far. | non_priority | regression with extensions and routing this is a multiple allowed bug enhancement feature discussion rfc cakephp version dev master x what you did updating core updating zendframework zend diactoros checking out updating cakephp cakephp checking out updating friendsofcake bootstrap ui dev develop dev master checking out updating cakephp debug kit dev master checking out updating dereuromark cakephp geo dev master checking out updating dereuromark cakephp ide helper dev master checking out updating dereuromark cakephp setup dev master checking out updating dereuromark cakephp test helper dev master checking out updating dereuromark cakephp tinyauth dev master checking out updating dereuromark cakephp tools dev master checking out updating friendsofcake search dev master checking out what happened integration tests around ext now fail see travis what you expected to happen there should be no regression from to it seems it happened in most likely around the legacy router part and might only be relevant for tests but there is also no indication how tests would need to be refactored to work in the patch es after tests are using php return void public function setup parent setup router extensions which worked fine so far | 0 |
642,470 | 20,888,573,337 | IssuesEvent | 2022-03-23 08:39:43 | bedita/manager | https://api.github.com/repos/bedita/manager | opened | Drag&drop files check size | feature Priority - Normal | When you drag & drop a file larger than allowed, in the drop area appears a `413 Request Entity Too Large` error.
We expect that the error is intercepted as done in #731, showing a proper warning dialog. | 1.0 | Drag&drop files check size - When you drag & drop a file larger than allowed, in the drop area appears a `413 Request Entity Too Large` error.
We expect that the error is intercepted as done in #731, showing a proper warning dialog. | priority | drag drop files check size when you drag drop a file larger than allowed in the drop area appears a request entity too large error we expect that the error is intercepted as done in showing a proper warning dialog | 1 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.