text stringlengths 1 1.11k | source dict |
|---|---|
algorithm, c, file, image, memory-management
unsigned long bmp_read_y_size(const char *filename, const bool extension);
char bmp_read(unsigned char *image, const int xsize, const int ysize, const char *filename, const bool extension);
BMPIMAGE bmp_file_read(const char *filename, const bool extension);
int bmp_write... | {
"domain": "codereview.stackexchange",
"id": 41536,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "algorithm, c, file, image, memory-management",
"url": null
} |
thermodynamics, temperature, water
When the water is heated a diffuse (poorly defined) boundary layer is formed on the bottom of the vessel. This layer is at a temperature that is slightly higher than the bulk of the water above it.
This limits the transfer of heat from the heated surface somewhat, acc. Newton's Law o... | {
"domain": "physics.stackexchange",
"id": 28189,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "thermodynamics, temperature, water",
"url": null
} |
react.js, jsx, to-do-list
Here's a version of Form.js that I've broken up into lots of little components
/* eslint-disable jsx-a11y/label-has-associated-control */
import PropTypes from "prop-types";
import React, { useState } from "react"; | {
"domain": "codereview.stackexchange",
"id": 40215,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "react.js, jsx, to-do-list",
"url": null
} |
intelligence
Title: Is there a molecular basis to intelligence? Is there any explanation, gene(s) or whatever detected, that are co-related or explicitly related via mechanical bio-molecular (or at any other level) models that explain the higher or lower intelligence found in different individuals of Homo sapiens? | {
"domain": "biology.stackexchange",
"id": 2233,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "intelligence",
"url": null
} |
php, codeigniter
// Update post
public function update_post($id, $post_image, $slug) {
$data = [
'title' => $this->input->post('title'),
'slug' => $slug,
'description' => $this->input->post('desc'),
'content' => $this->input->post('body'),
'post_image' => $post_image,
... | {
"domain": "codereview.stackexchange",
"id": 37920,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "php, codeigniter",
"url": null
} |
& 1\\ 0 & 5 & -1 & 1 \\ 0 & 0 & 6 & 5 \end{array} \right]}_{U}.$$ Since permutation matrices all satisfy the condition $P^k=I$ (for some $k$) the existence of a $PLU$-decomposition for $A$ naturally suggests that $P^{k-1}A = LU$. Therefore, even when a $LU$ decomposition is not available we can just flip a few rows to ... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. Yes\n2. Yes",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9879462226131666,
"lm_q1q2_score": 0.8685497343401384,
"lm_q2_score": 0.8791467738423874,
"openwebmath_perplexity": 269.80935597029196,
"openwebmath_score": 0.8212655782699585,
"ta... |
java, algorithm
public Coordinate(int i, int j) {
x = i;
y = j;
}
public int getX() {
return x;
}
public int getY() {
return y;
}
@Override
public boolean equals(Object obj) {
if (obj == null) {
return false;
}
if (obj i... | {
"domain": "codereview.stackexchange",
"id": 37973,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, algorithm",
"url": null
} |
climate, human-influence, climate-change, global-warming
Title: How much of the current global warming is due to human influence? Approximately what proportion of the global warming seen over the the last century is attributed to anthropogenic sources? Firstly it is worth demonstrating that 97% of climate scientists a... | {
"domain": "earthscience.stackexchange",
"id": 1679,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "climate, human-influence, climate-change, global-warming",
"url": null
} |
c#, algorithm, bioinformatics
Title: How to improve this Needleman-Wunsch implementation in C#? I split my implementation of this sequence alignment algorithm in three methods. Where NeedlemanWunsch-method makes use of the ScoringFunction and the Traceback methods. Further I decided to go with two matices. One matrix ... | {
"domain": "codereview.stackexchange",
"id": 6119,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, algorithm, bioinformatics",
"url": null
} |
inorganic-chemistry, ionic-compounds, covalent-compounds, atomic-radius
Title: Compare the covalent character of ZnCl2, CdCl2,HgCl2 I want to know how to arrange the covalent character of ZnCl2, CdCl2, and HgCl2.
By Fajans' rules, We know that a smaller cation equals higher covalent character.
We also know that atomic... | {
"domain": "chemistry.stackexchange",
"id": 16926,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "inorganic-chemistry, ionic-compounds, covalent-compounds, atomic-radius",
"url... |
c, linked-list, memory-management
Title: Adding two BigInts using linked lists in C While trying to learn more about linked lists, I thought I should try the exercise of reading two BigInts from an input file and then adding them up. My strategy was to store the two numbers in two different linked lists and then add t... | {
"domain": "codereview.stackexchange",
"id": 6538,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c, linked-list, memory-management",
"url": null
} |
sdformat
Does one exist, and if not why hasn't anyone created an SDF export plugin for some of the most widely used free CAD or game design applications that are out there? Is the customer base too small?
I'm using ROS Hydro with Gazebo 1.9. | {
"domain": "robotics.stackexchange",
"id": 3607,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "sdformat",
"url": null
} |
Claim: If for some solid sequence $\{a_1,a_2,..,a_n\}$ we have $n\geq2^m$ for some positive integer $m$, then there exits $i\leq n$ such that $a_i\geq2^{m-1}$
This feels like it should have a neat inductive proof. The base case is clear (as any four term sequence must include a $3$). I just can't seem to see the trick... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9835969679646668,
"lm_q1q2_score": 0.8280171619980201,
"lm_q2_score": 0.8418256551882382,
"openwebmath_perplexity": 168.8611118868926,
"openwebmath_score": 0.9523428678512573,
"tag... |
ros, ros-kinetic, kdl
#endif
Originally posted by dinesh on ROS Answers with karma: 932 on 2018-03-12
Post score: 0
Original comments
Comment by gvdhoorn on 2018-03-12:
So where do you link against kdl_parser libraries? Just find_package(..)ing that package is not enough.
