text
stringlengths
0
7.84M
meta
dict
Expendipedia Below you’ll find some general advice for your business. View answers to common questions on our FAQ page and find handy information and help guides on our help portal. If you need something else, feel free to reach out via our live support by clicking the chat icon in the bottom right of this page.
{ "pile_set_name": "Pile-CC" }
DOOH quickly and comprehensively informed the epidemic during Chinese New Year long holiday. DOOH quickly and comprehensively informed the epidemic during Chinese New Year long holiday. The coronavirus broke out unexpectedly before the Chinese New Year, in the late Jan 2020. This traditional travel rush is considered as the largest annual human migration in the world. The government needs to raise official alerts to the public. Driven by the China Advertising Association (CAA), many OOH vendors mobilized to use the advantages of their DOOH to assist the government in advocating for the epidemic in very short turn-around time. The Anti-epidemic propaganda was widely seen everywhere, from landmark OOH, airports, rail-stations, and even street furniture OOH. By Feb 20, over 400 OOH companies took part in, over 1.2 million panels/screens deployed. Total OOH advertising value is over 1.8 billion RMB. The efforts of this OOH vendors have been unremittingly appreciated and praised by CAA and the authorities. The advantages of outdoor media have also been demonstrated, while helps the general public. Due to restrictions on travel, the performance of OOH spending in Q1 will be significantly affected. Share This News: Search Archive Platinum Sponsors Gold Sponsors The World Out of Home Organization (previously FEPE International, established in 1959) is the only global Out of Home Association, working to promote and improve the OOH industry on behalf of our members.
{ "pile_set_name": "Pile-CC" }
Objective ========= Reduction of β-cell mass is increasingly recognized as one of the main contributing factors to the pathogenesis of type 2 diabetes. Chronic free fatty acid (FFA) exposure has been shown to induce endoplasmic reticulum (ER) stress that may contribute to promoting pancreatic β-cell apoptosis. In the present study, we first investigated whether anticonvulsant sodium valproate (VPA), at clinically relevant doses, protects pancreatic β-cell from palmitate-induced apoptosis and the mechanism underlying anti-apoptosis. Methods and results =================== INS1 cells exposed to 0.25\~1.0mM palmitate for 24\~48h under serum-free conditions showed marked apoptosis in time- and concentration-dependent as assessed by CCK-8 assay, Hoechst 33342 / PI, flow cytometric cell apoptosis assay and electron microscopy. Palmitate triggered ER stress and apoptosis in INS1 cells as evidenced by increased mRNA levels of C/EBP homologous transcription factor (CHOP), activating transcription factor 4 (ATF4) and X box-binding protein 1 (XBP-1) in a time-dependent fashion. Western blot analysis also showed significant increase of CHOP and caspase-3 in protein level. We also found that palmitate activated GSK3β by inhibiting phosphorylation at serine 9. While chronic, not acute, 1\~2mM VPA and 2mM LiCl remarkable reduced palmitate-induced cytotoxicity. Furthermore, INS1 cells treated with 10\~20μM TDZD-8, a specific GSK3β inhibitor, also elicited cytoprotective responses against 0.25\~0.5mM palmitate for 6\~48h and decreased mRNA level of CHOP, but not ATF4 or XBP-1. The protein levels of CHOP, caspase-3 and GSK3β activity were remarkable reduced by co-treatment of INS1 cells with 0.25mM palmitate and 1mM VPA, compared with 0.25mM palmitate only. Finally, down-regulation of CHOP expression in INS1 cells by small interfering RNA (SiRNA) did not show apparent cytoprotective responses against 0.25mM palmitate. Conclusion ========== ER stress and GSK3β involved in palmitate-induced β-cell apoptosis, however, GSK3β other than ER stress is likely playing a more prominent role. Valproate protected pancreatic β-cell from palmitate-induced apoptosis and ER stress by inhibiting GSK3β.
{ "pile_set_name": "PubMed Central" }
June 21, 2010 Siege takes toll on Gaza children Got this in my mail the same day I began posting this page: Bit of a sick joke. The "International Fellowship of Christians and Jews" must be laughing all the way to the bank. Jews starved to death millions of Ukranian and German Christians, they killed over 1.5 million civilians in the Gulf War through starvation and disease (including 600,000 children) and perhaps as many in the subsequent Iraq war. Jews ran GW's administration and they are running Obama's foreign policy - and Jews are profiting from the destruction which they have caused: Now Jews are starving the Palestinians and the only people that the brainwashed "Christian Zionists" of America can see are the Jews migrating into Israel to help with the slaughter of more Arabs and Muslims. Half of the billionaires in the US are Jews even though Jews comprise only 2% of the US population. Israel Shamir "Today, though barely 2% of the nation's population is Jewish, close to half its billionaires are Jews. The chief executive officers of the three major television networks and the four largest film studios are Jews, as are the owners of the nation's largest newspaper chain and most influential newspaper, the New York Times." Napoleon Bonaparte "By what miracle did whole provinces of France become heavily mortgaged to the Jews, when there are only sixty thousand of them in this country?" Archibald Maule Ramsay "When the debt grip has been firmly established, control of every form of publicity and political activity soon follows, together with a full grip on industrialists. The stage for the revolutionary blow is then set. The grip of the right hand of finance established the paralysis; while it is the revolutionary left that holds the dagger and deals the fatal blow. Moral corruption facilitates the whole process. By 1780 financial paralysis was making its appearance in France. The world's big financiers were firmly established. "They possessed so large a share of the world's gold and silver stocks, that they had most of Europe in their debt, certainly France." So writes Mr McNair Wilson in his Life of Napoleon, and continues on page 38: "A change of a fundamental kind had taken place in the economic structure of Europe whereby the old basis had ceased to be wealth and had become debt. In the old Europe wealth had been measured in lands, crops, herds and minerals; but a new standard had now been introduced, namely, a form of money to which the title 'credit' had been given." Nathan Rothschild "The to time buy is when blood is running in the streets." As they say, to the "victor belong the spoils". And even though today's "Jews" are not the descendants of the warlike Hyksos (the "Hebrews" of the Bible who conquered Egypt and ruled it until they were overthrown and enslaved by the Egyptians a hundred years later) they have certainly accepted the heart and soul of Judaism. David Ben Gurion "A Jew is anyone who says he is." Doesn't seem like very much of a "paradigm shift" to me. The American people are more apathetic than ever. In addition to sponsoring Nazi rallies the ADL defends perverts of all sorts - including child killing pedophiles. That's how it got it's start. Benjamin Freedman "I know and speak to these ambassadors in Washington and the United Nations -- and of the ninety-nine nations there, I've consulted with maybe seventy of them -- and when we go to war in Palestine to help the thieves retain possession of what they have stolen from these innocent people we're not going to have a man there to fight with us as our ally. " Benjamin Freedman, who was a Christian convert from Judaism, is in agreement with Mr. Napoleon Bonaparte. Napoleon Bonaparte "Jews are the master robbers of the modern age." But don't expect the the UN, which is a Jewish creation, to do anything substantial to help the Palestinians. It was the UN which imposed the sanctions on Iraq which killed 600,000 Iraqi children. Freedman made no distinction between Zionism and Judaism because, as a former Jew, he knew that former sprung from the latter. Nationalism by itself is not a bad thing. It makes sense that people who share the same language and culture should be able to govern themselves. And internationalism can be a good thing too - if it helps nations avoid conflict with one another and facilitates international trade. It is the religion of Judaism which has given both ideologies a bad name. Judaism turns nationalism in to genocidal Zionism and internationalism into genocidal Communism. To cover up their crimes against humanity Jewish Zionists and Jewish Communists play the victim while scapegoating non-Jews for their crimes against humanity. Curt Maynard "On December 20, 2007, after reading a post Bill White submitted on VNN insinuating that Ron Paul frequently met with so-called “racists,” and “anti-Semites,” at a restaurant in Washington DC, that I knew to be erroneous and written for no other reason than to harm Paul’s campaign, I sent Michael Rivero of Whatreallyhappened.com some information about Bill White which may have encouraged him to follow up on White’s most recent lies concerning this alleged relationship, which also allegedly included a couple of unnamed members of Stormfront, an alleged White Nationalist forum that has convinced me over these last several months is like Bill White’s website, Overthrow.com, a Mossad front operation. What do you think Mike Rivero found? Rivero found in a screen capture, that one of White’s boys is tied in with Jewish activism via something known as Megaphone, a tool disseminated to Jewish Internet activists enabling them to profoundly effect the results of certain Internet polls deemed to be of interest to Israel and Zionism. It appears that one of White’s [nee Weiss’] minions accidentally left his Megaphone icon on the screen capture, thus exposing him and White for what they really are, Jewish provocateurs, undoubtedly working for the ADL, SPLC or both! And if you’re paying attention you’ll also see and perhaps better understand how it is that white nationalism has received such a bad rap over the last several decades, people just like Bill Weiss, with covert media and law enforcement connections, doing everything they can to discredit our views and to alienate our fellow Americans against us." I'm paying attention, Curt. And to me you are smearing German Nationalism with American southern white racism exactly like Bill White and Frank Cohen et al. were doing. That's not hard to do these days since Germany lost the war. The German National Socialists made an alliance with the Japanese, who were commonly known as "Gooks" and "Japs" by the typical American G.I. They called the Germans "Krauts." The term "White Nationalism" is as ridiculous as the term "white race." Nationalism has to do with language and culture not with race and skin color. American racism stems from the religion of the Old Testament which was used as a pretext to enslave Africans by White Southern planters and Jewish slave traders before the American Civil war. Germany never had anything to do with the African slave trade. American Jewish Historical Society "Following his arrival in Newport, Duarte quickly redeemed himself and his family as Jews, assuming the name of Aaron, and with the help of his brother Moses set himself up in business....His business activities grew widely over the next 15 years to include whaling and a few ventures in the slave trade, as well as..." A "few ventures" in the slave trade? "Aaron Lopez (1731-1782) was the most notorious of the slave dealing Jews...Born in Portugal Lopez moved to Newport, Rhode Island in 1752, renounced his Marrano past and built an extensive trans-Atlantic slave dealing empire. Below are the recorded slaving voyages of Aaron Lopez in the years 1764 through 1774: Sloop Spry, Capt. Willaim Pinneger, July 16, 1764 - May 22, 1766, stopping at Barbados, Jamaica, and New York on the return voyage. The cargo included iron hoops, iron chains and slave shackles. Slaves sold: 57. There is only really one race and that is the human race. White skin is an adaptation to the ice age climate of Europe, as are blue eyes and fair hair. It helps to prevent rickets. Europeans got their genes for white skin from the Neanderthals. They got their high foreheads from people who migrated into Europe from Africa. "the Lagar Velho child's anatomy supports a scenario that combines a dispersal of anatomically modern humans out of Africa with mixing between that population and the archaic populations it encountered. (The African ancestry of early modern Europeans is reflected in their relatively long lower-leg bones, a tropical adaptation. Lagar Velho 1, however, has the short shins of the cold-adapted Neanderthals.)" Uncle Joe would have you to believe that "the Jews" are the Armenians and that "the Jews" are the Palestinians and forget about the real Palestinians and the real Armenians - not to mention the Ukranians and all of the other people the commies killed. Very conservative of him! Fake Opposition Update June 24, 2010 "The proof is in the pudding as can be seen here... the only ones advertising this vile video are the Zionists themselves. They are the only ones to benefit from such madness. They would love to see all Palestinian children self destruction it would facilitate their planned 'final solution'." Well, that definitely proves something: not that IDF snipers are justified in killing Palestinian kids as this article implies, but that some people claiming that they want peace (other that the peace of the grave for the Palestinians that they are trying to con) are phonies. We have to mention "final solution" which brings to mind the Holocaust propaganda which gives Jews the right to kill Palestinians (today's "Amalekites" who are out to get "the Jews"). We have to support the big stupid lie that Muslims are falling over each other to blow themselves up in order to kill Jews, Christians, people frequenting buildings in New York City, and Marines in their barracks. And We have to say "Zionists" as if Zionism has nothing to do with Judaism but is merely a Christian invention. Christians always make good scapegoats, don't they? And we need scapegoats if we are to make our Jewish prophecies come true. Don't we? "In the third rank we shall set up our own, to all appearance, opposition, which, in at least one of its organs, will present what looks like the very antipodes to us. Our real opponents at heart will accept this simulated opposition as their own and will show us their cards. " "Protocol 12, from the very curious forgery, Protocols of the Learned Elders of Zion." "A few weeks ago, another boy from Nablus, Muhammad Kuraan, made headlines when the Israeli army presented him to the media as a child who had been dispatched to blow himself up at an Israeli roadblock. However, when the boy returned home, he reportedly told his family and relatives "Jews told me to do this or else they would kill me." "When we look at the highest authority in Islam, the Quran, we find nothing in it endorsing rewards for suicide. Instead we find the strongest condemnation with severe punishments for those who commit suicide. When we look at Hadiths, which after the Quran is second in authority in Islam, we find nothing in the authentic Bukhari and Muslim Hadiths endorsing suicide. Instead we find strong condemnation for it. " "Numerous reports detailing how bombs were planted by the occupational forces in car vehicles, soldiers enticing Iraqi children with candy and then immediately rushing out of the area after setting off bombs, trucks used by Iraqis to carry fruits and vegetables stopped at check points only to have bombs stuck in their barrels by soldiers, Mossad agents carrying out fake suicide bombings, Israelis wiring retarded Palestinian boy for remote detonation to be labeled a suicide bombing, etc. If these incidents were not found to be what they were our too compliant media would have reported them as suicide killings." "The truck that blew up the Marine Barracks was loaded with 666 pounds of enhanced RDX "rag bombs." The Israelis call RDX, "rag bombs," because they use it to kill "rag-heads" or to blame bombings on "rag-heads." Also, the "safest" way to handle it is in "rags" that have been soaked in RDX and dried. Their planted bombs often look like a pile of dirty "rags." The only active sources of RDX in 1983 were the United States, Canada, France, Sweden, China - and Israel. But even 666 pounds of RDX (the most powerful, non-nuclear explosive in the world) couldn't have done the damage caused by "The largest non-nuclear explosion in history." Only "enhanced RDX," an Israeli specialty, could have caused that holocaust"
{ "pile_set_name": "Pile-CC" }
Masao Komatsu is a Japanese actor and comedian. Selected filmography Films Kaiju funsen–Daigoro tai Goriasu (1972) Pink Lady no Katsudō Daishashin (1978) Station (film) (1981) Izakaya Chōji (1983) University of Laughs (2004) Journey to the Shore (2015) Television Hissatsu Shiokiya Kagyō (1975) as Mamekichi Edo no Uzu (1978) Ōedo Sōsamō (1990) Sōri to Yobanai de (1997) Ōoka Echizen (1991-99) References External links NHK人物録 小松政夫/Masao Komatsu Category:Japanese male actors Category:Japanese comedians Category:1942 births Category:Living people
{ "pile_set_name": "Wikipedia (en)" }
Golan Heights – Join statement by Belgium, France, Germany, Poland and the United Kingdom 26 March 2019 On behalf of France, Germany, Poland, the United Kingdom and Belgium, we would like to make a brief statement on the occupied Golan Heights, in the context of the US Presidential Proclamation issued yesterday stating that the United States recognizes that the Golan Heights are part of the State of Israel. Our position on the status of the Golan Heights is well-known, and we would like to make clear that this position has not changed. In line with international law, and relevant Security Council resolutions, notably Resolutions 242 and 497, we do not recognize Israel’s sovereignty over the territories occupied by Israel since June 1967, including the Golan Heights, and we do not consider them to be part of the territory of the State of Israel. Annexation of territory by force is prohibited under international law. Any declaration of a unilateral border change goes against the foundation of the rules-based international order and the UN Charter. We raise our strong concerns about broader consequences of recognizing illegal annexation and also about the broader regional consequences./.
{ "pile_set_name": "OpenWebText2" }
I read the L is supposed to have some great improvements with ART. Has anyone tried using ART with the rooted debloated/deodexed ROMs? What differences did you notice? Sent from my SM-G900V using XDA Free mobile app I used ART on the stock rom, rooted, and the only difference I saw was a significant decrease in the available memory (internal). I went from about 86% free using Delvek to 76% free when I changed to ART. I used TiBu to clear Delvek but that didn't improve the available memory at all. Not sure why the big difference, but it was significant. XDA Developers was founded by developers, for developers. It is now a valuable resource for people who want to make the most of their mobile devices, from customizing the look and feel to adding new functionality.Are you a developer?
{ "pile_set_name": "Pile-CC" }
Pages Oxford | Shoe Unboxing Thursday, December 18, 2014 When I saw these beauties in the shop I knew there was no way I was walking without them. Even though I had originally made a pact with myself that I wasn't under any circumstance going to buy anything. . .oops. These little booties come in a rich wine color and adorned with a gold brass buckle which I personally find so fitting for the holidays. Don't you think? I typically don't go for such a short chunky heel because 5'10 obviously isn't tall enough as I always found them a tad bit silly looking. But, in this case I find them completely adorable and I find that it adds so much more character to them. Oh yeah, and more importantly you don't have to worry about wobbling around because these bad boys are super easy to walk in. No more "Ooops I dropped my hot chocolate on your designer gown" incidents. I on the other hand am still waiting for that incident to happen to me as I've never been invited to a Christmas party before. *glares out into the crowd* Any offers? Every time I wear these boots I feel like I belong at Oxford University. Walking on the cobblestones of England and sipping butterbeer. Rushing to class and running clumsily in the corridors searching for the Sorcerers Stone. Studying in the library researching Basilisks. Why I haven't received my acceptance letter is beyond me. . .
{ "pile_set_name": "Pile-CC" }
Share Abstract Following the entry into force of the Paris Agreement in November 2016, governments around the world are now expected to turn their nationally determined contributions into concrete climate policies. Given the global public good nature of climate change mitigation and the important cross-country differences in marginal abatement costs, distributing mitigation efforts across countries could substantially lower the overall cost of implementing climate policy. However, abating emissions abroad instead of domestically may face important political and popular resistance. We ran a lab experiment with more than 300 participants and asked them to choose between a domestic and an international reforestation project. We tested the effect of three informational treatments on the allocation of participants’ endowment between the domestic and the international project. The treatments consisted in: (1) making more salient the cost-effectiveness gains associated with offsetting carbon abroad; (2) providing guarantees on the reliability of reforestation programmes; (3) stressing local ancillary benefits associated with domestic offset projects. We found that stressing the cost-effectiveness of the reforestation programme abroad did increase its support, the economic argument in favour of offsetting abroad being otherwise overlooked by participants. We relate this finding to the recent literature on the drivers of public support for climate policies, generally pointing to a gap between people's preferences and economists’ prescriptions.
{ "pile_set_name": "Pile-CC" }
IFMA Names 2008 Fellows The International Facility Management Association (IFMA) announced earlier this week its 2008 class of IFMA Fellows. Bruce Kenneth Forbes of ARCHIBUS; Jon Eldon Martens, CFM®, CFMJ, of Sonoma County, CA, General Services; W. Kirtley Miller Jr., CFM, of Himes Associates; and Michael K. Schley of FM:Systems will receive the honor of IFMA Fellowship during the association’s Awards of Excellence banquet on October 17 in Dallas, TX. Established in 1992 to recognize members dedicated to IFMA and the facility management profession, the fellowship program creates a core of respected leaders who act as advisors to and ambassadors of the association. Being named an IFMA Fellow is the highest honor the association can bestow on a member. To date, 75 other facility professionals have received the distinction. “Everything about this group of IFMA Fellows is extraordinary, from their passion to their constant commitment to the profession and IFMA,” said John McGee, MBA, chairman of the IFMA board of directors. “Perhaps the most important and enjoyable task I’ll have at World Workplace will be announcing this group of fellows at the Awards of Excellence banquet.” With more than 100 years of combined facility management experience, the 2008 class of IFMA Fellows represents multiple industries and backgrounds. Bruce Kenneth Forbes, founder, president and CEO of ARCHIBUS, holds master’s degrees in architecture and computer science from Harvard and Cornell, where he has also held research and teaching positions. Forbes’ vision for the future of the industry led to the creation of the world’s first Computer Aided Facility Management solution in 1976. He has also held positions on the IFMA executive committee and board of directors. Jon Eldon Martens is the facilities operations division manager for Sonoma County, CA, General Services and the founder and president of JEMCOR, a facility management education and consulting firm. He is a lecturer and instructor at the University of California – Berkeley Haas School of Business. Working with IFMA and UC Berkeley, Martens was one of the founders of the association’s Recognized Certificate Program. W. Kirtley Miller Jr. is a program/project consultant at Himes Associates and program manager for the facility management certificate program at George Mason University. Miller worked as the manager of real estate for Verizon in Arlington, VA, when the company lost 650,000 square feet of office space during the 9/11 terrorist attacks. He led the planning team that provided emergency work locations for 2,300 displaced employees and created a long range plan for permanent work locations. Miller has also served as a regional vice president on the IFMA board of directors. Michael K. Schley is the founder and CEO of FM:Systems, a software company that helped pioneer facility management systems. As chair of the Task Force on CAD Layer Guidelines and the IFMA Task Group on Area Measurement Standards, his leadership has resulted in two essential standards critical to the profession. Schley holds a master’s degree in architecture and has served as a guest lecturer at numerous academic institutions, including Cornell, Michigan State and Brigham Young universities. To learn more about the IFMA Fellows program, or for a complete list of fellows, visit www.ifma.org/about_ifma/ifma_fellows.cfm. Featured Video Powered by highly advanced encryption and a software-based infrastructure, Seos secures trusted identities on any form factor and can be extended for applications beyond physical access control. Learn more at hidglobal.com/seos. More than a third have experienced absenteeism or impaired worker performance, and 31 percent have had an overdose, arrest, a near-miss or an injury because of employee opioid use, according to NSC survey. The company will expand its Nashville area operations for the second time in two years, creating 2,010 new jobs in the process. - Read: SmileDirectClub Investing $217M To Expand Middle Tennessee HQ at BusinessFacilities.com. Employees have been offered a position when they were underqualified most frequently in Charlotte, San Diego, Austin and Washington, DC, according to a new Robert Half survey. - Read: Companies Willing To Train Job Applicants Who Don’t Meet Requirements at BusinessFacilities.com. Knowledge Channels Join 25,000+ Subscribers & Get the latest from Facility Executive! Facility Executive is your one-stop source for information on quality operation, design and maintenance of facilities. Facility Executive offers a shared community of facility management experts who explore and analyze issues that affect your facility and its environment. Facility Executive is a specialized trade publication written and edited for corporate facility executives in all industry and service sectors whose responsibilities include purchasing, planning and approving products, services and materials for facility operations.
{ "pile_set_name": "Pile-CC" }
J.D. Drew heating up for Red Sox? APJ.D. Drew runs out a triple to lead off the game for the Boston Red Sox last night. He finished a double short of the cycle. Could this be J.D. Drew Time? That's the question, after watching him tear into the Baltimore Orioles last night with a triple, home run and single in his first three at-bats, keying the Red Sox to a win and allowing Jon Lester to collect a much-deserved victory. Drew now has at least two hits in three of his last five games, and has pushed his on-base percentage for the month of June over .420. Still, his power numbers (10 home runs, .489 slugging percentage) for the season don't yet have a boost from anything resembling a 2008 June, when Drew turned into the Teen Wolf of Baseball, hitting .337/.462//1.309 with 12 home runs and 27 RBI. Can we make that happen again, J.D.? It'd be fun to see maybe .300/.420/1.000 this July. After that, you can turn right back into Michael J. Fox, working walks like it's nobody's business. APBrian Roberts throws his bat after striking out against Jon Lester to end the fifth inning of last night's 4-0 Red Sox win. In all seriousness, it's hard to complain about much of anything about last night's game. Especially the pitching, considering Jon Lester again looked like an ace and Jonathan Papelbon tied Bob Stanley's team record with 132 career saves. Their career numbers against Baltimore? Lester's 8-0 with a 2.18 ERA in 10 starts and Papelbon is 20 for 20 on save opportunities with a 0.39 ERA. That's just mean. Two big concerns going forward: Mike Lowell's hip situation doesn't look good and Ramon Ramirez again struggled, failing to close out the game for the Red Sox when given a chance. After posting Nintendo numbers early in the year (four earned runs allowed in his first 26 innings), he has dropped back to earth in June, allowing seven hits and three home runs in eight innings. Why the long face, Ram-Ram?
{ "pile_set_name": "Pile-CC" }
Much of the tech world’s attention is focused on the Stop Online Piracy Act this week, with Wikipedia and others planning to black out their sites Wednesday to protest the bill and its companion Protect IP Act. Don’t look for Microsoft to join them, but the company is now weighing in on the issue — saying in response to an inquiry from GeekWire this afternoon that it doesn’t support SOPA. “We oppose the passage of the SOPA bill as currently drafted,” a Microsoft spokesperson says via email. “We think the White House statement points in a constructive way to problems with the current legislation, the need to fix them, and the opportunity for people on all sides to talk together about a better path forward.” That White House statement, issued this past weekend, cited problems including SOPA’s planned use of the Domain Name System to shut down sites found to be in violation of copyright laws. But administration officials also called online piracy “a real problem that harms the American economy” and encouraged opponents and supporters of SOPA and PIPA to work together to come up with constructive solutions. Microsoft has a multifaceted stake in the issue. The company operates major online sites and services such as MSN.com and Skype, but it also knows the challenges of piracy first-hand through Windows and other parts of its traditional business. Along with Apple, Adobe and others, the Redmond company is a member of the Business Software Alliance, which originally voiced its support for SOPA but has since softened its stance, saying that SOPA needs work and “could sweep in more than just truly egregious actors.” Opponents say SOPA goes too far by allowing the shutdown of sites accused of enabling copyright violations, which get an expanded definition under the bill. Google said today that it will put a message on its site on Wednesday highlighting its opposition to SOPA. Previously: Can this song help kill SOPA? ‘The Day the LOLcats Died’
{ "pile_set_name": "OpenWebText2" }
Junior College Sports Konta said: "I'm definitely recovering really well". However, 11th seed Kvitova broke again in the ninth game and saw out the win with an ace on her second match point. "It was very nice that he sat in the box for my match". "I hope it will stay with me forever until my career is finished". Because tennis isn't everything. The news comes on the same day that teenage striker Abraham penned a new long-term contract with his parent club that will keep him a Chelsea player for another five years until 2022. Chelsea want Abraham to complete at least two full seasons on loan before he is considered for a first-team squad place at Stamford Bridge. Swansea have managed to get a deal over the line, however, giving the 19-year-old a chance to get some top-flight experience under his belt before returning to ... In the summer of 2016, the Russian AS Monaco Vice President had already accounted for the departures of Bernardo Silva, Valère Germain and Nabil Dirar at the end of the 2016/17 campaign, and that was before their mythical season even began. Collison, 29, has spent the past three seasons in Sacramento. According to ESPN's Adrian Wojnarowski , "Free agent guard Darren Collison has agreed in principle to a two-year, $20 million deal with the Indian Pacers". After three years with the Sacramento Kings , Collison returns to the Pacers, where he was part of playoff success from 2010 to 2012. Collison is definitely a player worth eight figures annually, but not exactly a player a team can build a contender around. Brown finished with a double-double of 29 points and 13 rebounds, while Tatum had 21 points and seven boards. Well, Tatum got off to a solid start in his National Basketball Association debut for the Celtics in the Summer League opener on Monday night. They made that known. At the end of the day it was going to be the team that I felt most comfortable with and Atlanta - Atlanta chose to go another direction. They traded Dwight Howard to Charlotte and wouldn't get into a bidding war with the Nuggets to retain Millsap as they shift gears after seeing their win total drop from 60 in 2014-15 to 48 in 2015-16 and 43 last season. Woods, 41, said he was getting professional help to manage back pain, a sleep disorder and his medications in a June 19 tweet . Woods' agent confirmed that the 14-time major victor, who had back surgery in April, was seeking in-patient treatment. Boston has stockpiled a ton of assets. Resulting anger has mounted. Last season, when asked to choose between Brady and Green Bay Packers quarterback Aaron Rodgers by a Jazz reporter, Hayward replied, "Aaron Rodgers". Sports Since the two players became available, they grabbed the interest of the league quickly. They simply had to fleece the Nets back in 2013. How will they feel if Boston gets Hayward or Griffin in addition to George? Carmelo Anthony - The Celtics need more shot ... The auto club notes the Great Lakes region is finally experiencing some price stability, and Michigan's price drop over the past week and the last month is the second-largest in the nation. Market analysts agree that slumping global oil prices, which are the biggest factor in American gasoline prices, are keeping prices historically low. The Bianconeri are known to be on the lookout for midfield additions this summer, with the versatility of Ceballos (he can play through the middle or on the wing) leading Max Allegri's side to jump in with an initial bid this afternoon. "I want to relax and go unnoticed for three weeks". The winner was selected by UEFA's team of technical observers, who were looking for players to display exceptional skills, make decisive contributions, show a positive attitude and, crucially, dedicate their ...
{ "pile_set_name": "Pile-CC" }
Q: Linha com valor NULL é desconsiderada pela função SUM? Participei do concurso do IFNMG, prova elaborada pela Fundação CEFET. Resolvi a questão a seguir e marquei a letra C, mas o gabarito diz que o correto é a letra A. Questão 31 Considere que a tabela NotaFiscalItem está armazenada em um sistema gerenciador de banco de dados (SGBD) relacional, contendo os seguintes dados. Tabela: NotaFiscalItem Em seguida, observe o comando SQL apresentado a seguir. Figura: Comando SQL O resultado produzido pela execução do comando SQL, ao considerar os dados apresentados na tabela NotaFiscalItem, é a) 28,00 7,00 48,00 b) 28,00 NULL NULL c) 48,00 7,00 48,00 d) 48,00 0,00 55,00 e) NULL NULL NULL A instrução "sum(qtd_item*vlr_unitario - vlr_desconto)" não soma a primeira linha por conta do "null" na coluna "vlr_desconto"? Mas isso não depende do SGBD que se está utilizando? A: Na documentação de funções agrupadas do MySQL: ... group functions ignore NULL values. OU em tradução livre: ... funções agrupadas ignoram valores NULOS. No SQL Server o NULL de colunas agrupadas invalida a expressão, então para responder com precisão essa questão seria necessário saber qual o SGBD utilizado, porém segundo esta página (a qual não posso atestar com 100% de certeza a veracidade), no padrão ANSI todas as funções agregadas, exceto COUNT vão ignorar os valores NULL ao computar seus resultados. Schema (MySQL v5.7) CREATE TABLE NotaFiscalItem( nro_nota_fiscal int, nro_item smallint, qtd_item smallint, vlr_unitario numeric(7, 2), vlr_desconto numeric(7, 2) ); INSERT INTO NotaFiscalItem VALUES (1, 1, 2, 10.00, NULL), (1, 2, 2, 7.50, 2.00), (1, 3, 1, 20.00, 5.00); Query #1 SELECT SUM(qtd_item * vlr_unitario - vlr_desconto), SUM(vlr_desconto), SUM(qtd_item * vlr_unitario) - SUM(vlr_desconto) FROM NotaFiscalItem; Resultado: | SUM(qtd_item * vlr_unitario - vlr_desconto) | SUM(vlr_desconto) | SUM(qtd_item * vlr_unitario) - SUM(vlr_desconto) | | ------------------------------------------- | ----------------- | ------------------------------------------------ | | 28 | 7 | 48 | Você pode verificar a execução no DB Fiddle. A: Para criar o banco de dados: CREATE TABLE NotaFiscalItem ( nro_nota_fiscal integer, nro_item smallint, qtd_item smallint, vlr_unitario numeric(7, 2), vlr_desconto numeric(7, 2) ); INSERT INTO NotaFiscalItem (nro_nota_fiscal, nro_item, qtd_item, vlr_unitario, vlr_desconto) VALUES (1, 1, 2, 10, NULL); INSERT INTO NotaFiscalItem (nro_nota_fiscal, nro_item, qtd_item, vlr_unitario, vlr_desconto) VALUES (1, 2, 2, 7.50, 2.00); INSERT INTO NotaFiscalItem (nro_nota_fiscal, nro_item, qtd_item, vlr_unitario, vlr_desconto) VALUES (1, 3, 1, 20.00, 5.00); Transcrevendo o SELECT: Select sum(qtd_item*vlr_unitario - vlr_desconto), sum(vlr_desconto), sum(qtd_item*vlr_unitario) - sum(vlr_desconto) from NotaFiscalItem Ao executar isso (no MySQL 5.6), veio essa resposta: 28 7 48
{ "pile_set_name": "StackExchange" }
Q: How to generate a dict from string separated by semicolon? I am using Beautifulsoup to search for a specific number in HTML but got stuck here. The raw data is: <div class='box_content' hn_bookmark='true' ng_init=" bookmarked=false; bookmark_id=''; bookmarks_path='/en-US/bookmarks'; bookmarkable_id='000000'; bookmarkable_type=''; "> and I want to extract the "bookmarkable_id". bsobj = BeautifulSoup(text,"html.parser") questionID_line = bsobj.find("div",{"class":"box_content"})['ng_init'] It returns to me a string with words separated by semicolons: bookmarked=false; bookmark_id=''; bookmarks_path='/en-US/bookmarks'; bookmarkable_id='793447'; bookmarkable_type='Question' But I don't know how I can extract from here. Please help! A: Try this: data = "bookmarked=false; bookmark_id=''; bookmarks_path='/en-US/bookmarks'; bookmarkable_id='793447'; bookmarkable_type='Question'" fields = {} for f in data.split('; '): k , v = f.split('=') fields[k] = v.strip("'") print(fields) Gives: {'bookmarked': 'false', 'bookmark_id': '', 'bookmarks_path': '/en-US/bookmarks', 'bookmarkable_type': 'Question', 'bookmarkable_id': '793447'}
{ "pile_set_name": "StackExchange" }
Soaring carbon emissions will amplify the risk of conflict, hunger, floods and mass migration this century, the UN’s expert panel said Monday in a landmark report on the impact of climate change. Left unchecked, greenhouse gas emissions may cost trillions…
{ "pile_set_name": "Pile-CC" }
[Cutaneous squamous cell carcinoma]. Squamous cell carcinoma (SCC) of the skin accounts for 20 % of non-melanoma skin cancer and is one of the most frequent types of cancer in Caucasian populations. Diagnosis is based on the clinical features and should be histopathologically confirmed to adequately address the prognosis and treatment. Complete surgical excision with histopathological control of excision margins is the gold standard in the treatment of primary SCC. Sentinel lymph node biopsies (SLNB) can be considered in SCC with a tumor thickness of >6 mm but there is currently no evidence concerning prognostic and therapeutic effects. Radiotherapy can be discussed as an alternative to surgery for inoperable tumors or as adjuvant therapy for a high risk of recurrence. In SCC with distant metastases various chemotherapeutic agents are used; however, there is no standard regimen. The epidermal growth factor receptor (EGFR) inhibitors and immune checkpoint blockers can be discussed as treatment options, preferentially in clinical trials. There is no standard follow-up schedule for patients with SCC. A risk-adapted follow-up is recommended based on the risk of metastatic spread or development of new lesions primarily by dermatological control and supplemented by ultrasound investigations in high risk patients.
{ "pile_set_name": "PubMed Abstracts" }
Q: Disabling WebSockets compression and xor mask on the Browser side I use "WS" library in my NodeJS project. It is possible to disable compression? I'm trying to do this on the server side ws = new WebSocketServer({port: 8889, perMessageDeflate: false}) but it does not work Accept-Encoding: gzip, deflate Sec-WebSocket-Extensions: permessage-deflate And I have no idea what can i do to disable xor mask. A: You have disabled per message deflate in the server, however you are seeing that the client is announcing its capability of handling it, this is normal. I mean, that HTTP headers you have pasted are from the client request (because a server does not send Accept-* headers). To know if compression was finally selected as extension for the connection, check the Sec-WebSocket-Extensions header in the server response. XOR masking cannot be disabled, it is required from client to browser to mitigate some possible attacks and proxies doing funny things: https://softwareengineering.stackexchange.com/questions/226343/is-masking-really-necessary-when-sending-from-websocket-client
{ "pile_set_name": "StackExchange" }
Picture: Pablo Iglesias, secretary general of Spain’s new left Podemos party, greets his supporters as he arrives to speak at a party conference in Barcelona last month. The prospect of populist left election victories in Greece and Spain this year is real. So real, in fact, that the survivors of the old, un-populist left from the 20th century have concluded, in advance, that disaster looms. All across the social media you can, as you search for the words Podemos and Syriza, read as many denunciations from the hard left as you can critiques from the right. Though insignificant in themselves, the pained outrage of these far-left groups is a signal that something big and real is happening in European politics. To me it looks like a new form of social democracy is being born – and one moulded to a very different set of priorities to those that guided Labour and its socialist variants in the 20th century. It was the Bloomberg journalist Joe Wiesenthal who invented the term for it: “Tsiglesias” – a portmanteau for the Syriza leader Alexis Tsipras and Podemos leader Pablo Iglesias. But what does Tsiglesias actually stand for? When in office how might it react? And if successful, is it replicable across Europe? Iglesias’s party did not exist 18 months ago; Syriza – a more conventional product of the new left of the 1970s – has evolved both its politics and structure rapidly as the prospect of coming to power looms. But if you look at their respective manifestos, they are moulded around the 2014 Euro election programme of the European left, whose 52-strong group in the European parliament is four members bigger than Ukip’s. Debt restructuring At the centre of the economic policy is debt restructuring: the proposal that the scale of debt reduction facing most of peripheral Europe is so large that it will suppress growth for a generation. A reversal of austerity, some mild fiscal expansion and the reversal or end of privatisation programmes completes the basic list. Though this runs at odds with both the principles and rules of the eurozone, almost none of the new-left populist parties wants to leave it. Instead they propose the ECB becomes a true lender of last resort, using quantitative easing to revive consumption and manage debt forgiveness. The new-left parties, in other words, want Europe to become a Keynesian fiscal union with a high welfare state. It is not the status quo but it is not what the Marxist professors who staff their economics departments dreamed of when they were on the streets in 1968 either. The apoplectic reaction of free-market commentators to the possibility of a Syriza government in Greece, or a Socialist-Podemos coalition in Spain later this year, poses an interesting question, whose answer could shape politics in Britain just as much as in the Euro periphery. Is a Keynesian welfare state, committed to public ownership and deficit-financed growth either possible, or permissible, in the European Union? So far, much of what’s driven Euroscepticism has been the desire of conservative voters in various EU countries to take back control of issues important to the right: migration, business regulation, crime, agriculture and foreign policy. There’s been barely a glimmer of opposition to the EU project among traditional social democrats. Taking leads from Greece and Spain But the electoral logic of Greece and Spain may be about to change that. Within a month, Tsipras stands a 50:50 chance of becoming the Greek prime minister. Though he is ready for a prolonged negotiation with Frankfurt and Washington over debt reduction, he is pledged to cancel the austerity measures imposed by Greece’s creditors on day one. A clash with the ECB, the commission and probably parts of the Greek state are pretty likely thereafter – and the outcome will be watched closely across Europe. Because if basic Keynesianism and an expanded welfare state are not permissible, and if the European institutions are seen actively to collude with attempts to sabotage them, a change of sentiment about the EU on the centre-left might follow. If you study the programme of the new European left, much of it is not economic. Podemos, which has recruited thousands of young activists from the indignado protest movement of 2011, led its manifesto with demands to repeal anti-protest laws, for abortion rights and for the right of Spanish regions independence. Syriza’s 2012 programme emphasised – as well as anti-austerity policies – demands like drug decriminalisation, de-militarisation of the police, withdrawal from Nato and recognition of Palestine. The principles that radicalised young people across Europe in 2011-12, and which have continued to guide numerous protest movements since then, are summed up by the oft-repeated phrase: “I don’t want to live in an economy”. The one thing Bolshevism had in common with mainstream social democracy was that they were defined by economic programmes. The new populist left has begun from the recognition that – in the highly marketised, globalised and granular economy created in the past 25 years – social justice begins at a small scale and from below.It is as much about restoring the power of agency to deprived and shattered communities, and autonomy to peoples lives, as it is about delivering percentage points against various economic measures. And the absolute baseline for the youth swarming into the new left parties is that the state must get out and stay out of their private lives. What about at home? In Britain – beyond the one-man turbulence that is Russell Brand – the only political force that understood the power of these issues was the Radical Independence Campaign in the Scottish referendum. It promoted the idea that Scotland should become the “warm south of Scandinavia” – and if you think about it, all Podemos and Syriza are really trying to do is bring the Scandinavian model to the Aegean and the Med. But here’s the problem: in a neoliberal world, even the basic welfare state can look revolutionary. Most projections for the survival of free-market capitalism involve the creation of greater inequality, a smaller state sector and a lower-paid workforce. It is, then, most likely not over some prolonged debt restructure process that a populist left government in Greece or Spain might clash with the Euro authorities and the local elites; rather, on “Scandinavian” issues like police demilitarisation, abortion, the re-regulation of the labour market or an attempt to provide basic humanitarian solutions for illegal migrants clamouring at the borders of both countries. For more than a decade, radical demonstrators have held up banners saying “Another World Is Possible”. This year we might get to see what phase one of that other world looks like. The question it poses for the EU institutions and the elites who run them is existential: is another strategy even tolerable? The answer will make 2015 a critical year for the wider left in Europe. The whole crisis and decline of European social democracy after 2008 was triggered by the conviction that alternatives to austerity do not exist. For politicians like Ed Miliband, Francois Hollande and for that matter Jim Murphy, it is not the fate of Syriza they should be focused on but the fate of their own sister social-democratic party in Greece, Pasok. It, currently, stands on 4.6 per cent. Two years ago it ruled Greece. However inexperienced, naive, and lacking in machine-party discipline the new populist left in Europe is, it is setting the agenda. Follow @paulmasonnews on Twitter
{ "pile_set_name": "OpenWebText2" }
The recent AIPAC meeting brought four of the five remaining presidential candidates – all except Bernie Sanders – to Washington to grovel at the feet of the Israel lobby, a depressing scene, says ex-CIA analyst Paul R. Pillar. By Paul R. Pillar A depressing sameness characterized the speeches of presidential candidates to the recently concluded exercise in fervid conformity that is called the AIPAC annual meeting. Although the event and the organization ostensibly are dedicated to support for, and friendship with, the state of Israel, in practice the dedication was instead to the policies of the right-wing government that currently holds power in Israel, which is something different. There was nothing approaching a free and open discussion of what policies would be in the interest of the peace and security of Israel and that a true friend of Israel would support. There was no mention of the occupation that, in the course of nearly half a century, has become Israel’s defining characteristic and the single biggest barrier to Israel being able to enjoy a future as a democratic and Jewish state. The Republican candidates all found somewhat different ways to say they would destroy the agreement that limits Iran’s nuclear program. Such destruction would, of course, serve the purpose of the Netanyahu government in helping it to fulminate endlessly about Iran as the “real problem” in the Middle East, taking attention away from every other problem; maybe we would even see a return of cartoon bombs to the rostrum of the United Nations. But the candidates did not explain how destroying the agreement, which would mean the Iranians could spin as many centrifuges as they want, enrich as much uranium as they want to whatever level they want, and kick out all of the extra international inspectors provided for in the agreement, would somehow be in the interest of Israeli security. As leading Israelis who have dedicated careers to their nation’s security recognize , it would not be. Perhaps one question of interest regarding the candidates’ otherwise drearily similar speeches to the AIPAC meeting was who, in this contest in pandering, could out-pander the rest. Donald Trump made a go of it, evidently erasing some of the suspicions he had aroused among this constituency with earlier sinful suggestions such as that a posture of neutrality would be needed for the United States to do something about the Israeli-Palestinian conflict. No such lines were crossed in Trump’s speech at AIPAC, and he got a positive reception that would remind some observers of how earlier notorious demagogues could whip up frenzy in a crowd. But the prize for out-pandering the others should go to Ted Cruz’s speech , as measured by sheer shamelessness in using extreme and outright deceitful rhetoric. Speaking after Trump, Cruz made sure that no one would ever suspect him of falling into that disgraceful state known as neutrality or to do anything that might lead to creation of a Palestinian state. To make doubly sure no one missed the point, in the second sentence of his speech, right after saying “God bless AIPAC” and stating how thrilled he was to be there, Cruz declared that “Palestine has not existed since 1948.” And if any resolution on Palestinian statehood were to come to a vote at the United Nations, said Cruz, “I will fly to New York to personally veto it myself.” The thesaurus of extreme terminology at Cruz headquarters must be terribly dog-eared after preparing this speech, including, among much else, the portions about the Iran nuclear agreement. According to Cruz, the agreement “is Munich in 1938” and risks “catastrophic consequences” by “allowing a homicidal maniac to acquire the tools to murder millions” — never mind that the agreement is all about taking tools away from the Iranians. Among the cascade of deceitful references throughout the speech is a bizarre comparison in which Cruz says that the nuclear agreement “gives over $100 billion to the Ayatollah Khomeini, the world’s leading state sponsor of terrorism,” and that this “dwarfs the $3 billion we give each year to the nation of Israel,” a difference that is “unconscionable” and “fundamentally immoral.” No attention is paid to the fact that U.S. aid to Israel comes straight out of the pockets of American taxpayers whereas frozen assets that have been unfrozen under the nuclear agreement already belonged to the Iranians and the United States is not “giving” Iran any of this, that the amount of unfrozen assets not already spoken for to settle existing accounts is far less than $100 billion, and that Ayatollah Khomeini has been dead for 26 years. The one remaining presidential candidate who did not speak to the AIPAC meeting was Bernie Sanders. Sanders, campaigning elsewhere, instead submitted a written statement that addresses important issues involving Israel. Sanders, who happens to be the only Jew in the presidential race, notes at the outset of his statement that he is the only candidate with personal ties to Israel, having spent time there on a kibbutz as a young man. The leading issue that Sanders addresses in the statement is the Israeli-Palestinian conflict. What he says about it is vastly different from what the other candidates, and especially the Republicans, said about it in their speeches. What he says also should be seen as eminently reasonable by those who genuinely want peace to replace that conflict and by those who are true friends of Israel. It is a well-balanced statement that recognizes that peace “will require compromises on both sides” and will mean “security for every Israeli from violence and terrorism” as well as “security for every Palestinian.” Sanders does not shy away from using the word “occupation,” and he notes that “it is important to understand that today there is a whole lot of suffering among Palestinians and that cannot be ignored. You can’t have good policy that results in peace if you ignore one side.” The depressing sameness of speeches at the AIPAC meeting suggests that with the election of anyone other than Sanders, there will be a depressing sameness in U.S. policy toward Israel and the Israeli-Palestinian conflict beginning next January. That will mean Israel continuing down the path of apartheid and isolation, with more endless conflict and more shedding of blood of Israelis as well as Palestinians, and Israel moving farther away from ever being a peaceful, democratic, Jewish state. Barack Obama still has almost ten months to shift that momentum at least somewhat. He already has shown a willingness and ability to defy the rightist Israeli government and the lobby that works on its behalf when he waged the political battle needed to bring the Iran nuclear agreement into existence. He has given ample indication that he fully understands the underlying issues. He has given other indications of being able and willing to set some new directions notwithstanding the longevity of old, stale, and destructive directions — notably with his changing of U.S. policy toward Cuba. And he never needs to run in any election again, not even for dog-catcher. Mr. Obama should, sometime before the end of summer, give a major speech that lays out the main terms of what knowledgeable observers of the Israeli-Palestinian conflict have long understood to be necessary parts of any final settlement of that conflict. This would not preclude necessary negotiation of details between the parties, but would lay out the framework for a two-state solution that has been clear for some time. You might call this an updated version of the Clinton parameters. Then in the autumn the United States should not just not veto, and not just accept, but should sponsor and promote a resolution of the United Nations Security Council that incorporates this framework. Mr. Obama would be able to do this secure in the knowledge that he can make a case that is strong and truthful on multiple grounds. This step certainly would be very much in U.S. interests, given the damage to those interests of being associated with the continued occupation. It would be in the interests of justice and self-determination for the Palestinian people. And it would be in the interests of Israel, by helping to pull Israel off its current self-destructive path. The rightist government in Israel would scream, as would the U.S. lobby that works on its behalf. Until and unless there is significant political change in Israel, the combination of religious rationalization, economic greed, and government-stoked fear that has powered the tenacious clinging to conquered territory will still be a major barrier to a peaceful path. But a change in U.S. direction — if speeches and resolutions are backed up with corresponding use of material U.S. leverage — might at least lead Israeli voters and true friends of Israel elsewhere to see that the days of U.S. abetting of the self-destructive behavior are over, and to acknowledge that the conflict with the Palestinians over land and sovereignty cannot indefinitely be wished or bludgeoned away. And that would mean the new U.S. president, whoever he or she is, would be facing a new situation and new possibilities, different from the one that persists today. To return in the end to the United States’ own interests — as we always should — the slogan that the Trump campaign uses, about making America great again, has some relevance. A really great nation does not display the obsequiousness toward another government that was on display in the arena where AIPAC met, and people who want to lead a great nation should not display it either. We should ask, as President Bill Clinton did after his first meeting with a bullying Benjamin Netanyahu, “Who’s the [expletive deleted] superpower here?”
{ "pile_set_name": "OpenWebText2" }
565 F.Supp. 430 (1983) Phill Elvin GRANT, Jr., Plaintiff, v. Robert Grant PITCHFORD, et al., Defendants. Civ. No. 81-0629-G(M). United States District Court, S.D. California. May 2, 1983. Leyon D. Sakey, Susan Hildebrand, San Diego, Cal., for plaintiff. Peter K. Nunez, U.S. Atty., Peter W. Bowie, Chief Asst. U.S. Atty., San Diego, Cal., for defendants. MEMORANDUM DECISION GILLIAM, District Judge. On June 5, 1981, plaintiff Grant caused to be filed in the Superior Court for the State of California a "complaint for damages for assault & battery, conspiracy, dereliction of duty & intentional infliction of emotional distress." Named as defendants in that complaint were Robert Grant Pitchford, John F. Kelley, William C. Hughes, Jr., and some fictitiously named persons. The first cause of action in plaintiff's complaint alleged that defendant Pitchford committed a battery upon plaintiff by striking plaintiff with a hammer. In that same cause of action, plaintiff also alleged that defendant Kelley ratified the acts of defendant Pitchford by failing to take any action against him. Further, Mr. Grant alleged that defendant Hughes authorized the acts of defendant Pitchford "by allowing *431 him to continue in a position of authority even though defendant Hughes knew or should have known" of defendant Pitchford's alleged violent propensities. The second cause of action set out in plaintiff's state court complaint alleged that defendants Hughes and Kelley "conspired ... to take no action" to stop defendant Pitchford or to punish him for his alleged conduct. Plaintiff Grant also alleged that defendant Hughes ratified defendant Pitchford's alleged acts by not reporting them to superiors. Plaintiff's third cause of action alleged that defendant Hughes negligently supervised defendant Pitchford and that the breach of that duty owed to plaintiff resulted in the injuries he allegedly sustained. Following delivery of the state court process to one or more of the defendants, on July 8, 1981 counsel for defendants filed a petition for removal of the suit to this court. The petition recited in relevant part that defendant Hughes was at all pertinent times a member of the Armed Forces serving as the Commanding Officer of the USS FLASHER (SSN 613). Removal authority and jurisdiction was therefore invoked under 28 U.S.C. §§ 1442, 1442a. Subsequently, the defendants filed a motion to dismiss or for summary judgment. In that motion the defendants first made it a matter of record that plaintiff Grant was a third class petty officer in the U.S. Navy, on active duty and stationed aboard the USS FLASHER. The moving papers set forth that defendant Hughes was Commanding Officer of the FLASHER; established that defendant Kelley was a junior officer on board the FLASHER; and showed that defendant Pitchford was the Chief of the Boat aboard the FLASHER. Lastly, the moving papers disclosed that the alleged acts, to the extent of their actual occurrence, happened on board the FLASHER while it was underway and entering port. Because of the foregoing facts, the essence of the defendants' motion was that plaintiff's suit was barred by the doctrine of intra-military immunity as embodied in Feres v. United States, 340 U.S. 135, 71 S.Ct. 153, 95 L.Ed. 152 (1950), and as extended to individual defendants in Bailey v. Van Buskirk, 345 F.2d 298 (9th Cir.1965), cert. denied, 383 U.S. 948, 86 S.Ct. 1205, 16 L.Ed.2d 210 (1966), and Tirrill v. McNamara, 451 F.2d 579 (9th Cir.1971). The defendants argued in their motion that because plaintiff Grant was on active duty in the Navy serving on board the USS FLASHER at the time of the alleged incident the Feres doctrine barred the suit regardless of whether the defendants' conduct was characterized as negligent or intentional. Plaintiff Grant filed no opposition to the defendants' motion. Instead, he caused to be filed a first amended complaint, styled as one "For Violation of Federal Civil Rights; Assault & Battery, Conspiracy, Dereliction of Duty, Intentional Infliction of Emotional Distress." Much of what was alleged in plaintiff's original complaint was repeated, verbatim, in the First Amended Complaint. More to the point, the same conduct of each of the defendants which was urged to support plaintiff's state tort claims in the original complaint is the conduct of which plaintiff complains in his First Amended Complaint, although he now alleges that the conduct was also violative of his constitutional rights. Following service of the First Amended Complaint, the defendants, on December 4, 1981, filed a new motion to dismiss or for summary judgment. In essence, the defendants' position is that plaintiff's First Amended Complaint is an attempt to put a constitutional gloss on what are, in reality, state tort claims, and that plaintiff should not be permitted to evade the rule of Feres v. United States, supra, by engaging in an exercise in artful pleading. Defendants' motion was noticed for hearing before this court on February 22, 1982. On approximately January 27, 1982 plaintiff caused to be filed and noticed for hearing before Magistrate McCue motions for a continuance, to compel attendance at a deposition, and to compel production of certain documents. Those motions were noticed *432 for hearing on February 16, 1982. Plaintiff contended, in essence, that there was discovery he needed to counter the defendants' motion set before this court. Defendants, in turn, obtained an order shortening time and filed and served a motion for protective order which was heard by Magistrate McCue on February 3, 1982. The defendants contended that none of the discovery sought by plaintiff related to any of the issues raised by the motion to dismiss or for summary judgment. Because the discovery was not relevant to those issues, and because the motion to dismiss, if granted, would be dispositive of the case, said the defendants, discovery should be stayed pending resolution of the dispositive motion unless the plaintiff could show how the discovery was necessary to respond to the motion. Magistrate McCue agreed with the defendants' position and ordered that the requested discovery not go forward pending resolution of the motion to dismiss. Subsequently, plaintiff withdrew his motions for continuance and to compel attendance at the proposed deposition. The defendants' motion to dismiss or for summary judgment thereafter came on regularly for hearing before this court on February 22, 1982. For the reasons set out hereafter, the court finds that the defendants' motion is well taken and should be granted. In Feres v. United States, 340 U.S. 135, 71 S.Ct. 153, 95 L.Ed. 152 (1950) the Supreme Court held that a serviceman who is injured as a result of the negligence of fellow servicemen and "the injuries arise out of or are in the course of activity incident to service ..." will not be permitted to sue the United States under the Federal Tort Claims Act. That rule continues in full force. Stencel Aero Engineering Corp. v. United States, 431 U.S. 666, 97 S.Ct. 2054, 52 L.Ed.2d 665 (1977); Uptegrove v. United States, 600 F.2d 1248, 1251 (9th Cir.1979), cert. denied, 444 U.S. 1044, 100 S.Ct. 732, 62 L.Ed.2d 730 (1980). It has long been recognized by the Ninth Circuit Court of Appeals, as well as by other courts, that the rationale of the Feres rule applies as much to suits brought by injured servicemen against individual federal employees as it does to suits against the United States. Bailey v. Van Buskirk, 345 F.2d 298 (9th Cir.1965), cert. denied, 383 U.S. 948, 86 S.Ct. 1205, 16 L.Ed.2d 210 (1966); Tirrill v. McNamara, 451 F.2d 579 (9th Cir.1971); Calhoun v. United States, 475 F.Supp. 1 (S.D.Cal.1977), aff'd per curiam, 604 F.2d 647 (9th Cir.1979), cert. denied, 444 U.S. 1078, 100 S.Ct. 1029, 62 L.Ed.2d 761 (1980); Bailey v. De Quevedo, 375 F.2d 72 (3d Cir.1967), cert. denied, 389 U.S. 923, 88 S.Ct. 247, 19 L.Ed.2d 274 (1967); Stanley v. Central Intelligence Agency, 639 F.2d 1146, 1152 (5th Cir.1981). Central to a determination of whether the Feres rule applies in any particular case is whether the plaintiff sustained the claimed injuries incident to his military service. A review of the applicable cases discloses that resolution of this inquiry turns, in essence, upon whether at the time he sustained the injury the plaintiff was where he was because of his relationship to the military. See Uptegrove v. United States, supra; Shults v. United States, 421 F.2d 170 (5th Cir.1969); Vallance v. United States, 574 F.2d 1282 (5th Cir.1978); Veillette v. United States, 615 F.2d 505 (9th Cir.1980); Chambers v. United States, 357 F.2d 224 (8th Cir.1966); Stansberry v. Middendorf, 567 F.2d 617 (4th Cir.1978); Camassar v. United States, 531 F.2d 1149 (2d Cir.1976). In the instant case, it is undisputed that plaintiff was on active duty aboard the USS FLASHER while it was underway at the time of the alleged incident. In other words, plaintiff was where he was at the time of the incident precisely because of his military relationship. It is also undisputed that each of the defendants was similarly on active duty aboard USS FLASHER at the time of the alleged event. Accordingly, the court finds that the elements of the Feres rule have been met and that if the rule applies at all, it applies to bar the instant suit. Plaintiff argues, however, that the Feres rule should not be applied in the instant case because plaintiff has, in his First *433 Amended Complaint, asserted his claims as violations of the Constitution of the United States, to which he contends the Feres rule does not apply. In so arguing, plaintiff relies on the recent decision in Wallace v. Chappell, 661 F.2d 729 (9th Cir.1981). Plaintiff has, indeed, attempted to recast his claims as violations of the Constitution. However, such efforts are unavailing. Where, as here, a plaintiff's theory of constitutional deprivation is simply a "restatement" of a state tort cause of action, courts have generally declined to recognize a constitutional cause of action. Calhoun v. United States, 475 F.Supp. 1 (S.D.Cal.1977), aff'd per curiam, 604 F.2d 647 (9th Cir. 1979), cert. denied, 444 U.S. 1078, 100 S.Ct. 1029, 62 L.Ed.2d 761 (1980); Misko v. United States, 453 F.Supp. 513 (D.D.C.1978), aff'd, 593 F.2d 1371 (D.C.Cir.1979). In so holding, the courts have been mindful of the instruction of the Supreme Court in Paul v. Davis, 424 U.S. 693, 96 S.Ct. 1155, 47 L.Ed.2d 405 (1976). In that case, a plaintiff urged that a state tort claim for defamation really constituted a deprivation of a constitutionally protected right. In rejecting that contention, the Court wrote: But such a reading would make of the Fourteenth Amendment a font of tort law to be superimposed upon whatever systems may already be administered by the States. We have noted the "constitutional shoals" that confront any attempt to derive from congressional civil rights statutes a body of general federal tort law, Griffin v. Breckenridge, 403 U.S. 88, 101-102 [91 S.Ct. 1790, 1797-1798, 29 L.Ed.2d 338] (1971); a fortiori, the procedural guarantees of the Due Process Clause cannot be the source for such law. 424 U.S. at 701, 96 S.Ct. at 1160. Comparison of plaintiff's original complaint filed in state court with the First Amended Complaint now before this court discloses that both are virtually identical, particularly in terms of the alleged conduct of the defendants. The court concludes that plaintiff has simply attempted to recast traditional state tort claims as constitutional violations. Under the circumstances of this case, no constitutional claim is alleged sufficient to support a cause of action under Bivens v. Six Unknown Fed. Narcotics Agents, 403 U.S. 388, 91 S.Ct. 1999, 29 L.Ed.2d 619 (1971). The recent decision of Wallace v. Chappell, 661 F.2d 729 (9th Cir.1981) does not compel a contrary conclusion. Rather, the Wallace court itself recognized the foregoing when it wrote: With respect to constitutional claims, therefore, our adoption of the Mindes [v. Seaman, 453 F.2d 197 (5th Cir.1971)] test is limited to cases in which the plaintiff has alleged what the Calhoun court described as a "recognized" constitutional right. We do not mean by this term to eliminate from consideration those constitutional claims that have not yet been accepted by the courts. We mean only that the allegations must amount to more than a traditional state law claim. 661 F.2d at 734. Having concluded that plaintiff has alleged only traditional state tort claims, although he has attempted to recast them as constitutional violations, it is clear that Wallace v. Chappell, supra, is not applicable to the instant case. Inasmuch as defendants have established through uncontroverted declarations that plaintiff's alleged injuries were sustained incident to his military service on board USS FLASHER, and since there is no bar to application of the Feres rule to what are, in essence, state tort claims, the court finds that the Feres rule bars the instant suit. Accordingly, defendants' motion to dismiss is granted. Stanley v. Central Intelligence Agency, 639 F.2d 1146 (5th Cir.1981). Alternatively, it has been established that defendants are entitled to judgment as a matter of law based upon their uncontroverted declarations and the applicable law. Therefore, defendants' alternative motion for summary judgment is granted as well.