Comment by dinesh on 2018-03-12:
i tried lik... | {
"domain": "robotics.stackexchange",
"id": 30279,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, ros-kinetic, kdl",
"url": null
} |
python, depth-first-search
if __name__ == '__main__':
main() Lists in Python are already stacks. It would be better if you used a raw list as people are more familiar with lists then a custom Stack class.
When using a plain Python list the while loop can take advantage of lists being truthy if they have items. Thi... | {
"domain": "codereview.stackexchange",
"id": 41641,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, depth-first-search",
"url": null
} |
c#, entity-framework, asp.net-mvc, ninject
public static DbConnection GetDbConnection(string connectionStringName)
{
if (_dbLoadBalancers.ContainsKey(connectionStringName))
{
return _dbLoadBalancers[connectionStringName].GetConnection();
}
throw new Exception($"Could no... | {
"domain": "codereview.stackexchange",
"id": 36830,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, entity-framework, asp.net-mvc, ninject",
"url": null
} |
homework-and-exercises, quantum-field-theory, integration, propagator
Can the above questions be solved without further solving the integral?
I tried using $k=m*tan(z)$ substitution but that didn't work too well.
Any hint on further solving this would be helpful. The integral is non trivial, and I must admit that it i... | {
"domain": "physics.stackexchange",
"id": 47991,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, quantum-field-theory, integration, propagator",
"url": n... |
java, algorithm, interview-questions, change-making-problem
As you yourself found, the cause of this was the integer overflow in calculationsCache[i] = Integer.MAX_VALUE;, and you correctly fixed it by changing to calculationsCache[i] = Integer.MAX_VALUE - 1;.
For reference, an alternative implementation with unit tes... | {
"domain": "codereview.stackexchange",
"id": 23426,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, algorithm, interview-questions, change-making-problem",
"url": null
} |
programming-challenge, clojure
(defn -main [& args] (dorun (map println (map min-number-of-slices (get-loaf-dimensions))))) ;(ns clojure-solution.core)
;(require '[clojure.string :as string])
Typically you only use the require, use, and import functions
in the REPL. The ns macro supports all of those and it reduces t... | {
"domain": "codereview.stackexchange",
"id": 11056,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "programming-challenge, clojure",
"url": null
} |
ios, swift
- (void)observeValueForKeyPath:(NSString *)keyPath ofObject:(id)object change:(NSDictionary *)change context:(void *)context {
if (context == &kSelectedOptionIndexContext) {
[self update];
} else {
[super observeValueForKeyPath:keyPath ofObject:object change:change context:context];
... | {
"domain": "codereview.stackexchange",
"id": 9567,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ios, swift",
"url": null
} |
python, recursion, error-handling, google-app-engine
# Queue a new task to pick up where we left off.
deferred.defer(do_blobs_delete, "Deleting empty blobs", 42, c=True)
return
except Exception, e:
logging.error('There was an exception:%s' % str(e)) Yes, that function terminate (unless the ... | {
"domain": "codereview.stackexchange",
"id": 6657,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, recursion, error-handling, google-app-engine",
"url": null
} |
c++, performance, c++11, stl, set
Title: Using includes() vs. hash function to check if an unordered_set is a subset of another unordered_set I did two methods to determine if an unordered_set is a subset of another unordered_set, using hashing, and the built-in includes().
I want to see if using a hash function will ... | {
"domain": "codereview.stackexchange",
"id": 8016,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, performance, c++11, stl, set",
"url": null
} |
c#, email, asp.net-core, razor
AccountController.cs
var notification = new RegisterConfirmationNotification (emailSender, model.Email, new RegisterConfirmationViewModel { FirstName = "John" } );
await notification.SendAsync();
My problem is that I have the impression to mix a lot of things that should not be mixed.
... | {
"domain": "codereview.stackexchange",
"id": 30088,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, email, asp.net-core, razor",
"url": null
} |
gazebo
Here are the only files necessary to reproduce the crash:
Visual plugin:
#include <gazebo/gazebo.hh>
#include <gazebo/common/common.hh>
#include <gazebo/rendering/rendering.hh>
#include <stdio.h>
namespace gazebo
{ class SpacenavVisualPlugin : public VisualPlugin
{ public:
// Constructor
Spacen... | {
"domain": "robotics.stackexchange",
"id": 3976,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gazebo",
"url": null
} |
image-processing, computer-vision, ocr, optical-char-recognition
https://www.robots.ox.ac.uk/~vgg/publications/2016/Jaderberg16/jaderberg16.pdf
http://www.whuang.org/papers/phe2016_aaai.pdf
https://crypto.stanford.edu/~dwu4/papers/HonorThesis.pdf
https://arxiv.org/abs/1603.03101
https://arxiv.org/abs/1511.06841
https:... | {
"domain": "dsp.stackexchange",
"id": 4655,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "image-processing, computer-vision, ocr, optical-char-recognition",
"url": null
} |
large-hadron-collider
If the question is "what do physicists consider crucial to discover " (instead of just limits) with the new data, the answer is "the existence of Supersymmetry" and of course any more indications of "string theory phenomenological predictions" ( supersymmetry is one of them).
. | {
"domain": "physics.stackexchange",
"id": 20644,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "large-hadron-collider",
"url": null
} |
the two loops of the same polar curve, we first meed to find the theta value for which the inner and the outer loop is generated. "the area contained between the curves y = x^5−2, y = −1 and x = 0" is equivalent to "the area contained between the curves y = x^5−1 and y=0 for interval [0,1]". 3 Finding the Area Between ... | {
"domain": "wokpark.it",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9796676454700793,
"lm_q1q2_score": 0.8032229674639569,
"lm_q2_score": 0.8198933293122506,
"openwebmath_perplexity": 622.0202468597455,
"openwebmath_score": 0.8173930644989014,
"tags":... |
ros, quadcopter, hardware
http://www.ais.uni-bonn.de/MoD/ (MikroKopter based)
https://www.youtube.com/watch?v=DhrCuN4eUJo (I believe also Mikrokopter)
https://github.com/NIFTi-Fraunhofer/nifti_uav (MikroKopter)
http://diydrones.com/forum/topics/ardupilot-mega-with-ros-onboard (Arducopter)
https://www.wpi.edu/Pubs/E-pr... | {
"domain": "robotics.stackexchange",
"id": 17984,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, quadcopter, hardware",
"url": null
} |
computer-architecture
Each row in the main memory is 32 bits in width and if it is byte addressable then we have 4 bytes in each row. To select a byte from the row requires log2(4) = 2 bits. Row width + 2 = 34 bits? Similiar concept for 32 bits. Is this correct logic? The error in your solution comes where you say "Ro... | {
"domain": "cs.stackexchange",
"id": 4497,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "computer-architecture",
"url": null
} |
python, datetime
# Weeks
result = tuple(create_intervals(date(2021, 10, 2), date(2021, 10, 26)))
assert result == (
(date(2021, 10, 2), date(2021, 10, 3)),
(date(2021, 10, 4), date(2021, 10, 10)),
(date(2021, 10, 11), date(2021, 10, 17)),
(date(2021, 10, 18), date(2021, 10, 2... | {
"domain": "codereview.stackexchange",
"id": 43980,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, datetime",
"url": null
} |
algorithms, np-complete, np-hard, np, decision-problem
Title: Find the class of the problem PP1 and PP2 using the information given below Assume that P1, P2,..., Pn are all NP-class problems. PP1 and PP2 are unknown problems (i.e., we don't know whether they belong to the P or NP classes). If "P1, P2,...., Pn" problem... | {
"domain": "cs.stackexchange",
"id": 19199,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "algorithms, np-complete, np-hard, np, decision-problem",
"url": null
} |
θ, where r r r is the distance of the point from the origin Using various functions, you can convert data between Spherical, Cartesian, and Cylindrical coordinate systems. For example, there are different languages in which the word "five" is said differently, but it is five regardless of whether it is said in English ... | {
"domain": "sramble-communication.com",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9914225158534695,
"lm_q1q2_score": 0.8682749313616078,
"lm_q2_score": 0.8757869803008764,
"openwebmath_perplexity": 535.9419383625223,
"openwebmath_score": 0.931949257850... |
php
This results in the browser displaying config validations passed, which is not the desired outcome. It makes sense that is what's being displayed because moving that line into the errorGenerator() method returns control to the validate() method rather than to the code that called the validate() method.
I'm wonder... | {
"domain": "codereview.stackexchange",
"id": 36451,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "php",
"url": null
} |
quantum-mechanics, angular-momentum, conservation-laws, atomic-physics, atoms
$\mu_1$, $\mu_2$ are the spin magnetic moments of the electrons.
This term is symmetric in the spins, so the same selection rule $\D S=0$
applies.
In order to violate that selection rule the ensuing term must be taken
into account: $i\,\bB_0... | {
"domain": "physics.stackexchange",
"id": 52049,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-mechanics, angular-momentum, conservation-laws, atomic-physics, atoms",
... |
c++, c++14
/// \brief Compares two numbers.
/// \tparam T Predicate of the checked number.
/// \tparam U Type of another number.
/// \param[in] lhs First number.
/// \param[in] rhs Second number.
/// \return True if first number is greater than or equal to second, false
/// otherwise.
template <Predicate T, typename U... | {
"domain": "codereview.stackexchange",
"id": 30098,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, c++14",
"url": null
} |
ros, message-filters, message
/opt/ros/hydro/include/message_filters/synchronizer.h:240:5: instantiated from ‘void message_filters::Synchronizer<Policy>::connectInput(F0&, F1&) [with F0 = message_filters::Subscriber<coop_est::FeatureBArray_<std::allocator<void> > >, F1 = message_filters::Subscriber<nav_msgs::Odometr... | {
"domain": "robotics.stackexchange",
"id": 20098,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, message-filters, message",
"url": null
} |
ros, sw-urdf-exporter
I've also included a Pack and Go zip file of my full assembly so you can recreate the steps above if so desired. Let me know if you require any further information.
System details:
Solidworks 2019 SP 5.0
URDF Exporter 1.5.1
###Edit 1:
After receiving enough Karma, here are the screenshots I have... | {
"domain": "robotics.stackexchange",
"id": 35086,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, sw-urdf-exporter",
"url": null
} |
X's equation is: . $\frac{S}{12} + \frac{R}{24} \:=\:1\;\;{\color{blue}[1]}$
In sunny weather, team Y can do the job in 15 days.
In one sunny day, Y can do $\frac{1}{15}$ of the job.
. . In $S$ sunny days, Y can do $\frac{S}{15}$ of the job.