{ "pile_set_name": "FreeLaw" }
Exposure to bisphenol A from bis-glycidyl dimethacrylate-based dental sealants. Bisphenol A (BPA) is a common component of composites and dental sealants. The potential exists for human exposure after sealant placement. The authors prospectively enrolled 15 men in an exposure assessment study; 14 completed the study. After placement of clinically appropriate amounts of one of two sealants, the authors measured BPA in saliva and urine samples collected at prescribed intervals after the sealants were placed. They used selective and sensitive isotope-dilution mass-spectrometry-based methods for BPA measurements, thus providing the most reliable results. Helioseal F (Ivoclar Vivadent, Amherst, N.Y.) leached negligible amounts of BPA. Urinary and salivary BPA levels in subjects who received these sealants were similar to baseline levels. Delton Light Cure (LC) Opaque pit-and-fissure sealant (Dentsply/Ash, York, Pa.) leached more BPA, resulting in low-level BPA exposures similar to those used in laboratory animal testing. BPA exposure after Delton LC sealant placement was significantly higher than exposure after placement of Helioseal F. Patients treated with Delton LC had significantly higher doses of BPA (110 microg) than did those treated with Helioseal F (5.5 microg) (P < .0001). Placement of clinically relevant amounts of Delton LC sealant resulted in low-level BPA exposure; however, exposure was negligible after placement of Helioseal F. Saliva collection after sealant placement likely reduced systemic absorption of BPA from dental sealants. Sealants should remain a useful part of routine preventive dental practice, especially those that leach negligible amounts of BPA. Dental sealants may be a point source for low-level BPA exposure at levels that show health effects in rodents. Further research is required to determine whether human exposure to BPA at these levels causes adverse effects.
{ "pile_set_name": "PubMed Abstracts" }
Self-perception theory Self-perception theory (SPT) is an account of attitude formation developed by psychologist Daryl Bem. It asserts that people develop their attitudes (when there is no previous attitude due to a lack of experience, etc.—and the emotional response is ambiguous) by observing their own behavior and concluding what attitudes must have caused it. The theory is counterintuitive in nature, as the conventional wisdom is that attitudes determine behaviors. Furthermore, the theory suggests that people induce attitudes without accessing internal cognition and mood states. The person interprets their own overt behaviors rationally in the same way they attempt to explain others' behaviors. Bem's original experiment In an attempt to decide if individuals induce their attitudes as observers without accessing their internal states, Bem used interpersonal simulations, in which an "observer-participant" is given a detailed description of one condition of a cognitive dissonance experiment. Subjects listened to a tape of a man enthusiastically describing a tedious peg-turning task. Subjects were told that the man had been paid $20 for his testimonial and another group was told that he was paid $1. Those in the latter condition thought that the man must have enjoyed the task more than those in the $20 condition. The results obtained were similar to the original Festinger-Carlsmith experiment. Because the observers, who did not have access to the actors' internal cognition and mood states, were able to infer the true attitude of the actors, it is possible that the actors themselves also arrive at their attitudes by observing their own behavior. Specifically, Bem notes how "the attitude statements which comprise the major dependent variables in dissonance experiments may be regarded as interpersonal judgments in which the observer and the observed happen to be the same individual." Further evidence There are numerous studies conducted by psychologists that support the self-perception theory, demonstrating that emotions do follow behaviors. For example, it is found that corresponding emotions (including liking, disliking, happiness, anger, etc.) were reported following from their overt behaviors, which had been manipulated by the experimenters. These behaviors included making different facial expressions, gazes, and postures. In the end of the experiment, subjects inferred and reported their affections and attitudes from their practiced behaviors despite the fact that they were told previously to act that way. These findings are consistent with the James–Lange theory of emotion. In 1974, James Laird conducted two experiments on how changes in facial expression can trigger changes in emotion. Participants were asked to contract or relax various facial muscles, causing them to smile or frown without awareness of the nature of their expressions. Participants reported feeling more angry when frowning and happier when smiling. They also reported that cartoons viewed while they were smiling were more humorous than cartoons viewed while they were frowning. Furthermore, participants scored higher on aggression during frown trials than during smile trials, and scored higher on elation, surgency, and social affection factors during smile trials than during frown ones. Laird interpreted these results as "indicating that an individual's expressive behavior mediates the quality of his emotional experience." In other words, a person's facial expression can act as a cause of an emotional state, rather than an effect; instead of smiling because they feel happy, a person can make themselves feel happy by smiling. In 2006, Tiffany Ito and her colleagues conducted two studies to investigate if changes in facial expression can trigger changes in racial bias. The explicit goal of the studies was to determine "whether facial feedback can modulate implicit racial bias as assessed by the Implicit Association Test (IAT)." Participants were surreptitiously induced to smile through holding a pencil in their mouth while viewing photographs of unfamiliar black or white males or performed no somatic configuration while viewing the photographs (Study 1 only). All participants then completed the IAT with no facial manipulation. Results revealed a spreading attitude effect; people made to smile (unconsciously) at pictures of black males showed less implicit prejudice than those made to smile at pictures of white males. Their attitudes change as a result of their behavior. Chaiken and Baldwin's 1981 study on self-perception theory dealt with environmental attitudes. Each participant was identified as having well or poorly defined prior attitudes toward being an environmentalist or conservationist. Participants then completed one of two versions of a questionnaire designed to bring to mind either past pro-ecology behaviors or past anti-ecology behaviors. For example, questions such as "Have you ever recycled?" call to mind the times an individual has recycled, emphasizing their engagement in environmentalist behavior. On the other hand, questions like "Do you always recycle?" bring to mind all the times an individual did not recycle something, emphasizing a lack of environmentalist behavior. Afterward, participants' attitudes toward being an environmentalist/conservationist were re-measured. Those with strong initial/prior attitudes toward the environment were not really affected by the salient manipulation. Those with weak prior attitudes, however, were affected. At the end, those in the pro-ecology condition ("Have you ever recycled?") reported themselves as being much more pro-environment than those in the anti-ecology condition ("Do you always recycle?"). Bringing to mind certain past behaviors affected what people believed their attitudes to be. Evidence for the self-perception theory has also been seen in real life situations. After teenagers participated in repeated and sustained volunteering services, their attitudes were demonstrated to have shifted to be more caring and considerate towards others. Recent research Research incorporating self-perception theory has continued in recent years, appearing in conjunction with studies dealing with motivational "crowding out," terrorism, mindwandering, and the inclusion of others in the self. Guadagno and her fellow experimenters did a study in 2010 addressing the recruitment of new members by terrorist organization via the internet. In addition to looking at how such an organization might influence its targets to support more extreme ideologies (primarily through simple requests gradually increasing to larger commitments–an example of the foot-in-the-door technique), the authors looked at how "the new converts may form increasingly radical attitudes to be consistent with their increasingly radical behavior." Self-perception theory, then, has strong ties to social identity and social influence in this scenario. Also in 2010, Clayton Critcher and Thomas Gilovich performed four studies to test a connection between self-perception theory and mindwandering. Self-perception theory posits that people determine their attitudes and preferences by interpreting the meaning of their own behavior. Critcher and Gilovich looked at whether people also rely on the unobservable behavior that is their mindwandering when making inferences about their attitudes and preferences. They found that "Having the mind wander to positive events, to concurrent as opposed to past activities, and to many events rather than just one tends to be attributed to boredom and therefore leads to perceived dissatisfaction with an ongoing task." Participants relied on the content of their wandering minds as a cue to their attitudes unless an alternative cause for their mindwandering was brought to their attention. Similarly, Goldstein and Cialdini published work related to self-perception theory in 2007. In an extension of self-perception theory, the authors hypothesized that people sometimes infer their own attributes or attitudes by "observing the freely chosen actions of others with whom they feel a sense of merged identity – almost as if they had observed themselves performing the acts." Participants were made to feel a sense of merged identity with an actor through a perspective-taking task or feedback indicating overlapping brainwave patterns. Participants incorporated attributes relevant to the actor's behavior into their own self-concepts, leading participants to then change their own behaviors. The study addresses the self-expansion model: close relationships can lead to an inclusion of another person in an individual's sense of self. Applications One useful application of the self-perception theory is in changing attitude, both therapeutically and in terms of persuasion. Psychological therapy For therapies, self-perception theory holds a different view of psychological problems from the traditional perspectives. Traditionally, psychological problems come from the inner part of the clients. However, self-perception theory perspective suggests that people derive their inner feelings or abilities from their external behaviors. If those behaviors are maladjusted ones, people will attribute those maladjustments to their poor adapting abilities and thus suffer from the corresponding psychological problems. Thus, this concept can be used to treat clients with psychological problems that resulted from maladjustments by guiding them to first change their behavior and later dealing with the "problems". One of the most famous therapies making use of this concept is therapy for "heterosocial anxiety". In this case, the assumption is that an individual perceives that he or she has poor social skills because he/she has no dates. Experiments showed that males with heterosocial anxiety perceived less anxiety with females after several sessions of therapy in which they engaged in a 12-minute, purposefully biased dyadic social interactions with a separate females. From these apparently successful interactions, the males inferred that their heterosocial anxiety was reduced. This effect is shown to be quite long-lasting as the reduction in perceived heterosocial anxiety resulted in a significantly greater number of dates among subjects 6 months later. Marketing and persuasion Self-perception theory is also an underlying mechanism for the effectiveness of many marketing or persuasive techniques. One typical example is the foot-in-the-door technique, which is a widely used marketing technique for persuading target customers to buy products. The basic premise of this technique is that, once a person complies with a small request (e.g. filling in a short questionnaire), he/she will be more likely to comply with a more substantial request which is related to the original request (e.g. buying the related product). The idea is that the initial commitment on the small request will change one's self-image, therefore giving reasons for agreeing with the subsequent, larger request. It is because people observe their own behaviors (paying attention to and complying with the initial request) and the context in which they behave (no obvious incentive to do so), and thus infer they must have a preference for those products. Challenges and criticisms Self-perception theory was initially proposed as an alternative to explain the experimental findings of the cognitive dissonance theory, and there were debates as to whether people experience attitude changes as an effort to reduce dissonance or as a result of self-perception processes. Based on the fact that the self-perception theory differs from the cognitive dissonance theory in that it does not hold that people experience a "negative drive state" called "dissonance" which they seek to relieve, the following experiment was carried out to compare the two theories under different conditions. An early study on cognitive dissonance theory shows that people indeed experience arousal when their behavior is inconsistent with their previous attitude. Waterman designed an experiment in which 77 male college freshmen were asked to write an essay arguing against the position they actually agreed with. Then they were asked immediately to perform a simple task and a difficult task; their performance in both tasks was assessed. It was found that they performed better in the simple task and worse in the difficult task, compared to those who had just written an essay corresponding to their true attitude. As indicated by social facilitation, enhanced performance in simple tasks and worsened performance in difficult tasks shows that arousal is produced by people when their behavior is inconsistent with their attitude. Therefore, the cognitive dissonance theory is evident in this case. Apparent disproof Debate ensued over whether dissonance or self-perception was the valid mechanism behind attitude change. The chief difficulty lay in finding an experiment where the two flexible theories would make distinctly different predictions. Some prominent social psychologists such as Anthony Greenwald thought it would be impossible to distinguish between the two theories. In 1974, Zanna and Cooper conducted an experiment in which individuals were made to write a counter-attitudinal essay. They were divided into either a low choice or a high choice condition. They were also given a placebo; they were told the placebo would induce either tension, relaxation, or exert no effect. Under low choice, all participants exhibited no attitude change, which would be predicted by both cognitive dissonance theory and self-perception theory. Under high choice, participants who were told the placebo would produce tension exhibited no attitude change, and participants who were told the placebo would produce relaxation demonstrated larger attitude change. These results are not explainable by self-perception theory, as arousal should have nothing to do with the mechanism underlying attitude change. Cognitive dissonance theory, however, was readily able to explain these results: if the participants could attribute their state of unpleasant arousal to the placebo, they would not have to alter their attitude. Thus, for a period of time, it seemed the debate between the self-perception theory and cognitive dissonance had ended. Truce experiment Fazio, Zanna, and Cooper conducted another experiment in 1977, demonstrating that both cognitive dissonance and self-perception could co-exist. In an experimental design similar to Zanna and Cooper's 1974 study, another variable was manipulated: whether or not the stance of the counter-attitudinal essay fell in the latitude of acceptance or the latitude of rejection (see social judgment theory). It appeared that when the stance of the essay fell into the latitude of rejection, the results favoured cognitive dissonance. However, when the essay fell in the latitude of acceptance, the results favoured self-perception theory. Whether cognitive dissonance or self-perception is a more useful theory is a topic of considerable controversy and a large body of literature. There are some circumstances in which a certain theory is preferred, but it is traditional to use the terminology of cognitive dissonance theory by default. The cognitive dissonance theory accounts for attitude changes when people's behaviors are inconsistent with their original attitudes which are clear and important to them; meanwhile, the self-perception theory is used when those original attitudes are relatively ambiguous and less important. Studies have shown that, in contrast to traditional belief, a large proportion of people's attitudes are weak and vague. Thus, the self-perception theory is significant in interpreting one's own attitudes, such as the assessment of one's own personality traits and whether someone would cheat to achieve a goal. According to G. Jademyr and Yojiyfus, the perception of different aspect in the interpreting theory can be due to many factors, such as circumstances regarding dissonance and controversy. This can also be because of balance theory as it applies to the attitude towards accountability and dimensions. See also References Gilovich, T., Keltner, D., & Nisbett, R. E. (2006). Social Psychology. New York: Norton & Company. Bem, D. J. (1972). "Self-perception theory". In L. Berkowitz (Ed.), Advances in Experimental Social psychology, Vol. 6, 1-62. New York: Academic Press. Full text (PDF). Summary. External links Changingminds.org: self-perception theory Self-perception theory, Daryl Bem, 1972 Category:Attitude change Category:Self Category:Identity
{ "pile_set_name": "Wikipedia (en)" }
<?xml version="1.0" encoding="UTF-8"?> <configuration status="OFF"> <appenders> <Console name="Console" target="SYSTEM_OUT"> <PatternLayout pattern="%d [%t] %-5p %M(%F:%L) - %m%n"/> </Console> </appenders> <loggers> <root level="info"> <appender-ref ref="Console"/> <appender-ref ref="Console" level="error"/> </root> </loggers> </configuration>
{ "pile_set_name": "Github" }
Gridded ion thruster The gridded ion thruster is a common design for ion thrusters, a highly efficient low-thrust spacecraft propulsion running on electrical power. These designs use high-voltage grid electrodes to accelerate ions with electrostatic forces. History The ion engine was first demonstrated by German-born NASA scientist Ernst Stuhlinger, and developed in practical form by Harold R. Kaufman at NASA Lewis (now Glenn) Research Center from 1957 to the early 1960s. The use of ion propulsion systems were first demonstrated in space by the NASA Lewis "Space Electric Rocket Test" (SERT) I and II. These thrusters used mercury as the reaction mass. The first was SERT-1, launched July 20, 1964, which successfully proved that the technology operated as predicted in space. The second test, SERT-II, launched on February 3, 1970, verified the operation of two mercury ion engines for thousands of running hours. Despite the demonstration in the 1960s and 70s, though, they were rarely used before the late 1990s. NASA Glenn continued to develop electrostatic gridded ion thrusters through the 1980s, developing the NASA Solar Technology Application Readiness (NSTAR) engine, that was used successfully on the Deep Space 1 probe, the first mission to fly an interplanetary trajectory using electric propulsion as the primary propulsion. It is currently flying the Dawn asteroid mission. Hughes Aircraft Company (now L-3 ETI) has developed the XIPS (Xenon Ion Propulsion System) for performing station keeping on its geosynchronous satellites (more than 100 engines flying). NASA is currently working on a 20-50 kW electrostatic ion thruster called HiPEP which will have higher efficiency, specific impulse, and a longer lifetime than NSTAR. Aerojet has recently completed testing of a prototype NEXT ion thruster. Beginning in the 1970s, radio-frequency ion thrusters were developed at Giessen University and ArianeGroup. RIT-10 engines are flying on the EURECA and ARTEMIS. Qinetiq (UK) has developed the T5 and T6 engines (Kaufman type), used on the GOCE mission (T5) and the BepiColombo mission (T6). From Japan, the µ10, using microwaves, flew on the Hayabusa mission. Method of operation Propellant atoms are injected into the discharge chamber and are ionized by electron bombardment, forming a plasma. There are several ways of producing the energetic electrons for the discharge: electrons can be emitted from a hollow cathode and accelerated by potential difference with the anode; the electrons can be accelerated by an oscillating electric field induced by an alternating electromagnet, which results in a self-sustaining discharge and omits any cathode (radio frequency ion thruster); and microwave heating. The positively charged ions diffuse towards the chamber's extraction system (2 or 3 multi-aperture grids). After ions enter the plasma sheath at a grid hole, they are accelerated by the potential difference between the first and second grids (called the screen and accelerator grids, respectively). The ions are guided through the extraction holes by the powerful electric field. The final ion energy is determined by the potential of the plasma, which generally is slightly greater than the screen grids' voltage. The negative voltage of the accelerator grid prevents electrons of the beam plasma outside the thruster from streaming back to the discharge plasma. This can fail due to insufficient negative potential in the grid, which is a common ending for ion thrusters' operational life. The expelled ions propel the spacecraft in the opposite direction, according to Newton's 3rd law. Lower-energy electrons are emitted from a separate cathode, called the neutralizer, into the ion beam to ensure that equal amounts of positive and negative charge are ejected. Neutralizing is needed to prevent the spacecraft from gaining a net negative charge, which would attract ions back toward the spacecraft and cancel the thrust. Performance The ion optics are constantly bombarded by a small amount of secondary ions and erode or wear away, thus reducing engine efficiency and life. Ion engines need to be able to run efficiently and continuously for years. Several techniques were used to reduce erosion; most notable was switching to a different propellant. Mercury or caesium atoms were used as propellants during tests in the 1960s and 1970s, but these propellants adhered to, and eroded the grids. Xenon atoms, on the other hand, are far less corrosive, and became the propellant of choice for virtually all ion thruster types. NASA has demonstrated continuous operation of NSTAR engines for over 16,000 hours (1.8 years), and tests are still ongoing for double this lifetime. Electrostatic ion thrusters have also achieved a specific impulse of 30–100 kN·s/kg, better than most other ion thruster types. Electrostatic ion thrusters have accelerated ions to speeds reaching 100 km/s. In January 2006, the European Space Agency, together with the Australian National University, announced successful testing of an improved electrostatic ion engine, the Dual-Stage 4-Grid (DS4G), that showed exhaust speeds of 210 km/s, reportedly four times higher than previously achieved, allowing for a specific impulse which is four times higher. Conventional electrostatic ion thrusters possess only two grids, one high voltage and one low voltage, which perform both the ion extraction and acceleration functions. However, when the charge differential between these grids reaches around 5 kV, some of the particles extracted from the chamber collide with the low voltage grid, eroding it and compromising the engine's longevity. This limitation is successfully bypassed when two pairs of grids are used. The first pair operates at high voltage, possessing a voltage differential of around 3 kV between them; this grid pair is responsible for extracting the charged propellant particles from the gas chamber. The second pair, operating at low voltage, provides the electrical field that accelerates the particles outwards, creating thrust. Other advantages to the new engine include a more compact design, allowing it to be scaled up to higher thrusts, and a narrower, less divergent exhaust plume of 3 degrees, which is reportedly five times narrower than previously achieved. This reduces the propellant needed to correct the orientation of the spacecraft due to small uncertainties in the thrust vector direction. Variants The largest difference in the many electrostatic ion thrusters is the method of ionizing the propellant atoms - electron bombardment (NSTAR, NEXT, T5, T6), radiofrequency (rf) excitation (RIT 10, RIT 22, µN-RIT), microwave excitation (µ10, µ20). Related to this is the need for a cathode and a required effort for the power supplies. Kaufman type engines require at the least, supplies to the cathode, anode and chamber. The rf and microwave types require an additional rf generator, but no anode or cathode supplies. In the extraction grid systems, minor differences occur in the grid geometry and the materials used. This may have implications for the grid system operational lifetime. See also List of plasma (physics) articles Electrically powered spacecraft propulsion Ion thruster Dual-Stage 4-Grid References External links Aerojet (Redmond, Washington USA) - Gridded Ion Thruster Vendor NSTAR ion engine Technologies to Improve Ion Propulsion System (PDF) Electric Thruster Systems (PDF) HiPEP ESA And ANU Make Space Propulsion Breakthrough Category:Electrostatic motors Category:Plasma physics Category:Ion engines
{ "pile_set_name": "Wikipedia (en)" }
Administrative Assistant Resume Examples 24 Executive Resumes Administrative Assistant Resume Examples 24 Executive Resumes was posted in August 24 2018 at 1:23 am and has been seen by 1 users. If you want to view image in full size just click image on gallery bellow.
{ "pile_set_name": "Pile-CC" }
Association of antiphospholipid antibodies with systemic lupus erythematosus in a child presenting with chorea: a case report. A 16-year-old girl, diagnosed 1 year previously as having Sydenham chorea, was found to have systemic lupus erythematosus according to the American Rheumatism Association criteria. She now presented with pulmonary emboli and renal involvement and responded to immunosuppressive and anticoagulant therapy. The high levels of anticardiolipin antibodies returned to normal along with the clinical symptoms. We suggest that anticardiolipin antibodies are relevant to the development of chorea and thrombo-embolic complications and that these auto-antibodies should be sought for in similar cases.
{ "pile_set_name": "PubMed Abstracts" }
Thus far, high-capacity optical disks of various kinds have been achieved by reducing the size of an information mark that is written on a disk track and also by making a wavelength of the laser beam for use in recording/playback shorter and adopting an objective lens of a larger numerical aperture, to reduce the size of a focus spot on a focusing surface. In, for example, a CD (compact disc), its disk substrate serving as an optical transmissive layer (a transparent protective layer formed on an information recording layer, which is also called a transparent substrate) has a thickness of about 1.2 mm, a laser beam wavelength of about 780 nm and a numerical apertures (NA) of 0.45 of an objective lens are selected, with its recording capacity being 650 MB. In a DVD (digital versatile disc), its optical transmissive layer has a thickness of about 0.6 mm, and a laser beam wavelength of about 650 nm and an NA of 0.6 are selected, resulting in a recording capacity of 4.7 GB. In a higher-density BD (Blu-ray Disc), an optical disk whose optical transmissive layer thickness is 0.1 mm is used to determine the laser beam wavelength to be about 405 nm and the NA to be 0.85, thereby achieving a high capacity of 25 GB per layer. Besides these discs, there is an HD DVD (high-definition digital versatile disc) and the like in which an optical disk whose optical transmissive layer thickness is 0.6 mm that is the same as that of the DVD is used to determine the laser beam wavelength to be about 405 nm and the NA to be 0.65, thereby achieving a high capacity of 18 GB or more. In the field of optical recording, a high-density recording scheme has been researched in recent years which uses a super-definition optical disk on which a super definition mask layer is formed having a nonlinear optical absorption characteristic or a nonlinear optical transmission characteristic where an index of refraction varies depending on light intensity. In this scheme, by causing changes in the index of refraction in a localized high temperature zone or a localized high intensity zone in the focus spot of an optical disk, marks can be played back that is smaller than a diffraction limit λ/(4NA) that is determined by optical elements of an optical disk apparatus—i.e., the numerical aperture NA of a converging lens and optical wavelength λ (for instance, refer to Non-patent Document 1). In such a super resolution optical disk, however, because a mask layer thereof absorbs light, larger playback energy is needed in comparison to that in a conventional optical disk. It is known that as a result, a low frequency noise level (or disk noise) contained in playback signals increase (refer to Non-patent Document 2, for example). Non-patent Documents 1 and 2 relates to Super-RENS (super resolution near field structure) scheme, which is for a typical super resolution optical disk. In addition to this disk, another super resolution optical disk is proposed which is formed of a material having a nonlinear optical absorption characteristic or nonlinear optical transmission characteristic in which an index of refraction of the recorded information mark varies depending on light intensity (refer to Non-patent Document 3, for example). These are hereinafter collectively called super resolution optical disk. [Non-patent Document 1] “Observation of Eye Pattern on Super-Resolution Near-Field Structure Disk with Write-Strategy Technique”, Jpn. J. Appl. Phys., Vol. 43, No. 7A, pp. 4212-4215 (2004) [Non-patent Document 2] “Low Frequency Noise Reduction of Super-Resolution Near-Field Structure Disc with Platinum-Oxide Layer,” ODS, Technical Digest, ThC3 (2005) [Non-patent Document 3] “Sub-Terabyte-Data-Capacity Optical Discs Realized by Three-Dimensional Pit Selection,” Jpn. J. Appl. Phys., Vol. 45, No. 4A, pp. 2593-2597 (2006)
{ "pile_set_name": "USPTO Backgrounds" }
Wuhan–Yichang railway Hankou–Yichang railway (), or Hanyi railway, is a long high-speed railway between Hankou (a borough of Wuhan) and Yichang in Hubei province. The railway forms a section of the Huhanrong passenger-dedicated line from Shanghai to Wuhan to Chengdu. The Hanyi Railway was completed in spring 2012 and started commercial operations on July 1, 2012. Adjacent high-speed rail sections, the Hefei–Wuhan high-speed railway to the east and the Yichang−Wanzhou railway to the west, opened respectively in April 2009 and December 2010. Unlike most other high-speed railways in China which generally follow the route of pre-existing railway lines, the Hanyi railway takes a new, more direct, route between Wuhan and Yichang, bringing rail service for the first time to cities along the Yangtze River in central Hubei such as Hanchuan, Xiantao, and Qianjiang. Jingzhou, previously only served by a branch rail line to Jingmen to the north, now enjoys frequent through-train service to Wuhan and Yichang. Construction history According to a news item from the Wuhan City Government dated July 10, 2008, the plans for the railways were finalized at the time, and the construction was to begin shortly. According to the plans, the construction should have been completed by the end of 2011, however, this deadline was not met. A more recent schedule (confirmed in early May 2012 by Hubei provincial authorities) is for the railway to open in May 2012. It is constructed by the China Railway 12th Bureau Group Co. On March 1 it was reported that softer earth had been used in the foundation of the railway. Later the director of Hubei railway construction office told a section of the railway had sunk more than the allowed tolerance. On 9 March 2012 it was reported that due to heavy rainfall a 300-meter section of rail collapsed in central Hubei Province. Stations According to the final plan, there are 8 stations on the line: Hankou railway station 汉口站 Hanchuan railway station 汉川站 Tianmen South railway station 天门南站 Xiantao West railway station 仙桃西站 Qianjiang railway station 潜江站 Jingzhou railway station 荆州站 Zhijiang railway station 枝江站 Yichang East railway station 宜昌东站 Even though Tianmen City is west of Xiantao City, Xiantao West Station (located north of Xiantao's Sanfutan Town) is located west on Tianmen South Station (located near Tianmen's Duoxiang Town). In fact, Xiantao West is the closest station to downtown Tianmen, and Tianmen South is the closest station to downtown Xiantao. This geographical oddity has resulted because of the way the border between the two county-level cities (which runs mostly along the Hanshui River) is located relative to the new railway's route. Tianmen South Station is the station that early plans called "Xiantao Station". As of 2012, the Hanyi Railway's trains have never served the Yichang railway station in downtown Yichang. In 2012, that station was closed for renovations; it is expected that after the renovation project is completed, the station will also receive EMU (i.e., D-series) trains, presumably extending the route of Wuhan-Yichang trains by one more station, much closer to downtown Yichang. Service As of July 2012, the Hanyi railway is primarily used by frequent high-speed D-series trains circulating between Yichang East and Wuhan's three major rail stations (Hankou, Wuchang, and Wuhan). Some of them continue to the east (to Nanjing and Shanghai Hongqiao), or to the southeast (to Nanchang, over the Wuhan–Jiujiang Railway). A few "conventional" (K, T, Z-series) trains use the line as well. References Category:Rail transport in Hubei
{ "pile_set_name": "Wikipedia (en)" }
Neighbourhood income gradients in hospitalisations due to motor vehicle traffic incidents among Canadian children. To investigate income gradients in motor vehicle traffic injury hospitalisation for vehicle occupants and pedestrians/cyclists among children in urban and rural Canada. Four years (2001/02-2004/05) of acute-care hospitalisation discharge records for children aged 0-19 years were analysed. International Classification of Disease codes were used to determine hospitalisations due to motor vehicle traffic incidents for occupants and pedestrians/cyclists. Rates of injury (per 10 000 person years) were calculated by neighbourhood income quintiles for urban and rural areas. Among children (0-19 years), rates of vehicle occupant hospitalisation were higher in rural (5.07, 95% CI 4.90 to 5.25) than urban areas (2.08, 95% CI 2.03 to 2.14). In rural areas, children from lower income neighbourhoods had higher vehicle occupant hospitalisation rates than those from the richest neighbourhoods (5.52, 95% CI 5.13 to 5.93 vs 4.30, 95% CI 3.97 to 4.66). In urban areas vehicle occupant hospitalisation rates were similar among children from the poorest and richest neighbourhoods--but higher among children from middle income neighbourhoods. In urban areas, but not rural areas, the hospitalisation rate for pedestrians/cyclists systematically increased with decreasing neighbourhood income. In urban areas the pedestrian/cyclist hospitalisation rate was four times higher for children from the poorest (1.40, 95% CI 1.25 to 1.57) than from the richest (0.34, 95% CI 0.28 to 0.43) neighbourhoods. While vehicle occupant and pedestrian/cyclist motor vehicle traffic injuries are more frequent among children from lower income neighbourhoods, gradients are most pronounced for pedestrians/cyclists in urban areas.
{ "pile_set_name": "PubMed Abstracts" }
[Toxicological-hygienic assessment of the low-alcohol tonic (energizing) carbonated drinks]. The impact of the low-alcohol tonic (energizing) carbonated drinks on biochemical and hematological indices, on the functional state of the central nervous system and cardiovascular system was studied within the experiment over the outbred white male rats. The gained results were compared to indices of animals receiving the same concentrated solution of ethanol used for drinks preparation as well as to figures of intact group animals. The results gained from all compared animals groups had no significant differences.
{ "pile_set_name": "PubMed Abstracts" }
Olympus spruces up PEN E-P2 camera with silver coating Summary:The Olympus Digital PEN micro four thirds camera design is known (and perhaps loved) for its signature vintage design. Although not everyone was delighted by the black-only option on the PEN E-P2. Well, now behold that particular camera in a shiny shade of silver. The Olympus Digital PEN micro four thirds camera design is known (and perhaps loved) for its signature vintage design. Although not everyone was delighted by the black-only option on theE-P2. Well, now behold that particular camera in a shiny shade of silver. While it's not as powerful as the E-P1 or as much of a bargain as the E-PL1, at least now interested buyers have a little wiggle room when it comes to design. Although the E-P2 does sport an accessory port for attaching the electronic viewfinder and other accessories, as pictured above. The silver and sleek edition of the E-P2 will available in the middle of May, starting at €799 ($1,016). That asking price includes a M. Zuiko Digital ED 14-42mm 1:3.5-5.6 lens. Rachel King is a staff writer for CBS Interactive based in San Francisco, covering business and enterprise technology for ZDNet, CNET and SmartPlanet. She has previously worked for The Business Insider, FastCompany.com, CNN's San Francisco bureau and the U.S. Department of State. Rachel has also written for MainStreet.com, Irish Americ... Full Bio
{ "pile_set_name": "Pile-CC" }
Montell Seely Montell Seely, 74, passed away on Tuesday, Aug. 12, 2008, during a handcart expedition in Fairview, Utah. He was born Feb. 5, 1934, in Castle Dale, Utah, the fourth of six children born to Karl A. Seely and Cora Guymon Seely. He grew up and attended school in Castle Dale and Ferron, where he was active in athletics and leadership of FFA and served as studentbody president at South Emery High School, class of 1952. He lived in Emery County all his life, except for a few years in Logan and Provo to attend college, and in North Carolina 1954-56 to serve an LDS Mission in the Central Atlantic States. In 1965 he graduated from BYU with a BS degree in Animal Science. While at BYU, he was a member of the ballroom dance team and enjoyed ballroom and square dancing for many years. For four years the family lived in Orangeville. In 1970 they returned to Provo, where Montell earned a Masters degree in 1972 and was employed in the counseling department at Provo High for three years. In June, 1975, while moving the family back to Castle Dale, Montell was involved in a serious accident beneath a mobile home. The family returned to Provo during his hospitalization and recovery which lasted through the summer. Kind friends assisted with the farming until he was fully recovered. Montell was engaged in farming and livestock ranching all his life. He enjoyed running his farm that was originally homesteaded by his grandfather, Justus Wellington Seely II. An early interest in pioneers and the westward movement of the Saints in 1847 prompted him to acquire wagons and buggies and the work horses to pull them. He became friends with several Amish families and enjoyed their association as he worked with them in their fields with horses and old-fashioned equipment. In 1977 he organized a ward/community trek over the mountain from Fairview to Castle Dale. In 1978 he formed a committee to produce a pageant to tell the story of the first settlers who came to Castle Valley. Performed annually, the Castle Valley Pageant completed its 31st season on Aug. 9. After Montell wrote the script for the pageant, he pursued other writing ventures, including a large Emery County History in 1981, Seely history books in 1988 and 1996, and Castle Valley Pageant history in 2003. He kept a daily personal journal from 1976 until the day of his passing.
{ "pile_set_name": "Pile-CC" }
Trousdale Estates Trousdale Estates is a neighborhood of Beverly Hills, California, located in the foothills of the Santa Monica mountains. It was developed in the 1950s and 1960s and is named after Paul Trousdale, a real estate developer. , the average sale price of a home in Trousdale Estates is over $11 million. History The grounds originally belonged to Mrs. Lucy Smith Doheny Battson, wife of Edward L. Doheny, Jr. (1893–1929), son of oil tycoon Edward L. Doheny (1856–1935); were known as the Doheny Ranch or the Doheny Estate; and included the Greystone Mansion, which is now a United States Historical Site. In 1954, Paul Trousdale (1915–1990) purchased the grounds, while the mansion was purchased by industrialist Henry Crown (1896–1990). Shortly after, Trousdale convinced the Beverly Hills City Council to add the neighborhood to the city, which they accepted, and he renamed it the Trousdale Estates. Trousdale first built 532 original lots, all subject to strict regulations devised by the Architectural Committee, including how high roofs could be. Early houses were designed by renowned architects Wallace Neff (1895–1982), Paul R. Williams (1894–1980), A. Quincy Jones (1913–1979), Frank Lloyd Wright (1867–1959) and Harold Levitt (1922–2003). Allen Siple (1900–1973) acted as the supervising architect. By 1981, some houses were remodeled, blocking their neighbors' views. As a result, after some consultation in 1987 the Trousdale Estates Homeowners Association, a non-profit organization, and the City of Beverly Hills implemented the Trousdale Ordinance to preserve the neighborhood. There are also "view protections" that protect a resident's view from neighboring trees, outlined in the Trousdale Ordinance. The City of Beverly Hills now enforces these building codes and view protections. The 410-acre neighborhood has 24/7 security patrol cars with armed guards. In addition, the Beverly Hills Police Department has increased its day and night rounds in the neighborhood with dedicated patrols. Loma Vista is the main thoroughfare in Trousdale Estates. Notable residents Celebrity residents have included Elvis Presley, Frank Sinatra, Dean Martin, Tony Curtis, Ray Charles, Howard Hughes, and Groucho Marx. President Richard Nixon lived in the neighborhood. When Nixon, who had just been Vice President from 1953 to 1961 under President Dwight D. Eisenhower, purchased his residence, Frank McCullogh of the Los Angeles Times reported that he had only paid $90,000 for a house whose real price was $300,000 as the developers believed his name would add prestige to the neighborhood. More recently, Jennifer Aniston, David Spade, Zoë de Givenchy, Vera Wang, John Rich, Jane Fonda, Richard Perry, Markus Persson, Ringo Starr, Simon Cowell, and Charlie Puth have lived in the neighborhood. Jeffery Katzenberg, who co-founded DreamWorks, bought a $35 million, 8,704-square-foot mansion in Trousdale Estates from Simon Ramo, an American physicist, engineer, and business leader. Katzenberg hosted fundraisers for President Barack Obama at this mansion. In July 2019, Uber co-founder, Garrett Camp, and his wife, Eliza Nguyen, bought an 11,000 square foot mansion for $72.5 million in Trousdale Estates. References Further reading Category:Beverly Hills, California
{ "pile_set_name": "Wikipedia (en)" }
Official Blog Of Jlyricz Month: December 2017 Just in time for Christmas, Singer-songwriter Jlyricz gifts two singles as parting gifts for the year 2017. Recorder over two years back, So Gi is a mid-tempo groovy high-life number and talks about God being the only One deserving of our worship and praise. Jehovah is a slow emotive song that also gives reference to … More New Music: Jlyricz releases So Gi + Jehovah as parting gifts for 2017
{ "pile_set_name": "Pile-CC" }
![](envhper00385-0152.tif "scanned-page"){.155} ![](envhper00385-0153.tif "scanned-page"){.156} ![](envhper00385-0154.tif "scanned-page"){.157} ![](envhper00385-0155.tif "scanned-page"){.158} ![](envhper00385-0156.tif "scanned-page"){.159} ![](envhper00385-0157.tif "scanned-page"){.160} ![](envhper00385-0158.tif "scanned-page"){.161} ![](envhper00385-0159.tif "scanned-page"){.162} ![](envhper00385-0160.tif "scanned-page"){.163} ![](envhper00385-0161.tif "scanned-page"){.164} ![](envhper00385-0162.tif "scanned-page"){.165}
{ "pile_set_name": "PubMed Central" }
The regulation of proteolytic activity within the central nervous system (CNS) is essential in both normal and pathological processes. However, the precise role that proteolysis plays in the CNS is not well established. Recent work from many laboratories has indicated that the serine protease tissue-type plasminogen activator (tPA) is involved in a number of important processes both during development and in the adult brain. These include events associated with synaptic plasticity such as long term potentiation (LTP), motor learning and anxiety-like behavior, all processes which are though to involve synaptic remodeling. TPA has also been implicated in neuronal death following excitotoxic injury, seizure and stroke. The primary inhibitor of tPA within the CNS is the serine protease inhibitor (serpin) neuroserpin. The tissue distribution of neuroserpin indicates that it is predominantly expressed in neurons in areas where either tPA message or activity has also been localized. Neuroserpin is also found in areas known to have the highest susceptibility to ischemic injury, and neuroserpin is neuroprotective in stroke and seizure. Like tPA, neuroserpin has also been suggested to regulate anxiety-like behavior since both over-expression or complete deficiency of neuroserpin in mice leads to increased anxiety and neophobia. Thus, this proposal will focus on understanding the basic biology of neuroserpin and on its role in regulating tPA activity within the CNS. By using a combination of biochemical, molecular and genetic approaches both in vitro and in vivo, and building on previous studies of neuroserpin, and tPA, a number of important activities will be characterized and hypotheses tested. We will characterize the cell biology of neuroserpin and tPA within the CNS and test the hypothesis that tPA activity regulates neuroserpin release from neurons at the synapse. Sensitive assays will be used to localize neuroserpin and tPA and to monitor their trafficking and activity in primary neuronal cultures. We will also investigate the biochemical mechanisms of neuroserpin's regulation of tPA, and test the hypothesis that the inhibition of tPA by neuroserpin is regulated by pH. The role(s) of neuroserpin and tPA during normal and pathologic physiology such as anxiety and seizure will be examined in vivo, and we will test the hypothesis that neuroserpin and tPA regulate activity dependent changes in synaptic structure. Together these studies will give a better understanding of the roles of tPA and neuroserpin both normal and pathological processes, and may provide the basis for improved therapies for the treatment of CNS disorders. [unreadable] [unreadable] [unreadable]
{ "pile_set_name": "NIH ExPorter" }
Local AERO Institute, National Institute of Aerospace, and Ohio Aerospace Institute Partner with AIAA The American Institute of Aeronautics and Astronautics has partnered with the AERO Institute, Palmdale, Calif., the National Institute of Aerospace, Hampton, Va., and the Ohio Aerospace Institute, Cleveland, Ohio, to expand its offerings of continuing education stand-alone courses for aerospace professionals. “AIAA is proud to be teaming with three of the United States’ top developers of science and engineering graduate-level workshops and short courses,” said Col. Neal Barlow, AIAA vice president, Education. “As part of AIAA’s professional member education programs, AERO, NIA, and OAI offer members the opportunity to brush up on science and engineering skills or be introduced to new cutting-edge knowledge and application capabilities. “AIAA is committed to keeping aerospace professionals at their technical best by offering more than 90 technical courses, ranging from fundamentals to advanced-level topics,” Barlow continued. “AIAA’s Education Committee prides itself on recruiting and selecting the world’s best subject-matter experts to provide our member aerospace experts with proven expertise. These new partnerships bring a dozen new courses to AIAA education beginning in February 2013. Courses are our offered in a variety of formats and locations to accommodate member’s busy schedules. The AERO Institute, NIA, and OAI are welcomed new AIAA partners.” Susan Miller, executive director of the AERO Institute, said “The AERO is honored and delighted to welcome AIAA as a partner in our efforts to develop the necessary workforce for the aerospace industry. It is through collaborations such as this that future success can be assured.” Douglas O. Stanley, president and executive director of the National Institute of Aerospace, added, “The NIA is proud of our decade-long partnership with AIAA in continuing education and outreach, and we are very pleased to be a part of the wide range of innovative course offerings in the 2013 Stand-Alone Course Offerings.” Michael Heil, president and CEO of the Ohio Aerospace Institute, pointed out how the partnership will benefit Ohio’s aerospace industries: “OAI is pleased to partner with the world’s premier aerospace professional society to bring AIAA’s outstanding short courses to the ‘Buckeye’ state. Ohio is a major aerospace research and development leader and these courses will help ensure that our workforce is prepared for the challenges of the future.” AIAA is the world’s largest technical society dedicated to the global aerospace profession. With more than 35,000 individual members worldwide, and nearly 100 corporate members, AIAA brings together industry, academia, and government to advance engineering and science in aviation, space, and defense. For more information, visit www.aiaa.org. Local military discounts News: Carter: Military leaders could arm more troops at home – Following the recent fatal shooting of four Marines and a sailor in Tennessee, Defense Secretary Ash Carter is ordering the military services to consider new policies that would enhance security for troops at home, including potentially arming more personnel. Business: DOD weighs supplier base,... U.S. delivering eight newer F-16 warplanes to Egypt The United States Embassy in Cairo says the U.S. is delivering eight newer F-16 warplanes to Egypt as part of an ongoing military support package. It says in a July 30 statement that the aircraft, of the current Block 52 production variant, will be flown in from... Lockheed Martin photograph A protective panel for Orion’s service module is jettisoned during testing at Lockheed Martin’s Sunnyvale, California facility. This test series evaluated design changes to the spacecraft’s fair... Northrop Grumman has awarded the first Australian supplier contract for the U.S. Navy’s MQ-4C Triton unmanned aircraft system initial production lot to Ferra Engineering. Brisbane-based Ferra Engineering will manufacture mechanical sub-assemblies for the first four Triton air vehicles including structural components. “At Northrop Grumman it’s very important to not only develop... Boeing photograph The CH-46 Sea Knight helicopter commonly known as the “Phrog,” is set to retire and to be flown one last time by Reserve Marine Medium Helicopter Squadron (HMM) 774 on Aug. 1. The CH-46 Sea Knight is a med... Under the terms of its latest contract, Insitu will build six RQ-21A Blackjack systems for the U.S. Navy and Marine Corps. The $78-million Small Tactical Unmanned Aircraft Systems Lot IV Low Rate Initial Production contract is the latest event in the program’s progression toward the Initial Operational Test and Evaluation phase. “This award will... Information Publisher Aerotech News and Review is published every Friday serving the aerospace and defense industry of Southern California, Nevada and Arizona. News and ad copy deadline is noon on the Tuesday prior to publication. The publisher assumes no responsibility for error in ads other than space used. Disclaimer The appearance of advertising in this publication, including inserts or supplements, does not constitute endorsement by the Department of Defense, U.S. Air Force, U.S. Army, U.S. Navy, U.S. Marine Corps, or Aerotech News and Review, Inc., of the products or services advertised.