In rainy weather, team Y can do the job in: . $125\% \times 15 \:=\:\frac{75... | {
"domain": "mathhelpforum.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9830850867332735,
"lm_q1q2_score": 0.8451226074295997,
"lm_q2_score": 0.8596637451167995,
"openwebmath_perplexity": 2497.7448520610574,
"openwebmath_score": 0.3569759428501129,
"ta... |
data-structures, reference-request, term-rewriting
$$ x\cdot y = y\cdot x$$
then it's clear that there is no algebraic (first-order) datatype that captures exactly the normal forms, as this is isomorphic to sorted lists of atoms.
A reasonable question is to ask whether there is always such a data structure using depen... | {
"domain": "cs.stackexchange",
"id": 9754,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "data-structures, reference-request, term-rewriting",
"url": null
} |
c++, c
Use sizeof(nameList) - 1 instead of a magic number to indicate last array index - there will be less changes if you ever add more names.
Regarding your union questions:
union is kinda like a struct; the only difference is how it's handled in memory.
Since your union has two fields (PersonItem and CompanyItem),... | {
"domain": "codereview.stackexchange",
"id": 4968,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, c",
"url": null
} |
• What does this add to the existing answers? – Noah Schweber Jun 18 '16 at 21:44
• It answers the question. Completeness is not a topological invariant because it is dependent the metric. None of the other answers made that clear. – Rob Jun 18 '16 at 23:34
• That's simply false - read e.g. the first paragraph of the c... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9658995723244552,
"lm_q1q2_score": 0.8049078642219876,
"lm_q2_score": 0.8333245891029456,
"openwebmath_perplexity": 302.03117190272206,
"openwebmath_score": 0.7905623912811279,
"ta... |
Essentially we have to show that any coloring of the six cube faces, with no two adjacent faces the same color, must have a "ring" of four faces that alternates between two colors.
Consider a properly colored cube, and ignore for the moment the top and bottom faces. The vertical faces must have at least two colors. If... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9825575183283513,
"lm_q1q2_score": 0.8122918845598669,
"lm_q2_score": 0.8267117898012104,
"openwebmath_perplexity": 299.3082747041463,
"openwebmath_score": 0.5623217225074768,
"tag... |
connecting the top of the vertex set of a histogram is more commonly for... The parts of frequency polygons a frequency distribution using lines instead of bars by... Line graph to represent frequency distributions are used by non-mathematicians S. Jack summarized grouping of data found Caere... A histogram are joined ... | {
"domain": "desertdingo.com",
"id": null,
"lm_label": "1. Yes\n2. Yes",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.960361158630024,
"lm_q1q2_score": 0.827387826184822,
"lm_q2_score": 0.86153820232079,
"openwebmath_perplexity": 1024.6579595903306,
"openwebmath_score": 0.5896909832954407,
"tags": n... |
python, selenium, xpath
with Session() as session:
session.headers = {
'Accept':
'text/html,'
'application/xhtml+xml,'
'application/xml;q=0.9,'
'image/webp,'
'*/*;q=0.8',
'Accept-Encoding': 'gzip, deflate',
... | {
"domain": "codereview.stackexchange",
"id": 41482,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, selenium, xpath",
"url": null
} |
python
Title: Directory Clean Up I am brand new to Python coming from Ruby on Rails. I am building a cleanup script for cleaning (archiving, deleting, or viewing) directories. I would love to know anything that I can make better, safer, faster.
import os
import re
import shutil
import argparse
from datetime import da... | {
"domain": "codereview.stackexchange",
"id": 30056,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python",
"url": null
} |
$$\lim_{(x,y) \to (0,0), x \neq y} f(x,y) = 1,$$
and $f$ can be continuously extended to a function $\hat{f}$ on $\mathbb{R}^2$ such that
$$\lim_{(x,y) \to (0,0)} \hat{f}(x,y) = 1.$$
You can use polar coordinates here. Set $x=r\cos\theta$, $y=r\sin\theta$, then notice that $x^2-y^2=r^2\cos 2\theta$. Then the limit b... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9822877007780706,
"lm_q1q2_score": 0.8462783903666211,
"lm_q2_score": 0.8615382129861583,
"openwebmath_perplexity": 158.55366733589418,
"openwebmath_score": 0.9372547268867493,
"ta... |
spacetime, universe, equilibrium
However, if I venture a guess and say that you are talking about a system which is unchanging the current prevailing opinion is that everything changes. In particular, the first law of thermodynamics says that entropy is always increasing, so there is always energy being converted int... | {
"domain": "physics.stackexchange",
"id": 44981,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "spacetime, universe, equilibrium",
"url": null
} |
python, algorithm, markov-chain
A this point, if the user inputs a sequence with length > state_length,
we only consider state_length last letters,
for instance if the user inputs "NUTSHELL" with state_length = 4,
we consider "HELL"
If the user inputs a sequence with length < state_length,
we insert spaces before to m... | {
"domain": "codereview.stackexchange",
"id": 23456,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, algorithm, markov-chain",
"url": null
} |
if (current.second > threshold)
return current.first;
}
return -1;
}
### Sorting - Median
We can, however, make even better use of the fact that we have a sorted collection. The key idea here is that if a majority element exists then this element must be the median. After all, by definition , the median element is ri... | {
"domain": "davidespataro.it",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.981166866805362,
"lm_q1q2_score": 0.8218449549973456,
"lm_q2_score": 0.8376199633332891,
"openwebmath_perplexity": 773.9444100844225,
"openwebmath_score": 0.4095302224159241,
"tags"... |
Euler graph quick way to measure ocean currents is to determine currents ( see movie Twister.. Some algorithms for processing tree semi-Eulerian '' be written for a graph G is called Eulerian, lanț! This type of measurement is called an Eulerian circuit is also known as Hamiltonian Cycle two &! semi-Eulerian '' be writ... | {
"domain": "knhevelius.pl",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9441768588653856,
"lm_q1q2_score": 0.8080748545428159,
"lm_q2_score": 0.855851154320682,
"openwebmath_perplexity": 1173.8025448907829,
"openwebmath_score": 0.4884713590145111,
"tag... |
Graphing Parametric Equations by Plotting Points. Examine the graph below. A wide range of predefined functions is available, including trigonometric & hyperbolic functions, polar coordinates, differentiation and more. Graphing Parametric Equations by Plotting Points. Find new parametric equations that shift this graph... | {
"domain": "7cloudtech.com",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9814534316905263,
"lm_q1q2_score": 0.8069403500635977,
"lm_q2_score": 0.8221891370573388,
"openwebmath_perplexity": 1013.164896941815,
"openwebmath_score": 0.7880244851112366,
"ta... |
c#, multithreading, thread-safety, queue
empresa.Cnpj = cnpj;
empresa.IndicadorMatrizFilial = linha.Substring(17, 1).Trim();
empresa.RazaoSocial = linha.Substring(18, 150).Trim();
empresa.NomeFantasia = linha.Substring(168, 55).Trim();
... | {
"domain": "codereview.stackexchange",
"id": 39105,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, multithreading, thread-safety, queue",
"url": null
} |
classical-mechanics, gravity, orbital-motion, moon
The orbit we are interested in has a semimajor axis $a$ less than (400,000+1,700+6,300)/2 = 204,000 km.
The specific orbital energy is given by
$$\epsilon = -\frac{GM}{2a}$$
This means that the energy of the "grazing" orbit of the moon is $6.7\cdot 10^{-11}\cdot 6.0\c... | {
"domain": "physics.stackexchange",
"id": 28023,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "classical-mechanics, gravity, orbital-motion, moon",
"url": null
} |
can get solutions! Functions just as in the example above rows or columns with the lowest energy, you the... … this definition shows two differences already derivatives using the notation for ordinary derivatives before you partial... ) exist at a given point a, the total derivative of z with respect x. We interpret th... | {
"domain": "montserrat-flights.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9863631635159683,
"lm_q1q2_score": 0.8176346970004308,
"lm_q2_score": 0.8289387998695209,
"openwebmath_perplexity": 560.6435858355239,
"openwebmath_score": 0.9494776129722595,
... |
deep-learning, research, papers, academia
If you say your work was rejected or you are about to submit it, you need to check for the restrictions on uploading the manuscript online before submitting it to the conference. Some conference allows papers to be submitted only if they are not uploaded to sites like arXiv wi... | {
"domain": "ai.stackexchange",
"id": 1989,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "deep-learning, research, papers, academia",
"url": null
} |
ros, rospy, ros-kinetic, logging
Originally posted by jaduol391 on ROS Answers with karma: 11 on 2018-05-29
Post score: 1
Same issue for me.
I have a completely working python logger, but when I wrap my python code in a ROS node, python logging is disabled.
As I have seen, this is a known issue: for unknown reasons, ... | {
"domain": "robotics.stackexchange",
"id": 30928,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, rospy, ros-kinetic, logging",
"url": null
} |
java, array
@Override
public void append(E item) {
assert this.size < this.maxSize : "ArrayList capacity exceeded";
this.array[this.size++] = item;
}
@Override
public E remove() {
if ((this.currentPosition < 0) || (this.currentPosition >= this.size)) {
return null;
}
E item... | {
"domain": "codereview.stackexchange",
"id": 4670,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, array",
"url": null
} |
fluid-statics
Title: Why doesn't hydrostatic pressure glue objects to the seafloor? Consider a cement block of the same density as sea-water resting on the (perfectly polished) seafloor. I also assume the side-faces of the cement block are highly polished, so that no vertical hydrostatic forces can attack on them. A c... | {
"domain": "physics.stackexchange",
"id": 30864,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "fluid-statics",
"url": null
} |
# Probability: Choosing a girl from a group
1. Feb 27, 2012
### Xyius
1. The problem statement, all variables and given/known data
You walk into your class the first day of classes, and you notice that
there are 30 men and 20 women in the class already. Let's suppose you decide to choose
two people from the class to... | {
"domain": "physicsforums.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9883127430370156,
"lm_q1q2_score": 0.8496166446860307,
"lm_q2_score": 0.8596637559030338,
"openwebmath_perplexity": 884.5737781078805,
"openwebmath_score": 0.745750367641449,
"tags... |
energy, temperature, hamiltonian, eigenvalue, ising-model
I feel like I'm missing something here and may be using wrong terminology for things. I would really appreciate a practical method of finding the ground state (and energy) at non-zero temperature. A system is not usually in its ground state at finite temperatur... | {
"domain": "physics.stackexchange",
"id": 53554,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "energy, temperature, hamiltonian, eigenvalue, ising-model",
"url": null
} |
### Question 3.42
What Galois stuff can you say about $$x^{2n} - 2$$?
### Question 3.43
What are the cyclic extensions of (prime) order $$p$$?
### Question 3.44
Can you give me a polynomial whose Galois group is $${\mathbb{Z}}/3{\mathbb{Z}}$$?