{ "pile_set_name": "Pile-CC" }
[7:19 PM] cloppyhooves: you come home and waifu is sexin' one of her family members [7:19 PM] cloppyhooves: what do [7:20 PM] reahidru: Examine family memeber [7:20 PM] plotospex: Utterly perplexed do [7:20 PM] sammiepie: which family member? [7:20 PM] cloppyhooves: Pick one and answer based on that [7:21 PM] reahidru: Examine twin sister [7:21 PM] reahidru: (Fuckin score) [7:21 PM] tsiugnil: ^ [7:21 PM] sammiepie: ^ [7:21 PM] sunasmine: ^ [7:21 PM] reahidru: ^ [7:21 PM] cloppyhooves: "Oh hi. We were having an argument on who's plot was tastier, but we can't seem to reach [7:21 PM] cloppyhooves: a consensus." [7:21 PM] cloppyhooves: What do [7:22 PM] sunasmine: taste test [7:22 PM] sunasmine: (waifu wins) [7:22 PM] reahidru: BLIND taste test [7:23 PM] cloppyhooves: They tie a blindfold around you and push you onto the bed [7:23 PM] cloppyhooves: You hear a voice say "Subject 1" and you can feel somepony hoveing over you [7:23 PM] cloppyhooves: ... [7:24 PM] tsiugnil: taste [7:24 PM] sunasmine: taste? [7:24 PM] cloppyhooves: You reach your tongue out until it makes contact with sweet flesh [7:25 PM] cloppyhooves: It tastes utterly delicious, completely like <WAIFU FLAVOR HERE> [7:25 PM] cloppyhooves: You hear giggling as you continue to lap up some more juices [7:25 PM] cloppyhooves: You hear some moving around, and feel a presence above you again [7:26 PM] cloppyhooves: "Subject 2" [7:26 PM] sunasmine: ask for palette cleanse [7:26 PM] cloppyhooves: ... [7:26 PM] plotospex: Likcu~ [7:26 PM] sunasmine: gotta make it fair [7:26 PM] tsiugnil: [hey rozzak: http://amberblade.tumblr.com/post/11177240121/] [7:26 PM] plotospex: (except spelled correctly) [7:26 PM] cloppyhooves: You ask for a palette Cleanser [7:26 PM] cloppyhooves: You have to be fair, after all [7:26 PM] cloppyhooves: You hear your waifu giggle [7:26 PM] cloppyhooves: "Certainly" [7:27 PM] cloppyhooves: You suddenly feel a mouth around yours, its tongue making its way into yours [7:27 PM] sammiepie: [do twin ponies have different cutie marks?] [7:27 PM] tsiugnil: [that could get confusing...] [7:27 PM] reahidru: [They're mirrored of course] [7:27 PM] plotospex: [if not, are personality traits genetic for ponies?] [7:27 PM] sunasmine: [ i woudld argue no, unless they have same specia ltalent] [7:28 PM] cloppyhooves: You reciprocate the kiss, letting the tongue explore around your mouth, before it breaks [7:28 PM] cloppyhooves: away from you [7:28 PM] cloppyhooves: "Alright, *now* subject 2" [7:28 PM] plotospex: [by "if not" I mean "if so"] [7:28 PM] cloppyhooves: ... [7:28 PM] sunasmine: lucku~ [7:28 PM] plotospex: licku~ [7:28 PM] sammiepie: ^ [7:28 PM] sunasmine: or licku~ [7:28 PM] rozzak: [are we "lab raping" ?] [7:28 PM] reahidru: [Scroll up lazy bones] [7:29 PM] rozzak: [NO] [7:29 PM] rozzak: [I AM DRY BONES] [7:29 PM] cloppyhooves: You reach your tongue out once again, and begin running your tongue around the flesh [7:29 PM] cloppyhooves: you find, taking a taste of the juices dripping out of it [7:29 PM] tsiugnil: [ps ponies have cutie marks on both sides, which are themselves mirrored] [7:29 PM] tsiugnil: [rozzak, look at my link for you] [7:30 PM] cloppyhooves: It tastes exactly the same as before: sweet, delicious, and exactly like <WAIFU FLAVOR> [7:30 PM] cloppyhooves: You run your tongue along the slit a few more times before she pulls away [7:30 PM] tsiugnil: they're both our waifu? [7:30 PM] reahidru: Announce that you can not tell them apart by taste alone [7:30 PM] cloppyhooves: They undo your blindfold, sitting side by side [7:30 PM] cloppyhooves: "Okay, who tastes better?" [7:30 PM] cloppyhooves: ... [7:30 PM] rozzak: [Hey I distinctly remember reading a hentai with this very same plot, pun intended} [7:30 PM] plotospex: Okay, so when we asked for the cleaser, waifu giggles [7:31 PM] plotospex: But she couldn't have bent down if her plot was over you [7:31 PM] plotospex: Thus, waifu was #1 [7:31 PM] plotospex: Say #1 was a little better. [7:31 PM] rozzak: I also did a science project like this in highschool [7:31 PM] sunasmine: [the taste of pony plot?] [7:31 PM] rozzak: :) [7:31 PM] rozzak: [Sorta] [7:31 PM] sammiepie: nah, say they're both perfect [7:32 PM] rozzak: Say you cant decide you need another taste [7:32 PM] plotospex: ^ [7:32 PM] sammiepie: ^ [7:32 PM] plotospex: Let's derail science and turn it into ponysex. [7:32 PM] cloppyhooves: You look down in though: who's plot *was* better? [7:32 PM] cloppyhooves: You decide you can't really tell them apart [7:33 PM] cloppyhooves: When you look back up and say it, however, the two of them are making out and don't hear [7:33 PM] cloppyhooves: you [7:33 PM] cloppyhooves: They both look at you [7:33 PM] tsiugnil: [data.tumblr.com/tumblr_lt9y4wWeIF1r50fu2o1_1280.jpg] [7:33 PM] cloppyhooves: "Oh, sorry, what did you say? We got a little...distracted" [7:33 PM] guest-34321 entered the room. [7:33 PM] guest-34321 changed nickname to sillybear25 [7:33 PM] cloppyhooves: They both have the same expression, with the same half-closed eyes [7:33 PM] cloppyhooves: A trail of saliva lingers between their mouths before dropping [7:33 PM] cloppyhooves: ... [7:33 PM] reahidru: ==>Make this face :I [7:34 PM] plotospex: Oh, so the blindfold came off [7:34 PM] plotospex: Huggu~ both with one arm, tongue~ in between theirs [7:34 PM] plotospex: In between their tongu~s, that is [7:34 PM] sammiepie: ^ [7:35 PM] rozzak: Blindfold them now.... [7:35 PM] joeshmo101: ^ [7:35 PM] sunasmine: ploto^ [7:35 PM] rozzak: < [7:35 PM] sammiepie: > [7:35 PM] sillybear25: v [7:36 PM] joeshmo101: -_- [7:36 PM] cloppyhooves: You lean over to them and huggu both with one arm, and bring your head between theirs [7:36 PM] cloppyhooves: The three of you start your three-way makeout [7:36 PM] cloppyhooves: As you look at their faces, their eyes are close, completely into the kiss [7:37 PM] cloppyhooves: If you hadn't been aroused eariler, you certainly are now [7:37 PM] cloppyhooves: ... [7:37 PM] reahidru: Check inventory [7:37 PM] plotospex: Check map [7:37 PM] sammiepie: ask them to do some taste testing of their own [7:37 PM] plotospex: Actually ^ [7:39 PM] cloppyhooves: You have stuff in your pockets, but it seems irrelvant right now [7:39 PM] cloppyhooves: You don't have a map [7:39 PM] cloppyhooves: You break the kiss and tell them that it's time for their own taste-test [7:39 PM] cloppyhooves: They both look at you seductively [7:39 PM] cloppyhooves: "Oh?" Says your waifu. "How's this going to work? [7:39 PM] cloppyhooves: ... [7:40 PM] guest-34417 entered the room. [7:40 PM] joeshmo101: I knew this would ahppen... [7:40 PM] rozzak: [cloppy you gave me a boner, you should know thats a hard this to do....just sayin] [7:40 PM] reahidru: "Well you'll be comparing... uhh me to uhhh... me" [7:40 PM] plotospex: "My *PENIS* has two sides. I'm curious if they both taste the same." [7:40 PM] guest-34417 changed nickname to vpt2 [7:41 PM] rozzak: Asshole vs Penis? [7:41 PM] sammiepie: ^ [7:41 PM] reahidru: [That's hardly a fair fight] [7:41 PM] cloppyhooves: (Heh, whoo) [7:41 PM] plotospex: Or I guess not two sides because it's not a 2d object, but shuu up you know what I mean [7:41 PM] rozzak: Asshole simulation is awesome [7:41 PM] guest-34462 entered the room. [7:41 PM] guest-34462 changed nickname to lazeraze [7:41 PM] reahidru: [But still ^] [7:41 PM] vpt2: DERAILMENT! Random Request: Anyone seen the image of Human dash and non human dash? [7:42 PM] vpt2: (caption: "are you sure you're me" or summat) [7:42 PM] joeshmo101: I know waifu gives the best blowjobs, but does her twin as well? [7:42 PM] cloppyhooves: Yes, I'm getting it for you right now [7:42 PM] lazeraze: Stick it in the pony hole. [7:42 PM] rozzak: [im sure my ass tastes good,,,,) [7:42 PM] lazeraze: (I bet it does) [7:42 PM] sillybear25: [I've seen it, but I don't have a link to it atm [7:42 PM] vpt2: cloppyhooves is best pony [7:42 PM] sunasmine: {i know the one your taling about but son't have link] [7:42 PM] plotospex: http://i.imgur.com/9votK.png [7:42 PM] cloppyhooves: (Yeah, that was it) [7:42 PM] cloppyhooves: (Plotospex beat me to it) [7:43 PM] plotospex: Oh wait, you were getting it too [7:43 PM] plotospex: Oops [7:43 PM] tsiugnil: (where the hell ARE you ez?) [7:43 PM] tsiugnil: (finding pics is your job) [7:43 PM] lazeraze left the room. [7:43 PM] cloppyhooves: So, what is this taste test that you're organizing? [7:44 PM] equius_zahhak: [sorry, was snackin'] [7:44 PM] vpt2: Well if you all are chalelnging each other to post speed..... who can find the non-colored [7:44 PM] joeshmo101: ^me [7:44 PM] vpt2: version first? [7:44 PM] cloppyhooves: http://img.ponibooru.org/_images/7920bee59d4ff60b63b7dbb04cca3726/35964%20-%20artist%3Ameg [7:44 PM] equius_zahhak: http://tiny.cc/uikbu [7:44 PM] sammiepie: butt vs. penis [7:46 PM] cloppyhooves: Is everypony in agreement on taste test of BUTT vs PENIS [7:46 PM] tsiugnil: right nipple vs left nipper [7:46 PM] tsiugnil: nipple [7:46 PM] vpt2: 1 and 1 .... someone request something of them MORE obscure to settle it... [7:47 PM] tsiugnil: (i'm mostly not here) [7:47 PM] joeshmo101: I want what I suggested [7:47 PM] vpt2 left the room. [7:47 PM] sunasmine: competering bj's? [7:48 PM] sammiepie: nah, that's not a taste test [7:48 PM] joeshmo101: ^ [7:48 PM] tsiugnil: [http://www.youtube.com/watch?v=HtwppaX2yl4] [7:49 PM] cloppyhooves: http://poll.pollcode.com/ujGP [7:52 PM] cloppyhooves: (looks like competing blowjobs wins) [7:53 PM] cloppyhooves: You looks from one to the other [7:53 PM] tsiugnil: [http://www.youtube.com/watch?v=x12s6WEjnDA] [7:53 PM] cloppyhooves: "How about you do the tasting while I do the testing? I wanna see which of you gives the [7:53 PM] tsiugnil: [RD's face...] [7:53 PM] cloppyhooves: best blowjobs..." [7:53 PM] cloppyhooves: They look at each other, then back at you, and smile [7:54 PM] cloppyhooves: Waifu ties the blindfold back around you [7:54 PM] cloppyhooves: (dat RD face) [7:54 PM] cloppyhooves: They guide you sit on the edge of the bed, and you feel a pair of hooves on your thighs [7:54 PM] cloppyhooves: "Subject 1, when you're ready" [7:54 PM] cloppyhooves: ... [7:56 PM] joeshmo101: wait, is this the same subject 1 as before or did we randomize? [7:56 PM] cloppyhooves: (Randomized) [7:56 PM] cloppyhooves: (You can't science with bias) [7:57 PM] cloppyhooves: (Proceeding, cause there isn't really anything you *can* do) [7:57 PM] sunasmine: [lol] [7:58 PM] cloppyhooves: You lie back a bit, waiting and focusing all of your attention on your penis [7:58 PM] tsiugnil: [http://www.youtube.com/watch?v=V6mUhaqHYyc] [7:58 PM] cloppyhooves: So much so that, as you feel a pair of lips evelope around it, you let out a gasp [7:59 PM] cloppyhooves: The mystery mare slides further down until she has half your length in her mouth [7:59 PM] cloppyhooves: As she does, she runs her tongue all around the surface of your cock, circling around it [7:59 PM] cloppyhooves: in loving strokes [8:00 PM] cloppyhooves: she goes just a bit further, then withdraws a bit until she's back at just the tip [8:00 PM] cloppyhooves: You can feel the tongue run across the head of your penis, and you shudder in pleasure [8:00 PM] cloppyhooves: You now feel the mare moving up and down your shaft, continuing to work her tonue all [8:00 PM] cloppyhooves: around as she does [8:01 PM] cloppyhooves: You are breathing a little hard, and you grip the bed in reaction to how much pleasure [8:01 PM] cloppyhooves: you can feel shooting through you [8:01 PM] cloppyhooves: After several blissful moments, you feel the lips slide off you [8:02 PM] cloppyhooves: "Hey," you hear. "I can't let you go *too* far. *She* still needs a turn." [8:02 PM] cloppyhooves: The hooves move away from your thighs, and a new pair replaces them [8:02 PM] cloppyhooves: "Subject 2." [8:03 PM] sammiepie: go [8:03 PM] joeshmo101: wait,three ponies?? [8:03 PM] plotospex: What, it's just 2 [8:03 PM] sunasmine: just two ponies [8:03 PM] sunasmine: waifu and waifu twin [8:04 PM] cloppyhooves: Your cock is still throbbing from the last "test", but it does not have much time to [8:04 PM] tsiugnil: WE'RE A PONY [8:04 PM] joeshmo101: STOP [8:04 PM] cloppyhooves: recover before you feel it slide into another warm, wet enclosure [8:04 PM] cloppyhooves: (Why stop?) [8:05 PM] joeshmo101: at who was said hey, I can't let you get to far"? [8:05 PM] cloppyhooves: Whoever it was who was blowing you [8:05 PM] sunasmine: subject #1 [8:05 PM] cloppyhooves: You can't tell; you have a blindfold on [8:05 PM] joeshmo101: nvm, carry on [8:05 PM] joeshmo101: (I thought it was before subject one had finished, and speaking in the third person [8:06 PM] joeshmo101: made me think there was another pony) [8:06 PM] cloppyhooves: This mare is quick to get into the thythm the other had stopped, sliding up and down [8:06 PM] cloppyhooves: with an expert use of her tongue [8:07 PM] cloppyhooves: Your eyes roll back as this mare continues to work her magic [8:07 PM] joeshmo101: [so are we just doing this tonight or are we going back to A New Leaf?] [8:07 PM] cloppyhooves: (I didn't even know I was going to be doing this, heh) [8:07 PM] cloppyhooves: You think you hear her snickering, and are confused for a moment [8:08 PM] reahidru: [Just pretend it's an intermission] [8:08 PM] cloppyhooves: You don't have time to think, though: you feel her hooves press a bit into your thighs [8:08 PM] cloppyhooves: and suddenly feel the entirety of your erection enclosed in moist warmth [8:09 PM] cloppyhooves: The sudden senstaion causes you to gasp and moan, and your tongue lolls out [8:09 PM] cloppyhooves: "Hey, no fair!" you hear from the other pony [8:09 PM] cloppyhooves: The mare is keeping your member all the to the hilt in her mouth, using the entirely of [8:09 PM] cloppyhooves: her tongue to run over the entirety of your flesh [8:10 PM] cloppyhooves: Pleasure is radiating through every square inch of your loins, up through your chest and [8:10 PM] cloppyhooves: to your head [8:10 PM] cloppyhooves: The mare finally withdraws, sliding all the way off [8:10 PM] cloppyhooves: You're a little sad to feel her leave; your penis is throbbing hard, desparate for more [8:11 PM] cloppyhooves: attention [8:11 PM] cloppyhooves: They again take the blindfold off you, standing side by side [8:11 PM] cloppyhooves: "So, who won?" [8:11 PM] cloppyhooves: ... [8:11 PM] sammiepie: say nopony yet [8:12 PM] sunasmine: that was just the first round? [8:12 PM] plotospex: "#2, but she went all the way. It's only fair that #1 gets another shot." [8:12 PM] sammiepie: ^ [8:13 PM] cloppyhooves: "Well, Subject 2 was better, but I think you claimed she was cheating, didn't you?" [8:13 PM] cloppyhooves: "I'd said it's only fair that you get a redo." [8:14 PM] cloppyhooves: Er, replace "you" with "Subject 1" [8:14 PM] cloppyhooves: You think you see one of them grin, but it's so imperceptible that you can't tell who it [8:14 PM] cloppyhooves: was [8:15 PM] cloppyhooves: The blindfold comes back on [8:15 PM] cloppyhooves: Hooves once again rest on your thighs [8:15 PM] cloppyhooves: "Alright. I'll make sure this one...counts." [8:16 PM] cloppyhooves: You cock surges with pleasure as you feel it once again inside a mare's mouth [8:16 PM] cloppyhooves: The mare slides up and down a bit a few times, before pressing into your thighs as the [8:17 PM] cloppyhooves: other had [8:17 PM] cloppyhooves: You let out still more moans as you feel her lips touch the hilt of your penis once again [8:17 PM] cloppyhooves: (whoops, forget the "her") [8:18 PM] joeshmo101: (why forget her?) [8:18 PM] plotospex changed nickname to plotospexohnobrb [8:18 PM] cloppyhooves: (The word "her" shouldn't have been there) [8:19 PM] sunasmine: [" as you feel lips touch "?] [8:19 PM] cloppyhooves: (yeah) [8:19 PM] joeshmo101: (still works either way) [8:19 PM] cloppyhooves: You feel the tongue within stroke your erection lovingly [8:20 PM] cloppyhooves: It slides around the entire length, before you start to feel it ticking the tip [8:20 PM] cloppyhooves: The mare is making quick licks on the head of your penis, and the sensation is almost [8:20 PM] cloppyhooves: overwelming [8:20 PM] cloppyhooves: you wriggle around in your seat, the pleasure racing though you [8:21 PM] cloppyhooves: Your breathing has become more intense, and all you can focus on is the mare's tongue [8:21 PM] cloppyhooves: still carresing your cock and ticking your tip [8:21 PM] cloppyhooves: After what seems like an eternity, she slides off of you, and they take the blindfold off [8:21 PM] cloppyhooves: They once again ask who the winner is [8:22 PM] cloppyhooves: Your cock is throbbing, getting very near the brink of orgasm [8:22 PM] cloppyhooves: It begs to be touched once again [8:22 PM] cloppyhooves: ... [8:23 PM] joeshmo101: clop, then pass out [8:23 PM] sunasmine: try to find a way for both of them to go at once? [8:23 PM] sammiepie: ^ [8:23 PM] sammiepie: ask them to do a lightining round [8:23 PM] sunasmine: [ don't have any ideas how though] [8:24 PM] guest-35227 entered the room. [8:24 PM] guest-35227 changed nickname to hermocrates [8:24 PM] guest-35233 entered the room. [8:24 PM] guest-35233 left the room. [8:24 PM] hermocrates: Hi everypony! [8:25 PM] cloppyhooves: Your mind is clouded with lust, but you manage to form some words between your breaths [8:25 PM] sunasmine: [heya] [8:25 PM] cloppyhooves: (Hey) [8:25 PM] joeshmo101: say: "Winner? Me!" [8:25 PM] cloppyhooves: "You two don't make this easy, do you? I'd say it's time for a *LIGHTING ROUND*." [8:25 PM] sammiepie: [hi] [8:26 PM] joeshmo101 left the room. [8:26 PM] cloppyhooves: They giggle, and you waifu tells you "Oh, you won't *release* the answer? *Come* on, tell [8:26 PM] cloppyhooves: us. Just *blurt it out*." [8:27 PM] guest-35269 entered the room. [8:27 PM] guest-35269 changed nickname to rozzak_sketching [8:27 PM] cloppyhooves: Your arousal increases even more, and your penis is quivering [8:27 PM] guest-35272 entered the room. [8:27 PM] rozzak_sketching: Yum [8:27 PM] rozzak_sketching left the room. [8:27 PM] guest-35281 entered the room. [8:27 PM] cloppyhooves: "But sure, how do you want to..."finish" this?" [8:27 PM] cloppyhooves: ... [8:27 PM] guest-35281 left the room. [8:27 PM] guest-35272 changed nickname to joeshmo101 [8:28 PM] cloppyhooves: (if you guys can't come up with anything, I'll go with my own idea) [8:28 PM] joeshmo101: what did I miss since flash crashed [8:28 PM] joeshmo101: ? [8:28 PM] cloppyhooves: They giggle, and you waifu tells you "Oh, you won't *release* the answer? *Come* on, tell [8:28 PM] cloppyhooves: us. Just *blurt it out*." [8:28 PM] sunasmine: [lets eee if we can come up with somthing] [8:28 PM] cloppyhooves: Your arousal increases even more, and your penis is quivering [8:28 PM] cloppyhooves: "But sure, how do you want to..."finish" this?" [8:28 PM] cloppyhooves: (that's what you missed) [8:29 PM] sammiepie: tell them they both need to go at once so you can get a side by side comparison [8:29 PM] joeshmo101: http://www.youtube.com/watch?v=8txk6EhYZKA [8:29 PM] hermocrates: [Who are we "with" right now?] [8:30 PM] cloppyhooves: (Waifu and her twin sister) [8:30 PM] sunasmine: [waifu and waifu twin] [8:30 PM] cloppyhooves: "I think you guys need to both go at once. I need a side-by-side comparison" [8:30 PM] hermocrates: [Oh sweet, wolfgirl twins!] [8:31 PM] cloppyhooves: They both grin, and pounce onto your legs, one set of hooves on each [8:31 PM] cloppyhooves: the two begin each licking either side of your penis [8:31 PM] cloppyhooves: They alternate: one makes long strongs down the side while the other makes small circles [8:32 PM] cloppyhooves: all over, from base to tip [8:32 PM] cloppyhooves: The pleasure is unbearble; you feel ready to relase your sweet semen all over them [8:32 PM] cloppyhooves: ... [8:32 PM] sammiepie: let them know you're close [8:33 PM] joeshmo101: ^ [8:33 PM] hermocrates: [But wolves don't have hooves. . . .] [8:33 PM] cloppyhooves: (replace it in your mind as necessary) [8:33 PM] sunasmine: [pony wolves have hooves i guess?] [8:34 PM] rozzak: [Drew the philosodash FMA story board FUCKING AWESOME, be prepared folks] [8:34 PM] cloppyhooves: "I..." you pant. "I can't take...much more..." [8:34 PM] rozzak: [probably tomorrow] [8:34 PM] cloppyhooves: They look at each other, and move back a bit [8:34 PM] hermocrates: [Lookin' forward to it! I've enjoyed your stuff so far :) ] [8:34 PM] plotospexohnobrb changed nickname to plotospex [8:35 PM] cloppyhooves: They press their cheeks together, and line them elves up with your penis [8:35 PM] cloppyhooves: "Go ahead" they say in unison [8:35 PM] cloppyhooves: ... [8:35 PM] cloppyhooves: (Whoops, *themselves) [8:35 PM] cloppyhooves: (not them elves) [8:35 PM] sammiepie: let go all over their faces [8:35 PM] sunasmine: clop to the finish on their faces? [8:35 PM] hermocrates: [Dem elves! So gods-damned short!] [8:35 PM] tsiugnil: [joe: why is there russian singing over nazi pigs? i confuzzed] [8:35 PM] sillybear25: (elves? When did elves get involved? :P) [8:36 PM] joeshmo101 left the room. [8:36 PM] guest-35428 entered the room. [8:37 PM] cloppyhooves: You see the two of them side-by-side, eyes closed, mouths open [8:37 PM] guest-35428 changed nickname to joeshmo101 [8:37 PM] hermocrates: [You didn't miss anything this time] [8:37 PM] cloppyhooves: They've gotten you so close that you don't even need to touch yourself; the thought alone [8:37 PM] cloppyhooves: (well, and the sight of them) is enough to push you past the edge [8:38 PM] cloppyhooves: You feel pressure building in your loins as your member quivers [8:38 PM] cloppyhooves: You feel the pleasurable contractions building in within you, and you let out a low moan [8:38 PM] cloppyhooves: Your semen begins shooting out, landing in ropes across their faces [8:39 PM] cloppyhooves: As you continue to feel the pleasure of release, you see your penis ejaculate all over [8:39 PM] cloppyhooves: them [8:39 PM] cloppyhooves: your seed is streaked across their cheeks, some landing on their eyes, some in their [8:39 PM] cloppyhooves: hair, and even some in their mouths [8:40 PM] cloppyhooves: As the orgasm finally dies down, then two of them open their eyes and look at each other [8:40 PM] cloppyhooves: They giggle at their appearance, and begin to lick your semen off of each others faces [8:41 PM] cloppyhooves: you continue to hear the licking and giggling as you lie back, recovering from your [8:41 PM] hermocrates: [^ Why doesn't this happen in porn more often?] [8:41 PM] cloppyhooves: powerful orgasm [8:41 PM] cloppyhooves: You sigh [8:41 PM] cloppyhooves: She really needs to come over more often, you think to yourself [8:41 PM] cloppyhooves: THE END? [8:41 PM] sammiepie: the end
{ "pile_set_name": "OpenWebText2" }
/* (C) COPYRIGHT 1994-2002 Xiph.Org Foundation */ /* Modified by Jean-Marc Valin */ /* Redistribution and use in source and binary forms, with or without modification, are permitted provided that the following conditions are met: - Redistributions of source code must retain the above copyright notice, this list of conditions and the following disclaimer. - Redistributions in binary form must reproduce the above copyright notice, this list of conditions and the following disclaimer in the documentation and/or other materials provided with the distribution. THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS ``AS IS'' AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. */ /* opus_types.h based on ogg_types.h from libogg */ /** @file opus_types.h @brief Opus reference implementation types */ #ifndef OPUS_TYPES_H #define OPUS_TYPES_H /* Use the real stdint.h if it's there (taken from Paul Hsieh's pstdint.h) */ #if (defined(__STDC__) && __STDC__ && defined(__STDC_VERSION__) && __STDC_VERSION__ >= 199901L) || (defined(__GNUC__) && (defined(_STDINT_H) || defined(_STDINT_H_)) || defined (HAVE_STDINT_H)) #include <stdint.h> typedef int16_t opus_int16; typedef uint16_t opus_uint16; typedef int32_t opus_int32; typedef uint32_t opus_uint32; #elif defined(_WIN32) # if defined(__CYGWIN__) # include <_G_config.h> typedef _G_int32_t opus_int32; typedef _G_uint32_t opus_uint32; typedef _G_int16 opus_int16; typedef _G_uint16 opus_uint16; # elif defined(__MINGW32__) typedef short opus_int16; typedef unsigned short opus_uint16; typedef int opus_int32; typedef unsigned int opus_uint32; # elif defined(__MWERKS__) typedef int opus_int32; typedef unsigned int opus_uint32; typedef short opus_int16; typedef unsigned short opus_uint16; # else /* MSVC/Borland */ typedef __int32 opus_int32; typedef unsigned __int32 opus_uint32; typedef __int16 opus_int16; typedef unsigned __int16 opus_uint16; # endif #elif defined(__MACOS__) # include <sys/types.h> typedef SInt16 opus_int16; typedef UInt16 opus_uint16; typedef SInt32 opus_int32; typedef UInt32 opus_uint32; #elif (defined(__APPLE__) && defined(__MACH__)) /* MacOS X Framework build */ # include <sys/types.h> typedef int16_t opus_int16; typedef u_int16_t opus_uint16; typedef int32_t opus_int32; typedef u_int32_t opus_uint32; #elif defined(__BEOS__) /* Be */ # include <inttypes.h> typedef int16 opus_int16; typedef u_int16 opus_uint16; typedef int32_t opus_int32; typedef u_int32_t opus_uint32; #elif defined (__EMX__) /* OS/2 GCC */ typedef short opus_int16; typedef unsigned short opus_uint16; typedef int opus_int32; typedef unsigned int opus_uint32; #elif defined (DJGPP) /* DJGPP */ typedef short opus_int16; typedef unsigned short opus_uint16; typedef int opus_int32; typedef unsigned int opus_uint32; #elif defined(R5900) /* PS2 EE */ typedef int opus_int32; typedef unsigned opus_uint32; typedef short opus_int16; typedef unsigned short opus_uint16; #elif defined(__SYMBIAN32__) /* Symbian GCC */ typedef signed short opus_int16; typedef unsigned short opus_uint16; typedef signed int opus_int32; typedef unsigned int opus_uint32; #elif defined(CONFIG_TI_C54X) || defined (CONFIG_TI_C55X) typedef short opus_int16; typedef unsigned short opus_uint16; typedef long opus_int32; typedef unsigned long opus_uint32; #elif defined(CONFIG_TI_C6X) typedef short opus_int16; typedef unsigned short opus_uint16; typedef int opus_int32; typedef unsigned int opus_uint32; #else /* Give up, take a reasonable guess */ typedef short opus_int16; typedef unsigned short opus_uint16; typedef int opus_int32; typedef unsigned int opus_uint32; #endif #define opus_int int /* used for counters etc; at least 16 bits */ #define opus_int64 long long #define opus_int8 signed char #define opus_uint unsigned int /* used for counters etc; at least 16 bits */ #define opus_uint64 unsigned long long #define opus_uint8 unsigned char #endif /* OPUS_TYPES_H */
{ "pile_set_name": "Github" }
Genes associated to lactose metabolism illustrate the high diversity of Carnobacterium maltaromaticum. The dairy population of Carnobacterium maltaromaticum is characterized by a high diversity suggesting a high diversity of the genetic traits linked to the dairy process. As lactose is the main carbon source in milk, the genetics of lactose metabolism was investigated in this LAB. Comparative genomic analysis revealed that the species C. maltaromaticum exhibits genes related to the Leloir and the tagatose-6-phosphate (Tagatose-6P) pathways. More precisely, strains can bear genes related to one or both pathways and several strains apparently do not contain homologs related to these pathways. Analysis at the population scale revealed that the Tagatose-6P and the Leloir encoding genes are disseminated in multiple phylogenetic lineages of C. maltaromaticum: genes of the Tagatose-6P pathway are present in the lineages I, II and III, and genes of the Leloir pathway are present in the lineages I, III and IV. These data suggest that these genes evolved thanks to horizontal transfer, genetic duplication and translocation. We hypothesize that the lac and gal genes evolved in C. maltaromaticum according to a complex scenario that mirrors the high population diversity.
{ "pile_set_name": "PubMed Abstracts" }
Short cardiac iodine-123-metaiodobenzylguanidine imaging protocol in heart failure. For assessment of cardiac sympathetic nervous activity, the conventional protocol for iodine-123-metaiodobenzylguanidine ((123)I-MIBG) imaging requires several hours. To establish whether it is possible to shorten the conventional (123)I-MIBG imaging protocol, anterior planar imaging was performed in 42 heart failure (HF) patients at 5, 15 and 180 min. The washout rate of (123)I-MIBG from 5 to 15 min (WR5-15 min) was calculated as a novel index. WR5-15 min closely correlated with the conventional washout rate and inversely correlated with the heart to mediastinum ratio. Univariate Cox analysis revealed that rapid WR5-15 min, augmented plasma B-type natriuretic peptide level, and decreased left ventricular ejection fraction (LVEF) were predictors for cardiac events. Multivariate analysis showed WR5-15 min and LVEF were independent predictors. The cardiac event rate was markedly higher (73%) in patients when both WR5-15 min and LVEF were abnormal. WR5-15 min obtained from anterior planar imaging is useful for evaluating the severity of HF and clinical outcome, and may shorten the cardiac (123)I-MIBG scintigraphy protocol.
{ "pile_set_name": "PubMed Abstracts" }
Metal assisted catalyzed etched (MACE) black Si: optics and device physics. Metal-assisted catalyzed etching (MACE) of silicon (Si) is a controllable, room-temperature wet-chemical technique that uses a thin layer of metal to etch the surface of Si, leaving behind various nano- and micro-scale surface features, including nanowires (NWs), that can be tuned to achieve various useful engineering goals, in particular with respect to Si solar cells. In this review, we introduce the science and technology of MACE from the literature, and provide an in-depth analysis of MACE to enhance Si solar cells, including the outlook for commercial applications of this technology.
{ "pile_set_name": "PubMed Abstracts" }
using System; using System.Collections.Generic; using System.Linq; using System.Text; namespace RssDataSerices { class RssDataScheduler { public string PostRssFeed(string ProfileType) { string str = ""; try { Api.RssFeeds.RssFeeds objRssFeed = new Api.RssFeeds.RssFeeds(); str = objRssFeed.PostRssfeed(ProfileType); } catch (Exception ex) { str = ex.Message; } return str; } } }
{ "pile_set_name": "Github" }
Q: how to check for file extension in discord.py i am creating a python discord bot, and i have a function that if a message is sent in a certain channel, it randomly sends out a response,everything works fine but i want to restrict the bot to react only when the sent message contains a png, jpg or jpeg file heres the code(look for the bottom if str(message.channel) statement): @client.event async def on_message(message): await client.process_commands(message) if str(message.channel) not in restr: if message.content == ".sabaton": random.seed(time.time()) randnum = random.randint(0, len(songs) - 1) await message.channel.send(file=discord.File(songs[randnum])) elif message.content == ".time": await message.channel.send(f"Current time is {time.localtime()}") elif message.content == ".pmsh": await message.channel.send(help) if client.user.mention in message.content.split(): await message.channel.send('Дарова гандон(иха),мой префикс "."') if str(message.channel) == "творчество": random.seed(time.time()) rn3 = random.randint(1,2) if rn3 == 1 and message.author.bot == False: await message.channel.send("Заебись творчество") elif rn3 == 2 and message.author.bot == False: await message.channel.send("Фигня творчество") A: You can use the following conditions to restrict it: if message.attachments[0].url.endswith('PNG') or message.attachments[0].url.endswith('JPG') or message.attachments[0].url.endswith('JPEG'): pass else: pass Change the pass according to your content.
{ "pile_set_name": "StackExchange" }
I develop products that grow businesses by managing teams who leverage strategy, user experience, and agile development to bring great products to market. I have over 20 years’ experience in Fintech, building products for the investment management, private bank, retail bank, family office and RIA spaces. Go To Market Lead Instrumental in pivoting the core business of The Portrait Group to tangible investments by defining a new market via product development. For the pivot to work we employed generative research, prototyping, content strategy and daily dev cycles, all under an “agile umbrella”. We deployed a commercial product in under a year, establishing TPG as the product leader in the space. Branding Lead Branding lead on total wealth portal deployment for international retail and private bank. The 360 degree initiative (banking, liabilities, liquids and alternatives aggregation) was crafted for the bank to foster growth in the US market. Worked closely with executive management to ensure that the 360 degree vision and brand experience were implemented at all digital touch points. Best practice evangelist, passionate about the role of information design in growing business. Internally encouraged team members to embrace the role of design in our business model. Externally Client Experience Lead Client Experience lead on back office expansion initiative to capture Family Office market share. Optimized partner software for usability. Designed and led training for family office roles. Led evaluative research to promote user adoption. Facilitated role-based ethnographic studies to optimize system integration for analytics, management reporting and unique client configurations. Custom Solutions Seasoned in Client Services, with 15 years’ success coordinating requirement gathering, design, specification and production of custom reporting solutions for MFOs and private banks. Skilled in needs assessment, information architecture for UHNW, training and keeping everyone “delighted” with the engagement. Product Design Lead Design lead at start-up that revolutionized the production speed, accuracy and presentation of quarter end statements. At the time, it took operations teams up to 3 weeks to complete quarter end statements. We researched, envisioned, designed and built a SaaS solution that generated quarter end statements in 1 hour, every day of the quarter, available in both interactive and PDF format. Early Work FINEXA, 2000-2001 Designed desktop applications for financial advisors. Developed methodologies for interactive tables and charting. Belle Spring Consulting, 2000-2001 Branded and designed for startups and technology firms. Researched information rich domains, focused on financial.
{ "pile_set_name": "Pile-CC" }
Kim Yo-jong (left) trails her brother as they arrive to cast their ballots in Sunday's election. Photo: AFP
{ "pile_set_name": "OpenWebText2" }
Ni Xialian Ni Xialian (; born 4 July 1963) is a female Chinese-born table tennis player who now represents Luxembourg. She was born in Shanghai, and resides in Ettelbruck. Career She won team and mixed doubles gold medals in the 1983 World Table Tennis Championships. She moved to Germany in 1989 and settled down in Luxembourg two years later. Her husband, Tommy Danielsson, is her coach and training partner. She competed at the 2008 Summer Olympics, reaching the third round of the singles competition. She qualified for competition at the 2012 Summer Olympics in the Women's singles competition. She lost 4-2 to 16-year-old Ariel Hsing from the USA in the 2nd round in the London games. She competed for Luxembourg at the 2016 Summer Olympics in Rio de Janeiro in the women's singles competition. She lost 4-2 to Feng Tianwei of Singapore in the 3rd round. She was the flag bearer for Luxembourg during the closing ceremony. Qualified for the 2020 Summer Olympics, Xialian will become the oldest Olympian table tennis player. See also List of table tennis players List of World Table Tennis Championships medalists References External links Category:1963 births Category:Living people Category:Luxembourgian table tennis players Category:Table tennis players at the 2000 Summer Olympics Category:Table tennis players at the 2008 Summer Olympics Category:Table tennis players at the 2012 Summer Olympics Category:Table tennis players at the 2016 Summer Olympics Category:Olympic table tennis players of Luxembourg Category:Chinese expatriates in Germany Category:Chinese emigrants to Luxembourg Category:Table tennis players from Shanghai Category:European Games competitors for Luxembourg Category:Table tennis players at the 2015 European Games Category:Table tennis players at the 2019 European Games Category:European Games medalists in table tennis Category:European Games bronze medalists for Luxembourg Category:Chinese female table tennis players Category:Naturalised table tennis players Category:Naturalised citizens of Luxembourg Category:People from Ettelbruck
{ "pile_set_name": "Wikipedia (en)" }
4th July 2014 Ocean inside Titan could be as salty as the Dead Sea Scientists analysing data from NASA's Cassini mission have firm evidence the ocean inside Saturn's largest moon, Titan, might be as salty as Earth's Dead Sea. The new results come from a study of gravity and topography data collected during Cassini's repeated flybys of Titan during the past 10 years. Using the Cassini data, researchers presented a model structure for Titan, resulting in an improved understanding of the structure of the moon's outer ice shell. The findings are published in this week's edition of the journal Icarus. "Titan continues to prove itself as an endlessly fascinating world, and with our long-lived Cassini spacecraft, we're unlocking new mysteries as fast as we solve old ones," said Linda Spilker, Cassini project scientist at NASA's Jet Propulsion Laboratory in California. Additional findings support previous indications the moon's icy shell is rigid and in the process of freezing solid. Researchers found that a relatively high density was required for Titan's ocean in order to explain the gravity data. This indicates the ocean is probably an extremely salty brine of water mixed with dissolved salts likely composed of sulfur, sodium and potassium. The density indicated for this brine would give the ocean a salt content roughly equal to the saltiest bodies of water on Earth. The Dead Sea, Israel "This is an extremely salty ocean by Earth standards," said the paper's lead author, Giuseppe Mitri of the University of Nantes in France. "Knowing this may change the way we view this ocean as a possible abode for present-day life, but conditions might have been very different there in the past." Cassini data also indicate the thickness of Titan's ice crust varies slightly from place to place. The researchers said this can best be explained if the moon's outer shell is stiff, as would be the case if the ocean were slowly crystalizing and turning to ice. Otherwise, the moon's shape would tend to even itself out over time, like warm candle wax. This freezing process would have important implications for the habitability of Titan's ocean, as it would limit the ability of materials to exchange between the surface and the ocean. A further consequence of a rigid ice shell, according to the study, is that any outgassing of methane into Titan's atmosphere must happen at scattered "hot spots" – like the hot spot on Earth that gave rise to the Hawaiian Island chain. Titan's methane does not appear to result from convection or plate tectonics recycling its ice shell. How methane gets into the moon's atmosphere has long been of great interest to researchers, as molecules of this gas are broken apart by sunlight on short geological timescales. Titan's present atmosphere contains about five percent methane. This means some process, thought to be geological in nature, must be replenishing the gas. The study indicates that whatever process is responsible, the restoration of Titan's methane is localised and intermittent. "Our work suggests looking for signs of methane outgassing will be difficult with Cassini, and may require a future mission that can find localised methane sources," said Jonathan Lunine, a scientist on the Cassini mission at Cornell University, Ithaca, New York, and one of the paper's co-authors. "As on Mars, this is a challenging task." Size comparison of Titan (lower left), Earth and the Moon. Comments »
{ "pile_set_name": "OpenWebText2" }
Cue the Neil Degrasse Tyson meme, looks like we have a bad ass pair of socks over here! They came in the mail today! Thank you gifter!
{ "pile_set_name": "OpenWebText2" }
NEW DELHI: Treatment at AIIMS is likely to get costlier. The institute, in its latest proposal to the standing finance committee which meets on Tuesday, has proposed a hike of nearly 20-30% on its charges for various tests and procedures, including all heart surgeries. For example, according to the proposed changes, closure of atrial septal defect, a birth defect, would cost Rs 46,000 for general ward patients and Rs 70,000 for patients admitted in the private ward. The existing package rate for ASD closure is Rs 40,000 and Rs 57,000 respectively for the two categories. AIIMS spokesperson Dr Amit Gupta said the package rates are meant only for patients who do not fall in Below Poverty Line category. "Those who can afford should pay. We are not charging anywhere near market rate," he said. AIIMS has also proposed to revise the package rates for various treatment and procedures conducted at its dental centre and it has proposed to include new tests in department of paediatrics on chargeable basis. A faculty member, who did not want to be named, termed the move regressive. "In a poor country like India, where most people cannot afford treatment at private hospitals, how can the state absolve itself of the responsibility to provide health facilities? If AIIMS becomes even half as costly as the private hospitals, 90% of patients will not be able to afford treatment," said a doctor. Some faculty members also questioned the legitimacy of the standing finance committee to consider the agenda. "The standing finance committee mostly comprises ex-officio members," said a senior faculty member. Sources said the idea to make AIIMS self-reliant or run it on a revenue generation model had been proposed in 2005 and 2010 but was shot down by members of parliament and doctors, who felt it would affect poor. In 2010, AIIMS initiated a study to determine user charges for various services. The circular asked for the list of all procedures with respect to which user charges could be fixed. The SFC meet on Tuesday will also discuss award of work of Rs 505 crore for National Cancer Institute in Jhajjar, setting up of burns and plastic surgery unit at the trauma centre and procurement of MRI machines. The proposals will then be sent to the institute body and governing body, for final nod.
{ "pile_set_name": "OpenWebText2" }
Manumah Manumah is a village in Muscat, in northeastern Oman. References Category:Populated places in the Muscat Governorate
{ "pile_set_name": "Wikipedia (en)" }
New York, NY — Attorney Jared Johnson is by far the most ethical and respected member of the Trump for President campaign. “At first it was a little refreshing. There are all of these stereotypes about lawyers being unethical and devious, and that’s never really been in my nature. I happen to enjoy the legal profession and ensuring that people are playing by the rules. And in the beginning, the Trump campaign needed good, proven legal counsel, which I was happy to fulfill. But after a few months working in the campaign, it became clear that everyone, including the Candidate himself, expected me to find ways to bend the rules. I do have my ethics, and I find ways to stick to them.” “Every day it’s some new question. ‘Is this legal (no)’, ‘is that slander (yes)’, ‘if we don’t directly pay the person to break this person’s legs but still know about it is that legal (no)’. I mean really, how did these people get into the position they are in without the most basic knowledge of right and wrong?” RNC Endorsement “Mr. Johnson is the sole shining light in that entire campaign. I have no idea how a man of integrity got in there, but I hope to God that they find a way to keep him in,” said Jeremiah Golshan of the Republican National Committee. “Since we don’t have as direct a tie with the candidate as is usually the case, we’re relieved to know that at least one member of the campaign isn’t foaming … wait, is this on the record? We at the RNC have the utmost admiration for Mr. Johnson and for all of the members of the Trump campaign. Go Republicans! Vote Trump!”. Golshan nervously wandered away and refused to take further questions at that point. DNC Acceptance “Given the overall tone of the Trump campaign, we at the Democratic National Committee are pleased that there is at least one seemingly sane person in the Trump campaign. While we profoundly disagree with Mr. Trump and everyone associated with him, we actually admire and respect Mr. Johnson’s adherence to ethics. There have been several potential lawsuits we would have brought against the campaign if it were not for Mr. Johnson’s cool and principled intercessions,” declared Missy Henderson, DNC legal consultant. When contacted for further comment on this story, the Trump campaign informed the Brewblog that we were all horrible, horrible people for suggesting that Mr. Trump or anyone on his campaign staff was anything but above reproach. As our reporter left headquarters, he thought he saw a car following him for several blocks. But surely that was just his imagination. Comments comments
{ "pile_set_name": "OpenWebText2" }
17:32 11-03-2019 Thanh lý sofa da ở đâu? “Tôi muốn thanh lý sofa da ở đâu? Nơi nào bán sofa da bò thật xịn thanh lý giá tốt và uy tín nhất?” Sofa da thật 100% với độ êm ái cao, đàn hồi tốt và tính chất sang trọng, quý phái nên vô cùng được yêu thích trong gia đình, quán café, showroom, văn phòng, cửa hàng,….Với nhiều lý do, người dùng không có nhu cầu tiếp tục sử dụng sofa da mới mua cần bán hoặc người muốn mua sofa da nhưng bộ mới quá đắt, muốn mua lại sofa da thanh lý thì nên liên hệ địa chỉ nào? Đọc bài viết hữu ích để có được câu trả lời nhé! Mọi người thường mua sofa cũ hay sofa da thanh lý làm gì? Có rất nhiều người thích mua ghế sofa da cũ để mở quán cafe phong cách cổ. Hoặc họ dùng để làm đồ trang trí những studio theo concept cổ xưa. Nhưng hầu hết mọi người mua sofa cũ để có thể tiết kiệm chi phí. Bởi một bộ sofa thật mua mới sẽ có giá thành khá đắt đỏ. Còn một bộ sofa thanh lý sẽ có giá thành mềm mại hơn. Và nếu như biết cách chọn lựa, bạn cũng có thể sở hữu một bộ ghế xịn với chất lượng vẫn còn khá tốt. Rất nhiều khách hàng lựa chọn mua ghế sofa da được thanh lý, vì sao ư? Thị trường mua/bán sofa da thanh lý những năm gần đây rất sôi động. Khách hàng rất yêu thích sofa cũ có chất liệu xịn như da bò, da dê, da cừu,…bởi nhiều lý do: ❀ Bộ sofa da thật mới 100% có giá thành khá cao. Trên thị trường cũng có tràn lan mặt hàng sofa da Trung Quốc giả danh sofa nhập của Ý, Đức khiến người dùng lo lắng. ❀ Mua lại sofa da cũ để phục vụ nhu cầu kinh doanh quán café phong cách cổ điển. Mua làm sofa trang trí và sử dụng cho nhà ở, văn phòng, spa làm đẹp,…. ❀ Tiết kiệm được một khoản tiền đầu tư kha khá để dùng mua sắm đồ nội thất khác và đồ dùng trong gia đình. ❀ Sofa da xịn thanh lý vẫn có độ bền cao, đẹp mắt và nhiều nơi còn được bảo hành. Thời gian bảo hành tầm 1-2 năm, mẫu mã đa dạng phục vụ nhu cầu sử dụng của người dùng. Top địa chỉ thanh lý sofa da xịn cao cấp giá tốt Sofa da trở thành nội thất vô cùng được yêu thích do tính sang trọng, đẳng cấp của nó mang lại. Tuy nhiên, giá trị của bộ sofa mới có thể là hàng chục, thậm chí cả trăm triệu/bộ nên nhiều người muốn sở hữu mà không có đủ kinh tế. Để đáp ứng nhu cầu thanh lý sofa da xịn của khách hàng không sử dụng và đáp ứng nhu cầu mua sắm sofa thanh lý còn mới hơn 95%, giá tốt và uy tín của khách hàng có nhu cầu sử dụng, dưới đây là một vài địa chỉ thanh lý sofa da Hà Nội, TPHCM, Đà Nẵng được khách hàng đánh giá cao mà bạn có thể tham khảo để chọn mua sofa thanh lý yêu thích với giá thành mềm nhất! #1 Địa chỉ thanh lý sofa da cũ TPHCM: HÀNG THANH LÝ 436 Đc: 262A Lũy Bán Bích, Hòa Thạnh, Tân Phú, TPHCM Đt: 028.6660.2926 – 0948.920.921 #2 Địa chỉ thanh lý sofa uy tín tại Hà Nội NỘI THẤT ÁNH PHÁT Địa Chỉ: Số 75, Ngõ 18 Đinh Công Thượng, Hoàng Mai, Hà Nội CHỢ THANH LÝ NỘI THẤT BA HUY Địa chỉ: Số 8, đường Lê Quang Đạo, Mỹ Đình, Từ Liêm, Hà Nội #3 Địa chỉ thanh lý sofa uy tín Đà Nẵng NỘI THẤT THIÊN TIẾN Địa chỉ: 10 Nguyễn Khoa Chiêm – Cẩm Lệ – Đà Nẵng CỬA HÀNG THING STORE Địa chỉ: 114 Phạm Như Xương, Hòa Khánh Nam, Liên Chiểu, Đà Nẵng Những trang web có thể thanh lý sofa Chợ Tốt: https://www.chotot.com Thanh lý hàng cũ: https://thanhlyhangcu.com/ VinSave: vinsave.com Shoppee: https://shopee.vn Các group thanh lý nội thất trên facebook: https://www.facebook.com/ Rủi ro khi mua bàn ghế thanh lý Bên cạnh những ưu điểm đã kể trên thì việc mua đồ thanh lý cũng có nhiều bất cập. Thậm chí là với những nơi mà Kita giới thiệu đến bạn phía trên. Cũng từng gặp không ít phàn nàn và đánh giá không tốt từ khách hàng. Các rủi ro khi mua nội thất bàn ghế cũ có thể kể đến như: + Các sản phẩm nội thất không bán được đã để lâu năm, gần hết hạn sử dụng. Điều này thì bạn phải chấp nhận vì “tiền nào của nấy” + Các sản phẩm cũ bị hỏng hóc bên trong nhiều nhưng bạn không thể thấy. Chỉ cần bên ngoài bạn thấy ưng ý là sẽ mua. Thế nên xài được 1 thời gian ngắn bạn lại phải bỏ tiền đi sửa chữa, bọc lại. + Nhiều nơi nắm bắt tâm lý khách hàng muốn mua đồ thanh lý, đồ giá rẻ. Thế nên cho sản xuất hàng loạt các mẫu ghế hàng chợ kém chất lượng. Khách hàng xài chưa bao lâu đã hư. Điều này gây tốn kém hơn nếu so với việc mua ghế mới chất lượng, xài được lâu. Những điều cần làm khi mua nội thất thanh lý 1. Kiểm tra review cửa hàng dự định đến mua 2. Đến trực tiếp cửa hàng xem qua thử 3. Kiểm tra sản phẩm thực tế, nếu mua hàng onl hãy kiểm tra các thông tin cẩn thận 4. Hỏi kỹ về chế độ bảo quản và bảo hành sản phẩm 5. Xem xét giá thành để tránh việc mua hàng thanh lý giá cao hơn hàng mới với mặt hàng cùng chất liệu Nếu vẫn không an tâm khi mua nội thất bàn ghế cũ được thanh lý. Khách hàng hãy lựa chọn một đơn vị uy tín để đặt đóng mới hay mua bộ sofa phù hợp cho chính mình nhé! Xem những mẫu ghế sofa da mới nhất cùng Kita Công ty TNHH Kiến Tạo và Kiệt Tác Kita Sky Xây dựng nhà ở, thiết kế và thi công nội ngoại thất trọn gói. Sản xuất, nhập khẩu và mua bán sản phẩm, chất liệu nội ngoại thất giá tốt nhất thị trường. Trụ sở công ty: 16 Trần Bá Giao, phường 5 quận Gò Vấp Hotline: 0909506808 – 0938836608 – 0938183383 Fanpage: Tikita’s House – Kita Sofa – Kita Furniture – Kita Furniture Decoration
{ "pile_set_name": "OpenWebText2" }
[Quantitative analysis in nuclear nephrourology: clearance, uptake and transit time]. Radionuclide renal study is only a method that can provide anatomical as well as functional information on the kidney. There have been many reports on quantification of the renal function using radionuclides. They are summarized to two groups: blood and/or urine sampling method and external counting method. The former is accurate and reproducible in quantification of the renal function, but is rarely applicable in a routine practice due to technical complexity. On the contrary, the external counting method by means of a gamma camera and dedicated computer system is simple and practical in a routine use, but is less in reliability of quantitated renal function than sampling method. In this paper, technical and diagnostic characteristics of the quantitative methods on renal function using the radionuclide are reviewed.
{ "pile_set_name": "PubMed Abstracts" }
Q: 19F NMR of hexafluorobromine(VII) cation $\ce{[BrF6]+}$ is an octahedral species, and should have only one fluorine environment due to the symmetry. $\ce{Br}$ has nuclear spin $I=3/2$ and therefore is unlikely to cause splitting due to rapid interconversion between its spin up and spin down states averaging to a zero magnetic effect. Therefore I would expect one singlet in the $\ce{^19F}$ NMR spectrum. However... the $\ce{^19F}$ NMR is actually two $1:1:1:1$ quartets (at low temperatures). Can someone help me find the flaws in my reasoning? A: $\ce{BrF6^+}$ does have an octahedral structure consequently all of the fluorines are equivalent. As you point out, bromine is a spin = 3/2 nucleus, therefore, it is also a quadrupolar nucleus (all nuclei with spin > 1/2 are also quadrupolar). A spin 3/2 nucleus that is coupled to another nucleus (fluorine in this case) will split the nmr signal for the other nucleus into a 1:1:1:1 quartet. In the case of bromine we don't normally see this coupling because bromine typically undergoes rapid quadrupolar relaxation (some quadrupolar nuclei do, some don't) which washes the coupling out (e.g. rapid quadrupolar relaxation effectively decouples the nuclei, that's why the protons in $\ce{CH3Br}$ are a singlet, for example). However, when the quadrupolar nucleus exists in a highly symmetric environment (octahedral, tetrahedral geometry) the electric filed gradient at the nucleus is near zero and quadrupolar relaxation becomes slow (on the nmr timescale) and coupling can often be observed in such cases. Finally, bromine occurs naturally as a mixture of two isotopes, $\ce{^{79}Br}$ (50.7%) and $\ce{^{81}Br}$ (49.3%). Both isotopes are quadrupolar with spin = 3/2. Because of the slight difference in electronegativity of the two bromine isotopes, they will produce a slight difference in chemical shift for the fluorines bonded to them. Hence, this mixture of $\ce{^{79}BrF6^+}$ and $\ce{^{81}BrF6^+}$ will produce two 1:1:1:1 quartets in the $\ce{^{19}F}$ nmr spectrum.
{ "pile_set_name": "StackExchange" }
Introduction {#s1} ============ Depression has become one of the leading causes of disability worldwide. In 2015, 7.5% of depression patients lived with disability ([@B1]). However, many people living with this condition are not aware of their illness. In some cultures, it is also considered shameful to disclose one's mental health problems to family members or even doctors, partially due to the tradition of presenting a positive self-image to others ([@B2]). Similar to many other countries, China is facing a severe shortage of mental health professionals; China has 23,000 psychiatrists---about 1.7 for every 100,000 participants ([@B3]). The social stigma related to cultural and moral beliefs also deters people in China from seeking treatment. Therefore, it has become essential to help individuals be aware of their symptoms so that they can decide when to seek support from professionals. In the last decade, researchers have begun to explore the possibility of using digital footprints to monitor social media users' depression symptoms because social media data have provided a record of users' emotional and behavioral patterns. In this work, we introduce a new approach to analyze the affect patterns disclosed on social media posts and explore how the social media affective language is associated with depression symptoms. In psychology, affect refers to nonreflective feelings towards stimuli, e.g., the feelings of pleasure or tension ([@B4], [@B5]). Reduced positive affect (PA) and increased negative affect (NA) have been found to be classic markers of major depressive disorder (MDD) ([@B6], [@B7]). Increased NA signals negative interpretation bias and negative repetitive thinking, and decreased PA indicates a reduction of interest or pleasure in response to stimuli. Existing empirical studies often examine people's affect using measurement scales or professional interviews ([@B8]). The emergence of sentiment analysis provides an alternative way to study affect. Sentiment analysis is a process of extracting affective words or phrases from text. It has been found that affect, especially NA expressed in social media text, reflects social media users' psychological characteristics and mental health status ([@B9]--[@B11]). NA is a summary of a variety of negative emotions, including anger, sadness, fear, etc. Findings from both empirical studies and social media data have shown that users with high depression symptoms tend to use more words/phrases containing NA ([@B12], [@B13]). Why does the use of NA words relate to depression symptoms? On the one hand, depressed individuals tend to have cognitive vulnerabilities, which are cognitive processing biases in attention, memory, interpretation, and repetitive negative thoughts ([@B14]). For example, "No one cares about my problem," is a negative cognitive bias. On the other hand, frequent occurrences of NA reflect dysfunctional stress response. Individuals with a dysfunctional stress response system often fixate on the causes, consequences, and meanings of stressors, which results in "stress-reactive rumination," a passive comparison of one's current situation with some acknowledged standard ([@B15]). Contrary to NA, PA is in general beneficial to health and cognitive function ([@B16]). Studies have found that nondepressed individuals are often motivated to downregulate negative emotions and upregulate positive ones ([@B17], [@B18]), but depressed individuals usually experience reduction of pleasure ([@B19]). Similar to the empirical findings, social media users also tend to post positive content to seek social approval and/or form positive impression ([@B20], [@B21]). However, Locatelli and colleagues have recently found that people with depression symptoms also use more positive affective expressions in social media ([@B19]). Accordingly, they hypothesize that the relationship between PA and depression symptoms is possibly mediated by rumination. Although there exists a large amount of evidence to support that affect expressed in social media texts can reflect mental health status, few of the studies examine the life stressors that may trigger NA and the fixation behavior. In addition, although NA has been extensively studied, there is a very limited amount of literature that examines the relationship between PA in social media content and depression symptoms. In order to fill these gaps in this line of research, this paper investigates the patterns of positive and negative affect, as well as the rumination language following a stressful life event, targeting a popular microblogging social media website in China: Weibo. Examining life stressors presents a challenging question: What kind of events are considered to be more stressful, as opposed to those that are less so? Some stressors are uniformly perceived as more damaging to mental health than others. By asking participants from diverse cultures to rate how much readjustment was required for 42 life events, Masuda and colleagues identified a set of life events that were perceived as detrimental to mental health ([@B22]). Among others, death of a spouse, divorce, and marital separation were ranked as the top three events requiring the most life readjustment. Later studies found similar rankings in the life events requiring much life adjustment, but different rankings in those requiring moderate to low levels of adjustment, e.g., being "fired" from work dropped from the 8th in ([@B22]) to the 47th in ([@B23]). Here, we focus on three life stressors that respectively bring severe (e.g., marital separation), medium (e.g., severe illness of a family member), and low (e.g., being fired from work) levels of impact to mental health. In light of the above discussions, this paper aims to address the following two research questions: RQ1: Does social media affect reflect cognitive vulnerability to depression symptoms?RQ2: What are the characteristics of stress-reactive affective content on Weibo? In particular, we focus on rumination (NA), and investigate what stressful life events people tend to ruminate on social media. For RQ 1, we first visualized the positive and negative affect patterns of Weibo users in multiple time windows. Then, we examined the relationship between social media affect and depression symptom scores when specific life stressors were presented to the users. For RQ 2, we examined the rumination in postevent reaction. Stress reactive rumination reinforces the interpretation bias of an individual, thus putting an individual at higher risk of developing depression symptoms. We looked into how social media users ruminated on specific life events and summarized the characteristics of the rumination. Contribution {#s1_1} ------------ This paper provides an opportunity to advance the understanding of how positive and negative affect reflects cognitive vulnerabilities to depression. By examining the stress reactive affective language on social media data, we seek to identify affective content that links to cognitive vulnerability. Addressing these issues would help better understand the pattern of affect in a social media text and its association with people's vulnerability to affective disorders in general. Moreover, by observing what types of stressors social media users tend to ruminate on, this paper offers essential insights into cognitive biases in social media data, thus promoting future research on life events and affect in the social media context to take into account these biases. Data and Data Collection {#s2} ======================== Weibo {#s2_1} ----- Weibo is a social media platform where users can publish a short piece of text, video, or photo to customized lists of friends or followers. Before 2016, users could write up to 140 words on each post. Since then, the maximum number of words per post has been increased to 2,000. In Weibo, users can follow or unfollow others, like or dislike others' posts, make comments to those posts, or share some of those posts to their social networks. By 2017, there were nearly 300 million users on Weibo, accounting for one fifth of the population in China ([@B24]). Multiple survey studies show that the majority of Weibo users are in their 20s and 30s ([@B25], [@B26]). Female users are more likely to mention they were diagnosed with depression than male users ([@B27]). In this study, we collected a sample of participants' Weibo posts, and assessed their depression symptoms using a depression symptom screening test and subjective stresses of daily lives. Data Collection {#s2_2} --------------- We posted a recruitment notice for this study on a personal Weibo account on June 10, 2016. The survey was open from June to September, 2016. A few science bloggers and entertainment bloggers reposted our recruitment notice voluntarily. We also promoted our survey with paid advertisements to increase participation rates while the survey was open. The study targeted users residing in China, aged over 18. Participants of the study were asked to complete a survey containing the Center for Epidemiologic Studies Depression (CES-D) scale and a stressful life event survey. Participants could optionally sign a consent form (see Appendix A) to allow us to collect and analyze their Weibo posts by computer programs. A total of 1,918 participants responded to the survey between June and September 2016. Among them, 1,629 allowed us to access their Weibo data. We used a custom Python script to automatically collect 198,485 Weibo posts from these 1,629 users. All the posts were posted from January 2009 to September 2016. Depression Symptom Screening Test {#s2_3} --------------------------------- We used a depression screening test, namely, the Center for Epidemiologic Studies Depression Scale (CES-D), to infer participants' depression symptom levels. The original CES-D was a 20-item self-reported scale designed to measure depression symptoms in the general public ([@B28]). We adopted the short form developed by Kohout ([@B29]) and translated into Chinese by Chin et al. ([@B30]). A back translation version of the short form is provided in Appendix A. This short form sacrifices little precision and taps the same symptom dimensions as the original CES-D. Both the original CES-D and the short form were tested in the Chinese population. The internal consistency of CES-D 10 in the Chinese population was satisfactory (Cronbach *α* = 0.78 ± 0.79). Reliability over a period of 3 years was also found to be significant (*r* = 0.44, p 50.01) ([@B31]). In the short form, participants were asked to rate the extent to which they experienced depression symptoms. An example item could be: "My sleep was restless." Responses are on a Likert-type scale, including 1 ("Rarely or none of the time"), 2 ("1--2 days last week"), 3 ("3--4 days last week"), 4 ("Every day"), and 5 ("Every day for at least two weeks"). Appendix A shows the standard Chinese questionnaire used in this study (with English translation). Stressful Life Event Survey {#s2_4} --------------------------- We examined the stressful life events recently encountered by participants before completing the survey. A major problem in assessing life stress is that whether an event is considered stressful or not could be very subjective. Some stressors can be motivating to one person but stressful to others. Therefore, we focused on objective stressful life events. After asking the participants whether they had experienced, up to 3 months before completing the survey, any life events that they perceived as stressful, we asked them whether they had recently experienced one of three specific stressful events: relationship breakdown, a family member/close friend being diagnosed with severe illness, or being fired from work. The first two were ranked within the top three to top ten in the Social Readjustment Rating Scale (SRRS) ([@B32]); and the last one was found to drop from the top 10 to the top 50 in a recent revisit to SRRS ([@B23]). In addition to these specific events, we provided the option of "others" on the survey, which allowed participants to include any events that they themselves perceived as significant life stressors. Methodology {#s3} =========== Summary Statistics {#s3_1} ------------------ To compare the patterns of affect score from participants with high level of symptoms with those with low level of symptoms, we split participants into two groups according to their CES-D survey scores using a cutoff point of 22, which has been applied in multiple studies ([@B9], [@B28], [@B33]). Here, we present the summary statistics of the two groups. [**Figure 1A**](#f1){ref-type="fig"} shows the basic statistics of users' CES-D scores, and [**Figure 1B**](#f1){ref-type="fig"} shows the statistics in the H-group and L-group. Internal consistency of the CES-D scale was high (Cronbach's *α* = 0.62). Participants posted more positive Weibo posts (*N*=50,731) than negative ones (*N*= 35,651). Their mean affect was negatively correlated with their CES-D scores (*r* = -0.13, *p \<* 0.001). ![Statistics of the Center for Epidemiologic Studies Depression (CES-D) score. **(A)** shows the CES-D score in the whole sample (N = 1,628), the red line divides the users into the high and low groups according to their CES-D scores. **(B)** shows the CES-D scores of the high (N = 776) and low (N = 853) groups, the dotted lines indicate means.](fpsyt-11-00054-g001){#f1} Computing Affect Score {#s3_2} ---------------------- We used a sentiment analysis service provided by Lexalytics (<https://www.lexalytics.com/>) to assign a continuous sentiment score ranging from 1 to −1 to each document (i.e., Weibo post). Lexalytics has performed satisfactorily compared with other popular sentiment annotation tools ([@B34]), such as OpinionFinder and Sentistrength. Lexalytics uses part-of-speech tagging to identify adjective-noun combinations, and then counts the number of affective words in a sentence. The algorithm adds weights to the word count according to a sentiment library developed by Lexalytics. The sentiment library contains an extensive collection of adjectives, each manually scored by human annotators according to their judgment of how negative or positive the word is. The sentiments of the words are inverted in the presence of negators (e.g., "not") or some conjunction (e.g. "but" and "however"). Lexalytics also accounts for multilayered sentiment; if a sentence contains both positive and negative affective words, the two types of words may cancel each other out, thus making the document neutral. Before computing the affect score, we preprocessed the Weibo posts following some simple procedures, including removing Email addresses and hyperlinks and encoding emoticons using descriptive words within square brackets, e.g., \[sad\]. Visualizing Affect Pattern {#s3_3} -------------------------- We visualized the affect pattern of each user over a time series in the unit of day, and applied a generalized linear model to smooth the time series. The timeline was aligned in a backward manner, with the day when users completed the CES-D scale as "Day 0" and the day before "Day 0" was "Day 1." Note that "Day" here is not a calendar day. A calendar day might include events that influence public affect in general. For example, extreme weather might lead to more NA, and holidays to PA. To reduce the noise from holidays, weather, and other confounding factors on calendar dates, we residualized the daily affect of each participant *vi* by subtracting it with the mean affect score of the whole sample on that day *µ*. Therefore, the adjusted post affect score would be *vi* − *µ*. We were interested in participants' affect patterns at different stages before they developed depression symptoms. Examining the stages presented a challenge: How to define the time window of each stage? Note that the self-reported score is not a gold standard for diagnosis, participants might develop the symptoms long before they completed the measurement scale. Therefore, we first defined the time window (T3) as Day 0 to Day 30 to observe the affect score while participants were experiencing high symptoms. Literature suggests that early symptoms happened in a time ranging between 6 weeks and 23 months ([@B35], [@B36]). Hence, we defined T2 as Day 0 to Day 365 to examine the development of early symptoms within a year. We were also interested in the affect pattern beyond the flare-up of symptom, so we set up T1 as Day 0 to Day 1095 to observe the longitudinal affect over the three years (see [**Figure 2**](#f2){ref-type="fig"}). Note that depression is a persistent condition that can last for years if left untreated, thus, some participants might have been living with symptoms for years. ![Time windows.](fpsyt-11-00054-g002){#f2} Cognitive Vulnerability Analysis {#s3_4} -------------------------------- Individuals with cognitive vulnerability are more likely to develop depression symptoms if experiencing a stressful life event. Therefore, we conducted a within-subject correlation analysis between affect scores and CES-D scores before the occurrence of specific stressful life events. We divided the participants into two groups based on whether they had experienced certain life events in the recent 3 months. We focused on examining the events that could bring more severe impact on participants' depression symptoms. Among the 250 participants who answered the life event questions, 77 reported that they had encountered at least one stressful life event recently (CES-D median = 26) (see [**Table 1**](#T1){ref-type="table"}). Among them, those who reported having a breakup (CES-D median = 29) or being fired from work (CES-D median = 29) tended to develop more depression symptoms. Accordingly, we grouped the participants according to whether they had been through these two life events in the recent 3 months. ###### Center for Epidemiologic Studies Depression (CES-D) scores of the participants who experienced stressful life events. events N CES-D ----------------------- ---- ------- -------------- total 77 26.00 21.00--32.00 break up 33 29.00 24.00--34.00 illness 23 23.00 20.00--24.52 being fired from work 12 29.00 23.50--31.25 other 31 25.00 21.00--32.00 more than two 17 26.00 21.00--35.00 Since stressful life events occurred in the recent 3 months (90 days) prior to the completion of the survey, we selected three time windows: 90 days to 1 year, 90 days to 2.5 years and 90 days to 3 years before the completion of the survey. In each window, we computed the residualized daily mean affect score and conducted a correlation analysis between the mean affect score and CES-D score. Due to multiple correlation tests in the analysis, we used a permutation test to reduce the uncertainty of *p*. In the permutation test, the labels of the data were rearranged in each computation and the *p*-value achieved in the statistical test was estimated based on 20,000 simulations. Rumination Language {#s3_5} ------------------- Before analyzing the characteristics of rumination language, we first annotated the posts that contained rumination language following one of the three stressful life events (c.f Section 2.4). We selected the Weibo posts from 77 participants who reported having encountered at least one stressful life event in the recent 3 months, and focused on their Weibo posts between Day 0 and Day 90, because this is the time window closest to the time point when these participants self-reported their depression symptoms. Instead of using a keyword approach to capture the stressful life events, we manually annotated life events. In some cases, we identify life stressors from contextual information. For example, a post such as "She left me, my heart is broken" indicates a relationship breakup. Then, we analyzed whether these posts reflected any of the three types of cognitive tendencies ([@B37]), including the tendency to focus on negative attributions and inferences, the tendency to focus on hopeless thoughts, and the tendency to focus on coping strategies. To protect users' privacy, we removed the name entities and other sensitive information that might reveal the identities of these persons from the Weibo examples. Our annotation was carried out with an in-house, online annotation tool. Annotation guidelines for both rumination and stressful life events can be found in Appendix B. Two authors annotated life stressors. The interrater reliability was 0.80 for rumination language and 0.92 for life events. Appendix B shows the annotation guideline for both annotation tasks. Result: Cognitive Vulnerabilities {#s4} ================================= Visualizing Affect Patterns in Multiple Time Windows {#s4_1} ---------------------------------------------------- We computed the average affect score of each individual and examined the affect patterns in the three time windows. [**Table 2**](#T2){ref-type="table"} shows the statistics of the affect scores in the H-group and L-group, respectively. It is evident that the H-group consistently shows lower affect in T1, T2, and T3. ###### Basic statistics of affect and Center for Epidemiologic Studies Depression (CES-D). Time H-group L-group all participants ------ --------- --------- ------------------ ---- -------- ----- ------- ------ ---- -------- ------- ------ T1 781 −0.009 0.11 27 24--34 861 0.01 0.09 27 24--34 0.00 1.32 T2 732 −0.002 0.07 19 18--20 678 0.006 0.06 19 18--20 0.002 1.55 T3 794 −0.02 0.05 27 24--34 500 0.03 0.06 19 18--20 0.005 2.22 M, mean; sd, standard deviation; N, number of participants in each time window; T1, three-year time window; T2, one-year time window; T3, 30-day time window; Affect, mean affect score on a day. We plotted the participants' affect against the time (see [**Figure 3**](#f3){ref-type="fig"}). Note that Day 0 was the day when the participants completed the CES-D survey. We conducted a Welch t-test to detect the significance of the affect differences between the two groups, and the *p*-values were adjusted following the Bonferroni correction. ![Affect patterns of the high symptoms and low symptoms group. Red lines, H-group; Blue lines, L-group. T1, three-year time window; T2, one-year time window; T3, 30-day time window. Figures of negative affect are negative up.](fpsyt-11-00054-g003){#f3} We found distinguished affect patterns between the two groups. As for NA, the H-group showed significantly higher NA than the L-group in T1 (3 years) (*t*(2044) = 4.65, *p \<* 0.001, Cohen's *d* = 0.20) and T3 (30 days) (*t*(58.6) = 3.45, *p \<* 0.05, Cohen's *d* = 0.88), but not in T2 (1 year) (*t*(724.7) = 1.05, *p \>* 0.05, Cohen's *d* = 0.13). As for PA, the H-group showed significantly higher PA than the L-group in T2 (*t*(721.3) = 1.98, *p \<* 0.05, Cohen's *d* = 0.14), but not in T1 (*t*(2046) = 1.76, *p* = 0.07, Cohen's *d* = 0.08) and T3 (*t*(59.8) = 0.44, *p* = 0.6, Cohen's *d* = 0.11). The persistently high level of NA signals a negative cognitive bias in the H-group. The elevated level of PA might indicate that the participants in the H-group incorporated various coping skills to tackle life stress. However, this coping ability might be impaired when an individual has already developed severe depression symptoms. Life Stressors and Vulnerability {#s4_2} -------------------------------- We first looked at how many participants actually mentioned on their social media posts the life stressors they reported to us. Our annotation result shows that only seven participants indicated a breakup experience, but no one mentioned being fired from work. Among the 23 participants who reported to us that their significant others were diagnosed with severe illness, only one mentioned it on Weibo. Our result suggests that participants are very selective regarding what life stressors they want to share to the public, of which, relationship breakup is the one most commonly mentioned on social media. In the previous sections, we observed that people with high CES-D scores used more negative affective words on their social media posts over years, which indicates certain degrees of cognitive bias. In this part of analysis, we further raise the question, do people displaying cognitive bias in their social media posts over a long period of time have higher risks of developing depression symptoms when they are under stress? To answer this question, we conducted a correlation analysis between affect and depression symptoms before the life stressor occurred. Since participants reported that life stressors happened between day 0 and day 90, we used day 90 as a pivot. We broke down the timeline into three time windows and observed the correlations between depression symptoms and social media affect in each time window (see [**Table 3**](#T3){ref-type="table"}). Here, the time line starts from the pivot to 1 year, 2 year and 3 years before the pivot. Participants in table 3 all completed the life event survey. The 'Yes' group refers to participants who reported a relationship breakdown or being fired from work (N = 45), the 'No' group (N = 205) refers to participants who experienced other life stressors or no life stressors. We divided participants according to life stressors they experienced because those who experienced a relationship breakdown or being fired from work have highest self-reported symptom score (see [**Table 1**](#T1){ref-type="table"}). We found that the amount of negative affective words in the 'Yes' group is moderately correlated with their self-reported symptom score long before the life stressor occurred. Participants in this group seem to be less satisfied with their daily life activities in general. Our result suggests cognitive vulnerability can be observed in longitudinal social media data. ###### Correlation between Center for Epidemiologic Studies Depression (CES-D) score and social media affect before the occurrences of life stressors. Relationship breakdown/fired from work Yes No ---------------------------------------- -------- --------- --------- -------- --------- --------- time window (from 90 days to...) 1 year 2 years 3 years 1 year 2 years 3 years positive affect −0.17 −0.17 0.06 −0.017 −0.025 −0.025 negative affect 0.38 0.40\* 0.40\* −0.038 0.021 0.021 'Yes' refers to the fact that the participants experienced relationship breakdown or being fired from work in the recent 3 months before they completed the CES-D measurement. The number shows the correlation between participants' CES-D score and their average affect over a period of time (1 year, 2 years, 3 years before they completed CES-D measurement). \*p \< 0.05; p \< 0.1. Results: Stress-Reactive Rumination {#s5} =================================== Among the three life events we examined in this study, relationship breakdown was the most commonly mentioned stressor on Weibo. Therefore, we focused on examining the rumination language from the participants who had experienced relationship breakdown (N = 33). Among them, only seven mentioned the word "breakup" on their Weibo posts. We annotated 151 Weibo posts from the seven participants, these posts were posted between day 0 and day 90. We found that 23% (N = 33) of their posts contained rumination language, and all of the rumination contents were related to relationship breakup. We observed that the rumination language indicated various types of cognitive tendencies, and the most common one was focused on negative attribute. People tend to ruminate on the loss of a relationship. For example, "I can't face reality." "I can't move on." "Your favorite Mr. Z has left you." (see Examples 1 and 2 in [**Table 4**](#T4){ref-type="table"}). Occasionally, people have hopeless thoughts, such as "life is meaningless" (see Example 3 in [**Table 4**](#T4){ref-type="table"}). They tend to linger on the negative emotions, for example, "My tears keep pouring down when I'm not busy with anything." Meanwhile, we also observed that people adopted various coping strategies, such as reappraisal, e.g., "I don't like you anymore." and problem-solving, e.g., "I have to treat myself well." "stay strong and still" (see Example 4 in [**Table 4**](#T4){ref-type="table"}). These coping strategies often contain positive emotions. ###### Examples of rumination contents. Participant Rumination content Translation ---------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Example 1: Focus on negative attribute 1 你最爱的Z先生,已经离开你了 Your favorite Mr. Z has left you. 1 隐藏了关于你的一切,不后悔曾经爱过你,也没力气再向前。如果我的心痛全世界没有一个人懂,我也不后悔曾经爱过 I hide everything related to you, I never regret loving you, but I can't dare to move on. Even if no one else in the world knows my sorrow, I will never regret I fell in love with you. 1 曾经最爱的那个人怎么就不爱了呢,想起曾经的快乐,和再也回不去的困惑,总是做不到头也不回的回到现实中去。总想着有一天春风和煦,我们还是可以一起离开这里,忘掉所有不愉快。可是改变了就是改变了啊 How come I don't love the person I used to love anymore? I remember all the joy and confusion, I can't face the reality. I am always thinking about that one day, we will leave this place together and forget all the sorrows. However, something has changed. 1 一闲下来眼泪就往上涌,都会过去的,会过去的 My tears keep pouring down when I am not busy with anything, and everything will be fine, will be fine. Example 2: Focus on negative attribute 2 可能你很久以后才学会爱人,我很遗憾只做了你途中の风景 Maybe you will learn how to love again, and it's a shame that I'm only scenery in your life. 2 一万次的道别难道还不够,也许再见只是一个承诺,你在夕阳里回首的轮廓,我到现在依然记得 No matter how many times we say farewell, it's never enough. Maybe this is just a promise to you. I still remember the way you look at me at sunset. Example 3: Focus on hopeless thoughts 2 一句话也不想说,不是淡薄而是呵呵,不是不多想而是乏了。静的只听得见自己的呼吸,淋一场大雨不管不顾,放声大哭。然而眼泪也出不来,没有意义没有寻找的生活,人早已经麻木。在这么下去得抑郁不可 I don't want to say anything, because I'm too tired to think of anything else. The world is so quiet that I can hear my breath. I showered in the rain and cried out loud. There are no tears in my cry, and life is meaningless, I feel numb about my life. I will be depressed soon. Example 4: Focus on coping strategies 3 不做白日梦了,认真做事,好好生活 Stop daydreaming, work hard and enjoy life. (problem solving) 3 终于可以不再爱你了,真好 Finally, I don't love you anymore, that's great. (reappraisal) 3 25岁,不矫情,不任性,不抱怨!摒弃外界眼光,只为自己而活。 I'm 25 years old now, and I'll be strong, mature and stop complaining. (problem solving) 3 自己也要对自己好啊 I have to treat myself well. (problem solving) 2 真正能依靠的唯有内心的强大,坚强难得,却定心 I should rely on the power inside me, stay strong and still. (problem solving) 2 其实真的不用那么敏感,我不在喜欢你了,我的名字只是来自一句歌词,没翅膀也做梦想家 Don't be over-sensitive, I don't like you anymore. My name comes from a song lyric: "I want to be a dreamer even without wings". (reappraisal) Discussions {#s6} =========== Implications {#s6_1} ------------ In this paper, we applied a data-driven approach to analyze individuals' affect patterns on a Chinese social media platform. Overall, we found that people's affective expressions on social media could reflect their risks of developing depression symptoms long before early symptoms were expressed. Therefore, researchers should examine social media posts over a longer time frame when studying depression symptoms. By looking at NA and PA separately, we found that individuals with high depression symptoms tended to use more negative and positive affective words on their social media status updates in general. This finding is in contrast with the findings in traditional empirical studies but aligns well with the recent findings from Locatelli and colleagues ([@B19]). We speculate this is related to the fact that social media users tend to present themselves positively ([@B20], [@B21]). This finding might suggest that users with high depression symptoms are more likely subject to a greater level of self-presentation bias. Accordingly, researchers should take into account the characteristic of specific social media behaviors while using social media data to study psychological symptoms. We also found that users rarely mentioned significant life stress on social media. Among 77 people who told us on our survey that they had experienced a stressful life event, only about 10% of them had mentioned it on a Weibo post. This encourages the researcher to be aware of a highly biased sample when conducting research on life stressors with social media data. Since female users are more likely to disclose their mental state ([@B27]), our sample for rumination might also be biased toward female users. So far, most of the existing studies that make use of social media data to infer depression symptoms have only used a quantitative approach to analyze the language in the posts. Few studies have attempted to examine the content that is directly linked to negative cognitive biases. In our study, we examined the rumination language from the participants who had recently experienced a breakup. This group of people also had exceptionally high symptom scores (M = 29). We found that 23% of their Weibo posts contained rumination contents. Our finding aligns well with the literature on depression symptoms and post-event rumination ([@B38], [@B39]). Although their rumination often focused on negative attributes, we also found evidence of problem-solving coping strategies ([@B40]). These findings provide insights into identifying social media content that is directly associated with depression symptoms, and call for a more calibrated approach to measure depression symptoms by looking at cognitive biases in social media data. Limitations {#s6_2} ----------- Chinese Weibo has a sophisticated filtering system to censor Internet data; contents considered "harmful" to the community will be immediately tagged and discarded ([@B41]). Hence, swear words and some negative opinions are often censored in such a social media platform. In order to evade the censorship, social media users start to use metaphorical language or change the written forms of swear words. Simple natural language processing techniques are less reliable in detecting such variations of negative or sarcastic expressions. In addition, there are confounding factors that might affect our conclusions, such as the offline behaviors not observable in social media data. Therefore, affect expressed on social media data only reflects a small portion of daily life affect. Furthermore, the results of this study are also biased toward the data generated by active Weibo users. All these limitations prevent us from making stronger or more general claims, but our study still provides useful insights about cultural dependent symptoms and vulnerability as indicated by social media data. Conclusions and Future Work {#s7} =========================== We presented a comprehensive study of negative and positive affects shown on the Weibo posts of Chinese social media users. First, we collected Weibo status updates from users who completed a survey to measure their depression symptom levels and detect their life stressors. We visualized users' social media affect in a temporal manner and proceed to examine their language after they experienced specific life stressors. Our results show that increased negative and positive affects in social media status updates are closely related to elevated depression symptoms. Such a unique pattern reflects cognitive vulnerability to developing depression symptoms. Users with cognitive vulnerability have higher depression symptom scores after they experience specific stressors in life. Finally, we proposed to study the rumination language in social media content with negative affect, because rumination language is associated with dysfunctional stress response. This study reveals how social media based measures serve as a longitudinal resource to monitor participants' vulnerability to mental problems. It is potentially useful for clinicians to identify individuals at risk. Some of the findings could be limited to Chinese culture. More cross-cultural studies are necessary to identify the cultural differences and their influences on mental disorders. Data Availability Statement {#s8} =========================== The data of this paper can be made available based on appropriate requests to the corresponding authors. Ethics Statement {#s9} ================ This study was approved by the College Research Ethics Committee of City University of Hong Kong. The methods were carried out in accordance with the approved guidelines from the College Research Ethics Committee. Written informed consents were obtained from all the participants. Author Contributions {#s10} ==================== LC contributed to the design and data collection. LC and TG contributed to data analysis and interpretation, drafting, and revising the paper. CC contributed to supervision and paper revision. Funding {#s11} ======= TG is supported in part by the Natural Science Foundation Committee of Guangdong Province (Grant No. 2018A0303130235) and the MOE Project of the Centre for Linguistics and Applied Linguistics, Guangdong University of Foreign Studies. Conflict of Interest {#s12} ==================== The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The authors thank Dr. Zheng Pan from the South China Agricultural University for the help on web scraping and Dr. Rob Davidson for suggestions on this work. **Introduction:** This document contains the survey questions and the translated/back translated version of the CES-D survey. Data Collection Consent Form Options --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------- 本人是香港城市大学心理系硕士生,此研究目的是用微博数据建计算机模型自动预测心理特质。我们需要搜集你的微博数据,如同意我们收集您的数据,请在本问卷填写您的微博用户名称。如不同意,请忽略。本问卷收集的数据只用于研究用途。参与研究同意书: 1\. 本人已经明白上述的资料,并同意参与这次研究。2. 不同意参与这次研究 I am a master student from the City University of Hong Kong, HKSAR. We are looking for Weibo users to complete this survey. The purpose of this study is to identify the characteristics of social media users with depression symptoms. You are opting to fill out the review below and allow us to collect your Weibo data. Your data will only be used for this study. 1\. I understand the information, and I agree to participate in this study. 2. I don't want to participate in this study. Life Events Survey Question Translation Options 1\. 你的微博名称(不是你邮箱的名称,例如:luciasalar) 最关键的一步,大家务必要填写。实在没有微博请填写"无" Your Weibo account (Not your email address, e.g.: luciasalar) 1\. 你过去三个月有经历什么重大压力吗?(例如:失恋,亲人患病) Have you experienced any major stress in the past 3 months? (e.g., breakup, family member being diagnosed with illness) \(a\) Yes (b) No 2\. 如选择有,请选择(可多选): If you selected Yes in the previous question, please specify the stressful life event (multiple choice): \(a\) breakup (b) family member being diagnosed with severe illness (c) being fired from work (d) Others 3\. 你曾经得过抑郁症吗? Have you ever been diagnosed with depression? \(a\) Yes (b) No (c) I don't know Below is the translated CES-D scale and its back translation, the answers for each questions are: a. I barely feel that way; b. 1-2 days last week; c. 3-4 days last week; d. every day; e. every day and it has been for 2 weeks. Question Back Translation ---------------------------------- ----------------------------------------------------------------------- 1\. 你最近不想吃东西、胃口不好 You have a poor appetite recently and you don't want to eat anything. 2\. 你觉得心情很不好 You feel like having a bad mood. 3\. 你觉得做事情很不顺利 You feel that things don't go through smoothly 4\. 你睡不安稳 You have an uneasy sleep 5\. 你觉得很快乐 You feel happy 6\. 你觉得人人都不友善 You feel others are not friendly 7\. 你觉得日子过得很好很享受人生 You are enjoying your life 8\. 你觉得人不喜欢您 You think that people don't like you 9\. 你提不起劲做任何事 You don't have a mood to work on anything 10\. 你觉得很悲哀 You feel sad 11\. 你觉得寂寞,孤单 You feel lonely **Introduction:** This document describes the annotation guidelines for marking up Weibo that indicate specific stressful life events and ruminating behaviors. The document contains two tasks. Task 1: Annotate stressful life events, including relationship problem, unemployment and severe illnesses. Task 2: Annotate rumination in the post. **Task 1: Annotate stressful life events.** In this task, you are provided three sets of posts from Weibo users who have reported that they experienced at least one of the following LIFE EVENTs: Relationship breakdown, unemployment, and severe illness of a friend or family member. The title of the page indicates which LIFE EVENT that the author had been through. How to Annotate LIFE EventsRelationship breakdown. In this task, please annotate the earliest post that indicates that the poster experiences a breakup, divorce, or loss of a relationship. You only need one label for each user in this task. Once finding a post as such, you can skip the rest of the posts from the same user.Unemployment. In this task, please annotate the earliest post that indicates the state of unemployment. You only need one label for each user in this task. Once finding a post as such, you can skip the rest of the posts from the same user.Severe illness. In this task, please annotate the earliest post that indicates a family member or close friend being diagnosed with terminal illness. You only need one label for each user in this task. Once finding a post as such, you can skip the rest of the posts from the same user. **Task 2: Annotate rumination in the post.** Rumination is repetitively going over a thought or a problem without completion. The ruminating behavior on Weibo should be the act of posting multiple Weibo that show deep thoughts or reflections about the same topic. Content of ruminative thought can be positive or negative. Please select RUMINATION if the post fulfill all of the following conditions:Author describes a specific thought, emotion or a problem in the post.The thought or problem reoccur within one week after the previous post (Read the timestamp). Here shows an example of rumination on relationship breakup:可能你很久以后才学会爱人,我很遗憾只做了你途中の风景。Timestamp: 2015-2-14 (Translation: It might take longer for you to learn how to love a person. It's a shame that I am just scenery in your life.)有时候会想,为什么偏偏是天籁。以后每次坐他的车,都难以忘记第一次你用挂挡の那只手牵着我,跟我说手动挡都无所谓,何况这是自动挡。真的希望回忆不能欺骗时光太久,愿无岁月可回首,愿无深情共白头。Timestamp: 2015-2-15 (Translation: I can't forget how he held my hand the first time I was in his car. I hope my memory does not lie to the time for too long. Time flies by, and I hope we can grow old together.)隐藏了关于你的一切,不后悔曾经爱过你,也没力气再向前。如果我的心痛全世界没有一个人懂,我也不后悔曾经爱过。Timestamp: 2015-2-15 (Translation: I hide everything about you. I never regret to fall in love with you. But I can't move on anymore. Even if no one can understand how painful I am, I will never regret being in love with you.) All the above examples describes feelings toward the breakup and or memory toward the ex-lover and these posts occur within a few days. [^1]: Edited by: Meichun Mohler-Kuo, University of Applied Sciences and Arts of Western Switzerland, Switzerland [^2]: Reviewed by: Jessica L. Hamilton, University of Pittsburgh, United States; Oliver Gruebner, University of Zurich, Switzerland [^3]: This article was submitted to Public Mental Health, a section of the journal Frontiers in Psychiatry
{ "pile_set_name": "PubMed Central" }
Q: Serilog doesn't work in Reliable Actor Services I have two Service Fabric application. The first is an Asp.Net Core Service Fabric, the second is an Actor Service that run with timer. Both are set up with Serilog. The Asp.Net Core work very well. no problem there, but the second service, Actor Service, I use the same configurations and same nuget packages but Serilog doesn't save any log. Add Config <add key="serilog:using:Seq" value="Serilog.Sinks.Seq" /> <add key="serilog:write-to:Seq.serverUrl" value="http://*****" /> <add key="serilog:write-to:Seq.apiKey" value="UfKpKLicyZI3hGe7Vc" /> <add key="serilog:using:RollingFile" value="Serilog.Sinks.RollingFile" /> <add key="serilog:write-to:RollingFile.pathFormat" value="C:\File-{Date}.txt" /> <add key="serilog:write-to:RollingFile.retainedFileCountLimit" value="10" /> A: The most likely cause here is that the Serilog Logger is not being Dispose()d before the process hosting the actor shuts down (if you're setting up the static Log class instead of using a logger instance directly, this is achieved with Log.CloseAndFlush()).
{ "pile_set_name": "StackExchange" }
Okay, I Said I Wouldn't Complain About 'New Look' Gmail Any More But that was then. Also, it's a free country, and I can hardly be expected to keep others from expressing their views. So I have changed my mind and feel like complaining one more time. I'll start off by explaining why. Until yesterday afternoon at 4:30 EDT, the enforced change to "new look" Gmail was for me not a final, final thing. On both of my laptops, all of the tabs in all of the browsers had gone over to the new side. But on my desktop, one lonely Gmail tab in Chrome had been opened on April 21, in the innocent era just one day before the enforced changeover. I decided I would keep that tab and its Gmail session going as long as I could. I did all my email work in that one "legacy" tab, marveling at how much I preferred it to the new-look Gmail that was the only option in any newly opened tab. I carefully "slept" the machine at night rather than shutting it down. I cancelled any software update that required a system reboot. I worried about what would happen if I unthinkingly closed the tab. It was my living connection to happier days. It had to end some time. Power outage? Overall system freeze? Act of God? It ended yesterday afternoon. I was in the middle of composing a message -- as it happened, to a friend who works at Google -- and that tab froze. That's a deliberately low-rez shot of it, on the right, taken during what turned out to be a perpetual "still working" error message. I gave it overnight to stew, and then this morning I gave up altogether. I closed the tab, opened up a new one, and re-loaded Gmail. The new look is here, and the old one is finally gone. Stipulating again that this doesn't "really" matter, I'll say that the new look of Google makes me sad. At least for me it's worse -- less efficient -- to use. For seven-plus years I'd built much of my online life around Gmail. I'll vary it now with something else --Thunderbird? Sparrow? Who knows. They won't show me Google ads with my email any more, but that's not my problem. Enough about me! I pass the microphone to others. 1) The big picture. Ever wish you knew the thinking behind New Coke Look Gmail? Your dream has come true. Here's a presentation last year from a leader of the design team. He gets into new-look Gmail starting about ten minutes into the presentation. He admits that when it was tried out internally at Google, the initial response was strongly negative. "My eyes! They burn!" etc. But he says that eventually people came to accept it. Good to know. I've been using the new design for the last several hours. I happen to have a window open with the old design, so I know it's not merely my imagination that the new one is worse. Not enormously so, but definitely worse.‬ [Already-] Read mails are more legible in the old version, because there is more contrast between black letters and the old light blue background than between black and the new gray.‬‪It's also harder to parse the list of emails visually in the new design. In the old one, the 3D checkbox acted like a bullet point, and the name of the sender was closer to it. Now the heavy checkbox has been replaced by a faint square, and the sender's name is about 2x further away from it. So scanning my email is no longer like scanning a bulleted list. It's just rows of text.‬ [JF: In Google terms, I'll say +1000 to this and the preceding paragraph.]‪That's a big deal functionally. There's a reason bulleted lists exist as a format, and removing the bullet points from the average bulleted list would make it significantly less legible.‬ 3) The accessibility angle. A reader writes: Being visually impaired, I have a particularly difficult time with the new G-Mail, because, when "Zoomed" the unusability of G-Mail is even MORE pronounced, what with scrolling back and forth, and in many cases, being completely unable to view the rightmost part of an E-Mail message. I suppose, I will have to install a "Client" of some sort, which I have had problems with, in the past, due to targeted vulnerabilities, which hackers are prone to take advantage of. If you change your mind about writing on this topic, you might want to mention the "New Look's" disfuctionality, for the visually impaired. 4) Why not an option? From another reader: Some companies and websites have no difficulty in allowing users to choose which version to use. Eg: - The ruined "new" version of Weather Underground, with awful colours: Why can't a company like Google figure it out, despite all its wealth and resources? Most times, "improvements" on website are designed by people who wanted their own personal preferences that appeal to 1% of users instead of being useful to most. Changes aren't properly tested - google only tests on chrome and "hopes" it works on other browsers. (In reality, they hopes it DOESN'T work on other browsers so people are forced to change to google's.) This isn't the first time google has screwed up without consulting users (re: the menu "fade in" of 2009). And most of it is "feature creep", added bloat that makes the site run slower. I don't want "more and newer features!", I want streamlined, fast and reliable. If I were able to have a permanent domain name (which I don't need) and a POP email address, I would STILL be using Eudora 3.06, which was made 15 years ago. 5) Effect on the Google brand? From another reader: I'm sure you're aware that the main reason for the "artsy" look (which I prefer admittedly) is to synchronize all their products with Google+. You mention that it goes against everything Google has stood for, and that's most certainly true. Google sees that the future is inherently social, and so they're completely realigning their entire business to suit that. We'll see how this adjustment treats them in the long term because for now the shuffling is hurting their image(aka Google+/personalized search results) 6) A radical solution. There is a way to get back to a really old Old Gmail look, if you're willing to do without keyboard shortcuts and other useful features. A reader explains: The proper nomenclature [for this approach] is "HTML view," and what users gain in visible utility they lose in available features, such as keyboard shortcuts, spell checker, and chat. I get by without those features most of the time, but when I need them I just click on "Gmail view: standard" at the bottom of the HTML view page. 7) And upcoming: a message from an academic historian-of-technology, who has some very interesting observations on what the New Look says about Google, about its users, about people-and-computers, and related topics. But it's long and complex enough that I'll save it for presentation on its own. Now, to see whether the latest version of Thunderbird is less of a CPU-hog than it used to be. James Fallows is a national correspondent for The Atlantic and has written for the magazine since the late 1970s. He has reported extensively from outside the United States and once worked as President Carter's chief speechwriter. His latest book is China Airborne. More James Fallows is based in Washington as a national correspondent for The Atlantic. He has worked for the magazine for nearly 30 years and in that time has also lived in Seattle, Berkeley, Austin, Tokyo, Kuala Lumpur, Shanghai, and Beijing. He was raised in Redlands, California, received his undergraduate degree in American history and literature from Harvard, and received a graduate degree in economics from Oxford as a Rhodes scholar. In addition to working for The Atlantic, he has spent two years as chief White House speechwriter for Jimmy Carter, two years as the editor of US News & World Report, and six months as a program designer at Microsoft. He is an instrument-rated private pilot. He is also now the chair in U.S. media at the U.S. Studies Centre at the University of Sydney, in Australia. Fallows has been a finalist for the National Magazine Award five times and has won once; he has also won the American Book Award for nonfiction and a N.Y. Emmy award for the documentary series Doing Business in China. He was the founding chairman of the New America Foundation. His recent books Blind Into Baghdad (2006) and Postcards From Tomorrow Square (2009) are based on his writings for The Atlantic. His latest book is China Airborne. He is married to Deborah Fallows, author of the recent book Dreaming in Chinese. They have two married sons. Fallows welcomes and frequently quotes from reader mail sent via the "Email" button below. Unless you specify otherwise, we consider any incoming mail available for possible quotation -- but not with the sender's real name unless you explicitly state that it may be used. If you are wondering why Fallows does not use a "Comments" field below his posts, please see previous explanations here and here.
{ "pile_set_name": "Pile-CC" }
Fenikhi Fenikhi (, also Romanized as Fenīkhī, Faneykhī, and Fanikhi; also known as Fīnkhī-ye Kūchak) is a village in Bostan Rural District, Bostan District, Dasht-e Azadegan County, Khuzestan Province, Iran. At the 2006 census, its population was 251, in 39 families. References Category:Populated places in Dasht-e Azadegan County
{ "pile_set_name": "Wikipedia (en)" }
Q: Generating RSA and writing to file why do i get exception in this code: I get output: [*] Error creating your key [*] Error creating your key import os, hashlib from Crypto.Cipher import AES from Crypto.PublicKey import RSA raw_key = RSA.generate(2048) private_key = raw_key.exportKey('PEM') try: with open('master_private.pem', 'w+') as keyfile: keyfile.write(private_key) keyfile.close() print ("[*] Successfully created your MASTER RSA private key") except: print ("[*] Error creating your key") make_public = raw_key.publickey() public_key = make_public.exportKey('PEM') try: with open("master_public.pem", "w+") as keyfile: keyfile.write(public_key) keyfile.close() print ("[*] Successfully created your MASTER RSA public key") except: print ("[*] Error creating your key") File is created successfully but it is not filled with anything. I am just starting Python. A: you should catch exeception and show to know the problem, but i think your problem is the write method, private_key its bytes but you must be pass a str to write method them you can try: keyfile.write(private_key.decode()) other problem could be your permission permissions, mabe not have permission to create a file, try catching the excaption and printing to know what happen try: with open('master_private.pem', 'w+') as keyfile: keyfile.write(private_key) keyfile.close() print ("[*] Successfully created your MASTER RSA private key") except Exception as e: print ("[*] Error creating your key", e) also check your syntax why that code is not well tried
{ "pile_set_name": "StackExchange" }
Sk ipping breakfast may increase your ris k for cardiovascular disease. The connection, found in a study of 6,550 adults aged 65 to 75, was particularly strong for stroke. Almost 60 percent of the participants had breakfast every day, a quarter on some days, and 16 percent rarely or never. All were free of heart disease at the start of the study. Over an average 17 years of follow-up there were 2,318 deaths, including 619 from cardiovascular diseases. People who never ate breakfast were more likely to be obese and have high cholesterol, but the observational study, in the Journal of the American College of Cardiology, controlled for these and many other health, behavioral and socioeconomic factors. Compared with those who had breakfast every day, those who skipped the meal had an 87 percent increased risk for death from any cardiovascular disease and a 19 percent increased risk for all-cause death. Breakfast skippers had a 59 percent increased risk of developing heart disease, and more than triple the risk of stroke.
{ "pile_set_name": "OpenWebText2" }
Welcome to nose2 nose2 is the successor to nose . It’s unittest with plugins. nose2 is a new project and does not support all of the features of nose . See differences for a thorough rundown. nose2’s purpose is to extend unittest to make testing nicer and easier to understand. nose2 vs pytest nose2 may or may not be a good fit for your project. If you are new to python testing, we encourage you to also consider pytest, a popular testing framework. Quickstart Because nose2 is based on unittest, you can start from the Python Standard Library’s documentation for unittest and then use nose2 to add value on top of that. nose2 looks for tests in python files whose names start with test and runs every test function it discovers. Here’s an example of a simple test, written in typical unittest style: # in test_simple.py import unittest class TestStrings ( unittest . TestCase ): def test_upper ( self ): self . assertEqual ( "spam" . upper (), "SPAM" ) You can then run this test like so: $ nose2 -v test_upper (test_simple.TestStrings) ... ok ---------------------------------------------------------------------- Ran 1 test in 0.000s OK However, nose2 supports more testing configuration and provides more tools than unittest on its own. For example, this test exercises just a few of nose2 ’s features: # in test_fancy.py from nose2.tools import params @params ( "Sir Bedevere" , "Miss Islington" , "Duck" ) def test_is_knight ( value ): assert value . startswith ( 'Sir' ) and then run this like so: $ nose2 -v --pretty-assert test_fancy.test_is_knight:1 'Sir Bedevere' ... ok test_fancy.test_is_knight:2 'Miss Islington' ... FAIL test_fancy.test_is_knight:3 'Duck' ... FAIL ====================================================================== FAIL: test_fancy.test_is_knight:2 'Miss Islington' ---------------------------------------------------------------------- Traceback (most recent call last): File "/mnt/ebs/home/sirosen/tmp/test_fancy.py", line 6, in test_is_knight assert value.startswith('Sir') AssertionError >>> assert value.startswith('Sir') values: value = 'Miss Islington' value.startswith = <built-in method startswith of str object at 0x7f3c3172f430> ====================================================================== FAIL: test_fancy.test_is_knight:3 'Duck' ---------------------------------------------------------------------- Traceback (most recent call last): File "/mnt/ebs/home/sirosen/tmp/test_fancy.py", line 6, in test_is_knight assert value.startswith('Sir') AssertionError >>> assert value.startswith('Sir') values: value = 'Duck' value.startswith = <built-in method startswith of str object at 0x7f3c3172d490> ---------------------------------------------------------------------- Ran 3 tests in 0.001s FAILED (failures=2) Full Docs Full documentation for nose2 is available at docs.nose2.io
{ "pile_set_name": "OpenWebText2" }
Introduction {#s1} ============ In the research field of drug addiction the mesolimbic dopaminergic system has always received great attention since the evidence that most of the substances of abuse are able to increase dopamine extracellular concentration in the Nucleus Accumbens (Di Chiara and Imperato, [@B13]). Only recently it has been suggested that also dopaminergic neurons projecting to the medial prefrontal cortex (mPFC) might play a crucial role in the development of dependence (for reviews, see Kalivas and Volkow, [@B25]; Koob and Volkow, [@B30]; Jentsch et al., [@B22]). mPFC is part of the mesocorticolimbic dopaminergic system whose neurons project from the VTA also to the Nucleus Accumbens and Amydgala (Björklund and Dunnet, [@B3]). These areas together form the reward and motivation circuitry which is crucial in the regulation of functions that are altered in drug addiction, such as attribution of incentive salience to a stimulus (Robinson and Berridge, [@B38]), activation of goal-directed behaviors (Salamone et al., [@B39]), evaluation of reward (Koob and Volkow, [@B30]). In this circuitry, the mesocortical dopaminergic pathway has been proved to be fundamental in regulating impulsivity and action inhibition (Jentsch et al., [@B22]), which are key feature in all the stages of drug addiction. Accordingly, disruption of the processes that regulate inhibitory control and reward sensitivity has been suggested to be important mechanism in the development of addiction which has been proposed to involve neuroadaptive changes in the mesocorticolimbic circuitry that in turn alter the mechanisms that regulate reward, motivation, memory consolidation, sensitivity to stress, executive and inhibitory control (Koob and Volkow, [@B30]). The ventromedial PFC is highly involved in the evaluation of reward and in the process of decision making (Peters and Büchel, [@B36]). Thus, PFC dysfunction may exacerbate the loss of control associated with compulsive drug use and facilitate the progression to drug addiction (Jentsch et al., [@B22]; Koob et al., [@B31]). During abstinence from alcohol, mPFC functionally disconnects from the Amygdala while retaining connection to the Nucleus Accumbens; this functional disconnection has been suggested to be crucial for impaired executive control over motivated behavior suggesting that disregulation of mPFC interneurons may be an early index of neuroadaptation in alcohol dependence (Koob et al., [@B31]). In the development of addiction, stress is known to be a key factor, which can increase the vulnerability to drug abuse (Koob et al., [@B31]). Accordingly, in a model of chronic exposure to stress, like social isolation at weaning, socially isolated (SI) rats show several evidences of a high propensity to addiction. Thus, SI rats have been shown to be more prone to self-administer amphetamine (Bardo et al., [@B2]; Whitaker et al., [@B43]), cocaine (Howes et al., [@B20]) and ethanol (Hall et al., [@B18]; Lodge and Lawrence, [@B33]; Deehan et al., [@B12]; McCool and Chappell, [@B34]; Whitaker et al., [@B43]; Lesscher et al., [@B32]). In light of these evidences, in our study we evaluated the possibility that social isolation, as a model of chronic stress exposure, might induce a change in the sensitivity of mesocortical dopaminergic neurons to ethanol exposure which, in turn, would increase the vulnerability of SI rats to develop ethanol addiction. We hypothesize that a decreased response of mesocortical dopaminergic neurons to ethanol would induce a loss of control and a compulsive behavior toward drug use and facilitate the progression to drug addiction. In our study, we evaluated the effect of both acute and chronic administration of ethanol to test whether the ethanol-induced response of mesocortical dopaminergic neurons might be different after acute or chronic administration of the drug. Moreover, to evaluate whether a decrease in prefrontal cortical function was associated with a vulnerability to ethanol addiction, we also measured the amount of ethanol consumed during self-administration protocol in SI and group housed (GH) rats, as a possible index of a higher propensity of SI animals to develop dependence from the drug. Materials and Methods {#s2} ===================== Animals {#s2-1} ------- Male Sprague Dawley CD young-adult rats (Charles River, Como, Italy) were bred in our animal facility and maintained under an artificial 12 h-light, 12 h-dark cycle (lights on from 08:00 to 20:00 h), at a constant temperature of 22 ± 2°C, and a relative humidity of 65%. They had free access to water and standard laboratory food at all times. All efforts were made to minimize animal suffering. Animal care and handling throughout the whole experimental procedures were made in accordance with the European Communities Council Directive of 24 November 1986 (86/609/EEC). The experimental protocols were also approved by the Animal Ethics Committee of the University of Cagliari and by the Italian Ministry of Health (authorization \#353/2015-PR). Social Isolation and Voluntary Consumption of Ethanol Paradigm {#s2-2} -------------------------------------------------------------- At weaning, at postnatal day (PND) 21, the animals were housed individually SI or in groups of five per cage GH. From 28 PND to rats from both groups an ethanol solution was made available for self administration for 3 weeks, 2 h a day (from 11:00 to 13:00 h). To instigate ethanol reinforcement without food or fluid deprivation we used a modified initiation procedure (Samson et al., [@B40]) that involved the use of sucrose in the ethanol solution; sucrose concentration was progressively decreased, contextually keeping constant that of ethanol, according to the following paradigm: (days 1--2) 5% (v/v) ethanol + 5% (v/v) sucrose; (days 3--4) 5% ethanol + 4% sucrose; (days 5--6) 5% ethanol + 3% sucrose; (days 7--8) 5% ethanol + 2% sucrose; (day 9-end of treatment) 5% ethanol + 1% sucrose. By day 11 of treatment to the beginning of the experiment, the solution was kept constant to 5% ethanol (v/v) and 1% sucrose. Both SI and GH animals were placed in individual cages for the 2 hof daily exposure to ethanol to allow a precise measure of ethanol consumption. The weight of each rat, the amount of fluid (both water and ethanol), and food intake were monitored daily at the end of the session. Surgery and Experimental Procedures {#s2-3} ----------------------------------- Rats were anesthetized by intraperitoneal (i.p.) injection of chloral hydrate (0.4 g/kg), and a concentric dialysis probe was inserted at the level of the mPFC (A +3.2, ML +0.8, V −5.3 relative to the bregma), according to the Paxinos and Watson ([@B35]) Atlas. The active length of the dialysis membrane (Hospal Dasco, Bologna, Italy) was restricted to 4 mm. As previously described (Dazzi et al., [@B11]), the length of the dialitycal membrane allowed to sample from both infralimbic and prelimbic cortices. Experiments were performed in freely moving rats, 24 hafter probe implantation to allow recovery from surgery procedures. Ringer's solution \[3 mM KCl, 125 mM NaCl, 1.3 mM CaCl~2~, 1 mM MgCl~2~, 23 mM NaHCO~3~, 1.5 mM potassium phosphate (pH 7.3)\] was pumped through the dialysis probe at a constant rate of 2 μl/min. Samples of dialysate were collected every 20 min from 8:30 to 15:00 h and immediately analyzed for dopamine by high performance liquid chromatography (HPLC) with electrochemical detection as previously described (Dazzi et al., [@B10]); the detection limit for dopamine was 2 fmol per injection. The average neurotransmitter concentration in the first two samples was taken as 100%, and all subsequent values were expressed as mean ± SEM relative to the basal value. The mean *in vitro* recovery of the probes was 15 ± 3%. All probes were tested before implantation, and those with a recovery value outside of this range were not used. The absolute concentration of dopamine was not corrected for this value. At the end of each experiment, the placement of the probe was verified histologically. All rats in which the probe was located outside of the target region were excluded from the analysis. A group of rats were subjected to an acute treatment with ethanol (0.5, 2 g/kg, i.p., 20% solution v/v); the drug was injected after three stable samples (variation in dopamine concentrations less than 20%). For the acute ethanol administration experiments the average neurotransmitter concentration in the first three samples was taken as 100%, and all subsequent values were expressed as mean ± SEM relative to the basal value. Statistical Analysis {#s2-4} -------------------- Data are presented as Mean ± SEM of at least five animals per group. Microdialysis data were compared among groups with one- or two-way analysis of variance (ANOVA) for repeated measures, factors being treatment and time points. The raw values of dopamine concentration were used for the analysis, with absolute basal concentrations given in "Results" Section. Normal distribution of data was verified by Skewness and Kurtosis evaluation with Graph Pad Prism 5.0. *Post hoc* comparisons were performed with Newman-Keuls test. A *p* value of \<0.05 was considered statistically significant for all experiments. Results {#s3} ======= Basal Extracellular Concentration of Dopamine in SI and GH Rats {#s3-1} --------------------------------------------------------------- Basal extracellular concentration of dopamine in the mPFC of SI rats was not significantly different from that of GH rats (14.86 ± 2.926 fmol per 40 μl sample for GH rats vs. 20.22 ± 3.048 fmol per 40 μl sample for SI rats; Figure [1](#F1){ref-type="fig"}). One way ANOVA revealed a not significant effect between the two experimental groups \[*F*~(1,28)~ = 0.60; *P* = 0.4498\]. ![**Effect of social isolation on basal dopamine extracellular concentration.** Basal levels represent Mean ± SEM of 14 rats per group and are expressed as fmol of dopamine for 40 μl sample.](fncel-10-00155-g0001){#F1} Effect of Acute Administration of Ethanol on Extracellular Dopamine Concentration in the mPFC in SI and GH Rats {#s3-2} --------------------------------------------------------------------------------------------------------------- We have previously shown (Dazzi et al., [@B10]), that acute administration of ethanol is able to induce a biphasic effect on dopamine extracellular concentration in the mPFC, with lower doses inducing an increase and higher doses a decrease, respectively, in dopamine output. In this article, to evaluate whether in SI rats mesocortical dopaminergic neurons show a different sensitivity to the acute administration of ethanol, we used the same doses we used in our previous article (0.5--2 g/kg, i.p.). The present observations confirm our previous data and show that, in GH animals, the acute administration of a low dose of ethanol (0.5 g/kg, i.p., 20% v/v) induced an increase in dopamine extracellular concentration in the mPFC that was maximal (+60%) 40 min after administration and returned to basal values after 120 min (Figure [2A](#F2){ref-type="fig"}). An higher dose of ethanol (2 g/kg, i.p., 20% v/v), on the contrary, induced a significant decrease in the same parameter (Figure [2B](#F2){ref-type="fig"}) with the maximal effect (−50%) observed 80 min after ethanol administration and values returning to basal after 120 min. ![**Effect of acute administration of ethanol on extracellular dopamine concentration in the medial prefrontal cortex (mPFC).** Group housed (GH; □) or socially isolated (SI; ▪) animals received an acute administration of ethanol (0.5 or 2 g/kg, i.p., 20% v/v, **A,B**, respectively). **(C)** Shows the dose-response effect for GH and SI rats. Data are expressed as a percentage of basal values and are Mean ± SEM of at least 5 rats per group. ^a^*p* \< 0.05; ^a'^*p* \< 0.01 vs. basal value; ^b^*p* \< 0.05; ^b'^*p* \< 0.01 vs. corresponding point of GH rats.](fncel-10-00155-g0002){#F2} In contrast, in SI animals the acute administration of the lower dose of ethanol (0.5 g/kg, i.p.) failed to significantly modify basal dopamine extracellular concentration (Figure [2A](#F2){ref-type="fig"}) while the higher dose (2 g/kg, i.p.) induced a significant increase (+90% vs. basal values) in dopamine output 20 min after administration, reaching its maximum after 40 min. The increase persisted for 100 min after the injection and returned to basal values in 120 min (Figure [2B](#F2){ref-type="fig"}). The effect induced in SI animals by administration of the higher dose was similar to that observed in GH rats after injection of the lower dose of ethanol (0.5 g/kg, i.p.; Dazzi et al., [@B10]; present data), which, on the contrary, failed to induce any significant change in dopamine output in SI animals. Thus, social isolation induced a shift in the dose-response relation on the effect of ethanol on dopamine output in the mPFC (Figure [2C](#F2){ref-type="fig"}). For the dose of 0.5 g/kg, two-way ANOVA revealed a significant effect over time \[*F*~(8,64)~ = 1.89; *P* \< 0.01\]; a significant effect of treatment \[*F*~(1,64)~ = 7.28; *P* \< 0.01\]; and a significant effect of the interaction between factors \[*F*~(8,64)~ = 5.75; *P* \< 0.0001\]. For the dose of 2 g/kg, two-way ANOVA revealed a significant effect over time \[*F*~(8,64)~ = 2.92; *P* \< 0.01\]; a significant effect of treatment \[*F*~(1,64)~ = 8.83; *P* \< 0.05\]; and a significant effect of the interaction between factors \[*F*~(8,64)~ = 6.12; *P* \< 0.0001\]. Voluntary Ethanol Consumption in GH and SI Rats {#s3-3} ----------------------------------------------- To evaluate whether a chronic stress exposure like social isolation might alter the preference for ethanol and/or the amount of the drug consumed, we measured the amount of ethanol consumed by SI and GH animals. As shown in Figure [3](#F3){ref-type="fig"}, there was a significant difference in voluntary ethanol consumption relative to housing history, starting from the 5th day of the training protocol with SI animals consuming a significantly greater amount of ethanol than GH rats. The amount of ethanol consumed reached a plateau at the 5th day of the treatment for SI rats (\~6 g of ethanol/kg of body weight) and on the 9th day for GH (\~3.8 g of ethanol/kg of body weight). Two-way ANOVA revealed a significant effect over time \[*F*~(29,406)~ = 3.603; *P* \< 0.0001\]; a significant effect between the experimental groups \[*F*~(1,20)~ = 12.55; *P* \< 0.01\]; and a not significant interaction between the factors \[*F*~(29,406)~ = 1.130; *P* = 0.2962\]. ![**Amount of ethanol consumed by rats trained in a voluntary intake protocol.** The ethanol containing solution was made accessible to the animals between 11:00 and 13:00, every day for 3 weeks. The first 10 days represent a training phase with constant concentration of ethanol and decreasing concentration of sucrose. The amount of ethanol consumed was calculated every day as difference between the weight of the bottles before and after consumption session and is expressed as Mean ± SEM of 20 rats per group. ^a^*p* \< 0.05, ^a'^*p* \< 0.01 vs. GH.](fncel-10-00155-g0003){#F3} Figure [4](#F4){ref-type="fig"} shows that body weight did not differ significantly between the two experimental groups during the voluntary ethanol intake protocol. SI and GH rats also showed a similar intake of total fluid and food (data not shown). ![**Variations in the body weight of rats trained to a system of voluntary consumption of ethanol.** The solution was made accessible to the animals from 11:00 to 13:00, every day for 3 weeks. The body weights of both GH (□) and SI (▪) animals have been measured 3 days a week, for 3 weeks after removal of ethanol solution (at 13:00 h). Data are expressed as Mean ± SEM of 20 rats per group.](fncel-10-00155-g0004){#F4} Effect of Prolonged Voluntary Ethanol Intake on the Extracellular Concentration of Dopamine in the mPFC of SI and GH Rats {#s3-4} ------------------------------------------------------------------------------------------------------------------------- In GH rats the chronic voluntary consumption of ethanol induced a significant increase of extracellular dopamine concentration as early as 120 min before ethanol presentation and increased further to reach a maximal value of +70% of basal values by 60 min before ethanol consumption. It then slightly declined to a value of +50% during ethanol intake to return to basal values 40 min before removal of the alcoholic solution (Figure [5A](#F5){ref-type="fig"}). In contrast, social isolation markedly reduced the sensitivity of mesocortical dopaminergic neurons to anticipation of ethanol. Indeed, in SI rats, in contrast to GH animals, the extracellular concentration of dopamine didn't show any significant variation during the anticipatory phase; during the consummatory phase there was a slight but not significant decrease (−25% below basal values) in dopamine output. ANOVA revealed a significant effect over time \[*F*~(18,198)~ = 1.628; *P* \< 0.0001\]; a significant effect of housing \[*F*~(1198)~ = 9.130; *P* \< 0.0001\]; and a significant interaction between factors \[*F*~(18,198)~ = 1.628; *P* \< 0.05\]. ![**Effect of social isolation on extracellular dopamine concentration in the mPFC during anticipation and consumption of ethanol after a voluntary ethanol intake protocol (A) and** **amount of ethanol consumed during the microdialysis experiment by SI and GH animals (B).** Animals have been trained to voluntary consume ethanol from 11:00 to 13:00 every day for 3 weeks. During this time the ethanol containing solution was made accessible to the animals, and microdialysis samples were collected from the mPFC before, during, and after ethanol presentation. The amount of ethanol consumed during the experiment was calculated at the end of the experiment as difference between the weight of the bottles before and after the consumption session and is expressed as Mean ± SEM of 20 rats per group. Data are expressed as a percentage of basal values and are Mean ± SEM of at least 5 rats per group. ^a^*p* \< 0.05, ^a'^*p* \< 0.01 vs. basal values; ^b^*p* \< 0.05, ^b'^*p* \< 0.01 vs. corresponding GH value.](fncel-10-00155-g0005){#F5} The amount of ethanol consumed by the two groups of rats during the experiment is shown in Figure [5B](#F5){ref-type="fig"}, and was significantly higher for SI than for GH rats (*P* \< 0.01; Figure [5B](#F5){ref-type="fig"}). Discussion {#s4} ========== Our results have shown that social isolation induces, in rats, a shift in the dose-response relation for the effect of the acute administration of ethanol in mesocortical dopaminergic neurons. In SI rats, in fact, the administration of 2 g/kg of ethanol, which in GH rats elicited a significant decrease in dopamine extracellular concentration in the PFC, induced an increase in the same parameter that was similar to the effect elicited by a lower dose (0.5 g/kg) in GH rats (present data; Dazzi et al., [@B10]). The lower dose of ethanol failed to induce any significant effect in SI animals, while increased dopamine output in GH animals. One possible explanation for the observed effect is that SI rats show a marked decrease in plasma and cerebrocortical concentrations of neuroactive steroids (Serra et al., [@B41]) and the effect of ethanol on mesocortical dopaminergic neurons is particularly sensitive to brain concentrations of progesterone and 3α, 5α-THDOC. In fact, an increase in the concentrations of these neurosteroids by prolonged administration of progesterone, is able to increase the response of mesocortical dopaminergic neurons to an acute administration of ethanol (Dazzi et al., [@B10]). This effect was completely abolished by finasteride, which, by inhibiting 5α-reductase induces a marked decrease in plasma and brain concentration of 3α, 5α-THDOC (Concas et al., [@B7]; Dazzi et al., [@B9]), suggesting that this progesterone metabolite is crucially involved in mediating this effect. Alternatively, in SI rats the extracellular dopamine might be governed through a different mechanism or even circuitry with respect to GH animals. The effect of ethanol on mesocortical dopaminergic neurons shown here is opposite to that recently observed by Karkhanis et al. ([@B29], [@B28]) who, instead, described an increase in dopamine response to acute ethanol in the Nucleus Accumbens and Amygdala of SI rats. Although discordant, these results are in agreement with the suggested alteration in the balance between the activity of mesocortical *vs* mesolimbic pathway in addiction (Kalivas and Volkow, [@B25]; Koob and Volkow, [@B30]), where an increased sensitivity to reward (Bonci et al., [@B5]), an increase in impulsivity and a decrease in inhibitory control (Jentsch et al., [@B22]) have been identified as key features to the development of addiction. Accordingly, our data show that SI rats consumed significantly higher amounts of ethanol compared to their GH counterpart, suggesting that chronic exposure to stress, in a critical period like adolescence, might increase the vulnerability to develop addiction in this experimental group. The observation that SI and GH rats did not significantly differ in their body weight nor in the amount of food or total fluid consumed during the entire protocol, suggests that this effect is specific for ethanol. Our results are in line with previous studies showing that social isolation increase voluntary ethanol intake (Hall et al., [@B18]; Lodge and Lawrence, [@B33]; Deehan et al., [@B12]; McCool and Chappell, [@B34]; Lesscher et al., [@B32]). However, this effect is strictly depending on the strain of rats used, on the drinking protocol and on the concentration of the ethanol solution used for the experiments, and some authors found a decrease in the amount of ethanol consumed by SI rats (Fahlke et al., [@B16]), and others found no effect (Ehlers et al., [@B14]). We show that basal extracellular concentration of dopamine in the mPFC wasn't significantly different in SI vs. GH rats; in fact, although there was a tendency toward an increase in this parameter, it did not reach statistical significance. These results are in agreement with previous microdialysis data (Dalley et al., [@B8]) but not with measurements of dopamine function in postmortem tissues of SI rats (Blanc et al., [@B4]; Jones et al., [@B24]; Heidbreder et al., [@B19]) that showed a significant increase in DOPAC/dopamine ratio in homogenates from the mPFC of SI vs. GH rats. However, as suggested by Dalley et al. ([@B8]), microdialysis allows a more accurate measurement of the extracellular content of dopamine. Our observation that in SI animals the increase in dopamine output induced by both anticipation and consumption of ethanol was dramatically blunted, together with the increased consumption of ethanol by rats in this experimental group, suggest that early and prolonged exposure to stress might increase the vulnerability to drug addiction. Previous evidence that social isolation didn't change ethanol metabolism (Karkhanis et al., [@B29]), suggest that this effect may be due to a perturbation of the function of mesocortical dopaminergic neurons by chronic exposure to stress rather than to pharmacokinetic differences between the two experimental groups. Our results showing that a blunted response of mesocortical dopaminergic neurons to ethanol is accompanied by an increase in the consumption of ethanol in SI rats, confirm the link between addictive behavior and dopaminergic hypofrontality. Together with the previous observation that in SI rats there is, on the contrary, an increase in the sensitivity of dopaminergic neurons in the nucleus accumbens and amygdala to ethanol (Karkhanis et al., [@B29], [@B28]), they suggest that SI might be able to alter the balance between mesocortical and mesolimbic dopaminergic pathways, to increase vulnerability to addiction. A number of studies have in fact suggested that progression of addiction from a social use to compulsive use of a drug might be consequence of a decrease in the executive control and/or of a strengthening of the cortico-striatal circuitry that regulates habitual behavior. In fact, once a given behavior is acquired, the cortico-striatal-thalamic pathway allows the behavior to be efficiently performed without the activation of the prefrontal cortical circuitry (Jog et al., [@B23]; Canales, [@B6]) which is then able to integrate new information that can modify and drive the acquired behavior. Thus, by processing the environmental stimuli, the PFC has the ability to modify a given behavior whenever it results dangerous or inappropriate to the subject (Kalivas et al., [@B26]). Addiction is characterized by the inability to stop or modify a behavior even when it clearly has negative consequences on the individual (Everitt and Robbins, [@B15]; Kalivas et al., [@B26]). Accordingly, a number of studies described a functional "hypofrontality" as a key feature in addiction (for review, see Jentsch and Taylor, [@B21]; Goldstein and Volkov, [@B17]; Jentsch et al., [@B22]). Together with the decline in frontal executive control, it has been shown a progressive strengthening of the compulsive behavior of seeking and taking the drugs (Everitt and Robbins, [@B15]). The latest researches on drug addiction have pointed out that drugs of abuse, as well as certain palatable foods, are able to induce neuroadaptive changes in the activity of the mesocorticolimbic circuitry (Volkow et al., [@B42]; Koob et al., [@B31]); in particular, in animals, withdrawal from drug addiction has been characterized by an increased responsiveness to reward and a decreased activity in the mesocortical dopamine system (Volkow et al., [@B42]). Our observation of a blunted sensitivity of mesocortical dopaminergic neurons to ethanol anticipation in SI rats suggests that chronic stress is able to reduce the response of this pathway to ethanol. This data, together with the previous observation that in SI rats mesolimbic dopaminergic neurons show, on the contrary, an increased response to acute ethanol administration (Karkhanis et al., [@B29]), further support the hypothesis that an important mechanism for the development of addiction is a disruption in the balance of the function between mesolimbic and mesocortical dopaminergic pathway. They also suggest that chronic exposure to social isolation stress, by blunting the sensitivity of mPFC projecting neurons to ethanol exposure, might increase the vulnerability to drug addiction. Our observation of a decreased efficacy of ethanol in SI rats already after a single administration, seems to suggest that the increased vulnerability is not dependent on previous ethanol exposure. Accordingly, in previous studies SI rats have shown greater increases in dopamine extracellular concentration in the Nucleus Accumbens after an acute administration of amphetamine (Hall et al., [@B18]), an enhanced Conditioned Place Preference for amphetamine and ethanol after a single conditioning session (Whitaker et al., [@B43]), an increased locomotor response to cocaine (Phillips et al., [@B37]), as well as an increased self-administration of drugs of abuse (Hall et al., [@B18]; Lodge and Lawrence, [@B33]; Deehan et al., [@B12]; McCool and Chappell, [@B34]). In conclusion, our data show that chronic exposure to social isolation stress in a critical period such as early adolescence is able to modify the neurochemical response of mesocortical dopaminergic neurons to both acute and prolonged administration of ethanol. They suggest that a blunted sensitivity of mesocortical dopaminergic neurons might be a neuroadaptive adjustment to chronic stressful stimuli, which, in turn, would disrupt the balance between mesocortical and mesolimbic system's function that has been suggested to be crucial for the development of addictive behavior (Kalivas and Volkow, [@B25]). Thus, ours and others result (Karkhanis et al., [@B29]), seem to suggest that both a decrease in mPFC responsiveness and an increased sensitivity in the Nucleus Accumbens and Amygdala to the effect of ethanol, are already present at the first administration of the drug, and that prolonged administration abolishes the motivational salience of ethanol anticipation, thus building in SI rats a vulnerability to ethanol addiction. Author Contributions {#s5} ==================== VL: performed the experiments, analyzed the data, wrote the article. LM: performed the experiments. LD: conceived and designed the experiments, analyzed the data, wrote the article. Conflict of Interest Statement {#s6} ============================== The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer CSC and handling Editor declared their shared affiliation, and the handling Editor states that the process nevertheless met the standards of a fair and objective review. [^1]: Edited by: Marco Martina, Northwestern University, USA [^2]: Reviewed by: C. Savio Chan, Northwestern University, USA; Hau-Jie Yau, National Institutes of Health (NIH)/National Institute on Drug Abuse (NIDA), USA
{ "pile_set_name": "PubMed Central" }
Q: Adding a directory to the system path variable through registry I am trying to add a directory to the PATH variable in windows. This is what I am entering the command line. (Or a batch file) @echo off set value=%path%;%ProgramFiles%\AtomScript\ reg add "HKEY_LOCAL_MACHINE\SYSTEM\CurrentControlSet\Control\Sessions Manager\Environment" /v Path /t REG_EXPAND_SZ /d %value% /f And it comes up with this message ERROR: Invalid syntax. Type "REG ADD /?" for usage. What am I doing wrong? A: You probably have to quote %value% (with double-quotes) because its expansion has embedded blanks for C:\Program Files, etc. That would be reg add "HKEY_LOCAL_MACHINE\SYSTEM\CurrentControlSet\Control\Sessions Manager\Environment" /v Path /t REG_EXPAND_SZ /d "%value%" /f You can see what the actual expansions are by turning echo on in your script: @echo on
{ "pile_set_name": "StackExchange" }
// Copyright 2015 The Go Authors. All rights reserved. // Use of this source code is governed by a BSD-style // license that can be found in the LICENSE file. // Package rangetable provides utilities for creating and inspecting // unicode.RangeTables. package rangetable import ( "sort" "unicode" ) // New creates a RangeTable from the given runes, which may contain duplicates. func New(r ...rune) *unicode.RangeTable { if len(r) == 0 { return &unicode.RangeTable{} } sort.Sort(byRune(r)) // Remove duplicates. k := 1 for i := 1; i < len(r); i++ { if r[k-1] != r[i] { r[k] = r[i] k++ } } var rt unicode.RangeTable for _, r := range r[:k] { if r <= 0xFFFF { rt.R16 = append(rt.R16, unicode.Range16{Lo: uint16(r), Hi: uint16(r), Stride: 1}) } else { rt.R32 = append(rt.R32, unicode.Range32{Lo: uint32(r), Hi: uint32(r), Stride: 1}) } } // Optimize RangeTable. return Merge(&rt) } type byRune []rune func (r byRune) Len() int { return len(r) } func (r byRune) Swap(i, j int) { r[i], r[j] = r[j], r[i] } func (r byRune) Less(i, j int) bool { return r[i] < r[j] } // Visit visits all runes in the given RangeTable in order, calling fn for each. func Visit(rt *unicode.RangeTable, fn func(rune)) { for _, r16 := range rt.R16 { for r := rune(r16.Lo); r <= rune(r16.Hi); r += rune(r16.Stride) { fn(r) } } for _, r32 := range rt.R32 { for r := rune(r32.Lo); r <= rune(r32.Hi); r += rune(r32.Stride) { fn(r) } } } // Assigned returns a RangeTable with all assigned code points for a given // Unicode version. This includes graphic, format, control, and private-use // characters. It returns nil if the data for the given version is not // available. func Assigned(version string) *unicode.RangeTable { return assigned[version] }
{ "pile_set_name": "Github" }
Send this page to someone via email The NDP leadership race is down to four candidates. On Thursday afternoon, British Columbia MP Peter Julian confirmed that he is dropping out. Julian initially issued a press release saying that he would make an “important announcement” linked to his candidacy at 2 p.m. ET on Parliament Hill. He then confirmed via Twitter that he is indeed calling it quits. He thanked his campaign volunteers, fellow MPs who gave their support and his family. It's with mixed feelings that I'm announcing my withdrawal from #NDPldr race – fund-raising results have been disappointing. #NDP #cdnpoli — Peter Julian (@MPJulian) July 6, 2017 It has been a remarkable journey and I have had thousands of inspiring conversations. Thanks to MP's who gave their support #NDPldr #cdnpoli pic.twitter.com/b6f1o9XbG0 — Peter Julian (@MPJulian) July 6, 2017 Julian’s departure marks the second time in just over a month that a declared candidate has dropped out. In early June, Pat Stogran announced his departure and blamed the inner workings of the party. He called the process “fundamentally flawed” and claimed the NDP has put “major obstacles” in front of candidates trying to grow the party’s base from the grassroots. Story continues below advertisement For his part, Julian cited disappointing fundraising results. READ MORE: Niki Ashton’s pregnancy renews calls for better supports on Parliament Hill The deadline for registration of candidates has just passed. With Julian out, the four remaining candidates are Niki Ashton, Guy Caron, Jagmeet Singh and Charlie Angus. “Four terrific candidates have entered the race since I started it and I know each of them will make a great leader,” said Julian in a statement issued Thursday afternoon. Tweet This “I wish them all the best of luck. As the leadership race continues, I will be endorsing one of them closer to the ballot date.” NDP members are expected to choose a permanent replacement for current leader Tom Mulcair in October.
{ "pile_set_name": "OpenWebText2" }
Matchplay Event "As we all look out of the windows and see the snowdrifts and feel the icy wind it is difficult to believe that the time of year has rolled around again for the HowDidiDo match play event to be open for business. Registration for the event has been open now for around two weeks and traffic and registrations are building. The event this year will follow the same format as previous years and following the initial knockout competitions we will be running the regional finals at the MacDonald hotel venues that have supported us in the past. The Championship Finals, played over 5 rounds, will be held in the Algarve early in 2014 and we all hope for the same week of sunshine that we had this year. Alex, Alistair and Neil will all be on hand at the regional and the final events to give the same high level of support that all National Match Play golfers have become used to. So register now and make this the biggest, as well as the most enjoyable amateur event of the golfing season."