### Question 3.45
Which groups of order 4 can be realised as a Galois... | {
"domain": "dzackgarza.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9908743636887527,
"lm_q1q2_score": 0.8030827774478073,
"lm_q2_score": 0.8104789132480439,
"openwebmath_perplexity": 362.4303021135475,
"openwebmath_score": 0.9997151494026184,
"tags":... |
primer, crispr
Score Expect Identities Gaps Strand
40.1 bits(20) 0.017 20/20(100%) 0/20(0%) Plus/Minus
Query 1 GGAGGCCTCGGGCCGACTCG 20
||||||||||||||||||||
Sbjct 286 GGAGGCCTCGGGCCGACTCG 267
The sequence you have is 5'-3' and it matches the Minus strand on the human genom... | {
"domain": "biology.stackexchange",
"id": 7150,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "primer, crispr",
"url": null
} |
ruby
case second_digit
when 1 then century.to_s << "st century"
when 2 then century.to_s << "nd century"
when 3 then century.to_s << "rd century"
else
century.to_s << "th century"
end
end
puts "Type in a year:"
answer = gets.chomp
p which_century(answer) Let's clarify the logic. The code simplification... | {
"domain": "codereview.stackexchange",
"id": 27367,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ruby",
"url": null
} |
ros, network
Title: Topic sharing in two different newtworks
Hello,
I am trying to share a topic between two different networks.
There are three computers and let's call them as PC1,PC2, and PC3. (all are ubuntu and running ROS)
Each PC has the following network settings.
PC1:
wlan0 (obtaining IP from ISP's DHCP)
IP:... | {
"domain": "robotics.stackexchange",
"id": 19304,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, network",
"url": null
} |
homework-and-exercises, special-relativity, spacetime, relativity, time-dilation
For a stationary person on Earth we travelled a total distance of 8.78 light years with the speed of 0.87c. This translates into 10.1 years of Earth time.
But just our turn back caused the axis of simultaneously to shift the time on Earth... | {
"domain": "physics.stackexchange",
"id": 24376,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "homework-and-exercises, special-relativity, spacetime, relativity, time-dilation",... |
string-theory, string-field-theory, hadron-dynamics
[...] Strings in string theory also seem to possess a rather complicated and certainly non-trivial suite materials-like properties such as length, rigidity, tension, and I'm sure others (e.g. some analog of angular momentum?). [...] | {
"domain": "physics.stackexchange",
"id": 71220,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "string-theory, string-field-theory, hadron-dynamics",
"url": null
} |
python, beginner, strings, sorting, functional-programming
Basically, its more straightforward to sort first then decorate. Although, I'm not sure why you would need the length of the list in your tuple. If you don't really need it sorting by length can be much shorter.
EDIT:
If all I wanted was to output the data, I'... | {
"domain": "codereview.stackexchange",
"id": 5270,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, beginner, strings, sorting, functional-programming",
"url": null
} |
optics, material-science, everyday-life
The same applies to brick, cloth, etc. If you look at a lot of material close up you find they're actually transparent. For example cloth is made from cotton or man made fibres, and if you look at a single fibre under a microscope you'll find you can see through it. The reason t... | {
"domain": "physics.stackexchange",
"id": 19385,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "optics, material-science, everyday-life",
"url": null
} |
( of! Fitting process is an estimate of the model coefficients equation is by using the squares. Scipy.Optimize.Leastsq that overcomes its poor usability and is the independent variable and is the independent variable is. Α, β ) a curve squares regression for Quadratic curve fitting and. A and b = 1.3, the equation of ... | {
"domain": "velbyproductions.com",
"id": null,
"lm_label": "1. YES\n2. YES\n\n",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9597620550745211,
"lm_q1q2_score": 0.8515053069998764,
"lm_q2_score": 0.8872045966995027,
"openwebmath_perplexity": 680.8880732127594,
"openwebmath_score": 0.6570824384689331,... |
javascript, linked-list, ecmascript-6, iterator
Title: Iterators in JavaScript and remembering position This is an attempt to write a function link that creates a linked list from an array:
function link(list) {
let next = tail = null;
for(let i = list.length-1; i >= 0; i--) {
const value = lis... | {
"domain": "codereview.stackexchange",
"id": 26354,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, linked-list, ecmascript-6, iterator",
"url": null
} |
gravity, electrical-resistance, atmospheric-science
Lets assume it has a pointy bullet shape (best know shape) with 5cm diameter and the orbit is the lower possible out of atmosferic resistance, lets assume the ISS (150km). | {
"domain": "physics.stackexchange",
"id": 9153,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gravity, electrical-resistance, atmospheric-science",
"url": null
} |
php, mvc
Data models
Service
DataProvider
DB connection (PDO or mysqli)
DB resultsets and queries (PDOStatement, or mysqli_stmt)
Each of these components have a clear task to perform, and logic dictates that each task can go wrong. Therefore, each of these components must have means to notify the user that they were ... | {
"domain": "codereview.stackexchange",
"id": 10100,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "php, mvc",
"url": null
} |
mobile-robot, slam, localization, ekf, data-association
Title: EKF localization data association I am working with ROS indigo and clearpath huskyA200 and wanted to implement the EKF localization with unknown correspondences with my own hokuyo lidar data for a school project. Giving the algorithm in page 217 of the pro... | {
"domain": "robotics.stackexchange",
"id": 1738,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "mobile-robot, slam, localization, ekf, data-association",
"url": null
} |
c#, strings, .net, unity3d
Title: Generate Unique ID in C# Objective
To create a unique id with few characters as possible.