{ "pile_set_name": "Pile-CC" }
Q: Minimum release voltage for Relay I have an electronic socket that I am using and it uses a HLS8L-DC6V-S-C Helishun relay with a minimum release voltage of 0.3 Volts & max operating voltage 4.5 V Datasheet - http://www.helishun.com/secure/pdt/hls8-t73.pdf The voltage being applied to this relay in the socket is around 2.4V and the relay is not switching. But I got another unit of the same relay and it worked. Is the first relay damaged or is it due to something else? Also, what is minimum release voltage? In this case it is 0.3 V, so what is minimum voltage I should apply to the relay to make it switch? Thanks for your help! A: The datasheet linked above has the figures you quoted for a relay with a Rated Voltage of 6V. Rated Voltage - 6V Max Operating Voltage - 4.5V Min Release Voltage - 0.3V Max Applied Voltage - 7.8V What do these all mean? Rated Voltage 6V - this is the nominal operating voltage - the relay should operate from a voltage reasonably close to this. But power sources are rarely precise, so we need to know more information... Max Operating Voltage - 4.5V. The relay is guaranteed to operate (switch on) at Max Operate Voltage (4.5V) or higher, so you really can't expect it to switch at 2.4V. If one does, either it is performing better than spec, or check its coil resistance to see if it's a mis-labelled 4.5V relay! Min Release Voltage - 0.3V When you want it to switch off, reduce the voltage below Min Release Voltage - it will probably release at higher voltages but don't rely on it. Max Applied Voltage - 7.8V Above this voltage, the coil may overheat and fail. So just keep the voltage less than Max Applied Voltage (7.8V)
{ "pile_set_name": "StackExchange" }
Meta Second class from the second session of the Decatur School of Arms Topics covered: Review Advance lunge Disengagements Simple Parries Lesson: From the invitation in third, straight thrust (hand in fourth position) from the guard In time, as the instructor invites in third, straight thrust with a lunge In time, as the instructor attempts to engage in fourth, disengagement (hand in second) with a lunge In time, as the instructor attempts to engage in third, disengagement (hand in fourth) with a lunge From the student’s engagement in third, (instructor attacks with disengagement) simply parry of fourth, riposte by glide from the guard (no lunge) From the student’s engagement in fourth, (instructor attacks with disengagement) simply parry of third, riposte by glide from the guard (no lunge) Drill: Students maintains lunging distance while the opponent invites third and makes a series of advances and retreats. As soon as the opponent attempts to engage in fourth, the student makes a disengagement in time. Same drill as before, but the opponent now makes a parry of third and ripostes by glide Next week we will look at tempo and counterattacks! Share on Facebook
{ "pile_set_name": "Pile-CC" }
This article was downloaded by: [New York University] On: 20 February 2014, At: 08:31 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK AJOB Neuroscience Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/uabn20 The Revisability of Moral Concepts Nada Gligorov a a Mount Sinai School of Medicine Published online: 04 Oct 2010. To cite this article: Nada Gligorov (2010) The Revisability of Moral Concepts, AJOB Neuroscience, 1:4, 32-34, DOI: 10.1080/21507740.2010.514882 To link to this article: http://dx.doi.org/10.1080/21507740.2010.514882 PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the "Content") contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions AJOB Neuroscience researchers to judge whether brain-injured patients have this capacity, neuroscience can help to establish whether these patients meet the criterion of personhood. In addition, imaging showing brain dysfunction correlating with impulsive behavior can inform judgments of moral and legal responsibility that cannot be decided on behavioral evidence alone. Neuroimaging data may aid legal experts in assessing how impulse-control disorders affect behavior and whether they warrant full responsibility, mitigated responsibility, or excuse. These examples illustrate that neuroscience should not be judged by whether it preserves or threatens the contested concepts, but by whether it clarifies the conditions under which they obtain. Kaposy claims that our valued concepts "might require the rational refusal to believe discoveries of neuroscience that put them in doubt" (23). As matters now stand, there is not enough neuroscientific evidence to undermine the ideas that persons are natural kinds and that they have free will. Nevertheless, it is possible that future neuroscientific discoveries will show that unconscious brain processes completely control our thought and behavior. This could mean that personhood and free will, as we now define them, are illusions that enable human organisms to adapt to and survive in the environment. It would be irrational to ignore this knowledge and not revise our conception of who we are. If we are not essentially persons who act on the basis of conscious will, then it would not be contradictory to question our commitment to these concepts. It would also be irrational not to revise our ethical practices in the light of this knowledge. Suppose that a number of functional imaging studies indicate that brain processes constrain the choices open to a human agent at any given time. As a constraint, this would limit the scope of agency and the content of responsibility, what we are responsible for. Although this would not explain away free will and responsibility, it could mean that we are less free and less responsible than previously thought. Such a discovery may or may not occur in the foreseeable future. But it behooves us as rational beings to be open to this possibility. Neuroscience need not force us into a state of cognitive polyphasia, where ethical reasoning conflicts with a neuroscience-influenced understanding of human beings. Unless one accepts substance dualism and libertarianism, any such conflict is more apparent than real. If one accepts the view that persons are constituted by their minds and brains and can be the authors of their actions despite deterministic or mechanistic processes in the brain, then neuroscience does not warrant giving up our belief in personhood and free will. Empirical considerations pertaining to the brain and normative considerations pertaining to human agents should not be seen as competing but complementary. The psychological and behavioral criteria that ground personhood and free will can be informed by knowledge of how the brain enables the mind in mediating consciousness and the capacity for reasoning and decision-making. Neuroscience does not have the last word, though, since it is human agents who determine the metaphysical, moral, and legal significance of information about the brain. A proper interpretation of the philosophical implications of neuroscience shows that it does not threaten to eliminate our valued concepts and practices but can help us to gain a better understanding of them.  REFERENCES Farah, M. J., and A. S., Heberlein. 2007. Personhood and neuroscience: Naturalizing or nihilating? American Journal of Bioethicse– AJOB Neuroscience 7(1): 37–48. Greene, J. 2003. From neural 'is' to moral 'ought': What are the moral implications of neuroscientific moral psychology? Nature Reviews Neuroscience 4: 847–850. Greene, J., and J., Cohen. 2004. For the law, neuroscience changes nothing and everything. Philosophical Transactions of the Royal Society of London 359: 1775–1785. Kaposy, C. 2010. The supposed obligation to change one's beliefs about ethics because of discoveries in neuroscience. AJOB Neuroscience 1(4): 23–30. Wegner, D. 2002. The illusion of conscious will. Cambridge, MA: MIT Press. The Revisability of Moral Concepts Nada Gligorov, Mount Sinai School of Medicine The rise of scientific explanation for natural phenomena has produced some of the most exciting problems in philosophy, such as the problem of free will and the mind and body problem. Those philosophical areas seek to explain how free will and consciousness can exist in a natural Address correspondence Nada Gligorov, PhD, Assistant Professor of Medical Education, Mount Sinai School of Medicine, Box #1076, One Gustave Levy Place, New York, NY 10029, USA. E-mail: nada.gligorov@mssm.edu world that seems to be determined by mechanistic laws. Advancements in neuroscience further highlight this problem because, unlike physics, the object of study is various aspects of human psychology, including our ability to be conscious, rational, and free in our decision making. The 32 ajob Neuroscience October–December, Volume 1, Number 4, 2010 D ow nl oa de d by [ N ew Y or k U ni ve rs ity ] at 0 8: 31 2 0 Fe br ua ry 2 01 4 Obligation to Change One's Beliefs About Ethics aforementioned concepts feature prominently in commonsense psychology, and because of that the revision of those concepts in accordance with neuroscience is often met with animosity. Kaposy (2010) argues that moral norms relying on free will, personhood, and rationality should not be revised in accordance with neuroscientific discovery because they play important moral and social roles. I argue that most concepts, including moral ones, are a web of changing beliefs shaped by various sources of information, including scientific discovery. As there is continuous, bidirectional influence between science and commonsense, the strength of our current commitments cannot be the basis for an argument against their revision in accordance with neuroscientific discovery. The philosophical literature has mostly settled on two ways in which concepts can be altered: They could be revised or reconceptualized. Revision of concepts could occur in the following way: Imagine we endorse a theory much like our current commonsense psychology that predicts and explains human behavior by utilizing concepts such as free will, personhood, and rationality.1 Imagine further that a different and new theory proposes to explain and predict human behavior by positing physical entities such as brain states, much like current neuroscience. If the two theories are compatible, the new theory could reduce the old theory (for more on this issue, see Churchland 1989, 48). The concepts of the old theory, here commonsense psychology, would remain. A successful reduction of commonsense psychology would vindicate the entities endorsed by that theory because it would provide additional proof that free will and rationality have a physical instantiation in the brain. Reduction of free will would not require the elimination of that concept. It would, however, entail some revision of the original conceptual framework. For example, reduction could make it true that free will is localized in the brain and is a physical process, so the concept would have to be revised to include that fact. Commonsense psychology and neuroscience, however, could be incompatible, which would preclude the reduction of one theory to the other. In that case we would have to opt for the elimination of one of the two dueling theories. Incompatibility between theories arises when they posit disparate ontologies. For example, if commonsense psychology is committed to the view that free will cannot be a physical process, or that free will cannot, by definition, be subject to the workings of a determinist natural law, then any theory that is physicalist or deterministic would be incompatible with commonsense. The incongruity between the two theories would further entail that one of them is false and its conceptual categories illusory. In such cases, the better of the two theories would win and we would have to reconceptualize to the wining theory. Kaposy (2010) cites Green and Cohen as espousing precisely such a view; 1. The view that commonsense psychology is a theory has been defended by Churchland (1989, 2–6). For opposing views, please see Searle (1992, esp. 58–63). the authors predict that people will get used to an entirely different way of interpreting and explaining how humans make everyday decisions, whereby all our decisions are a result of a mechanical process. In this scenario, the winning theory would be neuroscience. An incompatibility, like the one just described, between commonsense views about the nature of moral concepts and the neuroscience of morality is unlikely. Arguments for elimination of our moral intuitions presume a type of essentialism for moral concepts. In order to create opposition between our moral intuitions and neuroscience, one needs to support the claim that we can specify a steady endorsement of a particular commonsense view about the nature of moral concepts, which is unlikely to change in the future. In other words, in order to argue for the elimination of a particular concept, that concept should be well defined. Given that all attempts to specify necessary and sufficient conditions for notions such as free will, personhood, and even rationality have failed in the past within the philosophical literature, it seems even more unlikely that we can find consensus on those issues in commonsense. One can, as Kaposy does, approximate a view based on our current use of those moral terms: how we speak of them, to whom we attribute them, and how they feature in our explanations of other people's behavior. But any such rendering of our moral intuitions would not be enough to argue that our intuitions entail the strict commitment to particular features of moral concepts. An additional problem with determining our intuitive moral commitments is correctly drawing the scope of commonsense and distinguishing purely commonsense conceptions from philosophical or scientific ones. We see this issue illustrated in Kaposy's article. The examples given for the definitions are either drawn from philosophical writings, such as the Kantian definition of rationality, or they are neurophilosophical conceptions like Patricia Churchland's compatibilist definition of free will. It is unclear how we could determine with any certainty that Kant's notion of rationality is more representative of commonsense then is Churchland's adjusted definition of free will. Furthermore, if we were to expunge both philosophical and scientific influences from our moral notions, one could wonder whether anything would remain of our concepts (for further discussion see Gligorov 2007, esp. chap. 2). Even if we could settle on a commonsense view of moral notions, our current commitment to those concepts cannot be an indication that those will remain the same in the future. Neuroscience has already influenced our ideas about mental states. A particularly conspicuous change in commonsense is the piecemeal abandonment of the Cartesian view of mental states. In Descartes's view, mental states are characterized as conscious and nonphysical states. Although nowadays there is still great diversity of opinion, we can claim with some conviction that most people would agree that the locus of their mental states is in the brain. Thus, any importance that we had previously ascribed to the notion that mental states are nonphysical has changed October–December, Volume 1, Number 4, 2010 ajob Neuroscience 33 D ow nl oa de d by [ N ew Y or k U ni ve rs ity ] at 0 8: 31 2 0 Fe br ua ry 2 01 4 AJOB Neuroscience over time. Another obvious conceptual shift resulted from the popularization of Freud's writings and has affected how we see the relationship between consciousness and mental states. Freud's theory shaped our commonsense by introducing the category of unconscious mental state into our everyday parlance. Nowadays people often refer to unconscious thoughts and motives, and accuse each other of "Freudian slips." It should not be assumed, however, that the interaction between scientific and commonsense views is unidirectional. Neuroscience of morality finds its basis in commonsense notions of moral concepts. Any localization, for example, of mental states in the brain begins by relying on intuitive notions of the nature of those and uses them to draw correlations between our manifest psychology and its underlying physical causes. Sellars (1991, 20) argues that scientific views are the "offspring" of commonsense, with the caveat that scientific conceptual frameworks are not restricted by commonsense. In this view, the complete revision of moral concepts is in principle possible, but the more correct characterization of the relation between moral intuition and neuroscience is that of continuity and mutual influence. As Kaposy (2010) correctly points out, free will, personhood, rationality, and other such notions feature prominently in our moral norms and guide our social expectations. We expect people to act rationally; we assume that they have autonomy and can make decisions for which they can assume responsibility. But given that our commonsense categories have changed in the past, their current prominence is not enough to argue against their revision. The extent to which neuroscience will shape our conceptions about ourselves is an empirical claim yet to be verified, but religion, philosophy, and science have shaped our beliefs in the past, and it seems likely that they will continue to do so in the future.  REFERENCES Churchland, P. M. 1989. A neurocomputational perspective: The nature of mind and the structure of science. Cambridge, MA: MIT Press. Gligorov, N. 2007. Eliminative materialism and the distinction between common sense and science. PhD dissertation, City University of New York, New York. Kaposy, C. 2010. The supposed obligation to change one's beliefs about ethics because of discoveries in neuroscience. AJOB Neuroscience 1(4): 23–30. Searle, J. R. 1992. The rediscovery of the mind. Cambridge, MA: MIT Press. Sellars, W. 1991. Philosophy and the scientific image of man. In Science, perception and reality, 20. Atascadero, CA: Ridgeview. Clarifying Conceptions of Freedom: Kaposy's Argument Against "The Inference" William Smith, Emory University Chris Kaposy's article "The Supposed Obligation to Change One's Beliefs About Ethics Because of Discoveries in Neuroscience" (2010) targets a common "inference" among neuroscientists and ethicists. Kaposy puts "The Inference" this way: "Scientific discoveries x, y, z imply that we ought not to believe claims in our ethical lives that are inconsistent with x, y, z." He claims this inference is increasingly deployed to eliminate the ethical concepts of free will, persons, and selves in light of neuroscientific evidence; he argues against it with two claims. First, he asserts that rationality requires the concepts that are attacked and concludes that we cannot be under a rational norm to eliminate a concept Thanks to Cicely Chen for reading a draft of this paper. Address correspondence to William Smith, Emory University, School of Medicine, 444 Burlington Rd, Atlanta, GA 30307, USA. E-mail: wsmithv@emory.edu grounded in rationality (henceforth, the "Freedom Is Rationally Necessary" claim). Second, he claims that the practical value of these concepts warrants belief therein whether or not scientific evidence undermines their epistemic warrant (henceforth, the "Freedom Is Practically Warranted" claim). Both claims strike me as naive in terms of active debates in the literature on free will and responsibility. In my view, Kaposy neither presents the best versions of these claims nor acknowledges responses that opponents of these views have been making for some time. Take the "Freedom Is Rationally Necessary" claim. Kaposy claims that we cannot be rationally required to 34 ajob Neuroscience October–December, Volume 1, Number 4, 2010 D ow nl oa de d by [ N ew Y or k U ni ve rs ity ] at 0 8: 31 2 0 Fe br ua ry 2 01
{ "pile_set_name": "PhilPapers" }
Background {#Sec1} ========== Uterine artery embolization (UAE) for the treatment of uterine fibroids was first reported in 1995 \[[@CR1]\], and since then, many reports \[[@CR2]--[@CR15]\] have described the risks and benefits of UAE. Some reports \[[@CR12]--[@CR15]\] stated that preoperative UAE can help reduce bleeding, and most reports indicated that UAE is safe for uterine fibroid. David et al. \[[@CR15]\] reported that patients undergoing a hysterectomy with a uterine weight of more than 1000 g have a significantly higher risk of perioperative complications and are at greater risk of requiring a blood transfusion. David and Kröncke \[[@CR15]\] also reported that only two of the three patients with myomata weighing more than 1100 g were able to avoid blood transfusion, because of preoperative UAE. The occurrence of hyperkalemia and acute kidney failure as complications of preoperative UAE has not been reported previously. Here we report the occurrence of hyperkalemia and acute kidney failure after preoperative UAE for a large uterine fibroid. To our knowledge, this is the first report on the occurrence of hyperkalemia and acute kidney failure after preoperative UAE. Case presentation {#Sec2} ================= A 48-year-old Japanese woman with a medical history of multiple sclerosis presented to our hospital complaining of compression in her abdomen and an abdominal mass. Magnetic resonance imaging revealed a uterine fibroid measuring 37.5×27×13.5 cm along with some small fibroids (Figs. [1](#Fig1){ref-type="fig"} and [2](#Fig2){ref-type="fig"}). We planned total abdominal hysterectomy and bilateral salpingo-oophorectomy 3 days after UAE.Fig. 1A sagittal T2-weighted magnetic resonance image of the uterus Fig. 2A coronal T2-weighted magnetic resonance image of the uterus Embolization of her bilateral uterine arteries and selective embolization of her left bladder artery were performed using a gelatin sponge (Figs. [3](#Fig3){ref-type="fig"} and [4](#Fig4){ref-type="fig"}), because her left bladder artery (Fig. [3](#Fig3){ref-type="fig"}, arrow) supplied the uterine fibroid. However, 12 hours after embolization, she experienced cold sweats and vomiting, and 15 hours after embolization, hyperkalemia was noted on venous blood analysis and acute kidney failure was identified (Table [1](#Tab1){ref-type="table"}). Arterial blood gas analysis showed compensated metabolic acidosis: pH, 7.368; partial pressure of carbon dioxide (pCO~2~), 27.3 mmHg; base excess, −8.2; and bicarbonate (HCO~3~), 15.4 mmol/L. Glucose-insulin therapy was administered; however, it was not successful in resolving her condition. She then received continuous hemodiafiltration in our intensive care unit; however, her hyperkalemia and kidney failure did not improve. Therefore, she underwent emergency surgery. Total abdominal hysterectomy and bilateral salpingo-oophorectomy were performed, and her intraoperative blood loss was 105 g (Figs. [5](#Fig5){ref-type="fig"}, [6](#Fig6){ref-type="fig"}, and [7](#Fig7){ref-type="fig"}). The weight of her uterus was 10.8 kg and the volume was 9964 cm^3^. The volume was calculated using the formula: volume = length (cm) × width (cm) × diameter (cm) × 0.5233 (Fig. [8](#Fig8){ref-type="fig"}). She underwent autotransfusion (800 mL) and received 1200 mL of packed red blood cells. Her uterus had necrotic tissue, and the pathological finding was uterine fibrosis with necrosis (Figs. [9](#Fig9){ref-type="fig"} and [10](#Fig10){ref-type="fig"}). Following surgery, her hyperkalemia and kidney failure resolved.Fig. 3An angiography image obtained before uterine artery embolization. The left bladder artery (*arrow*) supplied a uterine fibroid Fig. 4An angiography image obtained after uterine artery embolization Table 1Results of venous blood analysis 15 hours after uterine artery embolizationTestValueWhite blood cell count (μL)24800Red blood cell count (×10^4^/μL)454Hemoglobin (g/dL)13.3Hematocrit (%)39.3Platelet count (×10^4^/μL)32.5Total protein (g/dL)9.4Albumin (g/dL)4.7Potassium (mEq/L)8.0Sodium (mEq/L)134Chloride (mEq/L)96Blood urea nitrogen (mg/dL)28Creatinine (mg/dL)2.02Creatine kinase (IU/L)301Lactate dehydrogenase (IU/L)363Aspartate transaminase (IU/L)33Alanine transaminase (IU/L)17Alkaline phosphatase (IU/L)262C-reactive protein (mg/dL)1.49Activated partial thromboplastin time (s)25.6Prothrombin time international normalized ratio1.04Fibrinogen (mg/dL)452 Fig. 5An image of the patient's abdomen before surgery Fig. 6An image of the abdomen obtained during the surgery. The uterus occupies a large part of the intraperitoneal space Fig. 7An image of the uterus during the surgery Fig. 8An image of the excised specimen Fig. 9An image showing necrosis within the excised specimen Fig. 10A histological image showing necrotic cells (*yellow circle*). Hematoxylin and eosin stain, ×400 Discussion {#Sec3} ========== Previous reports \[[@CR2]--[@CR15]\] mentioned that most women who underwent UAE for uterine fibroids were satisfied with the clinical outcome and had few complications. Although complications have been reported after UAE, hyperkalemia and kidney failure have not been reported previously. The complication rate associated with UAE has been reported to be very low, and most complications have been found to be transient \[[@CR2]\]. The most serious complication associated with UAE is endometritis/uterine infection, with a reported incidence of approximately 2 % \[[@CR2]--[@CR4]\]; however, the associated morbidity rate was found to be very low \[[@CR2]\]. Complications following UAE can be classified into immediate (peri-procedure), early (within 30 days), and late (beyond 30 days) complications \[[@CR5]\]. Most immediate complications are local complications, such as hematoma, arterial thrombosis, dissection, and pseudoaneurysm, and other complications include spasm and non-target embolization \[[@CR5]\]. Non-target embolization is relatively rare, and it does not occur if a good technique is used \[[@CR5]\]. Most early complications are associated with post-embolization syndrome and include pain, nausea, fever, and malaise, and other complications are rare \[[@CR5]\]. Most complications of UAE have been shown to occur more than 30 days after the procedure \[[@CR5]\]. Late complications include vaginal discharge, fibroid expulsion and impaction, infection, amenorrhea, and sexual dysfunction \[[@CR5]\]. The rate of hysterectomy subsequent to UAE ranges from 0.25 to 1.6 % \[[@CR2]--[@CR4]\]. Uterine necrosis is a rare complication after UAE, and it necessitates hysterectomy and treatment with antibiotics to prevent bacteremia, sepsis, and death \[[@CR2], [@CR6]\]. In our case, we believe that the uterine fibroids became necrotic following UAE and the necrotic tissue caused hyperkalemia and acute kidney failure. Some reports have mentioned that patients with a septic uterus required urgent surgery 7 or more days after the initial procedure \[[@CR2], [@CR6]\]. However, in our case, necrotic tissue caused serious complications and necessitated surgical intervention within 48 hours. In addition, our patient needed a blood transfusion in spite of the small intraoperative blood loss; we think a blood transfusion was needed because after UAE the necrotic uterine fibroids lost blood. Previous reports found that the size of the uterine fibroid was not associated with complications after UAE \[[@CR7]--[@CR10]\]. In one report, complications were found to be associated with a large uterus size (500 mL), large dominant tumor volume (100 cm^3^), and high post-intervention creatine kinase level (170 U/L) \[[@CR11]\]. Among previous reports, the largest fibroid was approximately 4000 cm^3^ \[[@CR7]--[@CR10]\], while the uterus in the present case was 9964 cm^3^; therefore, it was not possible to generalize the previous findings to the present case. In our case, fibroid volume was the most important risk factor for serious complications. It has been reported that surgical intervention should be performed within 48 hours after preoperative UAE \[[@CR12]--[@CR15]\]. Therefore, for the prevention of serious complications, such as those in the present case, we suggest that surgical intervention should be performed immediately after preoperative UAE. Conclusions {#Sec4} =========== We reported the occurrence of serious complications, including hyperkalemia and acute kidney failure, after preoperative UAE for a large uterine fibroid. Preoperative UAE is effective for preventing blood loss. The findings of the present case indicate that UAE performed for a large uterine fibroid can cause hyperkalemia and acute kidney failure. We would like to thank the consultants of the Division of Gynaecology, the Department of Emergency Medicine, and the Department of Pathological Medicine, Hachinohe City Hospital. Funding {#FPar1} ======= There is no source of funding for the preparation of this manuscript. Availability of data and materials {#FPar2} ================================== Not applicable. Authors' contributions {#FPar3} ====================== KT, TK and TH carried out surgical intervention. KT, TK, TH, and NI contributed to the discussion of this case. All authors read and approved the final manuscript. Competing interests {#FPar4} =================== The authors declare that they have no competing interests. Consent for publication {#FPar5} ======================= Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Ethics approval and consent to participate {#FPar6} ========================================== Not applicable.
{ "pile_set_name": "PubMed Central" }
Modulation of swimming behavior in the medicinal leech. I. Effects of serotonin on the electrical properties of swim-gating cell 204. The effects of serotonin on the electrical properties of swim-gating neurons (cell 204) were examined in leech (Hirudo medicinalis) nerve cords. Exposure to serotonin decreased the threshold current required to elicit swim episodes by prolonged depolarization of an individual cell 204 in isolated nerve cords. This effect was correlated with a more rapid depolarization and an increased impulse frequency of cell 204 in the first second of stimulation. In normal leech saline, brief depolarizing current pulses (1 s) injected into cell 204 failed to elicit swim episodes. Following exposure to serotonin, however, identical pulses consistently evoked swim episodes. Thus, serotonin appears to transform cell 204 from a gating to a trigger cell. Serotonin had little effect on the steady-state current-voltage relation of cell 204. However, serotonin altered the membrane potential trajectories in response to injected current pulses and increased the amplitude of rebound responses occurring at the offset of current pulses. These changes suggest that serotonin modulates one or more voltage dependent conductances in cell 204, resulting in a more rapid depolarization and greater firing rate in response to injected currents. Thus, modulation of intrinsic ionic conductances in cell 204 may account in part for the increased probability of swimming behavior induced by serotonin in intact leeches.
{ "pile_set_name": "PubMed Abstracts" }
Create the Top of Your Sheet ... Blank Boxes will not appear on test form ... Remember my name and classroom on this PC. Saved Using Cookies Test Title: Move Test Title to a line all by itself, giving it more room. Teacher's Name: Teacher's Room: Hour Period Quarter Semester (enter value) Test: (Date, ID, Number, Etc) Display Line for Student Name ... Name: __________ Student ID: __________ _____________ (just a plain line) nothing is displayed Print "Date:___" (Students can write-in a date) Test Version: Or, enter Style Numbers 13-20 for Bubble Display Font Size Examples: 8pt 12pt 14pt 20pt 26pt Font Size Control for top of test: Font Point Size (12 is normal) Font Sizes allowed: 8-26 point. Font Size Control for test column numbering: Font Point Size (12 is normal) Does not change bubble size. The bubbles are graphic images, not text. Enter an optional comment (or instructions) line that appears on top ... Enter additional comments (or instructions) on a 2nd line ... Caution: Adding this line may push you onto a 2nd page on your printer. Display test headings in this language ... English Espanol Formatting height of paper ... Standard 8.5" X 11" paper only fits up to 30 questions per column. That assumes you use standard line spacing for questions. Any deviation from that may push your questions onto a 2nd page. You may have to use your printer options (shrink to fit) or (reduce by percent). Create the Columns of Bubbles ... Formatting Space Between Columns ... This spaces the columns apart narrower or wider. NARROWER WIDER Symbol to insert between question numbers and bubbles ... 1. Period 1) Parenthesis 1] Square Bracket 1 Nothing You can print up to five columns on the form. Each column can have a different bubble style. If you use all five columns, you may have to do "fit to page" for proper printout on 8.5inch paper. (use your print preview) Column Caption Question Numbers Bubble Style (See Below) (optional) Numbers to Style Numbers to Style Numbers to Style Numbers to Style Numbers to Style Express Fill-In 1-50 (2 cols) 1-75 (3 cols) 1-100 (4 cols) 1-125 (5 cols) 1-150 (5 cols) Bubble Styles to choose from ... 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 t-cap test numbering: 21 22 alternate numbering: 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 [no bubbles/blank] 39 40 some math functions: 41 42 more bubble styles (TAKS-M): 43 44 true - false: 45 46 47 48 49 50 51 52 53 Scroll this list for a variety of other graphic styles that are not necessarily normal looking bubbles. Ideas submitted by teachers. Teacher submitted bubble graphics: 500 (agree, disagree, undecided) 501 (feelings chart) 502 (pain chart) 503 (opinion - also see 523) 504 (opinion - also see 524) 505 (music - treble) 506 (music - bass) 507 (music - alto) 508 (music - tenor) 509 (TNT Reading Express) 510 (OPINION - FACT) 511 (FACT - OPINION) 512 (OPINION - FACT) 513 (FACT - OPINION) 514 (Long Line of Bubbles for Matching, etc.) 515 (Long Line of Bubbles for Matching, etc.) 516 (Alphabet 1st Half - for Matching, etc.) 517 (Alphabet 2nd Half - for Matching, etc.) 518 (Blank Set - for Matching, etc. - Use with 516 or 517) 519 (Boxes for whatever ...) 520 (T F w/line) 521 (Longer Line) 522 (Longer Line) 523 (opinion - one line for better spacing) 524 (opinion - one line for better spacing) 525 (1-8 special request) 526 (large size A-E) For very young students, or motor-skill challenged. 527 (large size A-D) 528 (large size A-C) 529 (large True - False) 530 (large 1-3) 531 (large 1-4) 532 (large 1-5) 533 (large A-F) These Essay Lines don't mix well with other styles. Like math grids, you will need to cut and paste with scissors. 540 Essay Answer 541 Essay Answer 542 Essay Answer 543 Vertical Shape Bubble - larger 544 Vertical Shape Bubble - larger 545 Vertical Shape Bubble - larger 546 Vertical Shape Bubble - smaller 547 Vertical Shape Bubble - smaller 548 Vertical Shape Bubble - smaller Teacher submitted bubble graphics:These Essay Lines don't mix well with other styles.Like math grids, you will need to cut and paste with scissors. Math Grids and X-Y Axis Graphs (scroll for various styles): PLEASE NOTE ... Because the column format is not working when you mix these grids with other styles, please generate the math grid columns one at a time. Print them out separately, and cut/paste (scissors and tape) together a master of your test sheet. I realize this consumes more paper, but until I can figure out how to align the columns, there is no other option. Math Grids and X-Y Axis Graphs (scroll for various styles):PLEASE NOTE ... Because the column format is not working when you mix thesegrids with other styles, please generate the math grid columns one at a time.Print them out separately, and cut/paste (scissors and tape) together a masterof your test sheet. I realize this consumes more paper, but until I can figureout how to align the columns, there is no other option. 600 629 601 602 603 604 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 630 STAAR Modified Texas Education 631 STAAR Modified Texas Education 632 STAAR Modified Texas Education 633 X-Y Axis Graph 634 X-Y Axis Graph 635 X-Y Axis Graph 636 X-Y Axis Graph 637 638 STAAR Modified Texas EducationSTAAR Modified Texas EducationSTAAR Modified Texas EducationX-Y Axis GraphX-Y Axis GraphX-Y Axis GraphX-Y Axis Graph Select Misc Options ... Print Alternating Color Background ... Background Color by Each Line Grouping (see Group below) Your browser needs to be set-up to print background colors. For instructions on printing background colors: printing colors Select Color: 1 2 3 4 5 6 7 Print BOLD Letters ... Example: Print BLANK Bubbles ... Example: Only valid for large and small round 'letter' bubbles. This option takes precedence over the BOLD option. - Select Styles 1-8, 29 or 30 for this option. Include TRUE - FALSE Letters ... Example: Prints at the top selected columns. (A=true, B=false) Include TRUE-FALSE for Column 1 Include TRUE-FALSE for Column 2 Include TRUE-FALSE for Column 3 Include TRUE-FALSE for Column 4 Include TRUE-FALSE for Column 5 ODD or EVEN Numbering of Columns. Force it to only print the ODD or EVEN numbers in your numbering range ... Column 1: Normal ODD EVEN Column 2: Normal ODD EVEN Column 3: Normal ODD EVEN Column 4: Normal ODD EVEN Column 5: Normal ODD EVEN SWAP Positions of Score Box and Instruction Box This determines which side of the page the boxes appear. Score Box Instruction Box Instruction Box Score Box Include Instructions: See page position above. Do Not Print Any Instruction Boxes Select a cool "meme" instead of a normal instruction box ... Select a cool "meme" instead of a normal instruction box ... Include Score Box: See page position above. Do Not Print Any Score Boxes Center the columns on printout. Force a Gap between each of the question numbers and the bubbles. This will allow the use of Assessment Indicators. This will widen the page format and possibly cause margins to overflow. Adjust your printer accordingly. (especially if you are using more than three columns) Force each column to begin with ABCD... For styles such as 21-34. Use this if you have an odd number of questions in a column and you don't want the letter sequence to carry-over into the next column. Force the first question in column to begin with FGHJ... For example, instead of starting the column with ABCD, it will start out with the 2nd line, like FGHJ. If selected, all columns will start the same way, regardless of the question no. Group sections of the test. (example: 5) This will cause a slight blank space between questions, making it easier for students to keep their place on the sheet. Select how many questions for each group. Grouping by 5 or 10 is most common. For background color, see that option above. (Leave this blank for non-grouping of questions) Add More Spacing between lines. (0-50 pixels) You can control the spacing between lines by entering the number of pixels to increase the space. Visualize: (Leave this blank for normal line spacing) Include Registration Marks ( ) Prints marks in the leftmost column to simulate printout for an automated test marking machine. Assign a unique 'Test ID' number. Select this option to reprint your form at a later date. All data is saved for future retrieval (for 1-2 months). The ID number will appear on your form.
{ "pile_set_name": "OpenWebText2" }
1. Field This disclosure relates generally to gain control, and more specifically, to gain control of a receiver using signal peak tracking. 2. Related Art Communication protocols have been widely adopted for providing connectivity in a number of applications, including healthcare, sports, and sensor applications. Such protocols often use a preamble sequence at the beginning of a transmission that is used to identify a valid start of the transmission. The preamble sequence indicates to a receiver that a transmission is underway. The present invention is illustrated by way of example and is not limited by the accompanying figures, in which like references indicate similar elements, unless otherwise noted. Elements in the figures are illustrated for simplicity and clarity and have not necessarily been drawn to scale.
{ "pile_set_name": "USPTO Backgrounds" }
1973 Gwent County Council election The 1973 Gwent County Council election was held on Thursday 12 April 1973 to elect councillors to the new Gwent County Council, governing the new county of Gwent, Wales. It took place on the same day as other county council elections in the United Kingdom. These were the first elections to the new county council, which would come into effect on 1 April 1974. Future elections would take place every four years, with the next one scheduled for April 1977. The 1973 election saw the Labour Party win a strong majority on the Council. Background Gwent was created following local government reorganisation enacted by the Local Government Act 1972. It covered the area of Monmouthshire and Newport County Borough, which would be transferred from England to Wales in 1974. The 1973 elections were the first to the new local authorities, with councillors acting in a shadow capacity until 1 April 1974 when the new councils took full effect. The position of alderman on the local authorities was abolished, with all members of the new councils being elected ward councillors. Overview of the result Seventy-eight Gwent County Council seats in 66 electoral wards were up for election in April 1973. Labour overall increased its presence in comparison with the old councils, though there were some close battles between Labour, the Liberals and Independents in some wards. In Cwmbran Labour did not fare so well, with an Independent and a Ratepayer candidate winning seats, and the Conservatives polling strongly. |} Ward results Contests took place in 49 wards, with candidates in seventeen of the wards being elected unopposed. Aberbeeg and Six Bells (1 seat) Abercarn and Cwmcarn (1 seat) Abergavenny Cantref and Grofield (1 seat) Abergavenny Castle and Priory (1 seat) Abersychan Central (1 seat) Abersychan North (1 seat) Abertillery (1 seat) Alexandra (1 seat) Allt-yr-yn (1 seat) Alway (2 seats) Bassaleg and Marshfield (1 seat) Bedwellty No. 2 Pengam (1 seat) Bedwellty No. 3 Argoed and Cefn Fforest (1 seat) Beechwood (2 seats) Bettws (1 seat) Blackwood (1 seat) Blaenavon (1 seat) Brynmawr (1 seat) Caerleon (1 seat) Caerwent (1 seat) Caldicot (1 seat) Central (1 seat) Chepstow (1 seat) Crickhowell and Llanelly Parish (1 seat) Crucorny Fawr and Llantilio Pertholey (1 seat) Crumlin (1 seat) Cwmbran Central and Llantarnam (1 seat) Cwmtillery (1 seat) Ebbw Vale, Badminton, Beaufort and N Central Ebbw Vale Central, Cwm and South Central Fairwater and Henllys (1 seat) Langstone (1 seat) Llanfoist and Llanover (1 seat) Llanfrechfa Lower (2 seats) Llanhilleth (1 seat) Liswerry (2 seats) Malpas (1 seat) Monmouth (1 seat) Mynyddislwyn Penmaen (1 seat) Nantyglo and Blaina Central and South (1 seat) Nantyglo and Blaina North (1 seat) Newbridge (1 seat) Old Cwmbran (1 seat) Councillor Rex was a credit company agent and had been a member of Cwmbran Urban Council for 16 years. Panteg East (1 seat) This was local newspaper reporter Don Touhig's first ever election, which he won by over 700 votes. Panteg West (1 seat) Pontllanfraith (1 seat) Pontnewydd (1 seat) Councillor Pritchard was General Secretary of the Monmouthshire Federation of Ratepayers. Pontnewydd North (1 seat) Pontnewydd South (1 seat) Pontypool (1 seat) Ringland (2 seats) Risca Central (1 seat) Risca North (1 seat) Risca South (1 seat) Rogerstone (1 seat) Shaftesbury (2 seats) Shirenewton and Tintern (1 seat) St Julians (2 seats) St Woolos (2 seats) Tredegar Central and West (1 seat) Bill Harry had been one of four Monmouthshire county councillors in Tredegar for 13 years, but Gwent County Council would only have three Tredegar county councillors, with Harry being the loser against Angus Donaldson who was a sitting Liberal Monmouthshire councillor for Tredegar. Tredegar Georgetown (1 seat) Tredegar Sirhowy (1 seat) Councillor Thomas won after a recount. Upper Cwmbran (1 seat) Usk and Pontypool Rural (1 seat) Victoria (1 seat) Percy Jones, an alderman and former major of Newport County Borough had been a council member in Newport for 20 years. Ynysddu (1 seat) See also 1972 Newport County Borough Council election Notes References Gwent Category:Council elections in Gwent
{ "pile_set_name": "Wikipedia (en)" }
Brian Wheeler Talks PVP in Morrowind By William Murphy on March 01, 2017 | Interviews | 0 During a recent trip to Zenimax Online Studios, we got to talk with ESO's PVP Lead Brian Wheeler about the upcoming PVP battlegrounds, Cyrodiil changes, and more. MMORPG.com: Are there PvP specific Battleground loot sets? Like item sets? Brian Wheeler: Yes, there will be specific sets. MMORPG.com: Will they help you in PvP? Or are they just meant to be exclusive to PvP? Brian: There's definitely uses for ones that I can see everywhere. I can't tell you anything else. There will be like four or five sets that you get from Battlegrounds. And that's full deal, rings, weapons, etc. MMORPG.com: And they'll look awesome and everything? Glowy particle effects? Brian: No glowy particle effects, but I do know what they're going to look like and I went, "Yes!" MMORPG.com: So you get points for Battlegrounds to spend? Brian: The way it will work, when you go into a Battleground match, there's obviously the score of the match. Then there's as you're playing, you're going to get medals as you play, and the medals reinforce the game. So, let's say, we have medals that are kill other player, get 5k crit, get a last hit, stuff like that. Those are great for Deathmatch. But in CTF, those medals won't exist. You'll get medals for capturing the flag, healing the flag carrier, killing a flag carrier, returning a flag. Those will be those types of medals. It's stuff that's reinforced in the game modes, so that matches don't simply turn into Deathmatch. MMORPG.com: And if you're a player that just sits there and doesn't do anything, do you get auto kicked? Brian: There will be an activity monitor behind the scenes that kicks you out if you sit there. If you're defending a flag, it knows. If you're at a flag, you're good. If you quit early there's gonna be a penalty. There will either be a penalty that doesn't let you rejoin or you get no AP for a period of time. Something like that. MMORPG.com: Everybody gets rewards, but winners get more? Brian: Yep. Depending upon the medals that you earned and depending upon first, second, and third, that's what's gonna dictate whether you got a green, blue, or purple item. MMORPG.com: What other kind of stuff do you get in your rewards? Brian: We're talking about adding other things that are more useful across the board. We just added the alchemy sacks to the Imperial City. So that's become a sort of, "Maybe we should do that for PvP as a whole." MMORPG.com: Maybe you're playing Battlegrounds and that's all you really have time for, but you still want to work on your crafting, so you get stuff like that. Brian: Yeah. I'm pretty sure the gear is going to be bind-on-equip. Pretty sure we're going to have selling. That's still getting a discussion. If it follows suit, like rewards for the Worthy, then you should be able to sell the stuff. MMORPG.com: Are there going to be seasons with these leaderboards? Brian: Leaderboards will be weekly leaderboards. There will be rewards, we haven't nailed those down just yet. There may just be all these purple versions of the Battleground gear or not. We are looking at adding ranked stuff later. Initially, when you play for now, there's going to be a 10-49 bracket, there will be a 10-50 bracket, and then maybe a 10-50 no CP bracket. There's also plans that when you're grouped you'll be matched against other grouped players, through a certain amount of cycles in the queue. If you're sitting there waiting too long, it's going to go "Screw it! Find some PUGs, put 'em in there, let's go!" That also being said, it's going to try and match single players against other single players. MMORPG.com: Will it look for class roles? Brian: That's going to be a very fast queue in that regard, that doesn't get hung up on those. But that also means you could have a team of all DPS, a team of all healers, a team of all tanks. MMORPG.com: Being able to switch between item sets and skill sets on the fly, with like a loadout? Brian: We haven't had any plans to introduce like an outfit. That'd be cool. I agree. That being said, before each match starts, there's a pre-game timer. So, if you look around and go, "OK. We're all DPS. I'm gonna switch out to my light armor and healing staff." MMORPG.com: Are there any updates coming to Cyrodiil? Brian: We're always doing tweaks. We just did the 1500 AP and 6000 AP thing, besides Blackwood Mine, which we fixed. To see if that changes player behavior, movement. We're looking at modifying their behaviors in terms of giving different rewards. Right now the 1500 AP and 6000 per keep thing, that is leading up to something we'll discuss when the time comes. But we didn't want to increase the values of those, because we wanted to have people try to spread out and try to take the objectives that are already there. A lot of feedback has been, "Give us more objectives to take." But you guys aren't taking the ones that are already there. And the feedback for that is that they're not worth anything. At that point, we said, "Let's make them the same value as a player kill." If it's a mine or a farm or a lumber mill, it's 1500 points, because a level 50 player is 1500 points. And you can take a mine solo. There is, of course, the timer for the thing to actually flip when you sit on a flag. We're looking at either adjusting that or looking at other values. MMORPG.com: So people aren't trading. Brian: Right. We know that that's going to occur, because of the path of least resistance to get AP, but on the other hand the question has been for a long time, "Why don't you make them worth more AP?" Well, now you know why! It's more of a matter of giving them what they want, but also showing and stating, "We know this is going to cause this behavior. But we are also prepared to do other changes to see how we can curb that behavior." Things like making, not necessarily things like making the flag flip slower, but if you notice when you flip a flag all the way, there's still a time delay before it actually flips. We may extend that wait period. We may add some form of non flip buff/debuff thing. There's always things when you're looking at to continually add to Cyrodiil or Imperial City. MMORPG.com: What are your thoughts on the map of Cyrodiil becoming a bit stale over time? What can you do to spice it up? Brian: There's a ton of unused areas and we have our own factions in the game already. We could add Alliance specific new things or we could add Imperial encampments. One of the things we could theoretically add is giving Cheydinhal or Chorrol capture locations. We can give them that. They were left empty at first, because we did one per Alliance, and if you rotated all three maps on top of each other, then Bruma, Vlastarus, and Cropsford, were the most even for the time being. The problem with doing it in Chorrol and Cheydinhal is that they are literally outside a keep's sight distance. You can see those towns. Shy of going in and adding in a whole new town, it would be difficult. But Bravil would have been perfect, but Bravil's out of bounds. MMORPG.com: What about something like unlocking a world boss for your faction? Brian: There's that. There's a possibility of adding a Murderball out there. So, there's things that we can add, that we're still going through the phases of design reviews. The Cyrodiil experience that we have is pretty good. When you play in an active Trueflame, or an active Azura's, or an active Blackwater Blade, it's hoppin'. People stay there a lot. It's one of the key stats about ESO. When a lot of people get into PvP, they love it. They just stay in there.
{ "pile_set_name": "OpenWebText2" }
Q: PHP dynamic select box using $_POST? I was wondering if there is a way similar to the code below in order to use 'conditional' select boxes. I tried a few jquery methods, but I really got stuck since I use wordpress, and this should be a search box so it complicates things for me. <form name="main" method="post"> <select name="currency-select"> <option value="default">Currency</option> <option value="a">U.S Dollars (USD)</option> <option value="b">Euros (EUR)</option> <option value="c">British Pounds (GBP)</option> </select> </form> <form name="child"> <select name="currency-child"> <?php if($_POST['currency-select'] == "a"): > <option value="1">price</option> <option value="2">100</option> <option value="3">200</option> <option value="4">300</option> <?php endif; ?> <?php if($_POST['currency-select'] == "b"): > <option value="5">price</option> <option value="6">50</option> <option value="7">60</option> <option value="8">70</option> <?php endif; ?> <?php if($_POST['currency-select'] == "c"): > <option value="9">price</option> <option value="10">130</option> <option value="11">260</option> <option value="12">390</option> <?php endif; ?> </select> </form> Update : syntax errors fixed A: As long as the form is not submited, PHP don't do any thing about your form, and you don't have a submit button in your html so the values won't be set in your PHP script. I suggest you jQuery. I wrote the code below for you, but you have to set the new attributes for your html elements and append a <div> with id="wrapper"--> <div id="wrapper"> If you didn't append wrapper, change $('#wrapper').on('change', 'form#main', function() { with$(document).on('change', 'form#main', function() {. but in larg codes, I suggest #wrapper instead of document. CODE: Add this lines in the <head> of page: //jQuery <script type="text/javascript" src="../jQuery/jquery-1.10.2.min.js"></script> <script type="text/javascript" language="javascript"> $(document).ready(function() { $('#wrapper').on('change', 'form#main', function() { if ( $('#a').is(':selected') ) { $('option.remove').remove(); $('#child1').append('<option value="1" class="remove">price</option>'); $('#child1').append('<option value="2" class="remove">100</option>'); $('#child1').append('<option value="3" class="remove">200</option>'); $('#child1').append('<option value="4" class="remove">300</option>'); } else if ( $('#b').is(':selected') ) { $('option.remove').remove(); $('#child1').append('<option value="1" class="remove">price</option>'); $('#child1').append('<option value="6" class="remove">50</option>'); $('#child1').append('<option value="7" class="remove">60</option>'); $('#child1').append('<option value="8" class="remove">70</option>'); } else if ( $('#c').is(':selected') ) { $('option.remove').remove(); $('#child1').append('<option value="9" class="remove">price</option>'); $('#child1').append('<option value="10" class="remove">130</option>'); $('#child1').append('<option value="11" class="remove">260</option>'); $('#child1').append('<option value="12" class="remove">390</option>'); } else if ( $('#default').is(':selected') ) { $('option.remove').remove();//reset every thing } }); }); </script> Body-html elements- <body> <div id="wrapper"> <form name="main" method="post" action="#" id="main"> <select name="currency-select"> <option value="default" id="default">Currency</option> <option value="a" id="a">U.S Dollars (USD)</option> <option value="b" id="b">Euros (EUR)</option> <option value="c" id="c">British Pounds (GBP)</option> </select> </form> <form name="child" id="child" method="post" action="#"> <select name="currency-child" id="child1"> </select> </form> </div> </body>
{ "pile_set_name": "StackExchange" }
Find Us on Facebook Subscribe to our newsletter Darryl Greenamyer Aviation - Class of 1997 One of the most successful unlimited pilots of the modern era. A seven-time champion, he was the Unlimited Class winner in the National Championships 1965-1969, 1971, 1977, all but the last in his highly-modified Grumman Bearcat. Set numerous qualifying and race records. In 1969, he set World 3-km speed record for piston-engine airplanes at 482 mph, breaking 1939 Nazi record.
{ "pile_set_name": "Pile-CC" }
Consumer sentiments falls in US March 13, 20151,548 Views Consumer sentiment in US fell more than expected in February, dropping from an 11-year high on concerns about wage growth, a survey released on Friday showed. The University of Michigan’s preliminary February reading on the overall index on consumer sentiment came in at 93.6, below the final January read of 98.1. It was below the median forecast of 98.1 among economists polled by Reuters. “Although confidence reversed the January gain, returning to the December level, the Sentiment Index was still higher than any other time since January 2007,” said Richard Curtin, the survey’s director. The survey’s barometer of current economic conditions fell to 103.1 from 109.3, below a forecast of 110. The survey’s gauge of consumer expectations slipped to 87.5 from 91, below an expected 92.2. The survey’s one-year inflation expectation was 2.8 percent, compared with 2.5 percent in January.
{ "pile_set_name": "Pile-CC" }
/* Whole cell */ div.container.cell { padding-left: 0; margin-bottom: 1em; } /* Removing all background formatting so we can control at the div level */ .cell_input div.highlight, .cell_input pre, .cell_output .output * { border: none; background: none; background-color: transparent; box-shadow: none; } .cell_output .output pre, .cell_input pre { margin: 0px; } /* Input cells */ div.cell div.cell_input { padding-left: 0em; padding-right: 0em; border: 1px #ccc solid; background-color: #f7f7f7; border-left-color: green; border-left-width: medium; } div.cell_input > div, div.cell_output div.output > div.highlight { margin: 0em !important; border: none !important; } /* All cell outputs */ .cell_output { padding-left: 1em; padding-right: 0em; margin-top: 1em; } /* Outputs from jupyter_sphinx overrides to remove extra CSS */ div.section div.jupyter_container { padding: .4em; margin: 0 0 .4em 0; background-color: none; border: none; -moz-box-shadow: none; -webkit-box-shadow: none; box-shadow: none; } /* Text outputs from cells */ .cell_output .output.text_plain, .cell_output .output.traceback, .cell_output .output.stream { background: #fcfcfc; margin-top: 1em; margin-bottom: 0em; box-shadow: none; } .cell_output .output.text_plain, .cell_output .output.stream { border: 1px solid #f7f7f7; } .cell_output .output.traceback { border: 1px solid #ffd6d6; } /* Math align to the left */ .cell_output .MathJax_Display { text-align: left !important; } /* Pandas tables. Pulled from the Jupyter / nbsphinx CSS */ div.cell_output table { border: none; border-collapse: collapse; border-spacing: 0; color: black; font-size: 1em; table-layout: fixed; } div.cell_output thead { border-bottom: 1px solid black; vertical-align: bottom; } div.cell_output tr, div.cell_output th, div.cell_output td { text-align: right; vertical-align: middle; padding: 0.5em 0.5em; line-height: normal; white-space: normal; max-width: none; border: none; } div.cell_output th { font-weight: bold; } div.cell_output tbody tr:nth-child(odd) { background: #f5f5f5; } div.cell_output tbody tr:hover { background: rgba(66, 165, 245, 0.2); } /* Inline text from `paste` operation */ span.pasted-text { font-weight: bold; } span.pasted-inline img { max-height: 2em; } tbody span.pasted-inline img { max-height: none; }
{ "pile_set_name": "Github" }
Mashfork, Kentucky Mashfork is an unincorporated community within Magoffin County, Kentucky, United States. References Category:Unincorporated communities in Magoffin County, Kentucky Category:Unincorporated communities in Kentucky
{ "pile_set_name": "Wikipedia (en)" }
Many years ago I was in a hospice visiting a freind who sadly passed away that evening. They where surrounded by family and it was a dignified passing. It was sad, but not a negative experience, in fact it posed a lot of questions. At the moment they passed away myself and two other people in the room felt an 'energy' go through us. It was like electricity. When weeks later we discussed what we felt, no one could fully explain what it was, 'soul' 'lifeforce' leaving the body. But we all felt it, many miles away from the hospice that night another relation to the deceased said they knew the exact moment the freind in the hospice died. They just felt it, and knew. Now for four people to all get that 'electricity' thing and one of those several miles away too? I remember leaving the hospice that night, looking up at the sky, it was a beautiful clear night, I was looking through pine trees and the stars sparkled, it was as if that energy had left the earth and gone up, up into those stars. I think there is a 'spark' an 'energy' in all of us, and even when are bodies cease to work that energy must find a place to go, where I have no idea. There are enough stars in the sky to give one each to every person that has ever existed, and for every person yet to be born, that's a lot of stars!
{ "pile_set_name": "Pile-CC" }
package org.nextrtc.signalingserver.api.dto; import org.nextrtc.signalingserver.api.NextRTCEvents; import org.nextrtc.signalingserver.exception.SignalingException; import java.time.ZonedDateTime; import java.util.Map; import java.util.Optional; public interface NextRTCEvent { NextRTCEvents type(); ZonedDateTime published(); Optional<NextRTCMember> from(); Optional<NextRTCMember> to(); Optional<NextRTCConversation> conversation(); Optional<SignalingException> exception(); Map<String, String> custom(); String content(); }
{ "pile_set_name": "Github" }
jinglestartk: PLEASE HELP !!! This Russia website re-upload so many cc creators’s creations without permission!, I try to contact them to put down the download, but I don’t know how to do, I do not speak Russian, so if you know, please help or please re-blog, thank you!! 中文也說一下…雖然不知道有沒有人懂俄語,這個俄國網站沒有經過同意重新上傳了很多作者的作品在他的網站分享,其中當然也很多我們認識的國內外作者的作品,我有嘗試要跟網站作者聯絡希望他把下載連結移除,但是由於我不懂俄語所以無從做起,大家能幫忙的請幫忙,不知道從何幫起的也請幫忙轉載,讓更多人看到,讓能幫忙的人幫忙,謝謝大家! PLEASE HELP !!! Thank you!
{ "pile_set_name": "OpenWebText2" }
OPTION DOTNAME .text$ SEGMENT ALIGN(256) 'CODE' EXTERN OPENSSL_ia32cap_P:NEAR PUBLIC aesni_multi_cbc_encrypt ALIGN 32 aesni_multi_cbc_encrypt PROC PUBLIC mov QWORD PTR[8+rsp],rdi ;WIN64 prologue mov QWORD PTR[16+rsp],rsi mov rax,rsp $L$SEH_begin_aesni_multi_cbc_encrypt:: mov rdi,rcx mov rsi,rdx mov rdx,r8 mov rax,rsp push rbx push rbp push r12 push r13 push r14 push r15 lea rsp,QWORD PTR[((-168))+rsp] movaps XMMWORD PTR[rsp],xmm6 movaps XMMWORD PTR[16+rsp],xmm7 movaps XMMWORD PTR[32+rsp],xmm8 movaps XMMWORD PTR[48+rsp],xmm9 movaps XMMWORD PTR[64+rsp],xmm10 movaps XMMWORD PTR[80+rsp],xmm11 movaps XMMWORD PTR[96+rsp],xmm12 movaps XMMWORD PTR[(-104)+rax],xmm13 movaps XMMWORD PTR[(-88)+rax],xmm14 movaps XMMWORD PTR[(-72)+rax],xmm15 sub rsp,48 and rsp,-64 mov QWORD PTR[16+rsp],rax $L$enc4x_body:: movdqu xmm12,XMMWORD PTR[rsi] lea rsi,QWORD PTR[120+rsi] lea rdi,QWORD PTR[80+rdi] $L$enc4x_loop_grande:: mov DWORD PTR[24+rsp],edx xor edx,edx mov ecx,DWORD PTR[((-64))+rdi] mov r8,QWORD PTR[((-80))+rdi] cmp ecx,edx mov r12,QWORD PTR[((-72))+rdi] cmovg edx,ecx test ecx,ecx movdqu xmm2,XMMWORD PTR[((-56))+rdi] mov DWORD PTR[32+rsp],ecx cmovle r8,rsp mov ecx,DWORD PTR[((-24))+rdi] mov r9,QWORD PTR[((-40))+rdi] cmp ecx,edx mov r13,QWORD PTR[((-32))+rdi] cmovg edx,ecx test ecx,ecx movdqu xmm3,XMMWORD PTR[((-16))+rdi] mov DWORD PTR[36+rsp],ecx cmovle r9,rsp mov ecx,DWORD PTR[16+rdi] mov r10,QWORD PTR[rdi] cmp ecx,edx mov r14,QWORD PTR[8+rdi] cmovg edx,ecx test ecx,ecx movdqu xmm4,XMMWORD PTR[24+rdi] mov DWORD PTR[40+rsp],ecx cmovle r10,rsp mov ecx,DWORD PTR[56+rdi] mov r11,QWORD PTR[40+rdi] cmp ecx,edx mov r15,QWORD PTR[48+rdi] cmovg edx,ecx test ecx,ecx movdqu xmm5,XMMWORD PTR[64+rdi] mov DWORD PTR[44+rsp],ecx cmovle r11,rsp test edx,edx jz $L$enc4x_done movups xmm1,XMMWORD PTR[((16-120))+rsi] pxor xmm2,xmm12 movups xmm0,XMMWORD PTR[((32-120))+rsi] pxor xmm3,xmm12 mov eax,DWORD PTR[((240-120))+rsi] pxor xmm4,xmm12 movdqu xmm6,XMMWORD PTR[r8] pxor xmm5,xmm12 movdqu xmm7,XMMWORD PTR[r9] pxor xmm2,xmm6 movdqu xmm8,XMMWORD PTR[r10] pxor xmm3,xmm7 movdqu xmm9,XMMWORD PTR[r11] pxor xmm4,xmm8 pxor xmm5,xmm9 movdqa xmm10,XMMWORD PTR[32+rsp] xor rbx,rbx jmp $L$oop_enc4x ALIGN 32 $L$oop_enc4x:: add rbx,16 lea rbp,QWORD PTR[16+rsp] mov ecx,1 sub rbp,rbx DB 102,15,56,220,209 prefetcht0 [31+rbx*1+r8] prefetcht0 [31+rbx*1+r9] DB 102,15,56,220,217 prefetcht0 [31+rbx*1+r10] prefetcht0 [31+rbx*1+r10] DB 102,15,56,220,225 DB 102,15,56,220,233 movups xmm1,XMMWORD PTR[((48-120))+rsi] cmp ecx,DWORD PTR[32+rsp] DB 102,15,56,220,208 DB 102,15,56,220,216 DB 102,15,56,220,224 cmovge r8,rbp cmovg r12,rbp DB 102,15,56,220,232 movups xmm0,XMMWORD PTR[((-56))+rsi] cmp ecx,DWORD PTR[36+rsp] DB 102,15,56,220,209 DB 102,15,56,220,217 DB 102,15,56,220,225 cmovge r9,rbp cmovg r13,rbp DB 102,15,56,220,233 movups xmm1,XMMWORD PTR[((-40))+rsi] cmp ecx,DWORD PTR[40+rsp] DB 102,15,56,220,208 DB 102,15,56,220,216 DB 102,15,56,220,224 cmovge r10,rbp cmovg r14,rbp DB 102,15,56,220,232 movups xmm0,XMMWORD PTR[((-24))+rsi] cmp ecx,DWORD PTR[44+rsp] DB 102,15,56,220,209 DB 102,15,56,220,217 DB 102,15,56,220,225 cmovge r11,rbp cmovg r15,rbp DB 102,15,56,220,233 movups xmm1,XMMWORD PTR[((-8))+rsi] movdqa xmm11,xmm10 DB 102,15,56,220,208 prefetcht0 [15+rbx*1+r12] prefetcht0 [15+rbx*1+r13] DB 102,15,56,220,216 prefetcht0 [15+rbx*1+r14] prefetcht0 [15+rbx*1+r15] DB 102,15,56,220,224 DB 102,15,56,220,232 movups xmm0,XMMWORD PTR[((128-120))+rsi] pxor xmm12,xmm12 DB 102,15,56,220,209 pcmpgtd xmm11,xmm12 movdqu xmm12,XMMWORD PTR[((-120))+rsi] DB 102,15,56,220,217 paddd xmm10,xmm11 movdqa XMMWORD PTR[32+rsp],xmm10 DB 102,15,56,220,225 DB 102,15,56,220,233 movups xmm1,XMMWORD PTR[((144-120))+rsi] cmp eax,11 DB 102,15,56,220,208 DB 102,15,56,220,216 DB 102,15,56,220,224 DB 102,15,56,220,232 movups xmm0,XMMWORD PTR[((160-120))+rsi] jb $L$enc4x_tail DB 102,15,56,220,209 DB 102,15,56,220,217 DB 102,15,56,220,225 DB 102,15,56,220,233 movups xmm1,XMMWORD PTR[((176-120))+rsi] DB 102,15,56,220,208 DB 102,15,56,220,216 DB 102,15,56,220,224 DB 102,15,56,220,232 movups xmm0,XMMWORD PTR[((192-120))+rsi] je $L$enc4x_tail DB 102,15,56,220,209 DB 102,15,56,220,217 DB 102,15,56,220,225 DB 102,15,56,220,233 movups xmm1,XMMWORD PTR[((208-120))+rsi] DB 102,15,56,220,208 DB 102,15,56,220,216 DB 102,15,56,220,224 DB 102,15,56,220,232 movups xmm0,XMMWORD PTR[((224-120))+rsi] jmp $L$enc4x_tail ALIGN 32 $L$enc4x_tail:: DB 102,15,56,220,209 DB 102,15,56,220,217 DB 102,15,56,220,225 DB 102,15,56,220,233 movdqu xmm6,XMMWORD PTR[rbx*1+r8] movdqu xmm1,XMMWORD PTR[((16-120))+rsi] DB 102,15,56,221,208 movdqu xmm7,XMMWORD PTR[rbx*1+r9] pxor xmm6,xmm12 DB 102,15,56,221,216 movdqu xmm8,XMMWORD PTR[rbx*1+r10] pxor xmm7,xmm12 DB 102,15,56,221,224 movdqu xmm9,XMMWORD PTR[rbx*1+r11] pxor xmm8,xmm12 DB 102,15,56,221,232 movdqu xmm0,XMMWORD PTR[((32-120))+rsi] pxor xmm9,xmm12 movups XMMWORD PTR[(-16)+rbx*1+r12],xmm2 pxor xmm2,xmm6 movups XMMWORD PTR[(-16)+rbx*1+r13],xmm3 pxor xmm3,xmm7 movups XMMWORD PTR[(-16)+rbx*1+r14],xmm4 pxor xmm4,xmm8 movups XMMWORD PTR[(-16)+rbx*1+r15],xmm5 pxor xmm5,xmm9 dec edx jnz $L$oop_enc4x mov rax,QWORD PTR[16+rsp] mov edx,DWORD PTR[24+rsp] lea rdi,QWORD PTR[160+rdi] dec edx jnz $L$enc4x_loop_grande $L$enc4x_done:: movaps xmm6,XMMWORD PTR[((-216))+rax] movaps xmm7,XMMWORD PTR[((-200))+rax] movaps xmm8,XMMWORD PTR[((-184))+rax] movaps xmm9,XMMWORD PTR[((-168))+rax] movaps xmm10,XMMWORD PTR[((-152))+rax] movaps xmm11,XMMWORD PTR[((-136))+rax] movaps xmm12,XMMWORD PTR[((-120))+rax] mov r15,QWORD PTR[((-48))+rax] mov r14,QWORD PTR[((-40))+rax] mov r13,QWORD PTR[((-32))+rax] mov r12,QWORD PTR[((-24))+rax] mov rbp,QWORD PTR[((-16))+rax] mov rbx,QWORD PTR[((-8))+rax] lea rsp,QWORD PTR[rax] $L$enc4x_epilogue:: mov rdi,QWORD PTR[8+rsp] ;WIN64 epilogue mov rsi,QWORD PTR[16+rsp] DB 0F3h,0C3h ;repret $L$SEH_end_aesni_multi_cbc_encrypt:: aesni_multi_cbc_encrypt ENDP PUBLIC aesni_multi_cbc_decrypt ALIGN 32 aesni_multi_cbc_decrypt PROC PUBLIC mov QWORD PTR[8+rsp],rdi ;WIN64 prologue mov QWORD PTR[16+rsp],rsi mov rax,rsp $L$SEH_begin_aesni_multi_cbc_decrypt:: mov rdi,rcx mov rsi,rdx mov rdx,r8 mov rax,rsp push rbx push rbp push r12 push r13 push r14 push r15 lea rsp,QWORD PTR[((-168))+rsp] movaps XMMWORD PTR[rsp],xmm6 movaps XMMWORD PTR[16+rsp],xmm7 movaps XMMWORD PTR[32+rsp],xmm8 movaps XMMWORD PTR[48+rsp],xmm9 movaps XMMWORD PTR[64+rsp],xmm10 movaps XMMWORD PTR[80+rsp],xmm11 movaps XMMWORD PTR[96+rsp],xmm12 movaps XMMWORD PTR[(-104)+rax],xmm13 movaps XMMWORD PTR[(-88)+rax],xmm14 movaps XMMWORD PTR[(-72)+rax],xmm15 sub rsp,48 and rsp,-64 mov QWORD PTR[16+rsp],rax $L$dec4x_body:: movdqu xmm12,XMMWORD PTR[rsi] lea rsi,QWORD PTR[120+rsi] lea rdi,QWORD PTR[80+rdi] $L$dec4x_loop_grande:: mov DWORD PTR[24+rsp],edx xor edx,edx mov ecx,DWORD PTR[((-64))+rdi] mov r8,QWORD PTR[((-80))+rdi] cmp ecx,edx mov r12,QWORD PTR[((-72))+rdi] cmovg edx,ecx test ecx,ecx movdqu xmm6,XMMWORD PTR[((-56))+rdi] mov DWORD PTR[32+rsp],ecx cmovle r8,rsp mov ecx,DWORD PTR[((-24))+rdi] mov r9,QWORD PTR[((-40))+rdi] cmp ecx,edx mov r13,QWORD PTR[((-32))+rdi] cmovg edx,ecx test ecx,ecx movdqu xmm7,XMMWORD PTR[((-16))+rdi] mov DWORD PTR[36+rsp],ecx cmovle r9,rsp mov ecx,DWORD PTR[16+rdi] mov r10,QWORD PTR[rdi] cmp ecx,edx mov r14,QWORD PTR[8+rdi] cmovg edx,ecx test ecx,ecx movdqu xmm8,XMMWORD PTR[24+rdi] mov DWORD PTR[40+rsp],ecx cmovle r10,rsp mov ecx,DWORD PTR[56+rdi] mov r11,QWORD PTR[40+rdi] cmp ecx,edx mov r15,QWORD PTR[48+rdi] cmovg edx,ecx test ecx,ecx movdqu xmm9,XMMWORD PTR[64+rdi] mov DWORD PTR[44+rsp],ecx cmovle r11,rsp test edx,edx jz $L$dec4x_done movups xmm1,XMMWORD PTR[((16-120))+rsi] movups xmm0,XMMWORD PTR[((32-120))+rsi] mov eax,DWORD PTR[((240-120))+rsi] movdqu xmm2,XMMWORD PTR[r8] movdqu xmm3,XMMWORD PTR[r9] pxor xmm2,xmm12 movdqu xmm4,XMMWORD PTR[r10] pxor xmm3,xmm12 movdqu xmm5,XMMWORD PTR[r11] pxor xmm4,xmm12 pxor xmm5,xmm12 movdqa xmm10,XMMWORD PTR[32+rsp] xor rbx,rbx jmp $L$oop_dec4x ALIGN 32 $L$oop_dec4x:: add rbx,16 lea rbp,QWORD PTR[16+rsp] mov ecx,1 sub rbp,rbx DB 102,15,56,222,209 prefetcht0 [31+rbx*1+r8] prefetcht0 [31+rbx*1+r9] DB 102,15,56,222,217 prefetcht0 [31+rbx*1+r10] prefetcht0 [31+rbx*1+r11] DB 102,15,56,222,225 DB 102,15,56,222,233 movups xmm1,XMMWORD PTR[((48-120))+rsi] cmp ecx,DWORD PTR[32+rsp] DB 102,15,56,222,208 DB 102,15,56,222,216 DB 102,15,56,222,224 cmovge r8,rbp cmovg r12,rbp DB 102,15,56,222,232 movups xmm0,XMMWORD PTR[((-56))+rsi] cmp ecx,DWORD PTR[36+rsp] DB 102,15,56,222,209 DB 102,15,56,222,217 DB 102,15,56,222,225 cmovge r9,rbp cmovg r13,rbp DB 102,15,56,222,233 movups xmm1,XMMWORD PTR[((-40))+rsi] cmp ecx,DWORD PTR[40+rsp] DB 102,15,56,222,208 DB 102,15,56,222,216 DB 102,15,56,222,224 cmovge r10,rbp cmovg r14,rbp DB 102,15,56,222,232 movups xmm0,XMMWORD PTR[((-24))+rsi] cmp ecx,DWORD PTR[44+rsp] DB 102,15,56,222,209 DB 102,15,56,222,217 DB 102,15,56,222,225 cmovge r11,rbp cmovg r15,rbp DB 102,15,56,222,233 movups xmm1,XMMWORD PTR[((-8))+rsi] movdqa xmm11,xmm10 DB 102,15,56,222,208 prefetcht0 [15+rbx*1+r12] prefetcht0 [15+rbx*1+r13] DB 102,15,56,222,216 prefetcht0 [15+rbx*1+r14] prefetcht0 [15+rbx*1+r15] DB 102,15,56,222,224 DB 102,15,56,222,232 movups xmm0,XMMWORD PTR[((128-120))+rsi] pxor xmm12,xmm12 DB 102,15,56,222,209 pcmpgtd xmm11,xmm12 movdqu xmm12,XMMWORD PTR[((-120))+rsi] DB 102,15,56,222,217 paddd xmm10,xmm11 movdqa XMMWORD PTR[32+rsp],xmm10 DB 102,15,56,222,225 DB 102,15,56,222,233 movups xmm1,XMMWORD PTR[((144-120))+rsi] cmp eax,11 DB 102,15,56,222,208 DB 102,15,56,222,216 DB 102,15,56,222,224 DB 102,15,56,222,232 movups xmm0,XMMWORD PTR[((160-120))+rsi] jb $L$dec4x_tail DB 102,15,56,222,209 DB 102,15,56,222,217 DB 102,15,56,222,225 DB 102,15,56,222,233 movups xmm1,XMMWORD PTR[((176-120))+rsi] DB 102,15,56,222,208 DB 102,15,56,222,216 DB 102,15,56,222,224 DB 102,15,56,222,232 movups xmm0,XMMWORD PTR[((192-120))+rsi] je $L$dec4x_tail DB 102,15,56,222,209 DB 102,15,56,222,217 DB 102,15,56,222,225 DB 102,15,56,222,233 movups xmm1,XMMWORD PTR[((208-120))+rsi] DB 102,15,56,222,208 DB 102,15,56,222,216 DB 102,15,56,222,224 DB 102,15,56,222,232 movups xmm0,XMMWORD PTR[((224-120))+rsi] jmp $L$dec4x_tail ALIGN 32 $L$dec4x_tail:: DB 102,15,56,222,209 DB 102,15,56,222,217 DB 102,15,56,222,225 pxor xmm6,xmm0 pxor xmm7,xmm0 DB 102,15,56,222,233 movdqu xmm1,XMMWORD PTR[((16-120))+rsi] pxor xmm8,xmm0 pxor xmm9,xmm0 movdqu xmm0,XMMWORD PTR[((32-120))+rsi] DB 102,15,56,223,214 DB 102,15,56,223,223 movdqu xmm6,XMMWORD PTR[((-16))+rbx*1+r8] movdqu xmm7,XMMWORD PTR[((-16))+rbx*1+r9] DB 102,65,15,56,223,224 DB 102,65,15,56,223,233 movdqu xmm8,XMMWORD PTR[((-16))+rbx*1+r10] movdqu xmm9,XMMWORD PTR[((-16))+rbx*1+r11] movups XMMWORD PTR[(-16)+rbx*1+r12],xmm2 movdqu xmm2,XMMWORD PTR[rbx*1+r8] movups XMMWORD PTR[(-16)+rbx*1+r13],xmm3 movdqu xmm3,XMMWORD PTR[rbx*1+r9] pxor xmm2,xmm12 movups XMMWORD PTR[(-16)+rbx*1+r14],xmm4 movdqu xmm4,XMMWORD PTR[rbx*1+r10] pxor xmm3,xmm12 movups XMMWORD PTR[(-16)+rbx*1+r15],xmm5 movdqu xmm5,XMMWORD PTR[rbx*1+r11] pxor xmm4,xmm12 pxor xmm5,xmm12 dec edx jnz $L$oop_dec4x mov rax,QWORD PTR[16+rsp] mov edx,DWORD PTR[24+rsp] lea rdi,QWORD PTR[160+rdi] dec edx jnz $L$dec4x_loop_grande $L$dec4x_done:: movaps xmm6,XMMWORD PTR[((-216))+rax] movaps xmm7,XMMWORD PTR[((-200))+rax] movaps xmm8,XMMWORD PTR[((-184))+rax] movaps xmm9,XMMWORD PTR[((-168))+rax] movaps xmm10,XMMWORD PTR[((-152))+rax] movaps xmm11,XMMWORD PTR[((-136))+rax] movaps xmm12,XMMWORD PTR[((-120))+rax] mov r15,QWORD PTR[((-48))+rax] mov r14,QWORD PTR[((-40))+rax] mov r13,QWORD PTR[((-32))+rax] mov r12,QWORD PTR[((-24))+rax] mov rbp,QWORD PTR[((-16))+rax] mov rbx,QWORD PTR[((-8))+rax] lea rsp,QWORD PTR[rax] $L$dec4x_epilogue:: mov rdi,QWORD PTR[8+rsp] ;WIN64 epilogue mov rsi,QWORD PTR[16+rsp] DB 0F3h,0C3h ;repret $L$SEH_end_aesni_multi_cbc_decrypt:: aesni_multi_cbc_decrypt ENDP EXTERN __imp_RtlVirtualUnwind:NEAR ALIGN 16 se_handler PROC PRIVATE push rsi push rdi push rbx push rbp push r12 push r13 push r14 push r15 pushfq sub rsp,64 mov rax,QWORD PTR[120+r8] mov rbx,QWORD PTR[248+r8] mov rsi,QWORD PTR[8+r9] mov r11,QWORD PTR[56+r9] mov r10d,DWORD PTR[r11] lea r10,QWORD PTR[r10*1+rsi] cmp rbx,r10 jb $L$in_prologue mov rax,QWORD PTR[152+r8] mov r10d,DWORD PTR[4+r11] lea r10,QWORD PTR[r10*1+rsi] cmp rbx,r10 jae $L$in_prologue mov rax,QWORD PTR[16+rax] mov rbx,QWORD PTR[((-8))+rax] mov rbp,QWORD PTR[((-16))+rax] mov r12,QWORD PTR[((-24))+rax] mov r13,QWORD PTR[((-32))+rax] mov r14,QWORD PTR[((-40))+rax] mov r15,QWORD PTR[((-48))+rax] mov QWORD PTR[144+r8],rbx mov QWORD PTR[160+r8],rbp mov QWORD PTR[216+r8],r12 mov QWORD PTR[224+r8],r13 mov QWORD PTR[232+r8],r14 mov QWORD PTR[240+r8],r15 lea rsi,QWORD PTR[((-56-160))+rax] lea rdi,QWORD PTR[512+r8] mov ecx,20 DD 0a548f3fch $L$in_prologue:: mov rdi,QWORD PTR[8+rax] mov rsi,QWORD PTR[16+rax] mov QWORD PTR[152+r8],rax mov QWORD PTR[168+r8],rsi mov QWORD PTR[176+r8],rdi mov rdi,QWORD PTR[40+r9] mov rsi,r8 mov ecx,154 DD 0a548f3fch mov rsi,r9 xor rcx,rcx mov rdx,QWORD PTR[8+rsi] mov r8,QWORD PTR[rsi] mov r9,QWORD PTR[16+rsi] mov r10,QWORD PTR[40+rsi] lea r11,QWORD PTR[56+rsi] lea r12,QWORD PTR[24+rsi] mov QWORD PTR[32+rsp],r10 mov QWORD PTR[40+rsp],r11 mov QWORD PTR[48+rsp],r12 mov QWORD PTR[56+rsp],rcx call QWORD PTR[__imp_RtlVirtualUnwind] mov eax,1 add rsp,64 popfq pop r15 pop r14 pop r13 pop r12 pop rbp pop rbx pop rdi pop rsi DB 0F3h,0C3h ;repret se_handler ENDP .text$ ENDS .pdata SEGMENT READONLY ALIGN(4) ALIGN 4 DD imagerel $L$SEH_begin_aesni_multi_cbc_encrypt DD imagerel $L$SEH_end_aesni_multi_cbc_encrypt DD imagerel $L$SEH_info_aesni_multi_cbc_encrypt DD imagerel $L$SEH_begin_aesni_multi_cbc_decrypt DD imagerel $L$SEH_end_aesni_multi_cbc_decrypt DD imagerel $L$SEH_info_aesni_multi_cbc_decrypt .pdata ENDS .xdata SEGMENT READONLY ALIGN(8) ALIGN 8 $L$SEH_info_aesni_multi_cbc_encrypt:: DB 9,0,0,0 DD imagerel se_handler DD imagerel $L$enc4x_body,imagerel $L$enc4x_epilogue $L$SEH_info_aesni_multi_cbc_decrypt:: DB 9,0,0,0 DD imagerel se_handler DD imagerel $L$dec4x_body,imagerel $L$dec4x_epilogue .xdata ENDS END
{ "pile_set_name": "Github" }
Identification of a 3-gene model as a powerful diagnostic tool for the recognition of ALK-negative anaplastic large-cell lymphoma. Anaplastic large-cell lymphomas (ALCLs) are a group of clinically and biologically heterogeneous diseases including the ALK(+) and ALK(-) systemic forms. Whereas ALK(+) ALCLs are molecularly characterized and can be readily diagnosed, specific immunophenotypic or genetic features to define ALK(-) ALCL are missing, and their distinction from other T-cell non-Hodgkin lymphomas (T-NHLs) remains controversial. In the present study, we undertook a transcriptional profiling meta-analysis of 309 cases, including ALCL and other primary T-NHL samples. Pathway discovery and prediction analyses defined a minimum set of genes capable of recognizing ALK(-) ALCL. Application of quantitative RT-PCR in independent datasets from cryopreserved and formalin-fixed paraffin-embedded samples validated a 3-gene model (TNFRSF8, BATF3, and TMOD1) able to successfully separate ALK(-) ALCL from peripheral T-cell lymphoma not otherwise specified, with overall accuracy near 97%. In conclusion, our data justify the possibility of translating quantitative RT-PCR protocols to routine clinical settings as a new approach to objectively dissect T-NHL and to select more appropriate therapeutic protocols.
{ "pile_set_name": "PubMed Abstracts" }
Background {#Sec1} ========== "Homeless" is a term generally conceptualised to refer to a group of individuals who have no regular access to a decent and conventional housing \[[@CR1]\]. However, the concept of decent housing is influenced by local cultural values, hence the difficulty to find a worldwide accepted definition \[[@CR2]\]. The homelessness continues to be a global and local social problem, but its true prevalence is underestimated. Urban centres have many people, seemingly homeless, poor and ragged, living all their lives in the street \[[@CR3]\]. This is an worldwide and complex phenomenon of big cities that has been increasing in the last decades, particularly due to socio-economic factors \[[@CR4], [@CR5]\]. Despite this evolving epidemiology there is scarcity of studies on the prevalence of mental illness in the homeless \[[@CR4]\]. Homelessness is known to increase the risk of mental illness, thus raising concerns in mental health providers \[[@CR6], [@CR7]\]. In the United States between 33 and 50% of homeless had schizophrenia, and a considerable proportion had substance use disorder, alcoholism and personality disorders \[[@CR3], [@CR8]\]. Particularly in children, the high level of exposure of the homeless to abuse and to urban violence can increase risk of developing mental illness \[[@CR9], [@CR10]\] in adulthood. On the other hand, schizophrenia can affect cognition and promote impairment of social and professional functioning \[[@CR11]\]. Effective intervention strategies may be adapted to promote familial reintegration of homeless people. Intervention models such as the assertive community treatment, were conceived aiming at hospital as well as those community-based approaches \[[@CR12]\]. They focus not only on the homeless but also involve the relatives, so as to reduce risk factors for violence, physical abuse and victimization \[[@CR1], [@CR9]\]. Between 25 and 50% of homeless populations have some sort of mental disorder in high-income countries. Alcohol dependence, drug addiction and psychotic disorders are among the most common mental health problems identified in previous studies \[[@CR8]\]. Little is known about the situation in low middle-income countries, but the impact of the mental disorders among the homeless people is higher in these settings due to shortage of mental health services. Particularly in Africa studies on homeless people are scarce, and thus the size of the problem in the region remains unknown \[[@CR13]\]. In Mozambique, although the National Mental Health Program has been providing and implementing services to reduce the gap in treatment of mental disorders, using strategies that include training of psychiatric technicians, there are no specific programs for homeless people. Moreover, there are no specific interventions for the homeless mentally ill in the country, which would combine hospital and community interventions, offered by a multidisciplinary team, composed by psychiatrists, psychologists, psychiatric technicians, nurses and social workers. A pilot study was designed to evaluate the profile of homeless with apparent mental illness in one urban and one suburban area in a low-income country. Using a referral strategy from community to hospital settings, we aimed to understand the mental health status of the homeless people, as well as to assess potential predictors of family integration, implementing a multidisciplinary approach. Thus, the present work had two main objectives: (a) to characterise the mental health status of the homeless people in Maputo and Matola utilising standardised clinical and sociodemographic assessment; and (b) to look at potential predictors of family integration among homeless submitted to psychiatric and psychosocial treatment. Methods {#Sec2} ======= Target population {#Sec3} ----------------- The study took place from August 2008 to December 2010, in Maputo city and Matola area, both in the southern region of Mozambique. These cities were chosen because of their accessibility and due to the dimension of the homeless population, representing an urban and suburban area respectively. The homeless were assisted at Infulene Psychiatric Hospital, the main psychiatric health facility in the country admitting patients with mental disorders, as well as providing psychiatric, psychological, occupational and social assistance. Study design {#Sec4} ------------ Homeless subjects from Maputo city and Matola area were recruited and referred to the Infulene Psychiatric Hospital. The sample comprised homeless people selected by convenience and included in the study using a snowball strategy. Patients with severe physical illness, under the age of 18 who were unable to give informed consent or those who were not in contact with their relatives were excluded. Patients discharged home from Infulene Psychiatric Hospital after being identified and referred by the researchers from homeless communities in Maputo and Matola to hospital, assessed, treated and provided group psychotherapy were eligible for this study. Study sample {#Sec5} ------------ After psychiatric assessment, patients started the recommended psychotropic treatment. Laboratorial analyses were performed to exclude organic conditions; in positive cases a full clinical examination was requested. Once the symptoms were controlled, the patients were submitted to a psychological evaluation and initiated group psychotherapy sessions and psychopharmacological treatment according to the individual needs. Group psychotherapy sessions included the following: training of social skills (communication, social interaction and assertive behaviors); cognitive stimulation and training of activities of daily living (personal hygiene, hygiene of spaces and standardized mealtimes). All patients were submitted to the same group psychotherapy and occupational therapy. Patients were also exposed to occupational therapy sessions to develop and improve autonomy and self-confidence. In a subsequent phase, group psychotherapy sessions and psychoeducation were also held involving patients' relatives, as part of family reintegration preparation process. Hospital stay varied from 3 to 6 months. Meanwhile, social workers performed 1--4 home visits to the relatives of the participants so as to create the appropriated environment to the family reintegration process. These visits were done in coordination with the community leaders and the municipal authorities after permission was obtained from patients and their relatives. Throughout these visits, the family social situation, the level of family involvement regarding the therapeutic process, the patient's health status, and the search information of their family member's disease were assessed. We defined family reintegration as the process of return of the homeless from an institution or shelter to its original, extensive or adopted family \[[@CR14]\]. In our study, we consider family reintegration as the return of the participant to family of origin after completing the treatment at the hospital level. We followed every patient for three months after family reintegration. Social workers conducted domiciliar monitoring of the families to provide additional information about disease and its management. Additionally, patients were registered and followed in a health unit near their residence areas as per usual standard of care in Mozambique. The support of clinical staff and social workers was maintained after the study period. Data collection method {#Sec6} ---------------------- The diagnosis was established by experienced psychiatrists through a structured clinical interview, the Mini International Neuropsychiatric Interview (MINI), which determines the likelihood of a psychiatric diagnosis by ICD10 \[[@CR15]\]. Socio-demographic data was collected using a questionnaire that also included a dichotomized question (yes/no), addressing whether the patient was present or not in the first, second and third monthly visit made by the health professionals. The questionnaire included questions for assessment of social skills adapted from social skills evaluation scale (EEHS) \[[@CR16]\], namely: verbal skills, non-verbal skills and conflict resolution that were explored in the three visits. Data analysis {#Sec7} ------------- Data analysis was performed using the Statistical Package for Social Sciences version 22, for the quantitative data analysis. All the collected information was coded including the identification of patients, relatives, health professionals and community leaders involved in the study. After three months of discharge a health professional was sent to their homes to check if the patient was leaving with their relatives and these was treated as a dichotomy variable. The presence of the patient after three months was defined as "reintegration". The present study was waived of approval by the National Bioethics Committee for Health (Ref. 343/CNBS), as it was part of an activity held by the Ministry of Health. Results {#Sec8} ======= Eighty-three homeless individuals were identified with apparent mental illness. Of these 12 refused to participate in the study. The 71 homeless recruited (85.5%) had a mean age of 37.83 ± 6.61 years, and 66 (93.0%) were male. Following identification and informed consent all 71 were referred for in-hospital treatment, and after clinical evaluation and social status assessment 38 (53.5%) (n = 38) were reintegrated in their nuclear or foster families. The remaining 33 (46.5%) stayed in the hospital as residents, or returned to the streets. From the participants in the study 59 (83.1%) were single and 12 (17.0%) married. Fifty-seven (80.3%) homeless were unemployed and 14 (19.6%) had an informal job such car washer, street or market seller, as well as other occasional jobs. The educational level was primary or secondary in 59 (83.1%) and 6 (8.4%) of the homeless had pre-university or university level; the latter have been entirely reintegrated. Regarding their origin 34 (47.9%) street residents were from provinces outside the southern region of Mozambique; Maputo City followed with 30 (42.3%). Before living on the street 32 (45.1%) lived in the suburban neighbourhoods of Maputo City, whilst 24 (33.4%) could not provide reliable data regarding their previous address (Table [1](#Tab1){ref-type="table"}).Table 1Comparison between socio-demographic data and familial reintegrationVariablesFamilial reintegrationNo\ n (%)Yes\ n (%)Total\ N (%)Gender Male31 (43.7)35 (49.3)66 (93.0) Female2 (2.8)3 (4.2)5 (7.0)Marital status Single29 (40.8)30 (42.3)59 (83.1) Married/partners2 (2.8)4 (5.6)6 (8.5) Divorced/separated2 (2.8)4 (5.6)6 (8.5)Occupational status Unemployed27 (38.0)30 (42.3)57 (80.3) Formally employed1 (1.4)4 (5.6)5 (7.0) Informally employed4 (5.6)5 (7.0)9 (12.6)Education Illiterate4 (5.6)2 (2.8)6 (8.5) Primary21 (29.6)15(21,1)36 (50.7) Secondary8 (11.3)15 (21.1)23 (32.4) Pre-university0 (0.0)5 (7.0)5 (7.0) Superior0 (0.0)1 (1.4)1 (1.4)Place of birth Maputo10 (14.1)20 (28.2)30 (42.3) Maputo province4 (5.6)3 (4.2)7 (9.9) Outside Maputo19 (26.8)15 (21.1)34 (47.9)Province residence before living on the street Maputo city9 (12.7)23 (32.4)32 (45.1) Maputo province4 (5.6)4 (5.6)8 (11.3) Outside Maputo3 (4.2)4 (5.6)7 (9.9) No information17 (23.9)7 (9.9)24 (33.4) Schizophrenia and other psychoses were present in 46 (64.8%) participants, mental and behavioural disturbance due to psychoactive substances in 21 (29.6%) and intellectual disability in 4 (5.6%). In general patients did not provide data related to previous treatment; for many the study provided the first contact with mental health professionals. Patients who gave information about their previous illness and hospital admissions reported diagnosis ranging from one to 30 years. Discharge by drop-out occurred in 28 (39.4%) patients. A statistically significant association ($\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\chi_{(2)}^{2}$$\end{document}$ = *46.1; p* = *0.000)* was verified between type of discharge and family reintegration (Table [2](#Tab2){ref-type="table"}).Table 2Association between diagnostic, type of discharge and familial reintegrationVariablesFamilial reintegration$\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\chi_{(df)}^{2}$$\end{document}$ *; p value*NoYesTotalDiagnosis (ICD-10)Schizophrenia and other psychosis22 (31.0)24 (33.8)46 (64.8)$\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\chi_{(2)}^{2}$$\end{document}$ = *6.1; p* = *0.047*Intellectual disability4 (5.6)0 (0.0)4 (5.6)Alcohol and substance use disorder7 (9.9)14 (19.7)21 (29.6)Type of discharge Clinical5 (7.0)33 (46.5)38 (53.5)$\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\chi_{(2)}^{2}$$\end{document}$ = *46.1; p* = *0.000* Drop-out26 (36.6)2 (2.8)28 (39.4) By request0 (0.0)3 (4.2)3 (4.2) Transference2 (2.8)0 (0.0)2 (2.8) Reintegration in family was associated with the clinical diagnosis ($\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\chi_{(2)}^{2}$$\end{document}$ = *6.1; p* = *0.047*); 24 patients reintegrated (33.8%) had schizophrenia/other psychoses, 14 (19.7%) had mental and behavioural disturbance due to psychoactive substances, and none had intellectual disability. Reintegrated patients' relatives possessed reasonable to good information about the mental illness in 30 cases and 24 (63.2%) were from low socio-economical level (Table [3](#Tab3){ref-type="table"}). Of these 38 families with reintegrated patients, 23 (60.6%) had reasonable to very good involvement with the patient's situation.Table 3Results of the familial reintegration, level of family involvement and family information about the illnessVariablen (%)Reintegration No33 (46.5) Yes38 (53.5)Level of family involvement (n = 38) Very low7 (18.4) Low8 (21.1) Reasonable6 (15.8) Good12 (31.6) Very good5 (13.2)Information that the family possesses about the illness (n = 38) Weak8 (21.1) Reasonable16 (42.1) Good14 (36.8)Family socio-economical level (n = 38) Medium high2 (5.3) Medium10 (26.3) Low24 (63.2) Very low2 (5.3) Discussion {#Sec9} ========== In this study in two areas of southern Mozambique we were able to map, screen, treat and reintegrate homeless with mental illness. The majority of participants were male, single and unemployed. More than half of the sample presented the diagnosis of schizophrenia/other psychoses, followed by mental disorders resulting from addiction, corroborating findings from studies that showed high prevalence of these conditions in people living in the streets \[[@CR8]\], and consider them as a driving force for the individual to live in the streets \[[@CR6]\]. Like others \[[@CR17]\] our results suggests an advantage for patients with schizophrenia/psychosis and mental/behavioural disorders resulting from substance abuse being to being reintegrated, compared to those with intellectual disability. The reduced reintegration of participants with intellectual disability might be explained by the stigma associated to intellectual disability. Intellectual disability being not curable may probably lead to relatives thinking about the patient as a permanent burden. Additionally, feelings of shame due to non-biological explanations for their condition \[[@CR18]\] may hamper the possibility of relatives taking their family member back home and assume again the responsibility for their care. Indeed, the conceptual framework for mental disorders may influence relative's attitudes and determine seeking care pattern. In our setting people attribute intellectual disability to unknown rather than supernatural causes, in contrast with psychosis and epilepsy considered to be have supernatural origins \[[@CR17]\]. Socio-demographic factors such as being married, having a nuclear family, being employed, having higher level of education before living in street appear to be protective for homeless people \[[@CR5]\] and to improve the chances of reintegration \[[@CR19], [@CR20]\]. In our study the reinsertion rate was higher in the female gender, suggesting that women are culturally more protected than men; additionally, having children and living with a partner seem to be protective factors \[[@CR19]\] and to influence reintegration in this particular group \[[@CR20]\]. The majority of reintegrated patients' relatives had reasonable to good information about the mental illness; this seems to have contributed to patients' reintegration and reinforces the importance of family involvement throughout process, including in the pharmacological treatment, rehabilitation and psychotherapy. Although this is not a causal study the fact that most participants presented mental illness, suggests that this condition may be a driving force (*driver*) for a person to live in the street \[[@CR6]\]. Severity of symptoms can lead to neglect of basic personal care (hygiene, seeking for services or resources for social support and health care in the community) \[[@CR3]\], besides decreasing the *coping* abilities \[[@CR5]\]. Schizophrenia and substance abuse are the two most prevalent disturbances in our sample, like in several epidemiological studies \[[@CR7], [@CR21]\], and are risk factor for becoming homeless \[[@CR21]\] with strong influence in the socio-family reintegration. Institutionalization can lead to lack of privacy for residents, but it is known that living in the street may be related to difficulty in socialisation \[[@CR22]\]. Our drop-outs were related to the difficulty to adhere to treatment plan, especially in learning social skills. Usually patients were unable to meet schedules and conform to living rules for the group. Additionally, some participants had had problems with the neighborhood before leaving their residences (burning houses or attacking people) leading to their relatives to avoid living with them again. Relatives would rather visit them in the hospital regularly. Difficult socialisation in hospital environment led to patients abandoning the institution. Dropout from hospital treatment may also be related to the way health providers take care of their clients, some of whom have already created forms of resilience to adapt to life in the street \[[@CR22]\] and interact with people around. Moreover, patients discharged following clinical improvement presented higher chances of being reintegrated (46.5%) than those who were discharged at their own request (4.2%) or drop out (2.8%), suggesting that clinical improvement may be an important factor to facilitate family reintegration. There are several limitations to this study namely lack of preliminary information on the number of homeless and the fact that its findings cannot be generalised to other Mozambican cities. The sample selection procedure chosen (convenience and snowball effect) can induce selection biases related to choosing patients who belong to a specially exposed and stigmatised population. The sample size also constitutes a challenge, considering that the total population of homeless is known. Because we did not have a control group we cannot assess if the success of reintegration was due to the study itself or to unknown confounding factors. Moreover, since only those who were willing to participate were included (or those whose relatives were contacted), homeless with no identified relatives were not represented. Finally, the fact that additional assessment of the global functioning and comorbidities (such as personality and evaluation of traumatic events) had not been included in the study constitutes also a limitation. Despite these limitations our study positively contributed to enhance comprehension regarding potential factors associated to family reintegration that may be considered in strategies to reduce the gap in the treatment of mental illness in Mozambique, specially through utilisation of available resources, and ensuring sustainable implementation of culturally accepted strategies directed to homeless people with mental illness. Conclusions {#Sec10} =========== Homelessness coexists with mental illness and is aggravated by low socio-economical level, low school level, unemployment and low healthcare access. Unfavourable socio-demographic factors such as being single or divorced, unemployment, poverty and lack of family involvement influenced family reintegration of the homeless. Schizophrenia, other psychotic disturbances and substance abuse were the conditions with facilitated family reintegration. Reintegration of the homeless that can be achieved with relatively inexpensive integrated approaches, using locally available resources, may help reduce the number of homeless people with mental disturbance in the streets. There is need for research to better understand homelessness and elaborate tailored and culturally adapted psychosocial interventions with multisectoral involvement to reduce the gap in mental care in low-income settings. LG and HM wrote and designed the protocol, performed and supervised data collection and wrote the manuscript; FM revised the protocol and did statistical analysis; WF and DM wrote and revised the manuscript, AOM and JM did overall revision of the protocol and manuscript. All authors read and approved the final manuscript. Acknowledgements {#FPar1} ================ We would like to express our gratitude to all the participants of the study. The success of this study was possible due to the commitment and professionalism of a large team composed by professionals from the mental health teams of the Department of Mental Health in the Ministry of Health, in the City and Province of Maputo, researchers, community leaders, and relatives. Our thankfulness is extended to the different institutions and political decision-makers, who made the successful implementation of this work possible. We could not end without addressing our special appreciation to Prof. Dr. Paulo Ivo Garrido, who was by that time the Minister of Health of Mozambique. The authors are also grateful to the comments and suggestions made by the referees of this paper. This publication was possible because of financial support from Mental Health Implementation Research Project for Official Portuguese Speakers Countries-FOGARTY/National Institute of Mental Health---D43TW009675. Competing interests {#FPar2} =================== The authors declare that they have no competing interests. Availability of data and supporting materials section {#FPar3} ===================================================== Data will not be shared because there is a need of changing the content in it in order not to break participant confidentiality. This process is still in course. Ethical considerations and consent to participate {#FPar4} ================================================= The present study was waived of approval by the National Bioethics Committee for Health, since it was realized on behalf of an activity held by the Ministry of Health: Ref. 343/CNBS. It was explained to the participants and their relatives the objectives of the study and they were asked to sign the informed consent after the explanation. Confidentiality of the information and the freedom to not accept participate or to discontinue participation without any damage resulting of it were guaranteed as well. Funding {#FPar5} ======= The funding for the design of study and collection of data was made by the Ministry of Health of Mozambique. National Institute of Mental Health---Fogarty D43TW009675 supported all the aspects of the research related to analysis, interpretation of data and in writing the manuscript. Publisher's Note {#FPar6} ================ Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
{ "pile_set_name": "PubMed Central" }
Barack Obama attended last week’s United Nations climate change conference. It would be odd if he didn’t – it was hosted in New York this year. But many world leaders didn’t bother. China, India, Germany, Russia – some of the world’s largest economies, and largest emitters of carbon dioxide – just couldn’t be bothered. Instead, celebrity spokesmodels took their place, actors like Leonardo DiCaprio and Mark Ruffalo. They’re probably more interesting to the media anyways. But all the celebrities and PR men in the world can’t hide a fact that the United Nations itself acknowledges: there just hasn’t been any measurable global warming since 1998. The UN has a $100 word for that -- a “hiatus.” Like a recess, or vacation. As in, it hasn’t happened since the 1990s, but it will be back for sure. Any moment now. Normally people, if they were campaigning to end something and it ended, would declare victory, have a celebration and move on. But you don’t understand the UN. To declare victory against global warming would mean that they would have to find new jobs. No more annual conventions in beautiful cities like New York, Bali, Marrakesh and Cancun. No more important meetings in five-star hotels. No more annual reunions with friends, paid for by taxpayers. And, most importantly, no more cosmic excuses for tax increases and government regulations. That’s why the UN – and their chorus in professional environmental groups and the mainstream media – have changed the terms. First it was global warming. Then climate change. Now it’s “climate disruption.” None of it is true – there are fewer tornadoes or hurricanes or sweltering days now than ever. Ice levels in the Arctic and Antarctic are firmly within normal bandwiths. But it’s all about keeping the PR pressure on. For what? What’s the plan from New York? A position paper from China, leaked to Fox News, has some clues. China is now the world’s largest carbon user and emitter – twice as much as the United States does. Which makes sense – carbon is the stuff of life, and China is the country with the most lives in it. They all need electricity and transportation and industrialization. That’s why they’re building two coal-fired power plants a week. There is no chance that China will reduce its carbon emissions. That would be tantamount to imperialism – the rich, industrialized West telling China that it can’t be rich and industrialized, too. Actually it’s more than that: China is the factory of the West. Look at everything in Walmart or Toys R Us – that pollution in China? That’s us outsourcing our emissions to them. Ironically, China has far worse pollution problems than colourless, odourless, harmless carbon dioxide. Its air, land and water really are polluted. But you don’t have five-star celebrity reunions about that. So if China will not tackle real pollution, and if it won’t tackle pretend pollution – namely carbon dioxide -- what does its position paper call for? That’s the scoop. They’re happy to reduce their carbon emissions – for a price. And that price is $100 billion a year, from the United States, Canada and Europe, paid into a UN fund to be redistributed to China and other beneficiaries. One hundred billion dollars a year. And that’s not all: Western countries must agree to give up intellectual property rights. As in patents. China is engaged in massive industrial sabotage, trying to steal the West’s commercial secrets on everything from cellphones to Hollywood. China – in the name of global warming – simply wants the West to give them that. For free. In the name of “climate change,” you see. Can you blame them? Western politicians want to tax carbon, to save the planet. Taxing carbon won’t save the planet. It’s an excuse that low-information celebrities seem to buy, though. So if Leonardo DiCaprio will go for that, maybe he’ll go for a $100 billion/year gift to China, too? I mean, it couldn’t hurt to ask for, right?
{ "pile_set_name": "OpenWebText2" }
Orlando Limo Service | Backstage Limousine There is something about the Orlando limo service that provides a feeling of luxury and style. For many, there is nothing quite like the experience and freedom of riding in the back of a modern, advanced, and high class limousine. It is a type of transportation with no comparison. Based in , Florida, Backstage Limousine is the leading choice for Orlando limo rental. We have a full fleet of vehicles for both small and large parties, and well trained drivers that offer superior support and service. If you are ready to book an Orlando limo, give us a call today at 321-945-3506, or use our online booking system to reserve your next luxury vehicle. Our Orlando Limo Rental Services Backstage Limousine is able to provide an Orlando limo for every purpose. While we offer a variety of specific limo services, we are also a transportation company that can take you to and from any locations, anywhere in the city, and are able to customize the experience to match the needs of you, your business, your friends, or your family. A small sample of our services include: Port Canaveral Limo – If you need to get to or from your cruise, our limos can pick you up from any location and get you to your destination on time. Corporate Limousine – Great for executives, clients, and more, our limos give you a chance to work or relax while we take care of your transportation. Night on the Town – Limos turn any night out into a memorable one, where no one has to drive and everyone can travel together and have a great time. Wedding Limo – Weddings are special events. With our Orlando wedding limos, we can make your wedding even more special. Great for guests, too. Prom Limo – Limos are considered one of the most important parts of the prom experience. Let us handle the needs of you or your teen, and make sure it is a great night. Attractions Limo – There are so many attractions in Orlando. Our limos will make sure that no matter where you’re going, you’ll have an amazing experience during your travel. Orlando Airport Car Service – We can provide affordable pick up and drop off services in limos that are more relaxing and memorable than other forms of Orlando airport car services. Enjoy our Orlando airport limo service. Disney World Transportation – Disney Land is a place of magic. Let our Orlando limos help add to that magic, and give you and yours an outstanding experience. Of course, we are also happy to provide limo rentals for any type of transportation need. We can provide personal driver services, for taking you anywhere you need to go. We also have the ability to wait for you when necessary, taking you to multiple locations, or simply be there when you need us. Backstage Limousine – Affordable Orlando Limo Travel Backstage Limousine has over 20 years of experience in limo transportation, with a tremendous fleet of vehicles, including town cars, stretch limos, Hummer limos, Escalade limos, luxury vans, party buses, and so much more. For no matter where you want to go or how big your party is, we have a beautiful limo that can be customized to your needs, and is certain to provide you with an incredible experience. If you are in need of a limo service in Orlando, and want a 5 star company that is truly committed to your satisfaction, call Backstage Limousine today at 321-945-3506. We’ll help you with all of your transportation needs, and do so in the style and luxury that comes from a custom limo, whether its a standard Orlando car service or Orlando airport limo. Call today, or book online to get started. Outside Orlando Limo Rides In case you need a reliable transportation in New York be free to visit our new Backstage Limo NYC branch to book a comfortable ride anywhere in New York City. Testimonials I have been using Backstage Limousine for few years,I love the way they check my flights if its delay.I never had any issues with them.They have very reasonable rates.Their drivers always on time,very courteous and punctual.I definitely recommend to everyone. - NY LimoLink I hired Backstage Orlando limo service to bring my family to meet me and my wife at Disney World for the day. They did a great job….right on time, communicating with me constantly. Their Orlando airport limo was impeccable. They were very flexible and helpful. I Highly recommend them! - Hussain Haidar I used Backstage Limo when I proposed to my girlfriend. Ash had everything organized perfectly, and Rick was a fantastic driver, he was very professional and went over and above to deliver great service. I would highly recommend this Orlando limo rental company. - Bobby Archibald When I went to Orlando on business my client sent an SUV from Backstage Limousine Company to pick me up. I found the Orlando car service to be top notch from the courteous driver to the comfortable and roomy ride. Next time I am in Orlando for any reason I am hiring this service as my Orlando airport limo transportation. - Christine Cook Excellent service. Driver was on time actually early. I reserved a Mercedes sprinter they upgraded with hummer Orlando limo rental service just to surprise my kids. Would recommend to anybody anytime. - Nimrah Chaudhry When our family went to Disney World we flew into Orlando and our ground transportation service was Backstage Limousine Company. The car was waiting when we arrived and took us right to the hotel in the park. After our stay was over the same driver picked us up for our ride to the airport. We found this Orlando limo service to be exceptional and the driver as professional, helpful and friendly as could be. I could tell that he really liked his job by his great attitude. We will definitely call this airport transportation service again.