Language: C#
Engine Unity3D
Target : iOS && iPadOS
Scenario
I found quite a few solutions from Stack Exchange but would like to know if someone could just look at my code to review it. It is... | {
"domain": "codereview.stackexchange",
"id": 36727,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c#, strings, .net, unity3d",
"url": null
} |
javascript, angular.js
};
});
app.directive('productPanel', function () {
return{
restrict: 'A',
templateUrl: 'layout/product-panel.html',
controller: function () {
this.tab = 1;
this.selectTab = function(setTab) {
... | {
"domain": "codereview.stackexchange",
"id": 10598,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, angular.js",
"url": null
} |
ros, navigation, stack, dwa-local-planner
Original comments
Comment by yasagitov on 2016-02-24:
Please provide launch file. Also include the output of roswtf
Comment by yasagitov on 2016-02-24:
Velocities should be generated regardless of holonomic option.
Comment by automate on 2016-02-24:
Thanks for the response @as... | {
"domain": "robotics.stackexchange",
"id": 23893,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, navigation, stack, dwa-local-planner",
"url": null
} |
operating-systems, memory-management
That describes the basic setup. The disadvantage of the basic setup is that clearing the TLB is slow, which adds a lot of overhead every time you switch processes. That slows things down. Many modern processors have optimizations that reduce this overhead.
For instance, modern I... | {
"domain": "cs.stackexchange",
"id": 11772,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "operating-systems, memory-management",
"url": null
} |
filters, discrete-signals, sampling, nyquist
As you have stated, the sampled signal has a spectrum which includes shifted and weighted copies of the original (possibly baseband) signal. Assuming no aliasing occured during the sampling operation, then any one of those shifted copies includes all the necessary and suffi... | {
"domain": "dsp.stackexchange",
"id": 7940,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "filters, discrete-signals, sampling, nyquist",
"url": null
} |
molecular-orbital-theory, stability, resonance, carbocation
Could someone give me a light on those matters? I assume I might be making a confusion regarding the carbocation hybridization of methylacetylene, would the secondary carbon have a sp geometry when it's positively charged? Basicity is the ability to donate a ... | {
"domain": "chemistry.stackexchange",
"id": 12044,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "molecular-orbital-theory, stability, resonance, carbocation",
"url": null
} |
geophysics, seismology, core
Title: Why does seismic activity shed light on the inner core rigidity? Reading Introduction to Geology (MIT 2005) and Wikipedia's article on Earth's inner core, it is specified that:
Earth was discovered to have a solid inner core distinct from its liquid outer
core in 1936, by the se... | {
"domain": "earthscience.stackexchange",
"id": 290,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "geophysics, seismology, core",
"url": null
} |
dft, finite-impulse-response, filtering, group-delay, fast-convolution
Given such a linear phase filter whose delay is $\tau = d$ and assume that you apply a very narrowband signal $x[n]$ such as:
$$ x[n] = \cos(\omega_0 n) \frac{ \sin(\omega_1 n)}{\pi n} $$
where $\omega_1 \ll 1$ and $0 < \omega_0 < \pi$. Then the... | {
"domain": "dsp.stackexchange",
"id": 5691,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "dft, finite-impulse-response, filtering, group-delay, fast-convolution",
"url": null
... |
java, sorting, stack
If a null is lurking in your unsorted object, this will fail.
Debugging and variable naming
If possible, use a logging framework like SLF4J so that you can configure when you want to see the debug statements, instead of simply printing via System.out.println(). Also:
" pushed from s1 to s2"
Isn't... | {
"domain": "codereview.stackexchange",
"id": 20058,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, sorting, stack",
"url": null
} |
gazebo, ros-kinetic, ubuntu, hector-localization, hector-quadrotor
NOTE: Forcing CMake to run for each package.
-------------------------------------------------------------
[build] Found '17' packages in 0.0 seconds.
[build] Updating package table. ... | {
"domain": "robotics.stackexchange",
"id": 30478,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gazebo, ros-kinetic, ubuntu, hector-localization, hector-quadrotor",
"url": nul... |
planet, temperature, mathematics
It seems reasonably accurate since (if memory serves me) using it yields a good answer for Earth and Mars. However this is for a system with one radiating body not a system with two radiating bodies (binary stars).
My instinct is to treat the two stars as one big star and add the watt... | {
"domain": "astronomy.stackexchange",
"id": 3436,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "planet, temperature, mathematics",
"url": null
} |
python, python-3.x, web-scraping
It's usually considered better practice to do all of your imports at the top of the source file.
Don't declare indices that you don't use
This loop:
i = avg_post_likes = 0
while i <=x-1:
# ...
i += 1
should be
for _ in range(x):
# ...
You also need a better name for x.
Us... | {
"domain": "codereview.stackexchange",
"id": 33090,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, python-3.x, web-scraping",
"url": null
} |
classical-mechanics, lagrangian-formalism, variational-principle, action, variational-calculus
Title: Other infinitesimal variation of the action I was reading this post about the virial theorem where the virial theorem comes from varying the action by the infinitesimal rescaling $x\rightarrow(1+\epsilon)x$ and asking... | {
"domain": "physics.stackexchange",
"id": 80385,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "classical-mechanics, lagrangian-formalism, variational-principle, action, variatio... |
### Week 9-10 Recurrence Relations and Generating Functions
Recurrence Relations Solving Linear Recurrence Relations. Recurrence Relations & Generating Functions This page is an extension to my Fibonacci and Phi Formulae with an introduction to Recurrence Relations and to Generating Functions. A recurrence relation is... | {
"domain": "severemusick.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9838471637570105,
"lm_q1q2_score": 0.8342706664773966,
"lm_q2_score": 0.8479677506936878,
"openwebmath_perplexity": 616.8304921082495,
"openwebmath_score": 0.6817836165428162,
"tags... |
python, performance, timer
font = Font(family="sans-serif", size=16)
Button(self.tk, text="Start", command=self.activate_timer,
font=font).grid(row=0, column=3)
Button(self.tk, text="Stop", command=self.deactivate,
font=font).grid(row=1, column=3)
Label(self.tk, r... | {
"domain": "codereview.stackexchange",
"id": 22893,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "python, performance, timer",
"url": null
} |
javascript, jquery, html, css, json
$(targetId).html(selectedDish(dishes[dishType][dishId].name, dishes[dishType][dishId].price);
});
The tl;dr version of my code review would be, Try to use the best data structures for your information, and think about how would the maintenance of the code, "how can i make it so its... | {
"domain": "codereview.stackexchange",
"id": 30448,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "javascript, jquery, html, css, json",
"url": null
} |
As you say correctly for speaking about the gcd in a sensible way and nontrivial way one needs two integers (or still more).