{ "pile_set_name": "Pile-CC" }
1. Introduction {#sec1-sensors-20-02641} =============== In recent years, the field of indoor localization has increased in popularity due to both the increasing number of applications \[[@B1-sensors-20-02641]\] in domains such as surveillance \[[@B2-sensors-20-02641]\], navigation (both assistive and general purpose) \[[@B3-sensors-20-02641]\], robotics \[[@B4-sensors-20-02641],[@B5-sensors-20-02641],[@B6-sensors-20-02641]\], and Augmented Reality (AR) \[[@B7-sensors-20-02641]\] and the many proposed solutions that differ in terms of the devices used for tracking, the type of sensor data, and the localization algorithms. This paper focuses on computer vision based localization methods; therefore, the solutions presented are based on input from cameras. Most navigation systems use cameras carried by the subject, which represents the mobile entity (e.g., person, robot) that requires positioning or tracking, as illustrated in the left-hand side of [Figure 1](#sensors-20-02641-f001){ref-type="fig"}. The other type of solutions uses an infrastructure of static cameras positioned at known locations throughout the building to track the subject, as shown in the right-hand side of [Figure 1](#sensors-20-02641-f001){ref-type="fig"}. The vision based localization systems use 2D or 3D cameras (e.g., stereo, depth, RGB-D cameras) and perform the localization by identifying artificial markers (such as Quick Response (QR) codes and fiducial markers like AprilTags, ARTags, and CALTags \[[@B8-sensors-20-02641]\]) or objects that are part of the environment. In many cases, the cameras are used in combination with other sensors such as WiFi, beacon, or inertial sensors \[[@B1-sensors-20-02641]\]. Depending on the application, the required level of location accuracy varies \[[@B9-sensors-20-02641]\]. Navigation solutions for guiding people to find specific rooms in a building or when changing underground lines accept an accuracy of several meters. In the same accuracy range are assistive solutions for the elderly that monitor their approximate location to confirm their compliance with certain routines and to detect situations of emergency such as a person ceasing to move. Other tracking or surveillance applications require 1--2 m accuracy to assess risky situations such as a person getting too close to an exhibit item in a museum. However, some of these surveillance applications require a higher accuracy of 10--20 cm when aiming to detect whether restricted areas/perimeters are only entered by authorized people. Applications for indoor autonomous robots or assistive systems for the visually impaired that perform obstacle detection cannot rely on an approximate localization and need centimeter-level accuracy. Modern AR solutions take the accuracy requirements even further. To offer seamless integration of the multimedia content, superimposed over video flows on smartphones or over smart glasses' lenses, these applications require centimeter to millimeter accuracy of the position and orientation of the user's mobile device. Even though a considerable number of surveys on indoor localization have been published \[[@B1-sensors-20-02641],[@B4-sensors-20-02641],[@B5-sensors-20-02641],[@B6-sensors-20-02641],[@B9-sensors-20-02641],[@B10-sensors-20-02641],[@B11-sensors-20-02641],[@B12-sensors-20-02641],[@B13-sensors-20-02641],[@B14-sensors-20-02641],[@B15-sensors-20-02641]\], as this research space continuously developed and the types of localization solutions diversified, we find that for the area of vision based localization, the majority of the previous surveys could have better focus as they are too general (encompassing all kinds of sensing devices) or too specific (addressing only a segment of the vision based localization problem, such as Simultaneous Localization and Mapping (SLAM) \[[@B16-sensors-20-02641],[@B17-sensors-20-02641],[@B18-sensors-20-02641],[@B19-sensors-20-02641],[@B20-sensors-20-02641],[@B21-sensors-20-02641]\], Structure from Motion (SfM) \[[@B22-sensors-20-02641]\], or image matching \[[@B23-sensors-20-02641]\]). Other surveys discuss indoor positioning solutions particular to certain application domains. For instance, Huang et al. \[[@B24-sensors-20-02641]\] analyzed only localization solutions that combined visual and inertial information. Marchand et al. \[[@B7-sensors-20-02641]\] provided a survey of pose estimation methods used only for AR. Silva and Wimalaratne \[[@B25-sensors-20-02641]\] presented a survey of navigation and positioning aids for the visually impaired. In comparison, we offer a comprehensive survey of image based localization solutions regardless of the application domain and propose a new classification. The paper is organized as follows: the next section describes the most impacted domains by indoor localization; [Section 3](#sec3-sensors-20-02641){ref-type="sec"} classifies 70 selected computer vision based indoor localization methods and details their main characteristics; [Section 4](#sec4-sensors-20-02641){ref-type="sec"} focuses on benchmarks used for evaluating image based indoor localization solutions; and [Section 5](#sec5-sensors-20-02641){ref-type="sec"} presents our conclusions. 2. Application Domains {#sec2-sensors-20-02641} ====================== 2.1. Assistive Devices {#sec2dot1-sensors-20-02641} ---------------------- With the advance in technology, researchers have focused on improving the lifestyle of people with various disabilities, including visual impairment \[[@B26-sensors-20-02641]\]. Two of their main problems are navigating and perceiving unknown environments. There are several solutions to this problem that map the environment with images containing different visual cues such as QR codes, bar codes, or other simple synthesized geometric shapes like circles and triangles. Idrees et al. \[[@B27-sensors-20-02641]\] proposed an indoor navigation system that used QR codes that were placed on the floor at certain locations. The system guided the user to a selected destination, checking the user's location every time a QR code was scanned. Fusco and Coughlan \[[@B28-sensors-20-02641]\] used sign detection and visual-inertial odometry to estimate the user's location inside a building, requiring only a digital map of that building that contained the locations of the signs. Other solutions create a 3D reconstruction of the environment in a configuration stage or create a database with images of the indoor space, annotated with location information. Endo et al. \[[@B29-sensors-20-02641]\] proposed a navigation system for visually impaired people, which applied Large-Scale Direct SLAM (LSD-SLAM) to estimate the user's position while constructing a 3D map of the environment. The 3D model of the environment allowed for the construction of an occupancy grid map, divided into quadrate cells, which stored information about the presence or absence of an obstacle in that location. The system created a cost map and conducted path finding through the navigation stack provided by the Robot Operating System (ROS) framework \[[@B30-sensors-20-02641]\]. Li et al. \[[@B19-sensors-20-02641]\] detected dynamic obstacles and applied path planning to improve navigation safety for people with visual disabilities. They built a 3D reconstruction of the environment with the visual positioning service provided by the Google Tango device. With a time-stamped map Kalman filter, they implemented an obstacle detection and avoidance algorithm that guided the user to a specified destination. As previously mentioned, some localization solutions use an infrastructure of static cameras located at known positions in the environment. Heya et al. \[[@B31-sensors-20-02641]\] employed color detection in an indoor localization system used for visually impaired people. A static camera located on the ceiling tracked the screen of a smartphone that was placed on the user's shoulder. Chaccour and Badr \[[@B32-sensors-20-02641]\] proposed an ambient navigation system that was composed of static cameras attached to the ceiling. The system detected the users' location and orientation based on markers located on their heads. Static and dynamic obstacles were identified based on their shape or predefined images that were stored in a database. The proposed solution provided navigation assistance and obstacle avoidance and allowed the visually impaired users to locate missing objects. Many navigation systems for visually impaired people assume the existence of a map for the current environment or create such a map in a configuration stage \[[@B25-sensors-20-02641]\]. However, there are some solutions that allow the user to navigate in unknown environments by simply translating the visual information through audio or haptic signals, allowing the user to create a mental map of the surroundings. Sound of Vision \[[@B33-sensors-20-02641],[@B34-sensors-20-02641]\] is such an example, which identifies the most important objects in the proximity of the user and sends information about their characteristics (weight, height, elevation, distance to the user, etc.) through headphones and a haptic belt. Sound of Vision is not only a navigation system, but also a solution for perceiving the environment. However, the understanding of the audio and haptic information that characterize the environment can be accomplished only through intensive training \[[@B35-sensors-20-02641]\]. More information about indoor positioning systems for visually impaired people can be found in Siva's and Wimalaratne's survey \[[@B25-sensors-20-02641]\]. 2.2. Autonomous Robots {#sec2dot2-sensors-20-02641} ---------------------- Designing autonomous robot applications can represent a challenge, since the localization methods cannot rely on external information. When navigating an environment, a human being can use the five senses, especially vision, touch, and hearing, to create a mental representation of the surroundings. This is not the case for robots, which navigate the environment only based on the information provided by the localization system. Therefore, localization solutions for autonomous robots require continuous computation of the robot's position and orientation relative to a digital representation of the environment, as well as obstacle detection and path planning. On the other hand, designing applications for specific robots can simplify the localization problem. Various characteristics of a robot, such as degrees of freedom, width, height, position of the sensors mounted on the robot, or wheel diameter can be used to make assumptions about the movement of the robot (dead reckoning), thus reducing the complexity of the localization algorithms. Since most robots operate in controlled environments, a popular approach is to configure the space with artificial landmarks such as QR codes. Li and Huang \[[@B18-sensors-20-02641]\] presented a system that assisted robots, as well as human beings, in navigating indoor environments. A Kinect device acquired color information that allowed the detection of QR codes attached to the walls at known locations in a room. The depth sensor measured the distance from the Kinect camera to the identified QR codes. Babu and Markose \[[@B36-sensors-20-02641]\] proposed a navigation system for Internet of Things (IoT) enabled robots. A QR code based detection solution estimated the position of the robot, while a path optimization step based on Dijkstra's algorithm assisted the robot in reaching a destination node. Nazemzadeh and Macii \[[@B37-sensors-20-02641]\] described a localization solution for unicycle-like wheeled robots. It computed the position of the robots by fusing information from QR codes, odometry based on dead reckoning, and a gyroscope platform. Cavanini et al. \[[@B38-sensors-20-02641]\] proposed a low-cost QR code based localization system for robots operating indoors, experimentally validated on smart wheelchairs. Other approaches used actual images of the environment, acquired with 2D or 3D cameras. Correa et al. \[[@B39-sensors-20-02641]\] described a Kinect based reactive navigation system that guided robots while performing obstacle avoidance. It recognized different configurations of the indoor space with an artificial neural network. Xin et al. \[[@B40-sensors-20-02641]\] introduced an RGB-D SLAM method that combined the Oriented FAST and Rotated BRIEF (ORB) and Random Sample Consensus (RANSAC) algorithms for feature extraction and matching. They created a 3D volumetric map of the environment that could be used for the navigation of a mobile robot. Kao and Huy \[[@B41-sensors-20-02641]\] proposed an indoor navigation system that performed smartphone based visual SLAM with ORB features using a wheel-robot. They combined WiFi signals, information from inertial sensors, and monocular images for the computation of the robot's position. Surveys dedicated to positioning solutions for autonomous robots \[[@B4-sensors-20-02641],[@B5-sensors-20-02641]\] present in-depth information on this topic. 2.3. Augmented Reality {#sec2dot3-sensors-20-02641} ---------------------- Currently, Augmented Reality (AR) has become very popular, due to the new technologies that are bringing it closer to the greater public. Smartphones are the most commonly used devices for displaying augmented content. However, smart glasses, such as Moverio \[[@B42-sensors-20-02641]\] or Google Glass \[[@B43-sensors-20-02641]\], are gaining ground \[[@B44-sensors-20-02641]\]. For a seamless integration of the multimedia content within the real environment, the position and orientation of the display device must be estimated with high accuracy. Gerstweiller \[[@B45-sensors-20-02641]\] presented HyMoTrack , a tracking solution that generated a 3D model of the environment out of a vectorized 2D floor plan, and an AR path concept, called FOVPath, for guiding people. Using the FOVPath approach, the display of a trajectory depended on the user's position and orientation and also on the Field Of View (FOV) capabilities of the device. Wang et al. \[[@B46-sensors-20-02641]\] described the development of a 3D augmented reality mobile navigation system that provided indoor localization based on Radio-Frequency Identification (RFID) readings and computer vision. They created 3D representations of internal and external structures of Oxford College, from the present and the past. Based on the position and orientation of the user's device, they displayed the 3D architectural appearance of the college during important time periods, as well as multimedia content such as texts, pictures, or 3D models related to various exhibits. Balint et al. \[[@B47-sensors-20-02641]\] presented an AR multiplayer treasure hunt game, which combined GPS position information with localization based on image recognition. The treasures were virtual 3D objects that were displayed when the user reached a checkpoint, and the device was oriented towards the respective direction. Baek et al. \[[@B48-sensors-20-02641]\] proposed an AR system for facility management, which computed the user's pose relative to the building, with a deep learning approach. The visualization module displayed location-specific information, holographic pipes in this case, which in reality were not visible because they were built within the walls. Marchand et al. \[[@B7-sensors-20-02641]\] offered more information on the topic of pose estimation for augmented reality, presenting the most important approaches on vision based positioning. ### AR Commercial Solutions This section presents some of the most popular commercial tools for developing augmented reality content, which have indoor localization capabilities. Wikitude \[[@B49-sensors-20-02641]\] is an augmented reality Software Development Kit (SDK) that uses the SLAM technology to reconstruct the environment. It also performs 2D and 3D image recognition and tracking, which can trigger the display of digital content, overlaid on the real world. ARKit \[[@B50-sensors-20-02641]\] is an iOS AR platform that provides scene understanding capabilities by combining inertial data with visual information to detect horizontal and vertical planes. It also recognizes images and 3D objects, determining the position and orientation of the camera relative to the target. ARCore \[[@B51-sensors-20-02641]\] is another SDK, launched by Google, which allows developers to build augmented reality experiences that seamlessly integrate the digital content into the real world. ARCore provides motion tracking capabilities, as well as environmental understanding based on plane detection. It performs SLAM, making use of inertial sensors and the data acquired with a smartphone camera, estimating the position and orientation of the user's device relative to a 3D coordinate system. Vuforia \[[@B52-sensors-20-02641]\] is a popular engine that provides detection and tracking of image targets and pose estimation of any tracked target or marker, allowing the rendering module to display the 3D virtual content naturally, depending on the position and orientation of the user. The pose computation is performed only relative to an image target or a marker, therefore not offering actual indoor positioning capabilities (relative to an entire room or another type of indoor space). ARToolKit \[[@B53-sensors-20-02641]\] is an open-source library intended for the development of augmented reality applications, which overlays 2D and 3D multimedia content on the real world. It is a tracking library that computes the camera position and orientation relative to square markers or to natural feature markers in real time. It works with both monocular and stereo cameras, providing calibration capabilities. MAXST \[[@B54-sensors-20-02641]\] is a cross-platform engine that provides a variety of tracking features for the development of augmented reality applications. It recognizes and tracks planar target images or planar surfaces, as well as markers with regular patterns or QR codes. Their implementation of visual SLAM can be used to create map files of the environment that are later loaded up by the Object Tracker module, which superimposes AR experiences on them. Another module, AR Fusion tracker, generates world representations and performs environment tracking by combining information from the other tracking modules. Other popular commercial solutions for developing augmented reality applications are EasyAR \[[@B55-sensors-20-02641]\], Kudan \[[@B56-sensors-20-02641]\], Onirix \[[@B57-sensors-20-02641]\], Pikkart \[[@B58-sensors-20-02641]\], and DeepAR \[[@B59-sensors-20-02641]\]. 2.4. Surveillance and Monitoring {#sec2dot4-sensors-20-02641} -------------------------------- Indoor positioning can also be used for surveillance or monitoring purposes, detecting whether an unauthorized person has breached a perimeter, or tracking a certain person throughout an entire building or house. Generally, surveillance systems use an infrastructure of static cameras for the purpose of detecting and tracking the users. However, there are cases when information from other sensors, such as WiFi access points or beacons, is fused with the video frames. Sun et al. \[[@B60-sensors-20-02641]\] proposed a localization solution that used panoramic cameras and a map of the indoor environment. They applied a background subtraction method to detect human beings, matching their location to a corresponding position on the indoor map. Desai and Rattan \[[@B61-sensors-20-02641]\] used a pan/tilt camera and wireless sensor networks to track objects within an indoor space. The estimation of an object's position was performed with the time difference of arrival method. The camera, equipped with a laser pointer, followed the object continuously, by computing the pan and tilt angles based on a listener Cricket mote carried by the object. Grzechca et al. \[[@B62-sensors-20-02641]\] fused Received Signal Strength Indication (RSSI) information with data from a static video camera to track human beings in indoor environments. Zhang et al. \[[@B63-sensors-20-02641]\] acquired video sequences with a surveillance camera and recognized a target person by matching the information provided by the inertial sensor of the person's smartphone with gait and heading azimuth features extracted from the videos. They applied a Convolutional Neural Networks (CNN) based object tracking technique in order to handle occlusion. As far as we know, there is no recent survey on computer vision based indoor localization dedicated to surveillance and monitoring, but further information on this topic can be found in the work of Shit et al. \[[@B64-sensors-20-02641]\], which presented localization solutions with static cameras, and in the survey of Jiao et al. \[[@B65-sensors-20-02641]\], which discussed deep learning methods for object positioning. 3. Indoor Localization Solutions {#sec3-sensors-20-02641} ================================ 3.1. Selection of Papers Included in the Survey {#sec3dot1-sensors-20-02641} ----------------------------------------------- Image based indoor localization has been intensely researched. Among existing scientific publications, we chose 70 papers based on publication date and relevance to the domain, using only prestigious research databases (IEEE Explore, ACMDigital Library, SpringerLink, MDPI, and Elsevier). [Figure 2](#sensors-20-02641-f002){ref-type="fig"} shows the distribution of selected papers over time, illustrating an increased interest in the image based localization domain in the last five years. Since it takes time for research papers to acquire visibility, the number of citations was not one of the selection criteria, as it disadvantaged the more recent research. The purpose of this survey was not to be exhaustive in terms of listing the work performed in the field of vision based indoor positioning, but to illustrate the main characteristics of the existing technologies and techniques. This allows the reader to attain an overview of the domain while understanding the advantages and drawbacks of the various methods. Choosing an appropriate solution does not boil down to just the application domain, but also to the particular requirements of the applications such as accuracy, computing time, equipment, and dynamic and static aspects (the properties of the objects contained in the environment). 3.2. Classification {#sec3dot2-sensors-20-02641} ------------------- Recent surveys in the indoor positioning domain have proposed various classifications. For instance, the survey of Yassin et al. \[[@B1-sensors-20-02641]\], which addressed the entire domain of indoor localization (not limited to vision based solutions), proposed a two-level classification. The first level grouped the solutions based on the positioning algorithms, which were divided into three classes: triangulation, scene analysis, and proximity detection. The second level classified the solutions within the first level classes based on the measurement techniques as follows: the triangulation class had two sub-classes: lateration and angulation; the scene analysis class had only one sub-class: fingerprinting based; and the proximity detection class had two sub-classes: cell-ID and RFID. Another general survey in indoor localization \[[@B10-sensors-20-02641]\] classified existing research solutions into local infrastructure dependent techniques (ultra-wideband, wireless beacons), local infrastructure independent techniques (ultrasound, assisted global navigation satellite systems, magnetic localization, inertial navigation systems, visual localization, infrared localization), and visual/depth sensors (structured light technology, pulsed light technology, stereo cameras). Mendoza-Silva et al. \[[@B9-sensors-20-02641]\] presented a meta-review of indoor positioning systems, resulting from the analysis of 62 indoor localization-related surveys. They reviewed the most commonly used technologies for localization applications and proposed the following classes: light, computer vision, sound, magnetic fields, dead reckoning, ultra-wideband, WiFi, Bluetooth Low Energy, RFID, and Near-Field Communication (NFC). In the computer vision class, they discussed several positioning techniques, such as visual odometry and vision based SLAM, and mentioned different acquisition devices (monocular, stereo, omnidirectional). However, they did not propose any classification for this domain. They also observed the complete lack of recent surveys on computer vision based indoor localization solutions and claimed the necessity of such a work. Analyzing the research papers mentioned in the previous section, several discriminating characteristics emerged. Therefore, we propose a new classification of computer vision based indoor localization solutions, as illustrated in [Figure 3](#sensors-20-02641-f003){ref-type="fig"}. All indoor positioning methods have a configuration stage, in which the environment is filled with landmarks and sensors, images from the environment are saved into a database, or a 3D representation of the indoor space is created. Therefore, environment data could consist of information about the position of the markers (e.g., QR codes, geometric synthetic identifiers) or the location of the static cameras placed within the scene. Another type of environment data is represented by databases with images or features from images, annotated with position and orientation information. Lastly, environment data could consist of a 3D model of the environment, a point cloud, a 3D mesh, or a 3D map, obtained with various methods such as manual modeling, SLAM, or SfM. Another element that helps discriminate between methods is the type of employed sensing devices. As previously mentioned in [Section 1](#sec1-sensors-20-02641){ref-type="sec"} and illustrated in [Figure 1](#sensors-20-02641-f001){ref-type="fig"}, the main acquisition devices are static and mobile cameras. Furthermore, the input information can be enriched with data from other sensors, such as WiFi access points or IMU devices. Another differentiating aspect of image based localization methods is the type of visual input, which can be either 2D or 3D. The localization methods can search for artificial markers (e.g., QR codes and other fiducial markers such as AprilTags \[[@B66-sensors-20-02641]\], ARTags, and CALTags \[[@B8-sensors-20-02641]\]) or for features from the real environment. The latter category includes any type of element that can be extracted from the real environment (without the need to insert synthesized items into the scene), either features of interest such as Speeded Up Robust Features (SURF) and Scale-Invariant Feature Transform (SIFT) or semantic objects. Therefore, we propose a new level of classification, namely the *detected elements*, which refers to the type of features (artificial markers or natural, real elements from the environment) that are tracked or matched within the images. Indoor positioning solutions employ various localization methods, which range from low-level feature matching to complex scene understanding. We divided the techniques into traditional image analysis and artificial intelligence. The ones belonging to the second category include any type of artificial intelligence, such as Bayesian approaches, Support-Vector Machine (SVM), and neural networks. We applied the proposed classification to the selected indoor localization solutions. [Table 1](#sensors-20-02641-t001){ref-type="table"} assigns each of the chosen research papers to a class, based on environment data, sensing devices, detected elements, and localization method. Out of all the classes that could result from combining the differentiating elements from [Figure 3](#sensors-20-02641-f003){ref-type="fig"}, we chose only 17 of the more popular ones, which were represented by a large number of research papers. The following sub-sections analyze each category, presenting representative indoor localization solutions and discussing their advantages and drawbacks. For each examined scientific paper, we include in [Table 2](#sensors-20-02641-t002){ref-type="table"}, [Table 3](#sensors-20-02641-t003){ref-type="table"}, [Table 4](#sensors-20-02641-t004){ref-type="table"}, [Table 5](#sensors-20-02641-t005){ref-type="table"}, [Table 6](#sensors-20-02641-t006){ref-type="table"}, [Table 7](#sensors-20-02641-t007){ref-type="table"}, [Table 8](#sensors-20-02641-t008){ref-type="table"}, [Table 9](#sensors-20-02641-t009){ref-type="table"}, [Table 10](#sensors-20-02641-t010){ref-type="table"}, [Table 11](#sensors-20-02641-t011){ref-type="table"}, [Table 12](#sensors-20-02641-t012){ref-type="table"}, [Table 13](#sensors-20-02641-t013){ref-type="table"}, [Table 14](#sensors-20-02641-t014){ref-type="table"}, [Table 15](#sensors-20-02641-t015){ref-type="table"}, [Table 16](#sensors-20-02641-t016){ref-type="table"}, [Table 17](#sensors-20-02641-t017){ref-type="table"} and [Table 18](#sensors-20-02641-t018){ref-type="table"} information about the characteristics of the datasets used for evaluation, the computing time or refresh rate (related to a certain running platform), and the achieved accuracy. If there were papers that did not report information about a certain characteristic, the field corresponding to that characteristic is marked with "-". Some papers evaluated their solutions only visually, while others applied various metrics, such as average and/or absolute errors for position and orientation, percentage of tested cases when accuracy was within certain intervals, Detection Success Rate (DSR), Root Mean Squared Error (RMSE), Navigation Success Rate (NSR), Relative Pose Error (RPE), and Absolute Trajectory Error (ATE). ### 3.2.1. Indoor Localization Solutions with 2D Static Cameras, Markers, and Traditional Image Analysis {#sec3dot2dot1-sensors-20-02641} This class of indoor localization methods uses an infrastructure of 2D static cameras with known locations. The images from these cameras are processed with traditional computer vision algorithms in order to detect synthetic identifiers carried by people or robots. Belonging to this class is the work of Heya et al. \[[@B31-sensors-20-02641]\], where the screen of the user's smartphone was detected with a simple color tracking algorithm. Each user was assigned a color, which was displayed on the smartphone, and the system tracked the screen of the device, which was placed on the user's shoulder. Another example of indoor localization solution using static 2D cameras and traditional image processing was an ambient navigation system proposed by Chaccour and Badr \[[@B32-sensors-20-02641]\], which detected the users' location and orientation based on markers located on their heads. The system was evaluated within a home composed of three rooms, kitchen, living room, and bedroom, each containing an IP camera placed on the ceiling. The tests performed with eight people, including dynamically added obstacles, proved the reliability of the system. The methods in this class require the map of the building and a configuration step that consists of annotating the positions of the static cameras on the map. They can achieve good, centimeter-level, accuracy, as can be seen in [Table 2](#sensors-20-02641-t002){ref-type="table"}, which makes them viable solutions for scenarios requiring high accuracy positioning in small spaces. However, maintaining this accuracy level in large indoor spaces comes with high costs in terms of both effort and infrastructure, due the cumbersome configurations and the high number of cameras required. ### 3.2.2. Indoor Localization Solutions with 2D Static Cameras, Real Features, and Traditional Image Analysis {#sec3dot2dot2-sensors-20-02641} In this class of indoor localization solutions, the images from the static cameras are processed with traditional computer vision algorithms in order to track objects or people and compute their positions within a certain room. Localization solutions within this class identify people or robots without the need for the tracked entities to carry devices or artificial markers. Bo et al. \[[@B67-sensors-20-02641]\] recursively updated the position of multiple people based on the detected foreground and the previous known locations of each person. The foreground was identified by analyzing changes in image structure (edges) based on the computation of the normalized cross-correlation for each pixel. They applied a greedy algorithm to maximize the likelihood of observing the foreground for all people. The efficiency of their algorithm was evaluated on public datasets, using the Multiple Object Tracking Accuracy (MOTA), a metric computed based on object misses, false positives, and mismatches. Shim and Cho \[[@B69-sensors-20-02641]\] employed a homography technique to create a 2D map with accurate object position, using several surveillance cameras. Dias and Jorge \[[@B68-sensors-20-02641]\] tracked people using multiple cameras and a two level processing strategy. Firstly they applied region extraction and matching to track people, and secondly, they fused the trajectories detected from multiple cameras in order to obtain the positions relative to a global coordinate system, using homography transformations between image planes. Sun et al. \[[@B60-sensors-20-02641]\] proposed a device-free human localization method using a panoramic camera. They employed pre-processing, human detection with background subtraction (with mean filtering and a Gaussian low pass filtering), and an association between the location of users in the image space and their location on a given map of the indoor environment. Compared to the previous class of solutions that use artificial markers, the methods in this class have slightly higher localization errors, as can be observed in [Table 3](#sensors-20-02641-t003){ref-type="table"}. However, this accuracy level (tens of centimeters) is still good for many types of applications, and these methods have a wider applicability, especially in the monitoring and surveillance domains, due to them not requiring the tracked entities to carry devices or markers. ### 3.2.3. Indoor Localization Solutions with 2D Static Cameras, Real Features, and Artificial Intelligence {#sec3dot2dot3-sensors-20-02641} This class of indoor localization methods differs from the class described in [Section 3.2.2](#sec3dot2dot2-sensors-20-02641){ref-type="sec"} by the type of employed algorithms for determining the entities' positions. An alternative to traditional image processing algorithms is artificial intelligence, in the form of Bayesian approaches, SVM, or neural networks. For instance, Utasi and Benedek \[[@B70-sensors-20-02641]\] proposed a Bayesian method for people localization in multi-camera systems. First, pixel-level features were extracted, providing information about the head and leg positions of pedestrians. Next, features from multiple camera views were fused to compute the location and the height of people with a 3D Marked Point Process (MPP) model, which followed a Bayesian approach. They evaluated their method on two public datasets and used the Ground Position Error (GPE) and Projected Position Error (PPE) metrics for accuracy computation. Cosma et al. \[[@B73-sensors-20-02641]\] described a location estimation solution based on 2D images from static surveillance cameras, which used pose estimation from key body points' detection to extend the pedestrian skeleton in case of occlusion. It achieved a location estimation accuracy of approximately 45 cm, as can be observed in [Table 4](#sensors-20-02641-t004){ref-type="table"}, in complex scenarios with a high level of occlusion, using a power efficient embedded computing device. See-your-room \[[@B74-sensors-20-02641]\] represents another localization solution that uses cameras placed on the ceiling. It employs Mask R-CNN and OpenPose \[[@B128-sensors-20-02641]\] to detect people and their pose (standing, sitting) and the perspective transformation to obtain the position of the users on a map. Hoyer et al. \[[@B71-sensors-20-02641]\] presented a localization framework for robots based on Convolutional Neural Networks (CNN) using static cameras. In a first stage, they used a CNN object detection to estimate the type and the bounding box of a robot. In the second stage, they ran two more neural networks, one for computing the orientation of the robot and another one to provide identification (based on a code placed on the robot). An algorithm was also proposed for generating synthetic training data by placing contour-cropped images of robots on background images. The solution described by Jain et al. \[[@B72-sensors-20-02641]\] was based on the assumption that, in an office, employees tend to keep their phones lying on the table and that the ceiling layout is unique throughout the building, containing different tiles. They used a combination of artificial intelligence and traditional image processing to detect landmarks such as ceiling tiles, heating or air conditioning vents, lights, sprinklers, audio speakers, or smoke detector sensors. First, they applied the Hough transform to extract tiles, then SURF for feature extraction, and SVM to classify the type of landmark with the ECOCframework \[[@B129-sensors-20-02641]\]. [Table 4](#sensors-20-02641-t004){ref-type="table"} presents the characteristics of the localization methods that use 2D static cameras, real features, and artificial intelligence based algorithms. The computational challenge of using neural networks or other AI based implementations can be met with the use of GPUs, as can be observed for several methods \[[@B71-sensors-20-02641],[@B73-sensors-20-02641]\], which achieve interactive or real-time performance. Although a higher complexity of the algorithms would lead to expecting a higher accuracy level compared to the previous class of solutions, relevant accuracy comparisons cannot be made due to the evaluations being performed on different datasets/scenarios. ### 3.2.4. Indoor Localization Solutions with 2D Mobile Cameras, Markers with Known Positions, and Traditional Image Analysis {#sec3dot2dot4-sensors-20-02641} This class of indoor localization solutions employs a configuration step, in which artificial landmarks, predominantly QR codes, are placed at known locations inside a building (generally on the ceiling, walls, or floor). These solutions make use of cameras attached to people or robots and apply traditional image processing during the localization stage. Each QR image codifies its position within the coordinate system of the building. Based on the appearance of the QR code in the acquired images during the localization stage, compared to the raw images of the QR codes, the orientation of the camera can also be estimated by computing the projective transform matrices. QR codes allow for fast detection and decoding of stored information. However, in cases where the video camera is moving fast, the detection of these codes can be difficult. This led Lee et al. \[[@B75-sensors-20-02641]\] and Goronzy et al. \[[@B76-sensors-20-02641]\] to surround their codes with simple borders such as circles or rectangles, which can be detected faster than QR codes with Hough transform. Ooi et al. \[[@B79-sensors-20-02641]\] used QR codes to reposition mobile sensor networks, in the form of four wheeled robots. When QR codes were not in range, the system estimated the position of the robot using dead reckoning. Lightbody et al. \[[@B78-sensors-20-02641]\] proposed WhyCode, a new family of circular markers that enable faster detection and pose estimation, of up to two orders of magnitude compared to other popular fiducial marker based solutions. They extended the WhyCon algorithm \[[@B130-sensors-20-02641]\], which localizes a large number of concentric black and white circles with adaptive thresholding, flood fill, and a circularity test. The position of a marker, along with the pitch and roll, was estimated based on eigenvalues with a method proposed by Yang et al. \[[@B131-sensors-20-02641]\]. The yaw was computed by detecting the Necklace code contained in the WhyCode marker. Benligiray et al. \[[@B80-sensors-20-02641]\] presented STag, a fiducial marker system that used geometric features to provide stable position estimation. The markers contained an inner circular border and an outer square border used for detection and homography estimation. They compared their detection capabilities against the ARToolkit, ArUco \[[@B132-sensors-20-02641]\], and RUNE-Tag \[[@B133-sensors-20-02641]\] fiducial markers. Khan et al. \[[@B81-sensors-20-02641]\] proposed a generic approach for indoor navigation and pathfinding using simple markers (ARToolkit) printed on paper and placed on ceilings. The orientation of the smartphone relative to a marker enabled the computation of the user's direction along a certain path. As can be observed in [Table 5](#sensors-20-02641-t005){ref-type="table"}, the performance of these methods is quite impressive. The centimeter or even sub-centimeter level position accuracy is achieved due to the precise matching mechanism when dealing with synthesized images. The fast detection and decoding of QR codes and fiducial markers enables real-time applications. Compared to the previously presented static camera based solutions, even though deploying such a system in a large built environment also comes with a considerable effort in the configuration stage, it is significantly less expensive (artificial markers are practically free in comparison to static cameras). However, the tracked entity is required to carry a mobile camera, which in certain scenarios can represent an inconvenience, and mapping a building with artificial images can have a negative impact on the building's appearance. Another important aspect when choosing marker based localization solutions is their detection success when facing occlusion. This problem was addressed in the solution proposed by Garrido-Jurado et al. \[[@B132-sensors-20-02641]\], which combined multiple markers with an occlusion mask computed by color segmentation. Sagitov et al. \[[@B8-sensors-20-02641]\] compared three fiducial marker systems, ARTag, AprilTag, and CALTag, in the presence of occlusion, claiming that CALTags showed a significantly higher resistance for both systematic and arbitrary occlusions. ### 3.2.5. Indoor Localization Solutions with 3D Mobile Cameras, Markers with Known Positions, and Traditional Image Analysis {#sec3dot2dot5-sensors-20-02641} Localization based on fiducial markers can also be performed by analyzing RGB-D images with traditional image processing methods. Li et al. \[[@B82-sensors-20-02641]\] used RGB-D images in order to detect and recognize QR landmarks with the Zbar \[[@B135-sensors-20-02641]\] code reader. The distance to the QR code was computed based on the depth image. Dutta \[[@B83-sensors-20-02641]\] proposed a real-time application for localization using QR codes from RGB-D images, based on the keystone effect in images from range cameras (the apparent distortion of an image caused by projecting it onto an angled surface). Some solutions achieve centimeter accuracy when computing the distance from the camera to the artificial marker (see [Table 6](#sensors-20-02641-t006){ref-type="table"}). These solutions are very practical, since 3D cameras already offer a depth map of the environment, allowing for a faster and less complex computation of the position in a 3D coordinate system. However, as can be observed in [Section 3.2.4](#sec3dot2dot4-sensors-20-02641){ref-type="sec"}, detection and pose computation for markers is very fast for 2D cameras as well, due to the geometric properties of the synthetic images. Therefore, using 3D cameras could represent an unnecessary excess of resources. Furthermore, RGB-D cameras usually have a lower resolution than RGB cameras, both for the color and depth maps. Thus, their use is rarely justified for marker based solutions. ### 3.2.6. Indoor Localization Solutions with 2D Cameras + Other Sensors, Markers with Known Positions, and Traditional Image Analysis {#sec3dot2dot6-sensors-20-02641} Synthetic identifiers represent a very powerful tool when estimating the subject's position and orientation in indoor scenarios. However, the use of other sensors, such as inertial sensors, WiFi, or beacons, could enrich the information, thus increasing the accuracy, or could help reduce the number of necessary synthetic landmarks. Nazemzadeh et al. \[[@B37-sensors-20-02641]\] proposed a localization solution for unicycle-like wheeled robots, using Zbar and OpenCV to detect QR codes that were placed on the floor. They applied an Extended H-Infinity Filter (EHF) to compute the odometry based on dead reckoning and on a gyroscope platform. Babu and Markose \[[@B36-sensors-20-02641]\] also invoked dead reckoning with accelerometer and gyroscope information, increasing the accuracy of their QR based localization solution. Gang and Pyun \[[@B84-sensors-20-02641]\] configured the indoor space, in an offline phase, by creating a fingerprint map with the RSSI of the beacon signals and the intensity of the geomagnetic field at each reference point. In the localization stage, they combined the information from the beacons and the inertial sensors with the coordinates extracted from QR codes, obtaining an accuracy of approximately 2 m, as can be observed in [Table 7](#sensors-20-02641-t007){ref-type="table"}. The use of other sensors besides cameras can add many benefits to a localization solution, especially if there is no need to acquire supplementary equipment. This is the case for WiFi access points, already installed in a building for other purposes. However, most of the WiFi localization solutions are based on the WiFi fingerprinting procedure, a manual and cumbersome configuration stage in which the signal strengths of the access points are recorded for known locations on the map of the building. Since smartphones have become very popular and their cameras have reached impressive capabilities, they can be successfully used as acquisition devices in computer vision based localization solutions. Another advantage of using a smartphone is represented by the built-in inertial sensors. Thus, an application that combines input from the camera and the inertial sensors of a smartphone does not require equipment that is not already owned by the users. ### 3.2.7. Indoor Localization Solutions with Real Image/Feature Databases, 2D Mobile Cameras, and Traditional Image Analysis {#sec3dot2dot7-sensors-20-02641} Using a database of real images or features from real images of the environment in localization solutions represents an alternative to decorating the indoor space with QR codes or other synthesized images. In a configuration stage, images or features, labeled with location and orientation information, are stored in a database. For instance, Hu et al. \[[@B85-sensors-20-02641]\] obtained a panoramic video of the scene, which was processed with traditional computer vision algorithms for computing omni-projection curves. Bai et al. \[[@B86-sensors-20-02641]\] constructed a landmark database by using a laser distance meter to measure the distance between the location of the camera and selected landmarks. In the localization stage, the images acquired with the mobile camera were compared with the ones from the database using feature matching algorithms such as SIFT, SURF, or ORB. The processing time in this stage is highly affected by the number of images/features in the database, which must be compared against the images from the mobile camera's video flow. The first line of [Table 8](#sensors-20-02641-t008){ref-type="table"} is a good example, as it shows that running the localization algorithm with a database of 1000 frames was eight times faster than with a database of 8000 frames. To reduce the processing time, Elloumi et al. \[[@B87-sensors-20-02641]\] limited the similarity search of two images to only a selection of areas within the images, thus reducing the number of features by 40%. These areas were considered to contain the most important characteristics and were selected based on a metric that combined orientation, color, intensity, flickering effects, and motion. Compared to solutions that use artificial markers, the solutions in this class do not require decorating the indoor space with visual markers, thus not affecting the aesthetics of the indoor space. Although they have a higher localization error (few meters), this error level can still be acceptable for certain applications. ### 3.2.8. Indoor Localization Solutions with Real Image/Feature Databases, 2D Mobile Cameras, and Artificial Intelligence {#sec3dot2dot8-sensors-20-02641} Artificial intelligence includes a plethora of localization algorithms for systems that use mobile cameras. For instance, Lu et al. \[[@B89-sensors-20-02641]\] proposed a multi-view regression model to determine the location and orientation of the user accurately. Xiao et al. \[[@B90-sensors-20-02641]\] determined the location of a smartphone, based on the detection of static objects within images acquired with the smartphone's cameras. Faster-RCNN was used for static object detection and identification. Another deep CNN, Convnet, was used in the localization system proposed by Akal et al. \[[@B91-sensors-20-02641]\]. This network uses compound images from four non-overlapping monocular images placed on a ground robot, achieving centimeter accuracy, but requiring a sizeable dataset of compound images for training. As can be observed in [Table 9](#sensors-20-02641-t009){ref-type="table"}, the machine learning based solutions achieved interactive computing times or even real-time performance and a localization accuracy of under one meter to tens of centimeters. These solutions seemed to have better accuracy performance compared to the solutions in the previous class, while benefiting from the same advantages of not requiring deploying visual markers in the indoor space. ### 3.2.9. Indoor Localization Solutions with Real Image/Feature Databases, 3D Mobile Cameras, and Artificial Intelligence {#sec3dot2dot9-sensors-20-02641} Another class of indoor localization methods uses RGB-D images acquired with mobile cameras that are processed with the help of CNN. Guo et al. \[[@B92-sensors-20-02641]\] used a CNN (PoseNet network) for exploiting the vision information and the long short-term memory network for incorporating the temporal information. Zhang et al. \[[@B63-sensors-20-02641]\] applied visual semantic information for performing indoor localization. A database with object information was constructed using Mask-RCNN, extracting the category and position for each object. Then, using the SURF descriptor, keypoints of the recognized objects were detected. Furthermore, CNN features were obtained using a pre-trained ResNet50 network. The visual localization was performed in two steps: the most similar key frames were obtained using the selected CNN features; the bundle adjustment method \[[@B137-sensors-20-02641]\] was used to estimate the matrix between the current image and candidate frames. Both methods were tested on public datasets. Localization results were within 0.3 m and 0.51 m (as shown in [Table 10](#sensors-20-02641-t010){ref-type="table"}). 3D cameras give access to a depth map of the environment, either through built-in algorithms, as in the case of structured light or time-of-flight devices, or through stereo matching algorithms that have multiple implementations, available to the public. However, these cameras come with various limitations. For instance, the estimation of the depth map with stereo cameras in the case of untextured surfaces (such as white walls) is very inaccurate. Furthermore, structured light and time-of-flight depth cameras cannot estimate the distance to reflective surfaces or in case of sunlit environments. Moreover, although 3D cameras have gained popularity, they are not as common as 2D cameras, and therefore, their applicability is reduced. While localization solutions with 2D mobile cameras can be easily deployed, using generally available smartphones, 3D cameras are more appropriate for specialized applications, in areas like assistive devices or autonomous robots. ### 3.2.10. Indoor Localization Solutions with Real Image/Feature Databases, 2D Cameras + Other Sensors, and Traditional Image Analysis {#sec3dot2dot10-sensors-20-02641} If WiFi signals, inertial sensors, beacons, or other sensors can increase the accuracy of marker based localization solutions or can help reduce the number of synthesized images that should be placed on the ceiling/floor/walls of the building (as discussed in [Section 3.2.6](#sec3dot2dot6-sensors-20-02641){ref-type="sec"}), a hybrid approach can be even more useful when dealing with natural features from the environment. Acquiring additional information from various sensors can help reduce the search space in the image matching stages. Yan et al. \[[@B94-sensors-20-02641]\] also used WiFi information to increase the accuracy and improve the processing time of a natural feature extraction algorithm, which combined Features from Accelerated Segment Test (FAST) with SURF. Marouane et al. \[[@B93-sensors-20-02641]\] used accelerometer data for step counting and gyroscope information for orientation and transformation of images into histograms for more efficient image matching. Rotation invariance was achieved by adding the perspective transformation of two planes. Another solution that used inertial sensors was the one proposed by Huang et al. \[[@B95-sensors-20-02641]\]. They applied the vanishing points method and indoor geometric reasoning, taking advantage of rules for 3D features, such as the ratio between width and height, the orientation, and the distribution on the 2D floor map. Arvai and Dobos \[[@B96-sensors-20-02641]\] applied the perspective-n-point algorithm to estimate the user's position inside the 2D floor-plan of a building, relative to a series of landmarks that were placed in the configuration stage. They used an extended Kalman filter to estimate the position by combining visual and inertial information. [Table 11](#sensors-20-02641-t011){ref-type="table"} presents the characteristics of indoor localization solutions that combine data from 2D cameras and other sensors, estimating the position and orientation of the subject with traditional image processing. Several such solutions achieved centimeter location accuracy, due to this fusion between images and information from inertial sensors, WiFi signals, RFID devices, or beacons. However, this fusion of data from several sensors brings a computational load. ### 3.2.11. Indoor Localization Solutions with Real Image/Feature Databases, 2D Cameras + Other Sensors, and Artificial Intelligence {#sec3dot2dot11-sensors-20-02641} The solutions based on the detection of objects or markers from RGB images offer a relative position and orientation estimation, but are unreliable when markers or objects are not visible. Furthermore, detection is influenced by camera exposure time. Thus, images combined with data from other sensors can increase the precision of the localization. Rituerto et al. \[[@B97-sensors-20-02641]\] estimated the user's location using values acquired from inertial sensors combined with computer vision methods applied on RGB images. The particle filtering method was used for combining all these data. A map with walls, corridors, and rooms and some important signs (such as exit signs and fiducial markers) was also considered. Neges et al. \[[@B98-sensors-20-02641]\] combined an IMU step based counter with video images for performing indoor localization. IMU data were used to estimate the position and orientation of the mobile device, and different semantic objects were extracted from the video (e.g., exit signs, fire extinguishers, etc.) for validation of the obtained position. The recognition of different markers was achieved using Metaio SDK \[[@B140-sensors-20-02641]\], a machine learning based development tool. In Sun et al. \[[@B99-sensors-20-02641]\], RSS samples, surveillance images, and room map information were used for performing indoor localization. People were detected using background subtraction from images acquired with a camera placed on the ceiling of the room. The foreground pixel that was the nearest to the location of the camera would approximate the person position in the image. Then, this position was mapped to a localization coordinate using a multi-layer neural network (with three layers). The iStart system \[[@B100-sensors-20-02641]\] combines WiFi fingerprints and RGB images for indoor localization. The system proposed by Zhao et al. \[[@B101-sensors-20-02641]\] was based on a combination of CNN with a dual-factor enhanced variational Bayes adaptive Kalman filter. Channel State Information (CSI) was extracted from an MIMO-OFDM PHY layer as a fingerprint image to express the spatial and temporal features of the WiFi signal. CSI features were learned with a CNN inspired by the AlexNet network obtaining the mapping relationship between the CSI and the 2D coordinates. Results were processed with the Bayes adaptive Kalman filter in order to achieve noise attenuation. These methods were evaluated on their own datasets with good results (position accuracy of approximately 1 m), as shown in [Table 12](#sensors-20-02641-t012){ref-type="table"}. Even though artificial intelligence and especially deep convolutional networks have become very popular, they still come with certain limitations. First, they require a large amount of training data, usually manually annotated. Second, the training stage is both time consuming and hardware demanding. Even though in the online stage, the already trained network requires less resources, adding the complexity of fusing the visual data with information from other sensors can have a negative impact on the runtime, as can be observed for several selected papers \[[@B97-sensors-20-02641],[@B100-sensors-20-02641]\]. ### 3.2.12. Indoor Localization Solutions with Real Image/Feature Databases, 3D Mobile Cameras + Other Sensors, and Traditional Image Analysis {#sec3dot2dot12-sensors-20-02641} Localization precision can be increased by matching of RGB-D images using traditional feature descriptors combined with information obtained from an IMU sensor. In Gao et al. \[[@B102-sensors-20-02641]\], key points were extracted from the RGB-D images using an improved SIFT descriptor. Then, the RANSAC algorithm \[[@B141-sensors-20-02641]\] eliminated mismatched points from the matching pairs. Their corresponding depth coordinates were obtained from the depth images. Using this information, the rotation matrix and translation vector were computed from two consecutive frames. Furthermore, IMU data were used to eliminate the noise, improving the stability and positioning accuracy. Adaptive fading extended Kalman filter fused the position information of Kinect and IMU outputs. Furthermore, this fusion eliminated the noise and improved the stability and accuracy of the system. A similar idea was proposed by Kim et al. \[[@B103-sensors-20-02641]\]. Their solution generated 3D feature points using the SURF descriptor, which were next rotated using IMU data to have the same rigid body rotation component between two consecutive images. The RANSAC algorithm \[[@B141-sensors-20-02641]\] was used for computing the rigid body transformation matrix. [Table 13](#sensors-20-02641-t013){ref-type="table"} shows the dataset characteristics and obtained accuracy for the localization methods based on RGB-D images processed with traditional image analysis algorithms and sensor fusion. Since robots can be equipped with many sensors, including 3D cameras and inertial units, the solutions in this class have been successfully applied to the autonomous robots domain. ### 3.2.13. Indoor Localization Solutions with a 3D Model of the Environment, 2D Mobile Cameras, Real Features, and Traditional Image Analysis {#sec3dot2dot13-sensors-20-02641} Simultaneous Localization and Mapping is a very popular algorithm in several domains, such as autonomous robots or Augmented Reality. During recent years, various solutions to the problem of localization and mapping have been proposed. For instance, Endo et al. \[[@B29-sensors-20-02641]\] used LSD-SLAM for map construction, localization, and detection of obstacles in real time. Teixeira et al. \[[@B104-sensors-20-02641]\] used the pattern recognition SURF method to locate natural markers and reinitialize Davison's Visual SLAM \[[@B142-sensors-20-02641]\]. Several SLAM based solution use 3D cameras in the configuration stage, to create a 3D reconstruction of the environment, and then change the acquisition device to a monocular camera in the localization stage. Sinha et al. \[[@B105-sensors-20-02641]\] applied RGBD-SLAM on images acquired with Microsoft Kinect to reconstruct 3D maps of indoor scenes. In the localization stage, they used monocular images acquired with a smartphone camera and estimated the transformation matrix between frames using RANSAC on the feature correspondences. They applied SIFT or SURF for feature extraction, in order to detect landmarks, which were cataloged as sets of distinguished features regularly observed in the mapping environment, being stationary, distinctive, repeatable, and robust against noise and lighting conditions. Deretey et al. \[[@B106-sensors-20-02641]\] also applied RGBD-SLAM in an offline, configuration stage, to create 3D point clouds that contained intensity information. 2D features were extracted with a matching algorithm (SIFT, SURF or ORB), and then, a projection matrix of matched features between 2D images and 3D points was computed. A comparison with RGBD-SLAM was offered by Zhao et al. \[[@B109-sensors-20-02641]\], which used Kinect to collect the 3D environment information in a configuration stage. They also built a 2D map of the indoor scene with Gmapping, an ROS package that used Rao--Blackwellized Particle Filters (RBPF) \[[@B143-sensors-20-02641]\] to learn grid maps. In the online phase, they applied Monte Carlo localization based on the previously created 2D map. Ruotsalainen et al. \[[@B107-sensors-20-02641]\] performed Visual SLAM for tactical situational awareness by applying a Kalman filter to combine a visual gyroscope and a visual odometer. The visual gyroscope estimated the position and orientation of the camera by detecting straight lines in three orthogonal directions. The visual odometer computed the transformation of the camera from the motion of image points matched using SIFT in adjacent images. A similar approach, which took into account the structural regularity of man-made building environments and detected structure lines along dominant directions, was the solution proposed by Zhou et al. \[[@B108-sensors-20-02641]\]. They also applied an extended Kalman filter to solve the SLAM problem. Ramesh et al. \[[@B110-sensors-20-02641]\] combined imaging geometry, visual odometry, object detection with aggregate channel features, and distance-depth estimation algorithms into a Visual SLAM based navigation system for the visually impaired. A different approach was the one proposed by Dong et al. \[[@B111-sensors-20-02641]\], which reused a previous traveler's (leader) trace experience to navigate future users or followers. They used ORB features for the mobile Visual SLAM. To combat environmental changes, they culled non-rigid contexts and kept only the static contents in use. SLAM based approaches can attain centimeter or even millimeter location accuracy, but at a high computational cost. They also require significant memory resources to store the 3D representation of the scene. [Table 14](#sensors-20-02641-t014){ref-type="table"} presents the characteristics of some solutions that create a 3D reconstruction of the environment in an offline stage, acquire images with a monocular camera in the localization stage, and perform low-level image processing to estimate the position and orientation of the user/robot. ### 3.2.14. Indoor Localization Solutions with a 3D Model of the Environment, 2D Mobile Cameras, Real Features, and Artificial Intelligence {#sec3dot2dot14-sensors-20-02641} Artificial intelligence based 2D localization methods can also be applied on 3D representations of the space. Han et al. \[[@B112-sensors-20-02641]\] removed obstacles detected with the Mask-RCNN network to enhance the performance of the localization. It detected persons as potential obstacles and split these obstacles from the background. Then, ORB-SLAM2 \[[@B148-sensors-20-02641]\] was used for localization. Xiao et al. \[[@B113-sensors-20-02641]\] proposed Dynamic-SLAM for solving SLAM in dynamic environments. It was based on ORB-SLAM. First, a CNN was used for static or dynamic object detection. Then, applying a missed detection compensation algorithm based on the speed invariance from adjacent frames, the detection recall rate was improved. Finally, tracking was performed using ORB features extracted from each keyframe image for performing feature based visual SLAM by processing feature points of dynamic objects. The pose estimation was obtained by solving the perspective-n-point problem with the bundle adjustment method. [Table 15](#sensors-20-02641-t015){ref-type="table"} presents the characteristics of some solutions belonging to the current class. The neural networks introduce a high computational load, but can help not only with the localization, but also with the scene understanding problem. ### 3.2.15. Indoor Localization Solutions with a 3D Model of the Environment, 3D Mobile Cameras, Real Features, and Traditional Image Analysis {#sec3dot2dot15-sensors-20-02641} Several localization solutions use 3D cameras in the configuration step, as well as in the actual localization stage. For instance, Du et al. \[[@B114-sensors-20-02641]\] created an interactive mapping system that partitioned the registration of RGB-D frames into local alignment, based on visual odometry, and global alignments, using loop closure information to produce globally consistent camera poses and maps. They combined RANSAC inlier count with visibility conflict in the three point matching algorithm to compute 6D transformations between pairs of frames. Paton and Kosecka \[[@B115-sensors-20-02641]\] applied feature extraction and mapping on RGB-D data with SIFT, motion estimation and outlier rejection with RANSAC, and estimation refinement to compute the position and orientation of a camera. Correspondences established between SIFT features could initialize a generalized Iterative Closest Point (ICP) algorithm. Salas-Moreno et al. \[[@B116-sensors-20-02641]\] proposed a GPGPUparallel 3D object detection algorithm and a pose refinement based on ICP. Their real-time incremental SLAM was designed to work even in large cluttered environments. Prior to SLAM, they created a database of 3D objects with KinectFusion. The scene was represented by a graph, where each node stored the pose of an object with a correspondent entry in the database. Their object level scene description offered a huge representation compression in comparison with the usual reconstruction of the environment into point clouds. A robust key-frame selection from RGB-D image streams, combined with pose tracking and global optimization based on the depth camera model, vertex-weighted pose estimation, and edge-weighted global optimization, was described by Tang et al. \[[@B118-sensors-20-02641]\]. Most solutions acquire images with structured light or time-of-flight cameras, but stereo cameras can also provide 3D information. For instance, Albrecht and Heide \[[@B117-sensors-20-02641]\] acquired images with a stereo camera and applied ORB-SLAM2 for poses of the keyframes, creating a 3D reconstruction of the environment with OpenCV's Semi-Global Block Matching (SGBM) algorithm. Then, they condensed the point cloud into a blueprint-like map of the reconstructed building, based on ground and wall segmentation. Martin et al. \[[@B119-sensors-20-02641]\] applied Monte Carlo based probabilistic self-localization on a map of colored 3D points, organized in an octree. They demonstrated that their algorithm recovered quickly from cases of unknown initial position or kidnappings (the robot was manually displaced from one place of the environment to another). [Table 16](#sensors-20-02641-t016){ref-type="table"} presents the computing capabilities and obtained accuracy for several SLAM based localization solutions that apply low-level image processing on data that contain both color and depth information. It can be observed that some of the researchers evaluated their algorithms only through visual inspection. Even so, inspection of the obtained 3D reconstruction and especially loop closure can demonstrate the performance in the case of SLAM based solutions. This class is reduced to a 3D to 3D matching problem, much less complex than the 3D to 2D matching problem described in [Section 3.2.13](#sec3dot2dot13-sensors-20-02641){ref-type="sec"} and [Section 3.2.14](#sec3dot2dot14-sensors-20-02641){ref-type="sec"}. However, the requirement to have a 3D camera both in the configuration stage and in the online phase greatly reduces the applicability of this kind of solution. ### 3.2.16. Indoor Localization Solutions with a 3D Model of the Environment, 3D Mobile Cameras, Real Features, and Artificial Intelligence {#sec3dot2dot16-sensors-20-02641} Another class of indoor localization solutions is the one that uses 3D cameras in the configuration stage, to create a reconstruction of the scene with SLAM or other algorithms, but also in the localization stage, applying high level computer vision techniques for computing the position and orientation of the user. Guclu et al. \[[@B121-sensors-20-02641]\] proposed an SLAM method applied on RGB-D images using a graph based approach. The keyframe autocorrelogram database estimated motion between frames. Keyframes were indexed based on their image autocorrelograms \[[@B150-sensors-20-02641]\], using a priority search k-means tree. Adaptive thresholding was used to increase the robustness of loop closure detection. Kuang et al. \[[@B120-sensors-20-02641]\] improved ORB-SLAM. A combination between quasi-physical sampling algorithm (based on BING features \[[@B151-sensors-20-02641]\], obtained by SVM training) with depth information was used to pre-process an image for decreasing the computing time of the ORB algorithm. Then, improved KD-trees were used to increase the matching speed of the ORB algorithm. Furthermore, using RGB-D images, a 3D dense point cloud map system was constructed, instead of a sparse map from ORB-SLAM. As can be observed in [Table 17](#sensors-20-02641-t017){ref-type="table"}, the use of 3D cameras can improve the accuracy of known localization methods such as ORB-SLAM or ORB-SLAM2. Still, the dimensionality of the data introduces a high computational cost. Furthermore, the lack of 3D training data could represent a limitation of this class. ### 3.2.17. Indoor Localization Solutions with a 3D Model of the Environment, 2D Mobile Cameras + Other Sensors, Real Features, and Traditional Image Analysis {#sec3dot2dot17-sensors-20-02641} A hybrid approach that fuses information from 2D cameras and other sensors can be applied on 3D models of the environment as well. For instance, Wang et al. \[[@B46-sensors-20-02641]\] used RFID readers for an approximate estimation of the location and calculation of 3D image coordinates with low-level image matching. Kao and Huy \[[@B41-sensors-20-02641]\] combined information from WiFi access points with the K-nearest neighbor method, inertial sensors (accelerometer and gyroscope), and a CMOS camera. They chose ORB features in their SLAM implementation to navigate Bluetooth connected wheeled robots in indoor environments. Yun et al. \[[@B122-sensors-20-02641]\] saved the WiFi access point information in a configuration stage and assembled the images acquired with an Xtion PRO LIVE depth camera, building a 3D indoor map of the indoor location. In the localization stage, they reduced the per-frame computation by splitting a video frame region into multiple sub-blocks and processing only a sub-block in a rotating sequence at each frame. They applied SIFT based keypoint detection and optical flow for tracking. Huang et al. \[[@B95-sensors-20-02641]\] applied an extended Kalman filter to fuse data from LSD-SLAM computed on RGB images, ZigBee localization, and IMU sensors (accelerometer, gyroscope, and magnetometer). Ullah et al. \[[@B125-sensors-20-02641]\] combined data from a monocular visual SLAM and an IMU with an unscented Kalman filter. Gerstweiler \[[@B45-sensors-20-02641]\] also fused IMU information with SLAM, using the HyMoTrack framework \[[@B153-sensors-20-02641]\], a hybrid tracking solution that uses multiple clusters of SLAM maps and image markers, anchored in the 3D model. Chan et al. \[[@B124-sensors-20-02641]\] computed a laser based SLAM and a RBPF based visual SLAM. Perspective trajectories obtained from the laser SLAM were mapped into images, and the essential matrix between two sets of trajectories was combined with the monocular camera based SLAM. Even if the fusion between sensor data and visual information introduces a high computational load, several solutions achieve real-time frame rates on commodity computers, as can be observed in [Table 18](#sensors-20-02641-t018){ref-type="table"}. 3.3. Discussion {#sec3dot3-sensors-20-02641} --------------- This section draws conclusions from our analysis of the proposed classes of vision based localization solutions, enabling readers to make better informed choices in terms of indoor positioning technologies to accommodate their specific requirements or particularities. While positioning technologies are numerous and do not limit themselves to image processing, vision based solutions have become popular due to the increasing affordability of cameras and their integration in pervasive devices such as smartphones. Localization methods that use static cameras can benefit from the camera surveillance infrastructure already available in most modern large office and public buildings. Furthermore, since most robotic platforms have RGB or RGB-D cameras, it makes it easier to port visual positioning solutions on the different platforms, enabling their use in assisted living scenarios. Other applications in the autonomous robots domain can take advantage of 2D/3D cameras already integrated in the robots. Smart glasses with cameras can enable a more seamless user experience for indoor localization applications; however, until they reach a wide market adoption, most applications that localize people (especially in the domains of assistive devices and augmented reality) use smartphones. Even though 2D cameras have larger applicability due to their ubiquity and the dimensionality of the acquired data, 3D cameras have several advantages. 3D cameras offer a depth map of the environment, either obtained from a disparity map computed with stereo matching algorithms or estimated with time-of-flight and structured light technologies. Stereo cameras require optimal lighting conditions and are affected by lens distortion, similar to 2D cameras. Furthermore, depth cannot be estimated in untextured environments through stereo matching. On the other hand, structured light and time-of-flight cameras work even in unlit environments and can estimate the depth regardless of texture properties. Although these cameras are affected by bright light and reflective surfaces, typical indoor environments contain untextured surfaces (especially uniformly painted walls) and are rarely characterized by bright sunlight. Therefore, we considered that among 3D cameras, structured light, and time-of-flight devices are the most suited for indoor applications. While cameras have many advantages, they are affected by lighting conditions, occlusion, and position changes of objects from the environment. In order to increase localization accuracy or to decrease the computational load of the computer-vision algorithms, visual data can be combined with data from other sensors. Other popular indoor localization solutions are those based on sensors such as WiFi, beacons, and RFID. WiFi based solutions use the received signal strength and the media access control address of access points to determine the position. WiFi based methods also enjoy the advantage of using existing infrastructure in buildings, as WiFi access points are even more widely available in buildings than camera surveillance systems. While beacon based positioning technologies can reach higher accuracy than WiFi based solutions, they require deploying additional hardware. The RFID technology poses even more limitations in terms of range. Although the positioning algorithms that use sensors such as WiFi, beacons, or RFID have a lower accuracy compared to vision based methods, they also have a lower complexity. Thus, possible localization solutions can benefit from a two-step positioning algorithm: firstly obtaining a quick, approximate location using beacons or WiFi, which tightens the search space of computer vision algorithms; secondly achieving an accurate and also quick location and orientation estimation of the tracked entity. Vision based indoor localization solutions can detect fiducial markers or features from real images of the environment. The use of artificial markers enables extremely fast detection and position estimation. Due to the geometric properties of the fiducial markers and their accurate localization with 2D cameras, the use of 3D cameras is unjustified. The biggest disadvantage of using markers is the requirement of covering the space with synthetic images, which can have a negative visual impact on the environment. Therefore, the applicability of such solutions is reduced. Features or semantic objects detected from real images of the environment do not visually influence the environment. However, setting up a database of features/images, annotated with position and orientation information, or creating a 3D model of the environment represent cumbersome processes. Furthermore, changes in the environment, such as rearranging furniture or paintings and posters, would require another configuration stage for rebuilding the feature/image database or the 3D model of the scene. Objects or features from images can be detected using traditional image processing or artificial intelligence methods. Traditional image processing methods perform detection by comparing different features that are extracted from the images, and the recognition success depends on the selected features. On the other hand, the artificial intelligence methods used for object recognition are mainly based on convolutional neural networks, thus not needing to select the features for recognizing objects, as convolutional neural networks learn specific objects directly from images. One disadvantage of these networks is the high number of images required for training the network. Training data can be obtained either by manual acquisition and annotation or from publicly available datasets. Public datasets are very helpful; however, they are only a few available (especially containing 3D data), and they are limited to several semantic classes. 4. Benchmarks {#sec4-sensors-20-02641} ============= The evaluation methods used for the indoor localization solutions presented in this paper differ. Some are based on visual inspection, some on testing the solutions in certain scenarios or testbeds, and some on using public datasets. This section presents benchmarks created for evaluating localization methods. They can differ based on the input information, which consists of monocular or RGB-D images and WiFi, along with other sensor readings. Some testbeds are designed with the purpose of evaluating only the location and orientation accuracy, while others can also evaluate the correctness of 3D reconstructions in SLAM based methods. Several research papers released to the public a series of datasets and evaluation tools \[[@B139-sensors-20-02641],[@B155-sensors-20-02641],[@B156-sensors-20-02641]\], while others proposed reference systems that can be used for testing the accuracy of localization solutions \[[@B157-sensors-20-02641]\], the latter enabling fair comparisons of existing localization systems in similar conditions \[[@B158-sensors-20-02641],[@B159-sensors-20-02641],[@B160-sensors-20-02641]\]. Sturm et al. \[[@B139-sensors-20-02641]\] proposed a benchmark for the evaluation of RGB-D SLAM based localization solutions. The TUM dataset and this benchmark represent a popular testing tool. This is noticeable in the tables in [Section 3](#sec3-sensors-20-02641){ref-type="sec"}. The database consists of images acquired with a Kinect sensor, containing both color and depth information, at a resolution of $640 \times 480$. They provide ground truth trajectories that are computed with a motion-capture system composed of eight cameras that acquire images at 100 Hz. These sequences cover a variety of cases, from short to long trajectories, with or without loop closure. Their benchmark offers automatic evaluation tools to assess the drift of visual odometry solutions, as well as the global pose error of SLAM based methods. Another popular benchmark, which contains the ICL-NUIM dataset, was provided by Handa et al. \[[@B138-sensors-20-02641]\]. The database consists of RGB-D frames within synthetically generated scenes with the point of view of handheld cameras. It contains ground truth camera poses and surface models, which enable not only the evaluation of localization solutions, but also of the surface reconstruction accuracy of SLAM based methods. Sun et al. \[[@B155-sensors-20-02641]\] proposed a dataset for evaluating computer vision based localization solutions that compute the pose of a 2D camera with respect to a 3D representation of the scene. Their database contained training data acquired with cameras and a LiDAR scanner, which measured the distance to a target by illuminating it with a laser light and computing the difference in return times for the reflected light. The LiDAR point clouds were used as a reference in a semi-automatic localization workflow that estimated the camera pose with six degrees of freedom. They compared this dataset with several image based localization datasets produced with the SfM algorithm \[[@B136-sensors-20-02641],[@B161-sensors-20-02641],[@B162-sensors-20-02641]\], claiming the creation of a point cloud with much higher density and precision. EgoCart \[[@B156-sensors-20-02641]\] is another benchmark dataset, comprising of almost 20,000 RGB-D images, annotated with information of the camera position and orientation. The authors made the dataset public, along with the evaluation (in terms of accuracy, computing time, and memory requirements) of various machine learning based localization solutions \[[@B163-sensors-20-02641],[@B164-sensors-20-02641],[@B165-sensors-20-02641],[@B166-sensors-20-02641]\]. Schmitt et al. \[[@B157-sensors-20-02641]\] presented an indoor localization system that relied on visual information provided by two Microsoft Kinect devices and on wheel-odometry data acquired with a Roomba robot. Within the ROS framework, they enhanced a pre-drawn floor plan with SLAM, achieving an average error of 6.7 cm for the position estimation. The authors claimed that the accuracy was sufficient to use the system as a reference, when testing the performance of other systems. Their robot could carry the components of the system under test and collect data, without interfering with the localization process. Ibragimov and Afanasyev \[[@B158-sensors-20-02641]\] analyzed the feasibility of using different visual SLAM based localization methods for robot systems in homogeneous indoor spaces. Their evaluation testbed was built with a monocular camera, a LiDAR sensor, a ZEDstereo camera, and a Kinect device. LIDAR based HECTORSLAM and a tape measure are considered ground truth for comparing trajectories obtained with ORB-SLAM \[[@B152-sensors-20-02641]\], Dense Piecewise Parallel Tracking and Mapping (DPPTAM) \[[@B167-sensors-20-02641]\], Stereolabs' ZedFu \[[@B168-sensors-20-02641]\] 3D mapping tool, and Real-Time Appearance Based Mapping (RTAB-MAP) \[[@B169-sensors-20-02641]\]. Filipenko and Afanasyev \[[@B159-sensors-20-02641]\] compared various SLAM based methods integrated in the ROS framework: GMapping \[[@B170-sensors-20-02641]\], Parallel Tracking and Mapping (PTAM) \[[@B171-sensors-20-02641]\], HectorSLAM \[[@B172-sensors-20-02641]\], Semi-direct Visual Odometry (SVO) \[[@B173-sensors-20-02641]\], LSD-SLAM \[[@B174-sensors-20-02641]\], RTAB-MAP \[[@B169-sensors-20-02641]\], ORB-SLAM \[[@B152-sensors-20-02641]\], DPPTAM \[[@B167-sensors-20-02641]\], Direct Sparse Odometry (DSO) \[[@B175-sensors-20-02641]\], Cartographer \[[@B176-sensors-20-02641]\], and Stereo Parallel Tracking and Mapping (S-PTAM) \[[@B177-sensors-20-02641]\]. They built a robot equipped with a 2D LiDAR, a monocular camera, and a ZED stereo camera. ATE was the chosen means of evaluation, represented through statistical metrics such as RMSE or the standard deviation. Ragot et al. \[[@B160-sensors-20-02641]\] performed an evaluation of two Visual SLAM algorithms, ORB-SLAM2 \[[@B148-sensors-20-02641]\] and RTAB-MAP \[[@B169-sensors-20-02641],[@B178-sensors-20-02641],[@B179-sensors-20-02641]\]. During the comparison of the two solutions, they used a VICON motion capture system as the ground truth. They performed various experiments, with straight-line, straight-line and back, circular paths, or trajectories containing loop closure. 5. Conclusions {#sec5-sensors-20-02641} ============== Indoor localization has an increasingly vast applicability in domains such as AR, navigation systems, assistive devices (especially for the visually impaired), autonomous robots, surveillance, and monitoring. Since surveillance cameras and smartphone cameras represent a commodity currently, researchers have developed a plethora of indoor localization solutions based on visual input. This paper offers an overview of the computer vision based indoor localization domain, discussing applications areas, commercial solutions, and benchmarks and presenting some of the most relevant contributions in the area. It also provides a survey of selected positioning solutions, proposing a new classification that organizes the solutions according to the use of known environment data, the sensing devices, the type of detected elements (artificial markers or real features), and the employed localization methods. The research papers selected in the 17 classes of the proposed taxonomy were chosen from prestigious research databases based on their relevance to the domain and publication date, and their purpose was to be illustrative for the reader in terms of the indoor positioning technologies. Since many relevant papers were too recent to have a considerable number of citations, we decided to not use this criterion for selection. The focus was on providing short descriptions of the solutions, highlighting the advantages and disadvantages and presenting the achieved performances (in terms of running time and location estimation accuracy), along with the properties of the datasets used for testing. [Table 2](#sensors-20-02641-t002){ref-type="table"}, [Table 3](#sensors-20-02641-t003){ref-type="table"}, [Table 4](#sensors-20-02641-t004){ref-type="table"}, [Table 5](#sensors-20-02641-t005){ref-type="table"}, [Table 6](#sensors-20-02641-t006){ref-type="table"}, [Table 7](#sensors-20-02641-t007){ref-type="table"}, [Table 8](#sensors-20-02641-t008){ref-type="table"}, [Table 9](#sensors-20-02641-t009){ref-type="table"}, [Table 10](#sensors-20-02641-t010){ref-type="table"}, [Table 11](#sensors-20-02641-t011){ref-type="table"}, [Table 12](#sensors-20-02641-t012){ref-type="table"}, [Table 13](#sensors-20-02641-t013){ref-type="table"}, [Table 14](#sensors-20-02641-t014){ref-type="table"}, [Table 15](#sensors-20-02641-t015){ref-type="table"}, [Table 16](#sensors-20-02641-t016){ref-type="table"}, [Table 17](#sensors-20-02641-t017){ref-type="table"} and [Table 18](#sensors-20-02641-t018){ref-type="table"} show that many papers did not report computing times and the specifics of their testbeds, and few papers discussed the financial implications of implementing such solutions in real life. The evaluation methodologies for the presented solutions differed. While some used visual observations to test their solutions, others chose to use private datasets. Although public datasets and benchmarks exist, they come with limitations in terms of required environment data and input from cameras, limiting their use to only certain localization solutions. We considered this paper a good guide to the field of computer vision based indoor localization. Our proposed classification and the selection of localization solutions for each category aimed to allow the reader to easily grasp the advantages and applicability of each class of solutions. Conceptualization, A.M. (Alin Moldoveanu), A.M. (Anca Morar) and I.M.; writing---original draft preparation, A.M. (Anca Morar), I.M. and I.E.R.; writing---review and editing, all authors; funding acquisition, A.M. (Alin Moldoveanu), A.M. (Anca Morar) and A.B. All authors have read and agreed to the published version of the manuscript. This work was supported by the grant "Ecosistem de cercetare, inovare si dezvoltare de produse si servicii TIC pentru o societate conectata la Internet of Things--NETIO" (MySMIS Code = 105976), subsidiary contract "Platformă imersivă de realitate virtuală și augmentată pentru spații culturale--CultReal", Number 4192/18.03.2019. The authors declare no conflict of interest. ![Indoor localization with a mobile camera (**left**) or with static cameras (**right**).](sensors-20-02641-g001){#sensors-20-02641-f001} ![Distribution of selected papers over time. The horizontal axis shows the publication years. The vertical axis shows the number of papers published per year.](sensors-20-02641-g002){#sensors-20-02641-f002} ![Proposed classification based on environment data, sensing devices, detected elements, and localization method.](sensors-20-02641-g003){#sensors-20-02641-f003} sensors-20-02641-t001_Table 1 ###### Classification of computer vision based localization research papers considering the environment data, the sensing devices, the detected elements, and the localization algorithm. Classification Research Papers ------------------------ --------------------- ------------ ---------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- Marker/camera position 2D static cameras Artificial Image analysis \[[@B31-sensors-20-02641],[@B32-sensors-20-02641]\] Marker/camera position 2D static cameras Real Image analysis \[[@B60-sensors-20-02641],[@B67-sensors-20-02641],[@B68-sensors-20-02641],[@B69-sensors-20-02641]\] Marker/camera position 2D static cameras Real AI \[[@B70-sensors-20-02641],[@B71-sensors-20-02641],[@B72-sensors-20-02641],[@B73-sensors-20-02641],[@B74-sensors-20-02641]\] Marker/camera position 2D mobile cameras Artificial Image analysis \[[@B38-sensors-20-02641],[@B75-sensors-20-02641],[@B76-sensors-20-02641],[@B77-sensors-20-02641],[@B78-sensors-20-02641],[@B79-sensors-20-02641],[@B80-sensors-20-02641],[@B81-sensors-20-02641]\] Marker/camera position 3D mobile cameras Artificial Image analysis \[[@B82-sensors-20-02641],[@B83-sensors-20-02641]\] Marker/camera position 2D cameras, sensors Artificial Image analysis \[[@B36-sensors-20-02641],[@B37-sensors-20-02641],[@B84-sensors-20-02641]\] Image/feature database 2D mobile cameras Real Image analysis \[[@B85-sensors-20-02641],[@B86-sensors-20-02641],[@B87-sensors-20-02641],[@B88-sensors-20-02641]\] Image/feature database 2D mobile cameras Real AI \[[@B89-sensors-20-02641],[@B90-sensors-20-02641],[@B91-sensors-20-02641]\] Image/feature database 3D mobile cameras Real AI \[[@B63-sensors-20-02641],[@B92-sensors-20-02641]\] Image/feature database 2D cameras, sensors Real Image analysis \[[@B93-sensors-20-02641],[@B94-sensors-20-02641],[@B95-sensors-20-02641],[@B96-sensors-20-02641]\] Image/feature database 2D cameras, sensors Real AI \[[@B97-sensors-20-02641],[@B98-sensors-20-02641],[@B99-sensors-20-02641],[@B100-sensors-20-02641],[@B101-sensors-20-02641]\] Image/feature database 3D cameras, sensors Real Image analysis \[[@B102-sensors-20-02641],[@B103-sensors-20-02641]\] 3D model 2D mobile cameras Real Image analysis \[[@B29-sensors-20-02641],[@B104-sensors-20-02641],[@B105-sensors-20-02641],[@B106-sensors-20-02641],[@B107-sensors-20-02641],[@B108-sensors-20-02641],[@B109-sensors-20-02641],[@B110-sensors-20-02641],[@B111-sensors-20-02641]\] 3D model 2D mobile cameras Real AI \[[@B112-sensors-20-02641],[@B113-sensors-20-02641]\] 3D model 3D mobile cameras Real Image analysis \[[@B114-sensors-20-02641],[@B115-sensors-20-02641],[@B116-sensors-20-02641],[@B117-sensors-20-02641],[@B118-sensors-20-02641],[@B119-sensors-20-02641]\] 3D model 3D mobile cameras Real AI \[[@B120-sensors-20-02641],[@B121-sensors-20-02641]\] 3D model 2D cameras, sensors Real Image analysis \[[@B41-sensors-20-02641],[@B45-sensors-20-02641],[@B46-sensors-20-02641],[@B122-sensors-20-02641],[@B123-sensors-20-02641],[@B124-sensors-20-02641],[@B125-sensors-20-02641]\] sensors-20-02641-t002_Table 2 ###### Characteristics of indoor localization solutions with 2D static cameras (with known positions), markers, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- -------------------------------------------------------- ---------------------------------- -------------------------------------------------- \[[@B31-sensors-20-02641]\] own dataset: 1 static camera, covering 1.26 m × 1.67 m avg. 0.2 s per frame on a server err. between 0.0002 and 0.01 m (max. err.: 1 cm) \[[@B32-sensors-20-02641]\] own dataset: 3 rooms, each with 1 IP camera real-time observational sensors-20-02641-t003_Table 3 ###### Characteristics of indoor localization solutions with 2D static cameras (with known positions), real features, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- ----------------------------------------------------------------------------------------------------- ---------------------------------------------------------------- ------------------------------------------------------------------------------------------------- \[[@B67-sensors-20-02641]\] public datasets: PETS2009 \[[@B126-sensors-20-02641]\], TUD-Stadtmitte \[[@B127-sensors-20-02641]\] approximately 140 ms on Intel Core2Quad 2.66 GHz with 8 GB RAM Multiple Object Tracking Accuracy (MOTA): 87.8% on the PETS2009 and 64.2% on the TUD-Stadtmitte \[[@B69-sensors-20-02641]\] own dataset: indoor space with 2.2 m × 6 m, images with $320 \times 240$ pixels from 2 cameras \- less than 7.1 cm \[[@B68-sensors-20-02641]\] own dataset: 12,690 frames acquired with 3 cameras; public dataset: PETS2001 \- 95.7% hit rate and 96.5% precision \[[@B60-sensors-20-02641]\] own dataset: office with 5.1 m × 8.5 m × 2.7 m \- mean err. of 0.37 m sensors-20-02641-t004_Table 4 ###### Characteristics of indoor localization solutions with 2D static cameras (with known positions), real features, and artificial intelligence. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- ------------------------------------------------------------------------------------------------------------ --------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------- \[[@B70-sensors-20-02641]\] public datasets: PETS 2009 (City Center), EPFLterrace dataset \- Ground Position Error (GPE) metric with total err. rate 0.122/0.131, Projected Position Error (PPE) metric with total err. rate 0.107/0.140 \[[@B71-sensors-20-02641]\] training: 1542 images (own) + 25,608 images from MS COCO; evaluation: 1400 images/robot type + 110/pattern 50 Hz on a GPU and 10 Hz on a CPU detection rate between 70% and 97.9%; orientation err. between 1.6 and 11.9 degrees \[[@B72-sensors-20-02641]\] own dataset: 47 employees, 18 rooms and 6 cubicles, 960 ceiling images 2.8 s per image (offline computation) 88.2% accuracy for identifying locations \[[@B73-sensors-20-02641]\] own dataset: over 2100 frames in 42 scenarios 6.25 fps on Jetson TX2 approximately 45 cm mean err. \[[@B74-sensors-20-02641]\] own dataset: office room with 1 camera and supermarket with 6 cameras 5 fps on a server detection success rate of 90% and avg. localization err. of 14.32 cm sensors-20-02641-t005_Table 5 ###### Characteristics of indoor localization solutions with 2D mobile cameras, markers with known positions, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ --------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------- \[[@B75-sensors-20-02641]\] own dataset: classroom with area 2.4 m × 1.8 m and 4 QR codes Nexus 4 Google (fps not mentioned) localization err. 6--8 cm, heading direction err. 1.2 angles \[[@B76-sensors-20-02641]\] own dataset, simplified and complex scenarios 47 ms for QR code extraction on a Raspberry Pi 2 complex scenario: planar position err. 17.5 cm, 3D pose estimation self-localization err. 10.4 cm \[[@B77-sensors-20-02641]\] public dataset proposed by Mikolajczyk and Schmid \[[@B134-sensors-20-02641]\], 4 image pairs 0.11 s, 0.16 s, 0.27 s, 0.14 s; 1--2 iterations to reach the threshold similarity threshold similarity 0.8 \[[@B38-sensors-20-02641]\] own dataset: hall with 6 QR codes and 2 possible trajectories (circular and 8-shape) 10 Hz on Linux Ubuntu 12.04 OS running ROS framework err. for circular path 0.2 m, err. for 8-shape path 0.14 m, orientation err. 0.267 radians \[[@B78-sensors-20-02641]\] own dataset acquired with an RGB camera fixed on an FLIR Pan Tilt Unit mounted on a mobile platform with an SICK s300 laser scanner (ground truth), markers placed on a wall 0.07 s avg processing time of a scene with 550 markers (up to 200 times faster than AprilTags) avg. error of angle estimates: 0.02 rad.for pitch/roll \[[@B79-sensors-20-02641]\] own dataset: space covered with 4 × 4 QR codes, placed 50 cm apart \- the robot can travel more than 7 times on the same route \[[@B80-sensors-20-02641]\] own dataset, images of resolution 1280 × 720 18.1 ms on an image with a cluttered scene and a single marker, using a single core 3.70 GHz Intel Xeon less than 0.6 degrees std. dev. for rotation, less than 0.4 cm std. dev. for translation \[[@B81-sensors-20-02641]\] own dataset in an academic building, four different paths, markers on the ceiling, guidance test with 10 blindfolded users \- 0 miss detections, 2 false detections out of 40 tests sensors-20-02641-t006_Table 6 ###### Characteristics of indoor localization solutions with 3D mobile cameras, markers with known positions, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- ------------------------- ----------------------------- ------------------------------------------------------------------------------------------- \[[@B82-sensors-20-02641]\] own dataset \- distance from the camera to the QR code: 1 cm err. \[[@B83-sensors-20-02641]\] own dataset real time maximum distance and angles from which the robot can see the QR code are: 270 cm and 51∘. sensors-20-02641-t007_Table 7 ###### Characteristics of indoor localization solutions with 2D cameras + other sensors, markers with known positions, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- ---------------------------------------------------------------------- ---------------------------------------------------------------------------- -------------------------------------------------------------------- \[[@B37-sensors-20-02641]\] own dataset less than 4 ms per frame; convergence time 18 s less than 0.2 m for position and less than 0.1 orientation for EHF \[[@B36-sensors-20-02641]\] own dataset computational load increases if dead reckoning is invoked with IMU sensors visual (performance affected if dead reckoning is not used) \[[@B84-sensors-20-02641]\] own dataset: corridor with 100 m × 2.25 m and hall with 14 m × 6.5 m \- accuracy is within 2 m 80% of the time sensors-20-02641-t008_Table 8 ###### Characteristics of indoor localization solutions with real image/feature databases, 2D mobile cameras, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- -------------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------- \[[@B85-sensors-20-02641]\] own datasets: 862 frames, 3674 frames single CPU/Kepler K 20 chip: 20 ms/1.13 ms for a database of 1000 frames, 160 ms/8.82 ms for 8000 frames within 2 m in most cases \[[@B86-sensors-20-02641]\] own datasets: hallways 15 m long \- estimated moving speed compared to ground truth: max absolute err. 0.0643 m/s, RMSE for speed 0.24--0.37 m/s, RMSE for distance 0.16--0.23 m \[[@B87-sensors-20-02641]\] own dataset: 1866 images, 40 key frames \- \- \[[@B88-sensors-20-02641]\] own dataset: over 90,000 annotated frames out of 60 videos from six corridors (approximately 3.5 km of data) \- 4 m avg. absolute err. for HOG3D and 1.3 m for SF GABOR, over a 50 m traveling distance sensors-20-02641-t009_Table 9 ###### Characteristics of indoor localization solutions with real image/feature databases, 2D mobile cameras, and artificial intelligence. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------------- -------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------- \[[@B89-sensors-20-02641]\] own dataset: 1800 images from 30 different locations, 480 indoor videos of buildings (each lasting around 2--3 s), public dataset: Dubrovnik \[[@B136-sensors-20-02641]\] 0.00092 s for image based localization and 0.0012 s for the video based method 95.56%/94.44% accuracy for location/orientation with image based localization and 98% with the video based method \[[@B90-sensors-20-02641]\] own dataset: 302 training images, resolution 3024 × 4032 object detection phase takes 0.3 s location accuracy is within 1 m \[[@B91-sensors-20-02641]\] own dataset: 112,919 compound images (composed of 4 images taken by 4 Google Nexus phones) of resolution 224 × 224 close to real-time avg. median err. after a 20 step moving for compound images is 12.1 cm sensors-20-02641-t010_Table 10 ###### Characteristics of indoor localization solutions with real image/feature databases, 3D mobile cameras, and artificial intelligence. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- ------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------ ----------------------------------------------------------------------------------------------------------- \[[@B92-sensors-20-02641]\] ICL-NUIMdataset \[[@B138-sensors-20-02641]\] and TUM dataset \[[@B139-sensors-20-02641]\] 296 ms to find the most similar frame and 277 ms to estimate the final pose on Intel Xeon E5-1650 v3 CPU 3.5 GHz, NVidia TITAN GPU more than 80% of the images are localized within 2.5 degrees and more than 90% are localized within 0.3 m \[[@B63-sensors-20-02641]\] ICL-NUIM dataset \[[@B138-sensors-20-02641]\] \- 0.51 m living room, 0.41 m office sensors-20-02641-t011_Table 11 ###### Characteristics of indoor localization solutions with real image/feature databases, 2D cameras + other sensors, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ----------------------------- -------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------ -------------------------------------------------------------------------------------------------------------- \[[@B93-sensors-20-02641]\] own dataset: 75 location images from 1.5--2 m distance query time 40--230 ms mean distance err. rate is 2.5/2.21 m for extended distance estimation method/hybrid approach \[[@B94-sensors-20-02641]\] own dataset 90 ms FAST-SURF, 100--130 ms indoor positioning, 3--7 ms character detection, 30--45 ms tracking and registration on Honor 3C smartphone \- \[[@B95-sensors-20-02641]\] own dataset (offices and hallways) 0.5 s per frame 90% of location and orientation errors are within 25 cm and 2 degrees \[[@B96-sensors-20-02641]\] \- iPhone5s, iPhone X, LG Nexus 5X, Samsung Galaxy S7, S9, Huawei Mate tablet best results, on Samsung S9: 4.5 deg. avg. rotation and 250 mm position err. from 1 m in front of the marker sensors-20-02641-t012_Table 12 ###### Characteristics of indoor localization solutions with real image/feature databases, 2D cameras + other sensors, and artificial intelligence. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ------------------------------ ---------------------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------------------------------------------------ ----------------------------------------------------------------------------------------------------------------------------------------- \[[@B97-sensors-20-02641]\] own dataset, 3 blind volunteers 2 fps on a laptop visual inspection \[[@B98-sensors-20-02641]\] own dataset, 5 people with different weight and height, walking at 3 different speeds, on two tracks (straight or zig-zag) real time 93% accuracy in case of normal speed \[[@B99-sensors-20-02641]\] own dataset: office floor 51 m × 20 m × 2.7 m and 7 WiFi routers \- panoramic camera based method: mean err. for localization 0.84 m, cumulative probability within localization err. of 1 m/2 m is 70%/86% \[[@B100-sensors-20-02641]\] own dataset: room-level environment and open large environment 4 s per image (0.8 s fingerprint location on server, 2.9 s image location on smartphone, 1 s data transmission) less than 0.6 m avg. location err. and less than 6 degrees avg. direction err., 90% location deviations are less than 1 m \[[@B101-sensors-20-02641]\] own dataset: 50 m${}^{2}$ office and 2 cases (with and without line-of-sight); ground divided into 42 reference points real time on Intel5300 NIC laptop with 3 antennas as signal receiver and Ubuntu server with Intel Xeon e5-2609 CPU, GeForce GTX TITAN X GPU and 256 GB RAM avg. position err. is 0.98/1.46 m for line-of-sight/none line-of-sight sensors-20-02641-t013_Table 13 ###### Characteristics of indoor localization solutions with real image/feature databases, 3D mobile cameras + other sensors, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ------------------------------ ------------------------------------------------------------------------ ----------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- \[[@B102-sensors-20-02641]\] own dataset: small number of experiments and short tested trajectories real time avg. err. in the X-axis direction is 0.06 m with IMU \[[@B103-sensors-20-02641]\] own dataset real time translation error: 0.1043 m, rotation err.: 6.6571 degrees for static environments; translation err.: 0.0431 m ± 0.0080 m, rotation err.: 2.3239 degrees ± 0.4241 degrees for dynamic environments sensors-20-02641-t014_Table 14 ###### Characteristics of indoor localization solutions with an existing/generated 3D model of the environment, 2D mobile cameras, real features, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ------------------------------ ----------------------------------------------------------------------------------------------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------------------------------------- \[[@B29-sensors-20-02641]\] own dataset: simple experiment with obstacles along a route real time on a single CPU visual inspection \[[@B104-sensors-20-02641]\] own dataset: images of resolution $320 \times 240$ 3 fps for SURF on 2.20 GHz dual-core computer 90% detection success rate and 14.32 cm avg. localization err. \[[@B105-sensors-20-02641]\] 3 own datasets: images of resolution $640 \times 480$ (from Galaxy S4 camera); public dataset: feature set of Liang et al. \[[@B144-sensors-20-02641]\] avg. search time for Dataset 1 (176 frames) is 10 ms and for Dataset 4 (285 frames) is 28 ms 80--100% accuracy, depending on dataset; 0.173--0.232 m localization error \[[@B106-sensors-20-02641]\] own dataset: reconstruction with RGBD-SLAM, Dataset 1 (50 frames, 139 mp), dataset 2 (33 frames, 37 mp) avg. localization time is 0.72 s per frame on an Intel Core i7 with 8 GB RAM avg. localization error is less than 10 mm: translation err. for Dataset 1 is 0.9--35 mm and for Dataset 2 is 0.3--17 mm \[[@B107-sensors-20-02641]\] own dataset: office environment, with 154 m long route images captured at 0.8 Hz using a smartphone camera, computing time not mentioned 1.5 degrees mean accuracy for visual gyroscope, 0.3 m/s mean accuracy for visual odometer, 1.8 m localization err. \[[@B108-sensors-20-02641]\] own dataset: synthetic scenes (20 m × 20 m scene with 88 lines and 160 points, 794 generated images); public dataset: Biccoca_2009 \[[@B145-sensors-20-02641]\] 0.5--1 s for MATLAB version, 25.8 ms avg. running time for C++ version 0.79 accuracy err. in position on a 967 m path; 0.2 m accuracy err. for synthetic scenes \[[@B109-sensors-20-02641]\] own dataset: Guangdong Key Laboratory, Shantou University \- only visual inspection, in comparison with the RGB-D SLAM method \[[@B146-sensors-20-02641]\] \[[@B110-sensors-20-02641]\] own dataset: indoor environment; public dataset: Karlsruhe outdoor datasets \[[@B147-sensors-20-02641]\] real time on an i7 processor 94--98% distance and depth measurements accuracy; absolute err. of 5.72/9.63 m for 2 outdoor datasets and 4.07/1.35 cm for 2 indoor datasets \[[@B111-sensors-20-02641]\] own datasets: office building (400 m${}^{2}$), gymnasium (1000 m${}^{2}$), and a shopping mall (6000 m${}^{2}$), 21 navigation paths, 274 checkpoints approximately 0.1 s for relocalization and navigation on Huawei P10, Nexus 6, Nexus 7, Lenovo Phab2 pro 98.6% immediate NSR, 93.1% NSR after 1 week, 83.4% NSR after 2 weeks sensors-20-02641-t015_Table 15 ###### Characteristics of indoor localization solutions with an existing/generated 3D model of the environment, 2D mobile cameras, real features, and artificial intelligence. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ------------------------------ -------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------- \[[@B112-sensors-20-02641]\] public dataset: TUM Dynamic Object dataset (RGB images, depth information, ground truth trajectory) 5fps for Mask-RCNN on NVidia Tesla M40 GPU \[[@B149-sensors-20-02641]\] RMSE between 0.006134 and 0.036156 \[[@B113-sensors-20-02641]\] own dataset: 370 m from route; public datasets: TUM dynamic dataset, KITTI dataset (outdoor large scenarios) real time the trajectory RMSE err. is 2.29 m, the accuracy is 7.48--62.33% higher than ORB-SLAM2 \[[@B148-sensors-20-02641]\] sensors-20-02641-t016_Table 16 ###### Characteristics of indoor localization solutions with an existing/generated 3D model of the environment, 3D mobile cameras, real features, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ------------------------------ ------------------------------------------------------------------------------------------------------------------------------------- --------------------------------------------------------- --------------------------------------------------------------------------------------------------------------------------------------------------------------------- \[[@B114-sensors-20-02641]\] own dataset: a room, check if the virtual objects have the same size as the real ones 3--4 fps for map building on a laptop with i7-720qm CPU difference in dimensions between 3D reconstructed and real objects: dm/cm level accuracy \[[@B115-sensors-20-02641]\] own dataset: barren office hallway; public dataset: TUM dataset \[[@B139-sensors-20-02641]\] \- 0.1--1.5 m translation RPE, 2--18 degrees rotational RPE, 0.02--1.1 m ATE \[[@B116-sensors-20-02641]\] own dataset: room of size 15 × 10 × 3 m${}^{3}$ 20 fps on a gaming laptop visual inspection, checking loop closure \[[@B117-sensors-20-02641]\] own dataset: a path of 70 m through a building 25 Hz visual inspection \[[@B118-sensors-20-02641]\] own datasets: taken with a handheld structure sensor; public datasets: Freiburg Benchmark, TUM dataset \[[@B139-sensors-20-02641]\] 5 fps 0.011--0.062 RMSE of ATE for public datasets; 1.4--4.1 cm closing distance and 1.08--3.32 degrees closure angle for own datasets \[[@B119-sensors-20-02641]\] own dataset collected with 2 wheeled robots (RB-1 and Kobuki) with Asus Xtion RGB-D sensors less than 30 s tracking mode (robot starts from a known position): x-mean: 0.082 m, y-mean 0.078 m; global mode (robot starts from unknown position): x-mean 0.27 m, y-mean 0.43 m sensors-20-02641-t017_Table 17 ###### Characteristics of indoor localization solutions with an existing/generated 3D model of the environment, 3D mobile cameras, real features, and artificial intelligence. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ------------------------------ ---------------------------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------- ----------------------------------------------------------------------------------------------------------- \[[@B120-sensors-20-02641]\] public dataset: TUM dataset \[[@B139-sensors-20-02641]\] 37.753 ms per frame on Intel i5 2.0 GHz CPU with 3 GB RAM 0.015 and 0.103 RMSE for the error size of the posture, better than ORB-SLAM \[[@B152-sensors-20-02641]\] \[[@B121-sensors-20-02641]\] public dataset: ICL-NUIM \[[@B138-sensors-20-02641]\] and TUM dataset \[[@B139-sensors-20-02641]\] 119.0 ms (average) on a desktop PC running Ubuntu 12.04 with an Intel Core i7-2600 CPU at 3.40 GHz and 8 GBRAM Absolute Trajectory Error ATE: 1 cm--5 cm, mostly competing with ORB-SLAM2 \[[@B152-sensors-20-02641]\] sensors-20-02641-t018_Table 18 ###### Characteristics of indoor localization solutions with an existing/generated 3D model of the environment, 2D mobile cameras + other sensors, real features, and traditional image analysis. Research Paper Dataset Characteristics Computing Time and Platform Accuracy ------------------------------ ----------------------------------------------------------------------------------- ---------------------------------------------------------------------------------------------------------------- ------------------------------------------------------------------------------------------------------------------ \[[@B46-sensors-20-02641]\] own dataset \- visual evaluation \[[@B41-sensors-20-02641]\] own dataset: robot moves along a specific path in a lab room, QVGA resolution 200 ms for basic image processing on LG P970, whole pipeline processed offline (manual extraction of features) position err. converges from 35--50 cm to less than 3 m \[[@B122-sensors-20-02641]\] own dataset: 120 m indoor hallway with 5200 video frames of size $640 \times 480$ from 3.2 fps to 23.3 fps on commodity laptop (2.6 GHz quad-core CPU and 4 GB RAM) 0.17 m position err. \[[@B95-sensors-20-02641]\] own dataset \- visual inspection \[[@B124-sensors-20-02641]\] own dataset map building and fusion process: real time on Intel Core i7-8550U CPU relative error of ORB-SLAM2 \[[@B148-sensors-20-02641]\] calibrated with proposed mapping matrix is less than 5% \[[@B125-sensors-20-02641]\] own dataset and public dataset: EuRoCdataset \[[@B154-sensors-20-02641]\] real time on an embedded board (1.92 GHz processor and 2 GB DDR3L RAM) 0.01--0.15 m position err. for own dataset; 0.234 m max. err. for EuRoC dataset \[[@B45-sensors-20-02641]\] own dataset: Vienna airport, path of 200 m 23 s for the proposed method to complete a guiding task visual inspection
{ "pile_set_name": "PubMed Central" }
RAAF Transport Flight (Japan) Transport Flight (Japan) was a Royal Australian Air Force (RAAF) transport unit that operated in the aftermath of the Korean War. It was formed in March 1955 at Iwakuni, Japan, and equipped with three Douglas C-47 Dakotas and a CAC Wirraway. The flight's main duty was flying a regular courier service between Japan and South Korea in support of Commonwealth military units based on the peninsula. Transport Flight (Japan) ceased operations in June 1956 and disbanded in September that year. History Transport Flight (Japan) traced its lineage to a transport contingent that the Royal Australian Air Force (RAAF) maintained in Japan prior to the Korean War. When the war broke out in June 1950, No. 77 (Fighter) Squadron was based at Iwakuni as part of the British Commonwealth Occupation Force. Equipped primarily with North American P-51 Mustangs, the squadron also operated a communications flight of two and two Austers. No. 91 (Composite) Wing was established at Iwakuni in October 1950 to administer all RAAF units during the war. This included No. 77 Squadron, the newly formed No. 391 (Base) Squadron and No. 491 (Maintenance) Squadron, and , formerly the No. 77 Squadron Communications Flight. It was designated No. 30 Communications Unit in November. By then it had a complement of eight Dakotas and two Austers. No. 30 Communications Unit was redesignated No. 30 Transport Unit in November 1951. By the end of 1952, its strength was eight Dakotas and one CAC Wirraway, and fifty-nine personnel. In March 1953, No. 30 Transport Unit re-formed as No. 36 (Transport) Squadron, which had disbanded the previous day at RAAF Base Richmond, New South Wales. Elements of No. 36 Squadron began returning to Australia in January 1955, and by the end of the month its strength was four Dakotas and one Wirraway, and fifty-eight personnel. No. 36 Squadron ceased flying on 13 March, after which its remaining strength left Iwakuni for Australia. RAAF Transport Flight (Japan) was formed at Iwakuni the next day under the control of No. 91 Wing. The unit was equipped with three Dakotas and one Wirraway, which had been left behind when the last members of No. 36 Squadron departed for Australia. Transport Flight (Japan)'s personnel, consisting of eight officers and sixty-six other ranks by the end of month, were drawn mainly from No. 36 Squadron, including its commanding officer, Squadron Leader G.L. Waller, as well as from No. 391 (Base) Squadron. The flight's regular duty consisted of a courier service to Pusan and Kimpo in South Korea five days a week—Wednesdays and Sundays were excluded—to support Commonwealth forces on the peninsula. It became known in the process as "Japan–Korea Airlines". Generally carrying freight on the outbound journey, the aircraft often ferried casualties back to Iwakuni, and two nurses formerly of No. 391 Squadron were attached to the flight to assist with this task. The unit was also responsible for transporting VIPs. No. 391 Squadron and No. 91 Wing were disbanded at Iwakuni on 30 April 1955. Transport Flight (Japan) flew its last courier missions on 28 June 1956, and shortly after handed over its base facilities to the United States Navy. The flight's last Dakota—the last RAAF aircraft to be based in Japan—took off for Australia from Iwakuni on 8 July. It left behind some ground staff and Flight Lieutenant Raleigh, a small yellow dog that had accompanied No. 81 (Fighter) Wing—parent formation of No. 77 Squadron at the time—to Japan as its mascot in 1945 and had remained with the RAAF contingent at Iwakuni ever since. Raleigh, a keen flyer but considered too old to return to Australia, was to be given over to the care of a US service family when the last RAAF personnel departed Iwakuni. Transport Flight (Japan) was disbanded on 28 September 1956. It was reported to have carried 4,400 passengers and of cargo between its first flight in March 1955 and its last in July 1956, including 690 Commonwealth troops in April 1956 alone, and to have only missed one scheduled service, owing to a typhoon. Notes References Transport Category:Military units and formations of Australia in the Korean War Category:Military units and formations established in 1955 Category:Military units and formations disestablished in 1956 Category:1955 establishments in Australia
{ "pile_set_name": "Wikipedia (en)" }
A Review of Regulations Applied to Spices, Herbs, and Flavorings-What Has Changed? A review of the world-wide regulations pertaining to spices, extracts, and flavorings. The areas covered include (1) guidance documents from trade organizations as well as international and regional regulatory bodies, (2) decontamination of spices and herbs, (3) extraction solvents used to make spice and herb oleoresins, and (4) general flavoring regulations. Specific links and references to guidance documents and regulations have been provided where they have been published on government, organization, and trade association websites.
{ "pile_set_name": "PubMed Abstracts" }
Witnesses said that the man was hit by several cars. In a video of the episode captured by a witness on his cell phone, the man is seen running erratically around the intersection as police officers tried to corral him out of the street. “He was just wandering, running away from the cop,” said a witness who described himself as a retired police officer and did not want to be named. “He tried to run and ended up getting hit by three different cars.” The police later wheeled the man into an ambulance. He was conscious and sitting upright, dressed in a green sweater. He appeared to be handcuffed.
{ "pile_set_name": "OpenWebText2" }
Q: Filtering a signal to have a constant exponential moving average Problem I wish to filter a discrete-time input signal, $x[n]$, so as the output signal's, $y[n]$, exponential moving average, $a[n+1] = a[n] + \alpha(y[n] - a[n])$, tracks around a constant reference $\mu_x$ such that $\mathbb{E}\{y[n]\} \approx \mu_x$, and also an approximately constant variance, $\text{var}\{y[n]\} \approx \sigma_x^2$, while maintaining as much information about the incoming signal as possible. Naive Motivating Solution 1) Maintain an average of the input, $b[n+1] = b[n] + \alpha(x[n] - b[n])$ and an approximation of the signal variance, $c[n]$. 2) Define the output to be $y[n] = \frac{x[n] - b[n]}{\sqrt{c[n]}}$ which tracks a reference of 0 with unity variance. Question There are a number of problems with this approach which make it not very numerically robust, such as when low values of variance occur. Is there a more intelligent way of doing this? Perhaps using a dynamic linear filter? Or high pass filter? Other Points The inputs can be considered independent, and are drawn from one of several dynamic distributions. The application, if you are interested, is comparing the amplitudes of recent inputs with each other by assigning them a "reward" output. This is high reward for relatively higher input values and a low for lower lower values. However, I desire the mean reward to be an approximately constant output mean. Furthermore, there may be some medium-time dynamics in the inputs, such as decaying toward zero over time. A: I'll draw on my (limited) experience in audio mixing and mastering. Speech recorded through a microphone requires the same statistical properties (constant moving average and constant variance), and two straightforward processing stages ensure this. An "exponential moving average" is another word for a 1-pole low-pass filter. This moving average can be brought close to zero by passing the signal through any high-pass filter, such as a "DC killer" or "remove subsonic rumble" filter that an audio processing package such as Audacity or Audition may provide. The stronger the high-pass characteristic, the closer the moving average will stick to the center line. Second, you want to make the variance constant. That's a job for a level compressor. Find the RMS (square root of variance) of the signal over the next few milliseconds, and adjust the gain (amplification) of the signal over that period to bring the variance up or down to the variance you want. Audio processing packages provide this as well. You mention numerical stability. The standard DSP literature describes ways to implement a robust high-pass filter. For instance, FIR filters tend to be very stable.
{ "pile_set_name": "StackExchange" }
Background ========== The intervertebral disc (IVD) lies between the vertebral bodies and links them together. The components of the disc are Nucleus pulposus (NP), Annulus fibrosus (AF) and the end-plates. Although the phenotype of IVD cells and the composition of the extracellular matrix (ECM) is still the subject of considerable debate, they appear quite comparable to those of articular cartilage particularly for NP cells \[[@B1],[@B2]\]. This composite nature of IVD endows the disc with both the tension-resisting properties of a ligament and the compression-resisting properties of articular cartilage. Unfortunately, disc structure and function does not remain optimal throughout life, but undergoes a progressive age-dependent degeneration. The IVD aging initiates early in the NP, as seen by a loss of cellularity and alteration of the ECM, thus compromising the mechanical properties of IVD \[[@B3]\]. It is well acknowledged that IVD degeneration encompasses several age-related processes influenced primarily by mechanical, nutritional and genetic factors. However, the underlying cellular and molecular mechanisms involved in the premature initiation and progression of IVD aging and degeneration still remains poorly deciphered (for review see \[[@B4]\]). In this context, the development of appropriate animal models capable of providing new insights into the IVD physiopathology should be further investigated. IVD blood supply terminates at the end-plate, making NP and AF non-vascularized tissue \[[@B3]\]. In addition, IVD is a poorly cellularized tissue \[[@B3]\]. Both these characteristics are responsible for the limited intrinsic repair capacity of IVD. Accordingly, IVD damages are irreversible and often result in clinical symptoms, such as low back pain, that require medical intervention \[[@B5]\]. Such treatments currently involve removal or replacement of the injured disc by surgery rather than its repair, which would be the preferred course of action. Successful transplantation of IVD autografts, allografts (fresh and fresh-frozen) have also been considered in primate models and in humans \[[@B6]\]. However the safety and efficiency of such techniques remain to be clarified. In this context, the use of cell-seeded biomaterials for tissue engineering of the IVD has been recently investigated \[[@B7],[@B8]\]. Although results thus far are promising, the development of an in vivo model that can closely mimic human IVD aging and degeneration is crucial to test the efficacy of such future regenerative cell-based biotherapies. Among the different animal models described in the literature \[[@B9],[@B10]\], the use of the rabbit disc model because in addition to being cost effective and the most widely investigated, it also appears to be a relevant model of age-linked altered proteoglycan metabolism and disc injury. The present study was conducted to address whether the rabbit could be considered (i) as a valuable model to provide new insights into the tissue and cellular changes occurring during IVD aging and degeneration and (ii) as an appropriate tool to investigate the efficacy of IVD biotherapies. To this end, lumbar IVD from rabbits with increasing ages (1, 6 and 30 months old) were compared by MRI and histological staining. In an effort to determine whether a close correlation may exist between the tissue and cellular changes observed during the early course of aging, we also analyze the variation of transcript expression in NP cells with increasing age. Methods ======= Animals and surgical procedures ------------------------------- All animal handling and surgical procedures were conducted according to European Community guidelines for the care and use of laboratory animals (DE 86/609/CEE). New Zealand White rabbits (Charles River, L\'Arbresle, France), 1, 6 and 30-month old, were used. The study protocol has been approved by the ethics committee at the National Veterinary School of Nantes (ENVN-ONIRIS). Three rabbits per age group were used to perform MRI and histological analyses as well as five additional rabbits per age group for the RT-PCR analysis. MRI scanning and image assessment --------------------------------- MRI scans were performed using a one Tesla clinical magnet (Siemens Magnetom Harmony/Syngo). One, six, 30 month old rabbits (n = 3 for every ages) were anesthetized by intramuscular injection of xylazine (Bayer, Puteaux, France) and ketamine (Merial, Lyon, France). A 2.5 mm midsagittal section image was obtained, using a T2-weighted imaging sequence (T2ws) (TR, 5000 milliseconds; TE, 111 milliseconds). Images were analysed by Pfirrmann\'s grading \[[@B11]\]. This grading system is based on MRI signal intensity, disc structure, distinction between NP and AF and disc height on T2-weighted magnetic resonance images. The degree of disc degeneration was ranked from grade 1 (normal disc) to grade 5 (severe degeneration) as previously described \[[@B11]\]. An evaluation of MRI scans was performed by three independent investigators expert in MRI image reading. Histological analysis --------------------- After rabbit euthanasia (n = 3 for every age group), the lumbar IVD were collected from five consecutive levels (L2-3, L3-4, L4-5, L5-6 and L6-7). IVD were dissected \[[@B2]\] and fixed in 10% paraformaldehyde for four days, decalcified for 24 hours in Decalcifier II^®^(Surgipath, Richmond, USA). After dehydration and incubation with Histosol^®^(Shandom, Brussels, Belgium), specimens were embedded in paraffin and sectioned into 3-μm slices. For histological analysis, 3 μm thick paraffin sections were deparaffined using toluene, rehydrated through a graded series of ethanol, and rinsed in distilled water. Sections were stained with hematoxylin phloxin safran (HPS) and with 0.1% alcian blue (Sigma-Aldrich, St Louis, USA) \[[@B12]\]. Histological sections were analyzed using Boos\' modified scoring \[[@B13]\]. Four parameters were specifically assessed to classify age-related changes in IVD: cell density, mucous degeneration, tears and cleft formations and granular changes \[[@B13]\]. Each parameter was ranked from 0 to 4 according to the intensity of the tested parameters (0: lowest; 4: highest). A blind evaluation of histological samples was performed by three independent investigators expert in reading histological slides. Transcript expression analysis ------------------------------ Five rabbits of each age were sacrificed. NP tissues from five consecutive lumbar levels (L2-3, L3-4, L4-5, L5-6 and L6-7) were isolated and enzymatically digested as previously described \[[@B2]\]. NP cells were frozen for subsequent real time PCR analysis. Total RNA was extracted using Trizol^®^reagent according to the manufacturer\'s instructions. Real-time PCR experiments were conducted as described extensively in \[[@B2]\]. Briefly, after deoxyribonuclease I digestion, RNA samples (2 μg) were reverse-transcribed using AMV-RT and random primers in a total volume of 30 μl. Complementary DNA (cDNA) was amplified in a total volume of 25 μl PCR reaction containing 12.5 μl of brilliant SYBR Green Master Mix (1X) and 30 nM of SYBR Green reference dye. The sequence of each primer (MWG Biotech, Ebersberg, Germany) set used are given in Table [1](#T1){ref-type="table"}. Real-time PCR was performed using the Mx3000P QPCR system (Stratagene, La Jolla, CA, USA). Cycle thresholds were normalized to β-actin in order to correct for potential cDNA quantification differences. The expression levels of each gene were normalized to the average of all the 1 month-old rabbits and the results are reported as fold change in gene expression. ###### real-time PCR investigation. --------------------------------------------------------------------------------------------------------------------------------------- Gene (Abbreviation) Accession number (Gene Bank) Forward primer (5\'-3\') Reverse primer (5\'-3\') Product length --------------------------------- ------------------------------ -------------------------- -------------------------- ---------------- *GAPDH* [NM_002046](NM_002046) agccacatcgctcagaca gcccaatacgaccaaatcc 66 pb Type II collagen\ [D83228](D83228) acagcaggttcacctataccg cccacttaccggtgtgtttc 60 pb *COL2A1* Aggrecan\ [L38480](L38480) gaggatggcttccaccagt tggggtacctgacagtctga 61 pb *AGC1* Type I colagen\ [D49399](D49399) agcgatggtcctccaggt gccagggtaaccacgttct 63 pb *COL1A1* Matrix metalloproteinase 13\ [NM_001082037](NM_001082037) ttttgaagacacgggcaag tcatcatagctccagacttggtt 60 pb *MMP13* Bone Morphogenic Protein 2\ [NM_001082650](NM_001082650) tgcagaacttcaggtttttcg tggaaaccgctgtcgtct 63 pb *BMP2* Matrix Gla protein\ [D21265](D21265) tggatataatgctgcttacaatcg tttccaatcttattcagctctgc 64 pb *MGP* P21-activated protein kinase I\ [NM_001082756](NM_001082756) agaaagaaaaagaacgaccagaga cgtggatggtgtgctcaa 60 pb *P21* --------------------------------------------------------------------------------------------------------------------------------------- GenBank reference of the genes evaluated and oligonucleotide primers used for real-time PCR. Statistical analysis -------------------- Each analysis was performed on three rabbits per age group for MRI and histology and on five rabbits per age group for RT-PCR. Results are expressed as mean +/- SD of triplicate samples. Comparative studies of means were performed using one-way ANOVA followed by a post hoc test (Fisher\'s projected least significant difference) with a statistical significance at p \< 0.05. Results ======= MRI and histological characterization of IVD aging -------------------------------------------------- In order to characterize the aging process of IVD, the T2ws intensity of lumbar spine from one, six and 30-month-old rabbits was assessed. Representative MRI picture of one-month-old IVD on Figure [1A](#F1){ref-type="fig"} indicates a grade I according to the Pfirrmann\'grading to IVD from L2 to L6 levels. The lowest lumbar IVD (L6-L7) appears non-homogeneous with a dark transverse band. A grade II was assigned to this disc. The six-month-old rabbits\' (Figure [1B](#F1){ref-type="fig"}) NP from L2 to L7 level showed a nonhomogeneous T2ws intensity with the presence of a dark transverse band and were assigned as grade II. Six-month-old disc height was not altered as compared to that of one-month old disc but the distinction between NP and AF became less discernable. For the 30-month-old rabbits (Figure [1C](#F1){ref-type="fig"}), all the IVD at lumbar level exhibited a non-homogeneous T2 signal intensity (gray). The IVD height was slightly decreased, and no distinction between NP and AF could be observed. These were scored as grade III. In summary, MRI data indicate that rabbits exhibit scalable IVD changes evolving as early as one-month old. ![**MRI images of the lumbar spine of rabbits with increasing ages**. T2-weighted midsagittal images of (A) one-, (B) six- and (C) 30-month-old rabbits. Representative MRI images are shown.](1471-2474-12-147-1){#F1} To further address whether the age-dependent MRI changes of rabbit IVD may correlate with some tissue alteration, we then performed histological stainings. Analysis of histological staining revealed a dramatic decrease in cell density as a function of age (Figure [2A, B, C](#F2){ref-type="fig"}). In addition, mucous degeneration and granular changes, shown by the presence of large decoloured and heterogeneous areas in granulated regions, were markedly increased (Figure [2D, E, F](#F2){ref-type="fig"}). Finally, the formation of tears and clefts shown by the presence of small thin defects was also affected by aging. To quantitatively assess the histological damage observed as a function of age, we next used a modified Boos\' scoring \[[@B13]\] (Figure [2G](#F2){ref-type="fig"}). Our results show a significant increase in the modified Boos\' scoring from one to 30 months old. This scoring was 5.5-times higher in the 30-month-old rabbits compared to one-month old rabbits (p \< 0.05). ![**Histological characterization of the *Nucleus pulposus*from IVD of rabbits with increasing ages**. Histological sections of IVD from (A,D) one-, (B,E) six-, (C,F) 30-month-old rabbits were stained with (A, B, C) Haematoxilin Phloxin Safran and (D, E, F) alcian blue. Bar: 50 μm. Representative images are shown. (G) A Modified Boos\'s scoring was used to assess quantitatively the age-dependent tissue changes. \*: p \< 0.05 as compared to 1-month old rabbits; \#: p \< 0.05 as compared to 6-month old rabbits.](1471-2474-12-147-2){#F2} Alteration of transcript expression patterns during IVD aging ------------------------------------------------------------- To address whether the structural age-related changes identified by MRI and histology may be related to alteration of cell phenotype, we analysed the expression levels of transcript coding for several IVD associated genes in freshly isolated NP cells from increasing ages. We first focused our attention on transcript coding for ECM genes (type II collagen COL2A1, type I collagen COL1A1 and aggrecan AGC1). Our data indicated that COL2A1 mRNA levels decreased significantly with aging in NP cells (Figure [3A](#F3){ref-type="fig"}). The COL2A1 mRNA level was 100-fold lower in the 30-month-old rabbit compared to that of a one-month-old rabbit (p \< 0.05). In parallel, a significant 2.5-fold decrease in AGC1 mRNA levels was also noted between one and 30-month-old rabbits (p \< 0.05) (Figure [3B](#F3){ref-type="fig"}). In contrast to the decrease in COL2A1 and AGC1 mRNA levels, the COL1A1 mRNA level increased significantly with aging in NP cells (Figure [3C](#F3){ref-type="fig"}) with a 2.5-fold increase in COL1A1 mRNA at the age of 30-months compared to one-month. Taken together, these data indicate that the expression of chondrogenic markers (COL2A1 and AGC1) decreases with age whereas that of the dedifferentiation marker (COL1A1) increases as early as thirty months. ![**Phenotypic markers in *Nucleus pulposus*cells**. Analysis of the expression levels of transcripts coding for the phenotypic markers (A) type II collagen, (B) Aggrecan, (C) type I collagen, (D) MMP-13, (E) BMP-2, (F) MGP and (G) p21 in Nucleus pulposus (NP) cells from IVD of rabbits with increasing ages. Messenger RNAs were purified from freshly isolated NP cells and analyzed by real-time PCR as described in the materials and methods section. Results are reported as fold change in gene expression related to one month old rabbits. \*: p \< 0.05 as compared to one-month-old rabbits; \#: p \< 0.05 as compared to six-month old rabbits.](1471-2474-12-147-3){#F3} Since it has been reported that the expression of matrix metalloprotease 13 (MMP13), bone morphogenetic protein-2 (BMP2) and the matrix Gla protein (MGP) were affected during the course of osteoarthritis \[[@B14]\] and IVD aging \[[@B15]\], we were interested in deciphering whether these genes may also be affected by aging in rabbit NP. Whilst a significant decrease in MMP-13 mRNA levels was found between one and six-month-old NP, our data indicate that MMP13 mRNA levels increased significantly between 6 and 30-month old rabbit (2.8-fold higher) (p \< 0.05) (Figure [3D](#F3){ref-type="fig"}). In addition, BMP2 mRNA levels was found to be significantly up-regulated between one and 30-month-old rabbits with a 2.5 fold increase (p \< 0.05) (Figure [3E](#F3){ref-type="fig"}). MGP mRNA levels were significantly increased as a function of age with a significant seven-fold increase between one-and 30-month-old rabbits (Figure [3F](#F3){ref-type="fig"}). Finally, since IVD aging has recently been associated with cellular senescence \[[@B16]\], we investigated whether the level of p21 mRNA may vary as a function of age (Figure [3G](#F3){ref-type="fig"}). Interestingly, our transcript analysis revealed that p21 mRNA level was significantly up-regulated (2 fold increase) between six month and 30-month-old rabbits. Viewed together, our data strongly suggest that the age-dependent tissue changes evidenced by MRI and histology were associated with alteration of the phenotype of NP cells. Discussion ========== The current therapeutic strategies for patients with lower back pain remain symptomatic and are mainly dedicated to relieving painful symptoms. Our current understanding of the physiopathology of IVD degeneration allows us to consider regenerative medicine as a promising strategy. Indeed, recent reviews have considered the imbalance between anabolism and catabolism as a pivotal factor of the IVD degeneration process. This imbalance between anabolism and catabolism contributes to the disorganization of the ECM. Accordingly, increasing attention has been paid to the regeneration of functional tissue based on the restoration of the ECM integrity by cell therapy and/or tissue engineering \[[@B3],[@B17]\]. Nevertheless, before these promising biotherapies may enter the therapeutic arsenal, some preclinical tests in adapted animal models that closely mimic the physiological aging and degeneration process of human IVD should be performed. In this context, the present study aims at characterizing IVD aging and degeneration in the rabbit to propose this model as a suitable tool to i) gain new insights in the complex mechanisms of IVD degeneration and ii) to perform preclinical experiments dedicated to the evaluation of the safety and efficacy of IVD tissue engineering strategies. In humans, MRI is the gold standard for the clinical investigation of IVD integrity. This technique allows the definition of IVD based on the tissue hydration shown by the intensity of the T2ws in the NP. The pictures of rabbit lumbar spines showed an age-dependent decrease in the T2ws and the appearance of a dark transverse band. This data is quite similar to that observed in humans during the course of IVD degeneration \[[@B18]\]. The decrease in T2ws intensity in human IVD after 20 years of age is well-acknowledged and reflects the decrease in water and proteoglycan contents during aging \[[@B19]\]. The dark transverse band is considered to be a normal structure in persons of 30 years or older \[[@B18]\]. Histological studies have thus suggested that this dark transverse band may likely to be due to the accumulation of fibrous tissue in the central zone of NP \[[@B20]\]. To precisely assess disc degeneration on routine T2ws in human, Pfirrmann et al. have developed a reliable grading system \[[@B11]\]. Interestingly, the use of Pfirrmann\'s system to grade IVD degeneration in rabbit reveals the same profile of T2ws variation as a function of age, thereby confirming the reliability of the different periods of life in rabbits previously described by Murakami et al. \[[@B21]\]: grade I for childhood (one-month old in rabbits is similar to a child in humans), grade II for adolescent rabbit (six months old in rabbits is similar to an adolescent in humans) and grade III-IV in adult age (30 months old in rabbits is similar to an adult in humans). All these MRI data suggest that the age-related changes that occurs in rabbit IVD share consistent similarities with those traditionally observed during the course of human IVD aging. To further address whether the age-related changes observed by MRI may correlate with some tissue alteration, we then performed histological stainings. We were interested in addressing whether the modified Boos\' scoring, originally developed to histologically assess IVD changes in humans, could be transposed to rabbit IVD aging. Accordingly, the main features of human IVD degeneration were found in rabbit IVD with mucous degeneration, granular changes as well as cracks and tears being formed as a function of age. Interestingly, these histological changes perfectly corroborate the changes observed by MRI (loss of T2ws intensity and formation of a dark band). Taken together, our MRI and histological data show some similarities between the process of IVD aging in rabbits and humans thereby strongly suggesting that rabbits could be considered as a valuable spontaneous model of age-dependent IVD changes. In addition to being a reliable model of IVD aging, this spontaneous model may provide a closer representation of the pathophysiology of IVD aging in humans compared to the degeneration induced by needle aspiration or chemonucleolysis \[[@B9]\]. Despite our data strongly suggesting that the rabbit is a relevant model of IVD aging, some limitations should, however, be considered. Contrarily to humans, rabbits have notochordal cells in their NP at least up to 6 months of age \[[@B22]\]. In addition, in small quadrupeds and despite a relative discrepancy in disc diameter, the spine is likely to be loaded with smaller forces as compared to humans \[[@B23],[@B24]\]. Whether both of these limits affect the relevance of the rabbit model is not yet known. To our knowledge, only two studies have partially described IVD aging in rabbits \[[@B25],[@B26]\]. In these previous studies, rabbit IVD aging was evaluated longitudinally between the age of 6 and 42 months. In this previous study, rabbit IVD aging is longitudinally evaluated between the age of six and 42 months. On the contrary to our study, no result is available for the period ranging from one to six months, which could be an essential period for the onset of IVD aging. In fact, it is well known that the NP of less than twelve-month-old rabbits contain some remnant cells originating from the embryonic notochord \[[@B22]\]. Whether the age-dependent loss of notochordal cells, most likely by apoptosis, is intimately related to IVD aging is not yet fully deciphered but has been proposed as a possible initiating mechanism for IVD degeneration \[[@B27]\]. NP is the structure in which IVD degeneration is initiated by dehydration followed by an alteration of the structural organization of the tissue \[[@B13]\]. Therefore, to strengthen our MRI and histological data, we finally sought to decipher whether the above described age-dependent tissue changes may correlate with alteration in the NP cell phenotype. To address this issue, we focused our attention on the expression levels of molecules that were previously shown to be modulated during the onset of IVD degeneration or osteoarthritis (COL1A1, COL2A1, AGC1, BMP2, MMP13, MGP and P21) \[[@B14],[@B16],[@B28]\]. Since it remains difficult to quantitatively evaluate the level of the corresponding proteins, particularly in the rabbit, we embarked on the analysis of the corresponding transcript levels by real-time RT-PCR. Our data describing an age-dependent increase in COL1A1 expression with a concomitant decrease in COL2A1 and AGC1 expression suggest that NP cells experience a process of dedifferentiation. Interestingly, this dedifferenciation process has been well described in cultured articular chondrocytes \[[@B29]\] and in osteoarthritic joints \[[@B30]\]. Our data also suggests that during the process of IVD aging, the molecules with a longer half-life (collagen type II) exhibit an early decrease in the corresponding transcript levels. Conversely, the molecules with a shorter half-life (aggrecan) have a transcript expression levels that starts to decline later on. Whether this differential regulation of ECM molecules may be of importance for the maintenance of IVD integrity deserves further attention. Among the various genes modulated in osteoarthritic chondrocytes \[[@B14]\], MMP-13 is probably the most trustworthy. We were therefore interested to find a significant modulation of these genes during IVD degeneration. MMP-13 is known to degrade collagens and glycosaminoglycans \[[@B31]\]. The increase in MMP13 could therefore be a major contributor of IVD degeneration \[[@B16]\] as it has been extensively reported in cartilage degradation during OA \[[@B14]\]. BMP-2, a growth factor that stimulates the production of ECM components in IVD \[[@B21]\] and articular cartilage \[[@B32]\], was also shown to be stimulated as a function of age in rabbit IVD. One can assume that the increase in BMP2 expression during IVD aging is related to the existence of reparative mechanisms that could contribute to slowing down ECM degradation. In line with this suggestion, MGP, one of the most potent inhibitors of calcification in mammals \[[@B33]\], was also found to be up-regulated as a function of age \[[@B15]\] thereby supporting our hypothesis of the existence of such compensatory mechanisms. Of note, similar compensatory mechanisms have been described in osteoarthritic cartilage, which draws attention to the physiopathological vicinity of IVD degeneration and osteoarthritis. Finally, the age-dependent increase in p21, a cycline dependant kinase inhibitor that in addition to being involved in cellular senescence \[[@B16]\] has also been reported to inhibit type II collagen expression in articular chondrocytes \[[@B34]\], further highlights the similarities between OA and IVD degeneration. Conclusions =========== This study describes the consistency of the rabbit as a model of age-dependent IVD changes. Our data also highlight some similarities between the physiopathological processes involved in the onset of IVD aging and those described for osteoarthritis. Finally, our study makes the rabbit a valuable tool (i) to gain new insights into the complex molecular mechanisms that govern IVD aging and (ii) to test the preclinical efficacy of tissue engineering strategy that may offer the possibility of regenerating damaged IVD. Competing interests =================== The authors declare that they have no competing interests. Authors\' contributions ======================= JC and MPV have conceived and coordinated the study. They participated in MRI analysis, Boos\'scoring and RT-PCR analysis. They also performed the statistical analysis and drafted the manuscript. MM performed the PCR analysis. JL performed the histological stainings. BHF, OG participated in the design of the study, particularly in animal management. MF performed MRI imaging and participated in analysis. YC participated in histological analysis. GG and YM have helped in the writing of the manuscript. JG and CV helped to the conception of the study, and participated in its design and have helped in the writing of the manuscript. All authors read and approved the final manuscript. Pre-publication history ======================= The pre-publication history for this paper can be accessed here: <http://www.biomedcentral.com/1471-2474/12/147/prepub> Acknowledgements ================ This study was supported by grants from Société Française de Rhumatologie, Fondation de l\'Avenir pour la Recherche Médicale Appliquée (ET8-491 and ET9-541), Agence Nationale de la Recherche AAP TeCSAN (chondrograft project), Agence de la Biomédecine, Institut National de la Santé et de la Recherche Médicale, région des Pays de la Loire (BIOREGOSproject), and the University Hospital of Nantes. The authors gratefully acknowledge the technical assistance of Pierre Weiss, Maïthe Gatius-Perré, Pierre Monmousseau, Patrice Roy, Stéphane Madec, Dominique Rouleau and Christian Raphael, as well as Joanna Ashton-Chess for the critical reading of the manuscript.
{ "pile_set_name": "PubMed Central" }
Larry Barbiere Lawrence Edward "Larry" Barbiere (born March 6, 1951) is an American former competition swimmer and Olympic athlete. Barbiere represented the United States as a 17-year-old at the 1968 Summer Olympics in Mexico City. He competed in the men's 100-meter backstroke, and finished fourth in the event final with a time of 1:01.1. Barbiere attended Indiana University in Bloomington, Indiana, where he swam for coach Doc Counsilman's Indiana Hoosiers swimming and diving team in National Collegiate Athletic Association (NCAA) and Big Ten Conference competition from 1970 to 1973. He was an eleven-time All-American as a college swimmer, and was a key member of the Hoosiers' three consecutive NCAA national championship teams in 1971, 1972 and 1973. Barbiere's son Jim also attended Indiana University and competed for the Hoosiers swim team from 2009 to 2013. His niece, swimmer Emily Silver, won a silver medal at the 2008 Olympics. See also List of Indiana University (Bloomington) people References Category:1951 births Category:Living people Category:American male backstroke swimmers Category:Indiana Hoosiers men's swimmers Category:Ohio lawyers Category:Olympic swimmers of the United States Category:Sportspeople from Dayton, Ohio Category:Swimmers at the 1968 Summer Olympics Category:University of Cincinnati College of Law alumni
{ "pile_set_name": "Wikipedia (en)" }
Q: Preview multiple uploaded images in symfony I wanna preview my images with javascript before uploading it, I'm working in symfony & I use its FileType for form.. Here is my Code : {% block content %} {{ form_start(form, {'attr': {'id': 'image_form', 'class': 'form-horizontal container'}} ) }} <div class="col-md-6"> <div class="form-group"> <div class="col-md-3 text-right"> {{ form_label(form.name, 'Images to upload :', {'label_attr': {'class': 'control-label'}}) }} </div> <div class="col-md-8"> <div id="wrapper" style="margin-top: 20px;"> {{ form_widget(form.name, {'attr': {'id' : 'fileUpload'}}) }} </div> {{ form_errors(form.name) }} </div> </div> <div class="col-md-offset-7"> {{ form_label(form.Upload) }} {{ form_widget(form.Upload, { 'label': 'Upload', 'attr': {'class': 'btn btn-info'}}) }} <button type="reset" class="btn btn-default">Clear</button> </div> <div id="image-holder"></div> </div> {{ form_end(form) }} {% endblock %} {% block javascripts %} {{ parent() }} <script> $(document).ready(function() { $("#fileUpload").on('change', function() { //Get count of selected files var countFiles = $(this)[0].files.length; var imgPath = $(this)[0].value; var extn = imgPath.substring(imgPath.lastIndexOf('.') + 1).toLowerCase(); var image_holder = $("#image-holder"); image_holder.empty(); if (extn == "gif" || extn == "png" || extn == "jpg" || extn == "jpeg") { if (typeof(FileReader) != "undefined") { //loop for each file selected for uploaded. for (var i = 0; i < countFiles; i++) { var reader = new FileReader(); reader.onload = function(e) { $("<img />", { "src": e.target.result, "class": "thumb-image" }).appendTo(image_holder); } image_holder.show(); reader.readAsDataURL($(this)[0].files[i]); } } else { alert("This browser does not support FileReader."); } } else { alert("Pls select only images"); } }); }); </script> {% endblock %} I, tried the same thing with a simple html input of type of file, & it was working fine, but why it doesn't in the Symfony form? A: It's because Symfony2 form_div_layout adding own id to every widget {%- block widget_attributes -%} id="{{ id }}" name="{{ full_name }}" .... So you have to change {'id' : 'fileUpload'} to {'class' : 'fileUpload'} and $("#fileUpload").on('change' to $(".fileUpload").on('change' and check the result. Or rewrite form layout.
{ "pile_set_name": "StackExchange" }
Welcome back to Robots in Design. I’ve got a couple of star cards to preview today, so I’m going to kick it off with a look at how we design star cards. As we were closing in on the final form of the core game system we went through several quick evolutions. There was a brief time where the teams were always characters and all characters had equal power. That quickly gave way to a star team building system that you would recognize, starting with 10 total stars and moving upwards to 20, and then finally settling at 25. Note that we weren’t changing the size of our expected teams, just rescaling their star values. The character who would become Optimus Prime, Battlefield Legend started at 5 stars, went up to 10, and then settled at 13 during this same time. This progression in stars was primarily driven by a balance between resolution (how accurately can we express the strength of a character in a limited range of star values) and math processing (how much are we taxing our players to build their teams. To many of you, that second factor might not seem that important, but you must remember three things: We designed the game to be accessible to kids as young as 8 years old. Up-front complexity is the most likely to keep a new game from “sticking”. People are much better at single-digit math, so we chose a range where the majority of characters would be 10 or fewer stars. You get diminishing returns with increased resolution. At some point, the precision of the measurement is finer than your accuracy. If we had had a 100-star scale, I doubt that the design team would have been able to reliably distinguish whether a 35-star character was stronger or weaker than a 36-star character. Even with the 10-star scale, we had no 1-star characters, as we knew a 10-character team would not lead to a fun play experience. The idea of star battle cards was there almost from the beginning, but we always planned to save it for the second set. The amount of power that you could have in a one-star battle card was one of the drivers that helped push the star total to 25. Star Performers Star cards walk a delicate line. We want them to be powerful enough that you are happy using them to fill out your ideal 22 or 23-star team but not so strong that you’re tempted to run something silly like a 15-star team with 10 star cards. (And yes, we’ve seen and been amused by the discussions online about running a 4-star character and 21 star cards). We want them to be swingy enough that you’re excited to draw them but not so much that a game feels like all that matters is who played the most star cards. Star cards are a lot of fun to make. The fact that they are self-limiting means we can take a lot more risks in their design and that we can play with effects that are exciting in small doses but scale problematically. This brings us at last to the first of our preview cards. In Wave 1, one of the most important cards was Force Field. In Rise of the Combiners, I was trying to design a slightly weaker Force Field with a different feel. Unfortunately, it ended up being even stronger (way too much stronger) and got cut from the set. We toned it down a bit and tried it again in War for Cybertron: Siege I, and it was still too good. It got cut again. Finally, in Siege II it gets to see the light of day. Walk through the fire with Blast Suit. This card is remarkably efficient. If your opponent is swinging for less than 10, it prevents more damage than Force Field does. If you’ve set it up with a Backup Bag as well, it’s a real beating. As another point of comparison, Medic! will repair you 2 damage with one card play. If your opponent is attacking for at least 3 damage, Blast Suit will save you at least that much damage. Finally, Raider Needlenose is Blast Suit’s best friend. Recurring the Blast Suit will give him incredible durability and let you draw out the game to continue accumulating advantage. Our second preview comes out of the paradox of interaction. We want there to be a healthy amount of interaction in the game. There should be plays and counterplays. Gambits that pay off and those that crash and burn. The challenge is that too much/too easy interaction can be almost as frustrating as no interaction. Because the Transformers TCG has no mana/resource system (we’re action based), it is possible to have lines of play where nothing “sticks”. Data Pad? Ramming Speed. Force Field? Bashing Shield. Noble’s Blaster? Vaporize it. Full Loadout a bunch of Upgrades? Inferno sends them all back. Even when you get some incremental value from the initial use of your upgrades, play patterns like this lead to people feeling frustrated that they can’t progress their board state. When you just want your opponent to leave your stuff alone and let you play with your shiny toys, I highly recommend you bust out Indestructible Sword. Don’t think of it as a Primary Laser. Think of it as a Primary Laser that NEVER GOES AWAY. Even if the character is KO’d, it still comes back. Also, it’s yet another double black battle icon to ensure that one way or another, you’re going to be getting some damage through. I hope you’re enjoying preview season. We’ve got a lot of exciting reveals still to come, so enjoy your discussion of Blast Suit and Indestructible Sword while keeping an eye out for more.
{ "pile_set_name": "OpenWebText2" }
Those who got a ticket for this film also bought Samuel Collardey Little Lion Comme un lion Inspired by the very real adventures of a player for FC Sochaux, the film is centered around a 15 year-old from Senegal (Mytri Attal), dreaming about Barça and Chelsea. Spotted by an agent, he sets off for Europe, placing his family in debt, but is abandoned penniless in Paris. Rejecting the prospect of a "shameful" return home, he then embarks on a series of makeshift efforts to get along, before being saved by meeting an amateur coach (Marc Barbé) who puts him back on track towards his dream.
{ "pile_set_name": "Pile-CC" }