The following would be a precise question:
Consider $$\gcd: \begin{cases} \mathbb{N}\times \mathbb{N} & \to \mathbb{N} \\ (a,b) & \mapsto \gcd(a,b) \end{cases}$$ Is this injective? Is this bije... | {
"domain": "stackexchange.com",
"id": null,
"lm_label": "1. YES\n2. YES",
"lm_name": "Qwen/Qwen-72B",
"lm_q1_score": 0.9664104972521579,
"lm_q1q2_score": 0.8430456601393828,
"lm_q2_score": 0.8723473746782093,
"openwebmath_perplexity": 226.38185093858618,
"openwebmath_score": 0.8535782098770142,
"ta... |
gazebo
Originally posted by hsu with karma: 5780 on 2012-08-28
This answer was ACCEPTED on the original site
Post score: 1 | {
"domain": "robotics.stackexchange",
"id": 10796,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gazebo",
"url": null
} |
thermodynamics, temperature, astrophysics, neutron-stars
At these temperatures, the neutrons, and protons in the core are partially degenerate and the core varies from being opaque to neutrinos for a few seconds, to partially opaque and then effectively transparent as the neutron star cools. The reason for this is tha... | {
"domain": "physics.stackexchange",
"id": 92786,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "thermodynamics, temperature, astrophysics, neutron-stars",
"url": null
} |
gate-synthesis, universal-gates, fault-tolerance, noise, solovay-kitaev-algorithm
1 Although, likely not the most efficient | {
"domain": "quantumcomputing.stackexchange",
"id": 17,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "gate-synthesis, universal-gates, fault-tolerance, noise, solovay-kitaev-algo... |
particle-physics
Title: Where do positron and electron get K.E from in Pair production In pair production, we get a positron and electron from a photon. The photon should have 1.02Mev energy to carry out this process
When the energy of positron and electron is added, we get the energy of photon.
hf = E- + E+ = (m0c2 ... | {
"domain": "physics.stackexchange",
"id": 6740,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "particle-physics",
"url": null
} |
c++, image, template, classes, variadic
(function(indexInput), ...);
Now function() will be called for every element in indexInput in succession. In that lambda you can do anything you want, including incrementing a loop counter. So use that to build up the index you need to read from image_data. This is left as an e... | {
"domain": "codereview.stackexchange",
"id": 45291,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c++, image, template, classes, variadic",
"url": null
} |
ros, ros-melodic, gazebo-ros
[ INFO] [1591968951.738905171, 0.163000000]: Laser Plugin: Using the 'robotNamespace' param: '/'
[ INFO] [1591968951.738957452, 0.163000000]: Starting Laser Plugin (ns = /)
[ INFO] [1591968951.740414014, 0.163000000]: Physics dynamic reconfigure ready.
[ INFO] [1591968951.740771321, 0.1630... | {
"domain": "robotics.stackexchange",
"id": 35112,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "ros, ros-melodic, gazebo-ros",
"url": null
} |
quantum-field-theory, condensed-matter, lagrangian-formalism, path-integral, action
A. Altland and B. Simons, Condensed Matter Field Theory, 2010, p. 180-191. | {
"domain": "physics.stackexchange",
"id": 13357,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "quantum-field-theory, condensed-matter, lagrangian-formalism, path-integral, actio... |
c, strings, converting, integer
num = 9
num = num * 10 + 8 [ which is 90 + 8 = 98 ]
*/
int _strlen = strlen(_string);
int _point=0;
int _minus = 1;
int _pointplace=0;
char _curchar;
float _return_num;
int _numfound = 0;
for(int _var=0;_var<_strlen;_var++)
{
//store c... | {
"domain": "codereview.stackexchange",
"id": 42207,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "c, strings, converting, integer",
"url": null
} |
java, grammar, lexical-analysis
Lexer.java
import java.io.IOException;
import java.nio.file.Files;
import java.nio.file.Paths;
import java.util.HashSet;
import java.util.Set;
import java.util.stream.Stream;
public class Lexer {
private StringBuilder input = new StringBuilder();
private Token token;
privat... | {
"domain": "codereview.stackexchange",
"id": 21495,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "java, grammar, lexical-analysis",
"url": null
} |
performance, sql, sql-server, xml, xpath
<Name>CONSUME ON OPERATION END</Name>
<Value>0</Value>
</CustomBomMaterialAttribute>
<CustomBomMaterialAttribute>
<Name>FLUSHING PRINCIPLE</Name>
<Value>0</Value>
</CustomBomMaterialAttrib... | {
"domain": "codereview.stackexchange",
"id": 22017,
"lm_label": null,
"lm_name": null,
"lm_q1_score": null,
"lm_q1q2_score": null,
"lm_q2_score": null,
"openwebmath_perplexity": null,
"openwebmath_score": null,
"tags": "performance, sql, sql-server, xml, xpath",
"url": null
} |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.